
Sample records for samarium 161

  1. Synthesis of Samarium Cobalt Nanoblades

    Energy Technology Data Exchange (ETDEWEB)

    Darren M. Steele


    As new portable particle acceleration technologies become feasible the need for small high performance permanent magnets becomes critical. With particle accelerating cavities of a few microns, the photonic crystal fiber (PCF) candidate demands magnets of comparable size. To address this need, samarium cobalt (SmCo) nanoblades were attempted to be synthesized using the polyol process. Since it is preferable to have blades of 1-2 {micro}m in length, key parameters affecting size and morphology including method of stirring, reaction temperature, reaction time and addition of hydroxide were examined. Nanoparticles consisting of 70-200 nm spherical clusters with a 3-5 nm polyvinylpyrrolidone (PVP) coating were synthesized at 285 C and found to be ferromagnetic. Nanoblades of 25nm in length were observed at the surface of the nanoclusters and appeared to suggest agglomeration was occurring even with PVP employed. Morphology and size were characterized using a transmission electron microscope (TEM). Powder X-Ray Diffraction (XRD) analysis was conducted to determine composition but no supportive evidence for any particular SmCo phase has yet been observed.

  2. Particle-Size-Induced Valence Changes in Samarium Clusters

    Energy Technology Data Exchange (ETDEWEB)

    Mason, M. G.; Lee, S. -T.; Apai, G.; Davis, R. F.; Shirley, D. A.; Franciosi, A.; Weaver, J. H.


    Samarium clusters exhibit mixed-valence behavior which is sensitive to particle size. XPS and UPS data show samarium to be primarily divalent (4f{sup 6} ) at small particle size. The trivalent state (4f{sup 5} ) becomes progressively more abundant with increasing s1ze, becoming the dominant state for the bulk metal. These results are interpreted using a model in which band narrowing, due to reduced surface coordination, is more dominant than surface tension effects in establishing the valence of small samarium clusters.

  3. Yellow-green electroluminescence of samarium complexes of 8-hydroxyquinoline

    Energy Technology Data Exchange (ETDEWEB)

    Behzad, Sara Karimi; Najafi, Ezzatollah [Department of Chemistry Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Amini, Mostafa M., E-mail: [Department of Chemistry Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Janghouri, Mohammad; Mohajerani, Ezeddin [Laser Research Institute Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Ng, Seik Weng [Department of Chemistry, University of Malaya, 50603 Kuala Lumpur (Malaysia)


    Four novel samarium complexes were prepared by reacting samarium(III) nitrate with 8-hydroxyquinoline, 2-methyl-8-hydroxyquinoline, and 1,10-phenanthroline and utilized as emitting materials in the electroluminescence device. All complexes were characterized by elemental analysis, infrared, UV–vis and {sup 1}H NMR spectroscopes and the molecular structure of a representative complex, [Sm{sub 2}(Me-HQ){sub 4}(NO{sub 3}){sub 6}] (1), was determined by single-crystal X-ray diffraction. Utilization of a π-conjugated (phenanthroline) ligand as a second ligand in the structure of the samarium complexes resulted in red shifts in both absorption and fluorescence spectra of complexes and moderately enhanced the photoluminescence intensity and the fluorescence quantum yield. The maximum emission peaks showed that a good correlation exists between the nature of the substituent group on the 8-hydroxyquinoline and the addition of the π-conjugated ligand in the structure of samarium complexes and emission wavelength. Devices with samarium(III) complexes with structure of ITO/PEDOT:PSS (90 nm)/PVK:PBD:Sm(III) complexes (75 nm)/Al (180 nm) were fabricated. In the electroluminescence (EL) spectra of the devices, a strong ligand-centered emission and narrow bands arising from the {sup 4}G{sub 5/2}→{sup 6}H{sub J} transitions (J=7/2, 9/2, and 11/2) of the samarium ion were observed for the complexes. The electroluminescent spectra of the samarium complexes were red-shifted as compared with the PVK:PBD blend. We believe that the electroluminescence performance of OLED devices based on samarium complexes relies on overlaps between the absorption of the samarium compounds and the emission of PVK:PBD. This revealed that it is possible to evaluate the electroluminescence performance of the samarium compounds-doped OLED devices based on the emission of PVK:PBD and the absorption of the dopants. - Highlights: • Four novel photoluminescence samarium complexes have been synthesized.

  4. Biodistribution of samarium-153-EDTMP in rats treated with docetaxel

    Energy Technology Data Exchange (ETDEWEB)

    Villarim Neto, Arthur; Acucena, Maria Kadja Meneses Torres; Pereira, Kercia Regina Santos Gomes; Rego, Amalia Cinthia Meneses [Universidade Federal do Rio Grande do Norte (UFRN), Natal, RN (Brazil). Postgraduate Program in Health Sciences; Azevedo, Italo Medeiros; Medeiros, Aldo Cunha [Universidade Federal do Rio Grande do Norte (UFRN), Natal, RN (Brazil). Dept. of Surgery; Bernardo-Filho, Mario [State University of Rio de Janeiro, RJ (Brazil). Dept. of Biophysics and Biometry


    Purpose: Many patients with metastatic bone disease have to use radiopharmaceuticals associated with chemotherapy to relieve bone pain. The aim of this study was to assess the influence of docetaxel on the biodistribution of samarium-153-EDTMP in bones and other organs of rats. Methods: Wistar male rats were randomly allocated into 2 groups of 6 rats each. The DS (docetaxel/samarium) group received docetaxel (15 mg/kg) intraperitoneally in two cycles 11 days apart. The S (samarium/control) group rats were not treated with docetaxel. Nine days after chemotherapy, all the rats were injected with 0.1 ml of samarium-153-EDTMP via orbital plexus (25 {mu} Ci. After 2 hours, the animals were killed and samples of the brain, thyroid, lung, heart, stomach, colon, liver, kidney and both femurs were removed. The percentage radioactivity of each sample (% ATI / g) was determined in an automatic gamma-counter (Wizard-1470, Perkin-Elmer, Finland). Results: On the ninth day after the administration of the second chemotherapy cycle, the rats had a significant weight loss (314.50 +- 22.09 g) compared (p<0.5) to pre-treatment weight (353.66 {+-} 22.8). The % ATI/g in the samples of rats treated with samarium-153-EDTMP had a significant reduction in the right femur, left femur, kidney, liver and lungs of animals treated with docetaxel, compared to the control rats. Conclusion: The combination of docetaxel and samarium-153-EDTMP was associated with a lower response rate in the biodistribution of the radiopharmaceutical to targeted tissues. Further investigation into the impact of docetaxel on biodistribution of samarium-153-EDTMP would complement the findings of this study. (author)

  5. The Basis for Developing Samarium AMS for Fuel Cycle Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Buchholz, B A; Biegalski, S R; Whitney, S M; Tumey, S J; Weaver, C J


    Modeling of nuclear reactor fuel burnup indicates that the production of samarium isotopes can vary significantly with reactor type and fuel cycle. The isotopic concentrations of {sup 146}Sm, {sup 149}Sm, and {sup 151}Sm are potential signatures of fuel reprocessing, if analytical techniques can overcome the inherent challenges of lanthanide chemistry, isobaric interferences, and mass/charge interferences. We review the current limitations in measurement of the target samarium isotopes and describe potential approaches for developing Sm-AMS. AMS sample form and preparation chemistry will be discussed as well as possible spectrometer operating conditions.

  6. Optical characteristics of transparent samarium oxide thin films ...

    Indian Academy of Sciences (India)

    Optical characteristics of transparent samarium oxide thin films deposited by the radio-frequency sputtering technique. A A ATTA M M EL-NAHASS KHALED M ELSABAWY M M ABD EL-RAHEEM A M HASSANIEN A ALHUTHALI ALI BADAWI AMAR MERAZGA. Regular Volume 87 Issue 5 November 2016 Article ID 72 ...

  7. Optical properties of zinc–vanadium glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Zinc–vanadium glasses doped with samarium oxide having the chemical composition Sm2O3() ZnO(40-)V2O5(60) (where = 0.1–0.5 mol%) were prepared by melt quenching method. The density of these glasses was measured by Archimedes method; the corresponding molar volumes have also been calculated.

  8. Optical properties of samarium doped zinc–tellurite glasses

    Indian Academy of Sciences (India)


    Optical properties of samarium doped zinc–tellurite glasses. B ERAIAH. Department of Physics, Karnatak University, Dharwad 580 003, India. Present address: Department of Physics, Bangalore University, Bangalore 560 056, India. MS received 20 March 2006; revised 13 June 2006. Abstract. Glasses with the composition, ...

  9. Effect of second ligand on the luminescence of Samarium (III ...

    Indian Academy of Sciences (India)

    Effect of second ligand on the luminescence of Samarium (III) dibenzoylmethane complexes: Syntheses, crystal structures, thermal analysis and luminescence study. MUHAMMAD IDIRIS SALEH, MIN YEE CHOO, TAI WEI CHAN and MOHD R RAZALI. ∗. School of Chemical Sciences, Universiti Sains Malaysia, Penang, ...

  10. Effect of second ligand on the luminescence of Samarium (III ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences; Volume 127; Issue 12. Effect of second ligand on the luminescence of Samarium (III) dibenzoylmethane complexes: ... Muhammad Idiris Saleh1 Min Yee Choo1 Tai Wei Chan1 Mohd R Razali1. School of Chemical Sciences, Universiti Sains Malaysia, Penang, Malaysia ...

  11. Dependence of samarium-soil interaction on samarium concentration: Implications for environmental risk assessment. (United States)

    Ramírez-Guinart, Oriol; Salaberria, Aitor; Vidal, Miquel; Rigol, Anna


    The sorption and desorption behaviour of samarium (Sm), an emerging contaminant, was examined in soil samples at varying Sm concentrations. The obtained sorption and desorption parameters revealed that soil possessed a high Sm retention capacity (sorption was higher than 99% and desorption lower than 2%) at low Sm concentrations, whereas at high Sm concentrations, the sorption-desorption behaviour varied among the soil samples tested. The fractionation of the Sm sorbed in soils, obtained by sequential extractions, allowed to suggest the soil properties (pH and organic matter solubility) and phases (organic matter, carbonates and clay minerals) governing the Sm-soil interaction. The sorption models constructed in the present work along with the sorption behaviour of Sm explained in terms of soil main characteristics will allow properly assessing the Sm-soil interaction depending on the contamination scenario under study. Moreover, the sorption and desorption K d values of radiosamarium in soils were strongly correlated with those of stable Sm at low concentrations (r = 0.98); indicating that the mobility of Sm radioisotopes and, thus, the risk of radioactive Sm contamination can be predicted using data from low concentrations of stable Sm. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Mechanism of the electrochemical deposition of samarium-based coatings

    Energy Technology Data Exchange (ETDEWEB)

    Ruiz, Edgar J. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Ortega-Borges, Raul [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Godinez, Luis A. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Chapman, Thomas W. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Meas-Vong, Yunny [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico)]. E-mail:


    Samarium-based films have been shown to form from aqueous solutions on the surfaces of metallic substrates such as steel or aluminum, and their presence has been reported to decrease substantially the corresponding corrosion rate of the underlying metallic substrate. Based on previous reports on the deposition of oxides or hydroxides of the closely related element cerium, this work demonstrates that samarium films are formed following a similar mechanism, which involves as the fundamental step an increase in interfacial pH resulting from cathodic oxygen-reduction or hydrogen-evolution reactions. With cyclic voltammetry (CV), electrochemical quartz-crystal microbalance (EQCM) measurements, rotating-disk electrode (RDE) tests, and surface characterization techniques, namely, scanning electron microscopy (SEM) and X-ray surface microanalysis (EDX), the postulated mechanism was verified, and the surface morphology of the resulting films was correlated with the nature of the reduction reaction that triggers film formation.

  13. Samarium Monosulfide (SmS): Reviewing Properties and Applications


    Sousanis, Andreas; Smet, Philippe; Poelman, Dirk


    In this review, we give an overview of the properties and applications of samarium monosulfide, SmS, which has gained considerable interest as a switchable material. It shows a pressure-induced phase transition from the semiconducting to the metallic state by polishing, and it switches back to the semiconducting state by heating. The material also shows a magnetic transition, from the paramagnetic state to an antiferromagnetically ordered state. The switching behavior between the semiconducti...

  14. Optical properties of zinc–vanadium glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Abstract. Zinc–vanadium glasses doped with samarium oxide having the chemical composition Sm2O3(x). ZnO(40−x)V2O5(60)(where x = 0·1–0·5 mol%) were prepared by melt quenching method. The density of these glasses was measured by Archimedes method; the corresponding molar volumes have also been ...

  15. Synthesis of nano-pore samarium (III)-imprinted polymer for preconcentrative separation of samarium ions from other lanthanide ions via solid phase extraction

    Energy Technology Data Exchange (ETDEWEB)

    Shirvani-Arani, Simindokht [Center of Excellence in Electrochemistry, Department of Chemistry, University of Tehran, P.O.Box:14155-6455, Tehran (Iran, Islamic Republic of); Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of); Ahmadi, Seyed Javad [Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of)], E-mail:; Bahrami-Samani, Ali [Nuclear Engineering and Physics Department, Amir Kabir University, P.O.Box: 15875-4413, Tehran (Iran, Islamic Republic of); Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of); Ghannadi-Maragheh, Mohammad [Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of)


    A batch process was developed to separate samarium ions from some lanthanide ions by a novel solid phase which was prepared via the ion-imprinting technique. The samarium (III) ion-imprinted polymer (IIP) particles were synthesized by preparing the ternary complex of samarium ions with 5,7-dichloroquinoline-8-ol (DCQ) and 4-vinylpyridine (VP). Then, thermally copolymerization with styrene (functional monomer, STY) and divinylbenzene (cross-linking monomer, DVB) followed in the presence of 2-methoxy ethanol (porogen) and 2,2'-azobisisobutyronitrile (initiator, AIBN). The imprinted ion was removed by stirring the above particles with 50% (v/v) HCl to obtain the leached IIP particles. Moreover, control polymer (CP) particles were similarly prepared without the samarium ions. The unleached and leached IIP particles were characterized by X-ray diffraction (XRD), infra-red spectroscopy (IR), thermo gravimetric analysis (TGA) and scanning electron microscopy (SEM). Finally, preconcentration and selectivity studies for samarium and the other lanthanide ions were carried out. The preconcentration of the samarium (III) traces was studied during rebinding with the leached IIP particles as a function of pH, the weight of the polymer material, the preconcentration and the elution times, the eluent volume and the aqueous phase volume. These studies indicated that the samarium (III) amount as low as 1 {mu}g, present in 200 mL, could be preconcentrated into 25 mL of 1.0 M HCl.

  16. Ionization of Samarium by Chemical Releases in the Upper Atmosphere (United States)

    Siefring, C. L.; Bernhardt, P. A.; Holmes, J. M.; Pedersen, T. R.; Caton, R.; Miller, D.; Groves, K. M.


    The release of Samarium vapor into the upper atmosphere was studied using during the Air Force Research Laboratory sponsored Metal Oxide Space Cloud (MOSC) rocket launches in May 2009. The Naval Research Laboratory supported these experiments with 3-D photochemical modeling of the artificial plasma cloud including (1) reactions with atomic oxygen, (2) photo excitation, (3) photoionization, (4) dissociative recombination, and (5) ion and neutral diffusion. NRL provided the experimental diagnostic instrument on the rocket which was a dual frequency radio beacon on the rocket to measure changes in total electron content. The AFRL provided ground based diagnostics of incoherent scatter radar and optical spectroscopy and imagery. The NRL Chemical Release Model (CRM) has over 600 excited states of atomic Samarium neutrals, atomic ions, along with Samarium Oxide Ions and electrons. Diffusive transport of neutrals in cylindrical geometry and ions along magnetic field lines is computed along with the reactive flow to predict the concentrations of Sm, Sm-Ion, Sm0, and SmO Ion. Comparison of the CRM with observations demonstrates that Sm release into the upper atmosphere initially produces enhanced electron densities and SmO-Ions. The diatomic ions recombine with electrons to yield neutral Sm and O. Only the photo ionization of Sm yields a stable atomic ion that does not substantially recombine. The MOSC releases in sunlight yielded long duration ion clouds that can be replicated with the CRM. The CRM predicts that Sm releases in darkness would not produce long duration plasma clouds because of the lack of photo excitation and photoionization.

  17. Reactive Materials for Evaporating Samarium (Pre-Print) (United States)


    SUBJECT TERMS energetic materials, heat sources, pyrotechnic charges, easily ionized metals 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF...experiments.    Keywords:  energetic  materials, heat sources, pyrotechnic charges, easily ionized metals  1. Introduction Ejection of clouds of...results  were  negatively  affected  by  reduced  efficiency   of  release  and  ionization of samarium [8]. It is possible that not the entire charge of

  18. Implementation of an analytical technique for Samarium; Implementacion de una tecnica analitica para Samario

    Energy Technology Data Exchange (ETDEWEB)

    Garcia G, N. [ININ, Carretera Mexico-Toluca Km. 36.5, 52045 Estado de Mexico (Mexico)


    Since the Samarium presents the same chemical properties that the plutonium, it has been used as homologous in studies that allow us to know the behavior that the plutonium presents in solution, with the advantage of working with an inactive and not very dangerous element. At the moment studies of sorption of plutonium or samarium are made on some mineral matrices that present certain surface properties. Due to the low concentrations that are used in the studies of sorption of samarium on those reagent substrates, their detection becomes very difficult for the conventional analysis media. The luminescence is a technique that can detect lower concentrations, smaller at 1 X 10{sup -} {sup 2} M, but when fluorofors are used this limit of detection increases in several orders of magnitude. In this work it has been used the arsenazo-III as fluorofor agent since it reacts in a specific way with the samarium, forming a complex that presents a proportional luminescence to the concentration of the present samarium. The advantage of making the quantification of samarium by luminescence is that it can use the same instrumental equipment to determine the speciation of the samarium sipped in the zircon. (Author)

  19. Synthesis of samarium binding bleomycin - a possible NCT radiosensitizer

    Energy Technology Data Exchange (ETDEWEB)

    Mendes, B.M., E-mail: bmm@cdtn.b [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Mendes, T.M.; Campos, T.P.R., E-mail: campos@nuclear.ufmg.b [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil)


    Bleomycin (BLM) is a drug that has attractive features for the development of a new radiopharmaceutical, particularly with regard to neutron capture therapy (NCT) sensitized by Sm-149. It has the ability to chelate many metal ions. In vitro studies have shown that up to 78% of BLM present in a cell is accumulated inside the nucleus or in the nuclear membrane. In addition, this drug has higher affinity for tumor tissues than for normal tissues. Radioactive isotopes carried by this antibiotic would be taken preferentially to one important cellular targets DNA. Besides, BLM displays intrinsic anti-tumor activity - it is a chemotherapic antibiotic clinically used against some cancers. This study aimed to obtain bleomycin molecules bound to samarium (BLM-Sm) for NCT studies in vitro and in vivo. The binding technique employed in this work has great simplicity and low cost. Thin layer chromatography, high performance liquid chromatography, fast protein liquid chromatography and analysis by ICP-AES were applied to verify the binding molecule. ICP-AES results showed the presence of samarium in the sample peaks related to BLM-Sm. However, efficiency and stability of this bond needs to be investigated. (author)

  20. Luminescent solutions and powders of new samarium complexes with N,N',O,O'-chelating ligands (United States)

    Kharcheva, Anastasia V.; Nikolskiy, Kirill S.; Borisova, Nataliya E.; Ivanov, Alexey V.; Reshetova, Marina D.; Yuzhakov, Viktor I.; Patsaeva, Svetlana V.


    Imaging techniques in biology and medicine are crucial tools to obtain information on structural and functional properties of living cells and organisms. To fulfill the requirements associated with application of these techniques it appears necessary to design markers with specific characteristics. Luminescent complexes of trivalent lanthanide ions with chelating ligands are of increasing importance in biomedical applications because of their millisecond luminescence lifetime, narrow emission band, high signal-to-noise ratio and minimal photodamage to biological samples. In order to extend the available emission wavelength range the luminescent samarium chelates are highly desirable. In this study the ligands with diamides of 2,2'-bipyridin-6,6'-dicarboxylic acid were used to improve photophysical characteristics of samarium complexes. We report the luminescence characteristics of samarium complexes with novel ligands. All complexes exhibited the characteristic emission of Sm (III) ion with the lines at 565, 597, 605, 645 and 654 nm, the intensity strongly depended on the ligand. Absorption and luminescence excitation spectra of Sm (III) complexes showed main peaks in the UV range demonstrating lanthanide coordination to the ligand. The absolute lumenescence quantum yield was measured for solutions in acetonitrile with excitation at 350 nm. The largest luminescence quantum yield was found for the samarium complex Bipy 6MePy Sm (3%) being much higher that for samarium complexes reported in the literature earlier. These results prove as well that samarium chelates are potential markers for multiparametric imaging techniques.

  1. Australian manufacture of Quadramet{sup TM} (Samarium-153 EDTMP)

    Energy Technology Data Exchange (ETDEWEB)

    Wood, N.R.; Whitwell, J. [Australian Nuclear Science and Technology Organisation (ANSTO), Lucas Heights, NSW (Australia). Australian Radioisotopes


    Quadramet{sup T} (Samarium-153 EDTMP) has been shown overseas to be potentially useful in the palliation of painful osteoblastic skeletal metastases and has been approved this year for general marketing in the USA. Australian Radioisotopes (ARI) has licensed this product from the Australian patent holders, Dow Chemical. Within the facilities of ARI, a hot cell has been dedicated to this product and fitted out to manufacture it weekly on a cycle related to the operating cycle of the Australian reactor HIFAR. Due to neutron flux limitations of HIFAR, the local formulation has an elemental Samarium content up to 200{mu}g/mL whereas the overseas formulation has a level of 20-46{mu}g/mL. All other specifications of the two products are essentially the same. In 1995 and 1996 a small clinical trial with 19 patients was held which demonstrated that the pharmacokinetic behaviour was also essentially the same by measuring blood clearance rates and skeletal uptake dynamics. Soft tissue uptake was also qualitatively determined. The ARI version is now the subject of an application for general marketing within Australia. Some useful characteristics of this agent are: almost complete excretion or fixation in the skeleton within 6 hours, rapid onset of clinical effect, applicability in most cases where an abnormal diagnostic bone scan correlates with painful sites, dosage can be tailored to individual patient uptake due to easy dose measurement and retreatment is quite possible. The use of this class of agents in pain palliation continues to increase. Australian manufacture of Quadramet{sup TM} provides a further option in the management of these difficult cases

  2. Electrochemical extraction of samarium from molten chlorides in pyrochemical processes

    Energy Technology Data Exchange (ETDEWEB)

    Castrillejo, Y., E-mail: [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Fernandez, P. [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Medina, J. [Dept Fisica Materia Condensada Cristalografia y Mineralogia, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Hernandez, P. [Centro de Investigaciones Quimicas, Universidad Autonoma del Estado de Hidalgo, Carr. Pachuca-Tulancingo Km. 4.5, C.P. 42076 Pachuca, Hidalgo (Mexico); Barrado, E. [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain)


    This work concerns the electrochemical extraction of samarium from molten chlorides. In this way, the electrochemical behaviour of samarium ions has been investigated in the eutectic LiCl-KCl at the surface of tungsten, aluminium and aluminium coated tungsten electrodes. On a W inert electrode the electro-reduction of Sm(III) takes place in only one soluble-soluble electrochemical step Sm(III)/Sm(II). The electrochemical system Sm(II)/Sm(0) has not been observed within the electrochemical window, because of the prior reduction of Li(I) ions from the solvent, which inhibits the electro-extraction of Sm species from the salt on such a substrate. Sm metal in contact with the melt react to give Li(0) according to the reaction: Sm(0) + 2Li(I) {r_reversible} Sm(II) + 2Li(0). On the contrary, on reactive Al electrodes the electrochemical system Sm(II)/Sm(0) was observed within the electroactive range. The potential shift of the redox couple is caused by the decrease of Sm activity in the metal phase due to the formation of Sm-Al alloys at the interface. The formation mechanism of the intermetallic compounds was studied in a melt containing: (i) both Sm(III) and Al(III) ions, using W and Al coated tungsten electrodes, and (ii) Sm(III) ions using an Al electrode. Analysis of the samples after potentiostatic electrolysis by X-ray diffraction and scanning electron microscopy (SEM) with energy dispersive X-ray spectroscopy (EDS), allowed the identification of Al{sub 3}Sm and Al{sub 2}Sm.

  3. Optical analysis of samarium doped sodium bismuth silicate glass. (United States)

    Thomas, V; Sofin, R G S; Allen, M; Thomas, H; Biju, P R; Jose, G; Unnikrishnan, N V


    Samarium doped sodium bismuth silicate glass was synthesized using the melt quenching method. Detailed optical spectroscopic studies of the glassy material were carried out in the UV-Vis-NIR spectral range. Using the optical absorption spectra Judd-Ofelt (JO) parameters are derived. The calculated values of the JO parameters are utilized in evaluating the various radiative parameters such as electric dipole line strengths (Sed), radiative transition probabilities (Arad), radiative lifetimes (τrad), fluorescence branching ratios (β) and the integrated absorption cross- sections (σa) for stimulated emission from various excited states of Sm3+‡ ion. The principal fluorescence transitions are identified by recording the fluorescence spectrum. Our analysis revealed that the novel glassy system has the optimum values for the key parameters viz. spectroscopic quality factor, optical gain, stimulated emission cross section and quantum efficiency, which are required for a high performance optical amplifier. Calculated chromaticity co-ordinates (0.61, 0.38) also confirm its application potential in display devices. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Samarium Monosulfide (SmS): Reviewing Properties and Applications. (United States)

    Sousanis, Andreas; Smet, Philippe F; Poelman, Dirk


    In this review, we give an overview of the properties and applications of samarium monosulfide, SmS, which has gained considerable interest as a switchable material. It shows a pressure-induced phase transition from the semiconducting to the metallic state by polishing, and it switches back to the semiconducting state by heating. The material also shows a magnetic transition, from the paramagnetic state to an antiferromagnetically ordered state. The switching behavior between the semiconducting and metallic states could be exploited in several applications, such as high density optical storage and memory materials, thermovoltaic devices, infrared sensors and more. We discuss the electronic, optical and magnetic properties of SmS, its switching behavior, as well as the thin film deposition techniques which have been used, such as e-beam evaporation and sputtering. Moreover, applications and possible ideas for future work on this material are presented. Our scope is to present the properties of SmS, which were mainly measured in bulk crystals, while at the same time we describe the possible deposition methods that will push the study of SmS to nanoscale dimensions, opening an intriguing range of applications for low-dimensional, pressure-induced semiconductor-metal transition compounds.

  5. Excitation induced spectroscopic study and quenching effect in cerium samarium codoped lithium aluminoborate glasses

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, Parvinder; Kaur, Simranpreet [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Singh, Gurinder Pal [Department of Physics, Khalsa College, Amritsar 143002 (India); Arora, Deepawali; Kumar, Sunil [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Singh, D.P., E-mail: [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India)


    Lithium aluminium borate host has been codoped with cerium and samarium to prepare glass by conventional melt quench technique. Their structural and spectroscopic investigation has been carried out using XRD, FTIR and density measurements. The UV‐Vis absorption spectra and fluorescence spectra (λ{sub exc}.=380 nm and 400 nm) have been studied for spectroscopic analysis. The amorphous nature of the prepared samples is shown by XRD. The density is increasing with addition of cerium at the expense of aluminium, keeping other components constant. FTIR study also shows the presence of compact and stable tetrahedral BO{sub 4} units thus supporting the density results. The UV‐ Vis absorption spectra show a shift of optical absorption edge towards longer wavelength along with an increase in intensity of peaks with rising samarium concentration. The fluorescence spectra show a blue shift and subsequent suppression of cerium peaks with addition of samarium.

  6. Effect of samarium doping on the dielectric behavior of barium zircomium titanate ceramic

    Energy Technology Data Exchange (ETDEWEB)

    Badapanda, T., E-mail: [Department of Physics, C.V. Raman College of Engineering, Bhubaneswar, Odisha-752054 (India); Sarangi, S.; Behera, B. [School of Physics, Sambalpur University, Jyoti Vihar Sambalpur, Odisha-768019 (India); Anwar, S. [Colloids and Materials Chemistry, Institute of Minerals and Materials Technology, Bhubaneswar, Odisha-751013 (India); Sinha, T. P. [Department of Physics, Bose Institute, Kolkata-700009 (India)


    Samarium doped Barium Zirconium Titanate ceramic with general formula Ba{sub 1−x}Sm{sub 2x/3}Zr{sub 0.05}Ti{sub 0.95}O{sub 3} [x=0.0,0.01,0.02,0.03,0.04] has been prepared by high energy ball milling. The X-ray diffraction (XRD) patterns confirmed that these ceramics have a single phase with perovskite-type upto x≤0.03 and a small secondary phase exist at x=0.04. The temperature dependent dielectric study shows a ferroelectric phase transition and transition temperature decreases with an increase in the Samarium content.

  7. Lithium Bromide/Water as Additives in Dearomatizing Samarium-Ketyl (Hetero)Arene Cyclizations. (United States)

    Rao, Chintada Nageswara; Bentz, Christoph; Reissig, Hans-Ulrich


    New conditions for dearomatizing samarium-ketyl (hetero)arene cyclizations are reported. In many examples of these samarium diiodide-mediated reactions, lithium bromide and water can be used as additives instead of the carcinogenic and mutagenic hexamethylphosphoramide (HMPA). The best results were obtained for the cyclizations of N-acylated indole derivatives delivering the expected indolines in good yields and excellent diastereoselectivities. A new type of cyclization delivering indolyl-substituted allene derivatives is also described. The scope and limitations of the lithium bromide/water system are discussed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. 40 CFR 35.161 - Definition. (United States)


    ... ASSISTANCE Environmental Program Grants Water Pollution Control (section 106) § 35.161 Definition. Recurrent expenditures are those expenditures associated with the activities of a continuing Water Pollution Control... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Definition. 35.161 Section 35.161...

  9. 46 CFR 161.012-9 - Performance. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Performance. 161.012-9 Section 161.012-9 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) EQUIPMENT, CONSTRUCTION, AND MATERIALS: SPECIFICATIONS AND APPROVAL ELECTRICAL EQUIPMENT Personal Flotation Device Lights § 161.012-9 Performance. (a) If...

  10. 7 CFR 1427.161 - Administration. (United States)


    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Administration. 1427.161 Section 1427.161 Agriculture Regulations of the Department of Agriculture (Continued) COMMODITY CREDIT CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS COTTON Recourse Seed Cotton Loans § 1427.161 Administration...

  11. 46 CFR 161.012-7 - Construction. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Construction. 161.012-7 Section 161.012-7 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) EQUIPMENT, CONSTRUCTION, AND MATERIALS: SPECIFICATIONS AND APPROVAL ELECTRICAL EQUIPMENT Personal Flotation Device Lights § 161.012-7 Construction. (a...

  12. 14 CFR 21.161 - Display. (United States)


    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Display. 21.161 Section 21.161 Aeronautics... PROCEDURES FOR PRODUCTS AND PARTS Production Certificates § 21.161 Display. The holder of a production certificate shall display it prominently in the main office of the factory in which the product concerned is...

  13. 14 CFR 161.5 - Definitions. (United States)


    ... NOTICE AND APPROVAL OF AIRPORT NOISE AND ACCESS RESTRICTIONS General Provisions § 161.5 Definitions. For... definition does not include peak-period pricing programs where the objective is to align the number of... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Definitions. 161.5 Section 161.5...

  14. One-step synthesis of samarium-doped ceria and its CO catalysis

    Indian Academy of Sciences (India)

    The samarium-doped ceria (SDC) nanospheres were prepared by the one-step hydrothermal method and characterized by transmission electron microscope, scanning electron microscope, powder X-ray diffraction, X-ray photoelectron spectroscopy, energy-dispersive spectrometer and Raman spectra. According to the ...

  15. A spectroscopic comparison of samarium-doped LiYF4 and KY3F10

    NARCIS (Netherlands)

    Wells, J. P. R.; Sugiyama, A.; Han, T. P. J.; Gallagher, H. G.


    Laser selective excitation and fluorescence has been performed on LiYF4 and KY3F10 doped with samarium ions. In LiYF4, a single, tetragonal symmetry center associated with isovalent substitution of Sm3+ with lattice yttrium ions is present. By contrast, three Sm2+ centres and a single, tetragonal

  16. The Use of a Flexible Calix[4]arene Template to Stabilize a Cyclooctatetraindiyl Samarium-Potassium Complex

    Directory of Open Access Journals (Sweden)

    Geoffroy Guillemot


    Full Text Available A sandwich compound of cyclooctatetraendiyl (COT2− samarium-potassium was synthesized and analyzed using a flexible calix[4]arene dianion. This compound, [p-tBu-calix[4]-(OMe2(O2]arenediyl-samarium-(η8-cyclooctatetraendiyl-potassium (tetrahydrofurane3, is constructed as a linear sequence L-Sm--K-, where L, , and are specific ligands with L = O,O-dimethyl-calix[4]arene2−, = cyclo-octatetraendiyl, and = tetrahydrofurane templates.

  17. Solar nebula heterogeneity in p-process samarium and neodymium isotopes. (United States)

    Andreasen, Rasmus; Sharma, Mukul


    Bulk carbonaceous chondrites display a deficit of approximately 100 parts per million (ppm) in 144Sm with respect to other meteorites and terrestrial standards, leading to a decrease in their 142Nd/144Nd ratios by approximately 11 ppm. The data require that samarium and neodymium isotopes produced by the p process associated with photodisintegration reactions in supernovae were heterogeneously distributed in the solar nebula. Other samarium and neodymium isotopes produced by rapid neutron capture (r process) in supernovae and by slow neutron capture (s process) in red giants were homogeneously distributed. The supernovae sources supplying the p- and r-process nuclides to the solar nebula were thus disconnected or only weakly connected.

  18. Samarium(II) iodide-mediated reductive annulations of ketones bearing a distal vinyl epoxide moiety

    Energy Technology Data Exchange (ETDEWEB)

    Molander, G.A.; Shakya, S.R. [Univ. of Colorado, Boulder, CO (United States)


    It was found that samarium (II) iodide promotes the intramolecular coupling of ketones with distal epoxy olefins while in the presence of hexamethylphosphoramide (HPMA). A number of epoxide compounds (1 a-k) fragment to form carbocycles with allylic alcohol side chains with high diastereoselectivity (2 a-k). Substituting tetramethylguanidine for HPMA reduces the diastereoselectivity. Adding Pd(0) as a catalyst reverses the diastereoselective sense. 40 refs., 1 tab.

  19. A temporal three-dimensional simulation of samarium release in the ionosphere (United States)

    Zhao, Hai-Sheng; Feng, Jie; Xu, Zheng-Wen; Wu, Jian; Wu, Zhen-Sen; Xu, Bin; Xue, Kun; Xu, Tong; Hu, Yan-Li


    For understanding plasma processes of the ionosphere and magnetosphere, the alkali and alkaline-earth metals are usually released in space for artificially increasing the electron density. However, it is a limitation that these releases must be in sunlight where the photoionization can take place. In recent years, the lanthanide metals, such as samarium, have been released to produce electrons in reaction with atomic oxygen in the upper space. The reaction could proceed without sunlight so that the restriction on experimental periods is broken. Unfortunately, any sophisticated models even preliminary ones are unavailable yet in the literature. A temporal three-dimensional model is presented for the samarium release in detail with respect to various altitudes and mass. Especially, the plasma diffusion equation is remarkably extended from 2-D to 3-D by importing the influence of geomagnetic declination, which could be also useful for other chemical releases. The field-aligned terms are brought so as to the presented model can describe the diffusion along the geomagnetic field subtly. On the basis of the presented model, behaviors of radio waves propagating through the release area are simulated by using ray tracing. This model could be as the theoretical support for samarium releases, and it also helpful for the research on the generation and evolution of the ionosphere irregularities.

  20. 29 CFR 1952.161 - Developmental schedule. (United States)


    ... 29 Labor 9 2010-07-01 2010-07-01 false Developmental schedule. 1952.161 Section 1952.161 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... provided by the plan: (a) Enabling legislation becomes effective (Chapter 88 of Iowa Code)—July 1972. (b...

  1. 50 CFR 14.161 - Primary enclosures. (United States)


    ... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false Primary enclosures. 14.161 Section 14.161... Primary enclosures. (a) Except as provided in § 14.106(j), ventilation openings must be located on at least two walls of a primary enclosure. When the required ventilation openings are located on two...

  2. 46 CFR 161.006-4 - Requirements. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Requirements. 161.006-4 Section 161.006-4 Shipping COAST... Requirements. (a) Corrosion-resisting materials. Silver, corrosion-resisting steel, copper, brass, bronze and... intensity. (k) Bolts, nuts, and screws. Bolts and nuts shall conform to the requirements of Navy Department...

  3. 40 CFR 417.161 - Specialized definitions. (United States)


    ... 40 Protection of Environment 28 2010-07-01 2010-07-01 true Specialized definitions. 417.161 Section 417.161 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS SOAP AND DETERGENT MANUFACTURING POINT SOURCE CATEGORY Manufacture of Liquid Detergents...

  4. Liquid–liquid anion exchange extraction studies of samarium(III from salicylate media using high molecular weight amine

    Directory of Open Access Journals (Sweden)

    Aniruddha M. Mandhare


    Full Text Available Liquid–liquid extraction and separation of samarium(III were carried out by using 0.025 mol dm−3 2-octylaminopyridine(2-OAP in xylene at 298 K. The extraction behavior of samarium was studied as a function of pH, weak acid concentration, extractant concentration, diluent, and equilibration time. Samarium was quantitatively extracted at pH 7.5 to 10.0 from 0.01 mol dm−3 sodium salicylate solution with 0.025 mol dm−3 2-OAP. The possible composition of the extracted species in organic phase has been determined by using model of slope analysis method and extraction mechanism was found to proceed via an anion exchange mechanism. The stripping efficiency was found to be quantitative in HNO3, HCl and CH3COOH. The robustness of the procedure was demonstrated by the average recoveries obtained (>99.6% for samarium(III extraction in the presence of several cations and anions which are commonly associated with it. The proposed method facilitates the separation and determination of samarium(III from binary and synthetic mixtures. The various thermodynamic functions like free energy (ΔG, enthalpy (ΔH and entropy (ΔS of extraction mechanism were discussed.

  5. 46 CFR 161.012-3 - Definitions. (United States)


    ... used in this subpart, PFD means Coast Guard approved personal flotation device. (b) For the purpose of § 161.012-7, storage life means the amount of time after the date of manufacture of the power source of...

  6. 161 Teachers' Continuing Professional Development as Correlates ...

    African Journals Online (AJOL)


    Pp. 161-177). Iyunade .... The statistics for 2008 is 1724. Teachers' Continuing Professional Development as Correlates of Sustainable UBE. .... implementation while instilling in them virtues of dedication, loyalty, commitment, discipline and ...

  7. Samarium(II) iodide-mediated intramolecular conjugate additions of alpha,beta-unsaturated lactones. (United States)

    Molander, Gary A; St Jean, David J


    Samarium(II) iodide, in the presence of catalytic amounts of nickel(II) iodide, has been used to promote intramolecular conjugate additions of alkyl halides onto alpha,beta-unsaturated lactones. This process has been shown to be applicable to a number of alpha,beta-unsaturated lactones, including tetrasubstituted olefins, and has been demonstrated to be quite general for the formation of saturated bicyclic and tricyclic lactones. The method presented herein provides a mild, efficient process to form structurally complex lactones from simple precursors.

  8. Dicty_cDB: CHF161 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHF161 (Link to dictyBase) - - - Contig-U16411-1 | Contig-U16470-1 CHF...161P (Link to Original site) CHF161F 559 CHF161Z 759 CHF161P 1298 - - Show CHF161 Library CH (Link to library) Clone ID CHF...411-1 | Contig-U16470-1 Original site URL Representative seq. ID CHF161P (Link to Original site) Representative DNA sequence >CHF161 (CHF...161Q) /CSM/CH/CHF1-C/CHF161Q.Seq.d/ ATTAATAAATAATAATTAAAATTTGCATATATAAAAGAAATAAAAATTTTTTATTTTTTG

  9. Ekstraksi Pemisahan Neodimium dari Samarium, Itrium dan Praseodimium Memakai Tri Butil Fosfat

    Directory of Open Access Journals (Sweden)

    Maria Veronica Purwani


    Full Text Available The extraction of Nd(OH3 (neodymium hydroxide concentrate containing Y (yttrium, Sm (samarium and Pr (praseodymium as product of monazite processed has been done. The purpose of this study is to determine the separation of Nd from Y, Pr and Nd Sm in Nd concentrate. The aqueous phase was concentrated Nd (OH3 in HNO3 and extractant while organic phase was Tri Butyl Phosphate (TBP in kerosene. Parameters studied were pH and concentration feed, concentration of TBP in kerosene, extraction time and stirring speed. The result showed that the optimization of separation extraction neodymium from samarium, yttrium and praseodymium in Nd(OH3 concentrated with TBP, obtained the optimum condition of pH = 0.2, concentration of feed 100 g /L, concentration of TBP in kerosene 5%, extraction time 15 minutes and stirring speed 150 rpm. With the conditions, Separation Factor (SF obtained for Nd-Y, Nd-Pr, Nd-Sm are 2.242, 4.811, 4.002 respectively, while D and extraction efficiency of Nd are 0.236 and 19.07%.

  10. X-Band Microwave Reflection Properties of Samarium/Bismuth-Substituted Barium Lanthanum Titanate Ceramics (United States)

    Bahel, Shalini; Pubby, Kunal; Narang, Sukhleen Bindra


    Samarium/bismuth-substituted barium lanthanum titanate ceramics with chemical composition Ba4 (La_{1 - y - z} Smy Biz )_{9.33} Ti_{18} O_{54} ( y = 0.5, 0.7; z = 0.05, 0.10, 0.15), intended as microwave reflecting materials, have been investigated in microwave X-band (8.2 GHz to 12.4 GHz) and the effect of substitution on their dielectric properties, i.e., dielectric constant and dielectric loss tangent, has been studied by vector network analyzer. Dielectric analysis showed that the dielectric constant increased with increasing samarium as well as bismuth content. Dielectric relaxation was observed for all samples in the scanned frequency range. Microwave reflection and transmission analysis of ceramic pellets of thickness 4 mm was carried out using two methods, i.e., open- and short-circuit approach, both indicating very high values of reflected power and very low values of transmitted power for all the doped materials in comparison with the base composition. The doped compositions are therefore potential microwave shielding materials for use in anechoic chambers, microwave laboratories, and radar equipment. Double-layer reflectors are also proposed, having better reflection properties (˜99% reflection) compared with single-layer reflectors.

  11. Microstructure and hysteresis curves of samarium-holmium-iron garnet synthesized by coprecipitation

    Directory of Open Access Journals (Sweden)

    Caffarena Valeska da Rocha


    Full Text Available An investigation was made into the synthesis and magnetic properties of Sm(3-xHo xFe5O12 (samarium-holmium-iron garnet ferrite, as yet absent from the literature. The material in question was synthesized by co-precipitation, starting from hydrated chlorides of rare-earth elements and ferrous sulfate, and the mixed hydroxide co-precipitate was calcined at 1000 °C. Using PVA as a binder, rectangular cross section-shaped compacts were produced by means of steel-die pressing, drying and sintering from 1200 to 1450 °C. The main conclusions of this study were that the coercive force decreases as the sintering temperature increases, and that the effect of substituting holmium for samarium in SmIG is entirely different from that provided by replacing yttrium by gadolinium in YIG, which is the most important result of this work. An in-depth investigation will be necessary to determine the correlation between microstructure/magnetic properties and ceramic processing variables.

  12. Bone-seeking radiopharmaceuticals as targeted agents of osteosarcoma: samarium-153-EDTMP and radium-223. (United States)

    Anderson, Peter M; Subbiah, Vivek; Rohren, Eric


    Osteosarcoma is a cancer characterized by formation of bone by malignant cells. Routine bone scan imaging with Tc-99m-MDP is done at diagnosis to evaluate primary tumor uptake and check for bone metastases. At time of relapse the Tc-99m-MDP bone scan also provides a specific means to assess formation of bone by malignant osteosarcoma cells and the potential for bone-seeking radiopharmaceuticals to deliver radioactivity directly into osteoblastic osteosarcoma lesions. This chapter will review and compare a bone-seeking radiopharmaceutical that emits beta-particles, samarium-153-EDTMP, with an alpha-particle emitter, radium-223. The charged alpha particles from radium-223 have far more mass and energy than beta particles (electrons) from Sm-153-EDTMP. Because radium-223 has less marrow toxicity and more radiobiological effectiveness, especially if inside the bone forming cancer cell than samarium-153-EDTMP, radium-223 may have greater potential to become widely used against osteosarcoma as a targeted therapy. Radium-223 also has more potential to be used with chemotherapy against osteosarcoma and bone metastases. Because osteosarcoma makes bone and radium-223 acts like calcium, this radiopharmaceutical could possibly become a new targeted means to achieve safe and effective reduction of tumor burden as well as facilitate better surgery and/or radiotherapy for difficult to resect large, or metastatic tumors.

  13. Polypyrrole-coated samarium oxide nanobelts: fabrication, characterization, and application in supercapacitors (United States)

    Liu, Peng; Wang, Yunjiao; Wang, Xue; Yang, Chao; Yi, Yanfeng


    Polypyrrole-coated samarium oxide nanobelts were synthesized by the in situ chemical oxidative surface polymerization technique based on the self-assembly of pyrrole on the surface of the amine-functionalized Sm2O3 nanobelts. The morphologies of the polypyrrole/samarium oxide (PPy/Sm2O3) nanocomposites were characterized using transmission electron microscope. The UV-vis absorbance of these samples was also investigated, and the remarkable enhancement was clearly observed. The electrochemical behaviors of the PPy/Sm2O3 composites were investigated by cyclic voltammetry, electrochemical impedance spectroscopy, and galvanostatic charge-discharge. The results indicated that the PPy/Sm2O3 composite electrode was fully reversible and achieved a very fast Faradaic reaction. After being corrected into the weight percentage of the PPy/Sm2O3 composite at a current density of 20 mA cm-2 in a 1.0 M NaNO3 electrolyte solution, a maximum discharge capacity of 771 F g-1 was achieved in a half-cell setup configuration for the PPy/Sm2O3 composites electrode with the potential application to electrode materials for electrochemical capacitors.

  14. Polypyrrole-coated samarium oxide nanobelts: fabrication, characterization, and application in supercapacitors

    Energy Technology Data Exchange (ETDEWEB)

    Liu Peng, E-mail:; Wang Yunjiao; Wang Xue; Yang Chao; Yi Yanfeng [College of Chemistry and Chemical Engineering, Lanzhou University, Key Laboratory of Nonferrous Metal Chemistry and Resources Utilization of Gansu Province and State Key Laboratory of Applied Organic Chemistry (China)


    Polypyrrole-coated samarium oxide nanobelts were synthesized by the in situ chemical oxidative surface polymerization technique based on the self-assembly of pyrrole on the surface of the amine-functionalized Sm{sub 2}O{sub 3} nanobelts. The morphologies of the polypyrrole/samarium oxide (PPy/Sm{sub 2}O{sub 3}) nanocomposites were characterized using transmission electron microscope. The UV-vis absorbance of these samples was also investigated, and the remarkable enhancement was clearly observed. The electrochemical behaviors of the PPy/Sm{sub 2}O{sub 3} composites were investigated by cyclic voltammetry, electrochemical impedance spectroscopy, and galvanostatic charge-discharge. The results indicated that the PPy/Sm{sub 2}O{sub 3} composite electrode was fully reversible and achieved a very fast Faradaic reaction. After being corrected into the weight percentage of the PPy/Sm{sub 2}O{sub 3} composite at a current density of 20 mA cm{sup -2} in a 1.0 M NaNO{sub 3} electrolyte solution, a maximum discharge capacity of 771 F g{sup -1} was achieved in a half-cell setup configuration for the PPy/Sm{sub 2}O{sub 3} composites electrode with the potential application to electrode materials for electrochemical capacitors.

  15. Behavior of Samarium III during the sorption process; Comportamiento del Samario-III durante el proceso de sorcion

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez R, E.; Garcia G, N.; Garcia R, G. [ININ, Carr. Mexico-Toluca Km 36.5, Salazar, Estado de Mexico (Mexico)]. e-mail:


    In this work the results of the behavior of samarium in solution are presented, in front of a fine powder of zirconium silicate (zircon). For that which is necessary to characterize the zircon, studying the crystallinity, the morphology, the surface area and the isoelectric point. The behavior of samarium in solution is studied by means of the elaboration of isotherm of sorption, using the technique by lots. One observes that to pH values of nearer to the isoelectric point (pH = 7.23) the process of sorption of the samarium begins, reaching a maximum to near pH at 9. The technique of luminescence is used to determine the concentration of the sipped samarium (phosphorescence) and also to make the speciation of the species formed in the surface of the zircon (phosphorescence). The results can be extrapolated with the plutonium when making the modeling of the migration of alpha emitting coming from the repositories of radioactive waste since both they have similar chemical properties (they are homologous). (Author)

  16. Neutron and Charged-Particle Induced Cross Sections for Radiochemistry in the Region of Samarium, Europium, and Gadolinium

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, R D; Kelley, K; Dietrich, F S; Bauer, R; Mustafa, M


    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron and proton induced nuclear reaction cross sections in the mass region of samarium, europium and gadolinium (62 {le} Z {le} 64, 82 {le} N {le} 96).

  17. Pemisahan Unsur Samarium dan Yttrium dari Mineral Tanah Jarang dengan Teknik Membran Cair Berpendukung (Supported Liquid Membrane

    Directory of Open Access Journals (Sweden)

    Amri Amin


    Full Text Available he increasing use of rare earth elements in high technology industries needs to be supported by developmental work for the separation of elements. The research objective is fiercely attracting and challenging considering the similarity of bath physical and chemical properties among these elements. The rate separation of samarium and yttrium elements using supported liquid membrane has been studied. Polytetrafluoroethylene (PTFE with pore size of 0.45 µm has been used as the membrane and di(2-ethylhexyl phosphate (D2EHP in hexane has been used as a carrier and nitric acid solution has been used as receiving phase. Result of experiments showed that the best separation rate of samarium and yttrium elements could be obtained at feeding phase of pH 3.0, di(2-ethylhexyl phosphate (D2EHP concentration of 0.3 M, agitation rate of 700 rpm, agitation time of 2 hours, and nitric acid and its solution concentrations of 1.0 M and 0.1 M, respectively. At this condition, separation rates of samarium and yttrium were 64.4 and 67.6%, respectively.   Keywords: liquid membrane, rare earth elements, samarium, yttrium

  18. 40 CFR 161.45 - Waivers. (United States)


    ... Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR REGISTRATION OF ANTIMICROBIAL PESTICIDES General Provisions § 161.45 Waivers. (a) Rationale and... not be useful in the Agency's evaluation of the risks or benefits of the product. The Agency will...

  19. 40 CFR 161.20 - Overview. (United States)


    ... Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR REGISTRATION OF ANTIMICROBIAL PESTICIDES General Provisions § 161.20 Overview. (a) Legal authority... information the Agency requires in order to make regulatory judgments about the risks and benefits of various...

  20. 25 CFR 16.1 - Definitions. (United States)


    ... individual who is either an enrolled member of the Cherokee, Chickasaw, Choctaw, Creek, or Seminole Tribes of... AFFAIRS, DEPARTMENT OF THE INTERIOR PROBATE ESTATES OF INDIANS OF THE FIVE CIVILIZED TRIBES § 16.1... affecting properties in which a restricted interest is owned by an Indian of the Five Civilized Tribes. (c...

  1. 33 CFR 161.21 - Automated reporting. (United States)


    ...) PORTS AND WATERWAYS SAFETY VESSEL TRAFFIC MANAGEMENT Vessel Movement Reporting System § 161.21 Automated... required to make continuous, all stations, AIS broadcasts, in lieu of voice Position Reports, to those..., until restored a vessel must: (1) Notify the Center; (2) Make voice radio Position Reports at designated...

  2. 40 CFR 161.155 - Product composition. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Product composition. 161.155 Section... composition. Information on the composition of the pesticide product must be furnished. The information... or chemical composition of an ingredient is not known to the applicant because it is proprietary or...

  3. Effects of the atomic environment on the electron binding energies in samarium

    Energy Technology Data Exchange (ETDEWEB)

    Inoyatov, A.Kh., E-mail: [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Institute of Applied Physics, National University, Tashkent, Republic of Uzbekistan (Uzbekistan); Kovalík, A. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Nuclear Physics Institute of the ASCR, CZ-25068 Řež near Prague (Czech Republic); Filosofov, D.V. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Ryšavý, M.; Vénos, D. [Nuclear Physics Institute of the ASCR, CZ-25068 Řež near Prague (Czech Republic); Yushkevich, Yu.V.; Perevoshchikov, L.L. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Zhdanov, V.S. [Nuclear Physics Institute, Almaty, Republic of Kazakhstan (Kazakhstan)


    Highlights: • Eight different matrices (evaporated and implanted at 30 keV) used. • The greatest average difference in the binding energies amounted to 3.1 ± 0.1 eV. • The presence of trivalent and divalent Sm ions found in some implanted samples. • No significant differences in Sm natural atomic level widths were observed. - Abstract: Effects of the atomic environment on the L{sub 1}, L{sub 2}, L{sub 3}, M{sub 1}, M{sub 2}, M{sub 3}, and N{sub 1} electron binding energies in samarium generated in the electron capture decay of radioactive {sup 149}Eu were investigated by means of the internal conversion electron spectroscopy using the conversion electron spectrum of the 22.5 keV M1 + E2 nuclear transition in the daughter {sup 149}Sm. In this investigation, four pairs of {sup 149}Eu sources prepared by vacuum evaporation deposition and by ion implantation at 30 keV with the use of four different source backing materials, namely polycrystalline carbon, aluminium, gadolinium and platinum foils, were employed. The greatest average difference of (3.1 ± 0.1) eV in the L{sub 1}, L{sub 2}, L{sub 3}, and M{sub 1} subshell electron binding energies was observed between the {sup 149}Eu sources prepared by ion implantation into the aluminium and platinum substrates. On the other hand, minimal differences in the electron binding energies were generally found between samarium generated in the evaporated layer and in the bulk for the individual investigated source backings with the exception of the gadolinium foil. A doublet structure of all investigated conversion electron lines with the average values of 8.1 ± 0.2 eV and 1.5 ± 0.1 for the separation energy and the intensity ratio of the low-energy to high-energy components, respectively, was observed for the {sup 149}Eu sources prepared by ion implantation into the aluminium and carbon foils. This structure was presumably caused by the presence of both the trivalent and divalent Sm ions in the sources. No

  4. Multiphoton laser wave-mixing absorption spectroscopy for samarium using a graphite furnace atomizer

    Energy Technology Data Exchange (ETDEWEB)

    Maniaci, Michael J.; Tong, William G. E-mail:


    Nonlinear laser wave-mixing optical technique is presented as a sensitive atomic spectroscopic method for the analysis of rare earth elements using an unmodified commercially available graphite furnace (GF) atomizer. A simple nonplanar backward-scattering degenerate four-wave mixing optical arrangement offers sub-picogram detection sensitivity with sub-Doppler Lorentzian-broadened resolution. Nonlinear wave mixing is an unusually sensitive absorption-based optical method that offers both excellent detection sensitivity and sub-Doppler spectral resolution. A mass detection limit of 0.7 pg and a concentration detection limit of 70 pg/ml are determined for a rare earth element, samarium, using the 429.7-nm excitation line.

  5. Samarium Doped Cerium Oxide Clusters: a Study on the Modulation of Electronic Structure (United States)

    Topolski, Josey E.; Kafader, Jared O.; Marrero-Colon, Vicmarie; Chick Jarrold, Caroline


    Cerium oxide is known for its use in solid oxide fuel cells due to its high ionic conductivity. The doping of trivalent samarium atoms into cerium oxide is known to enhance the ionic conductivity through the generation of additional oxygen vacancies. This study probes the electronic structure of Sm_{x}Ce_{y}O_{z} (x+y=3, z=2-4) anion and neutral clusters. Anion photoelectron spectra of these mixed metal clusters exhibit additional spectral features not present in the previously studied cerium oxide clusters. Density functional theory calculations have been used to aid interpretation of collected spectra. The results of this work can be used to inform the design of materials used for solid oxide fuel cells.

  6. Chelating Ligand-Mediated Hydrothermal Synthesis of Samarium Orthovanadate with Decavanadate as Vanadium Source

    Directory of Open Access Journals (Sweden)

    Quanguo Li


    Full Text Available A new ethylenediaminetetraacetic acid- (EDTA- mediated hydrothermal route to prepare chrysanthemum-shaped samarium orthovanadate (SmVO4 nanocrystals with decavanadate (K6V10O28·9H2O as vanadium source has been developed. The present hydrothermal approach is simple and reproducible and employs a relatively mild reaction temperature. The EDTA, pH value, and temperature of the reaction systems play important roles in determining the morphologies and growth process of the SmVO4 products. The products have been characterized by X-ray diffraction (XRD, scanning electron microscopy (SEM, Fourier transform infrared spectroscopy (FT-IR, photoluminescence spectra (PL, and UV-Vis spectroscopy.

  7. The Magnetocaloric Effect and Heat Capacity of Suspensions of High-Dispersity Samarium Ferrite (United States)

    Korolev, V. V.; Aref'ev, I. M.; Ramazanova, A. G.


    The magnetocaloric effect and specific heat capacity of an aqueous suspension of samarium ferrite were determined calorimetrically over the temperature range 288-343 K in magnetic fields of 0-0.7 T. The data obtained were used to calculate changes in the magnetic component of the molar heat capacity and entropy of the magnetic phase and changes in the enthalpy of the process under an applied magnetic field. The magnetocaloric effect was found to increase nonlinearly as the magnetic field induction grew. The corresponding temperature dependences contained a maximum at 313 K related to the second-order magnetic phase transition at the Curie point. The field and temperature dependences of heat capacity contained a maximum in fields of 0.4 T and a minimum at the magnetic phase transition temperature.

  8. Preparation of hollow core/shell microspheres of hematite and its adsorption ability for samarium. (United States)

    Yu, Sheng-Hui; Yao, Qi-Zhi; Zhou, Gen-Tao; Fu, Sheng-Quan


    Hollow core/shell hematite microspheres with diameter of ca. 1-2 μm have been successfully achieved by calcining the precursor composite microspheres of pyrite and polyvinylpyrrolidone (PVP) in air. The synthesized products were characterized by a wide range of techniques including powder X-ray diffraction (XRD), field-emission scanning electron microscopy (FESEM), energy-dispersive X-ray spectroscopy (EDX), transmission electron microscopy (TEM), high-resolution TEM (HRTEM), thermogravimetric analysis (TGA) and differential scanning calorimetry (DSC), and Brunauer-Emmett-Teller (BET) gas sorptometry. Temperature- and time-dependent experiments unveil that the precursor pyrite-PVP composite microspheres finally transform into hollow core/shell hematite microspheres in air through a multistep process including the oxidation and sulfation of pyrite, combustion of PVP occluded in the precursor, desulfation, aggregation, and fusion of nanosized hematite as well as mass transportation from the interior to the exterior of the microspheres. The formation of the hollow core/shell microspheres dominantly depends on the calcination temperature under current experimental conditions, and the aggregation of hematite nanocrystals and the core shrinking during the oxidation of pyrite are responsible for the formation of the hollow structures. Moreover, the adsorption ability of the hematite for Sm(III) was also tested. The results exhibit that the hematite microspheres have good adsorption activity for trivalent samarium, and that its adsorption capacity strongly depends on the pH of the solution, and the maximum adsorption capacity for Sm(III) is 14.48 mg/g at neutral pH. As samarium is a typical member of the lanthanide series, our results suggest that the hollow hematite microspheres have potential application in removal of rare earth elements (REEs) entering the water environment.

  9. The influence of the technological parameters on the ionic conductivity of samarium doped ceria thin films

    Directory of Open Access Journals (Sweden)

    Mantas Sriubas


    Full Text Available Sm0,20Ce0,80O2 powder was used for the formation of samarium doped cerium oxide (SDC thin films using e-beam. Surface area of powder was 34.9 m2/g and particle size – 0.3-0.5 μm. Thin films were deposited using physical vapor deposition system on SiO2 and Alloy 600 substrates. 2 Å/s – 16 Å/s growth rate and 20 °C – 600 °C substrate temperature were used during the deposition. Ionic conductivity investigation revealed that the maximum ionic conductivity (1.67 S/m has the thin film deposited on 300 °C temperature substrate using 4 Å/s growth rate. Minimum ionic conductivity (0.26 S/m has thin film which was deposited on 20 °C temperature substrate using 8 Å/s growth rate. Vacancy activation energies vary in 0.87 eV – 0.97 eV range. Furthermore the calculations of crystallite size revealed that crystallite size increases with increasing substrate temperature: from 7.50 nm to 46.23 nm on SiO2 substrate and from 9.30 nm to 44.62 nm on Alloy 600 substrate. Molar concentration of samarium in initial evaporated material is 19.38 mol% and varies from 11.37 mol% to 21 mol% in formed thin films depending on technological parameters.DOI:

  10. 40 CFR 161.590 - Nontarget insect data requirements. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Nontarget insect data requirements... § 161.590 Nontarget insect data requirements. (a) Table. Sections 161.100 through 161.102 describe how to use this table to determine the nontarget insect data requirements and the substance to be tested...

  11. 25 CFR 161.702 - Who will enforce this subpart? (United States)


    ... 25 Indians 1 2010-04-01 2010-04-01 false Who will enforce this subpart? 161.702 Section 161.702... GRAZING PERMITS Trespass § 161.702 Who will enforce this subpart? (a) BIA enforces the provisions of this subpart. If the Navajo Nation adopts the provisions of this subpart, the Navajo Nation will have...

  12. 27 CFR 44.161 - Discontinuance of operations. (United States)


    ... Operations § 44.161 Discontinuance of operations. Every export warehouse proprietor who desires to discontinue operations and close out his warehouse shall dispose of all cigars, cigarettes, and cigarette... operations. 44.161 Section 44.161 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE...

  13. 40 CFR 161.340 - Toxicology data requirements. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Toxicology data requirements. 161.340 Section 161.340 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR REGISTRATION OF ANTIMICROBIAL PESTICIDES Data Requirement Tables § 161.340...

  14. 46 CFR 161.013-11 - Prototype test. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Prototype test. 161.013-11 Section 161.013-11 Shipping...: SPECIFICATIONS AND APPROVAL ELECTRICAL EQUIPMENT Electric Distress Light for Boats § 161.013-11 Prototype test. (a) Each manufacturer must test a prototype light identical to the lights to be certified prior to...

  15. 25 CFR 161.203 - Are range management plans required? (United States)


    ... 25 Indians 1 2010-04-01 2010-04-01 false Are range management plans required? 161.203 Section 161... LANDS GRAZING PERMITS General Provisions § 161.203 Are range management plans required? Yes. BIA will... range restoration activities for the Navajo Partitioned Lands. (b) Develop range management plans with...

  16. 49 CFR 38.161 - Moveable aisle armrests. (United States)


    ... 49 Transportation 1 2010-10-01 2010-10-01 false Moveable aisle armrests. 38.161 Section 38.161 Transportation Office of the Secretary of Transportation AMERICANS WITH DISABILITIES ACT (ADA) ACCESSIBILITY SPECIFICATIONS FOR TRANSPORTATION VEHICLES Over-the-Road Buses and Systems § 38.161 Moveable aisle armrests. A...

  17. Formation of Core-Shell Nanoparticles Composed of Magnetite and Samarium Oxide in Magnetospirillum magneticum Strain RSS-1. (United States)

    Shimoshige, Hirokazu; Nakajima, Yoshikata; Kobayashi, Hideki; Yanagisawa, Keiichi; Nagaoka, Yutaka; Shimamura, Shigeru; Mizuki, Toru; Inoue, Akira; Maekawa, Toru


    Magnetotactic bacteria (MTB) synthesize magnetosomes composed of membrane-enveloped magnetite (Fe3O4) or greigite (Fe3S4) particles in the cells. Recently, several studies have shown some possibilities of controlling the biomineralization process and altering the magnetic properties of magnetosomes by adding some transition metals to the culture media under various environmental conditions. Here, we successfully grow Magnetospirillum magneticum strain RSS-1, which are isolated from a freshwater environment, and find that synthesis of magnetosomes are encouraged in RSS-1 in the presence of samarium and that each core magnetic crystal composed of magnetite is covered with a thin layer of samarium oxide (Sm2O3). The present results show some possibilities of magnetic recovery of transition metals and synthesis of some novel structures composed of magnetic particles and transition metals utilizing MTB.

  18. Co-reduction of aluminium and lanthanide ions in molten fluorides: Application to cerium and samarium extraction from nuclear wastes

    Energy Technology Data Exchange (ETDEWEB)

    Gibilaro, M. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France); Massot, L. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France)], E-mail:; Chamelot, P.; Taxil, P. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France)


    This work concerns the method of co-reduction process with aluminium ions in LiF-CaF{sub 2} medium (79-21 mol.%) on tungsten electrode for cerium and samarium extraction. Electrochemical techniques such as cyclic and square wave voltammetries, and potentiostatic electrolyses were used to study the co-reduction of CeF{sub 3} and SmF{sub 3} with AlF{sub 3}. For each of these elements, specific peaks of Al-Ce and Al-Sm alloys formation were observed by voltammetry as well as peaks of pure cerium and aluminium, and pure samarium and aluminium respectively. The difference of potential measured between the solvent reduction and the alloy formation suggests expecting an extraction efficiency of 99.99% of each lanthanide by the process. Different intermetallic compounds were obtained for different potentiostatic electrolysis and were characterised by Scanning Electron Microscopy with EDS probe. The validity of the process was verified by carrying out cerium and samarium extractions in the form of Al-Ln alloy; the extraction efficiency was 99.5% for Ce(III) and 99.4% for Sm(III)

  19. Structural and luminescence properties of samarium doped lead alumino borate glasses (United States)

    Mohan, Shaweta; Kaur, Simranpreet; Singh, D. P.; Kaur, Puneet


    The study reports the effect of samarium concentration on the physical, structural and spectroscopic characteristics of samarium doped lead alumino borate glasses having composition 20PbO-(10-x)Al2O3-70B2O3-xSm2O3; x = 0.1, 0.5, 1.0 and 2.0 mol %. The glasses were fabricated by conventional melt-quenching technique and then characterized by XRD, FTIR, optical absorption and fluorescence spectra. X-ray diffraction studies confirmed the amorphous nature of the prepared glasses. FTIR spectra indicate the presence of BO3, BO4, AlO6 and a few other structural groups. Various physical properties such as density, molar volume, refractive index, rare earth ion concentration, boron-boron distance and polarizability etc. were determined using conventional methods and standard formulae. The Judd-Ofelt theory was applied on the optical absorption spectra of the glasses to evaluate the three phenomenological intensity parameters Ω2, Ω4 and Ω6. The value of Ω2 was found to be highest for glass with 1 mol% Sm2O3 and attributed to the asymmetry of the ligand field at the rare earth ion site and the rare earth oxygen (Sm-O) covalency. The calculated intensity parameters and fluorescence spectra were further used to predict the radiative transition probability (A), radiative lifetime (τR), branching ratio (βR), peak wavelength (λp), effective line widths (Δλeff) and stimulated emission cross-section (σ) for the characteristic 4G5/2 → 6H5/2, 6H7/2 and 6H9/2 transitions of the Sm3+ ion. Concentration quenching was observed for 2 mol% concentration of Sm2O3 and ascribed to energy transfer through various cross-relaxation channels between Sm3+ ions. Reasonably high values of branching ratios and stimulated emission cross-section for the prepared glasses points towards their utility in the development of visible lasers emitting in the reddish-orange spectral region. However, the glass with 1 mol% Sm2O3 was found to show better radiative properties.

  20. X-ray Induced Luminescence Spectroscopy of Samarium Doped Barium Sulfate Prepared by Sintering Method (United States)

    Kumeda, T.; Maeda, K.; Shirano, Y.; Fujiwara, K.; Sakai, K.; Ikari, T.


    X-ray induced luminescence (XL) properties of phosphor materials made of samarium doped barium sulfate have been investigated. The samples were prepared by sintering method heated at 900-1250 °C for 3 hours in air from the mixture of BaSO4 and Sm2O3. The concentration of Sm were prepared from 0.01-6 at.%. In as-prepared sample, the Sm3+ was detected by photoluminescence (PL). The PL intensity is maximum about 2 at.% with Sm, and then starts decreasing. The PL intensity showed concentration quenching. The XL observed Sm2+ and Sm3+ ions. The XL was shown from the sample sintered up to 1200 °C. The XL intensity increased with Sm concentration up to 1 at.%. The intensity was almost constant larger than 1 at.% Sm. These concentration dependences is different since the X-ray energy absorbed to the host material at once, and the energy transferred to both Sm3+ and Sm2+ ions. Sm doped BaSO4 is found a host for XL phosphor materials.

  1. High-κ Samarium-Based Metal-Organic Framework for Gate Dielectric Applications. (United States)

    Pathak, Abhishek; Chiou, Guan Ru; Gade, Narsinga Rao; Usman, Muhammad; Mendiratta, Shruti; Luo, Tzuoo-Tsair; Tseng, Tien Wen; Chen, Jenq-Wei; Chen, Fu-Rong; Chen, Kuei-Hsien; Chen, Li-Chyong; Lu, Kuang-Lieh


    The self-assembly of a samarium-based metal-organic framework [Sm2(bhc)(H2O)6]n (1) in good yield was achieved by reacting Sm(NO3)3·6H2O with benzenehexacarboxylic acid (bhc) in a mixture of H2O-EtOH under hydrothermal conditions. A structural analysis showed that compound 1 crystallized in a space group of Pnmn and adopted a 3D structure with (4,8) connected nets. Temperature dependent dielectric measurements showed that compound 1 behaves as a high dielectric material with a high dielectric constant (κ = 45.1) at 5 kHz and 310 K, which is comparable to the values for some of the most commonly available dielectric inorganic metal oxides such as Sm2O3, Ta2O5, HfO2, and ZrO2. In addition, electrical measurements of 1 revealed an electrical conductivity of about 2.15 × 10-7 S/cm at a frequency of 5 kHz with a low leakage current (Ileakage = 8.13 × 10-12 Amm-2). Dielectric investigations of the Sm-based MOF provide an effective path for the development of high dielectric materials in the future.

  2. Pyroelectric properties and electrical conductivity in samarium doped BiFeO 3 ceramics

    KAUST Repository

    Yao, Yingbang


    Samarium (Sm 3+) doped BiFeO 3 (BFO) ceramics were prepared by a modified solid-state-reaction method which adopted a rapid heating as well as cooling during the sintering process. The pyroelectric coefficient increased from 93 to 137 μC/m 2 K as the Sm 3+ doping level increased from 1 mol% to 8 mol%. Temperature dependence of the pyroelectric coefficient showed an abrupt decrease above 80 °C in all samples, which was associated with the increase of electrical conductivity with temperature. This electrical conduction was attributed to oxygen vacancy existing in the samples. An activation energy of ∼0.7 eV for the conduction process was found to be irrespective of the Sm 3+ doping level. On the other hand, the magnetic Néel temperature (T N) decreased with increasing Sm 3+ doping level. On the basis of our results, the effects of Sm doping level on the pyroelectric and electrical properties of the BFO were revealed. © 2011 Elsevier Ltd. All rights reserved.

  3. Characterization of luminescent samarium doped HfO{sub 2} coatings synthesized by spray pyrolysis technique

    Energy Technology Data Exchange (ETDEWEB)

    Chacon-Roa, C [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Guzman-Mendoza, J [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Aguilar-Frutis, M [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Garcia-Hipolito, M [Departamento de Materiales Metalicos y Ceramicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autonoma de Mexico, A.P. 70-360 Coyoacan 04510, Mexico, D.F. (Mexico); Alvarez-Fragoso, O [Departamento de Materiales Metalicos y Ceramicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autonoma de Mexico, A.P. 70-360 Coyoacan 04510, Mexico, D.F. (Mexico); Falcony, C [Departamento de Fisica, CINVESTAV-IPN, A. P. 14-740, 07000 Mexico D.F. (Mexico)


    Trivalent samarium (Sm{sup 3+}) doped hafnium oxide (HfO{sub 2}) films were deposited using the spray pyrolysis deposition technique. The films were deposited on Corning glass substrates at temperatures ranging from 300 to 550 deg. C using chlorides as raw materials. Films, mostly amorphous, were obtained when deposition temperatures were below 350 deg. C. However, for temperatures higher than 400 deg. C, the films became polycrystalline, presenting the HfO{sub 2} monoclinic phase. Scanning electron microscopy of the films revealed a rough surface morphology with spherical particles. Also, electron energy dispersive analysis was performed on these films. The photoluminescence and cathodoluminescence characteristics of the HfO{sub 2} : SmCl{sub 3} films, measured at room temperature, exhibited four main bands centred at 570, 610, 652 and 716 nm, which are due to the well-known intra-4f transitions of the Sm{sup 3+} ion. It was found that the overall emission intensity rose as the deposition temperature was increased. Furthermore, a concentration quenching of the luminescence intensity was also observed.

  4. Samarium-153 EDTMP for metastatic bone pain palliation: the impact of europium impurities. (United States)

    Kalef-Ezra, J A; Valakis, S T; Pallada, S


    To evaluate the impact on the radiation protection policies of the radiocontaminants in Samarium-153 ethylenediamine tetramethylene phosphonate ((153)Sm-EDTMP). The internal contamination of patients treated with (153)Sm-EDMTP for palliation of painful disseminated multiple bone metastases due to long-lived impurities was assessed by direct measurements. These measurements were coupled with dose-rate measurements close to their bodies and spectroscopic analysis of the residual activity in post-treatment radiopharmaceutical vials. Whole-body counting carried out in six patients showed a 30-81-kBq europium -152 plus europium-154 contamination. The 0.85 mean (152)Eu- to -(154)Eu activity ratio obtained by direct counting was similar to that assessed by analysis of post-treatment residual activities in twelve radiopharmaceutical vials following radiopharmaceutical injection. The long-lived radiocontaminants in the patient's bodies and the treatment wastes require modifications of the applicable radiation protection policies. Copyright © 2014 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  5. Luminescence of trivalent samarium ions in silver and tin co-doped aluminophosphate glass (United States)

    Jiménez, José A.; Lysenko, Sergiy; Liu, Huimin; Sendova, Mariana


    This work presents the spectroscopic properties of trivalent samarium ions in a melt-quenched aluminophosphate glass containing silver and tin. Addition of 4 mol% of each Ag 2O and SnO into the glass system with 2 mol% Sm 2O 3 results in Sm 3+ ions luminescence under non-resonant UV excitation owing to energy transfer from single silver ions and/or twofold-coordinated Sn centers. Assessment of luminescence spectra and decay dynamics suggest the energy transfer mechanism to be essentially of the resonant radiative type. Moreover, a connection between the luminescent and structural properties of the rare-earth doped glass system was demonstrated. Raman spectroscopy characterization revealed that no significant variation in the glass matrix is induced by Sm 3+ doping at the concentration employed. A comparison was made with a structural study performed on the Eu 3+ doped system (containing 2 mol% Eu 2O 3 along with 4 mol% of each Ag 2O and SnO) where the radiative energy transfer mechanism was previously established. The data appears consistent regarding the lack of variation in glass structure upon the Eu 3+ and Sm 3+ doping in connection with the dominance of the radiative transfer in the matrix. Thermal treatment of the material leads to precipitation of Ag nanoparticles of a broad size range inside the dielectric as observed by transmission electron microspcopy. Assessment of 4G 5/2 excited state decay in Sm 3+ ions shows no influence from the silver particles.

  6. Samarium (III) adsorption on bentonite modified with N-(2-hydroxyethyl) ethylenediamine. (United States)

    Li, Dandan; Chang, Xijun; Hu, Zheng; Wang, Qihui; Li, Ruijun; Chai, Xiaoli


    A new material has been synthesized using dry process to activate bentonite followed by N-(2-hydroxyethyl) ethylenediamine connecting chlorosilane coupling agent. The synthesized new material was characterized by elemental analysis, FT-IR and thermogravimetry which proved that bentonite was successfully modified. The most interesting trait of the new material was its selective adsorption for rare earth elements. A variety of conditions of the new material were investigated for adsorption. The optimal conditions were determined with respect to pH and shaking time. Samarium (Sm) was quantitatively adsorbed at pH 4 and shaking time of 2 min onto the new material. Under these conditions the maximum static adsorption capacity of Sm(III) was found to be 17.7 mg g(-1). The adsorbed Sm(III) ion were quantitatively eluted by 2.0 mL 0.1 mol L(-1) HCl and 5% CS (NH(2))(2) solution. According to IUPAC definition, the detection limit (3σ) of this method was 0.60 ng mL(-1). The relative standard deviation (RSD) under optimum conditions was less than 3% (n=8). The new material also was applied for the preconcentration of trace Sm(III) in environmental samples with satisfactory results. Copyright © 2010 Elsevier B.V. All rights reserved.

  7. Dicty_cDB: VSK161 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VS (Link to library) VSK161 (Link to dictyBase) - - - Contig-U15185-1 VSK161P (Link to Original site)...VSK161Z 343 VSK161P 692 - - Show VSK161 Library VS (Link to library) Clone ID VSK161 (Link to dictyBase)...AL116011 |AL116011.1 Botrytis cinerea strain T4 cDNA library under conditions of nitrogen deprivation. 84 2e-14...AL116009 |AL116009.1 Botrytis cinerea strain T4 cDNA library under conditions of nitrogen deprivation. 84 2e-14...AL115603 |AL115603.1 Botrytis cinerea strain T4 cDNA library under conditions of nitrogen deprivation. 84 2e-14

  8. 26 CFR 31.3401(a)(16)-1 - Tips. (United States)


    ... 26 Internal Revenue 15 2010-04-01 2010-04-01 false Tips. 31.3401(a)(16)-1 Section 31.3401(a)(16)-1... Income Tax at Source § 31.3401(a)(16)-1 Tips. Tips paid to an employee are excepted from wages and hence not subject to withholding if— (a) The tips are paid in any medium other than cash, or (b) The cash...

  9. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Mandiwana, Vusani, E-mail:; Kalombo, Lonji, E-mail: [Centre of Polymers and Composites, CSIR (South Africa); Venter, Kobus, E-mail: [South African Medical Research Council (South Africa); Sathekge, Mike, E-mail: [University of Pretoria and Steve Biko Academic Hospital, Department of Nuclear Medicine (South Africa); Grobler, Anne, E-mail:; Zeevaart, Jan Rijn, E-mail: [North-West University, DST/NWU Preclinical Drug Development Platform (South Africa)


    Developing nanoparticulate delivery systems that will allow easy movement and localization of a drug to the target tissue and provide more controlled release of the drug in vivo is a challenge in nanomedicine. The aim of this study was to evaluate the biodistribution of poly(d,l-lactide-co-glycolide) (PLGA) nanoparticles containing samarium-153 oxide ([{sup 153}Sm]Sm{sub 2}O{sub 3}) in vivo to prove that orally administered nanoparticles alter the biodistribution of a drug. These were then activated in a nuclear reactor to produce radioactive {sup 153}Sm-loaded-PLGA nanoparticles. The nanoparticles were characterized for size, zeta potential, and morphology. The nanoparticles were orally and intravenously (IV) administered to rats in order to trace their uptake through imaging and biodistribution studies. The {sup 153}Sm-loaded-PLGA nanoparticles had an average size of 281 ± 6.3 nm and a PDI average of 0.22. The zeta potential ranged between 5 and 20 mV. The [{sup 153}Sm]Sm{sub 2}O{sub 3} loaded PLGA nanoparticles, orally administered were distributed to most organs at low levels, indicating that there was absorption of nanoparticles. While the IV injected [{sup 153}Sm]Sm{sub 2}O{sub 3}-loaded PLGA nanoparticles exhibited the highest localization of nanoparticles in the spleen (8.63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems would be suitable for improving permeability and thus the bioavailability of therapeutic compounds.

  10. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles (United States)

    Mandiwana, Vusani; Kalombo, Lonji; Venter, Kobus; Sathekge, Mike; Grobler, Anne; Zeevaart, Jan Rijn


    Developing nanoparticulate delivery systems that will allow easy movement and localization of a drug to the target tissue and provide more controlled release of the drug in vivo is a challenge in nanomedicine. The aim of this study was to evaluate the biodistribution of poly( d, l-lactide- co-glycolide) (PLGA) nanoparticles containing samarium-153 oxide ([153Sm]Sm2O3) in vivo to prove that orally administered nanoparticles alter the biodistribution of a drug. These were then activated in a nuclear reactor to produce radioactive 153Sm-loaded-PLGA nanoparticles. The nanoparticles were characterized for size, zeta potential, and morphology. The nanoparticles were orally and intravenously (IV) administered to rats in order to trace their uptake through imaging and biodistribution studies. The 153Sm-loaded-PLGA nanoparticles had an average size of 281 ± 6.3 nm and a PDI average of 0.22. The zeta potential ranged between 5 and 20 mV. The [153Sm]Sm2O3 loaded PLGA nanoparticles, orally administered were distributed to most organs at low levels, indicating that there was absorption of nanoparticles. While the IV injected [153Sm]Sm2O3-loaded PLGA nanoparticles exhibited the highest localization of nanoparticles in the spleen (8.63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems would be suitable for improving permeability and thus the bioavailability of therapeutic compounds.

  11. Fabrication and properties of samarium doped calcium sulphate thin films using spray pyrolysis technique

    Energy Technology Data Exchange (ETDEWEB)

    Reghima, Meriem [Université Tunis El Manar, Faculté des Sciences de Tunis, Département de Physique, LR99ES13 Laboratoire de Physique de la Matière Condensée (LPMC), 2092 Tunis, Tunisie (Tunisia); Institut d' Electronique et des systèmes, Unité Mixte de Recherche 5214 UM2-CNRS (ST2i) – Université Montpellier, 860 rue de Saint Priest, Bâtiment 5, 34097 Montpellier (France); Faculté des Sciences de Bizerte, Université de Carthage, Zarzouna 7021 (Tunisia); Guasch, Cathy [Institut d' Electronique et des systèmes, Unité Mixte de Recherche 5214 UM2-CNRS (ST2i) – Université Montpellier, 860 rue de Saint Priest, Bâtiment 5, 34097 Montpellier (France); Azzaza, Sonia; Alleg, Safia [Laboratoire de Magnétisme et Spectroscopie des Solides (LM2S), Département de Physique, Faculté des Sciences, Université Badji Mokhtar Annaba, B.P. 12, 23000 Annaba (Algeria); Kamoun-Turki, Najoua [Université Tunis El Manar, Faculté des Sciences de Tunis, Département de Physique, LR99ES13 Laboratoire de Physique de la Matière Condensée (LPMC), 2092 Tunis, Tunisie (Tunisia)


    Using low cost spray pyrolysis technique, polycrystalline CaSO{sub 4} thin films were successfully grown on a glass substrate with a thickness of about 1 μm. Samarium doping has been performed on CaSO{sub 4} thin films to explore luminescence properties. The characterizations of these films were carried out using X-ray diffraction, Scanning Electron Microscopy and optical measurements. The structural analyses reveal the existence of hexagonal CaSO{sub 4} phase with a (200) preferred orientation belonging to CaS compound for substrate temperatures below 350 °C. It is shown that the crystallinity of the sprayed thin films can be improved by increasing substrate temperature up to 250 °C. Warren-Averbach analysis has been applied on X-ray diffractogram to determine structural parameters involving the phase with its amount, the grain size and the lattice parameters using Maud software. The surface topography shows a rough surface covered by densely packed agglomerated clusters having faceted and hexagonal shapes. Energy dispersive microscopy measurements confirm the presence of calcium and sulfur in equal proportions as well as high percentage of oxygen. Photoluminescence at room temperature revealed that luminescence peaks are attributed to the intrinsic emission of pure CaSO{sub 4} phase. - Highlights: • Warren Averbach analysis reveal the presence of hcp structure of CaSO{sub 4} phase. • A mixture of CaSO{sub 4} and CaHO{sub 4.5}S phases has been detected for lower T{sub s}. • For increasing T{sub s}, the CaHO{sub 4.5}S phase has been disappeared. • The origin of PL peaks has been identified.

  12. 29 CFR 1910.161 - Fixed extinguishing systems, dry chemical. (United States)


    ... 29 Labor 5 2010-07-01 2010-07-01 false Fixed extinguishing systems, dry chemical. 1910.161 Section... § 1910.161 Fixed extinguishing systems, dry chemical. (a) Scope and application. This section applies to all fixed extinguishing systems, using dry chemical as the extinguishing agent, installed to meet a...

  13. 12 CFR 563.161 - Management and financial policies. (United States)


    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Management and financial policies. 563.161... ASSOCIATIONS-OPERATIONS Financial Management Policies § 563.161 Management and financial policies. (a)(1) For... corporation must be well managed and operate safely and soundly. Each also must pursue financial policies that...

  14. 22 CFR 161.6 - Responsibilities of departmental officials. (United States)


    ... Secretary for Congressional Relations in the preparation of environmental documents relating to legislation....6 Section 161.6 Foreign Relations DEPARTMENT OF STATE ENVIRONMENTAL PROTECTION REGULATIONS FOR IMPLEMENTATION OF THE NATIONAL ENVIRONMENTAL POLICY ACT (NEPA) NEPA and Departmental Decisionmaking § 161.6...

  15. 21 CFR 516.161 - Modifications to indexed drugs. (United States)


    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Modifications to indexed drugs. 516.161 Section 516.161 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS NEW ANIMAL DRUGS FOR MINOR USE AND MINOR SPECIES Index...

  16. 40 CFR 161.35 - Flexibility of the data requirements. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Flexibility of the data requirements. 161.35 Section 161.35 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE... Flexibility of the data requirements. Several provisions of this part provide EPA flexibility in requiring (or...

  17. 27 CFR 20.161 - Withdrawals under permit. (United States)


    ... permittee may obtain domestic specially denatured spirits only. The alcohol in domestic denatured spirits... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Withdrawals under permit. 20.161 Section 20.161 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU...

  18. 7 CFR 1150.161 - Promotion, research and nutrition education. (United States)


    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Promotion, research and nutrition education. 1150.161... Dairy Promotion and Research Order Promotion, Research and Nutrition Education § 1150.161 Promotion, research and nutrition education. (a) The Board shall receive and evaluate, or on its own initiative...

  19. 27 CFR 1.61 - Use of wine. (United States)


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Use of wine. 1.61 Section..., NONINDUSTRIAL USE OF DISTILLED SPIRITS AND WINE, BULK SALES AND BOTTLING OF DISTILLED SPIRITS Nonindustrial Use of Distilled Spirits and Wine Uses Regarded As Industrial § 1.61 Use of wine. The following uses of...

  20. 24 CFR 982.161 - Conflict of interest. (United States)


    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Conflict of interest. 982.161... and PHA Administration of Program § 982.161 Conflict of interest. (a) Neither the PHA nor any of its... responsibilities with respect to the programs; or (4) Any member of the Congress of the United States. (b) Any...

  1. Optical properties and electronic transitions of zinc oxide, ferric oxide, cerium oxide, and samarium oxide in the ultraviolet and extreme ultraviolet

    DEFF Research Database (Denmark)

    Pauly, N; Yubero, F; Espinós, J P


    Optical properties and electronic transitions of four oxides, namely zinc oxide, ferric oxide, cerium oxide, and samarium oxide, are determined in the ultraviolet and extreme ultraviolet by reflection electron energy loss spectroscopy using primary electron energies in the range 0.3-2.0 keV. This...

  2. Optical response and magnetic characteristic of samarium doped zinc phosphate glasses containing nickel nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Azmi, Siti Amlah M.; Sahar, M.R., E-mail:


    A magnetic glass of composition 40ZnO–(58−x) P{sub 2}O{sub 5}–1Sm{sub 2}O{sub 3}–xNiO, with x=0.0, 1.0, 1.5 and 2.0 mol% is prepared by melt-quenching technique. The glass is characterized by X-ray diffraction, high-resolution transmission electron microscope (HRTEM), photoluminescence (PL) spectroscopy and vibrating sample magnetometer (VSM) analysis. The X-rays diffraction confirms the amorphous nature of the glass while the HRTEM analysis reveals the presence of nickel nanoparticles in the glass samples. High-resolution TEM reveals that the lattice spacing of nickel nanoparticles is 0.35 nm at (100) plane. Photoluminescence emission shows the existence of four peaks that correspond to the transition from the upper level of {sup 4}G{sub 5/2} to the lower level of {sup 6}H{sub 5/2}, {sup 6}H{sub 7/2}, {sup 6}H{sub 9/2,} and {sup 6}H{sub 11/2.} It is observed that all peaks experience significant quenching effect with the increasing concentration of nickel nanoparticles, suggesting a strong energy transfer from excited samarium ions to the nickel ions. The glass magnetization and susceptibility at 12 kOe at room temperature are found to be in the range of (3.87±0.17×10{sup −2}–7.19±0.39×10{sup −2}) emu/g and (3.24±0.16×10{sup −6}–5.99±0.29×10{sup −6}) emu/Oe g respectively. The obtained hysteresis curve indicates that the glass samples are paramagnetic materials. The studied glass can be further used towards the development of magneto-optical functional glass. - Highlights: • Sm{sup 3+} doped zinc phosphate glass embedded with Ni NPs has been prepared. • The Laue pattern and lattice spacing of Ni NPs are confirmed by HRTEM image. • The magnetic response of glasses has been studied through VSM analysis. • Enhancement factor and decay half-lifetime are investigated.

  3. Treatment of bone pain secondary to metastases using samarium-153-EDTMP

    Directory of Open Access Journals (Sweden)

    Elba Cristina Sá de Camargo Etchebehere

    Full Text Available CONTEXT: More than 50% of patients with prostate, breast or lung cancer will develop painful bone metastases. The purpose of treating bone metastases is to relieve pain, reduce the use of steroids and to maintain motion. OBJECTIVE: To evaluate the use of samarium-153-EDTMP (153Sm-EDTMP for the treatment of bone pain secondary to metastases that is refractory to clinical management. TYPE OF STUDY: Retrospective. SETTING: Division of Nuclear Medicine, Universidade Estadual de Campinas (Unicamp. METHODS: Fifty-eight patients were studied (34 males with mean age 62 years; 31 patients had prostate cancer, 20 had breast cancer, three had lung cancer, one had lung hemangioendothelioma, one had parathyroid adenocarcinoma, one had osteosarcoma and one had an unknown primary tumor. All patients had multiple bone metastases demonstrated by bone scintigraphy using 99mTc-MDP,and were treated with 153Sm-EDTMP. Response to treatment was graded as good (pain reduction of 50-100%, intermediate (25-49% and poor (0-24%. RESULTS: All patients showed good uptake of 153Sm-EDTMP by bone metastases. Among the patients with prostate cancer, intermediate or good response to therapy occurred in 80.6% (25 patients and poor response in 19.4% (6. Among the patients with breast cancer, 85% (17 showed intermediate or good response to therapy while 15% (3 showed poor response. All three patients with lung cancer showed poor response to treatment. The lung hemangioendothelioma and unknown primary lesion patients showed intermediate response to treatment; the osteosarcoma and parathyroid adenocarcinoma patients showed good response to treatment. No significant myelotoxicity occurred. DISCUSSION: Pain control is important for improving the quality of life of patients with advanced cancers. The mechanism by which pain is relieved with the use of radionuclides is still not yet completely understood, however, the treatment is simple and provides a low risk of mielotoxicity

  4. Anchoring samarium oxide nanoparticles on reduced graphene oxide for high-performance supercapacitor

    Energy Technology Data Exchange (ETDEWEB)

    Dezfuli, Amin Shiralizadeh [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Ganjali, Mohammad Reza, E-mail: [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Biosensor Research Center, Endocrinology & Metabolism Molecular-Cellular Sciences Institute, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Naderi, Hamid Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of)


    Highlights: • Samarium oxide nanoparticles have been anchored on the surface of reduced graphene oxide for the first time. • Sm{sub 2}O{sub 3}/RGO nanocomposite show high capacitance, good rate and cycling performance. • Sm{sub 2}O{sub 3}/RGO nanocomposite can serve as efficient electrode material for energy storage. • The best composite electrode exhibits specific capacitance of 321 F g{sup −1} in 2 mV s{sup −1}. - Abstract: We have synthesized Sm{sub 2}O{sub 3} nanoparticles (SmNs) and anchored them onto the surface of reduced graphene oxide (RGO) through a self-assembly thereof by utilizing a facile sonochemical procedure. The nanomaterials were characterized by means of powder X-ray diffraction (XRD), Field-emission scanning electron microscopy (FE-SEM), fourier transform infrared spectroscopy (FT-IR) spectra, and X-ray photoelectron spectroscopy (XPS). As the next step, the supercapacitive behavior of the resulting nanocomposites were investigated when used as electrode material, through with cyclic voltammetric (CV), galvanostatic charge-discharge and electrochemical impedance spectroscopy (EIS) techniques. The SmNs decorated RGO (SmN-RGO) nanocomposites were found to possess a specific capacitance (SC) of 321 F g{sup −1} when used in a 0.5 M Na{sub 2}SO{sub 4} solution as an electrolyte, in a scan rate of 2 mV s{sup −1}. The SC of the SmN-RGO based electrodes were also found to be 268 F g{sup −1} at a current density of 2 A g{sup −1} through galvanostatic charge-discharge tests. The outstanding properties of the SmN-RGOs were attributed to synergy of the high charge mobility of SmNs and the flexibility of the sheets of RGOs. Additionally, the nano-composite revealed a unique cycling durability (maintaining 99% of its SC even after 4000 cycles).

  5. Phenotype abnormality: 161 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 161 decreased efficiency... in organ named stem during process named growth ... stem ... decreased efficiency ... growth ...

  6. Eestist osaleb rahvusvahelisel reklaamifestivalil 161 reklaami / Sergo Selder

    Index Scriptorium Estoniae

    Selder, Sergo


    Riias toimuvast kuuendast Baltimaade reklaamifestivalist "Kuldne haamer" ("Golden Hammer"). Eestist on esitatud 161 reklaami. Žüriisse kuulub eestlastest Jaanus Vahtra reklaamifirmast Saatchi & Saatchi, kelle Diseli õllereklaam võitis möödunud aastal telereklaamide Kuldhaamri

  7. 22 CFR 161.7 - Categories of actions. (United States)


    ... documents and delivering retirement checks, social security payments and veterans benefits; (3) Conduct of... in § 161.11 of these regulations); and (3) Ocean dumping, control of toxic substances, disposal and...

  8. 46 CFR 161.012-11 - Approval tests. (United States)


    ...: SPECIFICATIONS AND APPROVAL ELECTRICAL EQUIPMENT Personal Flotation Device Lights § 161.012-11 Approval tests. (a... procedures necessary to conduct the approval tests required by this subpart, and that is free of influence...

  9. Effect of Current Density on Thermodynamic Properties of Nanocrystalline Palladium Capped Samarium Hydride Thin Film Switchable Mirrors

    Directory of Open Access Journals (Sweden)

    Pushpendra Kumar


    Full Text Available A 55 nm samarium film capped with a 10 nm palladium overlayer switched from a metallic reflecting to a semiconducting, transparent in visible state during ex-situ hydrogen loading via electrochemical means in 1 M KOH electrolytic aqueous solution at room temperature. The switching between metal to semiconductor was accompanied by measurement of transmittance during hydrogen loading/unloading. The effect of current density on switching and thermodynamic properties was studied between dihydride state (FCC phase and trihydride state (hexagonal phase. From the plateau of partial pressure of hydrogen at x=2.6, enthalpy of formation was calculated at different current densities. The diffusion coefficients and switching kinetics are shown to depend on applied current density.

  10. Targeted bone marrow radioablation with 153Samarium-lexidronam promotes allogeneic hematopoietic chimerism and donor-specific immunologic hyporesponsiveness. (United States)

    Inverardi, Luca; Linetsky, Elina; Pileggi, Antonello; Molano, R Damaris; Serafini, Aldo; Paganelli, Giovanni; Ricordi, Camillo


    Transplantation tolerance, defined as acceptance of a graft by an otherwise fully immunocompetent host, has been an elusive goal. Although robust tolerance has been achieved by the induction of stable hematopoietic chimerism after bone marrow transplantation, lethal or sublethal radiation conditioning used to induce long-term chimerism precludes its clinical use. We studied whether targeted delivery of radiation to bone marrow could allow for bone marrow cell (BMC) engraftment, chimerism, and donor-specific tolerance in the absence of the side effects associated with external irradiation. We administered a radioactive bone-seeking compound (Samarium-Lexidronam, Quadramet, Berlex Laboratories, Wayne, NJ) together with transient T-cell costimulatory blockade to recipient mice. Allogeneic BMCs were given 7 or 14 days after preconditioning. Costimulatory blockade was obtained by the use of an anti-CD154 antibody for 4 weeks. Chimerism was assessed by flow cytometry. Mice then received donor-specific and third-party skin grafts. Graft survival was analyzed with mechanisms of donor-specific hyporesponsiveness. High levels of stable chimerism across an allogeneic barrier were achieved in mice by a single administration of Samarium-Lexidronam, transient T-cell costimulatory blockade, and BMC transplantation. A large percentage of chimeric animals retained donor-derived skin grafts for more than 120 days without requiring additional immunosuppression, suggesting that harsh cytotoxic preconditioning is not necessary to achieve stable chimerism and donor specific hyporesponsiveness. Analysis of the T-cell repertoire in chimeras indicates T-cell deletional mechanisms. These data broaden the potential use of BMC transplantation for tolerance induction and argue for its potential in treating autoimmune diseases.

  11. Sorption of samarium in soils: influence of soil properties and Sm concentration

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez-Guinart, Oriol; Salaberria, Aitor; Rigol, Anna; Vidal, Miquel [Analytical Chemistry department, Faculty of Chemistry, University of Barcelona, Marti i Franques 1-11, 08028, Barcelona (Spain)


    Due to the fact that barriers of Deep Geological Repositories (DGR) may lose efficiency before the radioisotopes present in the High Level Radioactive Waste (HLRW) completely decay, it is possible that, in the long-term, radioactive leachates may escape from the DGR and reach the soil and water compartments in the biosphere. Therefore, it is required to examine the interaction and mobility of radionuclides present in the HLRW, or their chemical analogues, to predict the impact of their eventual incorporation in the biosphere and to assess the derived risk. Although relevant data have been recently obtained for a few radionuclides in soils, there are still some important gaps for some radionuclides, such us for samarium (Sm). Sm is a lanthanide that, besides being considered as a natural analogue of actinides, may also be present in HLRW in the form of the radioactive isotope {sup 151}Sm. The main objective of this work was to obtain sorption data (K{sub d}) of {sup 151}Sm gathered from a set of soil samples physicochemical fully-characterized (pH, texture, cationic exchange capacity, soil solution cationic composition, organic matter, carbonate and metallic oxides content, etc.). Additionally, as an alternative for testing sorption capacity of radionuclides in soils is the use of the corresponding stable isotope or a chemical analogue, the influence of Sm concentration was also checked. To evaluate {sup 151}Sm sorption, batch assays were carried out for each soil sample, which consisted in a pre-equilibration step of 2 g of each soil with 50 ml of double deionised water, and a subsequent equilibration step with the same solution, but labelled with {sup 151}Sm. The activity of {sup 151}Sm in initial and final solutions was measured by liquid scintillation and K{sub d} ({sup 151}Sm) data were calculated. The reversibly sorbed fraction was estimated by the application of a single extraction test, with double deionised water, to soil residues coming from the previous

  12. Crystal growth of semiorganic complex- samarium chloride coordinated thiourea-L-tartaric acid and its studies on structure and optical characteristics (United States)

    Slathia, Goldy; Singh, Harjinder; Ramya, E.; Rao, D. Narayana; Bamzai, K. K.


    The semi-organic complex of samarium chloride coordinated thiourea-L-tartaric acid (SCTLT) has been grown as a single crystal by slow evaporation technique at room temperature. For structural studies, the grown crystal was subjected to single crystal X-ray diffraction and Fourier transform infra-red (FTIR) spectroscopy. Low cut off wavelength and transparent characteristics were explored by UV-VIS optical characterization. Third-order nonlinear optical properties of grown crystal were investigated by Z-scan technique.

  13. Lifetimes in {sup 161}Lu measured with recoil distance method

    Energy Technology Data Exchange (ETDEWEB)

    Yu, C.H.; Lewis, J.M.; Riedinger, L.L. [and others


    High spin states of {sup 161}Lu are populated using the {sup 120}Sn({sup 45}Sc,4n){sup 161}Lu reaction with a 205 MeV {sup 45}Sc beam provided by the Oak Ridge National Lab. A plunger was used to stop the recoils at various distances and the {gamma}-rays were detected by the compact array of 20 Compton-suppressed Ge detectors of 17, 30, 60, 85, 140, 210, and 320 micrometers. These data are being analyzed in order to extract lifetimes. High spin lifetimes in the {pi}h{sub 11/12}, 9/2[514] band of {sup 161}Lu were previously measured with DSAM technique. Large energy signature splitting was observed in the low spin portion of this band, which has been interpreted as the evidence for triaxiality and small quadrupole deformation. The authors measured lifetimes at low spin will be helpful for the verification of this prediction.

  14. Sorption of samarium in iron (II) and (III) phosphates in aqueous systems; Sorcion de samario en fosfatos de hierro (II) y (III) en sistemas acuosos

    Energy Technology Data Exchange (ETDEWEB)

    Diaz F, J.C


    The radioactive residues that are stored in the radioactive confinements its need to stay isolated of the environment while the radioactivity levels be noxious. An important mechanism by which the radioactive residues can to reach the environment, it is the migration of these through the underground water. That it makes necessary the investigation of reactive materials that interacting with those radionuclides and that its are able to remove them from the watery resources. The synthesis and characterization of materials that can be useful in Environmental Chemistry are very important because its characteristics are exposed and its behavior in chemical phenomena as the sorption watery medium is necessary to use it in the environmental protection. In this work it was carried out the sorption study of the samarium III ion in the iron (II) and (III) phosphate; obtaining the sorption isotherms in function of pH, of the phosphate mass and of the concentration of the samarium ion using UV-visible spectroscopy to determine the removal percentage. The developed experiments show that as much the ferrous phosphate as the ferric phosphate present a great affinity by the samarium III, for what it use like reactive material in contention walls can be very viable because it sorption capacity has overcome 90% to pH values similar to those of the underground and also mentioning that the form to obtain these materials is very economic and simple. (Author)

  15. Trace amounts of rare earth elements in high purity samarium oxide by sector field inductively coupled plasma mass spectrometry after separation by HPLC

    Energy Technology Data Exchange (ETDEWEB)

    Pedreira, W.R. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil) and Fundacao Jorge Duprat Figueiredo de Seguranca e Medicina do Trabalho (FUNDACENTRO), 05409-002 Sao Paulo, SP (Brazil)]. E-mail:; Queiroz, C.A. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Abrao, A. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Rocha, S.M. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Vasconcellos, M.E. de [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Boaventura, G.R. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil); Pimentel, M.M. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil)


    Today there is an increasing need for high purity rare earth compounds in various fields, the optical, the electronics, the ceramic, the nuclear and geochemistry. Samarium oxide has special uses in glass, phosphors, lasers and thermoelectric devices. Calcium chloride crystals treated with samarium have been employed in lasers, which produce light beams intense enough to burn metal. In general, the inductively coupled plasma mass spectrometry (ICP-MS) presents some advantages for trace element analysis, due to high sensitivity and resolution, when compared with other analytical techniques such as ICP optical emission spectrometry (ICP-OES). In this work, sector field inductively coupled plasma mass spectrometry was used. Sixteen elements (Sc, Y and 14 lanthanides) were determined selectively with the ICP-MS system using a concentration gradient method. The detection limits with the ICP-MS system were about 0.2 (La) pg mL{sup -1} to 8 (Gd) pg mL{sup -1}. The %R.S.D. of the methods varying between 0.9 and 1.5% for a set of five (n = 5) replicates was found for the IPEN's material and for the certificate reference sample. Determination of trace REEs in two high pure samarium oxides samples (IPEN and JMC) was performed. IPEN's material is highly pure (>99.99%) and was successfully analyzed without spectral interference (MO{sup +} and MOH{sup +})

  16. 14 CFR 161.409 - Required analysis by reevaluation petitioner. (United States)


    ... procedures in § 161.407 and shall include the following: (1) A copy of the restriction or the language of the... noise environment using methodology specified in this part; (4) Evidence of the relationship between... exclusion under FAA orders implementing the National Environmental Policy Act of 1969 (42 U.S.C. 4321). (c...

  17. 50 CFR 300.161 - Alternatives and exceptions. (United States)


    ... container or package containing fish or wildlife if the shipper has a valid wildlife import/export license... FISHERIES REGULATIONS Transportation and Labeling of Fish or Wildlife § 300.161 Alternatives and exceptions... containing fish or wildlife with the word “fish” or “wildlife” as appropriate for its contents, or with the...

  18. 46 CFR 161.002-1 - Incorporation by reference. (United States)


    ... Section 4 Albert Embankment, London SE1 7SR, United Kingdom. International Convention for the Safety of Life at Sea, 1974 (SOLAS 74) Consolidated Edition (Including 1992 Amendments to SOLAS 74, and 1994 Amendments to SOLAS 74), 1992—161.002-4(b). National Fire Protection Association (NFPA) National Fire...

  19. 14 CFR 121.161 - Airplane limitations: Type of route. (United States)


    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Airplane limitations: Type of route. 121... OPERATING REQUIREMENTS: DOMESTIC, FLAG, AND SUPPLEMENTAL OPERATIONS Aircraft Requirements § 121.161 Airplane... specifications, no certificate holder may operate a turbine-engine-powered airplane over a route that contains a...

  20. 33 CFR 161.12 - Vessel operating requirements. (United States)


    ... VTS. (b) If, in a specific circumstance, a VTS User is unable to safely comply with a measure or... respond promptly when hailed and communicate in the English language. Note to § 161.12(c): As stated in 47... Monitoring Areas Center MMSI 1 Call Sign Designated frequency (Channel designation)—purpose 2 Monitoring area...

  1. 30 CFR 75.161 - Plans for training programs. (United States)


    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Plans for training programs. 75.161 Section 75... for training programs. Each operator must submit to the district manager, of the Coal Mine Safety and... qualified. The program must provide— (a) For certified persons, annual training courses in first aid...

  2. 14 CFR 171.161 - Maintenance and operations requirements. (United States)


    ... shall provide a stock of spare parts of such a quantity to make possible the prompt replacement of... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Maintenance and operations requirements... (DME) § 171.161 Maintenance and operations requirements. (a) The owner of the facility shall establish...

  3. Closure report for underground storage tank 161-R1U1 and its associated underground piping

    Energy Technology Data Exchange (ETDEWEB)

    Mallon, B.J.; Blake, R.G.


    Underground storage tank (UST) 161-31 R at the Lawrence Livermore National Laboratory (LLNL) was registered with the State Water Resources Control Board on June 27, 1984. UST 161-31R was subsequently renamed UST 161-R1U1 (Fig. A-1, Appendix A). UST 161-R1U1 was installed in 1976, and had a capacity of 383 gallons. This tank system consisted of a fiberglass reinforced plastic tank, approximately 320 feet of polyvinyl chloride (PVC) underground piping from Building 161, and approximately 40 feet of PVC underground piping from Building 160. The underground piping connected laboratory drains and sinks inside Buildings 160 and 161 to UST 161-R1U1. The wastewater collected in UST 161-R1U1, contained organic solvents, metals, inorganic acids, and radionuclides, most of which was produced within Building 161. On June 28, 1989, the UST 161-R1U1 piping system.around the perimeter of Building 161 failed a precision test performed by Gary Peters Enterprises (Appendix B). The 161-R1U1 tank system was removed from service after the precision test. In July 1989, additional hydrostatic tests and helium leak detection tests were performed (Appendix B) to determine the locations of the piping failures in the Building 161 piping system. The locations of the piping system failures are shown in Figure A-2 (Appendix A). On July 11, 1989, LLNL submitted an Unauthorized Release Report to Alameda County Department of Environmental Health (ACDEH), Appendix C.

  4. Effectiveness of radiation synovectomy with samarium-{sup 153} particulate hydroxyapatite in rheumatoid arthritis patients with knee synovitis: a controlled randomized double-blind trial

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Marla Francisca dos; Furtado, Rita Nely Vilar; Konai, Monique Sayuri; Natour, Jamil, E-mail: jnatour@unifesp.b [Universidade Federal de Sao Paulo (UNIFESP-EPM), Sao Paulo, SP (Brazil). Divisao de Reumatologia; Castiglioni, Mario Luiz Vieira; Marchetti, Renata Rosa [Universidade Federal de Sao Paulo (UNIFESP-EPM), Sao Paulo, SP (Brazil). Divisao de Medicina Nuclear


    Objectives: the aim of the present study was to investigate the effectiveness of Samarium{sup 153}-particulate hydroxyapatite radiation synovectomy in rheumatoid arthritis patients with chronic knee synovitis. Methods: fifty-eight rheumatoid arthritis patients (60 knees) with chronic knee synovitis participated in a controlled double-blinded trial. Patients were randomized to receive either an intra-articular injection with 40 mg triamcinolone hexacetonide alone (TH group) or 40 mg triamcinolone hexacetonide combined with 15 mCi Samarium{sup 153}-particulate hydroxyapatite (Sm/TH group). Blinded examination at baseline (T0) and at 1 (T1), 4 (T4), 12 (T12), 32 (T32), and 48 (T48) weeks post-intervention were performed on all patients and included a visual analog scale for joint pain and swelling as well as data on morning stiffness, flexion, extension, knee circumference, Likert scale of improvement, percentage of improvement, SF-36 generic quality of life questionnaire, Stanford Health Assessment Questionnaire (HAQ), Lequesne index, use of non-steroidal anti-inflammatory drugs or oral corticosteroids, events and adverse effects, calls to the physician, and hospital visits. Results: the sample was homogeneous at baseline, and there were no withdrawals. Improvement was observed in both groups in relation to T0, but no statistically significant differences between groups were observed regarding all variables at the time points studied. The Sm/TH group exhibited more adverse effects at T1 (p<0.05), but these were mild and transitory. No severe adverse effects were reported during follow-up. Conclusion: intra-articular injection of Samarium{sup 153}-particulate hydroxyapatite (15 mCi) with 40 mg of triamcinolone hexacetonide is not superior to triamcinolone hexacetonide alone for the treatment of knee synovitis in patients with rheumatoid arthritis at 1 y of follow-up. (author)

  5. 26 CFR 31.3121(b)(16)-1 - Services performed under share-farming arrangement. (United States)


    ... 26 Internal Revenue 15 2010-04-01 2010-04-01 false Services performed under share-farming arrangement. 31.3121(b)(16)-1 Section 31.3121(b)(16)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT... Revenue Code of 1954) General Provisions § 31.3121(b)(16)-1 Services performed under share-farming...

  6. 20 CFR 702.161 - Liens against assets of insurance carriers and employers. (United States)


    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Liens against assets of insurance carriers and employers. 702.161 Section 702.161 Employees' Benefits EMPLOYMENT STANDARDS ADMINISTRATION... AND PROCEDURE General Provisions Liens on Compensation § 702.161 Liens against assets of insurance...

  7. 43 CFR 16.1 - Agreements to dispose of helium in natural gas. (United States)


    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Agreements to dispose of helium in natural gas. 16.1 Section 16.1 Public Lands: Interior Office of the Secretary of the Interior CONSERVATION OF HELIUM § 16.1 Agreements to dispose of helium in natural gas. (a) Pursuant to his authority and...

  8. 50 CFR 216.161 - Specified activity and incidental take levels by species. (United States)


    ... levels by species. 216.161 Section 216.161 Wildlife and Fisheries NATIONAL MARINE FISHERIES SERVICE.... Atlantic Coast § 216.161 Specified activity and incidental take levels by species. (a) Regulations in this... species: Minke whale (Balaenoptera acutorostrata), dwarf sperm whale (Kogia simus); pygmy sperm whale (K...

  9. 22 CFR 161.9 - Specific steps in the Department's NEPA process. (United States)


    ... identify those persons, community organizations, environmental interest groups, international organizations.... 161.9 Section 161.9 Foreign Relations DEPARTMENT OF STATE ENVIRONMENTAL PROTECTION REGULATIONS FOR IMPLEMENTATION OF THE NATIONAL ENVIRONMENTAL POLICY ACT (NEPA) Environmental Review Procedures § 161.9 Specific...

  10. 33 CFR 161.60 - Vessel Traffic Service Prince William Sound. (United States)


    ... William Sound. 161.60 Section 161.60 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... Movement Reporting System Areas and Reporting Points § 161.60 Vessel Traffic Service Prince William Sound... Cape Hinchinbrook Light to Schooner Rock Light, comprising that portion of Prince William Sound between...

  11. 40 CFR 161.55 - Agricultural vs. non-agricultural pesticides. (United States)


    ... pesticides. 161.55 Section 161.55 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR REGISTRATION OF ANTIMICROBIAL PESTICIDES General Provisions § 161.55 Agricultural vs. non-agricultural pesticides. Section 25(a)(1) of FIFRA instructs the...

  12. The properties of samarium-doped zinc oxide/phthalocyanine structure for optoelectronics prepared by pulsed laser deposition and organic molecular evaporation

    Czech Academy of Sciences Publication Activity Database

    Novotný, Michal; Marešová, Eva; Fitl, Přemysl; Vlček, Jan; Bergmann, M.; Vondráček, Martin; Yatskiv, Roman; Bulíř, Jiří; Hubík, Pavel; Hruška, Petr; Drahokoupil, Jan; Abdellaoui, N.; Vrňata, M.; Lančok, Ján


    Roč. 122, č. 3 (2016), 1-8, č. článku 225. ISSN 0947-8396 R&D Projects: GA MŠk(CZ) LG15050; GA ČR(CZ) GAP108/11/0958; GA MŠk(CZ) LM2011029; GA ČR(CZ) GA14-10279S; GA MŠk(CZ) 7AMB14FR010 Institutional support: RVO:68378271 ; RVO:67985882 Keywords : samarium-doped zinc oxide zinc/phthalocyanine deposition * evaporation * pulsed laser deposition * thin films Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.455, year: 2016

  13. Neutron Activated Samarium-153 Microparticles for Transarterial Radioembolization of Liver Tumour with Post-Procedure Imaging Capabilities (United States)

    Hashikin, Nurul Ab. Aziz; Yeong, Chai-Hong; Abdullah, Basri Johan Jeet; Ng, Kwan-Hoong; Chung, Lip-Yong; Dahalan, Rehir; Perkins, Alan Christopher


    Introduction Samarium-153 (153Sm) styrene divinylbenzene microparticles were developed as a surrogate for Yttrium-90 (90Y) microspheres in liver radioembolization therapy. Unlike the pure beta emitter 90Y, 153Sm possess both therapeutic beta and diagnostic gamma radiations, making it possible for post-procedure imaging following therapy. Methods The microparticles were prepared using commercially available cation exchange resin, Amberlite IR-120 H+ (620–830 μm), which were reduced to 20–40 μm via ball mill grinding and sieve separation. The microparticles were labelled with 152Sm via ion exchange process with 152SmCl3, prior to neutron activation to produce radioactive 153Sm through 152Sm(n,γ)153Sm reaction. Therapeutic activity of 3 GBq was referred based on the recommended activity used in 90Y-microspheres therapy. The samples were irradiated in 1.494 x 1012 neutron flux for 6 h to achieve the nominal activity of 3.1 GBq.g-1. Physicochemical characterisation of the microparticles, gamma spectrometry, and in vitro radiolabelling studies were carried out to study the performance and stability of the microparticles. Results Fourier Transform Infrared (FTIR) spectroscopy of the Amberlite IR-120 resins showed unaffected functional groups, following size reduction of the beads. However, as shown by the electron microscope, the microparticles were irregular in shape. The radioactivity achieved after 6 h neutron activation was 3.104 ± 0.029 GBq. The specific activity per microparticle was 53.855 ± 0.503 Bq. Gamma spectrometry and elemental analysis showed no radioactive impurities in the samples. Radiolabelling efficiencies of 153Sm-Amberlite in distilled water and blood plasma over 48 h were excellent and higher than 95%. Conclusion The laboratory work revealed that the 153Sm-Amberlite microparticles demonstrated superior characteristics for potential use in hepatic radioembolization. PMID:26382059

  14. Preparation and examination of properties of samarium-153-EDTMP complex; Otrzymywanie chelatu kwasu etylenodiaminotetrametylenofosfonowego (EDTMP) z samarem-153 i badanie jego wlasciwosci

    Energy Technology Data Exchange (ETDEWEB)

    Nowak, M. [Institute of Atomic Energy, Otwock-Swierk (Poland); Garnuszek, P.; Lukasiewicz, A.; Wozniak, I.; Zulczyk, W. [Osrodek Badawczo-Rozwojowy Izotopow, Otwock-Swierk (Poland); Licinska, I. [Instytut Lekow, Warsaw (Poland)


    Preparation and properties of ethylenediaminetetramethylenephosphonic acid (EDTMP) as well as some properties of {sup 153}Sm-EDTMP chelate have been examined. The chelate formed by samarium-153 (46.3 h, {beta}{sup -}-decay) with EDTMP exhibits high bone uptake and can be used for treatment of disseminated, painful skeletal metastases. The purity and stability of solutions of {sup 153}Sm-EDTMP chelate were examined in a broad range of samarium concentration and {sup 153}Sm specific activity. The complex under study was examined by radio-TLC, -electrophoresis and radio-HPLC. The results obtained suggest the small size of molecules of {sup 153}Sm-EDTMP chelate as compared with molecules of ``free``EDTMP. The results of biodistribution of {sup 153}Sm-EDTMP determined in rats indicate the quick blood clearance, high deposition of radioactivity in bone and quick excretion of radioactivity into urine. No specific uptake of {sup 153}Sm-EDTMP in extra-skeletal organs was found. (author). 42 refs, 13 figs, 22 tabs.

  15. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints

    Directory of Open Access Journals (Sweden)

    Mohammed Najeeb Al Hallak


    Full Text Available 153Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate and Samarium-153 [1]. 153Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of 153Sm-EDTMP leads to contamination with 154Eu (Europium-154 [2]. A previous study only alluded to the retention of 154Eu in the bones after receiving treatment with 153Sm-EDTMP [2]. Activation of the alarm at security checkpoints after 153Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received 153Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing theAmerican-Canadian border. We assume that the 154Eu which remained in the patients’ bones activated the sensors. Methods: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received 153Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. Results: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of 154Eu emissions. Conclusion: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of 154Eu retained in patients who received 153Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of 153Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with 153Sm-EDTMP at Roger Maris Cancer Center

  16. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints. (United States)

    Najeeb Al Hallak, Mohammed; McCurdy, Matt; Zouain, Nicolas; Hayes, Justin


    (153)Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate) and Samarium-153 [1]. (153)Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of (153)Sm-EDTMP leads to contamination with (154)Eu (Europium-154) [2]. A previous study only alluded to the retention of (154)Eu in the bones after receiving treatment with (153)Sm-EDTMP [2]. Activation of the alarm at security checkpoints after (153)Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received (153)Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA) activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing the American-Canadian border. We assume that the (154)Eu which remained in the patients' bones activated the sensors. METHODS: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received (153)Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. RESULTS: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of (154)Eu emissions. CONCLUSION: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of (154)Eu retained in patients who received (153)Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of (153)Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with (153)Sm-EDTMP at Roger Maris Cancer

  17. Dicty_cDB: SSE161 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 5' similar to SW:IPYR_CAEEL Q18680 PROBABLE INORGANIC PYROPHOSPHATASE ;, mRNA sequence. 36 2e-04 3 X14230...N-(5'-phosphoribosyl)anthranilate isomerase, histone H3 and inorganic pyrophosphatase (EC respectively. 38 5e-04...RecName: Full=Inorganic pyrophosphatase; EC=3.... 317 2e-85 (Q6C1T4) RecName: Full=Inorganic pyrophosphatase;...RecName: Full=Inorganic pyrophosphatase; EC=3.... 164 1e-39 ( P13998 ) RecName: Full=Inorganic pyrophosphatase;...RecName: Full=Inorganic pyrophosphatase; EC=3.... 161 1e-38 (Q6FRB7) RecName: Full=Inorganic pyrophosphatase;

  18. Spectroscopy of ^161Yb with ATLAS/Gammasphere (United States)

    Gaison, J.; Carroll, J.; Litz, M.; Wang, X.; Riley, M.; Baron, J.; Miller, S.; Simpson, J.; Paul, E.; Boston, A.; Boston, H.; Nolan, J.; Rees, M.; Revill, J.; Janssens, R.; Carpenter, M.; Kondev, F.; Lauritsen, T.; Zhu, S.; Riedinger, L.; Hartley, D.; Ayangeakaa, A.; Garg, U.; Chiara, C.


    An experiment was performed at Argonne National Laboratory's ATLAS accelerator using the Gammasphere array (˜100 HPGe detectors) whose primary aim was to investigate the collective bands beyond band termination in ^160Yb via the ^120Sn(^44Ca,4n) fusion-evaporation reaction. The high spin yield of the 4n channel was enhanced significantly by selecting a beam energy of 222 MeV and a considerable amount of data of 3n and 5n channels were also obtained. Here is presented the preliminary result of an initial spectroscopic analysis of ^161Yb, the product of the 3n channel. The RadWare (coincidence analysis) software package was utilized and the possibility of revised level placements has been suggested by the analysis, in comparison with previous level schemes.

  19. CD161 Defines a Transcriptional and Functional Phenotype across Distinct Human T Cell Lineages

    Directory of Open Access Journals (Sweden)

    Joannah R. Fergusson


    Full Text Available The C-type lectin CD161 is expressed by a large proportion of human T lymphocytes of all lineages, including a population known as mucosal-associated invariant T (MAIT cells. To understand whether different T cell subsets expressing CD161 have similar properties, we examined these populations in parallel using mass cytometry and mRNA microarray approaches. The analysis identified a conserved CD161++/MAIT cell transcriptional signature enriched in CD161+CD8+ T cells, which can be extended to CD161+ CD4+ and CD161+TCRγδ+ T cells. Furthermore, this led to the identification of a shared innate-like, TCR-independent response to interleukin (IL-12 plus IL-18 by different CD161-expressing T cell populations. This response was independent of regulation by CD161, which acted as a costimulatory molecule in the context of T cell receptor stimulation. Expression of CD161 hence identifies a transcriptional and functional phenotype, shared across human T lymphocytes and independent of both T cell receptor (TCR expression and cell lineage.

  20. Preparation of extractive resins for producing terbium-161; Preparacion de resinas extractivas para produccion de terbio-161

    Energy Technology Data Exchange (ETDEWEB)

    De la Cruz B, C. C.; Monroy G, F. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico)], e-mail:


    This paper presents the development of a methodology for extractive resins preparation to base of HDEHP, which allows to separation of Tb from Gd generating an own technology of preparation of these resins. The study included the extractive resins preparation from 6 different supports: kieselguhr Dg, alumina, red volcanic rock, chiluca, quarry and fluorite; two treatment types of of supports and varied concentrations of HDEHP extractant (di(2-etil hexyl) orthophosphoric acid), in order to determine which resin has improved efficiency of Gd and Tb separation, and radionuclide purity of {sup 161}Tb. Resins were prepared to base of kieselguhr to determine the most appropriate silicon deposition process. Two silicon deposition treatments were realized: treatment I , by contact with silicon deposition solution (dimethyldichlorosilane / heptane 1:30) and treatment II by contact with vapors of dimethyldichlorosilane in vacuum. The extractant retention was carried out to different concentrations of HDEHP / acetone: 1:4, 1:8, 1:15, 1:20, 1:30 and 1:40. According to the results, there is not direct relation of HDEHP concentration used in extractive resins preparation to base of kieselguhr over the efficiency of Gd and Tb separation and of radionuclide purity of {sup 161}Tb. The effect of support in the efficiency of Gd and Tb separation was studied to prepare resins with the supports kieselguhr, alumina, quarry, chiluca, volcanic rock and fluorite, using the silicon deposition treatment II for the supports and a concentration of HDEHP / acetone 1:20, for extractant retention. Only resins based on kieselguhr could separate to Gd from Tb quantitatively, the resin at a concentration of HDEHP / Acetone 1:20 was the best results obtained in Gd and Tb separation, achieving a separation efficiency greater than 90% and a radionuclide purity higher than 99%. (Author)

  1. Formation of a new adduct based on fullerene tris-malonate samarium salt C60-[C60(=C(COO)2)3]Sm2 (United States)

    Petrov, A. A.; Keskinov, V. A.; Semenov, K. N.; Charykov, N. A.; Letenko, D. G.; Nikitin, V. A.


    Gram quantities of a new adduct based on light fullerene tris-malonate samarium salt C60 [C60(=C(COO)2)3]Sm2 are obtained via the reaction of ion exchange. The obtained adduct is studied by means of electron and infrared spectroscopy, X-ray and elemental analysis, electron microscopy, and thermogravimetry. The polythermal solubility of [C60(=C(COO)2)3]Sm2 in water is determined in ampoules via saturation within 20-70°C. The composition of crystalline hydrate [C60(=C(COO)2)3]Sm2 · 36H2O, which exists in equilibrium with the saturated solution, is estimated.

  2. Biodistribution of samarium-153-EDTMP in rats treated with docetaxel Biodistribuição de EDTMP-153-samário em ratos tratados com docetaxel

    Directory of Open Access Journals (Sweden)

    Arthur Villarim Neto


    Full Text Available PURPOSE: Many patients with metastatic bone disease have to use radiopharmaceuticals associated with chemotherapy to relieve bone pain. The aim of this study was to assess the influence of docetaxel on the biodistribution of samarium-153-EDTMP in bones and other organs of rats. METHODS: Wistar male rats were randomly allocated into 2 groups of 6 rats each. The DS (docetaxel/samarium group received docetaxel (15 mg/kg intraperitoneally in two cycles 11 days apart. The S (samarium/control group rats were not treated with docetaxel. Nine days after chemotherapy, all the rats were injected with 0.1ml of samarium-153-EDTMP via orbital plexus (25µCi. After 2 hours, the animals were killed and samples of the brain, thyroid, lung, heart, stomach, colon, liver, kidney and both femurs were removed. The percentage radioactivity of each sample (% ATI/g was determined in an automatic gamma-counter (Wizard-1470, Perkin-Elmer, Finland. RESULTS: On the 9th day after the administration of the 2nd chemotherapy cycle, the rats had a significant weight loss (314.50±22.09g compared (pOBJETIVO: Muitos pacientes com metástases ósseas são tratados com radiofármacos associados com quimioterapia para alívio da dor óssea. O objetivo do trabalho foi estudar a influência do docetaxel na biodistribuição do EDTMP-153-samário nos ossos e outros órgãos de ratos. MÉTODOS: Ratos Wistar foram aleatoriamente alocados em 2 grupos de 6 animais cada. O grupo DS (docetaxel/samário recebeu docetaxel (15 mg/kg intraperitoneal em dois ciclos com 11 dias de intervalo. Os ratos do grupo S (samário/controle não foram tratados com docetaxel. Nove dias após a quimioterapia, todos os animais receberam 0,1ml de EDTMP-153-samário via plexo orbital (25µCi. Após 2 horas, os animais foram mortos e feitas biópsias de cérebro, tireóide, pulmão, coração, estômago, cólon, fígado, rim e fêmures. O percentual de radioatividade por grama (%ATI/g de tecido de cada bi

  3. Marrow irradiation with high-dose 153Samarium-EDTMP followed by chemotherapy and hematopoietic stem cell infusion for acute myelogenous leukemia. (United States)

    Rodriguez, Vilmarie; Anderson, Peter M; Litzow, Mark R; Erlandson, Linda; Trotz, Barbara A; Arndt, Carola A S; Khan, Shakila P; Wiseman, Gregory A


    In four patients, aged 15 - 20 years, with high-risk acute myeloid leukemia (AML), high-dose samarium 153-labelled ethylenediaminetetramethylenephosphonate (153Sm-EDTMP) was used for targeted marrow irradiation before preparative chemotherapy conditioning regimens and allogeneic (three patients) or autologous (one patient) hematopoietic stem cell transplantation. The dose of 153Sm-EDTMP was 703 MBq/kg (n = 1) or 1110 MBq/kg (n = 3). No side-effects occurred during the 30-min infusion of 153Sm-EDTMP. Samarium - melphalan regimens were given to three patients; one had 153Sm-EDTMP - busulfan + cyclophosphamide. Total body radioactivity was below the 133 MBq safe limit before infusion of stem cells (day 14 after 153Sm-EDTMP). No hemorrhagic cystitis, nephrotoxicity or serious infections occurred. Leukocyte engraftment (white blood cell count >0.5 x 10(9)/l) occurred between 12 and 23 days after stem cell infusion (mean of 17 days). Complete cytogenetic and morphologic remission of AML was evident on follow-up marrow aspirate and biopsy specimens from all patients. In two of the four study patients, the disease remains in complete remission and the patients have an excellent quality of life (Eastern Cooperative Oncology Group performance status 0; no medications) and no organ toxicity more than 2 years and more than 4 years, respectively, after their blood and bone marrow transplantations. Thus, in adolescents and adults, 153Sm-EDTMP may provide a relatively simple and effective means for using irradiation to eliminate AML within the marrow.

  4. 49 CFR 173.161 - Chemical kits and first aid kits. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Chemical kits and first aid kits. 173.161 Section... Class 7 § 173.161 Chemical kits and first aid kits. (a) Chemical kits and First aid kits must conform to... 10 kg. (b) Chemical kits and First aid kits are excepted from the specification packaging...

  5. 25 CFR 1000.161 - What is a self-governance compact? (United States)


    ... 25 Indians 2 2010-04-01 2010-04-01 false What is a self-governance compact? 1000.161 Section 1000... EDUCATION ACT Negotiation Process for Annual Funding Agreements Negotiating A Self-Governance Compact § 1000.161 What is a self-governance compact? A self-governance compact is an executed document that affirms...

  6. 34 CFR 222.161 - How is State aid treated under section 8009 of the Act? (United States)


    ... the school year in an elementary (including pre-kindergarten) or secondary school program. “Current... 34 Education 1 2010-07-01 2010-07-01 false How is State aid treated under section 8009 of the Act? 222.161 Section 222.161 Education Regulations of the Offices of the Department of Education OFFICE OF...

  7. 9 CFR 161.2 - Requirements and application procedures for accreditation. (United States)


    ... vaccination tags, and determine the state of origin of eartags, to properly identify animals in interstate... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Requirements and application procedures for accreditation. 161.2 Section 161.2 Animals and Animal Products ANIMAL AND PLANT HEALTH...

  8. 26 CFR 1.501(c)(16)-1 - Corporations organized to finance crop operations. (United States)


    ... 26 Internal Revenue 7 2010-04-01 2010-04-01 true Corporations organized to finance crop operations. 1.501(c)(16)-1 Section 1.501(c)(16)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE... Corporations organized to finance crop operations. A corporation organized by a farmers' cooperative marketing...

  9. 9 CFR 381.161 - “(Kind) A La Kiev.” (United States)


    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false â(Kind) A La Kiev.â 381.161 Section 381.161 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE... INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Definitions and Standards of Identity or...

  10. Circulating Glucagon 1-61 Regulates Blood Glucose by Increasing Insulin Secretion and Hepatic Glucose Production

    DEFF Research Database (Denmark)

    Wewer Albrechtsen, Nicolai J.; Kuhre, Rune E.; Hornburg, Daniel


    that PG 1-61 dose-dependently increases levels of cAMP, through the glucagon receptor, and increases insulin secretion and protein levels of enzymes regulating glycogenolysis and gluconeogenesis. In rats, PG 1-61 increases blood glucose and plasma insulin and decreases plasma levels of amino acids in...

  11. 75 FR 61655 - Airworthiness Directives; Piper Aircraft, Inc. Model PA-28-161 Airplanes (United States)


    ... Federal Aviation Administration 14 CFR Part 39 RIN 2120-AA64 Airworthiness Directives; Piper Aircraft, Inc... directive (AD) for all Piper Aircraft, Inc. (Piper) Model PA-28-161 airplanes equipped with Thielert.... Piper Model PA-28-161 airplanes modified by STC No. SA03303AT have a similar unsafe design feature that...

  12. 21 CFR 150.161 - Artificially sweetened fruit preserves and jams. (United States)


    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Artificially sweetened fruit preserves and jams. 150.161 Section 150.161 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN..., spice extract. (2) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric...

  13. 22 CFR 161.12 - Environmental effects abroad of major departmental actions. (United States)


    ... analysis shall be prepared in accordance with separate Departmental procedures (Foreign Affairs Manual... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Environmental effects abroad of major departmental actions. 161.12 Section 161.12 Foreign Relations DEPARTMENT OF STATE ENVIRONMENTAL PROTECTION...

  14. 22 CFR 161.8 - General description of the Department's NEPA process. (United States)


    ... (Foreign Affairs Manual, Volume 2). (b) Environmental Assessment. An environmental assessment is a concise... 22 Foreign Relations 1 2010-04-01 2010-04-01 false General description of the Department's NEPA process. 161.8 Section 161.8 Foreign Relations DEPARTMENT OF STATE ENVIRONMENTAL PROTECTION REGULATIONS...

  15. Management of sinonasal chondrosarcoma: a systematic review of 161 patients. (United States)

    Khan, Mohemmed N; Husain, Qasim; Kanumuri, Vivek V; Boghani, Zain; Patel, Chirag R; Liu, James K; Eloy, Jean Anderson


    This study reviews the published literature related to management of sinonasal chondrosarcoma. Clinical presentation, demographics, radiographic diagnosis, treatment, and management outcomes of this uncommon disease are reported. A systematic review of studies for sinonasal chondrosarcoma from 1950 to 2012 was conducted. A PubMed search for articles related to this condition, along with bibliographies of the selected articles was performed. Articles were examined for patient data that reported survivability. Demographic data, disease site, treatment strategies, follow-up, outcome, and survival were analyzed. A total of 63 journal articles were included, comprising a total of 161 cases of sinonasal chondrosarcoma. The average follow-up was 77.4 months (range, 1 to 325.2 months). Surgical resection was the most common treatment modality, used in 72.0% of cases. A combination of surgery and radiation therapy was the second most commonly used treatment modality, used in 21.7% of cases. This review contains the largest pool of sinonasal chondrosarcoma patients to date and suggests aggressive surgical resection is the most common treatment modality for this condition. The use of adjuvant radiotherapy for prevention of local recurrence after subtotal or total resection has not been proven effective. However, the use of radiotherapy in addition to surgical resection has shown benefit in some studies in terms of survival. © 2013 ARS-AAOA, LLC.

  16. Synthesis of samarium complexes with the derivative binder of Schiff Quinolinic base. Characterization and photophysical study; Sintesis de complejos de samario con el ligante derivado de base de Schiff Quinolinica. Caracterizacion y estudio fotofisico

    Energy Technology Data Exchange (ETDEWEB)

    Lucas H, J.


    In this work we determined the metal: binder stoichiometry of the species formed during the UV/Vis spectrophotometric titration of the derivative binder of Schiff quinolinic base, L1 with the samarium nitrate pentahydrate in methanol. Statistical analysis of the data allowed proposing the metal: binder stoichiometry for the synthesis of the complexes which was one mole of samarium salt by 2.5 moles of binder and thus favor the formation of complexes with 1M: 1L and 1M: 2L stoichiometries. They were synthesized in aqueous-organic medium (water-ethanol), isolated and purified two complexes with stoichiometry 1 Sm: 1 L1, complex 1 and 1 Sm: 2 L1, complex 2. The overall yield of the reaction was 76%. The characterization of the formed complexes was performed by visible ultraviolet spectrometry (UV/Vis), nuclear magnetic resonance, X-ray photoelectron spectroscopy (XP S), thermal gravimetric analysis with differential scanning calorimetry (TGA/DSC), and radial distribution function. These complexes were studied by fluorescence and emission phosphorescence at variable temperature. Spectroscopic techniques used in both solution and solid demonstrated the formation and stability of these complexes. In addition XP S indicated that in both complexes the samarium retains its oxidation state 3+. Luminescence studies indicated that there is intra-binding charge transfer which decreases the transfer of light energy from the binder to the samarium. Based on the experimental results, L1 binder molecules and complexes 1 and 2 were modeled that demonstrated the proposed Nc for each complex, as well as allowed to visualize the structural arrangement of the molecules, complexes and binder. (Author)

  17. The influence of quasineutron configurations on {sup 161}Ta and nearby odd-A nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Joss, D. T.; Thomson, J.; Bianco, L.; O' Donnell, D.; Page, R. D.; Paul, E. S.; Sapple, P. J.; Wiseman, D. R. [Oliver Lodge Laboratory, University of Liverpool, Liverpool, L69 7ZE (United Kingdom); Lagergren, K. [Joint Institute for Heavy Ion Research, Holifield Radioactive Ion Beam Facility, Oak Ridge, TN 37381 (United States); Appelbe, D. E.; Barton, C. J.; Gomez-Hornillos, M. B.; Labiche, M.; Simpson, J.; Warner, D. D. [STFC Daresbury Laboratory, Daresbury, Warrington, WA4 4AD (United Kingdom); Cederwall, B.; Hadinia, B.; Wyss, R. [Department of Physics, Royal Institute of Technology, S-10691 Stockholm (Sweden); Darby, I. G.; Grahn, T. [Department of Physics, University of Jyvaeskylae, P.O. Box 35, FI-40014 (Finland); and others


    Several strongly coupled bands in the neutron-deficient nucleus {sup 161}Ta have been identified and quasiparticle configuration assignments have been made on the basis of rotational alignments and cranked shell model calculations. The level scheme elucidated for {sup 161}Ta highlights the competition between the {nu}(h{sub 9/2}) and {nu}(i{sub 13/2}) orbitals to form the yrast spectrum. The band structures in {sup 161}Ta also provide new insights into the structural features of other heavy odd-A nuclei populated with much lower reaction cross sections in this region at the proton drip line.

  18. 34 CFR 403.161 - How must funds be used under the Comprehensive Career Guidance and Counseling Programs? (United States)


    ... Guidance and Counseling Programs? 403.161 Section 403.161 Education Regulations of the Offices of the... the Special Programs? Comprehensive Career Guidance and Counseling Programs § 403.161 How must funds be used under the Comprehensive Career Guidance and Counseling Programs? (a) A State shall use not...

  19. 33 CFR 165.161 - Safety zones: Coast Guard Captain of the Port New York annual fireworks displays. (United States)


    ... of the Port New York annual fireworks displays. 165.161 Section 165.161 Navigation and Navigable... Coast Guard District § 165.161 Safety zones: Coast Guard Captain of the Port New York annual fireworks displays. (a) Safety zones. The following areas are designated safety zones: (1) Bar Beach fireworks...

  20. Yeast Interacting Proteins Database: YGL161C, YDR084C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YGL161C YIP5 Protein that interacts with Rab GTPases, localized to late Golgi vesicles; computational...GTPases, localized to late Golgi vesicles; computational analysis of large-scale protein-protein interaction

  1. 22 CFR 161.10 - Non-Federal applicants for permits. (United States)


    ... IMPLEMENTATION OF THE NATIONAL ENVIRONMENTAL POLICY ACT (NEPA) Coordination of Other Requirements of NEPA § 161... permits for the construction of bridges and oil pipelines that cross the international boundaries with...

  2. Biologic and serologic characterization of the 161A strain of Naegleria fowleri. (United States)

    Visvesvara, G S; Healy, G R


    The 161A strain of Naegleria isolated from the nasal swab of a boy (9) was grown axenically in Nelson's medium. When 10,000 amoebae from the axenic medium were inoculated onto each monkey kidney cell (Vero) culture, characteristic cytopathic effects (CPE) were noticed in 4 to 5 days. The CPE consisted of granulation of the host cell cytoplasm, cell shrinkage, nuclear pycnosis, and discontinuity of cell sheet. When 10,000 amoebae were instilled intranasally into a group of ten 2- to 3-week-old mice, 8 of the 10 mice exhibited characteristic symptoms of primary amoebic meningoencephalitis and died within 10 to 12 days. Histopathology of the brain revealed necrotic tissue and an acute inflammatory reaction in the superficial regions of the brain. In the gel diffusion and immunoelectrophoresis tests the sonically disrupted antigens of 161A amoebae reacted extensively with the hyper-immune sera against 3 strains (CA, CJ, HB-1) of pathogenic N. fowleri and produced patterns very similar to those produced by the homologous systems. Further, anti-HB-1 serum absorbed with the 161A antigens failed to react with the antigens of HB-1, CA, CJ, and 161A strains thus indicating antigenic identity of 161A strain with N. fowleri. In view of these observations it was concluded that the strain 161A is pathogenic and should be reclassified as N. fowleri.

  3. Circulating Glucagon 1-61 Regulates Blood Glucose by Increasing Insulin Secretion and Hepatic Glucose Production

    Directory of Open Access Journals (Sweden)

    Nicolai J. Wewer Albrechtsen


    Full Text Available Glucagon is secreted from pancreatic α cells, and hypersecretion (hyperglucagonemia contributes to diabetic hyperglycemia. Molecular heterogeneity in hyperglucagonemia is poorly investigated. By screening human plasma using high-resolution-proteomics, we identified several glucagon variants, among which proglucagon 1-61 (PG 1-61 appears to be the most abundant form. PG 1-61 is secreted in subjects with obesity, both before and after gastric bypass surgery, with protein and fat as the main drivers for secretion before surgery, but glucose after. Studies in hepatocytes and in β cells demonstrated that PG 1-61 dose-dependently increases levels of cAMP, through the glucagon receptor, and increases insulin secretion and protein levels of enzymes regulating glycogenolysis and gluconeogenesis. In rats, PG 1-61 increases blood glucose and plasma insulin and decreases plasma levels of amino acids in vivo. We conclude that glucagon variants, such as PG 1-61, may contribute to glucose regulation by stimulating hepatic glucose production and insulin secretion.

  4. Pyrolysis result of polyethylene waste as fuel for solid oxide fuel cell with samarium doped-ceria (SDC)-carbonate as electrolyte (United States)

    Syahputra, R. J. E.; Rahmawati, F.; Prameswari, A. P.; Saktian, R.


    In this research, the result of pyrolysis on polyethylene was used as fuel for a solid oxide fuel cell (SOFC). The pyrolysis result is a liquid which consists of hydrocarbon chains. According to GC-MS analysis, the hydrocarbons mainly consist of C7 to C20 hydrocarbon chain. Then, the liquid was applied to a single cell of NSDC-L | NSDC | NSDC-L. NSDC is a composite SDC (samarium doped-ceria) with sodium carbonate. Meanwhile, NSDC-L is a composite of NSDC with LiNiCuO (LNC). NSDC and LNC were analyzed by X-ray diffraction to understand their crystal structure. The result shows that presence of carbonate did not change the crystal structure of SDC. SEM EDX analysis for fuel cell before and after being loaded with polyethylene oil to get information of element diffusion to the electrolyte. Meanwhile, the conductivity properties were investigated through impedance measurement. The presence of carbonate even increases the electrical conductivity. The single cell test with the pyrolysis result of polyethylene at 300 - 600 °C, found that the highest power density is at 600 °C with the maximum power density of 0.14 mW/cm2 and open circuit voltage of 0.4 Volt. Elemental analysis at three point spots of single cell NDSC-L |NSDC|NSDC-L found that a migration of ions was occurred during fuel operation at 300 - 600 °C.

  5. Effects of some rare earth and carbonate-based co-dopants on structural and electrical properties of samarium doped ceria (SDC) electrolytes for solid oxide fuel cells (United States)

    Anwar, Mustafa; Khan, Zuhair S.; Mustafa, Kamal; Rana, Akmal


    In the present study, samarium doped ceria (SDC) and SDC-based composite with the addition of K2CO3 were prepared by co-precipitation route and effects of pH of the solution and calcination temperature on microstructure of SDC and SDC-K2CO3, respectively, were investigated. Furthermore, experimentation was performed to investigate into the ionic conductivity of pure SDC by co-doping with yttrium i.e., YSDC, XRD and SEM studies show that the crystallite size and particle size of SDC increases with the increase in pH. The SEM images of all the samples of SDC synthesized at different pH values showed the irregular shaped and dispersed particles. SDC-K2CO3 was calcined at 600∘C, 700∘C and 800∘C for 4 h and XRD results showed that crystallite size increases while lattice strain, decreases with the increase in calcination temperature and no peaks were detected for K2CO3 as it is present in an amorphous form. The ionic conductivity of the electrolytes increases with the increase in temperature and SDC-K2CO3 shows the highest value of ionic conductivity as compared to SDC and YSDC. Chemical compatibility tests were performed between the co-doped electrolyte and lithiated NiO cathode at high temperature. It revealed that the couple could be used up to the temperature of 700∘C.

  6. Calculation of the Dose of Samarium-153-Ethylene Diamine Tetramethylene Phosphonate (153Sm-EDTMP as a Radiopharmaceutical for Pain Relief of bone Metastasis

    Directory of Open Access Journals (Sweden)

    Fatemeh Razghandi


    Full Text Available Introduction One of the important applications of nuclear physics in medicine is the use of radioactive elements as radiopharmaceuticals. Metastatic bone disease is the most common form of malignant bone tumors. Samarium-153-ethylene diamine tetramethylene phosphonate (153Sm-EDTMP as a radiopharmaceutical is used for pain palliation. This radiopharmaceutical usually emits beta particles, which have a high uptake in bone tissues. The purpose of this study was to calculate the radiation dose distribution of 153Sm-EDTMP in bone and other tissues, using MCNPX Monte Carlo code in the particle transport model. Materials and Methods Dose delivery to the bone was simulated by seeking radiopharmaceuticals on the bone surface. The phantom model had a simple cylindrical geometry and included bone, bone marrow, and soft tissue. Results The simulation results showed that a significant amount of radiation dose was delivered to the bone by the use of this radiopharmaceutical. Conclusion Thebone acted as a fine protective shield against rays for the bone marrow. Therefore, the trivial absorbed dose by the bone marrow caused less damage to bone-making cells. Also, the high absorbed dose of the bone could destroy cancer cells and relieve the pain in the bone.

  7. Synthesis, quality control and biological evaluation of tris[(1,10-phenanthroline)[{sup 153}Sm]samarium(III)]trithiocyanate complex as a therapeutic agent

    Energy Technology Data Exchange (ETDEWEB)

    Naseri, Z.; Kharat, A. Nemati [Tehran Univ. (Iran, Islamic Republic of). Inorganic Chemistry Dept.; Hakimi, A. [Islamic Azad Univ., Tehran (Iran, Islamic Republic of). Dept. of Nuclear Engineering, Science and Research Branch; Jalilian, A.R.; Shirvani-Arani, S.; Bahrami-Samani, A.; Ghannadi-Maragheh, M. [Nuclear Science and Technology Research Institute (NSTRI), Tehran (IR). Radiopharmaceutical Research and Development Lab (RRDL)


    Therapeutic radiopharmaceuticals are designed to deliver high doses of radiation to selected target organs or tissues with an aim of minimizing unwanted radiation to surrounding healthy tissue. In this work, [tris(1,10-phenanthroline)[{sup 153}Sm]samarium(III)]trithiocyanate ({sup 153}Sm-TPTTC) was developed for possible therapeutic properties. The cold compound, i.e. {sup nat}Sm-TPTTC was prepared and characterized by IR, UV, mass and {sup 1}H-NMR spectroscopy. {sup 153}Sm-TPTTC was prepared in two steps using [{sup 153}Sm]SmCl{sub 3}, obtained by neutron activation of an enriched {sup 152}Sm sample. Stability tests, partition coefficient determination, toxicity tests and biodistribution studies of the complex in wild-type and fibrosarcoma-bearing mice were determined. The radiolabeled complex was prepared in high radiochemical purity (> 99% precipitation method) and specific activity of 278 GBq/mmol and demonstrated significant stability at 4, 25 and 37 C (in presence of human serum). Initial complex biodistribution data showed significant liver accumulation in wild-type mice and significant tumor accumulation in fibrosarcoma-bearing mice with tumor:blood and tumor:muscle ratios of 3.55 (2 h) and 38.26 (96 h) respectively. {sup 153}Sm-TPTTC properties suggest an efficient tumor targeting agent with high tumor-avidity. Further investigation on the therapeutic properties must be conducted. (orig.)

  8. Performance evaluation of heat pump system using R744/R161 mixture refrigerant

    Directory of Open Access Journals (Sweden)

    Zhang Xian-Ping


    Full Text Available As an efficient and energy conservation technology, heat pumps working with R22, which are scheduled to be phased out by Montreal Protocol, are widely used in China at present. The global deteriorating ecology environment would accelerate the phase-out time of R22 in developing countries. Therefore, as a matter of urgency, an eco-friendly substitute should be investigated in order to replace R22. Under this context, and with a consideration of the environmental protection, R744/R161 mixture refrigerant is proposed. R744/R161 mixture refrigerant’s condensation pressure is reduced and its flammability and explosivity are suppressed. A thermodynamic model is developed, and under the given working conditions, the performances of subcritical heat pump system using R744/R161 mixture of variable mass fraction are discussed and compared with those of the R22 system. The optimal mass fraction of R744/R161 is given, which corresponds to a maximal heating coefficient of performance. The simulation results show that R744/R161 mixture can work as a competitive alternative to R22 in heat pump system.

  9. Retention capacity of samarium (III) in zircon for it possible use in retaining walls for confinement of nuclear residues; Capacidad de retencion de samario (III) en circon para su posible uso en barreras de contencion para confinamiento de residuos nucleares

    Energy Technology Data Exchange (ETDEWEB)

    Garcia G, N


    Mexico, as country that produces part of its electric power by nuclear means, should put special emphasis in the development of technologies guided to the sure and long term confinement of the high level nuclear residuals. This work studies the capacity that has the natural zircon to retain to the samarium (III) in solution, by what due, firstly, to characterize the zircon for technical instrumental to determine the purity and characteristic of the mineral in study. The instrumental techniques that were used to carry out the physicochemical characterization were the neutron activation analysis (NAA), the infrared spectroscopy (IS), the thermal gravimetric analysis (TGA), scanning electron microscopy (SEM), transmission electron microscopy (TEM), semiquantitative analysis, dispersive energy spectroscopy (EDS), X-ray diffraction (XRD) and luminescence technique. The characterization of the surface properties carries out by means of the determination of the surface area using the BET multipoint technique, acidity constants, hydration time, the determination of the point of null charge (pH{sub PCN}) and density of surface sites (D{sub s}). The luminescence techniques were useful to determine the optimal point hydration of the zircon and for the quantification of the samarium, for that here intends the development of both analysis techniques. With the adjustment of the titration curves in the FITEQL 4 package the constants of surface acidity in the solid/liquid interface were determined. To the finish of this study it was corroborated that the zircon is a mineral that presents appropriate characteristics to be proposed as a contention barrier for the deep geologic confinement. With regard to the study of adsorption that one carries out the samarium retention it is superior to 90% under the described conditions. This investigation could also be applicable in the confinement of dangerous industrial residuals. (Author)

  10. Percentages of CD4+CD161+ and CD4−CD8−CD161+ T Cells in the Synovial Fluid Are Correlated with Disease Activity in Rheumatoid Arthritis

    Directory of Open Access Journals (Sweden)

    Jinlin Miao


    Full Text Available Objective. CD161 has been identified as a marker of human IL-17-producing T cells that are implicated in the pathogenesis of rheumatoid arthritis (RA. This study aimed to investigate the potential link between the percentage of CD161+ T cells and disease activity in RA patients. Methods. Peripheral blood (PB from 54 RA patients and 21 healthy controls was evaluated. Paired synovial fluid (SF (n = 17 was analyzed. CD161 expression levels on CD4+, CD8+, and CD4−CD8− T cells were assessed by flow cytometry. Results. The percentage of CD4+CD161+ T cells in RA SF was higher than RA PB, and it was positively correlated with DAS28, erythrocyte sedimentation rate (ESR, and C-reactive protein (CRP. CD4−CD8−CD161+ T cell percentage was decreased in RA PB and was further reduced in RA SF, and its level in SF was inversely correlated with DAS28, ESR, and CRP. However, CD8+CD161+ T cell percentage was neither changed in RA PB and SF nor correlated with disease activity indices. Conclusion. An increased CD4+CD161+ T cell percentage and a decreased CD4−CD8−CD161+ T cell percentage are present in RA SF and are associated with disease activity, and the accumulation of CD4+CD161+ T cells in SF may contribute to the local inflammation of RA.

  11. SU-C-201-06: Utility of Quantitative 3D SPECT/CT Imaging in Patient Specific Internal Dosimetry of 153-Samarium with GATE Monte Carlo Package

    Energy Technology Data Exchange (ETDEWEB)

    Fallahpoor, M; Abbasi, M [Tehran University of Medical Sciences, Vali-Asr Hospital, Tehran, Tehran (Iran, Islamic Republic of); Sen, A [University of Houston, Houston, TX (United States); Parach, A [Shahid Sadoughi University of Medical Sciences, Yazd, Yazd (Iran, Islamic Republic of); Kalantari, F [UT Southwestern Medical Center, Dallas, TX (United States)


    Purpose: Patient-specific 3-dimensional (3D) internal dosimetry in targeted radionuclide therapy is essential for efficient treatment. Two major steps to achieve reliable results are: 1) generating quantitative 3D images of radionuclide distribution and attenuation coefficients and 2) using a reliable method for dose calculation based on activity and attenuation map. In this research, internal dosimetry for 153-Samarium (153-Sm) was done by SPECT-CT images coupled GATE Monte Carlo package for internal dosimetry. Methods: A 50 years old woman with bone metastases from breast cancer was prescribed 153-Sm treatment (Gamma: 103keV and beta: 0.81MeV). A SPECT/CT scan was performed with the Siemens Simbia-T scanner. SPECT and CT images were registered using default registration software. SPECT quantification was achieved by compensating for all image degrading factors including body attenuation, Compton scattering and collimator-detector response (CDR). Triple energy window method was used to estimate and eliminate the scattered photons. Iterative ordered-subsets expectation maximization (OSEM) with correction for attenuation and distance-dependent CDR was used for image reconstruction. Bilinear energy mapping is used to convert Hounsfield units in CT image to attenuation map. Organ borders were defined by the itk-SNAP toolkit segmentation on CT image. GATE was then used for internal dose calculation. The Specific Absorbed Fractions (SAFs) and S-values were reported as MIRD schema. Results: The results showed that the largest SAFs and S-values are in osseous organs as expected. S-value for lung is the highest after spine that can be important in 153-Sm therapy. Conclusion: We presented the utility of SPECT-CT images and Monte Carlo for patient-specific dosimetry as a reliable and accurate method. It has several advantages over template-based methods or simplified dose estimation methods. With advent of high speed computers, Monte Carlo can be used for treatment planning

  12. Fabrication of catalytically active nanocrystalline samarium (Sm)-doped cerium oxide (CeO2) thin films using electron beam evaporation (United States)

    Kundu, Subrata; Sutradhar, Narottam; Thangamuthu, R.; Subramanian, B.; Panda, Asit Baran; Jayachandran, M.


    Samarium (Sm)-doped cerium oxide (CeO2) thin films were fabricated using electron beam evaporation technique. The synthesized films were deposited either on glass or ITO substrates and studied their nature by annealing at different temperatures. The optical properties and other morphological studies were done by UV-Vis, XRD, XPS, SEM, EDS, and FT-IR analysis. XRD and XPS analysis clearly confirm the presence of Sm in the ceria site. From the SEM study, it was found that after annealing at high temperature ( 300 or 500 °C), the particles size was reduced due to breakdown of large aggregates of particles which is also confirmed from UV-Vis, XPS, and XRD analyses. The FT-IR study proves the presence of -COO-, -OH, or ammonium group on the particles surface. The deposition of Sm-doped CeO2 nanomaterials was found more feasible on ITO substrate compared to that of glass substrate in terms of stability and depth of film thickness. The Sm-doped CeO2 nanomaterial acts as a re-usable catalyst for the reduction of organic dye molecules in the presence of NaBH4. The catalysis rate was compared by considering the electron transfer process during the reduction. The synthesized Sm-doped CeO2 thin films might find wide variety of applications in various emerging fields like solid oxide fuel cells (SOFCs), oxygen sensor or as catalyst in different types of organic and inorganic catalytic reactions. The fabrication process is very simple, straightforward, less time consuming, and cost effective.

  13. Fabrication of catalytically active nanocrystalline samarium (Sm)-doped cerium oxide (CeO{sub 2}) thin films using electron beam evaporation

    Energy Technology Data Exchange (ETDEWEB)

    Kundu, Subrata, E-mail: [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India); Sutradhar, Narottam [G. B. Marg, Central Salt and Marine Chemical Research Institute - CSIR (India); Thangamuthu, R.; Subramanian, B. [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India); Panda, Asit Baran [G. B. Marg, Central Salt and Marine Chemical Research Institute (CSIR) (India); Jayachandran, M., E-mail: [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India)


    Samarium (Sm)-doped cerium oxide (CeO{sub 2}) thin films were fabricated using electron beam evaporation technique. The synthesized films were deposited either on glass or ITO substrates and studied their nature by annealing at different temperatures. The optical properties and other morphological studies were done by UV-Vis, XRD, XPS, SEM, EDS, and FT-IR analysis. XRD and XPS analysis clearly confirm the presence of Sm in the ceria site. From the SEM study, it was found that after annealing at high temperature ({approx}300 or 500 Degree-Sign C), the particles size was reduced due to breakdown of large aggregates of particles which is also confirmed from UV-Vis, XPS, and XRD analyses. The FT-IR study proves the presence of -COO-, -OH, or ammonium group on the particles surface. The deposition of Sm-doped CeO{sub 2} nanomaterials was found more feasible on ITO substrate compared to that of glass substrate in terms of stability and depth of film thickness. The Sm-doped CeO{sub 2} nanomaterial acts as a re-usable catalyst for the reduction of organic dye molecules in the presence of NaBH{sub 4}. The catalysis rate was compared by considering the electron transfer process during the reduction. The synthesized Sm-doped CeO{sub 2} thin films might find wide variety of applications in various emerging fields like solid oxide fuel cells (SOFCs), oxygen sensor or as catalyst in different types of organic and inorganic catalytic reactions. The fabrication process is very simple, straightforward, less time consuming, and cost effective.Graphical Abstract.

  14. CD3+CD8+CD161high Tc17 cells are depleted in HIV-infection

    DEFF Research Database (Denmark)

    Gaardbo, Julie Christine; Hartling, Hans Jakob; Thorsteinsson, Kristina


    CD8+ Tc17 cells with pro-inflammatory properties have only recently been acknowledged, and Tc17 cells in HIV-infection are undescribed. CD3+CD8+CD161 Tc17 cells and the production of Interleukin-17 were examined in untreated and treated HIV-infected patients, HIV-HCV co-infected patients...... and healthy controls. Depletion of CD3+CD8+CD161 Tc17 cells and diminished production of Interleukin-17 in HIV-infected patients was found. The level of Tc17 cells was associated with the level of the CD4+ count in treated patients....

  15. CD147-mediated chemotaxis of CD4+CD161+ T cells may contribute to local inflammation in rheumatoid arthritis. (United States)

    Lv, Minghua; Miao, Jinlin; Zhao, Peng; Luo, Xing; Han, Qing; Wu, Zhenbiao; Zhang, Kui; Zhu, Ping


    CD161 is used as a surrogate marker for Th17 cells, which are implicated in the pathogenesis of rheumatoid arthritis (RA). In this study, we evaluated the percentage, clinical significance, and CD98 and CD147 expression of CD4+CD161+ T cells. The potential role of CD147 and CD98 in cyclophilin A-induced chemotaxis of CD4+CD161+ T cells was analyzed. Thirty-seven RA patients, 15 paired synovial fluid (SF) of RA, and 22 healthy controls were recruited. The cell populations and surface expression of CD98 and CD147 were analyzed by flow cytometry. Spearman's rank correlation coefficient and multiple linear regression were applied to calculate the correlations. Chemotaxis assay was used to investigate CD4+CD161+ T cell migration. We found that the percentage of CD4+CD161+ T cells and their expression of CD147 and CD98 in SF were higher than in the peripheral blood of RA patients. Percentage of SF CD4+CD161+ T cells was positively correlated with 28-Joint Disease Activity Score (DAS28). CD147 monoclonal antibody (HAb18) attenuated the chemotactic ability of CD4+CD161+ T cells. An increased CD4+CD161+ T cell percentage and expression of CD147 and CD98 were shown in RA SF. Percentage of SF CD4+CD161+ T cells can be used as a predictive marker of disease activity in RA. CD147 block significantly decreased the chemotactic index of CD4+CD161+ cells induced by cyclophilin A (CypA). These results imply that the accumulation of CD4+CD161+ T cells in SF and their high expression of CD147 may be associated with CypA-mediated chemotaxis and contribute to local inflammation in RA.

  16. An Amphiphysin-Like Domain in Fus2p Is Required for Rvs161p Interaction and Cortical Localization

    Directory of Open Access Journals (Sweden)

    Richard A. Stein


    Full Text Available Cell–cell fusion fulfils essential roles in fertilization, development and tissue repair. In the budding yeast, Saccharomyces cerevisiae, fusion between two haploid cells of opposite mating type generates the diploid zygote. Fus2p is a pheromone-induced protein that regulates cell wall removal during mating. Fus2p shuttles from the nucleus to localize at the shmoo tip, bound to Rvs161p, an amphiphysin. However, Rvs161p independently binds a second amphiphysin, Rvs167p, playing an essential role in endocytosis. To understand the basis of the Fus2p–Rvs161p interaction, we analyzed Fus2p structural domains. A previously described N-terminal domain (NTD is necessary and sufficient to regulate nuclear/cytoplasmic trafficking of Fus2p. The Dbl homology domain (DBH binds GTP-bound Cdc42p; binding is required for cell fusion, but not localization. We identified an approximately 200 amino acid region of Fus2p that is both necessary and sufficient for Rvs161p binding. The Rvs161p binding domain (RBD contains three predicted alpha-helices; structural modeling suggests that the RBD adopts an amphiphysin-like structure. The RBD contains a 13-amino-acid region, conserved with Rvs161p and other amphiphysins, which is essential for binding. Mutations in the RBD, predicted to affect membrane binding, abolish cell fusion without affecting Rvs161p binding. We propose that Fus2p/Rvs161p form a novel heterodimeric amphiphysin required for cell fusion. Rvs161p binding is required but not sufficient for Fus2p localization. Mutations in the C-terminal domain (CTD of Fus2p block localization, but not Rvs161p binding, causing a significant defect in cell fusion. We conclude that the Fus2p CTD mediates an additional, Rvs161p-independent interaction at the shmoo tip.

  17. Page 1 Numerical simulation of the Indian monsoon 161 points out ...

    Indian Academy of Sciences (India)

    Numerical simulation of the Indian monsoon 161 points out “the dynamics of the whole terrestrial climate cannot be separated from the heat Storage effects of the upper ocean". For monsoon studies, the Indian. 9°ºan is the only ocean which experiences a bi-annual reversal of the wind circu- lation. The generation of the ...

  18. 28 CFR 35.161 - Telecommunication devices for the deaf (TDD's). (United States)


    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Telecommunication devices for the deaf... BASIS OF DISABILITY IN STATE AND LOCAL GOVERNMENT SERVICES Communications § 35.161 Telecommunication... beneficiaries, TDD's or equally effective telecommunication systems shall be used to communicate with...

  19. 78 FR 20888 - Foreign-Trade Zone (FTZ) 161-Sedgwick County, Kansas; Notification of Proposed Production... (United States)


    ... Production Activity; Siemens Energy, Inc., (Wind Turbine Nacelles and Hubs), Hutchinson, Kansas Siemens Energy, Inc. (SEI), an operator of FTZ 161, submitted a notification of proposed production activity for.../hoses/seals/sheets/tape/bags/ containers; bushings; funnels; weather strips; hydraulic hoses; rubber...

  20. 27 CFR 31.161 - Conversion between metric and U.S. units. (United States)


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Conversion between metric... Wholesale Dealers' Records and Reports § 31.161 Conversion between metric and U.S. units. When liters are... proof in metric bottles may be converted to U.S. units by multiplying the liters in one case by the...

  1. Yeast Interacting Proteins Database: YDR425W, YGL161C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available with this bait as prey (0) YGL161C YIP5 Protein that interacts with Rab GTPases, localized to late Golgi vesicles; computational...IP5 Prey description Protein that interacts with Rab GTPases, localized to late Golgi vesicles; computatio...nal analysis of large-scale protein-protein interaction data suggests a possible ro

  2. 40 CFR 161.100 - How to determine registration data requirements. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false How to determine registration data...) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR REGISTRATION OF ANTIMICROBIAL PESTICIDES How To Use Data Tables § 161.100 How to determine registration data requirements. To determine the specific kinds of data...

  3. 25 CFR 700.161 - Substitute personal property-nonresidential moves. (United States)


    ... 25 Indians 2 2010-04-01 2010-04-01 false Substitute personal property-nonresidential moves. 700... RELOCATION PROCEDURES Moving and Related Expenses, Temporary Emergency Moves § 700.161 Substitute personal... substitute item at the replacement site, the displaced person is entitled to payment of the lesser of— (1...

  4. 21 CFR 133.161 - Muenster and munster cheese for manufacturing. (United States)


    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Muenster and munster cheese for manufacturing. 133... Specific Standardized Cheese and Related Products § 133.161 Muenster and munster cheese for manufacturing. Muenster cheese for manufacturing conforms to the definition and standard of identity for muenster cheese...

  5. 46 CFR 161.002-10 - Automatic fire detecting system control unit. (United States)


    ... 46 Shipping 6 2010-10-01 2010-10-01 false Automatic fire detecting system control unit. 161.002-10...-10 Automatic fire detecting system control unit. (a) General. The fire detecting system control unit... control unit to silence the audible fire alarms, but operation of the audible fire alarm device shall...

  6. 26 CFR 31.3306(c)(16)-1 - Services in employ of international organization. (United States)


    ... of 1954) § 31.3306(c)(16)-1 Services in employ of international organization. (a) Subject to the provisions of section 1 of the International Organizations Immunities Act (22 U.S.C. 228), services performed in the employ of an international organization as defined in section 7701(a)(18) are excepted from...

  7. Molecular genetics of FAM161A in North American patients with early-onset retinitis pigmentosa.

    Directory of Open Access Journals (Sweden)

    Giulia Venturini

    Full Text Available Retinitis pigmentosa (RP is a hereditary disease that leads to the progressive degeneration of retinal photoreceptor cells and to blindness. It is caused by mutations in several distinct genes, including the ciliary gene FAM161A, which is associated with a recessive form of this disorder. Recent investigations have revealed that defects in FAM161A represent a rather prevalent cause of hereditary blindness in Israel and the Palestinian territories, whereas they seem to be rarely present within patients from Germany. Genetic or clinical data are currently not available for other countries. In this work, we screened a cohort of patients with recessive RP from North America to determine the frequency of FAM161A mutations in this ethnically-mixed population and to assess the phenotype of positive cases. Out of 273 unrelated patients, only 3 subjects had defects in FAM161A. A fourth positive patient, the sister of one of these index cases, was also identified following pedigree analysis. They were all homozygous for the p.T452Sfx3 mutation, which was previously reported as a founder DNA variant in the Israeli and Palestinian populations. Analysis of cultured lymphoblasts from patients revealed that mutant FAM161A transcripts were actively degraded by nonsense-mediated mRNA decay. Electroretinographic testing showed 30 Hz cone flicker responses in the range of 0.10 to 0.60 microvolts in all cases at their first visit (age 12 to 23 (lower norm  =  50 μV and of 0.06 to 0.32 microvolts at their most recent examination (age 27 to 43, revealing an early-onset of this progressive disease. Our data indicate that mutations in FAM161A are responsible for 1% of recessive RP cases in North America, similar to the prevalence detected in Germany and unlike the data from Israel and the Palestinian territories. We also show that, at the molecular level, the disease is likely caused by FAM161A protein deficiency.

  8. Nicotine Mediates CD161a+ Renal Macrophage Infiltration and Premature Hypertension in the Spontaneously Hypertensive Rat (United States)

    Harwani, Sailesh C.; Ratcliff, Jason; Sutterwala, Fayyaz S.; Ballas, Zuhair K.; Meyerholz, David K.; Chapleau, Mark W.; Abboud, Francois M.


    Rationale Renal inflammation contributes to the pathophysiology of hypertension. CD161a+ immune cells are dominant in the Spontaneously Hypertensive Rat (SHR) and expand in response to nicotinic cholinergic activation. Objective We aimed to phenotype CD161a+ immune cells in pre-hypertensive SHR following cholinergic activation with nicotine, and determine if these cells are involved in renal inflammation and the development of hypertension. Methods and Results Studies utilized young SHR and Wistar Kyoto (WKY) rats. Splenocytes and bone marrow cells were exposed to nicotine ex-vivo and nicotine was infused in-vivo. Blood pressures, kidney, serum, and urine were obtained. Flow cytometry, Luminex/ELISA, immunohistochemistry, confocal microscopy, and Western blot were used. Nicotinic cholinergic activation induced proliferation of CD161a+/CD68+ macrophages in SHR-derived splenocytes, their renal infiltration, and premature hypertension in SHR. These changes were associated with increased renal expression of monocyte-chemoattractant-protein-1 (MCP-1) and very-late-antigen-4 (VLA-4). Lectin-Like-Transcript 1 (LLT1), the ligand for CD161a, was overexpressed in SHR kidney, while vascular cellular (VCAM-1) and intracellular adhesion molecules (ICAM-1) were similar to WKY. Inflammatory cytokines were elevated in SHR kidney and urine following nicotine infusion. Nicotine mediated renal macrophage infiltration/inflammation was enhanced in denervated kidneys, not explained by angiotensin-II levels or expression of angiotensin type-1/2 receptors. Moreover, expression of the anti-inflammatory α7-nicotinic-acetylcholine receptor was similar in young SHR and WKY. Conclusions A novel, inherited nicotinic cholinergic inflammatory effect exists in young SHR, measured by expansion of CD161a+/CD68+ macrophages. This leads to renal inflammation and premature hypertension, which may be partially explained by increased renal expression of LLT-1, MCP-1, and VLA-4. PMID:27660287

  9. 42 CFR 84.161 - Man test for gases and vapors; Type B and Type BE respirators; test requirements. (United States)


    ... 42 Public Health 1 2010-10-01 2010-10-01 false Man test for gases and vapors; Type B and Type BE respirators; test requirements. 84.161 Section 84.161 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES OCCUPATIONAL SAFETY AND HEALTH RESEARCH AND RELATED ACTIVITIES APPROVAL OF RESPIRATORY PROTECTIVE DEVICES Supplied-Air...

  10. Crystal structure of monoclinic samarium and cubic europium sesquioxides and bound coherent neutron scattering lengths of the isotopes {sup 154}Sm and {sup 153}Eu

    Energy Technology Data Exchange (ETDEWEB)

    Kohlmann, Holger [Leipzig Univ. (Germany). Inst. of Inorganic Chemistry; Hein, Christina; Kautenburger, Ralf [Saarland Univ., Saarbruecken (Germany). Inorganic Solid State Chemistry; Hansen, Thomas C.; Ritter, Clemens [Institut Laue-Langevin, Grenoble (France); Doyle, Stephen [Karlsruhe Institute of Technology, Eggenstein-Leopoldshafen (Germany). Inst. for Synchrotron Radiation (ISS)


    The crystal structures of monoclinic samarium and cubic europium sesquioxide, Sm{sub 2}O{sub 3} and Eu{sub 2}O{sub 3}, were reinvestigated by powder diffraction methods (laboratory X-ray, synchrotron, neutron). Rietveld analysis yields more precise structural parameters than previously known, especially for oxygen atoms. Interatomic distances d(Sm-O) in Sm{sub 2}O{sub 3} range from 226.3(4) to 275.9(2) pm [average 241.6(3) pm] for the monoclinic B type Sm{sub 2}O{sub 3} [space group C2/m, a = 1418.04(3) pm, b = 362.660(7) pm, c = 885.48(2) pm, β = 100.028(1) ], d(Eu-O) in Eu{sub 2}O{sub 3} from 229.9(2) to 238.8(2) pm for the cubic bixbyite (C) type [space group Ia anti 3, a = 1086.87(1) pm]. Neutron diffraction at 50 K and 2 K did not show any sign for magnetic ordering in Sm{sub 2}O{sub 3}. Isotopically enriched {sup 154}Sm{sub 2}O{sub 3} and {sup 153}Eu{sub 2}O{sub 3} were used for the neutron diffraction work because of the enormous absorption cross section of the natural isotopic mixtures for thermal neutrons. The isotopic purity was determined by inductively coupled plasma - mass spectrometry to be 98.9% for {sup 154}Sm and 99.8% for {sup 153}Eu. Advanced analysis of the neutron diffraction data suggest that the bound coherent scattering lengths of {sup 154}Sm and {sup 153}Eu need to be revised. We tentatively propose b{sub c}({sup 154}Sm) = 8.97(6) fm and b{sub c}({sup 153}Eu) = 8.85(3) fm for a neutron wavelength of 186.6 pm to be better values for these isotopes, showing up to 8% deviation from accepted literature values. It is shown that inaccurate scattering lengths may result in severe problems in crystal structure refinements causing erroneous structural details such as occupation parameters, which might be critically linked to physical properties like superconductivity in multinary oxides.

  11. 161 | Page

    African Journals Online (AJOL)

    Fr. Ikenga

    A treaty is basically an agreement between parties on the international scene. Although treaties may be concluded, or made between States and international organizations, they are primarily concerned with relations between States.13In this wise, the 1969 Vienna Convention on the Law of Treaties defines a. 'Treaty' as: ...

  12. 161 | Page

    African Journals Online (AJOL)

    Fr. Ikenga

    49 JA Cohen 'The Personal Security of Businessmen and Trade Representatives' in VH Li Law and Politics in .... was not immune from prosecution by Spanish courts for the crimes of torture ..... Unofficial translation by Human Rights Watch.

  13. Expression of Lectin-Like Transcript 1, the Ligand for CD161, in Rheumatoid Arthritis.

    Directory of Open Access Journals (Sweden)

    Paulina Chalan

    Full Text Available Precursor Th17 lineage cells expressing CD161 are implicated in Rheumatoid Arthritis (RA pathogenesis. CD4+CD161+ T-cells accumulate in RA joints and may acquire a non classical Th1 phenotype. The endogenous ligand for CD161 is lectin-like transcript 1 (LLT1. CD161/LLT1 ligation may co-stimulate T-cell IFN-γ production. We investigated the presence and identity of LLT1-expressing cells in RA synovial fluid (SF and synovial tissue (ST. We also assessed levels of soluble LLT1 (sLLT1 in different phases of RA development.Paired samples of peripheral blood mononuclear cells (MC and SFMC (n = 14, digested ST cells (n = 4 and ST paraffin sections (n = 6 from late-stage RA were analyzed for LLT1 expression by flow cytometry and immunohistochemistry. sLLT1 was measured using a sandwich ELISA. Sera and SF from late-stage RA (n = 26, recently diagnosed RA patients (n = 39, seropositive arthralgia patients (SAP, n = 31, spondyloarthropathy patients (SpA, n = 26 and healthy controls (HC, n = 31 were assayed.In RA SF, LLT1 was expressed by a small proportion of monocytes. In RA ST, LLT1-expressing cells were detected in the lining, sublining layer and in areas with infiltrates. The LLT1 staining pattern overlapped with the CD68 staining pattern. FACS analysis of digested ST confirmed LLT1 expression by CD68+ cells. Elevated systemic sLLT1 was found in all patient groups.In RA joints, LLT1 is expressed by cells of the monocyte/macrophage lineage. Serum levels of sLLT1 were increased in all patient groups (patients with early- and late-stage RA, seropositive arthralgia and spondyloarthropathy when compared to healthy subjects.

  14. Yeast Interacting Proteins Database: YGL161C, YGL198W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YGL161C YIP5 Protein that interacts with Rab GTPases, localized to late Golgi vesicles; computational...that interacts with Rab GTPases, localized to late Golgi vesicles; computational ...eracts with Rab GTPases, localized to late Golgi vesicles; computational analysis of large-scale protein-pro...ized to late Golgi vesicles; computational analysis of large-scale protein-protein interaction data suggests

  15. Chemical stratification in the Orion Bar : JCMT spectral legacy survey observations (vol 498, pg 161, 2009)

    NARCIS (Netherlands)

    van der Wiel, M. H. D.; van der Tak, F. F. S.; Ossenkopf, V.; Spaans, M.; Roberts, H.; Fuller, G. A.; Plume, R.

    The integrated line intensities in Table 1 of Van der Wiel et al. (2009, A&A 498, 161) should be modified due to an error in the adopted channel widths: values are reduced by similar to 20% for C2H, H2CO and SO, reduced by a factor similar to 5 for (CO)-O-18 and HCN, and increased by similar to 40%

  16. Foot strike pattern and gait changes during a 161-km ultramarathon. (United States)

    Kasmer, Mark E; Wren, Jeremy J; Hoffman, Martin D


    Foot strike pattern has not been examined during ultramarathons where fatigue or avoidance of impact might have greater effect on foot strike and other gait parameters than in shorter events. In this study, video analysis from 3 level sites at a 161-km ultramarathon was used to: (a) examine changes in foot strike pattern, stride rate, and stride length; (b) determine if foot strike pattern is related to performance; and (c) ascertain if post-race blood creatine phosphokinase (CK) concentrations differ by foot strike pattern. Rear-foot strike (RFS) prevalence was 79.9, 89.0, and 83.9% at 16.5, 90.3, and 161.1 km, respectively. There was a significant distance effect observed between the 90.3 and 161.1-km site for stride rate (p foot strike pattern on performance. However, top 20 finishers had greater use (p = 0.02) of a non-RFS pattern at 161.1 km than the remaining finishers. There was a trend toward greater post-race blood CK values among non-RFS runners compared with RFS runners, reaching significance at the 90.3 km site (p race midpoint was likely because of greater muscular demands of non-RFS patterns as supported by the higher post-race blood CK concentrations among non-RFS runners. Faster runners maintained higher stride rates and lengths throughout the race and made greater use of a non-RFS pattern at the end of the race compared with the slower finishers.

  17. Investigation of production routes for the 161Ho Auger-electron emitting radiolanthanide, a candidate for therapy


    Tárkányi, F.; Ditrói, F.; Hermanne, A.; Takács, S.; Ignatyuk, A. V.


    The radiolanthanide 161Ho (2.48 h) is a promising Auger-electron emitter for internal radiotherapy that can be produced with particle accelerators. The excitation functions of the natDy(p,xn)161Ho and natDy(d,x)161Ho reactions were measured up to 40 and 50 MeV respectively by using the stacked foil activation method and gamma-ray spectrometry. The experimental data were compared with results of the TALYS code available in the TENDL 2011 library [1]. The main parameters of different production...

  18. Highly CO2-Tolerant Cathode for Intermediate-Temperature Solid Oxide Fuel Cells: Samarium-Doped Ceria-Protected SrCo0.85Ta0.15O3-δ Hybrid. (United States)

    Li, Mengran; Zhou, Wei; Zhu, Zhonghua


    Susceptibility to CO2 is one of the major challenges for the long-term stability of the alkaline-earth-containing cathodes for intermediate-temperature solid oxide fuel cells. To alleviate the adverse effects from CO2, we incorporated samarium-stabilized ceria (SDC) into a SrCo0.85Ta0.15O3-δ (SCT15) cathode by either mechanical mixing or a wet impregnation method and evaluated their cathode performance stability in the presence of a gas mixture of 10% CO2, 21% O2, and 69% N2. We observed that the CO2 tolerance of the hybrid cathode outperforms the pure SCT15 cathode by over 5 times at 550 °C. This significant enhancement is likely attributable to the low CO2 adsorption and reactivity of the SDC protective layer, which are demonstrated through thermogravimetric analysis, energy-dispersive spectroscopy, and electrical conductivity study.

  19. The low-energy {beta}{sup -} and electron emitter {sup 161}Tb as an alternative to {sup 177}Lu for targeted radionuclide therapy

    Energy Technology Data Exchange (ETDEWEB)

    Lehenberger, Silvia; Barkhausen, Christoph [Institute for Radiochemistry, Technical University of Munich, Walther-Meissner-Strasse 3, 85748 Garching (Germany); Cohrs, Susan; Fischer, Eliane; Gruenberg, Juergen; Hohn, Alexander [Center for Radiopharmaceutical Sciences, Paul Scherrer Institute, 5232 Villigen, PSI (Switzerland); Koester, Ulli [Institut Laue-Langevin, 6 rue Jules Horowitz, 38042 Grenoble (France); Schibli, Roger [Center for Radiopharmaceutical Sciences, Paul Scherrer Institute, 5232 Villigen, PSI (Switzerland); Tuerler, Andreas [Institute for Radiochemistry, Technical University of Munich, Walther-Meissner-Strasse 3, 85748 Garching (Germany); Laboratory of Radiochemistry and Environmental Chemistry, Paul Scherrer Institute, 5232 Villigen, PSI (Switzerland); Laboratory of Radiochemistry and Environmental Chemistry, Department of Chemistry and Biochemistry, University of Bern, Freiestr. 3, 3012 Bern (Switzerland); Zhernosekov, Konstantin, E-mail: [Institute for Radiochemistry, Technical University of Munich, Walther-Meissner-Strasse 3, 85748 Garching (Germany); Center for Radiopharmaceutical Sciences, Paul Scherrer Institute, 5232 Villigen, PSI (Switzerland); Laboratory of Radiochemistry and Environmental Chemistry, Paul Scherrer Institute, 5232 Villigen, PSI (Switzerland)


    Introduction: The low-energy {beta}{sup -} emitter {sup 161}Tb is very similar to {sup 177}Lu with respect to half-life, beta energy and chemical properties. However, {sup 161}Tb also emits a significant amount of conversion and Auger electrons. Greater therapeutic effect can therefore be expected in comparison to {sup 177}Lu. It also emits low-energy photons that are useful for gamma camera imaging. Methods: The {sup 160}Gd(n,{gamma}){sup 161}Gd{yields}{sup 161}Tb production route was used to produce {sup 161}Tb by neutron irradiation of massive {sup 160}Gd targets (up to 40 mg) in nuclear reactors. A semiautomated procedure based on cation exchange chromatography was developed and applied to isolate no carrier added (n.c.a.) {sup 161}Tb from the bulk of the {sup 160}Gd target and from its stable decay product {sup 161}Dy. {sup 161}Tb was used for radiolabeling DOTA-Tyr3-octreotate; the radiolabeling profile was compared to the commercially available n.c.a. {sup 177}Lu. A {sup 161}Tb Derenzo phantom was imaged using a small-animal single-photon emission computed tomography camera. Results: Up to 15 GBq of {sup 161}Tb was produced by long-term irradiation of Gd targets. Using a cation exchange resin, we obtained 80%-90% of the available {sup 161}Tb with high specific activity, radionuclide and chemical purity and in quantities sufficient for therapeutic applications. The {sup 161}Tb obtained was of the quality required to prepare {sup 161}Tb-DOTA-Tyr3-octreotate. Conclusions: We were able to produce {sup 161}Tb in n.c.a. form by irradiating highly enriched {sup 160}Gd targets; it can be obtained in the quantity and quality required for the preparation of {sup 161}Tb-labeled therapeutic agents.

  20. A 16:1 Serializer ASIC for Data Transmission at 5 Gbps

    CERN Document Server

    Gong, D; The ATLAS collaboration


    A high speed, low power 16:1 serializer is developed using a commercial 0.25 μm silicon-on-sapphire CMOS technology. It operates from 4.0 to 5.8 Gbps in the lab test. Its total jitter is measured to be 62 ps and the bathtub scan demonstrates a 122 ps opening at BER of less than 10-12 level at 5 Gbps. The measured power consumption is 507 mW at this data rate. A proton test of this chip is scheduled in June and test results will be discussed when available.

  1. A 16:1 Serializer ASIC for Data Transmission at 5 Gbps

    CERN Document Server

    Gong, D; The ATLAS collaboration


    A high speed, low power 16:1 serializer has been developed with a commercial 0.25 μm silicon-on-sapphire CMOS technology. The serializer operates from 4.0 to 5.7 Gbps. Total jitter is 62 ps and the eye openning of the bathtub curve is 122 ps at bit rate error of 10-12 at 5 Gbps. Power consumption is 463 mW at 5 Gbps. A proton beam test indicates the serializer is suitable for applications in high energy physics experiments.

  2. Development of A 16:1 serializer for data transmission at 5 Gbps

    CERN Document Server

    Gong, Datao; Liang, Zhihua; Liu, Chonghan; Liu, Tiankuan; Da-Shun Su,; Teng, Ping-Kun; Xiang, Annie C; Ye, Jingbo


    Radiation tolerant, high speed and low power serializer ASIC is critical for optical link systems in particle physics experiments. Based on a commercial 0.25 μm silicon-onsapphire CMOS technology, we design a 16:1 serializer with 5 Gbps serial data rate. This ASIC has been submitted for fabrication. The post-layout simulation indicates the deterministic jitter is 54 ps (pk-pk) and random jitter is 3 ps (rms). The power consumption of the serializer is 500 mW. The design details and post layout simulation results are presented in this paper.

  3. Corneal Opacity in a Participant of a 161-km Mountain Bike Race at High Altitude. (United States)

    Khodaee, Morteza; Torres, David R


    Visual dysfunction is a relatively uncommon complaint among athletes during ultraendurance races. The pathophysiology of most of these cases is unknown. Corneal opacity has been speculated as the etiology for most of reported cases. We are presenting a case of a 56-year-old man with a partial unilateral corneal opacity and edema at kilometer 150 of a 161-km mountain bike race in high altitude. He was not able to finish the race (12-hour cutoff) because of his visual symptoms. He completely recovered in 3 days with no sequelae. Copyright © 2016 Wilderness Medical Society. Published by Elsevier Inc. All rights reserved.

  4. Ferrites Ni{sub 0,5}Zn{sub 0,5}Fe{sub 2}O{sub 4} doped with samarium: structural analysis, morphological and electromagnetic; Ferritas Ni{sub 0,5}Zn{sub 0,5}Fe{sub 2}O{sub 4} dopada com samario: analise estrutural, morfologica e eletromagnetica

    Energy Technology Data Exchange (ETDEWEB)

    Costa, A.C.F.M.; Diniz, A.P., E-mail: [Universidade Federal de Campina Grande (UFCG), PB (Brazil). Unidade Academinca de Engenharia de Materiais; Viana, K.M.S. [Universidade Federal do Rio Grande do Norte (UFRN), Natal, PE (Brazil). Escola de Ciencias e Tecnologia; Cornejo, D.R. [Universidade de Sao Paulo (USP), SP (Brazil). Instituto de Fisica; Kiminami, R.H.G.A. [Universidade Federal de Sao Carlos (UFSCar), SP (Brazil). Departamento de Engenharia de Materiais


    This paper proposes to investigate the sintering at 1200 deg C/2h of Ni{sub 0.5}Zn{sub 0.5}Fe{sub 2-x}Sm{sub x}O{sub 4} ferrite doped with 0.05; 0.075 e 0.1 mol of Sm synthesized by combustion reaction to evaluate the performance materials as absorbers of electromagnetic radiation. The influence of the concentration of samarium on the structure, morphology and electromagnetic properties of ferrites was studied. The resulting samples were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), magnetic measurements and reflectivity measurements in the frequency range between 8-12 GHz. The results showed that increasing the concentration of samarium caused a decrease in particle size of the samples, encouraging, therefore, to obtain materials with better values of magnetization and reflectivity, allowing for use as absorbers in narrow-band frequency between 9-10 GHz. (author)

  5. Enhanced Th1/Th17 Functions of CD161+ CD8+ T Cells in Mucosal Tissues of Rhesus Macaques.

    Directory of Open Access Journals (Sweden)

    Namita Rout

    Full Text Available Expression of the C-type lectin-like receptor CD161 by human T cells is associated with type-17 responses, which play critical regulatory roles in immunity and inflammation at mucosal sites. However, the functions of CD161-expressing T cells in macaques, the pre-clinical model of several human diseases, remain unknown. This study examined the phenotypic and functional characteristics of CD161+ T cells in peripheral blood, mucosal tissues and lymph nodes of rhesus macaques. Majority of CD161-expressing T cells in peripheral blood and lung/intestinal mucosal tissues of rhesus macaques were found to be CD8+CD4- in phenotype. There was a significant enrichment of CD161+CD8+ T cells in the lungs and colonic mucosa (16.1%±6.6 and 16.8%±5.7 in comparison to peripheral blood (4.2%±1.2 and mesenteric lymph nodes (1.3%±0.8. Regardless of the tissue compartment, CD161+CD8+ T cells mainly comprised of γδ T cells and TCR Vα7.2+ MAIT cells (up to 80%, and displayed Th1 and Th17 cytokine responses to mitogen stimulation. Mucosal CD161+CD8+ T cells were characterized by very high expression of CD69, a recent activation marker that is preferentially expressed on tissue resident cells. Furthermore, lung and colonic mucosal CD161+CD8+ T cells showed enhanced IFN-γ, IL-17, and Perforin production in comparison to those in blood. Thus, macaque CD161+CD8+ T cells represent mucosal tissue-homing innate-like CD8+ T-cell populations with Th1/Th17 type cytokine and cytotoxic effector functions that can potentially enhance the recruitment of adaptive immune cells and control initial pathogen burden/dissemination in tissues. Analysis of their role in early immune responses to mucosal pathogens will be valuable in the design of vaccines and therapeutics.

  6. β-decay spectroscopy of neutron-rich 160,161,162Sm isotopes

    Directory of Open Access Journals (Sweden)

    Patel Z.


    Full Text Available Neutron-rich 160,161,162Sm isotopes have been populated at the RIBF, RIKEN via β first time. β-coincident γ rays were observed in all three isotopes including γ rays from the isomeric decay of 160Sm and 162Sm. The isomers in 160Sm and 162Sm have previously been observed but have been populated via β decay for the first time. The isomeric state in 162Sm is assigned a 4−v72+[ 633 ]⊗v12−[ 521 ]${4^ - }v{{7 \\over 2}^ + }\\left[ {633} \\right] \\otimes v{{1 \\over 2}^ - }\\left[ {521} \\right]$ configuration based on the decay pattern. The level schemes of 160Sm and 162Sm are presented. The ground states in the parent nuclei 160Pm and 162Pm are both assigned a 6−v72+[633]⊗π52−[532]${6^ - }v{{7 \\over 2}^ + }\\left[ {633} \\right] \\otimes \\pi {{5 \\over 2}^ - }\\left[ {532} \\right]$ configuration based on the population of states in the daughter nuclei. Blocked BCS calculations were performed to further investigate the spin-parities of the ground states in 160Pm, 161Pm, and 162Pm, and the isomeric state in 162Sm

  7. Innate signals overcome acquired TCR signaling pathway regulation and govern the fate of human CD161(hi) CD8α⁺ semi-invariant T cells. (United States)

    Turtle, Cameron J; Delrow, Jeff; Joslyn, Rochelle C; Swanson, Hillary M; Basom, Ryan; Tabellini, Laura; Delaney, Colleen; Heimfeld, Shelly; Hansen, John A; Riddell, Stanley R


    Type 17 programmed CD161(hi)CD8α(+) T cells contribute to mucosal immunity to bacteria and yeast. In early life, microbial colonization induces proliferation of CD161(hi) cells that is dependent on their expression of a semi-invariant Vα7.2(+) TCR. Although prevalent in adults, CD161(hi)CD8α(+) cells exhibit weak proliferative and cytokine responses to TCR ligation. The mechanisms responsible for the dichotomous response of neonatal and adult CD161(hi) cells, and the signals that enable their effector function, have not been established. We describe acquired regulation of TCR signaling in adult memory CD161(hi)CD8α(+) T cells that is absent in cord CD161(hi) cells and adult CD161(lo) cells. Regulated TCR signaling in CD161(hi) cells was due to profound alterations in TCR signaling pathway gene expression and could be overcome by costimulation through CD28 or innate cytokine receptors, which dictated the fate of their progeny. Costimulation with IL-1β during TCR ligation markedly increased proinflammatory IL-17 production, while IL-12-induced Tc1-like function and restored the response to TCR ligation without costimulation. CD161(hi) cells from umbilical cord blood and granulocyte colony stimulating factor-mobilized leukaphereses differed in frequency and function, suggesting future evaluation of the contribution of CD161(hi) cells in hematopoietic stem cell grafts to transplant outcomes is warranted.

  8. Entropy in hot $^{161,162}Dy$ and $^{171,172}Yb$ nuclei

    CERN Document Server

    Guttormsen, M; Hjorth-Jensen, M; Melby, E; Rekstad, J; Schiller, A; Siem, S; Belic, A


    The density of accessible levels at low spin in the (^3He,\\alpha \\gamma) reaction has been extracted for the ^{161,162}Dy and ^{171,172}Yb nuclei. The entropy of the even-odd and even-even nuclei has been deduced as a function of excitation energy, and found to reach a maximum of 15 k_B before neutron evaporation. The entropy of one quasi-particle outside an even-even core is found to be 1.70(15) k_B. This quasi-particle picture of hot nuclei is well accounted for within a simple pairing model. The onset of two, four and six quasi-particle excitations in the ^{162}Dy and ^{172}Yb nuclei is discussed and compared to theory. The number of quasi-particles excited per excitation energy is a measure for the ratio of the level energy spacing and the pairing strength.

  9. Cross-section measurement of some deuteron induced reactions on $^{160}$Gd for possible production of the therapeutic radionuclide $^{161}$Tb


    Tárkányi, F.; Hermanne, A.; Takács, S.; Ditrói, F.; Csikai, J.; Ignatyuk, A. V.


    The radionuclide 161Tb (T1/2=6.89 d) is potentially important for internal radiotherapy. It is generally produced through the 160Gd(n,{\\gamma})161Gd - 161Tb route at research reactors. In this work the possibility of its production at a cyclotron was investigated. Determination of the excitation function of the 160Gd(d,x)161Tb production route and that of the disturbing 160Gd(d,2n)160Tb side reaction was done over the deuteron energy range up to 50 MeV using the stacked-foil technique and hig...

  10. Differential Effect of Cytomegalovirus Infection with Age on the Expression of CD57, CD300a, and CD161 on T-Cell Subpopulations

    Directory of Open Access Journals (Sweden)

    Fakhri Hassouneh


    Full Text Available Immunosenescence is a progressive deterioration of the immune system with aging. It affects both innate and adaptive immunity limiting the response to pathogens and to vaccines. As chronic cytomegalovirus (CMV infection is probably one of the major driving forces of immunosenescence, and its persistent infection results in functional and phenotypic changes to the T-cell repertoire, the aim of this study was to analyze the effect of CMV-seropositivity and aging on the expression of CD300a and CD161 inhibitory receptors, along with the expression of CD57 marker on CD4+, CD8+, CD8+CD56+ (NKT-Like and CD4−CD8− (DN T-cell subsets. Our results showed that, regardless of the T-cell subset, CD57−CD161−CD300a+ T-cells expand with age in CMV-seropositive individuals, whereas CD57−CD161+CD300a+ T-cells decrease. Similarly, CD57+CD161−CD300a+ T-cells expand with age in CMV-seropositive individuals in all subsets except in DN cells and CD57−CD161+CD300a− T-cells decrease in all T-cell subsets except in CD4+ T-cells. Besides, in young individuals, CMV latent infection associates with the expansion of CD57+CD161−CD300a+CD4+, CD57−CD161−CD300a+CD4+, CD57+CD161−CD300a+CD8+, CD57−CD161−CD300a+CD8+, CD57+CD161−CD300a+NKT-like, and CD57+CD161−CD300a+DN T-cells. Moreover, in young individuals, CD161 expression on T-cells is not affected by CMV infection. Changes of CD161 expression were only associated with age in the context of CMV latent infection. Besides, CD300a+CD57+CD161+ and CD300a−CD57+CD161+ phenotypes were not found in any of the T-cell subsets studied except in the DN subpopulation, indicating that in the majority of T-cells, CD161 and CD57 do not co-express. Thus, our results show that CMV latent infection impact on the immune system depends on the age of the individual, highlighting the importance of including CMV serology in any study regarding immunosenescence.

  11. Retrospective evaluation of bone pain palliation after samarium-153-EDTMP therapy Avaliação retrospectiva do tratamento da dor óssea metastática com Samário-153-EDTMP

    Directory of Open Access Journals (Sweden)

    Marcelo Tatit Sapienza


    Full Text Available PURPOSE: The aim of this study was to evaluate the degree of metastatic bone pain palliation and medullar toxicity associated with samarium-153-EDTMP treatment. METHODS: Seventy-three patients with metastatic bone pain having previously undergone therapy with samarium-153-EDTMP (1 mCi/kg were retrospectively evaluated. Routine follow-up included pain evaluation and blood counts for 2 months after treatment. Pain was evaluated using a subjective scale (from 0 to 10 before and for 8 weeks after the treatment. Blood counts were obtained before treatment and once a week for 2 months during follow-up. Dosimetry, based upon the urinary excretion of the isotope, was estimated in 41 individuals, and the resulting radiation absorbed doses were correlated with hematological data. RESULTS: Reduction in pain scores of 75% to 100% was obtained in 36 patients (49%, with a decrease of 50% to 75%, 25% to 50%, and 0% to 25% in, respectively, 20 (27%, 10 (14%, and 7 (10% patients. There was no significant relationship between the pain response and location of the primary tumor (breast or prostate cancer. Mild to moderate myelosuppression was noted in 75.3% of patients, usually with hematological recovery at 8 weeks. The mean bone marrow dose was 347 ± 65 cGy, and only a weak correlation was found between absorbed dose and myelosuppression (Pearson coefficient = .4. CONCLUSIONS: Samarium-153-EDTMP is a valuable method for metastatic bone pain palliation. A mild to moderate and transitory myelosuppression is the main toxicity observed after samarium therapy, showing a weak correlation with dosimetric measures.OBJETIVO: O presente trabalho teve por objetivo avaliar o efeito paliativo da dor e a toxicidade medular associados ao tratamento com Samário-153-EDTMP em pacientes com metástases ósseas. MÉTODOS: O estudo foi realizado de forma retrospectiva, a partir do levantamento de prontuário de 178 pacientes submetidos a tratamento com 1mCi/kg de 153Sm

  12. The dynamics of the laser-induced metal-semiconductor phase transition of samarium sulfide (SmS); Die Dynamik des laserinduzierten Metall-Halbleiter-Phasenuebergangs von Samariumsulfid (SmS)

    Energy Technology Data Exchange (ETDEWEB)

    Kaempfer, Tino


    The present thesis is dedicated to the experimental study of the metal-semiconductor phase transition of samarium sulfide (SmS): Temperature- and time-resolved experiments on the characterization of the phase transition of mixed-valence SmS samples (M-SmS) are presented. The measurement of the dynamics of the laser-induced phase transition pursues via time-resolved ultrashort-time microscopy and by X-ray diffraction with sub-picosecond time resolution. The electronic and structural processes, which follow an excitation of M-SmS with infrared femtosecond laser pulses, are physically interpreted on the base of the results obtained in this thesis and model imaginations. [German] Die vorliegende Arbeit ist der experimentellen Untersuchung des Metall-Halbleiter-Phasenuebergangs von Samariumsulfid (SmS) gewidmet. Es werden temperatur- und zeitaufgeloeste Experimente zur Charakterisierung des Phasenuebergangs gemischt-valenter SmS Proben (M-SmS) vorgestellt. Die Messung der Dynamik des laserinduzierten Phasenuebergangs erfolgt ueber zeitaufgeloeste Ultrakurzzeit-Mikroskopie und durch Roentgenbeugung mit subpikosekunden Zeitaufloesung. Die elektronischen und strukturellen Prozesse, welche einer Anregung von M-SmS mit infraroten Femtosekunden-Laserpulsen folgen, werden auf der Basis der in dieser Arbeit gewonnenen Ergebnisse und Modellvorstellungen physikalisch interpretiert. (orig.)

  13. IAC 25 (Pedrinhas e IAC 161 (Taiamã: novos cultivares de trigo IAC 25 (Pedrinhas and IAC 161 (Taiamã: new wheat cultivars

    Directory of Open Access Journals (Sweden)

    João Carlos Felíco


    Full Text Available Avaliaram-se os cultivares de trigo IAC 25 (Pedrinhas e IAC 161 (Taiamã, provenientes de cruzamentos artificiais e obtidos por seleção pelo método genealógico, quanto à produtividade de grãos e às reações aos agentes causais da ferrugem-do-colmo e da-folha e da helmintosporiose no Vale do Paranapanema (SP, em condições de sequeiro, e na região Norte (SP, com irrigação por aspersão. Avaliaram-nos também em relação às qualidades industriais de panificação. Em condições de sequeiro, as produções médias de grãos dos novos cultivares não se apresentaram estatisticamente diferentes das da testemunha 'Anahuac', porém 'Pedrinhas' confirmou como grande vantagem o ciclo precoce (100-115 dias. Para as áreas com irrigação por aspersão, em solos com elevada acidez (porcentagem de saturação por bases inferior a 60% 'Pedrinhas' e Taiamã' exibiram melhor produção de grãos em relação ao 'Anahuac'. Para solos com baixa acidez, não houve diferença estatística entre os três cultivares. O 'Pedrinhas' e o 'Taiamã' apresentaram moderada tolerância ao Al3+, quando testados em soluções nutritivas contendo esse elemento; 'Taiamã' demonstrou alta suscetibilidade à toxicidade de ferro e, 'Pedrinhas', moderada tolerância, enquanto para o manganês ambos exibiram tolerância. O 'Taiamã' mostrou resistência à ferrugem-do-colmo e, o 'Pedrinhas', moderada resistência, em testes em casa de vegetação. O 'Pedrinhas' revelou-se mais suscetível à ferrugem-da-folha que o 'Taiamã' e o 'Anahuac' em condições de campo, enquanto, para a helmintosporiose, os três apresentaram-se suscetíveis. Nos ensaios de panificação, a farinha do 'Taiamã' foi superior à do 'Pedrinhas', proporcionando pães de excelente qualidade física, com volume específico bastante superior à farinha de trigo comercial.The wheat cultivars IAC 25 (Pedrinhas and IAC 161 (Taiamã originated from artificial crosses and selected by the pedigree method

  14. 77 FR 28406 - 161st Meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans; Notice of... (United States)


    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF LABOR Employee Benefits Security Administration 161st Meeting of the Advisory Council on Employee Welfare and Pension... Council on Employee Welfare and Pension Benefit Plans (also known as the ERISA Advisory Council) will be...

  15. CNV-association meta-analysis in 191,161 European adults reveals new loci associated with anthropometric traits

    DEFF Research Database (Denmark)

    Macé, Aurélien; Tuke, Marcus A; Deelen, Patrick


    There are few examples of robust associations between rare copy number variants (CNVs) and complex continuous human traits. Here we present a large-scale CNV association meta-analysis on anthropometric traits in up to 191,161 adult samples from 26 cohorts. The study reveals five CNV associations ...

  16. CNV-association meta-analysis in 191,161 European adults reveals new loci associated with anthropometric traits

    NARCIS (Netherlands)

    Macé, Aurélien; Tuke, Marcus A; Deelen, Patrick; Kristiansson, Kati; Mattsson, Hannele; Nõukas, Margit; Sapkota, Yadav; Schick, Ursula; Porcu, Eleonora; Rüeger, Sina; McDaid, Aaron F; Porteous, David; Winkler, Thomas W; Salvi, Erika; Shrine, Nick; Liu, Xueping; Ang, Wei Q; Zhang, Weihua; Feitosa, Mary F; Venturini, Cristina; van der Most, Peter J; Rosengren, Anders; Wood, Andrew R; Beaumont, Robin N; Jones, Samuel E; Ruth, Katherine S; Yaghootkar, Hanieh; Tyrrell, Jessica; Havulinna, Aki S; Boers, Harmen; Mägi, Reedik; Kriebel, Jennifer; Müller-Nurasyid, Martina; Perola, Markus; Nieminen, Markku; Lokki, Marja-Liisa; Kähönen, Mika; Viikari, Jorma S; Geller, Frank; Lahti, Jari; Palotie, Aarno; Koponen, Päivikki; Lundqvist, Annamari; Rissanen, Harri; Bottinger, Erwin P; Afaq, Saima; Wojczynski, Mary K; Lenzini, Petra; Nolte, Ilja M; Sparsø, Thomas; Schupf, Nicole; Christensen, Kaare; Perls, Thomas T; Newman, Anne B; Werge, Thomas; Snieder, Harold; Spector, Timothy D; Chambers, John C; Koskinen, Seppo; Melbye, Mads; Raitakari, Olli T; Lehtimäki, Terho; Tobin, Martin D; Wain, Louise V; Sinisalo, Juha; Peters, Annette; Meitinger, Thomas; Martin, Nicholas G; Wray, Naomi R; Montgomery, Grant W; Medland, Sarah E; Swertz, Morris A; Vartiainen, Erkki; Borodulin, Katja; Männistö, Satu; Murray, Anna; Bochud, Murielle; Jacquemont, Sébastien; Rivadeneira, Fernando; Hansen, Thomas F; Oldehinkel, Albertine J; Mangino, Massimo; Province, Michael A; Deloukas, Panos; Kooner, Jaspal S; Freathy, Rachel M; Pennell, Craig; Feenstra, Bjarke; Strachan, David P; Lettre, Guillaume; Hirschhorn, Joel; Cusi, Daniele; Heid, Iris M; Hayward, Caroline; Männik, Katrin; Beckmann, Jacques S; Loos, Ruth J F; Nyholt, Dale R; Metspalu, Andres; Eriksson, Johan G; Weedon, Michael N; Salomaa, Veikko; Franke, Lude; Reymond, Alexandre; Frayling, Timothy M; Kutalik, Zoltán


    There are few examples of robust associations between rare copy number variants (CNVs) and complex continuous human traits. Here we present a large-scale CNV association meta-analysis on anthropometric traits in up to 191,161 adult samples from 26 cohorts. The study reveals five CNV associations at

  17. Role of cysteine at positions 67, 161 and 241 of a Bacillus sphaericus binary toxin BinB. (United States)

    Boonyos, Patcharaporn; Soonsanga, Sumarin; Boonserm, Panadda; Promdonkoy, Boonhiang


    Binary toxin consisting of BinA and BinB from Bacillus sphaericus is toxic to mosquito larvae. BinB is responsible for specific binding to the larval gut cell membrane while BinA is crucial for toxicity. To investigate functional role of cysteine in BinB, three cysteine residues at positions 67, 161, and 241 were replaced by alanine or serine. Mutations at these positions did not affect protein production and overall structure of BinB. These cysteine residues are not involved in disulfide bond formation between BinB molecules. Mosquito-larvicidal assays revealed that C67 and C161 are essential for toxicity, whereas C241 is not. Mutations at C67 and C161 resulted in weaker BinA-BinB interaction. The loss of toxicity may be due to the reduction of interactions between BinA and BinB or BinB and its receptor. C67 and C161 could also play a part during conformational changes or internalization of the binary toxin into the target cell. [BMB reports 2010; 43(1): 23-28].

  18. Kui naine tahab olla kangelane : kestvus-perfomance "Äng - 161 km palja rindkerega" / Fideelia-Signe Roots

    Index Scriptorium Estoniae

    Roots, Fideelia-Signe, 1976-


    Fideelia-Signe Roots oma aktsioonist tegevuskunstiürituse "Äng" raames, mille käigus kunstnik kõndis jalgsi alasti ülakehaga 161 kilomeetrit Tartust Karepale eesmärgiga testida naise kehakuvandi piire. Kangelase ja superkangelase mõistest

  19. An investigation of genetic heterogeneity and linkage disequilibrium in 161 families with spinal muscular atrophy

    Energy Technology Data Exchange (ETDEWEB)

    Merette, C.; Gilliam, T.C.; Brzustowicz, L.M. (Columbia Univ., New York, NY (United States)); Daniels, R.J.; Davies, K.E. (Institute of Molecular Medicine, Oxford (United Kingdom)); Melki, J.; Munnich, A. (Hopital des Enfants-Malades, Paris (France)); Pericak-Vance, M.A. (Duke Univ Medical Center, Durham, NC (United States)); Siddique, T. (Northwestern Univ., Chicago, IL (United States)); Voosen, B. (Institute fuer Humangenetik der Universitaet, Bonn (Germany)) (and others)


    The authors performed linkage analysis of 161 families with spinal muscular atrophy (SMA) in which affected individuals suffer from the intermediate or mild form of the disease (Types II or III). Markers for six loci encompassing the chromosome 5q11.2-q13.3 region were typed. The best map location for the disease locus was found to be between D5S6 and MAP1B. The corresponding 1 lod unit support interval is confined to this interval and spans 0.5 cM. The data strongly support the hypothesis of linkage heterogeneity (likelihood ratio, 1.14 [times] 10[sup 4]), with 5% of the families unlinked. Four families have a probability of less than 50% of segregating the SMA gene linked to the region 5q11.2-q13.3. A likelihood approach to test for linkage disequilibrium revealed no significant departure from Hardy-Weinberg equilibrium with any marker under study. 28 refs., 4 figs., 3 tabs.

  20. Development and initial performance results of a Solo 161 Stirling refrigerator for temperatures between -30 C and -90 C; Entwicklung und erste Betriebserfahrungen einer Solo 161 Stirling-Kaeltemaschine fuer die Kaeltebereitstellung bei Temperaturen zwischen -30 C und -90 C

    Energy Technology Data Exchange (ETDEWEB)

    Schikora, H.; Siegel, A. [Essen Univ. (Gesamthochschule) (Germany). Inst. fuer Angewandte Thermodynamik und Klimatechnik


    Several theoretical investigations have shown that Stirling refrigerators could be a promising alternative for refrigeration at 'near-ambient' temperatures (above -40 C). These theoretical statements shall be validated in an actual research project by measurements taken from a Stirling refrigerator that is optimised for this range of temperature. In this paper first measurement results of this new developed Solo 161 Stirling refrigerator will be presented. Problems are investigated by detailed measurements. Possible improvements are described. (orig.) [German] Verschiedene theoretische Untersuchungen haben gezeigt, dass Stirling-Kaeltemaschinen eine interessante Alternative fuer die Kaelteerzeugung im sog. 'umgebungsnahen' Temperaturbereich (oberhalb von -40 C) darstellen koennten. In einem derzeit laufenden Forschungsvorhaben sollen diese theoretischen Untersuchungen durch Messungen an einer fuer diesen Temperaturbereich optimierten Stirling-Kaeltemaschine ueberprueft werden. In diesem Aufsatz werden erste Messergebnisse dieser neu entwickelten Solo 161 Stirling-Kaeltemaschine praesentiert. Anhand detaillierter Messergebnisse werden Schwachstellen lokalisiert und moegliche Verbesserungsmassnahmen beschrieben. (orig.)

  1. Measurement of Trilinear Gauge Couplings in $e^+ e^-$ Collisions at 161 GeV and 172 GeV

    CERN Document Server

    Abreu, P; Adye, T; Adzic, P; Alekseev, G D; Alemany, R; Allport, P P; Almehed, S; Amaldi, Ugo; Amato, S; Andersson, P; Andreazza, A; Antilogus, P; Apel, W D; Arnoud, Y; Åsman, B; Augustin, J E; Augustinus, A; Baillon, Paul; Bambade, P; Barão, F; Barbier, R; Bardin, Dimitri Yuri; Barker, G; Baroncelli, A; Bärring, O; Bates, M J; Battaglia, Marco; Baubillier, M; Becks, K H; Begalli, M; Beillière, P; Belokopytov, Yu A; Benvenuti, Alberto C; Bérat, C; Berggren, M; Bertini, D; Bertrand, D; Besançon, M; Bianchi, F; Bigi, M; Bilenky, S M; Billoir, P; Bizouard, M A; Bloch, D; Bonesini, M; Bonivento, W; Boonekamp, M; Booth, P S L; Borgland, A W; Borisov, G; Bosio, C; Botner, O; Boudinov, E; Bouquet, B; Bourdarios, C; Bowcock, T J V; Bozovic, I; Bozzo, M; Branchini, P; Brand, K D; Brenke, T; Brenner, R A; Brown, R; Brückman, P; Brunet, J M; Bugge, L; Buran, T; Burgsmüller, T; Buschmann, P; Cabrera, S; Caccia, M; Calvi, M; Camacho-Rozas, A J; Camporesi, T; Canale, V; Canepa, M; Carena, F; Carroll, L; Caso, Carlo; Castillo-Gimenez, M V; Cattai, A; Cavallo, F R; Cerruti, C; Chabaud, V; Chapkin, M M; Charpentier, P; Chaussard, L; Checchia, P; Chelkov, G A; Chen, M; Chierici, R; Chliapnikov, P V; Chochula, P; Chorowicz, V; Chudoba, J; Collins, P; Colomer, M; Contri, R; Cortina, E; Cosme, G; Cossutti, F; Cowell, J H; Crawley, H B; Crennell, D J; Crosetti, G; Cuevas-Maestro, J; Czellar, S; D'Almagne, B; Damgaard, G; Dauncey, P D; Davenport, Martyn; Da Silva, W; Deghorain, A; Della Ricca, G; Delpierre, P A; Demaria, N; De Angelis, A; de Boer, Wim; De Brabandere, S; De Clercq, C; La Vaissière, C de; De Lotto, B; De Min, A; De Paula, L S; Dijkstra, H; Di Ciaccio, Lucia; Di Diodato, A; Djannati, A; Dolbeau, J; Doroba, K; Dracos, M; Drees, J; Drees, K A; Dris, M; Duperrin, A; Durand, J D; Edsall, D M; Ehret, R; Eigen, G; Ekelöf, T J C; Ekspong, Gösta; Ellert, M; Elsing, M; Engel, J P; Erzen, B; Espirito-Santo, M C; Falk, E; Fanourakis, G K; Fassouliotis, D; Fayot, J; Feindt, Michael; Ferrari, P; Ferrer, A; Fichet, S; Firestone, A; Fischer, P A; Flagmeyer, U; Föth, H; Fokitis, E; Fontanelli, F; Formenti, F; Franek, B J; Frodesen, A G; Frühwirth, R; Fulda-Quenzer, F; Fuster, J A; Galloni, A; Gamba, D; Gandelman, M; García, C; García, J; Gaspar, C; Gaspar, M; Gasparini, U; Gavillet, P; Gazis, E N; Gelé, D; Gerber, J P; Gerdyukov, L N; Ghodbane, N; Glege, F; Gokieli, R; Golob, B; Gonçalves, P; González-Caballero, I; Gopal, Gian P; Gorn, L; Górski, M; Guz, Yu; Gracco, Valerio; Grahl, J; Graziani, E; Green, C; Grefrath, A; Gris, P; Grosdidier, G; Grzelak, K; Günther, M; Guy, J; Hahn, F; Hahn, S; Haider, S; Hajduk, Z; Hallgren, A; Hamacher, K; Harris, F J; Hedberg, V; Heising, S; Henriques, R P; Hernández, J J; Herquet, P; Herr, H; Hessing, T L; Heuser, J M; Higón, E; Holmgren, S O; Holt, P J; Holthuizen, D J; Hoorelbeke, S; Houlden, M A; Hrubec, Josef; Huet, K; Hultqvist, K; Jackson, J N; Jacobsson, R; Jalocha, P; Janik, R; Jarlskog, C; Jarlskog, G; Jarry, P; Jean-Marie, B; Johansson, E K; Jönsson, L B; Jönsson, P E; Joram, Christian; Juillot, P; Kapusta, F; Karafasoulis, K; Katsanevas, S; Katsoufis, E C; Keränen, R; Khomenko, B A; Khovanskii, N N; King, B J; Kjaer, N J; Klapp, O; Klein, H; Kluit, P M; Knoblauch, D; Kokkinias, P; Koratzinos, M; Korcyl, K; Kostyukhin, V; Kourkoumelis, C; Kuznetsov, O; Krammer, Manfred; Kreuter, C; Kronkvist, I J; Krumshtein, Z; Kubinec, P; Kucewicz, W; Kurvinen, K L; Lacasta, C; Lamsa, J; Lanceri, L; Lane, D W; Langefeld, P; Lapin, V; Laugier, J P; Lauhakangas, R; Leder, Gerhard; Ledroit, F; Lefébure, V; Legan, C K; Leisos, A; Leitner, R; Lemonne, J; Lenzen, Georg; Lepeltier, V; Lesiak, T; Lethuillier, M; Libby, J; Liko, D; Lipniacka, A; Lippi, I; Lörstad, B; Loken, J G; Lopes, J H; López, J M; Loukas, D; Lutz, P; Lyons, L; MacNaughton, J N; Mahon, J R; Maio, A; Malek, A; Malmgren, T G M; Malychev, V; Mandl, F; Marco, J; Marco, R P; Maréchal, B; Margoni, M; Marin, J C; Mariotti, C; Markou, A; Martínez-Rivero, C; Martínez-Vidal, F; Martí i García, S; Matorras, F; Matteuzzi, C; Matthiae, Giorgio; Mazzucato, F; Mazzucato, M; McCubbin, M L; McKay, R; McNulty, R; McPherson, G; Medbo, J; Meroni, C; Meyer, W T; Michelotto, M; Migliore, E; Mirabito, L; Mitaroff, Winfried A; Mjörnmark, U; Moa, T; Møller, R; Mönig, K; Monge, M R; Moreau, X; Morettini, P; Münich, K; Mulders, M; Mundim, L M; Murray, W J; Muryn, B; Myatt, Gerald; Myklebust, T; Naraghi, F; Navarria, Francesco Luigi; Navas, S; Nawrocki, K; Negri, P; Némécek, S; Neufeld, N; Neumann, W; Neumeister, N; Nicolaidou, R; Nielsen, B S; Nieuwenhuizen, M; Nikolaenko, V; Nikolenko, M; Niss, P; Nomerotski, A; Normand, Ainsley; Nygren, A; Oberschulte-Beckmann, W; Obraztsov, V F; Olshevskii, A G; Onofre, A; Orava, Risto; Orazi, G; Österberg, K; Ouraou, A; Paganini, P; Paganoni, M; Paiano, S; Pain, R; Paiva, R; Palka, H; Papadopoulou, T D; Papageorgiou, K; Pape, L; Parkes, C; Parodi, F; Parzefall, U; Passeri, A; Pegoraro, M; Pernegger, H; Pernicka, Manfred; Perrotta, A; Petridou, C; Petrolini, A; Phillips, H T; Piana, G; Pierre, F; Pimenta, M; Piotto, E; Podobnik, T; Podobrin, O; Pol, M E; Polok, G; Poropat, P; Pozdnyakov, V; Privitera, P; Pukhaeva, N; Pullia, Antonio; Radojicic, D; Ragazzi, S; Rahmani, H; Rames, J; Ratoff, P N; Read, A L; Rebecchi, P; Redaelli, N G; Regler, Meinhard; Reid, D; Reinhardt, R; Renton, P B; Resvanis, L K; Richard, F; Rídky, J; Rinaudo, G; Røhne, O M; Romero, A; Ronchese, P; Rosenberg, E I; Rosinsky, P; Roudeau, Patrick; Rovelli, T; Ruhlmann-Kleider, V; Ruiz, A; Saarikko, H; Sacquin, Yu; Sadovskii, A; Sajot, G; Salt, J; Sampsonidis, D; Sannino, M; Schneider, H; Schwickerath, U; Schyns, M A E; Scuri, F; Seager, P; Sedykh, Yu; Segar, A M; Sekulin, R L; Senko, V A; Shellard, R C; Sheridan, A; Silvestre, R; Simonetto, F; Sissakian, A N; Skaali, T B; Smadja, G; Smirnov, N; Smirnova, O G; Smith, G R; Solovyanov, O; Sopczak, André; Sosnowski, R; Souza-Santos, D; Spassoff, Tz; Spiriti, E; Sponholz, P; Squarcia, S; Stampfer, D; Stanescu, C; Stanic, S; Stapnes, Steinar; Stavitski, I; Stevenson, K; Stocchi, A; Strauss, J; Strub, R; Stugu, B; Szczekowski, M; Szeptycka, M; Tabarelli de Fatis, T; Chikilev, O G; Tegenfeldt, F; Terranova, F; Thomas, J; Tilquin, A; Timmermans, J; Tkatchev, L G; Todorov, T; Todorova, S; Toet, D Z; Tomaradze, A G; Tomé, B; Tonazzo, A; Tortora, L; Tranströmer, G; Treille, D; Tristram, G; Trombini, A; Troncon, C; Tsirou, A L; Turluer, M L; Tyapkin, I A; Tyndel, M; Tzamarias, S; Überschär, B; Ullaland, O; Uvarov, V; Valenti, G; Vallazza, E; van Apeldoorn, G W; van Dam, P; Van Doninck, W K; Van Eldik, J; Van Lysebetten, A; Van Vulpen, I B; Vassilopoulos, N; Vegni, G; Ventura, L; Venus, W A; Verbeure, F; Verlato, M; Vertogradov, L S; Verzi, V; Vilanova, D; Vincent, P; Vishnevski, N K; Vitale, L; Vlasov, E; Vodopyanov, A S; Vrba, V; Wahlen, H; Walck, C; Weiser, C; Wetherell, Alan M; Wicke, D; Wickens, J H; Wilkinson, G R; Williams, W S C; Winter, M; Witek, M; Wlodek, T; Wolf, G; Yi, J; Yushchenko, O P; Zalewska-Bak, A; Zalewski, Piotr; Zavrtanik, D; Zevgolatakos, E; Zimin, N I; Zucchelli, G C; Zumerle, G


    Trilinear gauge boson couplings are measured using data taken by DELPHI at 161~GeV and 172~GeV. Values for $WWV$ couplings ($V=Z, \\gamma$) are determined from a study of the reactions \\eeWW\\ and \\eeWev, using differential distributions from the $WW$ final state in which one $W$ decays hadronically and the other leptonically, and total cross-section4AU LWit

  2. Circulating CD3+CD4+CD161+ Cells Are Associated with Early Complications after Autologous Stem Cell Transplantation in Multiple Myeloma

    Directory of Open Access Journals (Sweden)

    Sung-Eun Lee


    Full Text Available The aim of this study was to explore if measurement of pretransplant circulating CD161-expressing cells, in addition to clinical risk factors, could predict mucositis and infections in patients with multiple myeloma (MM undergoing autologous stem cell transplantation (ASCT. To determine if CD161-expressing cells are likely to predict early complications, namely, mucositis (≥grade 3, infections, and cytomegalovirus (CMV reactivation, we prospectively examined CD161-expressing cells (CD3+CD4+CD161+ and CD3+CD8+CD161+ in peripheral blood samples from 108 patients with MM undergoing ASCT. After adjusting for factors identified by univariate analysis that predicted mucositis (≥grade 3, infection before engraftment, and CMV reactivation, multivariate analyses revealed that the low proportion of CD3+CD4+CD161+ cells in peripheral blood was an independent predictor of mucositis (≥grade 3 (P=0.020, infections before engraftment (P=0.014, and CMV reactivation (P=0.010. In addition, we found that female sex and decreased glomerular filtration rate were independent factors for predicting mucositis. Female sex and severe pulmonary comorbidity were independent factors for predicting infection before engraftment. We found that the proportion of circulating CD3+CD4+CD161+ cells is useful for predicting the occurrence of early complications, including mucositis and infections, after ASCT in patients with MM.

  3. Disruption of δ-opioid receptor phosphorylation at threonine 161 attenuates morphine tolerance in rats with CFA-induced inflammatory hypersensitivity. (United States)

    Chen, Hai-Jing; Xie, Wei-Yan; Hu, Fang; Zhang, Ying; Wang, Jun; Wang, Yun


    Our previous study identified Threonine 161 (Thr-161), located in the second intracellular loop of the δ-opioid receptor (DOR), as the only consensus phosphorylation site for cyclin-dependent kinase 5 (Cdk5). The aim of this study was to assess the function of DOR phosphorylation by Cdk5 in complete Freund's adjuvant (CFA)-induced inflammatory pain and morphine tolerance. Dorsal root ganglion (DRG) neurons of rats with CFA-induced inflammatory pain were acutely dissociated and the biotinylation method was used to explore the membrane localization of phosphorylated DOR at Thr-161 (pThr-161-DOR), and paw withdrawal latency was measured after intrathecal delivery of drugs or Tat-peptide, using a radiant heat stimulator in rats with CFA-induced inflammatory pain. Both the total amount and the surface localization of pThr-161-DOR were significantly enhanced in the ipsilateral DRG following CFA injection. Intrathecal delivery of the engineered Tat fusion-interefering peptide corresponding to the second intracellular loop of DOR (Tat-DOR-2L) increased inflammatory hypersensitivity, and inhibited DOR- but not µ-opioid receptor-mediated spinal analgesia in CFA-treated rats. However, intrathecal delivery of Tat-DOR-2L postponed morphine antinociceptive tolerance in rats with CFA-induced inflammatory pain. Phosphorylation of DOR at Thr-161 by Cdk5 attenuates hypersensitivity and potentiates morphine tolerance in rats with CFA-induced inflammatory pain, while disruption of the phosphorylation of DOR at Thr-161 attenuates morphine tolerance.

  4. Completion Report for Well ER-16-1 Corrective Action Unit 99: Rainier Mesa - Shoshone Mountain

    Energy Technology Data Exchange (ETDEWEB)

    NSTec Environmental Management


    Well ER-16-1 was drilled for the U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office, in support of the Nevada Environmental Restoration Project at the Nevada Test Site, Nye County, Nevada. The well was drilled in June and July 2005 as part of a hydrogeologic investigation program for the Rainier Mesa-Shoshone Mountain Corrective Action Unit, Number 99. The overall purpose of the well was to gather subsurface data to better characterize the hydrogeology of the Shoshone Mountain area, especially in the older Tertiary and pre-Tertiary strata. The main 46.99-centimeter hole was drilled to a depth of 702.9 meters and cased with 33.97-centimeter casing to 663.7 meters. The hole diameter was then decreased to 31.1 centimeters, and the well was drilled to total depth of 1,220.7 meters. A completion string set at the depth of 1,162.4 meters consisted of 13.97-centimeter stainless-steel casing, with one continuous slotted interval open to the lower carbonate aquifer. The fluid level in the borehole soon dropped, so the borehole was deepened in July 2006. To deepen the borehole, the slotted section was cemented and a 12.1-centimeter hole was drilled through the bottom of the completion string to the new total depth of 1,391.7 meters, which is 171.0 meters deeper than the original borehole. A string of 6.03-centimeter carbon-steel tubing with one continuous slotted interval at 1,361.8 to 1,381.4 meters, and open to the lower carbonate aquifer, was installed in the well with no gravel packing or cement, to serve as a monitoring string. Data gathered during and shortly after hole construction include composite drill cuttings samples collected every 3 meters (extra cuttings samples were collected from the Paleozoic rocks for paleontological analyses), sidewall core samples from 37 depths, various geophysical logs, and water level measurements. These data indicate that the well penetrated 646.8 meters of Tertiary volcanic rocks and 744.9 meters

  5. Activation cross sections of proton and deuteron induced nuclear reactions on holmium and erbium, related to the production of (161)Er and (160)Er medical isotopes. (United States)

    Tárkányi, F; Ditrói, F; Takács, S; Hermanne, A; Baba, M


    Experimental excitation functions for long-lived products in proton induced reactions were measured with the activation method in the 37-65MeV energy range on natural holmium. Stacked foil irradiation technique and high resolution gamma spectrometry were used in order to measure cross-section data for the production of (161)Er, (160)Er and (1)(59,157)Dy. For comparison of the production routes of medically related (161)Er and (160)Er radioisotopes new experimental cross section data were deduced for the (162)Er(p,x)(161,160)Er and (162)Er(d,x)(161,160)Er reactions by re-evaluating gamma-ray spectra from earlier measurements. No earlier data were found in the literature for these reactions. The experimental data are compared with results of TALYS theoretical code reported in TENDL-2015. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Clinical and Molecular Characterization of a Cohort of 161 Unrelated Women with Nonclassical Congenital Adrenal Hyperplasia Due to 21-Hydroxylase Deficiency and 330 Family Members

    National Research Council Canada - National Science Library

    Bidet, Maud; Bellanné-Chantelot, Christine; Galand-Portier, Marie-Béatrice; Tardy, Véronique; Billaud, Line; Laborde, Kathleen; Coussieu, Christiane; Morel, Yves; Vaury, Christelle; Golmard, Jean-Louis; Claustre, Aurélie; Mornet, Etienne; Chakhtoura, Zeina; Mowszowicz, Irene; Bachelot, Anne; Touraine, Philippe; Kuttenn, Frédérique


    .... Patients and Methods: A total of 161 NC-CAH unrelated women diagnosed on late-onset symptoms, mainly hirsutism, and post-ACTH 17-hydroxyprogesterone more than 10 ng/ml, and 330 of their relatives was explored...

  7. Cross-section measurement of some deuteron induced reactions on $^{160}$Gd for possible production of the therapeutic radionuclide $^{161}$Tb

    CERN Document Server

    Tárkányi, F; Takács, S; Ditrói, F; Csikai, J; Ignatyuk, A V


    The radionuclide 161Tb (T1/2=6.89 d) is potentially important for internal radiotherapy. It is generally produced through the 160Gd(n,{\\gamma})161Gd - 161Tb route at research reactors. In this work the possibility of its production at a cyclotron was investigated. Determination of the excitation function of the 160Gd(d,x)161Tb production route and that of the disturbing 160Gd(d,2n)160Tb side reaction was done over the deuteron energy range up to 50 MeV using the stacked-foil technique and high-resolution gamma-ray spectrometry. A comparison of this production route with the established (n,\\gamma) reaction at a nuclear reactor is made.

  8. Contribution of Auger/conversion electrons to renal side effects after radionuclide therapy: preclinical comparison of (161)Tb-folate and (177)Lu-folate. (United States)

    Haller, Stephanie; Pellegrini, Giovanni; Vermeulen, Christiaan; van der Meulen, Nicholas P; Köster, Ulli; Bernhardt, Peter; Schibli, Roger; Müller, Cristina


    The radiolanthanide (161)Tb has, in recent years, attracted increasing interest due to its favorable characteristics for medical application. (161)Tb exhibits similar properties to the widely-used therapeutic radionuclide (177)Lu. In contrast to (177)Lu, (161)Tb yields a significant number of short-ranging Auger/conversion electrons (≤50 keV) during its decay process. (161)Tb has been shown to be more effective for tumor therapy than (177)Lu if applied using the same activity. The purpose of this study was to investigate long-term damage to the kidneys after application of (161)Tb-folate and compare it to the renal effects caused by (177)Lu-folate. Renal side effects were investigated in nude mice after the application of different activities of (161)Tb-folate (10, 20, and 30 MBq per mouse) over a period of 8 months. Renal function was monitored by the determination of (99m)Tc-DMSA uptake in the kidneys and by measuring blood urea nitrogen and creatinine levels in the plasma. Histopathological analysis was performed by scoring of the tissue damage observed in HE-stained kidney sections from euthanized mice. Due to the co-emitted Auger/conversion electrons, the mean absorbed renal dose of (161)Tb-folate (3.0 Gy/MBq) was about 24 % higher than that of (177)Lu-folate (2.3 Gy/MBq). After application of (161)Tb-folate, kidney function was reduced in a dose- and time-dependent manner, as indicated by the decreased renal uptake of (99m)Tc-DMSA and the increased levels of blood urea nitrogen and creatinine. Similar results were obtained when (177)Lu-folate was applied at the same activity. Histopathological investigations confirmed comparable renal cortical damage after application of the same activities of (161)Tb-folate and (177)Lu-folate. This was characterized by collapsed tubules and enlarged glomeruli with fibrin deposition in moderately injured kidneys and glomerulosclerosis in severely damaged kidneys. Tb-folate induced dose-dependent radionephropathy over

  9. Alterations in the mir-15a/16-1 Loci Impairs Its Processing and Augments B-1 Expansion in De Novo Mouse Model of Chronic Lymphocytic Leukemia (CLL.

    Directory of Open Access Journals (Sweden)

    Siddha Kasar

    Full Text Available New Zealand Black (NZB mice, a de novo model of CLL, share multiple characteristics with CLL patients, including decreased expression of miR-15a/16-1. We previously discovered a point mutation and deletion in the 3' flanking region of mir-16-1 of NZB and a similar mutation has been found in a small number of CLL patients. However, it was unknown whether the mutation is the cause for the reduced miR-15a/16-1 expression and CLL development. Using PCR and in vitro microRNA processing assays, we found that the NZB sequence alterations in the mir-15a/16-1 loci result in deficient processing of the precursor forms of miR-15a/16-1, in particular, we observe impaired conversion of pri-miR-15a/16-1 to pre-miR-15a/16-1. The in vitro data was further supported by derivation of congenic strains with replaced mir-15a/16-1 loci at one or both alleles: NZB congenic mice (NmiR+/- and DBA congenic mice (DmiR-/-. The level of miR-15a/16-1 reflected the configuration of the mir-15a/16-1 loci with DBA congenic mice (DmiR-/- showing reduced miR-15a levels compared to homozygous wild-type allele, while the NZB congenic mice (NmiR+/- showed an increase in miR-15a levels relative to homozygous mutant allele. Similar to Monoclonal B-cell Lymphocytosis (MBL, the precursor stage of the human disease, an overall expansion of the B-1 population was observed in DBA congenic mice (DmiR-/- relative to wild-type (DmiR+/+. These studies support our hypothesis that the mutations in the mir-15a/16-1 loci are responsible for decreased expression of this regulatory microRNA leading to B-1 expansion and CLL development.

  10. Use of the Signature Fatty Acid 16:1ω5 as a Tool to Determine the Distribution of Arbuscular Mycorrhizal Fungi in Soil

    Directory of Open Access Journals (Sweden)

    Christopher Ngosong


    Full Text Available Biomass estimation of arbuscular mycorrhiza (AM fungi, widespread plant root symbionts, commonly employs lipid biomarkers, predominantly the fatty acid 16:1ω5. We briefly reviewed the application of this signature fatty acid, followed by a case study comparing biochemical markers with microscopic techniques in an arable soil following a change to AM non-host plants after 27 years of continuous host crops, that is, two successive cropping seasons with wheat followed by amaranth. After switching to the non-host amaranth, spore biomass estimated by the neutral lipid fatty acid (NLFA 16:1ω5 decreased to almost nil, whereas microscopic spore counts decreased by about 50% only. In contrast, AM hyphal biomass assessed by the phospholipid (PLFA 16:1ω5 was greater under amaranth than wheat. The application of PLFA 16:1ω5 as biomarker was hampered by background level derived from bacteria, and further enhanced by its incorporation from degrading spores used as microbial resource. Meanwhile, biochemical and morphological assessments showed negative correlation for spores and none for hyphal biomass. In conclusion, the NLFA 16:1ω5 appears to be a feasible indicator for AM fungi of the Glomales group in the complex field soils, whereas the use of PLFA 16:1ω5 for hyphae is unsuitable and should be restricted to controlled laboratory studies.

  11. Cytoplasmic Localization of WT1 and Decrease of miRNA-16-1 in Nephrotic Syndrome

    Directory of Open Access Journals (Sweden)

    Pablo Zapata-Benavides


    Full Text Available Nephrotic syndrome (NS is a glomerular disease that is defined by the leakage of protein into the urine and is associated with hypoalbuminemia, hyperlipidemia, and edema. Steroid-resistant NS (SRNS patients do not respond to treatment with corticosteroids and show decreased Wilms tumor 1 (WT1 expression in podocytes. Downregulation of WT1 has been shown to be affected by certain microRNAs (miRNAs. Twenty-one patients with idiopathic NS (68.75% were SSNS and 31.25% SRNS and 10 healthy controls were enrolled in the study. Podocyte number and WT1 location were determined by immunofluorescence, and the serum levels of miR-15a, miR-16-1, and miR-193a were quantified by RT-qPCR. Low expression and delocalization of WT1 protein from the nucleus to the cytoplasm were found in kidney biopsies of patients with SRNS and both nuclear and cytoplasmic localization were found in steroid-sensitive NS (SSNS patients. In sera from NS patients, low expression levels of miR-15a and miR-16-1 were found compared with healthy controls, but only the miR-16-1 expression levels showed statistically significant decrease (p=0.019. The miR-193a expression levels only slightly increased in NS patients. We concluded that low expression and delocalization from the WT1 protein in NS patients contribute to loss of podocytes while modulation from WT1 protein is not associated with the miRNAs analyzed in sera from the patients.

  12. Cytoplasmic Localization of WT1 and Decrease of miRNA-16-1 in Nephrotic Syndrome (United States)

    Rangel-Ochoa, Gloria Azucena; Rodríguez-Padilla, Cristina


    Nephrotic syndrome (NS) is a glomerular disease that is defined by the leakage of protein into the urine and is associated with hypoalbuminemia, hyperlipidemia, and edema. Steroid-resistant NS (SRNS) patients do not respond to treatment with corticosteroids and show decreased Wilms tumor 1 (WT1) expression in podocytes. Downregulation of WT1 has been shown to be affected by certain microRNAs (miRNAs). Twenty-one patients with idiopathic NS (68.75% were SSNS and 31.25% SRNS) and 10 healthy controls were enrolled in the study. Podocyte number and WT1 location were determined by immunofluorescence, and the serum levels of miR-15a, miR-16-1, and miR-193a were quantified by RT-qPCR. Low expression and delocalization of WT1 protein from the nucleus to the cytoplasm were found in kidney biopsies of patients with SRNS and both nuclear and cytoplasmic localization were found in steroid-sensitive NS (SSNS) patients. In sera from NS patients, low expression levels of miR-15a and miR-16-1 were found compared with healthy controls, but only the miR-16-1 expression levels showed statistically significant decrease (p = 0.019). The miR-193a expression levels only slightly increased in NS patients. We concluded that low expression and delocalization from the WT1 protein in NS patients contribute to loss of podocytes while modulation from WT1 protein is not associated with the miRNAs analyzed in sera from the patients. PMID:28299339

  13. The possible role of CD8+/Vα7.2+/CD161++ T (MAIT) and CD8+/Vα7.2+/CD161loT (MAIT-like) cells in the pathogenesis of early-onset pre-eclampsia. (United States)

    Meggyes, Matyas; Szanto, Julia; Lajko, Adrienn; Farkas, Balint; Varnagy, Akos; Tamas, Peter; Hantosi, Eszter; Miko, Eva; Szereday, Laszlo


    The objective of this study was to compare the expressions of different immune-checkpoint molecules by MAIT and MAIT-like cells in healthy pregnancy and in early-onset pre-eclampsia. Peripheral blood mononuclear cells (PBMC) were stained with monoclonal antibodies to characterize MAIT and MAIT-like cells. Flow cytometric analyses were used to measure PD-1, TIM-3, activation markers, and intracellular perforin expression. We identified CD3+/CD8+/Vα7.2+/CD161++ MAIT cells and a minor cell population characterized by CD3+/CD8+/Vα7.2+/CD161 lo surface markers. In measuring the expression of PD-1 receptor, we found a significantly lower expression by MAIT cells in women with early-onset pre-eclampsia. CD69 expression by MAIT cells was significantly elevated in early-onset pre-eclamptic patients. Intracellular perforin content by MAIT and PD-1+ MAIT cells was significantly increased in pre-eclamptic patients compared with healthy individuals. Altered frequency and reduced PD-1 expression combined together with the elevated perforin content of MAIT cells insinuate their potential roles in the pathogenesis of early-onset pre-eclampsia. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Investigation of the miR16-1 (C>T + 7 Substitution in Seven Different Types of Cancer from Three Ethnic Groups

    Directory of Open Access Journals (Sweden)

    Hulya Yazici


    Full Text Available Background. MicroRNAs are a type of small noncoding RNA molecules that have been shown to control gene expression in eukaryotes. Aberrant expression and alteration of miRNAs may be responsible for human diseases including cancer. An miR16-1 (C>T  + 7 gene mutation has been previously found in familial chronic lymphocytic leukemia patients, one of which reported a family history of breast cancer. miR16-1 regulates the expression of bcl-2, which is important in retinoblastoma, and is located in a genomic region that is frequently lost in nasopharyngeal and hepatocellular carcinomas (HCCs. Therefore, miR16-1 may be potentially important in the etiology of several solid tumors. To understand the power of the miR16-1 (C>T  + 7 mutation as a prognostic and diagnostic risk factor, we investigated the mutation in patients with seven different types of cancer including 188 with breast, 102 with ovarian, and 22 nasopharyngeal carcinomas, 96 HCC, 872 chronic myeloid leukemia (CML, 39 chronic lymphocytic leukemia (CLL, and 46 retinoblastoma cases from three different ethnic groups and of hereditary and sporadic etiology. Methods. 5′Nuclease TaqMan SNP genotyping assay was used to detect the miR16-1 gene C>T substitution. Results. The miR16-1 (C>T  + 7 substitution was not detected in any of the groups studied. Conclusions. Considering the large scale of our study, the representation of different ethnicities and levels of hereditary risk, we conclude that the miR-16-1 (C>T  + 7 mutation is not a good diagnostic or prognostic indicator of risk for the cancers tested.

  15. Preliminary measurements on a Solo 161 Stirling refrigerator at temperatures below -30 C; Erste Messergebnisse einer Solo 161 Stirling-Kaeltemaschine bei Temperaturen der Kaeltebereitstellung unterhalb von -30 C

    Energy Technology Data Exchange (ETDEWEB)

    Schikora, H.; Siegel, A.; Steimle, F. [Essen Univ. (Gesamthochschule) (Germany). Inst. fuer Angewandte Thermodynamik und Klimatechnik


    Theoretical investigations have shown that Stirling refrigerators may be an interesting alternative in this temperature range; they are now being verified by measurements. The authors present preliminary results. [German] Verschiedene theoretische Untersuchungen haben gezeigt, dass Stirling-Kaeltemaschinen eine interessante Alternative fuer die Kaelteerzeugung bei umgebungsnahen Temperaturen (oberhalb von -40 C) darstellen koennten. In einem derzeit laufenden Forschungsvorhaben sollen diese theoretischen Untersuchungen durch Messungen an einer fuer diesen Temperaturbereich optimierten Stirling-Kaeltemaschine ueberprueft werden. In diesem Aufsatz werden erste Messergebnisse dieser neu entwickelten Solo 161 Stirling-Kaeltemaschine praesentiert. Neben den herkoemmlichen Leistungsdaten wie Kaelteleistung und Leistungsaufnahme werden weitere Groessen im Inneren der Maschine gemessen. Dazu gehoeren die mittleren Gastemperaturen an einigen Stellen in der Maschine. Die Druckverlaeufe in den Arbeitsraeumen werden ueber eine Kurbelumdrehung aufgeloest. Aus den damit erstellten p,V-Diagrammen koennen wichtige Groessen wie die Reibleistung im Kurbeltrieb und den Zylindern ermittelt werden. Anhand so detaillierter Messtechnik werden Schwachstellen lokalisiert und moegliche Verbesserungsmassnahmen beschrieben. (orig.)

  16. A Study of Single W Production in $e^{+}e^{-}$ Collisions at $\\sqrt{s}$ = 161 - 183 GeV

    CERN Document Server

    Barate, R; Ghez, P; Goy, C; Jézéquel, S; Lees, J P; Martin, F; Merle, E; Minard, M N; Pietrzyk, B; Przysiezniak, H; Alemany, R; Casado, M P; Chmeissani, M; Crespo, J M; Fernández, E; Fernández-Bosman, M; Garrido, L; Graugès-Pous, E; Juste, A; Martínez, M; Merino, G; Miquel, R; Mir, L M; Morawitz, P; Pacheco, A; Park, I C; Riu, I; Colaleo, A; Creanza, D; De Palma, M; Iaselli, Giuseppe; Maggi, G; Maggi, M; Nuzzo, S; Ranieri, A; Raso, G; Ruggieri, F; Selvaggi, G; Silvestris, L; Tempesta, P; Tricomi, A; Zito, G; Huang, X; Lin, J; Ouyang, Q; Wang, T; Xie, Y; Xu, R; Xue, S; Zhang, J; Zhang, L; Zhao, W; Abbaneo, D; Becker, U; Boix, G; Cattaneo, M; Cerutti, F; Ciulli, V; Dissertori, G; Drevermann, H; Forty, Roger W; Frank, M; Gianotti, F; Greening, T C; Halley, A W; Hansen, J B; Harvey, J; Janot, P; Jost, B; Lehraus, Ivan; Leroy, O; Loomis, C; Maley, P; Mato, P; Minten, Adolf G; Moutoussi, A; Ranjard, F; Rolandi, Luigi; Schlatter, W D; Schmitt, M; Schneider, O; Spagnolo, P; Tejessy, W; Teubert, F; Tomalin, I R; Tournefier, E; Ajaltouni, Ziad J; Badaud, F; Chazelle, G; Deschamps, O; Dessagne, S; Falvard, A; Ferdi, C; Gay, P; Guicheney, C; Henrard, P; Jousset, J; Michel, B; Monteil, S; Montret, J C; Pallin, D; Perret, P; Podlyski, F; Hansen, J D; Hansen, J R; Hansen, P H; Nilsson, B S; Rensch, B; Wäänänen, A; Daskalakis, G; Kyriakis, A; Markou, C; Simopoulou, Errietta; Vayaki, Anna; Blondel, A; Brient, J C; Machefert, F P; Rougé, A; Swynghedauw, M; Tanaka, R; Valassi, Andrea; Videau, H L; Focardi, E; Parrini, G; Zachariadou, K; Cavanaugh, R J; Corden, M; Georgiopoulos, C H; Antonelli, A; Bencivenni, G; Bologna, G; Bossi, F; Campana, P; Capon, G; Chiarella, V; Laurelli, P; Mannocchi, G; Murtas, F; Murtas, G P; Passalacqua, L; Pepé-Altarelli, M; Chalmers, M; Curtis, L; Lynch, J G; Negus, P; O'Shea, V; Räven, B; Raine, C; Smith, D; Teixeira-Dias, P; Thompson, A S; Ward, J J; Buchmüller, O L; Dhamotharan, S; Geweniger, C; Hanke, P; Hansper, G; Hepp, V; Kluge, E E; Putzer, A; Sommer, J; Tittel, K; Werner, S; Wunsch, M; Beuselinck, R; Binnie, David M; Cameron, W; Dornan, Peter J; Girone, M; Goodsir, S M; Marinelli, N; Martin, E B; Nash, J; Nowell, J; Sedgbeer, J K; Thomson, E; Williams, M D; Ghete, V M; Girtler, P; Kneringer, E; Kuhn, D; Rudolph, G; Bowdery, C K; Buck, P G; Ellis, G; Finch, A J; Foster, F; Hughes, G; Jones, R W L; Robertson, N A; Smizanska, M; Williams, M; Giehl, I; Hölldorfer, F; Jakobs, K; Kleinknecht, K; Kröcker, M; Müller, A S; Nürnberger, H A; Quast, G; Renk, B; Rohne, E; Sander, H G; Schmeling, S; Wachsmuth, H W; Zeitnitz, C; Ziegler, T; Aubert, Jean-Jacques; Benchouk, C; Bonissent, A; Carr, J; Coyle, P; Ealet, A; Fouchez, D; Motsch, F; Payre, P; Rousseau, D; Talby, M; Thulasidas, M; Tilquin, A; Aleppo, M; Antonelli, M; Ragusa, F; Büscher, V; Dietl, H; Ganis, G; Hüttmann, K; Lütjens, G; Mannert, C; Männer, W; Moser, H G; Schael, S; Settles, Ronald; Seywerd, H C J; Stenzel, H; Wiedenmann, W; Wolf, G; Boucrot, J; Callot, O; Chen, S; Davier, M; Duflot, L; Grivaz, J F; Heusse, P; Jacholkowska, A; Kado, M; Kim, D W; Lefrançois, J; Serin, L; Veillet, J J; Videau, I; De Vivie de Régie, J B; Zerwas, D; Azzurri, P; Bagliesi, G; Bettarini, S; Boccali, T; Bozzi, C; Calderini, G; Dell'Orso, R; Fantechi, R; Ferrante, I; Giassi, A; Gregorio, A; Ligabue, F; Lusiani, A; Marrocchesi, P S; Messineo, A; Palla, Fabrizio; Rizzo, G; Sanguinetti, G; Sciabà, A; Sguazzoni, G; Tenchini, Roberto; Vannini, C; Venturi, A; Verdini, P G; Blair, G A; Chambers, J T; Coles, J; Cowan, G D; Green, M G; Hutchcroft, D E; Jones, L T; Medcalf, T; Strong, J A; Von Wimmersperg-Töller, J H; Botterill, David R; Clifft, R W; Edgecock, T R; Norton, P R; Thompson, J C; Wright, A E; Bloch-Devaux, B; Colas, P; Fabbro, B; Faïf, G; Lançon, E; Lemaire, M C; Locci, E; Pérez, P; Rander, J; Renardy, J F; Rosowsky, A; Trabelsi, A; Tuchming, B; Vallage, B; Black, S N; Dann, J H; Kim, H Y; Konstantinidis, N P; Litke, A M; McNeil, M A; Taylor, G; Booth, C N; Cartwright, S L; Combley, F; Hodgson, P N; Kelly, M S; Lehto, M H; Thompson, L F; Affholderbach, K; Böhrer, A; Brandt, S; Foss, J; Grupen, Claus; Hess, J; Misiejuk, A; Prange, G; Sieler, U; Smolik, L; Stephan, F; Giannini, G; Gobbo, B; Pütz, J; Rothberg, J E; Wasserbaech, S R; Williams, R W; Armstrong, S R; Elmer, P; Ferguson, D P S; Gao, Y; González, S; Hayes, O J; Hu, H; Jin, S; McNamara, P A; Nielsen, J; Orejudos, W; Pan, Y B; Saadi, Y; Scott, I J; Vogt, M; Walsh, J; Wu Sau Lan; Wu, X; Zobernig, G


    Single W production is studied in the data recorded with the ALEPH detector at LEP at centre-of-mass energies between 161 and 183 GeV. The cross section is measured to be sigma_W=0.41+-0.17 (stat) +-0.04 (syst) pb at 183 GeV, consistent with the Standard Model expectation. Limits on non-standard WWgamma couplings are deduced as -1.6 < kg < 1.5 (lg=0) and -1.6 < lg < 1.6 (kg=1) at 95% C.L. A search for effectively invisible decays of the W boson in W pair production is performed, leading to an upper limit on the branching ratio of 1.3% (\\Gamma_inv= 27 MeV) at 95% C.L.

  17. Evaluation of the topoisomerase II-inactive bisdioxopiperazine ICRF-161 as a protectant against doxorubicin-induced cardiomyopathy

    DEFF Research Database (Denmark)

    Martin, E.; Thougaard, A.V.; Grauslund, M.


    Anthracycline-induced cardiomyopathy is a major problem in anti-cancer therapy. The only approved agent for alleviating this serious dose limiting side effect is ICRF-187 (dexrazoxane). The current thinking is that the ring-opened hydrolysis product of this agent, ADR-925, which is formed inside...... or in cells, it is well tolerated and shows similar exposure to ICRF-187 in rodents, and it does not induce myelosuppression when given at high doses to mice as opposed to ICRF-187. However, when tested in a model of chronic anthracycline-induced cardiomyopathy in spontaneously hypertensive rats, ICRF-161...... chelation alone does not appear to be sufficient for protection against anthracycline-induced cardiomyopathy Udgivelsesdato: 2009/1/8...

  18. Age and CD161 expression contribute to inter-individual variation in interleukin-23 response in CD8+ memory human T cells.

    Directory of Open Access Journals (Sweden)

    Hui Shen

    Full Text Available The interleukin-23 (IL-23 pathway plays a critical role in the pathogenesis of multiple chronic inflammatory disorders, however, inter-individual variability in IL-23-induced signal transduction in circulating human lymphocytes has not been well-defined. In this study, we observed marked, reproducible inter-individual differences in IL-23 responsiveness (measured by STAT3 phosphorylation in peripheral blood CD8+CD45RO+ memory T and CD3+CD56+ NKT cells. Age, but not gender, was a significant (Pearson's correlation coefficient, r = -0.37, p = 0.001 source of variability observed in CD8+CD45RO+ memory T cells, with IL-23 responsiveness gradually decreasing with increasing age. Relative to cells from individuals demonstrating low responsiveness to IL-23 stimulation, CD8+CD45RO+ memory T cells from individuals demonstrating high responsiveness to IL-23 stimulation showed increased gene expression for IL-23 receptor (IL-23R, RORC (RORγt and CD161 (KLRB1, whereas RORA (RORα and STAT3 expression were equivalent. Similar to CD4+ memory T cells, IL-23 responsiveness is confined to the CD161+ subset in CD8+CD45RO+ memory T cells, suggesting a similar CD161+ precursor as has been reported for CD4+ Th17 cells. We observed a very strong positive correlation between IL-23 responsiveness and the fraction of CD161+, CD8+CD45RO+ memory T cells (r = 0.80, p<0.001. Moreover, the fraction of CD161+, CD8+CD45RO+ memory T cells gradually decreases with aging (r = -0.34, p = 0.05. Our data define the inter-individual differences in IL-23 responsiveness in peripheral blood lymphocytes from the general population. Variable expression of CD161, IL-23R and RORC affects IL-23 responsiveness and contributes to the inter-individual susceptibility to IL-23-mediated defenses and inflammatory processes.

  19. Anti-L1CAM radioimmunotherapy is more effective with the radiolanthanide terbium-161 compared to lutetium-177 in an ovarian cancer model

    Energy Technology Data Exchange (ETDEWEB)

    Gruenberg, Juergen; Lindenblatt, Dennis; Cohrs, Susan; Fischer, Eliane [Paul Scherrer Institute, Center for Radiopharmaceutical Sciences ETH-PSI-USZ, Villigen (Switzerland); Dorrer, Holger [Paul Scherrer Institute, Laboratory of Radiochemistry and Environmental Chemistry, Villigen (Switzerland); Zhernosekov, Konstantin [ITG Isotope Technologies Garching GmbH, Garching (Germany); Koester, Ulli [Institut Laue-Langevin, Grenoble (France); Tuerler, Andreas [Paul Scherrer Institute, Laboratory of Radiochemistry and Environmental Chemistry, Villigen (Switzerland); University of Bern, Department of Chemistry and Biochemistry, Berne (Switzerland); Schibli, Roger [Paul Scherrer Institute, Center for Radiopharmaceutical Sciences ETH-PSI-USZ, Villigen (Switzerland); ETH Zurich, Department of Chemistry and Applied Biosciences, Zurich (Switzerland)


    The L1 cell adhesion molecule (L1CAM) is considered a valuable target for therapeutic intervention in different types of cancer. Recent studies have shown that anti-L1CAM radioimmunotherapy (RIT) with {sup 67}Cu- and {sup 177}Lu-labelled internalising monoclonal antibody (mAb) chCE7 was effective in the treatment of human ovarian cancer xenografts. In this study, we directly compared the therapeutic efficacy of anti-L1CAM RIT against human ovarian cancer under equitoxic conditions with the radiolanthanide {sup 177}Lu and the potential alternative {sup 161}Tb in an ovarian cancer therapy model. Tb was produced by neutron bombardment of enriched {sup 160}Gd targets. {sup 161}Tb and {sup 177}Lu were used for radiolabelling of DOTA-conjugated antibodies. The in vivo behaviour of the radioimmunoconjugates (RICs) was assessed in IGROV1 tumour-bearing nude mice using biodistribution experiments and SPECT/CT imaging. After ascertaining the maximal tolerated doses (MTD) the therapeutic impact of 50 % MTD of {sup 177}Lu- and {sup 161}Tb-DOTA-chCE7 was evaluated in groups of ten mice by monitoring the tumour size of subcutaneous IGROV1 tumours. The average number of DOTA ligands per antibody was 2.5 and maximum specific activities of 600 MBq/mg were achieved under identical radiolabelling conditions. RICs were stable in human plasma for at least 48 h. {sup 177}Lu- and {sup 161}Tb-DOTA-chCE7 showed high tumour uptake (37.8-39.0 %IA/g, 144 h p.i.) with low levels in off-target organs. SPECT/CT images confirmed the biodistribution data. {sup 161}Tb-labelled chCE7 revealed a higher radiotoxicity in nude mice (MTD: 10 MBq) than the {sup 177}Lu-labelled counterpart (MTD: 12 MBq). In a comparative therapy study with equitoxic doses, tumour growth inhibition was better by 82.6 % for the {sup 161}Tb-DOTA-chCE7 than the {sup 177}Lu-DOTA-chCE7 RIT. Our study is the first to show that anti-L1CAM {sup 161}Tb RIT is more effective compared to {sup 177}Lu RIT in ovarian cancer xenografts


    African Journals Online (AJOL)

    INTRODUCTION. Fluorescent materials, particularly blue fluorescent materials have gained strong interest because ... emitting complexes in different technical applications, such as emitting materials for organic light emitting ..... properties of three novel two-dimensional lanthanide coordination polymers with mixed aromatic ...

  1. Pyroelectric Ferroelectric and Resistivity Studies on Samarium ...

    African Journals Online (AJOL)

    Barium Strontium Sodium Niobate (Ba1-xSrx)2NaNb5O15 (BSNN) belongs to tungsten bronze ferroelectric morphotrophic phase boundary (MPB) system at x = 0.6, having large spontaneous polarisation, pyroelectric coefficient and low dielectic constant and is expected to be applicable for piezoceramic filter and ...


    African Journals Online (AJOL)

    emitting complexes in different technical applications, such as emitting materials for organic light emitting diodes, sensitizers in solar energy conversion, chemical sensors and so forth [6-9]. The ability of bipy to act as a rigid ..... properties of three-dimensional organic-inorganic hybrids based on α-metatungstate. Inorg. Chim.

  3. CD161+CD4+ T cells are enriched in the liver during chronic hepatitis and associated with co-secretion of IL-22 and Interferon-gamma

    Directory of Open Access Journals (Sweden)

    Yu-Hoi eKang


    Full Text Available Hepatitis C virus infection is a major cause of chronic liver disease. CD4+ T cells play a key role in disease outcome. However, the critical functions and associated phenotypes of intrahepatic CD4+ T cells are not well defined. We have previously shown that CD8+ T cells expressing the C type lectin CD161 are highly enriched in the human liver, especially during chronic hepatitis. These cells are associated with a type 17 differentiation pattern and express cytokines including IL-17A, IL-22 and IFNγ. We therefore analysed expression of CD161 on CD4+ T cells in blood and liver and addressed the relevant phenotype and functional capacity of these populations. We observed marked enrichment of CD161+CD4+ T cells in the liver during chronic hepatitis such that they are the dominant subtype (mean 55% of CD4+ T cells. IL-22 and IL-17 secreting CD4+ cells were readily found in the livers of HCV+ and NASH donors, although not enriched compared to blood. There was, however, specific enrichment of a novel subset of IL-22/IFN-γ dual secretors (p=0.02 compared to blood, a result reconfirmed with direct ex vivo analyses. These data indicate the dominance of CD161+ expressing lymphocyte populations within the hepatic infiltrate, associated with a distinct cytokine profile. Given their documented roles as antiviral and hepatoprotective cytokines respectively, the impact of co-secretion of IFNγ and IL-22 in the liver may be particularly significant.

  4. Complement activation in Mycoplasma fermentans-induced mycoplasma clearance from infected cells: probing of the organism with monoclonal antibodies against M161Ag. (United States)

    Kikkawa, S; Matsumoto, M; Sasaki, T; Nishiguchi, M; Tanaka, K; Toyoshima, K; Seya, T


    Mycoplasma fermentans, a cell wall-less prokaryote, is capable of infecting humans and has been suggested to serve as a cofactor in AIDS development. Recently, we discovered a novel lipoprotein with a molecular mass of 43 kDa originating from M. fermentans. This protein, named M161Ag, activated human complement via the alternative pathway and efficiently induced the proinflammatory cytokines interleukin 1beta (IL-1beta), tumor necrosis factor alpha, IL-6, IL-10, and IL-12 in human peripheral blood monocytes. It is likely that M161Ag of M. fermentans affects the host immune system upon mycoplasma infection. In this study, we developed monoclonal antibodies (MAbs) against M161Ag and examined the direct role of complement in M. fermentans infection using these MAbs as probes. M. fermentans was rapidly cleared from the surfaces of infected cells by human complement, but a low-grade infection persisted in human tumor cell lines. Mycoplasma particles remaining alive in host cells may cause recurrent infection, and liberated M161Ag may serve as a biological response modifier affecting both innate and acquired immunity.

  5. How Are Substrate Binding and Catalysis Affected by Mutating Glu127 and Arg161 in Prolyl-4-hydroxylase? A QM/MM and MD Study

    Directory of Open Access Journals (Sweden)

    Amy Timmins


    Full Text Available Prolyl-4-hydroxylase is a vital enzyme for human physiology involved in the biosynthesis of 4-hydroxyproline, an essential component for collagen formation. The enzyme performs a unique stereo- and regioselective hydroxylation at the C4 position of proline despite the fact that the C5 hydrogen atoms should be thermodynamically easier to abstract. To gain insight into the mechanism and find the origin of this regioselectivity, we have done a quantum mechanics/molecular mechanics (QM/MM study on wildtype and mutant structures. In a previous study (Timmins et al., 2017 we identified several active site residues critical for substrate binding and positioning. In particular, the Glu127 and Arg161 were shown to form multiple hydrogen bonding and ion-dipole interactions with substrate and could thereby affect the regio- and stereoselectivity of the reaction. In this work, we decided to test that hypothesis and report a QM/MM and molecular dynamics (MD study on prolyl-4-hydroxylase and several active site mutants where Glu127 or Arg161 are mutated for Asp, Gln, or Lys. Thus, the R161D and R161Q mutants give very high barriers for hydrogen atom abstraction from any proline C–H bond and therefore will be inactive. The R161K mutant, by contrast, sees the regio- and stereoselectivity of the reaction change but still is expected to hydroxylate proline at room temperature. By contrast, the Glu127 mutants E127D and E127Q show possible changes in regioselectivity with the former being more probable to react compared to the latter.

  6. Search for R-Parity violating effects at $\\sqrt{s}$ 161 and 172 GeV

    CERN Document Server

    Arnoud, Y; Berat, C; Witek, M; Vassilopoulos, N; Sajot, G; Richard, F; Nicolaidou, R; Pimenta M; Papadopoulou, Th D; Palka, H; Onofre, A; Lola, S; Kluit, P; Katsanevas, S; Gris, P; Fichet, S; Cieslik, K; Boonekamp, M


    Searches for charginos, neutralinos and sleptons in e+ e collisions at center-of-mass energies of 161 and 172 GeV have been performed on DELPHI data, under the assumptions that R-Parity is not conserved and that the dominant R-Parity violating couplings involve only leptonic or only quark elds. Particular emphasis is given in decays involving, the minimally constrained by low-energy studies, third generation couplings including 's and b quarks in the decay products. Squark decays are also studied for the same energies assuming that the dominant R-Parity violating couplings involve a mixture of leptonic and quark elds. In the above studies, it is assumed that the strength of the couplings is such that the lifetimes can be neglected. These searches are used to constraint domains of the parameter space, previously explored under the assumption of R-Parity conservation. Further, the single sparticle production, possible when R-parity is not conserved, is studied. In particular the single squark production and the...

  7. Sleep Behavior and EEG Oscillations in Aged Dp(16)1Yey/+ Mice: A Down Syndrome Model. (United States)

    Levenga, J; Peterson, D J; Cain, P; Hoeffer, C A


    Down syndrome (DS) results from the triplication of genes located on human chromosome 21 (Hsa21). Though many cognitive and behavioral impairments are associated with DS, sleep disturbances remain poorly understood despite being a reported phenotype in approximately 60% of individuals diagnosed with DS. In this study, sleep and electroencephalography (EEG) oscillations were recorded from aged (12-14 mos.) Dp(16)1Yey/+ mice (Dp16), a mouse model of DS. We observed disrupted sleep demonstrated by increased activity during the dark phase and increased time awake at the expense of NREM sleep compared to wild-type mice. In addition, we found that Dp16 mice display significant differences in relative EEG power distribution among oscillation frequencies in both sleep and awake states. These results in Dp16 mice are consistent with sleep disturbances found in individuals with DS, and the abnormal EEG oscillations in aged Dp16 mice suggest a potential role for GABAergic activity in these sleep and EEG abnormalities. These sleep and EEG data reflect underlying differences in neuronal activity at the network level and thus are causative agents rather than merely symptoms of DS. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  8. Central and Eastern European countries between the 16+1 platform and Chinese OBOR - One Belt, One Road - Initiative

    Directory of Open Access Journals (Sweden)

    George Cornel Dumitrescu


    Full Text Available This paper aims at analysing the projects and the initiatives of the Central and Eastern European countries that have been finalised, are in progress or will be developed in the near future with the help of the existing or future financial instruments specific to the 16+1 platform and the One Belt, One Road complex program. For our research we selected four countries, namely: Poland, Romania, Serbia and Hungary, the group being relevant from the perspective of the transportation corridors connected to the ”One Belt, One Road” initiative: (1 - Piraeus, Skopje, Belgrade, Budapest, Western Europe; (2 - Suez Canal, Constanta and then Danube, Western Europe, or through Moldova towards Ukraine and Poland; (3 – Constanta, through the Black Sea and Caspian Sea and then the corridors mentioned at the previous point. We based our analysis on the data provided by the National Bureau of Statistics of China, China-CEEC think-tank network and the literature in the field.

  9. Searches for charginos and neutralinos in $e^+ e^-$ collisions at $\\sqrt{s}$ = 161 and 172 GeV

    CERN Document Server

    Barate, R; Décamp, D; Ghez, P; Goy, C; Lees, J P; Lucotte, A; Minard, M N; Nief, J Y; Pietrzyk, B; Casado, M P; Chmeissani, M; Comas, P; Crespo, J M; Delfino, M C; Fernández, E; Fernández-Bosman, M; Garrido, L; Juste, A; Martínez, M; Merino, G; Miquel, R; Mir, L M; Padilla, C; Park, I C; Pascual, A; Perlas, J A; Riu, I; Sánchez, F; Colaleo, A; Creanza, D; De Palma, M; Gelao, G; Iaselli, Giuseppe; Maggi, G; Maggi, M; Marinelli, N; Nuzzo, S; Ranieri, A; Raso, G; Ruggieri, F; Selvaggi, G; Silvestris, L; Tempesta, P; Tricomi, A; Zito, G; Huang, X; Lin, J; Ouyang, Q; Wang, T; Xie, Y; Xu, R; Xue, S; Zhang, J; Zhang, L; Zhao, W; Abbaneo, D; Alemany, R; Bazarko, A O; Becker, U; Bright-Thomas, P G; Cattaneo, M; Cerutti, F; Dissertori, G; Drevermann, H; Forty, Roger W; Frank, M; Gianotti, F; Hagelberg, R; Hansen, J B; Harvey, J; Janot, P; Jost, B; Kneringer, E; Lehraus, Ivan; Mato, P; Minten, Adolf G; Moneta, L; Pacheco, A; Pusztaszeri, J F; Ranjard, F; Rizzo, G; Rolandi, Luigi; Rousseau, D; Schlatter, W D; Schmitt, M; Schneider, O; Tejessy, W; Teubert, F; Tomalin, I R; Wachsmuth, H W; Wagner, A; Ajaltouni, Ziad J; Barrès, A; Boyer, C; Falvard, A; Ferdi, C; Gay, P; Guicheney, C; Henrard, P; Jousset, J; Michel, B; Monteil, S; Montret, J C; Pallin, D; Perret, P; Podlyski, F; Proriol, J; Rosnet, P; Rossignol, J M; Fearnley, Tom; Hansen, J D; Hansen, J R; Hansen, P H; Nilsson, B S; Rensch, B; Wäänänen, A; Daskalakis, G; Kyriakis, A; Markou, C; Simopoulou, Errietta; Vayaki, Anna; Blondel, A; Brient, J C; Machefert, F P; Rougé, A; Rumpf, M; Valassi, Andrea; Videau, H L; Boccali, T; Focardi, E; Parrini, G; Zachariadou, K; Cavanaugh, R J; Corden, M; Georgiopoulos, C H; Hühn, T; Jaffe, D E; Antonelli, A; Bencivenni, G; Bologna, G; Bossi, F; Campana, P; Capon, G; Casper, David William; Chiarella, V; Felici, G; Laurelli, P; Mannocchi, G; Murtas, F; Murtas, G P; Passalacqua, L; Pepé-Altarelli, M; Curtis, L; Dorris, S J; Halley, A W; Knowles, I G; Lynch, J G; O'Shea, V; Raine, C; Scarr, J M; Smith, K; Teixeira-Dias, P; Thompson, A S; Thomson, E; Thomson, F; Turnbull, R M; Buchmüller, O L; Dhamotharan, S; Geweniger, C; Graefe, G; Hanke, P; Hansper, G; Hepp, V; Kluge, E E; Putzer, A; Sommer, J; Tittel, K; Werner, S; Wunsch, M; Beuselinck, R; Binnie, David M; Cameron, W; Dornan, Peter J; Girone, M; Goodsir, S M; Martin, E B; Morawitz, P; Moutoussi, A; Nash, J; Sedgbeer, J K; Spagnolo, P; Stacey, A M; Williams, M D; Ghete, V M; Girtler, P; Kuhn, D; Rudolph, G; Betteridge, A P; Bowdery, C K; Buck, P G; Colrain, P; Crawford, G; Finch, A J; Foster, F; Hughes, G; Jones, R W L; Sloan, Terence; Whelan, E P; Williams, M I; Giehl, I; Hoffmann, C; Jakobs, K; Kleinknecht, K; Quast, G; Renk, B; Rohne, E; Sander, H G; Van Gemmeren, P; Zeitnitz, C; Aubert, Jean-Jacques; Benchouk, C; Bonissent, A; Bujosa, G; Carr, J; Coyle, P; Diaconu, C A; Ealet, A; Fouchez, D; Konstantinidis, N P; Leroy, O; Motsch, F; Payre, P; Talby, M; Sadouki, A; Thulasidas, M; Tilquin, A; Trabelsi, K; Aleppo, M; Antonelli, M; Ragusa, F; Berlich, R; Blum, Walter; Büscher, V; Dietl, H; Ganis, G; Gotzhein, C; Kroha, H; Lütjens, G; Lutz, Gerhard; Männer, W; Moser, H G; Richter, R H; Rosado-Schlosser, A; Schael, S; Settles, Ronald; Seywerd, H C J; Saint-Denis, R; Stenzel, H; Wiedenmann, W; Wolf, G; Boucrot, J; Callot, O; Chen, S; Davier, M; Duflot, L; Grivaz, J F; Heusse, P; Höcker, A; Jacholkowska, A; Kim, D W; Le Diberder, F R; Lefrançois, J; Lutz, A M; Marumi, M; Schune, M H; Serin, L; Tournefier, E; Veillet, J J; Videau, I; Zerwas, D; Azzurri, P; Bagliesi, G; Bettarini, S; Bozzi, C; Calderini, G; Ciulli, V; Dell'Orso, R; Fantechi, R; Ferrante, I; Giassi, A; Gregorio, A; Ligabue, F; Lusiani, A; Marrocchesi, P S; Messineo, A; Palla, Fabrizio; Sanguinetti, G; Sciabà, A; Sguazzoni, G; Steinberger, Jack; Tenchini, Roberto; Vannini, C; Venturi, A; Verdini, P G; Blair, G A; Bryant, L M; Chambers, J T; Green, M G; Medcalf, T; Perrodo, P; Strong, J A; Von Wimmersperg-Töller, J H; Botterill, David R; Clifft, R W; Edgecock, T R; Haywood, S; Maley, P; Norton, P R; Thompson, J C; Wright, A E; Bloch-Devaux, B; Colas, P; Fabbro, B; Lançon, E; Lemaire, M C; Locci, E; Pérez, P; Rander, J; Renardy, J F; Rosowsky, A; Roussarie, A; Schwindling, J; Trabelsi, A; Vallage, B; Black, S N; Dann, J H; Kim, H Y; Litke, A M; McNeil, M A; Taylor, G; Booth, C N; Brew, C A J; Cartwright, S L; Combley, F; Kelly, M S; Lehto, M H; Reeve, J; Thompson, L F; Affholderbach, K; Böhrer, A; Brandt, S; Cowan, G D; Foss, J; Grupen, Claus; Smolik, L; Stephan, F; Apollonio, M; Bosisio, L; Della Marina, R; Giannini, G; Gobbo, B; Musolino, G; Pütz, J; Rothberg, J E; Wasserbaech, S R; Williams, R W; Armstrong, S R; Charles, E; Elmer, P; Ferguson, D P S; Gao, Y; González, S; Greening, T C; Hayes, O J; Hu, H; Jin, S; McNamara, P A; Nachtman, J M; Nielsen, J; Orejudos, W; Pan, Y B; Saadi, Y; Scott, I J; Walsh, J; Wu Sau Lan; Wu, X; Yamartino, J M; Zobernig, G


    The data recorded by the ALEPH detector at centre-of-mass energies of 161, 170, and 172 GeV are analysed for signals of chargino and neutralino production. No evidence of a signal is found, although candidate events consistent with the expectations from Standard Model processes are observed. Limits at 95% C.L. on the production cross sections are derived and bounds on the parameters of the Minimal Supersymmetric Standard Model are set. The lower limit on the mass of the lightest chargino is 85.5 GeV/c^2 for gaugino-like charginos (mu = -500 GeV/c^2), and 85.0 GeV/c^2 for Higgsino-like charginos (M_2 = 500 GeV/c^2), for heavy sneutrinos (M(snu) > 200 GeV/c^2) and tanb = sqrt(2). The effect of light sleptons on chargino and neutralino limits is investigated. The assumptions of a universal slepton mass and a universal gaugino mass are relaxed, allowing less model-dependent limits to be obtained.

  10. Is there a gender equity for women farmers? Reflections on public policy and social CONPES 161/2013.

    Directory of Open Access Journals (Sweden)

    Ximena Marin Hermann


    Full Text Available Domestic roles ( reproductive and productive Colombian rural women are different and are marked by the dynamics of their own territories , but also developed in the areas of public and private unevenly and unfairly compared to men rural sector. Considering the above, raises feminist economics "care economy" as an effort to validate and make visible the contribution of women to the economy. But this trend can go further, can contribute to the transformation of reproductive and productive roles, encouraging participation and democracy for women. Considering this, the equitable use of the time in the private ( family enters debate. Women no longer want and seek only equality in public but do not want to share your time at home on an unequal footing . Public policies are needed to contribute to these disparities disappear. To this extent it is possible to ask yourself the current Public Policy Of Gender Equity for Women ( SOCIAL CONPES 161/2013 , can guarantee the full enjoyment of the rights of Colombian women applying the principles of equality and non-discrimination? This reflection tries to do, from a gender perspective, an analytical reading of the impact of public policy on the transformation of the reality of the Colombian rural women.

  11. 16.1% Efficient Hysteresis-Free Mesostructured Perovskite Solar Cells Based on Synergistically Improved ZnO Nanorod Arrays

    KAUST Repository

    Mahmood, Khalid


    Significant efficiency improvements are reported in mesoscopic perovskite solar cells based on the development of a low-temperature solution-processed ZnO nanorod (NR) array exhibiting higher NR aspect ratio, enhanced electron density, and substantially reduced work function than conventional ZnO NRs. These features synergistically result in hysteresis-free, scan-independent, and stabilized devices with an efficiency of 16.1%. Electron-rich, nitrogen-doped ZnO (N:ZnO) NR-based electron transporting materials (ETMs) with enhanced electron mobility produced using ammonium acetate show consistently higher efficiencies by one to three power points than undoped ZnO NRs. Additionally, the preferential electrostatic interaction between the -nonpolar facets of N:ZnO and the conjugated polyelectrolyte polyethylenimine (PEI) has been relied on to promote the hydrothermal growth of high aspect ratio NR arrays and substantially improve the infiltration of the perovskite light absorber into the ETM. Using the same interactions, a conformal PEI coating on the electron-rich high aspect ratio N:ZnO NR arrays is -successfully applied, resulting in a favorable work function shift and altogether leading to the significant boost in efficiency from <10% up to >16%. These results largely surpass the state-of-the-art PCE of ZnO-based perovskite solar cells and highlight the benefits of synergistically combining mesoscale control with doping and surface modification. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Absence of Prenatal Forebrain Defects in the Dp(16)1Yey/+ Mouse Model of Down Syndrome. (United States)

    Goodliffe, Joseph W; Olmos-Serrano, Jose Luis; Aziz, Nadine M; Pennings, Jeroen L A; Guedj, Faycal; Bianchi, Diana W; Haydar, Tarik F


    Studies in humans with Down syndrome (DS) show that alterations in fetal brain development are followed by postnatal deficits in neuronal numbers, synaptic plasticity, and cognitive and motor function. This same progression is replicated in several mouse models of DS. Dp(16)1Yey/+ (hereafter called Dp16) is a recently developed mouse model of DS in which the entire region of mouse chromosome 16 that is homologous to human chromosome 21 has been triplicated. As such, Dp16 mice may more closely reproduce neurodevelopmental changes occurring in humans with DS. Here, we present the first comprehensive cellular and behavioral study of the Dp16 forebrain from embryonic to adult stages. Unexpectedly, our results demonstrate that Dp16 mice do not have prenatal brain defects previously reported in human fetal neocortex and in the developing forebrains of other mouse models, including microcephaly, reduced neurogenesis, and abnormal cell proliferation. Nevertheless, we found impairments in postnatal developmental milestones, fewer inhibitory forebrain neurons, and deficits in motor and cognitive performance in Dp16 mice. Therefore, although this new model does not express prenatal morphological phenotypes associated with DS, abnormalities in the postnatal period appear sufficient to produce significant cognitive deficits in Dp16. Copyright © 2016 the authors 0270-6474/16/362926-19$15.00/0.

  13. Di-Jet Production in Photon-Photon Collisions at $\\sqrt{s}_{ee}$ = 161 and 172 GeV

    CERN Document Server

    Abbiendi, G.; Alexander, G.; Allison, John; Altekamp, N.; Anderson, K.J.; Anderson, S.; Arcelli, S.; Asai, S.; Ashby, S.F.; Axen, D.; Azuelos, G.; Ball, A.H.; Barberio, E.; Barillari, T.; Barlow, Roger J.; Bartoldus, R.; Batley, J.R.; Baumann, S.; Bechtluft, J.; Behnke, T.; Bell, Kenneth Watson; Bella, G.; Bellerive, A.; Bentvelsen, S.; Bethke, S.; Betts, S.; Biebel, O.; Biguzzi, A.; Bird, S.D.; Blobel, V.; Bloodworth, I.J.; Bobinski, M.; Bock, P.; Bohme, J.; Bonacorsi, D.; Boutemeur, M.; Braibant, S.; Bright-Thomas, P.; Brigliadori, L.; Brown, Robert M.; Burckhart, H.J.; Burgard, C.; Burgin, R.; Capiluppi, P.; Carnegie, R.K.; Carter, A.A.; Carter, J.R.; Chang, C.Y.; Charlton, David G.; Chrisman, D.; Ciocca, C.; Clarke, P.E.L.; Clay, E.; Cohen, I.; Conboy, J.E.; Cooke, O.C.; Couyoumtzelis, C.; Coxe, R.L.; Cuffiani, M.; Dado, S.; Dallavalle, G.Marco; Davis, R.; De Jong, S.; del Pozo, L.A.; De Roeck, A.; Desch, K.; Dienes, B.; Dixit, M.S.; Dubbert, J.; Duchovni, E.; Duckeck, G.; Duerdoth, I.P.; Eatough, D.; Estabrooks, P.G.; Etzion, E.; Evans, H.G.; Fabbri, F.; Fanti, M.; Faust, A.A.; Fiedler, F.; Fierro, M.; Fleck, I.; Folman, R.; Furtjes, A.; Futyan, D.I.; Gagnon, P.; Gary, J.W.; Gascon, J.; Gascon-Shotkin, S.M.; Gaycken, G.; Geich-Gimbel, C.; Giacomelli, G.; Giacomelli, P.; Gibson, V.; Gibson, W.R.; Gingrich, D.M.; Glenzinski, D.; Goldberg, J.; Gorn, W.; Grandi, C.; Gross, E.; Grunhaus, J.; Gruwe, M.; Hanson, G.G.; Hansroul, M.; Hapke, M.; Harder, K.; Hargrove, C.K.; Hartmann, C.; Hauschild, M.; Hawkes, C.M.; Hawkings, R.; Hemingway, R.J.; Herndon, M.; Herten, G.; Heuer, R.D.; Hildreth, M.D.; Hill, J.C.; Hillier, S.J.; Hobson, P.R.; Hocker, James Andrew; Homer, R.J.; Honma, A.K.; Horvath, D.; Hossain, K.R.; Howard, R.; Huntemeyer, P.; Igo-Kemenes, P.; Imrie, D.C.; Ishii, K.; Jacob, F.R.; Jawahery, A.; Jeremie, H.; Jimack, M.; Jones, C.R.; Jovanovic, P.; Junk, T.R.; Karlen, D.; Kartvelishvili, V.; Kawagoe, K.; Kawamoto, T.; Kayal, P.I.; Keeler, R.K.; Kellogg, R.G.; Kennedy, B.W.; Klier, A.; Kluth, S.; Kobayashi, T.; Kobel, M.; Koetke, D.S.; Kokott, T.P.; Kolrep, M.; Komamiya, S.; Kowalewski, Robert V.; Kress, T.; Krieger, P.; von Krogh, J.; Kuhl, T.; Kyberd, P.; Lafferty, G.D.; Lanske, D.; Lauber, J.; Lautenschlager, S.R.; Lawson, I.; Layter, J.G.; Lazic, D.; Lee, A.M.; Lellouch, D.; Letts, J.; Levinson, L.; Liebisch, R.; List, B.; Littlewood, C.; Lloyd, A.W.; Lloyd, S.L.; Loebinger, F.K.; Long, G.D.; Losty, M.J.; Ludwig, J.; Lui, D.; Macchiolo, A.; Macpherson, A.; Mader, W.; Mannelli, M.; Marcellini, S.; Markopoulos, C.; Martin, A.J.; Martin, J.P.; Martinez, G.; Mashimo, T.; Mattig, Peter; McDonald, W.John; McKenna, J.; Mckigney, E.A.; McMahon, T.J.; McPherson, R.A.; Meijers, F.; Menke, S.; Merritt, F.S.; Mes, H.; Meyer, J.; Michelini, A.; Mihara, S.; Mikenberg, G.; Miller, D.J.; Mir, R.; Mohr, W.; Montanari, A.; Mori, T.; Nagai, K.; Nakamura, I.; Neal, H.A.; Nellen, B.; Nisius, R.; O'Neale, S.W.; Oakham, F.G.; Odorici, F.; Ogren, H.O.; Oreglia, M.J.; Orito, S.; Palinkas, J.; Pasztor, G.; Pater, J.R.; Patrick, G.N.; Patt, J.; Perez-Ochoa, R.; Petzold, S.; Pfeifenschneider, P.; Pilcher, J.E.; Pinfold, J.; Plane, David E.; Poffenberger, P.; Polok, J.; Przybycien, M.; Rembser, C.; Rick, H.; Robertson, S.; Robins, S.A.; Rodning, N.; Roney, J.M.; Roscoe, K.; Rossi, A.M.; Rozen, Y.; Runge, K.; Runolfsson, O.; Rust, D.R.; Sachs, K.; Saeki, T.; Sahr, O.; Sang, W.M.; Sarkisian, E.K.G.; Sbarra, C.; Schaile, A.D.; Schaile, O.; Scharf, F.; Scharff-Hansen, P.; Schieck, J.; Schmitt, B.; Schmitt, S.; Schoning, A.; Schroder, Matthias; Schumacher, M.; Schwick, C.; Scott, W.G.; Seuster, R.; Shears, T.G.; Shen, B.C.; Shepherd-Themistocleous, C.H.; Sherwood, P.; Siroli, G.P.; Sittler, A.; Skuja, A.; Smith, A.M.; Snow, G.A.; Sobie, R.; Soldner-Rembold, S.; Sproston, M.; Stahl, A.; Stephens, K.; Steuerer, J.; Stoll, K.; Strom, David M.; Strohmer, R.; Surrow, B.; Talbot, S.D.; Tanaka, S.; Taras, P.; Tarem, S.; Teuscher, R.; Thiergen, M.; Thomson, M.A.; von Torne, E.; Torrence, E.; Towers, S.; Trigger, I.; Trocsanyi, Z.; Tsur, E.; Turcot, A.S.; Turner-Watson, M.F.; Van Kooten, Rick J.; Vannerem, P.; Verzocchi, M.; Voss, H.; Wackerle, F.; Wagner, A.; Ward, C.P.; Ward, D.R.; Watkins, P.M.; Watson, A.T.; Watson, N.K.; Wells, P.S.; Wermes, N.; White, J.S.; Wilson, G.W.; Wilson, J.A.; Wyatt, T.R.; Yamashita, S.; Yekutieli, G.; Zacek, V.; Zer-Zion, D.


    Di-jet production is studied in collisions of quasi-real photons radiated by the LEP beams at e+e- centre-of-mass energies 161 and 172 GeV. The jets are reconstructed using a cone jet finding algorithm. The angular distributions of direct and double-resolved processes are measured and compared to the predictions of leading order and next-to-leading order perturbative QCD. The jet energy profiles are also studied. The inclusive two-jet cross-section is measured as a function of transverse energy and rapidity and compared to next-to-leading order perturbative QCD calculations. The inclusive two-jet cross-section as a function of rapidity is compared to the prediction of the leading order Monte Carlo generators PYTHIA and PHOJET. The Monte Carlo predictions are calculated with different parametrisations of the parton distributions of the photon. The influence of the `underlying event' has been studied to reduce the model dependence of the predicted jet cross-sections from the Monte Carlo generators.

  14. Mental Status Test Scores are Inversely Correlated with Tremor Severity: A Study of 161 Elderly Essential Tremor Cases

    Directory of Open Access Journals (Sweden)

    Elan D. Louis


    Full Text Available Background: There is an increasing awareness that patients with essential tremor (ET may exhibit non-motor features, including cognitive dysfunction. Yet there are surprisingly few data in ET on the association, if any, between cognitive dysfunction and motor dysfunction (i.e., tremor severity. Establishing links between the cognitive and motor features of ET would imply that the two share a common underlying pathogenic process. Recent neuroimaging data support this notion.Methods: ET cases were enrolled in a clinical–pathological study at Columbia University Medical Center, New York. The Folstein Mini-Mental State Examination (FMMSE and Modified Mini Mental Status Examination (mMMSE were administered. Action tremor was rated with a total tremor score (TTS.Results: There were 161 ET cases (mean age 83.9±5.7 years, median FMMSE 28, median mMMSE 50. The FMMSE and mMMSE were inversely correlated with the TTS (r = −0.22, p = 0.005; and r = −0.17, p = 0.029. The association, while statistically significant, was modest in magnitude. In linear regression models that adjusted for age, gender, and education, the association between cognitive test scores and TTS remained robust (p<0.001. After excluding 68 (42.2% cases taking ET medications with potential cognitive side effects, results remained unchanged.Conclusions: Each of the two cognitive test scores was associated with tremor severity such that greater cognitive dysfunction occurred in cases with more marked tremor. These data support recent imaging data, which suggest that the cerebellar neurodegeneration underlying ET may be involved in the expression of cognitive symptoms in ET.

  15. Rates of intraoperative complications and conversion to laparotomy during laparoscopic ovariectomy performed by veterinary students: 161 cases (2010-2014). (United States)

    Nylund, Adam M; Drury, Adam; Weir, Heather; Monnet, Eric


    OBJECTIVE To assess rates of intraoperative complications and conversion to laparotomy associated with supervised veterinary students performing laparoscopic ovariectomy in dogs. DESIGN Retrospective case series. ANIMALS 161 female shelter dogs for which elective laparoscopic ovariectomy had been performed by supervised senior (fourth-year) veterinary students from 2010 through 2014. PROCEDURES Medical records of all dogs were reviewed and data collected regarding duration of surgery, surgical complications and other characteristics, and whether conversion to laparotomy was required. RESULTS Laparoscopic ovariectomy was performed with a 2-cannula technique and a 10-mm vessel-sealing device for hemostasis in all dogs. A Veress needle was used for initial insufflation in 144 (89.4%) dogs; method of insufflation was not reported for the remaining 17 (10.6%) dogs. Mean ± SD duration of surgery was 114.90 ± 33.40 minutes. Surgical complications, all classified as minor blood loss, occurred in 24 (14.9%) dogs. These included splenic puncture during insertion of the Veress needle (n = 20 [12.4%]) and minor bleeding from the ovarian pedicle (4 [2.5%]). Splenic puncture required no intervention, and ovarian pedicle bleeding required application of the vessel-sealing device an additional time to control the bleeding. Two ovaries were dropped in the abdominal cavity at the time of removal. Both were retrieved without complication. Conversion to laparotomy was not required for any dog. All dogs were discharged from the hospital within 24 hours after surgery. CONCLUSIONS AND CLINICAL RELEVANCE Laparoscopic ovariectomy in dogs was performed safely by closely supervised novice surgeons, with only minor intraoperative complications encountered and no need for conversion to laparotomy.

  16. Palmitoleic acid isomer (C16:1delta6) in human skin sebum is effective against gram-positive bacteria. (United States)

    Wille, J J; Kydonieus, A


    The percent lipid composition of pooled human sebum analyzed by thin-layer chromatography was: ceramides (13%), fatty acid (47%), cholesterol (7%), cholesterol esters (2%), squalene (11%), triglycerides (3%), and wax esters (17%). Total sebum lipids (2- 4 mg/ml), sonicated into bacterial culture medium, caused 4- to 5-fold log reduction in growth of gram-positive bacteria, Staphylococcus aureus, Streptococcus salivarius and the anaerobe Fusobacterium nucleatum, but was ineffective against most gram-negative bacteria. Fractionation of the sebum lipids showed that both saturated and unsaturated fatty acids contained the bulk of the antimicrobial activity. Lauric acid (C12:0) was the most active saturated fatty acid. The unsaturated fatty acid, palmitoleic acid (C16:1delta6, cPA) was both the most predominant monoene and the most active antimicrobial fatty acid. Purified cPA (>99%) yielded typical minimal inhibitory concentration (MIC) values of 10-20 microg/ml against gram-positive bacteria. Organically synthesized cPA isomer gave MIC values comparable to the natural material. Both natural and synthetic cPA were found to be the most active sebum lipid fraction in blocking the adherence of a pathogenic strain of Candida albicans to porcine stratum corneum. Ethanol in combination with cPA exerts a synergistic bactericidal activity against gram-negative pathogenic bacteria, including Pseudomonas aeruginosa, Propionibacterium acnes, Escherichia coli, and several methacillin-resistant strains of S. aureus. Palmitoleic acid may be useful in topical formulations for treatment of secondary gram-positive bacterial infections, as a gram-positive bacteria antimicrobial in wound dressings, and as a natural gram-positive antimicrobial preservative in skin and hair care products. Copyright 2003 S. Karger AG, Basel

  17. Epidemiologia e distribuição de lesões extrarrenais de uremia em 161 cães

    Directory of Open Access Journals (Sweden)

    Isadora P. Silveira


    Full Text Available Resumo: Com o objetivo de determinar a epidemiologia e as características morfológicas, incluindo a localização anatômica, das lesões extrarrenais de uremia, bem como determinar as principais lesões do sistema urinário associadas à ocorrência de uremia, foram revisados os protocolos de necropsias de cães realizadas no Laboratório de Patologia Veterinária da Universidade Federal de Santa Maria de janeiro de 1996 a dezembro de 2012 (17 anos. Nesse período foram necropsiados 4.201 cães, sendo que 161 (3,8% apresentaram lesões extrarrenais de uremia. Em 134 cães (83,2% foram descritos sinais clínicos associados à uremia. As lesões extrarrenais mais frequentes, em ordem decrescente, foram: gastrite ulcerativa e hemorrágica (56,5%, mineralização de tecidos moles (55,9%, edema pulmonar (47,2%, estomatite e/ou glossite ulcerativa (30,4%, endocardite/trombose atrial e aórtica (28,6%, hiperplasia das paratireoides (9,3%, osteodistrofia fibrosa (8,1%, anemia (6,2%, laringite ulcerativa (5%, enterite ulcerativa/hemorrágica (3,7%, esofagite fibrinonecrótica (1,9% e pericardite fibrinosa (1.9%. Na maioria dos casos as lesões extrarrenais de uremia foram decorrentes de azotemia prolongada por lesões renais graves, sendo as mais prevalentes a nefrite intersticial e a glomerulonefrite.

  18. Search for anomalous production of dilepton events with missing transverse momentum in $e^{+} e^{-}$ collisions at $\\sqrt{s}$ = 161 and 172 GeV

    CERN Document Server

    Ackerstaff, K.; Allison, John; Altekamp, N.; Anderson, K.J.; Anderson, S.; Arcelli, S.; Asai, S.; Axen, D.; Azuelos, G.; Ball, A.H.; Barberio, E.; Barlow, Roger J.; Bartoldus, R.; Batley, J.R.; Baumann, S.; Bechtluft, J.; Beeston, C.; Behnke, T.; Bell, A.N.; Bell, Kenneth Watson; Bella, G.; Bentvelsen, S.; Bethke, S.; Biebel, O.; Biguzzi, A.; Bird, S.D.; Blobel, V.; Bloodworth, I.J.; Bloomer, J.E.; Bobinski, M.; Bock, P.; Bonacorsi, D.; Boutemeur, M.; Bouwens, B.T.; Braibant, S.; Brigliadori, L.; Brown, Robert M.; Burckhart, H.J.; Burgard, C.; Burgin, R.; Capiluppi, P.; Carnegie, R.K.; Carter, A.A.; Carter, J.R.; Chang, C.Y.; Charlton, David G.; Chrisman, D.; Clarke, P.E.L.; Cohen, I.; Conboy, J.E.; Cooke, O.C.; Cuffiani, M.; Dado, S.; Dallapiccola, C.; Dallavalle, G.Marco; Davis, R.; De Jong, S.; del Pozo, L.A.; Desch, K.; Dienes, B.; Dixit, M.S.; do Couto e Silva, E.; Doucet, M.; Duchovni, E.; Duckeck, G.; Duerdoth, I.P.; Eatough, D.; Edwards, J.E.G.; Estabrooks, P.G.; Evans, H.G.; Evans, M.; Fabbri, F.; Fanti, M.; Faust, A.A.; Fiedler, F.; Fierro, M.; Fischer, H.M.; Fleck, I.; Folman, R.; Fong, D.G.; Foucher, M.; Furtjes, A.; Futyan, D.I.; Gagnon, P.; Gary, J.W.; Gascon, J.; Gascon-Shotkin, S.M.; Geddes, N.I.; Geich-Gimbel, C.; Geralis, T.; Giacomelli, G.; Giacomelli, P.; Giacomelli, R.; Gibson, V.; Gibson, W.R.; Gingrich, D.M.; Glenzinski, D.; Goldberg, J.; Goodrick, M.J.; Gorn, W.; Grandi, C.; Gross, E.; Grunhaus, J.; Gruwe, M.; Hajdu, C.; Hanson, G.G.; Hansroul, M.; Hapke, M.; Hargrove, C.K.; Hart, P.A.; Hartmann, C.; Hauschild, M.; Hawkes, C.M.; Hawkings, R.; Hemingway, R.J.; Herndon, M.; Herten, G.; Heuer, R.D.; Hildreth, M.D.; Hill, J.C.; Hillier, S.J.; Hobson, P.R.; Homer, R.J.; Honma, A.K.; Horvath, D.; Hossain, K.R.; Howard, R.; Huntemeyer, P.; Hutchcroft, D.E.; Igo-Kemenes, P.; Imrie, D.C.; Ingram, M.R.; Ishii, K.; Jawahery, A.; Jeffreys, P.W.; Jeremie, H.; Jimack, M.; Joly, A.; Jones, C.R.; Jones, G.; Jones, M.; Jost, U.; Jovanovic, P.; Junk, T.R.; Karlen, D.; Kartvelishvili, V.; Kawagoe, K.; Kawamoto, T.; Kayal, P.I.; Keeler, R.K.; Kellogg, R.G.; Kennedy, B.W.; Kirk, J.; Klier, A.; Kluth, S.; Kobayashi, T.; Kobel, M.; Koetke, D.S.; Kokott, T.P.; Kolrep, M.; Komamiya, S.; Kress, T.; Krieger, P.; von Krogh, J.; Kyberd, P.; Lafferty, G.D.; Lahmann, R.; Lai, W.P.; Lanske, D.; Lauber, J.; Lautenschlager, S.R.; Layter, J.G.; Lazic, D.; Lee, A.M.; Lefebvre, E.; Lellouch, D.; Letts, J.; Levinson, L.; Lloyd, S.L.; Loebinger, F.K.; Long, G.D.; Losty, M.J.; Ludwig, J.; Macchiolo, A.; Macpherson, A.; Mannelli, M.; Marcellini, S.; Markus, C.; Martin, A.J.; Martin, J.P.; Martinez, G.; Mashimo, T.; Mattig, Peter; McDonald, W.John; McKenna, J.; Mckigney, E.A.; McMahon, T.J.; McPherson, R.A.; Meijers, F.; Menke, S.; Merritt, F.S.; Mes, H.; Meyer, J.; Michelini, A.; Mikenberg, G.; Miller, D.J.; Mincer, A.; Mir, R.; Mohr, W.; Montanari, A.; Mori, T.; Morii, M.; Muller, U.; Mihara, S.; Nagai, K.; Nakamura, I.; Neal, H.A.; Nellen, B.; Nisius, R.; O'Neale, S.W.; Oakham, F.G.; Odorici, F.; Ogren, H.O.; Oh, A.; Oldershaw, N.J.; Oreglia, M.J.; Orito, S.; Palinkas, J.; Pasztor, G.; Pater, J.R.; Patrick, G.N.; Patt, J.; Pearce, M.J.; Perez-Ochoa, R.; Petzold, S.; Pfeifenschneider, P.; Pilcher, J.E.; Pinfold, J.; Plane, David E.; Poffenberger, P.; Poli, B.; Posthaus, A.; Rees, D.L.; Rigby, D.; Robertson, S.; Robins, S.A.; Rodning, N.; Roney, J.M.; Rooke, A.; Ros, E.; Rossi, A.M.; Routenburg, P.; Rozen, Y.; Runge, K.; Runolfsson, O.; Ruppel, U.; Rust, D.R.; Rylko, R.; Sachs, K.; Saeki, T.; Sarkisian, E.K.G.; Sbarra, C.; Schaile, A.D.; Schaile, O.; Scharf, F.; Scharff-Hansen, P.; Schenk, P.; Schieck, J.; Schleper, P.; Schmitt, B.; Schmitt, S.; Schoning, A.; Schroder, Matthias; Schultz-Coulon, H.C.; Schumacher, M.; Schwick, C.; Scott, W.G.; Shears, T.G.; Shen, B.C.; Shepherd-Themistocleous, C.H.; Sherwood, P.; Siroli, G.P.; Sittler, A.; Skillman, A.; Skuja, A.; Smith, A.M.; Snow, G.A.; Sobie, R.; Soldner-Rembold, S.; Springer, Robert Wayne; Sproston, M.; Stephens, K.; Steuerer, J.; Stockhausen, B.; Stoll, K.; Strom, David M.; Szymanski, P.; Tafirout, R.; Talbot, S.D.; Tanaka, S.; Taras, P.; Tarem, S.; Teuscher, R.; Thiergen, M.; Thomson, M.A.; von Torne, E.; Towers, S.; Trigger, I.; Trocsanyi, Z.; Tsur, E.; Turcot, A.S.; Turner-Watson, M.F.; Utzat, P.; Van Kooten, Rick J.; Verzocchi, M.; Vikas, P.; Vokurka, E.H.; Voss, H.; Wackerle, F.; Wagner, A.; Ward, C.P.; Ward, D.R.; Watkins, P.M.; Watson, A.T.; Watson, N.K.; Wells, P.S.; Wermes, N.; White, J.S.; Wilkens, B.; Wilson, G.W.; Wilson, J.A.; Wolf, G.; Wyatt, T.R.; Yamashita, S.; Yekutieli, G.; Zacek, V.; Zer-Zion, D.


    Events containing a pair of charged leptons and significant missing transverse momentum are selected from a data sample corresponding to a total integrated luminosity of 20.6 pb^-1 at centre-of-mass energies of 161 GeV and 172 GeV. The observed number of events, four at 161 GeV and nine at 172 GeV, is consistent with the number expected from Standard Model processes, predominantly arising from W+W- production with each W decaying leptonically. This topology is also an experimental signature for the pair production of new particles that decay to a charged lepton accompanied by one or more invisible particles. Further event selection criteria are described that optimise the sensitivity to particular new physics channels. No evidence for new phenomena is observed and limits on the production of scalar charged lepton pairs and other new particles are presented.

  19. Clinical significance of pre-transplant circulating CD3(+) CD4(+) CD161(+) cell frequency on the occurrence of neutropenic infections after allogeneic stem cell transplantation. (United States)

    Kim, Tae Woo; Lee, Sung-Eun; Lim, Ji-Young; Ryu, Da-Bin; Jeon, Young-Woo; Yoon, Jae-Ho; Cho, Byung-Sik; Eom, Ki-Seong; Kim, Yoo-Jin; Kim, Hee-Je; Lee, Seok; Cho, Seok-Goo; Kim, Dong-Wook; Lee, Jong Wook; Min, Woo-Sung; Min, Chang-Ki


    Few studies have been performed to identify factors that are associated with an increased risk of infections during the neutropenic period in patients undergoing allogeneic stem cell transplantation (allo-SCT). The aim of this study was to identify the host immune cells responsible for infections before engraftment. A total of 282 patients who underwent allo-SCT were enrolled. Peripheral blood samples were collected before conditioning therapy. Expression of CD161-expressing T cells, natural killer cells, and immature myeloid cells was analyzed by flow cytometry. Microbially and clinically defined infections and fevers of unknown origin as proposed by the Immunocompromised Host Society were included in this study. The median age was 45 years (range, 16-68 years). Patients had various hematologic disorders and were transplanted from human leukocyte antigen (HLA)-matched siblings, unrelated donors, and familial HLA-mismatched donors. In univariate analysis, younger age and a familial HLA-mismatched donor were risk factors for the occurrence of infections. After adjusting for potential variables in univariate analysis, multivariate analyses revealed that a lower frequency of CD3(+) CD4(+) CD161(+) cells was significantly associated with the occurrence of neutropenic infections. An age of 35 years or younger and allografting from familial HLA-mismatched donors showed a trend toward higher infection rates. Our data indicated that a lower frequency of CD3(+) CD4(+) CD161(+) T cells in peripheral blood before conditioning therapy was associated with a higher incidence of infection during the neutropenic period. These results suggest that recipient innate T cells with expression of C-type lectin CD161 can guard against infections before engraftment. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. May TLR4 Asp299Gly and IL17 His161Arg polymorphism be associated with progression of primary measles infection to subacute sclerosing panencephalitis? (United States)

    Karakas-Celik, Sevim; Piskin, Ibrahim Etem; Keni, Mehmet Fatih; Calık, Mustafa; Iscan, Akın; Dursun, Ahmet


    SSPE is a progressive neurological disorder of children. Only some of the children who are infected with measles virus develop SSPE, which supports individual variation. TLR-2 and TLR-4 play an important role in innate immunity by recognizing envelope proteins of MV. Another important cytokine that plays an important role in orchestrating innate immune function is IL-17. The purpose of our study is to elucidate whether the TLR2, TLR4, IL17F and IL17A gene polymorphisms are susceptibility genes for the development of SSPE. Using the PCR-RFLP methods, the single nucleotide polymorphisms of TLR2 (Arg753Gln, Arg677Trp, -194 to -174 del), TLR4 (Asp299Gly and Thr399Ile) IL17F (His161Arg, Glu126Gly) and IL17A were studied in 54 patients with SSPE and 81 healthy controls. For Asp299Gly polymorphism of the TLR4 gene we found that there were no control individuals who were homozygous carriers of the Gly/Gly genotype, and the risk for SSPE increased at approximately 4.7 fold for the heterozygous carriers of the Asp/Gly genotype (OR 4.727, 95%-CI 1.192-18.742; P=0.01), when compared to healthy controls. Also our findings demonstrate that homozygosity for the Arg161 variant of the IL17F His161Arg polymorphism is inversely associated with development of SSPE (OR 0.114 95%-CI 0.026-0.494; P<0.001). In conclusion, it is suggested that variation in susceptibility to SSPE disease may be in part due to variations in TLR4 and IL17 function resulting from polymorphisms of TLR4 Asp299Gly and IL17F His161Arg. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Solution NMR Structure and Backbone Dynamics of the Partially Disordered Arabidopsis thaliana Phloem Protein 16-1, A Putative mRNA Transporter. (United States)

    Sashi, Pulikallu; Singarapu, Kiran Kumar; Bhuyan, Abani K


    Although RNA-binding proteins in plant phloem are believed to carry out long-distance systemic transport of RNA in the phloem conduit, the structure of none of them is known. The Arabidopsis thaliana phloem protein 16-1 (AtPP16-1) is such a putative mRNA transporter whose structure and backbone dynamics have been studied at pH 4.1, 25oC, by high-resolution NMR spectroscopy. Results obtained using basic optical spectroscopic tools show that the protein is unstable with little secondary structure near the physiological pH of the phloem sap. Fluorescence-monitored titrations reveal that AtPP16-1 binds not only A. thaliana RNA (Kdiss ~ 67 nM) but also sheared DNA and model dodecamer DNA, albeit the affinity for DNA is ~15-fold less. In the solution structure of the protein secondary structural elements are formed of residues 3-9 (β1), 56-62 (β2), 133-135 (β3), and 96-110 (αα-helix). Most of the rest of the chain segments is disordered. The N-terminal disordered regions (residues 10-55) form a small lobe, which conjoins the rest of the molecule via a deep and large irregular cleft that could have functional implications. The average order parameter extracted by model-free analysis of 15N relaxation and {1H}-15N heteronuclear NOE data is 0.66, suggesting less restricted backbone motion. The average conformational entropy of the backbone NH vectors is -0.31 cal mol-1 K-1. These results also suggest structural disorder in AtPP16-1.

  2. The Effect of Problem Based Learning Strategic and Divergent Thinking Style on the Ability to Solve Environmental the Problems (An Experimental Study at SMP Negeri 161 Jakarta, 2015)


    Gultom, Saurmaida


    The aim of the research is to identify the influence of learning strategic and divergent thinking style on the ability to solve the problems in environmental topic biology subject matter. This research was conducted in SMP Negeri 161 Jakarta. Experimental method with factorial 2 x 2 was applied on this research. The sampling objects were 60-second grade students. The two ways Varian analysis (ANAVA) was used in hypothesis test and continued by t-Dunnet test. The research conclusion were: 1) G...

  3. Determination of specific radioactivity of samarium-153 product. 1. Quantitative determination of samarium by spectrophotometry

    Energy Technology Data Exchange (ETDEWEB)

    Izumo, Mishiroku [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Nemoto, Masahiro [Tokyo Nuclear Service Co., Ltd., Tokyo (Japan)


    On the specific radioactivity of Sm-153 for the radiotherapy of cancers, a simple method for determination of the amount of Sm was described. The method used Arsenazo III as a colorimetric reagent. The sample irradiated in the reactor was dissolved in 1M HCl solution. A small part of it was taken and mixed with Arsenazo III at pH 3.2, and the amount of Sm was determined by the spectrophotometric method at a wavelength of 652 nm. The molar absorptivity of Sm at 652 nm was 6.6x10{sup 3} m{sup -1}{center_dot}mm{sup -1}. The error of measurement in the partial different conditions was about 2% of the value determined. The effects of impurities, Fe, Zn and Cu mixing in the Sm during operation, were clarified. (author)

  4. Abnormal CD161+ immune cells and retinoic acid receptor-related orphan receptor γt-mediate enhanced IL-17F expression in the setting of genetic hypertension. (United States)

    Singh, Madhu V; Cicha, Michael Z; Kumar, Santosh; Meyerholz, David K; Irani, Kaikobad; Chapleau, Mark W; Abboud, François M


    Hypertension is considered an immunologic disorder. However, the role of the IL-17 family in genetic hypertension in the spontaneously hypertensive rat (SHR) has not been investigated. We tested the hypothesis that enhanced TH17 programming and IL-17 expression in abundant CD161+ immune cells in SHRs represent an abnormal proinflammatory adaptive immune response. Furthermore, we propose that this response is driven by the master regulator retinoic acid receptor-related orphan receptor γt (RORγt) and a nicotinic proinflammatory innate immune response. We measured expression of the CD161 surface marker on splenocytes in SHRs and normotensive control Wistar-Kyoto (WKY) rats from birth to adulthood. We compared expression of IL-17A and IL-17F in splenic cells under different conditions. We then determined the functional effect of these cytokines on vascular reactivity. Finally, we tested whether pharmacologic inhibition of RORγt can attenuate hypertension in SHRs. SHRs exhibited an abnormally large population of CD161+ cells at birth that increased with age, reaching more than 30% of the splenocyte population at 38 weeks. The SHR splenocytes constitutively expressed more RORγt than those of WKY rats and produced more IL-17F on induction. Exposure of WKY rat aortas to IL-17F impaired endothelium-dependent vascular relaxation, whereas IL-17A did not. Moreover, in vivo inhibition of RORγt by digoxin decreased systolic blood pressure in SHRs. SHRs have a markedly enhanced potential for RORγt-driven expression of proinflammatory and prohypertensive IL-17F in response to innate immune activation. Increased RORγt and IL-17F levels contribute to SHR hypertension and might be therapeutic targets. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  5. Space shuttle: Heat transfer rate measurements on Convair booster (B-15B-2) and North American Rockwell orbiter (161B) at nominal Mach number of 8 (United States)

    Warmbrod, J. D.; Martindale, W. R.; Matthews, R. K.


    Plotted and tabulated data from the thin-skin thermocouple phase of an experimental test program are presented. These data are representative of three events of simulated flight and are described as booster-orbiter ascent heating data, booster reentry heating data, and orbiter reentry heating data. The test was conducted in a 50-inch hypersonic tunnel b at a nominal Mach number of 8 and free-stream Reynolds number range of 700,000 to 3,700,000 per foot. The model employed was a 0.009 scale replica of the Convair B-15B-2 booster and North American Rockwell 161B orbiter.

  6. Search for the Standard Model Higgs Boson in $e^+ e^-$ Collisions at $\\sqrt{s}$ = 161-172 GeV

    CERN Document Server

    Ackerstaff, K; Allison, J; Altekamp, N; Anderson, K J; Anderson, S; Arcelli, S; Asai, S; Axen, D A; Azuelos, Georges; Ball, A H; Barberio, E; Barlow, R J; Bartoldus, R; Batley, J Richard; Baumann, S; Bechtluft, J; Beeston, C; Behnke, T; Bell, A N; Bell, K W; Bella, G; Bentvelsen, Stanislaus Cornelius Maria; Bethke, Siegfried; Biebel, O; Biguzzi, A; Bird, S D; Blobel, Volker; Bloodworth, Ian J; Bloomer, J E; Bobinski, M; Bock, P; Bonacorsi, D; Boutemeur, M; Bouwens, B T; Braibant, S; Brigliadori, L; Brown, R M; Burckhart, Helfried J; Burgard, C; Bürgin, R; Capiluppi, P; Carnegie, R K; Carter, A A; Carter, J R; Chang, C Y; Charlton, D G; Chrisman, D; Clarke, P E L; Cohen, I; Conboy, J E; Cooke, O C; Cuffiani, M; Dado, S; Dallapiccola, C; Dallavalle, G M; Davis, R; De Jong, S; del Pozo, L A; Desch, Klaus; Dienes, B; Dixit, M S; do Couto e Silva, E; Doucet, M; Duchovni, E; Duckeck, G; Duerdoth, I P; Eatough, D; Edwards, J E G; Estabrooks, P G; Evans, H G; Evans, M; Fabbri, Franco Luigi; Fanti, M; Faust, A A; Fiedler, F; Fierro, M; Fischer, H M; Fleck, I; Folman, R; Fong, D G; Foucher, M; Fürtjes, A; Futyan, D I; Gagnon, P; Gary, J W; Gascon, J; Gascon-Shotkin, S M; Geddes, N I; Geich-Gimbel, C; Geralis, T; Giacomelli, G; Giacomelli, P; Giacomelli, R; Gibson, V; Gibson, W R; Gingrich, D M; Glenzinski, D A; Goldberg, J; Goodrick, M J; Gorn, W; Grandi, C; Gross, E; Grunhaus, Jacob; Gruwé, M; Hajdu, C; Hanson, G G; Hansroul, M; Hapke, M; Hargrove, C K; Hart, P A; Hartmann, C; Hauschild, M; Hawkes, C M; Hawkings, R; Hemingway, Richard J; Herndon, M; Herten, G; Heuer, R D; Hildreth, M D; Hill, J C; Hillier, S J; Hobson, P R; Homer, R James; Honma, A K; Horváth, D; Hossain, K R; Howard, R; Hüntemeyer, P; Hutchcroft, D E; Igo-Kemenes, P; Imrie, D C; Ingram, M R; Ishii, K; Jawahery, A; Jeffreys, P W; Jeremie, H; Jimack, Martin Paul; Joly, A; Jones, C R; Jones, G; Jones, M; Jost, U; Jovanovic, P; Junk, T R; Karlen, D A; Kartvelishvili, V G; Kawagoe, K; Kawamoto, T; Kayal, P I; Keeler, Richard K; Kellogg, R G; Kennedy, B W; Kirk, J; Klier, A; Kluth, S; Kobayashi, T; Kobel, M; Koetke, D S; Kokott, T P; Kolrep, M; Komamiya, S; Kress, T; Krieger, P; Von Krogh, J; Kyberd, P; Lafferty, G D; Lahmann, R; Lai, W P; Lanske, D; Lauber, J; Lautenschlager, S R; Layter, J G; Lazic, D; Lee, A M; Lefebvre, E; Lellouch, Daniel; Letts, J; Levinson, L; Lloyd, S L; Loebinger, F K; Long, G D; Losty, Michael J; Ludwig, J; Macchiolo, A; MacPherson, A L; Mannelli, M; Marcellini, S; Markus, C; Martin, A J; Martin, J P; Martínez, G; Mashimo, T; Mättig, P; McDonald, W J; McKenna, J A; McKigney, E A; McMahon, T J; McPherson, R A; Meijers, F; Menke, S; Merritt, F S; Mes, H; Meyer, J; Michelini, Aldo; Mikenberg, G; Miller, D J; Mincer, A; Mir, R; Mohr, W; Montanari, A; Mori, T; Morii, M; Müller, U; Mihara, S; Nagai, K; Nakamura, I; Neal, H A; Nellen, B; Nisius, R; O'Neale, S W; Oakham, F G; Odorici, F; Ögren, H O; Oh, A; Oldershaw, N J; Oreglia, M J; Orito, S; Pálinkás, J; Pásztor, G; Pater, J R; Patrick, G N; Patt, J; Pearce, M J; Pérez-Ochoa, R; Petzold, S; Pfeifenschneider, P; Pilcher, J E; Pinfold, J L; Plane, D E; Poffenberger, P R; Poli, B; Posthaus, A; Rees, D L; Rigby, D; Robertson, S; Robins, S A; Rodning, N L; Roney, J M; Rooke, A M; Ros, E; Rossi, A M; Routenburg, P; Rozen, Y; Runge, K; Runólfsson, O; Ruppel, U; Rust, D R; Rylko, R; Sachs, K; Saeki, T; Sarkisyan-Grinbaum, E; Sbarra, C; Schaile, A D; Schaile, O; Scharf, F; Scharff-Hansen, P; Schenk, P; Schieck, J; Schleper, P; Schmitt, B; Schmitt, S; Schöning, A; Schröder, M; Schultz-Coulon, H C; Schumacher, M; Schwick, C; Scott, W G; Shears, T G; Shen, B C; Shepherd-Themistocleous, C H; Sherwood, P; Siroli, G P; Sittler, A; Skillman, A; Skuja, A; Smith, A M; Snow, G A; Sobie, Randall J; Söldner-Rembold, S; Springer, R W; Sproston, M; Stephens, K; Steuerer, J; Stockhausen, B; Stoll, K; Strom, D; Szymanski, P; Tafirout, R; Talbot, S D; Tanaka, S; Taras, P; Tarem, S; Teuscher, R; Thiergen, M; Thomson, M A; Von Törne, E; Towers, S; Trigger, I; Trócsányi, Z L; Tsur, E; Turcot, A S; Turner-Watson, M F; Utzat, P; Van Kooten, R; Verzocchi, M; Vikas, P; Vokurka, E H; Voss, H; Wäckerle, F; Wagner, A; Ward, C P; Ward, D R; Watkins, P M; Watson, A T; Watson, N K; Wells, P S; Wermes, N; White, J S; Wilkens, B; Wilson, G W; Wilson, J A; Wolf, G; Wyatt, T R; Yamashita, S; Yekutieli, G; Zacek, V; Zer-Zion, D


    This paper describes a search for the Standard Model Higgs boson using data from e^+e^- collisions collected at center-of-mass energies of 161, 170 and 172 GeV by the OPAL detector at LEP. The data collected at these energies correspond to integrated luminosities of 10.0, 1.0 and 9.4 pb^-1, respectively. The search is sensitive to the main final states from the process in which the Higgs boson is produced in association with a fermion anti-fermion pair, namely four jets, two jets with missing energy, and two jets produced together with a pair of electron, muon or tau leptons. One candidate event is observed, in agreement with the Standard Model background expectation. In combination with previous OPAL searches at center-of-mass energies close to the Z^0 resonance and the revised previous OPAL searches at 161 GeV, we derive a lower limit of 69.4 GeV for the mass of the Standard Model Higgs boson at the 95% confidence level.

  7. MicroRNA-15a and -16-1 act via MYB to elevate fetal hemoglobin expression in human trisomy 13. (United States)

    Sankaran, Vijay G; Menne, Tobias F; Šćepanović, Danilo; Vergilio, Jo-Anne; Ji, Peng; Kim, Jinkuk; Thiru, Prathapan; Orkin, Stuart H; Lander, Eric S; Lodish, Harvey F


    Many human aneuploidy syndromes have unique phenotypic consequences, but in most instances it is unclear whether these phenotypes are attributable to alterations in the dosage of specific genes. In human trisomy 13, there is delayed switching and persistence of fetal hemoglobin (HbF) and elevation of embryonic hemoglobin in newborns. Using partial trisomy cases, we mapped this trait to chromosomal band 13q14; by examining the genes in this region, two microRNAs, miR-15a and -16-1, appear as top candidates for the elevated HbF levels. Indeed, increased expression of these microRNAs in primary human erythroid progenitor cells results in elevated fetal and embryonic hemoglobin gene expression. Moreover, we show that a direct target of these microRNAs, MYB, plays an important role in silencing the fetal and embryonic hemoglobin genes. Thus we demonstrate how the developmental regulation of a clinically important human trait can be better understood through the genetic and functional study of aneuploidy syndromes and suggest that miR-15a, -16-1, and MYB may be important therapeutic targets to increase HbF levels in patients with sickle cell disease and β-thalassemia.

  8. Identification of a recombinant inulin fructotransferase (difructose dianhydride III forming) from Arthrobacter sp. 161MFSha2.1 with high specific activity and remarkable thermostability. (United States)

    Wang, Xiao; Yu, Shuhuai; Zhang, Tao; Jiang, Bo; Mu, Wanmeng


    Difructose dianhydride III (DFA III) is a functional carbohydrate produced from inulin by inulin fructotransferase (IFTase, EC In this work, an IFTase gene from Arthrobacter sp. 161MFSha2.1 was cloned and expressed in Escherachia coli. The recombinant enzyme was purified by metal affinity chromatography. It showed significant inulin hydrolysis activity, and the produced main product from inulin was determined as DFA III by nuclear magnetic resonance analysis. The molecular mass of the purified protein was calculated to be 43 and 125 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and gel filtration, respectively, suggesting the native enzyme might be a homotrimer. The recombinant enzyme showed maximal activity as 2391 units/mg at pH 6.5 and 55 °C. It displayed the highest thermostability among previously reported IFTases (DFA III forming) and was stable up to 80 °C for 4 h of incubation. The smallest substrate was determined as nystose. The conversion ratio of inulin to DFA III reached 81% when 100 g/L inulin was catalyzed by 80 nM recombinant enzyme for 20 min at pH 6.5 and 55 °C. All of these data indicated that the IFTase (DFA III forming) from Arthrobacter sp. 161MFSha2.1 had great potential for industrial DFA III production.

  9. Search for Acoplanar Lepton Pair Events in $e^{+}e^{-}$ Collisions at $\\sqrt{s}$ = 161, 172 and 183 GeV

    CERN Document Server

    Abbiendi, G.; Alexander, G.; Allison, John; Altekamp, N.; Anderson, K.J.; Anderson, S.; Arcelli, S.; Asai, S.; Ashby, S.F.; Axen, D.; Azuelos, G.; Ball, A.H.; Barberio, E.; Barlow, Roger J.; Bartoldus, R.; Batley, J.R.; Baumann, S.; Bechtluft, J.; Behnke, T.; Bell, Kenneth Watson; Bella, G.; Bellerive, A.; Bentvelsen, S.; Bethke, S.; Betts, S.; Biebel, O.; Biguzzi, A.; Bird, S.D.; Blobel, V.; Bloodworth, I.J.; Bobinski, M.; Bock, P.; Bohme, J.; Bonacorsi, D.; Boutemeur, M.; Braibant, S.; Bright-Thomas, P.; Brigliadori, L.; Brown, Robert M.; Burckhart, H.J.; Burgard, C.; Burgin, R.; Capiluppi, P.; Carnegie, R.K.; Carter, A.A.; Carter, J.R.; Chang, C.Y.; Charlton, David G.; Chrisman, D.; Ciocca, C.; Clarke, P.E.L.; Clay, E.; Cohen, I.; Conboy, J.E.; Cooke, O.C.; Couyoumtzelis, C.; Coxe, R.L.; Cuffiani, M.; Dado, S.; Dallavalle, G.Marco; Davis, R.; De Jong, S.; del Pozo, L.A.; De Roeck, A.; Desch, K.; Dienes, B.; Dixit, M.S.; Dubbert, J.; Duchovni, E.; Duckeck, G.; Duerdoth, I.P.; Eatough, D.; Estabrooks, P.G.; Etzion, E.; Evans, H.G.; Fabbri, F.; Fanti, M.; Faust, A.A.; Fiedler, F.; Fierro, M.; Fleck, I.; Folman, R.; Furtjes, A.; Futyan, D.I.; Gagnon, P.; Gary, J.W.; Gascon, J.; Gascon-Shotkin, S.M.; Gaycken, G.; Geich-Gimbel, C.; Giacomelli, G.; Giacomelli, P.; Gibson, V.; Gibson, W.R.; Gingrich, D.M.; Glenzinski, D.; Goldberg, J.; Gorn, W.; Grandi, C.; Gross, E.; Grunhaus, J.; Gruwe, M.; Hanson, G.G.; Hansroul, M.; Hapke, M.; Harder, K.; Hargrove, C.K.; Hartmann, C.; Hauschild, M.; Hawkes, C.M.; Hawkings, R.; Hemingway, R.J.; Herndon, M.; Herten, G.; Heuer, R.D.; Hildreth, M.D.; Hill, J.C.; Hillier, S.J.; Hobson, P.R.; Hocker, James Andrew; Homer, R.J.; Honma, A.K.; Horvath, D.; Hossain, K.R.; Howard, R.; Huntemeyer, P.; Igo-Kemenes, P.; Imrie, D.C.; Ishii, K.; Jacob, F.R.; Jawahery, A.; Jeremie, H.; Jimack, M.; Jones, C.R.; Jovanovic, P.; Junk, T.R.; Karlen, D.; Kartvelishvili, V.; Kawagoe, K.; Kawamoto, T.; Kayal, P.I.; Keeler, R.K.; Kellogg, R.G.; Kennedy, B.W.; Klier, A.; Kluth, S.; Kobayashi, T.; Kobel, M.; Koetke, D.S.; Kokott, T.P.; Kolrep, M.; Komamiya, S.; Kowalewski, Robert V.; Kress, T.; Krieger, P.; von Krogh, J.; Kuhl, T.; Kyberd, P.; Lafferty, G.D.; Lanske, D.; Lauber, J.; Lautenschlager, S.R.; Lawson, I.; Layter, J.G.; Lazic, D.; Lee, A.M.; Lellouch, D.; Letts, J.; Levinson, L.; Liebisch, R.; List, B.; Littlewood, C.; Lloyd, A.W.; Lloyd, S.L.; Loebinger, F.K.; Long, G.D.; Losty, M.J.; Ludwig, J.; Lui, D.; Macchiolo, A.; Macpherson, A.; Mader, W.; Mannelli, M.; Marcellini, S.; Markopoulos, C.; Martin, A.J.; Martin, J.P.; Martinez, G.; Mashimo, T.; Mattig, Peter; McDonald, W.John; McKenna, J.; Mckigney, E.A.; McMahon, T.J.; McPherson, R.A.; Meijers, F.; Menke, S.; Merritt, F.S.; Mes, H.; Meyer, J.; Michelini, A.; Mihara, S.; Mikenberg, G.; Miller, D.J.; Mir, R.; Mohr, W.; Montanari, A.; Mori, T.; Nagai, K.; Nakamura, I.; Neal, H.A.; Nellen, B.; Nisius, R.; O'Neale, S.W.; Oakham, F.G.; Odorici, F.; Ogren, H.O.; Oreglia, M.J.; Orito, S.; Palinkas, J.; Pasztor, G.; Pater, J.R.; Patrick, G.N.; Patt, J.; Perez-Ochoa, R.; Petzold, S.; Pfeifenschneider, P.; Pilcher, J.E.; Pinfold, J.; Plane, David E.; Poffenberger, P.; Polok, J.; Przybycien, M.; Rembser, C.; Rick, H.; Robertson, S.; Robins, S.A.; Rodning, N.; Roney, J.M.; Roscoe, K.; Rossi, A.M.; Rozen, Y.; Runge, K.; Runolfsson, O.; Rust, D.R.; Sachs, K.; Saeki, T.; Sahr, O.; Sang, W.M.; Sarkisian, E.K.G.; Sbarra, C.; Schaile, A.D.; Schaile, O.; Scharf, F.; Scharff-Hansen, P.; Schieck, J.; Schmitt, B.; Schmitt, S.; Schoning, A.; Schroder, Matthias; Schumacher, M.; Schwick, C.; Scott, W.G.; Seuster, R.; Shears, T.G.; Shen, B.C.; Shepherd-Themistocleous, C.H.; Sherwood, P.; Siroli, G.P.; Sittler, A.; Skuja, A.; Smith, A.M.; Snow, G.A.; Sobie, R.; Soldner-Rembold, S.; Sproston, M.; Stahl, A.; Stephens, K.; Steuerer, J.; Stoll, K.; Strom, David M.; Strohmer, R.; Surrow, B.; Talbot, S.D.; Tanaka, S.; Taras, P.; Tarem, S.; Teuscher, R.; Thiergen, M.; Thomson, M.A.; von Torne, E.; Torrence, E.; Towers, S.; Trigger, I.; Trocsanyi, Z.; Tsur, E.; Turcot, A.S.; Turner-Watson, M.F.; Van Kooten, Rick J.; Vannerem, P.; Verzocchi, M.; Voss, H.; Wackerle, F.; Wagner, A.; Ward, C.P.; Ward, D.R.; Watkins, P.M.; Watson, A.T.; Watson, N.K.; Wells, P.S.; Wermes, N.; White, J.S.; Wilson, G.W.; Wilson, J.A.; Wyatt, T.R.; Yamashita, S.; Yekutieli, G.; Zacek, V.; Zer-Zion, D.


    A selection of di-lepton events with significant missing transverse momentum has been performed using a total data sample of 77.0 pb-1 at e+e- centre-of-mass energies of 161 GeV, 172 GeV and 183 GeV. The observed numbers of events: four at 161 GeV, nine at 172 GeV, and 78 at 183 GeV, are consistent with the numbers expected from Standard Model processes, which arise predominantly from W+W- production with each W decaying leptonically. This topology is an experimental signature also for the pair production of new particles that decay to a charged lepton accompanied by one or more invisible particles. Further event selection criteria are described that optimise the sensitivity to particular new physics channels. No evidence for new phenomena is apparent and model independent limits on the production cross-section times branching ratio squared for various new physics processes are presented. Assuming a 100% branching ratio for the decay of a right-handed charged slepton to a charged lepton and the lightest neutr...

  10. Search for neutral and charged Higgs bosons in $e^+ e^-$ collisions at $\\sqrt{s}= 161 GeV$ and $172 GeV$

    CERN Document Server

    Abreu, P; Adye, T; Adzic, P; Ajinenko, I; Alekseev, G D; Alemany, R; Allport, P P; Almehed, S; Amaldi, Ugo; Amato, S; Andersson, P; Andreazza, A; Antilogus, P; Apel, W D; Arnoud, Y; Åsman, B; Augustin, J E; Augustinus, A; Baillon, Paul; Bambade, P; Barbi, M S; Bardin, Dimitri Yuri; Barker, G; Baroncelli, A; Bärring, O; Bates, M J; Battaglia, Marco; Baubillier, M; Baudot, J; Becks, K H; Begalli, M; Beillière, P; Belokopytov, Yu A; Benvenuti, Alberto C; Bérat, C; Berggren, M; Bertini, D; Bertrand, D; Besançon, M; Bianchi, F; Bigi, M; Bilenky, S M; Billoir, P; Bizouard, M A; Bloch, D; Blume, M; Bonesini, M; Bonivento, W; Boonekamp, M; Booth, P S L; Borgland, A W; Borisov, G; Bosio, C; Botner, O; Boudinov, E; Bouquet, B; Bourdarios, C; Bowcock, T J V; Bozzo, M; Branchini, P; Brand, K D; Brenke, T; Brenner, R A; Brown, R C A; Brückman, P; Brunet, J M; Bugge, L; Buran, T; Burgsmüller, T; Buschmann, P; Cabrera, S; Caccia, M; Calvi, M; Camacho-Rozas, A J; Camporesi, T; Canale, V; Canepa, M; Carena, F; Carroll, L; Caso, Carlo; Castillo-Gimenez, M V; Cattai, A; Cavallo, F R; Chabaud, V; Charpentier, P; Chaussard, L; Checchia, P; Chelkov, G A; Chen, M; Chierici, R; Chliapnikov, P V; Chochula, P; Chorowicz, V; Chudoba, J; Cindro, V; Collins, P; Colomer, M; Contri, R; Cortina, E; Cosme, G; Cossutti, F; Cowell, J H; Crawley, H B; Crennell, D J; Crosetti, G; Cuevas-Maestro, J; Czellar, S; Dahm, J; D'Almagne, B; Damgaard, G; Dauncey, P D; Davenport, Martyn; Da Silva, W; Deghorain, A; Della Ricca, G; Delpierre, P A; Demaria, N; De Angelis, A; de Boer, Wim; De Brabandere, S; De Clercq, C; La Vaissière, C de; De Lotto, B; De Min, A; De Paula, L S; Dijkstra, H; Di Ciaccio, Lucia; Di Diodato, A; Djannati, A; Dolbeau, J; Doroba, K; Dracos, M; Drees, J; Drees, K A; Dris, M; Durand, J D; Edsall, D M; Ehret, R; Eigen, G; Ekelöf, T J C; Ekspong, Gösta; Elsing, M; Engel, J P; Erzen, B; Espirito-Santo, M C; Falk, E; Fanourakis, G K; Fassouliotis, D; Feindt, Michael; Fenyuk, A; Ferrari, P; Ferrer, A; Fichet, S; Filippas-Tassos, A; Firestone, A; Fischer, P A; Föth, H; Fokitis, E; Fontanelli, F; Formenti, F; Franek, B J; Frodesen, A G; Frühwirth, R; Fulda-Quenzer, F; Fuster, J A; Galloni, A; Gamba, D; Gandelman, M; García, C; García, J; Gaspar, C; Gasparini, U; Gavillet, P; Gazis, E N; Gelé, D; Gerber, J P; Gerdyukov, L N; Gokieli, R; Golob, B; Gonçalves, P; Gopal, Gian P; Gorn, L; Górski, M; Guz, Yu; Gracco, Valerio; Graziani, E; Green, C; Grefrath, A; Gris, P; Grosdidier, G; Grzelak, K; Günther, M; Guy, J; Hahn, F; Hahn, S; Hajduk, Z; Hallgren, A; Hamacher, K; Harris, F J; Hedberg, V; Henriques, R P; Hernández, J J; Herquet, P; Herr, H; Hessing, T L; Heuser, J M; Higón, E; Holmgren, S O; Holt, P J; Holthuizen, D J; Hoorelbeke, S; Houlden, M A; Hrubec, Josef; Huet, K; Hultqvist, K; Jackson, J N; Jacobsson, R; Jalocha, P; Janik, R; Jarlskog, C; Jarlskog, G; Jarry, P; Jean-Marie, B; Johansson, E K; Jönsson, L B; Jönsson, P E; Joram, Christian; Juillot, P; Kaiser, M; Kapusta, F; Karafasoulis, K; Karvelas, E; Katsanevas, S; Katsoufis, E C; Keränen, R; Khokhlov, Yu A; Khomenko, B A; Khovanskii, N N; King, B J; Kjaer, N J; Klapp, O; Klein, H; Kluit, P M; Knoblauch, D; Kokkinias, P; Koratzinos, M; Korcyl, K; Kostyukhin, V; Kourkoumelis, C; Kuznetsov, O; Krammer, Manfred; Kreuter, C; Kronkvist, I J; Krumshtein, Z; Krupinski, W; Kubinec, P; Kucewicz, W; Kurvinen, K L; Lacasta, C; Laktineh, I; Lamsa, J; Lanceri, L; Lane, D W; Langefeld, P; Laugier, J P; Lauhakangas, R; Leder, Gerhard; Ledroit, F; Lefébure, V; Legan, C K; Leisos, A; Leitner, R; Lemonne, J; Lenzen, Georg; Lepeltier, V; Lesiak, T; Lethuillier, M; Libby, J; Liko, D; Lipniacka, A; Lippi, I; Lörstad, B; Loken, J G; López, J M; Loukas, D; Lutz, P; Lyons, L; Naughton, J M; Maehlum, G; Mahon, J R; Maio, A; Malmgren, T G M; Malychev, V; Mandl, F; Marco, J; Marco, R P; Maréchal, B; Margoni, M; Marin, J C; Mariotti, C; Markou, A; Martínez-Rivero, C; Martínez-Vidal, F; Martí i García, S; Masik, J; Matorras, F; Matteuzzi, C; Matthiae, Giorgio; Mazzucato, M; McCubbin, M L; McKay, R; McNulty, R; McPherson, G; Medbo, J; Meroni, C; Meyer, S; Meyer, W T; Michelotto, M; Migliore, E; Mirabito, L; Mitaroff, Winfried A; Mjörnmark, U; Moa, T; Møller, R; Mönig, K; Monge, M R; Morettini, P; Müller, H; Münich, K; Mulders, M; Mundim, L M; Murray, W J; Muryn, B; Myatt, Gerald; Myklebust, T; Naraghi, F; Navarria, Francesco Luigi; Navas, S; Nawrocki, K; Negri, P; Némécek, S; Neumann, W; Neumeister, N; Nicolaidou, R; Nielsen, B S; Nieuwenhuizen, M; Nikolaenko, V; Nikolenko, M; Niss, P; Nomerotski, A; Normand, Ainsley; Nygren, A; Oberschulte-Beckmann, W; Obraztsov, V F; Olshevskii, A G; Onofre, A; Orava, Risto; Orazi, G; Ortuno, S; Österberg, K; Ouraou, A; Paganini, P; Paganoni, M; Paiano, S; Pain, R; Palka, H; Papadopoulou, T D; Papageorgiou, K; Pape, L; Parkes, C; Parodi, F; Parzefall, U; Passeri, A; Pegoraro, M; Peralta, L; Pernegger, H; Pernicka, Manfred; Perrotta, A; Petridou, C; Petrolini, A; Phillips, H T; Piana, G; Pierre, F; Pimenta, M; Piotto, E; Podobnik, T; Podobrin, O; Pol, M E; Polok, G; Poropat, P; Pozdnyakov, V; Privitera, P; Pukhaeva, N; Pullia, Antonio; Radojicic, D; Ragazzi, S; Rahmani, H; Ratoff, P N; Read, A L; Reale, M; Rebecchi, P; Redaelli, N G; Regler, Meinhard; Reid, D; Reinhardt, R; Renton, P B; Resvanis, L K; Richard, F; Rídky, J; Rinaudo, G; Røhne, O M; Romero, A; Ronchese, P; Roos, L; Rosenberg, E I; Rosinsky, P; Roudeau, Patrick; Rovelli, T; Ruhlmann-Kleider, V; Ruiz, A; Rybicki, K; Saarikko, H; Sacquin, Yu; Sadovskii, A; Sajot, G; Salt, J; Sannino, M; Schneider, H; Schwickerath, U; Schyns, M A E; Sciolla, G; Scuri, F; Seager, P; Sedykh, Yu; Segar, A M; Seitz, A; Sekulin, R L; Serbelloni, L; Shellard, R C; Sheridan, A; Siegrist, P; Silvestre, R; Simonetto, F; Sissakian, A N; Skaali, T B; Smadja, G; Smirnova, O G; Smith, G R; Sokolov, A; Solovyanov, O; Sosnowski, R; Souza-Santos, D; Spassoff, Tz; Spiriti, E; Sponholz, P; Squarcia, S; Stampfer, D; Stanescu, C; Stanic, S; Stapnes, Steinar; Stavitski, I; Stevenson, K; Stocchi, A; Strauss, J; Strub, R; Stugu, B; Szczekowski, M; Szeptycka, M; Tabarelli de Fatis, T; Tavernet, J P; Chernyaev, E; Chikilev, O G; Tegenfeldt, F; Terranova, F; Thomas, J; Tilquin, A; Timmermans, J; Tkatchev, L G; Todorov, T; Todorova, S; Toet, D Z; Tomaradze, A G; Tomé, B; Tonazzo, A; Tortora, L; Tranströmer, G; Treille, D; Tristram, G; Trombini, A; Troncon, C; Tsirou, A L; Turluer, M L; Tyapkin, I A; Tyndel, M; Tzamarias, S; Überschär, B; Ullaland, O; Uvarov, V; Valenti, G; Vallazza, E; Van der Velde, C; van Apeldoorn, G W; van Dam, P; Van Doninck, W K; Van Eldik, J; Van Lysebetten, A; Vassilopoulos, N; Vegni, G; Ventura, L; Venus, W A; Verbeure, F; Verlato, M; Vertogradov, L S; Vilanova, D; Vincent, P; Vitale, L; Vlasov, E; Vodopyanov, A S; Vrba, V; Wahlen, H; Walck, C; Waldner, F; Weiser, C; Wetherell, Alan M; Wicke, D; Wickens, J H; Wielers, M; Wilkinson, G R; Williams, W S C; Winter, M; Witek, M; Wlodek, T; Yi, J; Yip, K; Yushchenko, O P; Zach, F; Zaitsev, A; Zalewska-Bak, A; Zalewski, Piotr; Zavrtanik, D; Zevgolatakos, E; Zimin, N I; Zucchelli, G C; Zumerle, G


    A search for neutral and charged Higgs bosons has been performed in the data collected by the {\\sc DELPHI} detector at centre-of-mass energies of 161~GeV and 172~GeV. The analysis assumes either the pair-production of charged Higgs bosons, ${\\mathrm H}^{\\pm}$, or the production of the lightest neutral Higgs boson, h, with either a Z or a neutral pseudoscalar Higgs boson, A. All final state topologies expected from the decay of h and A %neutral Higgs particles into hadrons or a pair of $\\tau$ leptons, and from the decay of ${\\mathrm H}^{\\pm}$ %charged Higgs bosons into a pair of quarks or a $\\tau \

  11. Searches for supersymmetry in the photon(s) plus missing energy channels at $\\sqrt{s}$ = 161 GeV and 172 GeV

    CERN Document Server

    Barate, R.; Decamp, D.; Ghez, Philippe; Goy, C.; Lees, J.P.; Lucotte, A.; Minard, M.N.; Nief, J.Y.; Pietrzyk, B.; Casado, M.P.; Chmeissani, M.; Comas, P.; Crespo, J.M.; Delfino, M.; Fernandez, E.; Fernandez-Bosman, M.; Garrido, L.; Juste, A.; Martinez, M.; Merino, G.; Miquel, R.; Mir, L.M.; Padilla, C.; Park, I.C.; Pascual, A.; Perlas, J.A.; Riu, I.; Sanchez, F.; Colaleo, A.; Creanza, D.; de Palma, M.; Gelao, G.; Iaselli, G.; Maggi, G.; Maggi, M.; Marinelli, N.; Nuzzo, S.; Ranieri, A.; Raso, G.; Ruggieri, F.; Selvaggi, G.; Silvestris, L.; Tempesta, P.; Tricomi, A.; Zito, G.; Huang, X.; Lin, J.; Ouyang, Q.; Wang, T.; Xie, Y.; Xu, R.; Xue, S.; Zhang, J.; Zhang, L.; Zhao, W.; Abbaneo, D.; Alemany, R.; Bazarko, A.O.; Becker, U.; Bright-Thomas, P.; Cattaneo, M.; Cerutti, F.; Dissertori, G.; Drevermann, H.; Forty, R.W.; Frank, M.; Hagelberg, R.; Hansen, J.B.; Harvey, John; Janot, P.; Jost, B.; Kneringer, E.; Lehraus, I.; Mato, P.; Minten, A.; Moneta, L.; Pacheco, A.; Pusztaszeri, J.F.; Ranjard, F.; Rizzo, G.; Rolandi, Gigi; Rousseau, D.; Schlatter, D.; Schmitt, M.; Schneider, O.; Tejessy, W.; Teubert, F.; Tomalin, I.R.; Wachsmuth, H.; Wagner, A.; Ajaltouni, Z.; Barres, A.; Boyer, C.; Falvard, A.; Ferdi, C.; Gay, P.; Guicheney, C.; Henrard, P.; Jousset, J.; Michel, B.; Monteil, S.; Montret, J.C.; Pallin, D.; Perret, P.; Podlyski, F.; Proriol, J.; Rosnet, P.; Rossignol, J.M.; Fearnley, T.; Hansen, J.D.; Hansen, J.R.; Hansen, P.H.; Nilsson, B.S.; Rensch, B.; Waananen, A.; Daskalakis, G.; Kyriakis, A.; Markou, C.; Simopoulou, E.; Vayaki, A.; Blondel, A.; Brient, J.C.; Machefert, F.; Rouge, A.; Rumpf, M.; Valassi, A.; Videau, H.; Boccali, T.; Focardi, E.; Parrini, G.; Zachariadou, K.; Cavanaugh, R.; Corden, M.; Georgiopoulos, C.; Huehn, T.; Jaffe, D.E.; Antonelli, A.; Bencivenni, G.; Bologna, G.; Bossi, F.; Campana, P.; Capon, G.; Casper, D.; Chiarella, V.; Felici, G.; Laurelli, P.; Mannocchi, G.; Murtas, F.; Murtas, G.P.; Passalacqua, L.; Pepe-Altarelli, M.; Curtis, L.; Dorris, S.J.; Halley, A.W.; Knowles, I.G.; Lynch, J.G.; O'Shea, V.; Raine, C.; Scarr, J.M.; Smith, K.; Teixeira-Dias, P.; Thompson, A.S.; Thomson, Evelyn J.; Thomson, F.; Turnbull, R.M.; Buchmuller, O.; Dhamotharan, S.; Geweniger, C.; Graefe, G.; Hanke, P.; Hansper, G.; Hepp, V.; Kluge, E.E.; Putzer, A.; Sommer, J.; Tittel, K.; Werner, S.; Wunsch, M.; Beuselinck, R.; Binnie, D.M.; Cameron, W.; Dornan, P.J.; Girone, M.; Goodsir, S.; Martin, E.B.; Morawitz, P.; Moutoussi, A.; Nash, J.; Sedgbeer, J.K.; Spagnolo, P.; Stacey, A.M.; Williams, M.D.; Ghete, V.M.; Girtler, P.; Kuhn, D.; Rudolph, G.; Betteridge, A.P.; Bowdery, C.K.; Buck, P.G.; Colrain, P.; Crawford, G.; Finch, A.J.; Foster, F.; Hughes, G.; Jones, R.W.L.; Sloan, T.; Whelan, E.P.; Williams, M.I.; Giehl, I.; Hoffmann, C.; Jakobs, K.; Kleinknecht, K.; Quast, G.; Renk, B.; Rohne, E.; Sander, H.G.; van Gemmeren, P.; Zeitnitz, C.; Aubert, J.J.; Benchouk, C.; Bonissent, A.; Bujosa, G.; Carr, J.; Coyle, P.; Diaconu, C.; Ealet, A.; Fouchez, D.; Konstantinidis, N.; Leroy, O.; Motsch, F.; Payre, P.; Talby, M.; Sadouki, A.; Thulasidas, M.; Tilquin, A.; Trabelsi, K.; Aleppo, M.; Antonelli, M.; Ragusa, F.; Berlich, R.; Blum, W.; Buescher, Volker; Dietl, H.; Ganis, G.; Gotzhein, C.; Kroha, H.; Lutjens, G.; Lutz, G.; Manner, W.; Moser, H.G.; Richter, Robert, 1; Rosado-Schlosser, A.; Schael, S.; Settles, R.; Seywerd, H.; St. Denis, Richard Dante; Stenzel, H.; Wiedenmann, W.; Wolf, G.; Boucrot, J.; Callot, O.; Chen, S.; Cordier, A.; Davier, M.; Duflot, L.; Grivaz, J.F.; Heusse, Ph.; Hocker, Andreas; Jacholkowska, A.; Jacquet, M.; Kim, D.W.; Le Diberder, F.; Lefrancois, J.; Lutz, A.M.; Nikolic, Irina; Schune, M.H.; Serin, L.; Simion, S.; Tournefier, E.; Veillet, J.J.; Videau, I.; Zerwas, D.; Azzurri, P.; Bagliesi, Giuseppe; Bettarini, S.; Bozzi, C.; Calderini, G.; Ciulli, V.; Dell'Orso, R.; Fantechi, R.; Ferrante, I.; Giassi, A.; Gregorio, A.; Ligabue, F.; Lusiani, A.; Marrocchesi, P.S.; Messineo, A.; Palla, F.; Sanguinetti, G.; Sciaba, A.; Sguazzoni, G.; Steinberger, J.; Tenchini, R.; Vannini, C.; Venturi, A.; Verdini, P.G.; Blair, G.A.; Bryant, L.M.; Chambers, J.T.; Gao, Y.; Green, M.G.; Medcalf, T.; Perrodo, P.; Strong, J.A.; von Wimmersperg-Toeller, J.H.; Botterill, D.R.; Clifft, R.W.; Edgecock, T.R.; Haywood, S.; Maley, P.; Norton, P.R.; Thompson, J.C.; Wright, A.E.; Bloch-Devaux, Brigitte; Colas, P.; Fabbro, B.; Kozanecki, W.; Lancon, E.; Lemaire, M.C.; Locci, E.; Perez, P.; Rander, J.; Renardy, J.F.; Rosowsky, A.; Roussarie, A.; Schuller, J.P.; Schwindling, J.; Trabelsi, A.; Vallage, B.; Black, S.N.; Dann, J.H.; Kim, H.Y.; Litke, A.M.; McNeil, M.A.; Taylor, G.; Booth, C.N.; Boswell, R.; Brew, C.A.J.; Cartwright, S.; Combley, F.; Kelly, M.S.; Lehto, M.; Newton, W.M.; Reeve, J.; Thompson, L.F.; Affholderbach, K.; Boehrer, Armin; Brandt, S.; Cowan, G.; Foss, J.; Grupen, C.; Lutters, G.; Saraiva, P.; Smolik, L.; Stephan, F.; Apollonio, M.; Bosisio, L.; Della Marina, R.; Giannini, G.; Gobbo, B.; Musolino, G.; Putz, J.; Rothberg, J.; Wasserbaech, S.; Williams, R.W.; Armstrong, S.R.; Charles, E.; Elmer, P.; Ferguson, D.P.S.; Gonzalez, S.; Greening, T.C.; Hayes, O.J.; Hu, H.; Jin, S.; McNamara, P.A., III; Nachtman, J.M.; Nielsen, J.; Orejudos, W.; Pan, Y.B.; Saadi, Y.; Scott, I.J.; Walsh, J.; Wu, Sau Lan; Wu, X.; Yamartino, J.M.; Zobernig, G.


    Searches for supersymmetric particles in channels with one or more photons and missing energy have been performed with data collected by the ALEPH detector at LEP. The data consist of 11.1 \\pb\\ at $\\sqrt{s} = 161 ~\\, \\rm GeV$, 1.1 \\pb\\ at 170 \\gev\\ and 9.5 \\pb\\ at 172 GeV. The \\eenunu\\ cross se ction is measured. The data are in good agreement with predictions based on the Standard Model, and are used to set upper limits on the cross sections for anomalous photon production. These limits are compared to two different SUSY models and used to set limits on the neutralino mass. A limit of 71 \\gevsq\\ at 95\\% C.L. is set on the mass of the lightest neutralin o ($\\tau_{\\chi_{1}^{0}} \\leq $ 3 ns) for the gauge-mediated supersymmetry breaking and LNZ models.

  12. Ricerca di chargini a 130 GeV < $\\sqrt{s}$ < 161 GeV, con l'esperimento L3 al LEP

    CERN Document Server

    Giagu, S


    The subject of this work is the search for charginos with the L3 detector at LEP, using the data collected by L3 during the years 1995-1996 at center of mass energies $130 GeV < \\sqrt{s} < 161 GeV$. In the thesis are described the design and realization of a new Monte Carlo generator (DFGT) for chargiNO1production and decay at $e^+e^-$ colliders, which is based on the evaluation of the full matrix elements of the process, and the realization and the results of two analysis, one cuts based conventional analysis, and a new and more advanced one based on the EPDE multivariate method. The results of this search are also compared with the predictions of the CMSSM model to obtain esclusion limits on the model parameters space and mass limits on charginos.

  13. Radiolesão vascular como efeito deletério da braquiterapia intra-arterial com dose elevada de Samário-153 em coelhos hipercolesterolêmicos Vascular radiolesion as a deleterious effect of high-dose-rate intraarterial brachytherapy with Samarium-153 in hypercholesterolemic rabbits

    Directory of Open Access Journals (Sweden)

    Dalton Bertolim Précoma


    Full Text Available OBJETIVO: Este estudo tem por objetivo avaliar as alterações vasculares morfológicas e morfométricas induzidas pela braquiterapia com Samário-153 (153 Sm em coelhos hipercolesterolêmicos, com doses elevadas. MÉTODOS: Foram analisados 43 coelhos hipercolesterolêmicos, brancos, da raça New Zealand, e o total de 86 artérias ilíacas submetidas a lesão por balão de angioplastia. Divididos em três grupos: dois (GI irradiados com as doses de 15Gy (n=14 e 60Gy (n=36 e um grupo controle (n=36. Foram realizadas avaliação histológica morfométrica e análise histológica qualitativa para análise tecidual. RESULTADOS: Foram observadas uma redução significativa da neoproliferação intimal (NPI no GI 15 Gy (pOBJECTIVE: This study was designed to evaluate vascular morphological and morphometric changes induced by brachytherapy with samarium-153 (Sm-153 at high doses in hypercholesterolemic rabbits. METHODS: Forty-three New Zealand White hypercholesterolemic rabbits were analyzed, and the total of 86 iliac arteries underwent balloon angioplasty injury. The rabbits were divided into three different groups: two irradiation groups (IG assigned to 15 Gy (n=14 and 60 Gy (n=36 irradiation doses, respectively, and a control group (n = 36. Histomorphometric and qualitative histological analyses were performed for tissue evaluation. RESULTS: Significant reductions were found in neointimal proliferation (NIP (p< 0.0001, media area (MA (p<0.0001 and percent stenosis (p<0.0001 in the 15-Gy IG, compared to the other groups. The 60-Gy IG had the higher rate of NIP, increase in media and vessel areas (VA and percent stenosis. The 60-Gy IG also showed the greatest number of xanthomatous cells (60-Gy IG: 86.11% and 15-Gy IG: 14.29%, p<0.0001 and the highest amount of hyaline amorphous tissue (60-Gy IG:58.33% and 15-Gy IG:0%, p=0.0001 and vascular proliferation (60-Gy IG:30.56% and 15-Gy IG:0%, p=0.0221. No statistically significant differences were found

  14. Measurement of the Mass and Width of the W Boson in $e^{+}e^{-}$ Collisions at $\\sqrt{s}$ = 161 - 209 GeV

    CERN Document Server

    Abdallah, J.; Adam, W.; Adzic, P.; Albrecht, T.; Alemany-Fernandez, R.; Allmendinger, T.; Allport, P.P.; Amaldi, U.; Amapane, N.; Amato, Sandra F.; Anashkin, E.; Andreazza, A.; Andringa, Sofia; Anjos, N.; Antilogus, Pierre; Apel, W-D.; Arnoud, Y.; Ask, S.; Asman, B.; Augustin, Jean-Eudes; Augustinus, A.; Baillon, P.; Ballestrero, A.; Bambade, P.; Barbier, R.; Bardin, D.; Barker, G.J.; Baroncelli, Antonio; Battaglia, Marco; Baubillier, M.; Becks, K-H.; Begalli, M.; Behrmann, A.; Ben-Haim, Eli; Benekos, N.; Benvenuti, A.; Berat, C.; Berggren, Mikael; Bertrand, D.; Besancon, Marc; Besson, N.; Bloch, Daniel; Blom, M.; Bluj, Michal; Bonesini, Maurizio; Boonekamp, M.; Booth, PSL; Borisov, G.; Botner, Olga; Bouquet, B.; Bowcock, T.J.V.; Boyko, I.; Bracko, Marko; Brenner, R.; Brodet, E.; Bruckman, P.; Brunet, J.M.; Buschbeck, B.; Buschmann, P.; Calvi, M.; Camporesi, Tiziano; Canale, V.; Carena, F.; Castro, Nuno Filipe; Cavallo, F.; Chapkin, M.; Charpentier, Ph.; Checchia, Paolo; Chierici, R.; Chliapnikov, P.; Chudoba, J.; Chung, Suh-Urk; Cieslik, K.; Collins, P.; Contri, Roberto; Cosme, G.; Cossutti, Fabio; Costa, M.J.; Crennell, D.; Cuevas, Javier; D'Hondt, J.; da Silva, T.; Da Silva, W.; Della Ricca, Giuseppe; De Angelis, Alessandro; De Boer, W.; De Clercq, C.; De Lotto, Barbara; De Maria, N.; De Min, A.; de Paula, L.; Di Ciaccio, L.; Di Simone, A.; Doroba, K.; Duperrin, A.; Eigen, G.; Ekelof, Tord; Ellert, Mattias; Elsing, M.; Espirito Santo, Maria Catarina; Fanourakis, George K.; Feindt, Michael; Fernandez, J.; Ferrer, Antonio; Ferro, F.; Flagmeyer, U.; Foeth, H.; Fokitis, E.; Fulda-Quenzer, F.; Fuster, J.; Gandelman, Miriam; Garcia, C.; Gavillet, Philippe; Gazis, Evangelos; Gomez-Ceballos, G.; Goncalves, P.; Graziani, E.; Grosdidier, G.; Grzelak, K.; Guy, J.; Haag, C.; Hallgren, A.; Hamacher, Klaus; Hamilton, K.; Haug, S.; Hauler, F.; Hedberg, Vincent; Hennecke, M.; Herr, H.; Hoffman, J.; Holmgren, S-O.; Holt, P.J.; Houlden, M.A.; Jackson, John Neil; Jarlskog, Goran; Jarry, P.; Jeans, D.; Johansson, Erik Karl; Jonsson, P.; Joram, C.; Jungermann, L.; Kapusta, Frederic; Katsanevas, S.; Katsoufis, E.; Kernel, Gabrijel; Kerzel, U.; King, B.T.; Kjaer, N.J.; Kluit, Peter; Kokkinias, P.; Kourkoumelis, C.; Kouznetsov, O.; Krumstein, Z.; Kucharczyk, M.; Lamsa, J.; Leder, G.; Ledroit, F.; Leinonen, L.; Leitner, R.; Lemonne, Jacques; Lepeltier, V.; Lesiak, T.; Liebig, W.; Liko, D.; Lipniacka, A.; Lopes, J.H.; Lopez, J.M.; Loukas, D.; Lutz, Pierre; Lyons, Louis; MacNaughton, J.; Malek, A.; Maltezos, S.; Mandl, F.; Marco, J.; Marco, R.; Marechal, B.; Margoni, M.; Marin, J-C.; Mariotti, C.; Markou, A.; Martinez-Rivero, C.; Masik, J.; Mastroyiannopoulos, N.; Matorras, F.; Matteuzzi, C.; Mazzucato, F.; Mazzucato, M.; Nulty, R.Mc; Meroni, C.; Migliore, E.; Mitaroff, W.; Mjoernmark, U.; Moa, T.; Moch, M.; Monge, R.; Montenegro, J.; Moraes, D.; Moreno, S.; Morettini, P.; Muller, Ulrich; Muenich, K.; Mulders, M.; Mundim Filho, Luiz Martins; Murray, W.; Muryn, B.; Myatt, G.; Myklebust, T.; Nassiakou, M.; Navarria, F.; Nawrocki, K.; Nicolaidou, R.; Oblakowska-Mucha, A.; Obraztsov, V.; Olshevski, A.; Onofre, A.; Orava, R.; Osterberg, K.; Ouraou, A.; Oyanguren, A.; Paganoni, M.; Paiano, S.; Palacios, J.P.; Palka, Henryk; Papadopoulou, Th.D.; Pape, L.; Parkes, C.; Parodi, F.; Parzefall, U.; Passeri, A.; Passon, O.; Peralta, L.; Perepelitsa, V.; Perrotta, Andrea; Petrolini, Alessandro; Piedra, Jonatan; Pieri, L.; Pierre, Francois; Pimenta, M.; Piotto, E.; Poireau, V.; Pol, M.E.; Polok, G.; Pozdniakov, V.; Pukhaeva, N.; Pullia, A.; Radojicic, D.; Rames, J.; Read, A.; Rebecchi, P.; Rehn, J.; Reid, D.; Reinhardt, R.; Renton, Peter; Richard, F.; Ridky, Jan; Rivero, M.; Rodriguez, D.; Romero, A.; Ronchese, Paolo; Roudeau, P.; Rovelli, T.; Ruhlmann, Vanina; Ryabtchikov, D.; Sadovsky, A.; Salmi, L.; Salt, J.; Sander, C.; Savoy-Navarro, A.; Schwickerath, U.; Segar, A.; Sekulin, R.; Siebel, Martin; Simard, L.; Sisakian, A.; Smadja, G.; Smirnova, O.; Sokolov, Andrei Valerevich; Sopczak, A.; Sosnowski, R.; Spassov, T.; Stanitzki, M.; Stocchi, A.; Strauss, J.; Stugu, B.; Szczekowski, M.; Szeptycka, M.; Szumlak, T.; Tabarelli de Fatis, T.; Taffard, A.C.; Tegenfeldt, F.; Thomas, J.; Timmermans, Jan; Tkatchev, L.; Tobin, M.; Todorovova, S.; Tome, B.; Tonazzo, A.; Tortosa, P.; Travnicek, Petr; Treille, D.; Tristram, G.; Trochimczuk, M.; Troncon, Clara; Turluer, M-L.; Tyapkin, I.A.; Tyapkin, P.; Tzamarias, S.; Uvarov, V.; Valenti, Giovanni; Van Dam, P.; Van Eldik, J.; van Remortel, N.; Van Vulpen, I.; Vegni, G.; Veloso, Filipe; Venus, W.; Verdier, Patrice; Verzi, V.; Vilanova, D.; Vitale, Lorenzo; Vrba, V.; Wahlen, H.; Washbrook, A.J.; Weiser, C.; Wicke, D.; Wickens, J.; Wilkinson, G.; Winter, M.; Witek, M.; Yushchenko, O.; Zalewska, A.; Zalewski, P.; Zavrtanik, Danilo; Zhuravlov, V.; Zimine, N.I.; Zintchenko, Alexandre


    A measurement of the W boson mass and width has been performed by the DELPHI collaboration using the data collected during the full LEP2 programme (1996-2000). The data sample has an integrated luminosity of 660 pb^-1 and was collected over a range of centre-of-mass energies from 161 to 209 GeV. Results are obtained by applying the method of direct reconstruction of the mass of the W from its decay products in both the W+W- -> lvqq and W+W- -> qqqq channels. The W mass result for the combined data set is M_W = 80.336 +/- 0.055 (Stat.) +/- 0.028 (Syst.) +/- 0.025 (FSI) +/- 0.009 (LEP) GeV/c^2, where FSI represents the uncertainty due to final state interaction effects in the qqqq channel, and LEP represents that arising from the knowledge of the collision energy of the accelerator. The combined value for the W width is Gamma_W = 2.404 +/- 0.140 (Stat.) +/- 0.077 (Syst.) +/- 0.065 (FSI) GeV/c^2. These results supersede all values previously published by the DELPHI collaboration. This paper is dedicated to the m...

  15. Prognostic value of CT findings to predict survival outcomes in patients with pancreatic neuroendocrine neoplasms: a single institutional study of 161 patients

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong Wook; Kim, Hyoung Jung; Kim, Kyung Won; Byun, Jae Ho; Kim, So Yeon [University of Ulsan College of Medicine, Department of Radiology and Research Institute of Radiology, Asan Medical Center, Seoul (Korea, Republic of); Song, Ki Byung [University of Ulsan College of Medicine, Department of Surgery, Asan Medical Center, Seoul (Korea, Republic of); Ramaiya, Nikhil H.; Tirumani, Sree Harsha [Harvard Medical School, Department of Imaging, Dana-Farber Cancer Institute, Brigham and Women' s Hospital, Boston, MA (United States); Hong, Seung-Mo [University of Ulsan College of Medicine, Department of Pathology, Asan Medical Center, Seoul (Korea, Republic of)


    To evaluate the prognostic value of CT to predict recurrence-free and overall survival in patients with pancreatic neuroendocrine neoplasms (PanNENs). Between January 2004 and December 2012, 161 consecutive patients who underwent preoperative triphasic CT and surgical resection with curative intent for PanNENs were identified. The tumour consistency, margin, presence of calcification, pancreatic duct dilatation, bile duct dilatation, vascular invasion, and hepatic metastases were evaluated. The tumour size, arterial enhancement ratio, and portal enhancement ratio were measured. The Cox proportional hazard model was used to determine the association between CT features and recurrence-free survival and overall survival. By multivariate analysis, tumour size (>3 cm) (hazard ratio, 3.314; p = 0.006), portal enhancement ratio (≤1.1) (hazard ratio, 2.718; p = 0.006), and hepatic metastases (hazard ratio, 4.374; p = 0.003) were independent significant variables for worse recurrence-free survival. Portal enhancement ratio (≤1.1) (hazard ratio, 5.951; p = 0.001) and hepatic metastases (hazard ratio, 4.122; p = 0.021) were independent significant variables for worse overall survival. Portal enhancement ratio (≤1.1) and hepatic metastases assessed on CT were common independent prognostic factors for worse recurrence-free survival and overall survival in patients with PanNENs. (orig.)

  16. An Intronic SINE insertion in FAM161A that causes exon-skipping is associated with progressive retinal atrophy in Tibetan Spaniels and Tibetan Terriers.

    Directory of Open Access Journals (Sweden)

    Louise M Downs

    Full Text Available Progressive retinal atrophy (PRA in dogs is characterised by the degeneration of the photoreceptor cells of the retina, resulting in vision loss and eventually complete blindness. The condition affects more than 100 dog breeds and is known to be genetically heterogeneous between breeds. Around 19 mutations have now been identified that are associated with PRA in around 49 breeds, but for the majority of breeds the mutation(s responsible have yet to be identified. Using genome-wide association with 22 Tibetan Spaniel PRA cases and 10 controls, we identified a novel PRA locus, PRA3, on CFA10 (p(raw = 2.01 × 10(-5, p(genome = 0.014, where a 3.8 Mb region was homozygous within 12 cases. Using targeted next generation sequencing, a short interspersed nuclear element insertion was identified near a splice acceptor site in an intron of a provocative gene, FAM161A. Analysis of mRNA from an affected dog revealed that the SINE causes exon skipping, resulting in a frame shift, leading to a downstream premature termination codon and possibly a truncated protein product. This mutation segregates with the disease in 22 out of 35 cases tested (63%. Of the PRA controls, none are homozygous for the mutation, 15% carry the mutation and 85% are homozygous wildtype. This mutation was also identified in Tibetan Terriers, although our results indicate that PRA is genetically heterogeneous in both Tibetan Spaniels and Tibetan Terriers.

  17. Antimicrobial activity in the egg wax of the tick Amblyomma hebraeum (Acari: Ixodidae) is associated with free fatty acids C16:1 and C18:2. (United States)

    Yu, Zhijun; Thomson, Euan L S; Liu, Jingze; Dennis, Jonathan J; Jacobs, René L; Kaufman, W Reuben


    Untreated eggs of the tick Amblyomma hebraeum Koch (Acari: Ixodidae) exhibited antimicrobial activity (AMA) against Gram-negative but not Gram-positive bacteria; eggs denuded of wax by solvent extraction showed no AMA. The unfractionated egg wax extract, however, showed AMA against Gram-positive but not Gram-negative bacteria, as also shown by Arrieta et al. (Exp Appl Acarol 39: 297-313, 2006). In this study we partitioned the egg wax into various fractions, using a variety of techniques, analyzed their compositions, and tested them for AMA. The crude aqueous extract exhibited AMA. However, although more than 30 metabolites were identified in this extract by nuclear magnetic resonance analysis, none of them seemed likely to be responsible for the observed AMA. In the crude organic extract, cholesterol esters were the most abundant lipids, but were devoid of AMA. Fatty acids (FAs), with chain lengths between C13 and C26 were the next most abundant lipids. After lipid fractionation and gas chromatography/mass spectroscopy, free FAs, especially C16:1 and C18:2, accounted for most of the AMA in the organic extract. The material responsible for AMA in the crude aqueous extract remains unidentified. No AMA was detected in the intracellular contents of untreated eggs.

  18. The parable of the shrewd manager (Lk 16:1–8: A biography of Jesus and a lesson on mercy

    Directory of Open Access Journals (Sweden)

    Dieter H. Reinstorf


    Full Text Available Many scholars have regarded the parable of the shrewd manager (Lk 16:1–8 as the most puzzling of all parables as Jesus seems to use the unrighteous actions of a dishonest (worldly manager as a model for emulation by others. The unease associated with this understanding was managed in part by focusing almost exclusively on the ‘shrewdness’ of the dishonest manager. In this interpretation, it is not his unjust behaviour that is to be imitated but his wise and intelligent actions. This interpretation has led to a divergence of applications regarding the ‘property’ that was entrusted to him. The author, however, argues that, in the context of the historical Jesus, the entrusted property in the parable references first and foremost the Torah entrusted to God’s people and that the manager mirrors the life of Jesus, who was ‘accused’ by the religious leaders of being unjust. Despite being threatened, he continued unabatedly to scatter God’s mercy, epitomised by the reduction of debt and symbolising the dawning of God’s Kingdom. The manager is therefore not a negative figure but a positive (diaphorical example of what it means to be a faithful manager of God in the light of adversary and opposition.

  19. Hematoma subdural crônico: estudo de 161 pacientes operados e a relação com alterações no coagulograma

    Directory of Open Access Journals (Sweden)

    Yasuda Clarissa Lin


    Full Text Available O objetivo deste estudo é analisar a evolução de pacientes com hematoma subdural crônico em relação aos achados do coagulograma. Foram analisados 161 pacientes operados no Hospital das Clínicas-UNICAMP entre abril de 1994 e 2000. Foi detectado um predomínio do sexo masculino (86,3%, da cor branca (85,1% e da faixa etária na quinta década (mediana 57 anos. O estudo mostrou mortalidade maior no período pós-operatório entre os pacientes com valores de RNI (international normalized ratio superiores a 1,25 e/ou trombocitopenia (p<0,001 e p=0,004, respectivamente e mortalidade menor para os pacientes com antecedente de traumatismo cranioencefálico (76% (p=0,044. Os resultados ressaltam a importância da avaliação pré-operatória com o coagulograma a fim de se corrigir possíveis alterações.

  20. Cell growth and resistance of Lactococcus lactis subsp. lactis TOMSC161 following freezing, drying and freeze-dried storage are differentially affected by fermentation conditions. (United States)

    Velly, H; Fonseca, F; Passot, S; Delacroix-Buchet, A; Bouix, M


    To investigate the effects of fermentation parameters on the cell growth and on the resistance to each step of the freeze-drying process of Lactococcus lactis subsp. lactis TOMSC161, a natural cheese isolate, using a response surface methodology. Cells were cultivated at different temperatures (22, 30 and 38°C) and pH (5·6, 6·2 and 6·8) and were harvested at different growth phases (0, 3 and 6 h of stationary phase). Cultivability and acidification activity losses of Lc. lactis were quantified after freezing, drying, 1 and 3 months of storage at 4 and 25°C. Lactococcus lactis was not damaged by freezing but was sensitive to drying and to ambient temperature storage. Moreover, the fermentation temperature and the harvesting time influenced the drying resistance of Lc. lactis. Lactococcus lactis cells grown in a whey-based medium at 32°C, pH 6·2 and harvested at late stationary phase exhibited both an optimal growth and the highest resistance to freeze-drying and storage. A better insight on the individual and interaction effects of fermentation parameters made it possible the freeze-drying and storage preservation of a sensitive strain of technological interest. Evidence on the particularly damaging effect of the drying step and the high-temperature storage is presented. © 2014 The Society for Applied Microbiology.

  1. Charged-particle multiplicity in $e^+ e^- \\rightarrow q \\overline{q}$ events at 161 and 172 GeV and from the decay of the W boson

    CERN Document Server

    Abreu, P; Adye, T; Ajinenko, I; Alekseev, G D; Alemany, R; Allport, P P; Almehed, S; Amaldi, Ugo; Amato, S; Andersson, P; Andreazza, A; Antilogus, P; Apel, W D; Arnoud, Y; Åsman, B; Augustin, J E; Augustinus, A; Baillon, Paul; Bambade, P; Barão, F; Barbi, M S; Bardin, Dimitri Yuri; Barker, G; Baroncelli, A; Bärring, O; Bates, M J; Battaglia, Marco; Baubillier, M; Baudot, J; Becks, K H; Begalli, M; Beillière, P; Belokopytov, Yu A; Belous, K S; Benvenuti, Alberto C; Bérat, C; Berggren, M; Bertini, D; Bertrand, D; Besançon, M; Bianchi, F; Bigi, M; Bilenky, S M; Billoir, P; Bizouard, M A; Bloch, D; Blume, M; Bonesini, M; Bonivento, W; Boonekamp, M; Booth, P S L; Borgland, A W; Borisov, G; Bosio, C; Botner, O; Boudinov, E; Bouquet, B; Bourdarios, C; Bowcock, T J V; Bozzo, M; Branchini, P; Brand, K D; Brenke, T; Brenner, R A; Brown, R C A; Brückman, P; Brunet, J M; Bugge, L; Buran, T; Burgsmüller, T; Buschmann, P; Cabrera, S; Caccia, M; Calvi, M; Camacho-Rozas, A J; Camporesi, T; Canale, V; Canepa, M; Carena, F; Carroll, L; Caso, Carlo; Castillo-Gimenez, M V; Cattai, A; Cavallo, F R; Chabaud, V; Charpentier, P; Chaussard, L; Checchia, P; Chelkov, G A; Chen, M; Chierici, R; Chliapnikov, P V; Chochula, P; Chorowicz, V; Chudoba, J; Cindro, V; Collins, P; Colomer, M; Contri, R; Cortina, E; Cosme, G; Cossutti, F; Cowell, J H; Crawley, H B; Crennell, D J; Crosetti, G; Cuevas-Maestro, J; Czellar, S; Dahm, J; D'Almagne, B; Damgaard, G; Dauncey, P D; Davenport, Martyn; Da Silva, W; Deghorain, A; Della Ricca, G; Delpierre, P A; Demaria, N; De Angelis, A; de Boer, Wim; De Brabandere, S; De Clercq, C; La Vaissière, C de; De Lotto, B; De Min, A; De Paula, L S; Dijkstra, H; Di Ciaccio, Lucia; Di Diodato, A; Djannati, A; Dolbeau, J; Doroba, K; Dracos, M; Drees, J; Drees, K A; Dris, M; Durand, J D; Edsall, D M; Ehret, R; Eigen, G; Ekelöf, T J C; Ekspong, Gösta; Elsing, M; Engel, J P; Erzen, B; Espirito-Santo, M C; Falk, E; Fanourakis, G K; Fassouliotis, D; Feindt, Michael; Fenyuk, A; Ferrari, P; Ferrer, A; Fichet, S; Filippas-Tassos, A; Firestone, A; Fischer, P A; Föth, H; Fokitis, E; Fontanelli, F; Formenti, F; Franek, B J; Frodesen, A G; Frühwirth, R; Fulda-Quenzer, F; Fuster, J A; Galloni, A; Gamba, D; Gandelman, M; García, C; García, J; Gaspar, C; Gasparini, U; Gavillet, P; Gazis, E N; Gelé, D; Gerber, J P; Gerdyukov, L N; Gokieli, R; Golob, B; Gonçalves, P; Gopal, Gian P; Gorn, L; Górski, M; Guz, Yu; Gracco, Valerio; Graziani, E; Green, C; Grefrath, A; Gris, P; Grosdidier, G; Grzelak, K; Günther, M; Guy, J; Hahn, F; Hahn, S; Hajduk, Z; Hallgren, A; Hamacher, K; Harris, F J; Hedberg, V; Henriques, R P; Hernández, J J; Herquet, P; Herr, H; Hessing, T L; Heuser, J M; Higón, E; Holmgren, S O; Holt, P J; Holthuizen, D J; Hoorelbeke, S; Houlden, M A; Hrubec, Josef; Huet, K; Hultqvist, K; Jackson, J N; Jacobsson, R; Jalocha, P; Janik, R; Jarlskog, C; Jarlskog, G; Jarry, P; Jean-Marie, B; Johansson, E K; Jönsson, L B; Jönsson, P E; Joram, Christian; Juillot, P; Kaiser, M; Kapusta, F; Karafasoulis, K; Karvelas, E; Katsanevas, S; Katsoufis, E C; Keränen, R; Khokhlov, Yu A; Khomenko, B A; Khovanskii, N N; King, B J; Kjaer, N J; Klapp, O; Klein, H; Kluit, P M; Knoblauch, D; Kokkinias, P; Koratzinos, M; Korcyl, K; Kostyukhin, V; Kourkoumelis, C; Kuznetsov, O; Krammer, Manfred; Kreuter, C; Kronkvist, I J; Krstic, J; Krumshtein, Z; Krupinski, W; Kubinec, P; Kucewicz, W; Kurvinen, K L; Lacasta, C; Laktineh, I; Lamsa, J; Lanceri, L; Lane, D W; Langefeld, P; Laugier, J P; Lauhakangas, R; Leder, Gerhard; Ledroit, F; Lefébure, V; Legan, C K; Leisos, A; Leitner, R; Lemonne, J; Lenzen, Georg; Lepeltier, V; Lesiak, T; Lethuillier, M; Libby, J; Liko, D; Lipniacka, A; Lippi, I; Lörstad, B; Loken, J G; López, J M; Loukas, D; Lutz, P; Lyons, L; MacNaughton, J N; Maehlum, G; Mahon, J R; Maio, A; Malmgren, T G M; Malychev, V; Mandl, F; Marco, J; Marco, R P; Maréchal, B; Margoni, M; Marin, J C; Mariotti, C; Markou, A; Martínez-Rivero, C; Martínez-Vidal, F; Martí i García, S; Masik, J; Matorras, F; Matteuzzi, C; Matthiae, Giorgio; Mazzucato, M; McCubbin, M L; McKay, R; McNulty, R; McPherson, G; Medbo, J; Meroni, C; Meyer, S; Meyer, W T; Michelotto, M; Migliore, E; Mirabito, L; Mitaroff, Winfried A; Mjörnmark, U; Moa, T; Møller, R; Mönig, K; Monge, M R; Morettini, P; Müller, H; Münich, K; Mulders, M; Mundim, L M; Murray, W J; Muryn, B; Myatt, Gerald; Myklebust, T; Naraghi, F; Navarria, Francesco Luigi; Navas, S; Nawrocki, K; Negri, P; Némécek, S; Neumann, W; Neumeister, N; Nicolaidou, R; Nielsen, B S; Nieuwenhuizen, M; Nikolaenko, V; Nikolenko, M; Niss, P; Nomerotski, A; Normand, Ainsley; Nygren, A; Oberschulte-Beckmann, W; Obraztsov, V F; Olshevskii, A G; Onofre, A; Orava, Risto; Orazi, G; Ortuno, S; Österberg, K; Ouraou, A; Paganini, P; Paganoni, M; Paiano, S; Pain, R; Palka, H; Papadopoulou, T D; Papageorgiou, K; Pape, L; Parkes, C; Parodi, F; Parzefall, U; Passeri, A; Pegoraro, M; Peralta, L; Pernegger, H; Pernicka, Manfred; Perrotta, A; Petridou, C; Petrolini, A; Phillips, H T; Piana, G; Pierre, F; Pimenta, M; Piotto, E; Podobnik, T; Podobrin, O; Pol, M E; Polok, G; Poropat, P; Pozdnyakov, V; Privitera, P; Pukhaeva, N; Pullia, Antonio; Radojicic, D; Ragazzi, S; Rahmani, H; Ratoff, P N; Read, A L; Reale, M; Rebecchi, P; Redaelli, N G; Regler, Meinhard; Reid, D; Reinhardt, R; Renton, P B; Resvanis, L K; Richard, F; Rídky, J; Rinaudo, G; Røhne, O M; Romero, A; Ronchese, P; Roos, L; Rosenberg, E I; Rosinsky, P; Roudeau, Patrick; Rovelli, T; Ruhlmann-Kleider, V; Ruiz, A; Rybicki, K; Saarikko, H; Sacquin, Yu; Sadovskii, A; Sajot, G; Salt, J; Sannino, M; Schneider, H; Schwickerath, U; Schyns, M A E; Sciolla, G; Scuri, F; Seager, P; Sedykh, Yu; Segar, A M; Seitz, A; Sekulin, R L; Serbelloni, L; Shellard, R C; Sheridan, A; Siegrist, P; Silvestre, R; Simonetto, F; Sissakian, A N; Skaali, T B; Smadja, G; Smirnov, N; Smirnova, O G; Smith, G R; Solovyanov, O; Sosnowski, R; Souza-Santos, D; Spassoff, Tz; Spiriti, E; Sponholz, P; Squarcia, S; Stampfer, D; Stanescu, C; Stanic, S; Stapnes, Steinar; Stavitski, I; Stevenson, K; Stocchi, A; Strauss, J; Strub, R; Stugu, B; Szczekowski, M; Szeptycka, M; Tabarelli de Fatis, T; Tavernet, J P; Chikilev, O G; Tegenfeldt, F; Terranova, F; Thomas, J; Tilquin, A; Timmermans, J; Tkatchev, L G; Todorov, T; Todorova, S; Toet, D Z; Tomaradze, A G; Tomé, B; Tonazzo, A; Tortora, L; Tranströmer, G; Treille, D; Tristram, G; Trombini, A; Troncon, C; Tsirou, A L; Turluer, M L; Tyapkin, I A; Tyndel, M; Tzamarias, S; Überschär, B; Ullaland, O; Uvarov, V; Valenti, G; Vallazza, E; van Apeldoorn, G W; van Dam, P; Van Eldik, J; Van Lysebetten, A; Vassilopoulos, N; Vegni, G; Ventura, L; Venus, W A; Verbeure, F; Verlato, M; Vertogradov, L S; Vilanova, D; Vincent, P; Vitale, L; Vlasov, E; Vodopyanov, A S; Vrba, V; Wahlen, H; Walck, C; Waldner, F; Weiser, C; Wetherell, Alan M; Wicke, D; Wickens, J H; Wielers, M; Wilkinson, G R; Williams, W S C; Winter, M; Witek, M; Wlodek, T; Yi, J; Yip, K; Yushchenko, O P; Zach, F; Zaitsev, A; Zalewska-Bak, A; Zalewski, Piotr; Zavrtanik, D; Zevgolatakos, E; Zimin, N I; Zucchelli, G C; Zumerle, G


    The data collected by DELPHI in 1996 have been used to measure the average charged particle multiplicities and dispersions in $q\\bar{q}$ events at centre-of-mass energies of $\\sqrt{s}=161$~GeV and $\\sqrt{s}=172$~GeV, and the average charge multiplicity in WW events at $\\sqrt{s}=172$~GeV. The multiplicities in $q\\bar{q}$ events are consistent with the evolution predicted by QCD. The dispersions in the multiplicity distributions are consistent with Koba-Nielsen-Olesen (KNO) scaling. The average multiplicity of charged particles in hadronic W decays has been measured for the first time; its value, $19.23 \\pm 0.74 (stat+syst)$, is consistent with that expected for an $e^+e^-$ interaction at a centre-of-mass energy equal to the W mass. The charged particle multiplicity in W decays shows no evidence of effects of colour reconnection between partons from different W's at the present level of statistics.

  2. Probing the Role of Two Critical Residues in Inulin Fructotransferase (DFA III-Producing) Thermostability from Arthrobacter sp. 161MFSha2.1. (United States)

    Yu, Shuhuai; Wang, Xiao; Zhang, Tao; Jiang, Bo; Mu, Wanmeng


    Inulin fructotransferase (IFTase) is an important enzyme that produces di-d-fructofuranose 1,2':2,3' dianhydride (DAF III), which is beneficial for human health. Present investigations mainly focus on screening and characterizing IFTase, including catalytic efficiency and thermostability, which are two important factors for enzymatic industrial applications. However, few reports aimed to improve these two characteristics based on the structure of IFTase. In this work, a structural model of IFTase (DFA III-producing) from Arthrobacter sp. 161MFSha2.1 was constructed through homology modeling. Analysis of this model reveals that two residues, Ser-309 and Ser-333, may play key roles in the structural stability. Therefore, the functions of the two residues were probed by site-directed mutagenesis combined with the Nano-DSC method and assays for residual activity. In contrast to other mutations, single mutation of serine 309 (or serine 333) to threonine did not decrease the enzymatic stability, whereas double mutation (serine 309 and serine 333 to threonine) can enhance thermostability (by approximately 5 °C). The probable mechanisms for this enhancement were investigated.

  3. Efficacy and safety of surgical lung biopsy for interstitial disease. Experience of 161 consecutive patients from a single institution in Italy. (United States)

    Rotolo, Nicola; Imperatori, Andrea; Dominioni, Lorenzo; Facchini, Annalaura; Conti, Valentina; Castiglioni, Massimo; Spanevello, Antonio


    The role of surgical biopsy for interstitial lung disease (ILD) is controversial, because of possible postoperative morbidity and mortality. We aimed to assess the efficacy and safety of surgical biopsy for ILD. We retrospectively analysed the diagnostic performance and the postoperative complications of 161 consecutive surgical lung biopsy procedures carried out in suspected ILD cases that were undefined after multidisciplinary clinico-radiological evaluation. In 151 cases (93.8%) the biopsy was performed by video-assisted thoracoscopic surgery (VATS), in 6.2% by limited thoracotomy. A specific histological diagnosis was obtained in 154 (95.7%) of the surgically biopsied patients, while 4.3% remained histologically unclassified. The predominant histological patterns were sarcoidosis (29.8 %), usual interstitial pneumonia/idiopathic pulmonary fibrosis (UIP/IPF) (24.2%), cryptogenic organizing pneumonia (18.6%) and nonspecific interstitial pneumonia (8.1%). The postoperative course was uneventful in 142 cases. In 19 patients (11.8%) we observed postoperative complications, predominantly prolonged air leakage (5.0% of all cases). Thirty-day postoperative mortality was 3.1%, mostly due to acute exacerbation of respiratory insufficiency. Postoperative mortality independently correlated with preoperative need of oxygen therapy (OR, 5.21; 95% CI, 1.19-22.95) and with UIP/IPF histology (OR, 5.67; 95% CI, 1.27-25.25). Lung biopsy was performed mostly by VATS, with limited morbidity, and was effective in yielding a specific histologic diagnosis in the vast majority of undefined ILD cases. To optimize the outcome of surgical biopsy for specific diagnosis of ILD, this procedure should be performed only exceptionally in patients with critical respiratory illness as postoperative mortality risk in these subjects is exceedingly high.

  4. Effect of a high-altitude expedition to a Himalayan peak (Pumori, 7,161 m) on plasma and erythrocyte antioxidant profile. (United States)

    Magalhães, José; Ascensão, António; Marques, Franklim; Soares, José M C; Ferreira, Rita; Neuparth, Maria J; Duarte, José A


    The effects of a high-altitude exposure were studied in six mountaineers who spent 3 weeks at an altitude range between 5,250 and 7,161 m after 1 week in an acclimatization trek (2,800-5,250 m). Blood drawn from the antecubital vein was collected at sea level 1 day before and 1 day after the expedition to analyse some haematological variables [haemoglobin (Hb), haematocrit (Htc) and red blood cell (RBC) count], erythrocyte antioxidant enzyme activity [superoxide dismutase (SOD), glutathione peroxidase (GPx) and glutathione reductase (Gr)] and membrane fatty acid profile [mono-unsaturated fatty acids (MUFA), polyunsaturated fatty acids (PUFA), saturated fatty acids (SFA), trans fatty acids (TRANS)]. Moreover, total antioxidant status (TAS), thiobarbituric acid reactive substances (TBARS), thiol protein groups (SH), SOD, GPx and Gr were measured in plasma. High-altitude exposure induced polycythaemia, with significant increases in RBC count (5.26%), Hb concentration (4.83%) and Htc (6.26%). Furthermore, a significant increase in plasma TBARS, SOD and Gr was observed after the expedition, whereas SH, TAS and GPx decreased. Erythrocyte glutathione-cycle-related antioxidant enzyme activity was upregulated, whereas SOD activity was maintained after the expedition. In addition, despite the unchanged (MUFA+PUFA)/SFA ratio, the membrane erythrocyte fatty acid content showed a significant increase in PUFAs and a decrease in TRANS, suggesting enhanced membrane fluidity. In conclusion, it seems that high-altitude exposure, besides quantitative variations in RBC expression, induced plasma oxidative stress and damage, and significant changes in erythrocyte components, namely in antioxidant enzyme activity and membrane fatty acid profile that might modify RBC functionality.

  5. Sausage-like toe and heel pain: value for diagnosing and evaluating the severity of spondyloarthropathies defined by Amor's criteria. A retrospective study in 161 patients. (United States)

    Eulry, François; Diamano, Joël; Launay, David; Tabache, Fatima; Lechevalier, Dominique; Magnin, Jacques


    To evaluate the frequency of sausage-like toe and talalgia in spondyloarthropathies diagnosed by the 12 items of Amor's criteria; to study the frequency of a diagnosis which would be impossible without these two symptoms; and to study the correlations between Amor's criteria score and the clinical and biological symptoms in the presence of both of these. Retrospective study of 161 cases (age, 38.8 +/- 13.1 years; duration, 7.12 +/- 7.3 years; HLA B27, 112). Peripheral involvement is observed in 89 cases (52 cases of pure peripheral form). Eighty cases (group N1) experience talalgia and/or sausage-like toe and 80 do not (group N2). Talalgia concerns 68 patients (42.2%) and sausage-like toe 37 (23.3%); both signs are present in 18. Age, duration, morning stiffness, SR, CRP are similar in both groups. Ankle involvement and oligoarthritis are significantly more frequent in group N1. In 17 cases the presence of talalgia or sausage-like toe are indispensable to the diagnosis (10.6%): 11 undetermined spondyloarthropathies, six psoriatic arthritis. In the N1 group, a positive correlation is present between the score of the 12 items and, respectively, morning stiffness (+ 0.69; P = 0.0001), SR (+ 0.6; P = 0.001 8), CRP (+ 0.59; P = 0.001 8) in patients with sausage-like toe, probably because of the associated oligoarthritis, but neither in patients with talalgia (N1) nor in patients of the group N2. Talalgia and sausage-like toe are present respectively in 42.2 and 23.6% of spondyloarthropathies and are indispensable to the diagnosis using Amor's criteria in 10.6% of cases. The sausage-like toe would indicate a more severe spondyloarthopathy because of the synovitis, even though talalgia (pure enthesopathy) does not reflect the inflammatory process.

  6. Common variants on 2p16.1, 6p22.1 and 10q24.32 are associated with schizophrenia in Han Chinese population. (United States)

    Yu, H; Yan, H; Li, J; Li, Z; Zhang, X; Ma, Y; Mei, L; Liu, C; Cai, L; Wang, Q; Zhang, F; Iwata, N; Ikeda, M; Wang, L; Lu, T; Li, M; Xu, H; Wu, X; Liu, B; Yang, J; Li, K; Lv, L; Ma, X; Wang, C; Li, L; Yang, F; Jiang, T; Shi, Y; Li, T; Zhang, D; Yue, W


    Many schizophrenia susceptibility loci have been identified through genome-wide association studies (GWASs) in European populations. However, until recently, schizophrenia GWASs in non-European populations were limited to small sample sizes and have yielded few loci associated with schizophrenia. To identify genetic risk variations for schizophrenia in the Han Chinese population, we performed a two-stage GWAS of schizophrenia comprising 4384 cases and 5770 controls, followed by independent replications of 13 single-nucleotide polymorphisms in an additional 4339 schizophrenia cases and 7043 controls of Han Chinese ancestry. Furthermore, we conducted additional analyses based on the results in the discovery stage. The combined analysis confirmed evidence of genome-wide significant associations in the Han Chinese population for three loci, at 2p16.1 (rs1051061, in an exon of VRK2, P=1.14 × 10 -12 , odds ratio (OR)=1.17), 6p22.1 (rs115070292 in an intron of GABBR1, P=4.96 × 10 -10 , OR=0.77) and 10q24.32 (rs10883795 in an intron of AS3MT, P=7.94 × 10 -10 , OR=0.87; rs10883765 at an intron of ARL3, P=3.06 × 10 -9 , OR=0.87). The polygenic risk score based on Psychiatric Genomics Consortium schizophrenia GWAS data modestly predicted case-control status in the Chinese population (Nagelkerke R 2 : 1.7% ~5.7%). Our pathway analysis suggested that neurological biological pathways such as GABAergic signaling, dopaminergic signaling, cell adhesion molecules and myelination pathways are involved in schizophrenia. These findings provide new insights into the pathogenesis of schizophrenia in the Han Chinese population. Further studies are needed to establish the biological context and potential clinical utility of these findings.

  7. Optical characteristics of transparent samarium oxide thin films ...

    Indian Academy of Sciences (India)


    Oct 7, 2016 ... 1Department of Physics, Faculty of Science, Taif University, Taif 888, Saudi Arabia. 2Department of Physics, Faculty of Education, Ain Shams University, Roxy 11757, Cairo, Egypt. 3Materials Science Unit, Department of Chemistry, Faculty of Science, Tanta University, 31725 Tanta, Egypt. 4Department of ...

  8. Optical properties of lead–tellurite glasses doped with samarium ...

    Indian Academy of Sciences (India)

    The optical properties of a new family of Sm2O3–(40–)PbO–60TeO2 glasses are investigated. The optical absorption spectra were recorded at ... The refractive index, molar refraction and polarizability of oxide ions have been calculated by using Lorentz–Lorentz relations. The non-linear variations of the above optical ...

  9. Optical properties of lead–tellurite glasses doped with samarium ...

    Indian Academy of Sciences (India)


    Abstract. The optical properties of a new family of xSm2O3–(40–x)PbO–60TeO2 glasses are investigated. The optical absorption spectra were recorded at room temperature in the UV-visible region. From the absorption edge studies, the values of optical bandgap energies have been evaluated. The refractive index, molar ...

  10. Measurement of radiative lifetime in atomic samarium using ...

    Indian Academy of Sciences (India)


    Feb 8, 2014 ... In this paper, we report the investigations of lifetime measurement of odd-parity energy level 19009.52 cm. −1 .... introduced by an electronic delay generator between the two Q-switch pulses of Nd-YAG laser. The slope of the .... Our values of the lifetimes are free from the common systematic errors. Thus ...

  11. A novel samarium complex with interesting photoluminescence and ...

    African Journals Online (AJOL)

    The 4,4'-Hbipy moieties, isolated nitrates and [Sm(H2O)4(NO3)3] species are held together via hydrogen bonds and p…p interactions to form a 3-D supramolecular framework. Luminescent investigation reveals a strong emission in blue region. Optical absorption spectrum of 1 reveals the presence of an optical gap of 3.60 ...

  12. Lithium samarium polyphosphate, LiSm(PO34

    Directory of Open Access Journals (Sweden)

    Dan Zhao


    Full Text Available The mixed-metal rare-earth polyphosphate LiSm(PO34 consists of a three-dimensional framework in which zigzag [(PO3n]n− chains with a periodicity of four PO4 tetrahedra are connected through Li+ and Sm3+ ions (both with 2. symmetry.

  13. Sodium samarium tetrakis(polyphosphate, NaSm(PO34

    Directory of Open Access Journals (Sweden)

    Dan Zhao


    Full Text Available NaSm(PO34 has been prepared by solid state reactions. It belongs to type II of the structural family of MILnIII(PO34 compounds (MI = alkali metal and LnIII = rare earth metal and is composed of ∞(PO3n]n− polyphosphate chains with a repeating unit of four PO4 tetrahedra. The chains extend parallel to [100] and share O atoms with irregular SmO8 polyhedra, forming a three-dimensional framework which delimits tunnels occupied by Na+ cations in a distorted octahedral environment.

  14. Isotopic Ratios of Samarium by TIMS for Nuclear Forensic Application

    Energy Technology Data Exchange (ETDEWEB)

    Louis Jean, James [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Inglis, Jeremy David [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)


    The isotopic ratio of Nd, Sm, and Gd can provide important information regarding fissile material (nuclear devices, reactors), neutron environment, and device yield. These studies require precise measurement of Sm isotope ratios, by either TIMS or MC-ICP-MS. There has been an increasing trend to measure smaller and smaller quantities of Sm bearing samples. In nuclear forensics 10-100 ng of Sm are needed for precise measurement. To measure sub-ng Sm samples using TIMS for nuclear forensic analysis.

  15. Synthesis of copper, silver, and samarium chalcogenides by mechanical alloying

    Energy Technology Data Exchange (ETDEWEB)

    Ohtani, T.; Maruyama, K.; Ohshima, K. [Okayama Univ. of Science (Japan). Lab. for Solid State Chemistry


    CuInX{sub 2} (X = S, Se, Te), Ag{sub 2}S, Ag{sub 2}Se, Ag{sub 3}Te{sub 2}, Ag{sub 1.9}Te, AgCuSe, Sm{sub 3}Se{sub 4}, Sm{sub 2}Se{sub 3}, and SmTe were synthesized by a mechanical alloying method, using a high-energy planetary ball mill. The compounds were obtained by milling mixtures of the elements with desired ratios in agate or Cu-Be vials for 60--180 min.

  16. Oriented growth of thin films of samarium oxide by MOCVD

    Indian Academy of Sciences (India)


    Abstract. Thin films of Sm2O3 have been grown on Si(100) and fused quartz by low-pressure chemical va- pour deposition using an adducted β-diketonate precursor. The films on quartz are cubic, with no preferred orientation at lower growth temperatures (~ 550°C), while they grow with a strong (111) orientation as the.

  17. 150 KVA Samarium Cobalt VSCF Starter Generator Electrical System (United States)


    considerable hand labor. Addition of a provision for suitable electrical connection by the SCR manufacturer wou;d be desirable for production runs. Predicted...licen- sing the holder or any other person or corporation, or conveying any rights or permission to manufacture , use, or sell any patented invent,’n...tesile strength to contain the magnets and pole pieces up through the overspeed rating of the rotor. The cho.;en process uses maraging steel as the

  18. Optical properties of samarium doped zinc–tellurite glasses

    Indian Academy of Sciences (India)

    Glasses with the composition, (Sm2O3)(ZnO)(40–)(TeO2)(60), were prepared by conventional melt quenching method. The density, molar volume, and optical energy band gap of these glasses have been measured. The refractive index, molar refraction and polarizability of oxide ion have been calculated by using ...

  19. China’s foreign policy towards Central and Eastern Europe: The “16+1” format in the South–South cooperation perspective. Cases of the Czech Republic and Hungary

    Directory of Open Access Journals (Sweden)

    Bartosz Kowalski


    Full Text Available This article discusses the “16+1” format initiated in 2012 as a platform for economic, trade, and cultural cooperation between Central and Eastern Europe (CEE and China. As Chinese authorities claim, the “16+1” initiative is complementary to the “New Silk Road” strategy, being a pragmatic formula without political goals, whose main rationale is to bring mutual benefits to all of its participants (win–win. However, despite the Chinese narratives concerning cooperation with the CEE countries as an economic bridgehead of the “One Road, One Belt” (OBOR initiative, some signs of the political dimension of the project can be noticed. Since at least the 1950s, active participation and promotion of the South–South cooperation has become an important component of China’s foreign relations. Although for Chinese policy makers Sino–South relations have been traditionally defined within the frame of, mostly postcolonial, developing countries of Southeast Asia, Central Asia, Africa, and Latin America, this article tries to examine the “South–South” pattern of China’s diplomacy towards Central and Eastern European states with a focus on the Czech Republic and Hungary.

  20. Delitos que Vulneran la Intimidad de las Personas: Análisis crítico del artículo 161-A del Código Penal Chileno

    Directory of Open Access Journals (Sweden)

    Regina Ingrid Díaz Tolosa


    Full Text Available El artículo 161-A del Código Penal chileno es una muestra de los resultados que se obtienen al legislar materias tan importantes, como lo es la protección penal de la intimidad de las personas, de forma acelerada. La norma en análisis resiste innumerables críticas; su redacción es confusa e imprecisa, lo que conlleva arduas tareas de interpretación. Este trabajo pretende contribuir en esta labor, reflexionando acerca de puntuales problemas asociados a la tipificación de los delitos recogidos en la citada disposición, así respecto al inciso primero se analiza, especialmente, si se penaliza la indiscreción o deslealtad en las comunicaciones y actuaciones privadas, mientras que en cuanto al inciso segundo se medita acerca de si se exige el conocimiento de la obtención subrepticia del material por parte de quien lo difunde. Además, se destaca la necesaria interpretación restrictiva de estos tipos, se analiza el interés público como fundamento de la autorización legal o judicial para ejecutar las conductas tipificadas, y de ¡egeferendae, se indican las ventajas que tendría introducir un elemento subjetivo del tipo distinto del dolo como la finalidad de vulnerar ¡a intimidad de otro, a fin de salvar las incertidumbres que existen en la actual legislaciónThe article 161-A of the Chilean Penal Code is a sample of the results that are obtained when so important matters, like the penal protection of the privacy, are legislated precipitately. The norm in analysis resists innumerable critiques; its draft is confused and vague, giving us an arduous interpretation work. This paper tries to contribute in this analysis, thinking over punctual problems, for example, regarding to the first clause we studied, specially, if the indiscretion or disloyalty is penalized in the communications and private performances, while as for the second clause it is pondered if who diffuse the information must to know about that it was obtained illegally

  1. Increased Tryptophan Catabolism is Associated with Increased Frequency of CD161+Tc17/MAIT Cells, and Lower CD4+ T cell Count in HIV-1 infected Patients on cART after Two Years of Follow-up

    DEFF Research Database (Denmark)

    Gaardbo, Julie Christine; Trøseid, Marius; Stiksrud, Birgitte


    of KTR on CD4+ T cell recovery in HIV-infected patients on cART after two years of follow-up was investigated. METHODS: Forty-one HIV-infected individuals treated with cART for a minimum of two years were included. Tregs, CD161+Tc17/MAIT cells, naïve cells, immune activation, senescence and apoptosis......BACKGROUND: HIV infection is associated with increased ratio between kynurenine and tryptophan (KTR) in plasma, increased microbial translocation, expansion of Tregs and depletion of Tc17/mucosa associated invariant T cells (MAIT) cells. The association between these parameters and the impact...... divided in two groups defined by high vs. low KTR. The CD4+ T cell count was determined at inclusion and after two years of follow-up. RESULTS: The KTR decreased following cART initiation. Patients on cART with high KTR displayed an immunological profile with high sCD14, high percentage Tregs, low...

  2. 32_155 - 161_BIO 083 Magashi

    African Journals Online (AJOL)


    pesticide and lubricant activities. Phytol-. Diterpene is an antimicrobial, anticancer, anti- inflammatory and diuretic agent (Praveen et al.,. 2010). Similarly Maria et .... Capitalizing on the Bio-Economic Value of Multi-purpuse Medicinal Plants for the. Rehabilitation of Drylands in Sub-Saharan. Africa.The International Bank for.

  3. 40 CFR 161.150 - General. (United States)


    .... Physicians, hospitals, and poison control centers also request this information to aid in their..., explodability, storage stability, corrosion, and dielectric breakdown voltage. For example, a study of the... container sides will not be damaged and cause the contents to leak during storage, transport, handling, or...

  4. 12 CFR 303.161 - Filing procedures. (United States)


    ... filed in letter form with the appropriate FDIC office at the same time as required conversion... letter form with the appropriate FDIC office as soon as practicable after adoption of its plan of...; (2) Certified board resolutions relating to the conversion; (3) A business plan, including a detailed...

  5. 21 CFR 161.130 - Oysters. (United States)


    ... oysters are drained on a strainer or skimmer which has an area of not less than 300 square inches per... evenly over the draining surface of the skimmer and drained for not less than 5 minutes; or (ii) The... packing by draining a representative gallon of oysters on a skimmer of the dimensions and in the manner...

  6. Publications | Page 161 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Openness and quality in Asian distance education : sub-project 5; development and evaluation of use of distance education technologies for enriching clinical practicum in nursing in the Philippines (restricted access). The Virtual Clinical Experience Courseware was distributed to all Master of Arts in Nursing (MAN) students ...

  7. 161 Teachers' Continuing Professional Development as Correlates ...

    African Journals Online (AJOL)


    Abstract. The study examined the correlates of teachers' continuing professional development on universal basic education in Bayelsa State, Nigeria. Using descriptive survey, a sample of 500 teachers was randomly selected from twenty (20) Basic Junior Secondary Schools and Primary Schools used for the study.

  8. Publications | Page 161 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    We share the results of our funded research, and offer free training materials to guide researchers and institutions. Want more? Explore outputs from ... The Coastal Cities at Risk project takes an interdisciplinary approach involving natural, social, and health scientists, engineers, and economists. The initiative focuses on ...

  9. 27 CFR 22.161 - Records. (United States)


    ... shall be kept current at all times. (b) Records of receipt and shipment. Records of receipt and shipment shall consist of the consignor's or consignee's (as the case may be) invoice, bill or bill of lading, or...) General. All persons qualified under this part shall keep accurate records of all receipts, shipments...

  10. Clean Cities Now Vol. 16.1

    Energy Technology Data Exchange (ETDEWEB)



    Biannual newsletter for the U.S. Department of Energy's Clean Cities initiative. The newsletter includes feature stories on advanced vehicle deployment, idle reduction, and articles on Clean Cities coalition successes across the country.

  11. 40 CFR 63.161 - Definitions. (United States)


    ... dripping means any visible leakage from the seal including dripping, spraying, misting, clouding, and ice...). Sensor means a device that measures a physical quantity or the change in a physical quantity, such as...

  12. 22 CFR 16.1 - Definitions. (United States)


    ... surviving spouse or dependent family member of the officer or employee. (c) Grievance means any act or..., misinterpretation, or misapplication of applicable law, regulation, or published policy affecting the terms and conditions of the grievant's employment or career status; (3) Allegedly wrongful disciplinary action against...

  13. 161-IJBCS-Article-Dr Ekanayake

    African Journals Online (AJOL)

    RHUMSIKI ABSTRACT. Cost effective primary and secondary wound care is needed and have significant importance in current medicine. The steroidal saponin Flabelliferin B with a UV active binder attached (FB), isolated from palmyrah.

  14. Environmental Radiation Data (ERD) Journal Report 161 (United States)

    RadNet environmental radiation monitoring data report for the period of January - March 2015. The report includes results for air, drinking water and precipitation samples collected as part of EPA's RadNet monitoring program.

  15. Reference: 161 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available ids, based on thin layer chromatography. The identity of the Ala, Asp, Phe, and T...rp conjugates was verified by gas chromatography-mass spectrometry. Insertional mutations in GH3.1, GH3.2, G

  16. The Art of Graffiti and Room 161 (United States)

    Forseth, Sonia


    Covering the walls of the art room with white paper and sealing off all the open edges with masking tape, students proceeded to do their thing'' by using tempera, oil crayons and India ink to create an environment that was completely their own. (Author/CB)

  17. 21 CFR 161.190 - Canned tuna. (United States)


    ... Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... peppers, spinach, and tomatoes. (vi) Garlic. (vii) Lemon flavoring to be prepared from lemon oil and citric acid together with safe and suitable carriers for the lemon oil which are present at nonfunctional...

  18. 40 CFR 82.161 - Technician certification. (United States)


    .... Programs are encouraged to make provisions for non-English speaking technicians by providing tests in other languages or allowing the use of a translator when taking the test. If a translator is used, the certificate... test offered by a training and certification program approved under § 82.40. (6) Apprentices are exempt...

  19. 7 CFR 905.161 - Repacking shipper. (United States)


    ... and Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE ORANGES, GRAPEFRUIT, TANGERINES, AND... repacking shipper is a person who repacks and ships citrus fruit grown in the production area in Florida... market (fruit shipped from the production area to any point outside thereof in the 48 contiguous States...

  20. 33 CFR 161.18 - Reporting requirements. (United States)


    ... call. H HOTEL Date, time and point of entry system Entry time expressed as in (B) and into the entry... Radiotelephone Act and participating in a Vessel Traffic Service (VTS) system when the watch is maintained on...

  1. 21 CFR 161.145 - Canned oysters. (United States)


    ... specifications for such cloth set forth under “2.38 mm (No. 8)” in “Official Methods of Analysis of the Association of Official Analytical Chemists,” 13th Ed. (1980), Table 1, “Nominal Dimensions of Standard Test... container. (2) Water capacity of containers is determined by the general method provided in § 130.12(a) of...

  2. Comparison of histopathology, acid fast bacillus smear and real-time polymerase chain reaction for detection of Mycobacterium tuberculosis in anal fistula in 161 patients: A prospective controlled trial. (United States)

    Garg, Pankaj; Garg, Mohinder K; Agarwal, Narinder


    Mycobacterium tuberculosis (MTB) is a known cause of refractory and recurrent fistula-in-ano. Histopathology of fistula tract and acid fast bacillus (AFB) smear of the pus are the standard procedures employed to diagnose MTB. However, they have some drawbacks. Nontubercular mycobacteria (NTM) has also been detected to cause fistula-in-ano and these methods cannot differentiate between MTB and NTM. Secondly, as these methods have low sensitivity, they could possibly be missing out MTB patients. Real-time polymerase chain reaction (RT-PCR) has high sensitivity in detecting mycobacteria. The aim of the study was to compare the sensitivity of RT-PCR, histopathology, and AFB smear in detecting MTB in fistula-in-ano. The histopathology and RT-PCR of tissue (fistula tract) was done along with AFB smear and RT-PCR of the pus was done in all the cases as per the availability of the specimen. The histopathology, AFB smear and RT-PCR was done by same pathologists in all the cases and all the patients were operated by a single surgeon. A total of 286 samples were tested in 161 patients of fistula-in-ano who were operated over a period of 1year. The mean age was 38.6±10.5 and male/female ratio was 153/8. Histopathology and RT-PCR of tissue (fistula tract) was done in 131 patients and 141 patients respectively. AFB smear and RT-PCR of pus (fistula) was done in 14 patients. Overall, MTB was detected in total of 17/161 (10.63%) patients. Out of these, MTB was detected in tissue (fistula tract) in 1/131 (0.76%) by histopathology and 14/141 (10%) by RT-PCR tissue. In pus samples, AFB smear was negative in all cases (0/14), whereas RT-PCR detected MTB in four of 14 (28.6%) patients. In 17 patients detected to have MTB, four-drug antitubercular therapy (ATT) was recommended. ATT was started in 15 patients. Nine of 17 patients completed 6months ATT and were cured. Six of 17 patients are currently taking ATT. Two patients did not take ATT; both of these have persistent symptoms of pus

  3. Contribution to the study of samarium-151 excited levels; Contribution a l'etude des niveaux excites du samarium-151

    Energy Technology Data Exchange (ETDEWEB)

    Locard, P. [Commissariat a l' Energie Atomique, Centre d' Etudes Nucleaires de Grenoble, 38 (France)


    The nucleus of {sup 151}Sm, which has 89 neutrons, happens to be on the lower edge of the deformed nuclei of region II. Therefore, the study of its levels is very interesting for the verification of the goodness of the collective models for deformed nuclei when the deformation is small (we introduce these models in the first chapter). {sup 151}Sm has often been studied, but the direct gamma spectrum measured with a lithium drift-germanium detector (chapter 3) shows many high energy transitions which did not appear in the previous level schemes. In order to settle these transitions, we have undertaken gamma-gamma coincidence spectra (as well as sum-coincidence spectra) experiments with a scintillation spectrometer designed in our laboratory (chapter 2). The investigation of the intensities of these coincidences leads us to modify the last proposed level schemes: we suppress the levels at 405,5 and 650 keV, we add levels at 245,6 - 306,6 - 522 - 952 and 962 keV. We have also verified the multipolarities of the main transitions and measured the half-lives of a few levels (chapter 3) (we find a half-life of 1.1 {+-} 0.5 nanosecond for the level at 167,7 keV). In chapter 4, we compare our results to the predictions of the models described in chapter 1. (author) [French] Le noyau de {sup 151}Sm, qui possede 89 neutrons, se trouve a la limite inferieure des noyaux deformes de la region II. L'etude de ses niveaux excites est donc d'un interet tout particulier pour la verification de la validite des differents modeles collectifs pour les noyaux deformes, lorsque la deformation est petite (nous introduisons ces modeles dans un premier chapitre). Le {sup 151}Sm a deja fait l'objet de nombreuses etudes, mais le spectre gamma direct fait avec une jonction de germanium compense au lithium (chapitre 3), nous a montre l'existence d'un grand nombre de transitions de hautes energies qui ne sont pas placees dans les schemas proposes jusqu'a ce jour. Pour preciser la place de ces transitions, nous avons donc entrepris des experiences de coincidences gamma-gamma (et de ''spectre de somme'') a l'aide d'un ensemble de spectrometrie a scintillation realise au laboratoire (chapitre 2). L'etude des intensites de ces coincidences (chapitre 3) nous amene a modifier le dernier schema propose: nous supprimons les niveaux a 405,5 et 650 keV, nous ajoutons des niveaux a 245,6 - 306,6 - 522 - 952 et 962 keV. Nous avons egalement verifie la multipolarite des principales transitions et mesure la duree de vie de certains des niveaux (chapitre 3) (nous trouvons une periode de 1,1 {+-} 0,5) nanoseconde pour le niveau a 167,7 keV). Le chapitre 4 est enfin consacre a la comparaison de nos resultats avec les predictions des differents modeles decrits au chapitre 1. (auteur)

  4. Quantitative imaging by pixel-based contrast-enhanced ultrasound reveals a linear relationship between synovial vascular perfusion and the recruitment of pathogenic IL-17A-F+IL-23+ CD161+ CD4+ T helper cells in psoriatic arthritis joints. (United States)

    Fiocco, Ugo; Stramare, Roberto; Martini, Veronica; Coran, Alessandro; Caso, Francesco; Costa, Luisa; Felicetti, Mara; Rizzo, Gaia; Tonietto, Matteo; Scanu, Anna; Oliviero, Francesca; Raffeiner, Bernd; Vezzù, Maristella; Lunardi, Francesca; Scarpa, Raffaele; Sacerdoti, David; Rubaltelli, Leopoldo; Punzi, Leonardo; Doria, Andrea; Grisan, Enrico


    To develop quantitative imaging biomarkers of synovial tissue perfusion by pixel-based contrast-enhanced ultrasound (CEUS), we studied the relationship between CEUS synovial vascular perfusion and the frequencies of pathogenic T helper (Th)-17 cells in psoriatic arthritis (PsA) joints. Eight consecutive patients with PsA were enrolled in this study. Gray scale CEUS evaluation was performed on the same joint immediately after joint aspiration, by automatic assessment perfusion data, using a new quantification approach of pixel-based analysis and the gamma-variate model. The set of perfusional parameters considered by the time intensity curve includes the maximum value (peak) of the signal intensity curve, the blood volume index or area under the curve, (BVI, AUC) and the contrast mean transit time (MTT). The direct ex vivo analysis of the frequencies of SF IL17A-F+CD161+IL23+ CD4+ T cells subsets were quantified by fluorescence-activated cell sorter (FACS). In cross-sectional analyses, when tested for multiple comparison setting, a false discovery rate at 10%, a common pattern of correlations between CEUS Peak, AUC (BVI) and MTT parameters with the IL17A-F+IL23+ - IL17A-F+CD161+ - and IL17A-F+CD161+IL23+ CD4+ T cells subsets, as well as lack of correlation between both peak and AUC values and both CD4+T and CD4+IL23+ T cells, was observed. The pixel-based CEUS assessment is a truly measure synovial inflammation, as a useful tool to develop quantitative imaging biomarker for monitoring target therapeutics in PsA.

  5. Results of an investigation to determine local flow characteristics at the air data probe locations using an 0.030-scale model (45-0) of the space shuttle vehicle orbiter configuration 140A/B (modified) in the NASA Ames Research Center unitary plan wind tunnel (OA161, A, B, C), volume 1 (United States)

    Nichols, M. E.


    Results are presented of wind tunnel test 0A161 of a 0.030-scale model 45-0 of the configuration 140A/B (modified) space shuttle vehicle orbiter in the NASA Ames Research Center Unitary Plan Wind Tunnel facilities. The purpose of this test was to determine local total and static pressure environments for the air data probe locations and relative effectiveness of alternate flight-test probe configurations. Testing was done in the Mach number range from 0.30 to 3.5. Angle of attack was varied from -8 to 25 degrees while sideslip varied between -8 and 8 degrees.

  6. Hb Midnapore [β53(D4)Ala→Val; HBB: c.161C>T]: A Novel Hemoglobin Variant with a Structural Abnormality Associated with IVS-I-5 (G>C) (HBB: c.92+5G>C) Found in a Bengali Indian Family. (United States)

    Panja, Amrita; Chowdhury, Prosanto; Basu, Anupam


    We describe a novel C>T substitution at codon 53 of the HBB gene (HBB: c.161C>T). The proband was a transfusion-dependent β-thalassemia major (β-TM) patient. DNA was extracted and subsequently, DNA sequencing was done to detect the mutations on the HBB gene. Capillary zone electrophoresis (CZE) revealed the presence of an unknown peak. She inherited this mutation from her grandmother through her mother. This mutation exists in cis with the common β0 mutation IVS-I-5 (G>C) (HBB: c.92+5G>C). The proband is homozygous for HBB: c.92+5G>C and needs monthly transfusions. On the other hand, her grandmother, mother and sister all possess this novel mutation cis with the heterozygous HBB: c.92+5G>C. They are carriers not thalassemic. This mutation produces the substitution β53(D4)Ala→Val; HBB: c.161C>T, a new structural hemoglobin (Hb) variant. As this variant was identified in a Bengali family from Paschim Midnapore district of West Bengal, India, it has been designated as Hb Midnapore. This variant has now been reported to the HbVar database.

  7. One-step synthesis of samarium-doped ceria and its CO catalysis

    Indian Academy of Sciences (India)


    Key Laboratory for Special Functional Aggregate Materials of Education Ministry,. School of Chemistry and Chemical ... been flourishing since its excellent electric properties were discovered in the 1980s.1 At present SDC is ... absolute ethanol three times and dried in an electric oven at 60°C overnight, and then calcined at ...

  8. Trichloridotris{N-[phenyl(pyridin-2-ylmethylidene]hydroxylamine-κ2N,N′}samarium(III

    Directory of Open Access Journals (Sweden)

    Yahong Li


    Full Text Available The SmIII ion in the title compound, [SmCl3(C12H10N2O3], shows a coordination number of nine with a slightly distorted tricapped trigonal prismatic geometry based on a Cl3N6 donor set. The molecular structure is stabilized by three intramolecular O—H...Cl hydrogen bonds.

  9. Biological studies of samarium-153 bleomycin complex in human breast cancer murine xenografts for therapeutic applications

    Energy Technology Data Exchange (ETDEWEB)

    Bahrami-Samani, A. [Faculty of Nuclear Engineering and Physics, Amirkabir Univ. of Tech., Tehran (Iran); Ghannadi-Maragheh, M. [Faculty of Nuclear Engineering and Physics, Amirkabir Univ. of Tech., Tehran (Iran); Radiopharmaceutical Research and Development Lab. (RRDL), Nuclear Science and Technology Research Inst. (NSTRI), Tehran (Iran); Jalilian, A.R.; Mazidi, M. [Radiopharmaceutical Research and Development Lab. (RRDL), Nuclear Science and Technology Research Inst. (NSTRI), Tehran (Iran)


    In this work, a potential therapeutic DNA targeting agent, {sup 153}Sm-bleomycin complex ({sup 153}Sm-BLM), was developed and the tumor accumulation studies were performed using single photon emission computed tomography (SPECT) and scarification studies. {sup 153}Sm-BLM was prepared at optimized conditions (room temperature, 4-8 h, 0.1 mg bleomycin for 740-3700 MBq {sup 153}SmCl{sub 3}, radiochemical purity over 98%, HPLC, specific activity = 55 TBq/mmol). {sup 153}Sm-BLM was administered into human breast cancer murine xenografts and the biodistribution and imaging studies were performed up to 48 h. {sup 153}Sm-BLM demonstrated superior tumor accumulation properties in contrast with the other radiolabeled bleomycins with tumor:blood ratios of 41, 72 and 182 at 4, 24 and 48 h, respectively, and tumor:muscle ratios of 23, 33 and > 1490 at 4, 24 and 48 h, respectively, while administered intravenously. The SPECT images also demonstrated the obvious tumor uptake at the chest region of the breast-tumor bearing mice. These initial experiments demonstrate significant accumulation of {sup 153}Sm-BLM in tumor tissues. (orig.)

  10. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles

    CSIR Research Space (South Africa)

    Mandiwana, V


    Full Text Available .63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems...

  11. Nanostructured Samarium Doped Fluorapatites and Their Catalytic Activity towards Synthesis of 1,2,4-Triazoles

    National Research Council Canada - National Science Library

    Gangu, Kranthi Kumar; Maddila, Suresh; Maddila, Surya Narayana; Jonnalagadda, Sreekantha B


    ...) and their properties. The nanostructured Sm doped fluorapatites (Sm-FAp) were prepared by a co-precipitation method using four different amino acids, namely glutamic acid, aspartic acid, glycine and histidine...

  12. Samarium(III) picrate tetraethylene glycol complex: Photoluminescence study and active material in monolayer electroluminescent

    Energy Technology Data Exchange (ETDEWEB)

    Kusrini, Eny, E-mail: [Department of Chemical Engineering, Faculty of Engineering, Universitas Indonesia, 16424 Depok (Indonesia); Saleh, Muhammad I. [School of Chemical Sciences, Universiti Sains Malaysia, 11800 Penang (Malaysia); Yulizar, Yoki [Department of Chemistry, Faculty of Mathematics and Natural Sciences, Universitas Indonesia, 16424 Depok (Indonesia); Za' aba, Noor K.; Abd. Majid, W.H. [Solid State Research Laboratory, Department of Physics, Universiti Malaya, 50603 Kuala Lumpur (Malaysia)


    A mononuclear Sm(III) complex involving Pic and EO4 (where Pic=picrate anion and EO4=tetraethylene glycol) has been studied. It shows a bright-orange emission when used as active material in a monolayer electroluminescent device of ITO/EO4-Sm-Pic/Al. The crystal structure of the complex consists of [Sm(Pic){sub 2}(H{sub 2}O)(EO4)]{sup +} cation and [Pic]{sup -} anion. The Sm(III) ion is coordinated with nine oxygen atoms from one EO4 ligand in a pentadentate mode, two Pic anions each in bidentate and monodentate modes, and one water molecule. Both the terminal alcohol groups of the acyclic EO4 ligand were involved in the O-H...O hydrogen bonding by infinite one-dimensional (1D) chain within a symmetry direction [0 1 0]. The photoluminescence (PL) spectrum of the thin film shows the typical spectral features of the Sm(III) ion ({sup 4}G{sub 5/2}{yields}{sup 6}H{sub 7/2} transitions). The root-mean-square (rms) of the roughness of thin film is 30.605 nm and indicates that the formation of the monolayer electroluminescent device is not uniform and retains a high crystallinity. Typical semiconductor current-voltage (I-V) property was also observed in this device with threshold and turn voltages of 2.8 and 6.2 V, respectively. The [Sm(Pic){sub 2}(H{sub 2}O)(EO4)](Pic).H{sub 2}O complex can be applied as a luminescent center in OLED for bright-orange emission. - Highlights: > The [Sm(Pic){sub 2}(H{sub 2}O)(EO4)](Pic).H{sub 2}O complex is crystallized in triclinic with space group P-1. > The complex is applied as a emissive center in monolayer device structure of ITO/EO4-Sm-Pic/Al. > The photoluminescence spectrum of the crystalline and thin film shows a bright-orange emission. > The current-voltage property showed the turn on voltage of 6.2 V.

  13. Pulsed laser deposition and optical characterizations of the magnetic samarium orthoferrite

    Energy Technology Data Exchange (ETDEWEB)

    Berini, Bruno, E-mail: [Groupe d' Etude de la Matiere Condensee (GEMAC), CNRS, Universite de Versailles St. Quentin, 45, Av. des Etats-Unis, 78035 Versailles Cedex (France); Mistrik, Jan [Institute of Applied Physics and Mathematics, Faculty of Chemical Technology, University of Pardubice, Studentska 84, 532 10 Pardubice (Czech Republic); Dumont, Yves; Popova, Elena; Fouchet, Arnaud; Scola, Joseph; Keller, Niels [Groupe d' Etude de la Matiere Condensee (GEMAC), CNRS, Universite de Versailles St. Quentin, 45, Av. des Etats-Unis, 78035 Versailles Cedex (France)


    Pulsed Laser Deposition of magnetically ordered polycrystalline SmFeO{sub 3} films has been optimized onto SiO{sub 2} glass substrates as function of substrate temperature, oxygen pressure and pulsed laser fluency. Using a KrF excimer laser, crystallization temperature is found to be about 1048 K for a weak fluency of only 1.7 J cm{sup -2}. We show that this growth temperature can be reduced using higher fluency and that it is possible to obtain a film texturation along the c axis by reducing the oxygen pressure at given temperature and fluency. In a second part, we focus on the SmFeO{sub 3} optical constants determined by in situ ellipsometry using a stacking model and the Cauchy dispersion relation for SmFeO{sub 3} layer. We show a good correlation between the transmission and reflection calculated from these data and measured by ex situ spectrophotometry in the visible range.

  14. Nanostructured Samarium Doped Fluorapatites and Their Catalytic Activity towards Synthesis of 1,2,4-Triazoles

    Directory of Open Access Journals (Sweden)

    Kranthi Kumar Gangu


    Full Text Available An investigation was conducted into the influence of the amino acids as organic modifiers in the facile synthesis of metal incorporated fluorapatites (FAp and their properties. The nanostructured Sm doped fluorapatites (Sm-FAp were prepared by a co-precipitation method using four different amino acids, namely glutamic acid, aspartic acid, glycine and histidine. The materials were characterized by various techniques including X-ray diffraction (XRD, Fourier transform infra-red spectroscopy (FT-IR, field emission scanning electron microscopy (FE-SEM, energy-dispersive X-ray spectroscopy (EDX, high resolution transmission electron microscopy (HR-TEM, N2-adsorption/desorption isotherm, temperature programmed desorption (TPD and fluorescence spectrophotometry. Under similar conditions, Sm-FAp prepared using different amino acids exhibited distinctly different morphological structures, surface area and pore properties. Their activity as catalysts was assessed and Sm-FAp/Glycine displayed excellent efficiency in the synthesis of 1,2,4-triazole catalyzing the reaction between 2-nitrobenzaldehyde and thiosemicarbazide with exceptional selectivity and 98% yield in a short time interval (10 min. The study provides an insight into the role of organic modifiers as controllers of nucleation, growth and aggregation which significantly influence the nature and activity of the catalytic sites on Sm-FAp. Sm-FAp could also have potential as photoactive material.

  15. Body composition analysis by DEXA by using dynamically changing samarium filtration

    DEFF Research Database (Denmark)

    Gotfredsen, Arne; Baeksgaard, L; Hilsted, J


    , which depends on the current-absorber thickness. With this system we found a good agreement (r = 0.99) between reference and measured amounts of tissue or fat percentages in a plastic phantom and in smaller (approximately 0.5-4 kg) and larger (approximately 5-20 kg) piles of tissue (ox muscle and lard......). Scans of six healthy volunteers covered with combinations of beef and lard (approximately 5-15 kg) showed a good agreement (r = 0.99) between reference and DEXA values of added soft tissue mass and fat percentage. We conclude that the DEXA method (and, in particular, the Norland XR-36 using dynamic...

  16. Synthesis, thermal and photoluminescent properties of ZnSe- based oxyfluoride glasses doped with samarium (United States)

    Kostova, I.; Okada, G.; Pashova, T.; Tonchev, D.; Kasap, S.


    Rare earth (RE) doped glasses and glass ceramic materials have recently received considerable attention because of their potential or realized applications as X-ray intensifying screens, phosphors, detectors, waveguides, lasers etc. [1]. In this work, we present a new RE doped ZnO-ZnSe-SrF2-P2O5-B2O3-Sm2O3-SmF3 (ZSPB) glass system synthesized by melt quenching technique. The resulting glasses were visually fully transparent and stable with glass the transition temperatures around 530°C. The thermal properties of this glass system were characterized by Modulated Differential Scanning Calorimetry (MDSC) measurements before and after annealing at 650°C. We have characterized these glasses by Raman spectroscopy and photoluminescence (PL) measurements over the UV-VIS range using light emitting diodes (LED) and laser diodes (LD) excitation sources. We have also irradiated thermally treated and non-treated glass samples by X-rays and have studied the resulting PL. We discuss the results in terms of previously reported models for Sm-doped Zn-borophosphate oxide, oxyfluoride and oxyselenide glasses.

  17. Laser-Induced Luminescence Study of Samarium(III) Thiodiglycolate Complexes

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Dong Yong; Lee, Eil Hee [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Kimura, Takaumi [Japan Atomic Energy Research Institute, Ibaraki-ken (Japan)


    The hydration number of Sm(III) has been obtained by using the difference in the decay rate constants in H{sub 2}O and D{sub 2}O solutions. In general, k{sub obs}(H{sub 2}O) >> k{sub obs}(D{sub 2}O), k{sub obs}(D{sub 2}O) ≅ constant, and ligands are not as effective in causing non-radiative de-excitation of the excited state. For Sm(III), a relationship has been proposed in which the hydration number is related directly to the decay rate constant in H{sub 2}O. If there is no contribution from the ligand to the de-excitation of the luminescence excited state, the hydration of Sm(III) in the different complexes can be obtained directly from the values of k{sub obs} measured in H{sub 2}O. The number and the geometric distribution of solvent molecules around a metal ion in solution are an important factor in the structural and chemical behavior of cation. Indeed, such information has been utilized to design novel ionophores and receptors. However, there have been few studies of hydration structure for lanthanides. The fact that many f-element salts which have relatively large lattice energies are fairly soluble in water is a reflection of the strength of the interactions between the metal cations and water molecules.

  18. Oxygen Fugacity of the Martian Mantle from Pigeonite/Melt Partitioning of Samarium, Europium and Gadolinium (United States)

    Musselwhite, S.; Jones, J. H.; Shearer, C.


    This study is part of an ongoing effort to calibrate the pyroxene/melt Eu oxybarometer for conditions relevant to the martian meteorites. There is fairly good agreement between a determinations using equilibria between Fe-Ti oxides and the estimates from Eu anomalies in shergottite augites in tenns of which meteorites are more or less oxidized. The Eu calibration was for angrite composition pyroxenes which are rather extreme. However, application of a calibration for martian composition augites 113 does not significantly reduce the discrepancy between the two methods. One possible reason for this discrepancy is that augites are non-liquidus. The use of pigeonite rather than augite as the oxy-barometer phase is considered. We have conducted experiments on martian composition pigeonite/melt REE partitioning as a function of fO2.

  19. Doping controlled spin reorientation in dysprosium-samarium orthoferrite single crystals (United States)

    Cao, Shixun; Zhao, Weiyao; Kang, Baojuan; Zhang, Jincang; Ren, Wei


    As one of the most important phase transitions, spin reorientation (SR) in rare earth transition metal oxides draws much attention of emerging materials technologies. The origin of SR is the competition between different spin configurations which possess different free energy. We report the control of spin reorientation (SR) transition in perovskite rare earth orthoferrite Dy1-xSmxFeO3, a whole family of single crystals grown by optical floating zone method from x =0 to 1. Temperature dependence of the magnetizations under zero-field-cooling (ZFC) and field-cooling (FC) processes are studied. We have found a remarkable linear change of SR transition temperature in Sm-rich samples for x>0.2, which covers an extremely wide temperature range including room temperature. The a-axis magnetization curves under FCC process bifurcate from and then jump down to that of warming process (ZFC and FCW curves) in single crystals when x =0.5-0.9, suggesting complicated 4f-3d electron interactions among Dy3+-Sm3+, Dy3+-Fe3+, and Sm3+-Fe3+ sublattices of diverse magnetic configurations for materials physics and design. The magnetic properties and the doping effect on SR transition temperature in these single crystals might be useful in the spintronics device application. This work is supported by the National Key Basic Research Program of China (Grant No. 2015CB921600), and the National Natural Science Foundation of China (NSFC, Nos. 51372149, 50932003, 11274222).

  20. Synthesis, crystal structure and luminescent properties of a new samarium-fluorescein metal-organic framework (United States)

    Thomas, Jesty; Ambili, K. S.


    A new metal-organic framework with empirical formula C43H30NO12Sm was solvothermally synthesized using SmCl3, fluorescein and N, N-Dimethyl formamide (DMF) and characterized by single crystal X-ray diffraction, powder X-ray diffraction, infrared spectroscopy, UV-Visible spectroscopy, scanning electron microscopy, optical microscopy, photoluminescence spectroscopy, CHN elemental analysis and thermogravimetric analysis. Single crystal X-ray diffraction revealed that the crystal structure belongs to the triclinic system, P-1 space group with a = 12.113 (6) Å, b = 12.1734 (7) Å, c = 13.2760(8) Å, α = 67.930(3)⁰, β = 87.779(3)⁰, γ = 77.603(3)⁰ and V = 1769.71 (17) Å3. The photoluminescence spectrum showed emission peaks at 550 nm, 600 nm and 647 nm due to the characteristic transitions 4G5/2 to 6H5/2, 4G5/2 to 6H7/2 and 4G5/2 to 6H9/2 respectively, when excited at 398 nm.

  1. High-temperature heat capacity of samarium and erbium titanates with pyrochlore structure (United States)

    Denisova, L. T.; Chumilina, L. G.; Denisov, V. M.; Ryabov, V. V.


    Titanates Sm2Ti2O7 and Er2Ti2O7 with pyrochlore structure have been prepared by solid-phase synthesis in air from stoichiometric Sm2O3 (Er2O3)-TiO2 mixtures sequentially at 1673 and 1773 K. Hightemperature heat capacity of the oxide compounds has been determined by differential scanning calorimetry. Their thermodynamic properties have been calculated from experimental temperature dependence C p = f( T).

  2. 40 CFR 51.161 - Public availability of information. (United States)


    ... advertisement in the area affected of the location of the source information and analysis specified in paragraph... submitted by owners and operators. The public information must include the agency's analysis of the effect... the information submitted by the owner or operator and of the State or local agency's analysis of the...

  3. Dicty_cDB: CFJ161 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available sae68c10.y1 Gm-c1064 Glycine max cDNA clone GENOME SYSTEMS CLONE ID: Gm-c1064-3212 5' similar to TR:O65744...sq98c12.y1 Gm-c1049 Glycine max cDNA clone GENOME SYSTEMS CLONE ID: Gm-c1049-1199 5' similar to TR:O65744...sg79d05.y1 Gm-c1007 Glycine max cDNA clone GENOME SYSTEMS CLONE ID: Gm-c1007-2626 5' similar to TR:O65744...saf75f12.y1 Gm-c1078 Glycine max cDNA clone GENOME SYSTEMS CLONE ID: Gm-c1078-2184 5' similar to TR:O65744...sa37e09.y1 Gm-c1004 Glycine max cDNA clone GENOME SYSTEMS CLONE ID: Gm-c1004-1505 5' similar to TR:O24653

  4. 40 CFR 161.101 - Required vs. conditionally required data. (United States)


    ...) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR REGISTRATION OF ANTIMICROBIAL PESTICIDES How To Use Data Tables... with a given general use pattern are needed by EPA to evaluate the risks or benefits of a product... pattern are needed by EPA to evaluate the risks or benefits of a product having that use pattern if the...

  5. 40 CFR 161.390 - Reentry protection data requirements. (United States)


    ...) PESTICIDE PROGRAMS DATA REQUIREMENTS FOR REGISTRATION OF ANTIMICROBIAL PESTICIDES Data Requirement Tables... oncogenic effects or other adverse effects as evidenced by subchronic, chronic, and reproduction studies... scientifically validated toxicological or epidemiological evidence that a pesticide or residue of a pesticide...

  6. 161---8 Dec 2009.indd [final version].indd

    African Journals Online (AJOL)


    Dec 8, 2009 ... Vol. 65 No. 1 Page 5 of 7. Table 1. Type Distribution for preachers, compared with the United Kingdom population norms. N = 389 + = 1% of N I = Selection Ratio Index *<.05 **p<.01 ***p<.001. The sixteen Complete Types. Dichotomous Preference. ISTJ. ISFJ. INFJ. INTJ. E. 147. (37.8%). ***I = 0.72 n = 44.

  7. What we do | Page 161 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Topic(s): Sri Lanka, Remittances, Peace, Terrorism, Conflict Resolution, Community Development. Region(s): Americas, Canada, North And Central America, Asia, South And Central Asia, Sri Lanka. This project will examine the role of diaspora funding and networking in ethno-political conflict in Sri Lanka by examining ...

  8. Dicty_cDB: CFG161 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ktmrtltisfhdf fiwfncfwffiglfgsngaihl*rfckssrtyifvl*lspvycidlhknviyf*hlhily gfnlwsiil*fikenl*fng****kiicns*ly...vnynaisffinvfnnwlhcyndygnns igkprlvictignvfihpl*t Frame C: ---KFMFLVFNLYWTHYVITYTCYSVVSGLVASWYFFADEDFNGMPPKP

  9. Dicty_cDB: SFD161 [Dicty_cDB

    Lifescience Database Archive (English)


  10. Dicty_cDB: SLJ161 [Dicty_cDB

    Lifescience Database Archive (English)


  11. 40 CFR 161.290 - Environmental fate data requirements. (United States)


    ... adsorption/desorption R R R R R TGAI or PAIRA TGAI or PAIRA 163-1 Volatility: (Lab) (2) CR CR CR TEP TEP 163-2 (Field) (2) CR CR CR TEP TEP 163-3 Dissipation studies-field Soil R R R TEP TEP 164-1 Aquatic (sediment) R R TEP TEP 164-2 Forestry R TEP TEP 164-3 Combination and tank mixes (2) 164-4 Soil, long-term...

  12. 33 CFR 161.5 - Deviations from the rules. (United States)


    ... appropriate District Commander. Upon receipt of the written request, the District Commander may authorize a... appropriate VTS Director. Requests to deviate shall be made as far in advance as practicable. Upon receipt of... handling characteristics, traffic density, radar contacts, environmental conditions and other relevant...

  13. 40 CFR 161.640 - Product performance data requirements. (United States)


    ... microbial pests associated with human and animal wastes (1) CR EP* 91-7 Products for treating water systems... data unless the pesticide product bears a claim to control pest microorganisms that pose a threat to..., microorganisms infectious to man in any area of the inanimate environment or a claim to control vertebrates (such...

  14. 40 CFR 161.167 - Discussion of formation of impurities. (United States)


    ... produce other products or substances. (viii) The process control, purification and quality control...) Technical grade active ingredients and products produced by an integrated system. (1) Each impurity associated with the active ingredient which was found to be present in any analysis of the product conducted...

  15. Dicty_cDB: CHP161 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available |CD169096.1 MM1-0024G-M078-E11-U.B MM1-0024 Schistosoma mansoni cDNA cloneMM1-0024G-M078-E11.B, mRNA...|CD169707.1 MM1-0024T-M086-B01-U.B MM1-0024 Schistosoma mansoni cDNA clone MM1-0024T-M086-B01.B, mRNA...|CD169077.1 MM1-0024G-M078-D02-U.B MM1-0024 Schistosoma mansoni cDNA clone MM1-0024G-M078-D02.B, mRNA...|CD169818.1 MM1-0024T-M087-D03-U.B MM1-0024 Schistosoma mansoni cDNA clone MM1-0024T-M087-D03.B, mRNA...|CD168683.1 MM1-0023U-M091-D09-U.B MM1-0023 Schistosoma mansoni cDNA clone MM1-0023U-M091-D09.B, mRNA

  16. A Formal Theory of Perception. Technical Report No. 161. (United States)

    Rottmayer, William Arthur

    An attempt to build a mathematical model of a device that could learn geometry is discussed. The report discusses the background and motivation of the study, the coding problem, the derivation of Suppes "Stimulus-Response Theory of Finite Automata" used in the work in learning theory, and a summary of the technical work. (DB)

  17. March 2001 EAST AFRICAN MEDICAL JOURNAL 161 East African ...

    African Journals Online (AJOL)


    Mar 1, 2001 ... Accident by bicycle 186 5.6 48 1,4 234 70. Dog bite 104 3.1 36 1.1 140 4.2. Accident falling .... useful guide as to whether particular injuries are a problem(5). Lack of complete morbidity data for ... 25 (l%) cases, snake and dog bites 26 (l%) cases each, human bites 13 cases and firearms 21 (1 %) cases.

  18. 9 CFR 161.3 - Standards for accredited veterinarian duties. (United States)


    ..., vaccination or treatment performed by him or her with respect to any animal in that program, unless he or she..., vaccination or treatment performed by him or her with respect to any animal in that program, unless he or she... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Standards for accredited veterinarian...

  19. 161---8 Dec 2009.indd [final version].indd

    African Journals Online (AJOL)


    Dec 8, 2009 ... ABSTRACT. A sample of 389 experienced preachers completed a measure of psychological type. They then read Mark 1:29–39 and recorded their evaluations of the four reflections on this passage proposed by Francis (1997) and which were derived from the SIFT method of biblical hermeneutics and.

  20. Dicty_cDB: SFJ161 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Translated Amino Acid sequence ifkhyn*ytfcffssflffyfhfifhckyi**kik*nkie**ik*KRMSSPPTTTTTTTT STGGNQETPKAI...sequence (All Frames) Frame A: ifkhyn*ytfcffssflffyfhfifhckyi**kik*nkie**ik*KRMSSPPTTTTTTTT STGGNQETPKAI

  1. What we do | Page 161 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    This knowledge can be used as a tool for addressing pressing global challenges. ... and future generations from the devastating health, social, environmental and economic consequences of tobacco consumption and exposure to tobacco smoke. ... Argentina, Bangladesh, Brazil, India, Kenya, Lebanon, Malawi, Viet Nam.

  2. 14 CFR 16.1 - Applicability and description of part. (United States)


    ..., regulation, or other authority that provides an administrative process for the investigation or adjudication of complaints by a Federal agency other than the FAA, persons shall use the administrative process... section 308 of the Federal Aviation Act of 1958, as amended). (2) Requirements of the Anti-Head Tax Act...

  3. What we do | Page 161 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Livelihood Diversification for Smallholder Tobacco Farmers in South Nyanza, Kenya - Phase I. Most of Kenya's tobacco production takes place in the South Nyanza region, where the land under tobacco cultivation has increased rapidly and often at the expense of traditional food crops and livestock activities. Kenya, North ...

  4. All projects related to | Page 161 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)


    This research will investigate how inclusive urban planning and governance can help reduce urban tensions, conflicts, inequalities, and violence in five Indian cities (Ahmedabad, Gurgaon, Patna, Guwahati, and Bidar). Start Date: December 21, 2012. End Date: September 12, 2016. Topic: VIOLENCE, Poverty, URBAN ...


    African Journals Online (AJOL)

    effectiveness of on-shore oil spillage remediation in Port-Harcourt in particular and the Niger. Delta region in ... The yearly mean. Eni D. D. & Okpiliya F. E. - Evaluation of On-Shore Oil Spill Remediation Operations in Port Harcourt, Nigeia .... contaminated environment for the purpose of detoxification of toxic pollutants.

  6. 40 CFR 80.161 - Detergent additive certification program. (United States)


    ... new certification information which demonstrates that the modification is consistent with the... fuel specifications must include: (A) The sulfur content in weight percent. (B) The T-90 distillation... the detergent may lose its eligibility to be used to comply with the detergency requirements of this...

  7. Dicty_cDB: SSG161 [Dicty_cDB

    Lifescience Database Archive (English)


  8. Publications | Page 161 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Cette publication explore le sens que revêt l'agriculture et guide le lecteur à travers un nouveau territoire à la jonction de l'alimentation, de l'écologie et de la culture. Dans les systèmes alimentaires d'Asie du Sud, la démarcation entre biodiversité cultivée et biodiversité naturelle s'... The Future Control of Food : A Guide to ...

  9. 21 CFR 161.170 - Canned Pacific salmon. (United States)


    ... 1.814 kg (64 oz). 301×411 454 g (16 oz). 301×408 439 g (151/2 oz). 401×211 439 g (151/2 oz). 607×406×108 439 g (151/2 oz). 301×308 340 g (12 oz). 307×200.25 220 g (73/4 oz). 513×307×103 220 g (73/4 oz... substandard fill specified in § 130.14(b) of this chapter, in the manner and form therein specified. [42 FR...

  10. 40 CFR 161.190 - Physical and chemical characteristics. (United States)


    .... (3) Required if technical chemical is organic and non-polar. (4) Required if test substance is dispersible with water. (5) Required if product contains an oxidizing or reducing agent. (6) Required if... pressure TGAI or PAI TGAI or PAI 63-9 Dissociation constant TGAI or PAI TGAI or PAI 63-10 Octanol/water...

  11. Dicty_cDB: SFF161 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CP000529_2493( CP000529 |pid:none) Polaromonas naphthalenivorans C... 45 0.002 AL132969_20( AL132969 |pid:none)...003 CP000530_47( CP000530 |pid:none) Polaromonas naphthalenivorans CJ2... 44 0.003 protein update 2009.

  12. Publications | Page 161 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Culture, Environment, and Food to Prevent Vitamin A Deficiency. Dans cet ouvrage qui s'adresse aux planificateurs du développement et aux étudiants en nutrition, santé publique et anthropologie culturelle humaine, on aborde des enjeux de l'utilisation des sources naturelles d'aliments pour prévenir la carence en ...

  13. 19 CFR 161.2 - Enforcement for other agencies. (United States)


    ... exportations of arms, ammunition, implements of war, helium gas, and other munitions of war are governed by...) Importations and exportations of controlled substances are governed by laws administered by the Drug...

  14. 21 CFR 161.175 - Frozen raw breaded shrimp. (United States)


    ... the sieves under a faucet, preferably with spray attached, and rinse shrimp with no rubbing of flesh... careful to avoid undue pressure or rubbing, and return each shrimp to the sieve. Remove the top sieve and...

  15. Modular forms and special cycles on Shimura curves (AM-161)

    CERN Document Server

    Kudla, Stephen S; Yang, Tonghai


    Modular Forms and Special Cycles on Shimura Curves is a thorough study of the generating functions constructed from special cycles, both divisors and zero-cycles, on the arithmetic surface ""M"" attached to a Shimura curve ""M"" over the field of rational numbers. These generating functions are shown to be the q-expansions of modular forms and Siegel modular forms of genus two respectively, valued in the Gillet-Soulé arithmetic Chow groups of ""M"". The two types of generating functions are related via an arithmetic inner product formula. In addition, an analogue of the classical Siegel-Weil


    African Journals Online (AJOL)

    the child after collecting same willingly give in for it with the adult, it is said to be rape as well. ... in their teens, while others are matured adults (Obasi, 2007). ... Christian teen girls are no less likely to become victims of the rape". Rape cases are not limited to Nigeria alone. Other countries of the globe have their own side of ...

  17. 7 CFR 4279.161 - Filing preapplications and applications. (United States)


    ... list of assumptions showing the basis for the projections. (8) Lender's complete written analysis... including a cash-flow analysis, history of debt repayment, necessity of any debt refinancing, and the credit... borrower's history, projections and equity, and the collateral to be obtained. (17) Any additional...

  18. What we do | Page 161 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Mariam Nakawa, photographed near her mine shaft at a gold mining site in central Uganda ... Golden girls: The hidden role of women in Africa's artisanal mines ... (graduate students, professors, researchers) from Canada and Latin America and the Caribbean (LAC) opportunities for face-to-face dialogue on development ...

  19. 40 CFR 161.32 - Format of data submission. (United States)


    ... of a published document, all relevant facts of publication, such as the journal title, volume, issue... include the following elements in addition to the study itself: (i) A title page, as described in... oversize pages and glued bindings are not acceptable. (c) Contents of title page. Each individual study...

  20. Dicty_cDB: AFM161 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available eus Uni-Zap XR EST Library Sp... 46 0.003 2 ( GO147943 ) CAGA3319.fwd CAGA Alvinella pompejana Normalized ...... 40 0.005 3 ( GO097927 ) CAFZ1859.fwd CAFZ Alvinella pompejana Incyte regu... 40

  1. 33 CFR 161.1 - Purpose and Intent. (United States)


    ..., enhances the safe routing of vessels through congested waterways or waterways of particular hazard. Under... promote safe vessel movement by reducing the potential for collisions, rammings, and groundings, and the...) Vessel Traffic Services provide the mariner with information related to the safe navigation of a waterway...

  2. Fluorescence enhancement of samarium (III) perchlorate by 1,10-phenanthroline on Phenylnaphthoylmethyl sulfoxide complex and luminescence mechanism

    Energy Technology Data Exchange (ETDEWEB)

    Li, Wen-Xian, E-mail:; Feng, Shu-Yan; Liu, Yu; Zhang, Jing; Xin, Xiao-Dong; Ao, Bo-Yang; Li, Ying-Jie


    A novel ligand, Phenylnaphthoylmethyl sulfoxide, was synthesized by a new method. Its novel binary complex, SmL{sub 5}·(ClO{sub 4}){sub 3}·2H{sub 2}O, and the ternary complex, SmL{sub 4}·L′(ClO{sub 4}){sub 3}·2H{sub 2}O, had been synthesized (using Phenylnaphthoylmethyl sulfoxide as the first ligand L, 1,10-phenanthroline as the second ligand L′). The complexes were characterized by element analysis, coordination titration, molar conductivity, IR, TG-DSC, {sup 1}HNMR and UV spectra. Their fluorescence emission mechanism, fluorescence intensities and phosphorescence spectra of the two ligands were also investigated by comparison. Fluorescent spectra illustrated that the ternary rare-earth complex presented stronger fluorescence intensity than the binary rare-earth complex in such material. The strongest characteristic fluorescence emission intensity of the ternary system was 1.81 times as strong as that of the binary system. By the analysis of fluorescence and phosphorescence spectra, it was found that the Phenylnaphthoylmethyl sulfoxide and phen had the advantage to absorb and transfer energy to Sm (III) ions effectively, and then the complexes emitted the characteristic fluorescence of Sm (III) ions. The phosphorescence spectra and fluorescence lifetime of the complexes were also measured. -- Highlights: • A novel ligand, Phenylnaphthoylmethyl sulfoxide, has been synthesized. • Its novel ternary complex and the binary complex have been synthesized. • The fluorescence emission intensity of ternary rare earth complex exhibit obvious enhancement. • The fluorescence emission mechanism and phosphorescence spectra are also investigated.

  3. Polypropylene oil as fuel for solid oxide fuel cell with samarium doped-ceria (SDC)-carbonate as electrolyte (United States)

    Syahputra, R. J. E.; Rahmawati, F.; Prameswari, A. P.; Saktian, R.


    The research focusses on converting polypropylene oil as pyrolysis product of polypropylene plastic into an electricity. The converter was a direct liquid fuel-solid oxide fuel cell (SOFC) with cerium oxide based material as electrolyte. The polypropylene vapor flowed into fuel cell, in the anode side and undergo oxidation reaction, meanwhile, the Oxygen in atmosphere reduced into oxygen ion at cathode. The fuel cell test was conducted at 400 - 600 °C. According to GC-MS analysis, the polypropylene oil consist of C8 to C27 hydrocarbon chain. The XRD analysis result shows that Na2CO3 did not change the crystal structure of SDC even increases the electrical conductivity. The maximum power density is 0.079 at 773 K. The open circuite voltage is 0.77 volt. Chemical stability test by analysing the single cell at before and after fuel cell test found that ionic migration occured during fuel cell operation. It is supported by the change of elemental composition in the point position of electrolyte and at the electrolyte-electrode interface

  4. A distribution pattern of cadmium, gadolinium and samarium in Phaseolus vulgaris (L) plants as assessed by dynamic neutron radiography (United States)

    Kőrösi, Ferenc; Balaskó, Márton; Sváb, Erzsébet


    The qualitative and semi-quantitative distributions, presumably apoplast transport patterns for the Gd, Sm and Cd were investigated in the primordial leaf tissues of the bean using dynamic neutron radiography. According to the applied 3D, 2D images and the pixel count distribution histograms of the considered gray levels, peculiar distribution patterns were postulated for the elements. Main and lateral vascular systems for Gd, the cell walls as well as intercellular spaces for Sm and the main leaf vein for Cd assumed to be the apoplast transport spaces and volumes.

  5. Ab initio calculation of the migration free energy of oxygen diffusion in pure and samarium-doped ceria (United States)

    Koettgen, Julius; Schmidt, Peter C.; Bučko, Tomáš; Martin, Manfred


    We have studied the free energy migration barriers Δ F‡ for oxygen diffusion in pure ceria and Sm-doped ceria for the temperatures 300, 700, and 1000 K. We used the density functional theory in the generalized gradient approximation and an additional Hubbard U parameter for the Ce 4 f electronic states. We compare the results for the free energy deduced from three different methods. First, a static harmonic approach is applied in which the temperature dependent vibrational contributions to energy and entropy are deduced from the phonon frequencies of supercells with a fixed volume. Second, a static quasiharmonic approach is used in which a part of the anharmonicity effect is introduced via an implicit dependence of the harmonic frequencies on the thermally expanding cell volume. Third, the free energy barriers are calculated using metadynamics and molecular dynamics in which anharmonicity effects are naturally taken into account. The three methods examined in this study lead to distinctly different results. According to the harmonic approximation, the migration free energy difference Δ F‡ increases with increasing temperature due to an increasing entropic contribution. According to the quasiharmonic approximation, the migration free energy is independent of temperature. Finally, molecular dynamics predicts a thermally induced increase in the migration free energy. We conclude that temperature dependent experimental lattice constants cancel out the increasing entropic contribution with increasing temperature in the static quasiharmonic approach. The full consideration of anharmonicity effects in the metadynamics method again leads to a temperature dependent migration free energy.

  6. Studies on the preparation and stability of samarium-153 propylene diamine tetramethylene phosphonate (PDTMP) complex as a bone seeker

    Energy Technology Data Exchange (ETDEWEB)

    Majali, M.A. E-mail:; Mathakar, A.R.; Shimpi, H.H.; Banerjee, Sharmila; Samuel, Grace


    Propylene diamine tetra methylene phosphonate (PDTMP) was synthesised by modifying a method reported for the synthesis of EDTMP. Complexation of the synthesised phosphonate ligand with {sup 153}Sm was carried out by varying the experimental parameters and the complex was radiochemically characterized. Biodistribution studies showed that the uptake by bone in rats was 2% per g of bone, which was retained up to 48 h. The uptake by other organs was insignificant, except by the liver which showed a slightly higher absorption.

  7. Crystal structure of a samarium(III nitrate chain cross-linked by a bis-carbamoylmethylphosphine oxide ligand

    Directory of Open Access Journals (Sweden)

    Julie A. Stoscup


    Full Text Available In the title compound poly[aquabis(μ-nitrato-κ4O,O′:O,O′′tetrakis(nitrato-κ2O,O′{μ4-tetraethyl [(ethane-1,2-diylbis(azanediylbis(2-oxoethane-2,1-diyl]diphosphonate-κ2O,O′}disamarium(III], [Sm2(NO36(C14H30N2O8P2(H2O]n, a 12-coordinate SmIII and a nine-coordinate SmIII cation are alternately linked via shared bis-bidentate nitrate anions into a corrugated chain extending parallel to the a axis. The nine-coordinate SmIII atom of this chain is also chelated by a bidentate, yet flexible, carbamoylmethylphoshine oxide (CMPO ligand and bears one water molecule. This water molecule is hydrogen bonded to nitrate groups bonded to the 12-coordinate SmIII cation. The CMPO ligand, which lies about an inversion center, links neighboring chains along the c axis, forming sheets parallel to the ac plane. Hydrogen bonds between the amide NH group and metal-bound nitrate anions are also present in these sheets. The sheets are packed along the b axis through only van der Waals interactions.

  8. Structure, reactivity, electronic configuration and magnetism of samarium atomic layers deposited on Si(0 0 1) by molecular beam epitaxy

    Energy Technology Data Exchange (ETDEWEB)

    Gheorghe, Nicoleta G.; Lungu, George A.; Husanu, Marius A.; Costescu, Ruxandra M.; Macovei, Dan [National Institute of Materials Physics, Atomistilor 105 b, 077125 Magurele-Ilfov (Romania); Teodorescu, Cristian M., E-mail: [National Institute of Materials Physics, Atomistilor 105 b, 077125 Magurele-Ilfov (Romania)


    The surface structure, interface reactivity, electron configuration and magnetic properties of Sm layers deposited on Si(0 0 1) at various temperatures are investigated by low-energy electron diffraction (LEED), X-ray photoelectron spectroscopy (XPS), X-ray absorption spectroscopy (XAS) and magneto-optical Kerr effect (MOKE). It is found that metal Sm is present on samples prepared at low temperature, with an interface layer containing SmSi{sub 2} and Sm{sub 4}Si{sub 3}. When samples are prepared at high temperature, much less metal Sm is found, with an increasing amount of SmSi{sub 2}. Room temperature ferromagnetism is observed for all prepared layers, with a decrease of the saturation magnetization when samples are prepared at high temperature. It is found that ferromagnetism implies mostly a compound with approximate stoichiometry Sm{sub 4}Si{sub 3}. Also, the decrease in the intensity of the XAS 2p{sub 3/2} → 3d white lines with the corresponding increasing amount of SmSi{sub 2} may be explained by assuming a higher occupancy of Sm 5d orbitals (5d{sup 2} configuration), most probably due to hybridation effects.

  9. Calculation and comparison of xenon and samarium reactivities of the HEU, LEU core in the low power research reactor. (United States)

    Dawahra, S; Khattab, K; Saba, G


    Comparative studies for the conversion of the fuel from HEU to LEU in the Miniature Neutron Source Reactor (MNSR) have been performed using the MCNP4C and GETERA codes. The precise calculations of (135)Xe and (149)Sm concentrations and reactivities were carried out and compared during the MNSR operation time and after shutdown for the existing HEU fuel (UAl4-Al, 90% enriched) and the potential LEU fuels (U3Si2-Al, U3Si-Al, U9Mo-Al, 19.75% enriched and UO2, 12.6% enriched) in this paper using the MCNP4C and GETERA codes. It was found that the (135)Xe and (149)Sm reactivities did not reach their equilibrium reactivities during the daily operating time of the reactor. The (149)Sm reactivities could be neglected compared to (135)Xe reactivities during the reactor operating time and after shutdown. The calculations for the UAl4-Al produced the highest (135)Xe reactivity in all the studied fuel group during the reactor operation (0.39 mk) and after the reactor shutdown (0.735 mk), It followed by U3Si-Al (0.34 mk, 0.653 mk), U3Si2-Al (0.33 mk, 0.634 mk), U9Mo-Al (0.3 mk, 0.568 mk) and UO2 (0.24 mk, 0.448 mk) fuels, respectively. Finally, the results showed that the UO2 was the best candidate for fuel conversion to LEU in the MNSR since it gave the lowest (135)Xe reactivity during the reactor operation and after shutdown. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Development of samarium [{sup 32}P] phosphate colloid for radiosynoviorthesis applications: Preparation, biological and preliminary clinical studies experience

    Energy Technology Data Exchange (ETDEWEB)

    Prabhakar, G. [Radiopharmaceuticals Programme, Board of Radiation and Isotope Technology (BRIT), BARC Vashi Complex, Sector-20, Navi Mumbai 400 705 (India)], E-mail:; Sachdev, Satbir S.; Umamaheswari, S.; Sivaprasad, N.; Bhatia, Manohar H. [Radiopharmaceuticals Programme, Board of Radiation and Isotope Technology (BRIT), BARC Vashi Complex, Sector-20, Navi Mumbai 400 705 (India); Chaudhari, Pradip R. [Laboratory Nuclear Medicine Services, BARC, Mumbai 400 012 (India); Solav, Srikant V. [Spect Lab, Nuclear Medicine Services, Opposite Dinanath Mangeshkar Hospital, Pune 411004 (India)


    A new therapeutic radio colloid for radiosynoviorthesis (RS) applications is reported. The method of preparation involves the reaction of SmCl{sub 3} carrier with carrier added [{sup 32}P]H{sub 3}PO{sub 4} in the presence of gelatin. The pure colloid was recovered by dialysis purification leading to radiochemical yield of around 90%. The radiochemical purity of the pure colloid formulated in isotonic saline was over 98%, for the usage period of 14 days, as assessed by paper chromatography. Ninety percent of colloid particles were in the size of 1-10 {mu}m as evident from the laser diffraction particle size analysis, ideally suitable for the intended end use. Animal studies revealed complete retention of the radio colloid in the rabbit knee joint. The results of clinical trials in humans are satisfactory and encouraging, satisfactory retention of the colloid in the knee joint and negligible leakage into the systemic circulation.

  11. KN161L01: WHOI cruise 161 leg 01 aboard the R/V Knorr from 2000-01-12 - 2000-01-20 (NODC Accession 0064332) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Post-cruise download of raw data from shipboard computer(s) as furnished by the Woods Hole Oceanographic Institution Shipboard Scientific Support Group and archived...

  12. KN161L07: WHOI cruise 161 leg 07 aboard the R/V Knorr from 2000-05-18 - 2000-06-05 (NODC Accession 0064323) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Post-cruise download of raw data from shipboard computer(s) as furnished by the Woods Hole Oceanographic Institution Shipboard Scientific Support Group and archived...

  13. KN161L05: WHOI cruise 161 leg 05 aboard the R/V Knorr from 2000-03-19 - 2000-04-05 (NODC Accession 0064325) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Post-cruise download of raw data from shipboard computer(s) as furnished by the Woods Hole Oceanographic Institution Shipboard Scientific Support Group and archived...

  14. KN161L06: WHOI cruise 161 leg 06 aboard the R/V Knorr from 2000-04-05 - 2000-05-16 (NODC Accession 0064324) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Post-cruise download of raw data from shipboard computer(s) as furnished by the Woods Hole Oceanographic Institution Shipboard Scientific Support Group and archived...

  15. KN161L09: WHOI cruise 161 leg 09 aboard the R/V Knorr from 2000-07-03 - 2000-09-08 (NODC Accession 0057655) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Post-cruise download of raw data from shipboard computer(s) as furnished by the Woods Hole Oceanographic Institution Shipboard Scientific Support Group and archived...

  16. Tetrakis(μ-propanoato-κ2O:O′bis[(1,10-phenanthroline-κ2N,N′(propanoato-κ2O,O′samarium(III

    Directory of Open Access Journals (Sweden)

    Chun-Xiang Wang


    Full Text Available The title complex, [Sm2(C3H5O26(C12H8N22], is a dinuclear centrosymmetric molecule, in which two crystallographically equivalent Sm atoms, separated by 3.9502 (2 Å, are bridged by four propanoate anions. Each Sm atom is coordinated by two N atoms from one chelating phenanthroline ligand and seven carboxylate O atoms from five propanoate anions, to form a distorted tricapped trigonal prism.

  17. Processing of composites based on NiO, samarium-doped ceria and carbonates (NiO-SDCC as anode support for solid oxide fuel cells

    Directory of Open Access Journals (Sweden)

    Lily Siong Mahmud


    Full Text Available NiO-SDCC composites consisting of NiO mixed with Sm-doped ceria (SDC and carbonates (Li2CO3 and Na2CO3 were sintered at different temperatures and reduced at 550 °C. The influence of reduction on structure of the NiO-SDCC anode support for solid oxide fuel cells (SOFCs was investigated. Raman spectra of the NiO-SDCC samples sintered at 500, 600 and 700 °C showed that after reducing at 550 °C NiO was reduced to Ni. In addition, SDC and carbonates (Li2CO3 and Na2CO3 did not undergo chemical transformation after reduction and were still detected in the samples. However, no Raman modes of carbonates were identified in the NiO-SDCC pellet sintered at 1000 °C and reduced at 550 °C. It is suspected that carbonates were decomposed at high sintering temperature and eliminated due to the reaction between the CO32– and hydrogen ions during reduction in humidified gases at 550 °C. The carbonate decomposition increased porosity in the Ni-SDCC pellets and consequently caused formation of brittle and fragile structure unappropriated for SOFC application. Because of that composite NiO-SDC samples without carbonates were also analysed to determine the factors affecting the crack formation. In addition, it was shown that the different reduction temperatures also influenced the microstructure and porosity of the pellets. Thus, it was observed that Ni-SDC pellet reduced at 800 °C has higher electrical conductivity of well-connected microstructures and sufficient porosity than the pellet reduced at 550 °C.

  18. The single cell of low temperature solid oxide fuel cell with sodium carbonate-SDC (samarium-doped ceria) as electrolyte and biodiesel as fuel (United States)

    Rahmawati, F.; Nuryanto, A.; Nugrahaningtyas, K. D.


    In this research NSDC (composite of Na2CO3-SDC) was prepared by the sol-gel method to produce NSDC1 and also by the ceramic method to produce NSDC2. The prepared NSDC then were analyzed by XRD embedded with Le Bail refinement to study the change of characteristic peaks, their crystal structure, and their cell parameters. Meanwhile, the measurement of impedance was conducted to study the electrical conductivity of the prepared materials. A single cell was prepared by coating NSDC-L (a composite of NSDC with Li0.2Ni0.7Cu0.1O2) on both surfaces of NSDC. The NSDC-L was used as anode and cathode. The ionic conductivity of NSDC1 and NSDC2 at 400 oC are 4.1109 x 10-2 and 1.6231 x 10-2, respectively. Both electrolytes have ionic conductivity higher than 1 x 10-4, therefore, can be categorized as good electrolyte [1]. However, the NSDC1 shows electrodeelectrolyte conduction. It indicates the existence of electronic migration from electrolyte- electrode or vice versa. Those may cause a short circuit during fuel cell operation and will reduce the fuel cell performance fastly. The single cell tests were conducted at 300, 400, 500 and 600 °C. The single fuel cell with NSDC1 and NSDC2 as electrolyte show maximum power density at 400 °C with the power density of 3.736 x 10-2 and 2.245 x 10-2, respectively.

  19. Samarium-neodymium chronology and rubidium-strontium systematics of an Allende calcium-aluminum-rich inclusion with implications for 146Sm half-life (United States)

    Marks, N. E.; Borg, L. E.; Hutcheon, I. D.; Jacobsen, B.; Clayton, R. N.


    Calcium-aluminum-rich inclusions (CAIs) are primitive objects that formed within the protoplanetary disk surrounding the young Sun. Recent Pb-Pb chronologic studies have demonstrated that CAIs are the oldest solar system solids, crystallizing 4567 Ma ago (Amelin et al., 2002; Connelly et al., 2012). The isotope systematics of CAIs therefore provide critical insight into the earliest history of the Solar System. Although Sm-Nd and Rb-Sr geochronometers are highly effective tools for investigating cosmochemical evolution in the early Solar System, previous studies of CAIs have revealed evidence for isotopically disturbed systems. Here we report new age data for Allende CAI Al3S4 derived from both the long-lived (147Sm-143Nd) and short-lived (146Sm-142Nd) isotopic systems. The 147Sm-143Nd chronometer yields an age of 4560 ± 34 Ma that is concordant with 207Pb-206Pb ages for CAIs and indicates that the Sm-Nd system was not significantly disturbed by secondary alteration or nucleosynthetic processes. The slope of the 146Sm-142Nd isochron defines the Solar System initial 146Sm/144Sm of 0.00828 ± 0.00044. This value is significantly different from the value of 0.0094 determined by Kinoshita et al. (2012). Ages recalculated from all published 146Sm-142Nd isochron data using the traditional 103 Ma half-life and the initial 146Sm/144Sm value determined here closely match Pb-Pb and 147Sm-143Nd ages determined on the same samples. In contrast, ages recalculated using the 68 Ma half-life determined by Kinoshita et al. (2012) and either of the initial 146Sm/144Sm values are often anomalously old. This is particularly true for the youngest samples with 146Sm-142Nd isochron ages that are most sensitive to the choice of 146Sm half-life used in the age calculation. In contrast to the Sm-Nd isotope system, the Rb-Sr system is affected by alteration but yields an apparent isochron with a slope corresponding to a much younger age of 4247 ± 110 Ma. Although the Rb-Sr system in CAIs appears to be disturbed, the initial 87Sr/86Sr value determined from the isochron is 0.698942 ± 0.000008, and closely approximates estimates of the initial Solar System value. Although this isochron may be a mixing line, it might also record alteration on the Allende parent body in which Rb was added to the Al3S4 CAI that was initially largely devoid of Rb.

  20. Anthropogenic dissolved and colloid/nanoparticle-bound samarium, lanthanum and gadolinium in the Rhine River and the impending destruction of the natural rare earth element distribution in rivers (United States)

    Kulaksız, Serkan; Bau, Michael


    The strong increase in the consumption of rare earth elements (REE) in high-tech products and processes is accompanied by increasing amounts of REE released into the environment. Following the first report of Gd contamination of the hydrosphere in 1996, anthropogenic Gd originating from contrast agents has now been reported worldwide from river and estuarine waters, coastal seawater, groundwater and tap water. Recently, microcontamination with La, that is derived from a point source where catalysts for petroleum refining are produced, has been detected in the Rhine River in Germany and the Netherlands. Here we report the occurrence of yet another REE microcontamination of river water: in addition to anthropogenic Gd and La, the Rhine River now also shows significant amounts of anthropogenic Sm. The anthropogenic Sm, which enters the Rhine River north of Worms, Germany, with the same industrial wastewater that carries the anthropogenic La, can be traced through the Middle and Lower Rhine to the Netherlands. At Leverkusen, Germany, some 250 km downstream from the point source at Worms, anthropogenic Sm still contributes up to 87% of the total dissolved Sm concentration of the Rhine River. Results from ultrafiltration suggest that while the anthropogenic Gd is not particle-reactive and hence exclusively present in the truly dissolved REE pool (Worms get close to and well-above, respectively, the levels at which ecotoxicological effects have been documented. Because of the increasing use of REE and other formerly "exotic" trace elements in high-tech applications, these critical metals have now become emerging contaminants that should be monitored, and it appears that studies of their biogeochemical behavior in natural freshwaters might soon no longer be possible.

  1. Ultra-Sensitive Nano Optical Sensor Samarium-Doxycycline Doped in Sol Gel Matrix for Assessment of Glucose Oxidase Activity in Diabetics Disease. (United States)

    Tharwat, Marwa M; Attia, M S; Alghamdi, M S; Mahros, Amr M


    A low cost and very sensitive method for the determination of the activity of glucose oxidase enzyme in different diabetics serum samples was developed. The method based on the assessment of the H2O2 concentration produced from the reaction of the glucose oxidase (GOx) enzyme with glucose as substrate in the serum of diabetics patients by nano optical sensor Sm-doxycycline doped in sol gel matrix. H2O2 enhances the luminescence intensity of all bands of the nano Sm-doxycycline complex [Sm-(DC)2](+) doped in sol-gel matrix, especially the 645 nm band at λex = 400 nm and pH 7.0 in water. The influence of the different analytical parameters that affect the luminescence intensity of the nano optical sensor, e.g. pH, H2O2 concentration and foreign ions concentrations were studied. The remarkable enhancement of the luminescence intensity of nano optical sensor [Sm-(DC)2](+) complex in water at 645 nm by the addition of various concentrations of H2O2 was successfully used as an optical sensor for the assessment of the activity of the glucose oxidase enzyme in different diabetics serum samples. The calibration plot was achieved over the activity range 0.1-240 U/L with a correlation coefficient of 0.999 and a detection limit of 0.05 U/L.

  2. Effect of Mg doping and sintering temperature on structural and morphological properties of samarium-doped ceria for IT-SOFC electrolyte (United States)

    Ahmad, Syed Ismail; Mohammed, Tasneem; Bahafi, Amal; Suresh, Madireddy Buchi


    Samples of Sm and Mg co-doped ceria electrolyte of Ce1- x Sm x- y Mg y O2- δ ( x = 0.2; y = 0.00, 0.05, 0.1, 0.15, and 0.175) were synthesized by sol-gel process. The prepared samples were sintered at 1100 and 1400 °C for 4 h. The bulk densities were measured by Archimedes method. XRD measurements indicate that the synthesized samples were in single-phase cubic fluorite structure (space group Fm3m). The cell parameters decrease with the concentration of Mg, and 2 θ values slightly shift towards right. The particle sizes obtained were between 7.14 and 17.44 nm. The sintered sample achieved 95% of theoretical density. FTIR spectra of samples sintered at 1400 °C indicates weak interactions between 3550-3400 cm-1 and 1600-1300 cm-1 are attributed to O-H stretching modes and strong bonds 850-450 cm-1 are assigned to characteristic Ce-O vibrations. The surface morphology and chemical composition were analyzed by SEM and EDS, SEM micrographs show spherical faceted grains, and the samples were crack free, dense material with some pores on surface which are inconsistent with density results. The average grain size obtained was 0.5 μm. Particle size obtained by TEM was in agreement with that obtained by XRD. The high-density ceria co-doped ceramic can be used as electrolyte in SOFC.

  3. Synthesis, spectroscopic, thermal and antimicrobial studies of neodymium(III) and samarium(III) complexes derived from tetradentate ligands containing N and S donor atoms (United States)

    Ain, Qurratul; Pandey, S. K.; Pandey, O. P.; Sengupta, S. K.


    Trivalent lanthanide complexes of the type [Ln(L)Cl(H2O)2] (where Ln = Nd(III) or Sm(III) and LH2 = Schiff bases derived by the condensation of 3-(phenyl/substitutedphenyl)-4-amino-5-mercapto-1,2,4-triazole with diacetyl/benzil) have been synthesized by the reactions of anhydrous lanthanide(III) chloride with Schiff bases in methanol. The structures of the complexes have been proposed on the basis of elemental analysis, electrical conductance, magnetic moment, spectroscopic measurements (IR, 1H, 13C NMR and UV-vis spectra) and X-ray diffraction studies. The spectral data reveal that the Schiff base ligands behave as dibasic tetradentate chelating agents having coordination sites at two thiol sulfur atoms and two azomethine nitrogen atoms. The presence of coordinated water in metal complexes was confirmed by thermal and IR data of the complexes. All the Schiff bases and their metal complexes have also been screened for their antibacterial activity against Bacillus subtilis, Staphylococcus aureus and antifungal activities against Aspergillus niger, Curvularia pallescens and Colletotrichum capsici.

  4. Logarithmic temperature dependence of samarium ion valence in the heavy-fermion S mxL a1 -xO s4S b12 (United States)

    Fushiya, Kengo; Miyazaki, Ryoichi; Higashinaka, Ryuji; Yamada, Akira; Mizumaki, Masaichiro; Tsutsui, Satoshi; Nitta, Kiyofumi; Uruga, Tomoya; Suemitsu, Bunya; Sato, Hideyuki; Aoki, Yuji


    We have measured x-ray absorption spectra at the Sm L3 edge to investigate the Sm-ion valence of (S mxL a1 -x) O s4S b12 , in which field-insensitive heavy-fermion behavior appears at low temperatures for x =1 . It has been found that the Sm-ion valance shifts to 2 + with La ion substitution; from v =+2.78 (x =1 ) to v =+2.73 (x =0.2 ) at 10 K. For all x investigated, its temperature dependence shows a logT behavior, indicating that the valence change is caused by "an unconventional Kondo effect" associated with Sm 4 f -electron charge degrees of freedom. Almost x independence of "the associated Kondo temperature" (T˜K=56 ±10 K ) indicates that the Kondo effect has a local nature, attributable to the cage structure of the filled skutterudite.

  5. Rare earth elements in the aragonitic shell of freshwater mussel Corbicula fluminea and the bioavailability of anthropogenic lanthanum, samarium and gadolinium in river water

    Energy Technology Data Exchange (ETDEWEB)

    Merschel, Gila, E-mail:; Bau, Michael


    High-technology metals — such as the rare earth elements (REE) — have become emerging contaminants in the hydrosphere, yet little is known about their bioavailability. The Rhine River and the Weser River in Germany are two prime examples of rivers that are subjected to anthropogenic REE input. While both rivers carry significant loads of anthropogenic Gd, originating from contrast agents used for magnetic resonance imaging, the Rhine River also carries large amounts of anthropogenic La and lately Sm which are discharged into the river from an industrial point source. Here, we assess the bioavailability of these anthropogenic microcontaminants in these rivers by analyzing the aragonitic shells of the freshwater bivalve Corbicula fluminea. Concentrations of purely geogenic REE in shells of comparable size cover a wide range of about one order of magnitude between different sampling sites. At a given sampling site, geogenic REE concentrations depend on shell size, i.e. mussel age. Although both rivers show large positive Gd anomalies in their dissolved loads, no anomalous enrichment of Gd relative to the geogenic REE can be observed in any of the analyzed shells. This indicates that the speciations of geogenic and anthropogenic Gd in the river water differ from each other and that the geogenic, but not the anthropogenic Gd is incorporated into the shells. In contrast, all shells sampled at sites downstream of the industrial point source of anthropogenic La and Sm in the Rhine River show positive La and Sm anomalies, revealing that these anthropogenic REE are bioavailable. Only little is known about the effects of long-term exposure to dissolved REE and their general ecotoxicity, but considering that anthropogenic Gd and even La have already been identified in German tap water and that anthropogenic La and Sm are bioavailable, this should be monitored and investigated further. - Highlights: • Corbicula fluminea shells are bioarchives of dissolved geogenic REE in rivers. • Anthropogenic La and Sm in the Rhine River are bioavailable, hence incorporated. • Anthropogenic Gd from contrast agents is not incorporated, i.e. not bioavailable. • REE concentrations in Corbicula shells decrease with increasing size, i.e. age.

  6. Mechanically induced strong red emission in samarium ions doped piezoelectric semiconductor CaZnOS for dynamic pressure sensing and imaging (United States)

    Wang, Wei; Peng, Dengfeng; Zhang, Hanlu; Yang, Xiaohong; Pan, Caofeng


    Piezoelectric semiconductor with optical, electrical and mechanical multifunctions has great potential applications in future optoelectronic devices. The rich properties and applications mainly encompass the intrinsic structures and their coupling effects. Here, we report that lanthanide ions doped piezoelectric semiconductor CaZnOS:Sm3+ showing strong red emission induced by dynamic mechanical stress. Under moderate mechanical load, the doped piezoelectric semiconductor exhibits strong visible red emission to the naked eyes even under the day light. A flexible dynamic pressure sensor device is fabricated based on the prepared CaZnOS:Sm3+ powders. The mechanical-induced emission properties of the device are investigated by the optical fiber spectrometer. The linear characteristic emissions are attributed to the 4G5/2→6H5/2 (566 nm), 4G5/2→6H7/2 (580-632 nm), 4G5/2→6H9/2 (653-673 nm) and 4G5/2→6H11/2 (712-735 nm) f-f transitions of Sm3+ ions. The integral emission intensity is proportional to the value of applied pressure. By using the linear relationship between integrated emission intensity and the dynamic pressure, the real-time pressure distribution is visualized and recorded. Our results highlight that the incorporation of lanthanide luminescent ions into piezoelectric semiconductors as smart materials could be applied into the flexible mechanical-optical sensor device without additional auxiliary power, which has great potential for promising applications such as mapping of personalized handwriting, smart display, and human machine interface.

  7. Investigation of oxidative coupling of methane over bismuth oxychloride, samarium chloride, or manganese chloride supported on lithium carbonate-magnesia systems

    Energy Technology Data Exchange (ETDEWEB)

    Khan, A.Z.; Ruckenstein, E. (State Univ. of New York, Buffalo, NY (United States))


    The magnesia-supported bismuth oxychloride with lithium carbonate present is significantly more effective and stable with time-on-stream than the unsupported or supported systems free of Li[sub 2]CO[sub 3] in the oxidative coupling of methane at 750[degrees]C, P[sub CH[sub 4

  8. Rare earth elements in the aragonitic shell of freshwater mussel Corbicula fluminea and the bioavailability of anthropogenic lanthanum, samarium and gadolinium in river water. (United States)

    Merschel, Gila; Bau, Michael


    High-technology metals - such as the rare earth elements (REE) - have become emerging contaminants in the hydrosphere, yet little is known about their bioavailability. The Rhine River and the Weser River in Germany are two prime examples of rivers that are subjected to anthropogenic REE input. While both rivers carry significant loads of anthropogenic Gd, originating from contrast agents used for magnetic resonance imaging, the Rhine River also carries large amounts of anthropogenic La and lately Sm which are discharged into the river from an industrial point source. Here, we assess the bioavailability of these anthropogenic microcontaminants in these rivers by analyzing the aragonitic shells of the freshwater bivalve Corbicula fluminea. Concentrations of purely geogenic REE in shells of comparable size cover a wide range of about one order of magnitude between different sampling sites. At a given sampling site, geogenic REE concentrations depend on shell size, i.e. mussel age. Although both rivers show large positive Gd anomalies in their dissolved loads, no anomalous enrichment of Gd relative to the geogenic REE can be observed in any of the analyzed shells. This indicates that the speciations of geogenic and anthropogenic Gd in the river water differ from each other and that the geogenic, but not the anthropogenic Gd is incorporated into the shells. In contrast, all shells sampled at sites downstream of the industrial point source of anthropogenic La and Sm in the Rhine River show positive La and Sm anomalies, revealing that these anthropogenic REE are bioavailable. Only little is known about the effects of long-term exposure to dissolved REE and their general ecotoxicity, but considering that anthropogenic Gd and even La have already been identified in German tap water and that anthropogenic La and Sm are bioavailable, this should be monitored and investigated further. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Samario-153-Lexidronam (EDTMP) en el tratamiento de las metástasis óseas Samarium-153-Lexidronam (EDTMP) for the management of bone metastases


    F. Torre; C. Gómez-Vega; A. Callejo; J. Genolla


    Las metástasis óseas son una complicación frecuente en pacientes neoplásicos, en este sentido, el tejido óseo ocupa el tercer lugar de todos los órganos y sistemas con metástasis después del pulmón e hígado. Aproximadamente un 75% de los enfermos con metástasis óseas sufrirán dolor, siendo estas la causa más frecuente de dolor en pacientes con cáncer. El dolor óseo aumenta con los movimientos y a la presión, limitando la autonomía del enfermo y su calidad de vida. El tratamiento incluye vario...

  10. Morphology and orientation of β-BaB{sub 2}O{sub 4} crystals patterned by laser in the inside of samarium barium borate glass

    Energy Technology Data Exchange (ETDEWEB)

    Nishii, Akihito; Shinozaki, Kenji; Honma, Tsuyoshi; Komatsu, Takayuki, E-mail:


    Nonlinear optical β-BaB{sub 2}O{sub 4} crystal lines (β-BBO) were patterned in the inside of 8Sm{sub 2}O{sub 3}–42BaO–50B{sub 2}O{sub 3} glass by irradiations of continuous-wave Yb:YVO{sub 4} lasers with a wavelength of 1080 nm (power: P=0.8–1.0 W, scanning speed: S=0.2–2.5 μm/s), in which the laser focal position was moved gradually from the surface to the inside. The morphology, size, and orientation of β-BBO crystals were examined from polarization optical microscope and birefringence imaging observations. It was demonstrated that c-axis oriented β-BBO crystals with long lengths (e.g., 20 mm) were patterned in the inside of the glass. The morphology of β-BBO in the cross-section of lines was a rectangular shape with rounded corners, and the volume of β-BBO formed increased with increasing laser power and with decreasing laser scanning speed. The maximum depth in the inside from the surface for β-BBO patterning increased with increasing laser power, e.g., D{sub max}∼100 μm at P=0.8 W, D{sub max}∼170 μm at P=0.9 W, and D{sub max}∼200 μm at P=1 W. The present study proposes that the laser-induced crystallization opens a new door for applied engineering in glassy solids. - Graphical abstract: This figure shows the POM photographs for β-BaB{sub 2}O{sub 4} crystal lines patterned by cw Yb:YVO{sub 4} fiber laser irradiations with a laser power of P=0.8 W and a laser scanning speed S=2 μm/s in the glass. The laser focal point was moved gradually from the surface into the inside. The results shown in Fig. 1 demonstrate that it is possible to pattern highly oriented β-BaB{sub 2}O{sub 4} crystals even in the inside of glasses. - Highlights: • β-BaB{sub 2}O{sub 4} crystal lines were patterned in the inside of a glass by lasers. • Laser focal position was moved gradually from the surface to the inside. • Birefringence imaging was observed. • Morphology, size, and orientation of crystals were clarified. • Crystal lines with long lengths (e.g., 20 mm) were patterned at the depth of 200 μm.

  11. 10 CFR Appendix C to Part 20 - Quantities 1 of Licensed Material Requiring Labeling (United States)


    ... Samarium-151 10 Samarium-153 100 Samarium-155 1,000 Samarium-156 1,000 Europium-145 100 Europium-146 100 Europium-147 100 Europium-148 10 Europium-149 100 Europium-150 (12.62h) 100 Europium-150 (34.2y) 1 Europium-152m 100 Europium-152 1 Europium-154 1 Europium-155 10 Europium-156 100 Europium-157 100 Europium-158 1...

  12. An experiment using neutron activation analysis and a rare earth element to mark cotton plants and two insects that feed on them

    Energy Technology Data Exchange (ETDEWEB)

    Showler, Allan T. [USDA-ARS IFNRRU, Kika de la Garza Subtropical Agricultural Research Center, 2413 East Highway 83, Weslaco, TX 78596 (United States)]. E-mail:; James, William D. [Elemental Analysis Laboratory, 3144 Texas A and M University, College Station, TX 77843-3144 (United States); Armstrong, John S. [USDA-ARS BIRU, Kika de la Garza Subtropical Agricultural Research Center, 2413 East Highway 83, Weslaco, TX 78596 (United States); Westbrook, John K. [USDA-ARS APMRU, 2771 F and B Road, College Station, TX 77845-4966 (United States)


    Studies on insect dispersal and other behaviors can benefit from using markers that will not alter flight and fitness. Rare earth elements, such as samarium (Sm), have been used as ingested markers of some insects and detected using neutron activation analysis (NAA). In this study, samarium nitrate hexahydrate was mixed into artificial diet for boll weevils, Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae), at different dosages and in water used to irrigate cotton, Gossypium hirsutum L. Samarium was detected in adult boll weevils fed on the samarium-labeled diet, but not after 5 or 10 days of being switched to non-labeled diet, even if the insects were given labeled diet for as long as 7 consecutive days. Introduced in irrigation water, 1% samarium (m/m) was detectable in cotton squares and leaf tissue. However, boll weevil adults fed samarium-labeled squares did not retain detectable levels of samarium, nor did boll weevil adults reared to adulthood from samarium-labeled squares. Fourth instar beet armyworms, Spodoptera exigua (Huebner) (Noctuidae: Lepidoptera), fed on samarium-labeled cotton leaves obtained enough samarium for NAA detection, but adult moths reared from them did not have detectable amounts of samarium. Although samarium can be useful as a marker when insects are presented with a continuous pulse of the label, elements that are assimilated by the insect would be more useful if a continuous infusion of the marker cannot be provided.

  13. Ce que nous faisons | Page 161 | CRDI - Centre de recherches pour ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Ce projet examinera le rôle du financement et des réseaux de la diaspora dans le conflit ethnopolitique au Sri Lanka, en étudiant les réseaux des collectivités transnationales tamoule et cinghalaise au Canada et leurs liens avec le Sri Lanka. Canada, Amérique Nord Et Centrale, Sri Lanka, Amérique Du Sud, Asie Centrale, ...

  14. 33 CFR 161.35 - Vessel Traffic Service Houston/Galveston. (United States)


    ... Areas Precautionary area name Radius (yds.) Center point Latitude Longitude Bolivar Roads 4000 29°20.9... Bayou 1000 29°45.0′ N 95°17.3′ W Note: Each Precautionary Area encompasses a circular area of the radius... Channel Lt. 12 29° 22.4′ N; 94° 50.9′ W X Houston Ship Channel ICW Intersection Houston Ship Channel (HSC...

  15. Adesina et al., Afr J Tradit Complement Altern Med. (2013) 10(3):161 ...

    African Journals Online (AJOL)


    C. Illoh, ³Imoh I. Johnny and ³Imo E. Jacobs. ¹Drug Research ... Wiens, 1998) and most genera of African mistletoes belong to the family Loranthaceae (Polhill and Wiens, 1998). Seven genera .... The most distinctive constituents of most European and Asian mistletoes are proteins, the viscotoxins, lectins and carbohydrates.

  16. 25 CFR 161.1 - What definitions do I need to know? (United States)


    ... traditionally confined his or her traditional grazing use and occupancy and/or an area traditionally inhabited... management plan is a statement of management objectives for grazing, farming, or other agriculture management...

  17. 40 CFR Appendix A to Part 161 - Data Requirements for Registration: Use Pattern Index (United States)


    .... Identify the Pesticide Use Site Group listed below (e.g., agricultural crops, forests, ornamental plants.... Ornamental Plants and Forest Trees. 3. General Soil Treatment and Composting. 4. Processed or Manufactured....g., grape, kiwi fruit) Strawberry Cranberry Pome fruits (e.g., apple, quince) Stone fruits (e.g...

  18. 40 CFR 161.490 - Wildlife and aquatic organisms data requirements. (United States)


    ...-3 Avian reproduction (preferably mallard and bobwhite) (3) CR CR CR CR CR CR TGAI TGAI 71-4... information, such as that derived from mammalian reproduction studies that indicates the reproduction in... organisms indicate the reproductive physiology of fish and/or invertebrates may be affected. (B...

  19. Page 1 Ife.Journal of Sciencevol. 9, no.2(2007) 161 KARYOTYPE ...

    African Journals Online (AJOL)

    were collected from the wet forest, dry forest and derived savanna areas of Nigeria to determine their karyotype. Each of the species has a chromosome number of n = 7 (2n = 14). A pair of satellited chromosomes was observed in the genome of Greenwayodendron suaveolens and Cleistopholis patens. The centromeric ...

  20. Pyrroloquinoline Quinone Is a Plant Growth Promotion Factor Produced by Pseudomonas fluorescens B161 (United States)

    Choi, Okhee; Kim, Jinwoo; Kim, Jung-Gun; Jeong, Yeonhwa; Moon, Jae Sun; Park, Chang Seuk; Hwang, Ingyu


    Pseudomonas fluorescens B16 is a plant growth-promoting rhizobacterium. To determine the factors involved in plant growth promotion by this organism, we mutagenized wild-type strain B16 using ΩKm elements and isolated one mutant, K818, which is defective in plant growth promotion, in a rockwool culture system. A cosmid clone, pOK40, which complements the mutant K818, was isolated from a genomic library of the parent strain. Tn3-gusA mutagenesis of pOK40 revealed that the genes responsible for plant growth promotion reside in a 13.3-kb BamHI fragment. Analysis of the DNA sequence of the fragment identified 11 putative open reading frames, consisting of seven known and four previously unidentified pyrroloquinoline quinone (PQQ) biosynthetic genes. All of the pqq genes showed expression only in nutrient-limiting conditions in a PqqH-dependent manner. Electrospray ionization-mass spectrometry analysis of culture filtrates confirmed that wild-type B16 produces PQQ, whereas mutants defective in plant growth promotion do not. Application of wild-type B16 on tomato (Solanum lycopersicum) plants cultivated in a hydroponic culture system significantly increased the height, flower number, fruit number, and total fruit weight, whereas none of the strains that did not produce PQQ promoted tomato growth. Furthermore, 5 to 1,000 nm of synthetic PQQ conferred a significant increase in the fresh weight of cucumber (Cucumis sativus) seedlings, confirming that PQQ is a plant growth promotion factor. Treatment of cucumber leaf discs with PQQ and wild-type B16 resulted in the scavenging of reactive oxygen species and hydrogen peroxide, suggesting that PQQ acts as an antioxidant in plants. PMID:18055583

  1. 161 Hydrologie et morphologie de l'estuaire du fleuve Sassandra ...

    African Journals Online (AJOL)

    HP 2000

    Résumé. Les études physico-chimiques des eaux de surface et de sub-surface et les levés bathymétriques effectués dans l'estuaire du fleuve Sassandra, ont permis de caractériser l'hydrologie et la morphologie du fond de cet embouchure. Sur toute la surface d'eau le pH est proche de la neutralité, la conductivité est ...

  2. 14 CFR 161.305 - Required analysis and conditions for approval of proposed restrictions. (United States)


    ... description of the relationship of the effect of the proposed restriction on airport users (by aviation user... Stage 3 operations shall prepare and make available for public comment an analysis that supports, by... effect at the airport; and measures taken to achieve land-use compatibility, such as controls or...

  3. 24 CFR 248.161 - Mandatory sale of housing in excess of the Federal cost limit. (United States)


    ... to purchase the project for a sale price less than the transfer preservation value of the project... fide offer in § 248.101, except for the requirement that the sale price equal the transfer preservation... any eligible low income housing for which the transfer preservation rent determined under § 248.121...

  4. 78 FR 56692 - Colorado River Storage Project-Rate Order No. WAPA-161 (United States)


    ... Bailey, Power Marketing Manager, CRSP Management Center, Western Area Power Administration, 150 East... Jeka, CRSP Manager, CRSP Management Center, Western Area Power Administration, 150 East Social Hall...) Organization Act (42 U.S.C. 7152) transferred to and vested in the Secretary of Energy the power marketing...

  5. : tous les projets | Page 161 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Pour davantage d'emplois décents au Pérou - renforcement des capacités de recherche et d'élaboration des politiques .... l'émergence des institutions de la société civile, ces dernières n'ont jamais atteint le degré d'inclusion, de participation et de pluralisme requis afin de donner lieu à une société ouverte et démocratique.

  6. 25 CFR 161.301 - What will a grazing permit contain? (United States)


    ... permits will contain the following provisions: (1) Name of permit holder; (2) Range management plan...) Animal identification requirements (i.e., brand, microchip, freeze brand, earmark, tattoo, etc.); (6...

  7. Yeast Interacting Proteins Database: YGL198W, YGL161C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YGL198W YIP4 Protein that interacts with Rab GTPases, localized to late Golgi vesicles; computational...that interacts with Rab GTPases, localized to late Golgi vesicles; computational ...eracts with Rab GTPases, localized to late Golgi vesicles; computational analysis of large-scale protein-pro...ized to late Golgi vesicles; computational analysis of large-scale protein-protein interaction data suggests

  8. SU-E-T-161: Evaluation of Dose Calculation Based On Cone-Beam CT

    Energy Technology Data Exchange (ETDEWEB)

    Abe, T; Nakazawa, T; Saitou, Y; Nakata, A; Yano, M [Graduate School of Medicine, Sapporo Medical University, Sapporo, Hokkaido (Japan); Tateoka, K [Graduate School of Medicine, Sapporo Medical University, Sapporo, Hokkaido (Japan); Radiation Therapy Research Institute, Social Medical Corporation Teishinkai, Sapporo, Hokkaido (Japan); Fujimoto, K [Radiation Therapy Research Institute, Social Medical Corporation Teishinkai, Sapporo, Hokkaido (Japan); Sakata, K [Graduate School of Medicine, Sapporo Medical University, Sapporo, Hokkaido (Japan); Sapporo Medical University, Sapporo, Hokkaido (Japan)


    Purpose: The purpose of this study is to convert pixel values in cone-beam CT (CBCT) using histograms of pixel values in the simulation CT (sim-CT) and the CBCT images and to evaluate the accuracy of dose calculation based on the CBCT. Methods: The sim-CT and CBCT images immediately before the treatment of 10 prostate cancer patients were acquired. Because of insufficient calibration of the pixel values in the CBCT, it is difficult to be directly used for dose calculation. The pixel values in the CBCT images were converted using an in-house program. A 7 fields treatment plans (original plan) created on the sim-CT images were applied to the CBCT images and the dose distributions were re-calculated with same monitor units (MUs). These prescription doses were compared with those of original plans. Results: In the results of the pixel values conversion in the CBCT images,the mean differences of pixel values for the prostate,subcutaneous adipose, muscle and right-femur were −10.78±34.60, 11.78±41.06, 29.49±36.99 and 0.14±31.15 respectively. In the results of the calculated doses, the mean differences of prescription doses for 7 fields were 4.13±0.95%, 0.34±0.86%, −0.05±0.55%, 1.35±0.98%, 1.77±0.56%, 0.89±0.69% and 1.69±0.71% respectively and as a whole, the difference of prescription dose was 1.54±0.4%. Conclusion: The dose calculation on the CBCT images achieve an accuracy of <2% by using this pixel values conversion program. This may enable implementation of efficient adaptive radiotherapy.

  9. 27 CFR 555.161 - Engaging in business without a license. (United States)


    ... the business of importing, manufacturing, or dealing in explosive materials without a license issued..., TOBACCO, FIREARMS, AND EXPLOSIVES, DEPARTMENT OF JUSTICE EXPLOSIVES COMMERCE IN EXPLOSIVES Unlawful Acts...

  10. Retention, Attrition, and Mobility among Teachers and Administrators in West Virginia. REL 2016-161 (United States)

    Lochmiller, Chad R.; Adachi, Eishi; Chesnut, Colleen E.; Johnson, Jerry


    Members of the West Virginia School Leadership Research Alliance partnered with Regional Educational Laboratory Appalachia to study the average retention, attrition, and mobility rates among teachers and administrators in the West Virginia public school system. There is increasing evidence nationwide that low teacher and administrator retention…

  11. 40 CFR 161.34 - Flagging of studies for potential adverse effects. (United States)


    ... a type listed in paragraph (b) of this section to support an application for new or amended... maternal toxicity at the same dose levels 5 Neurotoxicity 81-7 When compared with controls, treated animals...

  12. Page 1 The Specific Heats of Crystals—II 161 different techniques. It ...

    Indian Academy of Sciences (India)

    different techniques. It is a simple matter with the aid of the table to cal- culate the contributions to the specific heat arising from the nine modes of internal vibration of the diamond structure. The lowest frequency appearing in the table expressed in wave-numbers, viz., 621 cm." may also be properly assumed to be the upper ...

  13. SU-E-J-161: Inverse Problems for Optical Parameters in Laser Induced Thermal Therapy

    Energy Technology Data Exchange (ETDEWEB)

    Fahrenholtz, SJ; Stafford, RJ; Fuentes, DT [UT MD Anderson Cancer Center, Houston, TX (United States); UT Graduate School of Biomedical Sciences, Houston, TX (United States)


    Purpose: Magnetic resonance-guided laser-induced thermal therapy (MRgLITT) is investigated as a neurosurgical intervention for oncological applications throughout the body by active post market studies. Real-time MR temperature imaging is used to monitor ablative thermal delivery in the clinic. Additionally, brain MRgLITT could improve through effective planning for laser fiber's placement. Mathematical bioheat models have been extensively investigated but require reliable patient specific physical parameter data, e.g. optical parameters. This abstract applies an inverse problem algorithm to characterize optical parameter data obtained from previous MRgLITT interventions. Methods: The implemented inverse problem has three primary components: a parameter-space search algorithm, a physics model, and training data. First, the parameter-space search algorithm uses a gradient-based quasi-Newton method to optimize the effective optical attenuation coefficient, μ-eff. A parameter reduction reduces the amount of optical parameter-space the algorithm must search. Second, the physics model is a simplified bioheat model for homogeneous tissue where closed-form Green's functions represent the exact solution. Third, the training data was temperature imaging data from 23 MRgLITT oncological brain ablations (980 nm wavelength) from seven different patients. Results: To three significant figures, the descriptive statistics for μ-eff were 1470 m{sup −1} mean, 1360 m{sup −1} median, 369 m{sup −1} standard deviation, 933 m{sup −1} minimum and 2260 m{sup −1} maximum. The standard deviation normalized by the mean was 25.0%. The inverse problem took <30 minutes to optimize all 23 datasets. Conclusion: As expected, the inferred average is biased by underlying physics model. However, the standard deviation normalized by the mean is smaller than literature values and indicates an increased precision in the characterization of the optical parameters needed to plan MRgLITT procedures. This investigation demonstrates the potential for the optimization and validation of more sophisticated bioheat models that incorporate the uncertainty of the data into the predictions, e.g. stochastic finite element methods.

  14. Participatory Design in Academic Libraries: New Reports and Findings. CLIR Publication No. 161 (United States)

    Foster, Nancy Fried, Ed.


    This report is based on a series of presentations at the second CLIR Seminar on "Participatory Design of Academic Libraries," held at the University of Rochester's River Campus June 5-7, 2013. Participatory design is a relatively recent approach to understanding library user behavior. It is based on techniques used in anthropological and…

  15. 7 CFR 28.161 - Disputes involving contracts for shipment of cotton from United States. (United States)


    ... States to a contract made under the rules of the association or exchange. (b) The submission of samples... with the rules of the association or exchange shall be deemed to be a submission to the Department. (c... articles, rules, or bylaws of the association or exchange, such determinations may be evidenced by awards...

  16. Yeast Interacting Proteins Database: YKL057C, YGR161C-C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available required for even distribution of NPCs around the nuclear envelope, involved in establishment of a normal nu..., required for even distribution of NPCs around the nuclear envelope, involved in establishment of a normal

  17. 25 CFR 161.204 - How are carrying capacities and stocking rates established? (United States)


    ... be based on forage production, range utilization, the application of land management practices, and range improvements in place to achieve uniformity of grazing under sustained yield management principles... agricultural resource management plan and range unit management plan. (b) BIA, with the concurrence of the...

  18. 75 FR 81417 - Airworthiness Directives; Piper Aircraft, Inc. Model PA-28-161 Airplanes (United States)


    ...-057-AD; Amendment 39-16543; AD 2010-26-04] RIN 2120-AA64 Airworthiness Directives; Piper Aircraft, Inc...): 2010-26-04 Piper Aircraft, Inc: Amendment 39-16543; Docket No. FAA- 2010-1006; Directorate Identifier... alternative GmbH Supplement replacement times may be Airplane approved for this part. Maintenance Manual Piper...

  19. 29 CFR 4.161 - Minimum monetary wages under contracts exceeding $2,500. (United States)


    ... service contracts in excess of $2,500 to service employees engaged in performance of the contract or... wages to be paid the various classes of service employees engaged in the performance of the contract or... rates for such employees provided for in such agreement, including prospective wage increases as...

  20. 7 CFR 457.161 - Canola and rapeseed crop insurance provisions. (United States)


    ...: Canola and Rapeseed Crop Provisions If a conflict exists among the policy provisions, the order of... that contains at least 30 percent of an industrial type of oil as shown on the Special Provisions and... Official United States Standards for Grain including, but not limited to protein and oil, will not be...

  1. Horticultural Related Occupations. VEH Horticulture Related. Curriculum Guide for Agribusiness 161. (United States)

    Texas A and M Univ., College Station. Dept. of Agricultural Education.

    This curriculum guide provides materials for teachers to use in developing a 1- or 2-year course in horticulture-related occupations for at-risk and special education students. It is one of 28 semester courses in agricultural science and technology for Texas high schools. The program prepares low-achieving students with employability skills that…

  2. 21 CFR 161.173 - Canned wet pack shrimp in transparent or nontransparent containers. (United States)


    ... HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION FISH AND SHELLFISH Requirements for... ingredients. The following safe and suitable optional ingredients may be used: (i) Salt. (ii) Lemon juice...

  3. 25 CFR 161.3 - What is the purpose of this part? (United States)


    ... wildlife, fisheries, cultural resources, recreation and to regulate water runoff and minimize soil erosion... and economics of agribusiness, sources and use of credit and marketing of agricultural products, and...

  4. 40 CFR 93.161 - Conformity evaluation for Federal installations with facility-wide emission budgets. (United States)


    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Conformity evaluation for Federal... PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) DETERMINING CONFORMITY OF FEDERAL ACTIONS TO STATE OR FEDERAL IMPLEMENTATION PLANS Determining Conformity of General Federal Actions to State or Federal...

  5. Adesina et al., Afr J Tradit Complement Altern Med. (2013) 10(3):161 ...

    African Journals Online (AJOL)


    claimed a general use to counter sorcery and magical powers, to treat mental conditions, sterility, and health problems associated with urino-genital system, rheumatism and pain. These hemi-parasitic plants, mistletoes of the Loranthaceae and Viscaceae, are widely used in various cultures in almost every continent to treat ...

  6. Ce que nous faisons | Page 161 | CRDI - Centre de recherches pour ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Le CRDI finance des études de recherche dans les pays en voie de développement en vue de produire un changement durable à grande échelle. Pour que le savoir devienne un outil permettant de résoudre des problèmes urgents :

  7. The influence of hydration state on thermoregulation during a 161-km ultramarathon. (United States)

    Valentino, Taylor R; Stuempfle, Kristin J; Kern, Marialice; Hoffman, Martin D


    It is advised that individuals should avoid losing >2% of their body mass during exercise in order to prevent hyperthermia. This study sought to assess whether a loss of >2% body mass leads to elevations in core temperature during an ultramarathon. Thirty runners agreed to take part in the study. Body mass and core temperature were measured at the start, at three locations during the race and the finish. Core temperature was not correlated with percent body mass change (p = 0.19) or finish time (p = 0.11). Percent body mass change was directly associated with finish time (r = 0.58, p 3% body mass does not contribute to rises in core temperature. An emphasis on fluid replacement for body mass losses of this magnitude during prolonged exercise is not justified as a preventative measure for heat-related illnesses.

  8. Yeast Interacting Proteins Database: YIR016W, YNL161W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available olved in cell wall biosynthesis, apical growth, proper mating projection morphology, bipolar bud site select...sis, apical growth, proper mating projection morphology, bipolar bud site selection in diploid cells, and ce

  9. Yeast Interacting Proteins Database: YIL106W, YNL161W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available l morphogenesis pathways; involved in cell wall biosynthesis, apical growth, proper mating projection morphology, bipolar...ll morphogenesis pathways; involved in cell wall biosynthesis, apical growth, proper mating projection morphology, bipolar

  10. 76 FR 161 - Current List of Laboratories and Instrumented Initial Testing Facilities Which Meet Minimum... (United States)


    .... Advanced Toxicology Network, 3560 Air Center Cove, Suite 101, Memphis, TN 38118. 901-794-5770/888-290-1150....) Maxxam Analytics,\\*\\ 6740 Campobello Road, Mississauga, ON, Canada L5N 2L8.905-817-5700. (Formerly: Maxxam Analytics Inc., NOVAMANN (Ontario), Inc.) * The Standards Council of Canada (SCC) voted to end its...

  11. 40 CFR 86.161-00 - Air conditioning environmental test facility ambient requirements. (United States)


    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Air conditioning environmental test... conditioning environmental test facility ambient requirements. The goal of an air conditioning test facility is... elements that are discussed are ambient air temperature and humidity, minimum test cell size, solar heating...

  12. 40 CFR 161.202 - Purposes of the registration data requirements. (United States)


    ... chemistry. (1) Residue Chemistry Data are used by the Agency to estimate the exposure of the general...) Residue chemistry data are also needed to support the adequacy of one or more methods for the enforcement... water resources. (6) Accumulation studies. Accumulation studies indicate pesticide residue levels in...

  13. 25 CFR 161.200 - Is an Indian agricultural resource management plan required? (United States)


    ... 25 Indians 1 2010-04-01 2010-04-01 false Is an Indian agricultural resource management plan... resource management plan required? (a) Yes, Navajo Partitioned Lands must be managed in accordance with the goals and objectives in the agricultural resource management plan developed by the Navajo Nation, or by...

  14. 9 CFR 161.1 - Statement of purpose; performance of accredited duties in different States. (United States)


    ... documents. (iii) Recognize all USDA animal identification systems. (iv) Estimate the age of livestock using a dental formula. (v) Apply USDA-recognized identification (e.g., eartag, microchip, tattoo) for the... record breed information on official documents. (iii) Apply common animal identification for Category I...

  15. 9 CFR 161.4 - Suspension or revocation of veterinary accreditation; criminal and civil penalties. (United States)


    ... signs a false, incorrect, or mislabeled animal health or inspection certificate, blood sample, official brucellosis vaccination certificate, or official tuberculin test certificate in accordance with this chapter... was not endorsed; but if the State Animal Health Official fails to take one of these actions within 14...

  16. FCJ-161 Productive Provocations: Vitriolic Media, Spaces of Protest and Agonistic Outrage in the 2011 England Riots

    Directory of Open Access Journals (Sweden)

    Anthony McCosker


    Full Text Available The intense social upheaval that spread through a number of UK cities in the riots and protests of August, 2011 signalled the terrifying speed with which passionate disaffection can turn to uncontained violence. At stake in the dense and volatile debate that ensued, and in the acts of violence themselves, were contests over spaces as well as competing models of democracy, publics and citizenship, including the appropriate use of social media. Within these debates, almost universally, rational deliberative discourse and action is assumed to be the only route to legitimate “civil” society. So what is to be made of the violent physical contest over city squares, streets and property, as well as contests over acts of participation and demonstration played out online through the hundreds of eyewitness videos posted to sites like YouTube and the endless flow of often vitriolic words in blogs, comments spaces and social network sites? This paper uses a video posted to YouTube titled ‘Clapham Junction Speaker (London Riots 2011’ to examine the passion and provocation that flowed beyond the city streets to enliven, intensify and sustain forms of protest and civic engagement. We argue that the aggressive and antagonistic tenor of the Speaker’s twenty minute monologue, the bitter vitriol that flowed through the comments space, and even the act of posting it constitute significant elements of a generative, ‘agonistic’ public, to use Chantal Mouffe’s term, that operates in multiple spaces and outside of the rationalising discourse demanded by mainstream media and government. This paper develops a richer understanding of these spaces of protest, and the concept of provocation central to these events.

  17. National Indian Education Study 2015: American Indian and Alaska Native Students at Grades 4 and 8. NCES 2017-161 (United States)

    Ninneman, A. M.; Deaton, J.; Francis-Begay, K.


    The National Indian Education Study (NIES) is administered as part of the National Assessment of Educational Progress (NAEP) to allow more in-depth reporting on the achievement and experiences of American Indian/Alaska Native (AI/AN)1 students in grades 4 and 8. This report focuses primarily on two themes identified during the development of the…

  18. 37 CFR 2.161 - Requirements for a complete affidavit or declaration of continued use or excusable nonuse. (United States)


    ..., the Office will presume that the fee(s) cover the classes in ascending order, beginning with the... affidavit or declaration covers less than all the goods or services, or less than all the classes in the... audio or video cassette tape recording, CD-ROM, or a specimen in another appropriate medium. (3) Be a...

  19. Employment and Training Policy in the United States during the Economic Crisis. Upjohn Institute Working Paper No. 10-161 (United States)

    O'Leary, Christopher J.; Eberts, Randall W.


    This paper examines labor market conditions and public employment policies in the United States during what some are calling the Great Recession. We document the dramatic labor market changes that rapidly unfolded when the rate of gross domestic product growth turned negative, from the end of 2007 through early 2009. The paper reviews the…

  20. Space shuttle: Heat transfer rate measurements of North American Rockwell orbiter (161B) at nominal Mach number of 8 (United States)

    Warmbrod, J. D.; Martindale, W. R.; Matthews, R. K.


    Plots and tables which determine detailed heat transfer distributions on phase B space shuttle configurations are presented. A thin-skinned thermocouple was used to measure the reentry events of the delta wing orbiter. Data was obtained at a nominal Mach number of 8 and free stream Reynolds numbers ranging from 0.83 x 10 to the 6th power to 3.76 x 10 to the 6th power per foot. Angle of attack was varied from -5 to 50 degrees.

  1. CNV-association meta-analysis in 191,161 European adults reveals new loci associated with anthropometric traits

    DEFF Research Database (Denmark)

    Macé, Aurélien; Tuke, Marcus A; Deelen, Patrick


    )). Burden analysis shows a 0.41 cm decrease in height, a 0.003 increase in waist-to-hip ratio and increase in BMI by 0.14 kg/m(2) for each Mb of total deletion burden (P = 2.5 × 10(-10), 6.0 × 10(-5), and 2.9 × 10(-3)). Our study provides evidence that the same genes (e.g., MC4R, FIBIN, and FMO5) harbor...

  2. Central and Eastern European countries between the 16+1 platform and Chinese OBOR - One Belt, One Road - Initiative

    National Research Council Canada - National Science Library

    George Cornel Dumitrescu; Ion Alexandru Tănase


    .... For our research we selected four countries, namely: Poland, Romania, Serbia and Hungary, the group being relevant from the perspective of the transportation corridors connected to the ”One Belt, One Road” initiative: (1...

  3. 161. Necrosis por presión del septo de salida ventricular causado por dos implantes adyacentes

    Directory of Open Access Journals (Sweden)

    A. González Calle


    Conclusiones: Esta complicación ilustra que los tejidos entre dos dispositivos duros y con movimiento uno conrespecto al otro pueden desarrollar necrosis por presión y fricción y, consecuentemente, perforación. Probablemente, hubiera sido preferible sustituir el homoinjerto pulmonar con stent en el momento de la sustitución valvular aórtica.

  4. 77 FR 34935 - Foreign-Trade Zone 161; Temporary/Interim Manufacturing Authority; Siemens Energy, Inc., (Wind... (United States)


    ... Energy, Inc., (Wind Turbine Nacelles and Hubs); Notice of Approval On April 2, 2012, the Executive...) authority, on behalf of Siemens Energy, Inc., to manufacture wind turbine nacelles and hubs under FTZ...

  5. 75 FR 32357 - Gallatin National Forest; Montana; Jack Rabbit to Big Sky Meadow Village 161 kV Transmission Line... (United States)


    ... power outages from construction Fire risk Reclamation practices Alternative energy generation... Consideration of reroutes near Cascade Creek homes/Lava Lake Trailhead area, Greek Creek homes and the Deer...

  6. Hana Cervinkova, Playing Soldiers in Bohemia: An Ethnography of NATO Membership. Prague Studies in Sociocultural Anthropology 4, 2006, 161 pages.

    Directory of Open Access Journals (Sweden)

    Marybeth Peterson Ulrich


    Full Text Available Hana Cervinkova’s ethnographic portrait of the Czech military in its “post-socialist” moment is a fascinating contribution to the literature on post-communist transitions. Not merely concerned with the provision of several anthropological descriptions of disappearing cultures, such as the obsolescent enlisted ranks and Air Force technicians expert in the mechanics of moth-balled Soviet aircraft, Cervinkova is determined to link the military’s post-socialist story to the Czech state’s own fort...

  7. Borrowing at the Maximum: Undergraduate Stafford Loan Borrowers in 2007-08. Stats in Brief. NCES 2012-161 (United States)

    Wei, Christina Chang; Skomsvold, Paul


    Using data from the 2007-08 National Postsecondary Student Aid Study (NPSAS:08), this Statistics in Brief examines the extent to which undergraduate students borrow the maximum possible within the limits of the Stafford loan program (the program maximum) and their own financial need and student budgets (the individual maximum). Students who…

  8. 77 FR 20782 - Foreign-Trade Zone 161-Sedgwick County, KS; Application for Temporary/Interim Manufacturing... (United States)


    ... Manufacturing Authority; Siemens Energy, Inc.; (Wind Turbine Nacelles and Hubs); Hutchinson, KS An application... authority to produce wind turbine nacelles and hubs (HTSUS 8412.80, 8412.90, 8502.31; duty rates: free, 2.5... to wind turbine nacelles and hubs (duty rate: free, 2.5%) for the foreign inputs noted above. In...

  9. 1-[6-(1H-Indol-1-ylpyridin-2-yl]-1H-indole-3-carbaldehyde

    Directory of Open Access Journals (Sweden)

    C. Ramathilagam


    Full Text Available In the title compound, C22H15N3O, the dihedral angle between the two indole units is 33.72 (3°. The molecular structure features a weak intramolecular C—H...N interaction. In the crystal, weak C—H...O and C—H...π interactions, forming a two-dimensional network parallel to the bc plane.

  10. 161 Etude du pouvoir germinatif de quatre variétés de riz que sont ...

    African Journals Online (AJOL)


    animaux ; assurer le bien-être par l'amélioration des revenus ; créer un capital semencier de qualité des variétés ... La germination est le premier stade du cycle de vie des plantes pour produire une nouvelle ... Le but du travail est l'étude du pouvoir germinatif des semences de riz en notre possession, l'isolement et.

  11. Obtention of Samarium and Gadolinium concentrates by solvent extraction using mono-2-ethylhexyl ester of 2-ethylhexyl phosphonic acid; Obtencao de concentrados de samario e gadolinio via extracao por solventes com o ester mono-2-etilhexil do acido 2-etilhexilfosfonico

    Energy Technology Data Exchange (ETDEWEB)

    Miranda Junior, Pedro


    The rare earth chlorides solution employed in this study, which is constituted by medium and heavy fractions, is derived from monazite processing accomplished by NUCLEMON-Mineroquimica (SP). This solution shows an acidity about 1.18 M and 189 g/L of rare earth oxides, containing as main constituents: Sm(34.55%), Gd(23.85%), Dy (6.82%), and Y (24.45%). It was used, as organic phase, 2-ethylhexyl phosphonic acid, mono-2-ethylhexylester diluted to 1 M in isododecane. (author)

  12. Poly(dl)lactic acid/polyglycolic acid/iron and poly(dl)lactic acid/polyglycolic acid/samarium cobalt composites for use as a delivery mechanism for magnetically directed chondrogenesis (United States)

    Oppermann, Dean Alan

    Magnetically directed chondrogenesis (MDC) is a fundamental approach to articular cartilage repair. In MDC a magnet is implanted into the subchondral trabecular bone underlying a cartilage defect and used to attract chondrocytes, magnetically tagged with Fe nanoparticles, to the defect site. Pilot studies by Halpern, Crimp and Grande, using solid neodymium (Nd) magnets, indicated optimistic results by producing a hyaline-like articular cartilage after 8 weeks implantation. Since solid Nd magnets introduce long-term biocompatibility issues, the focus of this dissertation was to develop P(dl)A/PGA/Fe and P(dl)A/PGA/SmCo 5 implants for use in MDC. The effect of implant porosity, implant composition and magnetic material (Fe or SmCo5) on the initial and degraded magnetic properties were evaluated. The biocompatibility of P(dl)A/PGA/Fe implants were investigated by implantation into New Zealand white rabbits for 8 weeks. The effect of hydrogen peroxide (H2O2) and ethylene oxide (EO) sterilization techniques on the molecular weight and chemical structure of P(dl)A/PGA polymers were evaluated using gel permeation chromatography and Fourier transform infrared spectroscopy. The effect of implant morphology, size and number on the von Mises stress in the trabecular bone surrounding the implant was evaluated using a finite element model. In general, SmCo5 implants resulted in higher magnetic fields initially and after 8 weeks of degradation than comparable Fe implants. Increases in magnetic field strength were achieved by increasing the volume fraction of magnetic material and by increasing the PGA concentration. The magnetic field strength degradation rate decreased with increases in volume fraction of magnetic material and increases in PLA concentration. Implantation studies indicated that 50/50 P(dl)A/PGA were more bioactive than 75/25 P(dl)A/PGA with an increased cellular response that is specific to bone growth. The compressive strength and elastic modulus of porous implants were comparable to trabecular bone, and the compressive strength and elastic modulus of solid implants was higher than trabecular bone but less than cortical bone. Finite element modeling showed that the implantation of solid and porous P(dl)A/PGA/Fe implants did not significantly increase the von Mises stress concentration adjacent to the implant. The von Mises stress surrounding porous implants was higher than the solid implants which predicts faster bone remodeling. Comparing single implants to multiple implants indicated a significant decrease in von Mises stress between the implants. This would predict bone resorption in that area. H2O2 sterilization resulted in a gradual decrease in the molecular weight of P(dl)A/PGA polymers that was a result of hydrolytic scission of the ester bonds present between the individual monomers. The polymers were less affected by EO sterilization with only the 75/25 P(dl)A/PGA, indicating a decrease in molecular weight. From these results, it was concluded that solid 50/50 P(dl)A/PGA/SmCo 5 implants that span the entire width of the cartilage defect should be used to optimize the attraction potential and bioactivity of the implant. Also ethylene oxide, which caused less premature implant degradation, should be used for sterilization.

  13. Fabrication of a new samarium(III) ion-selective electrode based on 3-{l_brace}[2-oxo-1(2h)-acenaphthylenyliden]amino{r_brace}-2-thioxo -1,3-thiazolidin-4-one

    Energy Technology Data Exchange (ETDEWEB)

    Zamani, Hassan Ali [Islamic Azad University, Quchan (Iran, islamic Republic of). Quchan Branch. Dept. of Chemistry]. E-mail:; Ganjali, Mohammad Reza [Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of). Endocrine and Metabolism Research Center; Adib, Mehdi [University of Tehran, Tehran (Iran, Islamic Republic of). Faculty of Chemistry. Center of Excellence in Electrochemistry


    This paper introduces the development of an original PVC membrane electrode, based on 3-{l_brace}[2-oxo-1(2H)-acenaphthylenyliden]amino{r_brace}-2-thioxo-1,3-thiazolidin-4-one (ATTO) which has revealed to be a suitable carrier for Sm{sup 3+} ions. The resulting data illustrated that the electrode shows a Nernstian slope of 19.3 {+-} 0.6 mV per decade for Sm{sup 3+} ions over a broad working concentration range of 1.0 X 10{sup -6} to 1.0 X 10{sup -1} mol L{sup -1}. The lower detection limit was found to be equal to (5.5{+-} 0.3) X 10{sup -7} mol L{sup -}'1 in the pH range of 3.5-7.5, and the response time was very short ({approx}10 s). The potentiometric sensor displayed good selectivities for a number of cations such as alkali, alkaline earth, transition and heavy metal ions. (author)



  15. Assessment of Non-Traditional Isotopic Ratios by Mass Spectrometry for Analysis of Nuclear Activities (United States)


    distinguish between commercial nuclear reactor fuel cycles, fuel cycles for weapons grade plutonium , and products from nuclear weapons explosions. Methods will...Isotopic ratios will be calculated for radionuclides produced in commercial nuclear reactor fuel cycles, fuel cycles for weapons grade plutonium , and... chemistry for analysis of samarium. The chemical form of samarium required for analysis varies for different mass spectrometry techniques

  16. The Critical Technologies Project Executive Summary (United States)


    Materials with the Not covered Chalcopyrite Structure 7.8.23 Rare Earth- Transition Metal Permanent Not covered I Magnets (exanple: samarium cobalt and... Transition Metal Permanent - Magnets (example: samarium cobalt I and substituted samarium cobalt) New 7.8.24 Gadolinium Gallium Garnet (GGG) - - and...III T i mm~ 1.W 8 Poesse Maclw Tools 1110 1129. 1131 133 1142 0 F -~, oO 16.qm P c Metals 1145, 1203, 1236 4203 1365 00, awm.wq *4 1303 1311

  17. sup 8 sup 9 Sr and sup 1 sup 5 sup 3 Sm-EDTMP therapy of disseminated skeletal metastasis

    CERN Document Server

    Zhang Jun Ning; Zhu Shou Peng


    A retrospective analysis was performed on 72 patients with disseminated skeletal metastasis to evaluate the effect of strontium-89 or samarium-153 EDTMP therapy. There existed 87.88% of clinical response, 12.12% of no response in the group treated with strontium-89 as compared with 90.24% of clinical response, 9.76% no response in one treated with samarium-153 EDTMP; and there were no correlation between the treatment results and the amounts of isotopes administrated. The results suggest that strontium-89 or samarium-153 EDTMP therapy is a method of first choice in the palliative treatment for disseminated skeletal metastasis

  18. Measurement of the W-pair Production Cross-section and W Branching Ratios in $e^+ e^-$ Collisions at $\\sqrt{s}$ = 161-209 GeV

    CERN Document Server

    Abdallah, J.; Adam, W.; Adzic, P.; Albrecht, T.; Alderweireld, T.; Alemany-Fernandez, R.; Allmendinger, T.; Allport, P.P.; Amaldi, U.; Amapane, N.; Amato, S.; Anashkin, E.; Andreazza, A.; Andringa, S.; Anjos, N.; Antilogus, P.; Apel, W.D.; Arnoud, Y.; Ask, S.; Asman, B.; Augustin, J.E.; Augustinus, A.; Baillon, P.; Ballestrero, A.; Bambade, P.; Barbier, R.; Bardin, D.; Barker, G.; Baroncelli, A.; Battaglia, M.; Baubillier, M.; Becks, K.H.; Begalli, M.; Behrmann, A.; Ben-Haim, E.; Benekos, N.; Benvenuti, A.; Berat, C.; Berggren, M.; Berntzon, L.; Bertrand, D.; Besancon, M.; Besson, N.; Bloch, D.; Blom, M.; Bluj, M.; Bonesini, M.; Boonekamp, M.; Booth, P.S.L.; Borisov, G.; Botner, O.; Bouquet, B.; Bowcock, T.J.V.; Boyko, I.; Bracko, M.; Brenner, R.; Brodet, E.; Bruckman, P.; Brunet, J.M.; Bugge, L.; Buschmann, P.; Calvi, M.; Camporesi, T.; Canale, V.; Carena, F.; Castro, Nuno Filipe; Cavallo, F.; Chapkin, M.; Charpentier, Ph.; Checchia, P.; Chierici, R.; Chliapnikov, P.; Chudoba, J.; Chung, S.U.; Cieslik, K.; Collins, P.; Contri, R.; Cosme, G.; Cossutti, F.; Costa, M.J.; Crennell, D.; Cuevas, J.; D'Hondt, J.; Dalmau, J.; da Silva, T.; Da Silva, W.; Della Ricca, G.; De Angelis, A.; De Boer, W.; De Clercq, C.; De Lotto, B.; De Maria, N.; De Min, A.; de Paula, L.; Di Ciaccio, L.; Di Simone, A.; Doroba, K.; Drees, J.; Dris, M.; Eigen, G.; Ekelof, T.; Ellert, M.; Elsing, M.; Espirito Santo, M.C.; Fanourakis, G.; Fassouliotis, D.; Feindt, M.; Fernandez, J.; Ferrer, A.; Ferro, F.; Flagmeyer, U.; Foeth, H.; Fokitis, E.; Fulda-Quenzer, F.; Fuster, J.; Gandelman, M.; Garcia, C.; Gavillet, Ph.; Gazis, Evangelos; Gokieli, R.; Golob, B.; Gomez-Ceballos, G.; Goncalves, P.; Graziani, E.; Grosdidier, G.; Grzelak, K.; Guy, J.; Haag, C.; Hallgren, A.; Hamacher, K.; Hamilton, K.; Haug, S.; Hauler, F.; Hedberg, V.; Hennecke, M.; Herr, H.; Hoffman, J.; Holmgren, S.O.; Holt, P.J.; Houlden, M.A.; Hultqvist, K.; Jackson, John Neil; Jarlskog, G.; Jarry, P.; Jeans, D.; Johansson, Erik Karl; Johansson, P.D.; Jonsson, P.; Joram, C.; Jungermann, L.; Kapusta, Frederic; Katsanevas, S.; Katsoufis, E.; Kernel, G.; Kersevan, B.P.; Kerzel, U.; Kiiskinen, A.; King, B.T.; Kjaer, N.J.; Kluit, P.; Kokkinias, P.; Kourkoumelis, C.; Kouznetsov, O.; Krumstein, Z.; Kucharczyk, M.; Lamsa, J.; Leder, G.; Ledroit, Fabienne; Leinonen, L.; Leitner, R.; Lemonne, J.; Lepeltier, V.; Lesiak, T.; Liebig, W.; Liko, D.; Lipniacka, A.; Lopes, J.H.; Lopez, J.M.; Loukas, D.; Lutz, P.; Lyons, L.; MacNaughton, J.; Malek, A.; Maltezos, S.; Mandl, F.; Marco, J.; Marco, R.; Marechal, B.; Margoni, M.; Marin, J.C.; Mariotti, C.; Markou, A.; Martinez-Rivero, C.; Masik, J.; Mastroyiannopoulos, N.; Matorras, F.; Matteuzzi, C.; Mazzucato, F.; Mazzucato, M.; McNulty, R.; Meroni, C.; Migliore, E.; Mitaroff, W.; Mjoernmark, U.; Moa, T.; Moch, M.; Monig, Klaus; Monge, R.; Montenegro, J.; Moraes, D.; Moreno, S.; Morettini, P.; Mueller, U.; Muenich, K.; Mulders, M.; Mundim, L.; Murray, W.; Muryn, B.; Myatt, G.; Myklebust, T.; Nassiakou, M.; Navarria, F.; Nawrocki, K.; Nicolaidou, R.; Nikolenko, M.; Oblakowska-Mucha, A.; Obraztsov, V.; Olshevski, A.; Onofre, A.; Orava, R.; Osterberg, K.; Ouraou, A.; Oyanguren, A.; Paganoni, M.; Paiano, S.; Palacios, J.P.; Palka, H.; Papadopoulou, Th.D.; Pape, L.; Parkes, C.; Parodi, F.; Parzefall, U.; Passeri, A.; Passon, O.; Peralta, L.; Perepelitsa, V.; Perrotta, A.; Petrolini, A.; Piedra, J.; Pieri, L.; Pierre, F.; Pimenta, M.; Piotto, E.; Podobnik, T.; Poireau, V.; Pol, M.E.; Polok, G.; Poropat, P.; Pozdniakov, V.; Pukhaeva, N.; Pullia, A.; Rames, J.; Ramler, L.; Read, Alexander L.; Rebecchi, P.; Rehn, J.; Reid, D.; Reinhardt, R.; Renton, P.; Richard, F.; Ridky, J.; Rivero, M.; Rodriguez, D.; Romero, A.; Ronchese, P.; Roudeau, P.; Rovelli, T.; Ruhlmann-Kleider, V.; Ryabtchikov, D.; Sadovsky, A.; Salmi, L.; Salt, J.; Savoy-Navarro, A.; Schwickerath, U.; Segar, A.; Sekulin, R.; Siebel, M.; Sisakian, A.; Smadja, G.; Smirnova, O.; Sokolov, A.; Sopczak, A.; Sosnowski, R.; Spassov, T.; Stanitzki, M.; Stocchi, A.; Strauss, J.; Stugu, B.; Szczekowski, M.; Szeptycka, M.; Szumlak, T.; Tabarelli, T.; Taffard, A.C.; Tegenfeldt, F.; Timmermans, Jan; Tkatchev, L.; Tobin, M.; Todorovova, S.; Tome, B.; Tonazzo, A.; Tortosa, P.; Travnicek, P.; Treille, D.; Tristram, G.; Trochimczuk, M.; Troncon, C.; Turluer, M.L.; Tyapkin, I.A.; Tyapkin, P.; Tzamarias, S.; Uvarov, V.; Valenti, G.; Van Dam, Piet; Van Eldik, J.; Van Lysebetten, A.; van Remortel, N.; Van Vulpen, I.; Vegni, G.; Veloso, F.; Venus, W.; Verdier, P.; Verzi, V.; Vilanova, D.; Vitale, L.; Vrba, V.; Wahlen, H.; Washbrook, A.J.; Weiser, C.; Wicke, D.; Wickens, J.; Wilkinson, G.; Winter, M.; Witek, M.; Yushchenko, O.; Zalewska, A.; Zalewski, P.; Zavrtanik, D.; Zhuravlov, V.; Zimine, N.I.; Zintchenko, A.; Zupan, M.; Zinchenko, A.


    These final results on e+e- -> W+W- production cross-section measurements at LEP2 use data collected by the DELPHI detector at centre-of-mass energies up to 209 GeV. Measurements of total cross-sections, W angular differential distributions and decay branching fractions, and the value of the CKM element |V_{cs}| are compared to the expectations of the Standard Model. These results supersede all values previously published by DELPHI.

  19. Increase of CD69, CD161 and CD94 on NK Cells in Women with Recurrent Spontaneous Abortion and in Vitro Fertilization Failure

    National Research Council Canada - National Science Library

    Mehri Ghafourian; Najmeh Karami; Ali Khodadadi; Roshan Nikbakhat


    .... This paper aims to compare circulating NK cells expressing activation and inhibition surface markers between patients with RSA and IVF failure with those of healthy multiparous and successful IVF...

  20. Site Investigation Report. 161st Air Refueling Group, Arizona National Guard, Sky Harbor International Airport and Papago Military Reservation, Phoenix, Arizona. Volume 1. Report, Tables and Figures (United States)


    channel, floodplain, and alluvial fan environments derived from drainage areas of the Salt, Gila, Agua Fria, and Verde Rivers. Thickness of upper unit...groundwater media under consideration should be demonstrated to be potable and utilized as drinldng water, either currently or at some planncA future

  1. Prevalence of Bovine Viral Diarrhoea Virus (BVDV), Bovine Herpes Virus 1 (BHV 1), Leptospirosis and Neosporosis, and associated risk factors in 161 Irish beef herds. (United States)

    Barrett, Damien; Parr, Mervyn; Fagan, John; Johnson, Alan; Tratalos, Jamie; Lively, Francis; Diskin, Michael; Kenny, David


    There are limited data available, in Ireland or elsewhere, to determine the extent of exposure to various endemic diseases among beef cows and factors associated with exposure to causative pathogens. The objectives of this study were to determine the herd and within herd prevalence of Bovine Viral Diarrhoea Virus (BVDV), Bovine Herpes Virus 1 (BHV-1), Leptospirosis and Neosporosis in a large scale study of commercial beef herds on the island of Ireland, and to examine herd level factors associated with exposure to these pathogens in these herds. The average number of cows tested per herd was 35.5 (median 30). Herd level seroprevalence to Bovine Herpesvirus-1(BHV-1), Bovine Viral-Diarrhoea Virus (BVDV), Leptospirosis and Neosporosis was 90%, 100%, 91% and 67%, respectively, while the mean within herd prevalence for the these pathogens was 40%, 77.7%, 65.7% and 5.7%, respectively. The study confirms that the level of seroconversion for the four pathogens of interest increases with herd size. There was also evidence that exposure to one pathogen may increase the risk of exposure to another pathogen. Herd level seroprevalences were in excess of 90% for BVDV, BHV-1 and Leptosporosis. Larger herds were subject to increased exposure to disease pathogens. This study suggests that exposure to several pathogens may be associated with the further exposure to other pathogens.

  2. Endocrine phenotype of 6q16.1-q21 deletion involving SIM1 and Prader-Willi syndrome-like features. (United States)

    Izumi, Kosuke; Housam, Ryan; Kapadia, Chirag; Stallings, Virginia A; Medne, Livija; Shaikh, Tamim H; Kublaoui, Bassil M; Zackai, Elaine H; Grimberg, Adda


    Proximal interstitial 6q deletion involving Single-minded 1 (SIM1) gene causes a syndromic form of obesity mimicking Prader-Willi syndrome. In addition to obesity, Prader-Willi syndrome includes several other endocrinopathies, such as hypothyroidism, growth hormone deficiency, and hypogonadotropic hypogonadism. The endocrine phenotype of interstitial 6q deletion remains largely unknown, although clinical similarities between Prader-Willi syndrome and interstitial 6q deletion suggest endocrine abnormalities also may contribute to the interstitial 6q deletion phenotype. This report describes the endocrine phenotype in a propositus with the Prader-Willi-like syndrome associated with an interstitial 6q deletion including the SIM1 gene. Detailed endocrine evaluation of the propositus during childhood and adolescence revealed hypopituitarism, though initial endocrine evaluations during infancy were unremarkable. Our patient raises the possibility that hypopituitarism may be part of the phenotype, especially short stature, caused by interstitial 6q deletion. SIM1 plays an important role in the development of neuroendocrine lineage cells, implicating SIM1 haploinsufficiency in the pathophysiology of hypopituitarism seen in our propositus. Early identification of endocrine abnormalities can improve clinical outcome by allowing timely introduction of hormone replacement therapy. Hence, we suggest that detailed endocrine evaluation and longitudinal endocrine follow up be performed in individuals with proximal interstitial 6q deletion involving SIM1. © 2013 Wiley Periodicals, Inc.

  3. Site Investigation Report. 161st Air Refueling Group, Arizona National Guard, Sky Harbor International Airport and Papago Military Reservation, Phoenix, Arizona. Volume 2. Appendices A Through G (United States)


    Monitorina Revie, pD. 9l 1988, Lindorf, D., Fold , J., and Connelly , Groundwater Samolina Prpc @dure Gi elinui,% Wisconsin Department of Natural...a SRI model 8610 GC equipped with an PID and FID detector in series, purge and trap, and Peaksimple data system. The onboard integrator of the IOS50...representative of the formation water (Llndorf, Fold , Connelly, 1987). o According to the EPA Guidance, as soon as the well recovers, the order of sampling

  4. Properties of II-VI Semiconductors: Bulk Crystals, Epitaxial Films, Quantum Well Structures, and Dilute Magnetic Systems. Materials Research Society Symposium Proceedings. Volume 161 (United States)


    REPORT NJMEU Material Reserach Society 9800 McKnight Road, Suite 327 AFOSR TR- 1 () Pittsburgh, PA 15237-6005 C SWONSG MONIT0 hG A"IG Y NAME(S) £N0...OF ZnSe-ZnS STRAINED-LAYER SUPERLATTICES AND A FIBONACCI SEQUENCE 199 Tsunemasa Taguchi and Yoichi Yamada OPTICAL PROPERTIES OF CdZnS-ZnS STRAINED...the widespread alloy Hg0.8Cd0.2Te measured and calculated in a wide temperature range [5] : on the Te-saturated side as well as on the Hg- saturated

  5. SU-F-J-161: Prostate Contouring in Patients with Bilateral Hip Prostheses: Impact of Using Artifact-Reduced CT Images and MRI

    Energy Technology Data Exchange (ETDEWEB)

    Elzibak, A; Loblaw, A; Morton, G; Vesprini, D; Liu, S; Chung, H; Davidson, M [Odette Cancer Centre, Sunnybrook Health Sciences Centre, Toronto, Ontario (Canada)


    Purpose: To investigate the usefulness of metal artifact reduction in CT images of patients with bilateral hip prostheses (BHP) for contouring the prostate and determine if the inclusion of MR images provides additional benefits. Methods: Five patients with BHP were CT scanned using our clinical protocol (140kV, 300mAs, 3mm slices, 1.5mm increment, Philips Medical Systems, OH). Images were reconstructed with the orthopaedic metal artifact reduction (O-MAR) algorithm. MRI scanning was then performed (1.5T, GE Healthcare, WI) with a flat table-top (T{sub 2}-weighted, inherent body coil, FRFSE, 3mm slices with 0mm gap). All images were transferred to Pinnacle (Version 9.2, Philips Medical Systems). For each patient, two data sets were produced: one containing the O-MAR-corrected CT images and another containing fused MRI and O-MAR-corrected CT images. Four genito-urinary radiation oncologists contoured the prostate of each patient on the O-MAR-corrected CT data. Two weeks later, they contoured the prostate on the fused data set, blinded to all other contours. During each contouring session, the oncologists reported their confidence in the contours (1=very confident, 3=not confident) and the contouring difficulty that they experienced (1=really easy, 4=very challenging). Prostate volumes were computed from the contours and the conformity index was used to evaluate inter-observer variability. Results: Larger prostate volumes were found on the O-MAR-corrected CT set than on the fused set (p< 0.05, median=36.9cm{sup 3} vs. 26.63 cm{sup 3}). No significant differences were noted in the inter-observer variability between the two data sets (p=0.3). Contouring difficulty decreased with the addition of MRI (p<0.05) while the radiation oncologists reported more confidence in their contours when MRI was fused with the O-MAR-corrected CT data (p<0.05). Conclusion: This preliminary work demonstrated that, while O-MAR correction to CT images improves visualization of anatomy, the addition of MRI enhanced the oncologists’ confidence in contouring the prostate in patients with BHP.

  6. General Information about Osteosarcoma and Malignant Fibrous Histiocytoma of Bone (United States)

    ... providers who are experts in treating cancer in children. Treatment for osteosarcoma or malignant fibrous histiocytoma may cause side effects. Four types of standard treatment are used: Surgery Chemotherapy Radiation therapy Samarium New types of treatment are ...

  7. Treatment Option Overview (Osteosarcoma and Malignant Fibrous Histiocytoma of Bone) (United States)

    ... providers who are experts in treating cancer in children. Treatment for osteosarcoma or malignant fibrous histiocytoma may cause side effects. Four types of standard treatment are used: Surgery Chemotherapy Radiation therapy Samarium New types of treatment are ...

  8. Maximum Permissible Concentrations and Negligible Concentrations for Rare Earth Elements (REEs)

    NARCIS (Netherlands)

    Sneller FEC; Kalf DF; Weltje L; Wezel AP van; CSR


    In dit rapport worden maximaal toelaatbare risiconiveaus (MTR) en verwaarloosbare risiconiveaus (VR) afgeleid voor zeldzame aardmetalen (ZAM). De geselecteerde ZAMs zijn Yttrium (Y), Lanthanum (La), Cerium (Ce), Praseodymium (Pr), Neodymium (Nd), Samarium (Sm), Gadolinium (Gd), en Dysprosium

  9. Bulletin of the Chemical Society of Ethiopia - Vol 31, No 3 (2017)

    African Journals Online (AJOL)

    A novel samarium complex with interesting photoluminescence and semiconductive properties · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. D. W. Zhang, W. T. Chen, Y. F.Wang, 435-444 ...

  10. Specialty Metals: DOD Dissemination of National Security Waiver Information Could Enhance Awareness and Compliance with Restrictions (United States)


    Restrictions Why GAO Did This Study Specialty metals—such as titanium, certain steel alloys , and samarium- cobalt alloy magnets—are essential to DOD...highly magnetic, lightweight, corrosion resistant, or having high durability. Among these metals are samarium- cobalt alloy magnets used to make radar...the following elements: aluminum, chromium , cobalt , columbium, molybdenum, nickel, titanium, tungsten, or vanadium. Specialty metals were added

  11. Development of a methodology for the separation of europium and samarium from a mixture of rare earth oxides by electroreduction/ precipitation; Desenvolvimento de uma metodologia para a separacao de samario e europio a partir de mistura de oxidos de terras raras por reducao eletroquimica/precipitacao

    Energy Technology Data Exchange (ETDEWEB)

    Chepcanoff, Vera


    The rare earths (RE) were first used in 1903, when Welsbach developed a lighter that is still used today. Nowadays, the RE are employed in many different fields, as in the production of super-alloys , as catalysts for petroleum industry, in the manufacture of non-ferrous alloys, color television tubes, x-ray screens, special glasses, ceramics, computer industries, nuclear medicine, lasers, pigments, etc., moving, in the last decade , a market of US$ 2 billions per year. Due to their similar properties, the RE elements are very difficult to separate, requiring complex processes, what make the products very expensive. Elements like Eu and Sm, which contents in the minerals are low (0.05% and 2.0%, respectively, in monazite) are extremely expensive, but their field of application justifies the research for looking for other processes, more simple and/or more effective. Trivalent state is a characteristic of all RE, but some of them presents oxidation state +2, like Ce, Eu, Sm and Yb. In the case of Eu and Sm, the focus of the present work, the divalent state is achieved by electro-reduction in the potentials -0.65 and -1.55 (SCE), respectively. This makes possible the separation of these elements from the other rare earths and from each other. Thus, making use of this characteristic, a process for the individual separation of Eu and Sm in (NH{sub 4}){sub 2}SO{sub 4} solution by electro-reduction/precipitation is proposed, where Sm is first separated from the solution as sulfate, and Eu, that remains in the solution, is precipitated after the decrease of temperature and potential applied. The process developed from a synthetic Eu and Sm solution was applied to a mixture of semi-heavy RE oxide, produced at IPEN-CNEN/SP, obtaining the separation of Sm. This product was analyzed by spectrophotometry, showing high purity. (author)

  12. Tetrakis[μ-2-(3,4-dimethoxyphenylacetato]-κ4O:O′;κ3O,O′:O;κ3O:O,O′-bis{[2-(3,4-dimethoxyphenylacetato-κ2O,O′](1,10-phenanthroline-κ2N,N′samarium(III}

    Directory of Open Access Journals (Sweden)

    Jia-Lu Liu


    Full Text Available In the centrosymmetric dinuclear title complex, [Sm2(C10H11O46(C12H8N22], the SmIII ion is nine-coordinated by seven O atoms of five 2-(3,4-dimethoxyphenylacetate (DMPA ligands and two N atoms of one bis-chelating 1,10-phenanthroline (phen ligand, forming a distorted tricapped trigonal-prismatic environment. The DMPA ligands coordinate in bis-chelate, bridging and bridging tridentate modes. An intramolecular C—H...O hydrogen bond occurs. Intermolecular C—H...O interactions are also present in the crystal.

  13. Preparation, and Luminescence Properties of SiO2@Sm(MABA-Siphen Core-Shell Structure Nanometer Composite

    Directory of Open Access Journals (Sweden)

    Feng Li-Na


    Full Text Available A novel ternary samarium complex was prepared using HOOCC6H4N(CONH(CH23Si- (OCH2CH332 (MABA-Si as first ligand, and phen as second ligand. The corresponding SiO2@Sm(MABA-Siphen core-shell structure nanometer composite was synthesized as well, and the silica spheres was the core, and the ternary samarium complex was the shell layer. The ternary samarium complex has been characterized by element analysis, molar conductivity and IR spectra. The results show that the chemical formula of the complex is Sm(MABA-Si(phen2(ClO43·2H2O. The fluorescent spectra illustrat that the luminescence properties of the samarium complex are superior. The core-shell structure of SiO2@Sm(MABA-Siphen nanometer composite is characterized by SEM, TEM and IR spectra. The SiO2@Sm(MABA-Siphen core-shell structure composites exhibit stronger emission intensity than the ternary samarium complex. The fluorescence lifetime of the complex and core-shell structure composite is measured as well.

  14. CCDC 849283: Experimental Crystal Structure Determination : bis(N-(1-(6-(1H-pyrazol-1-yl)pyridin-2-yl)ethylidene)aniline)-cobalt tetrachloro-cobalt

    KAUST Repository

    Gong, Dirong


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  15. Comment on "Atomic structure calculations and identification of EUV and SXR spectral lines in Sr XXX" by A. Goyal, I. Khatri, S. Aggarwal, A.K. Singh, M. Mohan [J Quant Spectrosc Radiat Transf 2015;161:157 (United States)

    Aggarwal, Kanti M.


    Recently, Goyal et al. [1] reported energies and lifetimes (τ) for the lowest 113 levels of the 2s22p5, 2s2p6, 2s22p43ℓ, 2s2p53ℓ and 2p63ℓ configurations of F-like Sr XXX. For the calculations they adopted the multi-configuration Dirac-Fock (MCDF) and the flexible atomic code (FAC). Additionally, they also listed radiative rates (A- values), oscillator strengths (f- values) and line strengths (S- values) for four types of transitions, namely electric dipole (E1), electric quadrupole (E2), magnetic dipole (M1) and magnetic quadrupole (M2), but only from the ground to the higher excited levels. However, there are two clear anomalies in their reported data. Firstly, the f-values listed from FAC in their Tables 3-6 are larger than from MCDF by a factor of two, for all transitions. This is because they have blindly listed the output from FAC without realising that, unlike MCDF, FAC lists ωf where ω is the statistical weight, and happens to be exactly 2 in the present case. Secondly, their lifetime for level 2 (2s22p51/2 o 2P) is incorrect. This is because the dominant contributing transition for this level is 1-2 M1 for which A=3.25×106 s-1, listed (correctly) in their Table 5, and this leads to τ=3.08×10-7 s, and not 1.54×10-7 s, as listed in their Table 1.

  16. A genome-wide association study of Hodgkin's lymphoma identifies new susceptibility loci at 2p16.1 (REL), 8q24.21 and 10p14 (GATA3)

    DEFF Research Database (Denmark)

    Enciso-Mora, Victor; Broderick, Peter; Ma, Yussanne


    To identify susceptibility loci for classical Hodgkin's lymphoma (cHL), we conducted a genome-wide association study of 589 individuals with cHL (cases) and 5,199 controls with validation in four independent samples totaling 2,057 cases and 3,416 controls. We identified three new susceptibility l...

  17. Sabbatical Options for Academic Librarians in the U.S. Vary Widely. A Review of: Flaspohler, M. R. (2009. Librarian sabbatical leaves: Do we need to get out more? Journal of Academic Librarianship, 35(2, 152‐161.

    Directory of Open Access Journals (Sweden)

    Heather Ganshorn


    Full Text Available Objectives – To gather data on what proportion of U.S. academic libraries provide sabbatical opportunities to librarians, and to explore library directors’ perceptions of the effectiveness of sabbaticals and barriers to sabbatical‐taking among librarians at their institutions.Design – Online questionnaire.Setting – Academic libraries in the U.S..Subjects – Directors of 403 academic libraries.Methods – The author reviewed the literature on sabbatical leaves in the library profession. She then developed an online survey using the University of Washington’s Catalyst system (a tool similar to SurveyMonkey. The survey contained both closed and open‐ended questions, in order to generate quantitative data as well as to gather more in‐depth information on respondents’ views.A sample of American academic library directors was generated by choosing every eighth entry on a list of 3037 academic libraries generated by lib‐web‐cats, an online directory of libraries ( The survey was sent to 403 academic library directors based on this selection method. The author received 101 successfully completed surveys for a response rate of 25%.Main Results – The author found that just over half of respondents (53 libraries, or 52% indicated their institutions offered sabbatical leaves to librarians. Thirty‐six per cent indicated they did not, while 12% indicated “other” (many of these respondents commented with clarifications about what other leave programs were available to librarians. Of the 53 institutions that reported offering leave programs, only half (27 respondents indicated that library staff members had taken a sabbatical leave.Open‐ended questions generated some insight into the barriers to sabbatical leaves at academic libraries. Differences between institutions in terms of availability of sabbatical leaves appear to be due to a combination of librarian status (whether or not librarians have full faculty status; funding issues (in some institutions, the library, and not the college administration, has to cover the costs of a sabbatical; and availability of other staff to cover the duties of the individual taking the leave.Respondents also noted a discrepancy between the length and timing of librarian sabbaticals compared to other faculty (i.e., the professoriate, with librarians more often required to begin their leaves in the summer. Librarian sabbaticals were also sometimes shorter than those of other faculty; in some institutions a summer‐length sabbatical was available, but not a six‐month or year‐long sabbatical, even though these options were available to other faculty.In terms of impacts of sabbaticals, most respondents who had experienced a staff member taking sabbatical felt that the sabbatical benefited the staff member and the institution; positive results include improved morale, publications that raised the profile of the library, and learning that was applied in the workplace. Some respondents, however, had negative experiences to report, the most common being that the sabbatical had had no effect. Some respondents noted staff who had taken sabbaticals had failed to meet the goals that had been set for the sabbatical. When asked what could be done to enhance sabbatical programs, respondents at institutions with these programs had some interesting suggestions, such as aligning sabbatical programs more closely with institutional goals, or promoting the pursuit of more collaborative research while on sabbatical.Conclusion – The author notes that while it’s dangerous to over‐generalize from such a brief survey, many of the issues raised in the responses, such as faculty status, funding shortfalls, and staff shortages echo themes raised elsewhere in the library literature. These issues probably need to be addressed if we are to see any increase in the number of librarians taking sabbatical leaves.The author’s other conclusion is that librarians must be more accountable for demonstrating how a sabbatical could add institutional value, and for meeting the goals set in their sabbatical plans. The author conducted this study while on sabbatical herself, and concludes it “provides one example of how a librarian might create a manageable, research‐based project that more closely marries academic rigor to personal experience” (p. 160.

  18. Multibeam collection for KN161L06: Multibeam data collected aboard Knorr from 2000-04-07 to 2000-05-16, departing from Recife, Brazil and returning to Recife, Brazil (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set is part of a larger set of data called the Multibeam Bathymetry Database (MBBDB) where other similar data can be found at...

  19. CCDC 849284: Experimental Crystal Structure Determination : Dichloro-(2,6-diisopropyl-N-(1-(6-(1H-pyrazol-1-yl)pyridin-2-yl)ethylidene)aniline)-cobalt(ii)

    KAUST Repository

    Gong, Dirong


    An entry from the Cambridge Structural Database, the world’s repository for small molecule crystal structures. The entry contains experimental data from a crystal diffraction study. The deposited dataset for this entry is freely available from the CCDC and typically includes 3D coordinates, cell parameters, space group, experimental conditions and quality measures.

  20. Genome-wide association analysis of genetic generalized epilepsies implicates susceptibility loci at 1q43, 2p16.1, 2q22.3 and 17q21.32

    DEFF Research Database (Denmark)

    Steffens, M.; Leu, C.; Ruppert, A. K.


    Genetic generalized epilepsies (GGEs) have a lifetime prevalence of 0.3 and account for 2030 of all epilepsies. Despite their high heritability of 80, the genetic factors predisposing to GGEs remain elusive. To identify susceptibility variants shared across common GGE syndromes, we carried out a ...