WorldWideScience

Sample records for samarium 154

  1. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints

    Directory of Open Access Journals (Sweden)

    Mohammed Najeeb Al Hallak

    2009-08-01

    Full Text Available 153Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate and Samarium-153 [1]. 153Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of 153Sm-EDTMP leads to contamination with 154Eu (Europium-154 [2]. A previous study only alluded to the retention of 154Eu in the bones after receiving treatment with 153Sm-EDTMP [2]. Activation of the alarm at security checkpoints after 153Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received 153Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing theAmerican-Canadian border. We assume that the 154Eu which remained in the patients’ bones activated the sensors. Methods: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received 153Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. Results: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of 154Eu emissions. Conclusion: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of 154Eu retained in patients who received 153Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of 153Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with 153Sm-EDTMP at Roger Maris Cancer Center

  2. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints.

    Science.gov (United States)

    Najeeb Al Hallak, Mohammed; McCurdy, Matt; Zouain, Nicolas; Hayes, Justin

    2009-08-28

    (153)Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate) and Samarium-153 [1]. (153)Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of (153)Sm-EDTMP leads to contamination with (154)Eu (Europium-154) [2]. A previous study only alluded to the retention of (154)Eu in the bones after receiving treatment with (153)Sm-EDTMP [2]. Activation of the alarm at security checkpoints after (153)Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received (153)Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA) activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing the American-Canadian border. We assume that the (154)Eu which remained in the patients' bones activated the sensors. METHODS: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received (153)Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. RESULTS: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of (154)Eu emissions. CONCLUSION: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of (154)Eu retained in patients who received (153)Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of (153)Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with (153)Sm-EDTMP at Roger Maris Cancer

  3. Crystal structure of monoclinic samarium and cubic europium sesquioxides and bound coherent neutron scattering lengths of the isotopes {sup 154}Sm and {sup 153}Eu

    Energy Technology Data Exchange (ETDEWEB)

    Kohlmann, Holger [Leipzig Univ. (Germany). Inst. of Inorganic Chemistry; Hein, Christina; Kautenburger, Ralf [Saarland Univ., Saarbruecken (Germany). Inorganic Solid State Chemistry; Hansen, Thomas C.; Ritter, Clemens [Institut Laue-Langevin, Grenoble (France); Doyle, Stephen [Karlsruhe Institute of Technology, Eggenstein-Leopoldshafen (Germany). Inst. for Synchrotron Radiation (ISS)

    2016-11-01

    The crystal structures of monoclinic samarium and cubic europium sesquioxide, Sm{sub 2}O{sub 3} and Eu{sub 2}O{sub 3}, were reinvestigated by powder diffraction methods (laboratory X-ray, synchrotron, neutron). Rietveld analysis yields more precise structural parameters than previously known, especially for oxygen atoms. Interatomic distances d(Sm-O) in Sm{sub 2}O{sub 3} range from 226.3(4) to 275.9(2) pm [average 241.6(3) pm] for the monoclinic B type Sm{sub 2}O{sub 3} [space group C2/m, a = 1418.04(3) pm, b = 362.660(7) pm, c = 885.48(2) pm, β = 100.028(1) ], d(Eu-O) in Eu{sub 2}O{sub 3} from 229.9(2) to 238.8(2) pm for the cubic bixbyite (C) type [space group Ia anti 3, a = 1086.87(1) pm]. Neutron diffraction at 50 K and 2 K did not show any sign for magnetic ordering in Sm{sub 2}O{sub 3}. Isotopically enriched {sup 154}Sm{sub 2}O{sub 3} and {sup 153}Eu{sub 2}O{sub 3} were used for the neutron diffraction work because of the enormous absorption cross section of the natural isotopic mixtures for thermal neutrons. The isotopic purity was determined by inductively coupled plasma - mass spectrometry to be 98.9% for {sup 154}Sm and 99.8% for {sup 153}Eu. Advanced analysis of the neutron diffraction data suggest that the bound coherent scattering lengths of {sup 154}Sm and {sup 153}Eu need to be revised. We tentatively propose b{sub c}({sup 154}Sm) = 8.97(6) fm and b{sub c}({sup 153}Eu) = 8.85(3) fm for a neutron wavelength of 186.6 pm to be better values for these isotopes, showing up to 8% deviation from accepted literature values. It is shown that inaccurate scattering lengths may result in severe problems in crystal structure refinements causing erroneous structural details such as occupation parameters, which might be critically linked to physical properties like superconductivity in multinary oxides.

  4. Synthesis of Samarium Cobalt Nanoblades

    Energy Technology Data Exchange (ETDEWEB)

    Darren M. Steele

    2010-08-25

    As new portable particle acceleration technologies become feasible the need for small high performance permanent magnets becomes critical. With particle accelerating cavities of a few microns, the photonic crystal fiber (PCF) candidate demands magnets of comparable size. To address this need, samarium cobalt (SmCo) nanoblades were attempted to be synthesized using the polyol process. Since it is preferable to have blades of 1-2 {micro}m in length, key parameters affecting size and morphology including method of stirring, reaction temperature, reaction time and addition of hydroxide were examined. Nanoparticles consisting of 70-200 nm spherical clusters with a 3-5 nm polyvinylpyrrolidone (PVP) coating were synthesized at 285 C and found to be ferromagnetic. Nanoblades of 25nm in length were observed at the surface of the nanoclusters and appeared to suggest agglomeration was occurring even with PVP employed. Morphology and size were characterized using a transmission electron microscope (TEM). Powder X-Ray Diffraction (XRD) analysis was conducted to determine composition but no supportive evidence for any particular SmCo phase has yet been observed.

  5. Particle-Size-Induced Valence Changes in Samarium Clusters

    Energy Technology Data Exchange (ETDEWEB)

    Mason, M. G.; Lee, S. -T.; Apai, G.; Davis, R. F.; Shirley, D. A.; Franciosi, A.; Weaver, J. H.

    1981-09-01

    Samarium clusters exhibit mixed-valence behavior which is sensitive to particle size. XPS and UPS data show samarium to be primarily divalent (4f{sup 6} ) at small particle size. The trivalent state (4f{sup 5} ) becomes progressively more abundant with increasing s1ze, becoming the dominant state for the bulk metal. These results are interpreted using a model in which band narrowing, due to reduced surface coordination, is more dominant than surface tension effects in establishing the valence of small samarium clusters.

  6. Yellow-green electroluminescence of samarium complexes of 8-hydroxyquinoline

    Energy Technology Data Exchange (ETDEWEB)

    Behzad, Sara Karimi; Najafi, Ezzatollah [Department of Chemistry Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Amini, Mostafa M., E-mail: m-pouramini@sbu.ac.ir [Department of Chemistry Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Janghouri, Mohammad; Mohajerani, Ezeddin [Laser Research Institute Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Ng, Seik Weng [Department of Chemistry, University of Malaya, 50603 Kuala Lumpur (Malaysia)

    2014-12-15

    Four novel samarium complexes were prepared by reacting samarium(III) nitrate with 8-hydroxyquinoline, 2-methyl-8-hydroxyquinoline, and 1,10-phenanthroline and utilized as emitting materials in the electroluminescence device. All complexes were characterized by elemental analysis, infrared, UV–vis and {sup 1}H NMR spectroscopes and the molecular structure of a representative complex, [Sm{sub 2}(Me-HQ){sub 4}(NO{sub 3}){sub 6}] (1), was determined by single-crystal X-ray diffraction. Utilization of a π-conjugated (phenanthroline) ligand as a second ligand in the structure of the samarium complexes resulted in red shifts in both absorption and fluorescence spectra of complexes and moderately enhanced the photoluminescence intensity and the fluorescence quantum yield. The maximum emission peaks showed that a good correlation exists between the nature of the substituent group on the 8-hydroxyquinoline and the addition of the π-conjugated ligand in the structure of samarium complexes and emission wavelength. Devices with samarium(III) complexes with structure of ITO/PEDOT:PSS (90 nm)/PVK:PBD:Sm(III) complexes (75 nm)/Al (180 nm) were fabricated. In the electroluminescence (EL) spectra of the devices, a strong ligand-centered emission and narrow bands arising from the {sup 4}G{sub 5/2}→{sup 6}H{sub J} transitions (J=7/2, 9/2, and 11/2) of the samarium ion were observed for the complexes. The electroluminescent spectra of the samarium complexes were red-shifted as compared with the PVK:PBD blend. We believe that the electroluminescence performance of OLED devices based on samarium complexes relies on overlaps between the absorption of the samarium compounds and the emission of PVK:PBD. This revealed that it is possible to evaluate the electroluminescence performance of the samarium compounds-doped OLED devices based on the emission of PVK:PBD and the absorption of the dopants. - Highlights: • Four novel photoluminescence samarium complexes have been synthesized.

  7. Biodistribution of samarium-153-EDTMP in rats treated with docetaxel

    Energy Technology Data Exchange (ETDEWEB)

    Villarim Neto, Arthur; Acucena, Maria Kadja Meneses Torres; Pereira, Kercia Regina Santos Gomes; Rego, Amalia Cinthia Meneses [Universidade Federal do Rio Grande do Norte (UFRN), Natal, RN (Brazil). Postgraduate Program in Health Sciences; Azevedo, Italo Medeiros; Medeiros, Aldo Cunha [Universidade Federal do Rio Grande do Norte (UFRN), Natal, RN (Brazil). Dept. of Surgery; Bernardo-Filho, Mario [State University of Rio de Janeiro, RJ (Brazil). Dept. of Biophysics and Biometry

    2009-01-15

    Purpose: Many patients with metastatic bone disease have to use radiopharmaceuticals associated with chemotherapy to relieve bone pain. The aim of this study was to assess the influence of docetaxel on the biodistribution of samarium-153-EDTMP in bones and other organs of rats. Methods: Wistar male rats were randomly allocated into 2 groups of 6 rats each. The DS (docetaxel/samarium) group received docetaxel (15 mg/kg) intraperitoneally in two cycles 11 days apart. The S (samarium/control) group rats were not treated with docetaxel. Nine days after chemotherapy, all the rats were injected with 0.1 ml of samarium-153-EDTMP via orbital plexus (25 {mu} Ci. After 2 hours, the animals were killed and samples of the brain, thyroid, lung, heart, stomach, colon, liver, kidney and both femurs were removed. The percentage radioactivity of each sample (% ATI / g) was determined in an automatic gamma-counter (Wizard-1470, Perkin-Elmer, Finland). Results: On the ninth day after the administration of the second chemotherapy cycle, the rats had a significant weight loss (314.50 +- 22.09 g) compared (p<0.5) to pre-treatment weight (353.66 {+-} 22.8). The % ATI/g in the samples of rats treated with samarium-153-EDTMP had a significant reduction in the right femur, left femur, kidney, liver and lungs of animals treated with docetaxel, compared to the control rats. Conclusion: The combination of docetaxel and samarium-153-EDTMP was associated with a lower response rate in the biodistribution of the radiopharmaceutical to targeted tissues. Further investigation into the impact of docetaxel on biodistribution of samarium-153-EDTMP would complement the findings of this study. (author)

  8. The Basis for Developing Samarium AMS for Fuel Cycle Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Buchholz, B A; Biegalski, S R; Whitney, S M; Tumey, S J; Weaver, C J

    2008-10-13

    Modeling of nuclear reactor fuel burnup indicates that the production of samarium isotopes can vary significantly with reactor type and fuel cycle. The isotopic concentrations of {sup 146}Sm, {sup 149}Sm, and {sup 151}Sm are potential signatures of fuel reprocessing, if analytical techniques can overcome the inherent challenges of lanthanide chemistry, isobaric interferences, and mass/charge interferences. We review the current limitations in measurement of the target samarium isotopes and describe potential approaches for developing Sm-AMS. AMS sample form and preparation chemistry will be discussed as well as possible spectrometer operating conditions.

  9. Samarium-153 EDTMP for metastatic bone pain palliation: the impact of europium impurities.

    Science.gov (United States)

    Kalef-Ezra, J A; Valakis, S T; Pallada, S

    2015-02-01

    To evaluate the impact on the radiation protection policies of the radiocontaminants in Samarium-153 ethylenediamine tetramethylene phosphonate ((153)Sm-EDTMP). The internal contamination of patients treated with (153)Sm-EDMTP for palliation of painful disseminated multiple bone metastases due to long-lived impurities was assessed by direct measurements. These measurements were coupled with dose-rate measurements close to their bodies and spectroscopic analysis of the residual activity in post-treatment radiopharmaceutical vials. Whole-body counting carried out in six patients showed a 30-81-kBq europium -152 plus europium-154 contamination. The 0.85 mean (152)Eu- to -(154)Eu activity ratio obtained by direct counting was similar to that assessed by analysis of post-treatment residual activities in twelve radiopharmaceutical vials following radiopharmaceutical injection. The long-lived radiocontaminants in the patient's bodies and the treatment wastes require modifications of the applicable radiation protection policies. Copyright © 2014 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  10. Optical characteristics of transparent samarium oxide thin films ...

    Indian Academy of Sciences (India)

    Optical characteristics of transparent samarium oxide thin films deposited by the radio-frequency sputtering technique. A A ATTA M M EL-NAHASS KHALED M ELSABAWY M M ABD EL-RAHEEM A M HASSANIEN A ALHUTHALI ALI BADAWI AMAR MERAZGA. Regular Volume 87 Issue 5 November 2016 Article ID 72 ...

  11. Optical properties of zinc–vanadium glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Zinc–vanadium glasses doped with samarium oxide having the chemical composition Sm2O3() ZnO(40-)V2O5(60) (where = 0.1–0.5 mol%) were prepared by melt quenching method. The density of these glasses was measured by Archimedes method; the corresponding molar volumes have also been calculated.

  12. Optical properties of samarium doped zinc–tellurite glasses

    Indian Academy of Sciences (India)

    Unknown

    Optical properties of samarium doped zinc–tellurite glasses. B ERAIAH. Department of Physics, Karnatak University, Dharwad 580 003, India. Present address: Department of Physics, Bangalore University, Bangalore 560 056, India. MS received 20 March 2006; revised 13 June 2006. Abstract. Glasses with the composition, ...

  13. Effect of second ligand on the luminescence of Samarium (III ...

    Indian Academy of Sciences (India)

    Effect of second ligand on the luminescence of Samarium (III) dibenzoylmethane complexes: Syntheses, crystal structures, thermal analysis and luminescence study. MUHAMMAD IDIRIS SALEH, MIN YEE CHOO, TAI WEI CHAN and MOHD R RAZALI. ∗. School of Chemical Sciences, Universiti Sains Malaysia, Penang, ...

  14. Effect of second ligand on the luminescence of Samarium (III ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences; Volume 127; Issue 12. Effect of second ligand on the luminescence of Samarium (III) dibenzoylmethane complexes: ... Muhammad Idiris Saleh1 Min Yee Choo1 Tai Wei Chan1 Mohd R Razali1. School of Chemical Sciences, Universiti Sains Malaysia, Penang, Malaysia ...

  15. Dependence of samarium-soil interaction on samarium concentration: Implications for environmental risk assessment.

    Science.gov (United States)

    Ramírez-Guinart, Oriol; Salaberria, Aitor; Vidal, Miquel; Rigol, Anna

    2018-03-01

    The sorption and desorption behaviour of samarium (Sm), an emerging contaminant, was examined in soil samples at varying Sm concentrations. The obtained sorption and desorption parameters revealed that soil possessed a high Sm retention capacity (sorption was higher than 99% and desorption lower than 2%) at low Sm concentrations, whereas at high Sm concentrations, the sorption-desorption behaviour varied among the soil samples tested. The fractionation of the Sm sorbed in soils, obtained by sequential extractions, allowed to suggest the soil properties (pH and organic matter solubility) and phases (organic matter, carbonates and clay minerals) governing the Sm-soil interaction. The sorption models constructed in the present work along with the sorption behaviour of Sm explained in terms of soil main characteristics will allow properly assessing the Sm-soil interaction depending on the contamination scenario under study. Moreover, the sorption and desorption K d values of radiosamarium in soils were strongly correlated with those of stable Sm at low concentrations (r = 0.98); indicating that the mobility of Sm radioisotopes and, thus, the risk of radioactive Sm contamination can be predicted using data from low concentrations of stable Sm. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Mechanism of the electrochemical deposition of samarium-based coatings

    Energy Technology Data Exchange (ETDEWEB)

    Ruiz, Edgar J. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Ortega-Borges, Raul [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Godinez, Luis A. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Chapman, Thomas W. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Meas-Vong, Yunny [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico)]. E-mail: yunnymeas@cideteq.mx

    2006-11-12

    Samarium-based films have been shown to form from aqueous solutions on the surfaces of metallic substrates such as steel or aluminum, and their presence has been reported to decrease substantially the corresponding corrosion rate of the underlying metallic substrate. Based on previous reports on the deposition of oxides or hydroxides of the closely related element cerium, this work demonstrates that samarium films are formed following a similar mechanism, which involves as the fundamental step an increase in interfacial pH resulting from cathodic oxygen-reduction or hydrogen-evolution reactions. With cyclic voltammetry (CV), electrochemical quartz-crystal microbalance (EQCM) measurements, rotating-disk electrode (RDE) tests, and surface characterization techniques, namely, scanning electron microscopy (SEM) and X-ray surface microanalysis (EDX), the postulated mechanism was verified, and the surface morphology of the resulting films was correlated with the nature of the reduction reaction that triggers film formation.

  17. Samarium Monosulfide (SmS): Reviewing Properties and Applications

    OpenAIRE

    Sousanis, Andreas; Smet, Philippe; Poelman, Dirk

    2017-01-01

    In this review, we give an overview of the properties and applications of samarium monosulfide, SmS, which has gained considerable interest as a switchable material. It shows a pressure-induced phase transition from the semiconducting to the metallic state by polishing, and it switches back to the semiconducting state by heating. The material also shows a magnetic transition, from the paramagnetic state to an antiferromagnetically ordered state. The switching behavior between the semiconducti...

  18. Optical properties of zinc–vanadium glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Abstract. Zinc–vanadium glasses doped with samarium oxide having the chemical composition Sm2O3(x). ZnO(40−x)V2O5(60)(where x = 0·1–0·5 mol%) were prepared by melt quenching method. The density of these glasses was measured by Archimedes method; the corresponding molar volumes have also been ...

  19. Synthesis of nano-pore samarium (III)-imprinted polymer for preconcentrative separation of samarium ions from other lanthanide ions via solid phase extraction

    Energy Technology Data Exchange (ETDEWEB)

    Shirvani-Arani, Simindokht [Center of Excellence in Electrochemistry, Department of Chemistry, University of Tehran, P.O.Box:14155-6455, Tehran (Iran, Islamic Republic of); Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of); Ahmadi, Seyed Javad [Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of)], E-mail: sjahmadi@aeoi.org.ir; Bahrami-Samani, Ali [Nuclear Engineering and Physics Department, Amir Kabir University, P.O.Box: 15875-4413, Tehran (Iran, Islamic Republic of); Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of); Ghannadi-Maragheh, Mohammad [Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of)

    2008-08-08

    A batch process was developed to separate samarium ions from some lanthanide ions by a novel solid phase which was prepared via the ion-imprinting technique. The samarium (III) ion-imprinted polymer (IIP) particles were synthesized by preparing the ternary complex of samarium ions with 5,7-dichloroquinoline-8-ol (DCQ) and 4-vinylpyridine (VP). Then, thermally copolymerization with styrene (functional monomer, STY) and divinylbenzene (cross-linking monomer, DVB) followed in the presence of 2-methoxy ethanol (porogen) and 2,2'-azobisisobutyronitrile (initiator, AIBN). The imprinted ion was removed by stirring the above particles with 50% (v/v) HCl to obtain the leached IIP particles. Moreover, control polymer (CP) particles were similarly prepared without the samarium ions. The unleached and leached IIP particles were characterized by X-ray diffraction (XRD), infra-red spectroscopy (IR), thermo gravimetric analysis (TGA) and scanning electron microscopy (SEM). Finally, preconcentration and selectivity studies for samarium and the other lanthanide ions were carried out. The preconcentration of the samarium (III) traces was studied during rebinding with the leached IIP particles as a function of pH, the weight of the polymer material, the preconcentration and the elution times, the eluent volume and the aqueous phase volume. These studies indicated that the samarium (III) amount as low as 1 {mu}g, present in 200 mL, could be preconcentrated into 25 mL of 1.0 M HCl.

  20. Ionization of Samarium by Chemical Releases in the Upper Atmosphere

    Science.gov (United States)

    Siefring, C. L.; Bernhardt, P. A.; Holmes, J. M.; Pedersen, T. R.; Caton, R.; Miller, D.; Groves, K. M.

    2014-12-01

    The release of Samarium vapor into the upper atmosphere was studied using during the Air Force Research Laboratory sponsored Metal Oxide Space Cloud (MOSC) rocket launches in May 2009. The Naval Research Laboratory supported these experiments with 3-D photochemical modeling of the artificial plasma cloud including (1) reactions with atomic oxygen, (2) photo excitation, (3) photoionization, (4) dissociative recombination, and (5) ion and neutral diffusion. NRL provided the experimental diagnostic instrument on the rocket which was a dual frequency radio beacon on the rocket to measure changes in total electron content. The AFRL provided ground based diagnostics of incoherent scatter radar and optical spectroscopy and imagery. The NRL Chemical Release Model (CRM) has over 600 excited states of atomic Samarium neutrals, atomic ions, along with Samarium Oxide Ions and electrons. Diffusive transport of neutrals in cylindrical geometry and ions along magnetic field lines is computed along with the reactive flow to predict the concentrations of Sm, Sm-Ion, Sm0, and SmO Ion. Comparison of the CRM with observations demonstrates that Sm release into the upper atmosphere initially produces enhanced electron densities and SmO-Ions. The diatomic ions recombine with electrons to yield neutral Sm and O. Only the photo ionization of Sm yields a stable atomic ion that does not substantially recombine. The MOSC releases in sunlight yielded long duration ion clouds that can be replicated with the CRM. The CRM predicts that Sm releases in darkness would not produce long duration plasma clouds because of the lack of photo excitation and photoionization.

  1. Reactive Materials for Evaporating Samarium (Pre-Print)

    Science.gov (United States)

    2016-04-15

    SUBJECT TERMS energetic materials, heat sources, pyrotechnic charges, easily ionized metals 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF...experiments.    Keywords:  energetic  materials, heat sources, pyrotechnic charges, easily ionized metals  1. Introduction Ejection of clouds of...results  were  negatively  affected  by  reduced  efficiency   of  release  and  ionization of samarium [8]. It is possible that not the entire charge of

  2. Targeted bone marrow radioablation with 153Samarium-lexidronam promotes allogeneic hematopoietic chimerism and donor-specific immunologic hyporesponsiveness.

    Science.gov (United States)

    Inverardi, Luca; Linetsky, Elina; Pileggi, Antonello; Molano, R Damaris; Serafini, Aldo; Paganelli, Giovanni; Ricordi, Camillo

    2004-03-15

    Transplantation tolerance, defined as acceptance of a graft by an otherwise fully immunocompetent host, has been an elusive goal. Although robust tolerance has been achieved by the induction of stable hematopoietic chimerism after bone marrow transplantation, lethal or sublethal radiation conditioning used to induce long-term chimerism precludes its clinical use. We studied whether targeted delivery of radiation to bone marrow could allow for bone marrow cell (BMC) engraftment, chimerism, and donor-specific tolerance in the absence of the side effects associated with external irradiation. We administered a radioactive bone-seeking compound (Samarium-Lexidronam, Quadramet, Berlex Laboratories, Wayne, NJ) together with transient T-cell costimulatory blockade to recipient mice. Allogeneic BMCs were given 7 or 14 days after preconditioning. Costimulatory blockade was obtained by the use of an anti-CD154 antibody for 4 weeks. Chimerism was assessed by flow cytometry. Mice then received donor-specific and third-party skin grafts. Graft survival was analyzed with mechanisms of donor-specific hyporesponsiveness. High levels of stable chimerism across an allogeneic barrier were achieved in mice by a single administration of Samarium-Lexidronam, transient T-cell costimulatory blockade, and BMC transplantation. A large percentage of chimeric animals retained donor-derived skin grafts for more than 120 days without requiring additional immunosuppression, suggesting that harsh cytotoxic preconditioning is not necessary to achieve stable chimerism and donor specific hyporesponsiveness. Analysis of the T-cell repertoire in chimeras indicates T-cell deletional mechanisms. These data broaden the potential use of BMC transplantation for tolerance induction and argue for its potential in treating autoimmune diseases.

  3. Implementation of an analytical technique for Samarium; Implementacion de una tecnica analitica para Samario

    Energy Technology Data Exchange (ETDEWEB)

    Garcia G, N. [ININ, Carretera Mexico-Toluca Km. 36.5, 52045 Estado de Mexico (Mexico)

    2004-07-01

    Since the Samarium presents the same chemical properties that the plutonium, it has been used as homologous in studies that allow us to know the behavior that the plutonium presents in solution, with the advantage of working with an inactive and not very dangerous element. At the moment studies of sorption of plutonium or samarium are made on some mineral matrices that present certain surface properties. Due to the low concentrations that are used in the studies of sorption of samarium on those reagent substrates, their detection becomes very difficult for the conventional analysis media. The luminescence is a technique that can detect lower concentrations, smaller at 1 X 10{sup -} {sup 2} M, but when fluorofors are used this limit of detection increases in several orders of magnitude. In this work it has been used the arsenazo-III as fluorofor agent since it reacts in a specific way with the samarium, forming a complex that presents a proportional luminescence to the concentration of the present samarium. The advantage of making the quantification of samarium by luminescence is that it can use the same instrumental equipment to determine the speciation of the samarium sipped in the zircon. (Author)

  4. Synthesis of samarium binding bleomycin - a possible NCT radiosensitizer

    Energy Technology Data Exchange (ETDEWEB)

    Mendes, B.M., E-mail: bmm@cdtn.b [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Mendes, T.M.; Campos, T.P.R., E-mail: campos@nuclear.ufmg.b [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil)

    2011-07-01

    Bleomycin (BLM) is a drug that has attractive features for the development of a new radiopharmaceutical, particularly with regard to neutron capture therapy (NCT) sensitized by Sm-149. It has the ability to chelate many metal ions. In vitro studies have shown that up to 78% of BLM present in a cell is accumulated inside the nucleus or in the nuclear membrane. In addition, this drug has higher affinity for tumor tissues than for normal tissues. Radioactive isotopes carried by this antibiotic would be taken preferentially to one important cellular targets DNA. Besides, BLM displays intrinsic anti-tumor activity - it is a chemotherapic antibiotic clinically used against some cancers. This study aimed to obtain bleomycin molecules bound to samarium (BLM-Sm) for NCT studies in vitro and in vivo. The binding technique employed in this work has great simplicity and low cost. Thin layer chromatography, high performance liquid chromatography, fast protein liquid chromatography and analysis by ICP-AES were applied to verify the binding molecule. ICP-AES results showed the presence of samarium in the sample peaks related to BLM-Sm. However, efficiency and stability of this bond needs to be investigated. (author)

  5. Luminescent solutions and powders of new samarium complexes with N,N',O,O'-chelating ligands

    Science.gov (United States)

    Kharcheva, Anastasia V.; Nikolskiy, Kirill S.; Borisova, Nataliya E.; Ivanov, Alexey V.; Reshetova, Marina D.; Yuzhakov, Viktor I.; Patsaeva, Svetlana V.

    2016-04-01

    Imaging techniques in biology and medicine are crucial tools to obtain information on structural and functional properties of living cells and organisms. To fulfill the requirements associated with application of these techniques it appears necessary to design markers with specific characteristics. Luminescent complexes of trivalent lanthanide ions with chelating ligands are of increasing importance in biomedical applications because of their millisecond luminescence lifetime, narrow emission band, high signal-to-noise ratio and minimal photodamage to biological samples. In order to extend the available emission wavelength range the luminescent samarium chelates are highly desirable. In this study the ligands with diamides of 2,2'-bipyridin-6,6'-dicarboxylic acid were used to improve photophysical characteristics of samarium complexes. We report the luminescence characteristics of samarium complexes with novel ligands. All complexes exhibited the characteristic emission of Sm (III) ion with the lines at 565, 597, 605, 645 and 654 nm, the intensity strongly depended on the ligand. Absorption and luminescence excitation spectra of Sm (III) complexes showed main peaks in the UV range demonstrating lanthanide coordination to the ligand. The absolute lumenescence quantum yield was measured for solutions in acetonitrile with excitation at 350 nm. The largest luminescence quantum yield was found for the samarium complex Bipy 6MePy Sm (3%) being much higher that for samarium complexes reported in the literature earlier. These results prove as well that samarium chelates are potential markers for multiparametric imaging techniques.

  6. Australian manufacture of Quadramet{sup TM} (Samarium-153 EDTMP)

    Energy Technology Data Exchange (ETDEWEB)

    Wood, N.R.; Whitwell, J. [Australian Nuclear Science and Technology Organisation (ANSTO), Lucas Heights, NSW (Australia). Australian Radioisotopes

    1997-10-01

    Quadramet{sup T} (Samarium-153 EDTMP) has been shown overseas to be potentially useful in the palliation of painful osteoblastic skeletal metastases and has been approved this year for general marketing in the USA. Australian Radioisotopes (ARI) has licensed this product from the Australian patent holders, Dow Chemical. Within the facilities of ARI, a hot cell has been dedicated to this product and fitted out to manufacture it weekly on a cycle related to the operating cycle of the Australian reactor HIFAR. Due to neutron flux limitations of HIFAR, the local formulation has an elemental Samarium content up to 200{mu}g/mL whereas the overseas formulation has a level of 20-46{mu}g/mL. All other specifications of the two products are essentially the same. In 1995 and 1996 a small clinical trial with 19 patients was held which demonstrated that the pharmacokinetic behaviour was also essentially the same by measuring blood clearance rates and skeletal uptake dynamics. Soft tissue uptake was also qualitatively determined. The ARI version is now the subject of an application for general marketing within Australia. Some useful characteristics of this agent are: almost complete excretion or fixation in the skeleton within 6 hours, rapid onset of clinical effect, applicability in most cases where an abnormal diagnostic bone scan correlates with painful sites, dosage can be tailored to individual patient uptake due to easy dose measurement and retreatment is quite possible. The use of this class of agents in pain palliation continues to increase. Australian manufacture of Quadramet{sup TM} provides a further option in the management of these difficult cases

  7. Electrochemical extraction of samarium from molten chlorides in pyrochemical processes

    Energy Technology Data Exchange (ETDEWEB)

    Castrillejo, Y., E-mail: ycastril@qa.uva.es [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Fernandez, P. [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Medina, J. [Dept Fisica Materia Condensada Cristalografia y Mineralogia, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Hernandez, P. [Centro de Investigaciones Quimicas, Universidad Autonoma del Estado de Hidalgo, Carr. Pachuca-Tulancingo Km. 4.5, C.P. 42076 Pachuca, Hidalgo (Mexico); Barrado, E. [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain)

    2011-10-01

    This work concerns the electrochemical extraction of samarium from molten chlorides. In this way, the electrochemical behaviour of samarium ions has been investigated in the eutectic LiCl-KCl at the surface of tungsten, aluminium and aluminium coated tungsten electrodes. On a W inert electrode the electro-reduction of Sm(III) takes place in only one soluble-soluble electrochemical step Sm(III)/Sm(II). The electrochemical system Sm(II)/Sm(0) has not been observed within the electrochemical window, because of the prior reduction of Li(I) ions from the solvent, which inhibits the electro-extraction of Sm species from the salt on such a substrate. Sm metal in contact with the melt react to give Li(0) according to the reaction: Sm(0) + 2Li(I) {r_reversible} Sm(II) + 2Li(0). On the contrary, on reactive Al electrodes the electrochemical system Sm(II)/Sm(0) was observed within the electroactive range. The potential shift of the redox couple is caused by the decrease of Sm activity in the metal phase due to the formation of Sm-Al alloys at the interface. The formation mechanism of the intermetallic compounds was studied in a melt containing: (i) both Sm(III) and Al(III) ions, using W and Al coated tungsten electrodes, and (ii) Sm(III) ions using an Al electrode. Analysis of the samples after potentiostatic electrolysis by X-ray diffraction and scanning electron microscopy (SEM) with energy dispersive X-ray spectroscopy (EDS), allowed the identification of Al{sub 3}Sm and Al{sub 2}Sm.

  8. Optical analysis of samarium doped sodium bismuth silicate glass.

    Science.gov (United States)

    Thomas, V; Sofin, R G S; Allen, M; Thomas, H; Biju, P R; Jose, G; Unnikrishnan, N V

    2017-01-15

    Samarium doped sodium bismuth silicate glass was synthesized using the melt quenching method. Detailed optical spectroscopic studies of the glassy material were carried out in the UV-Vis-NIR spectral range. Using the optical absorption spectra Judd-Ofelt (JO) parameters are derived. The calculated values of the JO parameters are utilized in evaluating the various radiative parameters such as electric dipole line strengths (Sed), radiative transition probabilities (Arad), radiative lifetimes (τrad), fluorescence branching ratios (β) and the integrated absorption cross- sections (σa) for stimulated emission from various excited states of Sm3+‡ ion. The principal fluorescence transitions are identified by recording the fluorescence spectrum. Our analysis revealed that the novel glassy system has the optimum values for the key parameters viz. spectroscopic quality factor, optical gain, stimulated emission cross section and quantum efficiency, which are required for a high performance optical amplifier. Calculated chromaticity co-ordinates (0.61, 0.38) also confirm its application potential in display devices. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Samarium Monosulfide (SmS): Reviewing Properties and Applications.

    Science.gov (United States)

    Sousanis, Andreas; Smet, Philippe F; Poelman, Dirk

    2017-08-16

    In this review, we give an overview of the properties and applications of samarium monosulfide, SmS, which has gained considerable interest as a switchable material. It shows a pressure-induced phase transition from the semiconducting to the metallic state by polishing, and it switches back to the semiconducting state by heating. The material also shows a magnetic transition, from the paramagnetic state to an antiferromagnetically ordered state. The switching behavior between the semiconducting and metallic states could be exploited in several applications, such as high density optical storage and memory materials, thermovoltaic devices, infrared sensors and more. We discuss the electronic, optical and magnetic properties of SmS, its switching behavior, as well as the thin film deposition techniques which have been used, such as e-beam evaporation and sputtering. Moreover, applications and possible ideas for future work on this material are presented. Our scope is to present the properties of SmS, which were mainly measured in bulk crystals, while at the same time we describe the possible deposition methods that will push the study of SmS to nanoscale dimensions, opening an intriguing range of applications for low-dimensional, pressure-induced semiconductor-metal transition compounds.

  10. Excitation induced spectroscopic study and quenching effect in cerium samarium codoped lithium aluminoborate glasses

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, Parvinder; Kaur, Simranpreet [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Singh, Gurinder Pal [Department of Physics, Khalsa College, Amritsar 143002 (India); Arora, Deepawali; Kumar, Sunil [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Singh, D.P., E-mail: dpsinghdr@yahoo.com [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India)

    2016-08-15

    Lithium aluminium borate host has been codoped with cerium and samarium to prepare glass by conventional melt quench technique. Their structural and spectroscopic investigation has been carried out using XRD, FTIR and density measurements. The UV‐Vis absorption spectra and fluorescence spectra (λ{sub exc}.=380 nm and 400 nm) have been studied for spectroscopic analysis. The amorphous nature of the prepared samples is shown by XRD. The density is increasing with addition of cerium at the expense of aluminium, keeping other components constant. FTIR study also shows the presence of compact and stable tetrahedral BO{sub 4} units thus supporting the density results. The UV‐ Vis absorption spectra show a shift of optical absorption edge towards longer wavelength along with an increase in intensity of peaks with rising samarium concentration. The fluorescence spectra show a blue shift and subsequent suppression of cerium peaks with addition of samarium.

  11. Effect of samarium doping on the dielectric behavior of barium zircomium titanate ceramic

    Energy Technology Data Exchange (ETDEWEB)

    Badapanda, T., E-mail: badapanda.tanmaya@gmail.com [Department of Physics, C.V. Raman College of Engineering, Bhubaneswar, Odisha-752054 (India); Sarangi, S.; Behera, B. [School of Physics, Sambalpur University, Jyoti Vihar Sambalpur, Odisha-768019 (India); Anwar, S. [Colloids and Materials Chemistry, Institute of Minerals and Materials Technology, Bhubaneswar, Odisha-751013 (India); Sinha, T. P. [Department of Physics, Bose Institute, Kolkata-700009 (India)

    2014-04-24

    Samarium doped Barium Zirconium Titanate ceramic with general formula Ba{sub 1−x}Sm{sub 2x/3}Zr{sub 0.05}Ti{sub 0.95}O{sub 3} [x=0.0,0.01,0.02,0.03,0.04] has been prepared by high energy ball milling. The X-ray diffraction (XRD) patterns confirmed that these ceramics have a single phase with perovskite-type upto x≤0.03 and a small secondary phase exist at x=0.04. The temperature dependent dielectric study shows a ferroelectric phase transition and transition temperature decreases with an increase in the Samarium content.

  12. Lithium Bromide/Water as Additives in Dearomatizing Samarium-Ketyl (Hetero)Arene Cyclizations.

    Science.gov (United States)

    Rao, Chintada Nageswara; Bentz, Christoph; Reissig, Hans-Ulrich

    2015-11-02

    New conditions for dearomatizing samarium-ketyl (hetero)arene cyclizations are reported. In many examples of these samarium diiodide-mediated reactions, lithium bromide and water can be used as additives instead of the carcinogenic and mutagenic hexamethylphosphoramide (HMPA). The best results were obtained for the cyclizations of N-acylated indole derivatives delivering the expected indolines in good yields and excellent diastereoselectivities. A new type of cyclization delivering indolyl-substituted allene derivatives is also described. The scope and limitations of the lithium bromide/water system are discussed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. One-step synthesis of samarium-doped ceria and its CO catalysis

    Indian Academy of Sciences (India)

    The samarium-doped ceria (SDC) nanospheres were prepared by the one-step hydrothermal method and characterized by transmission electron microscope, scanning electron microscope, powder X-ray diffraction, X-ray photoelectron spectroscopy, energy-dispersive spectrometer and Raman spectra. According to the ...

  14. A spectroscopic comparison of samarium-doped LiYF4 and KY3F10

    NARCIS (Netherlands)

    Wells, J. P. R.; Sugiyama, A.; Han, T. P. J.; Gallagher, H. G.

    2000-01-01

    Laser selective excitation and fluorescence has been performed on LiYF4 and KY3F10 doped with samarium ions. In LiYF4, a single, tetragonal symmetry center associated with isovalent substitution of Sm3+ with lattice yttrium ions is present. By contrast, three Sm2+ centres and a single, tetragonal

  15. 46 CFR 154.1430 - Equipment locker.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Equipment locker. 154.1430 Section 154.1430 Shipping... FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Safety Equipment § 154.1430 Equipment locker. One of each item of equipment under §§ 154.1400 and 154.1420 must be...

  16. The Use of a Flexible Calix[4]arene Template to Stabilize a Cyclooctatetraindiyl Samarium-Potassium Complex

    Directory of Open Access Journals (Sweden)

    Geoffroy Guillemot

    2013-01-01

    Full Text Available A sandwich compound of cyclooctatetraendiyl (COT2− samarium-potassium was synthesized and analyzed using a flexible calix[4]arene dianion. This compound, [p-tBu-calix[4]-(OMe2(O2]arenediyl-samarium-(η8-cyclooctatetraendiyl-potassium (tetrahydrofurane3, is constructed as a linear sequence L-Sm--K-, where L, , and are specific ligands with L = O,O-dimethyl-calix[4]arene2−, = cyclo-octatetraendiyl, and = tetrahydrofurane templates.

  17. 46 CFR 154.446 - Tank design.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Tank design. 154.446 Section 154.446 Shipping COAST... SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Independent Tank Type B § 154.446 Tank design. An independent tank type B must meet the calculations under § 154...

  18. Solar nebula heterogeneity in p-process samarium and neodymium isotopes.

    Science.gov (United States)

    Andreasen, Rasmus; Sharma, Mukul

    2006-11-03

    Bulk carbonaceous chondrites display a deficit of approximately 100 parts per million (ppm) in 144Sm with respect to other meteorites and terrestrial standards, leading to a decrease in their 142Nd/144Nd ratios by approximately 11 ppm. The data require that samarium and neodymium isotopes produced by the p process associated with photodisintegration reactions in supernovae were heterogeneously distributed in the solar nebula. Other samarium and neodymium isotopes produced by rapid neutron capture (r process) in supernovae and by slow neutron capture (s process) in red giants were homogeneously distributed. The supernovae sources supplying the p- and r-process nuclides to the solar nebula were thus disconnected or only weakly connected.

  19. Samarium(II) iodide-mediated reductive annulations of ketones bearing a distal vinyl epoxide moiety

    Energy Technology Data Exchange (ETDEWEB)

    Molander, G.A.; Shakya, S.R. [Univ. of Colorado, Boulder, CO (United States)

    1996-08-23

    It was found that samarium (II) iodide promotes the intramolecular coupling of ketones with distal epoxy olefins while in the presence of hexamethylphosphoramide (HPMA). A number of epoxide compounds (1 a-k) fragment to form carbocycles with allylic alcohol side chains with high diastereoselectivity (2 a-k). Substituting tetramethylguanidine for HPMA reduces the diastereoselectivity. Adding Pd(0) as a catalyst reverses the diastereoselective sense. 40 refs., 1 tab.

  20. A temporal three-dimensional simulation of samarium release in the ionosphere

    Science.gov (United States)

    Zhao, Hai-Sheng; Feng, Jie; Xu, Zheng-Wen; Wu, Jian; Wu, Zhen-Sen; Xu, Bin; Xue, Kun; Xu, Tong; Hu, Yan-Li

    2016-10-01

    For understanding plasma processes of the ionosphere and magnetosphere, the alkali and alkaline-earth metals are usually released in space for artificially increasing the electron density. However, it is a limitation that these releases must be in sunlight where the photoionization can take place. In recent years, the lanthanide metals, such as samarium, have been released to produce electrons in reaction with atomic oxygen in the upper space. The reaction could proceed without sunlight so that the restriction on experimental periods is broken. Unfortunately, any sophisticated models even preliminary ones are unavailable yet in the literature. A temporal three-dimensional model is presented for the samarium release in detail with respect to various altitudes and mass. Especially, the plasma diffusion equation is remarkably extended from 2-D to 3-D by importing the influence of geomagnetic declination, which could be also useful for other chemical releases. The field-aligned terms are brought so as to the presented model can describe the diffusion along the geomagnetic field subtly. On the basis of the presented model, behaviors of radio waves propagating through the release area are simulated by using ray tracing. This model could be as the theoretical support for samarium releases, and it also helpful for the research on the generation and evolution of the ionosphere irregularities.

  1. Liquid–liquid anion exchange extraction studies of samarium(III from salicylate media using high molecular weight amine

    Directory of Open Access Journals (Sweden)

    Aniruddha M. Mandhare

    2015-07-01

    Full Text Available Liquid–liquid extraction and separation of samarium(III were carried out by using 0.025 mol dm−3 2-octylaminopyridine(2-OAP in xylene at 298 K. The extraction behavior of samarium was studied as a function of pH, weak acid concentration, extractant concentration, diluent, and equilibration time. Samarium was quantitatively extracted at pH 7.5 to 10.0 from 0.01 mol dm−3 sodium salicylate solution with 0.025 mol dm−3 2-OAP. The possible composition of the extracted species in organic phase has been determined by using model of slope analysis method and extraction mechanism was found to proceed via an anion exchange mechanism. The stripping efficiency was found to be quantitative in HNO3, HCl and CH3COOH. The robustness of the procedure was demonstrated by the average recoveries obtained (>99.6% for samarium(III extraction in the presence of several cations and anions which are commonly associated with it. The proposed method facilitates the separation and determination of samarium(III from binary and synthetic mixtures. The various thermodynamic functions like free energy (ΔG, enthalpy (ΔH and entropy (ΔS of extraction mechanism were discussed.

  2. 46 CFR 154.660 - Pipe welding.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Pipe welding. 154.660 Section 154.660 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... § 154.660 Pipe welding. (a) Pipe welding must meet Part 57 of this chapter. (b) Longitudinal butt welds...

  3. 46 CFR 154.466 - Design criteria.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Design criteria. 154.466 Section 154.466 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... § 154.466 Design criteria. (a) The insulation for a cargo tank without a secondary barrier must be...

  4. 46 CFR 154.471 - Design criteria.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Design criteria. 154.471 Section 154.471 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... § 154.471 Design criteria. (a) The cargo tank support system must be designed: (1) For the loads in...

  5. 33 CFR 154.570 - Lighting.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Lighting. 154.570 Section 154.570... TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Equipment Requirements § 154.570 Lighting. (a) Except as... fixed lighting that adequately illuminates: (1) Each transfer connection point on the facility; (2) Each...

  6. 32 CFR 154.61 - Security education.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Security education. 154.61 Section 154.61... PERSONNEL SECURITY PROGRAM REGULATION Continuing Security Responsibilities § 154.61 Security education. (a.... Through security briefings and education, the Department of Defense continues to provide for the...

  7. 29 CFR 1915.154 - Respiratory protection.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 7 2010-07-01 2010-07-01 false Respiratory protection. 1915.154 Section 1915.154 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... (PPE) § 1915.154 Respiratory protection. Respiratory protection for shipyard employment is covered by...

  8. 46 CFR 154.1405 - Respiratory protection.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Respiratory protection. 154.1405 Section 154.1405... Equipment § 154.1405 Respiratory protection. When Table 4 references this section, a vessel carrying the listed cargo must have: (a) Respiratory protection equipment for each person on board that protects the...

  9. 46 CFR 154.520 - Piping calculations.

    Science.gov (United States)

    2010-10-01

    ...: (a) Pipe weight loads; (b) Acceleration loads; (c) Internal pressure loads; (d) Thermal loads; and (e... 46 Shipping 5 2010-10-01 2010-10-01 false Piping calculations. 154.520 Section 154.520 Shipping... Process Piping Systems § 154.520 Piping calculations. A piping system must be designed to meet the...

  10. 46 CFR 154.429 - Calculations.

    Science.gov (United States)

    2010-10-01

    ... § 154.429 Calculations. The tank design load calculations for a membrane tank must include the following... submitted to meet this paragraph. (c) The combined strains from static, dynamic, and thermal loads. ... 46 Shipping 5 2010-10-01 2010-10-01 false Calculations. 154.429 Section 154.429 Shipping COAST...

  11. 46 CFR 154.1020 - Emergency power.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Emergency power. 154.1020 Section 154.1020 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS... § 154.1020 Emergency power. The emergency generator must be designed to allow operation at the final...

  12. 46 CFR 154.665 - Welding procedures.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Welding procedures. 154.665 Section 154.665 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS... Construction § 154.665 Welding procedures. Welding procedure tests for cargo tanks for a design temperature...

  13. 33 CFR 154.510 - Loading arms.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Loading arms. 154.510 Section 154... FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Equipment Requirements § 154.510 Loading arms. (a) Each mechanical loading arm used for transferring oil or hazardous material and placed into service...

  14. 46 CFR 154.439 - Tank design.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Tank design. 154.439 Section 154.439 Shipping COAST... SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Independent Tank Type A § 154.439 Tank design. An independent tank type A must meet the deep tank standard of the...

  15. 46 CFR 154.420 - Tank design.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Tank design. 154.420 Section 154.420 Shipping COAST... SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Integral Tanks § 154.420 Tank design. (a) The structure of an integral tank must meet the deep tank scantling standards...

  16. 11 CFR 100.154 - Candidate debates.

    Science.gov (United States)

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Candidate debates. 100.154 Section 100.154 Federal Elections FEDERAL ELECTION COMMISSION GENERAL SCOPE AND DEFINITIONS (2 U.S.C. 431) Exceptions to Expenditures § 100.154 Candidate debates. Funds used to defray costs incurred in staging candidate debates in...

  17. 46 CFR 154.1410 - Decontamination shower.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Decontamination shower. 154.1410 Section 154.1410... Equipment § 154.1410 Decontamination shower. When Table 4 references this section, a vessel carrying the listed cargo must have a decontamination shower and an eye wash that: (a) Are on the weatherdeck; and (b...

  18. 46 CFR 154.428 - Allowable stress.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Allowable stress. 154.428 Section 154.428 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... § 154.428 Allowable stress. The membrane tank and the supporting insulation must have allowable stresses...

  19. 46 CFR 154.447 - Allowable stress.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Allowable stress. 154.447 Section 154.447 Shipping COAST... Tank Type B § 154.447 Allowable stress. (a) An independent tank type B designed from bodies of revolution must have allowable stresses 3 determined by the following formulae: 3 See Appendix B for stress...

  20. 46 CFR 154.440 - Allowable stress.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Allowable stress. 154.440 Section 154.440 Shipping COAST... Tank Type A § 154.440 Allowable stress. (a) The allowable stresses for an independent tank type A must... Commandant (CG-522). (b) A greater allowable stress than required in paragraph (a)(1) of this section may be...

  1. 46 CFR 154.421 - Allowable stress.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Allowable stress. 154.421 Section 154.421 Shipping COAST... § 154.421 Allowable stress. The allowable stress for the integral tank structure must meet the American Bureau of Shipping's allowable stress for the vessel's hull published in “Rules for Building and Classing...

  2. 46 CFR 154.1840 - Protective clothing.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Protective clothing. 154.1840 Section 154.1840 Shipping... FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Operations § 154.1840 Protective clothing... operation, except those assigned to gas-safe cargo control rooms, wears protective clothing. ...

  3. 46 CFR 154.702 - Refrigerated carriage.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Refrigerated carriage. 154.702 Section 154.702 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS... Pressure and Temperature Control § 154.702 Refrigerated carriage. (a) Each refrigeration system must: (1...

  4. 7 CFR 58.154 - Refrigerated storage.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Refrigerated storage. 58.154 Section 58.154 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards... § 58.154 Refrigerated storage. Finished product in containers subject to such conditions that will...

  5. 46 CFR 154.1715 - Moisture control.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Moisture control. 154.1715 Section 154.1715 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS... § 154.1715 Moisture control. When a vessel is carrying sulfur dioxide, the master shall ensure that: (a...

  6. 32 CFR 154.55 - Requirements.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Requirements. 154.55 Section 154.55 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE SECURITY DEPARTMENT OF DEFENSE PERSONNEL SECURITY PROGRAM REGULATION Unfavorable Administrative Actions § 154.55 Requirements. (a) General. For...

  7. 46 CFR 154.703 - Methane (LNG).

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Methane (LNG). 154.703 Section 154.703 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR... and Temperature Control § 154.703 Methane (LNG). Unless a cargo tank carrying methane (LNG) can...

  8. 40 CFR 417.154 - [Reserved

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 28 2010-07-01 2010-07-01 true 417.154 Section 417.154 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS SOAP AND DETERGENT MANUFACTURING POINT SOURCE CATEGORY Manufacture of Spray Dried Detergents Subcategory § 417.154 ...

  9. Samarium(II) iodide-mediated intramolecular conjugate additions of alpha,beta-unsaturated lactones.

    Science.gov (United States)

    Molander, Gary A; St Jean, David J

    2002-05-31

    Samarium(II) iodide, in the presence of catalytic amounts of nickel(II) iodide, has been used to promote intramolecular conjugate additions of alkyl halides onto alpha,beta-unsaturated lactones. This process has been shown to be applicable to a number of alpha,beta-unsaturated lactones, including tetrasubstituted olefins, and has been demonstrated to be quite general for the formation of saturated bicyclic and tricyclic lactones. The method presented herein provides a mild, efficient process to form structurally complex lactones from simple precursors.

  10. Ekstraksi Pemisahan Neodimium dari Samarium, Itrium dan Praseodimium Memakai Tri Butil Fosfat

    Directory of Open Access Journals (Sweden)

    Maria Veronica Purwani

    2017-05-01

    Full Text Available The extraction of Nd(OH3 (neodymium hydroxide concentrate containing Y (yttrium, Sm (samarium and Pr (praseodymium as product of monazite processed has been done. The purpose of this study is to determine the separation of Nd from Y, Pr and Nd Sm in Nd concentrate. The aqueous phase was concentrated Nd (OH3 in HNO3 and extractant while organic phase was Tri Butyl Phosphate (TBP in kerosene. Parameters studied were pH and concentration feed, concentration of TBP in kerosene, extraction time and stirring speed. The result showed that the optimization of separation extraction neodymium from samarium, yttrium and praseodymium in Nd(OH3 concentrated with TBP, obtained the optimum condition of pH = 0.2, concentration of feed 100 g /L, concentration of TBP in kerosene 5%, extraction time 15 minutes and stirring speed 150 rpm. With the conditions, Separation Factor (SF obtained for Nd-Y, Nd-Pr, Nd-Sm are 2.242, 4.811, 4.002 respectively, while D and extraction efficiency of Nd are 0.236 and 19.07%.

  11. X-Band Microwave Reflection Properties of Samarium/Bismuth-Substituted Barium Lanthanum Titanate Ceramics

    Science.gov (United States)

    Bahel, Shalini; Pubby, Kunal; Narang, Sukhleen Bindra

    2017-03-01

    Samarium/bismuth-substituted barium lanthanum titanate ceramics with chemical composition Ba4 (La_{1 - y - z} Smy Biz )_{9.33} Ti_{18} O_{54} ( y = 0.5, 0.7; z = 0.05, 0.10, 0.15), intended as microwave reflecting materials, have been investigated in microwave X-band (8.2 GHz to 12.4 GHz) and the effect of substitution on their dielectric properties, i.e., dielectric constant and dielectric loss tangent, has been studied by vector network analyzer. Dielectric analysis showed that the dielectric constant increased with increasing samarium as well as bismuth content. Dielectric relaxation was observed for all samples in the scanned frequency range. Microwave reflection and transmission analysis of ceramic pellets of thickness 4 mm was carried out using two methods, i.e., open- and short-circuit approach, both indicating very high values of reflected power and very low values of transmitted power for all the doped materials in comparison with the base composition. The doped compositions are therefore potential microwave shielding materials for use in anechoic chambers, microwave laboratories, and radar equipment. Double-layer reflectors are also proposed, having better reflection properties (˜99% reflection) compared with single-layer reflectors.

  12. Microstructure and hysteresis curves of samarium-holmium-iron garnet synthesized by coprecipitation

    Directory of Open Access Journals (Sweden)

    Caffarena Valeska da Rocha

    2003-01-01

    Full Text Available An investigation was made into the synthesis and magnetic properties of Sm(3-xHo xFe5O12 (samarium-holmium-iron garnet ferrite, as yet absent from the literature. The material in question was synthesized by co-precipitation, starting from hydrated chlorides of rare-earth elements and ferrous sulfate, and the mixed hydroxide co-precipitate was calcined at 1000 °C. Using PVA as a binder, rectangular cross section-shaped compacts were produced by means of steel-die pressing, drying and sintering from 1200 to 1450 °C. The main conclusions of this study were that the coercive force decreases as the sintering temperature increases, and that the effect of substituting holmium for samarium in SmIG is entirely different from that provided by replacing yttrium by gadolinium in YIG, which is the most important result of this work. An in-depth investigation will be necessary to determine the correlation between microstructure/magnetic properties and ceramic processing variables.

  13. Bone-seeking radiopharmaceuticals as targeted agents of osteosarcoma: samarium-153-EDTMP and radium-223.

    Science.gov (United States)

    Anderson, Peter M; Subbiah, Vivek; Rohren, Eric

    2014-01-01

    Osteosarcoma is a cancer characterized by formation of bone by malignant cells. Routine bone scan imaging with Tc-99m-MDP is done at diagnosis to evaluate primary tumor uptake and check for bone metastases. At time of relapse the Tc-99m-MDP bone scan also provides a specific means to assess formation of bone by malignant osteosarcoma cells and the potential for bone-seeking radiopharmaceuticals to deliver radioactivity directly into osteoblastic osteosarcoma lesions. This chapter will review and compare a bone-seeking radiopharmaceutical that emits beta-particles, samarium-153-EDTMP, with an alpha-particle emitter, radium-223. The charged alpha particles from radium-223 have far more mass and energy than beta particles (electrons) from Sm-153-EDTMP. Because radium-223 has less marrow toxicity and more radiobiological effectiveness, especially if inside the bone forming cancer cell than samarium-153-EDTMP, radium-223 may have greater potential to become widely used against osteosarcoma as a targeted therapy. Radium-223 also has more potential to be used with chemotherapy against osteosarcoma and bone metastases. Because osteosarcoma makes bone and radium-223 acts like calcium, this radiopharmaceutical could possibly become a new targeted means to achieve safe and effective reduction of tumor burden as well as facilitate better surgery and/or radiotherapy for difficult to resect large, or metastatic tumors.

  14. Polypyrrole-coated samarium oxide nanobelts: fabrication, characterization, and application in supercapacitors

    Science.gov (United States)

    Liu, Peng; Wang, Yunjiao; Wang, Xue; Yang, Chao; Yi, Yanfeng

    2012-11-01

    Polypyrrole-coated samarium oxide nanobelts were synthesized by the in situ chemical oxidative surface polymerization technique based on the self-assembly of pyrrole on the surface of the amine-functionalized Sm2O3 nanobelts. The morphologies of the polypyrrole/samarium oxide (PPy/Sm2O3) nanocomposites were characterized using transmission electron microscope. The UV-vis absorbance of these samples was also investigated, and the remarkable enhancement was clearly observed. The electrochemical behaviors of the PPy/Sm2O3 composites were investigated by cyclic voltammetry, electrochemical impedance spectroscopy, and galvanostatic charge-discharge. The results indicated that the PPy/Sm2O3 composite electrode was fully reversible and achieved a very fast Faradaic reaction. After being corrected into the weight percentage of the PPy/Sm2O3 composite at a current density of 20 mA cm-2 in a 1.0 M NaNO3 electrolyte solution, a maximum discharge capacity of 771 F g-1 was achieved in a half-cell setup configuration for the PPy/Sm2O3 composites electrode with the potential application to electrode materials for electrochemical capacitors.

  15. Polypyrrole-coated samarium oxide nanobelts: fabrication, characterization, and application in supercapacitors

    Energy Technology Data Exchange (ETDEWEB)

    Liu Peng, E-mail: pliu@lzu.edu.cn; Wang Yunjiao; Wang Xue; Yang Chao; Yi Yanfeng [College of Chemistry and Chemical Engineering, Lanzhou University, Key Laboratory of Nonferrous Metal Chemistry and Resources Utilization of Gansu Province and State Key Laboratory of Applied Organic Chemistry (China)

    2012-11-15

    Polypyrrole-coated samarium oxide nanobelts were synthesized by the in situ chemical oxidative surface polymerization technique based on the self-assembly of pyrrole on the surface of the amine-functionalized Sm{sub 2}O{sub 3} nanobelts. The morphologies of the polypyrrole/samarium oxide (PPy/Sm{sub 2}O{sub 3}) nanocomposites were characterized using transmission electron microscope. The UV-vis absorbance of these samples was also investigated, and the remarkable enhancement was clearly observed. The electrochemical behaviors of the PPy/Sm{sub 2}O{sub 3} composites were investigated by cyclic voltammetry, electrochemical impedance spectroscopy, and galvanostatic charge-discharge. The results indicated that the PPy/Sm{sub 2}O{sub 3} composite electrode was fully reversible and achieved a very fast Faradaic reaction. After being corrected into the weight percentage of the PPy/Sm{sub 2}O{sub 3} composite at a current density of 20 mA cm{sup -2} in a 1.0 M NaNO{sub 3} electrolyte solution, a maximum discharge capacity of 771 F g{sup -1} was achieved in a half-cell setup configuration for the PPy/Sm{sub 2}O{sub 3} composites electrode with the potential application to electrode materials for electrochemical capacitors.

  16. Behavior of Samarium III during the sorption process; Comportamiento del Samario-III durante el proceso de sorcion

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez R, E.; Garcia G, N.; Garcia R, G. [ININ, Carr. Mexico-Toluca Km 36.5, Salazar, Estado de Mexico (Mexico)]. e-mail: edo@nuclear.inin.mx

    2004-07-01

    In this work the results of the behavior of samarium in solution are presented, in front of a fine powder of zirconium silicate (zircon). For that which is necessary to characterize the zircon, studying the crystallinity, the morphology, the surface area and the isoelectric point. The behavior of samarium in solution is studied by means of the elaboration of isotherm of sorption, using the technique by lots. One observes that to pH values of nearer to the isoelectric point (pH = 7.23) the process of sorption of the samarium begins, reaching a maximum to near pH at 9. The technique of luminescence is used to determine the concentration of the sipped samarium (phosphorescence) and also to make the speciation of the species formed in the surface of the zircon (phosphorescence). The results can be extrapolated with the plutonium when making the modeling of the migration of alpha emitting coming from the repositories of radioactive waste since both they have similar chemical properties (they are homologous). (Author)

  17. Neutron and Charged-Particle Induced Cross Sections for Radiochemistry in the Region of Samarium, Europium, and Gadolinium

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, R D; Kelley, K; Dietrich, F S; Bauer, R; Mustafa, M

    2004-11-30

    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron and proton induced nuclear reaction cross sections in the mass region of samarium, europium and gadolinium (62 {le} Z {le} 64, 82 {le} N {le} 96).

  18. Pemisahan Unsur Samarium dan Yttrium dari Mineral Tanah Jarang dengan Teknik Membran Cair Berpendukung (Supported Liquid Membrane

    Directory of Open Access Journals (Sweden)

    Amri Amin

    2009-06-01

    Full Text Available he increasing use of rare earth elements in high technology industries needs to be supported by developmental work for the separation of elements. The research objective is fiercely attracting and challenging considering the similarity of bath physical and chemical properties among these elements. The rate separation of samarium and yttrium elements using supported liquid membrane has been studied. Polytetrafluoroethylene (PTFE with pore size of 0.45 µm has been used as the membrane and di(2-ethylhexyl phosphate (D2EHP in hexane has been used as a carrier and nitric acid solution has been used as receiving phase. Result of experiments showed that the best separation rate of samarium and yttrium elements could be obtained at feeding phase of pH 3.0, di(2-ethylhexyl phosphate (D2EHP concentration of 0.3 M, agitation rate of 700 rpm, agitation time of 2 hours, and nitric acid and its solution concentrations of 1.0 M and 0.1 M, respectively. At this condition, separation rates of samarium and yttrium were 64.4 and 67.6%, respectively.   Keywords: liquid membrane, rare earth elements, samarium, yttrium

  19. Effects of the atomic environment on the electron binding energies in samarium

    Energy Technology Data Exchange (ETDEWEB)

    Inoyatov, A.Kh., E-mail: inoyatov@jinr.ru [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Institute of Applied Physics, National University, Tashkent, Republic of Uzbekistan (Uzbekistan); Kovalík, A. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Nuclear Physics Institute of the ASCR, CZ-25068 Řež near Prague (Czech Republic); Filosofov, D.V. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Ryšavý, M.; Vénos, D. [Nuclear Physics Institute of the ASCR, CZ-25068 Řež near Prague (Czech Republic); Yushkevich, Yu.V.; Perevoshchikov, L.L. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Zhdanov, V.S. [Nuclear Physics Institute, Almaty, Republic of Kazakhstan (Kazakhstan)

    2016-02-15

    Highlights: • Eight different matrices (evaporated and implanted at 30 keV) used. • The greatest average difference in the binding energies amounted to 3.1 ± 0.1 eV. • The presence of trivalent and divalent Sm ions found in some implanted samples. • No significant differences in Sm natural atomic level widths were observed. - Abstract: Effects of the atomic environment on the L{sub 1}, L{sub 2}, L{sub 3}, M{sub 1}, M{sub 2}, M{sub 3}, and N{sub 1} electron binding energies in samarium generated in the electron capture decay of radioactive {sup 149}Eu were investigated by means of the internal conversion electron spectroscopy using the conversion electron spectrum of the 22.5 keV M1 + E2 nuclear transition in the daughter {sup 149}Sm. In this investigation, four pairs of {sup 149}Eu sources prepared by vacuum evaporation deposition and by ion implantation at 30 keV with the use of four different source backing materials, namely polycrystalline carbon, aluminium, gadolinium and platinum foils, were employed. The greatest average difference of (3.1 ± 0.1) eV in the L{sub 1}, L{sub 2}, L{sub 3}, and M{sub 1} subshell electron binding energies was observed between the {sup 149}Eu sources prepared by ion implantation into the aluminium and platinum substrates. On the other hand, minimal differences in the electron binding energies were generally found between samarium generated in the evaporated layer and in the bulk for the individual investigated source backings with the exception of the gadolinium foil. A doublet structure of all investigated conversion electron lines with the average values of 8.1 ± 0.2 eV and 1.5 ± 0.1 for the separation energy and the intensity ratio of the low-energy to high-energy components, respectively, was observed for the {sup 149}Eu sources prepared by ion implantation into the aluminium and carbon foils. This structure was presumably caused by the presence of both the trivalent and divalent Sm ions in the sources. No

  20. Multiphoton laser wave-mixing absorption spectroscopy for samarium using a graphite furnace atomizer

    Energy Technology Data Exchange (ETDEWEB)

    Maniaci, Michael J.; Tong, William G. E-mail: william.tong@sdsu.edu

    2004-07-30

    Nonlinear laser wave-mixing optical technique is presented as a sensitive atomic spectroscopic method for the analysis of rare earth elements using an unmodified commercially available graphite furnace (GF) atomizer. A simple nonplanar backward-scattering degenerate four-wave mixing optical arrangement offers sub-picogram detection sensitivity with sub-Doppler Lorentzian-broadened resolution. Nonlinear wave mixing is an unusually sensitive absorption-based optical method that offers both excellent detection sensitivity and sub-Doppler spectral resolution. A mass detection limit of 0.7 pg and a concentration detection limit of 70 pg/ml are determined for a rare earth element, samarium, using the 429.7-nm excitation line.

  1. Samarium Doped Cerium Oxide Clusters: a Study on the Modulation of Electronic Structure

    Science.gov (United States)

    Topolski, Josey E.; Kafader, Jared O.; Marrero-Colon, Vicmarie; Chick Jarrold, Caroline

    2017-06-01

    Cerium oxide is known for its use in solid oxide fuel cells due to its high ionic conductivity. The doping of trivalent samarium atoms into cerium oxide is known to enhance the ionic conductivity through the generation of additional oxygen vacancies. This study probes the electronic structure of Sm_{x}Ce_{y}O_{z} (x+y=3, z=2-4) anion and neutral clusters. Anion photoelectron spectra of these mixed metal clusters exhibit additional spectral features not present in the previously studied cerium oxide clusters. Density functional theory calculations have been used to aid interpretation of collected spectra. The results of this work can be used to inform the design of materials used for solid oxide fuel cells.

  2. Chelating Ligand-Mediated Hydrothermal Synthesis of Samarium Orthovanadate with Decavanadate as Vanadium Source

    Directory of Open Access Journals (Sweden)

    Quanguo Li

    2013-01-01

    Full Text Available A new ethylenediaminetetraacetic acid- (EDTA- mediated hydrothermal route to prepare chrysanthemum-shaped samarium orthovanadate (SmVO4 nanocrystals with decavanadate (K6V10O28·9H2O as vanadium source has been developed. The present hydrothermal approach is simple and reproducible and employs a relatively mild reaction temperature. The EDTA, pH value, and temperature of the reaction systems play important roles in determining the morphologies and growth process of the SmVO4 products. The products have been characterized by X-ray diffraction (XRD, scanning electron microscopy (SEM, Fourier transform infrared spectroscopy (FT-IR, photoluminescence spectra (PL, and UV-Vis spectroscopy.

  3. The Magnetocaloric Effect and Heat Capacity of Suspensions of High-Dispersity Samarium Ferrite

    Science.gov (United States)

    Korolev, V. V.; Aref'ev, I. M.; Ramazanova, A. G.

    2008-02-01

    The magnetocaloric effect and specific heat capacity of an aqueous suspension of samarium ferrite were determined calorimetrically over the temperature range 288-343 K in magnetic fields of 0-0.7 T. The data obtained were used to calculate changes in the magnetic component of the molar heat capacity and entropy of the magnetic phase and changes in the enthalpy of the process under an applied magnetic field. The magnetocaloric effect was found to increase nonlinearly as the magnetic field induction grew. The corresponding temperature dependences contained a maximum at 313 K related to the second-order magnetic phase transition at the Curie point. The field and temperature dependences of heat capacity contained a maximum in fields of 0.4 T and a minimum at the magnetic phase transition temperature.

  4. Preparation of hollow core/shell microspheres of hematite and its adsorption ability for samarium.

    Science.gov (United States)

    Yu, Sheng-Hui; Yao, Qi-Zhi; Zhou, Gen-Tao; Fu, Sheng-Quan

    2014-07-09

    Hollow core/shell hematite microspheres with diameter of ca. 1-2 μm have been successfully achieved by calcining the precursor composite microspheres of pyrite and polyvinylpyrrolidone (PVP) in air. The synthesized products were characterized by a wide range of techniques including powder X-ray diffraction (XRD), field-emission scanning electron microscopy (FESEM), energy-dispersive X-ray spectroscopy (EDX), transmission electron microscopy (TEM), high-resolution TEM (HRTEM), thermogravimetric analysis (TGA) and differential scanning calorimetry (DSC), and Brunauer-Emmett-Teller (BET) gas sorptometry. Temperature- and time-dependent experiments unveil that the precursor pyrite-PVP composite microspheres finally transform into hollow core/shell hematite microspheres in air through a multistep process including the oxidation and sulfation of pyrite, combustion of PVP occluded in the precursor, desulfation, aggregation, and fusion of nanosized hematite as well as mass transportation from the interior to the exterior of the microspheres. The formation of the hollow core/shell microspheres dominantly depends on the calcination temperature under current experimental conditions, and the aggregation of hematite nanocrystals and the core shrinking during the oxidation of pyrite are responsible for the formation of the hollow structures. Moreover, the adsorption ability of the hematite for Sm(III) was also tested. The results exhibit that the hematite microspheres have good adsorption activity for trivalent samarium, and that its adsorption capacity strongly depends on the pH of the solution, and the maximum adsorption capacity for Sm(III) is 14.48 mg/g at neutral pH. As samarium is a typical member of the lanthanide series, our results suggest that the hollow hematite microspheres have potential application in removal of rare earth elements (REEs) entering the water environment.

  5. The influence of the technological parameters on the ionic conductivity of samarium doped ceria thin films

    Directory of Open Access Journals (Sweden)

    Mantas Sriubas

    2015-03-01

    Full Text Available Sm0,20Ce0,80O2 powder was used for the formation of samarium doped cerium oxide (SDC thin films using e-beam. Surface area of powder was 34.9 m2/g and particle size – 0.3-0.5 μm. Thin films were deposited using physical vapor deposition system on SiO2 and Alloy 600 substrates. 2 Å/s – 16 Å/s growth rate and 20 °C – 600 °C substrate temperature were used during the deposition. Ionic conductivity investigation revealed that the maximum ionic conductivity (1.67 S/m has the thin film deposited on 300 °C temperature substrate using 4 Å/s growth rate. Minimum ionic conductivity (0.26 S/m has thin film which was deposited on 20 °C temperature substrate using 8 Å/s growth rate. Vacancy activation energies vary in 0.87 eV – 0.97 eV range. Furthermore the calculations of crystallite size revealed that crystallite size increases with increasing substrate temperature: from 7.50 nm to 46.23 nm on SiO2 substrate and from 9.30 nm to 44.62 nm on Alloy 600 substrate. Molar concentration of samarium in initial evaporated material is 19.38 mol% and varies from 11.37 mol% to 21 mol% in formed thin films depending on technological parameters.DOI: http://dx.doi.org/10.5755/j01.ms.21.1.5700

  6. 33 CFR 154.1216 - Facility classification.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Facility classification. 154.1216... Vegetable Oils Facilities § 154.1216 Facility classification. (a) The Coast Guard classifies facilities that... classification of a facility that handles, stores, or transports animal fats or vegetable oils. The COTP may...

  7. 32 CFR 154.34 - Priority requests.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Priority requests. 154.34 Section 154.34... requests. To insure that personnel security investigations are conducted in an orderly and efficient manner, requests for priority for individual investigations or categories of investigations shall be kept to a...

  8. 42 CFR 441.154 - Active treatment.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Active treatment. 441.154 Section 441.154 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... treatment. Inpatient psychiatric services must involve “active treatment”, which means implementation of a...

  9. 46 CFR 154.1725 - Ethylene oxide.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Ethylene oxide. 154.1725 Section 154.1725 Shipping COAST....1725 Ethylene oxide. (a) A vessel carrying ethylene oxide must: (1) Have cargo piping, vent piping, and... space of an ethylene oxide cargo tank for a period of 30 days under the condition of paragraph (e) of...

  10. 32 CFR 154.30 - General.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false General. 154.30 Section 154.30 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE SECURITY DEPARTMENT OF DEFENSE PERSONNEL SECURITY... security investigations shall be limited to those required to accomplish the Defense mission. Such requests...

  11. 32 CFR 154.1 - Purpose.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Purpose. 154.1 Section 154.1 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE SECURITY DEPARTMENT OF DEFENSE PERSONNEL SECURITY... employees in the Department of Defense (DoD), and granting members of the Armed Forces, DoD civilian...

  12. 18 CFR 154.502 - Reports.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Reports. 154.502... OF ENERGY REGULATIONS UNDER NATURAL GAS ACT RATE SCHEDULES AND TARIFFS Refunds and Reports § 154.502 Reports. (a) When the natural gas company is required, either by a Commission order or as a part of a...

  13. 33 CFR 154.1075 - Appeal process.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Appeal process. 154.1075 Section 154.1075 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED....1075 Appeal process. (a) Any owner or operator of a facility who desires to appeal the classification...

  14. 46 CFR 154.1755 - Nitrogen.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Nitrogen. 154.1755 Section 154.1755 Shipping COAST GUARD... Nitrogen. Except for deck tanks and their piping systems, cargo containment systems and piping systems carrying nitrogen must be specially approved by the Commandant (CG-522). ...

  15. 46 CFR 154.605 - Toughness test.

    Science.gov (United States)

    2010-10-01

    ... of this chapter. (b) If subsize test specimens are used for the Charpy V-notch toughness test, the... 46 Shipping 5 2010-10-01 2010-10-01 false Toughness test. 154.605 Section 154.605 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR...

  16. 46 CFR 154.460 - Design criteria.

    Science.gov (United States)

    2010-10-01

    ... dynamic loads in § 154.409(e); (c) If the primary barrier fails, prevent the temperature of the vessel's structure from falling below the minimum allowable service temperature of the steel; and (d) Be designed so... tank for at least 15 days under the dynamic loads in § 154.409(e); (b) If a partial secondary barrier...

  17. 34 CFR 668.154 - Institutional accountability.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 3 2010-07-01 2010-07-01 false Institutional accountability. 668.154 Section 668.154 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF POSTSECONDARY... accountability. An institution shall be liable for the Title IV, HEA program funds disbursed to a student whose...

  18. 40 CFR 93.154 - Conformity analysis.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Conformity analysis. 93.154 Section 93...) DETERMINING CONFORMITY OF FEDERAL ACTIONS TO STATE OR FEDERAL IMPLEMENTATION PLANS Determining Conformity of General Federal Actions to State or Federal Implementation Plans § 93.154 Conformity analysis. Any Federal...

  19. 33 CFR 154.800 - Applicability.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Applicability. 154.800 Section 154.800 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED... receives cargo vapor from a vessel is connected to a facility vapor control system that serves tank storage...

  20. Formation of Core-Shell Nanoparticles Composed of Magnetite and Samarium Oxide in Magnetospirillum magneticum Strain RSS-1.

    Science.gov (United States)

    Shimoshige, Hirokazu; Nakajima, Yoshikata; Kobayashi, Hideki; Yanagisawa, Keiichi; Nagaoka, Yutaka; Shimamura, Shigeru; Mizuki, Toru; Inoue, Akira; Maekawa, Toru

    2017-01-01

    Magnetotactic bacteria (MTB) synthesize magnetosomes composed of membrane-enveloped magnetite (Fe3O4) or greigite (Fe3S4) particles in the cells. Recently, several studies have shown some possibilities of controlling the biomineralization process and altering the magnetic properties of magnetosomes by adding some transition metals to the culture media under various environmental conditions. Here, we successfully grow Magnetospirillum magneticum strain RSS-1, which are isolated from a freshwater environment, and find that synthesis of magnetosomes are encouraged in RSS-1 in the presence of samarium and that each core magnetic crystal composed of magnetite is covered with a thin layer of samarium oxide (Sm2O3). The present results show some possibilities of magnetic recovery of transition metals and synthesis of some novel structures composed of magnetic particles and transition metals utilizing MTB.

  1. Dicty_cDB: VHP154 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHP154 (Link to dictyBase) - G23560 DDB0231372 Contig-U12088-1 | Contig-U13789-1 VHP...154P (Link to Original site) VHP154F 617 VHP154Z 715 VHP154P 1312 - - Show VHP154 Libr...ary VH (Link to library) Clone ID VHP154 (Link to dictyBase) Atlas ID - NBRP ID G23560 dictyBase ID DDB02313...ycdb.biol.tsukuba.ac.jp/CSM/VH/VHP1-C/VHP154Q.Seq.d/ Representative seq. ID VHP154P (Link to Original site) ...Representative DNA sequence >VHP154 (VHP154Q) /CSM/VH/VHP1-C/VHP154Q.Seq.d/ TACAACTGCAGCTAATTTATTCAAGAAAACCG

  2. Co-reduction of aluminium and lanthanide ions in molten fluorides: Application to cerium and samarium extraction from nuclear wastes

    Energy Technology Data Exchange (ETDEWEB)

    Gibilaro, M. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France); Massot, L. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France)], E-mail: massot@chimie.ups-tlse.fr; Chamelot, P.; Taxil, P. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France)

    2009-09-01

    This work concerns the method of co-reduction process with aluminium ions in LiF-CaF{sub 2} medium (79-21 mol.%) on tungsten electrode for cerium and samarium extraction. Electrochemical techniques such as cyclic and square wave voltammetries, and potentiostatic electrolyses were used to study the co-reduction of CeF{sub 3} and SmF{sub 3} with AlF{sub 3}. For each of these elements, specific peaks of Al-Ce and Al-Sm alloys formation were observed by voltammetry as well as peaks of pure cerium and aluminium, and pure samarium and aluminium respectively. The difference of potential measured between the solvent reduction and the alloy formation suggests expecting an extraction efficiency of 99.99% of each lanthanide by the process. Different intermetallic compounds were obtained for different potentiostatic electrolysis and were characterised by Scanning Electron Microscopy with EDS probe. The validity of the process was verified by carrying out cerium and samarium extractions in the form of Al-Ln alloy; the extraction efficiency was 99.5% for Ce(III) and 99.4% for Sm(III)

  3. Structural and luminescence properties of samarium doped lead alumino borate glasses

    Science.gov (United States)

    Mohan, Shaweta; Kaur, Simranpreet; Singh, D. P.; Kaur, Puneet

    2017-11-01

    The study reports the effect of samarium concentration on the physical, structural and spectroscopic characteristics of samarium doped lead alumino borate glasses having composition 20PbO-(10-x)Al2O3-70B2O3-xSm2O3; x = 0.1, 0.5, 1.0 and 2.0 mol %. The glasses were fabricated by conventional melt-quenching technique and then characterized by XRD, FTIR, optical absorption and fluorescence spectra. X-ray diffraction studies confirmed the amorphous nature of the prepared glasses. FTIR spectra indicate the presence of BO3, BO4, AlO6 and a few other structural groups. Various physical properties such as density, molar volume, refractive index, rare earth ion concentration, boron-boron distance and polarizability etc. were determined using conventional methods and standard formulae. The Judd-Ofelt theory was applied on the optical absorption spectra of the glasses to evaluate the three phenomenological intensity parameters Ω2, Ω4 and Ω6. The value of Ω2 was found to be highest for glass with 1 mol% Sm2O3 and attributed to the asymmetry of the ligand field at the rare earth ion site and the rare earth oxygen (Sm-O) covalency. The calculated intensity parameters and fluorescence spectra were further used to predict the radiative transition probability (A), radiative lifetime (τR), branching ratio (βR), peak wavelength (λp), effective line widths (Δλeff) and stimulated emission cross-section (σ) for the characteristic 4G5/2 → 6H5/2, 6H7/2 and 6H9/2 transitions of the Sm3+ ion. Concentration quenching was observed for 2 mol% concentration of Sm2O3 and ascribed to energy transfer through various cross-relaxation channels between Sm3+ ions. Reasonably high values of branching ratios and stimulated emission cross-section for the prepared glasses points towards their utility in the development of visible lasers emitting in the reddish-orange spectral region. However, the glass with 1 mol% Sm2O3 was found to show better radiative properties.

  4. 154 GHz collective Thomson scattering in LHD

    Science.gov (United States)

    Tanaka, K.; Nishiura, M.; Kubo, S.; Shimozuma, T.; Saito, T.; Moseev, D.; Abramovic, I.

    2018-01-01

    Collective Thomson scattering (CTS) was developed by using a 154 GHz gyrotron, and the first data has been obtained. Already, 77 GHz CTS has worked successfully. However, in order to access higher density region, 154 GHz option enhances the usability that reduces the refraction effect, which deteriorates in the local measurements. The system in the down converted frequency was almost identical to the system for 77 GHz. Probing beam, a notch filter, a mixer, and a local oscillator in the receiver system for 77 GHz option were replaced to those for the 154 GHz option. 154 GHz gyrotron was originally prepared for the second harmonic electron cyclotron heating (ECRH) at 2.75 T. However, scattering signal was masked by the second harmonic electron cyclotron emission (ECE) at 2.75 T. Therefore, 154 GHz CTS was operated at 1.375 T with fourth harmonic ECE, and an acceptable signal to noise ratio was obtained. There is a signature of fast ion components with neutral beam (NB) injection. In addition, the CTS spectrum became broader in hydrogen discharge than in deuterium discharge, as the theoretical CTS spectrum expects. This observation indicates a possibility to identify ion species ratio by the 154 GHz CTS diagnostic.

  5. X-ray Induced Luminescence Spectroscopy of Samarium Doped Barium Sulfate Prepared by Sintering Method

    Science.gov (United States)

    Kumeda, T.; Maeda, K.; Shirano, Y.; Fujiwara, K.; Sakai, K.; Ikari, T.

    2015-06-01

    X-ray induced luminescence (XL) properties of phosphor materials made of samarium doped barium sulfate have been investigated. The samples were prepared by sintering method heated at 900-1250 °C for 3 hours in air from the mixture of BaSO4 and Sm2O3. The concentration of Sm were prepared from 0.01-6 at.%. In as-prepared sample, the Sm3+ was detected by photoluminescence (PL). The PL intensity is maximum about 2 at.% with Sm, and then starts decreasing. The PL intensity showed concentration quenching. The XL observed Sm2+ and Sm3+ ions. The XL was shown from the sample sintered up to 1200 °C. The XL intensity increased with Sm concentration up to 1 at.%. The intensity was almost constant larger than 1 at.% Sm. These concentration dependences is different since the X-ray energy absorbed to the host material at once, and the energy transferred to both Sm3+ and Sm2+ ions. Sm doped BaSO4 is found a host for XL phosphor materials.

  6. High-κ Samarium-Based Metal-Organic Framework for Gate Dielectric Applications.

    Science.gov (United States)

    Pathak, Abhishek; Chiou, Guan Ru; Gade, Narsinga Rao; Usman, Muhammad; Mendiratta, Shruti; Luo, Tzuoo-Tsair; Tseng, Tien Wen; Chen, Jenq-Wei; Chen, Fu-Rong; Chen, Kuei-Hsien; Chen, Li-Chyong; Lu, Kuang-Lieh

    2017-07-05

    The self-assembly of a samarium-based metal-organic framework [Sm2(bhc)(H2O)6]n (1) in good yield was achieved by reacting Sm(NO3)3·6H2O with benzenehexacarboxylic acid (bhc) in a mixture of H2O-EtOH under hydrothermal conditions. A structural analysis showed that compound 1 crystallized in a space group of Pnmn and adopted a 3D structure with (4,8) connected nets. Temperature dependent dielectric measurements showed that compound 1 behaves as a high dielectric material with a high dielectric constant (κ = 45.1) at 5 kHz and 310 K, which is comparable to the values for some of the most commonly available dielectric inorganic metal oxides such as Sm2O3, Ta2O5, HfO2, and ZrO2. In addition, electrical measurements of 1 revealed an electrical conductivity of about 2.15 × 10-7 S/cm at a frequency of 5 kHz with a low leakage current (Ileakage = 8.13 × 10-12 Amm-2). Dielectric investigations of the Sm-based MOF provide an effective path for the development of high dielectric materials in the future.

  7. Pyroelectric properties and electrical conductivity in samarium doped BiFeO 3 ceramics

    KAUST Repository

    Yao, Yingbang

    2012-06-01

    Samarium (Sm 3+) doped BiFeO 3 (BFO) ceramics were prepared by a modified solid-state-reaction method which adopted a rapid heating as well as cooling during the sintering process. The pyroelectric coefficient increased from 93 to 137 μC/m 2 K as the Sm 3+ doping level increased from 1 mol% to 8 mol%. Temperature dependence of the pyroelectric coefficient showed an abrupt decrease above 80 °C in all samples, which was associated with the increase of electrical conductivity with temperature. This electrical conduction was attributed to oxygen vacancy existing in the samples. An activation energy of ∼0.7 eV for the conduction process was found to be irrespective of the Sm 3+ doping level. On the other hand, the magnetic Néel temperature (T N) decreased with increasing Sm 3+ doping level. On the basis of our results, the effects of Sm doping level on the pyroelectric and electrical properties of the BFO were revealed. © 2011 Elsevier Ltd. All rights reserved.

  8. Characterization of luminescent samarium doped HfO{sub 2} coatings synthesized by spray pyrolysis technique

    Energy Technology Data Exchange (ETDEWEB)

    Chacon-Roa, C [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Guzman-Mendoza, J [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Aguilar-Frutis, M [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Garcia-Hipolito, M [Departamento de Materiales Metalicos y Ceramicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autonoma de Mexico, A.P. 70-360 Coyoacan 04510, Mexico, D.F. (Mexico); Alvarez-Fragoso, O [Departamento de Materiales Metalicos y Ceramicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autonoma de Mexico, A.P. 70-360 Coyoacan 04510, Mexico, D.F. (Mexico); Falcony, C [Departamento de Fisica, CINVESTAV-IPN, A. P. 14-740, 07000 Mexico D.F. (Mexico)

    2008-01-07

    Trivalent samarium (Sm{sup 3+}) doped hafnium oxide (HfO{sub 2}) films were deposited using the spray pyrolysis deposition technique. The films were deposited on Corning glass substrates at temperatures ranging from 300 to 550 deg. C using chlorides as raw materials. Films, mostly amorphous, were obtained when deposition temperatures were below 350 deg. C. However, for temperatures higher than 400 deg. C, the films became polycrystalline, presenting the HfO{sub 2} monoclinic phase. Scanning electron microscopy of the films revealed a rough surface morphology with spherical particles. Also, electron energy dispersive analysis was performed on these films. The photoluminescence and cathodoluminescence characteristics of the HfO{sub 2} : SmCl{sub 3} films, measured at room temperature, exhibited four main bands centred at 570, 610, 652 and 716 nm, which are due to the well-known intra-4f transitions of the Sm{sup 3+} ion. It was found that the overall emission intensity rose as the deposition temperature was increased. Furthermore, a concentration quenching of the luminescence intensity was also observed.

  9. Luminescence of trivalent samarium ions in silver and tin co-doped aluminophosphate glass

    Science.gov (United States)

    Jiménez, José A.; Lysenko, Sergiy; Liu, Huimin; Sendova, Mariana

    2011-06-01

    This work presents the spectroscopic properties of trivalent samarium ions in a melt-quenched aluminophosphate glass containing silver and tin. Addition of 4 mol% of each Ag 2O and SnO into the glass system with 2 mol% Sm 2O 3 results in Sm 3+ ions luminescence under non-resonant UV excitation owing to energy transfer from single silver ions and/or twofold-coordinated Sn centers. Assessment of luminescence spectra and decay dynamics suggest the energy transfer mechanism to be essentially of the resonant radiative type. Moreover, a connection between the luminescent and structural properties of the rare-earth doped glass system was demonstrated. Raman spectroscopy characterization revealed that no significant variation in the glass matrix is induced by Sm 3+ doping at the concentration employed. A comparison was made with a structural study performed on the Eu 3+ doped system (containing 2 mol% Eu 2O 3 along with 4 mol% of each Ag 2O and SnO) where the radiative energy transfer mechanism was previously established. The data appears consistent regarding the lack of variation in glass structure upon the Eu 3+ and Sm 3+ doping in connection with the dominance of the radiative transfer in the matrix. Thermal treatment of the material leads to precipitation of Ag nanoparticles of a broad size range inside the dielectric as observed by transmission electron microspcopy. Assessment of 4G 5/2 excited state decay in Sm 3+ ions shows no influence from the silver particles.

  10. Samarium (III) adsorption on bentonite modified with N-(2-hydroxyethyl) ethylenediamine.

    Science.gov (United States)

    Li, Dandan; Chang, Xijun; Hu, Zheng; Wang, Qihui; Li, Ruijun; Chai, Xiaoli

    2011-02-15

    A new material has been synthesized using dry process to activate bentonite followed by N-(2-hydroxyethyl) ethylenediamine connecting chlorosilane coupling agent. The synthesized new material was characterized by elemental analysis, FT-IR and thermogravimetry which proved that bentonite was successfully modified. The most interesting trait of the new material was its selective adsorption for rare earth elements. A variety of conditions of the new material were investigated for adsorption. The optimal conditions were determined with respect to pH and shaking time. Samarium (Sm) was quantitatively adsorbed at pH 4 and shaking time of 2 min onto the new material. Under these conditions the maximum static adsorption capacity of Sm(III) was found to be 17.7 mg g(-1). The adsorbed Sm(III) ion were quantitatively eluted by 2.0 mL 0.1 mol L(-1) HCl and 5% CS (NH(2))(2) solution. According to IUPAC definition, the detection limit (3σ) of this method was 0.60 ng mL(-1). The relative standard deviation (RSD) under optimum conditions was less than 3% (n=8). The new material also was applied for the preconcentration of trace Sm(III) in environmental samples with satisfactory results. Copyright © 2010 Elsevier B.V. All rights reserved.

  11. 46 CFR 154.355 - Bow and stern loading piping.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Bow and stern loading piping. 154.355 Section 154.355... Arrangements § 154.355 Bow and stern loading piping. (a) Bow and stern loading piping must: (1) Meet § 154.310... other openings to accommodation, service, or control spaces that face the bow or stern loading area must...

  12. 46 CFR 154.408 - Cargo tank external pressure load.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo tank external pressure load. 154.408 Section 154... Equipment Cargo Containment Systems § 154.408 Cargo tank external pressure load. For the calculation required under § 154.406 (a)(2) and (b), the external pressure load must be the difference between the...

  13. 46 CFR 154.178 - Contiguous hull structure: Heating system.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Contiguous hull structure: Heating system. 154.178... Equipment Hull Structure § 154.178 Contiguous hull structure: Heating system. The heating system for... the heating capacity to meet § 154.174(b)(2) or § 154.176(b)(2); (b) Have stand-by heating to provide...

  14. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Mandiwana, Vusani, E-mail: VMandiwana@csir.co.za; Kalombo, Lonji, E-mail: LKalombo@csir.co.za [Centre of Polymers and Composites, CSIR (South Africa); Venter, Kobus, E-mail: Kobus.Venter@mrc.ac.za [South African Medical Research Council (South Africa); Sathekge, Mike, E-mail: Mike.Sathekge@up.ac.za [University of Pretoria and Steve Biko Academic Hospital, Department of Nuclear Medicine (South Africa); Grobler, Anne, E-mail: Anne.Grobler@nwu.ac.za; Zeevaart, Jan Rijn, E-mail: zeevaart@necsa.co.za [North-West University, DST/NWU Preclinical Drug Development Platform (South Africa)

    2015-09-15

    Developing nanoparticulate delivery systems that will allow easy movement and localization of a drug to the target tissue and provide more controlled release of the drug in vivo is a challenge in nanomedicine. The aim of this study was to evaluate the biodistribution of poly(d,l-lactide-co-glycolide) (PLGA) nanoparticles containing samarium-153 oxide ([{sup 153}Sm]Sm{sub 2}O{sub 3}) in vivo to prove that orally administered nanoparticles alter the biodistribution of a drug. These were then activated in a nuclear reactor to produce radioactive {sup 153}Sm-loaded-PLGA nanoparticles. The nanoparticles were characterized for size, zeta potential, and morphology. The nanoparticles were orally and intravenously (IV) administered to rats in order to trace their uptake through imaging and biodistribution studies. The {sup 153}Sm-loaded-PLGA nanoparticles had an average size of 281 ± 6.3 nm and a PDI average of 0.22. The zeta potential ranged between 5 and 20 mV. The [{sup 153}Sm]Sm{sub 2}O{sub 3} loaded PLGA nanoparticles, orally administered were distributed to most organs at low levels, indicating that there was absorption of nanoparticles. While the IV injected [{sup 153}Sm]Sm{sub 2}O{sub 3}-loaded PLGA nanoparticles exhibited the highest localization of nanoparticles in the spleen (8.63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems would be suitable for improving permeability and thus the bioavailability of therapeutic compounds.

  15. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles

    Science.gov (United States)

    Mandiwana, Vusani; Kalombo, Lonji; Venter, Kobus; Sathekge, Mike; Grobler, Anne; Zeevaart, Jan Rijn

    2015-09-01

    Developing nanoparticulate delivery systems that will allow easy movement and localization of a drug to the target tissue and provide more controlled release of the drug in vivo is a challenge in nanomedicine. The aim of this study was to evaluate the biodistribution of poly( d, l-lactide- co-glycolide) (PLGA) nanoparticles containing samarium-153 oxide ([153Sm]Sm2O3) in vivo to prove that orally administered nanoparticles alter the biodistribution of a drug. These were then activated in a nuclear reactor to produce radioactive 153Sm-loaded-PLGA nanoparticles. The nanoparticles were characterized for size, zeta potential, and morphology. The nanoparticles were orally and intravenously (IV) administered to rats in order to trace their uptake through imaging and biodistribution studies. The 153Sm-loaded-PLGA nanoparticles had an average size of 281 ± 6.3 nm and a PDI average of 0.22. The zeta potential ranged between 5 and 20 mV. The [153Sm]Sm2O3 loaded PLGA nanoparticles, orally administered were distributed to most organs at low levels, indicating that there was absorption of nanoparticles. While the IV injected [153Sm]Sm2O3-loaded PLGA nanoparticles exhibited the highest localization of nanoparticles in the spleen (8.63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems would be suitable for improving permeability and thus the bioavailability of therapeutic compounds.

  16. Fabrication and properties of samarium doped calcium sulphate thin films using spray pyrolysis technique

    Energy Technology Data Exchange (ETDEWEB)

    Reghima, Meriem [Université Tunis El Manar, Faculté des Sciences de Tunis, Département de Physique, LR99ES13 Laboratoire de Physique de la Matière Condensée (LPMC), 2092 Tunis, Tunisie (Tunisia); Institut d' Electronique et des systèmes, Unité Mixte de Recherche 5214 UM2-CNRS (ST2i) – Université Montpellier, 860 rue de Saint Priest, Bâtiment 5, 34097 Montpellier (France); Faculté des Sciences de Bizerte, Université de Carthage, Zarzouna 7021 (Tunisia); Guasch, Cathy [Institut d' Electronique et des systèmes, Unité Mixte de Recherche 5214 UM2-CNRS (ST2i) – Université Montpellier, 860 rue de Saint Priest, Bâtiment 5, 34097 Montpellier (France); Azzaza, Sonia; Alleg, Safia [Laboratoire de Magnétisme et Spectroscopie des Solides (LM2S), Département de Physique, Faculté des Sciences, Université Badji Mokhtar Annaba, B.P. 12, 23000 Annaba (Algeria); Kamoun-Turki, Najoua [Université Tunis El Manar, Faculté des Sciences de Tunis, Département de Physique, LR99ES13 Laboratoire de Physique de la Matière Condensée (LPMC), 2092 Tunis, Tunisie (Tunisia)

    2016-10-01

    Using low cost spray pyrolysis technique, polycrystalline CaSO{sub 4} thin films were successfully grown on a glass substrate with a thickness of about 1 μm. Samarium doping has been performed on CaSO{sub 4} thin films to explore luminescence properties. The characterizations of these films were carried out using X-ray diffraction, Scanning Electron Microscopy and optical measurements. The structural analyses reveal the existence of hexagonal CaSO{sub 4} phase with a (200) preferred orientation belonging to CaS compound for substrate temperatures below 350 °C. It is shown that the crystallinity of the sprayed thin films can be improved by increasing substrate temperature up to 250 °C. Warren-Averbach analysis has been applied on X-ray diffractogram to determine structural parameters involving the phase with its amount, the grain size and the lattice parameters using Maud software. The surface topography shows a rough surface covered by densely packed agglomerated clusters having faceted and hexagonal shapes. Energy dispersive microscopy measurements confirm the presence of calcium and sulfur in equal proportions as well as high percentage of oxygen. Photoluminescence at room temperature revealed that luminescence peaks are attributed to the intrinsic emission of pure CaSO{sub 4} phase. - Highlights: • Warren Averbach analysis reveal the presence of hcp structure of CaSO{sub 4} phase. • A mixture of CaSO{sub 4} and CaHO{sub 4.5}S phases has been detected for lower T{sub s}. • For increasing T{sub s}, the CaHO{sub 4.5}S phase has been disappeared. • The origin of PL peaks has been identified.

  17. 18 CFR 154.309 - Incremental expansions.

    Science.gov (United States)

    2010-04-01

    ... Changes § 154.309 Incremental expansions. (a) For every expansion for which incremental rates are charged... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Incremental expansions... incremental facilities to be rolled-in to the pipeline's rates. For every expansion that has an at-risk...

  18. 46 CFR 154.448 - Calculations.

    Science.gov (United States)

    2010-10-01

    ... SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Independent... similar vessel. (d) A tank buckling analysis considering the maximum construction tolerance. (e) A finite element analysis using the loads determined under § 154.406. (f) A fracture mechanics analysis using the...

  19. 32 CFR 154.41 - Central adjudication.

    Science.gov (United States)

    2010-07-01

    ... administrative action is contemplated under § 154.56(b), the letter of intent (LOI) to deny or revoke must be...-5. A final notification of unfavorable administrative action, subsequent to the issuance of the LOI.... A final notification of unfavorable administrative action subsequent to the issuance of the LOI must...

  20. 18 CFR 154.106 - Map.

    Science.gov (United States)

    2010-04-01

    ....106 Map. (a) The map must show the general geographic location of the company's principal pipeline... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Map. 154.106 Section... on a single map. In addition, a separate map should be provided for each zone. (b) (c) The map must...

  1. 46 CFR 154.1345 - Gas detection.

    Science.gov (United States)

    2010-10-01

    ...” in Table 4 must have: (1) A fixed flammable gas detection system that meets § 154.1350; and (2) Two portable gas detectors that can each measure 0 to 100% of the lower flammable limit of the cargo carried... sulfur dioxide must have a fixed gas detection system that is not located in a gas-safe space. (d) A...

  2. 33 CFR 154.1010 - Purpose.

    Science.gov (United States)

    2010-07-01

    ... FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Response Plans for Oil Facilities § 154.1010 Purpose. This subpart establishes oil spill response plan requirements for all marine transportation... response plan prepares the facility owner or operator to respond to an oil spill. These requirements...

  3. 7 CFR 3560.154 - Tenant selection.

    Science.gov (United States)

    2010-01-01

    ... AGRICULTURE DIRECT MULTI-FAMILY HOUSING LOANS AND GRANTS Multi-Family Housing Occupancy § 3560.154 Tenant... documented in the housing project's management plan and Affirmative Fair Housing Marketing Plan. (d... regardless of income. Such applicants, however, will be ranked among themselves by income level, giving...

  4. Studies of the N=90 region: The decay of 154Eu to 154Gd

    Energy Technology Data Exchange (ETDEWEB)

    Kulp, W.D.; Wood, J.L.; Krane, K.S.; Loats, J.; Schmelzenbach, P.; Stapels, C.J.; Larimer, R.-M.; Norman, E.B.

    2003-12-05

    The decay of {sup 154}Eu {yields} {sup 154}Gd has been studied by {gamma}-ray singles and {gamma}-{gamma} coincidence spectroscopy using an array of 20 Compton-suppressed Ge detectors. The primary goal of the work was to confirm or refute a large number of questionable features in the decay scheme: the outcome is the removal of 8 levels from the previously adopted scheme, with the result that a new type of collective band is revealed. Many weak decay branches for the decay are clarified. These results are critical for understanding the structure of {sup 154}Gd and the N = 90 isotones; and the improved completeness of the decay scheme contributes to the use of {sup 154}Eu as a metrological standard.

  5. Optical properties and electronic transitions of zinc oxide, ferric oxide, cerium oxide, and samarium oxide in the ultraviolet and extreme ultraviolet

    DEFF Research Database (Denmark)

    Pauly, N; Yubero, F; Espinós, J P

    2017-01-01

    Optical properties and electronic transitions of four oxides, namely zinc oxide, ferric oxide, cerium oxide, and samarium oxide, are determined in the ultraviolet and extreme ultraviolet by reflection electron energy loss spectroscopy using primary electron energies in the range 0.3-2.0 keV. This...

  6. 46 CFR 154.411 - Cargo tank thermal loads.

    Science.gov (United States)

    2010-10-01

    ... Containment Systems § 154.411 Cargo tank thermal loads. For the calculations required under § 154.406(a)(4... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo tank thermal loads. 154.411 Section 154.411... thermal loads for the cooling down periods of cargo tanks for design temperatures lower than −55 °C (−67...

  7. Optical response and magnetic characteristic of samarium doped zinc phosphate glasses containing nickel nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Azmi, Siti Amlah M.; Sahar, M.R., E-mail: mrahim057@gmail.com

    2015-11-01

    A magnetic glass of composition 40ZnO–(58−x) P{sub 2}O{sub 5}–1Sm{sub 2}O{sub 3}–xNiO, with x=0.0, 1.0, 1.5 and 2.0 mol% is prepared by melt-quenching technique. The glass is characterized by X-ray diffraction, high-resolution transmission electron microscope (HRTEM), photoluminescence (PL) spectroscopy and vibrating sample magnetometer (VSM) analysis. The X-rays diffraction confirms the amorphous nature of the glass while the HRTEM analysis reveals the presence of nickel nanoparticles in the glass samples. High-resolution TEM reveals that the lattice spacing of nickel nanoparticles is 0.35 nm at (100) plane. Photoluminescence emission shows the existence of four peaks that correspond to the transition from the upper level of {sup 4}G{sub 5/2} to the lower level of {sup 6}H{sub 5/2}, {sup 6}H{sub 7/2}, {sup 6}H{sub 9/2,} and {sup 6}H{sub 11/2.} It is observed that all peaks experience significant quenching effect with the increasing concentration of nickel nanoparticles, suggesting a strong energy transfer from excited samarium ions to the nickel ions. The glass magnetization and susceptibility at 12 kOe at room temperature are found to be in the range of (3.87±0.17×10{sup −2}–7.19±0.39×10{sup −2}) emu/g and (3.24±0.16×10{sup −6}–5.99±0.29×10{sup −6}) emu/Oe g respectively. The obtained hysteresis curve indicates that the glass samples are paramagnetic materials. The studied glass can be further used towards the development of magneto-optical functional glass. - Highlights: • Sm{sup 3+} doped zinc phosphate glass embedded with Ni NPs has been prepared. • The Laue pattern and lattice spacing of Ni NPs are confirmed by HRTEM image. • The magnetic response of glasses has been studied through VSM analysis. • Enhancement factor and decay half-lifetime are investigated.

  8. Treatment of bone pain secondary to metastases using samarium-153-EDTMP

    Directory of Open Access Journals (Sweden)

    Elba Cristina Sá de Camargo Etchebehere

    Full Text Available CONTEXT: More than 50% of patients with prostate, breast or lung cancer will develop painful bone metastases. The purpose of treating bone metastases is to relieve pain, reduce the use of steroids and to maintain motion. OBJECTIVE: To evaluate the use of samarium-153-EDTMP (153Sm-EDTMP for the treatment of bone pain secondary to metastases that is refractory to clinical management. TYPE OF STUDY: Retrospective. SETTING: Division of Nuclear Medicine, Universidade Estadual de Campinas (Unicamp. METHODS: Fifty-eight patients were studied (34 males with mean age 62 years; 31 patients had prostate cancer, 20 had breast cancer, three had lung cancer, one had lung hemangioendothelioma, one had parathyroid adenocarcinoma, one had osteosarcoma and one had an unknown primary tumor. All patients had multiple bone metastases demonstrated by bone scintigraphy using 99mTc-MDP,and were treated with 153Sm-EDTMP. Response to treatment was graded as good (pain reduction of 50-100%, intermediate (25-49% and poor (0-24%. RESULTS: All patients showed good uptake of 153Sm-EDTMP by bone metastases. Among the patients with prostate cancer, intermediate or good response to therapy occurred in 80.6% (25 patients and poor response in 19.4% (6. Among the patients with breast cancer, 85% (17 showed intermediate or good response to therapy while 15% (3 showed poor response. All three patients with lung cancer showed poor response to treatment. The lung hemangioendothelioma and unknown primary lesion patients showed intermediate response to treatment; the osteosarcoma and parathyroid adenocarcinoma patients showed good response to treatment. No significant myelotoxicity occurred. DISCUSSION: Pain control is important for improving the quality of life of patients with advanced cancers. The mechanism by which pain is relieved with the use of radionuclides is still not yet completely understood, however, the treatment is simple and provides a low risk of mielotoxicity

  9. Anchoring samarium oxide nanoparticles on reduced graphene oxide for high-performance supercapacitor

    Energy Technology Data Exchange (ETDEWEB)

    Dezfuli, Amin Shiralizadeh [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Ganjali, Mohammad Reza, E-mail: ganjali@khayam.ut.ac.ir [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Biosensor Research Center, Endocrinology & Metabolism Molecular-Cellular Sciences Institute, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Naderi, Hamid Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of)

    2017-04-30

    Highlights: • Samarium oxide nanoparticles have been anchored on the surface of reduced graphene oxide for the first time. • Sm{sub 2}O{sub 3}/RGO nanocomposite show high capacitance, good rate and cycling performance. • Sm{sub 2}O{sub 3}/RGO nanocomposite can serve as efficient electrode material for energy storage. • The best composite electrode exhibits specific capacitance of 321 F g{sup −1} in 2 mV s{sup −1}. - Abstract: We have synthesized Sm{sub 2}O{sub 3} nanoparticles (SmNs) and anchored them onto the surface of reduced graphene oxide (RGO) through a self-assembly thereof by utilizing a facile sonochemical procedure. The nanomaterials were characterized by means of powder X-ray diffraction (XRD), Field-emission scanning electron microscopy (FE-SEM), fourier transform infrared spectroscopy (FT-IR) spectra, and X-ray photoelectron spectroscopy (XPS). As the next step, the supercapacitive behavior of the resulting nanocomposites were investigated when used as electrode material, through with cyclic voltammetric (CV), galvanostatic charge-discharge and electrochemical impedance spectroscopy (EIS) techniques. The SmNs decorated RGO (SmN-RGO) nanocomposites were found to possess a specific capacitance (SC) of 321 F g{sup −1} when used in a 0.5 M Na{sub 2}SO{sub 4} solution as an electrolyte, in a scan rate of 2 mV s{sup −1}. The SC of the SmN-RGO based electrodes were also found to be 268 F g{sup −1} at a current density of 2 A g{sup −1} through galvanostatic charge-discharge tests. The outstanding properties of the SmN-RGOs were attributed to synergy of the high charge mobility of SmNs and the flexibility of the sheets of RGOs. Additionally, the nano-composite revealed a unique cycling durability (maintaining 99% of its SC even after 4000 cycles).

  10. 46 CFR 154.1435 - Medical first aid guide.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Medical first aid guide. 154.1435 Section 154.1435 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY... Equipment § 154.1435 Medical first aid guide. Each vessel must have a copy of the IMO Medical First Aid...

  11. 46 CFR 154.1150 - Distribution of dry chemical.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Distribution of dry chemical. 154.1150 Section 154.1150... Firefighting System: Dry Chemical § 154.1150 Distribution of dry chemical. (a) All locations on the above deck... chemical hand hose lines; or (2) At least one dry chemical hand hose line and one dry chemical monitor. (b...

  12. 46 CFR 154.560 - Cargo hose: Prototype test.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo hose: Prototype test. 154.560 Section 154.560... Hose § 154.560 Cargo hose: Prototype test. (a) Each cargo hose must be of a type that passes a prototype test at a pressure of at least five times its maximum working pressure at or below the minimum...

  13. 46 CFR 154.802 - Alternate pressure relief settings.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Alternate pressure relief settings. 154.802 Section 154... Equipment Cargo Vent Systems § 154.802 Alternate pressure relief settings. Cargo tanks with more than one relief valve setting must have one of the following arrangements: (a) Relief valves that: (1) Are set and...

  14. 46 CFR Appendix A to Part 154 - Equivalent Stress

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Equivalent Stress A Appendix A to Part 154 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Pt. 154, App. A Appendix A to Part 154...

  15. 46 CFR Appendix B to Part 154 - Stress Analyses Definitions

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Stress Analyses Definitions B Appendix B to Part 154 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Pt. 154, App. B Appendix B to Part 154...

  16. 46 CFR 154.1870 - Bow and stern loading.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Bow and stern loading. 154.1870 Section 154.1870... STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Operations § 154.1870 Bow and stern loading. (a) When the bow or stern loading piping is not in use, the master shall lock closed the shut-off...

  17. 21 CFR 133.154 - High-moisture jack cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false High-moisture jack cheese. 133.154 Section 133.154... FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.154 High-moisture jack cheese. High-moisture jack cheese conforms to...

  18. 46 CFR 154.412 - Cargo tank corrosion allowance.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo tank corrosion allowance. 154.412 Section 154.412... Containment Systems § 154.412 Cargo tank corrosion allowance. A cargo tank must be designed with a corrosion...) carries a cargo that corrodes the tank material. Note: Corrosion allowance for independent tank type C is...

  19. 46 CFR 154.180 - Contiguous hull structure: Welding procedure.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Contiguous hull structure: Welding procedure. 154.180 Section 154.180 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS... Equipment Hull Structure § 154.180 Contiguous hull structure: Welding procedure. Welding procedure tests for...

  20. 46 CFR 154.546 - Excess flow valve: Closing flow.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Excess flow valve: Closing flow. 154.546 Section 154.546... and Process Piping Systems § 154.546 Excess flow valve: Closing flow. (a) The rated closing flow of vapor or liquid cargo for an excess flow valve must be specially approved by the Commandant (CG-522). (b...

  1. 46 CFR 154.9 - Issuance of documents.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Issuance of documents. 154.9 Section 154.9 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES General § 154.9 Issuance of documents. The...

  2. 46 CFR 154.188 - Membrane tank: Inner hull steel.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Membrane tank: Inner hull steel. 154.188 Section 154.188... Structure § 154.188 Membrane tank: Inner hull steel. For a vessel with membrane tanks, the inner hull... “Rules for Building and Classing Steel Vessels”, 1981. ...

  3. 46 CFR 154.1340 - Temperature measuring devices.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Temperature measuring devices. 154.1340 Section 154.1340... STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Instrumentation § 154.1340 Temperature measuring devices. (a) Each cargo tank must have devices that measure the...

  4. 46 CFR 154.172 - Contiguous steel hull structure.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Contiguous steel hull structure. 154.172 Section 154.172... Structure § 154.172 Contiguous steel hull structure. (a) Except as allowed in paragraphs (b) and (c) of this... construction of the contiguous steel hull structure must meet the thickness and steel grade in Table 1 for the...

  5. 33 CFR 154.820 - Fire, explosion, and detonation protection.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Fire, explosion, and detonation protection. 154.820 Section 154.820 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... Systems § 154.820 Fire, explosion, and detonation protection. (a) A vapor control system with a single...

  6. 46 CFR 154.528 - Piping joints: Flange type.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Piping joints: Flange type. 154.528 Section 154.528 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY... and Process Piping Systems § 154.528 Piping joints: Flange type. (a) A flange must be one of the...

  7. 46 CFR 154.526 - Piping joints: Flange connection.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Piping joints: Flange connection. 154.526 Section 154... Equipment Cargo and Process Piping Systems § 154.526 Piping joints: Flange connection. Flange connections for pipe joints must meet § 56.30-10 and § 56.50-105 (a)(4) and (b)(4) of this chapter. ...

  8. 46 CFR 154.195 - Aluminum cargo tank: Steel enclosure.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Aluminum cargo tank: Steel enclosure. 154.195 Section 154.195 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS... Equipment Hull Structure § 154.195 Aluminum cargo tank: Steel enclosure. (a) An aluminum cargo tank and its...

  9. 46 CFR 154.514 - Piping: Electrical bonding.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Piping: Electrical bonding. 154.514 Section 154.514... and Process Piping Systems § 154.514 Piping: Electrical bonding. (a) Cargo tanks or piping that are... side. (c) An electrical bond must be made by at least one of the following methods: (1) A metal bonding...

  10. 46 CFR 154.1205 - Mechanical ventilation system: Standards.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Mechanical ventilation system: Standards. 154.1205... Equipment Cargo Area: Mechanical Ventilation System § 154.1205 Mechanical ventilation system: Standards. (a) Each exhaust type mechanical ventilation system required under § 154.1200 (a) must have ducts for...

  11. 46 CFR 154.1702 - Materials of construction.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Materials of construction. 154.1702 Section 154.1702... § 154.1702 Materials of construction. When Table 4 references one of the following paragraphs in this section, the materials in the referenced paragraph must not be in components that contact the cargo liquid...

  12. 46 CFR 154.1145 - Dry chemical supply.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Dry chemical supply. 154.1145 Section 154.1145 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SAFETY STANDARDS... Firefighting System: Dry Chemical § 154.1145 Dry chemical supply. (a) A vessel with a cargo carrying capacity...

  13. Effect of Current Density on Thermodynamic Properties of Nanocrystalline Palladium Capped Samarium Hydride Thin Film Switchable Mirrors

    Directory of Open Access Journals (Sweden)

    Pushpendra Kumar

    2007-01-01

    Full Text Available A 55 nm samarium film capped with a 10 nm palladium overlayer switched from a metallic reflecting to a semiconducting, transparent in visible state during ex-situ hydrogen loading via electrochemical means in 1 M KOH electrolytic aqueous solution at room temperature. The switching between metal to semiconductor was accompanied by measurement of transmittance during hydrogen loading/unloading. The effect of current density on switching and thermodynamic properties was studied between dihydride state (FCC phase and trihydride state (hexagonal phase. From the plateau of partial pressure of hydrogen at x=2.6, enthalpy of formation was calculated at different current densities. The diffusion coefficients and switching kinetics are shown to depend on applied current density.

  14. Sorption of samarium in soils: influence of soil properties and Sm concentration

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez-Guinart, Oriol; Salaberria, Aitor; Rigol, Anna; Vidal, Miquel [Analytical Chemistry department, Faculty of Chemistry, University of Barcelona, Marti i Franques 1-11, 08028, Barcelona (Spain)

    2014-07-01

    Due to the fact that barriers of Deep Geological Repositories (DGR) may lose efficiency before the radioisotopes present in the High Level Radioactive Waste (HLRW) completely decay, it is possible that, in the long-term, radioactive leachates may escape from the DGR and reach the soil and water compartments in the biosphere. Therefore, it is required to examine the interaction and mobility of radionuclides present in the HLRW, or their chemical analogues, to predict the impact of their eventual incorporation in the biosphere and to assess the derived risk. Although relevant data have been recently obtained for a few radionuclides in soils, there are still some important gaps for some radionuclides, such us for samarium (Sm). Sm is a lanthanide that, besides being considered as a natural analogue of actinides, may also be present in HLRW in the form of the radioactive isotope {sup 151}Sm. The main objective of this work was to obtain sorption data (K{sub d}) of {sup 151}Sm gathered from a set of soil samples physicochemical fully-characterized (pH, texture, cationic exchange capacity, soil solution cationic composition, organic matter, carbonate and metallic oxides content, etc.). Additionally, as an alternative for testing sorption capacity of radionuclides in soils is the use of the corresponding stable isotope or a chemical analogue, the influence of Sm concentration was also checked. To evaluate {sup 151}Sm sorption, batch assays were carried out for each soil sample, which consisted in a pre-equilibration step of 2 g of each soil with 50 ml of double deionised water, and a subsequent equilibration step with the same solution, but labelled with {sup 151}Sm. The activity of {sup 151}Sm in initial and final solutions was measured by liquid scintillation and K{sub d} ({sup 151}Sm) data were calculated. The reversibly sorbed fraction was estimated by the application of a single extraction test, with double deionised water, to soil residues coming from the previous

  15. Crystal growth of semiorganic complex- samarium chloride coordinated thiourea-L-tartaric acid and its studies on structure and optical characteristics

    Science.gov (United States)

    Slathia, Goldy; Singh, Harjinder; Ramya, E.; Rao, D. Narayana; Bamzai, K. K.

    2017-05-01

    The semi-organic complex of samarium chloride coordinated thiourea-L-tartaric acid (SCTLT) has been grown as a single crystal by slow evaporation technique at room temperature. For structural studies, the grown crystal was subjected to single crystal X-ray diffraction and Fourier transform infra-red (FTIR) spectroscopy. Low cut off wavelength and transparent characteristics were explored by UV-VIS optical characterization. Third-order nonlinear optical properties of grown crystal were investigated by Z-scan technique.

  16. 46 CFR 154.1854 - Methane (LNG) as fuel.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Methane (LNG) as fuel. 154.1854 Section 154.1854... fuel. (a) If methane (LNG) vapors are used as fuel in the main propulsion system of a vessel, the master shall ensure that the fuel oil fired pilot under § 154.705(c) is used when the vessel is on the...

  17. Sorption of samarium in iron (II) and (III) phosphates in aqueous systems; Sorcion de samario en fosfatos de hierro (II) y (III) en sistemas acuosos

    Energy Technology Data Exchange (ETDEWEB)

    Diaz F, J.C

    2006-07-01

    The radioactive residues that are stored in the radioactive confinements its need to stay isolated of the environment while the radioactivity levels be noxious. An important mechanism by which the radioactive residues can to reach the environment, it is the migration of these through the underground water. That it makes necessary the investigation of reactive materials that interacting with those radionuclides and that its are able to remove them from the watery resources. The synthesis and characterization of materials that can be useful in Environmental Chemistry are very important because its characteristics are exposed and its behavior in chemical phenomena as the sorption watery medium is necessary to use it in the environmental protection. In this work it was carried out the sorption study of the samarium III ion in the iron (II) and (III) phosphate; obtaining the sorption isotherms in function of pH, of the phosphate mass and of the concentration of the samarium ion using UV-visible spectroscopy to determine the removal percentage. The developed experiments show that as much the ferrous phosphate as the ferric phosphate present a great affinity by the samarium III, for what it use like reactive material in contention walls can be very viable because it sorption capacity has overcome 90% to pH values similar to those of the underground and also mentioning that the form to obtain these materials is very economic and simple. (Author)

  18. Trace amounts of rare earth elements in high purity samarium oxide by sector field inductively coupled plasma mass spectrometry after separation by HPLC

    Energy Technology Data Exchange (ETDEWEB)

    Pedreira, W.R. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil) and Fundacao Jorge Duprat Figueiredo de Seguranca e Medicina do Trabalho (FUNDACENTRO), 05409-002 Sao Paulo, SP (Brazil)]. E-mail: walter.pedreira@fundacentro.gov.br; Queiroz, C.A. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Abrao, A. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Rocha, S.M. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Vasconcellos, M.E. de [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Boaventura, G.R. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil); Pimentel, M.M. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil)

    2006-07-20

    Today there is an increasing need for high purity rare earth compounds in various fields, the optical, the electronics, the ceramic, the nuclear and geochemistry. Samarium oxide has special uses in glass, phosphors, lasers and thermoelectric devices. Calcium chloride crystals treated with samarium have been employed in lasers, which produce light beams intense enough to burn metal. In general, the inductively coupled plasma mass spectrometry (ICP-MS) presents some advantages for trace element analysis, due to high sensitivity and resolution, when compared with other analytical techniques such as ICP optical emission spectrometry (ICP-OES). In this work, sector field inductively coupled plasma mass spectrometry was used. Sixteen elements (Sc, Y and 14 lanthanides) were determined selectively with the ICP-MS system using a concentration gradient method. The detection limits with the ICP-MS system were about 0.2 (La) pg mL{sup -1} to 8 (Gd) pg mL{sup -1}. The %R.S.D. of the methods varying between 0.9 and 1.5% for a set of five (n = 5) replicates was found for the IPEN's material and for the certificate reference sample. Determination of trace REEs in two high pure samarium oxides samples (IPEN and JMC) was performed. IPEN's material is highly pure (>99.99%) and was successfully analyzed without spectral interference (MO{sup +} and MOH{sup +})

  19. Platelet-derived or soluble CD154 induces vascularized allograft rejection independent of cell-bound CD154

    OpenAIRE

    Xu, He; Zhang, Xiaojie; Mannon, Roslyn B.; Kirk, Allan D.

    2006-01-01

    CD154 is a cell surface molecule expressed on activated T cells that binds to CD40, an activating molecule on APCs. Its blockade has been shown to prevent allograft rejection, presumably by interrupting interactions between T cells and APCs. It is known that activated human platelets express and shed CD154 and can induce APC activation and other immune processes in vitro. Here we show that platelet-derived CD154 is sufficient to initiate cardiac allograft rejection independent of any cellular...

  20. The role of CD154 in haematopoietic development

    NARCIS (Netherlands)

    Seijkens, Tom; Engel, David; Tjwa, Marc; Lutgens, Esther

    2010-01-01

    CD154 (CD40 ligand, CD40L, gp139) is a co-stimulatory molecule of the tumour necrosis factor (TNF) family. CD154 was originally discovered on T-cells, and was found to be involved in many immune responses including B-cell activation, isotype switching, and germinal centre formation. The expression

  1. 42 CFR 483.154 - Nurse aide competency evaluation.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 5 2010-10-01 2010-10-01 false Nurse aide competency evaluation. 483.154 Section... Requirements That Must Be Met by States and State Agencies: Nurse Aide Training and Competency Evaluation, and Paid Feeding Assistants § 483.154 Nurse aide competency evaluation. (a) Notification to Individual. The...

  2. 76 FR 2726 - Withdrawal of Regulatory Guide 1.154

    Science.gov (United States)

    2011-01-14

    ... Regulatory Guide 1.154, ``Format and Content of Plant-Specific Pressurized Thermal Shock Safety Analysis... Regulatory Guide (RG) 1.154, ``Format and Content of Plant-Specific Pressurized Thermal Shock Safety Analysis... format and content acceptable to the NRC staff for plant-specific pressurized thermal shock (PTS) safety...

  3. 21 CFR 520.154 - Bacitracin oral dosage forms.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Bacitracin oral dosage forms. 520.154 Section 520...) ANIMAL DRUGS, FEEDS, AND RELATED PRODUCTS ORAL DOSAGE FORM NEW ANIMAL DRUGS § 520.154 Bacitracin oral dosage forms. ...

  4. 46 CFR 154.1808 - Limitations in the endorsement.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Limitations in the endorsement. 154.1808 Section 154... Limitations in the endorsement. No person may operate a vessel unless that person complies with all limitations in the endorsement on the vessel's Certificate of Inspection or Certificate of Compliance. ...

  5. 32 CFR Appendix G to Part 154 - [Reserved

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false G Appendix G to Part 154 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE SECURITY DEPARTMENT OF DEFENSE PERSONNEL SECURITY PROGRAM REGULATION Appendix G to Part 154 ...

  6. 46 CFR 154.1735 - Methyl acetylene-propadiene mixture.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Methyl acetylene-propadiene mixture. 154.1735 Section... CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Special Design and Operating Requirements § 154.1735 Methyl acetylene-propadiene mixture. (a) The composition of the methyl...

  7. 43 CFR 15.4 - Refuse and polluting substances.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Refuse and polluting substances. 15.4... § 15.4 Refuse and polluting substances. No person shall dump or deposit in or on the waters of this..., boxes, cans, dirt, rubbish, waste garbage, refuse or other debris or polluting substance. ...

  8. 49 CFR 572.154 - Thorax assembly and test procedure.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 7 2010-10-01 2010-10-01 false Thorax assembly and test procedure. 572.154... 12-Month-Old Infant, Alpha Version § 572.154 Thorax assembly and test procedure. (a) Thorax Assembly (refer to § 572.150(a)(1)(iv)) . The thorax consists of the part of the torso assembly shown in drawing...

  9. 33 CFR 154.810 - Vapor line connections.

    Science.gov (United States)

    2010-07-01

    ...) POLLUTION FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Vapor Control Systems § 154.810 Vapor... the OCIMF International Safety Guide for Oil Tankers and Terminals (incorporated by reference; see § 154.106). (h) A vapor collection system fitted with an enriching system that operates at a positive...

  10. 46 CFR 154.174 - Transverse contiguous hull structure.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Transverse contiguous hull structure. 154.174 Section... Equipment Hull Structure § 154.174 Transverse contiguous hull structure. (a) The transverse contiguous hull structure of a vessel having cargo containment systems without secondary barriers must meet the standards of...

  11. 46 CFR 154.176 - Longitudinal contiguous hull structure.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Longitudinal contiguous hull structure. 154.176 Section... Equipment Hull Structure § 154.176 Longitudinal contiguous hull structure. (a) The longitudinal contiguous hull structure of a vessel having cargo containment systems without secondary barriers must meet the...

  12. 46 CFR 154.1200 - Mechanical ventilation system: General.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Mechanical ventilation system: General. 154.1200 Section... Equipment Cargo Area: Mechanical Ventilation System § 154.1200 Mechanical ventilation system: General. (a... cargo handling equipment must have a fixed, exhaust-type mechanical ventilation system. (b) The...

  13. 33 CFR 154.530 - Small discharge containment.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Small discharge containment. 154.530 Section 154.530 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... serves one or more hoses of 6-inch inside diameter or smaller, or loading arms of 6-inch nominal pipe...

  14. 21 CFR 520.154a - Soluble bacitracin methylene disalicylate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Soluble bacitracin methylene disalicylate. 520.154a Section 520.154a Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN... Soluble bacitracin methylene disalicylate. (a) Specifications. Each pound of soluble powder contains the...

  15. 18 CFR 154.312 - Composition of Statements.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Composition of Statements. 154.312 Section 154.312 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY... this chapter) with subtotals by functional classifications, e.g., Intangible Plant, Manufactured Gas...

  16. 24 CFR 982.154 - ACC reserve account.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false ACC reserve account. 982.154... and PHA Administration of Program § 982.154 ACC reserve account. (a) HUD may establish and maintain an unfunded reserve account for the PHA program from available budget authority under the consolidated ACC...

  17. 29 CFR 1926.154 - Temporary heating devices.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 8 2010-07-01 2010-07-01 false Temporary heating devices. 1926.154 Section 1926.154 Labor... Temporary heating devices. (a) Ventilation. (1) Fresh air shall be supplied in sufficient quantities to... heating devices shall be installed to provide clearance to combustible material not less than the amount...

  18. CD154 Induces Matrix Metalloproteinase-9 Secretion in Human Podocytes.

    Science.gov (United States)

    Rigothier, Claire; Daculsi, Richard; Lepreux, Sébastien; Auguste, Patrick; Villeneuve, Julien; Dewitte, Antoine; Doudnikoff, Evelyne; Saleem, Moin; Bourget, Chantal; Combe, Christian; Ripoche, Jean

    2016-12-01

    Matrix remodeling is a key feature of glomerulosclerosis secondary to diabetes or hypertension. Podocytes contribute to glomerular basement membrane (GBM) turnover by producing matrix components and matrix remodelling enzymes, including matrix metalloproteinases (MMPs). The CD40/CD154 signaling pathway modulates matrix remodeling through the synthesis of MMPs and tissue inhibitors of MMPs. Platelets are a primary blood reservoir of CD154. Here we studied, the impact of the CD154/CD40 pathway on MMP-9 expression by cultured human podocytes. The role of CD40/CD154 was evaluated upon exposure of podocytes to recombinant human CD154 (rhCD154) or activated platelet supernatants from healthy human subjects. We first showed by protein and mRNA expression that CD40 was synthesized by podocytes and detectable on kidney tissue sections. CD40 expression was acquired during podocyte differentiation and enhanced upon exposure to rhCD154. In podocytes, rhCD154 induced an increase of MMP-9 production as shown by RT-PCR, Western blot and and gelatin zymography. Activated platelet supernatants induced MMP-9 mRNA synthesis in podocytes, an effect reduced by anti-CD40 antibody. Our results underscore a potential role for platelets through the CD40/CD154 signaling pathway in the control of GBM synthesis and degradation, via its regulatory role on MMP-9 production. CD154 secretion by activated platelets may contribute to GBM alterations in proteinuric nephropathies. J. Cell. Biochem. 117: 2737-2747, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  19. Effectiveness of radiation synovectomy with samarium-{sup 153} particulate hydroxyapatite in rheumatoid arthritis patients with knee synovitis: a controlled randomized double-blind trial

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Marla Francisca dos; Furtado, Rita Nely Vilar; Konai, Monique Sayuri; Natour, Jamil, E-mail: jnatour@unifesp.b [Universidade Federal de Sao Paulo (UNIFESP-EPM), Sao Paulo, SP (Brazil). Divisao de Reumatologia; Castiglioni, Mario Luiz Vieira; Marchetti, Renata Rosa [Universidade Federal de Sao Paulo (UNIFESP-EPM), Sao Paulo, SP (Brazil). Divisao de Medicina Nuclear

    2009-07-01

    Objectives: the aim of the present study was to investigate the effectiveness of Samarium{sup 153}-particulate hydroxyapatite radiation synovectomy in rheumatoid arthritis patients with chronic knee synovitis. Methods: fifty-eight rheumatoid arthritis patients (60 knees) with chronic knee synovitis participated in a controlled double-blinded trial. Patients were randomized to receive either an intra-articular injection with 40 mg triamcinolone hexacetonide alone (TH group) or 40 mg triamcinolone hexacetonide combined with 15 mCi Samarium{sup 153}-particulate hydroxyapatite (Sm/TH group). Blinded examination at baseline (T0) and at 1 (T1), 4 (T4), 12 (T12), 32 (T32), and 48 (T48) weeks post-intervention were performed on all patients and included a visual analog scale for joint pain and swelling as well as data on morning stiffness, flexion, extension, knee circumference, Likert scale of improvement, percentage of improvement, SF-36 generic quality of life questionnaire, Stanford Health Assessment Questionnaire (HAQ), Lequesne index, use of non-steroidal anti-inflammatory drugs or oral corticosteroids, events and adverse effects, calls to the physician, and hospital visits. Results: the sample was homogeneous at baseline, and there were no withdrawals. Improvement was observed in both groups in relation to T0, but no statistically significant differences between groups were observed regarding all variables at the time points studied. The Sm/TH group exhibited more adverse effects at T1 (p<0.05), but these were mild and transitory. No severe adverse effects were reported during follow-up. Conclusion: intra-articular injection of Samarium{sup 153}-particulate hydroxyapatite (15 mCi) with 40 mg of triamcinolone hexacetonide is not superior to triamcinolone hexacetonide alone for the treatment of knee synovitis in patients with rheumatoid arthritis at 1 y of follow-up. (author)

  20. The properties of samarium-doped zinc oxide/phthalocyanine structure for optoelectronics prepared by pulsed laser deposition and organic molecular evaporation

    Czech Academy of Sciences Publication Activity Database

    Novotný, Michal; Marešová, Eva; Fitl, Přemysl; Vlček, Jan; Bergmann, M.; Vondráček, Martin; Yatskiv, Roman; Bulíř, Jiří; Hubík, Pavel; Hruška, Petr; Drahokoupil, Jan; Abdellaoui, N.; Vrňata, M.; Lančok, Ján

    2016-01-01

    Roč. 122, č. 3 (2016), 1-8, č. článku 225. ISSN 0947-8396 R&D Projects: GA MŠk(CZ) LG15050; GA ČR(CZ) GAP108/11/0958; GA MŠk(CZ) LM2011029; GA ČR(CZ) GA14-10279S; GA MŠk(CZ) 7AMB14FR010 Institutional support: RVO:68378271 ; RVO:67985882 Keywords : samarium-doped zinc oxide zinc/phthalocyanine deposition * evaporation * pulsed laser deposition * thin films Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.455, year: 2016

  1. 46 CFR 154.1872 - Cargo emergency jettisoning.

    Science.gov (United States)

    2010-10-01

    ... jettisoning. (a) The master shall ensure that emergency jettisoning piping under § 154.356, except bow and stern loading and discharging piping, is only used when an emergency exists. (b) Emergency jettisoning...

  2. Neutron Activated Samarium-153 Microparticles for Transarterial Radioembolization of Liver Tumour with Post-Procedure Imaging Capabilities

    Science.gov (United States)

    Hashikin, Nurul Ab. Aziz; Yeong, Chai-Hong; Abdullah, Basri Johan Jeet; Ng, Kwan-Hoong; Chung, Lip-Yong; Dahalan, Rehir; Perkins, Alan Christopher

    2015-01-01

    Introduction Samarium-153 (153Sm) styrene divinylbenzene microparticles were developed as a surrogate for Yttrium-90 (90Y) microspheres in liver radioembolization therapy. Unlike the pure beta emitter 90Y, 153Sm possess both therapeutic beta and diagnostic gamma radiations, making it possible for post-procedure imaging following therapy. Methods The microparticles were prepared using commercially available cation exchange resin, Amberlite IR-120 H+ (620–830 μm), which were reduced to 20–40 μm via ball mill grinding and sieve separation. The microparticles were labelled with 152Sm via ion exchange process with 152SmCl3, prior to neutron activation to produce radioactive 153Sm through 152Sm(n,γ)153Sm reaction. Therapeutic activity of 3 GBq was referred based on the recommended activity used in 90Y-microspheres therapy. The samples were irradiated in 1.494 x 1012 n.cm-2.s-1 neutron flux for 6 h to achieve the nominal activity of 3.1 GBq.g-1. Physicochemical characterisation of the microparticles, gamma spectrometry, and in vitro radiolabelling studies were carried out to study the performance and stability of the microparticles. Results Fourier Transform Infrared (FTIR) spectroscopy of the Amberlite IR-120 resins showed unaffected functional groups, following size reduction of the beads. However, as shown by the electron microscope, the microparticles were irregular in shape. The radioactivity achieved after 6 h neutron activation was 3.104 ± 0.029 GBq. The specific activity per microparticle was 53.855 ± 0.503 Bq. Gamma spectrometry and elemental analysis showed no radioactive impurities in the samples. Radiolabelling efficiencies of 153Sm-Amberlite in distilled water and blood plasma over 48 h were excellent and higher than 95%. Conclusion The laboratory work revealed that the 153Sm-Amberlite microparticles demonstrated superior characteristics for potential use in hepatic radioembolization. PMID:26382059

  3. Preparation and examination of properties of samarium-153-EDTMP complex; Otrzymywanie chelatu kwasu etylenodiaminotetrametylenofosfonowego (EDTMP) z samarem-153 i badanie jego wlasciwosci

    Energy Technology Data Exchange (ETDEWEB)

    Nowak, M. [Institute of Atomic Energy, Otwock-Swierk (Poland); Garnuszek, P.; Lukasiewicz, A.; Wozniak, I.; Zulczyk, W. [Osrodek Badawczo-Rozwojowy Izotopow, Otwock-Swierk (Poland); Licinska, I. [Instytut Lekow, Warsaw (Poland)

    1995-12-31

    Preparation and properties of ethylenediaminetetramethylenephosphonic acid (EDTMP) as well as some properties of {sup 153}Sm-EDTMP chelate have been examined. The chelate formed by samarium-153 (46.3 h, {beta}{sup -}-decay) with EDTMP exhibits high bone uptake and can be used for treatment of disseminated, painful skeletal metastases. The purity and stability of solutions of {sup 153}Sm-EDTMP chelate were examined in a broad range of samarium concentration and {sup 153}Sm specific activity. The complex under study was examined by radio-TLC, -electrophoresis and radio-HPLC. The results obtained suggest the small size of molecules of {sup 153}Sm-EDTMP chelate as compared with molecules of ``free``EDTMP. The results of biodistribution of {sup 153}Sm-EDTMP determined in rats indicate the quick blood clearance, high deposition of radioactivity in bone and quick excretion of radioactivity into urine. No specific uptake of {sup 153}Sm-EDTMP in extra-skeletal organs was found. (author). 42 refs, 13 figs, 22 tabs.

  4. Reduced Lentivirus Susceptibility in Sheep with TMEM154 Mutations

    Science.gov (United States)

    Heaton, Michael P.; Clawson, Michael L.; Chitko-Mckown, Carol G.; Leymaster, Kreg A.; Smith, Timothy P. L.; Harhay, Gregory P.; White, Stephen N.; Herrmann-Hoesing, Lynn M.; Mousel, Michelle R.; Lewis, Gregory S.; Kalbfleisch, Theodore S.; Keen, James E.; Laegreid, William W.

    2012-01-01

    Visna/Maedi, or ovine progressive pneumonia (OPP) as it is known in the United States, is an incurable slow-acting disease of sheep caused by persistent lentivirus infection. This disease affects multiple tissues, including those of the respiratory and central nervous systems. Our aim was to identify ovine genetic risk factors for lentivirus infection. Sixty-nine matched pairs of infected cases and uninfected controls were identified among 736 naturally exposed sheep older than five years of age. These pairs were used in a genome-wide association study with 50,614 markers. A single SNP was identified in the ovine transmembrane protein (TMEM154) that exceeded genome-wide significance (unadjusted p-value 3×10−9). Sanger sequencing of the ovine TMEM154 coding region identified six missense and two frameshift deletion mutations in the predicted signal peptide and extracellular domain. Two TMEM154 haplotypes encoding glutamate (E) at position 35 were associated with infection while a third haplotype with lysine (K) at position 35 was not. Haplotypes encoding full-length E35 isoforms were analyzed together as genetic risk factors in a multi-breed, matched case-control design, with 61 pairs of 4-year-old ewes. The odds of infection for ewes with one copy of a full-length TMEM154 E35 allele were 28 times greater than the odds for those without (p-valuesheep from Nebraska, Idaho, and Iowa, the relative risk of infection was 2.85 times greater for sheep with a full-length TMEM154 E35 allele (p-valuesheep were homozygous for TMEM154 deletion mutations and remained uninfected despite a lifetime of significant exposure. Together, these findings indicate that TMEM154 may play a central role in ovine lentivirus infection and removing sheep with the most susceptible genotypes may help eradicate OPP and protect flocks from reinfection. PMID:22291605

  5. Posttranscriptional Regulation in Lymphocytes: The case of CD154

    Science.gov (United States)

    Vavassori, Stefano; Covey, Lori R.

    2010-01-01

    The control of mRNA decay is emerging as an important control point and a major contributor to gene expression in both immune and non-immune cells. The identification of protein factors and cis-acting elements responsible for transcript degradation has illuminated a comprehensive picture of precisely orchestrated events required to both regulate and establish the decay process. One gene that is highly regulated at the posttranscriptional level is CD40 ligand (CD154 or CD40L). CD154 on CD4+ T cells is tightly controlled by an interacting network of transcriptional and posttranscriptional processes that result in precise surface levels of protein throughout an extended time course of antigen stimulation. The activation-induced stabilization of the CD154 transcript by a polypyrimidine tract-binding protein (PTB)-complex is a key event that corresponds to the temporal expression of CD154. In this review, we discuss known and potential roles of major mRNA decay pathways in lymphocytes and focus on the unique posttranscriptional mechanisms leading to CD154 expression by activated CD4+ T cells. PMID:19395873

  6. CD154: the atherosclerotic risk factor in rheumatoid arthritis?

    Science.gov (United States)

    2013-01-01

    Atherosclerosis, now regarded as a chronic inflammatory disease of the arterial wall, and its clinical manifestations have increasingly been associated with rheumatoid arthritis (RA), supporting the notion that autoimmune diseases and vascular disorders share common etiological features. Indeed, evidence pertaining to this matter indicates that inflammation and its multiple components are the driving force behind the pathogenesis of these disorders. Interestingly, CD154 and its receptors have emerged as major players in the development of RA and atherosclerosis, which raises the possibility that this axis may represent an important biological link between both complications. Indeed, CD154 signaling elicits critical inflammatory responses that are common to the pathogenesis of both diseases. Here, we provide an overview of the traditional and disease-related interrelations between RA and vascular abnormalities, while focusing on CD154 as a potential mediator in the development of atherosclerotic events in RA patients. PMID:23433179

  7. Requirement of Transmembrane Domain for CD154 Association to Lipid Rafts and Subsequent Biological Events

    Science.gov (United States)

    Benslimane, Nadir; Hassan, Ghada S.; Yacoub, Daniel; Mourad, Walid

    2012-01-01

    Interaction of CD40 with CD154 leads to recruitment of both molecules into lipid rafts, resulting in bi-directional cell activation. The precise mechanism by which CD154 is translocated into lipid rafts and its impact on CD154 signaling remain largely unknown. Our aim is to identify the domain of CD154 facilitating its association to lipid rafts and the impact of such association on signaling events and cytokine production. Thus, we generated Jurkat cell lines expressing truncated CD154 lacking the cytoplasmic domain or chimeric CD154 in which the transmembrane domain was replaced by that of transferrin receptor I, known to be excluded from lipid rafts. Our results show that cell stimulation with soluble CD40 leads to the association of CD154 wild-type and CD154-truncated, but not CD154-chimera, with lipid rafts. This is correlated with failure of CD154-chimera to activate Akt and p38 MAP kinases, known effectors of CD154 signaling. We also found that CD154-chimera lost the ability to promote IL-2 production upon T cell stimulation with anti-CD3/CD28 and soluble CD40. These results demonstrate the implication of the transmembrane domain of CD154 in lipid raft association, and that this association is necessary for CD154-mediated Akt and p38 activation with consequent enhancement of IL-2 production. PMID:22905203

  8. Requirement of transmembrane domain for CD154 association to lipid rafts and subsequent biological events.

    Directory of Open Access Journals (Sweden)

    Nadir Benslimane

    Full Text Available Interaction of CD40 with CD154 leads to recruitment of both molecules into lipid rafts, resulting in bi-directional cell activation. The precise mechanism by which CD154 is translocated into lipid rafts and its impact on CD154 signaling remain largely unknown. Our aim is to identify the domain of CD154 facilitating its association to lipid rafts and the impact of such association on signaling events and cytokine production. Thus, we generated Jurkat cell lines expressing truncated CD154 lacking the cytoplasmic domain or chimeric CD154 in which the transmembrane domain was replaced by that of transferrin receptor I, known to be excluded from lipid rafts. Our results show that cell stimulation with soluble CD40 leads to the association of CD154 wild-type and CD154-truncated, but not CD154-chimera, with lipid rafts. This is correlated with failure of CD154-chimera to activate Akt and p38 MAP kinases, known effectors of CD154 signaling. We also found that CD154-chimera lost the ability to promote IL-2 production upon T cell stimulation with anti-CD3/CD28 and soluble CD40. These results demonstrate the implication of the transmembrane domain of CD154 in lipid raft association, and that this association is necessary for CD154-mediated Akt and p38 activation with consequent enhancement of IL-2 production.

  9. Enfoque terapéutico en 154 pacientes con acromegalia Therapeutic management in 154 acromegalic patients

    Directory of Open Access Journals (Sweden)

    Marcos P. Manavela

    2010-08-01

    Full Text Available La acromegalia es una enfermedad poco frecuente producida en más del 95% de los casos por un tumor hipofisario secretor de hormona de crecimiento (GH. Las manifestaciones clínicas están asociadas a síntomas locales por crecimiento del tumor o a las consecuencias orgánicas y metabólicas secundarias a la hipersecreción de GH. Debido a la alta morbilidad y mortalidad asociadas a la acromegalia, un tratamiento individualizado y optimizado para cada paciente es fundamental. Informamos el enfoque terapéutico de nuestro servicio de endocrinología en la atención de 154 pacientes con acromegalia. Utilizando criterios bioquímicos estrictos, con la cirugía logramos un 32% de remisión global, tasa relativamente baja debido fundamentalmente a que la mayor parte de los pacientes presentaban macroadenomas con un alto porcentaje de invasividad local. Con radioterapia complementaria o como tratamiento inicial se logró la remisión en el 65.4% de los pacientes irradiados. El 14.0% de los pacientes controlaron la enfermedad utilizando agonistas dopaminérgicos solos o combinados con otra droga, mientras que aquellos que utilizaron análogos de la somatostatina normalizaron los parámetros bioquímicos en un 45.7% de los casos. En conclusión, con los diferentes tratamientos utilizados obtuvimos el control de la acromegalia en el 55.2% de los casos, esperando optimizar el tratamiento de estos pacientes en la medida en que contemos con y tengamos acceso a nuevas herramientas terapéuticas.Acromegaly is a chronic, invalidating disease due in over 95% of cases to a growth hormone (GH secreting pituitary adenoma. Its clinical manifestations are associated to local complications related to the tumor growth and/or to the metabolic consequences of GH excess. We report here our experience on 154 acromegalic patients. Surgical remission rate using stringent biochemical criteria was 32%, a figure relatively low due to the great number of patients bearing

  10. Phenotype abnormality: 154 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 154 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u660i decreased efficiency...ent of blue light regimen http://metadb.riken.jp/db/SciNetS_ria224i/cria224u2ria224u29i root ... decreased efficiency ...

  11. Requirement for CD154 in the progression of atherosclerosis

    NARCIS (Netherlands)

    Lutgens, E.; Gorelik, L.; Daemen, M. J.; de Muinck, E. D.; Grewal, I. S.; Koteliansky, V. E.; Flavell, R. A.

    1999-01-01

    Atherosclerosis is a systemic disease of the large arteries, and activation of inflammatory pathways is important in its pathogenesis. Increasing evidence supports the importance of CD40-CD154 interactions in atherosclerosis, interactions originally known to be essential in major immune reactions

  12. 46 CFR 154.438 - Design vapor pressure.

    Science.gov (United States)

    2010-10-01

    ... Independent Tank Type A § 154.438 Design vapor pressure. (a) If the surface of an independent tank type A are mostly flat surfaces,the Po must not exceed 69 kPa gauge (10 psig). (b) If the surfaces of an independent tank type A are formed by bodies of revolution, the design calculation of the Po must be specially...

  13. 32 CFR 154.42 - Evaluation of personnel security information.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Evaluation of personnel security information... SECURITY DEPARTMENT OF DEFENSE PERSONNEL SECURITY PROGRAM REGULATION Adjudication § 154.42 Evaluation of personnel security information. (a) The criteria and adjudicative policy to be used in applying the...

  14. 32 CFR 154.15 - Military appointment, enlistment, and induction.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Military appointment, enlistment, and induction... Requirements § 154.15 Military appointment, enlistment, and induction. (a) General. The appointment, enlistment, and induction of each member of the Armed Forces or their Reserve Components shall be subject to the...

  15. 29__154 -158_ _Galadanci_ANALYSIS OF AURORAL

    African Journals Online (AJOL)

    User

    Bayero Journal of Pure and Applied Sciences, 9(2): 154 - 158. Received: April, 2016. Accepted: August, 2016 ... 1Department of Physics, Bayero University, Kano. NIGERIA. 2Department of Mathematical Sciences, Bayero ... first described by a Japanese geophysicist named. Syun-IchiAkasofu in 1964 (Sarris and Li, 2005).

  16. 27 CFR 44.154 - Claim for refund of tax.

    Science.gov (United States)

    2010-04-01

    ..., WITHOUT PAYMENT OF TAX, OR WITH DRAWBACK OF TAX Operations by Export Warehouse Proprietors Claims § 44.154... refunded (without interest) to an export warehouse proprietor on proof satisfactory to the appropriate TTB... ownership of such export warehouse proprietor, or withdrawn by him from the market. Any claim for refund...

  17. 21 CFR 146.154 - Concentrated orange juice with preservative.

    Science.gov (United States)

    2010-04-01

    ... Canned Fruit Juices and Beverages § 146.154 Concentrated orange juice with preservative. (a) Concentrated... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Concentrated orange juice with preservative. 146... ingredients prescribed for concentrated orange juice for manufacturing by § 146.153, except that a...

  18. 154.pdf | 25jan2011 | currsci | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; currsci; 25jan2011; 154.pdf. 404! error. The page your are looking for can not be found! Please check the link or use the navigation bar at the top. YouTube · Twitter · Facebook · Blog. Academy News. IAS Logo. Ethical Guidelines and Procedures document. Posted on 17 January 2017. A revised version of the ...

  19. 46 CFR 154.1350 - Flammable gas detection system.

    Science.gov (United States)

    2010-10-01

    ... compressor room; (3) Each motor room for cargo handling machinery; (4) Each cargo control station that is not... the space where the gas detection system's readout is located and must meet § 154.1365. (h) Remote... away from all ignition sources. (o) Each flammable gas detection system must not have common sampling...

  20. 33 CFR 154.1125 - Additional response plan requirements.

    Science.gov (United States)

    2010-07-01

    ...) for exercises that test either the entire appendix or individual components(s). (3) Testing... Prince William Sound, Alaska § 154.1125 Additional response plan requirements. (a) The owner or operator of a TAPAA facility shall include the following information in the Prince William Sound appendix to...

  1. 18 CFR 154.401 - RD&D expenditures.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false RD&D expenditures. 154....401 RD&D expenditures. (a) Requirements. Upon approval by the Commission, a natural gas company may file to recover research, development, and demonstration (RD&D) expenditures in its rates under this...

  2. 20 CFR 655.154 - Additional positive recruitment.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Additional positive recruitment. 655.154... recruitment. (a) Where to conduct additional positive recruitment. The employer must conduct positive recruitment within a multistate region of traditional or expected labor supply where the CO finds that there...

  3. 33 CFR 154.545 - Discharge containment equipment.

    Science.gov (United States)

    2010-07-01

    ... (CONTINUED) POLLUTION FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Equipment Requirements § 154... chapter may be utilized in the planning requirements of subpart F and subpart H of this part. ... material and equipment to contain any oil or hazardous material discharged on the water from operations at...

  4. 33 CFR 154.1210 - Purpose and applicability.

    Science.gov (United States)

    2010-07-01

    ... planning requirements for an owner or operator of a facility that handles, stores, or transports animal... (CONTINUED) POLLUTION FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Response Plans for Animal Fats and Vegetable Oils Facilities § 154.1210 Purpose and applicability. (a) The requirements of this...

  5. 33 CFR 154.1110 - Purpose and applicability.

    Science.gov (United States)

    2010-07-01

    ... (CONTINUED) POLLUTION FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Additional Response Plan Requirements for a Trans-Alaska Pipeline Authorization Act (TAPAA) Facility Operating in Prince William Sound, Alaska § 154.1110 Purpose and applicability. (a) This subpart establishes oil spill response planning...

  6. Formation of a new adduct based on fullerene tris-malonate samarium salt C60-[C60(=C(COO)2)3]Sm2

    Science.gov (United States)

    Petrov, A. A.; Keskinov, V. A.; Semenov, K. N.; Charykov, N. A.; Letenko, D. G.; Nikitin, V. A.

    2017-03-01

    Gram quantities of a new adduct based on light fullerene tris-malonate samarium salt C60 [C60(=C(COO)2)3]Sm2 are obtained via the reaction of ion exchange. The obtained adduct is studied by means of electron and infrared spectroscopy, X-ray and elemental analysis, electron microscopy, and thermogravimetry. The polythermal solubility of [C60(=C(COO)2)3]Sm2 in water is determined in ampoules via saturation within 20-70°C. The composition of crystalline hydrate [C60(=C(COO)2)3]Sm2 · 36H2O, which exists in equilibrium with the saturated solution, is estimated.

  7. Biodistribution of samarium-153-EDTMP in rats treated with docetaxel Biodistribuição de EDTMP-153-samário em ratos tratados com docetaxel

    Directory of Open Access Journals (Sweden)

    Arthur Villarim Neto

    2009-02-01

    Full Text Available PURPOSE: Many patients with metastatic bone disease have to use radiopharmaceuticals associated with chemotherapy to relieve bone pain. The aim of this study was to assess the influence of docetaxel on the biodistribution of samarium-153-EDTMP in bones and other organs of rats. METHODS: Wistar male rats were randomly allocated into 2 groups of 6 rats each. The DS (docetaxel/samarium group received docetaxel (15 mg/kg intraperitoneally in two cycles 11 days apart. The S (samarium/control group rats were not treated with docetaxel. Nine days after chemotherapy, all the rats were injected with 0.1ml of samarium-153-EDTMP via orbital plexus (25µCi. After 2 hours, the animals were killed and samples of the brain, thyroid, lung, heart, stomach, colon, liver, kidney and both femurs were removed. The percentage radioactivity of each sample (% ATI/g was determined in an automatic gamma-counter (Wizard-1470, Perkin-Elmer, Finland. RESULTS: On the 9th day after the administration of the 2nd chemotherapy cycle, the rats had a significant weight loss (314.50±22.09g compared (pOBJETIVO: Muitos pacientes com metástases ósseas são tratados com radiofármacos associados com quimioterapia para alívio da dor óssea. O objetivo do trabalho foi estudar a influência do docetaxel na biodistribuição do EDTMP-153-samário nos ossos e outros órgãos de ratos. MÉTODOS: Ratos Wistar foram aleatoriamente alocados em 2 grupos de 6 animais cada. O grupo DS (docetaxel/samário recebeu docetaxel (15 mg/kg intraperitoneal em dois ciclos com 11 dias de intervalo. Os ratos do grupo S (samário/controle não foram tratados com docetaxel. Nove dias após a quimioterapia, todos os animais receberam 0,1ml de EDTMP-153-samário via plexo orbital (25µCi. Após 2 horas, os animais foram mortos e feitas biópsias de cérebro, tireóide, pulmão, coração, estômago, cólon, fígado, rim e fêmures. O percentual de radioatividade por grama (%ATI/g de tecido de cada bi

  8. Immunotargeting with CD154 (CD40 Ligand) Enhances DNA Vaccine Responses in Ducks

    OpenAIRE

    Sheryl L. Gares; Karl P Fischer; Congly, Stephen E.; Lacoste, Stacey; Addison, William R.; Tyrrell, D Lorne; Gutfreund, Klaus S.

    2006-01-01

    Engagement of CD154 on activated T cells with CD40 on antigen-presenting cells (APCs) potentiates adaptive immune responses in mammals. Soluble multimeric forms of CD154 have been used as an adjuvant or in immunotargeting strategies to enhance vaccine responses. The objective of our study was to examine the ability of duck CD154 (DuCD154) to enhance DNA vaccine responses in the duck hepatitis B model. Constructs were generated to express the functional domain of DuCD154 (tCD154), truncated du...

  9. Counteractive functions are encrypted in the residues of CD154.

    Science.gov (United States)

    Bandyopadhyay, Syamdas; Chandel, Himanshu Singh; Singh, Shailza; Roy, Somenath; Krishnasastry, M V; Saha, Bhaskar

    2015-09-01

    CD40, as a single receptor that binds CD154 (CD40-ligand or CD40L), regulates counteractive effector functions such as production of pro- and anti-inflammatory cytokines. Therefore, we examined whether such dual messages are encrypted in CD40L. As such message encryption was never investigated, we hypothesized that mutation of certain amino acid residues should in principle enhance pro-inflammatory cytokine production whereas mutation of some others would enhance anti-inflammatory cytokine secretion. We mutated six such residues, which were previously showed to participate in CD40L function. Here, we report that the mutant CD154 129E→V was superior to the wild-type CD154 in killing of Leishmania donovani, induction of inducible nitric oxide synthase (iNOS) and production of IL-12 and relative phosphorylation of p38MAPK and ERK-1/2 in PBMC-derived macrophages. By contrast, 128S→V promoted L. donovani survival, reducing iNOS, but increasing IL-10 expression and predominant ERK-1/2 phosphorylation. The mutant 144G→V did not have significant effects. Other mutants (142E→V, 143K→A, 145Y→F) mimicked the wild-type CD154. Molecular dynamics simulation suggested that these mutations induced differential conformational changes in the CD40-CD154 complex. Therefore, assortment of the contrasting messages encrypted in a given ligand performing counteractive functions presents a novel fundamental biological principle that can be used for devising various therapies. Copyright © 2015. Published by Elsevier Inc.

  10. Marrow irradiation with high-dose 153Samarium-EDTMP followed by chemotherapy and hematopoietic stem cell infusion for acute myelogenous leukemia.

    Science.gov (United States)

    Rodriguez, Vilmarie; Anderson, Peter M; Litzow, Mark R; Erlandson, Linda; Trotz, Barbara A; Arndt, Carola A S; Khan, Shakila P; Wiseman, Gregory A

    2006-08-01

    In four patients, aged 15 - 20 years, with high-risk acute myeloid leukemia (AML), high-dose samarium 153-labelled ethylenediaminetetramethylenephosphonate (153Sm-EDTMP) was used for targeted marrow irradiation before preparative chemotherapy conditioning regimens and allogeneic (three patients) or autologous (one patient) hematopoietic stem cell transplantation. The dose of 153Sm-EDTMP was 703 MBq/kg (n = 1) or 1110 MBq/kg (n = 3). No side-effects occurred during the 30-min infusion of 153Sm-EDTMP. Samarium - melphalan regimens were given to three patients; one had 153Sm-EDTMP - busulfan + cyclophosphamide. Total body radioactivity was below the 133 MBq safe limit before infusion of stem cells (day 14 after 153Sm-EDTMP). No hemorrhagic cystitis, nephrotoxicity or serious infections occurred. Leukocyte engraftment (white blood cell count >0.5 x 10(9)/l) occurred between 12 and 23 days after stem cell infusion (mean of 17 days). Complete cytogenetic and morphologic remission of AML was evident on follow-up marrow aspirate and biopsy specimens from all patients. In two of the four study patients, the disease remains in complete remission and the patients have an excellent quality of life (Eastern Cooperative Oncology Group performance status 0; no medications) and no organ toxicity more than 2 years and more than 4 years, respectively, after their blood and bone marrow transplantations. Thus, in adolescents and adults, 153Sm-EDTMP may provide a relatively simple and effective means for using irradiation to eliminate AML within the marrow.

  11. 46 CFR 154.1836 - Vapor venting as a means of cargo tank pressure and temperature control.

    Science.gov (United States)

    2010-10-01

    ... LIQUEFIED GASES Operations § 154.1836 Vapor venting as a means of cargo tank pressure and temperature... temperature control. 154.1836 Section 154.1836 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... cargo pressure and temperature control system under §§ 154.701 through 154.709 is operating and that...

  12. Immunotargeting with CD154 (CD40 ligand) enhances DNA vaccine responses in ducks.

    Science.gov (United States)

    Gares, Sheryl L; Fischer, Karl P; Congly, Stephen E; Lacoste, Stacey; Addison, William R; Tyrrell, D Lorne; Gutfreund, Klaus S

    2006-08-01

    Engagement of CD154 on activated T cells with CD40 on antigen-presenting cells (APCs) potentiates adaptive immune responses in mammals. Soluble multimeric forms of CD154 have been used as an adjuvant or in immunotargeting strategies to enhance vaccine responses. The objective of our study was to examine the ability of duck CD154 (DuCD154) to enhance DNA vaccine responses in the duck hepatitis B model. Constructs were generated to express the functional domain of DuCD154 (tCD154), truncated duck hepatitis B virus (DHBV) core antigen (tcore) and chimera of tcore fused to tCD154 (tcore-tCD154). Expression in LMH cells demonstrated that all proteins were secreted and that tCD154 and tcore-tCD154 formed multimers. Ducks immunized with the plasmid ptcore-tCD154 developed accelerated and enhanced core-specific antibody responses compared to ducks immunized with ptcore or ptcore plus ptCD154. Antibody responses were better sustained in both ptcore-tCD154- and ptcore plus ptCD154-immunized ducks. Core-specific proliferative responses of duck peripheral blood mononuclear cells were enhanced in ducks immunized with ptcore-tCD154 or ptcore alone. This study suggests that the role of CD154 in the regulation of adaptive immune responses had already evolved before the divergence of birds and mammals. Thus, targeting of antigens to APCs with CD154 is an effective strategy to enhance DNA vaccine responses not only in mammalian species but also in avian species.

  13. Platelet-derived CD154: ultrastructural localization and clinical correlation in organ transplantation

    OpenAIRE

    Ali H. Charafeddine; Kim, Eugenia J.; Maynard, Dawn M.; Yi, Hong; Weaver, Timothy A; Gunay-Aygun, Meral; Russell, Maria; Gahl, William A.; Kirk, Allan D.

    2012-01-01

    CD154 is an immunostimulatory ligand for CD40 that markedly influences alloimmunity. Its presence in platelets suggests that its release and subsequent immune effects are driven by trauma and thus could be relevant following organ transplantation. However, the release of platelet derived CD154 and its consequences have not been investigated in a clinical transplant setting. To better characterize the relationship between platelet activation and CD154 release, we investigated CD154 release by ...

  14. Requirement of Transmembrane Domain for CD154 Association to Lipid Rafts and Subsequent Biological Events

    OpenAIRE

    Benslimane, Nadir,; Hassan, Ghada,; Yacoub, Daniel; Mourad, Walid,

    2012-01-01

    International audience; Interaction of CD40 with CD154 leads to recruitment of both molecules into lipid rafts, resulting in bi-directional cell activation. The precise mechanism by which CD154 is translocated into lipid rafts and its impact on CD154 signaling remain largely unknown. Our aim is to identify the domain of CD154 facilitating its association to lipid rafts and the impact of such association on signaling events and cytokine production. Thus, we generated Jurkat cell lines expressi...

  15. Synthesis of samarium complexes with the derivative binder of Schiff Quinolinic base. Characterization and photophysical study; Sintesis de complejos de samario con el ligante derivado de base de Schiff Quinolinica. Caracterizacion y estudio fotofisico

    Energy Technology Data Exchange (ETDEWEB)

    Lucas H, J.

    2016-07-01

    In this work we determined the metal: binder stoichiometry of the species formed during the UV/Vis spectrophotometric titration of the derivative binder of Schiff quinolinic base, L1 with the samarium nitrate pentahydrate in methanol. Statistical analysis of the data allowed proposing the metal: binder stoichiometry for the synthesis of the complexes which was one mole of samarium salt by 2.5 moles of binder and thus favor the formation of complexes with 1M: 1L and 1M: 2L stoichiometries. They were synthesized in aqueous-organic medium (water-ethanol), isolated and purified two complexes with stoichiometry 1 Sm: 1 L1, complex 1 and 1 Sm: 2 L1, complex 2. The overall yield of the reaction was 76%. The characterization of the formed complexes was performed by visible ultraviolet spectrometry (UV/Vis), nuclear magnetic resonance, X-ray photoelectron spectroscopy (XP S), thermal gravimetric analysis with differential scanning calorimetry (TGA/DSC), and radial distribution function. These complexes were studied by fluorescence and emission phosphorescence at variable temperature. Spectroscopic techniques used in both solution and solid demonstrated the formation and stability of these complexes. In addition XP S indicated that in both complexes the samarium retains its oxidation state 3+. Luminescence studies indicated that there is intra-binding charge transfer which decreases the transfer of light energy from the binder to the samarium. Based on the experimental results, L1 binder molecules and complexes 1 and 2 were modeled that demonstrated the proposed Nc for each complex, as well as allowed to visualize the structural arrangement of the molecules, complexes and binder. (Author)

  16. 46 CFR 154.1015 - Lighting in gas-dangerous space.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Lighting in gas-dangerous space. 154.1015 Section 154... Equipment Electrical § 154.1015 Lighting in gas-dangerous space. (a) Each gas-dangerous space that has... protective device for any lighting circuit that is in a gas-dangerous space must open each conductor of the...

  17. 46 CFR 154.706 - Cargo boil-off as fuel: Fuel lines.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo boil-off as fuel: Fuel lines. 154.706 Section 154... Equipment Cargo Pressure and Temperature Control § 154.706 Cargo boil-off as fuel: Fuel lines. (a) Gas fuel lines must not pass through accommodation, service, or control spaces. Each gas fuel line passing...

  18. 29 CFR 780.154 - Delivery “to market.”

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false Delivery âto market.â 780.154 Section 780.154 Labor... of Agriculture Specified Delivery Operations § 780.154 Delivery “to market.” The term “delivery * * * to market” includes taking agricultural or horticultural commodities, dairy products, livestock, bees...

  19. 46 CFR 154.300 - Segregation of hold spaces from other spaces.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Segregation of hold spaces from other spaces. 154.300 Section 154.300 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS... Equipment Ship Arrangements § 154.300 Segregation of hold spaces from other spaces. Hold spaces must be...

  20. 46 CFR 154.305 - Segregation of hold spaces from the sea.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Segregation of hold spaces from the sea. 154.305 Section 154.305 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS... Equipment Ship Arrangements § 154.305 Segregation of hold spaces from the sea. In vessels having cargo...

  1. 37 CFR 1.54 - Parts of application to be filed together; filing receipt.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Parts of application to be filed together; filing receipt. 1.54 Section 1.54 Patents, Trademarks, and Copyrights UNITED STATES... Processing Provisions The Application § 1.54 Parts of application to be filed together; filing receipt. (a...

  2. M1 spin strength distribution in [sup 154]Sm

    Energy Technology Data Exchange (ETDEWEB)

    Sarriguren, P.; Guerra, E.M. de (Consejo Superior de Investigaciones Cientificas, Madrid (Spain). Inst. Estructura de la Materia); Nojarov, R.; Faessler, Amand (Tuebingen Univ. (Germany). Inst. fuer Theoretische Physik)

    1993-02-01

    The effect of the residual spin-spin interaction on the M1 spin-flip strength distribution in [sup 154]Sm is studied within the quasi-particle random phase approximation. The double-peaked structure found experimentally is reproduced. A new interpretation for the origin of the two peaks emerges from an analysis of our results. We identify these peaks as isoscalar and isovector and discuss previous theoretical interpretations. (Author).

  3. IL-15 prolongs CD154 expression on human CD4 T cells via STAT5 binding to the CD154 transcriptional promoter

    OpenAIRE

    Lowe, RM; Genin, A; Orgun, N; Cron, RQ

    2014-01-01

    Activation induced CD154 expression on CD4 T cells is prolonged in systemic lupus erythematosus but the mechanism(s) for its dysregulation are unknown. The studies reported herein demonstrate that IL-15 is capable of prolonging CD154 expression on PHA activated CD4 T cells. Since IL-15 signals through STAT5, predicted STAT5 binding sites in the human CD154 transcriptional promoter were identified, and STAT5 binding to the proximal CD154 promoter in vitro and in vivo following primary CD4 T ce...

  4. Identification and characterization of functional CD154 (CD40 ligand) in the Pekin duck.

    Science.gov (United States)

    Fischer, Karl P; Gares, Sheryl L; Wang, Dakun; Lorne Tyrrell, D; Gutfreund, Klaus S

    2007-01-01

    Binding of CD154, a member of the TNF ligand superfamily, to its receptor CD40 is essential for the development and regulation of adaptive immune responses in mammals. The duck CD154 (DuCD154) encoding gene was isolated from activated splenocytes using RT-PCR. Sequence analysis of the cloned DuCD154 gene revealed an open reading frame of 819 base pairs encoding a 272 amino acid protein. The extracellular domain of DuCD154 was identified and expressed for characterization and generation of antibodies. DuCD154 mRNA was predominantly expressed in spleen, thymus and duodenum. DuCD154 protein generated in cell culture was secreted and formed dimers. DuCD154 markedly enhanced proliferative responses in duck splenocytes when used alone or in conjunction with LPS or PHA. These observations suggest that DuCD154 has functional equivalence with mammalian CD154 and that the central role of CD154 as an immunoregulatory protein had already evolved before the divergence of birds and mammals.

  5. Interaction of CD154 with different receptors and its role in bidirectional signals.

    Science.gov (United States)

    Alturaihi, Haydar; Hassan, Ghada S; Al-Zoobi, Loubna; Salti, Suzanne; Darif, Youssef; Yacoub, Daniel; El Akoum, Souhad; Oudghiri, Mounia; Merhi, Yahye; Mourad, Walid

    2015-02-01

    In addition to its classical receptor, CD40, it is now well established that CD154 also binds αIIbβ3, α5β1, and αMβ2 integrins. Although these integrins are all members of the same family, they bind CD154 differently. The current investigation aims to analyze the interaction of CD154 with α5β1 and αMβ2 and investigate its role in bidirectional signals in various human cell lines. Results obtained herein indicate that the CD154 residues involved in the interaction with α5β1 are N151 and Q166, whereas those involved in αMβ2 binding are common to residues required for CD40, namely Y145 and R203. Soluble CD40/CD154 or αMβ2/CD154 complexes do not interfere with the binding of CD154 to α5β1-positive cells, but inhibit the binding of CD154 to CD40- or αMβ2-positive cells, respectively. Ligation of CD154 on CD154-positive cells with soluble CD40, αIIbβ3, α5β1, or αMβ2 stimulates intracellular signaling, including MAPK phosphorylation. Given that CD154 exists as a trimer, our data strongly suggest that CD154 may bind concomitantly to two receptors of the same or different family, and biologically activate cells expressing both receptors. The characterization of CD154/receptor interactions helps the identification of new therapeutic targets for the prevention and/or treatment of CD154-associated autoimmune and inflammatory diseases. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Phase Transitions above the Yrast Line in {sup 154}Dy

    Energy Technology Data Exchange (ETDEWEB)

    Ma, W. C. [Mississippi State University, Mississippi State, Mississippi 39762 (United States); Martin, V. [Analisis Numerico, Facultad de Informatica, Universidad Politecnica de Madrid, E-28660 Madrid, (Spain); Khoo, T. L. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Lauritsen, T. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Egido, J. L. [Departamento de Fisica Teorica C-XI, Universidad Autonoma de Madrid, E-28049 Madrid, (Spain); Ahmad, I. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Bhattacharyya, P. [Purdue University, West Lafayette, Indiana 47907 (United States); Carpenter, M. P. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Daly, P. J. [Purdue University, West Lafayette, Indiana 47907 (United States); Grabowski, Z. W. [Purdue University, West Lafayette, Indiana 47907 (United States)] (and others)

    2000-06-26

    Spectra of the E2 quasicontinuum {gamma} rays feeding different spin regions of the {sup 154}Dy yrast line have been extracted. These are compared with corresponding theoretical spectra obtained by numerical simulations based on temperature-dependent Hartree-Fock theory, with thermal shape fluctuations. In this manner, different regions of the spin-energy plane can be examined. The results support the predictions of a smeared-out phase transition at high spin above the yrast line. (c) 2000 The American Physical Society.

  7. Platelet-derived CD154: ultrastructural localization and clinical correlation in organ transplantation

    Science.gov (United States)

    Charafeddine, Ali H.; Kim, Eugenia J.; Maynard, Dawn M.; Yi, Hong; Weaver, Timothy A.; Gunay-Aygun, Meral; Russell, Maria; Gahl, William A.; Kirk, Allan D.

    2012-01-01

    CD154 is an immunostimulatory ligand for CD40 that markedly influences alloimmunity. Its presence in platelets suggests that its release and subsequent immune effects are driven by trauma and thus could be relevant following organ transplantation. However, the release of platelet derived CD154 and its consequences have not been investigated in a clinical transplant setting. To better characterize the relationship between platelet activation and CD154 release, we investigated CD154 release by platelets obtained from normal individuals, and patients with two genetic defects that influence platelet granule development. Using these unique patient populations and immune-electron microscopy, we confirmed that CD154 was an alpha granule and not a cell surface protein, and thereafter optimized the methods for its in vivo measurement in humans. We then investigated plasma CD154 levels in kidney and liver transplant recipients and found no evidence that CD154 levels fluctuated systemically as a result of kidney or liver transplant procedures. Paradoxically, we found that kidney transplant patients had significantly lower systemic CD154 levels during episodes of rejection. These data suggest that the immune effects of CD154 are likely mediated through local and not systemic mechanisms, and discourage the use of CD154 as a peripheral biomarker in organ transplantation. PMID:22947105

  8. Pyrolysis result of polyethylene waste as fuel for solid oxide fuel cell with samarium doped-ceria (SDC)-carbonate as electrolyte

    Science.gov (United States)

    Syahputra, R. J. E.; Rahmawati, F.; Prameswari, A. P.; Saktian, R.

    2017-02-01

    In this research, the result of pyrolysis on polyethylene was used as fuel for a solid oxide fuel cell (SOFC). The pyrolysis result is a liquid which consists of hydrocarbon chains. According to GC-MS analysis, the hydrocarbons mainly consist of C7 to C20 hydrocarbon chain. Then, the liquid was applied to a single cell of NSDC-L | NSDC | NSDC-L. NSDC is a composite SDC (samarium doped-ceria) with sodium carbonate. Meanwhile, NSDC-L is a composite of NSDC with LiNiCuO (LNC). NSDC and LNC were analyzed by X-ray diffraction to understand their crystal structure. The result shows that presence of carbonate did not change the crystal structure of SDC. SEM EDX analysis for fuel cell before and after being loaded with polyethylene oil to get information of element diffusion to the electrolyte. Meanwhile, the conductivity properties were investigated through impedance measurement. The presence of carbonate even increases the electrical conductivity. The single cell test with the pyrolysis result of polyethylene at 300 - 600 °C, found that the highest power density is at 600 °C with the maximum power density of 0.14 mW/cm2 and open circuit voltage of 0.4 Volt. Elemental analysis at three point spots of single cell NDSC-L |NSDC|NSDC-L found that a migration of ions was occurred during fuel operation at 300 - 600 °C.

  9. Effects of some rare earth and carbonate-based co-dopants on structural and electrical properties of samarium doped ceria (SDC) electrolytes for solid oxide fuel cells

    Science.gov (United States)

    Anwar, Mustafa; Khan, Zuhair S.; Mustafa, Kamal; Rana, Akmal

    2015-09-01

    In the present study, samarium doped ceria (SDC) and SDC-based composite with the addition of K2CO3 were prepared by co-precipitation route and effects of pH of the solution and calcination temperature on microstructure of SDC and SDC-K2CO3, respectively, were investigated. Furthermore, experimentation was performed to investigate into the ionic conductivity of pure SDC by co-doping with yttrium i.e., YSDC, XRD and SEM studies show that the crystallite size and particle size of SDC increases with the increase in pH. The SEM images of all the samples of SDC synthesized at different pH values showed the irregular shaped and dispersed particles. SDC-K2CO3 was calcined at 600∘C, 700∘C and 800∘C for 4 h and XRD results showed that crystallite size increases while lattice strain, decreases with the increase in calcination temperature and no peaks were detected for K2CO3 as it is present in an amorphous form. The ionic conductivity of the electrolytes increases with the increase in temperature and SDC-K2CO3 shows the highest value of ionic conductivity as compared to SDC and YSDC. Chemical compatibility tests were performed between the co-doped electrolyte and lithiated NiO cathode at high temperature. It revealed that the couple could be used up to the temperature of 700∘C.

  10. Calculation of the Dose of Samarium-153-Ethylene Diamine Tetramethylene Phosphonate (153Sm-EDTMP as a Radiopharmaceutical for Pain Relief of bone Metastasis

    Directory of Open Access Journals (Sweden)

    Fatemeh Razghandi

    2016-04-01

    Full Text Available Introduction One of the important applications of nuclear physics in medicine is the use of radioactive elements as radiopharmaceuticals. Metastatic bone disease is the most common form of malignant bone tumors. Samarium-153-ethylene diamine tetramethylene phosphonate (153Sm-EDTMP as a radiopharmaceutical is used for pain palliation. This radiopharmaceutical usually emits beta particles, which have a high uptake in bone tissues. The purpose of this study was to calculate the radiation dose distribution of 153Sm-EDTMP in bone and other tissues, using MCNPX Monte Carlo code in the particle transport model. Materials and Methods Dose delivery to the bone was simulated by seeking radiopharmaceuticals on the bone surface. The phantom model had a simple cylindrical geometry and included bone, bone marrow, and soft tissue. Results The simulation results showed that a significant amount of radiation dose was delivered to the bone by the use of this radiopharmaceutical. Conclusion Thebone acted as a fine protective shield against rays for the bone marrow. Therefore, the trivial absorbed dose by the bone marrow caused less damage to bone-making cells. Also, the high absorbed dose of the bone could destroy cancer cells and relieve the pain in the bone.

  11. Synthesis, quality control and biological evaluation of tris[(1,10-phenanthroline)[{sup 153}Sm]samarium(III)]trithiocyanate complex as a therapeutic agent

    Energy Technology Data Exchange (ETDEWEB)

    Naseri, Z.; Kharat, A. Nemati [Tehran Univ. (Iran, Islamic Republic of). Inorganic Chemistry Dept.; Hakimi, A. [Islamic Azad Univ., Tehran (Iran, Islamic Republic of). Dept. of Nuclear Engineering, Science and Research Branch; Jalilian, A.R.; Shirvani-Arani, S.; Bahrami-Samani, A.; Ghannadi-Maragheh, M. [Nuclear Science and Technology Research Institute (NSTRI), Tehran (IR). Radiopharmaceutical Research and Development Lab (RRDL)

    2012-07-01

    Therapeutic radiopharmaceuticals are designed to deliver high doses of radiation to selected target organs or tissues with an aim of minimizing unwanted radiation to surrounding healthy tissue. In this work, [tris(1,10-phenanthroline)[{sup 153}Sm]samarium(III)]trithiocyanate ({sup 153}Sm-TPTTC) was developed for possible therapeutic properties. The cold compound, i.e. {sup nat}Sm-TPTTC was prepared and characterized by IR, UV, mass and {sup 1}H-NMR spectroscopy. {sup 153}Sm-TPTTC was prepared in two steps using [{sup 153}Sm]SmCl{sub 3}, obtained by neutron activation of an enriched {sup 152}Sm sample. Stability tests, partition coefficient determination, toxicity tests and biodistribution studies of the complex in wild-type and fibrosarcoma-bearing mice were determined. The radiolabeled complex was prepared in high radiochemical purity (> 99% precipitation method) and specific activity of 278 GBq/mmol and demonstrated significant stability at 4, 25 and 37 C (in presence of human serum). Initial complex biodistribution data showed significant liver accumulation in wild-type mice and significant tumor accumulation in fibrosarcoma-bearing mice with tumor:blood and tumor:muscle ratios of 3.55 (2 h) and 38.26 (96 h) respectively. {sup 153}Sm-TPTTC properties suggest an efficient tumor targeting agent with high tumor-avidity. Further investigation on the therapeutic properties must be conducted. (orig.)

  12. The role of CD154 in organ transplant rejection and acceptance.

    OpenAIRE

    Kirk, A. D.; Blair, P.J.; Tadaki, D K; Xu, H; Harlan, D. M.

    2001-01-01

    CD154 plays a critical role in determining the outcome of a transplanted organ. This simple statement is amply supported by experimental evidence demonstrating that anti-CD154 antibodies are potent inhibitors of allograft rejection in many rigorous transplant models. Unfortunately, despite intensive investigation over the past ten years, the precise mechanisms by which antibodies against CD154 exert their anti-rejection effects have remained less obvious. Though originally classified with ref...

  13. Cloning, sequence analysis and expression of ovine CD154 (CD40 ligand).

    Science.gov (United States)

    Oledzka, Gabriela; Li, Bo; William Kay, Graham; Chomicz, Lidia; Stankiewicz, Miroslaw

    2007-02-01

    The CD154 (CD40 ligand) molecule is a member of the tumor necrosis factor (TNF) family and plays an important role in the interaction between antigen-specific lymphocytes and antigen-presenting cells. In this study, reverse transcription-PCR cloning was used to derive the sequence encoding ovine CD154. Sequence analysis of the cloned CD154 gene showed a similarity of 97%, 89%, and 88% with the bovine, porcine and human sequences, respectively, at the nucleic acid level. The deduced amino acid sequence for the ovine CD154 shared 97%, 91%, and 87% similarity with the CD154 protein of bovine, porcine and human. The cysteine residues characteristic of the TNF family and N-linked glycosylation sites are conserved although one of the cysteine residues (Cys9) appeared only in ovine CD154. The isolated CD154 sequence was expressed as a mature protein in Chinese hamster ovary (CHO) cells. The analysis of expression of ovine CD154 in mammalian cells by Western blot confirmed the cross reactivity with anti-CD154 antibody.

  14. Polymorphisms at Amino Acid Residues 141 and 154 Influence Conformational Variation in Ovine PrP

    Directory of Open Access Journals (Sweden)

    Sujeong Yang

    2014-01-01

    Full Text Available Polymorphisms in ovine PrP at amino acid residues 141 and 154 are associated with susceptibility to ovine prion disease: Leu141Arg154 with classical scrapie and Phe141Arg154 and Leu141His154 with atypical scrapie. Classical scrapie is naturally transmissible between sheep, whereas this may not be the case with atypical scrapie. Critical amino acid residues will determine the range or stability of structural changes within the ovine prion protein or its functional interaction with potential cofactors, during conversion of PrPC to PrPSc in these different forms of scrapie disease. Here we computationally identified that regions of ovine PrP, including those near amino acid residues 141 and 154, displayed more conservation than expected based on local structural environment. Molecular dynamics simulations showed these conserved regions of ovine PrP displayed genotypic differences in conformational repertoire and amino acid side-chain interactions. Significantly, Leu141Arg154 PrP adopted an extended beta sheet arrangement in the N-terminal palindromic region more frequently than the Phe141Arg154 and Leu141His154 variants. We supported these computational observations experimentally using circular dichroism spectroscopy and immunobiochemical studies on ovine recombinant PrP. Collectively, our observations show amino acid residues 141 and 154 influence secondary structure and conformational change in ovine PrP that may correlate with different forms of scrapie.

  15. Increased T cell expression of CD154 (CD40-ligand) in multiple sclerosis

    DEFF Research Database (Denmark)

    Jensen, J; Krakauer, M; Sellebjerg, F

    2001-01-01

    CD154 (CD40-ligand, gp39), expressed on activated T cells, is crucial in T cell-dependent immune responses and may be involved in the pathogenesis of multiple sclerosis (MS). We studied cerebro-spinal fluid and peripheral blood T cell expression of CD154 in MS by flow cytometry. Patients with sec......CD154 (CD40-ligand, gp39), expressed on activated T cells, is crucial in T cell-dependent immune responses and may be involved in the pathogenesis of multiple sclerosis (MS). We studied cerebro-spinal fluid and peripheral blood T cell expression of CD154 in MS by flow cytometry. Patients...

  16. Retention capacity of samarium (III) in zircon for it possible use in retaining walls for confinement of nuclear residues; Capacidad de retencion de samario (III) en circon para su posible uso en barreras de contencion para confinamiento de residuos nucleares

    Energy Technology Data Exchange (ETDEWEB)

    Garcia G, N

    2006-07-01

    Mexico, as country that produces part of its electric power by nuclear means, should put special emphasis in the development of technologies guided to the sure and long term confinement of the high level nuclear residuals. This work studies the capacity that has the natural zircon to retain to the samarium (III) in solution, by what due, firstly, to characterize the zircon for technical instrumental to determine the purity and characteristic of the mineral in study. The instrumental techniques that were used to carry out the physicochemical characterization were the neutron activation analysis (NAA), the infrared spectroscopy (IS), the thermal gravimetric analysis (TGA), scanning electron microscopy (SEM), transmission electron microscopy (TEM), semiquantitative analysis, dispersive energy spectroscopy (EDS), X-ray diffraction (XRD) and luminescence technique. The characterization of the surface properties carries out by means of the determination of the surface area using the BET multipoint technique, acidity constants, hydration time, the determination of the point of null charge (pH{sub PCN}) and density of surface sites (D{sub s}). The luminescence techniques were useful to determine the optimal point hydration of the zircon and for the quantification of the samarium, for that here intends the development of both analysis techniques. With the adjustment of the titration curves in the FITEQL 4 package the constants of surface acidity in the solid/liquid interface were determined. To the finish of this study it was corroborated that the zircon is a mineral that presents appropriate characteristics to be proposed as a contention barrier for the deep geologic confinement. With regard to the study of adsorption that one carries out the samarium retention it is superior to 90% under the described conditions. This investigation could also be applicable in the confinement of dangerous industrial residuals. (Author)

  17. Regiospecific synthesis of 15-(4-[{sup 123}I]iodophenyl)pentadecanoic acid-IPPA via methyl 15-(4-trimethylstannylphenyl)pentadecanoate

    Energy Technology Data Exchange (ETDEWEB)

    Culbert, P.A. [Glaxo Wellcome Inc., Mississauga, ON (Canada); Jianming Lu; Adam, M.J. [TRIUMF, Vancouver, BC (Canada)

    1997-06-01

    The synthesis of methyl 15-(4-trimethylstannylphenyl)pentadecanoate (p-SnPPA), a precursor for the regiospecific production of 15-(4-[{sup 123}I]-iodophenyl)pentadecanoic acid, is described. The stannylated precursor is synthesized in six steps from 4-bromophenylacetylene in an overall yield of 16%. p-SnPPA reacts with N.C.A. [{sup 123}I]NaI in the presence of peracetic acid to yield IPPA in 62% radiochemical yield following hydrolysis. (author).

  18. SU-C-201-06: Utility of Quantitative 3D SPECT/CT Imaging in Patient Specific Internal Dosimetry of 153-Samarium with GATE Monte Carlo Package

    Energy Technology Data Exchange (ETDEWEB)

    Fallahpoor, M; Abbasi, M [Tehran University of Medical Sciences, Vali-Asr Hospital, Tehran, Tehran (Iran, Islamic Republic of); Sen, A [University of Houston, Houston, TX (United States); Parach, A [Shahid Sadoughi University of Medical Sciences, Yazd, Yazd (Iran, Islamic Republic of); Kalantari, F [UT Southwestern Medical Center, Dallas, TX (United States)

    2015-06-15

    Purpose: Patient-specific 3-dimensional (3D) internal dosimetry in targeted radionuclide therapy is essential for efficient treatment. Two major steps to achieve reliable results are: 1) generating quantitative 3D images of radionuclide distribution and attenuation coefficients and 2) using a reliable method for dose calculation based on activity and attenuation map. In this research, internal dosimetry for 153-Samarium (153-Sm) was done by SPECT-CT images coupled GATE Monte Carlo package for internal dosimetry. Methods: A 50 years old woman with bone metastases from breast cancer was prescribed 153-Sm treatment (Gamma: 103keV and beta: 0.81MeV). A SPECT/CT scan was performed with the Siemens Simbia-T scanner. SPECT and CT images were registered using default registration software. SPECT quantification was achieved by compensating for all image degrading factors including body attenuation, Compton scattering and collimator-detector response (CDR). Triple energy window method was used to estimate and eliminate the scattered photons. Iterative ordered-subsets expectation maximization (OSEM) with correction for attenuation and distance-dependent CDR was used for image reconstruction. Bilinear energy mapping is used to convert Hounsfield units in CT image to attenuation map. Organ borders were defined by the itk-SNAP toolkit segmentation on CT image. GATE was then used for internal dose calculation. The Specific Absorbed Fractions (SAFs) and S-values were reported as MIRD schema. Results: The results showed that the largest SAFs and S-values are in osseous organs as expected. S-value for lung is the highest after spine that can be important in 153-Sm therapy. Conclusion: We presented the utility of SPECT-CT images and Monte Carlo for patient-specific dosimetry as a reliable and accurate method. It has several advantages over template-based methods or simplified dose estimation methods. With advent of high speed computers, Monte Carlo can be used for treatment planning

  19. Fabrication of catalytically active nanocrystalline samarium (Sm)-doped cerium oxide (CeO2) thin films using electron beam evaporation

    Science.gov (United States)

    Kundu, Subrata; Sutradhar, Narottam; Thangamuthu, R.; Subramanian, B.; Panda, Asit Baran; Jayachandran, M.

    2012-08-01

    Samarium (Sm)-doped cerium oxide (CeO2) thin films were fabricated using electron beam evaporation technique. The synthesized films were deposited either on glass or ITO substrates and studied their nature by annealing at different temperatures. The optical properties and other morphological studies were done by UV-Vis, XRD, XPS, SEM, EDS, and FT-IR analysis. XRD and XPS analysis clearly confirm the presence of Sm in the ceria site. From the SEM study, it was found that after annealing at high temperature ( 300 or 500 °C), the particles size was reduced due to breakdown of large aggregates of particles which is also confirmed from UV-Vis, XPS, and XRD analyses. The FT-IR study proves the presence of -COO-, -OH, or ammonium group on the particles surface. The deposition of Sm-doped CeO2 nanomaterials was found more feasible on ITO substrate compared to that of glass substrate in terms of stability and depth of film thickness. The Sm-doped CeO2 nanomaterial acts as a re-usable catalyst for the reduction of organic dye molecules in the presence of NaBH4. The catalysis rate was compared by considering the electron transfer process during the reduction. The synthesized Sm-doped CeO2 thin films might find wide variety of applications in various emerging fields like solid oxide fuel cells (SOFCs), oxygen sensor or as catalyst in different types of organic and inorganic catalytic reactions. The fabrication process is very simple, straightforward, less time consuming, and cost effective.

  20. Fabrication of catalytically active nanocrystalline samarium (Sm)-doped cerium oxide (CeO{sub 2}) thin films using electron beam evaporation

    Energy Technology Data Exchange (ETDEWEB)

    Kundu, Subrata, E-mail: skundu@cecri.res.in [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India); Sutradhar, Narottam [G. B. Marg, Central Salt and Marine Chemical Research Institute - CSIR (India); Thangamuthu, R.; Subramanian, B. [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India); Panda, Asit Baran [G. B. Marg, Central Salt and Marine Chemical Research Institute (CSIR) (India); Jayachandran, M., E-mail: mjayam54@yahoo.com [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India)

    2012-08-15

    Samarium (Sm)-doped cerium oxide (CeO{sub 2}) thin films were fabricated using electron beam evaporation technique. The synthesized films were deposited either on glass or ITO substrates and studied their nature by annealing at different temperatures. The optical properties and other morphological studies were done by UV-Vis, XRD, XPS, SEM, EDS, and FT-IR analysis. XRD and XPS analysis clearly confirm the presence of Sm in the ceria site. From the SEM study, it was found that after annealing at high temperature ({approx}300 or 500 Degree-Sign C), the particles size was reduced due to breakdown of large aggregates of particles which is also confirmed from UV-Vis, XPS, and XRD analyses. The FT-IR study proves the presence of -COO-, -OH, or ammonium group on the particles surface. The deposition of Sm-doped CeO{sub 2} nanomaterials was found more feasible on ITO substrate compared to that of glass substrate in terms of stability and depth of film thickness. The Sm-doped CeO{sub 2} nanomaterial acts as a re-usable catalyst for the reduction of organic dye molecules in the presence of NaBH{sub 4}. The catalysis rate was compared by considering the electron transfer process during the reduction. The synthesized Sm-doped CeO{sub 2} thin films might find wide variety of applications in various emerging fields like solid oxide fuel cells (SOFCs), oxygen sensor or as catalyst in different types of organic and inorganic catalytic reactions. The fabrication process is very simple, straightforward, less time consuming, and cost effective.Graphical Abstract.

  1. 46 CFR 154.650 - Cargo tank and process pressure vessel welding.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo tank and process pressure vessel welding. 154.650... Equipment Construction § 154.650 Cargo tank and process pressure vessel welding. (a) Cargo tank and process pressure vessel welding must meet Subpart 54.05 and Part 57 of this chapter. (b) Welding consumables used...

  2. 32 CFR 536.154 - Claims involving tortfeasors other than nonappropriated fund employees: NAFI risk management...

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 3 2010-07-01 2010-07-01 true Claims involving tortfeasors other than nonappropriated fund employees: NAFI risk management program (RIMP) claims. 536.154 Section 536.154 National... nonappropriated fund employees: NAFI risk management program (RIMP) claims. The risk management program (RIMP) is...

  3. Elevated serum levels of soluble CD154 in children with juvenile idiopathic arthritis

    Directory of Open Access Journals (Sweden)

    Zeft Andrew S

    2008-05-01

    Full Text Available Abstract Objective Cytokines play important roles in mediating inflammation in autoimmunity. Several cytokines are elevated in serum and synovial fluid samples from children with Juvenile Idiopathic Arthritis (JIA. Soluble CD154 (sCD154 is elevated in other autoimmune disorders, but has not been characterized in JIA. Our objectives were to determine if sCD154 is elevated in JIA, and to examine correlations between sCD154 and other inflammatory cytokines. Methods Serum from 77 children with JIA and 81 pediatric controls was analyzed for interleukin (IL1β, IL2, IL4, IL5, IL6, IL8, IL10, IL12, IL13, sCD154, interferon-γ (IFNγ, soluble IL2 receptor (sIL2R, and tumor necrosis factor-α (TNFα, using the Luminex Multi-Analyte Profiling system. Differences in levels of cytokines between cases and controls were analyzed. Logistic regression was also performed. Results sCD154 was significantly elevated in cases compared to controls (p Conclusion Serum levels of sCD154, IL1β, IL6, IL8, sIL2R and TNFα are elevated in most JIA subtypes, suggesting a major role for sCD154, and these cytokines and cytokine receptors in the pathogenesis of JIA.

  4. 46 CFR 154.1730 - Ethylene oxide: Loading and off loading.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Ethylene oxide: Loading and off loading. 154.1730... Operating Requirements § 154.1730 Ethylene oxide: Loading and off loading. (a) The master shall ensure that before ethylene oxide is loaded into a cargo tank: (1) The tank is thoroughly clean, dry, and free of...

  5. 21 CFR 520.154b - Bacitracin methylene disalicylate and streptomycin sulfate powder.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Bacitracin methylene disalicylate and streptomycin sulfate powder. 520.154b Section 520.154b Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF... bacterial enteritis caused by pathogens susceptible to bacitracin and streptomycin such as Escherichia coli...

  6. 7 CFR 1900.154 - Determining the need for special handling.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 12 2010-01-01 2010-01-01 false Determining the need for special handling. 1900.154 Section 1900.154 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING... OF AGRICULTURE PROGRAM REGULATIONS GENERAL Processing and Servicing FmHA or Its Successor Agency...

  7. 46 CFR 154.701 - Cargo pressure and temperature control: General.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Cargo pressure and temperature control: General. 154.701... CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Cargo Pressure and Temperature Control § 154.701 Cargo pressure and temperature control: General...

  8. 46 CFR 154.1375 - Readout for temperature measuring device: Marking.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Readout for temperature measuring device: Marking. 154... DANGEROUS CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Instrumentation § 154.1375 Readout for temperature measuring device: Marking. Each...

  9. 17 CFR 230.154 - Delivery of prospectuses to investors at the same address.

    Science.gov (United States)

    2010-04-01

    ... investors at the same address. 230.154 Section 230.154 Commodity and Securities Exchanges SECURITIES AND... prospectuses to investors at the same address. (a) Delivery of a single prospectus. If you must deliver a... all of the following conditions are met: (1) The investor has the same last name as the other...

  10. The relationship between hepatic immunoglobulin production and CD154 expression in chronic liver diseases.

    Science.gov (United States)

    Mayo, Marlyn J; Mosby, James M; Jeyarajah, Rohan; Combes, Burton; Khilnani, Smina; Al-halimi, Maha; Handem, Iorna; Grammer, Amrie C; Lipsky, Peter E

    2006-03-01

    CD40-CD154 is a receptor-ligand pair that provides key communication signals between cells of the adaptive immune system in states of inflammation and autoimmunity. The CD40 receptor is expressed constitutively on B lymphocytes, for which it provides important signals regulating clonal expansion and antibody production. CD154 is a member of the tumor necrosis factor superfamily, which is primarily expressed by activated T cells. Because many chronic liver diseases are characterized by lymphocytic infiltration of the liver and several have increased immunoglobulin (Ig) production, the role of CD40-CD154 in hepatic Ig production was investigated in patients with primary biliary cirrhosis (PBC), primary sclerosing cholangitis, autoimmune hepatitis (AIH), hepatitis C, hepatitis B, alcoholic and non-alcoholic steatohepatitis, as well as normal controls. Soluble CD154 levels in the serum were found to be no different in chronic liver diseases vs normal controls. Likewise, CD154 mRNA levels in peripheral blood mononuclear cells did not differ. However, mRNA for CD154 was significantly increased in the liver of individuals with PBC and AIH as compared with the other groups. The quantity of CD154 mRNA in the liver correlated positively with the quantity of mRNA for secretory Ig. These findings suggest that CD40-CD154 signals may be involved in Ig production within the liver of autoimmune liver diseases.

  11. Allospecific CD154+ T-cells associate with rejection risk after pediatric liver transplantation

    Science.gov (United States)

    AshokKumar, Chethan; Talukdar, Anjan; Sun, Qing; Higgs, Brandon W; Janosky, Janine; Wilson, Patrick; Mazariegos, George; Jaffe, Ronald; Demetris, Anthony; Dobberstein, Jennifer; Soltys, Kyle; Bond, Geoffrey; Thomson, Angus; Zeevi, Adriana; Sindhi, Rakesh

    2010-01-01

    Antigen-specific T-cells, which express CD154 rapidly, but remain untested in alloimmunity, were measured with flow cytometry in 16-hour MLR of 58 identically-immunosuppressed children with liver transplantation (LTx), to identify Rejectors (who had experienced biopsy-proven rejection within 60 days post-transplantation). Thirty one children were sampled once, cross-sectionally. Twenty seven children were sampled longitudinally, pre-LTx, and at 1–60 and 61–200 days after LTx. Results were correlated with proliferative alloresponses measured by CFSE-dye dilution (n=23), and CTLA4, a negative T-cell costimulator, which antagonizes CD154-mediated effects (n=31). In cross-sectional observations, logistic regression and leave-one-out cross-validation identified donor-specific, CD154+T-cytotoxic (Tc)-memory cells as best associated with rejection outcomes. In the longitudinal cohort, 1) the association between CD154+Tc-memory cells and rejection outcomes was replicated with sensitivity/specificity 92.3%/84.6% for observations at 1–60 days, and 2) elevated pre-LTx CD154+Tc-memory cell responses were associated with significantly increased incidence (p=0.02) and hazard (HR=7.355) of rejection in survival/proportional hazard analysis. CD154 expression correlated with proliferative alloresponses (r=0.835, p=7.1e-07), and inversely with CTLA4 expression of allospecific CD154+Tc-memory cells (r=−0.706, p=3.0e-05). Allospecific CD154+T-helper-memory cells, not CD154+Tc-memory, were inhibited by increasing Tacrolimus concentrations (p=0.026). Collectively, allospecific CD154+T-cells provide an estimate of rejection risk in children with LTx. PMID:18976293

  12. BRCA2 Mutations in 154 Finnish Male Breast Cancer Patients

    Directory of Open Access Journals (Sweden)

    Kirsi Syrjäkoski

    2004-09-01

    Full Text Available The etiology and pathogenesis of male breast cancer (MBC are poorly known. This is due to the fact that the disease is rare, and large-scale genetic epidemiologic studies have been difficult to carry out. Here, we studied the frequency of eight recurrent Finnish BRCA2 founder mutations in a large cohort of 154 MBC patients (65% diagnosed in Finland from 1967 to 1996. Founder mutations were detected in 10 patients (6.5%, eight of whom carried the 9346(-2 A>G mutation. Two novel mutations (4075 delGT and 5808 del5 were discovered in a screening of the entire BRCA2 coding region in 34 samples. However, these mutations were not found in the rest of the 120 patients studied. Patients with positive family history of breast and/or ovarian cancer were often BRCA2 mutation carriers (44%, whereas those with no family history showed a low frequency of involvement (3.6%; P < .0001. Finally, we found only one Finnish MBC patient with 999 dell, the most common founder mutation in Finnish female breast cancer (FBC patients, and one that explains most of the hereditary FBC and MBC cases in Iceland. The variation in BRCA2 mutation spectrum between Finnish MBC patients and FBC patients in Finland and breast cancer patients in Iceland suggests that modifying genetic and environmental factors may significantly influence the penetrance of MBC and FBC in individuals carrying germline BRCA2 mutations in some populations.

  13. AGR-2 Data Qualification Report for ATR Cycle 154B

    Energy Technology Data Exchange (ETDEWEB)

    Binh Pham; Jeff Einerson

    2014-01-01

    This report provides the data qualification status of Advanced Gas Reactor-2 (AGR-2) fuel irradiation experimental data from Advanced Test Reactor (ATR) Cycle 154B as recorded in the Nuclear Data Management and Analysis System (NDMAS). This is the last cycle of AGR-2 irradiation, as the test train was pulled from the ATR core during the outage portion of ATR Cycle 155A. The AGR-2 data streams addressed in this report include thermocouple (TC) temperatures, sweep gas data (flow rates including new Fission Product Monitoring (FPM) downstream flows from Fission Product Monitoring System (FPMS) detectors, pressure, and moisture content), and FPMS data (release rates and release-to-birth rate ratios [R/Bs]) for each of the six capsules in the AGR-2 experiment. The final data qualification status for these data streams is determined by a Data Review Committee (DRC) comprised of AGR technical leads, Sitewide Quality Assurance (QA), and NDMAS analysts. The Data Review Committee reviewed the data acquisition process, considered whether the data met the requirements for data collection as specified in QA-approved Very High Temperature Reactor (VHTR) data collection plans, examined the results of NDMAS data testing and statistical analyses, and confirmed the qualification status of the data as given in this report.

  14. CD154-CD40 interactions in the control of murine B cell hematopoiesis

    Science.gov (United States)

    Carlring, Jennifer; Altaher, Hala M.; Clark, Susan; Chen, Xi; Latimer, Sarah L.; Jenner, Tracey; Buckle, Anne-Marie; Heath, Andrew W.

    2011-01-01

    Interactions between CD40 and CD154 play a very important role in control of immune responses, including the delivery of T cell help to B cells and other APCs. Thus far, there has been no role postulated for CD40-CD154 interactions in hematopoiesis. We show here that CD40 is expressed on murine pro-B cells and that its ligation enhances pro-B cell proliferation in vitro and in vivo. In addition, CD154 mRNA is present in the BM. Moreover, we show that a deficiency in CD154 expression has effects on B cell hematopoiesis. Aged, CD154-deficient mice have significantly lower levels of B hematopoietic subsets downstream of pro-B cells in the BM. In addition, B lineage cells reconstitute more slowly following BMT into CD154-deficient recipients. We hypothesize that CD154 is expressed by radio-resistant cells in the BM and plays a role in fine-tuning B cell hematopoiesis. PMID:21330346

  15. A Role for CD154, the CD40 Ligand, in Granulomatous Inflammation.

    Science.gov (United States)

    Villeneuve, Julien; Desmoulière, Alexis; Dewitte, Antoine; Bordeau, Nelly; Costet, Pierre; Bassaganyas, Laia; Fricain, Jean-Christophe; Ripoche, Jean; Lepreux, Sébastien

    2017-01-01

    Granulomatous inflammation is a distinctive form of chronic inflammation in which predominant cells include macrophages, epithelioid cells, and multinucleated giant cells. Mechanisms regulating granulomatous inflammation remain ill-understood. CD154, the ligand of CD40, is a key mediator of inflammation. CD154 confers a proinflammatory phenotype to macrophages and controls several macrophagic functions. Here, we studied the contribution of CD154 in a mouse model of toxic liver injury with carbon tetrachloride and a model of absorbable suture graft. In both models, granulomas are triggered in response to endogenous persistent liver calcified necrotic lesions or by grafted sutures. CD154-deficient mice showed delayed clearance of carbon tetrachloride-induced liver calcified necrotic lesions and impaired progression of suture-induced granuloma. In vitro, CD154 stimulated phagocytosis of opsonized erythrocytes by macrophages, suggesting a potential mechanism for the altered granulomatous inflammation in CD154KO mice. These results suggest that CD154 may contribute to the natural history of granulomatous inflammation.

  16. The role of platelets CD40 ligand (CD154) in acute coronary syndromes.

    Science.gov (United States)

    Abu el-Makrem, Mona A; Mahmoud, Yehia Z; Sayed, Douaa; Nassef, Noussa M; Abd el-Kader, Samir S; Zakhary, Madiha; Ghazaly, Taghreed; Matta, Ragaa

    2009-12-01

    Despite of the proof of the biological function of CD154 on platelets, there has been little information about its role either in patients with stable angina or in those with acute coronary syndrome (ACS). This study aimed to investigate the expression of CD154 on platelets and its role in ACS. The study included 50 patients with ACS (24 patients with acute myocardial infarction (AMI) and 26 patients with unstable angina (UA)), 20 patients with stable angina (SA) and 18 healthy volunteers. CD154 and CD62 expression on platelets were analyzed by flow cytometry. Their relations to the clinical and laboratory data were assessed in the studied group. Patients with AMI and UA had higher levels of platelets CD154 and CD62 as compared to those with SA and among patients with AMI, UA and SA versus healthy volunteers. Platelets CD154 showed significant positive correlations with the studied pro-inflammatory markers (Ox-LDL, CRP and fibrinogen), segmental wall motion score and the studied risk factors. There were significant negative correlations between platelet CD154 and serum nitric oxide among patients. CD154 may be used as a marker of thrombo-embolic events. Nitric oxide may have an anti-atherogenic effect. There is an association between platelet activation and severity of coronary artery disease among patients with ACS.

  17. CD40/CD154 blockade inhibits dendritic cell expression of inflammatory cytokines but not costimulatory molecules.

    Science.gov (United States)

    Ferrer, Ivana R; Liu, Danya; Pinelli, David F; Koehn, Brent H; Stempora, Linda L; Ford, Mandy L

    2012-11-01

    Blockade of the CD40/CD154 pathway remains one of the most effective means of promoting graft survival following transplantation. However, the effects of CD40/CD154 antagonism on dendritic cell (DC) phenotype and functionality following transplantation remain incompletely understood. To dissect the effects of CD154/CD40 blockade on DC activation in vivo, we generated hematopoietic chimeras in mice that expressed a surrogate minor Ag (OVA). Adoptive transfer of OVA-specific CD4(+) and CD8(+) T cells led to chimerism rejection, which was inhibited by treatment with CD154 blockade. Surprisingly, CD154 antagonism did not alter the expression of MHC and costimulatory molecules on CD11c(+) DCs compared with untreated controls. However, DCs isolated from anti-CD154-treated animals exhibited a significant reduction in inflammatory cytokine secretion. Combined blockade of inflammatory cytokines IL-6 and IL-12p40 attenuated the expansion of Ag-specific CD4(+) and CD8(+) T cells and transiently inhibited the rejection of OVA-expressing cells. These results suggest that a major effect of CD154 antagonism in vivo is an impairment in the provision of signal three during donor-reactive T cell programming, as opposed to an impact on the provision of signal two. We conclude that therapies designed to target inflammatory cytokines during donor-reactive T cell activation may be beneficial in attenuating these responses and prolonging graft survival.

  18. A Role for CD154, the CD40 Ligand, in Granulomatous Inflammation

    Directory of Open Access Journals (Sweden)

    Julien Villeneuve

    2017-01-01

    Full Text Available Granulomatous inflammation is a distinctive form of chronic inflammation in which predominant cells include macrophages, epithelioid cells, and multinucleated giant cells. Mechanisms regulating granulomatous inflammation remain ill-understood. CD154, the ligand of CD40, is a key mediator of inflammation. CD154 confers a proinflammatory phenotype to macrophages and controls several macrophagic functions. Here, we studied the contribution of CD154 in a mouse model of toxic liver injury with carbon tetrachloride and a model of absorbable suture graft. In both models, granulomas are triggered in response to endogenous persistent liver calcified necrotic lesions or by grafted sutures. CD154-deficient mice showed delayed clearance of carbon tetrachloride-induced liver calcified necrotic lesions and impaired progression of suture-induced granuloma. In vitro, CD154 stimulated phagocytosis of opsonized erythrocytes by macrophages, suggesting a potential mechanism for the altered granulomatous inflammation in CD154KO mice. These results suggest that CD154 may contribute to the natural history of granulomatous inflammation.

  19. Patients with acute coronary syndromes express enhanced CD40 ligand/CD154 on platelets.

    Science.gov (United States)

    Garlichs, C D; Eskafi, S; Raaz, D; Schmidt, A; Ludwig, J; Herrmann, M; Klinghammer, L; Daniel, W G; Schmeisser, A

    2001-12-01

    To investigate whether CD40L/CD154 on platelets and soluble CD40L/CD154 may play a role in the inflammatory process of acute coronary syndromes. Observational study in a university hospital. 15 patients with acute myocardial infarction, 25 patients with unstable angina, 15 patients with stable angina, and 12 controls. CD40L/CD154 on platelets, P-selectin/CD62P on platelets, soluble CD40L/CD154 serum concentrations. Mean (SD) CD40L/CD154 expression on platelets was 6.2 (2.8) MFI (mean fluorescence intensity) in the infarct group, 11 (3.3) MFI in the unstable angina group (p angina group (p angina), and 3.2 (1.0) MFI in the controls (p angina; NS v stable angina). Soluble CD40L/CD154 concentration was 5.2 (1.1) ng/ml in the infarct group, 4.2 (0.7) ng/ml in the unstable angina group (p angina group (p angina), and 3.0 (0.5) ng/ml in the controls (p angina; NS v stable angina). At a six months follow up, there was lower expression of CD40L/CD154 on platelets in patients with unstable angina (12.3 (3.6) v 3.8 (1.2) MFI, p angina who needed redo coronary angioplasty (PTCA) or who had recurrence of angina were characterised by increased CD40L/CD154 expression on platelets compared with the remainder of the study group (recurrence of angina: 12.7 (3.2) v 9.7 (1.6) MFI, p angina and myocardial infarction. These findings suggest that CD40-CD40L/CD154 interactions may play a pathogenic role in triggering and propagation of acute coronary syndromes.

  20. 33 CFR 154.106 - Incorporation by reference: Where can I get a copy of the publications incorporated by reference...

    Science.gov (United States)

    2010-07-01

    ... approved for § 154.735. (2) NFPA 70, National Electrical Code, 2008, IBR approved for § 154.812. (h) Oil..., IBR approved for § 154.812. (f) National Electrical Manufacturers Association (NEMA), 1300 North 17th... the public. All approved material is available for inspection at the National Archives and Records...

  1. CD154 is a negative regulator of autoaggressive CD8+ T cells in type 1 diabetes

    OpenAIRE

    McGregor, Catrin M.; Schoenberger, Stephen P.; Green, E. Allison

    2004-01-01

    TNF/CD80 mice, a CD8+ T cell-mediated model for type 1 diabetes, transgenically express tumor necrosis factor α (TNF-α) and the costimulatory molecule CD80 in their pancreatic islets. Here we show that these molecules bypass the need for CD40–CD154 costimulatory interactions in activation of CD8+ T cells, allowing us to determine the role of CD40–CD154 signals in regulation of autoaggressive CD8+ T cells after their in vivo priming. TNF/CD80 CD154-deficient mice rapidly develop diabetes, wher...

  2. CD40 ligand (CD154) involvement in platelet transfusion reactions.

    Science.gov (United States)

    Sahler, J; Spinelli, S; Phipps, R; Blumberg, N

    2012-06-01

    Platelet transfusions are commonly used treatments that occasionally lead to adverse reactions. Clinical trials, in vitro and animal studies have been performed to try to understand the causes of such reactions. Multiple studies have shown that the supernatant fraction of platelet concentrates contain prothrombotic and pro-inflammatory mediators. The origin of these mediators was first ascribed to white blood cells contaminating the platelet preparation. However, the accumulation of bioactive mediators after leukoreduction focused attention on platelets themselves during storage. Numerous cytokines, chemokines and prostaglandins are released in stored platelet concentrates. We have focused on a powerful mediator called soluble CD40 ligand (sCD40L, formally known as CD154) as a seminal contributor to adverse reactions. sCD40L can bind and signal the surface receptor, CD40, which is present on various types of human cells including white blood cells, vascular cells and fibroblasts. Downstream results of sCD40L/CD40 signaling include pro-inflammatory cytokine and chemokine production, prothrombotic mediator release, adherence and transmigration of leukocytes to endothelium and other undesirable vascular inflammatory events. Increased plasma levels of sCD40L can be detected in conditions such as myocardial infarction, stroke, unstable angina, high cholesterol, or other cardiovascular conditions. In retrospective studies, correlations were made between increased sCD40L levels of platelet concentrates and adverse transfusion reactions. We hypothesize that transfusion of partially activated, CD40L-expressing platelets along with sCD40L into a recipient with damaged or dysfunctional vascular tissue results in a "double-hit", thus inciting inflammation and vascular damage in the recipient. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  3. Enfoque terapéutico en 154 pacientes con acromegalia

    Directory of Open Access Journals (Sweden)

    Marcos P. Manavela

    2010-08-01

    Full Text Available La acromegalia es una enfermedad poco frecuente producida en más del 95% de los casos por un tumor hipofisario secretor de hormona de crecimiento (GH. Las manifestaciones clínicas están asociadas a síntomas locales por crecimiento del tumor o a las consecuencias orgánicas y metabólicas secundarias a la hipersecreción de GH. Debido a la alta morbilidad y mortalidad asociadas a la acromegalia, un tratamiento individualizado y optimizado para cada paciente es fundamental. Informamos el enfoque terapéutico de nuestro servicio de endocrinología en la atención de 154 pacientes con acromegalia. Utilizando criterios bioquímicos estrictos, con la cirugía logramos un 32% de remisión global, tasa relativamente baja debido fundamentalmente a que la mayor parte de los pacientes presentaban macroadenomas con un alto porcentaje de invasividad local. Con radioterapia complementaria o como tratamiento inicial se logró la remisión en el 65.4% de los pacientes irradiados. El 14.0% de los pacientes controlaron la enfermedad utilizando agonistas dopaminérgicos solos o combinados con otra droga, mientras que aquellos que utilizaron análogos de la somatostatina normalizaron los parámetros bioquímicos en un 45.7% de los casos. En conclusión, con los diferentes tratamientos utilizados obtuvimos el control de la acromegalia en el 55.2% de los casos, esperando optimizar el tratamiento de estos pacientes en la medida en que contemos con y tengamos acceso a nuevas herramientas terapéuticas.

  4. 10 CFR Appendix C to Part 20 - Quantities 1 of Licensed Material Requiring Labeling

    Science.gov (United States)

    2010-01-01

    ... Samarium-151 10 Samarium-153 100 Samarium-155 1,000 Samarium-156 1,000 Europium-145 100 Europium-146 100 Europium-147 100 Europium-148 10 Europium-149 100 Europium-150 (12.62h) 100 Europium-150 (34.2y) 1 Europium-152m 100 Europium-152 1 Europium-154 1 Europium-155 10 Europium-156 100 Europium-157 100 Europium-158 1...

  5. CD154: An Immunoinflammatory Mediator in Systemic Lupus Erythematosus and Rheumatoid Arthritis

    Science.gov (United States)

    Alaaeddine, Nada; Hassan, Ghada S.; Yacoub, Daniel; Mourad, Walid

    2012-01-01

    Systemic lupus erythematosus and rheumatoid arthritis are two major chronic inflammatory autoimmune diseases with significant prevalence rates among the population. Although the etiology of these diseases remains unresolved, several evidences support the key role of CD154/CD40 interactions in initiating and/or propagating these diseases. The discovery of new receptors (αIIbβ3, α5β1, and αMβ2) for CD154 has expanded our understanding about the precise role of this critical immune mediator in the physiopathology of chronic inflammatory autoimmune diseases in general, and in systemic lupus erythematosus and rheumatoid arthritis in particular. This paper presents an overview of the interaction of CD154 with its various receptors and outlines its role in the pathogenesis of systemic lupus erythematosus and rheumatoid arthritis. Moreover, the potential usefulness of various CD154-interfering agents in the treatment and prevention of these diseases is also discussed. PMID:22110533

  6. CD154: An Immunoinflammatory Mediator in Systemic Lupus Erythematosus and Rheumatoid Arthritis

    Directory of Open Access Journals (Sweden)

    Nada Alaaeddine

    2012-01-01

    Full Text Available Systemic lupus erythematosus and rheumatoid arthritis are two major chronic inflammatory autoimmune diseases with significant prevalence rates among the population. Although the etiology of these diseases remains unresolved, several evidences support the key role of CD154/CD40 interactions in initiating and/or propagating these diseases. The discovery of new receptors (αIIbβ3, α5β1, and αMβ2 for CD154 has expanded our understanding about the precise role of this critical immune mediator in the physiopathology of chronic inflammatory autoimmune diseases in general, and in systemic lupus erythematosus and rheumatoid arthritis in particular. This paper presents an overview of the interaction of CD154 with its various receptors and outlines its role in the pathogenesis of systemic lupus erythematosus and rheumatoid arthritis. Moreover, the potential usefulness of various CD154-interfering agents in the treatment and prevention of these diseases is also discussed.

  7. Abnormal CD40 Ligand (CD154) Expression in Human Immunodeficiency Virus-Infected Children

    Science.gov (United States)

    O'Gorman, Maurice R. G.; DuChateau, Brian; Paniagua, Mary; Hunt, Janelle; Bensen, Nicolas; Yogev, Ram

    2001-01-01

    The CD40 ligand (CD154), expressed primarily on activated CD4-positive T cells, is a costimulatory molecule involved in B-cell proliferation, germinal center formation, and immunoglobulin class switching. Since B-cell abnormalities including hypergammaglobulinemia and abnormal antibody-specific immune responses are prominent and occur early during the course of pediatric human immunodeficiency virus (HIV) infection, we measured the baseline levels and the induced levels of expression of CD154 on CD3+ CD8− (T helper cells) in HIV-infected children and uninfected children born to HIV-positive mothers. The percentage of CD154+ T helper cells activated in vitro and the level of CD154 expressed per T helper cell (mean fluorescent channel [MFC]) were significantly lower in the HIV-infected children than in the uninfected control group (77% ± 3% versus 89% ± 1%, respectively [P CD154 expressed on resting T helper cells in the HIV-infected group were not significantly different from the levels observed in the control group. In the HIV-infected children, the level of CD154 on activated T helper cells correlated with the level of immunodeficiency, as assessed by the CD4 T-cell levels (correlation coefficient [r] = 0.707, P = 0.003), but did not correlate with the viral load or with any of the serum immunoglobulin concentrations measured in this group of HIV-infected children. The baseline level of CD154 expressed on T helper cells did, however, correlate with the concentration of immunoglobulin A in serum. We conclude that HIV-infected children have impaired regulation of CD154 expression which may contribute to the immune dysregulation commonly observed. PMID:11687447

  8. The CD40-CD154 co-stimulation pathway mediates innate immune injury in adriamycin nephrosis.

    Science.gov (United States)

    Lee, Vincent W S; Qin, Xiaohong; Wang, Yiping; Zheng, Guoping; Wang, Ya; Wang, Ying; Ince, Jon; Tan, Thian K; Kairaitis, Lukas K; Alexander, Stephen I; Harris, David C H

    2010-03-01

    Blockade of CD40-CD40 ligand (CD154) interactions protects against renal injury in adriamycin nephropathy (AN) in immunocompetent mice. To investigate whether this protection relied on adaptive or cognate immunity, we tested the effect of CD40-CD154 blockade in severe combined immunodeficient (SCID) mice. SCID mice were divided into three groups: normal, AN + hamster IgG (ADR+IgG group) and AN + anti-CD154 antibody (MR1) (ADR+MR1 group). AN was induced by tail vein injection of 5.2 mg/kg of adriamycin (ADR). Hamster IgG (control Ab) or MR1 was administered intraperitoneally on days 5, 7, 9 and 11 after ADR injection. Histological and functional data were collected 4 weeks after ADR injection. In vitro experiments tested the effect of soluble and cell-bound CD154 co-cultured with CD40-expressing cells [macrophages, mesangial cells and renal tubular epithelial cells (RTEC)]. All experimental animals developed nephropathy. Compared to the ADR+IgG group, ADR+MR1 animals had significantly less histological injury (glomerulosclerosis and tubular atrophy) and functional injury (creatinine clearance). Kidneys of ADR+MR1 animals had significantly less macrophage infiltration than those of ADR+IgG animals. Interestingly, expression of CD40 and CD41 (a platelet-specific marker) was significantly less in ADR+MR1 animals compared to ADR+IgG animals. In vitro, CD154 blockade significantly attenuated upregulation of CCL2 gene expression by RTEC stimulated by activated macrophage-conditioned medium. In contrast, platelet-induced upregulation of macrophage and mesangial cell proinflammatory cytokine gene expression were not CD154-dependent. CD40-CD154 blockade has a significant innate renoprotective effect in ADR nephrosis. This is potentially due to inhibition of macrophage-derived soluble CD154.

  9. Deficiencies in the CD40 and CD154 receptor-ligand system reduce experimental lung metastasis.

    Science.gov (United States)

    Ingersoll, Susan Blaydes; Langer, Florian; Walker, Jamie M; Meyer, Todd; Robson, Theresa; Amaya, Mildred; Desai, Hina; Francis, John L; Amirkhosravi, Ali

    2009-01-01

    It is established that experimental metastasis requires platelet activity. CD154 expressed on and released from activated platelets induces an inflammatory response in endothelial cells and monocytes, including tissue factor production. CD154 has also been shown to activate platelets in vitro and promote thrombus stability in vivo. These CD154 effects may be mediated, at least in part, by CD40 signaling on platelets and vascular endothelial cells. We have previously demonstrated prolonged bleeding and PFA-100 closure times in mice deficient for Cd154 or its receptor Cd40. In the present study, we hypothesized that Cd40 and Cd154 promote lung tumor formation in experimental metastasis in mice. We created mice doubly deficient in Cd40 and Cd154 (Dbl KO) and found them to be both fertile and viable. Injected tumor cells seeded poorly in mice deficient in Cd40 or Cd154, as well as Dbl KO, compared to wild-type mice. We sought to determine whether blood-borne Cd40 versus endothelial Cd40 contribute differentially to reduced experimental lung metastasis, as observed in Cd40 deficient mice. By bone marrow transplantation, we created mice deficient for Cd40 either in the blood compartment but not in the endothelium, or vice versa. We found that mice deficient in blood compartment Cd40 had fewer lung nodules compared to wild-type mice and mice deficient in endothelial Cd40. Our findings suggest an important contribution of the Cd40-Cd154 pathway to experimental lung metastasis. Furthermore, the data points to a selective role for peripheral blood cell Cd40 in this process.

  10. Highly CO2-Tolerant Cathode for Intermediate-Temperature Solid Oxide Fuel Cells: Samarium-Doped Ceria-Protected SrCo0.85Ta0.15O3-δ Hybrid.

    Science.gov (United States)

    Li, Mengran; Zhou, Wei; Zhu, Zhonghua

    2017-01-25

    Susceptibility to CO2 is one of the major challenges for the long-term stability of the alkaline-earth-containing cathodes for intermediate-temperature solid oxide fuel cells. To alleviate the adverse effects from CO2, we incorporated samarium-stabilized ceria (SDC) into a SrCo0.85Ta0.15O3-δ (SCT15) cathode by either mechanical mixing or a wet impregnation method and evaluated their cathode performance stability in the presence of a gas mixture of 10% CO2, 21% O2, and 69% N2. We observed that the CO2 tolerance of the hybrid cathode outperforms the pure SCT15 cathode by over 5 times at 550 °C. This significant enhancement is likely attributable to the low CO2 adsorption and reactivity of the SDC protective layer, which are demonstrated through thermogravimetric analysis, energy-dispersive spectroscopy, and electrical conductivity study.

  11. [Effect of ICOS signaling on CD154/CD40 expressions in mice infected with Schistosoma japonicum].

    Science.gov (United States)

    Wang, Yu; Cai, Ru; Xia, Chao-ming

    2015-08-01

    To explore the effect of ICOS signaling on the CD154/CD40 expressions and immunopathology in mice infected with Schistosoma japonicum. ICOS transgenic (ICOS-Tg) mice and wildtype FVB/NJ mice were used as experimental schistosomiasis models. The expressions of CD154 and CD40 on splenocytes and on inflammatory cells around granulomatous infiltration of the liver in the mice infected with S. japonicuin were detected by flow cytometry and im- munohistochemical staining. HE staining was applied to observe the changes on the granulomatous of the mice liver. Compared with the wildtype FVB/NJ mice, the expressions of CD154 on CD4 T splenocytes and of CD40 on CD19' B splenocytes in the ICOS-Tg mice significantly increased in 12 and 16 weeks post-infection (all P CD154 on inflammatory cells around granulomatous infiltration in the liver of the ICOS-Tg mice were significantly higher than those of the wildtype FVB/NJ mice in 7, 12, 16 and 20 weeks post-infection (all P CD154/CD40 expressions, and may play an important role in the hepatic egg granuloma formation of schistosomiasis.

  12. Ferrites Ni{sub 0,5}Zn{sub 0,5}Fe{sub 2}O{sub 4} doped with samarium: structural analysis, morphological and electromagnetic; Ferritas Ni{sub 0,5}Zn{sub 0,5}Fe{sub 2}O{sub 4} dopada com samario: analise estrutural, morfologica e eletromagnetica

    Energy Technology Data Exchange (ETDEWEB)

    Costa, A.C.F.M.; Diniz, A.P., E-mail: anacristina@dema.ufcg.edu.br [Universidade Federal de Campina Grande (UFCG), PB (Brazil). Unidade Academinca de Engenharia de Materiais; Viana, K.M.S. [Universidade Federal do Rio Grande do Norte (UFRN), Natal, PE (Brazil). Escola de Ciencias e Tecnologia; Cornejo, D.R. [Universidade de Sao Paulo (USP), SP (Brazil). Instituto de Fisica; Kiminami, R.H.G.A. [Universidade Federal de Sao Carlos (UFSCar), SP (Brazil). Departamento de Engenharia de Materiais

    2010-07-01

    This paper proposes to investigate the sintering at 1200 deg C/2h of Ni{sub 0.5}Zn{sub 0.5}Fe{sub 2-x}Sm{sub x}O{sub 4} ferrite doped with 0.05; 0.075 e 0.1 mol of Sm synthesized by combustion reaction to evaluate the performance materials as absorbers of electromagnetic radiation. The influence of the concentration of samarium on the structure, morphology and electromagnetic properties of ferrites was studied. The resulting samples were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), magnetic measurements and reflectivity measurements in the frequency range between 8-12 GHz. The results showed that increasing the concentration of samarium caused a decrease in particle size of the samples, encouraging, therefore, to obtain materials with better values of magnetization and reflectivity, allowing for use as absorbers in narrow-band frequency between 9-10 GHz. (author)

  13. 46 CFR 154.540 - Quick-closing shut-off valves: Emergency shut-down system.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Quick-closing shut-off valves: Emergency shut-down... shut-down system. The quick-closing shut-off valves under §§ 154.530, 154.532, and 154.538 must have an emergency shut-down system that: (a) Closes all the valves; (b) Is actuated by a single control in at least...

  14. Novel insights into anti-CD40/CD154 immunotherapy in transplant tolerance.

    Science.gov (United States)

    Pinelli, David F; Ford, Mandy L

    2015-01-01

    Since the discovery of the CD40-CD154 costimulatory pathway and its critical role in the adaptive immune response, there has been considerable interest in therapeutically targeting this interaction with monoclonal antibodies in transplantation. Unfortunately, initial promise in animal models gave way to disappointment in clinical trials following a number of thromboembolic complications. However, recent mechanistic studies have identified the mechanism of these adverse events, as well as detailed a myriad of interactions between CD40 and CD154 on a wide variety of immune cell types and the critical role of this pathway in generating both humoral and cell-mediated alloreactive responses. This has led to resurgence in interest and the potential resurrection of anti-CD154 and anti-CD40 antibodies as clinically viable therapeutic options.

  15. A hydrophobic patch surrounding Trp154 in human neuroserpin controls the helix F dynamics with implications in inhibition and aggregation

    Science.gov (United States)

    Ali, Mohammad Farhan; Kaushik, Abhinav; Kapil, Charu; Gupta, Dinesh; Jairajpuri, Mohamad Aman

    2017-02-01

    Neuroserpin (NS) mediated inhibition of tissue-type plasminogen activator (tPA) is important for brain development, synapse formation and memory. Aberrations in helix F and β-sheet A movement during inhibition can directly lead to epilepsy or dementia. Conserved W154 residue in a hydrophobic patch between helix F and β-sheet A is ideally placed to control their movement during inhibition. Molecular Dynamics (MD) simulation on wild type (WT) NS and its two variants (W154A and W154P) demonstrated partial deformation in helix F and conformational differences in strands 1A and 2A only in W154P. A fluorescence and Circular Dichroism (CD) analysis with purified W154 variants revealed a significant red-shift and an increase in α-helical content in W154P as compared to W154A and WT NS. Kinetics of tPA inhibition showed a decline in association rates (ka) for W154A as compared to WT NS with indication of complex formation. Appearance of cleaved without complex formation in W154P indicates that the variant acts as substrate due to conformational misfolding around helix F. Both the variants however showed increased rate of aggregation as compared to WT NS. The hydrophobic patch identified in this study may have importance in helix F dynamics of NS.

  16. Barrier distribution from 28Si+154Sm quasielastic scattering: Coupling effects in the fusion process

    Directory of Open Access Journals (Sweden)

    Kaur Gurpreet

    2016-01-01

    Full Text Available Barrier distribution for the 28Si+154Sm system has been extracted from large angle quasielastic scattering measurement to investigate the role of various channel couplings on fusion dynamics. The coupled channel calculations, including the collective excitation of the target and projectile, are observed to reproduce the experimental BD rather well. It seems that the role of neutron transfer, relative to collective excitation, is in fact weak in the 28Si+154Sm system even though it has positive Q-value for neutron transfer channels.

  17. Tumor necrosis factor-α blockade treatment decreased CD154 (CD40-ligand expression in rheumatoid arthritis.

    Directory of Open Access Journals (Sweden)

    Chien-Hsueh Tung

    Full Text Available CD154 (commonly referred to as CD40-ligand is a critical T cell factor that participates in the pathogenesis of autoimmune and is over-expressed in rheumatoid arthritis (RA. TNF-α blockade treatment had dramatic efficacy in RA.To investigate whether TNF-α blockade treatment can inhibit CD154 expression in RA.Blood samples were collected from 33 patients with rheumatoid arthritis before and 3 months after TNF-α blockade treatment. Clinical serological data determined by standard assays and T cell CD154 expression levels determined by flow cytometry were statistically analyzed for these two time points.The percentage of CD154 expression on gated CD4+ T cells of PBMCs from RA patients after 3 months TNF-α blockade treatment was significantly lower than before treatment (2.94 ± 3.21% vs. 7.21 ± 5.64%; p = 0.0001. The disease activity and anti-CCP antibody levels were also significantly reduced after TNF-α blockade treatment. The CD154 expression levels were positively correlated with disease activity index DAS28, and CRP. The post-stimulated CD154 expression percentage of purified CD4+ T cells between baseline and after TNF-α blockade treatment was not significantly different (p = 0.221. Baseline CD154 levels were positively correlated with treatment-induced changes in DAS28 (p = 0.014; r2 = 0.187.TNF-α blockade treatment significantly decreased the CD154 expression on CD4+ T cells, disease activity and anti-CCP antibody simultaneously in RA patients. However TNF-α blockade did not impair T cell capacity to express CD154 after stimulation. These results suggest that decreased CD154 expression after TNF-α blockade may be due to decreased RA disease activity but not direct inhibition of CD154 responsiveness of T cells.

  18. Tumor necrosis factor-α blockade treatment decreased CD154 (CD40-ligand) expression in rheumatoid arthritis.

    Science.gov (United States)

    Tung, Chien-Hsueh; Lu, Ming-Chi; Lai, Ning-Sheng; Wu, Shu-Fen

    2017-01-01

    CD154 (commonly referred to as CD40-ligand) is a critical T cell factor that participates in the pathogenesis of autoimmune and is over-expressed in rheumatoid arthritis (RA). TNF-α blockade treatment had dramatic efficacy in RA. To investigate whether TNF-α blockade treatment can inhibit CD154 expression in RA. Blood samples were collected from 33 patients with rheumatoid arthritis before and 3 months after TNF-α blockade treatment. Clinical serological data determined by standard assays and T cell CD154 expression levels determined by flow cytometry were statistically analyzed for these two time points. The percentage of CD154 expression on gated CD4+ T cells of PBMCs from RA patients after 3 months TNF-α blockade treatment was significantly lower than before treatment (2.94 ± 3.21% vs. 7.21 ± 5.64%; p = 0.0001). The disease activity and anti-CCP antibody levels were also significantly reduced after TNF-α blockade treatment. The CD154 expression levels were positively correlated with disease activity index DAS28, and CRP. The post-stimulated CD154 expression percentage of purified CD4+ T cells between baseline and after TNF-α blockade treatment was not significantly different (p = 0.221). Baseline CD154 levels were positively correlated with treatment-induced changes in DAS28 (p = 0.014; r2 = 0.187). TNF-α blockade treatment significantly decreased the CD154 expression on CD4+ T cells, disease activity and anti-CCP antibody simultaneously in RA patients. However TNF-α blockade did not impair T cell capacity to express CD154 after stimulation. These results suggest that decreased CD154 expression after TNF-α blockade may be due to decreased RA disease activity but not direct inhibition of CD154 responsiveness of T cells.

  19. A microscopic study of deformation systematics in 154− 166Dy ...

    Indian Academy of Sciences (India)

    The Hartree–Bogoliubov (HB) framework of calculations has been applied for calculating various nuclear structure quantities for 154−166Dy mass chains. In this framework, the intrinsic quadrupole moments, the low-lying yrast states ( E 2 + and E 4 + ) and occupation numbers for various shell model orbits have been ...

  20. Dual function of the hemagglutinin H5 fused to chicken CD154 in a ...

    African Journals Online (AJOL)

    Dual function of the hemagglutinin H5 fused to chicken CD154 in a potential strategy of DIVA against avian influenza disease: preliminary study. AG Pose, ES Rodriguez, AC Mendez, JN Gomez, AV Redondo, ER Rodriguez, EMG Ramos, AA Gutierrez, MPR Molto, DG Roche, YS Ugalde, AM Lopez ...

  1. 40 CFR 154.5 - Burden of persuasion in determinations under this part.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Burden of persuasion in determinations... (CONTINUED) PESTICIDE PROGRAMS SPECIAL REVIEW PROCEDURES General Provisions § 154.5 Burden of persuasion in... principle that the burden of persuasion that a pesticide product is entitled to registration or continued...

  2. A microscopic study of deformation systematics in 154−166Dy ...

    Indian Academy of Sciences (India)

    A microscopic study of deformation systematics in 154−166Dy isotopes. AMITA DUA, ARUN BHARTI. ∗ and S K KHOSA. Department of Physics, University of Jammu, Jammu & Kashmir 180 006, India. ∗. Corresponding Author. E-mail: arunbharti 2003@yahoo.co.in. MS received 30 March 2006; revised 9 March 2007; ...

  3. 5 CFR 1201.154 - Time for filing appeal; closing record in cases involving grievance decisions.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Time for filing appeal; closing record in... Allegations of Discrimination § 1201.154 Time for filing appeal; closing record in cases involving grievance... matter otherwise appealable to the Board must comply with the following time limits: (a) Where the...

  4. 32 CFR Appendix C to Part 154 - Tables for Requesting Investigations

    Science.gov (United States)

    2010-07-01

    ... the Award Forces Before appointment (after appointment for health professionals, chaplains, and attorneys, under conditions authorized by § 154.15(d) of this part). Naval Academy Midshipman, Military Academy Cadet, or Air Force Academy Cadet Enrollment To be initiated 90 days after entry. Reserve Officer...

  5. Characterization of human papillomavirus type 154 and tissue tropism of gammapapillomaviruses.

    Science.gov (United States)

    Ure, Agustín Enrique; Forslund, Ola

    2014-01-01

    The novel human papillomavirus type 154 (HPV154) was characterized from a wart on the crena ani of a three-year-old boy. It was previously designated as the putative HPV type FADI3 by sequencing of a subgenomic FAP amplicon. We obtained the complete genome by combined methods including rolling circle amplification (RCA), genome walking through an adapted method for detection of integrated papillomavirus sequences by ligation-mediated PCR (DIPS-PCR), long-range PCR, and finally by cloning of four overlapping amplicons. Phylogenetically, the HPV154 genome clustered together with members of the proposed species Gammapapillomavirus 11, and demonstrated the highest identity in L1 to HPV136 (68.6%). The HPV154 was detected in 3% (2/62) of forehead skin swabs from healthy children. In addition, the different detection sites of 62 gammapapillomaviruses were summarized in order to analyze their tissue tropism. Several of these HPV types have been detected from multiple sources such as skin, oral, nasal, and genital sites, suggesting that the gammapapillomaviruses are generalists with a broader tissue tropism than previously appreciated. The study expands current knowledge concerning genetic diversity and tropism among HPV types in the rapidly growing gammapapillomavirus genus.

  6. 33 CFR Appendix B to Part 154 - Standard Specification for Tank Vent Flame Arresters

    Science.gov (United States)

    2010-07-01

    ... be qualified in accordance with section IX of the ASME Code. 8.7The design of flame arresters shall... section VIII, Division 1, Pressure Vessels; section IX, Welding and Brazing Qualifications. 3.3... 1155 (incorporated by reference, see § 154.106), or section VIII, Division 1 of the ASME Boiler and...

  7. 32 CFR 154.8 - Types and scope of personnel security investigations.

    Science.gov (United States)

    2010-07-01

    ... in § 154.19(a) and other national directives, certain categories of duties, clearance, and access... Manager, S-2, Counterintelligence Specialist, Personnel Security Specialist, or Personnel Officer); or... “Personal Interview Conducted by (cite the duty assignment of the designated official (e.g., Commander...

  8. THE ANGULAR-MOMENTUM DEPENDENCE OF THE GIANT-DIPOLE RESONANCE IN DY-154

    NARCIS (Netherlands)

    NOORMAN, RF; BACELAR, JC; HARAKEH, MN; HESSELINK, WHA; HOFMANN, HJ; Kalantar-Nayestanaki, Nasser; VANSCHAGEN, JPS; STOLK, A; SUJKOWSKI, Z; DEVOIGT, MJA; VANDERWOUDE, A

    1994-01-01

    The statistical gamma-ray decay of the compound nucleus 154Dy* formed at an excitation energy of 69 MeV is studied in three angular-momentum windows [J] = 31,42 and 50h. The GDR strength function extracted from the data indicates a constant centroid energy for the resonance E(GDR) = 15.2 +/- 0.5

  9. CD154 Blockade Results in Transient Reduction in Theiler's Murine Encephalomyelitis Virus-Induced Demyelinating Disease

    OpenAIRE

    Howard, Laurence M.; Neville, Katherine L.; Haynes, Lia M.; Dal Canto, Mauro C.; Miller, Stephen D

    2003-01-01

    Transient CD154 blockade at the onset of Theiler's murine encephalomyelitis virus-induced demyelinating disease ameliorated disease progression for 80 days, reduced immune cell infiltration, and transiently increased viral loads in the central nervous system. Peripheral antiviral and autoimmune T-cell responses were normal, and disease severity returned to control levels by day 120.

  10. IL-2 and IL-15 regulate CD154 expression on activated CD4 T cells

    DEFF Research Database (Denmark)

    Skov, S; Bonyhadi, M; Odum, Niels

    2000-01-01

    activated CD4 T cells could respond to IL-2, or the related cytokine IL-15, by de novo CD154 production and expression without requiring an additional signal from CD3 and CD28. These results provide evidence that CD28 costimulation of CD4 T cells, through autocrine IL-2 production, maintains high levels...

  11. 38 CFR 17.154 - Dog-guides and equipment for blind.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Dog-guides and equipment... AFFAIRS MEDICAL Prosthetic, Sensory, and Rehabilitative Aids § 17.154 Dog-guides and equipment for blind... disability may be furnished a trained dog-guide. In addition, they may be furnished necessary travel expense...

  12. 32 CFR 154.35 - Personal data provided by the subject of the investigation.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Personal data provided by the subject of the... Investigations § 154.35 Personal data provided by the subject of the investigation. (a) To conduct the required investigation, it is necessary that the investigative agency be provided certain relevant data concerning the...

  13. 18 CFR 154.208 - Service of tariff filings on customers and other parties.

    Science.gov (United States)

    2010-04-01

    ... SCHEDULES AND TARIFFS Procedures for Changing Tariffs § 154.208 Service of tariff filings on customers and... customers and state regulatory commissions that have made a standing request for such service. (c) Within... section, service upon the designated recipient will be deemed service upon the customer or other party. (e...

  14. 30 CFR 250.154 - What identification signs must I display?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What identification signs must I display? 250... Facilities and Wells (does Not Include Modus) § 250.154 What identification signs must I display? (a) You... maintained in a legible condition. (1) You must display an identification sign that can be viewed from the...

  15. Selective steroid oxyfunctionalisation by CYP154C5, a bacterial cytochrome P450

    Science.gov (United States)

    2013-01-01

    Background Cytochrome P450 monooxygenases – able to regio- and stereoselectively hydroxylate non-activated carbon atoms – are important enzymes for the synthesis of valuable intermediates in the production of steroid hormones in the pharmaceutical industry. However, up to now only a few bacterial enzymes able to hydroxylate steroids have been reported. CYP154C5 from Nocardia farcinica IFM 10152, a bacterial P450 monooxygenase, was previously shown to convert testosterone to 16α-hydroxytestosterone. Since the hydroxylation at 16α-position is of special interest for the pharmaceutical industry, we have studied this enzyme in more detail to investigate its activity and selectivity in bioconversions of further steroids. Results CYP154C5 was coexpressed in Escherichia coli together with putidaredoxin and putidaredoxin reductase from Pseudomonas putida as redox partners for electron transfer and applied in bioconversions of various pregnanes and androstanes [pregnenolone (1), dehydroepiandrosterone (2), progesterone (3), androstenedione (4), testosterone (5) and nandrolone (6)]. Structure elucidation of the formed products revealed an exclusive regio- and stereoselectivity of CYP154C5, always yielding the corresponding 16α-hydroxylated steroids. Application of whole cells expressing the three components, P450, Pdx and PdR, in steroid biotransformations resulted in significantly higher conversions and total turnover numbers (TTN) compared to reactions using cell-free extracts. Additionally, considerably higher substrate loads (up to 15 mM) were tolerated by the whole-cell system. Furthermore, turnover numbers (TON) were determined for the six different steroids using whole cells. Thus, testosterone was found to be the worst substrate with a TON of only 0.8 μmol substrate consumed min-1 μmol-1 CYP154C5, while progesterone and pregnenolone were converted the fastest resulting in TON of 3.3 μmol substrate consumed min-1 μmol-1 CYP154C5. Conclusion CYP154C5

  16. CD154 induces p73 to overcome the resistance to apoptosis of chronic lymphocytic leukemia cells lacking functional p53

    NARCIS (Netherlands)

    Dicker, Frank; Kater, Arnon P.; Prada, Carlos E.; Fukuda, Tetsuya; Castro, Januario E.; Sun, Guizhen; Wang, Jean Y.; Kipps, Thomas J.

    2006-01-01

    Intravenous infusion of autologous chronic lymphocytic leukemia (CLL) cells transduced with an adenovirus encoding CD40-ligand (CD154) caused rapid reductions in leukemia-cell counts and lymphnode size. We hypothesized that CD40-ligation via CD154 sensitized CLL cells to death-receptor-mediated

  17. 27 CFR 31.154 - Records to be kept by alcohol beverage producers, processors, and bonded warehousemen.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Records to be kept by alcohol beverage producers, processors, and bonded warehousemen. 31.154 Section 31.154 Alcohol, Tobacco... alcohol beverage producers, processors, and bonded warehousemen. Wholesale liquor dealer operations...

  18. 33 CFR 154.T150 - Temporary suspension of requirements to permit support of deepwater horizon spill response.

    Science.gov (United States)

    2010-07-01

    ... requirements to permit support of deepwater horizon spill response. 154.T150 Section 154.T150 Navigation and... support of deepwater horizon spill response. (a) Applicability. This section applies to— (1) Any facility... support of the response to the Deepwater Horizon Spill of National Significance; and (2) Any facility...

  19. 17 CFR 1.54 - Contract market rules submitted to and approved or not disapproved by the Secretary of Agriculture.

    Science.gov (United States)

    2010-04-01

    ... submitted to and approved or not disapproved by the Secretary of Agriculture. 1.54 Section 1.54 Commodity... Secretary of Agriculture. Notwithstanding any provision of these rules, any bylaw, rule, regulation, or resolution of a contract market that was submitted to the Secretary of Agriculture pursuant or § 1.38(a) or...

  20. A polymorphic CD40 ligand (CD154) molecule mediates CD40‐dependent signalling but interferes with the ability of soluble CD40 to functionally block CD154 : CD40 interactions

    Science.gov (United States)

    Barnhart, B; Ford, G S; Bhushan, A; Song, C; Covey, L R

    2000-01-01

    We report the characterization of a naturally occurring polymorphism in CD40 ligand (CD40L, CD154) expressed by activated T cells from a young female patient. This polymorphism encodes a nonconservative Gly → Arg substitution in amino acid 219 in the extracellular, CD40 binding domain of the molecule. Studies carried out with 293 epithelial cells ectopically expressing the polymorphic protein (CD154/G219R) revealed reduced levels of binding to different anti‐CD154 monoclonal antibodies (mAb) and CD40‐immunoglobulin (CD40‐Ig). However, recognition of the polymorphic and wild‐type CD154 molecules by a polyclonal antiserum was comparable, suggesting that the polymorphism affects the ability of the protein to interact with CD40 but does not significantly alter its surface expression. To determine if reduced cross‐linking of CD40 mediated decreased functional effects, three CD40‐dependent properties were measured. We found that pathways leading to the induction of surface CD23, CD80, and Iγ transcription were activated in response to CD154/G219R signalling. However, the decrease in affinity for CD40 by the mutated CD154 affected the ability of CD40‐Ig to efficiently interfere with the binding and effectively block induced CD80 expression. In contrast, we found that the 5c8 mAb, which recognized the polymorphic molecule to a similar extent as wild‐type CD154, effectively blocked the interaction between CD154/G219R and CD40 as measured by CD80 expression. These findings suggest that naturally occurring polymorphisms in the CD154 molecule may affect the ability of CD40‐mediated functions to be blocked by soluble CD40 or anti‐CD154 mAb in the therapeutic treatment of disease and graft rejection. PMID:10651941

  1. Retrospective evaluation of bone pain palliation after samarium-153-EDTMP therapy Avaliação retrospectiva do tratamento da dor óssea metastática com Samário-153-EDTMP

    Directory of Open Access Journals (Sweden)

    Marcelo Tatit Sapienza

    2004-01-01

    Full Text Available PURPOSE: The aim of this study was to evaluate the degree of metastatic bone pain palliation and medullar toxicity associated with samarium-153-EDTMP treatment. METHODS: Seventy-three patients with metastatic bone pain having previously undergone therapy with samarium-153-EDTMP (1 mCi/kg were retrospectively evaluated. Routine follow-up included pain evaluation and blood counts for 2 months after treatment. Pain was evaluated using a subjective scale (from 0 to 10 before and for 8 weeks after the treatment. Blood counts were obtained before treatment and once a week for 2 months during follow-up. Dosimetry, based upon the urinary excretion of the isotope, was estimated in 41 individuals, and the resulting radiation absorbed doses were correlated with hematological data. RESULTS: Reduction in pain scores of 75% to 100% was obtained in 36 patients (49%, with a decrease of 50% to 75%, 25% to 50%, and 0% to 25% in, respectively, 20 (27%, 10 (14%, and 7 (10% patients. There was no significant relationship between the pain response and location of the primary tumor (breast or prostate cancer. Mild to moderate myelosuppression was noted in 75.3% of patients, usually with hematological recovery at 8 weeks. The mean bone marrow dose was 347 ± 65 cGy, and only a weak correlation was found between absorbed dose and myelosuppression (Pearson coefficient = .4. CONCLUSIONS: Samarium-153-EDTMP is a valuable method for metastatic bone pain palliation. A mild to moderate and transitory myelosuppression is the main toxicity observed after samarium therapy, showing a weak correlation with dosimetric measures.OBJETIVO: O presente trabalho teve por objetivo avaliar o efeito paliativo da dor e a toxicidade medular associados ao tratamento com Samário-153-EDTMP em pacientes com metástases ósseas. MÉTODOS: O estudo foi realizado de forma retrospectiva, a partir do levantamento de prontuário de 178 pacientes submetidos a tratamento com 1mCi/kg de 153Sm

  2. The dynamics of the laser-induced metal-semiconductor phase transition of samarium sulfide (SmS); Die Dynamik des laserinduzierten Metall-Halbleiter-Phasenuebergangs von Samariumsulfid (SmS)

    Energy Technology Data Exchange (ETDEWEB)

    Kaempfer, Tino

    2009-12-15

    The present thesis is dedicated to the experimental study of the metal-semiconductor phase transition of samarium sulfide (SmS): Temperature- and time-resolved experiments on the characterization of the phase transition of mixed-valence SmS samples (M-SmS) are presented. The measurement of the dynamics of the laser-induced phase transition pursues via time-resolved ultrashort-time microscopy and by X-ray diffraction with sub-picosecond time resolution. The electronic and structural processes, which follow an excitation of M-SmS with infrared femtosecond laser pulses, are physically interpreted on the base of the results obtained in this thesis and model imaginations. [German] Die vorliegende Arbeit ist der experimentellen Untersuchung des Metall-Halbleiter-Phasenuebergangs von Samariumsulfid (SmS) gewidmet. Es werden temperatur- und zeitaufgeloeste Experimente zur Charakterisierung des Phasenuebergangs gemischt-valenter SmS Proben (M-SmS) vorgestellt. Die Messung der Dynamik des laserinduzierten Phasenuebergangs erfolgt ueber zeitaufgeloeste Ultrakurzzeit-Mikroskopie und durch Roentgenbeugung mit subpikosekunden Zeitaufloesung. Die elektronischen und strukturellen Prozesse, welche einer Anregung von M-SmS mit infraroten Femtosekunden-Laserpulsen folgen, werden auf der Basis der in dieser Arbeit gewonnenen Ergebnisse und Modellvorstellungen physikalisch interpretiert. (orig.)

  3. Crystallographic and Mutational Analysis of the CD40-CD154 Complex and Its Implications for Receptor Activation*

    Science.gov (United States)

    An, Hyun-Jung; Kim, Young Jin; Song, Dong Hyun; Park, Beom Suk; Kim, Ho Min; Lee, Ju Dong; Paik, Sang-Gi; Lee, Jie-Oh; Lee, Hayyoung

    2011-01-01

    CD40 is a tumor necrosis factor receptor (TNFR) family protein that plays an important role in B cell development. CD154/CD40L is the physiological ligand of CD40. We have determined the crystal structure of the CD40-CD154 complex at 3.5 Å resolution. The binding site of CD40 is located in a crevice formed between two CD154 subunits. Charge complementarity plays a critical role in the CD40-CD154 interaction. Some of the missense mutations found in hereditary hyper-IgM syndrome can be mapped to the CD40-CD154 interface. The CD40 interaction area of one of the CD154 subunits is twice as large as that of the other subunit forming the binding crevice. This is because cysteine-rich domain 3 (CRD3) of CD40 has a disulfide bridge in an unusual position that alters the direction of the ladder-like structure of CD40. The Ser132 loop of CD154 is not involved in CD40 binding but its substitution significantly reduces p38- and ERK-dependent signaling by CD40, whereas JNK-dependent signaling is not affected. These findings suggest that ligand-induced di- or trimerization is necessary but not sufficient for complete activation of CD40. PMID:21285457

  4. CD40/CD154 Blockade Inhibits Dendritic Cell Expression of Inflammatory Cytokines but not Costimulatory Molecules1

    Science.gov (United States)

    Ferrer, Ivana R.; Liu, Danya; Pinelli, David F.; Koehn, Brent H.; Stempora, Linda L.; Ford, Mandy L.

    2012-01-01

    Blockade of the CD40/CD154 pathway remains one of the most effective means of promoting graft survival following transplantation. However, the effects of CD40/CD154 antagonsim on dendritic cell (DC) phenotype and functionality following transplantation remain incompletely understood. To dissect the effects of CD154/CD40 blockade on DC activation in vivo, we generated hematopoietic chimeras in mice that expressed a surrogate minor antigen (OVA). Adoptive transfer of OVA-specific CD4+ and CD8+ T cells led to chimerism rejection, which was inhibited by treatment with CD154 blockade. Surprisingly, CD154 antagonism did not alter the expression of MHC and costimulatory molecules on CD11c+ DC compared to untreated controls. However, DCs isolated from anti-CD154 treated animals exhibited a significant reduction in inflammatory cytokine secretion. Combined blockade of inflammatory cytokines IL-6 and IL-12p40 attenuated the expansion of antigen-specific CD4+ and CD8+ T cells and transiently inhibited the rejection of OVA-expressing cells. These results suggest that a major effect of CD154 antagonism in vivo is an impairment in the provision of signal three during donor-reactive T cell programming, as opposed to an impact on the provision of signal two. We conclude that therapies designed to target inflammatory cytokines during donor-reactive T cell activation may be beneficial in attenuating these responses and prolonging graft survival. PMID:23002440

  5. Relationship between metalloproteinase 2 and 9 concentrations and soluble CD154 expression in Iranian patients with multiple sclerosis

    Directory of Open Access Journals (Sweden)

    Javad Sanchooli

    2014-05-01

    Full Text Available Matrix metalloproteinases (MMPs play a critical role in the blood–brain barrier permeability and in invasion of the leukocytes into the central nervous system during multiple sclerosis (MS. In this respect, in the present study, we have evaluated the possible role of MMP-9 and MMP-2 on the expression of soluble CD154 (sCD154 and membrane-bound isoform of the CD154 in Iranian MS patients. The expressions of the aforementioned protein-related genes were analyzed at the levels of messenger RNA and proteins by real-time reverse transcription polymerase chain reaction, enzyme-linked immunosorbent assay, and Western blotting. The results showed a high expression of CD154 isoforms, MMP-9 and MMP-2, in MS patients in contrast to controls (p 3-fold in patients with a higher MMPs/tissue inhibitor of metalloproteinase 1 (TIMP-1 ratio. Furthermore, secondary-progressive MS patients with exacerbate period showed higher positive correlation between increasing sCD154 concentration and overexpression of MMP-2 (p < 0.001. Our data demonstrate that following the exacerbation period, sCD154 concentration is increased in patients, which is mutually related to the MMPs/TIMP-1 ratio. This relationship may represent a new link between sCD154 concentration and the MMPs/TIMP-1 ratio with prognostic implications.

  6. Platelet-associated CD40/CD154 mediates remote tissue damage after mesenteric ischemia/reperfusion injury.

    Directory of Open Access Journals (Sweden)

    Peter H Lapchak

    Full Text Available Several innate and adaptive immune cell types participate in ischemia/reperfusion induced tissue injury. Amongst them, platelets have received little attention as contributors in the process of tissue damage after ischemia reperfusion (I/R injury. It is currently unknown whether platelets participate through the immunologically important molecules including, CD40 and when activated, CD154 (CD40L, in the pathogenesis of I/R injury. We hypothesized that constitutive expression of CD40 and activation-induced expression of CD154 on platelets mediate local mesenteric and remote lung tissue damage after I/R injury. Wild type (WT; C57BL/6J, CD40 and CD154 deficient mice underwent mesenteric ischemia for 30 minutes followed by reperfusion for 3 hours. WT mice subjected to mesenteric I/R injury displayed both local intestinal and remote lung damage. In contrast, there was significantly less intestinal damage and no remote lung injury in CD40 and CD154 deficient mice when compared to WT mice. Platelet-depleted WT mice transfused with platelets from CD40 or CD154 deficient mice failed to reconstitute remote lung damage. In contrast, when CD40 or CD154 deficient mice were transfused with WT platelets lung tissue damage was re-established. Together, these findings suggest that multiple mechanisms are involved in local and remote tissue injury and also identify platelet-expressed CD40 and/or CD154 as mediators of remote tissue damage.

  7. Crystallographic and mutational analysis of the CD40-CD154 complex and its implications for receptor activation.

    Science.gov (United States)

    An, Hyun-Jung; Kim, Young Jin; Song, Dong Hyun; Park, Beom Suk; Kim, Ho Min; Lee, Ju Dong; Paik, Sang-Gi; Lee, Jie-Oh; Lee, Hayyoung

    2011-04-01

    CD40 is a tumor necrosis factor receptor (TNFR) family protein that plays an important role in B cell development. CD154/CD40L is the physiological ligand of CD40. We have determined the crystal structure of the CD40-CD154 complex at 3.5 Å resolution. The binding site of CD40 is located in a crevice formed between two CD154 subunits. Charge complementarity plays a critical role in the CD40-CD154 interaction. Some of the missense mutations found in hereditary hyper-IgM syndrome can be mapped to the CD40-CD154 interface. The CD40 interaction area of one of the CD154 subunits is twice as large as that of the other subunit forming the binding crevice. This is because cysteine-rich domain 3 (CRD3) of CD40 has a disulfide bridge in an unusual position that alters the direction of the ladder-like structure of CD40. The Ser(132) loop of CD154 is not involved in CD40 binding but its substitution significantly reduces p38- and ERK-dependent signaling by CD40, whereas JNK-dependent signaling is not affected. These findings suggest that ligand-induced di- or trimerization is necessary but not sufficient for complete activation of CD40.

  8. Association between Serum Soluble CD154 Levels and Mortality in Patients with Malignant Middle Cerebral Artery Infarction

    Directory of Open Access Journals (Sweden)

    Leonardo Lorente

    2015-05-01

    Full Text Available Background: CD154 and its soluble counterpart (sCD154 are proteins of the tumor necrosis factor (TNF family and exhibit proinflamatory and procoagulant properties. Higher circulating sCD154 levels have been found in ischemic stroke patients than in controls. However, the association between circulating sCD154 levels and mortality in ischemic stroke patients has not been reported, and was the focus of this study. Methods: This was a multicenter, observational and prospective study carried out in six Spanish Intensive Care Units. We measured serum sCD154 from 50 patients with severe malignant middle cerebral artery infarction (MMCAI, defined as Glasgow Coma Scale (GCS lower than 9, at the moment of the severe MMCAI diagnosis and from 50 healthy controls. The end-point of the study was 30-day mortality. Results: We found higher serum sCD154 levels in patients with severe MMCAI than in healthy controls (p < 0.001. We found higher serum sCD154 levels (p < 0.001 in non-surviving (n = 26 than in surviving MMCAI patients (n = 24. Multiple binomial logistic regression analysis showed that serum sCD154 levels >1.41 ng/mmL were associated with 30-day mortality (OR = 10.25; 95% CI = 2.34–44.95; p = 0.002. Conclusions: The new more important finding of our study was that serum sCD154 levels in MMCAI patients were associated with mortality.

  9. Update on CD40 and CD154 blockade in transplant models.

    Science.gov (United States)

    Zhang, Tianshu; Pierson, Richard N; Azimzadeh, Agnes M

    2015-01-01

    Generation of an effective immune response against foreign antigens requires two distinct molecular signals: a primary signal provided by the binding of antigen-specific T-cell receptor to peptide-MHC on antigen-presenting cells and a secondary signal delivered via the engagement of costimulatory molecules. Among various costimulatory signaling pathways, the interactions between CD40 and its ligand CD154 have been extensively investigated given their essential roles in the modulation of adaptive immunity. Here, we review current understanding of the role CD40/CD154 costimulation pathway has in alloimmunity, and summarize recent mechanistic and preclinical advances in the evaluation of candidate therapeutic approaches to target this receptor-ligand pair in transplantation.

  10. Thermoregulation in unrestrained rats during and after exposure to 1.5-4 G

    Science.gov (United States)

    Giacchino, J.; Horwitz, B. A.; Horowitz, J. M.

    1979-01-01

    Unrestrained rats were exposed to cold for 1 h during and immediately after exposure to hypergravic fields (1.5-4 G) to determine if they recover their ability to thermoregulate on reentry to 1-G conditions. In contrast to the decreased body temperatures observed when cold exposure occurred concurrently with acceleration, hypothalamic, carotid, and brown fat temperatures did not fall when rats were exposed to cold immediately after return to 1 G. These results support the hypothesis that the thermoregulatory alterations seen under hypergravic conditions are manifestations of an effect of ongoing exposure to hypergravity and can be reversed on termination of acceleration. The reversibility of the thermoregulatory impairment is apparently unaffected by the magnitude of the acceleration field over a range of 1.5-4 G.

  11. Orbital ordering in {sup 154}SmNiO{sub 3}

    Energy Technology Data Exchange (ETDEWEB)

    Medarde, M.; Rosenkranz, S. [Paul Scherrer Inst. (PSI), Villigen (Switzerland); Rodrigeuez-Carvajal, J. [Laboratoire Leon Brillouin (LLB) - Centre d`Etudes de Saclay, 91 - Gif-sur-Yvette (France); Lacorre, P. [Lab. Fluorures, LeMans (France); Trounov, V. [PNPI, Gatchina (Russian Federation); Fernandez-Diaz, M.T. [Institut Max von Laue - Paul Langevin, 75 - Paris (France)

    1997-09-01

    We have investigated the existence of a structural distortion associated to the k = (1/2 0 1/2) orbital ordering recently proposed to explain the magnetic structure of RNiO{sub 3} perovskites (R = rare earth). Our results on a {sup 154}SmNiO{sub 3} powder sample indicate that, if existing, the associated superstructure reflections are as a maximum 10{sup 4} times smaller than the largest nuclear reflection. (author) 2 figs., 3 refs.

  12. Yeast Interacting Proteins Database: YNL154C, YDR264C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YNL154C YCK2 Palmitoylated plasma membrane-bound casein kinase I isoform; shares re... gene name YCK2 Bait description Palmitoylated plasma membrane-bound casein kinase I isoform; shares redunda...ature on prey (YPD) 11 Literature shared by bait and prey 5 Literature sharing score 14 CuraGen (0 or 1) 0 S

  13. A metabolomic assessment of NAC154 transcription factor overexpression in field grown poplar stem wood.

    Science.gov (United States)

    Jervis, Judith; Hildreth, Sherry B; Sheng, Xiaoyan; Beers, Eric P; Brunner, Amy M; Helm, Richard F

    2015-07-01

    Several xylem-associated regulatory genes have been identified that control processes associated with wood formation in poplar. Prominent among these are the NAC domain transcription factors (NACs). Here, the putative involvement of Populus NAC154, a co-ortholog of the Arabidopsis gene SND2, was evaluated as a regulator of "secondary" biosynthetic processes in stem internode tissues by interrogating aqueous methanolic extracts from control and transgenic trees. Comprehensive untargeted metabolite profiling was accomplished with a liquid chromatography-mass spectrometry platform that utilized two different chromatographic supports (HILIC and reversed phase) and both positive and negative ionization modes. Evaluation of current and previous year tissues provided datasets for assessing the effects of NAC154 overexpression in wood maturation processes. Phenolic glycoside levels as well as those of oligolignols, sucrose and arginine were modulated with phenotypic and chemotypic traits exhibiting similar trends. Specifically, increased levels of arginine in the NAC154 overexpressing tissues supports a role for the transcription factor in senescence/dormancy-associated processes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. AGR-3/4 Data Qualification Report for ATR Cycles 151A, 151B, 152A, 152B, 154A, and 154B

    Energy Technology Data Exchange (ETDEWEB)

    Binh T. Pham

    2014-02-01

    This data report provides the qualification status of Advanced Gas Reactor-3/4 (AGR-3/4) fuel irradiation experimental data from Advanced Test Reactor (ATR) Cycles 151A, 151B, 152A, 152B, 154A, and 154B, as recorded in the Nuclear Data Management and Analysis System (NDMAS). Of these cycles, ATR Cycle 152A is a low power cycle that occurred when the ATR core was briefly at low power. The irradiation data are not used for physics and thermal calculation, but the qualification status of these cycle data is still covered in this report. On the other hand, during ATR Cycles 153A (unplanned Outage cycle) and 153B (Power Axial Locator Mechanism [PALM] cycle), the AGR-3/4 was pulled out from the ATR core and stored in the canal to avoid being overheated. Therefore, qualification of the AGR-3/4 irradiation data from these 2 cycles was excluded in this report. By the end of ATR Cycle 154B, AGR-3/4 was irradiated for a total of 264.1 effective full power days. The AGR-3/4 data streams addressed in this report include thermocouple (TC) temperatures, sweep gas data (flow rates, pressure, and moisture content), and Fission Product Monitoring System (FPMS) data (release rates and release-to-birth rate ratios [R/Bs]) for each of the twelve capsules in the AGR-3/4 experiment. The final data qualification status for these data streams is determined by a Data Review Committee (DRC) composed of AGR technical leads, Sitewide Quality Assurance (QA), and NDMAS analysts. The DRC convened on February 12, 2014, reviewed the data acquisition process, and considered whether the data met the requirements for data collection as specified in QA-approved Very High Temperature Reactor (VHTR) Technology Development Office (TDO) data collection plans. The DRC also examined the results of NDMAS data testing and statistical analyses, and confirmed the qualification status of the data as given in this report.

  15. 33 CFR 154.1047 - Response plan development and evaluation criteria for facilities that handle, store, or transport...

    Science.gov (United States)

    2010-07-01

    ...) POLLUTION FACILITIES TRANSFERRING OIL OR HAZARDOUS MATERIAL IN BULK Response Plans for Oil Facilities § 154...) Sonar, sampling equipment, or other methods for locating the petroleum oil on the bottom or suspended in...

  16. Expression of CD154 by a Simian Immunodeficiency Virus Vector Induces Only Transitory Changes in Rhesus Macaques

    OpenAIRE

    Vida L. Hodara; Velasquillo, M. Cristina; Parodi, Laura M.; Giavedoni, Luis D.

    2005-01-01

    Human immunodeficiency virus infection is characterized by dysregulation of antigen-presenting cell function and defects in cell-mediated immunity. Recent evidence suggests that impaired ability of CD4+ T cells to upregulate the costimulatory molecule CD154 is at the core of this dysregulation. To test the hypothesis that increased expression of CD154 on infected CD4+ T cells could modulate immune function, we constructed a replication-competent simian immunodeficiency virus (SIV) vector that...

  17. 46 CFR 154.610 - Design temperature not colder than 0 °C (32 °F).

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Design temperature not colder than 0 °C (32 °F). 154... DANGEROUS CARGOES SAFETY STANDARDS FOR SELF-PROPELLED VESSELS CARRYING BULK LIQUEFIED GASES Design, Construction and Equipment Materials § 154.610 Design temperature not colder than 0 °C (32 °F). Materials for...

  18. Neutralizing interleukin-4 prevents transplant arteriosclerosis mediated by indirect pathway T cells under CD40-CD154 costimulation blockade.

    Science.gov (United States)

    Spriewald, Bernd M; Ensminger, Stephan M; Bushell, Andrew; Wood, Kathryn J

    2008-12-15

    Blockade of the CD40-CD154 costimulatory pathway can prolong allograft survival, but does not prevent the development of transplant arteriosclerosis in several models. In this study, we investigated the mechanisms of CD40-CD154-independent transplant arteriosclerosis in major histocompatibility complex (MHC)-class I-mismatched aortic allografts. MHC class I-mismatched CBK (H2k+Kb) donor aortas were transplanted into CBA (H2k) recipients who can only recognize the graft through CD8+ T cells and CD4+ T cells responding to the class I MHC mismatch through the indirect pathway of allorecognition. Recipients were treated with anti-CD154 antibody (MR1) alone or in combination with anti-CD8 (YTS169) or anti-interleukin (IL)-4 (11B11) antibodies. Grafts were analyzed by histology on days 30 and 60 and for intragraft mRNA expression on day 14 after transplantation. Repeated treatment with anti-CD154 alone or in combination with anti-CD8 antibody did not prevent intimal proliferation compared with untreated controls (65%+/-6%, 62%+/-9%, and 71%+/-7% luminal occlusion, respectively, 60 days after transplantation). In both treatment groups, the expression of IL-4, IL-5, and eotaxin was increased compared with control grafts, and an eosinophilic infiltration was observed. Neutralizing IL-4 in combination with CD40-CD154 blockade and CD8+ T-cell depletion abrogated transplant arteriosclerosis (9%+/-4% luminal occlusion 60 days after transplantation). Prolonged treatment with anti-CD154 was not able to prevent the development of transplant arteriosclerosis in MHC class I-mismatched aortic allografts, in the presence or absence of CD8+ T cells. This CD40-CD154 pathway resistant transplant arteriosclerosis was mediated by IL-4, because neutralizing IL-4 in addition to CD40-CD154 costimulation blockade and CD8+ T-cell depletion prevented its development.

  19. Two regimes of galaxy dynamics: mass models of NGC 5055 and DDO 154

    Science.gov (United States)

    Jovanović, Milena

    2017-08-01

    We derive detailed dynamical models for two galaxies, the massive spiral galaxy NGC 5055 and the dwarf irregular DDO 154. We used Navarro, Frenk & White (NFW) and isothermal halo models for the dark matter (DM) distribution, along with the most recent and reliable radio observations of H i to determine the rotation curves of these galaxies. Contributions from the neutral gas and the luminous matter were accounted for. For NGC 5055, the latest stellar population synthesis (SPS) models, combining metallicity and age as indicators of the stellar mass-to-light ratio (M/L) were used to better constrain both the DM model and the contribution to the total mass from all components. The isothermal dark halo model successfully fitted both observed rotation curves with realistic values for stellar M/L, while the NFW model needed further constraints for M/L to fit the rotation curve of DDO 154. In the case of NGC 5055, we found the best-fitting M/L in the 3.6 μm band (M/L3.6) for stellar disc to be 0.57 ± 0.04 for isothermal, and 0.50 ± 0.05 for NFW DM model. The most probable value for M/L3.6 from SPS models is 0.46, which is in agreement within uncertainties with our best-fitting NFW model. In the case of DDO 154, we obtained the stellar disc M/L3.6 of 0.25 ± 0.20 for the isothermal DM model. The stellar disc M/L3.6 for the NFW model was fixed to 0.26, as best reasonable value. For NGC 5055, we derived radial profiles of stellar M/L for our best estimate for a particular DM model.

  20. Near-barrier transfer reactions in the sup 36 S+ sup 144,154 Sm systems

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez Niello, J.O.; Testoni, J.E.; di Tada, M.; Pacheco, A.J. (TANDAR, Departamento de Fisica, Comision Nacional de Energia Atomica, Avenida del Libertador 8250, 1429 Buenos Aires (Argentina)); Napoli, D.R.; Stefanini, A.M.; Corradi, L.; Million, B.; Narayanasamy, M.; Spolaore, P. (Istituto Nazionale di Fisica Nucleare, Laboratori Nazionali di Legnaro, Padova (Italy)); Beghini, S.; Montagnoli, G.; Scarlassara, F.; Segato, G.F.; Signorini, C.; Soramel, F. (Dipartimento di Fisica, Universita e Istituto Nazionale di Fisica Nucleare, Padova (Italy))

    1992-02-01

    Angular distributions and {ital Q}-value spectra for transfer reactions in the systems {sup 36}S+{sup 144,154}Sm have been measured at two energies close to the Coulomb barrier. Mass and charge identification was achieved using a time-of-flight system followed by an ionization chamber. Transfer probabilities were analyzed considering direct and sequential barrier penetration mechanisms. The dependence of the cross sections on the static quadrupole deformation of the targets was compared with the predictions of a semiclassical approach. The relative yields of the different channels were analyzed in the light of a random-walk approach based on the reaction {ital Q} values.

  1. Allospecific CD154+ T-cells associate with rejection risk after pediatric liver transplantation

    OpenAIRE

    AshokKumar, Chethan; Talukdar, Anjan; Sun, Qing; Higgs, Brandon W; Janosky, Janine; Wilson, Patrick; Mazariegos, George; Jaffe, Ronald; Demetris, Anthony; Dobberstein, Jennifer; Soltys, Kyle; Bond, Geoffrey; Thomson, Angus; Zeevi, Adriana; Sindhi, Rakesh

    2008-01-01

    Antigen-specific T-cells, which express CD154 rapidly, but remain untested in alloimmunity, were measured with flow cytometry in 16-hour MLR of 58 identically-immunosuppressed children with liver transplantation (LTx), to identify Rejectors (who had experienced biopsy-proven rejection within 60 days post-transplantation). Thirty one children were sampled once, cross-sectionally. Twenty seven children were sampled longitudinally, pre-LTx, and at 1–60 and 61–200 days after LTx. Results were cor...

  2. CD40 ligand (CD154) takes part in regulation of the transition to mononuclear cell dominance during peritonitis.

    Science.gov (United States)

    Mazar, Julia; Agur, Timna; Rogachev, Boris; Ziv, Nadav Yehuda; Zlotnik, Moshe; Chaimovitz, Cidio; Douvdevani, Amos

    2005-04-01

    CD40 is a member of the tumor necrosis factor (TNF) family of receptors whose ligand (CD154) is found mainly on membranes of activated mononuclear cells. CD154-CD40 cross-linking is a central event in antigen presentation, B-cell activation, and regulation of cytokine and chemokine secretion from various types of cells. We have previously demonstrated in vitro the presence of CD40 on human peritoneal mesothelial cells (PMC) and have also shown that CD40 ligation synergizes with interferon-gamma (IFN-gamma) to up-regulate CC chemokine secretion from these cells. The aim of the present study was to investigate the role of CD40 ligation in leukocyte recruitment during peritonitis. Peritonitis was induced in mice by bacterial inoculation, CD40 levels were analyzed on PMC by reverse transcription-polymerase chain reaction (RT-PCR) and immunohistochemistry. CD154 levels on leukocytes were analyzed by flow cytometry and RT-PCR. Chemokines mRNA levels were analyzed by RT-PCR. CD154 was blocked in vivo using monoclonal antibodies. Results. In mice inoculated by Staphylococcus epidermidis or Escherichia coli, CD40 in PMC increased twofold at 24 hours and CD154 was induced and reached a peak at 48 hours. In both Gram-positive and Gram-negative-peritonitis, peritoneal macrophages were the main peritoneal leukocyte population to express CD154. Similar results were observed in human subjects during peritonitis. Injection of CD154 blocking monoclonal antibody (MR1) reduced the mononuclear infiltrate by 50% and had no effect on granulocyte recruitment 48 hours after inoculation of S. epidermidis. Our data suggest that CD40 plays a significant role in the process of the mononuclear infiltration during peritonitis.

  3. CD154+ CD4+ T-cell dependence for effective memory influenza virus-specific CD8+ T-cell responses.

    Science.gov (United States)

    Olson, Matthew R; Seah, Shirley Gk; Edenborough, Kathryn; Doherty, Peter C; Lew, Andrew M; Turner, Stephen J

    2014-08-01

    CD40-CD154 (CD40 ligand) interactions are essential for the efficient priming of CD8(+) cytotoxic T lymphocyte (CTL) responses. This is typically via CD4(+)CD154(+) T-cell-dependent 'licensing' of CD40(+) dendritic cells (DCs); however, DCs infected with influenza A virus (IAV) upregulate CD154 expression, thus enabling efficient CTL priming in the absence of CD4(+) T activation. Therefore, it is unclear whether CD4 T cells and DCs have redundant or unique roles in the priming of primary and secondary CTL responses after infection. Here we determine the precise cellular interactions involved in CD40-CD154 regulation of both primary and secondary IAV-specific CTL responses. Infection of both CD40 KO and CD154 KO mice resulted in diminished quantitative and qualitative CTL responses after both primary and secondary infection. Adoptive transfer of CD154(+), but not CD154 KO, CD4 T cells into CD154 KO mice restored both primary and secondary IAV-specific CD8 T-cell responses. These data show that, although CD154 expression on CD4 T cells and other cell types (that is, DCs) may be redundant for the priming of primary CTL responses, CD154 expression by CD4 T cells is required for the priming memory CD8 T cells that are capable of fully responding to secondary infection.

  4. Vaccination Produces CD4 T Cells with a Novel CD154-CD40-Dependent Cytolytic Mechanism.

    Science.gov (United States)

    Coler, Rhea N; Hudson, Thomas; Hughes, Sean; Huang, Po-Wei D; Beebe, Elyse A; Orr, Mark T

    2015-10-01

    The discovery of new vaccines against infectious diseases and cancer requires the development of novel adjuvants with well-defined activities. The TLR4 agonist adjuvant GLA-SE elicits robust Th1 responses to a variety of vaccine Ags and is in clinical development for both infectious diseases and cancer. We demonstrate that immunization with a recombinant protein Ag and GLA-SE also induces granzyme A expression in CD4 T cells and produces cytolytic cells that can be detected in vivo. Surprisingly, these in vivo CTLs were CD4 T cells, not CD8 T cells, and this cytolytic activity was not dependent on granzyme A/B or perforin. Unlike previously reported CD4 CTLs, the transcription factors Tbet and Eomes were not necessary for their development. CTL activity was also independent of the Fas ligand-Fas, TRAIL-DR5, and canonical death pathways, indicating a novel mechanism of CTL activity. Rather, the in vivo CD4 CTL activity induced by vaccination required T cell expression of CD154 (CD40L) and target cell expression of CD40. Thus, vaccination with a TLR4 agonist adjuvant induces CD4 CTLs, which kill through a previously unknown CD154-dependent mechanism. Copyright © 2015 by The American Association of Immunologists, Inc.

  5. Persistent Polyclonal B Cell Lymphocytosis B Cells Can Be Activated through CD40-CD154 Interaction

    Directory of Open Access Journals (Sweden)

    Emmanuelle Dugas-Bourdages

    2014-01-01

    Full Text Available Persistent polyclonal B cell lymphocytosis (PPBL is a rare disorder, diagnosed primarily in adult female smokers and characterized by an expansion of CD19+CD27+IgM+ memory B cells, by the presence of binucleated lymphocytes, and by a moderate elevation of serum IgM. The clinical course is usually benign, but it is not known whether or not PPBL might be part of a process leading to the emergence of a malignant proliferative disorder. In this study we sought to investigate the functional response of B cells from patients with PPBL by use of an optimal memory B cell culture model based on the CD40-CD154 interaction. We found that the proliferation of PPBL B cells was almost as important as that of B cells from normal controls, resulting in high immunoglobulin secretion with in vitro isotypic switching. We conclude that the CD40-CD154 activation pathway is functional in the memory B cell population of PPBL patients, suggesting that the disorder may be due to either a dysfunction of other cells in the microenvironment or a possible defect in another B cell activation pathway.

  6. Self-assembly in aqueous solution of wheel-shaped Mo154 oxide clusters into vesicles.

    Science.gov (United States)

    Liu, Tianbo; Diemann, Ekkehard; Li, Huilin; Dress, Andreas W M; Müller, Achim

    2003-11-06

    Surfactants and membrane lipids readily assemble into complex structures such as micelles, liposomes or hollow vesicles owing to their amphiphilic character-the fact that part of their structure is attracted to polar environments while another part is attracted to non-polar environments. The self-assembly of complex structures also occurs in polyoxometallate chemistry, as exemplified by the molybdenum blue solutions known for centuries. But while the presence of nanometre-sized metal oxide aggregates in these solutions has long been recognized, unravelling the composition and formation process of these aggregates proved difficult. Recent work has indicated that discrete, wheel-shaped mixed-valence polyoxomolybdate clusters of the type [Mo154] (refs 2-4) assemble into well-defined nanometre-sized aggregates, including spherical structures. Here we report light-scattering data and transmission electron microscopy images of hollow spherical structures with an average, almost monodisperse radius of about 45 nm and composed of approximately 1,165 [Mo154] wheel-shaped clusters. The clusters appear to lie flat and homogeneously distributed on the vesicle surface. Unlike conventional lipid vesicles, the structures we observe are not stabilized by hydrophobic interactions. Instead, we believe the polyoxomolybdate-based vesicles form owing to a subtle interplay between short-range van der Waals attraction and long-range electrostatic repulsion, with important further stabilization arising from hydrogen bonding involving water molecules encapsulated between the wheel-shaped clusters and in the vesicles' interior.

  7. The Interaction of CD154 with the α5β1 Integrin Inhibits Fas-Induced T Cell Death.

    Directory of Open Access Journals (Sweden)

    Meriem Bachsais

    Full Text Available CD154, a critical regulator of the immune response, is usually associated with chronic inflammatory, autoimmune diseases as well as malignant disorders. In addition to its classical receptor CD40, CD154 is capable of binding other receptors, members of the integrin family, the αIIbβ3, αMβ2 and α5β1. Given the role attributed to integrins and particularly the β1 integrins in inhibiting apoptotic events in normal as well as malignant T cells, we were highly interested in investigating the role of the CD154/α5β1 interaction in promoting survival of malignant T cells contributing as such to tumor development and/or propagation. To support our hypothesis, we first show that soluble CD154 binds to the T-cell acute lymphoblastic leukemia cell line, Jurkat E6.1 in a α5β1-dependent manner. Binding of soluble CD154 to α5β1 integrin of Jurkat cells leads to the activation of key survival proteins, including the p38 and ERK1/2 mitogen-activated protein kinases (MAPKs, phosphoinositide 3 kinase (PI-3K, and Akt. Interestingly, soluble CD154 significantly inhibits Fas-mediated apoptosis in T cell leukemia-lymphoma cell lines, Jurkat E6.1 and HUT78 cells, an important hallmark of T cell survival during malignancy progression. These anti-apoptotic effects were mainly mediated by the activation of the PI-3K/Akt pathway but also involved the p38 and the ERK1/2 MAPKs cascades. Our data also demonstrated that the CD154-triggered inhibition of the Fas-mediated cell death response was dependent on a suppression of caspase-8 cleavage, but independent of de novo protein synthesis or alterations in Fas expression on cell surface. Together, our results highlight the impact of the CD154/α5β1 interaction in T cell function/survival and identify novel targets for the treatment of malignant disorders, particularly of T cell origin.

  8. The X-ray emission mechanism in the protostellar jet HH 154

    Science.gov (United States)

    Bonito, R.; Orlando, S.; Peres, G.; Favata, F.; Rosner, R.

    2004-09-01

    We study the mechanism causing the X-ray emission recently detected in protostellar jets, by performing a detailed modeling of the interaction between a supersonic jet originating from a young stellar object and the ambient medium, for various values of density contrast, ν, between the ambient density and the jet, and of Mach number, M; radiative losses and thermal conduction have been taken into account. Here we report a representative case which reproduces, without any ad hoc assumption, the characteristics of the X-ray emission recently observed in the protostellar jet HH 154. We find that the X-ray emission originates from a localized blob, consistent with observations, which moves with velocity v ˜ 500 km s-1; we therefore predict the X-ray source to have a detectable proper motion.

  9. Study of XK and {gamma} photon emission following decay of {sup 154}Eu

    Energy Technology Data Exchange (ETDEWEB)

    Terechtchenko, E. E-mail: tee@vniim.ru; Rasko, M.; Sepman, S.; Zanevsky, A.; Tuan, A. Tran; Amiot, M.N.; Bobin, C.; Morel, J

    2004-04-01

    A joint project has been established between VNIIM (D.I. Mendeleyev Institute for Metrology) and LNHB (Laboratoire National Henri Becquerel) to determine as accurately as possible the X- and {gamma}-ray emission probabilities of {sup 154}Eu. Point sources were prepared by VNIIM, and absolute measurements of activity per unit mass were undertaken by both laboratories using coincidence, anti-coincidence and 4{pi}-{gamma} counting methods. Other point sources and one aliquot were also prepared for precise {gamma}-ray spectrometry measurements. Absolute photon emission probabilities were determined with a maximum uncertainty of 0.5% for the most intense lines, supporting the development of this nuclide as a multigamma standard.

  10. [Influence of blocking B7/CD28 and CD40/CD154 co-stimulatory signals on immune function of sensitized mice].

    Science.gov (United States)

    Ye, Qi-Xiang; Xu, Lu-Hong; Xu, Wei; Fang, Jian-Pei

    2014-06-01

    This study was aimed to explore the effects of blocking B7/CD28 and CD40/CD154 co-stimulatory signals on immune function of sensitized mice', and provide the evidences of acquired immune tolerance for allogeneic bone marrow transplantation. The mice sensitized on 7 day before transplant were divided into 4 groups: (1)CTLA4Ig+ anti-CD154 isotype control IgG; (2)anti-CD154 +CTLA4Ig isotype control IgG; (3)CTLA4Ig and anti-CD154; (4)isotype control IgG of CTLA4Ig and anti-CD154. CTLA4Ig and anti-CD154 used in normal BALB/c mice as isotype control IgG. Each mouse in all groups received CTLA4Ig and anti-CD154 (or corresponding isotype control IgG) 500 µg respectively, and was injected via tail vein on 7 day before transplant. There were 5 mice in each group. The mice were sacrificed on day 0, then the number of CD19(+)CD69(+)B cells, CD44(high)/CD62L(high) and CD44(high)/CD62L(low)/- T cells were measured by flow cytometry. Changes of cytokines and sensitized antibody were tested by ELISA or flow cytometry. The results showed that the numbers of CD19(+)CD69(+)B cells were significantly increased in comparison with the normal group (P CD154 co-stimulatory signals (P CD154 co-stimulatory signals. Blocking these two signals together, displayed a synergistic effect (P CD154 treated groups significantly decreased as compared with sensitized group (P CD154 co-stimulatory signal can inhibit the cellular and humoral immune function, whereas blocking these two signals together displays a synergistic effect.

  11. Hyperexpression of CD40 ligand (CD154) in inflammatory bowel disease and its contribution to pathogenic cytokine production

    NARCIS (Netherlands)

    Liu, Z.; Colpaert, S.; D'Haens, G. R.; Kasran, A.; de Boer, M.; Rutgeerts, P.; Geboes, K.; Ceuppens, J. L.

    1999-01-01

    CD40 ligand (CD40L or CD154), a type II membrane protein with homology to TNF, is transiently expressed on activated T cells and known to be important for B cell Ig production and for activation and differentiation of monocytes and dendritic cells. Both Crohn's disease and ulcerative colitis are

  12. Antigen-specific induced Foxp3+ regulatory T cells are generated following CD40/CD154 blockade

    Science.gov (United States)

    Ferrer, Ivana R.; Wagener, Maylene E.; Song, Minqing; Kirk, Allan D.; Larsen, Christian P.; Ford, Mandy L.

    2011-01-01

    Blockade of the CD40/CD154 pathway potently attenuates T-cell responses in models of autoimmunity, inflammation, and transplantation. Indeed, CD40 pathway blockade remains one of the most powerful methods of prolonging graft survival in models of transplantation. But despite this effectiveness, the cellular and molecular mechanisms underlying the protective effects of CD40 pathway blockade are incompletely understood. Furthermore, the relative contributions of deletion, anergy, and regulation have not been measured in a model in which donor-reactive CD4+ and CD8+ T-cell responses can be assessed simultaneously. To investigate the impact of CD40/CD154 pathway blockade on graft-specific T-cell responses, a transgenic mouse model was used in which recipients containing ovalbumin-specific CD4+ and CD8+ TCR transgenic T cells were grafted with skin expressing ovalbumin in the presence or absence of anti-CD154 and donor-specific transfusion. The results indicated that CD154 blockade altered the kinetics of donor-reactive CD8+ T-cell expansion, delaying differentiation into IFN-γ+ TNF+ multifunctional cytokine producers. The eventual differentiation of cytokine-producing effectors in tolerant animals coincided with the emergence of an antigen-specific CD4+ CD25hi Foxp3+ T-cell population, which did not arise from endogenous natural Treg but rather were peripherally generated from naïve Foxp3− precursors. PMID:22143783

  13. 75 FR 64947 - 154th Meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans; Notice of...

    Science.gov (United States)

    2010-10-20

    ... Pension Benefit Plans; Notice of Meeting; Notice #0;#0;Federal Register / Vol. 75, No. 202 / Wednesday... Meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans; Notice of Meeting Pursuant... (ERISA), 29 U.S.C. 1142, the 154th open meeting of the Advisory Council on Employee Welfare and Pension...

  14. 33 CFR 154.1240 - Specific requirements for animal fats and vegetable oils facilities that could reasonably be...

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Specific requirements for animal fats and vegetable oils facilities that could reasonably be expected to cause substantial harm to the... Animal Fats and Vegetable Oils Facilities § 154.1240 Specific requirements for animal fats and vegetable...

  15. 42 CFR 84.154 - Airflow resistance test; Type B and Type BE supplied-air respirators; minimum requirements.

    Science.gov (United States)

    2010-10-01

    ... APPROVAL OF RESPIRATORY PROTECTIVE DEVICES Supplied-Air Respirators § 84.154 Airflow resistance test; Type B and Type BE supplied-air respirators; minimum requirements. (a) Airflow resistance shall be... diameter. (b) Airflow resistance shall not exceed 38 mm. (1.5 inches) of water-column height to air drawn...

  16. 33 CFR 154.1045 - Response plan development and evaluation criteria for facilities that handle, store, or transport...

    Science.gov (United States)

    2010-07-01

    ... the National Oil and Hazardous Substances Pollution Contingency Plan Product Schedule (which is contained in 40 CFR part 300, and available online from the U.S. Government Printing Office). (ii... or the annual plan review required under § 154.1065(a). Facility owners or operators are not required...

  17. In situ demonstration of CD40- and CD154-positive cells in psoriatic lesions and keratinocyte production of chemokines by CD40 ligation in vitro

    NARCIS (Netherlands)

    Pasch, Marcel C.; Timár, Krisztina K.; van Meurs, Marjan; Heydendael, Vera M. R.; Bos, Jan D.; Laman, Jon D.; Asghar, Syed S.

    2004-01-01

    In psoriatic lesions, T cells and keratinocytes are in an activated state. Ligation of CD40 expressed on activated keratinocytes with CD154 expressed on activated T cells is thought to be involved in the pathogenesis of psoriasis. However, the presence of CD40(+) and CD154(+) cells in psoriatic skin

  18. Chimpanzee CD4+ T cells are relatively insensitive to HIV-1 envelope-mediated inhibition of CD154 up-regulation

    NARCIS (Netherlands)

    Rutjens, Erik; Vermeulen, Joost; Verstrepen, Babs; Hofman, Sam; Prins, Jan M.; Srivastava, Indresh; Heeney, Jonathan L.; Koopman, Gerrit

    2008-01-01

    CD40-CD154 interaction forms a key event in regulation of crosstalk between dendritic cells and CD4 T cells. In human immunodeficiency virus (HIV)-1 infected patients CD154 expression is impaired, and the resulting loss of immune responsiveness by CD4+ T cells contributes to a progressive state of

  19. In situ demonstration of CD40- and CD154-positive cells in psoriatic lesions and keratinocyte production of chemokines by CD40 ligation in vitro.

    NARCIS (Netherlands)

    Pasch, M.C.; Timar, K.K.; Meurs, M. van; Heydendael, V.M.; Bos, J.D.; Laman, J.D.; Asghar, S.S.

    2004-01-01

    In psoriatic lesions, T cells and keratinocytes are in an activated state. Ligation of CD40 expressed on activated keratinocytes with CD154 expressed on activated T cells is thought to be involved in the pathogenesis of psoriasis. However, the presence of CD40(+) and CD154(+) cells in psoriatic skin

  20. Organic dyes as small molecule protein-protein interaction inhibitors for the CD40-CD154 costimulatory interaction.

    Science.gov (United States)

    Buchwald, Peter; Margolles-Clark, Emilio; Kenyon, Norma S; Ricordi, Camillo

    2010-01-01

    It is becoming increasingly clear that small molecules can often act as effective protein-protein interaction (PPI) inhibitors, an area of increasing interest for its many possible therapeutic applications. We have identified several organic dyes and related small molecules that (i) concentration-dependently inhibit the important CD40-CD154 costimulatory interaction with activities in the low micromolar (microM) range, (ii) show selectivity toward this particular PPI, (iii) seem to bind on the surface of CD154, and (iv) concentration-dependently inhibit the CD154-induced B cell proliferation. They were identified through an iterative activity screening/structural similarity search procedure starting with suramin as lead, and the best smaller compounds, the main focus of the present work, achieved an almost 3-fold increase in ligand efficiency (DeltaG(0)/nonhydrogen atom = 0.8 kJ/N(nHa)) approaching the average of known promising small-molecule PPI inhibitors (approximately 1.0 kJ/N(nHa)). Since CD154 is a member of the tumor necrosis factor (TNF) superfamily of cell surface interaction molecules, inhibitory activities on the TNF-R1-TNF-alpha interactions were also determined to test for specificity, and the compounds selected here all showed more than 30-fold selectivity toward the CD40-CD154 interaction. Because of their easy availability in various structural scaffolds and because of their good protein-binding ability, often explored for tissue-specific staining and other purposes, such organic dyes can provide a valuable addition to the chemical space searched to identify small molecule PPI inhibitors in general. (c) 2009 John Wiley & Sons, Ltd.

  1. Stimulation-dependent induction of CD154 on a subset of CD4+ FoxP3+ T-regulatory cells

    Science.gov (United States)

    Li, Wen; Carlson, Timothy L.; Green, William R.

    2013-01-01

    CD40-ligand/CD154 is predominantly expressed on activated CD4 T cells and plays a central role in regulating CD4 T-cell-dependent responses. To define the relative abilities of CD4 T-cell functional subsets in the induction of CD154—specifically FoxP3− effector, versus FoxP3+ regulatory, CD4 T cells—multiple CD4 T cell preparations were isolated from B6 and B6.FoxP3-GFP mice and stimulated in vitro to examine the kinetics of stimulation-dependent CD154 expression. CD154 was induced in 40–60% of total CD4 T cells in various cell preparations. However, despite similar kinetics of CD154-induced expression, the average percentage of CD154 expression among CD4+ FoxP3+ T regulatory (Treg) cells was only about 4–9%. Such differential, stimulation-dependent CD154 induction by total CD4+ T cells versus CD4+ FoxP3+ Treg cells was consistent, despite multiple stimulation conditions utilizing a variety of cell preparations of different composition. Similar induction of CD154 occurred irrespective of whether the CD4+ FoxP3+ Treg cells were first sorted to 98% purity and stimulated in vitro alone, or stimulated as non-purified cells in the presence of CD4+ FoxP3− T effector cells, suggesting that CD154 induction by CD4+ FoxP3+ Treg cells is regulated by cell-intrinsic mechanisms. Differential CD154 induction may be a key factor in determining the distinguishable functions of FoxP3− T-effector, versus FoxP3+ Treg, CD4+ T cells. PMID:21496498

  2. Establishment of long-term CD154-dependent porcine B-cell cultures

    Science.gov (United States)

    Takamatsu, H; Andersen, J K; Denyer, M S; Parkhouse, R M E

    1999-01-01

    Cells of the B-cell lineage play an essential part in the immune response, not only as the producers of antigen-specific antibodies, but also as antigen-presenting cells. Unlike T cells, however, the establishment of long-term normal B-cell lines has proved to be exceedingly difficult. In this paper we demonstrate that cell membrane-expressed CD154 (CD40 ligand) is able to support the continual growth of porcine mesenteric lymph node B-cell cultures for more than 4 months without the addition of exogenous cytokines, such as interleukin-4 (IL-4). Addition of IL-4, but not interferon-γ (IFN-γ) or IL-13, to these cultures enhanced proliferation, as, to a lesser extent, did addition of IL-2. Interestingly, however, whilst IFN-γ-supplemented cultures largely consisted of immunoglobulin M (IgM)-positive cells, cultures with IL-13 or IL-4 contained a significantly increased proportion of IgG-positive cells. PMID:10447734

  3. New neutron-rich isotope production in 154Sm+160Gd

    Directory of Open Access Journals (Sweden)

    Ning Wang

    2016-09-01

    Full Text Available Deep inelastic scattering in 154Sm+160Gd at energies above the Bass barrier is for the first time investigated with two different microscopic dynamics approaches: improved quantum molecular dynamics (ImQMD model and time dependent Hartree–Fock (TDHF theory. No fusion is observed from both models. The capture pocket disappears for this reaction due to strong Coulomb repulsion and the contact time of the di-nuclear system formed in head-on collisions is about 700 fm/c at an incident energy of 440 MeV. The isotope distribution of fragments in the deep inelastic scattering process is predicted with the simulations of the latest ImQMD-v2.2 model together with a statistical code (GEMINI for describing the secondary decay of fragments. More than 40 extremely neutron-rich unmeasured nuclei with 58≤Z≤76 are observed and the production cross sections are at the order of μb to mb. The multi-nucleon transfer reaction of Sm+Gd could be an alternative way to synthesize new neutron-rich lanthanides which are difficult to be produced with traditional fusion reactions or fission of actinides.

  4. Allospecific CD154 + T-cytotoxic memory cells as potential surrogate for rejection risk in pediatric intestine transplantation.

    Science.gov (United States)

    Sindhi, Rakesh; Ashokkumar, Chethan; Higgs, Brandon W; Gilbert, P B; Sun, Qing; Ranganathan, Sarangarajan; Jaffe, Ron; Snyder, Sara; Ningappa, Mylarappa; Soltys, Kyle A; Bond, Geoffrey J; Mazariegos, George V; Abu-Elmagd, Kareem; Zeevi, Adriana

    2012-02-01

    Clinical end-points dictate large trial enrollments and exclude children with the rare intestine transplant procedure (ITx), who experience higher drug-related morbidity. We evaluate the novel rejection-risk parameter, allo-(antigen)-specific CD154 + TcMs (i) as surrogates for ACR using Prentice's criteria, (ii) for association with immunosuppression targets to determine Fleming's surrogate end-point designation, and (iii) as time-to-event end-point in a simulated comparison of alemtuzumab (NCT#01208337, n = 14) and rabbit anti-human thymocyte globulin (rATG, n = 16) among 30 children with ITx. CD154 + TcM were measured in MLR before, and at 1-60 and 61-200 days after ITx (NCT#01163578). CD154 + TcM correlate significantly with rejection severity (Spearman r = 0.685, p = 2.03E-5) and associate with biopsy-proven ITx rejection with sensitivity/specificity of 94%/84% [corrected] independent of immunosuppressant. Previously stated sensitivity of 90% is incorrect. [corrected]. The rejection-risk threshold of CD154 + TcM resolves rapidly in 200-day follow-up (46 ± 20 vs. 158 ± 59 days, p = 0.009, K-M) with alemtuzumab, which demonstrates lower 90-day ACR incidence (50% vs. 69%, p=NS, Fisher's exact), and is associated with accelerated prednisone minimization to ≤2.5 mg/day, compared with rATG (120 ± 28 vs. 180 ± 30 days, p = 0.027, K-M). As a surrogate end-point, time-to-rejection-risk resolution measured with CD154 + TcM portends 50% reduction in sample sizes in a simulated trial of alemtuzumab vs. rATG. Rejection-risk assessment with CD154 + TcM may enable informed immunosuppression minimization, and preliminary efficacy comparisons in pediatric ITx. © 2011 John Wiley & Sons A/S.

  5. A NOVEL SAMARIUM COMPLEX WITH INTERESTING ...

    African Journals Online (AJOL)

    INTRODUCTION. Fluorescent materials, particularly blue fluorescent materials have gained strong interest because ... emitting complexes in different technical applications, such as emitting materials for organic light emitting ..... properties of three novel two-dimensional lanthanide coordination polymers with mixed aromatic ...

  6. Pyroelectric Ferroelectric and Resistivity Studies on Samarium ...

    African Journals Online (AJOL)

    Barium Strontium Sodium Niobate (Ba1-xSrx)2NaNb5O15 (BSNN) belongs to tungsten bronze ferroelectric morphotrophic phase boundary (MPB) system at x = 0.6, having large spontaneous polarisation, pyroelectric coefficient and low dielectic constant and is expected to be applicable for piezoceramic filter and ...

  7. A NOVEL SAMARIUM COMPLEX WITH INTERESTING ...

    African Journals Online (AJOL)

    emitting complexes in different technical applications, such as emitting materials for organic light emitting diodes, sensitizers in solar energy conversion, chemical sensors and so forth [6-9]. The ability of bipy to act as a rigid ..... properties of three-dimensional organic-inorganic hybrids based on α-metatungstate. Inorg. Chim.

  8. T cells responding to Trypanosoma cruzi detected by membrane TNF-α and CD154 in chagasic patients.

    Science.gov (United States)

    Ripoll, Juan G; Giraldo, Nicolás A; Bolaños, Natalia I; Roa, Nubia; Rosas, Fernando; Cuéllar, Adriana; Puerta, Concepción J; González, John M

    2018-03-01

    Chagas disease is a parasitic infection whose pathogenesis is related to parasite persistence and a dysfunctional cellular immune response. Variability in cytokine secretion among chronic Trypanosoma cruzi-infected patients might preclude the identification of the pool of antigen specific T cells. The goal of this study was to determine the fraction of T cells responding to T. cruzi antigen measured by the expression of membrane TNF-α and CD154. A total of 21 chagasic patients, 11 healthy and 5 non-chagasic cardiomyopathy controls were analyzed. PBMCs were short-term cultured in the presence of anti-CD28, anti-CD49d, anti-TNF-α, and TACE (TNF-α converting enzyme) inhibitor either under T. cruzi-lysate or polyclonal stimuli. Cells were stained with anti-CD3, anti-CD4, anti-CD8, and anti-CD154, and analyzed with flow cytometry. CD4+ and CD8+ T cells in chagasic patients displayed higher percentages of membrane-bound TNF-α+ and CD154+ compared with controls after T. cruzi-antigen stimulation. Both markers displayed a positive correlation in the T cell subpopulations analyzed. Symptomatic chagasic patients were differentiated from asymptomatic patients based on the expression of CD154 and membrane TNF-α in TCD4+ and TCD8+ compartments, respectively. These results show that both markers could be useful for assessing the pool of antigen-specific T cells in chronic chagasic patients. © 2017 The Authors. Immunity, Inflammation and Disease Published by John Wiley & Sons Ltd.

  9. KLF10 Mediated Epigenetic Dysregulation of Epithelial CD40/CD154 Promotes Endometriosis.

    Science.gov (United States)

    Delaney, Abigail A; Khan, Zaraq; Zheng, Ye; Correa, Luiz F; Zanfagnin, Valentina; Shenoy, Chandra C; Schoolmeester, John K; Saadalla, Abdulrahman M; El-Nashar, Sherif; Famuyide, Abimbola O; Subramaniam, Malayannan; Hawse, John R; Khazaie, Khashayarsha; Daftary, Gaurang S

    2016-09-01

    Endometriosis is a highly prevalent, chronic, heterogeneous, fibro-inflammatory disease that remains recalcitrant to conventional therapy. We previously showed that loss of KLF11, a transcription factor implicated in uterine disease, results in progression of endometriosis. Despite extensive homology, co-expression, and human disease association, loss of the paralog Klf10 causes a unique inflammatory, cystic endometriosis phenotype in contrast to fibrotic progression seen with loss of Klf11. We identify here for the first time a novel role for KLF10 in endometriosis. In an animal endometriosis model, unlike wild-type controls, Klf10(-/-) animals developed cystic lesions with massive immune infiltrate and minimal peri-lesional fibrosis. The Klf10(-/-) disease progression phenotype also contrasted with prolific fibrosis and minimal immune cell infiltration seen in Klf11(-/-) animals. We further found that lesion genotype rather than that of the host determined each unique disease progression phenotype. Mechanistically, KLF10 regulated CD40/CD154-mediated immune pathways. Both inflammatory as well as fibrotic phenotypes are the commonest clinical manifestations in chronic fibro-inflammatory diseases such as endometriosis. The complementary, paralogous Klf10 and Klf11 models therefore offer novel insights into the mechanisms of inflammation and fibrosis in a disease-relevant context. Our data suggests that divergence in underlying gene dysregulation critically determines disease-phenotype predominance rather than the conventional paradigm of inflammation being precedent to fibrotic scarring. Heterogeneity in clinical progression and treatment response are thus likely from disparate gene regulation profiles. Characterization of disease phenotype-associated gene dysregulation offers novel approaches for developing targeted, individualized therapy for recurrent and recalcitrant chronic disease. © 2016 by the Society for the Study of Reproduction, Inc.

  10. CD154 blockade alters innate immune cell recruitment and programs alloreactive CD8+ T cells into KLRG-1(high short-lived effector T cells.

    Directory of Open Access Journals (Sweden)

    Ivana R Ferrer

    Full Text Available CD154/CD40 blockade combined with donor specific transfusion remains one of the most effective therapies in prolonging allograft survival. Despite this, the mechanisms by which these pathways synergize to prevent rejection are not completely understood. Utilizing a BALB/c (H2-K(d to B6 (H2-K(b fully allogeneic skin transplant model system, we performed a detailed longitudinal analysis of the kinetics and magnitude of CD8(+ T cell expansion and differentiation in the presence of CD154/CD40 pathway blockade. Results demonstrated that treatment with anti-CD154 vs. DST had distinct and opposing effects on activated CD44(high CD62L(low CD8(+ T cells in skin graft recipients. Specifically, CD154 blockade delayed alloreactive CD8(+ T cell responses, while DST accelerated them. DST inhibited the differentiation of alloreactive CD8(+ T cells into multi-cytokine producing effectors, while CD40/CD154 blockade led to the diminution of the KLRG-1(low long-lived memory precursor population compared with either untreated or DST treated animals. Moreover, only CD154 blockade effectively inhibited CXCL1 expression and neutrophil recruitment into the graft. When combined, anti-CD154 and DST acted synergistically to profoundly diminish the absolute number of IFN-γ producing alloreactive CD8(+ T cells, and intra-graft expression of inflammatory chemokines. These findings demonstrate that the previously described ability of anti-CD154 and DST to result in alloreactive T cell deletion involves both delayed kinetics of T cell expansion and differentiation and inhibited development of KLRG-1(low memory precursor cells.

  11. Exploratory computational assessment of possible binding modes for small molecule inhibitors of the CD40-CD154 co-stimulatory interaction.

    Science.gov (United States)

    Ganesan, L; Vidović, D; Schürer, S C; Buchwald, P

    2012-05-01

    Protein-protein interactions (PPI) tend to involve extensive, flat, and featureless interfaces that are difficult to disrupt by small molecule binding. However, recently, PPIs are being recognized as increasingly valuable 'druggable' targets. We have identified several small molecule inhibitors of the immunologically relevant CD40-CD154 co-stimulatory interaction that bind to the homotrimeric CD154, a member of the tumor necrosis factor superfamily (TNFSF). Recently, on the basis of the co-crystal structure of CD154 with another small molecule (BIO8898), it has been suggested that these PPIs could be particularly susceptible to small molecule blockade due to a subunit fracture mechanism resulting in a distortion of the trimeric structure. To investigate whether this mechanism can occur with our organic dye-related inhibitors, we performed exploratory computational docking experiments. Possible druggable pockets that can serve as binding sites for small molecule inhibitors were identified with the FFT map algorithm both along the CD154-CD40 binding interface (competitive, orthosteric model) and in the interior core of the CD154 trimer corresponding to the BIO8898 binding site (allosteric model). Docking experiments (using Glide) were performed at these sites using the PDB ID: 3QD6 (CD40-CD154) and 3LKJ (BIO8898-CD154) co-crystal structures, respectively. The docking algorithm was able to better discriminate binders from non-binders at the deeper allosteric site than at the competitive site. Accordingly, an allosteric inhibitory mechanism that involves intercalation between monomeric subunits seems feasible for our small molecules making the constitutively trimeric CD154 a likely druggable target.

  12. CD154 Is Released from T-cells by a Disintegrin and Metalloproteinase Domain-containing Protein 10 (ADAM10) and ADAM17 in a CD40 Protein-dependent Manner*

    Science.gov (United States)

    Yacoub, Daniel; Benslimane, Nadir; Al-Zoobi, Loubna; Hassan, Ghada; Nadiri, Amal; Mourad, Walid

    2013-01-01

    CD154 (CD40 ligand) is a type II transmembrane protein that belongs to the tumor necrosis factor superfamily. The soluble form of CD154 (sCD154), which results from the shedding of membrane-bound CD154, plays a key role in the production of proinflammatory cytokines and has been linked to various autoimmune and vascular disorders. Therefore, elucidating the mechanisms by which CD154 is released from the cell surface following its interaction with its various receptors is of primordial importance. Using co-culture experiments, we show that CD154 is shed predominantly upon its engagement with CD40. Indeed, only CD40 (both membrane-bound and soluble) and not α5β1 or αMβ2 is involved in the cleavage and release of CD154 from Jurkat E6.1 T-cells. Interestingly, CD154 is cleaved independently of the formation of cell surface CD40 homodimers and independently of its association into lipid rafts. In contrast, we found that the protein kinase C (PKC) signaling family and the matrix metalloproteinases ADAM10 and ADAM17 are intimately involved in this process. In conclusion, our data indicate that CD154 is released from T-cells by ADAM10 and ADAM17 upon CD40 ligation. These findings add significant insights into the mechanisms by which CD154 is down-regulated and may lead to the generation of novel therapeutic targets for the treatment of CD154-associated disorders. PMID:24189063

  13. CD154 is released from T-cells by a disintegrin and metalloproteinase domain-containing protein 10 (ADAM10) and ADAM17 in a CD40 protein-dependent manner.

    Science.gov (United States)

    Yacoub, Daniel; Benslimane, Nadir; Al-Zoobi, Loubna; Hassan, Ghada; Nadiri, Amal; Mourad, Walid

    2013-12-13

    CD154 (CD40 ligand) is a type II transmembrane protein that belongs to the tumor necrosis factor superfamily. The soluble form of CD154 (sCD154), which results from the shedding of membrane-bound CD154, plays a key role in the production of proinflammatory cytokines and has been linked to various autoimmune and vascular disorders. Therefore, elucidating the mechanisms by which CD154 is released from the cell surface following its interaction with its various receptors is of primordial importance. Using co-culture experiments, we show that CD154 is shed predominantly upon its engagement with CD40. Indeed, only CD40 (both membrane-bound and soluble) and not α5β1 or αMβ2 is involved in the cleavage and release of CD154 from Jurkat E6.1 T-cells. Interestingly, CD154 is cleaved independently of the formation of cell surface CD40 homodimers and independently of its association into lipid rafts. In contrast, we found that the protein kinase C (PKC) signaling family and the matrix metalloproteinases ADAM10 and ADAM17 are intimately involved in this process. In conclusion, our data indicate that CD154 is released from T-cells by ADAM10 and ADAM17 upon CD40 ligation. These findings add significant insights into the mechanisms by which CD154 is down-regulated and may lead to the generation of novel therapeutic targets for the treatment of CD154-associated disorders.

  14. Endoscopic repair in 154 cases of urethral occlusion: the promise of guided optical urethral reconstruction.

    Science.gov (United States)

    al-Ali, M; al-Shukry, M

    1997-01-01

    We determined whether optical urethral reconstruction, with the use of a Béniqué bougie in the proximal urethra and transrectal digital guidance, is effective for the treatment of long and severe urethral occlusions. However, with some skill the procedure can be done without the bougie for the treatment of short occlusions. During a 9-year period 154 men with complete urethral occlusion underwent core through optical urethrotomy via transrectal digital guidance, using the Béniqué bougie in 89 (58%). A total of 400 urethrotomies was performed. All lesions were in the posterior urethra except 8 in the pendulous portion. There were 64 war related injuries (41.6%). Combined voiding and retrograde urethrography was not useful to measure the length of the occlusion due to failure of proximal urethral filling. Guided optical urethral reconstruction consisted of optical urethrotomy performed with a Béniqué bougie introduced proximally through the suprapubic catheter site and into the proximal urethra with the index finger of the operator in the rectum. The same procedure was performed blindly without use of the bougie in 65 patients (42%), and in 43 with lesions shorter than 1 cm. and 4 with multiple annular lesions. We also used the blind technique successfully to reestablish 18 occlusions longer than 1 cm. For optimal epithelialization of the urethral tract we suggest leaving a silicone catheter indwelling for 3 months. No prophylactic antibiotics were given. Of the patients 54 (35%) were cured after 1 procedure, whereas the remaining 100 (65%) required 1 to 9 additional urethrotomies (mean 3). Patients with an uninstrumented urethra who were treated initially with suprapubic catheterization required 1 to 6 urethrotomies (mean 2), compared to 1 to 10 (mean 3) for those who had undergone a prior procedure. Hematuria occurred in 9% of the patients, symptomatic urinary tract infection in 7% and slight extravasation in 3.2%. One patient had stress incontinence. Our

  15. Protocol-based management of 154 cases of pediatric liver abscess.

    Science.gov (United States)

    Roy Choudhury, Subhasis; Khan, Niyaz Ahmed; Saxena, Rahul; Yadav, Partap Singh; Patel, Jigar N; Chadha, Rajiv

    2017-02-01

    Although liver abscess (LA) is prevalent worldwide, especially in developing countries, there is a paucity of data regarding the protocol for management of LA in children. The aim of this study was to analyze the outcome of a protocol-based management of pediatric LA from a single institution. This prospective observational study was conducted in a tertiary-care children's hospital and included all patients with LA managed over a 5-year period. Detailed clinical, laboratory, microbiological and imaging parameters were recorded, and the patients were treated according to a standardized management protocol. Small abscesses (managed with antimicrobial therapy alone. Liquefied abscesses on imaging were additionally subjected to US guided percutaneous needle aspirations (PNA). Large abscesses pointing to the surface were treated by percutaneous drainage (PCD). Ruptured LA, abscess inaccessible to image-guided drainage and those not responding to other modes of treatment were subjected to open surgical drainage (OSD). Pleural collections were treated by aspirations or intercostal tube drainage. Outcome was analyzed in terms of duration of recovery and complications including mortality. Over the 5-year period, 154 pediatric LA patients underwent protocol-based management. The mean age of the patients was 6.76 years with the male:female being 1.26:1. Medical management alone, PNA, PCD and OSD were successful in 38 (24.6%), 76 (49.3%), 11 (7.14%) and 29 (18.8%) cases, respectively. Pleural collections developed in 43 (27.9%) patients out of which aspiration/drainage was needed in 24 (55.81%) cases. The mean duration of hospital stay was 20.67 ± 9.52 days. Ongoing sepsis and multi-organ failure lead to mortality in 6 (3.8%) cases; rest of the patients were doing well on follow-up. Ultra-sonography was useful for the initial diagnosis, monitoring the progress and management of LA in children. The outcome of a protocol-based management of LA in children was favorable.

  16. Increased soluble CD154 (CD40 ligand) levels in xenograft recipients correlate with the development of de novo anti-pig IgG antibodies.

    Science.gov (United States)

    Ezzelarab, Mohamed B; Ekser, Burcin; Isse, Kumiko; Iwase, Hayato; Morelli, Adrian E; Ayares, David; Cooper, David K C

    2014-03-15

    De novo anti-pig antibodies are associated with acute humoral xenograft rejection. We explored the relative efficacy of CD40/CD154-pathway blockade versus CD28/B7-pathway blockade in the prevention of de novo anti-pig IgG antibodies in xenograft recipients. After α1,3-galactosyltransferase gene-knockout pig artery patch xenotransplantation, recipient baboons received no immunosuppression (IS; n=3), or anti-CD154mAb-based (n=5) or CTLA4-Ig-based (n=5) IS. CD4 T-cell and CD20 B-cell numbers in blood were determined. Serum anti-pig IgG antibodies and serum soluble (s)CD154 levels were measured. In lymph nodes, germinal center formation was examined and numbers of proliferating cells were evaluated by Ki-67 staining. After transplantation, with no IS, CD4 T-cell and CD20 B-cell numbers were increased, but were reduced by IS.In lymph nodes, with no IS, there was enhanced germinal center formation, which was significantly reduced by anti-CD154mAb-based (PCD154 and circulating sCD154, thus preventing subsequent stimulation of B cells and activation of lymphoid follicles in secondary lymphoid tissues.

  17. Activation of CD40 with platelet derived CD154 promotes reactive oxygen species dependent death of human hepatocytes during hypoxia and reoxygenation.

    Directory of Open Access Journals (Sweden)

    Ricky H Bhogal

    Full Text Available BACKGROUND: Hypoxia and hypoxia-reoxygenation (H-R are pathogenic factors in many liver diseases that lead to hepatocyte death as a result of reactive oxygen species (ROS accumulation. The tumor necrosis factor super-family member CD154 can also induce hepatocyte apoptosis via activation of its receptor CD40 and induction of autocrine/paracrine Fas Ligand/CD178 but the relationship between CD40 activation, ROS generation and apoptosis is poorly understood. We hypothesised that CD40 activation and ROS accumulation act synergistically to drive human hepatocyte apoptosis. METHODS: Human hepatocytes were isolated from liver tissue and exposed to an in vitro model of hypoxia and H-R in the presence or absence of CD154 and/or various inhibitors. Hepatocyte ROS production, apoptosis and necrosis were determined by labelling cells with 2',7'-dichlorofluorescin, Annexin-V and 7-AAD respectively in a three-colour reporter flow cytometry assay. RESULTS: Exposure of human hepatocytes to recombinant CD154 or platelet-derived soluble CD154 augments ROS accumulation during H-R resulting in NADPH oxidase-dependent apoptosis and necrosis. The inhibition of c-Jun N-terminal Kinase and p38 attenuated CD154-mediated apoptosis but not necrosis. CONCLUSIONS: CD154-mediated apoptosis of hepatocytes involves ROS generation that is amplified during hypoxia-reoxygenation. This finding provides a molecular mechanism to explain the role of platelets in hepatocyte death during ischemia-reperfusion injury.

  18. Activation of CD40 with platelet derived CD154 promotes reactive oxygen species dependent death of human hepatocytes during hypoxia and reoxygenation.

    Science.gov (United States)

    Bhogal, Ricky H; Weston, Christopher J; Curbishley, Stuart M; Adams, David H; Afford, Simon C

    2012-01-01

    Hypoxia and hypoxia-reoxygenation (H-R) are pathogenic factors in many liver diseases that lead to hepatocyte death as a result of reactive oxygen species (ROS) accumulation. The tumor necrosis factor super-family member CD154 can also induce hepatocyte apoptosis via activation of its receptor CD40 and induction of autocrine/paracrine Fas Ligand/CD178 but the relationship between CD40 activation, ROS generation and apoptosis is poorly understood. We hypothesised that CD40 activation and ROS accumulation act synergistically to drive human hepatocyte apoptosis. Human hepatocytes were isolated from liver tissue and exposed to an in vitro model of hypoxia and H-R in the presence or absence of CD154 and/or various inhibitors. Hepatocyte ROS production, apoptosis and necrosis were determined by labelling cells with 2',7'-dichlorofluorescin, Annexin-V and 7-AAD respectively in a three-colour reporter flow cytometry assay. Exposure of human hepatocytes to recombinant CD154 or platelet-derived soluble CD154 augments ROS accumulation during H-R resulting in NADPH oxidase-dependent apoptosis and necrosis. The inhibition of c-Jun N-terminal Kinase and p38 attenuated CD154-mediated apoptosis but not necrosis. CD154-mediated apoptosis of hepatocytes involves ROS generation that is amplified during hypoxia-reoxygenation. This finding provides a molecular mechanism to explain the role of platelets in hepatocyte death during ischemia-reperfusion injury.

  19. The Periplasmic Cavity of LacY Mutant Cys154→Gly: How Open is Open?

    Science.gov (United States)

    Jiang, Xiaoxu; Driessen, Arnold J. M.; Feringa, Ben L.; Kaback, H. Ronald

    2013-01-01

    The lactose permease from Escherichia coli (LacY) is a galactoside/H+ symporter that catalyzes the coupled stoichiometric transport of a sugar and an H + across the cytoplasmic membrane. x-ray crystal structures of WT LacY and the conformationally restricted mutant Cys154→Gly exhibit an inward-facing conformation with a tightly sealed periplasmic side and a deep central cleft or cavity open to the cytoplasm. Although the crystal structures may give the impression that LacY is a rigid molecule, multiple converging lines of evidence demonstrate that galactoside binding to WT LacY induces reciprocal opening and closing of periplasmic and cytoplasmic cavities, respectively. By this means, the sugar- and H+-binding sites in the middle of the molecule are exposed alternatively to either side of the membrane. In contrast to the crystal structure, biochemical/biophysical studies with mutant Cys154→Gly show that the periplasmic side is paralyzed in an open-outward conformation. In this study, a rigid, funnel-shaped, maleimide-containing molecule was used to probe the periplasmic cavity of a pseudo WT and the Cys154→Gly mutant by site-directed alkylation. The findings provide strong support for previous observations and indicate further that the external opening of the periplasmic cleft in the mutant is patent to the extent of at least 8.5 Å in the absence of sugar or about half that of the WT cavity with bound galactoside. PMID:23962108

  20. Nuclear structure effects of the nuclei {sup 152,154,156}Dy at high excitation energy and large angular momentum

    Energy Technology Data Exchange (ETDEWEB)

    Martin, V. [Analisis Numerico, Facultad de Informatica, Universidad Politecnica de Madrid, E-28660 Madrid (Spain); Egido, J.L. [Departamento de Fisica Teorica C-XI, Universidad Autonoma de Madrid, E-28049 Madrid (Spain)

    1995-06-01

    Using the finite-temperature Hartree-Fock-Bogoliubov formalism we analyze the properties of the nuclei {sup 152,154,156}Dy at the quasicontinuum region from {ital I}=0{h_bar} to 70{h_bar} and excitation energy up to approximately 16 MeV. We discuss energy gaps, shapes, moments of inertia, and entropy among others. The role of shape fluctuations is studied in the frame of classical statistics and we find large effects on several observables. A very rich structure is found in terms of excitation energy and angular momentum.

  1. T cells interact with T cells via CD40-CD154 to promote autoimmunity in T1D

    Science.gov (United States)

    Baker, Rocky L; Mallevaey, Thierry; Gapin, Laurent; Haskins, Kathryn

    2013-01-01

    Summary We have investigated the role of CD40 signaling in islet-reactive, diabetogenic CD4 Th1 T cell clones. Using multispectral flow cytometry, we showed that CD40 and CD154 are co-expressed and form complexes on the surface of activated T cells. We also demonstrate that activated T cells can transactivate CD4+CD40+ T cells through the CD40-CD154 pathway. To investigate the role of CD40 signaling on Th1 cells, we used the diabetogenic clone BDC-5.2.9 retrovirally transduced with a truncated form of the CD40 molecule to produce a CD40 dominant-negative T cell clone. Upon challenge with antigen in vitro, the production of IFN-γ by BDC-5.2.9 CD40DN was greatly reduced and in vivo, the dominant-negative variant was unable to induce diabetes. Transduction with the CD40DN vector was also effective in preventing transfer of disease by primary NOD CD4 T cells. Ex vivo analysis of pancreatic infiltrates after transfer of BDC-5.2.9 CD40DN revealed an overall reduction of cell numbers and cytokine production by both T cells and macrophages. These data indicate that CD40 is an important signaling molecule on autoreactive CD4 T cells and contributes to their pathogenic effector function. PMID:22488364

  2. Vaccination produces CD4 T cells with a novel CD154-CD40 dependent cytolytic mechanism ¶

    Science.gov (United States)

    Coler, Rhea N.; Hudson, Thomas; Hughes, Sean; Huang, Po-wei D.; Beebe, Elyse A.; Orr, Mark T.

    2015-01-01

    The discovery of new vaccines against infectious diseases and cancer requires the development of novel adjuvants with well-defined activities. The TLR4 agonist adjuvant GLA-SE elicits robust TH1 responses to a variety of vaccine antigens and is in clinical development for both infectious diseases and cancer. We demonstrate that immunization with a recombinant protein antigen and GLA-SE also induces granzyme A expression in CD4 T cells and produces cytolytic cells that can be detected in vivo. Surprisingly these in vivo CTLs were CD4 T cells, not CD8 T cells and this cytolytic activity was not dependent on granzyme A/B or perforin. Unlike previously reported CD4 CTLs the transcription factors Tbet and Eomes were not necessary for their development. CTL activity was also independent of the FasL-Fas, TRAIL-DR5, and canonical death pathways, indicating a novel mechanism of CTL activity. Rather, the in vivo CD4 CTL activity induced by vaccination required T cell expression of CD154 (CD40 ligand) and target cell expression of CD40. Thus, vaccination with a TLR4 agonist adjuvant induces CD4 CTLs which kill through a previously unknown CD154-dependent mechanism. PMID:26297758

  3. Method for the validation of immunohistochemical staining using SCID mouse xenografts: expression of CD40 and CD154 in human non-small cell lung cancer.

    Science.gov (United States)

    Ishikawa, Keidai; Miyamoto, Masaki; Yoshioka, Tatsuya; Kadoya, Masatoshi; Li, Li; Mishra, Roshan; Ichinokawa, Kazuomi; Shoji, Yasuhito; Matsumura, Yoshiyuki; Hida, Yasuhiro; Kaga, Kichizo; Kato, Tatsuya; Kaji, Mitsuhito; Ohbuchi, Toshiro; Itoh, Tomoo; Dosaka-Akita, Hirotoshi; Matsui, Yoshiro; Hirano, Satoshi

    2013-04-01

    This report proposes a concept for the standardization of immunohistochemical evaluation. Immunohistochemical staining has several problems associated with the sensitivity of the technical process and standardization of the assessment of potent staining. We provided data focusing on this concept through immunostaining for CD154 in non-small cell lung cancer (NSCLC). We used two types of anti-CD154 antibody as primary antibodies in immunohistochemical staining, as previously reported. Western blot analysis confirmed strong CD154 expression in the cultured cell line PC10, but not in LK2. We also assessed CD154 expression in SCID mouse xenografts of these cell lines. SCID xenograft data on western blot analysis were consistent with those of cultured cell lines. These xenografts could thus be used as positive or negative tissue controls for CD154 immunostaining. Primary antibodies should therefore be confirmed as recognizing target lesions, while control tissue specimens should be objectively confirmed as having target products using another experimental method. Our method would allow results to be unified at more than one laboratory and could act as an objective control assessment method in immunohistochemistry.

  4. NF-κB is involved in the regulation of CD154 (CD40 ligand) expression in primary human T cells

    Science.gov (United States)

    Srahna, M; Remacle, J E; Annamalai, K; Pype, S; Huylebroeck, D; Boogaerts, M A; Vandenberghe, P

    2001-01-01

    Cognate interactions between CD154 (CD40 ligand, CD40L) on activated T cells and its receptor CD40 on various antigen-presenting cells are involved in thymus-dependent humoral immune responses and multiple other cell-mediated immune responses. We have studied the regulation of CD154 expression in human T cells after activation with anti-CD3 and anti-CD28 antibodies or after pharmacological activation of protein kinase C with phorbol 12-myristate 13-acetate, and the calcium ionophore ionomycin. Under these conditions, transcription of the CD154 gene was rapidly induced without requiring de novo protein synthesis. Pharmacological inhibitors of NF-κB activation down-regulated CD154 mRNA and protein levels. Cyclosporin A, an inhibitor of NF-AT activation, acted similarly, and the effects of both inhibitors were additive. A potential NF-κB binding site is present within the CD154 promoter at positions −1190 to −1181. In electrophoretic mobility shift assays, this sequence was specifically bound by NF-κB present in nuclear extracts from activated T cells. Furthermore, in transient co-transfection of Jurkat T cells, p65 activated the transcription of a reporter construct containing a multimer of this NF-κB binding site. These observations demonstrate a role of NF-κB transcription factors in the regulation of CD40L expression in activated primary human T cells. PMID:11529914

  5. Separate cis-trans pathways post-transcriptionally regulate murine CD154 (CD40 ligand) expression: a novel function for CA repeats in the 3'-untranslated region.

    Science.gov (United States)

    Hamilton, B JoNell; Wang, Xiao-Wei; Collins, Jane; Bloch, Donald; Bergeron, Alan; Henry, Brian; Terry, Benjamin M; Zan, Moe; Mouland, Andrew J; Rigby, William F C

    2008-09-12

    We report a role for CA repeats in the 3'-untranslated region (3'-UTR) in regulating CD154 expression. Human CD154 is encoded by an unstable mRNA; this instability is conferred in cis by a portion of its 3'-UTR that includes a polypyrimidine-rich region and CA dinucleotide repeat. We demonstrate similar instability activity with the murine CD154 3'-UTR. This instability element mapped solely to a conserved 100-base CU-rich region alone, which we call a CU-rich response element. Surprisingly, the CA dinucleotide-rich region also regulated reporter expression but at the level of translation. This activity was associated with poly(A) tail shortening and regulated by heterogeneous nuclear ribonucleoprotein L levels. We conclude that the CD154 3'-UTR contains dual cis-acting elements, one of which defines a novel function for exonic CA dinucleotide repeats. These findings suggest a mechanism for the association of 3'-UTR CA-rich response element polymorphisms with CD154 overexpression and the subsequent risk of autoimmune disease.

  6. CD4+ T helper cells use CD154-CD40 interactions to counteract T reg cell-mediated suppression of CD8+ T cell responses to influenza.

    Science.gov (United States)

    Ballesteros-Tato, André; León, Beatriz; Lund, Frances E; Randall, Troy D

    2013-07-29

    CD4(+) T cells promote CD8(+) T cell priming by licensing dendritic cells (DCs) via CD40-CD154 interactions. However, the initial requirement for CD40 signaling may be replaced by the direct activation of DCs by pathogen-derived signals. Nevertheless, CD40-CD154 interactions are often required for optimal CD8(+) T cell responses to pathogens for unknown reasons. Here we show that CD40 signaling is required to prevent the premature contraction of the influenza-specific CD8(+) T cell response. CD40 is required on DCs but not on B cells or T cells, whereas CD154 is required on CD4(+) T cells but not CD8(+) T cells, NKT cells, or DCs. Paradoxically, even though CD154-expressing CD4(+) T cells are required for robust CD8(+) T cell responses, primary CD8(+) T cell responses are apparently normal in the absence of CD4(+) T cells. We resolved this paradox by showing that the interaction of CD40-bearing DCs with CD154-expressing CD4(+) T cells precludes regulatory T cell (T reg cell)-mediated suppression and prevents premature contraction of the influenza-specific CD8(+) T cell response. Thus, CD4(+) T helper cells are not required for robust CD8(+) T cell responses to influenza when T reg cells are absent.

  7. C4b binding protein binds to CD154 preventing CD40 mediated cholangiocyte apoptosis: a novel link between complement and epithelial cell survival.

    Directory of Open Access Journals (Sweden)

    Kevin T Williams

    Full Text Available Activation of CD40 on hepatocytes and cholangiocytes is critical for amplifying Fas-mediated apoptosis in the human liver. C4b-Binding Protein (C4BP has been reported to act as a potential surrogate ligand for CD40, suggesting that it could be involved in modulating liver epithelial cell survival. Using surface plasmon resonance (BiaCore analysis supported by gel filtration we have shown that C4BP does not bind CD40, but it forms stable high molecular weight complexes with soluble CD40 ligand (sCD154. These C4BP/sCD154 complexes bound efficiently to immobilised CD40, but when applied to cholangiocytes they failed to induce apoptosis or proliferation or to activate NFkB, AP-1 or STAT 3, which are activated by sCD154 alone. Thus C4BP can modulate CD40/sCD154 interactions by presenting a high molecular weight multimeric sCD154/C4BP complex that suppresses critical intracellular signalling pathways, permitting cell survival without inducing proliferation. Immunohistochemistry demonstrated co-localisation and enhanced expression of C4BP and CD40 in human liver cancers. These findings suggest a novel pathway whereby components of the complement system and TNF ligands and receptors might be involved in modulating epithelial cell survival in chronic inflammation and malignant disease.

  8. Determination of specific radioactivity of samarium-153 product. 1. Quantitative determination of samarium by spectrophotometry

    Energy Technology Data Exchange (ETDEWEB)

    Izumo, Mishiroku [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Nemoto, Masahiro [Tokyo Nuclear Service Co., Ltd., Tokyo (Japan)

    2002-03-01

    On the specific radioactivity of Sm-153 for the radiotherapy of cancers, a simple method for determination of the amount of Sm was described. The method used Arsenazo III as a colorimetric reagent. The sample irradiated in the reactor was dissolved in 1M HCl solution. A small part of it was taken and mixed with Arsenazo III at pH 3.2, and the amount of Sm was determined by the spectrophotometric method at a wavelength of 652 nm. The molar absorptivity of Sm at 652 nm was 6.6x10{sup 3} m{sup -1}{center_dot}mm{sup -1}. The error of measurement in the partial different conditions was about 2% of the value determined. The effects of impurities, Fe, Zn and Cu mixing in the Sm during operation, were clarified. (author)

  9. Human circulating group 2 innate lymphoid cells can express CD154 and promote IgE production.

    Science.gov (United States)

    Maggi, Laura; Montaini, Gianni; Mazzoni, Alessio; Rossettini, Beatrice; Capone, Manuela; Rossi, Maria Caterina; Santarlasci, Veronica; Liotta, Francesco; Rossi, Oliviero; Gallo, Oreste; De Palma, Raffaele; Maggi, Enrico; Cosmi, Lorenzo; Romagnani, Sergio; Annunziato, Francesco

    2017-03-01

    Protection against helminths consists of adaptive responses by T H 2 cells and innate responses by group 2 innate lymphoid cells (ILC2s), with these latter being well characterized in mice but less so in human subjects. We sought to characterize human circulating ILC2s and compare their functional profile with that of autologous T H 2 cells. Circulating ILC2s and T H 2 cells were isolated by means of fluorescence-activated cell sorting and magnetic cell sorting and expanded in vitro. ILC2s were then stimulated with phorbol 12-myristate 13-acetate plus ionomycin, IL-25 plus IL-33 (IL-25/IL-33), or a mixture of Toll-like receptor ligands to evaluate their ability to produce cytokines, express CD154, and induce IgE production by autologous B cells. Cytokines and transcription factor gene methylation were assessed. ILC2s expressed GATA-3, retinoic acid orphan receptor (RORC) 2, and RORα; were able to produce IL-5, IL-13, and IL-4; and, accordingly, were characterized by demethylation of IL4, IL13, IL5, GATA3, and RORC2, whereas the IFNG, IFNG promoter, and TBX21 regions of interest were methylated. ILC2s expressed TLR1, TLR4, and TLR6, and TLR stimulation induced IL-5 and IL-13 production. Moreover, ILC2s expressed CD154 in response to phorbol 12-myristate 13-acetate plus ionomycin, IL-25/IL-33, or a mixture of TLR ligands. Stimulated ILC2s also induced IgM, IgG, IgA, and IgE production by B cells. Finally, circulating ILC2s from atopic patients were not different in numbers and frequency but expressed higher IL-4 levels than those from nonatopic subjects. This study provides the first evidence that human ILC2s can express CD154 and stimulate the production of IgE by B lymphocytes through IL-25/IL-33 stimulation or TLR triggering. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  10. Evaluation of CD86/CD28 and CD40/CD154 pathways in regulating monocyte-derived CD80 expression during their interaction with allogeneic endothelium.

    Science.gov (United States)

    Wang, P; Liu, Z; Wu, C; Zhu, B; Wang, Y; Xu, H

    2008-10-01

    This study was designed to examine the role of monocyte-derived CD80 in providing costimulation to CD4+ cells, and to determine whether monocyte-derived CD80 expression is regulated by CD86/CD28 and CD40/CD154 pathways during allogeneic immunoresponses. Human endothelial cells (EC) and purified monocytes cocultured with or without CD4+ cells were analyzed by real-time quantitative polymerase chain reaction (RT-PCR) and florescence-activated cell scanning (FACS). Peripheral blood mononuclear cells (PBMC)-EC cocultures with or without costimulation blockade were analyzed by FACS. The effects of CD154 and CD28 blockade to inhibit lymphocyte proliferation were evaluated by mixed lymphocyte-EC reaction (MLER). RT-PCR demonstrated upregulation of CD80 transcripts in EC-stimulated monocytes in the absence of CD4+ cells. However, the surface expression of CD80 was undetectable. The expression of CD80 was restored in the presence of CD4+ cells. Additionally, CD80 blockade partially inhibited CD4+ cell proliferation induced by EC-conditioned monocytes. Monocytes demonstrated upregulation of CD80 on the surface during PBMC-EC interaction. CD86, CD28, and CD154 blockade did not prevent upregulation of monocyte-derived CD80 expression. CD28 and CD154 blockade partially inhibited lymphocyte proliferation of MLER. In summary, EC-stimulated monocytes upregulated CD80 expression at the transcript level but not on their surface in the absence of T cells. The surface expression of monocyte-derived CD80 is upregulated on EC-stimulated monocytes in the presence of T cells. CD154/CD40 and CD28/CD86 blockade cannot prevent monocyte-derived CD80 expression, suggesting that CD80 upregulation is through a CD154- or CD86-independent pathway. Specific therapy to prevent monocyte activation may be required for successful allograft transplantation.

  11. Numerical simulation of the electromagnetic decay of the nuclei {sup 152,154,156}Dy with self-consistent collective strength functions

    Energy Technology Data Exchange (ETDEWEB)

    Martin, V. [Analisis Numerico, Facultad de Informatica, Universidad Politecnica de Madrid, E-28660 Madrid (Spain); Egido, J.L. [Departamento de Fisica Teorica C-XI, Universidad Autonoma de Madrid, E-28049 Madrid (Spain); Khoo, T.L.; Lauritsen, T. [Argonne National Laboratory, Argonne, Illinois 60439 (United States)

    1995-06-01

    The electromagnetic decay of the nuclei {sup 152,154,156}Dy is analyzed using microscopic Hartree-Fock calculations at finite temperature. The theoretical collective transition probabilities are implemented in numerical simulations to produce theoretical spectra. Thermal shape fluctuations are also taken into account. The inclusion of these correlation is crucial in order to understand the main features of the collective {ital E}2 spectra of these isotopes at different energies. The theoretical calculations suggest a shape change as responsible for the unusual features of the spectrum of the nucleus {sup 154}Dy at high energy.

  12. Low-energy dipole modes in the heavy deformed nucleus 154Sm via inelastic polarized proton scattering at 0°

    Directory of Open Access Journals (Sweden)

    Poltoratska I.

    2012-12-01

    Full Text Available A high resolution proton scattering experiment has been performed on the heavy deformed nucleus 154Sm at extreme forward angles with 300 MeV polarized protons at RCNP, Osaka. Our scientific goal is to investigate the impact of ground state deformation on the properties of the pygmy dipole resonance and on the spin-M1 resonance showing a double-humped structure in heavy deformed nuclei. The (p, p′ cross sections can be decomposed into E1 and M1 parts in two independent ways based either on a multipole decomposition of the cross sections or on spin-transfer observables as has been demonstrated for the case of 208Pb. We present the method and preliminary results from the analysis of polarization transfer observables.

  13. Experimental investigation of the 0{sub 2}{sup +} band in {sup 154}Sm as a β-vibrational band

    Energy Technology Data Exchange (ETDEWEB)

    Smallcombe, J., E-mail: james.smallcombe@outlook.com [Department of Physics, University of York, Heslington, York YO10 5DD (United Kingdom); Davies, P.J.; Barton, C.J.; Jenkins, D.G. [Department of Physics, University of York, Heslington, York YO10 5DD (United Kingdom); Andersson, L.L.; Butler, P.A.; Cox, D.M.; Herzberg, R.-D.; Mistry, A.; Parr, E. [Oliver Lodge Laboratory, University of Liverpool, Liverpool L69 9ZE (United Kingdom); Grahn, T.; Greenlees, P.T. [Department of Physics, University of Jyväskylä, FI-40014 (Finland); Hauschild, K. [Department of Physics, University of Jyväskylä, FI-40014 (Finland); CSNSM-IN2P3-CNRS, Université Paris-Sud, 91406 Orsay (France); Herzan, A.; Jakobsson, U.; Jones, P.; Julin, R.; Juutinen, S.; Ketelhut, S.; Leino, M. [Department of Physics, University of Jyväskylä, FI-40014 (Finland); and others

    2014-05-01

    A study of {sup 154}Sm through γ-ray and internal conversion electron coincidence measurements was performed using the Silicon And GErmanium spectrometer (SAGE). An upper limit for the ρ{sup 2}(E0;2{sub 2}{sup +}→2{sub 1}{sup +}) and measurement of the ρ{sup 2}(E0;4{sub 2}{sup +}→4{sub 1}{sup +}) monopole transitions strengths were determined. The extracted transition strength for each is significantly lower than that predicted by either the Bohr and Mottelson β-vibration description or the interacting boson model. Hence, the long standing interpretation of these states as a collective band built on the 0{sub 2}{sup +} state, which is conventionally assigned as a Bohr and Mottelson β vibration is questionable.

  14. Photoluminescence around 1.54 mu m wavelength from Erbium-doped silicon dependence on annealing temperature

    CERN Document Server

    Xu Fei; Cheng Guo An; ZengYuXin; XiaoZhiSong; YiZhongZhen; ZhangTongHe

    2002-01-01

    Er ions were implanted into Si substrates using metal vapor vacuum arc (MEVVA) ion source implanter, and Er-doped Si thin films have been formed after rapid thermal annealing (RTA). It was analyzed by Rutherford back-scattering spectroscopy (RBS) that Er concentrations in the thin films were close to 10 at% corresponding to the level of approx 10 sup 2 sup 1 atoms/cm sup 3 and Er segregation in the surface layer of the thin films appeared with increasing the temperature of RTA. The recovery of irradiation damage, Er segregation and Si solid phase epitaxy of Si amorphous layers were closely dependent on annealing temperature, which would influence on photoluminescence around 1.54 mu m from Er-doped Si thin film

  15. Optical amplification and electroluminescence at 1.54 μm in Er-doped zinc silicate germanate on silicon

    Science.gov (United States)

    Baker, C. C.; Heikenfeld, J.; Yu, Z.; Steckl, A. J.

    2004-03-01

    Optical amplification and electroluminescence at 1.5 μm is reported in Er-doped Zn2Si0.5Ge0.5O4 (ZSG:Er) on silicon. ZSG:Er films were deposited by rf sputtering from a composite target in Ar/O2 mixtures. Channel waveguides were fabricated by plasma etching with Cl/Ar. The refractive index of ZSG:Er was found to be 1.75 at 1.54 μm. Signal enhancement greater than 13 dB and an internal gain of ˜2 dB have been achieved by optically pumping a 4.7 cm ZSG:Er amplifier. Electroluminescence at 1.5 μm was achieved using an ac device structure with a ZSG:Er central layer and upper and lower dielectric layers.

  16. CDCC calculations of fusion of 6Li with targets 144Sm and 154Sm: effect of resonance states

    Science.gov (United States)

    Gómez Camacho, A.; Lubian, J.; Zhang, H. Q.; Zhou, Shan-Gui

    2017-12-01

    Continuum Discretized Coupled-Channel (CDCC) model calculations of total, complete and incomplete fusion cross sections for reactions of the weakly bound 6Li with 144,154Sm targets at energies around the Coulomb barrier are presented. In the cluster structure frame of 6Li→α+d, short-range absorption potentials are considered for the interactions between the ground state of the projectile 6Li and α-d fragments with the target. In order to separately calculate complete and incomplete fusion and to reduce double-counting, the corresponding absorption potentials are chosen to be of different range. Couplings to low-lying excited states 2+, 3‑ of 144Sm and 2+, 4+ of 154Sm are included. So, the effect on total fusion from the excited states of the target is investigated. Similarly, the effect on fusion due to couplings to resonance breakup states of 6Li, namely, l=2, J π =3+,2+,1+ is also calculated. The latter effect is determined by using two approaches, (a) by considering only resonance state couplings and (b) by omitting these states from the full discretized energy space. Among other things, it is found that both resonance and non-resonance continuum breakup couplings produce fusion suppression at all the energies considered. A. Gómez Camacho from CONACYT, México, J. Lubian from CNPq, FAPERJ, Pronex, Brazil. S.G.Z was partly supported by the NSF of China (11120101005, 11275248, 11525524, 11621131001, 11647601, 11711540016), 973 Program of China (2013CB834400) and the Key Research Program of Frontier Sciences of CAS. H.Q.Z. from NSF China (11375266)

  17. AGR-2 Final Data Qualification Report for U.S. Capsules - ATR Cycles 147A Through 154B

    Energy Technology Data Exchange (ETDEWEB)

    Pham, Binh T. [Idaho National Lab. (INL), Idaho Falls, ID (United States). Very High-Temperature Reactor Technology Development Office; Einerson, Jeffrey J. [Idaho National Lab. (INL), Idaho Falls, ID (United States). Very High-Temperature Reactor Technology Development Office

    2014-07-01

    This report provides the data qualification status of AGR-2 fuel irradiation experimental data in four U.S. capsules from all 15 Advanced Test Reactor (ATR) Cycles 147A, 148A, 148B, 149A, 149B, 150A, 150B, 151A, 151B, 152A, 152B, 153A, 153B, 154A, and 154B, as recorded in the Nuclear Data Management and Analysis System (NDMAS). Thus, this report covers data qualification status for the entire AGR-2 irradiation and will replace four previously issued AGR-2 data qualification reports (e.g., INL/EXT-11-22798, INL/EXT-12-26184, INL/EXT-13-29701, and INL/EXT-13-30750). During AGR-2 irradiation, two cycles, 152A and 153A, occurred when the ATR core was briefly at low power, so AGR-2 irradiation data are not used for physics and thermal calculations. Also, two cycles, 150A and 153B, are Power Axial Locator Mechanism (PALM) cycles when the ATR power is higher than during normal cycles. During the first PALM cycle, 150A, the experiment was temporarily moved from the B-12 location to the ATR water canal and during the second PALM cycle, 153B, the experiment was temporarily moved from the B-12 location to the I-24 location to avoid being overheated. During the “Outage” cycle, 153A, seven flow meters were installed downstream from seven Fission Product Monitoring System (FPMS) monitors to measure flows from the monitors and these data are included in the NDMAS database.

  18. ZNT7 binds to CD40 and influences CD154-triggered p38 MAPK activity in B lymphocytes-a possible regulatory mechanism for zinc in immune function

    Science.gov (United States)

    Zinc deficiency impairs immune system leading to frequent infections. Although it is known that zinc plays critical roles in maintaining healthy immune function, the underlying molecular targets are largely unknown. In this study, we showed that zinc is important for the CD154-CD40-mediated activati...

  19. Prevention of experimental colitis in SCID mice reconstituted with CD45RBhigh CD4+ T cells by blocking the CD40-CD154 interactions

    NARCIS (Netherlands)

    Liu, Z.; Geboes, K.; Colpaert, S.; Overbergh, L.; Mathieu, C.; Heremans, H.; de Boer, M.; Boon, L.; D'Haens, G.; Rutgeerts, P.; Ceuppens, J. L.

    2000-01-01

    Increased expression of CD40 and CD40 ligand (CD40L or CD154) has been found in inflamed mucosa of human inflammatory bowel disease (IBD), and interactions between these molecules seem to be involved in local cytokine production by macrophages. However, the precise role of CD40 signaling in the

  20. Blockade of CD40-CD154 at the time of donor-specific blood transfusion does not lead to prolonged kidney allograft survival in nonhuman primates

    NARCIS (Netherlands)

    Ringers, J; Haanstra, KG; Kroczek, RA; Kliem, K; Kuhn, EM; Wubben, J; Ossevoort, MA; Volk, HD; Jonker, M

    2002-01-01

    Background. In rodents it has been demonstrated that blockade of the CD40-CD154 (CD40L) pathway at the time of donor-specific blood transfusion (DST) can result in indefinite graft survival. Because it has been reported in the past that DST in monkeys can have a favorable effect on graft outcome and

  1. LHC dipoles flood into CERN : the dipole nr 154 crowns the efforts of the LHC teams for increasing the fabrication rate of the magnets.

    CERN Multimedia

    Maximilien Brice

    2003-01-01

    On 3 December the "tableau" on the 4th floor in building 30 indicated 1078 dipoles to completion - or in other words, 154 dipoles had by this day been delivered to CERN, enough to complete the first octant of the machine. CERN has also now received enough superconducting cable - the "heart" of the magnets - for 600 dipoles, nearly half the total number of 1232.

  2. Suppression effect of silicon (Si on Er3+ 1.54μm excitation in ZnO thin films

    Directory of Open Access Journals (Sweden)

    Bo Xu

    2016-08-01

    Full Text Available We have investigated the photoluminescence (PL characteristics of ZnO:Er thin films on Si (100 single crystal and SiO2-on-silicon (SiO2 substrates, synthesized by radio frequency magnetron sputtering. Rutherford backscattering/channeling spectrometry (RBS, X-ray diffraction (XRD and atomic force microscope (AFM were used to analyze the properties of thin films. The diffusion depth profiles of Si were determined by second ion mass spectrometry (SIMS. Infrared spectra were obtained from the spectrometer and related instruments. Compared with the results at room temperature (RT, PL (1.54μm intensity increased when samples were annealed at 250°C and decreased when at 550°C. A new peak at 1.15μm from silicon (Si appeared in 550°C samples. The Si dopants in ZnO film, either through the diffusion of Si from the substrate or ambient, directly absorbed the energy of pumping light and resulted in the suppression of Er3+ 1.54μm excitation. Furthermore, the energy transmission efficiency between Si and Er3+ was very low when compared with silicon nanocrystal (Si-NC. Both made the PL (1.54μm intensity decrease. All the data in experiments proved the negative effects of Si dopants on PL at 1.54μm. And further research is going on.

  3. Functional Interaction of CD154 Protein with α5β1 Integrin Is Totally Independent from Its Binding to αIIbβ3 Integrin and CD40 Molecules*

    Science.gov (United States)

    El Fakhry, Youssef; Alturaihi, Haydar; Yacoub, Daniel; Liu, Lihui; Guo, Wenyan; Leveillé, Claire; Jung, Daniel; Khzam, Lara Bou; Merhi, Yahye; Wilkins, John A.; Li, Hongmin; Mourad, Walid

    2012-01-01

    In addition to its classical CD40 receptor, CD154 also binds to αIIbβ3, α5β1, and αMβ2 integrins. Binding of CD154 to these receptors seems to play a key role in the pathogenic processes of chronic inflammation. This investigation was aimed at analyzing the functional interaction of CD154 with CD40, αIIbβ3, and α5β1 receptors. We found that the binding affinity of CD154 for αIIbβ3 is ∼4-fold higher than for α5β1. We also describe the generation of sCD154 mutants that lost their ability to bind CD40 or αIIbβ3 and show that CD154 residues involved in its binding to CD40 or αIIbβ3 are distinct from those implicated in its interaction to α5β1, suggesting that sCD154 may bind simultaneously to different receptors. Indeed, sCD154 can bind simultaneously to CD40 and α5β1 and biologically activate human monocytic U937 cells expressing both receptors. The simultaneous engagement of CD40 and α5β1 activates the mitogen-activated protein kinases, p38, and extracellular signal-related kinases 1/2 and synergizes in the release of inflammatory mediators MMP-2 and -9, suggesting a cross-talk between these receptors. PMID:22461623

  4. Blockade of CD40-CD154 costimulatory pathway promotes long-term survival of full-thickness porcine corneal grafts in nonhuman primates: clinically applicable xenocorneal transplantation.

    Science.gov (United States)

    Choi, H J; Lee, J J; Kim, D H; Kim, M K; Lee, H J; Ko, A Y; Kang, H J; Park, C; Wee, W R

    2015-03-01

    The porcine cornea may be a good solution for the shortage of human donor corneas because its size and refractive properties are comparable to those of the human cornea. However, antigenic differences need to be overcome to apply xenocorneal transplantation in actual clinical practice. We aimed to investigate the feasibility of full-thickness porcine corneas as human corneal substitutes using a CD40-CD154 costimulatory pathway blocking strategy in a clinically applicable pig-to-nonhuman primate corneal transplantation model. As a result, the mean survival time of the xenocorneal grafts in recipients who received anti-CD154 antibody-based immunosuppressants (POD318 (n = 4); >933, >243, 318 and >192) was significantly longer than that in controls (POD28 (n = 3); 21, 28 and 29; p = 0.010, log-rank test). Administration of anti-CD154 antibodies markedly reduced inflammatory cellular infiltrations (predominantly CD8 T cells and macrophages) into the xenocorneal grafts and almost completely blocked xenoantigen-triggered increases in Th1-associated cytokines, chemokines and C3a in the aqueous humor. Moreover, systemic expansion of memory T cells was effectively controlled and responses of anti-Gal/donor pig-specific antibodies were considerably diminished by programmed injection of anti-CD154 antibodies. Consequently, porcine corneas might be promising human corneal substitutes when the transplantation is accompanied by potent immunosuppression such as a CD40-CD154 costimulatory pathway blockade. © Copyright 2015 The American Society of Transplantation and the American Society of Transplant Surgeons.

  5. Tier 2 safety Basis Document for the B151 Complex (B151, B152, and B154)

    Energy Technology Data Exchange (ETDEWEB)

    Cooper, G A

    2006-12-07

    This Safety Basis Document (SBD) has been prepared for the B151 Complex at Site 200 to meet the current contractual requirements at Lawrence Livermore National Laboratory (LLNL). B151 Complex consists of three separate complex and distinct buildings: B151, B152, and B154, represented within this document as facility segments. Based upon its chemical and radiological inventories, Segment B151 is classified as a Low Hazard facility segment. All other hazards associated with Segment B151 operations have been determined to be LSI. Based upon their inventories, Segment B152 and Segment B154 are each classified as LSI facility segments. However, for operational flexibility involving radiological materials, CMS chooses to classify each of these as Low Hazard facility segments. Changes in operations, maximum inventories, materials, or release potential that could result in larger consequences, or that could negatively impact the safety of the facility, will necessitate a re-evaluation of these facility classifications. This SBD is governed by the LLNL Non-Nuclear Work Smart Standards (WSSs) requirements including the ES&H Manual, Document 3.1, Non-Nuclear Safety Basis Program [LLNL, 2004a] and the DOE Explosives Safety Manual (ESM) [LLNL, 2004b]. This SBD demonstrates that the three segments of B151 Complex can be operated as Low Hazard facility segments without undue risks to co-located workers, the public, or the environment. This SBD: (1) Provides a systematic identification of the safety and health hazards associated with operations in the B151 Complex, (2) Compares facility inventories of explosives, biological materials, chemicals, radioisotopes with LLNL threshold values for each facility hazard classification criteria, (3) Examines standard and non-standard industrial hazards, (4) Examines the hazards of greatest significance, (5) Qualitatively discusses the programs that evaluate and control these hazards to ensure the protection of co-located workers, the public

  6. Particle-γ coincidence spectroscopy of the N = 90 nucleus {sup 154}Gd by (p, tγ)

    Energy Technology Data Exchange (ETDEWEB)

    Allmond, J.M. [Oak Ridge National Laboratory, Physics Division, Oak Ridge, TN (United States); University of Richmond, Department of Physics, Richmond, VA (United States); Beausang, C.W.; Ross, T.J.; Brooks, W.; Darakchieva, B.K. [University of Richmond, Department of Physics, Richmond, VA (United States); Humby, P. [University of Richmond, Department of Physics, Richmond, VA (United States); University of Surrey, Department of Physics, Guildford, Surrey (United Kingdom); Basunia, M.S.; Fallon, P.; Jeppesen, H.B.; McMahan, M.A.; Phair, L.; Rasmussen, J.O. [Lawrence Berkeley National Laboratory, Nuclear Science Division, Berkeley, CA (United States); Bernstein, L.A. [Lawrence Berkeley National Laboratory, Nuclear Science Division, Berkeley, CA (United States); University of California, Department of Nuclear Engineering, Berkeley, CA (United States); Bleuel, D.L.; Burke, J.T.; Scielzo, N.D. [Lawrence Livermore National Laboratory, Livermore, CA (United States); Brown, N. [Georgia Institute of Technology, School of Physics, Atlanta, GA (United States); Dudziak, K.R.; LeBlanc, J.D.; Meyer, D.A. [Rhodes College, Department of Physics, Memphis, TN (United States); Evans, K.E. [University of California, Department of Nuclear Engineering, Berkeley, CA (United States); Lesher, S.R. [Lawrence Livermore National Laboratory, Livermore, CA (United States); University of Wisconsin-La Crosse, Department of Physics, La Crosse, WI (United States); Stroberg, S.R. [University of California, Department of Nuclear Engineering, Berkeley, CA (United States); TRIUMF, Vancouver, British Columbia (Canada); Wiedeking, M. [Lawrence Livermore National Laboratory, Livermore, CA (United States); iThemba LABS, Department of Nuclear Physics, P.O. Box 722, Somerset West (South Africa)

    2017-03-15

    A segmented Si-telescope and HPGe array, STARS-LIBERACE, was used to study the {sup 156}Gd(p, tγ){sup 154}Gd direct reaction by particle-γ coincidence spectroscopy. New cross sections with a 25MeV proton beam are reported and compared to previous (p, t) and (t, p) studies. Furthermore, additional evidence for coexisting K{sup π} = 0{sub 1}{sup +}, 2{sub 1}{sup +} and 0{sub 2}{sup +}, 2{sub 2}{sup +} configurations at N = 90 is presented. Direct and indirect population patterns of the low-lying states are also explored. Review of the new and existing evidence favors an interpretation based on a configuration-dependent pairing interaction. The weakening of monopole pairing strength and an increase in quadrupole pairing strength could bring 2p-2h 0{sup +} states below 2Δ. This may account for a large number of the low-lying 0{sup +} states observed in two-nucleon transfer reactions. A hypothesis for the origin of the 0{sub 2}{sup +} and 0{sub 3}{sup +} states is provided. (orig.)

  7. Intratumoral injection of Ad-ISF35 (Chimeric CD154) breaks tolerance and induces lymphoma tumor regression.

    Science.gov (United States)

    Urquiza, Mauricio; Melo-Cardenas, Johanna; Aguillon, Robier; Kipps, Thomas J; Castro, Januario E

    2015-01-01

    Ad-ISF35, an adenovirus vector encoding a membrane-bound engineered CD154 chimeric protein (ISF35), induces complete A20 lymphoma tumor regression in mice after intratumoral direct injection (IDI). Ad-ISF35 induced durable local and systemic antitumor responses associated with a rapid tumor infiltration of macrophages and neutrophils as well as increased levels of proinflammatory cytokines in the tumor microenvironment. Ad-ISF35 IDI transduced preferentially fibroblasts and macrophages present in the tumor microenvironment, and ISF35 protein expression was observed in only 0.25% of cells present in the tumor. Moreover, Ad-ISF35 IDI induced upregulation of CD40 in tumor and immune regulatory cells, including those that did not express ISF35, suggesting the presence of a strong bystander effect. These responses resulted in the generation of IFN-γ-secreting cytotoxic lymphocytes and the production of specific cytotoxic antibodies against lymphoma cells. Overall, cellular immune therapy based on ISF35 induced phenotypic changes in the tumor cells and tumor microenvironment that were associated with a break in tumor immune tolerance and a curative antitumor effect in this lymphoma mouse model. Our data highlight the potential activity that modulation of costimulatory signaling has in cancer therapy.

  8. Spin distribution of evaporation residues formed in complete and incomplete fusion in 16O+154Sm system

    Directory of Open Access Journals (Sweden)

    D. Singh

    2017-11-01

    Full Text Available Spin distributions for several evaporation residues populated in the 16O+154Sm system have been measured at projectile energy ≈ 6.2 MeV/A by using the charged particle–γ-coincidence technique. The measured spin distributions of the evaporation residues populated through incomplete fusion associated with ‘fast’ α and 2α-emission channels are found to be entirely different from fusion–evaporation channels. It is observed that the mean input angular momentum for the evaporation residues formed in incomplete fusion channel is relatively higher than that observed for evaporation residues in complete fusion channels. The feeding intensity profile of evaporation residues populated through complete fusion and incomplete fusion have also been studied. The incomplete fusion channels are found to have narrow range feeding only for high spin states, while complete fusion channels are strongly fed over a broad spin range and widely populated. Comparison of present results with earlier data suggests that the mean input angular momentum values are relatively smaller for spherical target than that of deformed target using the same projectile and incident energy highlighting the role of target deformation in incomplete fusion dynamics.

  9. Clinical features and outcomes in 154 patients with haemorrhagic moyamoya disease: comparison of conservative treatment and surgical revascularization.

    Science.gov (United States)

    Huang, Zheng; Ding, Xuehu; Men, Weidong; Zhang, Dong; Zhao, Yuanli; Wang, Rong; Wang, Shuo; Zhao, Jizong

    2015-10-01

    Rebleeding is an unsatisfactory outcome for patients with haemorrhagic MMD. This study mainly investigated clinical features and outcomes in haemorrhagic MMD. A retrospective review was performed on a total of 154 patients with haemorrhagic MMD comprising 126 surgically treated and 28 conservatively treated patients. There were 102 female and 52 male patients with a mean age at the initial bleeding of 33.95 years. Preoperative rebleeding occurred in 37 patients, and multivariate Cox regression analysis demonstrated that age at the time of initial bleeding (P revascularization, perioperative ischaemic stroke occurred in five (4.03%) and intracranial bleeding in four (3.23%). The mean follow-up period was 36.12  months. Recurrent bleeding occurred in six (10.17%) of 59 patients treated with direct revascularization, seven (20.69%) of 34 patients treated with indirect revascularization, two (6.45%) of 31 patients treated with combined revascularization and six (21.43%) of 28 patients treated conservatively. Kaplan-Meier analysis revealed no statistical differences in preventing rebleeding between direct, indirect and combined revascularization and conservative treatment (P = 0.311). Age at the initial bleeding is a risk factor for rebleeding in haemorrhagic MMD. Although surgical revascularization show the tendency to decrease the rebleeding rate, there is no statistical difference between direct revascularization, indirect revascularization, combined revascularization and conservative treatment in preventing rebleeding. Further study is needed to determine whether surgical revascularization is effective in select population or with certain techniques.

  10. Spin distribution of evaporation residues formed in complete and incomplete fusion in 16O+154Sm system

    Science.gov (United States)

    Singh, D.; Linda, Sneha B.; Giri, Pankaj K.; Mahato, Amritraj; Tripathi, R.; Kumar, Harish; Afzal Ansari, M.; Sathik, N. P. M.; Ali, Rahbar; Kumar, Rakesh; Muralithar, S.; Singh, R. P.

    2017-11-01

    Spin distributions for several evaporation residues populated in the 16O+154Sm system have been measured at projectile energy ≈ 6.2 MeV/A by using the charged particle-γ-coincidence technique. The measured spin distributions of the evaporation residues populated through incomplete fusion associated with 'fast' α and 2α-emission channels are found to be entirely different from fusion-evaporation channels. It is observed that the mean input angular momentum for the evaporation residues formed in incomplete fusion channel is relatively higher than that observed for evaporation residues in complete fusion channels. The feeding intensity profile of evaporation residues populated through complete fusion and incomplete fusion have also been studied. The incomplete fusion channels are found to have narrow range feeding only for high spin states, while complete fusion channels are strongly fed over a broad spin range and widely populated. Comparison of present results with earlier data suggests that the mean input angular momentum values are relatively smaller for spherical target than that of deformed target using the same projectile and incident energy highlighting the role of target deformation in incomplete fusion dynamics.

  11. [Dynamic alteration of CD154/CD40 and its effects on Th1/Th2 polarization in inducible co-stimulator ligand knockout mice infected with Schistosoma japonicum].

    Science.gov (United States)

    Wang, Yu; Xia, Chao-ming

    2015-12-18

    To analyze effect on the CD154-CD40 signaling pathway and Th1/Th2 polarization by deficient inducible co-stimulator (ICOS)-ICOS ligand (ICOSL) signaling in mice infected with Schistosoma japonicum. ICOSL knockout (ICOSL-KO) mice and wild-type C57BL/6J mice were used as experimental Schistosomiasis model infected with Schistosoma japonicum. The expressions of CD154 and CD40 on splenocytes and on inflammatory cells around granulomatous infiltration of liver in mice infected with Schistosoma japonicum were analyzed by flow cytometry,immunohistochemical staining, respectively, on the day before infection (0 week)and at the end of 4, 7, 12, 16 and 20 weeks post-infection. The splenocytes of the mice were stimulated with soluble egg antigen(SEA) for 72 hours, then the concentrations of interferon gamma(IFN-γ) and interleukin-4 (IL-4) in the culture supernatants were measured by sandwich enzyme-linked immunosorbent assay (ELISA) kits. The levels of SEA-specific antibodies of IgG and IgG1 and IgG2a were measured in the mice sera by ELISA. The granulomatous pathology in the mice liver was dynamically observed by hematoxylin and eosin (HE) staining. Compared with the wild-type C57BL/6J mice, the expressions of CD154 on CD4+ T splenocytes [(18.62 ± 4.76)% vs.(27.91 ± 3.94)%, (22.44 ± 4.67)% vs.(40.86 ± 5.21)%, (25.50 ± 6.81)% vs.(43.81 ± 8.41)%, (20.22 ± 5.28)% vs.(40.95 ± 7.34)%, (17.87 ± 4.59)% vs.(33.16 ± 6.31)%, all PCD154[(0.319 ± 0.066) vs.(0.488 ± 0.086), (0.389 ± 0.067) vs.(0.596 ± 0.082), (0.378 ± 0.064) vs.(0.543 ± 0.072), (0.348 ± 0.069) vs.(0.523 ± 0.076), all PCD154 and CD40 and impairment of Th2 immune response in the ICOSL-KO mice infected with Schistosoma japonicum, accompanying with notedly reduced hepatic granulomatous pathology. The ICOS-ICOSL signaling has a regulatory effect on CD154-CD40 signaling pathway, and may play an important role in the hepatic egg granuloma formation of Schistosomiasis.

  12. Study of Association of CD40-CD154 Gene Polymorphisms with Disease Susceptibility and Cardiovascular Risk in Spanish Rheumatoid Arthritis Patients

    Science.gov (United States)

    García-Bermúdez, Mercedes; González-Juanatey, Carlos; López-Mejías, Raquel; Teruel, María; Corrales, Alfonso; Miranda-Filloy, José A.; Castañeda, Santos; Balsa, Alejandro; Fernández-Gutierrez, Benjamín; González-Álvaro, Isidoro; Gómez-Vaquero, Carmen; Blanco, Ricardo; Llorca, Javier

    2012-01-01

    Objective Rheumatoid arthritis (RA) is a chronic inflammatory disease associated with increased cardiovascular (CV) mortality. Since CD40-CD154 binding has direct consequences on inflammation process initiation, we aimed to replicate previous findings related to disease susceptibility in Spanish RA population. Furthermore, as the major complication in RA disease patients is the development of CV events due to accelerated atherosclerosis, and elevated levels of CD40L/CD154 are present in patients with acute myocardial infarction, we assessed the potential association of CD40 and CD154/CD40L gene variants with CV risk in Spanish RA patients. Methods One thousand five hundred and seventy-five patients fulfilling the 1987 ACR classification criteria for RA and 1600 matched controls were genotyped for the CD40 rs1883832, rs4810485 and rs1535045 and CD154 rs3092952 and rs3092920 gene polymorphisms, using predesigned TaqMan single nucleotide polymorphism genotyping assays. Afterwards, we investigated the influence of CD40-CD154 gene variants in the development of CV events. Also, in a subgroup of 273 patients without history of CV events, we assessed the influence of these polymorphisms in the risk of subclinical atherosclerosis determined by carotid ultrasonography. Results Nominally significant differences in the allele frequencies for the rs1883832 CD40 gene polymorphism between RA patients and controls were found (p = 0.038). Although we did not observe a significant association of CD40-CD154 gene variants with the development of CV events, an ANCOVA model adjusted for sex, age at the time of the ultrasonography assessment, follow-up time, traditional CV risk factors and anti-cyclic citrullinated peptide antibodies disclosed a significant association (p = 0.0047) between CD40 rs1535045 polymorphism and carotid intima media thickness, a surrogate marker of atherosclerosis. Conclusion Data from our pilot study indicate a potential association of rs1883832 CD40

  13. Study of association of CD40-CD154 gene polymorphisms with disease susceptibility and cardiovascular risk in Spanish rheumatoid arthritis patients.

    Directory of Open Access Journals (Sweden)

    Mercedes García-Bermúdez

    Full Text Available OBJECTIVE: Rheumatoid arthritis (RA is a chronic inflammatory disease associated with increased cardiovascular (CV mortality. Since CD40-CD154 binding has direct consequences on inflammation process initiation, we aimed to replicate previous findings related to disease susceptibility in Spanish RA population. Furthermore, as the major complication in RA disease patients is the development of CV events due to accelerated atherosclerosis, and elevated levels of CD40L/CD154 are present in patients with acute myocardial infarction, we assessed the potential association of CD40 and CD154/CD40L gene variants with CV risk in Spanish RA patients. METHODS: One thousand five hundred and seventy-five patients fulfilling the 1987 ACR classification criteria for RA and 1600 matched controls were genotyped for the CD40 rs1883832, rs4810485 and rs1535045 and CD154 rs3092952 and rs3092920 gene polymorphisms, using predesigned TaqMan single nucleotide polymorphism genotyping assays. Afterwards, we investigated the influence of CD40-CD154 gene variants in the development of CV events. Also, in a subgroup of 273 patients without history of CV events, we assessed the influence of these polymorphisms in the risk of subclinical atherosclerosis determined by carotid ultrasonography. RESULTS: Nominally significant differences in the allele frequencies for the rs1883832 CD40 gene polymorphism between RA patients and controls were found (p=0.038. Although we did not observe a significant association of CD40-CD154 gene variants with the development of CV events, an ANCOVA model adjusted for sex, age at the time of the ultrasonography assessment, follow-up time, traditional CV risk factors and anti-cyclic citrullinated peptide antibodies disclosed a significant association (p=0.0047 between CD40 rs1535045 polymorphism and carotid intima media thickness, a surrogate marker of atherosclerosis. CONCLUSION: Data from our pilot study indicate a potential association of rs

  14. Detection of Foreign Antigen-specific CD4+Foxp3+ Regulatory T Cells by MHC Class II Tetramer and Intracellular CD154 Staining

    Science.gov (United States)

    Choi, Jin Young

    2013-01-01

    The unrestricted population of CD4+Foxp3+ regulatory T (Treg) cells, which have been known to control the expression of autoimmune diseases and protective immunity to inflammatory reactions, has led to greater appreciation of functional plasticity. Detecting and/or isolating Ag-specific CD4+Foxp3+ Tregs at the single cell level are required to study their function and plasticity. In this study, we established and compared both MHC class II tetramer and intracellular CD154 staining, in order to detect CD4+Foxp3+ Treg specific for foreign Ag in acute and chronic infections with lymphocytic choriomeningitis virus (LCMV). Our results revealed that MHC class II tetramer staining showed a lower detection rate of LCMV GP66-77-specific CD4+ T cells because most of MHC class II tetramers were unbound and unstable when combined staining was performed with intracellular cytokines. In contrast, intracellular CD154 staining was revealed to be easier and simple for detecting LCMV GP66-77-specific CD4+ T cells, compared to MHC class II tetramer staining. Subsequently, we employed intracellular CD154 staining to detect LCMV GP66-77-specific CD4+Foxp3+ Tregs using Foxp3GFP knock-in mouse, and found that LCMV GP66-77-specific CD4+Foxp3+ Tregs and polyclonal CD4+Foxp3+ Tregs showed differential expansion in mice infected with LCMV Arms or Cl13 at acute (8 and 13 days pi) and chronic phases (35 days pi). Therefore, our results provide insight into the valuable use of intracellular CD154 staining to detect and characterize foreign Ag-specific CD4+Foxp3+ Treg in various models. PMID:24385945

  15. Detection of Foreign Antigen-specific CD4(+)Foxp3(+) Regulatory T Cells by MHC Class II Tetramer and Intracellular CD154 Staining.

    Science.gov (United States)

    Choi, Jin Young; Eo, Seong Kug

    2013-12-01

    The unrestricted population of CD4(+)Foxp3(+) regulatory T (Treg) cells, which have been known to control the expression of autoimmune diseases and protective immunity to inflammatory reactions, has led to greater appreciation of functional plasticity. Detecting and/or isolating Ag-specific CD4(+)Foxp3(+) Tregs at the single cell level are required to study their function and plasticity. In this study, we established and compared both MHC class II tetramer and intracellular CD154 staining, in order to detect CD4(+)Foxp3(+) Treg specific for foreign Ag in acute and chronic infections with lymphocytic choriomeningitis virus (LCMV). Our results revealed that MHC class II tetramer staining showed a lower detection rate of LCMV GP66-77-specific CD4(+) T cells because most of MHC class II tetramers were unbound and unstable when combined staining was performed with intracellular cytokines. In contrast, intracellular CD154 staining was revealed to be easier and simple for detecting LCMV GP66-77-specific CD4(+) T cells, compared to MHC class II tetramer staining. Subsequently, we employed intracellular CD154 staining to detect LCMV GP66-77-specific CD4(+)Foxp3(+) Tregs using Foxp3(GFP) knock-in mouse, and found that LCMV GP66-77-specific CD4(+)Foxp3(+) Tregs and polyclonal CD4(+)Foxp3(+) Tregs showed differential expansion in mice infected with LCMV Arms or Cl13 at acute (8 and 13 days pi) and chronic phases (35 days pi). Therefore, our results provide insight into the valuable use of intracellular CD154 staining to detect and characterize foreign Ag-specific CD4(+)Foxp3(+) Treg in various models.

  16. Draft Genome Sequence of Saccharomonospora sp. Strain LRS4.154, a Moderately Halophilic Actinobacterium with the Biotechnologically Relevant Polyketide Synthase and Nonribosomal Peptide Synthetase Systems

    Science.gov (United States)

    Alonso-Carmona, Scarlett; Vera-Gargallo, Blanca; de la Haba, Rafael R.; Ventosa, Antonio; Sandoval-Trujillo, Horacio

    2017-01-01

    ABSTRACT The draft genome sequence of Saccharomonospora sp. strain LRS4.154, a moderately halophilic actinobacterium, has been determined. The genome has 4,860,108 bp, a G+C content of 71.0%, and 4,525 open reading frames (ORFs). The clusters of PKS and NRPS genes, responsible for the biosynthesis of a large number of biomolecules, were identified in the genome. PMID:28546487

  17. [Organizational problems of disaster victim identification in mass casualties as exemplified by Tu 154-M and Airbus A310 passenger plane crashes].

    Science.gov (United States)

    Volkov, A V; Kolkutin, V V; Klevno, V A; Shkol'nikov, B V; Kornienko, I V

    2008-01-01

    Managerial experience is described that was gained during the large-scale work on victim identification following mass casualties in the Tu 154-M and Airbus A310 passenger plane crashes. The authors emphasize the necessity to set up a specialized agency of constant readiness meeting modern requirements for the implementation of a system of measures for personality identification. This agency must incorporate relevant departments of the Ministries of Health, Defense, and Emergency Situations as well as investigative authorities and other organizations.

  18. Preparation of activated carbon from doum stone and its application on adsorption of 60Co and 152+154Eu: Equilibrium, kinetic and thermodynamic studies.

    Science.gov (United States)

    Hamed, Mostafa M; Ali, M M S; Holiel, M

    2016-11-01

    Removal of radionuclides from wastewater before discharging to environment is necessary for the safety of living beings. Activated carbon prepared from doum stone (DS), an agricultural waste by-product, has been used for the sorption of 60Co and 152+154Eu radionuclides from aqueous solutions. DS has been characterized by different analytical tools. The efficiency of the adsorbent was investigated using batch sorption technique under different experimental conditions. The equilibrium sorption data were analyzed using Freundlich and Langmuir isotherm models. The kinetic experimental data were analyzed using four kinetic models including pseudo-first order, pseudo-second order, Elovich and intraparticle diffusion model to examine the mechanism of sorption and potential rate-controlling step. The maximum capacity of DS was found to be 121 mg/g and 166 mg/g for cobalt and europium, respectively. Sorption efficiency of DS to remove 60Co, 152+154Eu and 134Cs from real radioactive wastewater and environmental (river water and sea water) samples was also investigated. The results revealed that the prepared DS as low cost could be used as a promising material for the simultaneous removal of different radionuclides such as 60Co, 152+154Eu and 134Cs, or trivalent actinides such as 241, 242m,243Am from real radioactive waste and environmental water samples. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Antitumor activity of an oncolytic adenoviral-CD40 ligand (CD154) transgene construct in human breast cancer cells.

    Science.gov (United States)

    Gomes, Erica M; Rodrigues, Margret S; Phadke, Anagha P; Butcher, Lindsay D; Starling, Cherry; Chen, Salina; Chang, Dongkun; Hernandez-Alcoceba, Ruben; Newman, Joseph T; Stone, Marvin J; Tong, Alex W

    2009-02-15

    CD40 ligand (CD40L, CD154) plays a central role in immunoregulation and also directly modulates epithelial cell growth and differentiation. We previously showed that the CD40 receptor is commonly expressed in primary breast cancer tissues. In this proof-of-principle study, we examined the breast cancer growth-regulatory activities of an oncolytic adenoviral construct carrying the CD40L transgene (AdEHCD40L). In vitro and in vivo evaluations were carried out on AdEHCD40L to validate selective viral replication and CD40L transgene activity in hypoxia inducing factor-1alpha and estrogen receptor-expressing human breast cancer cells. AdEHCD40L inhibited the in vitro growth of CD40+ human breast cancer lines (T-47D, MDA-MB-231, and BT-20) by up to 80% at a low multiplicity of infection of 1. Incorporation of the CD40L transgene reduced the effective dose needed to achieve 50% growth inhibition (ED50) by approximately 10-fold. In contrast, viral and transgene expression of AdEHCD40L, as well its cytotoxicity, was markedly attenuated in nonmalignant cells. Intratumoral injections with AdEHCD40L reduced preexisting MDA-MB-231 xenograft growth in severe combined immunodeficient mice by >99% and was significantly more effective (P<0.003) than parental virus AdEH (69%) or the recombinant CD40L protein (49%). This enhanced antitumor activity correlated with cell cycle blockade and increased apoptosis in AdEHCD40L-infected tumor cells. These novel findings, together with the previously known immune-activating features of CD40L, support the potential applicability of AdEHCD40L for experimental treatment of human breast cancer.

  20. Lymphoscintigraphy of the lower limbs: a retrospective study of 154 cases from March 2009 to June 2010

    Energy Technology Data Exchange (ETDEWEB)

    Barral, Carlyle Marques; Carvalho, Luciana Araujo; Stehling, Alexandre Pace; Silva, Antonio Carlos Moura da; Castro, Atena Cipriano; Ivo, Claudio Santana; Korman, Daniel Einstoss; Couto, Eneida de Melo; Magalhaes, Leonardo Neuenschwander; Felix, Marco Tulio Marques; Machado, Fernando Santana [ECOAR Medicina Diagnostica, Belo Horizonte, MG (Brazil)

    2013-07-01

    Introduction: Lymphoscintigraphy of the lower limbs (LLL) is an effective method to assess lymphatic function. Objective: to present the case of 154 patients undergoing LLL between March 2009 and June 2010. Methods: Images of the pelvis and lower limbs were acquired after simultaneous intradermal administration of 1.0 mCi of 99mTc-Dextran 500 in 0.1mL in the interdigital space of the first and second toes, bilaterally. Results: 129 (83.77%) patients were female, mean age was 51.48 years, with 32 patients (20.78%) aged between 40 and 49 years. 58 patients (37.66%) had body mass index between 25 and 30 kg/m², 92 patients (59.74%) reported edema, lymphedema or swelling as the reason for examination. 93 patients (60.39%) without previous vascular surgery or procedure, 108 patients (70.13%) without previous inflammation, erysipelas or trauma. 103 patients (66.88%) presented with bilateral swelling upon examination, with 48 patients (31.17%) reporting edema that worsened in the evening. 77 patients (50%) with symptoms for over a year. 31 patients (20.13%) were hypertensive. Scintigraphic findings: 149 patients (96.75%) with some abnormality caracteupon examination, 38 with severe bilateral delay in lymphatic transit time, 85 (55.19%) with normo functioning lymph nodes, 62 patients with bilateral radiotracer drainage via small saphenous veins, 84 patients (54.55%) without collateral vessels, 92 (59.74%) without lymphatic retention, 85 patients (55.19%) without dermal backflow. 15 patients (9.74%) showed lymph nodes in the popliteal region. Conclusions: lower limb lymphoscintigraphy is available as a method to detect lymphedema and changes in lymphatic drainage, and is important for initial investigative screenings, early stage assessments of edema, and for monitoring therapeutic, clinical or surgical interventions. (author)

  1. Gene immunotherapy of chronic lymphocytic leukemia: a phase I study of intranodally injected adenovirus expressing a chimeric CD154 molecule.

    Science.gov (United States)

    Castro, Januario E; Melo-Cardenas, Johanna; Urquiza, Mauricio; Barajas-Gamboa, Juan S; Pakbaz, Ramin S; Kipps, Thomas J

    2012-06-15

    New therapies for chronic lymphocytic leukemia (CLL) are needed, particularly those that can eradicate residual disease and elicit anti-CLL immune responses. CD40 ligation on CLL cells, which can be achieved using adenovirus encoding chimeric CD154 (Ad-ISF35), enhances their ability to function as antigen-presenting cells and increases their sensitivity to clearance by immune-effector mechanisms. In this study, we report the results of a first-in-man phase I trial of intranodal direct injection (IDI) of Ad-ISF35 in patients with CLL to evaluate toxicity, safety, and tolerability. Fifteen patients received a single IDI of 1 × 10(10) to 33 × 10(10) Ad-ISF35 viral particles (vp), with a defined maximum tolerated dose as 1 × 10(11) vp. Although the most common adverse events were transient grade 1 to 2 pain at the injection site and flu-like symptoms following IDI, some patients receiving the highest dose had transient, asymptomatic grade 3 to 4 hypophosphatemia, neutropenia, or transaminitis. Increased expression of death receptor, immune costimulatory molecules, and Ad-ISF35 vector DNA was detected in circulating CLL cells. Notably, we also observed preliminary clinical responses, including reductions in leukemia cell counts, lymphadenopathy, and splenomegaly. Six patients did not require additional therapy for more than 6 months, and three achieved a partial remission. In conclusion, Ad-ISF35 IDI was safely delivered in patients with CLLs and induced systemic biologic and clinical responses. These results provide the rationale for phase II studies in CLLs, lymphomas, and CD40-expressing solid tumors.

  2. Revisiting the Ceara Rise, equatorial Atlantic Ocean: isotope stratigraphy of ODP Leg 154 from 0 to 5 Ma

    Directory of Open Access Journals (Sweden)

    R. H. Wilkens

    2017-07-01

    Full Text Available Isotope stratigraphy has become the method of choice for investigating both past ocean temperatures and global ice volume. Lisiecki and Raymo (2005 published a stacked record of 57 globally distributed benthic δ18O records versus age (LR04 stack. In this study LR04 is compared to high-resolution records collected at all of the sites drilled during ODP Leg 154 on the Ceara Rise, in the western equatorial Atlantic Ocean. Newly developed software is used to check data splices of the Ceara Rise sites and better align out-of-splice data with in-splice data. Core images recovered from core table photos are depth and age scaled and greatly assist in the data analysis. The entire splices of ODP sites 925, 926, 927, 928 and 929 were reviewed. Most changes were minor although several were large enough to affect age models based on orbital tuning. A Ceara Rise composite record of benthic δ18O is out of sync with LR04 between 1.80 and 1.90 Ma, where LR04 exhibits two maxima but Ceara Rise data contain only one. The interval between 4.0 and 4.5 Ma in the Ceara Rise compilation is decidedly different from LR04, reflecting both the low amplitude of the signal over this interval and the limited amount of data available for the LR04 stack. A regional difference in benthic δ18O of 0.2 ‰ relative to LR04 was found. Independent tuning of Site 926 images and physical property data to the Laskar et al. (2004 orbital solution and integration of available benthic stable isotope data from the Ceara Rise provides a new regional reference section for the equatorial Atlantic covering the last 5 million years.

  3. Relationship Between Enterococcus faecalis Infective Endocarditis and Colorectal Neoplasm: Preliminary Results From a Cohort of 154 Patients.

    Science.gov (United States)

    Pericàs, Juan M; Corredoira, Juan; Moreno, Asunción; García-País, M José; Falces, Carlos; Rabuñal, Ramón; Mestres, Carlos A; Alonso, M Pilar; Marco, Francesc; Quintana, Eduard; Almela, Manel; Paré, Juan C; Llopis, Jaume; Castells, Antoni; Miró, José M

    2017-06-01

    The association between Streptococcus bovis group infective endocarditis and colorectal neoplasm (CRN) is well-known. However, no studies have assessed the association between Enterococcus faecalis infective endocarditis (EFIE) and CRN. We aimed to determine whether the prevalence of CRN is higher in patients with EFIE and an unclear source of infection than in patients with EFIE and a known source of infection or in the general population. Retrospective analysis of a cohort of 154 patients with definite EFIE (109 with an unclear source of infection and 45 with an identified source) from 2 Spanish teaching hospitals to determine the prevalence of CRN and other colorectal diseases. In the group with an unknown source of infection, 61 patients (56%) underwent colonoscopy; of these, 31 (50.8%) had CRN. Nonadvanced colorectal adenoma was detected in 22 patients (36%), advanced adenoma in 5 (8.2%), and colorectal carcinoma (CRC) in 4 (6.6%). Among patients who survived the EFIE episode with ≥ 2 years of follow-up, 1 case of CRC was subsequently diagnosed. Only 6 patients (13.3%) with an identified focus of infection underwent colonoscopy; 1 of these patients (16.7%) was diagnosed with CRN. The prevalence of adenomas was slightly higher than that of the Spanish population in the same age range, whereas that of CRC was 17-fold higher. CRN was found in more than half of patients with EFIE and an unclear focus of infection who underwent colonoscopy. Colonoscopy should be recommended in patients with EFIE and an unclear source of infection. Copyright © 2017 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.

  4. 154 ORIGINAL ARTICLE

    African Journals Online (AJOL)

    boaz

    The samples were cultured on bile aesculinazide agar and the isolates were identified with microgen test kit. The enterococcal strains isolated include. Enterococcus faecalis, Enterococcus faecium, Enterococcus mundtii, Enterococcus gallinarum, Enterococcus casseliflavus,. Enterococcus dispar, Enterococcoushirae and ...

  5. 154 ORIGINAL ARTICLE

    African Journals Online (AJOL)

    boaz

    Les exemples inclus et de l'environnement clinique. Les échantillons cliniques inclus les selles, l'urine et d'écouvillons plaie tandis que les échantillons environnementaux inclus écouvillons prélevés sur des fournisseurs de soins de santé les mains, étage, lits, poignée de porte, un brassard, stéthoscope, lavabo, toilettes ...

  6. Radiolesão vascular como efeito deletério da braquiterapia intra-arterial com dose elevada de Samário-153 em coelhos hipercolesterolêmicos Vascular radiolesion as a deleterious effect of high-dose-rate intraarterial brachytherapy with Samarium-153 in hypercholesterolemic rabbits

    Directory of Open Access Journals (Sweden)

    Dalton Bertolim Précoma

    2006-10-01

    Full Text Available OBJETIVO: Este estudo tem por objetivo avaliar as alterações vasculares morfológicas e morfométricas induzidas pela braquiterapia com Samário-153 (153 Sm em coelhos hipercolesterolêmicos, com doses elevadas. MÉTODOS: Foram analisados 43 coelhos hipercolesterolêmicos, brancos, da raça New Zealand, e o total de 86 artérias ilíacas submetidas a lesão por balão de angioplastia. Divididos em três grupos: dois (GI irradiados com as doses de 15Gy (n=14 e 60Gy (n=36 e um grupo controle (n=36. Foram realizadas avaliação histológica morfométrica e análise histológica qualitativa para análise tecidual. RESULTADOS: Foram observadas uma redução significativa da neoproliferação intimal (NPI no GI 15 Gy (pOBJECTIVE: This study was designed to evaluate vascular morphological and morphometric changes induced by brachytherapy with samarium-153 (Sm-153 at high doses in hypercholesterolemic rabbits. METHODS: Forty-three New Zealand White hypercholesterolemic rabbits were analyzed, and the total of 86 iliac arteries underwent balloon angioplasty injury. The rabbits were divided into three different groups: two irradiation groups (IG assigned to 15 Gy (n=14 and 60 Gy (n=36 irradiation doses, respectively, and a control group (n = 36. Histomorphometric and qualitative histological analyses were performed for tissue evaluation. RESULTS: Significant reductions were found in neointimal proliferation (NIP (p< 0.0001, media area (MA (p<0.0001 and percent stenosis (p<0.0001 in the 15-Gy IG, compared to the other groups. The 60-Gy IG had the higher rate of NIP, increase in media and vessel areas (VA and percent stenosis. The 60-Gy IG also showed the greatest number of xanthomatous cells (60-Gy IG: 86.11% and 15-Gy IG: 14.29%, p<0.0001 and the highest amount of hyaline amorphous tissue (60-Gy IG:58.33% and 15-Gy IG:0%, p=0.0001 and vascular proliferation (60-Gy IG:30.56% and 15-Gy IG:0%, p=0.0221. No statistically significant differences were found

  7. The type 2 diabetes risk allele of TMEM154-rs6813195 associates with decreased beta cell function in a study of 6,486 Danes.

    Directory of Open Access Journals (Sweden)

    Marie Neergaard Harder

    Full Text Available A trans-ethnic meta-analysis of type 2 diabetes genome-wide association studies has identified seven novel susceptibility variants in or near TMEM154, SSR1/RREB1, FAF1, POU5F1/TCF19, LPP, ARL15 and ABCB9/MPHOSPH9. The aim of our study was to investigate associations between these novel risk variants and type 2 diabetes and pre-diabetic traits in a Danish population-based study with measurements of plasma glucose and serum insulin after an oral glucose tolerance test in order to elaborate on the physiological impact of the variants.Case-control analyses were performed in up to 5,777 patients with type 2 diabetes and 7,956 individuals with normal fasting glucose levels. Quantitative trait analyses were performed in up to 5,744 Inter99 participants naïve to glucose-lowering medication. Significant associations between TMEM154-rs6813195 and the beta cell measures insulinogenic index and disposition index and between FAF1-rs17106184 and 2-hour serum insulin levels were selected for further investigation in additional Danish studies and results were combined in meta-analyses including up to 6,486 Danes.We confirmed associations with type 2 diabetes for five of the seven SNPs (TMEM154-rs6813195, FAF1-rs17106184, POU5F1/TCF19-rs3130501, ARL15-rs702634 and ABCB9/MPHOSPH9-rs4275659. The type 2 diabetes risk C-allele of TMEM154-rs6813195 associated with decreased disposition index (n=5,181, β=-0.042, p=0.012 and insulinogenic index (n=5,181, β=-0.032, p=0.043 in Inter99 and these associations remained significant in meta-analyses including four additional Danish studies (disposition index n=6,486, β=-0.042, p=0.0044; and insulinogenic index n=6,486, β=-0.037, p=0.0094. The type 2 diabetes risk G-allele of FAF1-rs17106184 associated with increased levels of 2-hour serum insulin (n=5,547, β=0.055, p=0.017 in Inter99 and also when combining effects with three additional Danish studies (n=6,260, β=0.062, p=0.0040.Studies of type 2 diabetes intermediary

  8. Hepatic in vitro toxicity assessment of PBDE congeners BDE47, BDE153 and BDE154 in Atlantic salmon (Salmo salar L.)

    Energy Technology Data Exchange (ETDEWEB)

    Softeland, Liv, E-mail: lso@nifes.no [National Institute of Nutrition and Seafood Research, PO Box 2029 Nordnes, N-5817 Bergen (Norway); Petersen, Kjell [Computational Biology Unit, Bergen Centre for Computational Science, Uni Research AS, Thormohlensgt 55, N5008 Bergen (Norway); Stavrum, Anne-Kristin [Dept of Clinical Medicine, University of Bergen (Norway); Wu, Terence [Yale University W.M. Keck Biotechnology Resource, 300 George St., Room G001, New Haven, CT 06511 (United States); Olsvik, Pal A. [National Institute of Nutrition and Seafood Research, PO Box 2029 Nordnes, N-5817 Bergen (Norway)

    2011-10-15

    The brominated flame retardant congeners BDE47, BDE153 and BDE154 are among the congeners accumulating to the highest degree in fish. In order to gain knowledge about the toxicological effects of PBDEs in fish, microarray-based transcriptomic and 2D-DIGE/MALDI-TOF/TOF proteomic approaches were used to screen for effects in primary Atlantic salmon hepatocytes exposed to these congeners alone or in combination (PBDE-MIX). A small set of stress related transcripts and proteins were differentially expressed in the PBDE exposed hepatocytes. The PBDE-MIX, and BDE153 to a lesser degree, seems to have induced metabolic disturbances by affecting several pathways related to glucose homeostasis. Further, effects on cell cycle control and proliferation signal pathways in PBDE-MIX-exposed hepatocytes clearly suggest that the PBDE exposure affected cell proliferation processes. CYP1A was 7.41- and 7.37-fold up-regulated in hepatocytes exposed to BDE47 and PBDE-MIX, respectively, and was the only biotransformation pathway affected by the PBDE exposure. The factorial design and PLS regression analyses of the effect of the PBDE-MIX indicated that BDE47 contributed the most to the observed CYP1A response, suggesting that this congener should be incorporated in the toxic equivalent (TEQ) concept in future risk assessment of dioxin-like chemicals. Additionally, a significant up-regulation of the ER-responsive genes VTG and ZP3 was observed in cells exposed to BDE47 and PBDE-MIX. Further analyses suggested that BDE47 and BDE154 have an estrogenic effect in male fish. The data also suggested an antagonistic interaction between BDE153 and BDE154. In conclusion, this study shows that PBDEs can affect several biological systems in Atlantic salmon cells, and demonstrates the need for more studies on the simultaneous exposure to chemical mixtures to identify combined effects of chemicals.

  9. S-glutathionylation of glyceraldehyde-3-phosphate dehydrogenase induces formation of C150-C154 intrasubunit disulfide bond in the active site of the enzyme.

    Science.gov (United States)

    Barinova, K V; Serebryakova, M V; Muronetz, V I; Schmalhausen, E V

    2017-12-01

    Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a glycolytic protein involved in numerous non-glycolytic functions. S-glutathionylated GAPDH was revealed in plant and animal tissues. The role of GAPDH S-glutathionylation is not fully understood. Rabbit muscle GAPDH was S-glutathionylated in the presence of H 2 O 2 and reduced glutathione (GSH). The modified protein was assayed by MALDI-MS analysis, differential scanning calorimetry, dynamic light scattering, and ultracentrifugation. Incubation of GAPDH in the presence of H 2 O 2 together with GSH resulted in the complete inactivation of the enzyme. In contrast to irreversible oxidation of GAPDH by H 2 O 2 , this modification could be reversed in the excess of GSH or dithiothreitol. By data of MALDI-MS analysis, the modified protein contained both mixed disulfide between Cys150 and GSH and the intrasubunit disulfide bond between Cys150 and Cys154 (different subunits of tetrameric GAPDH may contain different products). S-glutathionylation results in loosening of the tertiary structure of GAPDH, decreases its affinity to NAD + and thermal stability. The mixed disulfide between Cys150 and GSH is an intermediate product of S-glutathionylation: its subsequent reaction with Cys154 results in the intrasubunit disulfide bond in the active site of GAPDH. The mixed disulfide and the C150-C154 disulfide bond protect GAPDH from irreversible oxidation and can be reduced in the excess of thiols. Conformational changes that were observed in S-glutathionylated GAPDH may affect interactions between GAPDH and other proteins (ligands), suggesting the role of S-glutathionylation in the redox signaling. The manuscript considers one of the possible mechanisms of redox regulation of cell functions. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. The generation of thymus-independent germinal centers depends on CD40 but not on CD154, the T cell-derived CD40-ligand.

    Science.gov (United States)

    Gaspal, Fabrina M C; McConnell, Fiona M; Kim, Mi-Yeon; Gray, David; Kosco-Vilbois, Marie H; Raykundalia, Chandra R; Botto, Marina; Lane, Peter J L

    2006-07-01

    In this report, we show that the formation of germinal center (GC)-like structures to thymus-independent type 2 antigens in mice depends on intact signals through CD40, but does not depend on T cell-derived CD40-ligand (CD154). In addition, we show that follicular dendritic cells (FDC) are also critical to thymus-independent GC formation, as their depletion by blockade of lymphotoxin-beta receptor signals abrogated GC development unless the responding B cells bound antigen with high affinity. Further evidence that immune complexes drove this CD40-dependent B cell proliferation was provided by the observation that an antibody that detects immune complexes containing complement component 4 on FDC also inhibited thymus-independent GC formation when injected in vivo at the time of immunization. Finally, we show that thymus-independent B cell proliferation was associated with class switching to IgG3, as IgG3(+) antigen-specific switched B cells could be visualized directly in GC, suggesting that immune complexes can provide the signals for class switching within GC in the absence of CD154.

  11. Characterization of Cichopeptins, New Phytotoxic Cyclic Lipodepsipeptides Produced by Pseudomonas cichorii SF1-54 and Their Role in Bacterial Midrib Rot Disease of Lettuce.

    Science.gov (United States)

    Huang, Chien-Jui; Pauwelyn, Ellen; Ongena, Marc; Debois, Delphine; Leclère, Valerie; Jacques, Philippe; Bleyaert, Peter; Höfte, Monica

    2015-09-01

    The lettuce midrib rot pathogen Pseudomonas cichorii SF1-54 produces seven bioactive compounds with biosurfactant properties. Two compounds exhibited necrosis-inducing activity on chicory leaves. The structure of the two phytotoxic compounds, named cichopeptin A and B, was tentatively characterized. They are related cyclic lipopeptides composed of an unsaturated C12-fatty acid chain linked to the N-terminus of a 22-amino acid peptide moiety. Cichopeptin B differs from cichopeptin A only in the last C-terminal amino acid residue, which is probably Val instead of Leu/Ile. Based on peptide sequence similarity, cichopeptins are new cyclic lipopeptides related to corpeptin, produced by the tomato pathogen Pseudomonas corrugata. Production of cichopeptin is stimulated by glycine betaine but not by choline, an upstream precursor of glycine betaine. Furthermore, a gene cluster encoding cichopeptin synthethases, cipABCDEF, is responsible for cichopeptin biosynthesis. A cipA-deletion mutant exhibited significantly less virulence and rotten midribs than the parental strain upon spray inoculation on lettuce. However, the parental and mutant strains multiplied in lettuce leaves at a similar rate. These results demonstrate that cichopeptins contribute to virulence of P. cichorii SF1-54 on lettuce.

  12. Measurement of keV-neutron capture cross sections and capture gamma-ray spectra of {sup 147,148,149,150,152,154}Sm

    Energy Technology Data Exchange (ETDEWEB)

    Duamet, B.; Igashira, Masayuki; Mizumachi, Mari; Mizuno, Satoshi; Hori, Jun-ichi; Masuda, Koji; Ohsaki, Toshiro [Research Laboratory for Nuclear Reactors, Tokyo Institute of Technology, Tokyo (Japan)

    1999-10-01

    The neutron capture cross sections and capture {gamma}-ray spectra of {sup 147,148,149,150,152,154}Sm were measured in the neutron energy region of 10 to 90 keV and at 550 keV. A neutron time-of-flight method was adopted with a 1.5-ns pulsed neutron source by the {sup 7}Li(p, n){sup 7}Be reaction and with a large anti-Compton NaI(Tl) {gamma}-ray spectrometer. A pulse-height weighting technique was applied to observed capture {gamma}-ray pulse-height spectra to derive capture yields. The capture cross sections were obtained with the error of about 5% by using the standard capture cross sections of {sup 197}Au. The present results were compared with the evaluated values of JENDL-3.2 and previous measurements. The capture {gamma}-ray spectra were obtained by unfolding the observed capture {gamma}-ray pulse-height spectra. An anomalous shoulder was cleary observed around 3 MeV in the {gamma}-ray spectra of {sup 150,152,154}Sm, and the energy position of the shoulder was consistent with the systematics obtained in our previous work. (author)

  13. Intense 1.54 μm fluorescence of Er3+/Yb3+ codoped phosphate glass and the three-photon phenomenon of near infrared upconversion luminescence

    Science.gov (United States)

    Luo, Lanjun; Song, Feng; Yu, Xiaochen; Wang, Wentao; Ming, Chengguo; Han, Lin; Yu, Yin; Wu, Hao; Tian, Jianguo

    2010-02-01

    Transparent P2O5-CaO-Na2O glasses codoped with Er3+ and Yb3+ ions were fabricated by high-temperature melting technique. Strong near infrared and visible upconversion luminescence were observed under 975 nm laser diode excitation, and the luminescence processes were explained in details. For 1.54 μm band, the calculated peak emission cross sections is 1.04×10-20 cm2, and it is better than that in germinate, tellurite, silicate, and other phosphate glasses. The near infrared upconversion emission around 828 nm contains two-photon and three-photon processes, and it is attributed to the transition S43/2→I413/2, which enhances the population of the upper level for 1.54 μm laser emission and reduces the energy loss due to upconversion. Efficient near infrared fluorescence indicates Er3+/Yb3+ codoped phosphate glass is a promising laser and amplifier material.

  14. CD4+ T helper cells use CD154–CD40 interactions to counteract T reg cell–mediated suppression of CD8+ T cell responses to influenza

    Science.gov (United States)

    Ballesteros-Tato, André; León, Beatriz; Lund, Frances E.

    2013-01-01

    CD4+ T cells promote CD8+ T cell priming by licensing dendritic cells (DCs) via CD40–CD154 interactions. However, the initial requirement for CD40 signaling may be replaced by the direct activation of DCs by pathogen-derived signals. Nevertheless, CD40–CD154 interactions are often required for optimal CD8+ T cell responses to pathogens for unknown reasons. Here we show that CD40 signaling is required to prevent the premature contraction of the influenza-specific CD8+ T cell response. CD40 is required on DCs but not on B cells or T cells, whereas CD154 is required on CD4+ T cells but not CD8+ T cells, NKT cells, or DCs. Paradoxically, even though CD154-expressing CD4+ T cells are required for robust CD8+ T cell responses, primary CD8+ T cell responses are apparently normal in the absence of CD4+ T cells. We resolved this paradox by showing that the interaction of CD40-bearing DCs with CD154-expressing CD4+ T cells precludes regulatory T cell (T reg cell)–mediated suppression and prevents premature contraction of the influenza-specific CD8+ T cell response. Thus, CD4+ T helper cells are not required for robust CD8+ T cell responses to influenza when T reg cells are absent. PMID:23835849

  15. Optical characteristics of transparent samarium oxide thin films ...

    Indian Academy of Sciences (India)

    2016-10-07

    Oct 7, 2016 ... 1Department of Physics, Faculty of Science, Taif University, Taif 888, Saudi Arabia. 2Department of Physics, Faculty of Education, Ain Shams University, Roxy 11757, Cairo, Egypt. 3Materials Science Unit, Department of Chemistry, Faculty of Science, Tanta University, 31725 Tanta, Egypt. 4Department of ...

  16. Optical properties of lead–tellurite glasses doped with samarium ...

    Indian Academy of Sciences (India)

    The optical properties of a new family of Sm2O3–(40–)PbO–60TeO2 glasses are investigated. The optical absorption spectra were recorded at ... The refractive index, molar refraction and polarizability of oxide ions have been calculated by using Lorentz–Lorentz relations. The non-linear variations of the above optical ...

  17. Optical properties of lead–tellurite glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Administrator

    Abstract. The optical properties of a new family of xSm2O3–(40–x)PbO–60TeO2 glasses are investigated. The optical absorption spectra were recorded at room temperature in the UV-visible region. From the absorption edge studies, the values of optical bandgap energies have been evaluated. The refractive index, molar ...

  18. Measurement of radiative lifetime in atomic samarium using ...

    Indian Academy of Sciences (India)

    2014-02-08

    Feb 8, 2014 ... In this paper, we report the investigations of lifetime measurement of odd-parity energy level 19009.52 cm. −1 .... introduced by an electronic delay generator between the two Q-switch pulses of Nd-YAG laser. The slope of the .... Our values of the lifetimes are free from the common systematic errors. Thus ...

  19. A novel samarium complex with interesting photoluminescence and ...

    African Journals Online (AJOL)

    The 4,4'-Hbipy moieties, isolated nitrates and [Sm(H2O)4(NO3)3] species are held together via hydrogen bonds and p…p interactions to form a 3-D supramolecular framework. Luminescent investigation reveals a strong emission in blue region. Optical absorption spectrum of 1 reveals the presence of an optical gap of 3.60 ...

  20. Lithium samarium polyphosphate, LiSm(PO34

    Directory of Open Access Journals (Sweden)

    Dan Zhao

    2010-02-01

    Full Text Available The mixed-metal rare-earth polyphosphate LiSm(PO34 consists of a three-dimensional framework in which zigzag [(PO3n]n− chains with a periodicity of four PO4 tetrahedra are connected through Li+ and Sm3+ ions (both with 2. symmetry.

  1. Sodium samarium tetrakis(polyphosphate, NaSm(PO34

    Directory of Open Access Journals (Sweden)

    Dan Zhao

    2010-07-01

    Full Text Available NaSm(PO34 has been prepared by solid state reactions. It belongs to type II of the structural family of MILnIII(PO34 compounds (MI = alkali metal and LnIII = rare earth metal and is composed of ∞(PO3n]n− polyphosphate chains with a repeating unit of four PO4 tetrahedra. The chains extend parallel to [100] and share O atoms with irregular SmO8 polyhedra, forming a three-dimensional framework which delimits tunnels occupied by Na+ cations in a distorted octahedral environment.

  2. Isotopic Ratios of Samarium by TIMS for Nuclear Forensic Application

    Energy Technology Data Exchange (ETDEWEB)

    Louis Jean, James [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Inglis, Jeremy David [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-08-08

    The isotopic ratio of Nd, Sm, and Gd can provide important information regarding fissile material (nuclear devices, reactors), neutron environment, and device yield. These studies require precise measurement of Sm isotope ratios, by either TIMS or MC-ICP-MS. There has been an increasing trend to measure smaller and smaller quantities of Sm bearing samples. In nuclear forensics 10-100 ng of Sm are needed for precise measurement. To measure sub-ng Sm samples using TIMS for nuclear forensic analysis.

  3. Synthesis of copper, silver, and samarium chalcogenides by mechanical alloying

    Energy Technology Data Exchange (ETDEWEB)

    Ohtani, T.; Maruyama, K.; Ohshima, K. [Okayama Univ. of Science (Japan). Lab. for Solid State Chemistry

    1997-03-01

    CuInX{sub 2} (X = S, Se, Te), Ag{sub 2}S, Ag{sub 2}Se, Ag{sub 3}Te{sub 2}, Ag{sub 1.9}Te, AgCuSe, Sm{sub 3}Se{sub 4}, Sm{sub 2}Se{sub 3}, and SmTe were synthesized by a mechanical alloying method, using a high-energy planetary ball mill. The compounds were obtained by milling mixtures of the elements with desired ratios in agate or Cu-Be vials for 60--180 min.

  4. Oriented growth of thin films of samarium oxide by MOCVD

    Indian Academy of Sciences (India)

    Unknown

    Abstract. Thin films of Sm2O3 have been grown on Si(100) and fused quartz by low-pressure chemical va- pour deposition using an adducted β-diketonate precursor. The films on quartz are cubic, with no preferred orientation at lower growth temperatures (~ 550°C), while they grow with a strong (111) orientation as the.

  5. 150 KVA Samarium Cobalt VSCF Starter Generator Electrical System

    Science.gov (United States)

    1978-12-01

    considerable hand labor. Addition of a provision for suitable electrical connection by the SCR manufacturer wou;d be desirable for production runs. Predicted...licen- sing the holder or any other person or corporation, or conveying any rights or permission to manufacture , use, or sell any patented invent,’n...tesile strength to contain the magnets and pole pieces up through the overspeed rating of the rotor. The cho.;en process uses maraging steel as the

  6. Optical properties of samarium doped zinc–tellurite glasses

    Indian Academy of Sciences (India)

    Glasses with the composition, (Sm2O3)(ZnO)(40–)(TeO2)(60), were prepared by conventional melt quenching method. The density, molar volume, and optical energy band gap of these glasses have been measured. The refractive index, molar refraction and polarizability of oxide ion have been calculated by using ...

  7. Role of silicon excess in Er-doped silicon-rich nitride light emitting devices at 1.54 μm

    Energy Technology Data Exchange (ETDEWEB)

    Ramírez, J. M., E-mail: jmramirez@el.ub.edu; Berencén, Y.; Garrido, B. [MIND-IN2UB, Department Electrònica, Universitat de Barcelona, Martí i Franquès 1, Barcelona 08028 (Spain); Cueff, S. [Institut des Nanotechnologies de Lyon, École Centrale de Lyon, Écully 69134 (France); Labbé, C. [Centre de Recherche sur les Ions, les Matériaux et la Photonique (CIMAP), UMR 6252 CNRS/CEA/Ensicaen/UCBN, Caen 14050 (France)

    2014-08-28

    Erbium-doped silicon-rich nitride electroluminescent thin-films emitting at 1.54 μm have been fabricated and integrated within a metal-oxide-semiconductor structure. By gradually varying the stoichiometry of the silicon nitride, we uncover the role of silicon excess on the optoelectronic properties of devices. While the electrical transport is mainly enabled in all cases by Poole-Frenkel conduction, power efficiency and conductivity are strongly altered by the silicon excess content. Specifically, the increase in silicon excess remarkably enhances the conductivity and decreases the charge trapping; however, it also reduces the power efficiency. The main excitation mechanism of Er{sup 3+} ions embedded in silicon-rich nitrides is discussed. The optimum Si excess that balances power efficiency, conductivity, and charge trapping density is found to be close to 16%.

  8. Investigation of low-energy dipole modes in the heavy deformed nucleus 154Sm via inelastic polarized proton scattering at zero degree

    Directory of Open Access Journals (Sweden)

    Krugmann A.

    2014-03-01

    Full Text Available A high resolution proton scattering experiment has been performed on the heavy deformed nucleus 154Sm at extreme forward angles with 295 MeV polarized protons at RCNP, Osaka. Our scientific goal is to investigate the impact of ground state deformation on the properties of the pygmy dipole resonance and on the spin-M1 resonance in heavy deformed nuclei. The (p,p’ cross sections can be decomposed into E1 and M1 parts in two independent ways based either on a multipole decomposition of the cross sections or on spin-transfer observables as has been demonstrated for the case of 208Pb. We present the method and preliminary results from the analysis of polarization transfer observables.

  9. Resíduos de glifosato e ácido aminometilfosfônico e teores de isoflavonas em soja BRS 244 RR e BRS 154

    OpenAIRE

    Bohm,Giani Mariza Bärwald; Genovese,Maria Inés; Pigosso,Gustavo; Trichez,Daniel; Rombaldi,Cesar Valmor

    2008-01-01

    A principal forma de controle das plantas daninhas durante o cultivo de soja geneticamente modificada (GM RR) BRS 244 RR é o uso de glifosato. Porém, existem dúvidas quanto à segurança desse herbicida, à qualidade dos grãos e do solo da soja GM RR cultivada em Planossolo. Resíduos da molécula do glifosato e do metabólito ácido aminometilfosfônico (AMPA) podem estar presentes nos grãos, bem como, podem afetar a concentração de isoflavonas. Por isso, avaliaram-se as sojas BRS 244 RR e BRS 154 c...

  10. 1.54  μm photoluminescence from Er:Ox centers at extremely low concentration in silicon at 300 K.

    Science.gov (United States)

    Celebrano, Michele; Ghirardini, Lavinia; Finazzi, Marco; Shimizu, Yasuo; Tu, Yuan; Inoue, Koji; Nagai, Yasuyoshi; Shinada, Takahiro; Chiba, Yuki; Abdelghafar, Ayman; Yano, Maasa; Tanii, Takashi; Prati, Enrico

    2017-09-01

    The demand for single photon emitters at λ=1.54  μm, which follows from the consistent development of quantum networks based on optical fiber technologies, makes Er:Ox centers in Si a viable resource, thanks to the I13/24→I415/2 optical transition of Er(3+). While its implementation in high-power applications is hindered by the extremely low emission rate, the study of such systems in the low concentration regime remains relevant for quantum technologies. In this Letter, we explore the room-temperature photoluminescence at the telecomm wavelength from very low implantation doses of Er:Ox in Si. The lower-bound number of optically active Er atoms detected is of the order of 10(2), corresponding to a higher-bound value for the emission rate per individual ion of about 10(4)  s(-1).

  11. Resíduos de glifosato e ácido aminometilfosfônico e teores de isoflavonas em soja BRS 244 RR e BRS 154 Residues of glyphosate and aminomethylphosphonic acid and levels of isoflavones in BRS 244 RR and BRS 154 soybean

    Directory of Open Access Journals (Sweden)

    Giani Mariza Bärwald Bohm

    2008-12-01

    Full Text Available A principal forma de controle das plantas daninhas durante o cultivo de soja geneticamente modificada (GM RR BRS 244 RR é o uso de glifosato. Porém, existem dúvidas quanto à segurança desse herbicida, à qualidade dos grãos e do solo da soja GM RR cultivada em Planossolo. Resíduos da molécula do glifosato e do metabólito ácido aminometilfosfônico (AMPA podem estar presentes nos grãos, bem como, podem afetar a concentração de isoflavonas. Por isso, avaliaram-se as sojas BRS 244 RR e BRS 154 cultivadas nos seguintes tratamentos: T1 - soja BRS 244 RR, sem aplicação de herbicida, com capina manual aos 28 dias após o plantio (dap; T2 - soja BRS 154 sem aplicação de herbicida, com capina manual também aos 28 dap; T3 - soja BRS 244 RR com uma aplicação de glifosato a 960 g ia ha-1 aos 28 dap; T4 - soja BRS 244 RR com duas aplicações de glifosato a 960 g ia ha-1 aos 28 e 56 dap; T5 - soja BRS 244 RR com uma aplicação de herbicida imazetapir a 100 g ia ha-1 aos 28 dap; T6 - soja BRS 154 com uma aplicação de herbicida imazetapir a 100 g ia ha-1 aos 28 dap. Verificou-se que a aplicação de glifosato no controle de plantas daninhas resultou em teores elevados de glifosato e ácido aminometilfosfônico no solo. Nos grãos, o teor de isoflavonas não parece ser significativamente afetado pela aplicação de glifosato, mas os resíduos desse herbicida foram superiores ao permitido pela legislação vigente, que é de 10 mg.kg-1.The use of Glyphosate is the best way to control weed growing when cultivating genetically modified soybean (GMRR BRS 244 RR. However, there have been doubts about the safety of this herbicide use concerning its effects on the quality of grains and on the soil of Albaqualf cultivated GMRR soybean. Glyphosate and the metabolite aminomethylphosphonic acid (AMPA residues can be present in the grains and affect the isoflavones concentration. Therefore, BRS 244 RR and BRS 154 soybeans with the following

  12. Dual function of the hemagglutinin H5 fused to chicken CD154 in a potential strategy of DIVA against avian influenza disease: preliminary study

    Directory of Open Access Journals (Sweden)

    A.G. Pose

    2015-09-01

    Full Text Available In this study we demonstrated that the vaccine candidate against avian influenza virus H5N1 based on the hemagglutinin H5 (HA fused to the chicken CD154 (HACD can also be used for differentiating infected from vaccinated animals (DIVA. As the strategy of DIVA requires at least two proteins, we obtained a variant of the nucleoprotein (NP49-375 in E. coli. After its purification by IMAC, the competence of the proteins NP49-375 and HACD as coating antigens in indirect ELISA assays were tested by using the sera of chickens immunized with the proteins HA and HACD and the reference sera from several avian influenza subtypes. Together with these sera, the sera from different species of birds and the sera of chickens infected with other avian viral diseases were analyzed by competition ELISA assays coated with the proteins NP49-375 and HACD. The results showed that the segment CD154 in the chimeric protein HACD did not interfere with the recognition of the molecule HA by its specific antibodies. Also, we observed variable detection levels when the reference sera were analyzed in the ELISA plates coated with the protein NP49-375. Moreover, only the antibodies of the reference serum subtype H5 were detected in the ELISA plates coated with the protein HACD. The competition ELISA assays showed percentages of inhibition of 88-91% for the positives sera and less than 20% for the negative sera. We fixed the cut-off value of these assays at 25%. No antibody detection was observed in the sera from different species of birds or the sera of chickens infected with other avian viral diseases. This study supported the fact that the ELISA assays using the proteins NP49-375 and HACD could be valuable tools for avian influenza surveillance and as a strategy of DIVA for counteracting the highly pathogenic avian influenza virus H5N1 outbreaks.

  13. Clinical role of HER2 gene amplification and chromosome 17: a study on 154 IHC-equivocal cases of invasive breast carcinoma patients.

    Science.gov (United States)

    Afzal, Muhammad; Amir, Mohammed; Hassan, Muhammad Jawad; Hussain, Muhammad Sikander; Aziz, Muhammad Naveed; Murad, Sheeba; Murtaza, Iram; Anees, Mariam; Sultan, Aneesa

    2016-07-01

    Accurate evaluation of human epidermal growth factor receptor 2 (HER2) status is quite crucial for invasive breast tumor patients in order to select anti-HER2 therapy for effective clinical outcomes. Immunohistochemistry (IHC) assay is routinely used to evaluate the HER2 oncoprotein overexpression but is unable to explain the chromosomal and genetic alterations and has been considered as a hot issue in IHC-equivocal cases. We investigated these molecular aberrations in correlation with prognostic factors. A cohort of 154 IHC-equivocal (+2) cases was selected and retrospectively analyzed by dual-probe fluorescence in situ hybridization (FISH) assay by using locus-specific HER2 and centromere enumeration probes (CEP17) for the identification of HER2 proto-oncogene amplification and chromosomal copy number per cell, respectively. The data were analyzed by SPSS 16.0 version using chi-square test (p cases (23.4 %) showing HER2 gene amplification (average HER2 gene copies per cell >4 or 2) in concordance with HER2 oncoprotein overexpression, and significant correlation was observed with prognostic parameters including histological type, tumor grade II to III, histology and pathological type, lymphatic invasion, ductal carcinoma in situ (DCIS), and estrogen-positive and progesterone-negative receptors. Of the 154 cases, 18 cases (11.7 %) showed polysomy 17 with CEP17 probe signals per cell ≥3 and 22 cases (14.3 %) presented monosomy 17 (CEP17 probe signals per cell ≤1). Our data indicate that the use of anti-HER2 therapy should not be suggested unless true evaluation of HER2 protein expression is made regarding gene amplification essentially in IHC-ambiguous invasive breast tumors.

  14. The non-peptide CRH1-antagonist CP-154,526 elicits a paradoxical route-dependent activation of the HPA axis.

    Science.gov (United States)

    Zaretsky, Dmitry V; Zaretskaia, Maria V; Sarkar, Sumit; Rusyniak, Daniel E; DiMicco, Joseph A

    2017-07-13

    The corticotropin-releasing hormone (CRH) plays an important role in mediating physiological response to stress and is thought to be involved in the development of various psychiatric disorders. In this paper, we compare the differences between the effect of intraperitoneal (i.p.) and intraarterial (i.a.) administration of the non-peptide CRH1 antagonist CP-154,526 (CP) (10 and 20mg/kg) on plasma adrenocorticotropic hormone levels (ACTH), heart rate, MAP, and c-Fos expression in the paraventricular nucleus of the hypothalamus. Intraperitoneal, but not i.a., injection of CP resulted in an increase in plasma ACTH (from 105±13 to 278±51pg/ml after 20mg/kg). This effect was accompanied by a dramatic increase in c-Fos expression in cells immunoreactive for CRH in the paraventricular nucleus of the hypothalamus. When the drug was administered i.p., CP-induced activation of the HPA appears to mask the inhibitory effect of CP on stress-induced ACTH secretion, an effect which was readily apparent when the drug was given i.a. Intraperitoneal administration of CP also increased the baseline MAP which may account for previous reports that treatment with this drug attenuated the increases associated with stress. CP given by either route had no effect on baseline heart rate or stress-induced tachycardia. Thus, in all studies in which CP 154,526 is given, the route of delivery must be given careful consideration. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Friedreich's Ataxia Variants I154F and W155R Diminish Frataxin-Based Activation of the Iron-Sulfur Cluster Assembly Complex

    Energy Technology Data Exchange (ETDEWEB)

    Tsai, Chi-Lin; Bridwell-Rabb, Jennifer; Barondeau, David P

    2011-11-07

    Friedreich's ataxia (FRDA) is a progressive neurodegenerative disease that has been linked to defects in the protein frataxin (Fxn). Most FRDA patients have a GAA expansion in the first intron of their Fxn gene that decreases protein expression. Some FRDA patients have a GAA expansion on one allele and a missense mutation on the other allele. Few functional details are known for the ~15 different missense mutations identified in FRDA patients. Here in vitro evidence is presented that indicates the FRDA I154F and W155R variants bind more weakly to the complex of Nfs1, Isd11, and Isu2 and thereby are defective in forming the four-component SDUF complex that constitutes the core of the Fe-S cluster assembly machine. The binding affinities follow the trend Fxn ~ I154F > W155F > W155A ~ W155R. The Fxn variants also have diminished ability to function as part of the SDUF complex to stimulate the cysteine desulfurase reaction and facilitate Fe-S cluster assembly. Four crystal structures, including the first for a FRDA variant, reveal specific rearrangements associated with the loss of function and lead to a model for Fxn-based activation of the Fe-S cluster assembly complex. Importantly, the weaker binding and lower activity for FRDA variants correlate with the severity of disease progression. Together, these results suggest that Fxn facilitates sulfur transfer from Nfs1 to Isu2 and that these in vitro assays are sensitive and appropriate for deciphering functional defects and mechanistic details for human Fe-S cluster biosynthesis.

  16. Production cross sections of elements near the N=126 shell in Ca48-induced reactions with Gd154,Tb159,Dy162, and Ho165 targets

    Science.gov (United States)

    Mayorov, D. A.; Werke, T. A.; Alfonso, M. C.; Bennett, M. E.; Folden, C. M.

    2014-08-01

    Excitation functions for shell-stabilized evaporation residues produced in Ca48-induced reactions with Gd154,Tb159,Dy162, and Ho165 targets have been measured in experiments performed at the Cyclotron Institute at Texas A&M University. The examined energy range predominantly covers the 3n and 4n evaporation channels with higher cross sections measured for the 4n products. The σ4n are nearly invariant within experimental uncertainty in reactions with Tb159,Dy162, and Ho165 with the maxima at 12.6 ± 1.9, 12.6 ± 1.7, and 9.4 ± 1.3 mb, respectively. For the reaction with Gd154, the maximum is slightly lower at 4.0 ± 0.6 mb. A simple model to describe the measured production cross sections was employed. Capture was estimated by using the "diffused barrier formula" from the "fusion by diffusion" model proposed by Świątecki et al. [Phys. Rev. C 71, 014602 (2005)]., 10.1103/PhysRevC.71.014602 The fusion probability was estimated by using a phenomenological expression presented by Siwek-Wilczyńska et al. [Int. J. Mod. Phys. E 17, 12 (2008)]., 10.1142/S0218301308009501 The survival probability was calculated according to the formula of Vandenbosch and Huizenga [Nuclear Fission (Academic, New York, 1973)], derived from transition-state theory. The best agreement is reached between calculation and experiment upon inclusion of collective effects in the calculation of the survival probability, shown previously to be important for production of weakly deformed nuclei. This, in turn, challenges the expectation that strong shell stabilization benefits the production cross section. The present data are compared with earlier studies on production of neutron-deficient nuclei in Ca-induced reactions with lanthanide targets.

  17. Social Health Insurance-Based Simultaneous Screening for 154 Mutations in 19 Deafness Genes Efficiently Identified Causative Mutations in Japanese Hearing Loss Patients.

    Directory of Open Access Journals (Sweden)

    Kentaro Mori

    Full Text Available Sensorineural hearing loss is one of the most common neurosensory disorders in humans. The incidence of SNHL is estimated to be 1 in 500-1000 newborns. In more than half of these patients, the hearing loss is associated with genetic causes. In Japan, genetic testing for the patients with SNHL using the Invader assay to screen for 46 mutations in 13 deafness genes was approved by the Ministry of Health, Labour and Welfare for inclusion in social health insurance coverage in 2012. Furthermore, from August 2015, this genetic testing has been expanded to screen for 154 mutations in 19 deafness genes using targeted genomic enrichment with massively parallel DNA sequencing combined with the Invader assay and TaqMan genotyping. For this study we analyzed 717 unrelated Japanese hearing loss patients. The total allele frequency of 154 mutations in 19 deafness genes was 32.64% (468/1434 and the total numbers of cases associated with at least one mutation was 44.07% (316/717. Among these, we were able to diagnose 212 (30% patients, indicating that the present screening could efficiently identify causative mutations in hearing loss patients. It is noteworthy that 27 patients (3.8% had coexistent multiple mutations in different genes. Five of these 27 patients (0.7%, 5/717 overall were diagnosed with genetic hearing loss affected by concomitant with responsible mutations in more than two different genes. For patients identified with multiple mutations in different genes, it is necessary to consider that several genes might have an impact on their phenotypes.

  18. TL1A increases expression of CD25, LFA-1, CD134 and CD154, and induces IL-22 and GM-CSF production from effector CD4 T-cells

    DEFF Research Database (Denmark)

    Reichwald, Kirsten; Jørgensen, Tina Z.; Skov, Søren

    2014-01-01

    together with IL-12, IL-15 and IL-18 increases expression of the co-stimulatory molecules CD154 (CD40 ligand) and CD134 (OX40) on previously activated CD4+ T cells. This indicates that TL1A functions as a co-stimulatory molecule, decreasing the activation threshold of T-cells. We have previously shown...

  19. Abrogation of CD40–CD154 Signaling Impedes the Homeostasis of Thymic Resident Regulatory T Cells by Altering the Levels of IL-2, but Does Not Affect Regulatory T Cell Development

    Science.gov (United States)

    Cuss, Steven M.

    2012-01-01

    Identification of costimulatory signals required for murine regulatory T (Treg) cell development relies on measuring the frequency of total thymic Treg cells. However, the thymus contains both resident and newly developed Treg cells; whether such signals target both populations is unknown. In this study, we show that CD40–CD154 blockade specifically targeted thymic resident Treg cells, but not, as was previously believed, newly developed Treg cells. Unlike CD28–CD80/CD86 signals, CD40–CD154 signals were not required for Treg cell precursor development. Instead we demonstrate that homeostatic proliferation of thymic resident Treg cells was dependent on CD40–CD154 signals maintaining IL-2 levels. Furthermore, in newborn mice, where all Treg cells are newly developed, blockade of CD40–CD154 signals had no effect on thymic Treg numbers or their proliferation. Our studies highlight the complexity in the study of thymic Treg cell development due to the heterogeneity of thymic Treg cells. PMID:22802415

  20. The proportion of CD40+ mucosal macrophages is increased in inflammatory bowel disease whereas CD40 ligand (CD154)+ T cells are relatively decreased, suggesting differential modulation of these costimulatory molecules in human gut lamina propria.

    Science.gov (United States)

    Carlsen, Hege S; Yamanaka, Takeshi; Scott, Helge; Rugtveit, Jarle; Brandtzaeg, Per

    2006-11-01

    Signal transduction through binding of CD40 on antigen-presenting cells and CD40 ligand (CD154) on T cells appears to be crucial for mutual cellular activation. Antibodies aimed at blocking the CD40-CD154 costimulatory pathway dampen the severity of experimental colitis. To elucidate the microanatomical basis for signaling through this costimulatory pathway in human inflammatory bowel disease, we studied in situ the cellular distribution of these 2 molecules on lamina propria macrophages and T cells, respectively. Colonic specimens from 8 patients with ulcerative colitis and 8 with Crohn's disease, 8 small bowel specimens of Crohn's disease, and histologically normal control samples (6 from colon and 6 from small bowel) were included. Multicolor immunofluorescence in situ staining was performed to determine the percentage of subepithelial macrophages expressing CD40 and that of lamina propria T cells expressing CD154 while avoiding cells in lymphoid aggregates. The proportion of subepithelial CD40CD68 macrophages was significantly increased in normal colon compared with normal small bowel and showed further elevation in both colon and small bowel afflicted with inflammatory bowel disease. In addition, on a per-CD68-cell basis, CD40 expression was significantly increased in severely inflamed compared with moderately inflamed colonic specimens. Conversely, the proportion of CD154 T cells was similar in colon and small bowel, and interestingly, it was significantly reduced in colonic inflammatory bowel disease. Our findings suggested that modulation of CD40 expression by subepithelial macrophages and CD154 by lamina propria T cells is inversely modulated in the human gut.

  1. miR-125b and miR-155 contribute to BCL2 repression and proliferation in response to CD40 ligand (CD154) in human leukemic B-cells.

    Science.gov (United States)

    Willimott, Shaun; Wagner, Simon D

    2012-01-20

    Developmental stage-specific regulation of BCL2 occurs during B-cell maturation and has a role in normal immunity. CD40 signaling promotes proliferation and rescues B-cells from apoptosis, partly through induction of BCL2L1 and BCL2A1 and repression of BCL2. We previously showed that a stromal cell/CD40 ligand (CD154) culture system reproduced this switch in survival protein expression in primary human leukemic B-cells and we employed this model system to investigate BCL2 repression. BCL2 was post-transcriptionally regulated and the repressed BCL2 mRNA was associated with non-polysomal, but dense fractions on sucrose density gradients. Microarrays identified a set of miRNA that were induced by culture conditions and potentially able to bind to the BCL2 3'-UTR. Luciferase reporter assays demonstrated that miR-125b and miR-155 repressed BCL2 mRNA but while stromal cell contact alone was sufficient to induce strongly miR-125b this did not cause BCL2 repression. miR-155, which is the most abundant miRNA under basal conditions, specifically required CD154 for further induction above a threshold to exert its full repressive effects. Anti-miR-125b and anti-miR-155 prevented CD154-mediated repression of BCL2 and reduced CD154-mediated proliferation in the MEC1 B-cell line. We suggest that miR-155 and miR-125b, which are induced by CD154 and stromal cell signals, contribute to regulating proliferation and that BCL2 is one of their target mRNAs.

  2. miR-125b and miR-155 Contribute to BCL2 Repression and Proliferation in Response to CD40 Ligand (CD154) in Human Leukemic B-cells*

    Science.gov (United States)

    Willimott, Shaun; Wagner, Simon D.

    2012-01-01

    Developmental stage-specific regulation of BCL2 occurs during B-cell maturation and has a role in normal immunity. CD40 signaling promotes proliferation and rescues B-cells from apoptosis, partly through induction of BCL2L1 and BCL2A1 and repression of BCL2. We previously showed that a stromal cell/CD40 ligand (CD154) culture system reproduced this switch in survival protein expression in primary human leukemic B-cells and we employed this model system to investigate BCL2 repression. BCL2 was post-transcriptionally regulated and the repressed BCL2 mRNA was associated with non-polysomal, but dense fractions on sucrose density gradients. Microarrays identified a set of miRNA that were induced by culture conditions and potentially able to bind to the BCL2 3′-UTR. Luciferase reporter assays demonstrated that miR-125b and miR-155 repressed BCL2 mRNA but while stromal cell contact alone was sufficient to induce strongly miR-125b this did not cause BCL2 repression. miR-155, which is the most abundant miRNA under basal conditions, specifically required CD154 for further induction above a threshold to exert its full repressive effects. Anti-miR-125b and anti-miR-155 prevented CD154-mediated repression of BCL2 and reduced CD154-mediated proliferation in the MEC1 B-cell line. We suggest that miR-155 and miR-125b, which are induced by CD154 and stromal cell signals, contribute to regulating proliferation and that BCL2 is one of their target mRNAs. PMID:22139839

  3. Higher percentage of CD3⁺CD154⁺ T lymphocytes predicts efficacy of TNF-α inhibitors in active axial SpA patients.

    Science.gov (United States)

    Lin, Zhiming; Lin, Qu; Liao, Zetao; Li, Qiuxia; Zhang, Fucheng; Wei, Qiujing; Cao, Shuangyan; Gu, Jieruo

    2014-12-01

    The objective of this study was to evaluate which subtypes of T lymphocytes (CD3(+)CD28(+) and CD3(+)CD154(+)) could predict clinical efficacy after TNF-α inhibitor treatment in active axial SpA patients. Patients who fulfilled Assessment of SpondyloArthritis international Society (ASAS) criteria for axial SpA had a BASDAI of ≥40 mm. All patients received TNF-α inhibitor treatment for 12 weeks. ASAS20 was used to evaluate the effect of the treatment at week 12. We detected the percentage of CD3(+)CD28(+) and CD3(+)CD154(+) T lymphocytes on lymphocyte cells in the peripheral blood in patients and healthy controls. We evaluated whether the percentage of the above subtypes of T lymphocytes could predict clinical efficacy by ROC curve analysis. Fifty-eight healthy controls and 74 active axial SpA patients were included. Mean age was 26.28 ± 9.08 and 26.95 ± 8.13 years for healthy controls and patients, respectively (p = 0.767). The percentage of CD3(+)CD154(+) T lymphocytes was significantly higher in axial SpA patients than in healthy controls (1.62 ± 1.89 % vs 0.79 ± 0.52 %, p SpA patients with TNF-α inhibitor treatment (AUC = 0.733, p = 0.014). High percentage of CD3(+)CD154(+) is over-expressed on lymphocytes in peripheral blood of active SpA patients and can be down-regulated by TNF-α inhibitor therapy. High-percentage of CD3(+)CD154(+) T lymphocytes may predict clinical efficacy of TNF-α inhibitor treatment in active axial SpA patients.

  4. CD154-CD40 T-cell co-stimulation pathway is a key mechanism in kidney ischemia-reperfusion injury.

    Science.gov (United States)

    de Ramon, Laura; Ripoll, Elia; Merino, Ana; Lúcia, Marc; Aran, Josep M; Pérez-Rentero, S; Lloberas, Nuria; Cruzado, Josep M; Grinyó, Josep M; Torras, Juan

    2015-09-01

    Ischemia-reperfusion occurs in a great many clinical settings and contributes to organ failure or dysfunction. CD154-CD40 signaling in leukocyte-endothelial cell interactions or T-cell activation facilitates tissue inflammation and injury. Here we tested a siRNA anti-CD40 in rodent warm and cold ischemia models to check the therapeutic efficacy and anti-inflammatory outcome of in vivo gene silencing. In the warm ischemia model different doses were used, resulting in clear renal function improvement and a structural renoprotective effect. Renal ischemia activated the CD40 gene and protein expression, which was inhibited by intravenous siRNA administration. CD40 gene silencing improved renal inflammatory status, as seen by the reduction of CD68 and CD3 T-cell infiltrates, attenuated pro-inflammatory, and enhanced anti-inflammatory mediators. Furthermore, siRNA administration decreased a spleen pro-inflammatory monocyte subset and reduced TNFα secretion by splenic T cells. In the cold ischemia model with syngeneic and allogeneic renal transplantation, the most effective dose induced similar functional and structural renoprotective effects. Our data show the efficacy of our siRNA in modulating both the local and the systemic inflammatory milieu after an ischemic insult. Thus, CD40 silencing could emerge as a novel therapeutic strategy in solid organ transplantation.

  5. Excitation energy dependence of fragment-mass distributions from fission of 180,190Hg formed in fusion reactions of 36Ar + 144,154Sm

    Directory of Open Access Journals (Sweden)

    K. Nishio

    2015-09-01

    Full Text Available Mass distributions of fission fragments from the compound nuclei 180Hg and 190Hg formed in fusion reactions 36Ar + 144Sm and 36Ar + 154Sm, respectively, were measured at initial excitation energies of E⁎(Hg180=33–66 MeV and E⁎(Hg190=48–71 MeV. In the fission of 180Hg, the mass spectra were well reproduced by assuming only an asymmetric-mass division, with most probable light and heavy fragment masses A¯L/A¯H=79/101. The mass asymmetry for 180Hg agrees well with that obtained in the low-energy β+/EC-delayed fission of 180Tl, from our earlier ISOLDE(CERN experiment. Fission of 190Hg is found to proceed in a similar way, delivering the mass asymmetry of A¯L/A¯H=83/107, throughout the measured excitation energy range. The persistence as a function of excitation energy of the mass-asymmetric fission for both proton-rich Hg isotopes gives strong evidence for the survival of microscopic effects up to effective excitation energies of compound nuclei as high as 40 MeV. This behavior is different from fission of actinide nuclei and heavier mercury isotope 198Hg.

  6. Intratumoral delivery of CD154 homolog (Ad-ISF35) induces tumor regression: analysis of vector biodistribution, persistence and gene expression.

    Science.gov (United States)

    Melo-Cardenas, J; Urquiza, M; Kipps, T J; Castro, J E

    2012-05-01

    Ad-ISF35 is an adenovirus (Ad) vector that encodes a mouse-human chimeric CD154. Ad-ISF35 induces activation of chronic lymphocytic leukemia (CLL) cells converting them into CLL cells capable of promoting immune recognition and anti-leukemia T-cell activation. Clinical trials in humans treated with Ad-ISF35-transduced leukemia cells or intranodal injection of Ad-ISF35 have shown objective clinical responses. To better understand the biology of Ad-ISF35 and to contribute to its clinical development, we preformed studies to evaluate biodistribution, persistence and toxicity of repeat dose intratumoral administration of Ad-ISF35 in a mouse model. Ad-ISF35 intratumoral administration induced tumor regression in more than 80% of mice bearing A20 tumors. There were no abnormalities in the serum chemistry. Mice receiving Ad-ISF35 presented severe extramedullary hematopoiesis and follicular hyperplasia in the spleen and extramedullary hematopoiesis with lymphoid hyperplasia in lymph nodes. After Ad-ISF35 injection, the vector was found primarily in the injected tumors with a biodistribution pattern that showed a rapid clearance with no evidence of Ad-ISF35 accumulation or persistence in the injected tumor or peripheral organs. Furthermore, pre-existing antibodies against Ad-5 did not abrogate Ad-ISF35 anti-tumor activity. In conclusion, intratumoral administration of Ad-ISF35 induced tumor regression in A20 tumor bearing mice without toxicities and with no evidence of vector accumulation or persistence.

  7. Large-moment antiferromagnetic order in overdoped high-Tc superconductor 154SmFeAsO1-x D x.

    Science.gov (United States)

    Iimura, Soshi; Okanishi, Hiroshi; Matsuishi, Satoru; Hiraka, Haruhiro; Honda, Takashi; Ikeda, Kazutaka; Hansen, Thomas C; Otomo, Toshiya; Hosono, Hideo

    2017-05-30

    In iron-based superconductors, high critical temperature (Tc) superconductivity over 50 K has only been accomplished in electron-doped hREFeAsO (hRE is heavy rare earth (RE) element). Although hREFeAsO has the highest bulk Tc (58 K), progress in understanding its physical properties has been relatively slow due to difficulties in achieving high-concentration electron doping and carrying out neutron experiments. Here, we present a systematic neutron powder diffraction study of 154SmFeAsO1-x D x , and the discovery of a long-range antiferromagnetic ordering with x ≥ 0.56 (AFM2) accompanying a structural transition from tetragonal to orthorhombic. Surprisingly, the Fe magnetic moment in AFM2 reaches a magnitude of 2.73 μB/Fe, which is the largest in all nondoped iron pnictides and chalcogenides. Theoretical calculations suggest that the AFM2 phase originates in kinetic frustration of the Fe-3dxy orbital, in which the nearest-neighbor hopping parameter becomes zero. The unique phase diagram, i.e., highest-Tc superconducting phase adjacent to the strongly correlated phase in electron-overdoped regime, yields important clues to the unconventional origins of superconductivity.

  8. 46 CFR 154.615 - Design temperature below 0 °C (32 °F) and down to −55 °C (−67 °F).

    Science.gov (United States)

    2010-10-01

    ... LIQUEFIED GASES Design, Construction and Equipment Materials § 154.615 Design temperature below 0 °C (32 °F... 46 Shipping 5 2010-10-01 2010-10-01 false Design temperature below 0 °C (32 °F) and down to â55... tanks and secondary barriers for a design temperature below 0 °C (32 °F) and down to −55 °C (−67 °F...

  9. CD154 and IL-2 signaling of CD4+ T cells play a critical role in multiple phases of CD8+ CTL responses following adenovirus vaccination.

    Directory of Open Access Journals (Sweden)

    Channakeshava Sokke Umeshappa

    Full Text Available Adenoviral (AdV vectors represent most commonly utilized viral vaccines in clinical studies. While the role of CD8(+ cytotoxic T lymphocyte (CTL responses in mediating AdV-induced protection is well understood, the involvement of CD4(+ T cell-provided signals in the development of functional CD8(+ CTL responses remain unclear. To explore CD4(+ T helper signals required for AdVova-stimulated CTL responses, we established an adoptive transfer system by transferring CD4(+ T cells derived from various knock out and transgenic mice into wild-type and/or CD4-deficient animals, followed by immunizing with recombinant ovalbumin (OVA-expressing AdVova vector. Without CD4(+ T help, both primary and memory CTL responses were greatly reduced in this model, and were associated with increased PD-1 expression. The provision of OVA-specific CD4(+ T help in CD4(+ T cell-deficient mice restored AdVova-induced primary CTL responses, and supported survival and recall responses of AdVova-stimulated memory CTLs. These effects were specifically mediated by CD4(+ T cell-produced IL-2 and CD154 signals. Adoptive transfer of "helped" or "unhelped" effector and memory CTLs into naïve CD4(+ T cell-deficient or -sufficient mice also revealed an additional role for polyclonal CD4(+ T cell environment in the survival of AdVova-stimulated CTLs, partially explaining the extension of CTL contraction phase. Finally, during recall responses, CD4(+ T cell environment, particularly involving memory CD4(+ T cells, greatly enhanced expansion of memory CTLs. Collectively, our data strongly suggest a critical role for CD4(+ T help in multiple phases of AdV-stimulated CTL responses, and could partially explain certain failures in AdV-based immunization trials targeting malignant tumors and chronic diseases that are often associated with compromised CD4(+ T cell population and function.

  10. Anti-CD154 mAb and rapamycin induce T regulatory cell mediated tolerance in rat-to-mouse islet transplantation.

    Directory of Open Access Journals (Sweden)

    Yannick D Muller

    Full Text Available BACKGROUND: Anti-CD154 (MR1 monoclonal antibody (mAb and rapamycin (RAPA treatment both improve survival of rat-to-mouse islet xenograft. The present study investigated the effect of combined RAPA/MR1 treatment on rat-to-mouse islet xenograft survival and analyzed the role of CD4(+CD25(+Foxp3(+ T regulatory cells (Treg in the induction and maintenance of the ensuing tolerance. METHODOLOGY/PRINCIPAL FINDINGS: C57BL/6 mice were treated with MR1/RAPA and received additional monoclonal anti-IL2 mAb or anti CD25 mAb either early (0-28 d or late (100-128 d post-transplantation. Treg were characterised in the blood, spleen, draining lymph nodes and within the graft of tolerant and rejecting mice by flow cytometry and immunohistochemistry. Fourteen days of RAPA/MR1 combination therapy allowed indefinite islet graft survival in >80% of the mice. Additional administration of anti-IL-2 mAb or depleting anti-CD25 mAb at the time of transplantation resulted in rejection (100% and 89% respectively, whereas administration at 100 days post transplantation lead to lower rejection rates (25% and 40% respectively. Tolerant mice showed an increase of Treg within the graft and in draining lymph nodes early post transplantation, whereas 100 days post transplantation no significant increase of Treg was observed. Rejecting mice showed a transient increase of Treg in the xenograft and secondary lymphoid organs, which disappeared within 7 days after rejection. CONCLUSIONS/SIGNIFICANCES: These results suggest a critical role for Treg in the induction phase of tolerance early after islet xenotransplantation. These encouraging data support the need of developing further Treg therapy for overcoming the species barrier in xenotransplantation.

  11. Daily life changes and adaptations investigated in 154 families with a child suffering from a rare disability at a public centre for rare diseases in Northern Italy.

    Science.gov (United States)

    Silibello, G; Vizziello, P; Gallucci, M; Selicorni, A; Milani, D; Ajmone, P F; Rigamonti, C; De Stefano, S; Bedeschi, M F; Lalatta, Faustina

    2016-08-31

    Living with a disabled child has profound effects on the entire family. With a prevalence of developmental disabilities around 2,5 %, there is a considerable need to promote improvements in the health care system. Little is known about changes and adaptations in the lives of affected families and this paucity of information hinders the improvement of services. This study sought to explore the needs and changes in the everyday life of families with children suffering from rare diseases of varying severity, with and without mental disability. The aim was to measure the socio-demographic characteristics, health care problems and living conditions of a large cohort of families with an affected member. A sample of 154 families was recruited between September 2011 and April 2013 to respond to a 136 item questionnaire that explored different areas of concern (diagnosis and follow-up of clinical specialists, relationship with pediatrician, rehabilitation, school, work, institutional and/or private support, child care needs and family relationships). All parents answered the questionnaire. They were satisfied with the services provided in particular for diagnosis and follow-up, relationships with the family pediatrician, rehabilitation services and school, regardless of the severity of condition, presence of intellectual disability (ID) or absence of diagnosis. Negative scores were reported for institutional and/or private support and family relationships in severe conditions. The Health Care System should maintain a family-centered care and a multi-agency working, improving quality of life of families with disabled child to allow adaptation. At present these services are uncoordinated and financial support is poor, resulting in a heavy burden for these families.

  12. Influence of daily dosage and frequency of administration of rifampicin-levofloxacin therapy on tolerance and effectiveness in 154 patients treated for prosthetic joint infections.

    Science.gov (United States)

    Nguyen, S; Robineau, O; Titecat, M; Blondiaux, N; Valette, M; Loiez, C; Beltrand, E; Migaud, H; Senneville, E

    2015-08-01

    Data on the tolerance and effectiveness of rifampicin-levofloxacin combination therapy (RLCT) in patients treated for prosthetic joint infections (PJIs) according to daily dosage are lacking. A review of the clinical data from patients treated with RLCT for PJIs in a French referent center for PJIs was conducted. A total of 154 patients (75 F/79 M), with a median age of 64.1 years and median body weight of 83.1 kg, were included. The median daily dosages of rifampicin and levofloxacin were, respectively, 1,200 mg (range 300-2,100) and 750 mg (range 500-1,500), corresponding to a mean daily dose per kg of, respectively, 16.2 ± 4.3 mg/kg and 10.1 ± 3.0 mg/kg. After a mean follow-up period of 55.6 ± 27.1 months (range 24-236), 127 patients (82.5 %) were in remission. Adverse events attributable to rifampicin and levofloxacin were reported in 48 (31.2 %) and 13 (8.4 %) patients (p levofloxacin daily dosage on both tolerance and patient outcome. Our results suggest that adjusting rifampicin daily doses to the patient total body weight when combined with levofloxacin for the treatment of PJIs is associated with a poor tolerance. High daily doses of rifampicin (>600 mg) and levofloxacin (750 mg) do not improve patient outcome when compared to lower daily doses in this setting.

  13. Okiyo 147-154.pmd

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    Moisture stress and aluminium toxicity in sorghum production can be overcome by breeding for tolerance. This study was set up to determine the response of sorghum (Sorghum bicolor L.) genotypes to post- anthesis drought and aluminium toxicity. Sorghum inbred P1 with stay green drought tolerance was crossed with P2, ...

  14. Clonal analysis of the T-cell response to in vivo expressed Mycobacterium tuberculosis protein Rv2034, using a CD154 expression based T-cell cloning method.

    Directory of Open Access Journals (Sweden)

    Susanna Commandeur

    Full Text Available Tuberculosis (TB, caused by Mycobacterium tuberculosis (Mtb, remains a leading cause of death worldwide. A better understanding of the role of CD4+ and CD8+ T cells, which are both important to TB protection, is essential to unravel the mechanisms of protection and to identify the key antigens seen by these T cells. We have recently identified a set of in vivo expressed Mtb genes (IVE-TB which is expressed during in vivo pulmonary infection in mice, and shown that their encoded antigens are potently recognized by polyclonal T cells from tuberculin skin test-positive, in vitro ESAT-6/CFP10-responsive individuals. Here we have cloned T cells specific for one of these newly identified in vivo expressed Mtb (IVE-TB antigens, Rv2034. T cells were enriched based on the expression of CD154 (CD40L, which represents a new method for selecting antigen-specific (low frequency T cells independent of their specific function. An Rv2034-specific CD4+ T-cell clone expressed the Th1 markers T-bet, IFN-γ, TNF-α, IL-2 and the cytotoxicity related markers granzyme B and CD107a as measured by flow cytometry. The clone specifically recognized Rv2034 protein, Rv2034 peptide p81-100 and Mtb lysate. Remarkably, while the recognition of the dominant p81-100 epitope was HLA-DR restricted, the T-cell clone also recognized a neighboring epitope (p88-107 in an HLA-DR- as well as HLA-DQ1-restricted fashion. Importantly, the T-cell clone was able to inhibit Mtb outgrowth from infected monocytes significantly. The characterization of the polyfunctional and Mtb inhibitory T-cell response to IVE-TB Rv2034 at the clonal level provides detailed further insights into the potential of IVE-TB antigens as new vaccine candidate antigens in TB. Our new approach allowed the identification of T-cell subsets that likely play a significant role in controlling Mtb infection, and can be applied to the analysis of T-cell responses in patient populations.

  15. La legge 154/2001 in tema di "Misure contro la violenza nelle relazioni familiari": cosa è cambiato nel nostro Paese dopo la sua entrata in vigore?

    Directory of Open Access Journals (Sweden)

    Susanna Vezzadini

    2007-09-01

    Full Text Available Domestic violence is a crime. All international and national studies on this subject have contributed to uncovering part of it, shedding light on a very serious and dramatic reality. For that reason, in April 2001, the Italian Parliament passed the law n. 154 concerning “Measures against domestic violence”, therefore affirming in by this act its will to respond to the problem. The law, which is considered an example of a “normative act against the blackmail of fear”, consists of a series of guide lines to prevent the offender from repeating the crime. In view of this, it is essential to find out today what has actually changed in Italy six years after its coming into force. La violence intrafamiliale est un délit. Les études réalisées à l'échelle internationale, tout comme les études nationales, ont ouvert une brèche sur cette réalité dont la gravité est déconcertante. Cependant le Parlement italien a approuvé en avril 2001, la loi relative aux "Mesures contre la violence dans la famille", affirmant ainsi sa volonté de répondre concrètement au problème de la violence domestique en Italie. Cette loi, présentée par les législateurs comme un example "d'acte normatif contre le chantage de la peur", contient une série de provisions destinées à empêcher à l'offenseur de réitérer son crime, introduisant des instruments procéduraux contre les abus intrafamiliaux. Face à de telles innovations, il est d'autant plus utile de continuer à se demander ce qui a changé en Italie, six ans après l'entrée en viguer de la loi.

  16. AGR-2 Data Qualification Report for ATR Cycles 151B-2, 152A, 152B, 153A, 153B and 154A

    Energy Technology Data Exchange (ETDEWEB)

    Binh T. Pham; Jeffrey J. Einerson

    2013-09-01

    This report documents the data qualification status of AGR-2 fuel irradiation experimental data from Advanced Test Reactor (ATR) Cycles 152A, 152B, 153A, 153B, and 154A, as recorded in the Nuclear Data Management and Analysis System (NDMAS). The AGR-2 data streams addressed include thermocouple (TC) temperatures, sweep gas data (flow rate, pressure, and moisture content), and fission product monitoring system (FPMS) data for each of the six capsules in the experiment. A total of 13,400,520 every minute instantaneous TC and sweep gas data records were received and processed by NDMAS for this period. Of these data, 8,911,791 records (66.5% of the total) were determined to be Qualified based on NDMAS accuracy testing and data validity assessment. For temperature, there were 4,266,081 records (74% of the total TC data) that were Failed due to TC instrument failures. For sweep gas flows, there were 222,648 gas flow records (2.91% of the flow data) that were Failed. The inlet gas flow failures due to gas flow cross-talk and leakage problems that occurred after Cycle 150A were corrected by using the same gas mixture in all six capsules and the Leadout. For FPMS data, NDMAS received and processed preliminary release rate and release-to-birth rate ratio (R/B) data for three reactor cycles (Cycles 149B, 150B, and 151A) . This data consists of 45,983 release rate records and 45,235 R/B records for the 12 radionuclides reported. The qualification status of these FPMS data has been set to In Process until receipt of Quality Assurance-approved data generator reports. All of the above data have been processed and tested using a SAS®-based enterprise application software system, stored in a secure Structured Query Language database, made available on the NDMAS Web portal (http://ndmas.inl.gov), and approved by the INL STIM for release to both internal and appropriate external Very High Temperature Reactor Program participants.

  17. Metabolism of 15-(4'-[[sup 123]I]iodophenyl)pentadecanoic acid ([[sup 123]I]IPPA) in the rat heart; identification of new metabolites by high pressure liquid chromatography and fast atom bombardment-mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Eisenhut, Michael; Suetterle, Andreas (Heidelberg Univ. (Germany). Abt. fuer Klinische Nuklearmedizin); Lehmann, W.D. (Deutsches Krebsforschungszentrum, Heidelberg (Germany))

    1993-08-01

    The metabolism of 15-(4'-iodophenyl)pentadecanoic acid (IPPA) in the heart muscle is commonly believed to end at 4-iodobenzoic acid as the main and final product of [beta]-oxidation. However, investigation of the metabolic fate of IPPA in Langendorff rat hearts using high pressure liquid chromatography (HPLC) and negative fast atom bombardment mass spectrometry (FAB-MS) revealed new results. This metabolic behaviour may be of importance for the interpretation of sequential heart scintigraphy performed with [[sup 123]I]IPPA. (author).

  18. Substitution of arginine for glycine at position 154 of the {alpha}1 chain of type I collagen in a variant of osteogenesis imperfecta: Comparison to previous cases with the same mutation

    Energy Technology Data Exchange (ETDEWEB)

    Zhuang, J.; Tromp, G.; Kuivaniemi, H.; Prockop, D.J. [Thomas Jefferson Univ., Philadelphia, PA (United States); Castells, S. [Univ. Hospital of Brooklyn, NY (United States)

    1996-01-11

    A substitution of arginine for glycine at amino acid position 154 of the {alpha}1(I) collagen chain was found in a father and his three children. The phenotype of the patients includes manifestations of types I and III/IV osteogenesis imperfecta, but appears to be milder than that of the previously described two unrelated patients that had the identical mutation in the {alpha}1(I) collagen chain. The variability in the phenotype raises the possibility of epistatic loci or environmental effects on expression of the disorder. 35 refs., 3 figs., 2 tabs.

  19. 46 CFR 154.625 - Design temperature below 0 °C (32 °F) and down to −165 °C (−265 °F).

    Science.gov (United States)

    2010-10-01

    ... LIQUEFIED GASES Design, Construction and Equipment Materials § 154.625 Design temperature below 0 °C (32 °F... 46 Shipping 5 2010-10-01 2010-10-01 false Design temperature below 0 °C (32 °F) and down to â165... process piping for a design temperature below 0 °C (32 °F) and down to −165 °C (−265 °F) must meet § 56.50...

  20. 46 CFR 154.620 - Design temperature below −55 °C (−67 °F) and down to −165 °C (−265 °F).

    Science.gov (United States)

    2010-10-01

    ... LIQUEFIED GASES Design, Construction and Equipment Materials § 154.620 Design temperature below −55 °C (−67... 46 Shipping 5 2010-10-01 2010-10-01 false Design temperature below â55 °C (â67 °F) and down to... design temperature below −55 °C (−67 °F) and down to −165 °C (−265 °F) must: (a) Meet § 54.25-10(b)(2...

  1. The measurement of g{sub 1}{sup n} polarized structure of the neutron by the E154 experiment at SLAC; Mesure de la fonction de structure polarisee g{sub 1}{sup n} du neutron par l`experience E154 au SLAC

    Energy Technology Data Exchange (ETDEWEB)

    Incerti, Sebastien [Ecole Doctorale des Sciences Fondamentales, Universite Blaise Pascal, U.F.R. de Recherche Scientifique et Technique, F-63177 Aubiere (France)

    1998-01-21

    This thesis presents the precision measurement of the neutron polarized structure g{sub 1}{sup n} performed by the E154 collaboration at the Standford Linear Accelerator Center, USA, in autumn 1995, using a 48.3 GeV polarized electron beam scattered off a polarized Helium 3 target. The scattered electrons were detected using two spectrometer arms, covering the deep inelastic scattering range: 0.0134 < x < 0.7 and 1 GeV{sup 2} < Q{sup 2} < 17 GeV{sup 2} at an average value of Q{sup 2} = 5 GeV{sup 2}. Two electromagnetic calorimeters have been designed by the LPC in Clermont-Ferrand and the SphN-CEA in Saclay to measure the scattered electron energy and to eject the contaminating hadron background using, a cellular automaton and a neural network, widely described in this thesis. The analysis performed in Clermont-Ferrand and presented in this document led us to the integral on the measurement region of g{sub 1}{sup n} equaling: - 0.34 {+-} 0.003{sub STAT} {+-} 0.004{sub SYST} {+-} 0.001{sub EVOL} at Q{sup 2} = 5 GeV{sup 2}, where our data have been evolved to Q{sup 2} = 5 GeV{sup 2} using the next-to-leading order DGLAP evolution equations and a world parametrization of the polarized parton distributions. The Ellis and Jaffe sum rule is clearly violated. Using different low x extrapolations, our integral is compatible with the Bjorken sum rule. The quark contribution to the nucleon spin is {Delta}{Sigma} = 29 {+-} 6 % in the M S-bar scheme and {Delta}{Sigma} = 37 {+-} 7% in the AB scheme, at Q{sup 2} = 5 GeV{sup 2}. The gluon contribution seems to be positive and within the range: 0 < {Delta}G < 2. (author) 245 refs., 170 figs., 60 tabs.

  2. Comparison of optimised germanium gamma spectrometry and multicollector inductively coupled plasma mass spectrometry for the determination of {sup 134}Cs, {sup 137}Cs and {sup 154}Eu single ratios in highly burnt UO{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Caruso, S. [Laboratory for Reactor Physics and Systems Behaviour, Paul Scherrer Institute, CH-5232 Villigen PSI (Switzerland); Ecole Polytechnique Federale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland)], E-mail: stefano.caruso@nok.ch; Guenther-Leopold, I. [Laboratory for Materials Behaviour, Paul Scherrer Institute, CH-5232 Villigen PSI (Switzerland); Murphy, M.F.; Jatuff, F. [Laboratory for Reactor Physics and Systems Behaviour, Paul Scherrer Institute, CH-5232 Villigen PSI (Switzerland); Chawla, R. [Laboratory for Reactor Physics and Systems Behaviour, Paul Scherrer Institute, CH-5232 Villigen PSI (Switzerland); Ecole Polytechnique Federale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland)

    2008-05-15

    Non-destructive and destructive methods have been compared to validate their corresponding assessed accuracies in the measurement of {sup 134}Cs/{sup 137}Cs and {sup 154}Eu/{sup 137}Cs isotopic concentration ratios in four spent UO{sub 2} fuel samples with very high (52 and 71 GWd/t) and ultra-high (91 and 126 GWd/t) burnup values, and about 10 (in the first three samples) and 4 years (in the latter sample) cooling time. The non-destructive technique tested was high-resolution gamma spectrometry using a high-purity germanium detector (HPGe) and a special tomographic station for the handling of highly radioactive 400 mm spent fuel segments that included a tungsten collimator, lead filter (to enhance the signal to Compton background ratio and reduce the dead time) and paraffin wax (to reduce neutron damage). The non-destructive determination of these isotopic concentration ratios has been particularly challenging for these segments because of the need to properly derive non-Gaussian gamma-peak areas and subtract the background from perturbing capture gammas produced by the intrinsic high-intensity neutron emissions from the spent fuel. Additionally, the activity distribution within each pin was determined tomographically to correct appropriately for self-attenuation and geometrical effects. The ratios obtained non-destructively showed a 1{sigma} statistical error in the range 1.9-2.9%. The destructive technique used was a high-performance liquid chromatographic separation system, combined online to a multicollector inductively coupled plasma mass spectrometer (HPLC-MC-ICP-MS), for the analysis of dissolved fuel solutions. During the mass spectrometric analyses, special care was taken in the optimisation of the chromatographic separation for Eu and the interfering element Gd, as also in the mathematical correction of the {sup 154}Gd background from the {sup 154}Eu signal. The ratios obtained destructively are considerably more precise (1{sigma} statistical error in

  3. Search for scalar diphoton resonances with 15.4~fb$^{-1}$ of data collected at $\\sqrt{s}$=13 TeV in 2015 and 2016 with the ATLAS detector

    CERN Document Server

    The ATLAS collaboration

    2016-01-01

    A search for new spin-0 resonances decaying into two photons in the ATLAS experiment at the LHC is described. The analysis is based on $pp$ collision data corresponding to an integrated luminosity of 15.4 fb$^{-1}$ at $\\sqrt{s}$=13~\\TeV\\ recorded in 2015 and 2016. A deviation from the Standard Model background-only hypothesis corresponding to 3.4 standard deviations is observed in the 2015 data for a resonance mass hypothesis of 730~GeV. No significant excess at such mass over the background expectation is observed in the 2016 data. The global significance is estimated to be less than one standard deviation. Limits on the production cross section times branching ratio to two photons of such resonances are reported.

  4. Contribution to the study of samarium-151 excited levels; Contribution a l'etude des niveaux excites du samarium-151

    Energy Technology Data Exchange (ETDEWEB)

    Locard, P. [Commissariat a l' Energie Atomique, Centre d' Etudes Nucleaires de Grenoble, 38 (France)

    1967-07-01

    The nucleus of {sup 151}Sm, which has 89 neutrons, happens to be on the lower edge of the deformed nuclei of region II. Therefore, the study of its levels is very interesting for the verification of the goodness of the collective models for deformed nuclei when the deformation is small (we introduce these models in the first chapter). {sup 151}Sm has often been studied, but the direct gamma spectrum measured with a lithium drift-germanium detector (chapter 3) shows many high energy transitions which did not appear in the previous level schemes. In order to settle these transitions, we have undertaken gamma-gamma coincidence spectra (as well as sum-coincidence spectra) experiments with a scintillation spectrometer designed in our laboratory (chapter 2). The investigation of the intensities of these coincidences leads us to modify the last proposed level schemes: we suppress the levels at 405,5 and 650 keV, we add levels at 245,6 - 306,6 - 522 - 952 and 962 keV. We have also verified the multipolarities of the main transitions and measured the half-lives of a few levels (chapter 3) (we find a half-life of 1.1 {+-} 0.5 nanosecond for the level at 167,7 keV). In chapter 4, we compare our results to the predictions of the models described in chapter 1. (author) [French] Le noyau de {sup 151}Sm, qui possede 89 neutrons, se trouve a la limite inferieure des noyaux deformes de la region II. L'etude de ses niveaux excites est donc d'un interet tout particulier pour la verification de la validite des differents modeles collectifs pour les noyaux deformes, lorsque la deformation est petite (nous introduisons ces modeles dans un premier chapitre). Le {sup 151}Sm a deja fait l'objet de nombreuses etudes, mais le spectre gamma direct fait avec une jonction de germanium compense au lithium (chapitre 3), nous a montre l'existence d'un grand nombre de transitions de hautes energies qui ne sont pas placees dans les schemas proposes jusqu'a ce jour. Pour preciser la place de ces transitions, nous avons donc entrepris des experiences de coincidences gamma-gamma (et de ''spectre de somme'') a l'aide d'un ensemble de spectrometrie a scintillation realise au laboratoire (chapitre 2). L'etude des intensites de ces coincidences (chapitre 3) nous amene a modifier le dernier schema propose: nous supprimons les niveaux a 405,5 et 650 keV, nous ajoutons des niveaux a 245,6 - 306,6 - 522 - 952 et 962 keV. Nous avons egalement verifie la multipolarite des principales transitions et mesure la duree de vie de certains des niveaux (chapitre 3) (nous trouvons une periode de 1,1 {+-} 0,5) nanoseconde pour le niveau a 167,7 keV). Le chapitre 4 est enfin consacre a la comparaison de nos resultats avec les predictions des differents modeles decrits au chapitre 1. (auteur)

  5. Anti-CD25 mAb, anti-IL2 mAb, and IL2 block tolerance induction through anti-CD154 mAb and rapamycin in xenogeneic islet transplantation.

    Science.gov (United States)

    Pan, H; Lu, H M; Hu, W-M; Tian, B-L; Liu, X-B; Zhang, Z-D; Mai, G

    2007-12-01

    We have used anti-CD154 monoclonal antibody (mAb; MR1) and rapamycin (rapa) to induce tolerance to islet xenografts. The aim of this study was to investigate whether classical anergy and/or regulation by interleukin (IL)2-dependent CD25+ T regulatory cells played roles in the induction and maintenance of tolerance in this model. Streptozotocin-induced diabetic mice were transplanted with rat islets. We performed the following groups: control group, islet transplantation without therapy; rapamycin group, 0.2 mg/kg by oral gavage on days 0, 1, 2, and every other day to day 14; anti-CD154 mAb (MR1) group, 0.5 mg intraperitoneally on days 0, 2, and 4; combination therapy group with rapa and MR1. We then administered in addition to the combination therapy with early (from days 0 to 14 [for IL2] or to 28 [for anti-IL2 mAb and anti-CD25 mAb] post-transplantation) or late (from days 100 to 114 [for IL2] or to 128 [for anti-IL2 mAb and anti-CD25 mAb] posttransplantation) recombinant IL2 (2000 U, intraperitoneally twice a day), a neutralizing anti-IL2 mAb (S4B6-1, 0.3 mg intraperitoneally twice weekly), and a depleting anti-CD25 mAb (PC61, 0.3 mg intraperitoneally twice weekly), respectively. Histology was performed at time of rejection. Rapa and MR1 therapy alone significantly prolonged xenograft survival compared to the control group: median graft survival was 34 days versus 17 days (P200 days, PIL2 was administered early with MR1 and rapa, rapid rejection developed in 18 of 18 mice (MGS 7 days), whereas when IL2 was given late, only 3 of 10 developed rejection. Early administration of anti-IL2 mAb led to rejection in 10 of 10 mice (MGS 42 days), whereas late administration led to rejection in only one of four mice. Early administration of anti-CD25 mAb led to rejection in eight of nine mice (MGS 49 days), whereas late administration led to rejection in only three of seven mice. Rapa and MR1 allowed indefinite graft survival of islet xenografts. Classical anergy and

  6. IL-2-Mediated In Vivo Expansion of Regulatory T Cells Combined with CD154–CD40 Co-Stimulation Blockade but Not CTLA-4 Ig Prolongs Allograft Survival in Naive and Sensitized Mice

    Directory of Open Access Journals (Sweden)

    Dela Golshayan

    2017-04-01

    Full Text Available In recent years, regulatory T cells (Treg-based immunotherapy has emerged as a promising strategy to promote operational tolerance after solid organ transplantation (SOT. However, a main hurdle for the therapeutic use of Treg in transplantation is their low frequency, particularly in non-lymphopenic hosts. We aimed to expand Treg directly in vivo and determine their efficacy in promoting donor-specific tolerance, using a stringent experimental model. Administration of the IL-2/JES6-1 immune complex at the time of transplantation resulted in significant expansion of donor-specific Treg, which suppressed alloreactive T cells. IL-2-mediated Treg expansion in combination with short-term CD154–CD40 co-stimulation blockade, but not CTLA-4 Ig or rapamycin, led to tolerance to MHC-mismatched skin grafts in non-lymphopenic mice, mainly by hindering alloreactive CD8+ effector T cells and the production of alloantibodies. Importantly, this treatment also allowed prolonged survival of allografts in the presence of either donor-specific or cross-reactive memory cells. However, late rejection occurred in sensitized hosts, partly mediated by activated B cells. Overall, these data illustrate the potential but also some important limitations of Treg-based therapy in clinical SOT as well as the importance of concomitant immunomodulatory strategies in particular in sensitized hosts.

  7. The relation of a family history of alcoholism, obstetric complications and family environment to behavioral problems among 154 adolescents in Germany: results from the children of alcoholics study in Pomerania.

    Science.gov (United States)

    Barnow, Sven; Lucht, Michael; Hamm, Alfons; John, Ulrich; Freyberger, Harald-J

    2004-01-01

    Behavioral problems in adolescence have been shown to be associated with the presence of a positive family history of alcoholism (FH+), obstetric complications (OCs), and negative parenting practices. This study tested the relation of these factors to aggression/delinquency and attention problems in an untreated population sample of 154 adolescents in Pomerania. Furthermore, we evaluated the predictive strength of a FH+, OCs and negative parenting styles in a prospective subsample of 127 adolescents using a hierarchical regression analysis. Group comparisons between offspring with higher vs. lower values on aggression/delinquency revealed that only rejection by the parents was significantly more often reported by teenagers with higher measures on these behavioral problems. Offspring with higher values on attention problems had more OCs reported by the mother and also had more feelings of parental rejection compared to controls. The results of the hierarchical regression analysis showed that parental rejection was the only significant predictor for both aggression/delinquency, and attention problems measured 1 year after the initial assessment. We conclude that parental rejection is a major risk factor for both aggression/delinquency and attention problems. Reflecting the fact that these behavioral problems have been reported to be strongly associated with later substance misuse, the improvement of parenting practices should be considered in prevention and intervention programs. Copyright 2004 S. Karger AG, Basel

  8. Signature inversion in πh{sub 11/2} x νi{sub 13/2} band of {sup 152}Eu and {sup 154,156}Tb

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Sushil [Akal University, Department of Physics, Talwandi Sabo (India); Maharishi Markandeshwar University, Department of Physics, Mullana (India); Singh, Sukhjeet [Akal University, Department of Physics, Talwandi Sabo (India); Sharma, Vandana; Sharma, J.K. [Maharishi Markandeshwar University, Department of Physics, Mullana (India)

    2017-04-15

    The phenomenon of signature inversion observed in the πh{sub 11/2} x νi{sub 13/2} band of {sup 152}Eu and {sup 156}Tb nuclides is revisited through the axially symmetric two quasiparticle plus rotor model approach. The magnitude of experimentally observed signature splitting and point of signature inversion, which could not be explicitly reproduced in the earlier calculations, is successfully reproduced in the present study. Some of the critical issues, such as violation of the well-established Gallagher Moszkowski (GM) rule for eight GM doublets appearing in the basis space of earlier calculations of {sup 152}Eu and {sup 156}Tb, are fixed and also the ambiguity regarding spin assignment to this band observed in {sup 156}Tb is resolved. These calculations are further extended to the same band (πh{sub 11/2} x νi{sub 13/2}) observed in {sup 154}Tb nuclide and signature inversion observed in this band is successfully reproduced. (orig.)

  9. One-step synthesis of samarium-doped ceria and its CO catalysis

    Indian Academy of Sciences (India)

    Administrator

    Key Laboratory for Special Functional Aggregate Materials of Education Ministry,. School of Chemistry and Chemical ... been flourishing since its excellent electric properties were discovered in the 1980s.1 At present SDC is ... absolute ethanol three times and dried in an electric oven at 60°C overnight, and then calcined at ...

  10. Trichloridotris{N-[phenyl(pyridin-2-ylmethylidene]hydroxylamine-κ2N,N′}samarium(III

    Directory of Open Access Journals (Sweden)

    Yahong Li

    2012-03-01

    Full Text Available The SmIII ion in the title compound, [SmCl3(C12H10N2O3], shows a coordination number of nine with a slightly distorted tricapped trigonal prismatic geometry based on a Cl3N6 donor set. The molecular structure is stabilized by three intramolecular O—H...Cl hydrogen bonds.

  11. Biological studies of samarium-153 bleomycin complex in human breast cancer murine xenografts for therapeutic applications

    Energy Technology Data Exchange (ETDEWEB)

    Bahrami-Samani, A. [Faculty of Nuclear Engineering and Physics, Amirkabir Univ. of Tech., Tehran (Iran); Ghannadi-Maragheh, M. [Faculty of Nuclear Engineering and Physics, Amirkabir Univ. of Tech., Tehran (Iran); Radiopharmaceutical Research and Development Lab. (RRDL), Nuclear Science and Technology Research Inst. (NSTRI), Tehran (Iran); Jalilian, A.R.; Mazidi, M. [Radiopharmaceutical Research and Development Lab. (RRDL), Nuclear Science and Technology Research Inst. (NSTRI), Tehran (Iran)

    2010-07-01

    In this work, a potential therapeutic DNA targeting agent, {sup 153}Sm-bleomycin complex ({sup 153}Sm-BLM), was developed and the tumor accumulation studies were performed using single photon emission computed tomography (SPECT) and scarification studies. {sup 153}Sm-BLM was prepared at optimized conditions (room temperature, 4-8 h, 0.1 mg bleomycin for 740-3700 MBq {sup 153}SmCl{sub 3}, radiochemical purity over 98%, HPLC, specific activity = 55 TBq/mmol). {sup 153}Sm-BLM was administered into human breast cancer murine xenografts and the biodistribution and imaging studies were performed up to 48 h. {sup 153}Sm-BLM demonstrated superior tumor accumulation properties in contrast with the other radiolabeled bleomycins with tumor:blood ratios of 41, 72 and 182 at 4, 24 and 48 h, respectively, and tumor:muscle ratios of 23, 33 and > 1490 at 4, 24 and 48 h, respectively, while administered intravenously. The SPECT images also demonstrated the obvious tumor uptake at the chest region of the breast-tumor bearing mice. These initial experiments demonstrate significant accumulation of {sup 153}Sm-BLM in tumor tissues. (orig.)

  12. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles

    CSIR Research Space (South Africa)

    Mandiwana, V

    2015-09-01

    Full Text Available .63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems...

  13. Nanostructured Samarium Doped Fluorapatites and Their Catalytic Activity towards Synthesis of 1,2,4-Triazoles

    National Research Council Canada - National Science Library

    Gangu, Kranthi Kumar; Maddila, Suresh; Maddila, Surya Narayana; Jonnalagadda, Sreekantha B

    2016-01-01

    ...) and their properties. The nanostructured Sm doped fluorapatites (Sm-FAp) were prepared by a co-precipitation method using four different amino acids, namely glutamic acid, aspartic acid, glycine and histidine...

  14. Samarium(III) picrate tetraethylene glycol complex: Photoluminescence study and active material in monolayer electroluminescent

    Energy Technology Data Exchange (ETDEWEB)

    Kusrini, Eny, E-mail: ekusrini@che.ui.ac.id [Department of Chemical Engineering, Faculty of Engineering, Universitas Indonesia, 16424 Depok (Indonesia); Saleh, Muhammad I. [School of Chemical Sciences, Universiti Sains Malaysia, 11800 Penang (Malaysia); Yulizar, Yoki [Department of Chemistry, Faculty of Mathematics and Natural Sciences, Universitas Indonesia, 16424 Depok (Indonesia); Za' aba, Noor K.; Abd. Majid, W.H. [Solid State Research Laboratory, Department of Physics, Universiti Malaya, 50603 Kuala Lumpur (Malaysia)

    2011-09-15

    A mononuclear Sm(III) complex involving Pic and EO4 (where Pic=picrate anion and EO4=tetraethylene glycol) has been studied. It shows a bright-orange emission when used as active material in a monolayer electroluminescent device of ITO/EO4-Sm-Pic/Al. The crystal structure of the complex consists of [Sm(Pic){sub 2}(H{sub 2}O)(EO4)]{sup +} cation and [Pic]{sup -} anion. The Sm(III) ion is coordinated with nine oxygen atoms from one EO4 ligand in a pentadentate mode, two Pic anions each in bidentate and monodentate modes, and one water molecule. Both the terminal alcohol groups of the acyclic EO4 ligand were involved in the O-H...O hydrogen bonding by infinite one-dimensional (1D) chain within a symmetry direction [0 1 0]. The photoluminescence (PL) spectrum of the thin film shows the typical spectral features of the Sm(III) ion ({sup 4}G{sub 5/2}{yields}{sup 6}H{sub 7/2} transitions). The root-mean-square (rms) of the roughness of thin film is 30.605 nm and indicates that the formation of the monolayer electroluminescent device is not uniform and retains a high crystallinity. Typical semiconductor current-voltage (I-V) property was also observed in this device with threshold and turn voltages of 2.8 and 6.2 V, respectively. The [Sm(Pic){sub 2}(H{sub 2}O)(EO4)](Pic).H{sub 2}O complex can be applied as a luminescent center in OLED for bright-orange emission. - Highlights: > The [Sm(Pic){sub 2}(H{sub 2}O)(EO4)](Pic).H{sub 2}O complex is crystallized in triclinic with space group P-1. > The complex is applied as a emissive center in monolayer device structure of ITO/EO4-Sm-Pic/Al. > The photoluminescence spectrum of the crystalline and thin film shows a bright-orange emission. > The current-voltage property showed the turn on voltage of 6.2 V.

  15. Pulsed laser deposition and optical characterizations of the magnetic samarium orthoferrite

    Energy Technology Data Exchange (ETDEWEB)

    Berini, Bruno, E-mail: bruno.berini@uvsq.fr [Groupe d' Etude de la Matiere Condensee (GEMAC), CNRS, Universite de Versailles St. Quentin, 45, Av. des Etats-Unis, 78035 Versailles Cedex (France); Mistrik, Jan [Institute of Applied Physics and Mathematics, Faculty of Chemical Technology, University of Pardubice, Studentska 84, 532 10 Pardubice (Czech Republic); Dumont, Yves; Popova, Elena; Fouchet, Arnaud; Scola, Joseph; Keller, Niels [Groupe d' Etude de la Matiere Condensee (GEMAC), CNRS, Universite de Versailles St. Quentin, 45, Av. des Etats-Unis, 78035 Versailles Cedex (France)

    2012-01-01

    Pulsed Laser Deposition of magnetically ordered polycrystalline SmFeO{sub 3} films has been optimized onto SiO{sub 2} glass substrates as function of substrate temperature, oxygen pressure and pulsed laser fluency. Using a KrF excimer laser, crystallization temperature is found to be about 1048 K for a weak fluency of only 1.7 J cm{sup -2}. We show that this growth temperature can be reduced using higher fluency and that it is possible to obtain a film texturation along the c axis by reducing the oxygen pressure at given temperature and fluency. In a second part, we focus on the SmFeO{sub 3} optical constants determined by in situ ellipsometry using a stacking model and the Cauchy dispersion relation for SmFeO{sub 3} layer. We show a good correlation between the transmission and reflection calculated from these data and measured by ex situ spectrophotometry in the visible range.

  16. Nanostructured Samarium Doped Fluorapatites and Their Catalytic Activity towards Synthesis of 1,2,4-Triazoles

    Directory of Open Access Journals (Sweden)

    Kranthi Kumar Gangu

    2016-09-01

    Full Text Available An investigation was conducted into the influence of the amino acids as organic modifiers in the facile synthesis of metal incorporated fluorapatites (FAp and their properties. The nanostructured Sm doped fluorapatites (Sm-FAp were prepared by a co-precipitation method using four different amino acids, namely glutamic acid, aspartic acid, glycine and histidine. The materials were characterized by various techniques including X-ray diffraction (XRD, Fourier transform infra-red spectroscopy (FT-IR, field emission scanning electron microscopy (FE-SEM, energy-dispersive X-ray spectroscopy (EDX, high resolution transmission electron microscopy (HR-TEM, N2-adsorption/desorption isotherm, temperature programmed desorption (TPD and fluorescence spectrophotometry. Under similar conditions, Sm-FAp prepared using different amino acids exhibited distinctly different morphological structures, surface area and pore properties. Their activity as catalysts was assessed and Sm-FAp/Glycine displayed excellent efficiency in the synthesis of 1,2,4-triazole catalyzing the reaction between 2-nitrobenzaldehyde and thiosemicarbazide with exceptional selectivity and 98% yield in a short time interval (10 min. The study provides an insight into the role of organic modifiers as controllers of nucleation, growth and aggregation which significantly influence the nature and activity of the catalytic sites on Sm-FAp. Sm-FAp could also have potential as photoactive material.

  17. Body composition analysis by DEXA by using dynamically changing samarium filtration

    DEFF Research Database (Denmark)

    Gotfredsen, Arne; Baeksgaard, L; Hilsted, J

    1997-01-01

    , which depends on the current-absorber thickness. With this system we found a good agreement (r = 0.99) between reference and measured amounts of tissue or fat percentages in a plastic phantom and in smaller (approximately 0.5-4 kg) and larger (approximately 5-20 kg) piles of tissue (ox muscle and lard......). Scans of six healthy volunteers covered with combinations of beef and lard (approximately 5-15 kg) showed a good agreement (r = 0.99) between reference and DEXA values of added soft tissue mass and fat percentage. We conclude that the DEXA method (and, in particular, the Norland XR-36 using dynamic...

  18. Synthesis, thermal and photoluminescent properties of ZnSe- based oxyfluoride glasses doped with samarium

    Science.gov (United States)

    Kostova, I.; Okada, G.; Pashova, T.; Tonchev, D.; Kasap, S.

    2014-12-01

    Rare earth (RE) doped glasses and glass ceramic materials have recently received considerable attention because of their potential or realized applications as X-ray intensifying screens, phosphors, detectors, waveguides, lasers etc. [1]. In this work, we present a new RE doped ZnO-ZnSe-SrF2-P2O5-B2O3-Sm2O3-SmF3 (ZSPB) glass system synthesized by melt quenching technique. The resulting glasses were visually fully transparent and stable with glass the transition temperatures around 530°C. The thermal properties of this glass system were characterized by Modulated Differential Scanning Calorimetry (MDSC) measurements before and after annealing at 650°C. We have characterized these glasses by Raman spectroscopy and photoluminescence (PL) measurements over the UV-VIS range using light emitting diodes (LED) and laser diodes (LD) excitation sources. We have also irradiated thermally treated and non-treated glass samples by X-rays and have studied the resulting PL. We discuss the results in terms of previously reported models for Sm-doped Zn-borophosphate oxide, oxyfluoride and oxyselenide glasses.

  19. Laser-Induced Luminescence Study of Samarium(III) Thiodiglycolate Complexes

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Dong Yong; Lee, Eil Hee [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Kimura, Takaumi [Japan Atomic Energy Research Institute, Ibaraki-ken (Japan)

    2003-09-15

    The hydration number of Sm(III) has been obtained by using the difference in the decay rate constants in H{sub 2}O and D{sub 2}O solutions. In general, k{sub obs}(H{sub 2}O) >> k{sub obs}(D{sub 2}O), k{sub obs}(D{sub 2}O) ≅ constant, and ligands are not as effective in causing non-radiative de-excitation of the excited state. For Sm(III), a relationship has been proposed in which the hydration number is related directly to the decay rate constant in H{sub 2}O. If there is no contribution from the ligand to the de-excitation of the luminescence excited state, the hydration of Sm(III) in the different complexes can be obtained directly from the values of k{sub obs} measured in H{sub 2}O. The number and the geometric distribution of solvent molecules around a metal ion in solution are an important factor in the structural and chemical behavior of cation. Indeed, such information has been utilized to design novel ionophores and receptors. However, there have been few studies of hydration structure for lanthanides. The fact that many f-element salts which have relatively large lattice energies are fairly soluble in water is a reflection of the strength of the interactions between the metal cations and water molecules.

  20. Oxygen Fugacity of the Martian Mantle from Pigeonite/Melt Partitioning of Samarium, Europium and Gadolinium

    Science.gov (United States)

    Musselwhite, S.; Jones, J. H.; Shearer, C.

    2004-01-01

    This study is part of an ongoing effort to calibrate the pyroxene/melt Eu oxybarometer for conditions relevant to the martian meteorites. There is fairly good agreement between a determinations using equilibria between Fe-Ti oxides and the estimates from Eu anomalies in shergottite augites in tenns of which meteorites are more or less oxidized. The Eu calibration was for angrite composition pyroxenes which are rather extreme. However, application of a calibration for martian composition augites 113 does not significantly reduce the discrepancy between the two methods. One possible reason for this discrepancy is that augites are non-liquidus. The use of pigeonite rather than augite as the oxy-barometer phase is considered. We have conducted experiments on martian composition pigeonite/melt REE partitioning as a function of fO2.

  1. Doping controlled spin reorientation in dysprosium-samarium orthoferrite single crystals

    Science.gov (United States)

    Cao, Shixun; Zhao, Weiyao; Kang, Baojuan; Zhang, Jincang; Ren, Wei

    2015-03-01

    As one of the most important phase transitions, spin reorientation (SR) in rare earth transition metal oxides draws much attention of emerging materials technologies. The origin of SR is the competition between different spin configurations which possess different free energy. We report the control of spin reorientation (SR) transition in perovskite rare earth orthoferrite Dy1-xSmxFeO3, a whole family of single crystals grown by optical floating zone method from x =0 to 1. Temperature dependence of the magnetizations under zero-field-cooling (ZFC) and field-cooling (FC) processes are studied. We have found a remarkable linear change of SR transition temperature in Sm-rich samples for x>0.2, which covers an extremely wide temperature range including room temperature. The a-axis magnetization curves under FCC process bifurcate from and then jump down to that of warming process (ZFC and FCW curves) in single crystals when x =0.5-0.9, suggesting complicated 4f-3d electron interactions among Dy3+-Sm3+, Dy3+-Fe3+, and Sm3+-Fe3+ sublattices of diverse magnetic configurations for materials physics and design. The magnetic properties and the doping effect on SR transition temperature in these single crystals might be useful in the spintronics device application. This work is supported by the National Key Basic Research Program of China (Grant No. 2015CB921600), and the National Natural Science Foundation of China (NSFC, Nos. 51372149, 50932003, 11274222).

  2. Synthesis, crystal structure and luminescent properties of a new samarium-fluorescein metal-organic framework

    Science.gov (United States)

    Thomas, Jesty; Ambili, K. S.

    2015-10-01

    A new metal-organic framework with empirical formula C43H30NO12Sm was solvothermally synthesized using SmCl3, fluorescein and N, N-Dimethyl formamide (DMF) and characterized by single crystal X-ray diffraction, powder X-ray diffraction, infrared spectroscopy, UV-Visible spectroscopy, scanning electron microscopy, optical microscopy, photoluminescence spectroscopy, CHN elemental analysis and thermogravimetric analysis. Single crystal X-ray diffraction revealed that the crystal structure belongs to the triclinic system, P-1 space group with a = 12.113 (6) Å, b = 12.1734 (7) Å, c = 13.2760(8) Å, α = 67.930(3)⁰, β = 87.779(3)⁰, γ = 77.603(3)⁰ and V = 1769.71 (17) Å3. The photoluminescence spectrum showed emission peaks at 550 nm, 600 nm and 647 nm due to the characteristic transitions 4G5/2 to 6H5/2, 4G5/2 to 6H7/2 and 4G5/2 to 6H9/2 respectively, when excited at 398 nm.

  3. High-temperature heat capacity of samarium and erbium titanates with pyrochlore structure

    Science.gov (United States)

    Denisova, L. T.; Chumilina, L. G.; Denisov, V. M.; Ryabov, V. V.

    2017-12-01

    Titanates Sm2Ti2O7 and Er2Ti2O7 with pyrochlore structure have been prepared by solid-phase synthesis in air from stoichiometric Sm2O3 (Er2O3)-TiO2 mixtures sequentially at 1673 and 1773 K. Hightemperature heat capacity of the oxide compounds has been determined by differential scanning calorimetry. Their thermodynamic properties have been calculated from experimental temperature dependence C p = f( T).

  4. TL1A increases expression of CD25, LFA-1, CD134 and CD154, and induces IL-22 and GM-CSF production from effector CD4 T-cells.

    Directory of Open Access Journals (Sweden)

    Kirsten Reichwald

    Full Text Available Elevated levels of the cytokine TL1A is associated with several autoimmune diseases e.g. rheumatoid arthritis and inflammatory bowel disease. However, the exact role of TL1A remains elusive. In this study, we investigated the function of TL1A in a pro-inflammatory setting. We show that TL1A together with IL-12, IL-15 and IL-18 increases expression of the co-stimulatory molecules CD154 (CD40 ligand and CD134 (OX40 on previously activated CD4+ T cells. This indicates that TL1A functions as a co-stimulatory molecule, decreasing the activation threshold of T-cells. We have previously shown that TL1A co-stimulation strongly induces IL-6 in human healthy leukocytes. Interestingly, the cytokine-activated effector T-cells did not produce IL-6 in response to TL1A, indicating distinct effects of TL1A on different cell populations. We further show that this co-stimulation increases the expression of CD25 (IL-2Rα and CD11a (α-chain of LFA-1 on CD4 T-cells, likely governing increased IL-2/IL-15 sensitivity and cell-cell contact. Along with this, TL1A co-stimulation caused a specific induction of IL-22 and GM-CSF from the activated T-cells. These results substantially contribute to the explanation of TL1A's role in inflammation. Our results suggest that TL1A should be considered as a target for immunotherapeutic treatment of rheumatoid arthritis and inflammatory bowel disease.

  5. The FUT2 secretor variant p.Trp154Ter influences serum vitamin B12 concentration via holo-haptocorrin, but not holo-transcobalamin, and is associated with haptocorrin glycosylation.

    Science.gov (United States)

    Velkova, Aneliya; Diaz, Jennifer E L; Pangilinan, Faith; Molloy, Anne M; Mills, James L; Shane, Barry; Sanchez, Erica; Cunningham, Conal; McNulty, Helene; Cropp, Cheryl D; Bailey-Wilson, Joan E; Wilson, Alexander F; Brody, Lawrence C

    2017-12-15

    Vitamin B12 deficiency is common in older individuals. Circulating vitamin B12 concentration can be used to diagnose deficiency, but this test has substantial false positive and false negative rates. We conducted genome-wide association studies (GWAS) in which we resolved total serum vitamin B12 into the fractions bound to transcobalamin and haptocorrin: two carrier proteins with very different biological properties. We replicated reported associations between total circulating vitamin B12 concentrations and a common null variant in FUT2. This allele determines the secretor phenotype in which blood group antigens are found in non-blood body fluids. Vitamin B12 bound to haptocorrin (holoHC) remained highly associated with FUT2 rs601338 (p.Trp154Ter). Transcobalamin bound vitamin B12 (holoTC) was not influenced by this variant. HoloTC is the bioactive the form of the vitamin and is taken up by all tissues. In contrast, holoHC is only taken up by the liver. Using holoHC from individuals with known FUT2 genotypes, we demonstrated that FUT2 rs601338 genotype influences the glycosylation of haptocorrin. We then developed an experimental model demonstrating that holoHC is transported into cultured hepatic cells (HepG2) via the asialoglycoprotein receptor (ASGR). Our data challenge current published hypotheses on the influence of genetic variation on this clinically important measure and are consistent with a model in which FUT2 rs601338 influences holoHC by altering haptocorrin glycosylation, whereas B12 bound to non-glycosylated transcobalamin (i.e. holoTC) is not affected. Our findings explain some of the observed disparity between use of total B12 or holoTC as first-line clinical tests of vitamin B12 status. Published by Oxford University Press 2017. This work is written by US Government employees and is in the public domain in the US.

  6. 46 CFR 154.431 - Model test.

    Science.gov (United States)

    2010-10-01

    ...(c). (b) Analyzed data of a model test for the primary and secondary barrier of the membrane tank... Model test. (a) The primary and secondary barrier of a membrane tank, including the corners and joints...

  7. BDML Metadata: 154 [SSBD[Archive

    Lifescience Database Archive (English)

    Full Text Available Ce_KK_P002 BDML file for quantitative information about nuclear division dynamics o...f R08D7.1(RNAi) embryo quantitative information about nuclear division dynamics in R08D7.1(RNAi) embryo C. e

  8. 32 CFR 154.48 - Issuing clearance.

    Science.gov (United States)

    2010-07-01

    ... provided there has been no additional investigation or development of derogatory information. (c) Personnel... Chiefs of Staff, initiates an SBI (or PR) for access to SCI on a military member, DIS will return the...

  9. Reference: 154 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available n Arabidopsis provides an elegant paradigm for cell patterning during development. Here, we describe a new gene, SCRAMBLED (SCM), re...quired for cells to appropriately interpret their locatio...n within the developing root epidermis. SCM encodes a receptor-like kinase protein with a predicted extracel...lular domain of six leucine-rich repeats and an intracellular serine-threonine kinase domain. SCM regulates the expre...iption factor genes that define the cell fates. Further, the SCM gene is expressed throughout the developing root. Therefore

  10. 33 CFR 154.1020 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... visibility, and currents within the COTP zone in which the systems or equipment are intended to function. Animal fat means a non-petroleum oil, fat, or grease derived from animals, and not specifically... chapter extending seaward to 50 nautical miles. Oil means oil of any kind or in any form, including, but...

  11. 46 CFR 154.1830 - Warning sign.

    Science.gov (United States)

    2010-10-01

    ... (2) Facing outboard towards the water so that the sign may be seen from the water. (b) Except as provided in paragraph (e) of this section, each warning sign must have the following words: (1) Warning. (2) Dangerous Cargo. (3) No Visitors. (4) No Smoking. (5) No Open Lights. (c) Each letter in the words on the...

  12. 154 THE NEUROTIC CHRISTIAN: IMPLICATIONS FOR CHRISTIAN ...

    African Journals Online (AJOL)

    Introduction. Neurosis was the term first used to classify psychological disorders in which anxiety is the ... neuroses, though obsolete psychodynamic term, is used to describe psychological disorder thought to result from ... Church amongst other things focuses on the individual: his salvation, his happiness, his wellbeing and ...

  13. 45 CFR 400.154 - Employability services.

    Science.gov (United States)

    2010-10-01

    ...-sufficiency plan and an individual employability plan, world-of-work and job orientation, job clubs, job... emphasis on English as it relates to obtaining and retaining a job. (e) Vocational training, including...

  14. 33 CFR 154.735 - Safety requirements.

    Science.gov (United States)

    2010-07-01

    ..., scale, and sediment does not apply if personnel use breathing apparatus which protect them from the tank... that access to the marine transfer area is limited to— (1) Personnel who work at the facility including...

  15. 32 CFR 154.31 - Authorized requesters.

    Science.gov (United States)

    2010-07-01

    ... National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE SECURITY DEPARTMENT OF DEFENSE.... (b) Defense Agencies—Directors of Security and activity commanders. (c) Organization of the Joint Chiefs of Staff—Chief, Security Division. (d) Office of the Secretary of Defense—Director for Personnel...

  16. 7 CFR 932.154 - Handler transfer.

    Science.gov (United States)

    2010-01-01

    ... Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... to destinations outside the area except fresh market outlets. For natural condition and processed... a destination outside the area, except fresh market outlets, two copies of said form shall be...

  17. 154-IJBCS-Article-Dr Koanga Mogtomo

    African Journals Online (AJOL)

    RHUMSIKI

    1990.Adenovirus types 40 and 41 and rotaviruses associated with diarrhea in children from Guatemala. J. Clin. Microbiol., 28: 1780–1784. De Jong JC, Bijlsma K, Wermenbol AG,. Verweij-Uijterwaal MW, Vander Avoort. HG, Wood DJ, Bailey AS, Osterhaus. AD.1993. Detection, typing and sub- typing of enteric adenoviruses ...

  18. Publications | Page 154 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    The aim of this paper is to contribute to the empirical literature that evaluates the effects of public financial support on total innovation expenditure, innovation and productivity. We apply propensity score matching techniques to analyze the impact of public financial support to innovation in... Mitigating food losses in Benin ...

  19. Publications | Page 154 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Significance of social networks in sustainable land management in Central Ethiopia and Eastern Uganda (open access). Fostering collective action is necessary for scaling sustainable land management (SLM) innovations. This paper analyses the significance of social networks in SLM among agricultural rural communities ...

  20. Publications | Page 154 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    (open access). This final report is concerned with the role played by the CINBIOSE node in the Community of Practice in Ecosystem Approaches to Human Health: Latin America and the Caribbean and should be seen as a complement of the final report of this Community. This role primarily involved (i) support to.