
Sample records for samarium 147 target

  1. Bone-seeking radiopharmaceuticals as targeted agents of osteosarcoma: samarium-153-EDTMP and radium-223. (United States)

    Anderson, Peter M; Subbiah, Vivek; Rohren, Eric


    Osteosarcoma is a cancer characterized by formation of bone by malignant cells. Routine bone scan imaging with Tc-99m-MDP is done at diagnosis to evaluate primary tumor uptake and check for bone metastases. At time of relapse the Tc-99m-MDP bone scan also provides a specific means to assess formation of bone by malignant osteosarcoma cells and the potential for bone-seeking radiopharmaceuticals to deliver radioactivity directly into osteoblastic osteosarcoma lesions. This chapter will review and compare a bone-seeking radiopharmaceutical that emits beta-particles, samarium-153-EDTMP, with an alpha-particle emitter, radium-223. The charged alpha particles from radium-223 have far more mass and energy than beta particles (electrons) from Sm-153-EDTMP. Because radium-223 has less marrow toxicity and more radiobiological effectiveness, especially if inside the bone forming cancer cell than samarium-153-EDTMP, radium-223 may have greater potential to become widely used against osteosarcoma as a targeted therapy. Radium-223 also has more potential to be used with chemotherapy against osteosarcoma and bone metastases. Because osteosarcoma makes bone and radium-223 acts like calcium, this radiopharmaceutical could possibly become a new targeted means to achieve safe and effective reduction of tumor burden as well as facilitate better surgery and/or radiotherapy for difficult to resect large, or metastatic tumors.

  2. Targeted bone marrow radioablation with 153Samarium-lexidronam promotes allogeneic hematopoietic chimerism and donor-specific immunologic hyporesponsiveness. (United States)

    Inverardi, Luca; Linetsky, Elina; Pileggi, Antonello; Molano, R Damaris; Serafini, Aldo; Paganelli, Giovanni; Ricordi, Camillo


    Transplantation tolerance, defined as acceptance of a graft by an otherwise fully immunocompetent host, has been an elusive goal. Although robust tolerance has been achieved by the induction of stable hematopoietic chimerism after bone marrow transplantation, lethal or sublethal radiation conditioning used to induce long-term chimerism precludes its clinical use. We studied whether targeted delivery of radiation to bone marrow could allow for bone marrow cell (BMC) engraftment, chimerism, and donor-specific tolerance in the absence of the side effects associated with external irradiation. We administered a radioactive bone-seeking compound (Samarium-Lexidronam, Quadramet, Berlex Laboratories, Wayne, NJ) together with transient T-cell costimulatory blockade to recipient mice. Allogeneic BMCs were given 7 or 14 days after preconditioning. Costimulatory blockade was obtained by the use of an anti-CD154 antibody for 4 weeks. Chimerism was assessed by flow cytometry. Mice then received donor-specific and third-party skin grafts. Graft survival was analyzed with mechanisms of donor-specific hyporesponsiveness. High levels of stable chimerism across an allogeneic barrier were achieved in mice by a single administration of Samarium-Lexidronam, transient T-cell costimulatory blockade, and BMC transplantation. A large percentage of chimeric animals retained donor-derived skin grafts for more than 120 days without requiring additional immunosuppression, suggesting that harsh cytotoxic preconditioning is not necessary to achieve stable chimerism and donor specific hyporesponsiveness. Analysis of the T-cell repertoire in chimeras indicates T-cell deletional mechanisms. These data broaden the potential use of BMC transplantation for tolerance induction and argue for its potential in treating autoimmune diseases.

  3. MicroRNA-147b regulates vascular endothelial barrier function by targeting ADAM15 expression.

    Directory of Open Access Journals (Sweden)

    Victor Chatterjee

    Full Text Available A disintegrin and metalloproteinase15 (ADAM15 has been shown to be upregulated and mediate endothelial hyperpermeability during inflammation and sepsis. This molecule contains multiple functional domains with the ability to modulate diverse cellular processes including cell adhesion, extracellular matrix degradation, and ectodomain shedding of transmembrane proteins. These characteristics make ADAM15 an attractive therapeutic target in various diseases. The lack of pharmacological inhibitors specific to ADAM15 prompted our efforts to identify biological or molecular tools to alter its expression for further studying its function and therapeutic implications. The goal of this study was to determine if ADAM15-targeting microRNAs altered ADAM15-induced endothelial barrier dysfunction during septic challenge by bacterial lipopolysaccharide (LPS. An in silico analysis followed by luciferase reporter assay in human vascular endothelial cells identified miR-147b with the ability to target the 3' UTR of ADAM15. Transfection with a miR-147b mimic led to decreased total, as well as cell surface expression of ADAM15 in endothelial cells, while miR-147b antagomir produced an opposite effect. Functionally, LPS-induced endothelial barrier dysfunction, evidenced by a reduction in transendothelial electric resistance and increase in albumin flux across endothelial monolayers, was attenuated in cells treated with miR-147b mimics. In contrast, miR-147b antagomir exerted a permeability-increasing effect in vascular endothelial cells similar to that caused by LPS. Taken together, these data suggest the potential role of miR147b in regulating endothelial barrier function by targeting ADAM15 expression.

  4. Biodistribution of samarium-153-EDTMP in rats treated with docetaxel

    Energy Technology Data Exchange (ETDEWEB)

    Villarim Neto, Arthur; Acucena, Maria Kadja Meneses Torres; Pereira, Kercia Regina Santos Gomes; Rego, Amalia Cinthia Meneses [Universidade Federal do Rio Grande do Norte (UFRN), Natal, RN (Brazil). Postgraduate Program in Health Sciences; Azevedo, Italo Medeiros; Medeiros, Aldo Cunha [Universidade Federal do Rio Grande do Norte (UFRN), Natal, RN (Brazil). Dept. of Surgery; Bernardo-Filho, Mario [State University of Rio de Janeiro, RJ (Brazil). Dept. of Biophysics and Biometry


    Purpose: Many patients with metastatic bone disease have to use radiopharmaceuticals associated with chemotherapy to relieve bone pain. The aim of this study was to assess the influence of docetaxel on the biodistribution of samarium-153-EDTMP in bones and other organs of rats. Methods: Wistar male rats were randomly allocated into 2 groups of 6 rats each. The DS (docetaxel/samarium) group received docetaxel (15 mg/kg) intraperitoneally in two cycles 11 days apart. The S (samarium/control) group rats were not treated with docetaxel. Nine days after chemotherapy, all the rats were injected with 0.1 ml of samarium-153-EDTMP via orbital plexus (25 {mu} Ci. After 2 hours, the animals were killed and samples of the brain, thyroid, lung, heart, stomach, colon, liver, kidney and both femurs were removed. The percentage radioactivity of each sample (% ATI / g) was determined in an automatic gamma-counter (Wizard-1470, Perkin-Elmer, Finland). Results: On the ninth day after the administration of the second chemotherapy cycle, the rats had a significant weight loss (314.50 +- 22.09 g) compared (p<0.5) to pre-treatment weight (353.66 {+-} 22.8). The % ATI/g in the samples of rats treated with samarium-153-EDTMP had a significant reduction in the right femur, left femur, kidney, liver and lungs of animals treated with docetaxel, compared to the control rats. Conclusion: The combination of docetaxel and samarium-153-EDTMP was associated with a lower response rate in the biodistribution of the radiopharmaceutical to targeted tissues. Further investigation into the impact of docetaxel on biodistribution of samarium-153-EDTMP would complement the findings of this study. (author)

  5. Production, separation and target preparation of 171Tm an 147Pm for neutron cross section measurements

    CERN Document Server

    Heinitz, S; Schumann, D; Dressler, R; Kivel, N; Guerrero, C; Köster, U; Tessler, M; Paul, M; Halfon, S


    The knowledge of the neutron capture cross sections of s-process branching point isotopes represents a basic requirement for the understanding of star evolution. Since such branching point isotopes are by definition radioactive, the measurement of their cross sections from thermal to stellar energies becomes a challenging task. Considerable amounts of material have to be produced, representing a significant radioactive hazard. We report here on the production and separation of 3.5 mg 171Tm from 240 mg 170Er2O3 and 72 µg 147Pm from 100 mg 146Nd2O3 irradiated at the ILL high flux reactor. Thin targets were prepared with high chemical and radioisotopic purity suitable for neutron capture measurements at n_TOF CERN and the SARAF-LiLiT facility.

  6. The Basis for Developing Samarium AMS for Fuel Cycle Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Buchholz, B A; Biegalski, S R; Whitney, S M; Tumey, S J; Weaver, C J


    Modeling of nuclear reactor fuel burnup indicates that the production of samarium isotopes can vary significantly with reactor type and fuel cycle. The isotopic concentrations of {sup 146}Sm, {sup 149}Sm, and {sup 151}Sm are potential signatures of fuel reprocessing, if analytical techniques can overcome the inherent challenges of lanthanide chemistry, isobaric interferences, and mass/charge interferences. We review the current limitations in measurement of the target samarium isotopes and describe potential approaches for developing Sm-AMS. AMS sample form and preparation chemistry will be discussed as well as possible spectrometer operating conditions.

  7. RNA interference targeting CD147 inhibits the proliferation, invasiveness, and metastatic activity of thyroid carcinoma cells by down-regulating glycolysis. (United States)

    Huang, Peng; Chang, Shi; Jiang, Xiaolin; Su, Juan; Dong, Chao; Liu, Xu; Yuan, Zhengtai; Zhang, Zhipeng; Liao, Huijun


    A high rate of glycolytic flux, even in the presence of oxygen, is a key metabolic hallmark of cancer cells. Lactate, the end product of glycolysis, decreases the extracellular pH and contributes to the proliferation, invasiveness and metastasis of tumor cells. CD147 play a crucial role in tumorigenicity, invasion and metastasis; and CD147 also interacts strongly and specifically with monocarboxylate transporter1 (MCT1) that mediates the transport of lactate. The objective of this study was to determine whether CD147 is involved, via its association with MCT1 to transport lactate, in glycolysis, contributing to the progression of thyroid carcinoma. The expression levels of CD147 in surgical specimens of normal thyroid, nodular goiter (NG), well-differentiated thyroid carcinoma (WDTC), and undifferentiated thyroid carcinoma (UDTC) were determined using immunohistochemical techniques. The effects of CD147 silencing on cell proliferation, invasiveness, metastasis, co-localization with MCT1, glycolysis rate and extracellular pH of thyroid cancer cells (WRO and FRO cell lines) were measured after CD147 was knocked-down using siRNA targeting CD147. Immunohistochemical analysis of thyroid carcinoma (TC) tissues revealed significant increases in signal for CD147 compared with normal tissue or NG, while UDTC expressed remarkably higher levels of CD147 compared with WDTC. Furthermore, silencing of CD147 in TC cells clearly abrogated the expression of MCT1 and its co-localization with CD147 and dramatically decreased both the glycolysis rate and extracellular pH. Thus, cell proliferation, invasiveness, and metastasis were all significantly decreased by siRNA. These results demonstrate in vitro that the expression of CD147 correlates with the degree of dedifferentiation of thyroid cancer, and show that CD147 interacts with MCT1 to regulate tumor cell glycolysis, resulting in the progression of thyroid carcinoma.

  8. Synthesis of Samarium Cobalt Nanoblades

    Energy Technology Data Exchange (ETDEWEB)

    Darren M. Steele


    As new portable particle acceleration technologies become feasible the need for small high performance permanent magnets becomes critical. With particle accelerating cavities of a few microns, the photonic crystal fiber (PCF) candidate demands magnets of comparable size. To address this need, samarium cobalt (SmCo) nanoblades were attempted to be synthesized using the polyol process. Since it is preferable to have blades of 1-2 {micro}m in length, key parameters affecting size and morphology including method of stirring, reaction temperature, reaction time and addition of hydroxide were examined. Nanoparticles consisting of 70-200 nm spherical clusters with a 3-5 nm polyvinylpyrrolidone (PVP) coating were synthesized at 285 C and found to be ferromagnetic. Nanoblades of 25nm in length were observed at the surface of the nanoclusters and appeared to suggest agglomeration was occurring even with PVP employed. Morphology and size were characterized using a transmission electron microscope (TEM). Powder X-Ray Diffraction (XRD) analysis was conducted to determine composition but no supportive evidence for any particular SmCo phase has yet been observed.

  9. Oesophageal heat exchangers with a diameter of 11mm or 14.7mm are equally effective and safe for targeted temperature management. (United States)

    Schroeder, Daniel C; Guschlbauer, Maria; Maul, Alexandra C; Cremer, Daniel A; Becker, Ingrid; de la Puente Bethencourt, David; Paal, Peter; Padosch, Stephan A; Wetsch, Wolfgang A; Annecke, Thorsten; Böttiger, Bernd W; Sterner-Kock, Anja; Herff, Holger


    Targeted temperature management (TTM) is widely used in critical care settings for conditions including hepatic encephalopathy, hypoxic ischemic encephalopathy, meningitis, myocardial infarction, paediatric cardiac arrest, spinal cord injury, traumatic brain injury, ischemic stroke and sepsis. Furthermore, TTM is a key treatment for patients after out-of-hospital cardiac-arrest (OHCA). However, the optimal cooling method, which is quick, safe and cost-effective still remains controversial. Since the oesophagus is adjacent to heart and aorta, fast heat-convection to the central blood-stream could be achieved with a minimally invasive oesophageal heat exchanger (OHE). To date, the optimal diameter of an OHE is still unknown. While larger diameters may cause thermal- or pressure-related tissue damage after long-term exposure to the oesophageal wall, smaller diameter (e.g., gastric tubes, up to 11mm) may not provide effective cooling rates. Thus, the objective of the study was to compare OHE-diameters of 11mm (OHE11) and 14.7mm (OHE14.7) and their effects on tissue and cooling capability. Pigs were randomized to OHE11 (N = 8) or OHE14.7 (N = 8). After cooling, pigs were maintained at 33°C for 1 hour. After 10h rewarming, oesophagi were analyzed by means of histopathology. The oesophagus of four animals from a separate study that underwent exactly the identical preparation and cooling protocol described above but received a maintenance period of 24h were used as histopathological controls. Mean cooling rates were 2.8±0.4°C°C/h (OHE11) and 3.0±0.3°C °C/h (OHE14.7; p = 0.20). Occasional mild acute inflammatory transepithelial infiltrates were found in the cranial segment of the oesophagus in all groups including controls. Deviations from target temperature were 0.1±0.4°C (OHE11) and 0±0.1°C (OHE14.7; p = 0.91). Rewarming rates were 0.19±0.07°C °C/h (OHE11) and 0.20±0.05°C °C/h (OHE14.7; p = 0.75). OHE with diameters of 11 mm and 14.7 mm achieve effective

  10. Oesophageal heat exchangers with a diameter of 11mm or 14.7mm are equally effective and safe for targeted temperature management.

    Directory of Open Access Journals (Sweden)

    Daniel C Schroeder

    Full Text Available Targeted temperature management (TTM is widely used in critical care settings for conditions including hepatic encephalopathy, hypoxic ischemic encephalopathy, meningitis, myocardial infarction, paediatric cardiac arrest, spinal cord injury, traumatic brain injury, ischemic stroke and sepsis. Furthermore, TTM is a key treatment for patients after out-of-hospital cardiac-arrest (OHCA. However, the optimal cooling method, which is quick, safe and cost-effective still remains controversial. Since the oesophagus is adjacent to heart and aorta, fast heat-convection to the central blood-stream could be achieved with a minimally invasive oesophageal heat exchanger (OHE. To date, the optimal diameter of an OHE is still unknown. While larger diameters may cause thermal- or pressure-related tissue damage after long-term exposure to the oesophageal wall, smaller diameter (e.g., gastric tubes, up to 11mm may not provide effective cooling rates. Thus, the objective of the study was to compare OHE-diameters of 11mm (OHE11 and 14.7mm (OHE14.7 and their effects on tissue and cooling capability.Pigs were randomized to OHE11 (N = 8 or OHE14.7 (N = 8. After cooling, pigs were maintained at 33°C for 1 hour. After 10h rewarming, oesophagi were analyzed by means of histopathology. The oesophagus of four animals from a separate study that underwent exactly the identical preparation and cooling protocol described above but received a maintenance period of 24h were used as histopathological controls.Mean cooling rates were 2.8±0.4°C°C/h (OHE11 and 3.0±0.3°C °C/h (OHE14.7; p = 0.20. Occasional mild acute inflammatory transepithelial infiltrates were found in the cranial segment of the oesophagus in all groups including controls. Deviations from target temperature were 0.1±0.4°C (OHE11 and 0±0.1°C (OHE14.7; p = 0.91. Rewarming rates were 0.19±0.07°C °C/h (OHE11 and 0.20±0.05°C °C/h (OHE14.7; p = 0.75.OHE with diameters of 11 mm and 14.7 mm achieve

  11. Synthesis of samarium binding bleomycin - a possible NCT radiosensitizer

    Energy Technology Data Exchange (ETDEWEB)

    Mendes, B.M., E-mail: bmm@cdtn.b [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Mendes, T.M.; Campos, T.P.R., E-mail: campos@nuclear.ufmg.b [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil)


    Bleomycin (BLM) is a drug that has attractive features for the development of a new radiopharmaceutical, particularly with regard to neutron capture therapy (NCT) sensitized by Sm-149. It has the ability to chelate many metal ions. In vitro studies have shown that up to 78% of BLM present in a cell is accumulated inside the nucleus or in the nuclear membrane. In addition, this drug has higher affinity for tumor tissues than for normal tissues. Radioactive isotopes carried by this antibiotic would be taken preferentially to one important cellular targets DNA. Besides, BLM displays intrinsic anti-tumor activity - it is a chemotherapic antibiotic clinically used against some cancers. This study aimed to obtain bleomycin molecules bound to samarium (BLM-Sm) for NCT studies in vitro and in vivo. The binding technique employed in this work has great simplicity and low cost. Thin layer chromatography, high performance liquid chromatography, fast protein liquid chromatography and analysis by ICP-AES were applied to verify the binding molecule. ICP-AES results showed the presence of samarium in the sample peaks related to BLM-Sm. However, efficiency and stability of this bond needs to be investigated. (author)

  12. Particle-Size-Induced Valence Changes in Samarium Clusters

    Energy Technology Data Exchange (ETDEWEB)

    Mason, M. G.; Lee, S. -T.; Apai, G.; Davis, R. F.; Shirley, D. A.; Franciosi, A.; Weaver, J. H.


    Samarium clusters exhibit mixed-valence behavior which is sensitive to particle size. XPS and UPS data show samarium to be primarily divalent (4f{sup 6} ) at small particle size. The trivalent state (4f{sup 5} ) becomes progressively more abundant with increasing s1ze, becoming the dominant state for the bulk metal. These results are interpreted using a model in which band narrowing, due to reduced surface coordination, is more dominant than surface tension effects in establishing the valence of small samarium clusters.

  13. Yellow-green electroluminescence of samarium complexes of 8-hydroxyquinoline

    Energy Technology Data Exchange (ETDEWEB)

    Behzad, Sara Karimi; Najafi, Ezzatollah [Department of Chemistry Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Amini, Mostafa M., E-mail: [Department of Chemistry Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Janghouri, Mohammad; Mohajerani, Ezeddin [Laser Research Institute Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Ng, Seik Weng [Department of Chemistry, University of Malaya, 50603 Kuala Lumpur (Malaysia)


    Four novel samarium complexes were prepared by reacting samarium(III) nitrate with 8-hydroxyquinoline, 2-methyl-8-hydroxyquinoline, and 1,10-phenanthroline and utilized as emitting materials in the electroluminescence device. All complexes were characterized by elemental analysis, infrared, UV–vis and {sup 1}H NMR spectroscopes and the molecular structure of a representative complex, [Sm{sub 2}(Me-HQ){sub 4}(NO{sub 3}){sub 6}] (1), was determined by single-crystal X-ray diffraction. Utilization of a π-conjugated (phenanthroline) ligand as a second ligand in the structure of the samarium complexes resulted in red shifts in both absorption and fluorescence spectra of complexes and moderately enhanced the photoluminescence intensity and the fluorescence quantum yield. The maximum emission peaks showed that a good correlation exists between the nature of the substituent group on the 8-hydroxyquinoline and the addition of the π-conjugated ligand in the structure of samarium complexes and emission wavelength. Devices with samarium(III) complexes with structure of ITO/PEDOT:PSS (90 nm)/PVK:PBD:Sm(III) complexes (75 nm)/Al (180 nm) were fabricated. In the electroluminescence (EL) spectra of the devices, a strong ligand-centered emission and narrow bands arising from the {sup 4}G{sub 5/2}→{sup 6}H{sub J} transitions (J=7/2, 9/2, and 11/2) of the samarium ion were observed for the complexes. The electroluminescent spectra of the samarium complexes were red-shifted as compared with the PVK:PBD blend. We believe that the electroluminescence performance of OLED devices based on samarium complexes relies on overlaps between the absorption of the samarium compounds and the emission of PVK:PBD. This revealed that it is possible to evaluate the electroluminescence performance of the samarium compounds-doped OLED devices based on the emission of PVK:PBD and the absorption of the dopants. - Highlights: • Four novel photoluminescence samarium complexes have been synthesized.

  14. Optical characteristics of transparent samarium oxide thin films ...

    Indian Academy of Sciences (India)

    Optical characteristics of transparent samarium oxide thin films deposited by the radio-frequency sputtering technique. A A ATTA M M EL-NAHASS KHALED M ELSABAWY M M ABD EL-RAHEEM A M HASSANIEN A ALHUTHALI ALI BADAWI AMAR MERAZGA. Regular Volume 87 Issue 5 November 2016 Article ID 72 ...

  15. Optical properties of zinc–vanadium glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Zinc–vanadium glasses doped with samarium oxide having the chemical composition Sm2O3() ZnO(40-)V2O5(60) (where = 0.1–0.5 mol%) were prepared by melt quenching method. The density of these glasses was measured by Archimedes method; the corresponding molar volumes have also been calculated.

  16. Optical properties of samarium doped zinc–tellurite glasses

    Indian Academy of Sciences (India)


    Optical properties of samarium doped zinc–tellurite glasses. B ERAIAH. Department of Physics, Karnatak University, Dharwad 580 003, India. Present address: Department of Physics, Bangalore University, Bangalore 560 056, India. MS received 20 March 2006; revised 13 June 2006. Abstract. Glasses with the composition, ...

  17. Effect of second ligand on the luminescence of Samarium (III ...

    Indian Academy of Sciences (India)

    Effect of second ligand on the luminescence of Samarium (III) dibenzoylmethane complexes: Syntheses, crystal structures, thermal analysis and luminescence study. MUHAMMAD IDIRIS SALEH, MIN YEE CHOO, TAI WEI CHAN and MOHD R RAZALI. ∗. School of Chemical Sciences, Universiti Sains Malaysia, Penang, ...

  18. Effect of second ligand on the luminescence of Samarium (III ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences; Volume 127; Issue 12. Effect of second ligand on the luminescence of Samarium (III) dibenzoylmethane complexes: ... Muhammad Idiris Saleh1 Min Yee Choo1 Tai Wei Chan1 Mohd R Razali1. School of Chemical Sciences, Universiti Sains Malaysia, Penang, Malaysia ...

  19. Dependence of samarium-soil interaction on samarium concentration: Implications for environmental risk assessment. (United States)

    Ramírez-Guinart, Oriol; Salaberria, Aitor; Vidal, Miquel; Rigol, Anna


    The sorption and desorption behaviour of samarium (Sm), an emerging contaminant, was examined in soil samples at varying Sm concentrations. The obtained sorption and desorption parameters revealed that soil possessed a high Sm retention capacity (sorption was higher than 99% and desorption lower than 2%) at low Sm concentrations, whereas at high Sm concentrations, the sorption-desorption behaviour varied among the soil samples tested. The fractionation of the Sm sorbed in soils, obtained by sequential extractions, allowed to suggest the soil properties (pH and organic matter solubility) and phases (organic matter, carbonates and clay minerals) governing the Sm-soil interaction. The sorption models constructed in the present work along with the sorption behaviour of Sm explained in terms of soil main characteristics will allow properly assessing the Sm-soil interaction depending on the contamination scenario under study. Moreover, the sorption and desorption K d values of radiosamarium in soils were strongly correlated with those of stable Sm at low concentrations (r = 0.98); indicating that the mobility of Sm radioisotopes and, thus, the risk of radioactive Sm contamination can be predicted using data from low concentrations of stable Sm. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Mechanism of the electrochemical deposition of samarium-based coatings

    Energy Technology Data Exchange (ETDEWEB)

    Ruiz, Edgar J. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Ortega-Borges, Raul [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Godinez, Luis A. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Chapman, Thomas W. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Meas-Vong, Yunny [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico)]. E-mail:


    Samarium-based films have been shown to form from aqueous solutions on the surfaces of metallic substrates such as steel or aluminum, and their presence has been reported to decrease substantially the corresponding corrosion rate of the underlying metallic substrate. Based on previous reports on the deposition of oxides or hydroxides of the closely related element cerium, this work demonstrates that samarium films are formed following a similar mechanism, which involves as the fundamental step an increase in interfacial pH resulting from cathodic oxygen-reduction or hydrogen-evolution reactions. With cyclic voltammetry (CV), electrochemical quartz-crystal microbalance (EQCM) measurements, rotating-disk electrode (RDE) tests, and surface characterization techniques, namely, scanning electron microscopy (SEM) and X-ray surface microanalysis (EDX), the postulated mechanism was verified, and the surface morphology of the resulting films was correlated with the nature of the reduction reaction that triggers film formation.

  1. Samarium Monosulfide (SmS): Reviewing Properties and Applications


    Sousanis, Andreas; Smet, Philippe; Poelman, Dirk


    In this review, we give an overview of the properties and applications of samarium monosulfide, SmS, which has gained considerable interest as a switchable material. It shows a pressure-induced phase transition from the semiconducting to the metallic state by polishing, and it switches back to the semiconducting state by heating. The material also shows a magnetic transition, from the paramagnetic state to an antiferromagnetically ordered state. The switching behavior between the semiconducti...

  2. Optical properties of zinc–vanadium glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Abstract. Zinc–vanadium glasses doped with samarium oxide having the chemical composition Sm2O3(x). ZnO(40−x)V2O5(60)(where x = 0·1–0·5 mol%) were prepared by melt quenching method. The density of these glasses was measured by Archimedes method; the corresponding molar volumes have also been ...

  3. Synthesis of nano-pore samarium (III)-imprinted polymer for preconcentrative separation of samarium ions from other lanthanide ions via solid phase extraction

    Energy Technology Data Exchange (ETDEWEB)

    Shirvani-Arani, Simindokht [Center of Excellence in Electrochemistry, Department of Chemistry, University of Tehran, P.O.Box:14155-6455, Tehran (Iran, Islamic Republic of); Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of); Ahmadi, Seyed Javad [Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of)], E-mail:; Bahrami-Samani, Ali [Nuclear Engineering and Physics Department, Amir Kabir University, P.O.Box: 15875-4413, Tehran (Iran, Islamic Republic of); Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of); Ghannadi-Maragheh, Mohammad [Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of)


    A batch process was developed to separate samarium ions from some lanthanide ions by a novel solid phase which was prepared via the ion-imprinting technique. The samarium (III) ion-imprinted polymer (IIP) particles were synthesized by preparing the ternary complex of samarium ions with 5,7-dichloroquinoline-8-ol (DCQ) and 4-vinylpyridine (VP). Then, thermally copolymerization with styrene (functional monomer, STY) and divinylbenzene (cross-linking monomer, DVB) followed in the presence of 2-methoxy ethanol (porogen) and 2,2'-azobisisobutyronitrile (initiator, AIBN). The imprinted ion was removed by stirring the above particles with 50% (v/v) HCl to obtain the leached IIP particles. Moreover, control polymer (CP) particles were similarly prepared without the samarium ions. The unleached and leached IIP particles were characterized by X-ray diffraction (XRD), infra-red spectroscopy (IR), thermo gravimetric analysis (TGA) and scanning electron microscopy (SEM). Finally, preconcentration and selectivity studies for samarium and the other lanthanide ions were carried out. The preconcentration of the samarium (III) traces was studied during rebinding with the leached IIP particles as a function of pH, the weight of the polymer material, the preconcentration and the elution times, the eluent volume and the aqueous phase volume. These studies indicated that the samarium (III) amount as low as 1 {mu}g, present in 200 mL, could be preconcentrated into 25 mL of 1.0 M HCl.

  4. Ionization of Samarium by Chemical Releases in the Upper Atmosphere (United States)

    Siefring, C. L.; Bernhardt, P. A.; Holmes, J. M.; Pedersen, T. R.; Caton, R.; Miller, D.; Groves, K. M.


    The release of Samarium vapor into the upper atmosphere was studied using during the Air Force Research Laboratory sponsored Metal Oxide Space Cloud (MOSC) rocket launches in May 2009. The Naval Research Laboratory supported these experiments with 3-D photochemical modeling of the artificial plasma cloud including (1) reactions with atomic oxygen, (2) photo excitation, (3) photoionization, (4) dissociative recombination, and (5) ion and neutral diffusion. NRL provided the experimental diagnostic instrument on the rocket which was a dual frequency radio beacon on the rocket to measure changes in total electron content. The AFRL provided ground based diagnostics of incoherent scatter radar and optical spectroscopy and imagery. The NRL Chemical Release Model (CRM) has over 600 excited states of atomic Samarium neutrals, atomic ions, along with Samarium Oxide Ions and electrons. Diffusive transport of neutrals in cylindrical geometry and ions along magnetic field lines is computed along with the reactive flow to predict the concentrations of Sm, Sm-Ion, Sm0, and SmO Ion. Comparison of the CRM with observations demonstrates that Sm release into the upper atmosphere initially produces enhanced electron densities and SmO-Ions. The diatomic ions recombine with electrons to yield neutral Sm and O. Only the photo ionization of Sm yields a stable atomic ion that does not substantially recombine. The MOSC releases in sunlight yielded long duration ion clouds that can be replicated with the CRM. The CRM predicts that Sm releases in darkness would not produce long duration plasma clouds because of the lack of photo excitation and photoionization.

  5. Reactive Materials for Evaporating Samarium (Pre-Print) (United States)


    SUBJECT TERMS energetic materials, heat sources, pyrotechnic charges, easily ionized metals 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF...experiments.    Keywords:  energetic  materials, heat sources, pyrotechnic charges, easily ionized metals  1. Introduction Ejection of clouds of...results  were  negatively  affected  by  reduced  efficiency   of  release  and  ionization of samarium [8]. It is possible that not the entire charge of

  6. Implementation of an analytical technique for Samarium; Implementacion de una tecnica analitica para Samario

    Energy Technology Data Exchange (ETDEWEB)

    Garcia G, N. [ININ, Carretera Mexico-Toluca Km. 36.5, 52045 Estado de Mexico (Mexico)


    Since the Samarium presents the same chemical properties that the plutonium, it has been used as homologous in studies that allow us to know the behavior that the plutonium presents in solution, with the advantage of working with an inactive and not very dangerous element. At the moment studies of sorption of plutonium or samarium are made on some mineral matrices that present certain surface properties. Due to the low concentrations that are used in the studies of sorption of samarium on those reagent substrates, their detection becomes very difficult for the conventional analysis media. The luminescence is a technique that can detect lower concentrations, smaller at 1 X 10{sup -} {sup 2} M, but when fluorofors are used this limit of detection increases in several orders of magnitude. In this work it has been used the arsenazo-III as fluorofor agent since it reacts in a specific way with the samarium, forming a complex that presents a proportional luminescence to the concentration of the present samarium. The advantage of making the quantification of samarium by luminescence is that it can use the same instrumental equipment to determine the speciation of the samarium sipped in the zircon. (Author)

  7. Luminescent solutions and powders of new samarium complexes with N,N',O,O'-chelating ligands (United States)

    Kharcheva, Anastasia V.; Nikolskiy, Kirill S.; Borisova, Nataliya E.; Ivanov, Alexey V.; Reshetova, Marina D.; Yuzhakov, Viktor I.; Patsaeva, Svetlana V.


    Imaging techniques in biology and medicine are crucial tools to obtain information on structural and functional properties of living cells and organisms. To fulfill the requirements associated with application of these techniques it appears necessary to design markers with specific characteristics. Luminescent complexes of trivalent lanthanide ions with chelating ligands are of increasing importance in biomedical applications because of their millisecond luminescence lifetime, narrow emission band, high signal-to-noise ratio and minimal photodamage to biological samples. In order to extend the available emission wavelength range the luminescent samarium chelates are highly desirable. In this study the ligands with diamides of 2,2'-bipyridin-6,6'-dicarboxylic acid were used to improve photophysical characteristics of samarium complexes. We report the luminescence characteristics of samarium complexes with novel ligands. All complexes exhibited the characteristic emission of Sm (III) ion with the lines at 565, 597, 605, 645 and 654 nm, the intensity strongly depended on the ligand. Absorption and luminescence excitation spectra of Sm (III) complexes showed main peaks in the UV range demonstrating lanthanide coordination to the ligand. The absolute lumenescence quantum yield was measured for solutions in acetonitrile with excitation at 350 nm. The largest luminescence quantum yield was found for the samarium complex Bipy 6MePy Sm (3%) being much higher that for samarium complexes reported in the literature earlier. These results prove as well that samarium chelates are potential markers for multiparametric imaging techniques.

  8. Australian manufacture of Quadramet{sup TM} (Samarium-153 EDTMP)

    Energy Technology Data Exchange (ETDEWEB)

    Wood, N.R.; Whitwell, J. [Australian Nuclear Science and Technology Organisation (ANSTO), Lucas Heights, NSW (Australia). Australian Radioisotopes


    Quadramet{sup T} (Samarium-153 EDTMP) has been shown overseas to be potentially useful in the palliation of painful osteoblastic skeletal metastases and has been approved this year for general marketing in the USA. Australian Radioisotopes (ARI) has licensed this product from the Australian patent holders, Dow Chemical. Within the facilities of ARI, a hot cell has been dedicated to this product and fitted out to manufacture it weekly on a cycle related to the operating cycle of the Australian reactor HIFAR. Due to neutron flux limitations of HIFAR, the local formulation has an elemental Samarium content up to 200{mu}g/mL whereas the overseas formulation has a level of 20-46{mu}g/mL. All other specifications of the two products are essentially the same. In 1995 and 1996 a small clinical trial with 19 patients was held which demonstrated that the pharmacokinetic behaviour was also essentially the same by measuring blood clearance rates and skeletal uptake dynamics. Soft tissue uptake was also qualitatively determined. The ARI version is now the subject of an application for general marketing within Australia. Some useful characteristics of this agent are: almost complete excretion or fixation in the skeleton within 6 hours, rapid onset of clinical effect, applicability in most cases where an abnormal diagnostic bone scan correlates with painful sites, dosage can be tailored to individual patient uptake due to easy dose measurement and retreatment is quite possible. The use of this class of agents in pain palliation continues to increase. Australian manufacture of Quadramet{sup TM} provides a further option in the management of these difficult cases

  9. Electrochemical extraction of samarium from molten chlorides in pyrochemical processes

    Energy Technology Data Exchange (ETDEWEB)

    Castrillejo, Y., E-mail: [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Fernandez, P. [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Medina, J. [Dept Fisica Materia Condensada Cristalografia y Mineralogia, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Hernandez, P. [Centro de Investigaciones Quimicas, Universidad Autonoma del Estado de Hidalgo, Carr. Pachuca-Tulancingo Km. 4.5, C.P. 42076 Pachuca, Hidalgo (Mexico); Barrado, E. [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain)


    This work concerns the electrochemical extraction of samarium from molten chlorides. In this way, the electrochemical behaviour of samarium ions has been investigated in the eutectic LiCl-KCl at the surface of tungsten, aluminium and aluminium coated tungsten electrodes. On a W inert electrode the electro-reduction of Sm(III) takes place in only one soluble-soluble electrochemical step Sm(III)/Sm(II). The electrochemical system Sm(II)/Sm(0) has not been observed within the electrochemical window, because of the prior reduction of Li(I) ions from the solvent, which inhibits the electro-extraction of Sm species from the salt on such a substrate. Sm metal in contact with the melt react to give Li(0) according to the reaction: Sm(0) + 2Li(I) {r_reversible} Sm(II) + 2Li(0). On the contrary, on reactive Al electrodes the electrochemical system Sm(II)/Sm(0) was observed within the electroactive range. The potential shift of the redox couple is caused by the decrease of Sm activity in the metal phase due to the formation of Sm-Al alloys at the interface. The formation mechanism of the intermetallic compounds was studied in a melt containing: (i) both Sm(III) and Al(III) ions, using W and Al coated tungsten electrodes, and (ii) Sm(III) ions using an Al electrode. Analysis of the samples after potentiostatic electrolysis by X-ray diffraction and scanning electron microscopy (SEM) with energy dispersive X-ray spectroscopy (EDS), allowed the identification of Al{sub 3}Sm and Al{sub 2}Sm.

  10. SU-E-T-147: Beam Specific Planning Target Volumes Incorporating 4DCT for Pencil Beam Scanning Proton Therapy of Thoracic Tumors

    Energy Technology Data Exchange (ETDEWEB)

    Lin, L; Kang, M; Huang, S; McDonough, J; Solberg, T; Simone, C [University of Pennsylvania, Philadelphia, PA (United States); Mayer, R [Henry Jackson Foundation, Bethesda, MD (United States); Thomas, A [ATC healthcare, Bethesda, MD (United States)


    Purpose: The purpose of this study is to determine whether organ sparing and target coverage can be simultaneously maintained for pencil beam scanning (PBS) proton therapy treatment of thoracic tumors in the presence of motion, stopping power uncertainties and patient setup variations. Methods: Ten consecutive patients that were previously treated with proton therapy to 66.6/1.8 Gy (RBE) using double scattering (DS) were replanned with PBS. Minimum and maximum intensity images from 4DCT were used to introduce flexible smearing in the determination of the beam specific PTV (BSPTV). Datasets from eight 4DCT phases, using ±3% uncertainty in stopping power, and ±3 mm uncertainty in patient setup in each direction were used to create 8*12*10=960 PBS plans for the evaluation of ten patients. Plans were normalized to provide identical coverage between DS and PBS. Results: The average lung V20, V5, and mean doses were reduced from 29.0%, 35.0%, and 16.4 Gy with DS to 24.6%, 30.6%, and 14.1 Gy with PBS, respectively. The average heart V30 and V45 were reduced from 10.4% and 7.5% in DS to 8.1% and 5.4% for PBS, respectively. Furthermore, the maximum spinal cord, esophagus and heart dose were decreased from 37.1 Gy, 71.7 Gy and 69.2 Gy with DS to 31.3 Gy, 67.9 Gy and 64.6 Gy with PBS. The conformity index (CI), homogeneity index (HI), and global maximal dose were improved from 3.2, 0.08, 77.4 Gy with DS to 2.8, 0.04 and 72.1 Gy with PBS. All differences are statistically significant, with p values <0.05, with the exception of the heart V45 (p= 0.146). Conclusion: PBS with BSPTV achieves better organ sparing and improves target coverage using a repainting method for the treatment of thoracic tumors. Incorporating motion-related uncertainties is essential This work was supported by the US Army Medical Research and Materiel Command under Contract Agreement No. DAMD17-W81XWH-07-2-0121 and W81XWH-09-2-0174.

  11. Optical analysis of samarium doped sodium bismuth silicate glass. (United States)

    Thomas, V; Sofin, R G S; Allen, M; Thomas, H; Biju, P R; Jose, G; Unnikrishnan, N V


    Samarium doped sodium bismuth silicate glass was synthesized using the melt quenching method. Detailed optical spectroscopic studies of the glassy material were carried out in the UV-Vis-NIR spectral range. Using the optical absorption spectra Judd-Ofelt (JO) parameters are derived. The calculated values of the JO parameters are utilized in evaluating the various radiative parameters such as electric dipole line strengths (Sed), radiative transition probabilities (Arad), radiative lifetimes (τrad), fluorescence branching ratios (β) and the integrated absorption cross- sections (σa) for stimulated emission from various excited states of Sm3+‡ ion. The principal fluorescence transitions are identified by recording the fluorescence spectrum. Our analysis revealed that the novel glassy system has the optimum values for the key parameters viz. spectroscopic quality factor, optical gain, stimulated emission cross section and quantum efficiency, which are required for a high performance optical amplifier. Calculated chromaticity co-ordinates (0.61, 0.38) also confirm its application potential in display devices. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Samarium Monosulfide (SmS): Reviewing Properties and Applications. (United States)

    Sousanis, Andreas; Smet, Philippe F; Poelman, Dirk


    In this review, we give an overview of the properties and applications of samarium monosulfide, SmS, which has gained considerable interest as a switchable material. It shows a pressure-induced phase transition from the semiconducting to the metallic state by polishing, and it switches back to the semiconducting state by heating. The material also shows a magnetic transition, from the paramagnetic state to an antiferromagnetically ordered state. The switching behavior between the semiconducting and metallic states could be exploited in several applications, such as high density optical storage and memory materials, thermovoltaic devices, infrared sensors and more. We discuss the electronic, optical and magnetic properties of SmS, its switching behavior, as well as the thin film deposition techniques which have been used, such as e-beam evaporation and sputtering. Moreover, applications and possible ideas for future work on this material are presented. Our scope is to present the properties of SmS, which were mainly measured in bulk crystals, while at the same time we describe the possible deposition methods that will push the study of SmS to nanoscale dimensions, opening an intriguing range of applications for low-dimensional, pressure-induced semiconductor-metal transition compounds.

  13. Excitation induced spectroscopic study and quenching effect in cerium samarium codoped lithium aluminoborate glasses

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, Parvinder; Kaur, Simranpreet [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Singh, Gurinder Pal [Department of Physics, Khalsa College, Amritsar 143002 (India); Arora, Deepawali; Kumar, Sunil [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Singh, D.P., E-mail: [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India)


    Lithium aluminium borate host has been codoped with cerium and samarium to prepare glass by conventional melt quench technique. Their structural and spectroscopic investigation has been carried out using XRD, FTIR and density measurements. The UV‐Vis absorption spectra and fluorescence spectra (λ{sub exc}.=380 nm and 400 nm) have been studied for spectroscopic analysis. The amorphous nature of the prepared samples is shown by XRD. The density is increasing with addition of cerium at the expense of aluminium, keeping other components constant. FTIR study also shows the presence of compact and stable tetrahedral BO{sub 4} units thus supporting the density results. The UV‐ Vis absorption spectra show a shift of optical absorption edge towards longer wavelength along with an increase in intensity of peaks with rising samarium concentration. The fluorescence spectra show a blue shift and subsequent suppression of cerium peaks with addition of samarium.

  14. Effect of samarium doping on the dielectric behavior of barium zircomium titanate ceramic

    Energy Technology Data Exchange (ETDEWEB)

    Badapanda, T., E-mail: [Department of Physics, C.V. Raman College of Engineering, Bhubaneswar, Odisha-752054 (India); Sarangi, S.; Behera, B. [School of Physics, Sambalpur University, Jyoti Vihar Sambalpur, Odisha-768019 (India); Anwar, S. [Colloids and Materials Chemistry, Institute of Minerals and Materials Technology, Bhubaneswar, Odisha-751013 (India); Sinha, T. P. [Department of Physics, Bose Institute, Kolkata-700009 (India)


    Samarium doped Barium Zirconium Titanate ceramic with general formula Ba{sub 1−x}Sm{sub 2x/3}Zr{sub 0.05}Ti{sub 0.95}O{sub 3} [x=0.0,0.01,0.02,0.03,0.04] has been prepared by high energy ball milling. The X-ray diffraction (XRD) patterns confirmed that these ceramics have a single phase with perovskite-type upto x≤0.03 and a small secondary phase exist at x=0.04. The temperature dependent dielectric study shows a ferroelectric phase transition and transition temperature decreases with an increase in the Samarium content.

  15. Lithium Bromide/Water as Additives in Dearomatizing Samarium-Ketyl (Hetero)Arene Cyclizations. (United States)

    Rao, Chintada Nageswara; Bentz, Christoph; Reissig, Hans-Ulrich


    New conditions for dearomatizing samarium-ketyl (hetero)arene cyclizations are reported. In many examples of these samarium diiodide-mediated reactions, lithium bromide and water can be used as additives instead of the carcinogenic and mutagenic hexamethylphosphoramide (HMPA). The best results were obtained for the cyclizations of N-acylated indole derivatives delivering the expected indolines in good yields and excellent diastereoselectivities. A new type of cyclization delivering indolyl-substituted allene derivatives is also described. The scope and limitations of the lithium bromide/water system are discussed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Mandiwana, Vusani, E-mail:; Kalombo, Lonji, E-mail: [Centre of Polymers and Composites, CSIR (South Africa); Venter, Kobus, E-mail: [South African Medical Research Council (South Africa); Sathekge, Mike, E-mail: [University of Pretoria and Steve Biko Academic Hospital, Department of Nuclear Medicine (South Africa); Grobler, Anne, E-mail:; Zeevaart, Jan Rijn, E-mail: [North-West University, DST/NWU Preclinical Drug Development Platform (South Africa)


    Developing nanoparticulate delivery systems that will allow easy movement and localization of a drug to the target tissue and provide more controlled release of the drug in vivo is a challenge in nanomedicine. The aim of this study was to evaluate the biodistribution of poly(d,l-lactide-co-glycolide) (PLGA) nanoparticles containing samarium-153 oxide ([{sup 153}Sm]Sm{sub 2}O{sub 3}) in vivo to prove that orally administered nanoparticles alter the biodistribution of a drug. These were then activated in a nuclear reactor to produce radioactive {sup 153}Sm-loaded-PLGA nanoparticles. The nanoparticles were characterized for size, zeta potential, and morphology. The nanoparticles were orally and intravenously (IV) administered to rats in order to trace their uptake through imaging and biodistribution studies. The {sup 153}Sm-loaded-PLGA nanoparticles had an average size of 281 ± 6.3 nm and a PDI average of 0.22. The zeta potential ranged between 5 and 20 mV. The [{sup 153}Sm]Sm{sub 2}O{sub 3} loaded PLGA nanoparticles, orally administered were distributed to most organs at low levels, indicating that there was absorption of nanoparticles. While the IV injected [{sup 153}Sm]Sm{sub 2}O{sub 3}-loaded PLGA nanoparticles exhibited the highest localization of nanoparticles in the spleen (8.63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems would be suitable for improving permeability and thus the bioavailability of therapeutic compounds.

  17. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles (United States)

    Mandiwana, Vusani; Kalombo, Lonji; Venter, Kobus; Sathekge, Mike; Grobler, Anne; Zeevaart, Jan Rijn


    Developing nanoparticulate delivery systems that will allow easy movement and localization of a drug to the target tissue and provide more controlled release of the drug in vivo is a challenge in nanomedicine. The aim of this study was to evaluate the biodistribution of poly( d, l-lactide- co-glycolide) (PLGA) nanoparticles containing samarium-153 oxide ([153Sm]Sm2O3) in vivo to prove that orally administered nanoparticles alter the biodistribution of a drug. These were then activated in a nuclear reactor to produce radioactive 153Sm-loaded-PLGA nanoparticles. The nanoparticles were characterized for size, zeta potential, and morphology. The nanoparticles were orally and intravenously (IV) administered to rats in order to trace their uptake through imaging and biodistribution studies. The 153Sm-loaded-PLGA nanoparticles had an average size of 281 ± 6.3 nm and a PDI average of 0.22. The zeta potential ranged between 5 and 20 mV. The [153Sm]Sm2O3 loaded PLGA nanoparticles, orally administered were distributed to most organs at low levels, indicating that there was absorption of nanoparticles. While the IV injected [153Sm]Sm2O3-loaded PLGA nanoparticles exhibited the highest localization of nanoparticles in the spleen (8.63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems would be suitable for improving permeability and thus the bioavailability of therapeutic compounds.

  18. Importance of N-Glycosylation on CD147 for Its Biological Functions

    Directory of Open Access Journals (Sweden)

    Yang Bai


    Full Text Available Glycosylation of glycoproteins is one of many molecular changes that accompany malignant transformation. Post-translational modifications of proteins are closely associated with the adhesion, invasion, and metastasis of tumor cells. CD147, a tumor-associated antigen that is highly expressed on the cell surface of various tumors, is a potential target for cancer diagnosis and therapy. A significant biochemical property of CD147 is its high level of glycosylation. Studies on the structure and function of CD147 glycosylation provide valuable clues to the development of targeted therapies for cancer. Here, we review current understanding of the glycosylation characteristics of CD147 and the glycosyltransferases involved in the biosynthesis of CD147 N-glycans. Finally, we discuss proteins regulating CD147 glycosylation and the biological functions of CD147 glycosylation.

  19. One-step synthesis of samarium-doped ceria and its CO catalysis

    Indian Academy of Sciences (India)

    The samarium-doped ceria (SDC) nanospheres were prepared by the one-step hydrothermal method and characterized by transmission electron microscope, scanning electron microscope, powder X-ray diffraction, X-ray photoelectron spectroscopy, energy-dispersive spectrometer and Raman spectra. According to the ...

  20. A spectroscopic comparison of samarium-doped LiYF4 and KY3F10

    NARCIS (Netherlands)

    Wells, J. P. R.; Sugiyama, A.; Han, T. P. J.; Gallagher, H. G.


    Laser selective excitation and fluorescence has been performed on LiYF4 and KY3F10 doped with samarium ions. In LiYF4, a single, tetragonal symmetry center associated with isovalent substitution of Sm3+ with lattice yttrium ions is present. By contrast, three Sm2+ centres and a single, tetragonal

  1. The Use of a Flexible Calix[4]arene Template to Stabilize a Cyclooctatetraindiyl Samarium-Potassium Complex

    Directory of Open Access Journals (Sweden)

    Geoffroy Guillemot


    Full Text Available A sandwich compound of cyclooctatetraendiyl (COT2− samarium-potassium was synthesized and analyzed using a flexible calix[4]arene dianion. This compound, [p-tBu-calix[4]-(OMe2(O2]arenediyl-samarium-(η8-cyclooctatetraendiyl-potassium (tetrahydrofurane3, is constructed as a linear sequence L-Sm--K-, where L, , and are specific ligands with L = O,O-dimethyl-calix[4]arene2−, = cyclo-octatetraendiyl, and = tetrahydrofurane templates.

  2. Solar nebula heterogeneity in p-process samarium and neodymium isotopes. (United States)

    Andreasen, Rasmus; Sharma, Mukul


    Bulk carbonaceous chondrites display a deficit of approximately 100 parts per million (ppm) in 144Sm with respect to other meteorites and terrestrial standards, leading to a decrease in their 142Nd/144Nd ratios by approximately 11 ppm. The data require that samarium and neodymium isotopes produced by the p process associated with photodisintegration reactions in supernovae were heterogeneously distributed in the solar nebula. Other samarium and neodymium isotopes produced by rapid neutron capture (r process) in supernovae and by slow neutron capture (s process) in red giants were homogeneously distributed. The supernovae sources supplying the p- and r-process nuclides to the solar nebula were thus disconnected or only weakly connected.

  3. Samarium(II) iodide-mediated reductive annulations of ketones bearing a distal vinyl epoxide moiety

    Energy Technology Data Exchange (ETDEWEB)

    Molander, G.A.; Shakya, S.R. [Univ. of Colorado, Boulder, CO (United States)


    It was found that samarium (II) iodide promotes the intramolecular coupling of ketones with distal epoxy olefins while in the presence of hexamethylphosphoramide (HPMA). A number of epoxide compounds (1 a-k) fragment to form carbocycles with allylic alcohol side chains with high diastereoselectivity (2 a-k). Substituting tetramethylguanidine for HPMA reduces the diastereoselectivity. Adding Pd(0) as a catalyst reverses the diastereoselective sense. 40 refs., 1 tab.

  4. A temporal three-dimensional simulation of samarium release in the ionosphere (United States)

    Zhao, Hai-Sheng; Feng, Jie; Xu, Zheng-Wen; Wu, Jian; Wu, Zhen-Sen; Xu, Bin; Xue, Kun; Xu, Tong; Hu, Yan-Li


    For understanding plasma processes of the ionosphere and magnetosphere, the alkali and alkaline-earth metals are usually released in space for artificially increasing the electron density. However, it is a limitation that these releases must be in sunlight where the photoionization can take place. In recent years, the lanthanide metals, such as samarium, have been released to produce electrons in reaction with atomic oxygen in the upper space. The reaction could proceed without sunlight so that the restriction on experimental periods is broken. Unfortunately, any sophisticated models even preliminary ones are unavailable yet in the literature. A temporal three-dimensional model is presented for the samarium release in detail with respect to various altitudes and mass. Especially, the plasma diffusion equation is remarkably extended from 2-D to 3-D by importing the influence of geomagnetic declination, which could be also useful for other chemical releases. The field-aligned terms are brought so as to the presented model can describe the diffusion along the geomagnetic field subtly. On the basis of the presented model, behaviors of radio waves propagating through the release area are simulated by using ray tracing. This model could be as the theoretical support for samarium releases, and it also helpful for the research on the generation and evolution of the ionosphere irregularities.

  5. Liquid–liquid anion exchange extraction studies of samarium(III from salicylate media using high molecular weight amine

    Directory of Open Access Journals (Sweden)

    Aniruddha M. Mandhare


    Full Text Available Liquid–liquid extraction and separation of samarium(III were carried out by using 0.025 mol dm−3 2-octylaminopyridine(2-OAP in xylene at 298 K. The extraction behavior of samarium was studied as a function of pH, weak acid concentration, extractant concentration, diluent, and equilibration time. Samarium was quantitatively extracted at pH 7.5 to 10.0 from 0.01 mol dm−3 sodium salicylate solution with 0.025 mol dm−3 2-OAP. The possible composition of the extracted species in organic phase has been determined by using model of slope analysis method and extraction mechanism was found to proceed via an anion exchange mechanism. The stripping efficiency was found to be quantitative in HNO3, HCl and CH3COOH. The robustness of the procedure was demonstrated by the average recoveries obtained (>99.6% for samarium(III extraction in the presence of several cations and anions which are commonly associated with it. The proposed method facilitates the separation and determination of samarium(III from binary and synthetic mixtures. The various thermodynamic functions like free energy (ΔG, enthalpy (ΔH and entropy (ΔS of extraction mechanism were discussed.

  6. 46 CFR 147.70 - Acetylene. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Acetylene. 147.70 Section 147.70 Shipping COAST GUARD... Special Requirements for Particular Materials § 147.70 Acetylene. (a) Seventeen cubic meters (600 standard cubic feet) or less of acetylene may be stowed on or below decks on any vessel. (b) More than 17 m3 (600...

  7. 7 CFR 1703.147 - Appeals. (United States)


    ... 7 Agriculture 11 2010-01-01 2010-01-01 false Appeals. 1703.147 Section 1703.147 Agriculture Regulations of the Department of Agriculture (Continued) RURAL UTILITIES SERVICE, DEPARTMENT OF AGRICULTURE RURAL DEVELOPMENT Distance Learning and Telemedicine Loan Program § 1703.147 Appeals. Any appeal must be...

  8. 46 CFR 147.100 - Radioactive materials. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Radioactive materials. 147.100 Section 147.100 Shipping... Stowage and Other Special Requirements for Particular Materials § 147.100 Radioactive materials. (a) Radioactive materials must not be brought on board, used in any manner, or stored on the vessel, unless the...

  9. 13 CFR 147.670 - Suspension. (United States)


    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Suspension. 147.670 Section 147...-FREE WORKPLACE (NONPROCUREMENT) Definitions § 147.670 Suspension. Suspension means an action taken by a..., subpart 9.4) and the common rule, Government-wide Debarment and Suspension (Nonprocurement), that...

  10. 9 CFR 147.21 - Flock sanitation. (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Flock sanitation. 147.21 Section 147... LIVESTOCK IMPROVEMENT AUXILIARY PROVISIONS ON NATIONAL POULTRY IMPROVEMENT PLAN Sanitation Procedures § 147.21 Flock sanitation. To aid in the maintenance of healthy flocks, the following procedures should be...

  11. 32 CFR 147.18 - Introduction. (United States)


    ... 32 National Defense 1 2010-07-01 2010-07-01 false Introduction. 147.18 Section 147.18 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE PERSONNEL, MILITARY AND CIVILIAN... Standards § 147.18 Introduction. The following investigative standards are established for all United States...

  12. 32 CFR 147.28 - Introduction. (United States)


    ... 32 National Defense 1 2010-07-01 2010-07-01 false Introduction. 147.28 Section 147.28 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE PERSONNEL, MILITARY AND CIVILIAN... Temporary Access § 147.28 Introduction. The following minimum investigative standards, implementing section...

  13. 14 CFR 147.45 - Advertising. (United States)


    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Advertising. 147.45 Section 147.45... OTHER CERTIFICATED AGENCIES AVIATION MAINTENANCE TECHNICIAN SCHOOLS Operating Rules § 147.45 Advertising... aviation maintenance technician school indicates in advertising that it is a certificated school, it shall...

  14. Marrow irradiation with high-dose 153Samarium-EDTMP followed by chemotherapy and hematopoietic stem cell infusion for acute myelogenous leukemia. (United States)

    Rodriguez, Vilmarie; Anderson, Peter M; Litzow, Mark R; Erlandson, Linda; Trotz, Barbara A; Arndt, Carola A S; Khan, Shakila P; Wiseman, Gregory A


    In four patients, aged 15 - 20 years, with high-risk acute myeloid leukemia (AML), high-dose samarium 153-labelled ethylenediaminetetramethylenephosphonate (153Sm-EDTMP) was used for targeted marrow irradiation before preparative chemotherapy conditioning regimens and allogeneic (three patients) or autologous (one patient) hematopoietic stem cell transplantation. The dose of 153Sm-EDTMP was 703 MBq/kg (n = 1) or 1110 MBq/kg (n = 3). No side-effects occurred during the 30-min infusion of 153Sm-EDTMP. Samarium - melphalan regimens were given to three patients; one had 153Sm-EDTMP - busulfan + cyclophosphamide. Total body radioactivity was below the 133 MBq safe limit before infusion of stem cells (day 14 after 153Sm-EDTMP). No hemorrhagic cystitis, nephrotoxicity or serious infections occurred. Leukocyte engraftment (white blood cell count >0.5 x 10(9)/l) occurred between 12 and 23 days after stem cell infusion (mean of 17 days). Complete cytogenetic and morphologic remission of AML was evident on follow-up marrow aspirate and biopsy specimens from all patients. In two of the four study patients, the disease remains in complete remission and the patients have an excellent quality of life (Eastern Cooperative Oncology Group performance status 0; no medications) and no organ toxicity more than 2 years and more than 4 years, respectively, after their blood and bone marrow transplantations. Thus, in adolescents and adults, 153Sm-EDTMP may provide a relatively simple and effective means for using irradiation to eliminate AML within the marrow.

  15. Samarium(II) iodide-mediated intramolecular conjugate additions of alpha,beta-unsaturated lactones. (United States)

    Molander, Gary A; St Jean, David J


    Samarium(II) iodide, in the presence of catalytic amounts of nickel(II) iodide, has been used to promote intramolecular conjugate additions of alkyl halides onto alpha,beta-unsaturated lactones. This process has been shown to be applicable to a number of alpha,beta-unsaturated lactones, including tetrasubstituted olefins, and has been demonstrated to be quite general for the formation of saturated bicyclic and tricyclic lactones. The method presented herein provides a mild, efficient process to form structurally complex lactones from simple precursors.

  16. Ekstraksi Pemisahan Neodimium dari Samarium, Itrium dan Praseodimium Memakai Tri Butil Fosfat

    Directory of Open Access Journals (Sweden)

    Maria Veronica Purwani


    Full Text Available The extraction of Nd(OH3 (neodymium hydroxide concentrate containing Y (yttrium, Sm (samarium and Pr (praseodymium as product of monazite processed has been done. The purpose of this study is to determine the separation of Nd from Y, Pr and Nd Sm in Nd concentrate. The aqueous phase was concentrated Nd (OH3 in HNO3 and extractant while organic phase was Tri Butyl Phosphate (TBP in kerosene. Parameters studied were pH and concentration feed, concentration of TBP in kerosene, extraction time and stirring speed. The result showed that the optimization of separation extraction neodymium from samarium, yttrium and praseodymium in Nd(OH3 concentrated with TBP, obtained the optimum condition of pH = 0.2, concentration of feed 100 g /L, concentration of TBP in kerosene 5%, extraction time 15 minutes and stirring speed 150 rpm. With the conditions, Separation Factor (SF obtained for Nd-Y, Nd-Pr, Nd-Sm are 2.242, 4.811, 4.002 respectively, while D and extraction efficiency of Nd are 0.236 and 19.07%.

  17. X-Band Microwave Reflection Properties of Samarium/Bismuth-Substituted Barium Lanthanum Titanate Ceramics (United States)

    Bahel, Shalini; Pubby, Kunal; Narang, Sukhleen Bindra


    Samarium/bismuth-substituted barium lanthanum titanate ceramics with chemical composition Ba4 (La_{1 - y - z} Smy Biz )_{9.33} Ti_{18} O_{54} ( y = 0.5, 0.7; z = 0.05, 0.10, 0.15), intended as microwave reflecting materials, have been investigated in microwave X-band (8.2 GHz to 12.4 GHz) and the effect of substitution on their dielectric properties, i.e., dielectric constant and dielectric loss tangent, has been studied by vector network analyzer. Dielectric analysis showed that the dielectric constant increased with increasing samarium as well as bismuth content. Dielectric relaxation was observed for all samples in the scanned frequency range. Microwave reflection and transmission analysis of ceramic pellets of thickness 4 mm was carried out using two methods, i.e., open- and short-circuit approach, both indicating very high values of reflected power and very low values of transmitted power for all the doped materials in comparison with the base composition. The doped compositions are therefore potential microwave shielding materials for use in anechoic chambers, microwave laboratories, and radar equipment. Double-layer reflectors are also proposed, having better reflection properties (˜99% reflection) compared with single-layer reflectors.

  18. Microstructure and hysteresis curves of samarium-holmium-iron garnet synthesized by coprecipitation

    Directory of Open Access Journals (Sweden)

    Caffarena Valeska da Rocha


    Full Text Available An investigation was made into the synthesis and magnetic properties of Sm(3-xHo xFe5O12 (samarium-holmium-iron garnet ferrite, as yet absent from the literature. The material in question was synthesized by co-precipitation, starting from hydrated chlorides of rare-earth elements and ferrous sulfate, and the mixed hydroxide co-precipitate was calcined at 1000 °C. Using PVA as a binder, rectangular cross section-shaped compacts were produced by means of steel-die pressing, drying and sintering from 1200 to 1450 °C. The main conclusions of this study were that the coercive force decreases as the sintering temperature increases, and that the effect of substituting holmium for samarium in SmIG is entirely different from that provided by replacing yttrium by gadolinium in YIG, which is the most important result of this work. An in-depth investigation will be necessary to determine the correlation between microstructure/magnetic properties and ceramic processing variables.

  19. Polypyrrole-coated samarium oxide nanobelts: fabrication, characterization, and application in supercapacitors (United States)

    Liu, Peng; Wang, Yunjiao; Wang, Xue; Yang, Chao; Yi, Yanfeng


    Polypyrrole-coated samarium oxide nanobelts were synthesized by the in situ chemical oxidative surface polymerization technique based on the self-assembly of pyrrole on the surface of the amine-functionalized Sm2O3 nanobelts. The morphologies of the polypyrrole/samarium oxide (PPy/Sm2O3) nanocomposites were characterized using transmission electron microscope. The UV-vis absorbance of these samples was also investigated, and the remarkable enhancement was clearly observed. The electrochemical behaviors of the PPy/Sm2O3 composites were investigated by cyclic voltammetry, electrochemical impedance spectroscopy, and galvanostatic charge-discharge. The results indicated that the PPy/Sm2O3 composite electrode was fully reversible and achieved a very fast Faradaic reaction. After being corrected into the weight percentage of the PPy/Sm2O3 composite at a current density of 20 mA cm-2 in a 1.0 M NaNO3 electrolyte solution, a maximum discharge capacity of 771 F g-1 was achieved in a half-cell setup configuration for the PPy/Sm2O3 composites electrode with the potential application to electrode materials for electrochemical capacitors.

  20. Polypyrrole-coated samarium oxide nanobelts: fabrication, characterization, and application in supercapacitors

    Energy Technology Data Exchange (ETDEWEB)

    Liu Peng, E-mail:; Wang Yunjiao; Wang Xue; Yang Chao; Yi Yanfeng [College of Chemistry and Chemical Engineering, Lanzhou University, Key Laboratory of Nonferrous Metal Chemistry and Resources Utilization of Gansu Province and State Key Laboratory of Applied Organic Chemistry (China)


    Polypyrrole-coated samarium oxide nanobelts were synthesized by the in situ chemical oxidative surface polymerization technique based on the self-assembly of pyrrole on the surface of the amine-functionalized Sm{sub 2}O{sub 3} nanobelts. The morphologies of the polypyrrole/samarium oxide (PPy/Sm{sub 2}O{sub 3}) nanocomposites were characterized using transmission electron microscope. The UV-vis absorbance of these samples was also investigated, and the remarkable enhancement was clearly observed. The electrochemical behaviors of the PPy/Sm{sub 2}O{sub 3} composites were investigated by cyclic voltammetry, electrochemical impedance spectroscopy, and galvanostatic charge-discharge. The results indicated that the PPy/Sm{sub 2}O{sub 3} composite electrode was fully reversible and achieved a very fast Faradaic reaction. After being corrected into the weight percentage of the PPy/Sm{sub 2}O{sub 3} composite at a current density of 20 mA cm{sup -2} in a 1.0 M NaNO{sub 3} electrolyte solution, a maximum discharge capacity of 771 F g{sup -1} was achieved in a half-cell setup configuration for the PPy/Sm{sub 2}O{sub 3} composites electrode with the potential application to electrode materials for electrochemical capacitors.

  1. Dicty_cDB: CHP147 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHP147 (Link to dictyBase) - - - Contig-U16471-1 CHP147P (Link to Original site) CHP...147F 556 CHP147Z 747 CHP147P 1283 - - Show CHP147 Library CH (Link to library) Clone ID CHP...e URL Representative seq. ID CHP...147P (Link to Original site) Representative DNA sequence >CHP147 (CHP147Q) /CSM/CH/CHP1-B/CHP...qeknqql leqeqnkn Translated Amino Acid sequence (All Frames) Frame A: llaywxkker*kkknfffff*nwyn*kcxvknihp

  2. Behavior of Samarium III during the sorption process; Comportamiento del Samario-III durante el proceso de sorcion

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez R, E.; Garcia G, N.; Garcia R, G. [ININ, Carr. Mexico-Toluca Km 36.5, Salazar, Estado de Mexico (Mexico)]. e-mail:


    In this work the results of the behavior of samarium in solution are presented, in front of a fine powder of zirconium silicate (zircon). For that which is necessary to characterize the zircon, studying the crystallinity, the morphology, the surface area and the isoelectric point. The behavior of samarium in solution is studied by means of the elaboration of isotherm of sorption, using the technique by lots. One observes that to pH values of nearer to the isoelectric point (pH = 7.23) the process of sorption of the samarium begins, reaching a maximum to near pH at 9. The technique of luminescence is used to determine the concentration of the sipped samarium (phosphorescence) and also to make the speciation of the species formed in the surface of the zircon (phosphorescence). The results can be extrapolated with the plutonium when making the modeling of the migration of alpha emitting coming from the repositories of radioactive waste since both they have similar chemical properties (they are homologous). (Author)

  3. Neutron and Charged-Particle Induced Cross Sections for Radiochemistry in the Region of Samarium, Europium, and Gadolinium

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, R D; Kelley, K; Dietrich, F S; Bauer, R; Mustafa, M


    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron and proton induced nuclear reaction cross sections in the mass region of samarium, europium and gadolinium (62 {le} Z {le} 64, 82 {le} N {le} 96).

  4. Pemisahan Unsur Samarium dan Yttrium dari Mineral Tanah Jarang dengan Teknik Membran Cair Berpendukung (Supported Liquid Membrane

    Directory of Open Access Journals (Sweden)

    Amri Amin


    Full Text Available he increasing use of rare earth elements in high technology industries needs to be supported by developmental work for the separation of elements. The research objective is fiercely attracting and challenging considering the similarity of bath physical and chemical properties among these elements. The rate separation of samarium and yttrium elements using supported liquid membrane has been studied. Polytetrafluoroethylene (PTFE with pore size of 0.45 µm has been used as the membrane and di(2-ethylhexyl phosphate (D2EHP in hexane has been used as a carrier and nitric acid solution has been used as receiving phase. Result of experiments showed that the best separation rate of samarium and yttrium elements could be obtained at feeding phase of pH 3.0, di(2-ethylhexyl phosphate (D2EHP concentration of 0.3 M, agitation rate of 700 rpm, agitation time of 2 hours, and nitric acid and its solution concentrations of 1.0 M and 0.1 M, respectively. At this condition, separation rates of samarium and yttrium were 64.4 and 67.6%, respectively.   Keywords: liquid membrane, rare earth elements, samarium, yttrium

  5. Investigation of the production of promethium-147 via particle accelerator (United States)

    Artun, Ozan


    In the present paper, we mainly aim to extend nuclear data of production of radionuclide promethium-147 used in nuclear battery technology due to its weak experimental measurement and theoretical calculation. Therefore, the cross-section for charged particle induced reactions on Nd target is calculated, and moreover, the reaction processes are simulated by particle accelerator with the energy range {{E}}_{{particle}} = 50 \\to 5 MeV and in the particle beam current of 20 mA to figure out yield, activity of reaction and integral yield. For a proper understanding of investigation, the obtained results are also discussed to determine the most suitable reaction and target material for the production of radionuclide promethium-147 via particle accelerator on the basis of process.

  6. 9 CFR 147.42 - General. (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false General. 147.42 Section 147.42 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE LIVESTOCK... subchapter without observance of such procedure when such action is deemed necessary in the public interest. ...

  7. 24 CFR 100.147 - Adjudication. (United States)


    ... DISCRIMINATORY CONDUCT UNDER THE FAIR HOUSING ACT Discrimination in Residential Real Estate-Related Transactions... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Adjudication. 100.147 Section 100.147 Housing and Urban Development Regulations Relating to Housing and Urban Development OFFICE OF...

  8. 19 CFR 147.1 - Definitions. (United States)


    ... (CONTINUED) TRADE FAIRS General Provisions § 147.1 Definitions. The following are general definitions for the purposes of part 147: (a) The Act. “The Act” means the Trade Fair Act of 1959. (Secs. 2-7, 73 Stat. 18, 19... Secretary of Commerce pursuant to the Trade Fair Act. (c) Fair operator. “Fair operator” means the party...

  9. 40 CFR 147.102 - Aquifer exemptions. (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Aquifer exemptions. 147.102 Section 147.102 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS...) Granite Point. (ii) McArthur River Field. (iii) Middle Ground Shoal Field. (iv) Trading Bay Field. (3) The...

  10. 14 CFR 147.15 - Space requirements. (United States)


    ... areas equipped with washtank and degreasing equipment with air pressure or other adequate cleaning... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Space requirements. 147.15 Section 147.15 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED) SCHOOLS AND...

  11. 9 CFR 147.23 - Hatchery sanitation. (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Hatchery sanitation. 147.23 Section... AGRICULTURE LIVESTOCK IMPROVEMENT AUXILIARY PROVISIONS ON NATIONAL POULTRY IMPROVEMENT PLAN Sanitation Procedures § 147.23 Hatchery sanitation. An effective program for the prevention and control of Salmonella...

  12. 33 CFR 117.147 - Cerritos Channel. (United States)


    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Cerritos Channel. 117.147 Section... DRAWBRIDGE OPERATION REGULATIONS Specific Requirements California § 117.147 Cerritos Channel. (a) The draw of... immediately. Channel 13 (156.65 MHZ) or other assigned frequencies may be used. (b) The draw of the Henry Ford...

  13. 32 CFR 147.1 - Introduction. (United States)


    ... 32 National Defense 1 2010-07-01 2010-07-01 false Introduction. 147.1 Section 147.1 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE PERSONNEL, MILITARY AND CIVILIAN... Introduction. The following adjudicative guidelines are established for all United States Government civilian...

  14. 13 CFR 147.660 - Recipient. (United States)


    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Recipient. 147.660 Section 147.660 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE..., partnership, association, unit of government (except a Federal agency) or legal entity, however organized...

  15. Effects of the atomic environment on the electron binding energies in samarium

    Energy Technology Data Exchange (ETDEWEB)

    Inoyatov, A.Kh., E-mail: [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Institute of Applied Physics, National University, Tashkent, Republic of Uzbekistan (Uzbekistan); Kovalík, A. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Nuclear Physics Institute of the ASCR, CZ-25068 Řež near Prague (Czech Republic); Filosofov, D.V. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Ryšavý, M.; Vénos, D. [Nuclear Physics Institute of the ASCR, CZ-25068 Řež near Prague (Czech Republic); Yushkevich, Yu.V.; Perevoshchikov, L.L. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Zhdanov, V.S. [Nuclear Physics Institute, Almaty, Republic of Kazakhstan (Kazakhstan)


    Highlights: • Eight different matrices (evaporated and implanted at 30 keV) used. • The greatest average difference in the binding energies amounted to 3.1 ± 0.1 eV. • The presence of trivalent and divalent Sm ions found in some implanted samples. • No significant differences in Sm natural atomic level widths were observed. - Abstract: Effects of the atomic environment on the L{sub 1}, L{sub 2}, L{sub 3}, M{sub 1}, M{sub 2}, M{sub 3}, and N{sub 1} electron binding energies in samarium generated in the electron capture decay of radioactive {sup 149}Eu were investigated by means of the internal conversion electron spectroscopy using the conversion electron spectrum of the 22.5 keV M1 + E2 nuclear transition in the daughter {sup 149}Sm. In this investigation, four pairs of {sup 149}Eu sources prepared by vacuum evaporation deposition and by ion implantation at 30 keV with the use of four different source backing materials, namely polycrystalline carbon, aluminium, gadolinium and platinum foils, were employed. The greatest average difference of (3.1 ± 0.1) eV in the L{sub 1}, L{sub 2}, L{sub 3}, and M{sub 1} subshell electron binding energies was observed between the {sup 149}Eu sources prepared by ion implantation into the aluminium and platinum substrates. On the other hand, minimal differences in the electron binding energies were generally found between samarium generated in the evaporated layer and in the bulk for the individual investigated source backings with the exception of the gadolinium foil. A doublet structure of all investigated conversion electron lines with the average values of 8.1 ± 0.2 eV and 1.5 ± 0.1 for the separation energy and the intensity ratio of the low-energy to high-energy components, respectively, was observed for the {sup 149}Eu sources prepared by ion implantation into the aluminium and carbon foils. This structure was presumably caused by the presence of both the trivalent and divalent Sm ions in the sources. No

  16. Dicty_cDB: CFC147 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CF (Link to library) CFC147 (Link to dictyBase) - - - Contig-U16381-1 CFC147F (Link to Original site) CFC...147F 122 - - - - - - Show CFC147 Library CF (Link to library) Clone ID CFC147 (Link Representative seq. ID CFC14...7F (Link to Original site) Representative DNA sequence >CFC147 (CFC147Q) /CSM/CF/CFC1-B/CFC147Q.Seq.d/ TACAT...nificant alignments: (bits) Value CFC147 (CFC147Q) /CSM/CF/CFC1-B/CFC147Q.Seq.d/ 218 1e-56 SLK648 (SLK648Q)

  17. Multiphoton laser wave-mixing absorption spectroscopy for samarium using a graphite furnace atomizer

    Energy Technology Data Exchange (ETDEWEB)

    Maniaci, Michael J.; Tong, William G. E-mail:


    Nonlinear laser wave-mixing optical technique is presented as a sensitive atomic spectroscopic method for the analysis of rare earth elements using an unmodified commercially available graphite furnace (GF) atomizer. A simple nonplanar backward-scattering degenerate four-wave mixing optical arrangement offers sub-picogram detection sensitivity with sub-Doppler Lorentzian-broadened resolution. Nonlinear wave mixing is an unusually sensitive absorption-based optical method that offers both excellent detection sensitivity and sub-Doppler spectral resolution. A mass detection limit of 0.7 pg and a concentration detection limit of 70 pg/ml are determined for a rare earth element, samarium, using the 429.7-nm excitation line.

  18. Samarium Doped Cerium Oxide Clusters: a Study on the Modulation of Electronic Structure (United States)

    Topolski, Josey E.; Kafader, Jared O.; Marrero-Colon, Vicmarie; Chick Jarrold, Caroline


    Cerium oxide is known for its use in solid oxide fuel cells due to its high ionic conductivity. The doping of trivalent samarium atoms into cerium oxide is known to enhance the ionic conductivity through the generation of additional oxygen vacancies. This study probes the electronic structure of Sm_{x}Ce_{y}O_{z} (x+y=3, z=2-4) anion and neutral clusters. Anion photoelectron spectra of these mixed metal clusters exhibit additional spectral features not present in the previously studied cerium oxide clusters. Density functional theory calculations have been used to aid interpretation of collected spectra. The results of this work can be used to inform the design of materials used for solid oxide fuel cells.

  19. Chelating Ligand-Mediated Hydrothermal Synthesis of Samarium Orthovanadate with Decavanadate as Vanadium Source

    Directory of Open Access Journals (Sweden)

    Quanguo Li


    Full Text Available A new ethylenediaminetetraacetic acid- (EDTA- mediated hydrothermal route to prepare chrysanthemum-shaped samarium orthovanadate (SmVO4 nanocrystals with decavanadate (K6V10O28·9H2O as vanadium source has been developed. The present hydrothermal approach is simple and reproducible and employs a relatively mild reaction temperature. The EDTA, pH value, and temperature of the reaction systems play important roles in determining the morphologies and growth process of the SmVO4 products. The products have been characterized by X-ray diffraction (XRD, scanning electron microscopy (SEM, Fourier transform infrared spectroscopy (FT-IR, photoluminescence spectra (PL, and UV-Vis spectroscopy.

  20. The Magnetocaloric Effect and Heat Capacity of Suspensions of High-Dispersity Samarium Ferrite (United States)

    Korolev, V. V.; Aref'ev, I. M.; Ramazanova, A. G.


    The magnetocaloric effect and specific heat capacity of an aqueous suspension of samarium ferrite were determined calorimetrically over the temperature range 288-343 K in magnetic fields of 0-0.7 T. The data obtained were used to calculate changes in the magnetic component of the molar heat capacity and entropy of the magnetic phase and changes in the enthalpy of the process under an applied magnetic field. The magnetocaloric effect was found to increase nonlinearly as the magnetic field induction grew. The corresponding temperature dependences contained a maximum at 313 K related to the second-order magnetic phase transition at the Curie point. The field and temperature dependences of heat capacity contained a maximum in fields of 0.4 T and a minimum at the magnetic phase transition temperature.

  1. Preparation of hollow core/shell microspheres of hematite and its adsorption ability for samarium. (United States)

    Yu, Sheng-Hui; Yao, Qi-Zhi; Zhou, Gen-Tao; Fu, Sheng-Quan


    Hollow core/shell hematite microspheres with diameter of ca. 1-2 μm have been successfully achieved by calcining the precursor composite microspheres of pyrite and polyvinylpyrrolidone (PVP) in air. The synthesized products were characterized by a wide range of techniques including powder X-ray diffraction (XRD), field-emission scanning electron microscopy (FESEM), energy-dispersive X-ray spectroscopy (EDX), transmission electron microscopy (TEM), high-resolution TEM (HRTEM), thermogravimetric analysis (TGA) and differential scanning calorimetry (DSC), and Brunauer-Emmett-Teller (BET) gas sorptometry. Temperature- and time-dependent experiments unveil that the precursor pyrite-PVP composite microspheres finally transform into hollow core/shell hematite microspheres in air through a multistep process including the oxidation and sulfation of pyrite, combustion of PVP occluded in the precursor, desulfation, aggregation, and fusion of nanosized hematite as well as mass transportation from the interior to the exterior of the microspheres. The formation of the hollow core/shell microspheres dominantly depends on the calcination temperature under current experimental conditions, and the aggregation of hematite nanocrystals and the core shrinking during the oxidation of pyrite are responsible for the formation of the hollow structures. Moreover, the adsorption ability of the hematite for Sm(III) was also tested. The results exhibit that the hematite microspheres have good adsorption activity for trivalent samarium, and that its adsorption capacity strongly depends on the pH of the solution, and the maximum adsorption capacity for Sm(III) is 14.48 mg/g at neutral pH. As samarium is a typical member of the lanthanide series, our results suggest that the hollow hematite microspheres have potential application in removal of rare earth elements (REEs) entering the water environment.

  2. The influence of the technological parameters on the ionic conductivity of samarium doped ceria thin films

    Directory of Open Access Journals (Sweden)

    Mantas Sriubas


    Full Text Available Sm0,20Ce0,80O2 powder was used for the formation of samarium doped cerium oxide (SDC thin films using e-beam. Surface area of powder was 34.9 m2/g and particle size – 0.3-0.5 μm. Thin films were deposited using physical vapor deposition system on SiO2 and Alloy 600 substrates. 2 Å/s – 16 Å/s growth rate and 20 °C – 600 °C substrate temperature were used during the deposition. Ionic conductivity investigation revealed that the maximum ionic conductivity (1.67 S/m has the thin film deposited on 300 °C temperature substrate using 4 Å/s growth rate. Minimum ionic conductivity (0.26 S/m has thin film which was deposited on 20 °C temperature substrate using 8 Å/s growth rate. Vacancy activation energies vary in 0.87 eV – 0.97 eV range. Furthermore the calculations of crystallite size revealed that crystallite size increases with increasing substrate temperature: from 7.50 nm to 46.23 nm on SiO2 substrate and from 9.30 nm to 44.62 nm on Alloy 600 substrate. Molar concentration of samarium in initial evaporated material is 19.38 mol% and varies from 11.37 mol% to 21 mol% in formed thin films depending on technological parameters.DOI:

  3. Synthesis, quality control and biological evaluation of tris[(1,10-phenanthroline)[{sup 153}Sm]samarium(III)]trithiocyanate complex as a therapeutic agent

    Energy Technology Data Exchange (ETDEWEB)

    Naseri, Z.; Kharat, A. Nemati [Tehran Univ. (Iran, Islamic Republic of). Inorganic Chemistry Dept.; Hakimi, A. [Islamic Azad Univ., Tehran (Iran, Islamic Republic of). Dept. of Nuclear Engineering, Science and Research Branch; Jalilian, A.R.; Shirvani-Arani, S.; Bahrami-Samani, A.; Ghannadi-Maragheh, M. [Nuclear Science and Technology Research Institute (NSTRI), Tehran (IR). Radiopharmaceutical Research and Development Lab (RRDL)


    Therapeutic radiopharmaceuticals are designed to deliver high doses of radiation to selected target organs or tissues with an aim of minimizing unwanted radiation to surrounding healthy tissue. In this work, [tris(1,10-phenanthroline)[{sup 153}Sm]samarium(III)]trithiocyanate ({sup 153}Sm-TPTTC) was developed for possible therapeutic properties. The cold compound, i.e. {sup nat}Sm-TPTTC was prepared and characterized by IR, UV, mass and {sup 1}H-NMR spectroscopy. {sup 153}Sm-TPTTC was prepared in two steps using [{sup 153}Sm]SmCl{sub 3}, obtained by neutron activation of an enriched {sup 152}Sm sample. Stability tests, partition coefficient determination, toxicity tests and biodistribution studies of the complex in wild-type and fibrosarcoma-bearing mice were determined. The radiolabeled complex was prepared in high radiochemical purity (> 99% precipitation method) and specific activity of 278 GBq/mmol and demonstrated significant stability at 4, 25 and 37 C (in presence of human serum). Initial complex biodistribution data showed significant liver accumulation in wild-type mice and significant tumor accumulation in fibrosarcoma-bearing mice with tumor:blood and tumor:muscle ratios of 3.55 (2 h) and 38.26 (96 h) respectively. {sup 153}Sm-TPTTC properties suggest an efficient tumor targeting agent with high tumor-avidity. Further investigation on the therapeutic properties must be conducted. (orig.)

  4. Dicty_cDB: AFF147 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFF147 (Link to dictyBase) - - - Contig-U15511-1 AFF147P (Link to Original site) AFF1...47F 120 AFF147Z 478 AFF147P 598 - - Show AFF147 Library AF (Link to library) Clone ID AFF1... URL Representative seq. ID AFF1...47P (Link to Original site) Representative DNA sequence >AFF147 (AFF147Q) /CSM/AF/AFF1-B/AFF1...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value AFF147 (AFF147Q) /CSM/AF/AFF1-B/AFF1

  5. CD147 deficiency blocks IL-8 secretion and inhibits lung cancer-induced osteoclastogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Hongkai; Zhuo, Yunyun; Hu, Xu; Shen, Weiwei; Zhang, Ying; Chu, Tongwei, E-mail:


    Bone is a frequent target of lung cancer metastasis, which is associated with significant morbidity and poor prognosis; however, the molecular basis of this process is still unknown. This study investigated the role of extracellular matrix metalloproteinase inducer (also known as cluster of differentiation (CD)147) in osteoclastogenesis resulting from bone metastasis, based on the enrichment of this glycoprotein on the surface of many malignant bone tumors. RNA interference was used to silence CD147 expression in A549 human lung cancer cells. Compared with conditioned medium (CM) from control cells (A549-CM), CM from CD147-deficient cells (A549-si-CM) suppressed receptor activator of nuclear factor κB ligand-stimulated osteoclastogenesis in RAW 264.7 cells and bone marrow-derived macrophages. The mRNA levels of osteoclast-specific genes such as tartrate-resistant acid phosphatase, calcitonin receptor, and cathepsin K were also reduced in the presence of A549-si-CM. CD147 knockdown in A549 cells decreased interleukin (IL)-8mRNA and protein expression. IL-8 is present in large amounts in A549-CM and mimicked its inductive effect on osteoclastogenesis; this was reversed by depletion of IL-8 from the medium. Taken together, these results indicate that CD147 promotes lung cancer-induced osteoclastogenesis by modulating IL-8 secretion, and suggest that CD147 is a potential therapeutic target for cancer-associated bone resorption in lung cancer patients. - Highlights: • Bone loss frequently results from lung cancer metastasis. • Cluster of differentiation (CD)147 was depleted in A549 lung adenocarcinoma cells. • RAW 264.7 cell osteoclastogenesis was blocked by medium from CD147-deficient cells. • Interleukin (IL)-8 level was reduced in the conditioned medium. • Osteoclastogenesis induced by lung tumor cells requires CD147-mediated IL-8 release.

  6. Formation of Core-Shell Nanoparticles Composed of Magnetite and Samarium Oxide in Magnetospirillum magneticum Strain RSS-1. (United States)

    Shimoshige, Hirokazu; Nakajima, Yoshikata; Kobayashi, Hideki; Yanagisawa, Keiichi; Nagaoka, Yutaka; Shimamura, Shigeru; Mizuki, Toru; Inoue, Akira; Maekawa, Toru


    Magnetotactic bacteria (MTB) synthesize magnetosomes composed of membrane-enveloped magnetite (Fe3O4) or greigite (Fe3S4) particles in the cells. Recently, several studies have shown some possibilities of controlling the biomineralization process and altering the magnetic properties of magnetosomes by adding some transition metals to the culture media under various environmental conditions. Here, we successfully grow Magnetospirillum magneticum strain RSS-1, which are isolated from a freshwater environment, and find that synthesis of magnetosomes are encouraged in RSS-1 in the presence of samarium and that each core magnetic crystal composed of magnetite is covered with a thin layer of samarium oxide (Sm2O3). The present results show some possibilities of magnetic recovery of transition metals and synthesis of some novel structures composed of magnetic particles and transition metals utilizing MTB.

  7. Decay Properties of {sup 147}Nd

    Energy Technology Data Exchange (ETDEWEB)

    Baecklin, A. [Inst. of Physics, Univ. of Uppsala (Sweden); Swedish Research Councils' Laboratory, Studsvik, Nykoeping (Sweden); Malmskog, S.G. [AB Atomenergi, Nykoeping (Sweden)


    Electron and gamma transition energies and intensities in the decay of {sup 147}Nd have been studied using a double focussing beta spectrometer and a Ge(Li)-detector. From the deduced multipolarities of the transitions all levels in {sup 147}Pm are found to have positive parity in contrast to the fact that the neighbouring nucleus {sup 149}Pm has been found to have several low lying negative parity states.

  8. Dicty_cDB: CFD147 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CF (Link to library) CFD147 (Link to dictyBase) - - - Contig-U16381-1 CFD147F (Link to Original site) CFD...147F 107 - - - - - - Show CFD147 Library CF (Link to library) Clone ID CFD147 (Link Representative seq. ID CFD14...7F (Link to Original site) Representative DNA sequence >CFD147 (CFD147Q) /CSM/CF/CFD1-B/CFD147Q.Seq.d/ TGTAG...s: 3101297 Number of Hits to DB: 85,114,509 protein update 2009. 5.12 PSORT - 5' end seq. ID CFD147F 5' end seq. >CFD

  9. Dicty_cDB: CHR147 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHR147 (Link to dictyBase) - - - Contig-U15337-1 | Contig-U16527-1 CHR...147P (Link to Original site) CHR147F 601 CHR147Z 802 CHR147P 1383 - - Show CHR147 Library CH (Link to library) Clone ID CHR...337-1 | Contig-U16527-1 Original site URL Representative seq. ID CHR147P (Link to Original site) Representative DNA sequence >CHR147 (CHR...147Q) /CSM/CH/CHR1-B/CHR147Q.Seq.d/ ATAGCAAGAATCATAGACCCGAGTCAATTGAAGTTGACAAAGGTTTACAAACTGTAAATC

  10. Co-reduction of aluminium and lanthanide ions in molten fluorides: Application to cerium and samarium extraction from nuclear wastes

    Energy Technology Data Exchange (ETDEWEB)

    Gibilaro, M. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France); Massot, L. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France)], E-mail:; Chamelot, P.; Taxil, P. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France)


    This work concerns the method of co-reduction process with aluminium ions in LiF-CaF{sub 2} medium (79-21 mol.%) on tungsten electrode for cerium and samarium extraction. Electrochemical techniques such as cyclic and square wave voltammetries, and potentiostatic electrolyses were used to study the co-reduction of CeF{sub 3} and SmF{sub 3} with AlF{sub 3}. For each of these elements, specific peaks of Al-Ce and Al-Sm alloys formation were observed by voltammetry as well as peaks of pure cerium and aluminium, and pure samarium and aluminium respectively. The difference of potential measured between the solvent reduction and the alloy formation suggests expecting an extraction efficiency of 99.99% of each lanthanide by the process. Different intermetallic compounds were obtained for different potentiostatic electrolysis and were characterised by Scanning Electron Microscopy with EDS probe. The validity of the process was verified by carrying out cerium and samarium extractions in the form of Al-Ln alloy; the extraction efficiency was 99.5% for Ce(III) and 99.4% for Sm(III)

  11. Structural and luminescence properties of samarium doped lead alumino borate glasses (United States)

    Mohan, Shaweta; Kaur, Simranpreet; Singh, D. P.; Kaur, Puneet


    The study reports the effect of samarium concentration on the physical, structural and spectroscopic characteristics of samarium doped lead alumino borate glasses having composition 20PbO-(10-x)Al2O3-70B2O3-xSm2O3; x = 0.1, 0.5, 1.0 and 2.0 mol %. The glasses were fabricated by conventional melt-quenching technique and then characterized by XRD, FTIR, optical absorption and fluorescence spectra. X-ray diffraction studies confirmed the amorphous nature of the prepared glasses. FTIR spectra indicate the presence of BO3, BO4, AlO6 and a few other structural groups. Various physical properties such as density, molar volume, refractive index, rare earth ion concentration, boron-boron distance and polarizability etc. were determined using conventional methods and standard formulae. The Judd-Ofelt theory was applied on the optical absorption spectra of the glasses to evaluate the three phenomenological intensity parameters Ω2, Ω4 and Ω6. The value of Ω2 was found to be highest for glass with 1 mol% Sm2O3 and attributed to the asymmetry of the ligand field at the rare earth ion site and the rare earth oxygen (Sm-O) covalency. The calculated intensity parameters and fluorescence spectra were further used to predict the radiative transition probability (A), radiative lifetime (τR), branching ratio (βR), peak wavelength (λp), effective line widths (Δλeff) and stimulated emission cross-section (σ) for the characteristic 4G5/2 → 6H5/2, 6H7/2 and 6H9/2 transitions of the Sm3+ ion. Concentration quenching was observed for 2 mol% concentration of Sm2O3 and ascribed to energy transfer through various cross-relaxation channels between Sm3+ ions. Reasonably high values of branching ratios and stimulated emission cross-section for the prepared glasses points towards their utility in the development of visible lasers emitting in the reddish-orange spectral region. However, the glass with 1 mol% Sm2O3 was found to show better radiative properties.

  12. Dicty_cDB: CHF147 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHF147 (Link to dictyBase) - - - Contig-U16327-1 - (Link to Original site) - - CHF1...47Z 579 - - - - Show CHF147 Library CH (Link to library) Clone ID CHF147 (Link to Representative seq. ID - (Link to ...Original site) Representative DNA sequence >CHF147 (CHF147Q) /CSM/CH/CHF1-B/CHF147Q.Seq.d/ XXXXXXXXXXAAAAAAA...omology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value CHF147 (CHF147Q) /CSM/CH/CHF1-B/CHF1

  13. X-ray Induced Luminescence Spectroscopy of Samarium Doped Barium Sulfate Prepared by Sintering Method (United States)

    Kumeda, T.; Maeda, K.; Shirano, Y.; Fujiwara, K.; Sakai, K.; Ikari, T.


    X-ray induced luminescence (XL) properties of phosphor materials made of samarium doped barium sulfate have been investigated. The samples were prepared by sintering method heated at 900-1250 °C for 3 hours in air from the mixture of BaSO4 and Sm2O3. The concentration of Sm were prepared from 0.01-6 at.%. In as-prepared sample, the Sm3+ was detected by photoluminescence (PL). The PL intensity is maximum about 2 at.% with Sm, and then starts decreasing. The PL intensity showed concentration quenching. The XL observed Sm2+ and Sm3+ ions. The XL was shown from the sample sintered up to 1200 °C. The XL intensity increased with Sm concentration up to 1 at.%. The intensity was almost constant larger than 1 at.% Sm. These concentration dependences is different since the X-ray energy absorbed to the host material at once, and the energy transferred to both Sm3+ and Sm2+ ions. Sm doped BaSO4 is found a host for XL phosphor materials.

  14. High-κ Samarium-Based Metal-Organic Framework for Gate Dielectric Applications. (United States)

    Pathak, Abhishek; Chiou, Guan Ru; Gade, Narsinga Rao; Usman, Muhammad; Mendiratta, Shruti; Luo, Tzuoo-Tsair; Tseng, Tien Wen; Chen, Jenq-Wei; Chen, Fu-Rong; Chen, Kuei-Hsien; Chen, Li-Chyong; Lu, Kuang-Lieh


    The self-assembly of a samarium-based metal-organic framework [Sm2(bhc)(H2O)6]n (1) in good yield was achieved by reacting Sm(NO3)3·6H2O with benzenehexacarboxylic acid (bhc) in a mixture of H2O-EtOH under hydrothermal conditions. A structural analysis showed that compound 1 crystallized in a space group of Pnmn and adopted a 3D structure with (4,8) connected nets. Temperature dependent dielectric measurements showed that compound 1 behaves as a high dielectric material with a high dielectric constant (κ = 45.1) at 5 kHz and 310 K, which is comparable to the values for some of the most commonly available dielectric inorganic metal oxides such as Sm2O3, Ta2O5, HfO2, and ZrO2. In addition, electrical measurements of 1 revealed an electrical conductivity of about 2.15 × 10-7 S/cm at a frequency of 5 kHz with a low leakage current (Ileakage = 8.13 × 10-12 Amm-2). Dielectric investigations of the Sm-based MOF provide an effective path for the development of high dielectric materials in the future.

  15. Pyroelectric properties and electrical conductivity in samarium doped BiFeO 3 ceramics

    KAUST Repository

    Yao, Yingbang


    Samarium (Sm 3+) doped BiFeO 3 (BFO) ceramics were prepared by a modified solid-state-reaction method which adopted a rapid heating as well as cooling during the sintering process. The pyroelectric coefficient increased from 93 to 137 μC/m 2 K as the Sm 3+ doping level increased from 1 mol% to 8 mol%. Temperature dependence of the pyroelectric coefficient showed an abrupt decrease above 80 °C in all samples, which was associated with the increase of electrical conductivity with temperature. This electrical conduction was attributed to oxygen vacancy existing in the samples. An activation energy of ∼0.7 eV for the conduction process was found to be irrespective of the Sm 3+ doping level. On the other hand, the magnetic Néel temperature (T N) decreased with increasing Sm 3+ doping level. On the basis of our results, the effects of Sm doping level on the pyroelectric and electrical properties of the BFO were revealed. © 2011 Elsevier Ltd. All rights reserved.

  16. Characterization of luminescent samarium doped HfO{sub 2} coatings synthesized by spray pyrolysis technique

    Energy Technology Data Exchange (ETDEWEB)

    Chacon-Roa, C [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Guzman-Mendoza, J [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Aguilar-Frutis, M [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Garcia-Hipolito, M [Departamento de Materiales Metalicos y Ceramicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autonoma de Mexico, A.P. 70-360 Coyoacan 04510, Mexico, D.F. (Mexico); Alvarez-Fragoso, O [Departamento de Materiales Metalicos y Ceramicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autonoma de Mexico, A.P. 70-360 Coyoacan 04510, Mexico, D.F. (Mexico); Falcony, C [Departamento de Fisica, CINVESTAV-IPN, A. P. 14-740, 07000 Mexico D.F. (Mexico)


    Trivalent samarium (Sm{sup 3+}) doped hafnium oxide (HfO{sub 2}) films were deposited using the spray pyrolysis deposition technique. The films were deposited on Corning glass substrates at temperatures ranging from 300 to 550 deg. C using chlorides as raw materials. Films, mostly amorphous, were obtained when deposition temperatures were below 350 deg. C. However, for temperatures higher than 400 deg. C, the films became polycrystalline, presenting the HfO{sub 2} monoclinic phase. Scanning electron microscopy of the films revealed a rough surface morphology with spherical particles. Also, electron energy dispersive analysis was performed on these films. The photoluminescence and cathodoluminescence characteristics of the HfO{sub 2} : SmCl{sub 3} films, measured at room temperature, exhibited four main bands centred at 570, 610, 652 and 716 nm, which are due to the well-known intra-4f transitions of the Sm{sup 3+} ion. It was found that the overall emission intensity rose as the deposition temperature was increased. Furthermore, a concentration quenching of the luminescence intensity was also observed.

  17. Samarium-153 EDTMP for metastatic bone pain palliation: the impact of europium impurities. (United States)

    Kalef-Ezra, J A; Valakis, S T; Pallada, S


    To evaluate the impact on the radiation protection policies of the radiocontaminants in Samarium-153 ethylenediamine tetramethylene phosphonate ((153)Sm-EDTMP). The internal contamination of patients treated with (153)Sm-EDMTP for palliation of painful disseminated multiple bone metastases due to long-lived impurities was assessed by direct measurements. These measurements were coupled with dose-rate measurements close to their bodies and spectroscopic analysis of the residual activity in post-treatment radiopharmaceutical vials. Whole-body counting carried out in six patients showed a 30-81-kBq europium -152 plus europium-154 contamination. The 0.85 mean (152)Eu- to -(154)Eu activity ratio obtained by direct counting was similar to that assessed by analysis of post-treatment residual activities in twelve radiopharmaceutical vials following radiopharmaceutical injection. The long-lived radiocontaminants in the patient's bodies and the treatment wastes require modifications of the applicable radiation protection policies. Copyright © 2014 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  18. Luminescence of trivalent samarium ions in silver and tin co-doped aluminophosphate glass (United States)

    Jiménez, José A.; Lysenko, Sergiy; Liu, Huimin; Sendova, Mariana


    This work presents the spectroscopic properties of trivalent samarium ions in a melt-quenched aluminophosphate glass containing silver and tin. Addition of 4 mol% of each Ag 2O and SnO into the glass system with 2 mol% Sm 2O 3 results in Sm 3+ ions luminescence under non-resonant UV excitation owing to energy transfer from single silver ions and/or twofold-coordinated Sn centers. Assessment of luminescence spectra and decay dynamics suggest the energy transfer mechanism to be essentially of the resonant radiative type. Moreover, a connection between the luminescent and structural properties of the rare-earth doped glass system was demonstrated. Raman spectroscopy characterization revealed that no significant variation in the glass matrix is induced by Sm 3+ doping at the concentration employed. A comparison was made with a structural study performed on the Eu 3+ doped system (containing 2 mol% Eu 2O 3 along with 4 mol% of each Ag 2O and SnO) where the radiative energy transfer mechanism was previously established. The data appears consistent regarding the lack of variation in glass structure upon the Eu 3+ and Sm 3+ doping in connection with the dominance of the radiative transfer in the matrix. Thermal treatment of the material leads to precipitation of Ag nanoparticles of a broad size range inside the dielectric as observed by transmission electron microspcopy. Assessment of 4G 5/2 excited state decay in Sm 3+ ions shows no influence from the silver particles.

  19. Samarium (III) adsorption on bentonite modified with N-(2-hydroxyethyl) ethylenediamine. (United States)

    Li, Dandan; Chang, Xijun; Hu, Zheng; Wang, Qihui; Li, Ruijun; Chai, Xiaoli


    A new material has been synthesized using dry process to activate bentonite followed by N-(2-hydroxyethyl) ethylenediamine connecting chlorosilane coupling agent. The synthesized new material was characterized by elemental analysis, FT-IR and thermogravimetry which proved that bentonite was successfully modified. The most interesting trait of the new material was its selective adsorption for rare earth elements. A variety of conditions of the new material were investigated for adsorption. The optimal conditions were determined with respect to pH and shaking time. Samarium (Sm) was quantitatively adsorbed at pH 4 and shaking time of 2 min onto the new material. Under these conditions the maximum static adsorption capacity of Sm(III) was found to be 17.7 mg g(-1). The adsorbed Sm(III) ion were quantitatively eluted by 2.0 mL 0.1 mol L(-1) HCl and 5% CS (NH(2))(2) solution. According to IUPAC definition, the detection limit (3σ) of this method was 0.60 ng mL(-1). The relative standard deviation (RSD) under optimum conditions was less than 3% (n=8). The new material also was applied for the preconcentration of trace Sm(III) in environmental samples with satisfactory results. Copyright © 2010 Elsevier B.V. All rights reserved.

  20. 19 CFR 147.0 - Scope. (United States)


    ...) TRADE FAIRS § 147.0 Scope. This part governs the entry of merchandise intended for exhibition or for use in constructing, installing, or maintaining foreign exhibits at trade fairs which have been so... merchandise, and the disposition of the merchandise after the fair has closed. The entry of articles which may...

  1. 19 CFR 147.11 - Entry. (United States)


    ...) TRADE FAIRS Procedure for Importation § 147.11 Entry. (a) Made in name of fair operator. All entries of articles for a fair shall be made at the port in the name of the fair operator which shall be deemed for... exhibition purposes under the Trade Fair Act of 1959. Mark Number Package and contents Quality Invoice value...

  2. 45 CFR 147.138 - Patient protections. (United States)


    ... INSURANCE REFORM REQUIREMENTS FOR THE GROUP AND INDIVIDUAL HEALTH INSURANCE MARKETS § 147.138 Patient... participant (in the individual market, primary subscriber) of the terms of the plan or health insurance.... If a group health plan, or a health insurance issuer offering group or individual health insurance...

  3. 27 CFR 44.147 - General. (United States)


    ... PAYMENT OF TAX, OR WITH DRAWBACK OF TAX Operations by Export Warehouse Proprietors Reports § 44.147 General. Every export warehouse proprietor shall make a report on Form 5220.4 of all tobacco products... any operations or transactions occurred during the period covered by the report. A copy of each report...

  4. CD147 (EMMPRIN/Basigin) in kidney diseases: from an inflammation and immune system viewpoint. (United States)

    Kosugi, Tomoki; Maeda, Kayaho; Sato, Waichi; Maruyama, Shoichi; Kadomatsu, Kenji


    The glycosylated transmembrane protein CD147/basigin, also known as extracellular matrix metalloproteinase (MMP) inducer (EMMPRIN), contributes to cell survival, migration and cancer invasion. In normal kidneys, high expression of CD147 is detected only in the basolateral side of tubular epithelial cells (TECs). The pathophysiological roles of CD147 in the kidneys are diverse, ranging from involvement in the occurrence of acute kidney injury (AKI) that is frequently accompanied by ischemia, inflammation and a loss of self-tolerance to the progression of chronic kidney disease (CKD) that is caused by an imbalance in extracellular matrix protein turnover. In AKI induced by ischemia, it is the CD147 on neutrophils, rather than that on TECs, that coordinately participates in massive neutrophil recruitment via acting as a physiological ligand for E-selectin, which is specifically enhanced in the endothelium upon inflammatory stimulation. In the CKD that follows AKI, a molecular circuit involving CD147, MMPs and transforming growth factor-β may be involved in the pathogenesis of progressive fibrosis through hyaluronan production and macrophage infiltration. Whereas CD147 thus plays deleterious roles in ischemic and fibrotic kidney injuries, CD147 expression on lymphocytes might decrease the disease activity of lupus nephritis (LN) by functioning as a potential negative regulator of the extraordinary proliferation of lymphocytes that occurs in this disease. In line with these basic studies, our clinical data indicate the potential of plasma CD147 to function as a critical biomarker for both ischemic AKI and LN. CD147 is also involved in crosstalk between the kidneys and distant organs, which may be mediated by chemotactic cytokines that are derived from circulating inflammatory cells and damaged organs. Disruption of such a vicious chain reaction involving CD147 would therefore be required in order to overcome kidney diseases. Multidisciplinary research regarding CD147

  5. Fabrication and properties of samarium doped calcium sulphate thin films using spray pyrolysis technique

    Energy Technology Data Exchange (ETDEWEB)

    Reghima, Meriem [Université Tunis El Manar, Faculté des Sciences de Tunis, Département de Physique, LR99ES13 Laboratoire de Physique de la Matière Condensée (LPMC), 2092 Tunis, Tunisie (Tunisia); Institut d' Electronique et des systèmes, Unité Mixte de Recherche 5214 UM2-CNRS (ST2i) – Université Montpellier, 860 rue de Saint Priest, Bâtiment 5, 34097 Montpellier (France); Faculté des Sciences de Bizerte, Université de Carthage, Zarzouna 7021 (Tunisia); Guasch, Cathy [Institut d' Electronique et des systèmes, Unité Mixte de Recherche 5214 UM2-CNRS (ST2i) – Université Montpellier, 860 rue de Saint Priest, Bâtiment 5, 34097 Montpellier (France); Azzaza, Sonia; Alleg, Safia [Laboratoire de Magnétisme et Spectroscopie des Solides (LM2S), Département de Physique, Faculté des Sciences, Université Badji Mokhtar Annaba, B.P. 12, 23000 Annaba (Algeria); Kamoun-Turki, Najoua [Université Tunis El Manar, Faculté des Sciences de Tunis, Département de Physique, LR99ES13 Laboratoire de Physique de la Matière Condensée (LPMC), 2092 Tunis, Tunisie (Tunisia)


    Using low cost spray pyrolysis technique, polycrystalline CaSO{sub 4} thin films were successfully grown on a glass substrate with a thickness of about 1 μm. Samarium doping has been performed on CaSO{sub 4} thin films to explore luminescence properties. The characterizations of these films were carried out using X-ray diffraction, Scanning Electron Microscopy and optical measurements. The structural analyses reveal the existence of hexagonal CaSO{sub 4} phase with a (200) preferred orientation belonging to CaS compound for substrate temperatures below 350 °C. It is shown that the crystallinity of the sprayed thin films can be improved by increasing substrate temperature up to 250 °C. Warren-Averbach analysis has been applied on X-ray diffractogram to determine structural parameters involving the phase with its amount, the grain size and the lattice parameters using Maud software. The surface topography shows a rough surface covered by densely packed agglomerated clusters having faceted and hexagonal shapes. Energy dispersive microscopy measurements confirm the presence of calcium and sulfur in equal proportions as well as high percentage of oxygen. Photoluminescence at room temperature revealed that luminescence peaks are attributed to the intrinsic emission of pure CaSO{sub 4} phase. - Highlights: • Warren Averbach analysis reveal the presence of hcp structure of CaSO{sub 4} phase. • A mixture of CaSO{sub 4} and CaHO{sub 4.5}S phases has been detected for lower T{sub s}. • For increasing T{sub s}, the CaHO{sub 4.5}S phase has been disappeared. • The origin of PL peaks has been identified.

  6. 33 CFR 147.1112 - Platform HIDALGO safety zone. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Platform HIDALGO safety zone. 147.1112 Section 147.1112 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OUTER CONTINENTAL SHELF ACTIVITIES SAFETY ZONES § 147.1112 Platform HIDALGO safety zone. (a...

  7. 19 CFR 147.13 - Transfer to fair building. (United States)


    ... TREASURY (CONTINUED) TRADE FAIRS Procedure for Importation § 147.13 Transfer to fair building. (a... 19 Customs Duties 2 2010-04-01 2010-04-01 false Transfer to fair building. 147.13 Section 147.13... to articles for a fair. (b) After entry. Upon the entry being made, a permit may be issued by the...

  8. 19 CFR 147.33 - Reimbursement by fair operator. (United States)


    ... THE TREASURY (CONTINUED) TRADE FAIRS Customs Supervision § 147.33 Reimbursement by fair operator. All... 19 Customs Duties 2 2010-04-01 2010-04-01 false Reimbursement by fair operator. 147.33 Section 147... reimbursed by the fair operator to the Government, payment to be made on demand to the port director for...

  9. 19 CFR 147.44 - Entry for another fair. (United States)


    ... TREASURY (CONTINUED) TRADE FAIRS Disposition of Articles Entered for Fairs § 147.44 Entry for another fair. Articles entered for a fair which are to be entered for another fair under the provisions of this part... 19 Customs Duties 2 2010-04-01 2010-04-01 false Entry for another fair. 147.44 Section 147.44...

  10. 40 CFR 147.2907 - Confidentiality of information. (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Confidentiality of information. 147.2907 Section 147.2907 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER... Mineral Reserve-Class II Wells § 147.2907 Confidentiality of information. (a) The following information...

  11. 32 CFR 147.4 - Guideline B-Foreign influence. (United States)


    ... 32 National Defense 1 2010-07-01 2010-07-01 false Guideline B-Foreign influence. 147.4 Section 147... Adjudication § 147.4 Guideline B—Foreign influence. (a) The concern. A security risk may exist when an... affection, influence, or obligation are not citizens of the Untied States or may be subject to duress. These...

  12. 33 CFR 147.831 - Holstein Truss Spar safety zone. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Holstein Truss Spar safety zone. 147.831 Section 147.831 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OUTER CONTINENTAL SHELF ACTIVITIES SAFETY ZONES § 147.831 Holstein Truss Spar safety zone. (a) Description. Holstein, Green Canyon 645 ...

  13. 19 CFR 147.31 - Articles to be kept separate. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Articles to be kept separate. 147.31 Section 147... THE TREASURY (CONTINUED) TRADE FAIRS Customs Supervision § 147.31 Articles to be kept separate. Articles for exhibit at a fair shall be segregated from domestic articles and from imported articles...

  14. SU-C-201-06: Utility of Quantitative 3D SPECT/CT Imaging in Patient Specific Internal Dosimetry of 153-Samarium with GATE Monte Carlo Package

    Energy Technology Data Exchange (ETDEWEB)

    Fallahpoor, M; Abbasi, M [Tehran University of Medical Sciences, Vali-Asr Hospital, Tehran, Tehran (Iran, Islamic Republic of); Sen, A [University of Houston, Houston, TX (United States); Parach, A [Shahid Sadoughi University of Medical Sciences, Yazd, Yazd (Iran, Islamic Republic of); Kalantari, F [UT Southwestern Medical Center, Dallas, TX (United States)


    Purpose: Patient-specific 3-dimensional (3D) internal dosimetry in targeted radionuclide therapy is essential for efficient treatment. Two major steps to achieve reliable results are: 1) generating quantitative 3D images of radionuclide distribution and attenuation coefficients and 2) using a reliable method for dose calculation based on activity and attenuation map. In this research, internal dosimetry for 153-Samarium (153-Sm) was done by SPECT-CT images coupled GATE Monte Carlo package for internal dosimetry. Methods: A 50 years old woman with bone metastases from breast cancer was prescribed 153-Sm treatment (Gamma: 103keV and beta: 0.81MeV). A SPECT/CT scan was performed with the Siemens Simbia-T scanner. SPECT and CT images were registered using default registration software. SPECT quantification was achieved by compensating for all image degrading factors including body attenuation, Compton scattering and collimator-detector response (CDR). Triple energy window method was used to estimate and eliminate the scattered photons. Iterative ordered-subsets expectation maximization (OSEM) with correction for attenuation and distance-dependent CDR was used for image reconstruction. Bilinear energy mapping is used to convert Hounsfield units in CT image to attenuation map. Organ borders were defined by the itk-SNAP toolkit segmentation on CT image. GATE was then used for internal dose calculation. The Specific Absorbed Fractions (SAFs) and S-values were reported as MIRD schema. Results: The results showed that the largest SAFs and S-values are in osseous organs as expected. S-value for lung is the highest after spine that can be important in 153-Sm therapy. Conclusion: We presented the utility of SPECT-CT images and Monte Carlo for patient-specific dosimetry as a reliable and accurate method. It has several advantages over template-based methods or simplified dose estimation methods. With advent of high speed computers, Monte Carlo can be used for treatment planning

  15. RNAi-mediated silencing of CD147 inhibits tumor cell proliferation, invasion and increases chemosensitivity to cisplatin in SGC7901 cells in vitro

    Directory of Open Access Journals (Sweden)

    Zhu Chan


    Full Text Available Abstract Background CD147 is a widely distributed cell surface glycoprotein that belongs to the Ig superfamily. CD147 has been implicated in numerous physiological and pathological activities. Enriched on the surface of many tumor cells, CD147 promotes tumor growth, invasion, metastasis and angiogenesis and confers resistance to some chemotherapeutic drugs. In this study, we investigated the possible role of CD147 in the progression of gastric cancer. Methods Short hairpin RNA (shRNA expressing vectors targeting CD147 were constructed and transfected into human gastric cancer cells SGC7901 and CD147 expression was monitored by quantitative realtime RT-PCR and Western blot. Cell proliferation, the activities of MMP-2 and MMP-9, the invasive potential and chemosensitivity to cisplatin of SGC7901 cells were determined by MTT, gelatin zymography, Transwell invasion assay and MTT, respectively. Results Down-regulation of CD147 by RNAi approach led to decreased cell proliferation, MMP-2 and MMP-9 activities and invasive potential of SGC7901 cells as well as increased chemosensitivity to cisplatin. Conclusion CD147 involves in proliferation, invasion and chemosensitivity of human gastric cancer cell line SGC7901, indicating that CD147 may be a promising therapeutic target for gastric cancer.

  16. Optical properties and electronic transitions of zinc oxide, ferric oxide, cerium oxide, and samarium oxide in the ultraviolet and extreme ultraviolet

    DEFF Research Database (Denmark)

    Pauly, N; Yubero, F; Espinós, J P


    Optical properties and electronic transitions of four oxides, namely zinc oxide, ferric oxide, cerium oxide, and samarium oxide, are determined in the ultraviolet and extreme ultraviolet by reflection electron energy loss spectroscopy using primary electron energies in the range 0.3-2.0 keV. This...

  17. The Biological Function and Clinical Utilization of CD147 in Human Diseases: A Review of the Current Scientific Literature

    Directory of Open Access Journals (Sweden)

    Lijuan Xiong


    Full Text Available CD147 or EMMPRIN is a member of the immunoglobulin superfamily in humans. It is widely expressed in human tumors and plays a central role in the progression of many cancers by stimulating the secretion of matrix metalloproteinases (MMPs and cytokines. CD147 regulates cell proliferation, apoptosis, and tumor cell migration, metastasis and differentiation, especially under hypoxic conditions. CD147 is also important to many organ systems. This review will provide a detailed overview of the discovery, characterization, molecular structure, diverse biological functions and regulatory mechanisms of CD147 in human physiological and pathological processes. In particular, recent studies have demonstrated the potential application of CD147 not only as a phenotypic marker of activated regulatory T cells but also as a potential diagnostic marker for early-stage disease. Moreover, CD147 is recognized as an effective therapeutic target for hepatocellular carcinoma (HCC and other cancers, and exciting clinical progress has been made in HCC treatment using CD147-directed monoclonal antibodies.

  18. Optical response and magnetic characteristic of samarium doped zinc phosphate glasses containing nickel nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Azmi, Siti Amlah M.; Sahar, M.R., E-mail:


    A magnetic glass of composition 40ZnO–(58−x) P{sub 2}O{sub 5}–1Sm{sub 2}O{sub 3}–xNiO, with x=0.0, 1.0, 1.5 and 2.0 mol% is prepared by melt-quenching technique. The glass is characterized by X-ray diffraction, high-resolution transmission electron microscope (HRTEM), photoluminescence (PL) spectroscopy and vibrating sample magnetometer (VSM) analysis. The X-rays diffraction confirms the amorphous nature of the glass while the HRTEM analysis reveals the presence of nickel nanoparticles in the glass samples. High-resolution TEM reveals that the lattice spacing of nickel nanoparticles is 0.35 nm at (100) plane. Photoluminescence emission shows the existence of four peaks that correspond to the transition from the upper level of {sup 4}G{sub 5/2} to the lower level of {sup 6}H{sub 5/2}, {sup 6}H{sub 7/2}, {sup 6}H{sub 9/2,} and {sup 6}H{sub 11/2.} It is observed that all peaks experience significant quenching effect with the increasing concentration of nickel nanoparticles, suggesting a strong energy transfer from excited samarium ions to the nickel ions. The glass magnetization and susceptibility at 12 kOe at room temperature are found to be in the range of (3.87±0.17×10{sup −2}–7.19±0.39×10{sup −2}) emu/g and (3.24±0.16×10{sup −6}–5.99±0.29×10{sup −6}) emu/Oe g respectively. The obtained hysteresis curve indicates that the glass samples are paramagnetic materials. The studied glass can be further used towards the development of magneto-optical functional glass. - Highlights: • Sm{sup 3+} doped zinc phosphate glass embedded with Ni NPs has been prepared. • The Laue pattern and lattice spacing of Ni NPs are confirmed by HRTEM image. • The magnetic response of glasses has been studied through VSM analysis. • Enhancement factor and decay half-lifetime are investigated.

  19. Treatment of bone pain secondary to metastases using samarium-153-EDTMP

    Directory of Open Access Journals (Sweden)

    Elba Cristina Sá de Camargo Etchebehere

    Full Text Available CONTEXT: More than 50% of patients with prostate, breast or lung cancer will develop painful bone metastases. The purpose of treating bone metastases is to relieve pain, reduce the use of steroids and to maintain motion. OBJECTIVE: To evaluate the use of samarium-153-EDTMP (153Sm-EDTMP for the treatment of bone pain secondary to metastases that is refractory to clinical management. TYPE OF STUDY: Retrospective. SETTING: Division of Nuclear Medicine, Universidade Estadual de Campinas (Unicamp. METHODS: Fifty-eight patients were studied (34 males with mean age 62 years; 31 patients had prostate cancer, 20 had breast cancer, three had lung cancer, one had lung hemangioendothelioma, one had parathyroid adenocarcinoma, one had osteosarcoma and one had an unknown primary tumor. All patients had multiple bone metastases demonstrated by bone scintigraphy using 99mTc-MDP,and were treated with 153Sm-EDTMP. Response to treatment was graded as good (pain reduction of 50-100%, intermediate (25-49% and poor (0-24%. RESULTS: All patients showed good uptake of 153Sm-EDTMP by bone metastases. Among the patients with prostate cancer, intermediate or good response to therapy occurred in 80.6% (25 patients and poor response in 19.4% (6. Among the patients with breast cancer, 85% (17 showed intermediate or good response to therapy while 15% (3 showed poor response. All three patients with lung cancer showed poor response to treatment. The lung hemangioendothelioma and unknown primary lesion patients showed intermediate response to treatment; the osteosarcoma and parathyroid adenocarcinoma patients showed good response to treatment. No significant myelotoxicity occurred. DISCUSSION: Pain control is important for improving the quality of life of patients with advanced cancers. The mechanism by which pain is relieved with the use of radionuclides is still not yet completely understood, however, the treatment is simple and provides a low risk of mielotoxicity

  20. Anchoring samarium oxide nanoparticles on reduced graphene oxide for high-performance supercapacitor

    Energy Technology Data Exchange (ETDEWEB)

    Dezfuli, Amin Shiralizadeh [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Ganjali, Mohammad Reza, E-mail: [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Biosensor Research Center, Endocrinology & Metabolism Molecular-Cellular Sciences Institute, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Naderi, Hamid Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of)


    Highlights: • Samarium oxide nanoparticles have been anchored on the surface of reduced graphene oxide for the first time. • Sm{sub 2}O{sub 3}/RGO nanocomposite show high capacitance, good rate and cycling performance. • Sm{sub 2}O{sub 3}/RGO nanocomposite can serve as efficient electrode material for energy storage. • The best composite electrode exhibits specific capacitance of 321 F g{sup −1} in 2 mV s{sup −1}. - Abstract: We have synthesized Sm{sub 2}O{sub 3} nanoparticles (SmNs) and anchored them onto the surface of reduced graphene oxide (RGO) through a self-assembly thereof by utilizing a facile sonochemical procedure. The nanomaterials were characterized by means of powder X-ray diffraction (XRD), Field-emission scanning electron microscopy (FE-SEM), fourier transform infrared spectroscopy (FT-IR) spectra, and X-ray photoelectron spectroscopy (XPS). As the next step, the supercapacitive behavior of the resulting nanocomposites were investigated when used as electrode material, through with cyclic voltammetric (CV), galvanostatic charge-discharge and electrochemical impedance spectroscopy (EIS) techniques. The SmNs decorated RGO (SmN-RGO) nanocomposites were found to possess a specific capacitance (SC) of 321 F g{sup −1} when used in a 0.5 M Na{sub 2}SO{sub 4} solution as an electrolyte, in a scan rate of 2 mV s{sup −1}. The SC of the SmN-RGO based electrodes were also found to be 268 F g{sup −1} at a current density of 2 A g{sup −1} through galvanostatic charge-discharge tests. The outstanding properties of the SmN-RGOs were attributed to synergy of the high charge mobility of SmNs and the flexibility of the sheets of RGOs. Additionally, the nano-composite revealed a unique cycling durability (maintaining 99% of its SC even after 4000 cycles).

  1. Inhibition of CD147 expression by RNA interference reduces proliferation, invasion and increases chemosensitivity in cancer stem cell-like HT-29 cells. (United States)

    Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui


    The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.

  2. Effect of Current Density on Thermodynamic Properties of Nanocrystalline Palladium Capped Samarium Hydride Thin Film Switchable Mirrors

    Directory of Open Access Journals (Sweden)

    Pushpendra Kumar


    Full Text Available A 55 nm samarium film capped with a 10 nm palladium overlayer switched from a metallic reflecting to a semiconducting, transparent in visible state during ex-situ hydrogen loading via electrochemical means in 1 M KOH electrolytic aqueous solution at room temperature. The switching between metal to semiconductor was accompanied by measurement of transmittance during hydrogen loading/unloading. The effect of current density on switching and thermodynamic properties was studied between dihydride state (FCC phase and trihydride state (hexagonal phase. From the plateau of partial pressure of hydrogen at x=2.6, enthalpy of formation was calculated at different current densities. The diffusion coefficients and switching kinetics are shown to depend on applied current density.

  3. Sorption of samarium in soils: influence of soil properties and Sm concentration

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez-Guinart, Oriol; Salaberria, Aitor; Rigol, Anna; Vidal, Miquel [Analytical Chemistry department, Faculty of Chemistry, University of Barcelona, Marti i Franques 1-11, 08028, Barcelona (Spain)


    Due to the fact that barriers of Deep Geological Repositories (DGR) may lose efficiency before the radioisotopes present in the High Level Radioactive Waste (HLRW) completely decay, it is possible that, in the long-term, radioactive leachates may escape from the DGR and reach the soil and water compartments in the biosphere. Therefore, it is required to examine the interaction and mobility of radionuclides present in the HLRW, or their chemical analogues, to predict the impact of their eventual incorporation in the biosphere and to assess the derived risk. Although relevant data have been recently obtained for a few radionuclides in soils, there are still some important gaps for some radionuclides, such us for samarium (Sm). Sm is a lanthanide that, besides being considered as a natural analogue of actinides, may also be present in HLRW in the form of the radioactive isotope {sup 151}Sm. The main objective of this work was to obtain sorption data (K{sub d}) of {sup 151}Sm gathered from a set of soil samples physicochemical fully-characterized (pH, texture, cationic exchange capacity, soil solution cationic composition, organic matter, carbonate and metallic oxides content, etc.). Additionally, as an alternative for testing sorption capacity of radionuclides in soils is the use of the corresponding stable isotope or a chemical analogue, the influence of Sm concentration was also checked. To evaluate {sup 151}Sm sorption, batch assays were carried out for each soil sample, which consisted in a pre-equilibration step of 2 g of each soil with 50 ml of double deionised water, and a subsequent equilibration step with the same solution, but labelled with {sup 151}Sm. The activity of {sup 151}Sm in initial and final solutions was measured by liquid scintillation and K{sub d} ({sup 151}Sm) data were calculated. The reversibly sorbed fraction was estimated by the application of a single extraction test, with double deionised water, to soil residues coming from the previous

  4. 14 CFR Appendix B to Part 147 - General Curriculum Subjects (United States)


    ...) SCHOOLS AND OTHER CERTIFICATED AGENCIES AVIATION MAINTENANCE TECHNICIAN SCHOOLS Pt. 147, App. B Appendix B.... (3) 27. Perform algebraic operations involving addition, subtraction, multiplication, and division of...

  5. Crystal growth of semiorganic complex- samarium chloride coordinated thiourea-L-tartaric acid and its studies on structure and optical characteristics (United States)

    Slathia, Goldy; Singh, Harjinder; Ramya, E.; Rao, D. Narayana; Bamzai, K. K.


    The semi-organic complex of samarium chloride coordinated thiourea-L-tartaric acid (SCTLT) has been grown as a single crystal by slow evaporation technique at room temperature. For structural studies, the grown crystal was subjected to single crystal X-ray diffraction and Fourier transform infra-red (FTIR) spectroscopy. Low cut off wavelength and transparent characteristics were explored by UV-VIS optical characterization. Third-order nonlinear optical properties of grown crystal were investigated by Z-scan technique.

  6. Sorption of samarium in iron (II) and (III) phosphates in aqueous systems; Sorcion de samario en fosfatos de hierro (II) y (III) en sistemas acuosos

    Energy Technology Data Exchange (ETDEWEB)

    Diaz F, J.C


    The radioactive residues that are stored in the radioactive confinements its need to stay isolated of the environment while the radioactivity levels be noxious. An important mechanism by which the radioactive residues can to reach the environment, it is the migration of these through the underground water. That it makes necessary the investigation of reactive materials that interacting with those radionuclides and that its are able to remove them from the watery resources. The synthesis and characterization of materials that can be useful in Environmental Chemistry are very important because its characteristics are exposed and its behavior in chemical phenomena as the sorption watery medium is necessary to use it in the environmental protection. In this work it was carried out the sorption study of the samarium III ion in the iron (II) and (III) phosphate; obtaining the sorption isotherms in function of pH, of the phosphate mass and of the concentration of the samarium ion using UV-visible spectroscopy to determine the removal percentage. The developed experiments show that as much the ferrous phosphate as the ferric phosphate present a great affinity by the samarium III, for what it use like reactive material in contention walls can be very viable because it sorption capacity has overcome 90% to pH values similar to those of the underground and also mentioning that the form to obtain these materials is very economic and simple. (Author)

  7. Trace amounts of rare earth elements in high purity samarium oxide by sector field inductively coupled plasma mass spectrometry after separation by HPLC

    Energy Technology Data Exchange (ETDEWEB)

    Pedreira, W.R. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil) and Fundacao Jorge Duprat Figueiredo de Seguranca e Medicina do Trabalho (FUNDACENTRO), 05409-002 Sao Paulo, SP (Brazil)]. E-mail:; Queiroz, C.A. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Abrao, A. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Rocha, S.M. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Vasconcellos, M.E. de [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Boaventura, G.R. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil); Pimentel, M.M. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil)


    Today there is an increasing need for high purity rare earth compounds in various fields, the optical, the electronics, the ceramic, the nuclear and geochemistry. Samarium oxide has special uses in glass, phosphors, lasers and thermoelectric devices. Calcium chloride crystals treated with samarium have been employed in lasers, which produce light beams intense enough to burn metal. In general, the inductively coupled plasma mass spectrometry (ICP-MS) presents some advantages for trace element analysis, due to high sensitivity and resolution, when compared with other analytical techniques such as ICP optical emission spectrometry (ICP-OES). In this work, sector field inductively coupled plasma mass spectrometry was used. Sixteen elements (Sc, Y and 14 lanthanides) were determined selectively with the ICP-MS system using a concentration gradient method. The detection limits with the ICP-MS system were about 0.2 (La) pg mL{sup -1} to 8 (Gd) pg mL{sup -1}. The %R.S.D. of the methods varying between 0.9 and 1.5% for a set of five (n = 5) replicates was found for the IPEN's material and for the certificate reference sample. Determination of trace REEs in two high pure samarium oxides samples (IPEN and JMC) was performed. IPEN's material is highly pure (>99.99%) and was successfully analyzed without spectral interference (MO{sup +} and MOH{sup +})

  8. 40 CFR 147.3009 - Area of review. (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Area of review. 147.3009 Section 147.3009 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED... the times exceeds injection to produce a net withdrawal; or (3) A suitable distance, not less than one...

  9. 41 CFR 105-53.147 - Public Buildings Service. (United States)


    ... space is used more effectively and efficiently; providing leadership in the development and maintenance... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Public Buildings Service. 105-53.147 Section 105-53.147 Public Contracts and Property Management Federal Property Management...

  10. 27 CFR 478.147 - Return of firearm. (United States)


    ... 27 Alcohol, Tobacco Products and Firearms 3 2010-04-01 2010-04-01 false Return of firearm. 478.147 Section 478.147 Alcohol, Tobacco Products, and Firearms BUREAU OF ALCOHOL, TOBACCO, FIREARMS, AND EXPLOSIVES, DEPARTMENT OF JUSTICE FIREARMS AND AMMUNITION COMMERCE IN FIREARMS AND AMMUNITION Exemptions...

  11. 32 CFR 147.9 - Guideline G-Alcohol consumption. (United States)


    ... 32 National Defense 1 2010-07-01 2010-07-01 false Guideline G-Alcohol consumption. 147.9 Section... Adjudication § 147.9 Guideline G—Alcohol consumption. (a) The concern. Excessive alcohol consumption often... worker who is a staff member of a recognized alcohol treatment program; (5) Habitual or binge consumption...

  12. 21 CFR 133.147 - Grated American cheese food. (United States)


    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Grated American cheese food. 133.147 Section 133...) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.147 Grated American cheese food. (a)(1) Grated American cheese food is...

  13. 40 CFR 147.1 - Purpose and scope. (United States)


    ... provisions of 40 CFR parts 124, 144, 145 and 146. A Federally-administered program is promulgated in those... of 40 CFR parts 124, 144, 146, and 148, and any other additional requirements pertinent to the... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Purpose and scope. 147.1 Section 147.1...

  14. 45 CFR 147.130 - Coverage of preventive health services. (United States)


    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Coverage of preventive health services. 147.130... § 147.130 Coverage of preventive health services. (a) Services—(1) In general. Beginning at the time... rating of A or B in the current recommendations of the United States Preventive Services Task Force with...

  15. 40 CFR 147.3005 - Radioactive waste injection wells. (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Radioactive waste injection wells. 147... the Navajo, Ute Mountain Ute, and All Other New Mexico Tribes § 147.3005 Radioactive waste injection... dispose of radioactive waste (as defined in 10 CFR part 20, appendix B, table II, but not including high...

  16. 40 CFR 147.2921 - Schedule of compliance. (United States)


    ...-Class II Wells § 147.2921 Schedule of compliance. The permit may, when appropriate, specify a schedule... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Schedule of compliance. 147.2921.... (a) Any schedule of compliance shall require compliance as soon as possible, and in no case later...

  17. 40 CFR 98.147 - Records that must be retained. (United States)


    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Records that must be retained. 98.147... (CONTINUED) MANDATORY GREENHOUSE GAS REPORTING Glass Production § 98.147 Records that must be retained. In addition to the information required by § 98.3(g), you must retain the records listed in paragraphs (a), (b...

  18. 14 CFR 147.21 - General curriculum requirements. (United States)


    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false General curriculum requirements. 147.21... Requirements § 147.21 General curriculum requirements. (a) An applicant for an aviation maintenance technician school certificate and rating, or for an additional rating, must have an approved curriculum that is...

  19. 14 CFR 147.38 - Maintenance of curriculum requirements. (United States)


    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Maintenance of curriculum requirements. 147... § 147.38 Maintenance of curriculum requirements. (a) Each certificated aviation maintenance technician school shall adhere to its approved curriculum. With FAA approval, curriculum subjects may be taught at...

  20. 19 CFR 147.43 - Entry under the Customs laws. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Entry under the Customs laws. 147.43 Section 147.43 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF... the Customs laws. (a) Payment of duties and taxes. Any applicable duties and internal revenue taxes on...

  1. 9 CFR 147.22 - Hatching egg sanitation. (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Hatching egg sanitation. 147.22... AGRICULTURE LIVESTOCK IMPROVEMENT AUXILIARY PROVISIONS ON NATIONAL POULTRY IMPROVEMENT PLAN Sanitation Procedures § 147.22 Hatching egg sanitation. Hatching eggs should be collected from the nests at frequent...

  2. 33 CFR 147.1104 - Platform ELLEN & ELLY safety zone. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Platform ELLEN & ELLY safety zone. 147.1104 Section 147.1104 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... serving either structure, (2) a vessel under 100 feet in length overall not engaged in towing, or (3) a...

  3. 7 CFR 762.147 - Servicing shared appreciation agreements. (United States)


    ... service the account in accordance with § 762.149. (4) Paying the Agency. Any shared appreciation... 7 Agriculture 7 2010-01-01 2010-01-01 false Servicing shared appreciation agreements. 762.147 Section 762.147 Agriculture Regulations of the Department of Agriculture (Continued) FARM SERVICE AGENCY...

  4. 7 CFR 58.147 - Insect and rodent control program. (United States)



  5. Time-of-flight and activation experiments on 147Pm and 171Tm for astrophysics

    Directory of Open Access Journals (Sweden)

    Guerrero C.


    Full Text Available The neutron capture cross section of several key unstable isotopes acting as branching points in the s-process are crucial for stellar nucleosynthesis studies, but they are very challenging to measure due to the difficult production of sufficient sample material, the high activity of the resulting samples, and the actual (n,γ measurement, for which high neutron fluxes and effective background rejection capabilities are required. As part of a new program to measure some of these important branching points, radioactive targets of 147Pm and 171Tm have been produced by irradiation of stable isotopes at the ILL high flux reactor. Neutron capture on 146Nd and 170Er at the reactor was followed by beta decay and the resulting matrix was purified via radiochemical separation at PSI. The radioactive targets have been used for time-of-flight measurements at the CERN n_TOF facility using the 19 and 185 m beam lines during 2014 and 2015. The capture cascades were detected using a set of four C6D6 scintillators, allowing to observe the associated neutron capture resonances. The results presented in this work are the first ever determination of the resonance capture cross section of 147Pm and 171Tm. Activation experiments on the same 147Pm and 171Tm targets with a high-intensity 30 keV quasi-Maxwellian flux of neutrons will be performed using the SARAF accelerator and the Liquid-Lithium Target (LiLiT in order to extract the corresponding Maxwellian Average Cross Section (MACS. The status of these experiments and preliminary results will be presented and discussed as well.

  6. Time-of-flight and activation experiments on 147Pm and 171Tm for astrophysics (United States)

    Guerrero, C.; Lerendegui-Marco, J.; Domingo-Pardo, C.; Casanovas, A.; Dressler, R.; Halfon, S.; Heinitz, S.; Kivel, N.; Köster, U.; Paul, M.; Quesada-Molina, J. M.; Schumann, D.; Tarifeño-Saldivia, A.; Tessler, M.; Weissman, L.; Aberle, O.; Andrzejewski, J.; Audouin, L.; Bacak, M.; Balibrea, J.; Barbagallo, M.; Becvar, F.; Berthoumieux, E.; Billowes, J.; Bosnar, D.; Brown, A.; Caamaño, M.; Calviño, F.; Calviani, M.; Cano-Ott, D.; Cardella, R.; Cerutti, F.; Chen, Y. H.; Chiaveri, E.; Colonna, N.; Cortés, G.; Cortés-Giraldo, M. A.; Cosentino, L.; Damone, L. A.; Diakaki, M.; Dupont, E.; Durán, I.; Fernández-Domínguez, B.; Ferrari, A.; Ferreira, P.; Finocchiaro, P.; Göbel, K.; García, A. R.; Gawlik, A.; Gilardoni, S.; Glodariu, T.; Gonçalves, I. F.; González, E.; Griesmayer, E.; Gunsing, F.; Harada, H.; Heyse, J.; Jenkins, D. G.; Jericha, E.; Käppeler, F.; Kadi, Y.; Kalamara, A.; Kavrigin, P.; Kimura, A.; Kivel, N.; Kokkoris, M.; Krticka, M.; Kurtulgil, D.; Leal-Cidoncha, E.; Lederer, C.; Leeb, H.; Meo, S. Lo; Lonsdale, S. J.; Macina, D.; Marganiec, J.; Martínez, T.; Masi, A.; Massimi, C.; Mastinu, P.; Mastromarco, M.; Maugeri, E. A.; Mazzone, A.; Mendoza, E.; Mengoni, A.; Milazzo, P. M.; Mingrone, F.; Musumarra, A.; Negret, A.; Nolte, R.; Oprea, A.; Patronis, N.; Pavlik, A.; Perkowski, J.; Porras, I.; Praena, J.; Radeck, D.; Rauscher, T.; Reifarth, R.; Rout, P. C.; Rubbia, C.; Ryan, J. A.; Sabaté-Gilarte, M.; Saxena, A.; Schillebeeckx, P.; Smith, A. G.; Sosnin, N. V.; Stamatopoulos, A.; Tagliente, G.; Tain, J. L.; Tassan-Got, L.; Tsinganis, A.; Valenta, S.; Vannini, G.; Variale, V.; Vaz, P.; Ventura, A.; Vlachoudis, V.; Vlastou, R.; Wallner, A.; Warren, S.; Weiss, C.; Woods, P. J.; Wright, T.; Žugec, P.


    The neutron capture cross section of several key unstable isotopes acting as branching points in the s-process are crucial for stellar nucleosynthesis studies, but they are very challenging to measure due to the difficult production of sufficient sample material, the high activity of the resulting samples, and the actual (n,γ) measurement, for which high neutron fluxes and effective background rejection capabilities are required. As part of a new program to measure some of these important branching points, radioactive targets of 147Pm and 171Tm have been produced by irradiation of stable isotopes at the ILL high flux reactor. Neutron capture on 146Nd and 170Er at the reactor was followed by beta decay and the resulting matrix was purified via radiochemical separation at PSI. The radioactive targets have been used for time-of-flight measurements at the CERN n_TOF facility using the 19 and 185 m beam lines during 2014 and 2015. The capture cascades were detected using a set of four C6D6 scintillators, allowing to observe the associated neutron capture resonances. The results presented in this work are the first ever determination of the resonance capture cross section of 147Pm and 171Tm. Activation experiments on the same 147Pm and 171Tm targets with a high-intensity 30 keV quasi-Maxwellian flux of neutrons will be performed using the SARAF accelerator and the Liquid-Lithium Target (LiLiT) in order to extract the corresponding Maxwellian Average Cross Section (MACS). The status of these experiments and preliminary results will be presented and discussed as well.

  7. Effectiveness of radiation synovectomy with samarium-{sup 153} particulate hydroxyapatite in rheumatoid arthritis patients with knee synovitis: a controlled randomized double-blind trial

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Marla Francisca dos; Furtado, Rita Nely Vilar; Konai, Monique Sayuri; Natour, Jamil, E-mail: jnatour@unifesp.b [Universidade Federal de Sao Paulo (UNIFESP-EPM), Sao Paulo, SP (Brazil). Divisao de Reumatologia; Castiglioni, Mario Luiz Vieira; Marchetti, Renata Rosa [Universidade Federal de Sao Paulo (UNIFESP-EPM), Sao Paulo, SP (Brazil). Divisao de Medicina Nuclear


    Objectives: the aim of the present study was to investigate the effectiveness of Samarium{sup 153}-particulate hydroxyapatite radiation synovectomy in rheumatoid arthritis patients with chronic knee synovitis. Methods: fifty-eight rheumatoid arthritis patients (60 knees) with chronic knee synovitis participated in a controlled double-blinded trial. Patients were randomized to receive either an intra-articular injection with 40 mg triamcinolone hexacetonide alone (TH group) or 40 mg triamcinolone hexacetonide combined with 15 mCi Samarium{sup 153}-particulate hydroxyapatite (Sm/TH group). Blinded examination at baseline (T0) and at 1 (T1), 4 (T4), 12 (T12), 32 (T32), and 48 (T48) weeks post-intervention were performed on all patients and included a visual analog scale for joint pain and swelling as well as data on morning stiffness, flexion, extension, knee circumference, Likert scale of improvement, percentage of improvement, SF-36 generic quality of life questionnaire, Stanford Health Assessment Questionnaire (HAQ), Lequesne index, use of non-steroidal anti-inflammatory drugs or oral corticosteroids, events and adverse effects, calls to the physician, and hospital visits. Results: the sample was homogeneous at baseline, and there were no withdrawals. Improvement was observed in both groups in relation to T0, but no statistically significant differences between groups were observed regarding all variables at the time points studied. The Sm/TH group exhibited more adverse effects at T1 (p<0.05), but these were mild and transitory. No severe adverse effects were reported during follow-up. Conclusion: intra-articular injection of Samarium{sup 153}-particulate hydroxyapatite (15 mCi) with 40 mg of triamcinolone hexacetonide is not superior to triamcinolone hexacetonide alone for the treatment of knee synovitis in patients with rheumatoid arthritis at 1 y of follow-up. (author)

  8. In vitro and in vivo prostate cancer metastasis and chemoresistance can be modulated by expression of either CD44 or CD147.

    Directory of Open Access Journals (Sweden)

    Jingli Hao

    Full Text Available CD44 and CD147 are associated with cancer metastasis and progression. Our purpose in the study was to investigate the effects of down-regulation of CD44 or CD147 on the metastatic ability of prostate cancer (CaP cells, their docetaxel (DTX responsiveness and potential mechanisms involved in vitro and in vivo. CD44 and CD147 were knocked down (KD in PC-3M-luc CaP cells using short hairpin RNA (shRNA. Expression of CD44, CD147, MRP2 (multi-drug resistance protein-2 and MCT4 (monocarboxylate tranporter-4 was evaluated using immunofluorescence and Western blotting. The DTX dose-response and proliferation was measured by MTT and colony assays, respectively. The invasive potential was assessed using a matrigel chamber assay. Signal transduction proteins in PI3K/Akt and MAPK/Erk pathways were assessed by Western blotting. An in vivo subcutaneous (s.c. xenograft model was established to assess CaP tumorigenecity, lymph node metastases and DTX response. Our results indicated that KD of CD44 or CD147 decreased MCT4 and MRP2 expression, reduced CaP proliferation and invasive potential and enhanced DTX sensitivity; and KD of CD44 or CD147 down-regulated p-Akt and p-Erk, the main signal modulators associated with cell growth and survival. In vivo, CD44 or CD147-KD PC-3M-luc xenografts displayed suppressed tumor growth with increased DTX responsiveness compared to control xenografts. Both CD44 and CD147 enhance metastatic capacity and chemoresistance of CaP cells, potentially mediated by activation of the PI3K and MAPK pathways. Selective targeting of CD44/CD147 alone or combined with DTX may limit CaP metastasis and increase chemosensitivity, with promise for future CaP treatment.

  9. The properties of samarium-doped zinc oxide/phthalocyanine structure for optoelectronics prepared by pulsed laser deposition and organic molecular evaporation

    Czech Academy of Sciences Publication Activity Database

    Novotný, Michal; Marešová, Eva; Fitl, Přemysl; Vlček, Jan; Bergmann, M.; Vondráček, Martin; Yatskiv, Roman; Bulíř, Jiří; Hubík, Pavel; Hruška, Petr; Drahokoupil, Jan; Abdellaoui, N.; Vrňata, M.; Lančok, Ján


    Roč. 122, č. 3 (2016), 1-8, č. článku 225. ISSN 0947-8396 R&D Projects: GA MŠk(CZ) LG15050; GA ČR(CZ) GAP108/11/0958; GA MŠk(CZ) LM2011029; GA ČR(CZ) GA14-10279S; GA MŠk(CZ) 7AMB14FR010 Institutional support: RVO:68378271 ; RVO:67985882 Keywords : samarium-doped zinc oxide zinc/phthalocyanine deposition * evaporation * pulsed laser deposition * thin films Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.455, year: 2016

  10. Neutron Activated Samarium-153 Microparticles for Transarterial Radioembolization of Liver Tumour with Post-Procedure Imaging Capabilities (United States)

    Hashikin, Nurul Ab. Aziz; Yeong, Chai-Hong; Abdullah, Basri Johan Jeet; Ng, Kwan-Hoong; Chung, Lip-Yong; Dahalan, Rehir; Perkins, Alan Christopher


    Introduction Samarium-153 (153Sm) styrene divinylbenzene microparticles were developed as a surrogate for Yttrium-90 (90Y) microspheres in liver radioembolization therapy. Unlike the pure beta emitter 90Y, 153Sm possess both therapeutic beta and diagnostic gamma radiations, making it possible for post-procedure imaging following therapy. Methods The microparticles were prepared using commercially available cation exchange resin, Amberlite IR-120 H+ (620–830 μm), which were reduced to 20–40 μm via ball mill grinding and sieve separation. The microparticles were labelled with 152Sm via ion exchange process with 152SmCl3, prior to neutron activation to produce radioactive 153Sm through 152Sm(n,γ)153Sm reaction. Therapeutic activity of 3 GBq was referred based on the recommended activity used in 90Y-microspheres therapy. The samples were irradiated in 1.494 x 1012 neutron flux for 6 h to achieve the nominal activity of 3.1 GBq.g-1. Physicochemical characterisation of the microparticles, gamma spectrometry, and in vitro radiolabelling studies were carried out to study the performance and stability of the microparticles. Results Fourier Transform Infrared (FTIR) spectroscopy of the Amberlite IR-120 resins showed unaffected functional groups, following size reduction of the beads. However, as shown by the electron microscope, the microparticles were irregular in shape. The radioactivity achieved after 6 h neutron activation was 3.104 ± 0.029 GBq. The specific activity per microparticle was 53.855 ± 0.503 Bq. Gamma spectrometry and elemental analysis showed no radioactive impurities in the samples. Radiolabelling efficiencies of 153Sm-Amberlite in distilled water and blood plasma over 48 h were excellent and higher than 95%. Conclusion The laboratory work revealed that the 153Sm-Amberlite microparticles demonstrated superior characteristics for potential use in hepatic radioembolization. PMID:26382059

  11. [Expression and significance of CD147 protein in prostate cancer]. (United States)

    He, Hui-Chan; Han, Zhao-Dong; Dai, Qi-Shan; Zou, Jun; Zhang, Yang; Zhang, Zheng; Liang, Yu-Xiang; Ye, Yong-Kang; Chen, Zhi-Nan; Zhong, Wei-De


    To investigate the expression of CD147 in prostate cancer and discuss its diagnostic value in prostate cancer. The method of immunohistochemical SP was employed to detect the expression of CD147 in 101 cases of prostate cancer, 90 cases of benign prostatic hyperplasia, 36 cases of normal prostate and 15 cases of embryonic prostate by so as to evaluate its clinical significance in the histological classification and prognosis of prostate cancer. The CD147 expression was positively expressed in 67/101 (66.3%) of prostate cancer, 21/90 (23.3%) of benign prostatic hypertrophy, 2/36 (5.6%) of normal prostate and 0/15 (0.0) of embryonic prostate respectively. A positive expression of CD147 was dramatically associated with TNM stage (P prostatic capsule invasion (P = 0.002) and histological grade (P = 0.006). The detection of CD147 is helpful to raise the early diagnosis rate of prostate cancer. It will become a tumor marker of reflecting the malignant degree and predicting the prognosis of prostate cancer.

  12. Preparation and examination of properties of samarium-153-EDTMP complex; Otrzymywanie chelatu kwasu etylenodiaminotetrametylenofosfonowego (EDTMP) z samarem-153 i badanie jego wlasciwosci

    Energy Technology Data Exchange (ETDEWEB)

    Nowak, M. [Institute of Atomic Energy, Otwock-Swierk (Poland); Garnuszek, P.; Lukasiewicz, A.; Wozniak, I.; Zulczyk, W. [Osrodek Badawczo-Rozwojowy Izotopow, Otwock-Swierk (Poland); Licinska, I. [Instytut Lekow, Warsaw (Poland)


    Preparation and properties of ethylenediaminetetramethylenephosphonic acid (EDTMP) as well as some properties of {sup 153}Sm-EDTMP chelate have been examined. The chelate formed by samarium-153 (46.3 h, {beta}{sup -}-decay) with EDTMP exhibits high bone uptake and can be used for treatment of disseminated, painful skeletal metastases. The purity and stability of solutions of {sup 153}Sm-EDTMP chelate were examined in a broad range of samarium concentration and {sup 153}Sm specific activity. The complex under study was examined by radio-TLC, -electrophoresis and radio-HPLC. The results obtained suggest the small size of molecules of {sup 153}Sm-EDTMP chelate as compared with molecules of ``free``EDTMP. The results of biodistribution of {sup 153}Sm-EDTMP determined in rats indicate the quick blood clearance, high deposition of radioactivity in bone and quick excretion of radioactivity into urine. No specific uptake of {sup 153}Sm-EDTMP in extra-skeletal organs was found. (author). 42 refs, 13 figs, 22 tabs.

  13. Neutron Capture Cross Sections of the s-Process Branching Points 147Pm, 171Tm, and 204Tl (United States)

    Guerrero, Carlos; Domingo-Pardo, Cesar; Lerendegui-Marco, Jorge; Casanovas, Adria; Cortes-Giraldo, Miguel A.; Dressler, Rugard; Halfon, Shlomi; Heinitz, Stephan; Kivel, Niko; Köster, Ulli; Paul, Michael; Quesada-Molina, Jose Manuel; Schumann, Dorothea; Tarifeño-Saldivia, Ariel; Tessler, Moshe; Weissman, Leo

    The neutron capture cross section of several key unstable isotopes acting as branching points in the s-process are crucial for stellar nucleosynthesis studies, but they are very challenging to measure due to the difficult production of sufficient sample material, the high activity of the resulting samples, and the actual (n, γ) measurement, for which high neutron fluxes and effective background rejection capabilities are required. As part of a new program to measure some of these important branching points, radioactive targets of 147Pm, 171Tm, and 204Tl have been produced by irradiation of stable isotopes (146Nd, 170Er, and 203Tl) at the Institut Laue-Langevin (ILL) high flux reactor. After breeding in the reactor and a certain cooling period, the resulting mixed 204Tl/203Tl sample was used directly while 147Pm and 171Tm were radiochemically separated in non-carrier-added quality at the Paul Scherrer Institut (PSI), then prepared as targets. A set of theses samples has been used for time-of-flight measurements at the CERN n_TOF facility using the 19 and 185 m beam lines, during 2014 and 2015. The capture cascades were detected with a set of four C6D6 scintillators, allowing to observe the associated neutron capture resonances. The results presented in this work are the first ever determination of the resonance capture cross sections of 147Pm, 171Tm, and 204Tl. Activation experiments on the same 147Pm and 171Tm targets with a high-intensity quasi-Maxwellian flux of neutrons have been performed using the SARAF accelerator and the Liquid-Lithium Target (LiLiT) in order to extract the corresponding Maxwellian Average Cross Section (MACS). The experimental setups are here described together with the first, preliminary results of the n_TOF measurement.

  14. Biological studies of samarium-153 bleomycin complex in human breast cancer murine xenografts for therapeutic applications

    Energy Technology Data Exchange (ETDEWEB)

    Bahrami-Samani, A. [Faculty of Nuclear Engineering and Physics, Amirkabir Univ. of Tech., Tehran (Iran); Ghannadi-Maragheh, M. [Faculty of Nuclear Engineering and Physics, Amirkabir Univ. of Tech., Tehran (Iran); Radiopharmaceutical Research and Development Lab. (RRDL), Nuclear Science and Technology Research Inst. (NSTRI), Tehran (Iran); Jalilian, A.R.; Mazidi, M. [Radiopharmaceutical Research and Development Lab. (RRDL), Nuclear Science and Technology Research Inst. (NSTRI), Tehran (Iran)


    In this work, a potential therapeutic DNA targeting agent, {sup 153}Sm-bleomycin complex ({sup 153}Sm-BLM), was developed and the tumor accumulation studies were performed using single photon emission computed tomography (SPECT) and scarification studies. {sup 153}Sm-BLM was prepared at optimized conditions (room temperature, 4-8 h, 0.1 mg bleomycin for 740-3700 MBq {sup 153}SmCl{sub 3}, radiochemical purity over 98%, HPLC, specific activity = 55 TBq/mmol). {sup 153}Sm-BLM was administered into human breast cancer murine xenografts and the biodistribution and imaging studies were performed up to 48 h. {sup 153}Sm-BLM demonstrated superior tumor accumulation properties in contrast with the other radiolabeled bleomycins with tumor:blood ratios of 41, 72 and 182 at 4, 24 and 48 h, respectively, and tumor:muscle ratios of 23, 33 and > 1490 at 4, 24 and 48 h, respectively, while administered intravenously. The SPECT images also demonstrated the obvious tumor uptake at the chest region of the breast-tumor bearing mice. These initial experiments demonstrate significant accumulation of {sup 153}Sm-BLM in tumor tissues. (orig.)

  15. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints

    Directory of Open Access Journals (Sweden)

    Mohammed Najeeb Al Hallak


    Full Text Available 153Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate and Samarium-153 [1]. 153Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of 153Sm-EDTMP leads to contamination with 154Eu (Europium-154 [2]. A previous study only alluded to the retention of 154Eu in the bones after receiving treatment with 153Sm-EDTMP [2]. Activation of the alarm at security checkpoints after 153Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received 153Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing theAmerican-Canadian border. We assume that the 154Eu which remained in the patients’ bones activated the sensors. Methods: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received 153Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. Results: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of 154Eu emissions. Conclusion: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of 154Eu retained in patients who received 153Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of 153Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with 153Sm-EDTMP at Roger Maris Cancer Center

  16. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints. (United States)

    Najeeb Al Hallak, Mohammed; McCurdy, Matt; Zouain, Nicolas; Hayes, Justin


    (153)Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate) and Samarium-153 [1]. (153)Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of (153)Sm-EDTMP leads to contamination with (154)Eu (Europium-154) [2]. A previous study only alluded to the retention of (154)Eu in the bones after receiving treatment with (153)Sm-EDTMP [2]. Activation of the alarm at security checkpoints after (153)Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received (153)Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA) activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing the American-Canadian border. We assume that the (154)Eu which remained in the patients' bones activated the sensors. METHODS: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received (153)Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. RESULTS: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of (154)Eu emissions. CONCLUSION: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of (154)Eu retained in patients who received (153)Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of (153)Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with (153)Sm-EDTMP at Roger Maris Cancer

  17. Phenotype abnormality: 147 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 147 decreased efficiency... in organ named cotyledon during process named cell-cell adhesion ... cotyledon ... decreased efficiency ... cell-cell adhesion ...

  18. 40 CFR 147.2903 - Prohibition of unauthorized injection. (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Prohibition of unauthorized injection... PROGRAMS (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Osage Mineral Reserve-Class II Wells § 147.2903 Prohibition of unauthorized injection. (a) Any underground...

  19. 45 CFR 147.126 - No lifetime or annual limits. (United States)


    ... HEALTH INSURANCE REFORM REQUIREMENTS FOR THE GROUP AND INDIVIDUAL HEALTH INSURANCE MARKETS § 147.126 No... health insurance coverage on the first day of the first plan year (in the individual market, policy year... section, a group health plan, or a health insurance issuer offering group or individual health insurance...

  20. 40 CFR 147.2500 - State-administered program. (United States)


    ... Statutes Annotated (West 1974 and Supp. 1983); (3) Chapter 162, Pure Drinking Water, Wisconsin Statutes... Section 147.2500 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS... NR 113, Servicing Septic Tanks, Seepage Pits, Grease Traps or Privies, Wisconsin Administrative Code...

  1. 46 CFR 147.45 - Flammable and combustible liquids. (United States)


    ... Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) DANGEROUS CARGOES HAZARDOUS SHIPS' STORES... gasoline and diesel oil), other than liquids used as fuel for cooking, heating, and lighting under § 147.50... equipment must be stored in— (1) Integral tanks that form part of the vessel's structure; (2) An independent...

  2. 40 CFR 147.901 - EPA-administered program. (United States)


    ... lands, is administered by EPA. This program consists of the UIC program requirements of 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the remainder of this subpart. Injection... (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Kentucky § 147.901 EPA...

  3. 40 CFR 147.751 - EPA-administered program. (United States)


    ... program consists of the UIC program requirements of 40 CFR parts 124, 144, 146, and 148 and the additional... (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Indiana § 147.751 EPA-administered program. (a) Contents. The UIC program for all classes of wells on Indian lands, and for Class I...

  4. 40 CFR 147.601 - EPA-administered program. (United States)


    ... administered by EPA. This program consists of the UIC program requirements of 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the remainder of this subpart. Injection well owners and... (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Hawaii § 147.601 EPA...

  5. 40 CFR 147.801 - EPA-administered program. (United States)


    ... administered by EPA. This program consists of the UIC program requirements of 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the remainder of this subpart. Injection well owners and... (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Iowa § 147.801 EPA...

  6. 40 CFR 147.101 - EPA-administered program. (United States)


    ... program requirements of 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the... (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Alaska § 147.101 EPA-administered program. (a) Contents. The UIC program in the State of Alaska for Class I, III, IV, and V wells...

  7. 40 CFR 147.151 - EPA-administered program. (United States)


    ... Navajo Indian lands consists of the UIC program requirements of 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the remainder of this subpart. Injection well owners and operators, and... (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Arizona § 147.151 EPA...

  8. 14 CFR Appendix D to Part 147 - Powerplant Curriculum Subjects (United States)


    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Powerplant Curriculum Subjects D Appendix D to Part 147 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION... starting systems (2) 17. Overhaul magneto and ignition harness. (2) 18. Inspect, service, troubleshoot, and...

  9. 45 CFR 147.100 - Basis and scope. (United States)


    ... Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES REQUIREMENTS RELATING TO HEALTH CARE ACCESS HEALTH INSURANCE REFORM REQUIREMENTS FOR THE GROUP AND INDIVIDUAL HEALTH INSURANCE MARKETS § 147.100 Basis and... Care Act that apply to group health plans and health insurance issuers in the Group and Individual...

  10. 45 CFR 147.128 - Rules regarding rescissions. (United States)



  11. 27 CFR 24.147 - Operations bond or unit bond. (United States)


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Operations bond or unit... § 24.147 Operations bond or unit bond. Notwithstanding the provisions of § 24.146, each person... amended, give an operations bond or unit bond in accordance with the applicable provisions of 27 CFR part...

  12. 14 CFR Appendix A to Part 147 - Curriculum Requirements (United States)


    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Curriculum Requirements A Appendix A to... to Part 147—Curriculum Requirements This appendix defines terms used in appendices B, C, and D of this part, and describes the levels of proficiency at which items under each subject in each curriculum...

  13. 14 CFR 406.147 - Notice of hearing. (United States)


    ... consolidated with aviation hearing under 14 CFR part 13 subpart G. With the consent of the administrative law... Aeronautics and Space COMMERCIAL SPACE TRANSPORTATION, FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF... Transportation Adjudications § 406.147 Notice of hearing. (a) Notice. The administrative law judge must give each...

  14. MicroRNAs 146a and 147b Biomarkers for Colorectal Tumor’s Localization

    Directory of Open Access Journals (Sweden)

    Inés Omrane


    Full Text Available The recently identified class of microRNAs (miRs provided a new insight into cancer research, since abnormalities of members of microRNAs family have been found in various types of cancer. However, the relationship between five miRNAs (miR146a, miR155, miR21, miR135a, and miR147b and colorectal cancer remains unclear. In the present study, we examined expression of these miRNAs in 25 pair-matched colon cancer tissues and normal colon mucosa. The expression levels of miR146a, miR155, miR21, miR135a, and miR147b were quantified by real-time PCR. We found that miR21, miR146a, and miR135a were all expressed at higher levels in colon tumors. On the other hand, miR146a and miR147b expressions are significantly higher in left colon compared to right colon. These two miRs, especially miR146a, seemed to be markers for the left colon tumors. Moreover, significant proportional and inverse correlations were found between miR expressions in tumor and healthy tissue, and the correlations profiles were different depending on cancer localization. Taken together, these results lead us to suggest the presence of different mechanisms regulating miRs expression and consequently their target genes in left and right colon. So the pathway of colorectal carcinogenesis would be different according to the site of the tumor.

  15. Formation of a new adduct based on fullerene tris-malonate samarium salt C60-[C60(=C(COO)2)3]Sm2 (United States)

    Petrov, A. A.; Keskinov, V. A.; Semenov, K. N.; Charykov, N. A.; Letenko, D. G.; Nikitin, V. A.


    Gram quantities of a new adduct based on light fullerene tris-malonate samarium salt C60 [C60(=C(COO)2)3]Sm2 are obtained via the reaction of ion exchange. The obtained adduct is studied by means of electron and infrared spectroscopy, X-ray and elemental analysis, electron microscopy, and thermogravimetry. The polythermal solubility of [C60(=C(COO)2)3]Sm2 in water is determined in ampoules via saturation within 20-70°C. The composition of crystalline hydrate [C60(=C(COO)2)3]Sm2 · 36H2O, which exists in equilibrium with the saturated solution, is estimated.

  16. Biodistribution of samarium-153-EDTMP in rats treated with docetaxel Biodistribuição de EDTMP-153-samário em ratos tratados com docetaxel

    Directory of Open Access Journals (Sweden)

    Arthur Villarim Neto


    Full Text Available PURPOSE: Many patients with metastatic bone disease have to use radiopharmaceuticals associated with chemotherapy to relieve bone pain. The aim of this study was to assess the influence of docetaxel on the biodistribution of samarium-153-EDTMP in bones and other organs of rats. METHODS: Wistar male rats were randomly allocated into 2 groups of 6 rats each. The DS (docetaxel/samarium group received docetaxel (15 mg/kg intraperitoneally in two cycles 11 days apart. The S (samarium/control group rats were not treated with docetaxel. Nine days after chemotherapy, all the rats were injected with 0.1ml of samarium-153-EDTMP via orbital plexus (25µCi. After 2 hours, the animals were killed and samples of the brain, thyroid, lung, heart, stomach, colon, liver, kidney and both femurs were removed. The percentage radioactivity of each sample (% ATI/g was determined in an automatic gamma-counter (Wizard-1470, Perkin-Elmer, Finland. RESULTS: On the 9th day after the administration of the 2nd chemotherapy cycle, the rats had a significant weight loss (314.50±22.09g compared (pOBJETIVO: Muitos pacientes com metástases ósseas são tratados com radiofármacos associados com quimioterapia para alívio da dor óssea. O objetivo do trabalho foi estudar a influência do docetaxel na biodistribuição do EDTMP-153-samário nos ossos e outros órgãos de ratos. MÉTODOS: Ratos Wistar foram aleatoriamente alocados em 2 grupos de 6 animais cada. O grupo DS (docetaxel/samário recebeu docetaxel (15 mg/kg intraperitoneal em dois ciclos com 11 dias de intervalo. Os ratos do grupo S (samário/controle não foram tratados com docetaxel. Nove dias após a quimioterapia, todos os animais receberam 0,1ml de EDTMP-153-samário via plexo orbital (25µCi. Após 2 horas, os animais foram mortos e feitas biópsias de cérebro, tireóide, pulmão, coração, estômago, cólon, fígado, rim e fêmures. O percentual de radioatividade por grama (%ATI/g de tecido de cada bi

  17. Fermi-LAT Observation of Supernova Remnant S147

    Energy Technology Data Exchange (ETDEWEB)

    Katsuta, J.; Uchiyama, Y.; Tanaka, T.; /SLAC /KIPAC, Menlo Park; Tajima, H.; /SLAC /KIPAC, Menlo Park /Nagoya U., Solar-Terrestrial Environ. Lab.; Bechtol, K.; Funk, S.; Lande, J.; /SLAC /KIPAC, Menlo Park; Ballet, J.; /AIM, Saclay; Hanabata, Y.; /Hiroshima U.; Lemoine-Goumard, M.; /CENBG, Gradignan; Takahashi, T.; /JAXA, Sagamihara


    We present an analysis of gamma-ray data obtained with the Large Area Telescope (LAT) onboard the Fermi Gamma-ray Space Telescope in the region around SNR S147 (G180.0-1.7). A spatially extended gamma-ray source detected in an energy range of 0.2-10 GeV is found to coincide with SNR S147. We confirm its spatial extension at >5{sigma} confidence level. The gamma-ray flux is (3.8 {+-} 0.6) x 10{sup -8} photons cm{sup -2} s{sup -1}, corresponding to a luminosity of 1.3 x 10{sup 34} (d/1.3 kpc){sup 2} erg s{sup -1} in this energy range. The gamma-ray emission exhibits a possible spatial correlation with prominent H{alpha} filaments of S147. There is no indication that the gamma-ray emission comes from the associated pulsar PSR J0538+2817. The gamma-ray spectrum integrated over the remnant is likely dominated by the decay of neutral {pi} mesons produced through the proton-proton collisions in the filaments. Reacceleration of pre-existing CRs and subsequent adiabatic compression in the filaments is sufficient to provide the required energy density of high-energy protons.


    Energy Technology Data Exchange (ETDEWEB)

    Katsuta, J.; Uchiyama, Y.; Tanaka, T.; Tajima, H.; Bechtol, K.; Funk, S.; Lande, J. [W. W. Hansen Experimental Physics Laboratory, Kavli Institute for Particle Astrophysics and Cosmology, Department of Physics and SLAC National Accelerator Laboratory, Stanford University, Stanford, CA 94305 (United States); Ballet, J. [Laboratoire AIM, CEA-IRFU/CNRS/Universite Paris Diderot, Service d' Astrophysique, CEA Saclay, 91191 Gif sur Yvette (France); Hanabata, Y. [Department of Physical Sciences, Hiroshima University, Higashi-Hiroshima, Hiroshima 739-8526 (Japan); Lemoine-Goumard, M. [Universite Bordeaux 1, CNRS/IN2p3, Centre d' Etudes Nucleaires de Bordeaux Gradignan, 33175 Gradignan (France); Takahashi, T., E-mail:, E-mail: [Institute of Space and Astronautical Science, Japanese Aerospace Exploration Agency, 3-1-1 Yoshinodai, Chuo-ku, Sagamihara, Kanagawa 252-5210 (Japan)


    We present an analysis of gamma-ray data obtained with the Large Area Telescope on board the Fermi Gamma-ray Space Telescope in the region around supernova remnant (SNR) S147 (G180.0-1.7). A spatially extended gamma-ray source detected in an energy range of 0.2-10 GeV is found to coincide with SNR S147. We confirm its spatial extension at >5{sigma} confidence level. The gamma-ray flux is (3.8 {+-} 0.6) Multiplication-Sign 10{sup -8} photons cm{sup -2} s{sup -1}, corresponding to a luminosity of 1.3 Multiplication-Sign 10{sup 34} (d/1.3 kpc){sup 2} erg s{sup -1} in this energy range. The gamma-ray emission exhibits a possible spatial correlation with the prominent H{alpha} filaments of SNR S147. There is no indication that the gamma-ray emission comes from the associated pulsar PSR J0538+2817. The gamma-ray spectrum integrated over the remnant is likely dominated by the decay of neutral {pi} mesons produced through the proton-proton collisions in the filaments. The reacceleration of the pre-existing cosmic rays and subsequent adiabatic compression in the filaments is sufficient to provide the energy density required of high-energy protons.

  19. CD147 promotes the formation of functional osteoclasts through NFATc1 signalling

    Energy Technology Data Exchange (ETDEWEB)

    Nishioku, Tsuyoshi, E-mail: [Department of Clinical Pharmacology, Faculty of Pharmaceutical Sciences, Nagasaki International University, 2825-7 Huis Ten Bosch, Sasebo, Nagasaki 859-3298 (Japan); Department of Pharmaceutical Care and Health Sciences, Faculty of Pharmaceutical Sciences, Fukuoka University, 8-19-1 Nanakuma, Jonan-ku, Fukuoka 814-0180 (Japan); Terasawa, Mariko; Baba, Misaki; Yamauchi, Atsushi; Kataoka, Yasufumi [Department of Pharmaceutical Care and Health Sciences, Faculty of Pharmaceutical Sciences, Fukuoka University, 8-19-1 Nanakuma, Jonan-ku, Fukuoka 814-0180 (Japan)


    CD147, a membrane glycoprotein of the immunoglobulin superfamily, is highly upregulated during dynamic cellular events including tissue remodelling. Elevated CD147 expression is present in the joint of rheumatoid arthritis patients. However, the role of CD147 in bone destruction remains unclear. To determine whether CD147 is involved in osteoclastogenesis, we studied its expression in mouse osteoclasts and its role in osteoclast differentiation and function. CD147 expression was markedly upregulated during osteoclast differentiation. To investigate the role of CD147 in receptor activator of nuclear factor-kappa B ligand (RANKL)-induced osteoclastogenesis and bone resorption activity, osteoclast precursor cells were transfected with CD147 siRNA. Decreased CD147 expression inhibited osteoclast formation and bone resorption, inhibited RANKL-induced nuclear translocation of the nuclear factor of activated T cells (NFAT) c1 and decreased the expression of the d2 isoform of vacuolar ATPase Vo domain and cathepsin K. Therefore, CD147 plays a critical role in the differentiation and function of osteoclasts by upregulating NFATc1 through the autoamplification of its expression in osteoclastogenesis. - Highlights: • CD147 expression was markedly upregulated during osteoclast differentiation. • Downregulation of CD147 expression inhibited osteoclastgenesis and bone resorption. • Decreased CD147 expression inhibited RANKL-induced nuclear translocation of NFATc1.

  20. 9 CFR 147.9 - Standard test procedures for avian influenza. (United States)


    ... influenza. 147.9 Section 147.9 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE... Blood Testing Procedures § 147.9 Standard test procedures for avian influenza. (a) The agar gel immunodiffusion (AGID) test should be considered the basic screening test for antibodies to Type A influenza...

  1. 46 CFR 147.15 - Hazardous ships' stores permitted on board vessels. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Hazardous ships' stores permitted on board vessels. 147... HAZARDOUS SHIPS' STORES General Provisions § 147.15 Hazardous ships' stores permitted on board vessels...' stores if the material— (a) Is labeled according to § 147.30; and (b) Meets the requirements, if any, in...

  2. 13 CFR 147.105 - Does this part apply to me? (United States)


    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Does this part apply to me? 147.105 Section 147.105 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (NONPROCUREMENT) Purpose and Coverage § 147.105 Does this part apply to me...

  3. 9 CFR 147.8 - Procedures for preparing egg yolk samples for diagnostic tests. (United States)


    ... samples for diagnostic tests. 147.8 Section 147.8 Animals and Animal Products ANIMAL AND PLANT HEALTH... a representative sample of 30 eggs collected from a single day's production from the flock, must be... IgG antibodies set forth for testing serum in § 147.7 (for these tests the resultant supernatant...

  4. 9 CFR 147.3 - The stained-antigen, rapid, whole-blood test. 3 (United States)


    ...-blood test. 3 147.3 Section 147.3 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE... Blood Testing Procedures § 147.3 The stained-antigen, rapid, whole-blood test. 3 3 The procedure... necessary. The test plate should be rocked from side to side a few times to mix the antigen and blood...

  5. The retinal specific CD147 Ig0 domain: from molecular structure to biological activity

    Energy Technology Data Exchange (ETDEWEB)

    Redzic, Jasmina S.; Armstrong, Geoffrey S.; Isern, Nancy G.; Jones, David N.M.; Kieft, Jeffrey S.; Eisenmesser, Elan Z.


    CD147 is a type I transmembrane protein that is involved in inflammatory diseases, cancer progression, and multiple human pathogens utilize CD147 for efficient infection. In several cancers, CD147 expression is so high that it is now used as a prognostic marker. The two primary isoforms of CD147 that are related to cancer progression have been identified, differing in their number of immunoglobulin (Ig)-like domains. These include CD147 Ig1-Ig2 that is ubiquitously expressed in most tissues and CD147 Ig0-Ig1-Ig2 that is retinal specific and implicated in retinoblastoma. However, little is known in regard to the retinal specific CD147 Ig0 domain despite its potential role in retinoblastoma. Thus, here we have extensively characterized the CD147 Ig0 domain by elucidating its three-dimensional structure through crystallography and its solution behavior through several biophysical methods that include nuclear magnetic resonance. Furthermore, we have utilized this data together with mutagenesis to probe the biological activity of CD147-containing proteins both with and without the CD147 Ig0 domain within several model cell lines. Our findings reveal that the CD147 Ig0 domain is a potent stimulator of interleukin-6, which is a well-known contributor to retinoblastoma and suggest that the CD147 Ig0 domain has its own receptor distinct from that of the other CD147 Ig-like domains, CD147 Ig1-Ig2. Furthermore, we show that the CD147 Ig0 dimer is the functional unit required for activity and can be disrupted by a single point mutation.

  6. Synthesis of samarium complexes with the derivative binder of Schiff Quinolinic base. Characterization and photophysical study; Sintesis de complejos de samario con el ligante derivado de base de Schiff Quinolinica. Caracterizacion y estudio fotofisico

    Energy Technology Data Exchange (ETDEWEB)

    Lucas H, J.


    In this work we determined the metal: binder stoichiometry of the species formed during the UV/Vis spectrophotometric titration of the derivative binder of Schiff quinolinic base, L1 with the samarium nitrate pentahydrate in methanol. Statistical analysis of the data allowed proposing the metal: binder stoichiometry for the synthesis of the complexes which was one mole of samarium salt by 2.5 moles of binder and thus favor the formation of complexes with 1M: 1L and 1M: 2L stoichiometries. They were synthesized in aqueous-organic medium (water-ethanol), isolated and purified two complexes with stoichiometry 1 Sm: 1 L1, complex 1 and 1 Sm: 2 L1, complex 2. The overall yield of the reaction was 76%. The characterization of the formed complexes was performed by visible ultraviolet spectrometry (UV/Vis), nuclear magnetic resonance, X-ray photoelectron spectroscopy (XP S), thermal gravimetric analysis with differential scanning calorimetry (TGA/DSC), and radial distribution function. These complexes were studied by fluorescence and emission phosphorescence at variable temperature. Spectroscopic techniques used in both solution and solid demonstrated the formation and stability of these complexes. In addition XP S indicated that in both complexes the samarium retains its oxidation state 3+. Luminescence studies indicated that there is intra-binding charge transfer which decreases the transfer of light energy from the binder to the samarium. Based on the experimental results, L1 binder molecules and complexes 1 and 2 were modeled that demonstrated the proposed Nc for each complex, as well as allowed to visualize the structural arrangement of the molecules, complexes and binder. (Author)

  7. Evaluation of (89Zr-labeled human anti-CD147 monoclonal antibody as a positron emission tomography probe in a mouse model of pancreatic cancer.

    Directory of Open Access Journals (Sweden)

    Aya Sugyo

    Full Text Available INTRODUCTION: Pancreatic cancer is an aggressive cancer and its prognosis remains poor. Therefore, additional effective therapy is required to augment and/or complement current therapy. CD147, high expression in pancreatic cancer, is involved in the metastatic process and is considered a good candidate for targeted therapy. CD147-specfic imaging could be useful for selection of appropriate patients. Therefore, we evaluated the potential of a fully human anti-CD147 monoclonal antibody 059-053 as a new positron emission tomography (PET probe for pancreatic cancer. METHODS: CD147 expression was evaluated in four pancreatic cancer cell lines (MIA Paca-2, PANC-1, BxPC-3, and AsPC-1 and a mouse cell line A4 as a negative control. Cell binding, competitive inhibition and internalization assays were conducted with (125I-, (67Ga-, or (89Zr-labeled 059-053. In vivo biodistribution of (125I- or (89Zr-labeled 059-053 was conducted in mice bearing MIA Paca-2 and A4 tumors. PET imaging with [(89Zr]059-053 was conducted in subcutaneous and orthotopic tumor mouse models. RESULTS: Among four pancreatic cancer cell lines, MIA Paca-2 cells showed the highest expression of CD147, while A4 cells had no expression. Immunohistochemical staining showed that MIA Paca-2 xenografts also highly expressed CD147 in vivo. Radiolabeled 059-053 specifically bound to MIA Paca-2 cells with high affinity, but not to A4. [(89Zr]059-053 uptake in MIA Paca-2 tumors increased with time from 11.0±1.3% injected dose per gram (ID/g at day 1 to 16.9±3.2% ID/g at day 6, while [(125I]059-053 uptake was relatively low and decreased with time, suggesting that 059-053 was internalized into tumor cells in vivo and (125I was released from the cells. PET with [(89Zr]059-053 clearly visualized subcutaneous and orthotopic tumors. CONCLUSION: [(89Zr]059-053 is a promising PET probe for imaging CD147 expression in pancreatic cancer and has the potential to select appropriate patients with CD147

  8. Pyrolysis result of polyethylene waste as fuel for solid oxide fuel cell with samarium doped-ceria (SDC)-carbonate as electrolyte (United States)

    Syahputra, R. J. E.; Rahmawati, F.; Prameswari, A. P.; Saktian, R.


    In this research, the result of pyrolysis on polyethylene was used as fuel for a solid oxide fuel cell (SOFC). The pyrolysis result is a liquid which consists of hydrocarbon chains. According to GC-MS analysis, the hydrocarbons mainly consist of C7 to C20 hydrocarbon chain. Then, the liquid was applied to a single cell of NSDC-L | NSDC | NSDC-L. NSDC is a composite SDC (samarium doped-ceria) with sodium carbonate. Meanwhile, NSDC-L is a composite of NSDC with LiNiCuO (LNC). NSDC and LNC were analyzed by X-ray diffraction to understand their crystal structure. The result shows that presence of carbonate did not change the crystal structure of SDC. SEM EDX analysis for fuel cell before and after being loaded with polyethylene oil to get information of element diffusion to the electrolyte. Meanwhile, the conductivity properties were investigated through impedance measurement. The presence of carbonate even increases the electrical conductivity. The single cell test with the pyrolysis result of polyethylene at 300 - 600 °C, found that the highest power density is at 600 °C with the maximum power density of 0.14 mW/cm2 and open circuit voltage of 0.4 Volt. Elemental analysis at three point spots of single cell NDSC-L |NSDC|NSDC-L found that a migration of ions was occurred during fuel operation at 300 - 600 °C.

  9. Effects of some rare earth and carbonate-based co-dopants on structural and electrical properties of samarium doped ceria (SDC) electrolytes for solid oxide fuel cells (United States)

    Anwar, Mustafa; Khan, Zuhair S.; Mustafa, Kamal; Rana, Akmal


    In the present study, samarium doped ceria (SDC) and SDC-based composite with the addition of K2CO3 were prepared by co-precipitation route and effects of pH of the solution and calcination temperature on microstructure of SDC and SDC-K2CO3, respectively, were investigated. Furthermore, experimentation was performed to investigate into the ionic conductivity of pure SDC by co-doping with yttrium i.e., YSDC, XRD and SEM studies show that the crystallite size and particle size of SDC increases with the increase in pH. The SEM images of all the samples of SDC synthesized at different pH values showed the irregular shaped and dispersed particles. SDC-K2CO3 was calcined at 600∘C, 700∘C and 800∘C for 4 h and XRD results showed that crystallite size increases while lattice strain, decreases with the increase in calcination temperature and no peaks were detected for K2CO3 as it is present in an amorphous form. The ionic conductivity of the electrolytes increases with the increase in temperature and SDC-K2CO3 shows the highest value of ionic conductivity as compared to SDC and YSDC. Chemical compatibility tests were performed between the co-doped electrolyte and lithiated NiO cathode at high temperature. It revealed that the couple could be used up to the temperature of 700∘C.

  10. Calculation of the Dose of Samarium-153-Ethylene Diamine Tetramethylene Phosphonate (153Sm-EDTMP as a Radiopharmaceutical for Pain Relief of bone Metastasis

    Directory of Open Access Journals (Sweden)

    Fatemeh Razghandi


    Full Text Available Introduction One of the important applications of nuclear physics in medicine is the use of radioactive elements as radiopharmaceuticals. Metastatic bone disease is the most common form of malignant bone tumors. Samarium-153-ethylene diamine tetramethylene phosphonate (153Sm-EDTMP as a radiopharmaceutical is used for pain palliation. This radiopharmaceutical usually emits beta particles, which have a high uptake in bone tissues. The purpose of this study was to calculate the radiation dose distribution of 153Sm-EDTMP in bone and other tissues, using MCNPX Monte Carlo code in the particle transport model. Materials and Methods Dose delivery to the bone was simulated by seeking radiopharmaceuticals on the bone surface. The phantom model had a simple cylindrical geometry and included bone, bone marrow, and soft tissue. Results The simulation results showed that a significant amount of radiation dose was delivered to the bone by the use of this radiopharmaceutical. Conclusion Thebone acted as a fine protective shield against rays for the bone marrow. Therefore, the trivial absorbed dose by the bone marrow caused less damage to bone-making cells. Also, the high absorbed dose of the bone could destroy cancer cells and relieve the pain in the bone.

  11. The level of CD147 expression correlates with cyclophilin-induced signalling and chemotaxis

    Directory of Open Access Journals (Sweden)

    Constant Stephanie


    Full Text Available Abstract Background Previous studies identified CD147 as the chemotactic receptor on inflammatory leukocytes for extracellular cyclophilins (eCyp. However, CD147 is not known to associate with signal transducing molecules, so other transmembrane proteins, such as proteoglycans, integrins, and CD98, were suggested as receptor or co-receptor for eCyp. CD147 is ubiquitously expressed on many cell types, but relationship between the level of CD147 expression and cellular responses to eCyp has never been analyzed. Given the role of eCyp in pathogenesis of many diseases, it is important to know whether cellular responses to eCyp are regulated at the level of CD147 expression. Results Here, we manipulated CD147 expression levels on HeLa cells using RNAi and investigated the signalling and chemotactic responses to eCypA. Both Erk activation and chemotaxis correlated with the level of CD147 expression, with cells exhibiting low level expression being practically unresponsive to eCypA. Conclusions Our results provide the first demonstration of a chemotactic response of HeLa cells to eCypA, establish a correlation between the level of CD147 expression and the magnitude of cellular responses to eCypA, and indicate that CD147 may be a limiting factor in the receptor complex determining cyclophilin-induced Erk activation and cell migration.

  12. Tumor Vesicle—Associated CD147 Modulates the Angiogenic Capability of Endothelial Cells

    Directory of Open Access Journals (Sweden)

    Danilo Millimaggi


    Full Text Available Matrix metalloproteinase (MMP degradation of extracellular matrix is thought to play an important role in invasion, angiogenesis, tumor growth, and metastasis. Several studies have demonstrated that CD147/ extracellular MMP inducer, a membrane-spanning molecule highly expressed in tumor cells, may be involved in the progression of malignancies by regulating expression of MMP in peritumoral stromal cells. In the present study we show that CD147 is expressed in microvesicles derived from epithelial ovarian cancer cells and that CD147-positive vesicles may promote an angiogenic phenotype in endothelial cells in vitro. Vesicles shed by human ovarian carcinoma cell lines OVCAR3, SKOV3, and A2780 expressed different levels of CD147 and stimulated proangiogenic activities of human umbilical vein endothelial cells (HUVECs in a CD147-dependent fashion (OVCAR3 > SKOV3 > A2780. Moreover, vesicles shed by ovarian carcinoma cell line CABA I with low CD147 expression had no significant effect on the development of angiogenic phenotype in HUVECs. The treatment of OVCAR3 cells with small interfering RNA against CD147 suppressed the angiogenic potential of OVCAR3-derived microvesicles. However, transfection of CD147 cDNA into the CABA I cell line enabled CABA I-derived vesicles to induce angiogenesis and to promote MMP genes expression in HUVECs. We therefore conclude that vesicles shed by ovarian cancer cells may induce proangiogenic activities of HUVECs by a CD147-mediated mechanism.

  13. Identification of the neutron-rich nuclides /sup 147; 148/Ba and half- life determination of the heavy isotopes of Rb, Sr, Y, Cs, Ba and La

    CERN Document Server

    Amiel, S; Nir-El, Y; Shmid, M


    The neutron nuclides /sup 147; 148/Ba were produced in the thermal neutron induced fission of /sup 235/U. A new surface ionization integrated target ion source operating at temperatures in the region of 1800 degrees C permits the measurement of half-lives of isotopes down to about 0.1 sec due to the very fast release of atoms from the target. Isotopes of Rb, Sr, Cs, and Ba were separated by positive surface ionization and their half-lives measured using beta activity detected by a silicon surface barrier detector with a depletion depth of 300 mu . The isotopes /sup 147/Ba and /sup 148/Ba were identified for the first time and their half-lives were found to be 0.72+or-0.07 sec and 0.47+or-0.20 sec, respectively. (0 refs).

  14. 29 CFR 1910.147 - The control of hazardous energy (lockout/tagout). (United States)


    ... devices. Energy source. Any source of electrical, mechanical, hydraulic, pneumatic, chemical, thermal, or... 29 Labor 5 2010-07-01 2010-07-01 false The control of hazardous energy (lockout/tagout). 1910.147... § 1910.147 The control of hazardous energy (lockout/tagout). (a) Scope, application and purpose—(1) Scope...

  15. 9 CFR 147.11 - Laboratory procedure recommended for the bacteriological examination of salmonella. (United States)


    ... the bacteriological examination of salmonella. 147.11 Section 147.11 Animals and Animal Products... procedure recommended for the bacteriological examination of salmonella. (a) For egg- and meat-type chickens... 25 birds, and birds from Salmonella enteritidis (SE) positive environments should be cultured in...

  16. 9 CFR 147.26 - Procedures for establishing isolation and maintaining sanitation and good management practices... (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Procedures for establishing isolation... infections. 147.26 Section 147.26 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE... rodent population and other pests under control; (6) Tailor vaccination programs to needs of farm and...

  17. 40 CFR 147.501 - EPA-administered program-Class II wells and Indian lands. (United States)


    ... 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the remainder of this... wells and Indian lands. 147.501 Section 147.501 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION...

  18. 19 CFR 147.32 - Detail of officers to protect the revenue. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Detail of officers to protect the revenue. 147.32...; DEPARTMENT OF THE TREASURY (CONTINUED) TRADE FAIRS Customs Supervision § 147.32 Detail of officers to protect the revenue. The port director shall detail an officer to act as his representative at the fair and...

  19. 40 CFR 147.3016 - Criteria and standards applicable to Class V wells. (United States)


    ... Class V wells. 147.3016 Section 147.3016 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... standards applicable to Class V wells. In addition to the criteria and standards applicable to Class V wells... within the Class IV category but that are used to dispose of radioactive wastes (as defined in 10 CFR...

  20. 9 CFR 147.14 - Procedures to determine status and effectiveness of sanitation monitored program. (United States)


    ... effectiveness of sanitation monitored program. 147.14 Section 147.14 Animals and Animal Products ANIMAL AND... status and effectiveness of sanitation monitored program. The following monitoring procedures 10 may be... sanitation program. (1) Culture the surface of cased eggs periodically for fecal contaminating organisms as...

  1. Retention capacity of samarium (III) in zircon for it possible use in retaining walls for confinement of nuclear residues; Capacidad de retencion de samario (III) en circon para su posible uso en barreras de contencion para confinamiento de residuos nucleares

    Energy Technology Data Exchange (ETDEWEB)

    Garcia G, N


    Mexico, as country that produces part of its electric power by nuclear means, should put special emphasis in the development of technologies guided to the sure and long term confinement of the high level nuclear residuals. This work studies the capacity that has the natural zircon to retain to the samarium (III) in solution, by what due, firstly, to characterize the zircon for technical instrumental to determine the purity and characteristic of the mineral in study. The instrumental techniques that were used to carry out the physicochemical characterization were the neutron activation analysis (NAA), the infrared spectroscopy (IS), the thermal gravimetric analysis (TGA), scanning electron microscopy (SEM), transmission electron microscopy (TEM), semiquantitative analysis, dispersive energy spectroscopy (EDS), X-ray diffraction (XRD) and luminescence technique. The characterization of the surface properties carries out by means of the determination of the surface area using the BET multipoint technique, acidity constants, hydration time, the determination of the point of null charge (pH{sub PCN}) and density of surface sites (D{sub s}). The luminescence techniques were useful to determine the optimal point hydration of the zircon and for the quantification of the samarium, for that here intends the development of both analysis techniques. With the adjustment of the titration curves in the FITEQL 4 package the constants of surface acidity in the solid/liquid interface were determined. To the finish of this study it was corroborated that the zircon is a mineral that presents appropriate characteristics to be proposed as a contention barrier for the deep geologic confinement. With regard to the study of adsorption that one carries out the samarium retention it is superior to 90% under the described conditions. This investigation could also be applicable in the confinement of dangerous industrial residuals. (Author)

  2. Fabrication of catalytically active nanocrystalline samarium (Sm)-doped cerium oxide (CeO2) thin films using electron beam evaporation (United States)

    Kundu, Subrata; Sutradhar, Narottam; Thangamuthu, R.; Subramanian, B.; Panda, Asit Baran; Jayachandran, M.


    Samarium (Sm)-doped cerium oxide (CeO2) thin films were fabricated using electron beam evaporation technique. The synthesized films were deposited either on glass or ITO substrates and studied their nature by annealing at different temperatures. The optical properties and other morphological studies were done by UV-Vis, XRD, XPS, SEM, EDS, and FT-IR analysis. XRD and XPS analysis clearly confirm the presence of Sm in the ceria site. From the SEM study, it was found that after annealing at high temperature ( 300 or 500 °C), the particles size was reduced due to breakdown of large aggregates of particles which is also confirmed from UV-Vis, XPS, and XRD analyses. The FT-IR study proves the presence of -COO-, -OH, or ammonium group on the particles surface. The deposition of Sm-doped CeO2 nanomaterials was found more feasible on ITO substrate compared to that of glass substrate in terms of stability and depth of film thickness. The Sm-doped CeO2 nanomaterial acts as a re-usable catalyst for the reduction of organic dye molecules in the presence of NaBH4. The catalysis rate was compared by considering the electron transfer process during the reduction. The synthesized Sm-doped CeO2 thin films might find wide variety of applications in various emerging fields like solid oxide fuel cells (SOFCs), oxygen sensor or as catalyst in different types of organic and inorganic catalytic reactions. The fabrication process is very simple, straightforward, less time consuming, and cost effective.

  3. Fabrication of catalytically active nanocrystalline samarium (Sm)-doped cerium oxide (CeO{sub 2}) thin films using electron beam evaporation

    Energy Technology Data Exchange (ETDEWEB)

    Kundu, Subrata, E-mail: [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India); Sutradhar, Narottam [G. B. Marg, Central Salt and Marine Chemical Research Institute - CSIR (India); Thangamuthu, R.; Subramanian, B. [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India); Panda, Asit Baran [G. B. Marg, Central Salt and Marine Chemical Research Institute (CSIR) (India); Jayachandran, M., E-mail: [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India)


    Samarium (Sm)-doped cerium oxide (CeO{sub 2}) thin films were fabricated using electron beam evaporation technique. The synthesized films were deposited either on glass or ITO substrates and studied their nature by annealing at different temperatures. The optical properties and other morphological studies were done by UV-Vis, XRD, XPS, SEM, EDS, and FT-IR analysis. XRD and XPS analysis clearly confirm the presence of Sm in the ceria site. From the SEM study, it was found that after annealing at high temperature ({approx}300 or 500 Degree-Sign C), the particles size was reduced due to breakdown of large aggregates of particles which is also confirmed from UV-Vis, XPS, and XRD analyses. The FT-IR study proves the presence of -COO-, -OH, or ammonium group on the particles surface. The deposition of Sm-doped CeO{sub 2} nanomaterials was found more feasible on ITO substrate compared to that of glass substrate in terms of stability and depth of film thickness. The Sm-doped CeO{sub 2} nanomaterial acts as a re-usable catalyst for the reduction of organic dye molecules in the presence of NaBH{sub 4}. The catalysis rate was compared by considering the electron transfer process during the reduction. The synthesized Sm-doped CeO{sub 2} thin films might find wide variety of applications in various emerging fields like solid oxide fuel cells (SOFCs), oxygen sensor or as catalyst in different types of organic and inorganic catalytic reactions. The fabrication process is very simple, straightforward, less time consuming, and cost effective.Graphical Abstract.

  4. Solution characterization of the extracellular region of CD147 and its interaction with its enzyme ligand cyclophilin-A

    Energy Technology Data Exchange (ETDEWEB)

    Schlegel, Jennifer; Redzic, Jasmina S.; Porter, Christopher; Yurchenko, Vyacheslav; Bukrinsky, Michael; Labeikovsky, Wladimir; Armstrong, Geoffrey S.; Zhang, Fengli; Isern, Nancy G.; Degregori, James; Hodges, Robert; Eisenmesser, Elan Z.


    The CD147 receptor plays an integral role in numerous diseases by stimulating the expression of several protein families and serving as the receptor for extracellular cyclophilins, however, neither CD147 nor its interactions with its cyclophilin ligands have been well characterized in solution. CD147 is a unique protein in that it can function both at the cell membrane and after being released from cells where it continues to retain activity. Thus, the CD147 receptor functions through at least two mechanisms that include both cyclophilin-independent and cyclophilin-dependent modes of action. In regard to CD147 cyclophilin-independent activity, CD147 homophilic interactions are thought to underlie its activity. In regard to CD147 cyclophilin-dependent activity, cyclophilin/CD147 interactions may represent a novel means of signaling since cyclophilins are also peptidyl-prolyl isomerases.

  5. 9 CFR 147.10 - Laboratory procedure recommended for the bacteriological examination of egg-type breeding flocks... (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedure recommended for... environments. 147.10 Section 147.10 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE...) Enrichment culture of organ (non-intestinal) tissues using a non- selective broth, § 147.11(a)(2) of this...

  6. 40 CFR 147.2650 - State-administered program-Class I, II, III, IV, and V wells. (United States)


    ... CONTROL PROGRAMS Puerto Rico § 147.2650 State-administered program—Class I, II, III, IV, and V wells. The... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I, II, III, IV, and V wells. 147.2650 Section 147.2650 Protection of Environment ENVIRONMENTAL PROTECTION...

  7. 40 CFR 147.2000 - State-administered program-Class I, II, III, IV, and V wells. (United States)


    ... CONTROL PROGRAMS Rhode Island § 147.2000 State-administered program—Class I, II, III, IV, and V wells. The... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I, II, III, IV, and V wells. 147.2000 Section 147.2000 Protection of Environment ENVIRONMENTAL PROTECTION...

  8. 33 CFR 147.847 - Safety Zone; BW PIONEER Floating Production, Storage, and Offloading System Safety Zone. (United States)


    ... Production, Storage, and Offloading System Safety Zone. 147.847 Section 147.847 Navigation and Navigable... ZONES § 147.847 Safety Zone; BW PIONEER Floating Production, Storage, and Offloading System Safety Zone. (a) Description. The BW PIONEER, a Floating Production, Storage and Offloading (FPSO) system, is in...

  9. 19 CFR 147.23 - Compliance with Plant Quarantine Act and Federal Food, Drug, and Cosmetic Act. (United States)


    ... Food, Drug, and Cosmetic Act. 147.23 Section 147.23 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION... Laws § 147.23 Compliance with Plant Quarantine Act and Federal Food, Drug, and Cosmetic Act. (a) Plant... the plant quarantine regulations. (b) Federal Food, Drug, and Cosmetic Act. The entry of food products...

  10. Crystal field analysis of Pm$^{3+}$ (4$^{f4}) and Sm$^{3+}$ (4$^{f5}) and lattice location studies of $^{147}$Nd and $^{147}$Pm in w-AlN

    CERN Document Server

    Vetter, Ulrich; Nijjar, Anmol S; Zandi, Bahram; Öhl, Gregor; Wahl, Ulrich; De Vries, Bart; Hofsäss, Hans; Dietrich, Marc


    We report a detailed crystal field analysis of Pm3+ and Sm3+ as well as lattice location studies of 147Pm and 147Nd in 2H-aluminum nitride (w-AlN). The isotopes of mass 147 were produced by nuclear fission and implanted at an energy of 60 keV. The decay chain of interest in this work is 147Nd→147Pm→147Sm (stable). Lattice location studies applying the emission channeling technique were carried out using the β− particles and conversion electrons emitted in the radioactive decay of 147Nd→147Pm. The samples were investigated as implanted, and also they were investigated after annealing to temperatures of 873 K as well as 1373 K. The main fraction of about 60% of both 147Pm as well as 147Nd atoms was located on substitutional Al sites in the AlN lattice; the remainder of the ions were located randomly within the AlN lattice. Following radioactive decay of 147Nd, the cathodoluminescence spectra of Pm3+ and Sm3+ were obtained between 500 nm and 1050 nm at sample temperatures between 12 K and 300 K. High-re...

  11. CD147 as a Novel Prognostic Biomarker for Hepatocellular Carcinoma: A Meta-Analysis

    Directory of Open Access Journals (Sweden)

    Fei Peng


    Full Text Available We conducted a meta-analysis to investigate the controversial association of CD147 expression with HCC prognosis and clinicopathological characteristics. Eight studies from PubMed (1966–2016, EMBASE (1980–2016, Cochrane Library (1996–2016, Web of Science (1945–2016, China National Knowledge Infrastructure (1982–2016, and Wanfang databases (1988–2016 were considered. The associations between CD147 expression and clinicopathological parameters and overall survival (OS or DFS/RFS were reassessed using the meta-analysis for odds ratio (OR or hazard ratio (HR and 95% confidence interval (CI. CD147 expression was associated with DFS/RFS (HR = 3.26; 95% CI: 1.82–5.83; P<0.0001 but not with OS (HR = 1.35; 95% CI: 0.56–3.29; P=0.51. We also delved deeper into the association between median survival time and CD147 expression owing to significant heterogeneity and found significant differences between high and low CD147 expression groups with respect to median survival time. CD147 expression was closely associated with the TNM stage (OR = 0.18; 95% CI: 0.04–0.85; P=0.03 and venous invasion (OR = 6.29; 95% CI: 1.70–23.20; P=0.006. In contrast, there was no association between CD147 expression and tumor stage, cirrhosis, differentiation, lymph node metastasis, HBsAg, and serum AFP levels. Thus, CD147 expression is potentially closely related to HCC survival and associated clinicopathological parameters, paving the way for further research.

  12. Crystal structure of monoclinic samarium and cubic europium sesquioxides and bound coherent neutron scattering lengths of the isotopes {sup 154}Sm and {sup 153}Eu

    Energy Technology Data Exchange (ETDEWEB)

    Kohlmann, Holger [Leipzig Univ. (Germany). Inst. of Inorganic Chemistry; Hein, Christina; Kautenburger, Ralf [Saarland Univ., Saarbruecken (Germany). Inorganic Solid State Chemistry; Hansen, Thomas C.; Ritter, Clemens [Institut Laue-Langevin, Grenoble (France); Doyle, Stephen [Karlsruhe Institute of Technology, Eggenstein-Leopoldshafen (Germany). Inst. for Synchrotron Radiation (ISS)


    The crystal structures of monoclinic samarium and cubic europium sesquioxide, Sm{sub 2}O{sub 3} and Eu{sub 2}O{sub 3}, were reinvestigated by powder diffraction methods (laboratory X-ray, synchrotron, neutron). Rietveld analysis yields more precise structural parameters than previously known, especially for oxygen atoms. Interatomic distances d(Sm-O) in Sm{sub 2}O{sub 3} range from 226.3(4) to 275.9(2) pm [average 241.6(3) pm] for the monoclinic B type Sm{sub 2}O{sub 3} [space group C2/m, a = 1418.04(3) pm, b = 362.660(7) pm, c = 885.48(2) pm, β = 100.028(1) ], d(Eu-O) in Eu{sub 2}O{sub 3} from 229.9(2) to 238.8(2) pm for the cubic bixbyite (C) type [space group Ia anti 3, a = 1086.87(1) pm]. Neutron diffraction at 50 K and 2 K did not show any sign for magnetic ordering in Sm{sub 2}O{sub 3}. Isotopically enriched {sup 154}Sm{sub 2}O{sub 3} and {sup 153}Eu{sub 2}O{sub 3} were used for the neutron diffraction work because of the enormous absorption cross section of the natural isotopic mixtures for thermal neutrons. The isotopic purity was determined by inductively coupled plasma - mass spectrometry to be 98.9% for {sup 154}Sm and 99.8% for {sup 153}Eu. Advanced analysis of the neutron diffraction data suggest that the bound coherent scattering lengths of {sup 154}Sm and {sup 153}Eu need to be revised. We tentatively propose b{sub c}({sup 154}Sm) = 8.97(6) fm and b{sub c}({sup 153}Eu) = 8.85(3) fm for a neutron wavelength of 186.6 pm to be better values for these isotopes, showing up to 8% deviation from accepted literature values. It is shown that inaccurate scattering lengths may result in severe problems in crystal structure refinements causing erroneous structural details such as occupation parameters, which might be critically linked to physical properties like superconductivity in multinary oxides.

  13. 10 CFR Appendix C to Part 20 - Quantities 1 of Licensed Material Requiring Labeling (United States)


    ... Samarium-151 10 Samarium-153 100 Samarium-155 1,000 Samarium-156 1,000 Europium-145 100 Europium-146 100 Europium-147 100 Europium-148 10 Europium-149 100 Europium-150 (12.62h) 100 Europium-150 (34.2y) 1 Europium-152m 100 Europium-152 1 Europium-154 1 Europium-155 10 Europium-156 100 Europium-157 100 Europium-158 1...

  14. Increased expression of CD147 and MMP-9 is correlated with poor prognosis of salivary duct carcinoma. (United States)

    Piao, Songlin; Zhao, Shu; Guo, Fulin; Xue, Jie; Yao, Guodong; Wei, Zhili; Huang, Qi; Sun, Yao; Zhang, Bin


    The aim of this study was to investigate expression of CD147 and MMP-9 in salivary duct carcinoma (SDC) so as to determine whether these two genes may be correlated with poor prognosis of SDC. We examined the significance of the CD147 and MMP-9 expression in SDC (n = 35), non-cancerous salivary tissue (n = 20) in previously untreated patients using immunohistochemical staining. Furthermore, we analyzed the correlation between the expression of these two genes and various clinicopathologic factors including survival status of patients with SDC. Positive stain of CD147 and MMP-9 was seen in all 35 cases of tumor samples. A statistical correlation was observed between CD147 and MMP-9 expression in SDC tissues. The incidences of high expression were 45.71% for CD147 and 51.43% for MMP-9 in 35 SDC tissues, respectively. High expression of CD147 and MMP-9 was significantly correlated with clinical feature and shorter progression-free survival (PFS) (P (CD147) = 0.031; P (MMP-9) = 0.020) and overall survival (OS) (P (CD147) = 0.044; P (MMP-9) = 0.013). CD147 and MMP-9 expression is correlated with invasion, metastasis and shorter PFS/OS of SDC. Patients with high expression of CD147 and MMP-9 had poor prognosis than SDC patients with low expression.

  15. Highly CO2-Tolerant Cathode for Intermediate-Temperature Solid Oxide Fuel Cells: Samarium-Doped Ceria-Protected SrCo0.85Ta0.15O3-δ Hybrid. (United States)

    Li, Mengran; Zhou, Wei; Zhu, Zhonghua


    Susceptibility to CO2 is one of the major challenges for the long-term stability of the alkaline-earth-containing cathodes for intermediate-temperature solid oxide fuel cells. To alleviate the adverse effects from CO2, we incorporated samarium-stabilized ceria (SDC) into a SrCo0.85Ta0.15O3-δ (SCT15) cathode by either mechanical mixing or a wet impregnation method and evaluated their cathode performance stability in the presence of a gas mixture of 10% CO2, 21% O2, and 69% N2. We observed that the CO2 tolerance of the hybrid cathode outperforms the pure SCT15 cathode by over 5 times at 550 °C. This significant enhancement is likely attributable to the low CO2 adsorption and reactivity of the SDC protective layer, which are demonstrated through thermogravimetric analysis, energy-dispersive spectroscopy, and electrical conductivity study.

  16. Stabilized Polymer Micelles for the Development of IT-147, an Epothilone D Drug-Loaded Formulation

    Directory of Open Access Journals (Sweden)

    Adam Carie


    Full Text Available Epothilones have demonstrated promising potential for oncology applications but suffer from a narrow therapeutic window. Epothilone D stabilizes microtubules leading to apoptosis, is active against multidrug-resistant cells, and is efficacious in animal tumor models despite lack of stability in rodent plasma. Clinical development was terminated in phase II due to dose limiting toxicities near the efficacious dose. Taken together, this made epothilone D attractive for encapsulation in a stabilized polymer micelle for improved safety and efficacy. We have designed a library of triblock copolymers to develop IT-147, a lead formulation of epothilone D that extends plasma circulation for accumulation in the tumor environment, and potentially decrease systemic exposure to reduce dose limiting toxicities. The drug loading efficiency for IT-147 exceeds 90%, is 75 nm in diameter, and demonstrates pH-dependent release of epothilone D without chemical conjugation or enzymatic activation. Administration of IT-147 at 20 mg/kg increases exposure of epothilone D to the plasma compartment over 6-fold compared to free drug. At the same dose, 20 mg/kg epothilone D from IT-147 is considered the no observed adverse effect level (NOAEL but is the maximum tolerated dose for free drug. Consequently, IT-147 is positioned to be a safer, more effective means to deliver epothilone D.

  17. Full-length soluble CD147 promotes MMP-2 expression and is a potential serological marker in detection of hepatocellular carcinoma (United States)


    Background As a surface glycoprotein, CD147 is capable of stimulating the production of matrix metalloproteinases (MMPs) from neighboring fibroblasts. The aim of the present study is to explore the role of soluble CD147 on MMPs secretion from hepatocellular carcinoma (HCC) cells, and to investigate the diagnostic value of serum soluble CD147 in the HCC detection. Methods We identified the form of soluble CD147 in cell culture supernate of HCC cells and serum of patients with HCC, and explored the role of soluble CD147 on MMPs secretion. Serum CD147 levels were detected by the enzyme-linked immunosorbent assay, and the value of soluble CD147 as a marker in HCC detection was analyzed. Results Full length soluble CD147 was presented in the culture medium of HCC cells and serum of patients with HCC. The extracellular domain of soluble CD147 promoted the expression of CD147 and MMP-2 from HCC cells. Knockdown of CD147 markedly diminished the up-regulation of CD147 and MMP-2 which induced by soluble CD147. Soluble CD147 activated ERK, FAK, and PI3K/Akt pathways, leading to the up-regulation of MMP-2. The level of soluble CD147 in serum of patients with HCC was significantly elevated compared with healthy individuals (P Soluble CD147 levels were found to be associated with HCC tumor size (P = 0.007) and Child-Pugh grade (P = 0.007). Moreover, soluble CD147 showed a better performance in distinguishing HCC compared with alpha-fetoprotein. Conclusions The extracellular domain of soluble CD147 enhances the secretion of MMP-2 from HCC cells, requiring the cooperation of membrane CD147 and activation of ERK, FAK, and PI3K/Akt signaling. The measurement of soluble CD147 may offer a useful approach in diagnosis of HCC. PMID:24996644

  18. Near-IR TRGB Distance to Dwarf Elliptical Galaxy NGC 147

    Directory of Open Access Journals (Sweden)

    A. Kang


    Full Text Available We report the distance modulus of nearby dwarf elliptical galaxy NGC 147 estimated from the Tip of Red-giant Branch (TRGB method applying to the color-magnitude diagrams and luminosity functions in the near-infrared JHK bands. Apparent magnitudes of TRGBs in each band are obtained by applying Savitzky-Golay filter to the luminosity functions, and the theoretical absolute magnitudes are estimated from Yonsei-Yale isochrones. The derived values of distance modulus to NGC 147 are (m-M=23.69±0.12, 23.78±0.17, and 23.85±0.22 for J, H, and K bands, respectively. Distance modulus in bolometric magnitude is also derived as (m-M=23.87±0.11. We compare the derived values of the TRGB distance modulus to NGC 147 in the near-infrared bands with the previous results in other bands.

  19. Co-expression of CD147 and GLUT-1 indicates radiation resistance and poor prognosis in cervical squamous cell carcinoma. (United States)

    Huang, Xin-Qiong; Chen, Xiang; Xie, Xiao-Xue; Zhou, Qin; Li, Kai; Li, Shan; Shen, Liang-Fang; Su, Juan


    The aim of this study was to investigate the association of CD147 and GLUT-1, which play important roles in glycolysis in response to radiotherapy and clinical outcomes in patients with locally advanced cervical squamous cell carcinoma (LACSCC). The records of 132 female patients who received primary radiation therapy to treat LACSCC at FIGO stages IB-IVA were retrospectively reviewed. Forty-seven patients with PFS (progression-free survival) of less than 36 months were regarded as radiation-resistant. Eighty-five patients with PFS longer than 36 months were regarded as radiation-sensitive. Using pretreatment paraffin-embedded tissues, we evaluated CD147 and GLUT-1 expression by immunohistochemistry. Overexpression of CD147, GLUT-1, and CD147 and GLUT-1 combined were 44.7%, 52.9% and 36.5%, respectively, in the radiation-sensitive group, and 91.5%, 89.4% and 83.0%, respectively, in the radiation-resistant group. The 5-year progress free survival (PFS) rates in the CD147-low, CD147-high, GLUT-1-low, GLUT-1-high, CD147- and/or GLUT-1-low and CD147- and GLUT-1- dual high expression groups were 66.79%, 87.10%, 52.78%, 85.82%, 55.94%, 82.90% and 50.82%, respectively. CD147 and GLUT-1 co-expression, FIGO stage and tumor diameter were independent poor prognostic factors for patients with LACSCC in multivariate Cox regression analysis. Patients with high expression of CD147 alone, GLUT-1 alone or co-expression of CD147 and GLUT-1 showed greater resistance to radiotherapy and a shorter PFS than those with low expression. In particular, co-expression of CD147 and GLUT-1 can be considered as a negative independent prognostic factor.

  20. The Biological Function and Clinical Utilization of CD147 in Human Diseases: A Review of the Current Scientific Literature


    Lijuan Xiong; Edwards, Carl K.; Lijun Zhou


    CD147 or EMMPRIN is a member of the immunoglobulin superfamily in humans. It is widely expressed in human tumors and plays a central role in the progression of many cancers by stimulating the secretion of matrix metalloproteinases (MMPs) and cytokines. CD147 regulates cell proliferation, apoptosis, and tumor cell migration, metastasis and differentiation, especially under hypoxic conditions. CD147 is also important to many organ systems. This review will provide a detailed overview of the dis...

  1. Samarium-neodymium chronology and rubidium-strontium systematics of an Allende calcium-aluminum-rich inclusion with implications for 146Sm half-life (United States)

    Marks, N. E.; Borg, L. E.; Hutcheon, I. D.; Jacobsen, B.; Clayton, R. N.


    Calcium-aluminum-rich inclusions (CAIs) are primitive objects that formed within the protoplanetary disk surrounding the young Sun. Recent Pb-Pb chronologic studies have demonstrated that CAIs are the oldest solar system solids, crystallizing 4567 Ma ago (Amelin et al., 2002; Connelly et al., 2012). The isotope systematics of CAIs therefore provide critical insight into the earliest history of the Solar System. Although Sm-Nd and Rb-Sr geochronometers are highly effective tools for investigating cosmochemical evolution in the early Solar System, previous studies of CAIs have revealed evidence for isotopically disturbed systems. Here we report new age data for Allende CAI Al3S4 derived from both the long-lived (147Sm-143Nd) and short-lived (146Sm-142Nd) isotopic systems. The 147Sm-143Nd chronometer yields an age of 4560 ± 34 Ma that is concordant with 207Pb-206Pb ages for CAIs and indicates that the Sm-Nd system was not significantly disturbed by secondary alteration or nucleosynthetic processes. The slope of the 146Sm-142Nd isochron defines the Solar System initial 146Sm/144Sm of 0.00828 ± 0.00044. This value is significantly different from the value of 0.0094 determined by Kinoshita et al. (2012). Ages recalculated from all published 146Sm-142Nd isochron data using the traditional 103 Ma half-life and the initial 146Sm/144Sm value determined here closely match Pb-Pb and 147Sm-143Nd ages determined on the same samples. In contrast, ages recalculated using the 68 Ma half-life determined by Kinoshita et al. (2012) and either of the initial 146Sm/144Sm values are often anomalously old. This is particularly true for the youngest samples with 146Sm-142Nd isochron ages that are most sensitive to the choice of 146Sm half-life used in the age calculation. In contrast to the Sm-Nd isotope system, the Rb-Sr system is affected by alteration but yields an apparent isochron with a slope corresponding to a much younger age of 4247 ± 110 Ma. Although the Rb-Sr system in CAIs

  2. Target Laboratory (United States)

    Federal Laboratory Consortium — [Part of the ATLAS user facility.] The Physics Division operates a target development laboratory that produces targets and foils of various thickness and substrates,...

  3. Ferrites Ni{sub 0,5}Zn{sub 0,5}Fe{sub 2}O{sub 4} doped with samarium: structural analysis, morphological and electromagnetic; Ferritas Ni{sub 0,5}Zn{sub 0,5}Fe{sub 2}O{sub 4} dopada com samario: analise estrutural, morfologica e eletromagnetica

    Energy Technology Data Exchange (ETDEWEB)

    Costa, A.C.F.M.; Diniz, A.P., E-mail: [Universidade Federal de Campina Grande (UFCG), PB (Brazil). Unidade Academinca de Engenharia de Materiais; Viana, K.M.S. [Universidade Federal do Rio Grande do Norte (UFRN), Natal, PE (Brazil). Escola de Ciencias e Tecnologia; Cornejo, D.R. [Universidade de Sao Paulo (USP), SP (Brazil). Instituto de Fisica; Kiminami, R.H.G.A. [Universidade Federal de Sao Carlos (UFSCar), SP (Brazil). Departamento de Engenharia de Materiais


    This paper proposes to investigate the sintering at 1200 deg C/2h of Ni{sub 0.5}Zn{sub 0.5}Fe{sub 2-x}Sm{sub x}O{sub 4} ferrite doped with 0.05; 0.075 e 0.1 mol of Sm synthesized by combustion reaction to evaluate the performance materials as absorbers of electromagnetic radiation. The influence of the concentration of samarium on the structure, morphology and electromagnetic properties of ferrites was studied. The resulting samples were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), magnetic measurements and reflectivity measurements in the frequency range between 8-12 GHz. The results showed that increasing the concentration of samarium caused a decrease in particle size of the samples, encouraging, therefore, to obtain materials with better values of magnetization and reflectivity, allowing for use as absorbers in narrow-band frequency between 9-10 GHz. (author)

  4. 33 CFR 147.827 - Marlin Tension Leg Platform safety zone. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Marlin Tension Leg Platform... SECURITY (CONTINUED) OUTER CONTINENTAL SHELF ACTIVITIES SAFETY ZONES § 147.827 Marlin Tension Leg Platform safety zone. (a) Description. The Marlin Tension Leg Platform (Marlin TLP), Viasca Knoll, Block 915 (VK...

  5. 9 CFR 147.1 - The standard tube agglutination test. 1 (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false The standard tube agglutination test... Blood Testing Procedures § 147.1 The standard tube agglutination test. 1 1 The procedure described is a... alternate medium for the preparation of tube agglutination antigen. The TG medium, formerly used for the...

  6. 9 CFR 147.7 - Standard test procedures for mycoplasma. 5 (United States)


    ... Blood Testing Procedures § 147.7 Standard test procedures for mycoplasma. 5 5 For additional information... pipette or standardized loop (rinsed between samples) to 11/2 inch squares on a ruled glass plate. Limit... deposit resuspended to give a 25 percent suspension of packed RBC's in Alsever's solution. (In testing...

  7. 19 CFR 147.45 - Merchandise from a foreign-trade zone. (United States)


    ...; DEPARTMENT OF THE TREASURY (CONTINUED) TRADE FAIRS Disposition of Articles Entered for Fairs § 147.45 Merchandise from a foreign-trade zone. Articles entered for a fair from a foreign-trade zone status of “zone-restricted merchandise” can afterwards be entered for consumption from a fair if the Foreign-Trade Zones...

  8. 33 CFR 147.837 - Marco Polo Tension Leg Platform safety zone. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Marco Polo Tension Leg Platform... SECURITY (CONTINUED) OUTER CONTINENTAL SHELF ACTIVITIES SAFETY ZONES § 147.837 Marco Polo Tension Leg Platform safety zone. (a) Description. Marco Polo Tension Leg Platform, Green Canyon 608 (GC 608), located...

  9. 33 CFR 147.809 - Mars Tension Leg Platform safety zone. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Mars Tension Leg Platform safety... SECURITY (CONTINUED) OUTER CONTINENTAL SHELF ACTIVITIES SAFETY ZONES § 147.809 Mars Tension Leg Platform safety zone. (a) Description. The Mars Tension Leg Platform (Mars TLP) is located at position 28°10′10.29...

  10. Prognostic Indications of Elevated MCT4 and CD147 across Cancer Types: A Meta-Analysis

    Directory of Open Access Journals (Sweden)

    Cory D. Bovenzi


    Full Text Available Background. Metabolism in the tumor microenvironment can play a critical role in tumorigenesis and tumor aggression. Metabolic coupling may occur between tumor compartments; this phenomenon can be prognostically significant and may be conserved across tumor types. Monocarboxylate transporters (MCTs play an integral role in cellular metabolism via lactate transport and have been implicated in metabolic synergy in tumors. The transporters MCT1 and MCT4 are regulated via expression of their chaperone, CD147. Methods. We conducted a meta-analysis of existing publications on the relationship between MCT1, MCT4, and CD147 expression and overall survival and disease-free survival in cancer, using hazard ratios derived via multivariate Cox regression analyses. Results. Increased MCT4 expressions in the tumor microenvironment, cancer cells, or stromal cells were all associated with decreased overall survival and decreased disease-free survival (p<0.001 for all analyses. Increased CD147 expression in cancer cells was associated with decreased overall survival and disease-free survival (p<0.0001 for both analyses. Few studies were available on MCT1 expression; MCT1 expression was not clearly associated with overall or disease-free survival. Conclusion. MCT4 and CD147 expression correlate with worse prognosis across many cancer types. These results warrant further investigation of these associations.

  11. 46 CFR 147.50 - Fuel for cooking, heating, and lighting. (United States)


    ... SHIPS' STORES Stowage and Other Special Requirements for Particular Materials § 147.50 Fuel for cooking... and commercial standard fuel oil No. 1, No. 2, and No. 3 are prohibited for cooking, heating, or... used, a non-flammable priming liquid must be used. (4) Fuel tanks for fixed stoves must be separated...

  12. 40 CFR 147.651 - EPA-administered program-Indian lands. (United States)


    ... requirements of 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the remainder of this subpart. Injection well owners and operators, and EPA shall comply with these requirements. (b... PROGRAMS (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Idaho § 147...

  13. 40 CFR 147.1001 - EPA-administered program-Indian lands. (United States)


    ... requirements of 40 CFR parts 124, 144, 146, 148, and any additional requirements set forth in the remainder of this subpart. Injection well owners and operators and EPA shall comply with these requirements. (b... PROGRAMS (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Maine § 147...

  14. 32 CFR 147.11 - Guideline I-Emotional, mental, and personality disorders. (United States)


    ... professional that an individual's previous emotional, mental, or personality disorder is cured, under control... 32 National Defense 1 2010-07-01 2010-07-01 false Guideline I-Emotional, mental, and personality... CLASSIFIED INFORMATION Adjudication § 147.11 Guideline I—Emotional, mental, and personality disorders. (a...

  15. 29 CFR 780.147 - Practices performed on farm products-special factors considered. (United States)


    ... in Conjunction Withâ the Farming Operations § 780.147 Practices performed on farm products—special... commodities is incident to or in conjunction with the farming operations of a farmer or a farm, it is also... between operations incident to agriculture and operations of commercial or industrial processors who...

  16. 27 CFR 28.147 - Return of beer or beer concentrate. (United States)


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Return of beer or beer... BUREAU, DEPARTMENT OF THE TREASURY LIQUORS EXPORTATION OF ALCOHOL Removal of Beer and Beer Concentrate...-Trade Zone § 28.147 Return of beer or beer concentrate. Beer or beer concentrate removed without payment...

  17. 46 CFR 147A.31 - Removal of fumigation material and warning signs. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Removal of fumigation material and warning signs. 147A... material and warning signs. After ventilation is completed and a marine chemist or other qualified person... vessel, shall ensure that all warning signs are removed and fumigation containers and materials are...

  18. 10 CFR 30.19 - Self-luminous products containing tritium, krypton-85, or promethium-147. (United States)


    ... 10 Energy 1 2010-01-01 2010-01-01 false Self-luminous products containing tritium, krypton-85, or... DOMESTIC LICENSING OF BYPRODUCT MATERIAL Exemptions § 30.19 Self-luminous products containing tritium... transfer for sale or distribution self-luminous products containing tritium, krypton-85, or promethium-147...

  19. 40 CFR 147.1401 - State administered program-Class I, III, IV and V wells. (United States)


    ... CONTROL PROGRAMS Nebraska § 147.1401 State administered program—Class I, III, IV and V wells. The UIC program for Class I, III, IV, and V wells in the State of Nebraska, except those on Indian lands, is the... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State administered program-Class I...

  20. Spherical harmonics based descriptor for neural network potentials: Structure and dynamics of Au147 nanocluster (United States)

    Jindal, Shweta; Chiriki, Siva; Bulusu, Satya S.


    We propose a highly efficient method for fitting the potential energy surface of a nanocluster using a spherical harmonics based descriptor integrated with an artificial neural network. Our method achieves the accuracy of quantum mechanics and speed of empirical potentials. For large sized gold clusters (Au147), the computational time for accurate calculation of energy and forces is about 1.7 s, which is faster by several orders of magnitude compared to density functional theory (DFT). This method is used to perform the global minimum optimizations and molecular dynamics simulations for Au147, and it is found that its global minimum is not an icosahedron. The isomer that can be regarded as the global minimum is found to be 4 eV lower in energy than the icosahedron and is confirmed from DFT. The geometry of the obtained global minimum contains 105 atoms on the surface and 42 atoms in the core. A brief study on the fluxionality in Au147 is performed, and it is concluded that Au147 has a dynamic surface, thus opening a new window for studying its reaction dynamics.

  1. 32 CFR 147.15 - Guideline M-Misuse of Information technology systems. (United States)


    ... 32 National Defense 1 2010-07-01 2010-07-01 false Guideline M-Misuse of Information technology... CLASSIFIED INFORMATION Adjudication § 147.15 Guideline M—Misuse of Information technology systems. (a) The... ability to properly protect classified systems, networks, and information. Information Technology Systems...

  2. 33 CFR 147.839 - Mad Dog Truss Spar Platform safety zone. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Mad Dog Truss Spar Platform... SECURITY (CONTINUED) OUTER CONTINENTAL SHELF ACTIVITIES SAFETY ZONES § 147.839 Mad Dog Truss Spar Platform safety zone. (a) Description. Mad Dog Truss Spar Platform, Green Canyon 782 (GC 782), located at position...

  3. A new approach to determine {sup 147}Pm in irradiated fuel solutions

    Energy Technology Data Exchange (ETDEWEB)

    Brennetot, R.; Stadelmann, G.; Caussignac, C.; Gombert, C.; Fouque, M.; Lamouroux, Ch. [CEA, Dept Chim Phys, Serv Etud Comportement Radionucleides, Lab Anal Nucl Isotop et Elementaires, Ctr Etud Sacl, F-91191 Gif Sur Yvette, (France)


    Developments carried out in the Laboratory of Isotopic Nuclear and Elementary Analyses in order to quantify {sup 147}Pm in spent nuclear fuels analyzed at the CEA within the framework of the Burn Up Credit research program for neutronic code validation are presented here. This determination is essential for safety-criticality Studies. The quantity and the nature of the radionuclides in irradiated fuel solutions force LIS to separate the elements of interest before measuring their isotopic content by mass spectrometry. The main objective of this study is to modify the separation protocol used in our laboratory in order to recover and to measure the {sup 147}Pm at the same time as the other lanthanides and actinides determined by mass spectrometry. A very complete study oil synthetic solution (containing or not {sup 147}Pm) Was undertaken in order to determine the yield of the various stages of separation carried out before obtaining the isolated Pm fraction from the whole of the elements present in the spent fuel Solutions. With the lack of natural tracer to carry out the measurement with the isotope dilution technique, the great number of isotopes in fuel, the originality of this work tests oil the use of another present lanthanide in fuel to define the output of separation. The yields were measured at the conclusion of each stage of separation with two others lanthanides in order to show that one of them could be used as a tracer to correct the measurement of the {sup 147}Pm with the separation yield. The total yield (at the conclusion of the two stages of separation) was measured at the same time by ICP-MS and liquid scintillation. This last determination made it possible to validate the use of the Sm-147 (natural) to measure the {sup 147}Pm in ICP-MS since the outputs determined in liquid scintillation and ICP-MS (starting from the radioactive decrease of the source having been used to make the synthetic solution) were equivalent. It is the first time that such


    Energy Technology Data Exchange (ETDEWEB)

    Geha, M. [Astronomy Department, Yale University, New Haven, CT 06520 (United States); Weisz, D. [Astronomy Department, Box 351580, University of Washington, Seattle, WA 98195 (United States); Grocholski, A. [Department of Physics and Astronomy, Louisiana State University, Baton Rouge, LA 70803 (United States); Dolphin, A. [Raytheon, 1151 E. Hermans Road, Tucson, AZ 85756 (United States); Marel, R. P. van der [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Guhathakurta, P., E-mail: [UCO/Lick Observatory, University of California, Santa Cruz, 1156 High Street, Santa Cruz, CA 95064 (United States)


    We present the deepest optical photometry for any dwarf elliptical (dE) galaxy based on Hubble Space Telescope Advanced Camera for Surveys (ACS) observations of the Local Group dE galaxies NGC 147 and NGC 185. Our F606W and F814W color–magnitude diagrams are the first to reach below the oldest main sequence turnoff in a dE galaxy, allowing us to determine full star formation histories in these systems. The ACS fields are located roughly ∼1.5 effective radii from the galaxy center to avoid photometric crowding. While both ACS fields show unambiguous evidence for old and intermediate age stars, the mean age of NGC 147 is ∼4–5 Gyr younger as compared to NGC 185. In NGC 147, only 40% of stars were in place 12.5 Gyr ago (z ∼ 5), with the bulk of the remaining stellar population forming between 5 to 7 Gyr. In contrast, 70% of stars were formed in NGC 185 prior to 12.5 Gyr ago with the majority of the remaining population forming between 8 to 10 Gyr ago. Star formation has ceased in both ACS fields for at least 3 Gyr. Previous observations in the central regions of NGC 185 show evidence for star formation as recent as 100 Myr ago, and a strong metallicity gradient with radius. This implies a lack of radial mixing between the center of NGC 185 and our ACS field. The lack of radial gradients in NGC 147 suggests that our inferred SFHs are more representative of its global history. We interpret the inferred differences in star formation histories to imply an earlier infall time into the M31 environment for NGC 185 as compared to NGC 147.

  5. 40 CFR 147.1653 - Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells authorized... (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells authorized by rule. 147.1653 Section 147.1653 Protection of... recovery and hydrocarbon storage) and III wells authorized by rule. Maximum injection pressure. The owner...

  6. 40 CFR 147.1953 - Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells authorized... (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells authorized by rule. 147.1953 Section 147.1953 Protection of... enhanced recovery and hydrocarbon storage) and III wells authorized by rule. Maximum injection pressure...

  7. 40 CFR 147.503 - Existing Class II (except enhanced recovery and hydrocarbon storage) wells authorized by rule. (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Existing Class II (except enhanced recovery and hydrocarbon storage) wells authorized by rule. 147.503 Section 147.503 Protection of... recovery and hydrocarbon storage) wells authorized by rule. Maximum injection pressure. To meet the...

  8. 40 CFR 147.1453 - Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells authorized... (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells authorized by rule. 147.1453 Section 147.1453 Protection of... recovery and hydrocarbon storage) and III wells authorized by rule. Maximum injection pressure. The owner...

  9. 40 CFR 147.2153 - Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells authorized... (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells authorized by rule. 147.2153 Section 147.2153 Protection of... recovery and hydrocarbon storage) and III wells authorized by rule. Maximum injection pressure. The owner...

  10. 40 CFR 147.1353 - Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells authorized... (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells authorized by rule. 147.1353 Section 147.1353 Protection of... recovery and hydrocarbon storage) and III wells authorized by rule. Maximum injection pressure. The owner...

  11. 40 CFR 147.1153 - Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells authorized... (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells authorized by rule. 147.1153 Section 147.1153 Protection of... recovery and hydrocarbon storage) and III wells authorized by rule. Maximum injection pressure. The owner...

  12. 9 CFR 147.16 - Procedure for the evaluation of mycoplasma reactors by in vivo bio-assay (enrichment). (United States)


    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Procedure for the evaluation of mycoplasma reactors by in vivo bio-assay (enrichment). 147.16 Section 147.16 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE LIVESTOCK IMPROVEMENT AUXILIARY...

  13. 10 CFR 32.22 - Self-luminous products containing tritium, krypton-85 or promethium-147: Requirements for license... (United States)


    ... 10 Energy 1 2010-01-01 2010-01-01 false Self-luminous products containing tritium, krypton-85 or... containing tritium, krypton-85 or promethium-147: Requirements for license to manufacture, process, produce... self-luminous products containing tritium, krypton-85, or promethium-147, or to initially transfer such...

  14. 40 CFR 147.2800 - State-administered program-Class I, II, III, IV, and V wells. (United States)


    ... I, II, III, IV, and V wells. The UIC program for Class I, II, III, IV, and V wells in the... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I, II, III, IV, and V wells. 147.2800 Section 147.2800 Protection of Environment ENVIRONMENTAL PROTECTION...

  15. 17 CFR 14.7 - Finding of violation of Commodity Exchange Act or Federal securities laws in another proceeding. (United States)


    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Finding of violation of Commodity Exchange Act or Federal securities laws in another proceeding. 14.7 Section 14.7 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION RULES RELATING TO SUSPENSION OR DISBARMENT FROM...

  16. Understanding β-mannanase from Streptomyces sp. CS147 and its potential application in lignocellulose based biorefining. (United States)

    Yoo, Hah Y; Pradeep, G C; Lee, Soo K; Park, Don H; Cho, Seung S; Choi, Yun H; Yoo, Jin C; Kim, Seung W


    Hydrolytic enzymes such as cellulase and hemicellulase have been attracted in lignocellulose based biorefinery. Especially, mannanase has been a growing interest in industrial applications due to its importance in the bioconversion. In this study, an extracellular endo-β-1,4-D-mannanase was produced by Streptomyces sp. CS147 (Mn147) and purified 8.5-fold with a 43.4% yield using Sephadex G-50 column. The characterization of Mn147 was performed, and the results were as follows: molecular weight of ∼25 kDa with an optimum temperature of 50°C and pH of 11.0. The effect of metal ions and various reagents on Mn147 was strongly activated by Ca(+2) but inhibited by Mg(+2) , Fe(+2) , hydrogen peroxide, EDTA and EGTA. Km and Vmax values of Mn147 were 0.13 mg/mL and 294 μmol/min mg, respectively, when different concentrations (3.1 to 50 mg/mL) of locust bean gum galactomannan were used as substrate. In enzymatic hydrolysis of heterogeneous substrate (spent coffee grounds), Mn147 shows a similar conversion compared to commercial enzymes. In addition, lignocellulosic biomass can be hydrolyzed to oligosaccharides (reducing sugars), which can be further utilized for the production of biomaterials. These results showed that Mn147 is attractive in quest of potential bioindustrial applications. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Large scale structural optimization of trimetallic Cu-Au-Pt clusters up to 147 atoms (United States)

    Wu, Genhua; Sun, Yan; Wu, Xia; Chen, Run; Wang, Yan


    The stable structures of Cu-Au-Pt clusters up to 147 atoms are optimized by using an improved adaptive immune optimization algorithm (AIOA-IC method), in which several motifs, such as decahedron, icosahedron, face centered cubic, sixfold pancake, and Leary tetrahedron, are randomly selected as the inner cores of the starting structures. The structures of Cu8AunPt30-n (n = 1-29), Cu8AunPt47-n (n = 1-46), and partial 75-, 79-, 100-, and 147-atom clusters are analyzed. Cu12Au93Pt42 cluster has onion-like Mackay icosahedral motif. The segregation phenomena of Cu, Au and Pt in clusters are explained by the atomic radius, surface energy, and cohesive energy.

  18. Ovarian metastases resection from extragenital primary sites: outcome and prognostic factor analysis of 147 patients


    Li Wenhua; Wang Huaying; Wang Jian; Lv, Fangfang; Zhu Xiaodong; Wang Zhonghua


    Abstract Background To explore the outcomes and prognostic factors of ovarian metastasectomy intervention on overall survival from extragenital primary cancer. Methods Patients with ovarian metastases from extragenital primary cancer confirmed by laparotomy surgery and ovarian metastases resection were retrospectively collected in a single institution during an 8-year period. A total of 147 cases were identified and primary tumor sites were colorectal region (49.0%), gastric (40.8%), breast (...

  19. Heterotopic ossification after hip arthroplasty: a randomized double-blind multicenter study tenoxicam in 147 hips

    DEFF Research Database (Denmark)

    Gebuhr, Peter Henrik; Sletgård, J; Dalsgård, J


    147 patients due to have a cemented total hip arthroplasty were randomized to 4 groups. They received either tenoxicam 20 mg or 40 mg, or placebo, for 5 days or morphine on the day of operation and placebo for 4 days. During the first 5 days 14 patients were excluded. The patients were followed f...... that tenoxicam 20 mg for 5 days postoperatively can reduce heterotopic ossification after cemented total hip arthroplasty....

  20. 147 | Page

    African Journals Online (AJOL)

    Fr. Ikenga

    negatively affects the habitat structure by acidifying the soil, halting cellular respiration and starving the roots of plants of vital oxygen.13When an area of the mangrove has been destroyed by oil, such an area can no longer be supportive of the growth of native plants species until bacterial remediation has taken place.

  1. 13 CFR 147.220 - By when must I publish my drug-free workplace statement and establish my drug-free awareness... (United States)


    ...-free workplace statement and establish my drug-free awareness program? 147.220 Section 147.220 Business... workplace statement and establish my drug-free awareness program? If you are a new recipient that does not already have a policy statement as described in § 147.205 and an ongoing awareness program as described in...

  2. Retrospective evaluation of bone pain palliation after samarium-153-EDTMP therapy Avaliação retrospectiva do tratamento da dor óssea metastática com Samário-153-EDTMP

    Directory of Open Access Journals (Sweden)

    Marcelo Tatit Sapienza


    Full Text Available PURPOSE: The aim of this study was to evaluate the degree of metastatic bone pain palliation and medullar toxicity associated with samarium-153-EDTMP treatment. METHODS: Seventy-three patients with metastatic bone pain having previously undergone therapy with samarium-153-EDTMP (1 mCi/kg were retrospectively evaluated. Routine follow-up included pain evaluation and blood counts for 2 months after treatment. Pain was evaluated using a subjective scale (from 0 to 10 before and for 8 weeks after the treatment. Blood counts were obtained before treatment and once a week for 2 months during follow-up. Dosimetry, based upon the urinary excretion of the isotope, was estimated in 41 individuals, and the resulting radiation absorbed doses were correlated with hematological data. RESULTS: Reduction in pain scores of 75% to 100% was obtained in 36 patients (49%, with a decrease of 50% to 75%, 25% to 50%, and 0% to 25% in, respectively, 20 (27%, 10 (14%, and 7 (10% patients. There was no significant relationship between the pain response and location of the primary tumor (breast or prostate cancer. Mild to moderate myelosuppression was noted in 75.3% of patients, usually with hematological recovery at 8 weeks. The mean bone marrow dose was 347 ± 65 cGy, and only a weak correlation was found between absorbed dose and myelosuppression (Pearson coefficient = .4. CONCLUSIONS: Samarium-153-EDTMP is a valuable method for metastatic bone pain palliation. A mild to moderate and transitory myelosuppression is the main toxicity observed after samarium therapy, showing a weak correlation with dosimetric measures.OBJETIVO: O presente trabalho teve por objetivo avaliar o efeito paliativo da dor e a toxicidade medular associados ao tratamento com Samário-153-EDTMP em pacientes com metástases ósseas. MÉTODOS: O estudo foi realizado de forma retrospectiva, a partir do levantamento de prontuário de 178 pacientes submetidos a tratamento com 1mCi/kg de 153Sm

  3. The dynamics of the laser-induced metal-semiconductor phase transition of samarium sulfide (SmS); Die Dynamik des laserinduzierten Metall-Halbleiter-Phasenuebergangs von Samariumsulfid (SmS)

    Energy Technology Data Exchange (ETDEWEB)

    Kaempfer, Tino


    The present thesis is dedicated to the experimental study of the metal-semiconductor phase transition of samarium sulfide (SmS): Temperature- and time-resolved experiments on the characterization of the phase transition of mixed-valence SmS samples (M-SmS) are presented. The measurement of the dynamics of the laser-induced phase transition pursues via time-resolved ultrashort-time microscopy and by X-ray diffraction with sub-picosecond time resolution. The electronic and structural processes, which follow an excitation of M-SmS with infrared femtosecond laser pulses, are physically interpreted on the base of the results obtained in this thesis and model imaginations. [German] Die vorliegende Arbeit ist der experimentellen Untersuchung des Metall-Halbleiter-Phasenuebergangs von Samariumsulfid (SmS) gewidmet. Es werden temperatur- und zeitaufgeloeste Experimente zur Charakterisierung des Phasenuebergangs gemischt-valenter SmS Proben (M-SmS) vorgestellt. Die Messung der Dynamik des laserinduzierten Phasenuebergangs erfolgt ueber zeitaufgeloeste Ultrakurzzeit-Mikroskopie und durch Roentgenbeugung mit subpikosekunden Zeitaufloesung. Die elektronischen und strukturellen Prozesse, welche einer Anregung von M-SmS mit infraroten Femtosekunden-Laserpulsen folgen, werden auf der Basis der in dieser Arbeit gewonnenen Ergebnisse und Modellvorstellungen physikalisch interpretiert. (orig.)

  4. Optimized design of shields for diagnostic X rays with NCRP 147 technique; Diseno optimizado de blindajes para rayos X diagnostico con tecnica NCRP 147

    Energy Technology Data Exchange (ETDEWEB)

    Gama T, G. [Calidad XXI SA de CV, Zacatecas 67-007 Col. Roma, 06700 Mexico D.F. (Mexico)]. e-mail:


    A comparison among the design techniques of shielding for X-ray diagnostic rooms with the NCRP 49 (1976) report technique, AAPM 39 (1993) Y the one of the NCRP 147 (2005) technique. The designs correspond to a room of conventional X-rays, one of fluoroscopy, one of tomography Y one of mammography. In all the cases it demonstrates that the NCRP 49 technique overestimate the shieldings. The causes of the overestimation of the NCRP 49 can be attributed to: a) high values of the work charge that don't consider the spectral fluence of the photons that are present in each room, b) to the differences in the values of the kerma in air without attenuation for the dispersed primary radiation Y of leakage among both reports. (Author)

  5. Metabolic characterization and transformation of the non-dairy Lactococcus lactis strain KF147, for production of ethanol from xylose

    DEFF Research Database (Denmark)

    Petersen, Kia Vest; Liu, Jianming; Chen, Jun


    over-expression of phosphoketolase increased the flux through the phosphoketolase pathway. In general, significant amounts of the mixed-acid products, including lactate, formate, acetate and ethanol, were formed irrespective of xylose concentrations. To demonstrate the potential of KF147 for converting......The non-dairy lactic acid bacterium Lactococcus lactis KF147 can utilize xylose as the sole energy source. To assess whether KF147 could serve as a platform organism for converting second generation sugars into useful chemicals, we characterized growth and product formation for KF147 when grown...... the arcA gene encoding the arginine deiminase. The fermentation product profile suggested two routes for xylose degradation, the phosphoketolase pathway and the pentose phosphate pathway. Inactivation of the phosphoketolase pathway redirected the entire flux through the pentose phosphate pathway whereas...

  6. CD147-mediated chemotaxis of CD4+CD161+ T cells may contribute to local inflammation in rheumatoid arthritis. (United States)

    Lv, Minghua; Miao, Jinlin; Zhao, Peng; Luo, Xing; Han, Qing; Wu, Zhenbiao; Zhang, Kui; Zhu, Ping


    CD161 is used as a surrogate marker for Th17 cells, which are implicated in the pathogenesis of rheumatoid arthritis (RA). In this study, we evaluated the percentage, clinical significance, and CD98 and CD147 expression of CD4+CD161+ T cells. The potential role of CD147 and CD98 in cyclophilin A-induced chemotaxis of CD4+CD161+ T cells was analyzed. Thirty-seven RA patients, 15 paired synovial fluid (SF) of RA, and 22 healthy controls were recruited. The cell populations and surface expression of CD98 and CD147 were analyzed by flow cytometry. Spearman's rank correlation coefficient and multiple linear regression were applied to calculate the correlations. Chemotaxis assay was used to investigate CD4+CD161+ T cell migration. We found that the percentage of CD4+CD161+ T cells and their expression of CD147 and CD98 in SF were higher than in the peripheral blood of RA patients. Percentage of SF CD4+CD161+ T cells was positively correlated with 28-Joint Disease Activity Score (DAS28). CD147 monoclonal antibody (HAb18) attenuated the chemotactic ability of CD4+CD161+ T cells. An increased CD4+CD161+ T cell percentage and expression of CD147 and CD98 were shown in RA SF. Percentage of SF CD4+CD161+ T cells can be used as a predictive marker of disease activity in RA. CD147 block significantly decreased the chemotactic index of CD4+CD161+ cells induced by cyclophilin A (CypA). These results imply that the accumulation of CD4+CD161+ T cells in SF and their high expression of CD147 may be associated with CypA-mediated chemotaxis and contribute to local inflammation in RA.

  7. 40 CFR 147.850 - State-administered program-Class I, III, IV and V wells. (United States)


    ... PROGRAMS Kansas § 147.850 State-administered program—Class I, III, IV and V wells. The UIC program for Class I, III, IV and V wells in the State of Kansas, except those on Indian lands as described in § 147... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I...

  8. Antiproton Target

    CERN Multimedia


    Antiproton target used for the AA (antiproton accumulator). The first type of antiproton production target used from 1980 to 1982 comprised a rod of copper 3mm diameter and 120mm long embedded in a graphite cylinder that was itself pressed into a finned aluminium container. This assembly was air-cooled and it was used in conjunction with the Van der Meer magnetic horn. In 1983 Fermilab provided us with lithium lenses to replace the horn with a view to increasing the antiproton yield by about 30%. These lenses needed a much shorter target made of heavy metal - iridium was chosen for this purpose. The 50 mm iridium rod was housed in an extension to the original finned target container so that it could be brought very close to the entrance to the lithium lens. Picture 1 shows this target assembly and Picture 2 shows it mounted together with the lithium lens. These target containers had a short lifetime due to a combination of beam heating and radiation damage. This led to the design of the water-cooled target in...

  9. KCNQ1 mutation Q147R is associated with atrial fibrillation and prolonged QT interval

    DEFF Research Database (Denmark)

    Lundby, Alicia; Ravn, Lasse Steen; Svendsen, Jesper Hastrup


    BACKGROUND: Atrial fibrillation (AF) and long QT syndrome (LQTS) are cardiac arrhythmia disorders that have been related to dysfunction of the voltage-gated potassium channel subunit Kv7.1 encoded by the KCNQ1 gene. OBJECTIVE: The purpose of this study was functional assessment of a mutation in Kv7.......1 identified in a proband with permanent AF and prolonged QT interval. We investigated whether this KCNQ1 missense mutation could form the genetic basis for AF and LQTS simultaneously in this patient. METHODS: We investigated the functional consequences of the novel mutation KCNQ1 Q147R by heterologous...

  10. Tackling the s-process stellar neutron density via the 147Pm(n,?) reaction

    CERN Multimedia

    Branching points along the reaction path of the slow nucleosynthesis process are very special isotopes for which there is competition between neutron capture and β-decay. The accurate knowledge of the decay properties and capture cross sections in the vicinity of these branching points are of key importance for determining the stellar conditions, namely the neutron density and temperature during the main s-process component in low-mass AGB stars. However, accurate values of these quantities, in particular capture cross sections at the corresponding stellar temperatures, are difficult to measure; thus data are very scarce and, when existing, very limited. For the particular and important case of the branching at A=147/148, the main branching point is $^{147}$Pm; for which there was a very challenging and successful activation measurement in 2003 at the stellar neutron energy of kT=25 keV using just 28 ng of material. In the main s-process, however, 95% of the neutron exposure takes place during H-burning epis...

  11. Targeted Learning

    CERN Document Server

    van der Laan, Mark J


    The statistics profession is at a unique point in history. The need for valid statistical tools is greater than ever; data sets are massive, often measuring hundreds of thousands of measurements for a single subject. The field is ready to move towards clear objective benchmarks under which tools can be evaluated. Targeted learning allows (1) the full generalization and utilization of cross-validation as an estimator selection tool so that the subjective choices made by humans are now made by the machine, and (2) targeting the fitting of the probability distribution of the data toward the targe

  12. X-ray emission from Au-Sm alloy target irradiated with high power sub nanosecond laser (United States)

    Chaurasia, S.; Munda, D. S.; Tripathi, S.; Kumar, M.; Gupta, N. K.; Dhareshwar, L. J.; Bajaj, P. N.


    The hohlraum cavity is generally made out of gold (Au) and recently it has been shown that laser-target coupling efficiency can be increased by using cocktail or mixed targets such as gold-samarium (Au-Sm). We report here results of experiments performed on Au-Sm alloy in various spectral regions for various compositions. In these experiments, a 12 Joule/500ps Nd:glass laser has been used. It is observed that the soft x-ray emission in the spectral region 0.7 -1.56 keV is enhanced by about 40-50% by using a composition of Au:Sm:: 3:7 as compared to pure Au .However, in case of hard x-ray emission (3.2 -5 keV), there is a reduction in x-ray emission from Au-Sm target as compared to pure gold. This behaviour, that enhancement occurs in soft x-rays in the case of mixed Au-Sm targets is desirable in the ICF scheme.

  13. Study of the superdeformed states of the gadolinium nuclei: neutron excitations in {sup 147}Gd nucleus; Etude des etats superdeformes de noyaux de Gadolinium: Excitations neutron dans le noyau {sup 147}Gd

    Energy Technology Data Exchange (ETDEWEB)

    Khadiri, Najia [Institut de Recherche Subatomique, CNRS-IN2P3 - Universite Louis Pasteur, 67 - Strasbourg (France)


    This work is devoted to nuclear structure studies of superdeformed states in the second potential well. Under focus are the gadolinium isotopes and in particular the {sup 147}Gd nucleus. High spin states in {sup 147}Gd have been populating by {sup 122}Sn ({sup 30}Si,5n){sup 147}Gd fusion-evaporation reaction with a silicon beam of 158 MeV delivered by the VIVITRON accelerator of the Institut de Recherches Subatomiques. The nucleus {gamma} de-excitations have been measured using the EUROGAM II {gamma}-ray multidetector. On the basis of multiple coincidences, four new superdeformed (SD) rotational bands have been assigned to {sup 147}Gd nucleus. Nuclear structures corresponding to these bands have been investigated by shell model calculations using a harmonic oscillator potential with cranking, in the Nilsson Strutinsky formalism. Comparison of dynamical moments of inertia of band (1) and (5) in {sup 147}Gd with {sup 148}Gd(2) and {sup 146}Gd(1) SD bands has fixed the role of the [651 1/2]{alpha} = -1/2 orbital crossing frequency. Theoretical calculations reproduce quite well the {sup 148}Gd(2), {sup 127}Gd(1,5) and G{sup 146}Gd(1) dynamical moments of inertia. Using the particle hole excitation nature of {sup 149,148,147,146}Gd bands, effective spin alignment of [651 1/2]{alpha}= {+-}1/2, [770 1/2]{alpha} = -1/2 and [441 1/2]{alpha} = +1/2 orbitals have been deduced from the experiment in agreement with the theoretical values. Of particular interest, the spin alignment measured for the [441 1/2]{alpha} +1/2 orbital, with a value close to zero, is in contradiction with the value predicted by the Pseudo SU(3) model, formalism often used to explain the identical band phenomenon. (author) 68 refs., 41 figs., 17 tabs.

  14. Effects of matrix metalloproteinase inhibitor doxycycline and CD147 antagonist peptide-9 on gallbladder carcinoma cell lines. (United States)

    Wang, Shihang; Liu, Chao; Liu, Xinjiang; He, Yanxin; Shen, Dongfang; Luo, Qiankun; Dong, Yuxi; Dong, Haifeng; Pang, Zhigang


    Gallbladder carcinoma is the most common and aggressive malignancy of the biliary tree and highly expresses CD147, which is closely related to disease prognosis in a variety of human cancers. Doxycycline exhibited anti-tumor properties in many cancer cells. CD147 antagonist peptide-9 is a polypeptide and can specifically bind to CD147. The effect of these two drugs on gallbladder cancer cells has not been studied. The aim of this study is to investigate the effect of doxycycline and antagonist peptide-9 on gallbladder carcinoma cells and the possible mechanism of inhibition on cancer cell of doxycycline. To investigate the effects of doxycycline and antagonist peptide-9 on gallbladder carcinoma cells (GBC-SD and SGC-996), cell proliferation, CD147 expression, and early-stage apoptosis rate were measured after treated with doxycycline. Matrix metalloproteinase-2 and matrix metalloproteinase-9 activities were measured after treated with different concentrations of doxycycline, antagonist peptide-9, and their combination. The results demonstrated that doxycycline inhibited cell proliferation, reduced CD147 expression level, and induced an early-stage apoptosis response in GBC-SD and SGC-996 cells. The matrix metalloproteinase-2 and matrix metalloproteinase-9 activities were inhibited by antagonist peptide-9 and doxycycline, and the inhibitory effects were enhanced by combined drugs in gallbladder carcinoma cell lines. Taken together, doxycycline showed inhibitory effects on gallbladder carcinoma cell lines and reduced the expression of CD147, and this may be the mechanism by which doxycycline inhibits cancer cells. This study provides new information and tries to implement the design of adjuvant therapy method for gallbladder carcinoma.

  15. Bis(1,4,7-trithiacyclononanenickel(II bis(tetrafluoridoborate nitromethane disolvate

    Directory of Open Access Journals (Sweden)

    Bruce C. Noll


    Full Text Available The homoleptic thioether title complex, [Ni(C6H12S32](BF42·2CH3NO2, shows the expeced hexakis(thioether octahedral environment around the NiII atom. It crystallized as two crystallographically independent complex cations, [Ni(9S32]2+ (9S3 = 1,4,7-trithiacyclononane, within the unit cell where each NiII lies on an inversion center. In addition to the complex cations, there are two crystallographically independent BF4− anions present to balance the charge, and each shows disorder along a pseudo-C3 axis with ratios of 0.53 (2:0.47 (2 and 0.55 (2:0.45 (2. Two nitromethane solvent molecules per complex cation are also present in the unit cell.

  16. Galectin-3 induces clustering of CD147 and integrin-β1 transmembrane glycoprotein receptors on the RPE cell surface.

    Directory of Open Access Journals (Sweden)

    Claudia S Priglinger

    Full Text Available Proliferative vitreoretinopathy (PVR is a blinding disease frequently occurring after retinal detachment surgery. Adhesion, migration and matrix remodeling of dedifferentiated retinal pigment epithelial (RPE cells characterize the onset of the disease. Treatment options are still restrained and identification of factors responsible for the abnormal behavior of the RPE cells will facilitate the development of novel therapeutics. Galectin-3, a carbohydrate-binding protein, was previously found to inhibit attachment and spreading of retinal pigment epithelial cells, and thus bares the potential to counteract PVR-associated cellular events. However, the identities of the corresponding cell surface glycoprotein receptor proteins on RPE cells are not known. Here we characterize RPE-specific Gal-3 containing glycoprotein complexes using a proteomic approach. Integrin-β1, integrin-α3 and CD147/EMMPRIN, a transmembrane glycoprotein implicated in regulating matrix metalloproteinase induction, were identified as potential Gal-3 interactors on RPE cell surfaces. In reciprocal immunoprecipitation experiments we confirmed that Gal-3 associated with CD147 and integrin-β1, but not with integrin-α3. Additionally, association of Gal-3 with CD147 and integrin-β1 was observed in co-localization analyses, while integrin-α3 only partially co-localized with Gal-3. Blocking of CD147 and integrin-β1 on RPE cell surfaces inhibited binding of Gal-3, whereas blocking of integrin-α3 failed to do so, suggesting that integrin-α3 is rather an indirect interactor. Importantly, Gal-3 binding promoted pronounced clustering and co-localization of CD147 and integrin-β1, with only partial association of integrin-α3. Finally, we show that RPE derived CD147 and integrin-β1, but not integrin-α3, carry predominantly β-1,6-N-actyl-D-glucosamine-branched glycans, which are high-affinity ligands for Gal-3. We conclude from these data that extracellular Gal-3 triggers

  17. Galectin-3 induces clustering of CD147 and integrin-β1 transmembrane glycoprotein receptors on the RPE cell surface. (United States)

    Priglinger, Claudia S; Szober, Christoph M; Priglinger, Siegfried G; Merl, Juliane; Euler, Kerstin N; Kernt, Marcus; Gondi, Gabor; Behler, Jennifer; Geerlof, Arie; Kampik, Anselm; Ueffing, Marius; Hauck, Stefanie M


    Proliferative vitreoretinopathy (PVR) is a blinding disease frequently occurring after retinal detachment surgery. Adhesion, migration and matrix remodeling of dedifferentiated retinal pigment epithelial (RPE) cells characterize the onset of the disease. Treatment options are still restrained and identification of factors responsible for the abnormal behavior of the RPE cells will facilitate the development of novel therapeutics. Galectin-3, a carbohydrate-binding protein, was previously found to inhibit attachment and spreading of retinal pigment epithelial cells, and thus bares the potential to counteract PVR-associated cellular events. However, the identities of the corresponding cell surface glycoprotein receptor proteins on RPE cells are not known. Here we characterize RPE-specific Gal-3 containing glycoprotein complexes using a proteomic approach. Integrin-β1, integrin-α3 and CD147/EMMPRIN, a transmembrane glycoprotein implicated in regulating matrix metalloproteinase induction, were identified as potential Gal-3 interactors on RPE cell surfaces. In reciprocal immunoprecipitation experiments we confirmed that Gal-3 associated with CD147 and integrin-β1, but not with integrin-α3. Additionally, association of Gal-3 with CD147 and integrin-β1 was observed in co-localization analyses, while integrin-α3 only partially co-localized with Gal-3. Blocking of CD147 and integrin-β1 on RPE cell surfaces inhibited binding of Gal-3, whereas blocking of integrin-α3 failed to do so, suggesting that integrin-α3 is rather an indirect interactor. Importantly, Gal-3 binding promoted pronounced clustering and co-localization of CD147 and integrin-β1, with only partial association of integrin-α3. Finally, we show that RPE derived CD147 and integrin-β1, but not integrin-α3, carry predominantly β-1,6-N-actyl-D-glucosamine-branched glycans, which are high-affinity ligands for Gal-3. We conclude from these data that extracellular Gal-3 triggers clustering of CD147 and

  18. Spongionella secondary metabolites, promising modulators of immune response through CD147 receptor modulation

    Directory of Open Access Journals (Sweden)

    Jon Andoni Sánchez


    Full Text Available The modulation of the immune system can have multiple applications such as cancer treatment, and a wide type of processes involving inflammation where the potent chemotactic agent cyclophilin A (Cyp A is implicated. The Porifera phylum, in which Spongionella is encompassed, is the main producer of marine bioactive compounds. Four secondary metabolites obtained from Spongionella (Gracilin H, A, L and Tetrahydroaplysulphurin-1 were described to hit Cyp A and to block the release of inflammation mediators. Based on these results some role of Spongionella compounds on other steps of the signalling pathway mediated by this chemotactic agent can be hypothesised. In the present paper we studied the effect of these four compounds on the surface membrane CD147 receptor expression, on the extracellular levels of Cyp A and on the ability to migrate of concanavalin (Con A-activated T lymphocytes. Similarly to a well-known immunosuppressive agent cyclosporine A (CsA, Gracilin H, A, L and tetrahydroaplysulphurin-1 were able to reduce the CD147 membrane expression and to block the release of Cyp A to the medium. Besides, by using Cyp A as chemotactic agent, T cell migration was inhibited when cells were previously incubated with Gracilin A and Gracilin L. These positive results lead us to test the in vivo effect of Gracilin H and L in a mouse ear delayed hypersensitive reaction. Thus, both compounds efficiently reduce the ear swelling as well as the inflammatory cell infiltration. These results provide more evidences for their potential therapeutic application in immune related diseases of Spongionella compounds.

  19. Inhibition of Ovarian Cancer Chemoresistance and Metastasis with Antagonists of Hyaluronan-CD44-CD147 Interactions (United States)


    measured after sacrifice. P values: Control siRNA vs. Combo = 0.0068; Control siRNA + Cisplatin vs. Combo = 0.0047; Control siRNA vs. CD147 siRNA...2006. Acylation of CD44 and its association with lipid rafts are required for receptor and hyaluronan endocytosis . J Biol Chem. 281:34601-34609. Toole

  20. 17 CFR 147.3 - General requirement of open meetings; grounds upon which meetings may be closed. (United States)


    ... COMMODITY FUTURES TRADING COMMISSION OPEN COMMISSION MEETINGS § 147.3 General requirement of open meetings... 15 through 21 of this chapter; (F) Reports concerning option positions of large traders required to... significant financial speculation in currencies, securities, or commodities, (ii) significantly endanger the...

  1. 40 CFR 147.51 - State-administered program-Class I, III, IV, and V wells. (United States)


    ... PROGRAMS Alabama § 147.51 State-administered program—Class I, III, IV, and V wells. The UIC program for Class I, III, IV and V wells in the State of Alabama, except those on Indian lands, is the program... for Class I, III, IV, and V UIC Program,” September 21, 1982; (3) Letter from Alabama Chief Assistant...

  2. 40 CFR 147.2550 - State-administered program-Class I, III, IV and V wells. (United States)


    ... CONTROL PROGRAMS Wyoming § 147.2550 State-administered program—Class I, III, IV and V wells. The UIC program for Class I, III, IV and V wells in the State of Wyoming, except those on Indian lands is the... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I...

  3. 40 CFR 147.251 - EPA-administered program-Class I, III, IV and V wells and Indian lands. (United States)


    ... INJECTION CONTROL PROGRAMS California § 147.251 EPA-administered program—Class I, III, IV and V wells and Indian lands. (a) Contents. The UIC program in the State of California for Class I, III, IV and V wells... 40 Protection of Environment 22 2010-07-01 2010-07-01 false EPA-administered program-Class I, III...

  4. 40 CFR 147.500 - State-administered program-Class I, III, IV, and V wells. (United States)


    ... CONTROL PROGRAMS Florida § 147.500 State-administered program—Class I, III, IV, and V wells. The UIC program for Class I, III, IV, and V wells in the State of Florida, except for those on Indian lands is... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I...

  5. 40 CFR 147.1601 - State-administered program-Class I, III, IV and V wells. (United States)


    ... CONTROL PROGRAMS New Mexico § 147.1601 State-administered program—Class I, III, IV and V wells. The UIC program for Class I, III, IV and V injection wells in the State of New Mexico, except for those on Indian... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I...

  6. 40 CFR 147.2250 - State-administered program-Class I, III, IV, and V wells. (United States)


    ... CONTROL PROGRAMS Utah § 147.2250 State-administered program—Class I, III, IV, and V wells. The UIC program for Class I, III, IV, and V wells in the State of Utah, except those on Indian lands, is administered... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I...

  7. 40 CFR 147.1301 - State-administered program-Class I, III, IV, and V wells. (United States)


    ... CONTROL PROGRAMS Missouri § 147.1301 State-administered program—Class I, III, IV, and V wells. The UIC program for Class I, III, IV, and V wells in the State of Missouri, other than those on Indian lands, is... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I...

  8. 40 CFR 147.301 - EPA-administered program-Class I, III, IV, V wells and Indian lands. (United States)


    ... INJECTION CONTROL PROGRAMS Colorado § 147.301 EPA-administered program—Class I, III, IV, V wells and Indian lands. (a) Contents. The UIC program for Class I, III, IV and V wells on all lands in Colorado... 40 Protection of Environment 22 2010-07-01 2010-07-01 false EPA-administered program-Class I, III...

  9. 40 CFR 147.1850 - State-administered program-Class I, III, IV and V wells. (United States)


    ... CONTROL PROGRAMS Oklahoma § 147.1850 State-administered program—Class I, III, IV and V wells. The UIC program for Class I, III, IV, and V wells in the State of Oklahoma, except those on Indian lands, is the... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I...

  10. 40 CFR 147.1751 - State-administered program-Class I, III, IV and V wells. (United States)


    ... CONTROL PROGRAMS North Dakota § 147.1751 State-administered program—Class I, III, IV and V wells. The UIC program for Class I, III, IV, and V wells in the State of North Dakota, except those on Indian lands, is... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I...

  11. 40 CFR 147.200 - State-administered program-Class I, III, IV, and V wells. (United States)


    ... CONTROL PROGRAMS Arkansas § 147.200 State-administered program—Class I, III, IV, and V wells. The UIC program for Class I, III, IV and V wells in the State of Arkansas, except those wells on Indian lands, is... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I...

  12. 40 CFR 147.700 - State-administered program-Class I, III, IV, and V wells. (United States)


    ... CONTROL PROGRAMS Illinois § 147.700 State-administered program—Class I, III, IV, and V wells. The UIC program for Class I, III, IV and V wells in the State of Illinois, except those on Indian lands, is the... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I...

  13. 40 CFR 147.1250 - State-administered program-Class I, III, IV, and V wells. (United States)


    ... CONTROL PROGRAMS Mississippi § 147.1250 State-administered program—Class I, III, IV, and V wells. The UIC program for Class I, III, IV and V wells in the State of Mississippi, except those on Indian lands, is the... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I...

  14. Vegetation response to the 14.7 and11.5 ka yrs BP climate transitions: is vegetation lagging climate?

    NARCIS (Netherlands)

    Hoek, W.Z.


    The transition from the Last Glacial towards the Holocene is marked by two rapid increases in temperature. These climate transitions are recorded in detail in the Greenland ice-cores, and these records reveal that the climate shifts around 14.7 and 11.5 ka cal. BP seem to have occurred within a few

  15. Monitoring microevolution of OXA-48-producing Klebsiella pneumoniae ST147 in a hospital setting by SMRT sequencing. (United States)

    Zautner, Andreas E; Bunk, Boyke; Pfeifer, Yvonne; Spröer, Cathrin; Reichard, Utz; Eiffert, Helmut; Scheithauer, Simone; Groß, Uwe; Overmann, Jörg; Bohne, Wolfgang


    Carbapenemase-producing Klebsiella pneumoniae pose an increasing risk for healthcare facilities worldwide. A continuous monitoring of ST distribution and its association with resistance and virulence genes is required for early detection of successful K. pneumoniae lineages. In this study, we used WGS to characterize MDR blaOXA-48-positive K. pneumoniae isolated from inpatients at the University Medical Center Göttingen, Germany, between March 2013 and August 2014. Closed genomes for 16 isolates of carbapenemase-producing K. pneumoniae were generated by single molecule real-time technology using the PacBio RSII platform. Eight of the 16 isolates showed identical XbaI macrorestriction patterns and shared the same MLST, ST147. The eight ST147 isolates differed by only 1-25 SNPs of their core genome, indicating a clonal origin. Most of the eight ST147 isolates carried four plasmids with sizes of 246.8, 96.1, 63.6 and 61.0 kb and a novel linear plasmid prophage, named pKO2, of 54.6 kb. The blaOXA-48 gene was located on a 63.6 kb IncL plasmid and is part of composite transposon Tn1999.2. The ST147 isolates expressed the yersinabactin system as a major virulence factor. The comparative whole-genome analysis revealed several rearrangements of mobile genetic elements and losses of chromosomal and plasmidic regions in the ST147 isolates. Single molecule real-time sequencing allowed monitoring of the genetic and epigenetic microevolution of MDR OXA-48-producing K. pneumoniae and revealed in addition to SNPs, complex rearrangements of genetic elements.

  16. Periodontitis promotes the diabetic development of obese rat via miR-147 induced classical macrophage activation. (United States)

    Xu, Ran; Zeng, Guang; Wang, Shuyong; Tao, Hong; Ren, Le; Zhang, Zhe; Zhang, Qingna; Zhao, Jinxiu; Gao, Jing; Li, Daxu


    Emerging evidence has indicated the bad effect of periodontal inflammation on diabetes control. However, the exact regulatory mechanisms within the association between periodontitis and diabetic development remain unclear. This study aims to investigate the function of microRNAs in regulating periodontitis-induced inflammation in an obese rat model. Experimental periodontitis was introduced into OLETF and LETO rat. Intraperitoneal glucose tolerance test was performed to detect diabetic development. Serum cytokines levels and microRNAs expression were detected by ELISA and RT-PCR analysis respectively. And, macrophages were isolated for gain- and loss-of-function studies, to investigate the regulatory mechanism of miR-147 in periodontitis-induced inflammation. Periodontitis induced proinflammatory response with classical activated macrophages in both rats, but distinctively aggravated the impaired glucose tolerance of OLETF rat with spontaneous type 2 diabetes. Analysis for serum microRNAs expression showed the distinctive and synergistic upregulation of miR-147 with periodontitis-induced effects in rats, while further experiments demonstrated the positive regulatory mechanism of miR-147 on classical activated macrophages with overexpressed proinflammatory markers, showing M1 phenotype. This study provided new evidence for the positive effect of periodontal inflammation on diabetic development, while the regulatory mechanism of miR-147 on classical macrophage activation, was verified, and presumed to contribute to the impaired glucose tolerance aggravated by periodontitis in obese rats. Besides, this study indicated the application of miR-147 for therapeutic approach in the treatment of diabetes with periodontitis. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  17. 76 FR 81999 - Submission for Review: Verification of Who Is Getting Payments, RI 38-107 and RI 38-147 (United States)


    ... MANAGEMENT Submission for Review: Verification of Who Is Getting Payments, RI 38-107 and RI 38-147 AGENCY: [email protected] or faxed to (202) 395-6974. SUPPLEMENTARY INFORMATION: RI 38-107, Verification of Who..., must verify that the entitled person is indeed receiving the monies payable. RI 38-147, Verification of...

  18. Downregulation of CD147 expression by RNA interference inhibits HT29 cell proliferation, invasion and tumorigenicity in vitro and in vivo. (United States)

    Li, Rui; Pan, Yuqin; He, Bangshun; Xu, Yeqiong; Gao, Tianyi; Song, Guoqi; Sun, Huiling; Deng, Qiwen; Wang, Shukui


    We investigated the effect of CD147 silencing on HT29 cell proliferation and invasion. We constructed a novel short hairpin RNA (shRNA) expression vector pYr-mir30-shRNA. The plasmid was transferred to HT29 cells. The expression of CD147, MCT1 (lactate transporters monocarboxylate transporter 1) and MCT4 (lactate transporters monocarboxylate transporter 4) were monitored by quantitative PCR and western blotting, respectively. The MMP-2 (matrix metalloproteinase-2) and MMP-9 (matrix metalloproteinase-9) activities were determined by gelatin zymography assay, while the intracellular lactate concentration was determined by the lactic acid assay kit. WST-8 assay was used to determine the HT29 cell proliferation and the chemosensitivity. Invasion assay was used to determine the invasion of HT29 cells. In addition, we established a colorectal cancer model, and detected CD147 expression in vivo. The results showed that the expression of CD147 and MCT1 was significantly reduced at both mRNA and protein levels, and also the activity of MMP-2 and MMP-9 was reduced. The proliferation and invasion were decreased, but chemosensitivity to cisplatin was increased. In vivo, the CD147 expression was also significantly decreased, and reduced the tumor growth after CD147 gene silencing. The results demonstrated that silencing of CD147 expression inhibited the proliferation and invasion, suggesting CD147 silencing might be an adjuvant gene therapy strategy to chemotherapy.

  19. Complications after 147 consecutive vertebral column resections for severe pediatric spinal deformity: a multicenter analysis. (United States)

    Lenke, Lawrence G; Newton, Peter O; Sucato, Daniel J; Shufflebarger, Harry L; Emans, John B; Sponseller, Paul D; Shah, Suken A; Sides, Brenda A; Blanke, Kathy M


    Retrospective multicenter review. Determine the definition, indications, results, and outcomes, focusing on complications of vertebral column resection (VCR) for severe pediatric spinal deformity. The strict definition of the VCR procedure, indications, results, outcomes, and the numerous, potentially serious complications are unknown or controversial, and a large multicenter review has never been performed. A total of 147 patients treated by 7 pediatric spinal deformity surgeons were reviewed-seventy-four females and 73 males, with an average age of 13.7 years, an average of 1.6 (range, 1-5) vertebrae resected, and an average follow-up of 17 months (range, 0.5-64 mo). The strict definition of VCR used was a "3-column circumferential vertebral osteotomy creating a segmental defect with sufficient instability to require provisional instrumentation." Indications for a VCR were divided into 5 diagnostic categories: kyphoscoliosis (n = 52), severe scoliosis (n = 37), congenital deformity (n = 28), global kyphosis (n = 17), and angular kyphosis (n = 13). Eighty-four primary and 63 revision patients with 174 operative procedures, 127 posterior-only (17 staged), and 20 patients combined anterior-posterior (10 staged) were reviewed. Average preoperative upright, flexibility, and postoperative Cobb measures (% correction or average kyphosis decrease) were kyphoscoliosis: 91°, 65°, 44° (51% coronal), 104°, 81°, and 47° (decrease, 57° sagittal); severe scoliosis: 104°, 78°, and 33° (67%); congenital deformity: 47°, 38°, 22° (46% coronal), 56°, 48°, and 32° (decrease, 24° sagittal); global kyphosis: 101°, 79°, and 47° (decrease, 54°); and angular kyphosis: 88°, 90°, and 38° (decrease, 50°), respectively. Operative time averaged 545 minutes (range, 204-1355 min) and estimated blood loss averaged 1610 mL (range, 50-8244 mL) for an average 65% blood volume loss (range, 6%-316%). Eighty-six patients (59%) developed a complication, 39 patients (27%) having

  20. The Cytomegalovirus UL146 Gene Product vCXCL1 Targets Both CXCR1 and CXCR2 as an Agonist

    DEFF Research Database (Denmark)

    Luttichau, H.R.


    Large DNA viruses, such as herpesvirus and poxvirus, encode proteins that target and exploit the chemokine system of their host. UL146 and UL147 in the cytomegalovirus (CMV) genome encode the two CXC chemokines vCXCL1 and vCXCL2. In this study, vCXCL1 was probed against a panel of the 18 classified...

  1. Technical Evaluation Report for Symposium AVT-147: Computational Uncertainty in Military Vehicle Design (United States)

    Radespiel, Rolf; Hemsch, Michael J.


    The complexity of modern military systems, as well as the cost and difficulty associated with experimentally verifying system and subsystem design makes the use of high-fidelity based simulation a future alternative for design and development. The predictive ability of such simulations such as computational fluid dynamics (CFD) and computational structural mechanics (CSM) have matured significantly. However, for numerical simulations to be used with confidence in design and development, quantitative measures of uncertainty must be available. The AVT 147 Symposium has been established to compile state-of-the art methods of assessing computational uncertainty, to identify future research and development needs associated with these methods, and to present examples of how these needs are being addressed and how the methods are being applied. Papers were solicited that address uncertainty estimation associated with high fidelity, physics-based simulations. The solicitation included papers that identify sources of error and uncertainty in numerical simulation from either the industry perspective or from the disciplinary or cross-disciplinary research perspective. Examples of the industry perspective were to include how computational uncertainty methods are used to reduce system risk in various stages of design or development.

  2. Measurements of the cosmic microwave background temperature at 1.47 GHz

    Energy Technology Data Exchange (ETDEWEB)

    Bensadoun, Marc John [Univ. of California, Berkeley, CA (United States)


    A radiofrequency-gain total power radiometer measured the intensity of the cosmic microwave background (CMB) at a frequency of 1.47 GHz (20.4 cm wavelength) from White Mountain, California, in September 1988 and from the South Pole, Antarctica, in December 1989. The CMB thermodynamic temperature, TCMB, is 2.27 ± 0.25 K (68% C.L.) measured from White Mountain and 2.26 ± 0.21 K from the South Pole site. The combined result is 2.27 ± 0.19 K. The correction for galactic emission has been derived from scaled low-frequency maps and constitutes the main source, of error. The atmospheric signal is found by extrapolation from zenith scan measurements at higher frequencies. The result is consistent with previous low-frequency measurements, including a measurement at 1.41 GHz (Levin et al. 1988) made with an earlier version of this instrument. The result is ~2.5 σ (~l% probability) from the 2.74 ± 0.02,K global average CMB temperature.

  3. Extracellular matrix metalloproteinase inducer (EMMPRIN/CD147) as a novel regulator of myogenic cell differentiation. (United States)

    Attia, Mohamed; Mohamed, Attia; Huet, Eric; Eric, Huet; Delbé, Jean; Jean, Delbé; Ledoux, Dominique; Dominique, Ledoux; Menashi, Suzanne; Suzanne, Menashi; Martelly, Isabelle; Isabelle, Martelly


    Matrix metalloproteinases (MMPs) are thought to play an important role in skeletal muscle cell growth and differentiation. In view of the MMP inducing function of EMMPRIN/CD147, its role in myogenic cell differentiation was investigated. EMMPRIN level increased during differentiation of both rat primary myoblasts derived from satellite cells and mouse C2.7 myogenic cells and was associated with an alteration in its molecular forms. In parallel, expression of pro-MMP-9 gradually decreased and that of pro-MMP-2 and active MMP-2 increased. While small interfering RNA (siRNA) inhibition of EMMPRIN expression accelerated cell differentiation, exogenously added recombinant EMMPRIN inhibited differentiation by an MMP-mediated mechanism, as the MMP inhibitor marimastat abrogated EMMPRIN's effect. Our results further suggest that EMMPRIN regulates differentiation through an MMP activation of transforming growth factor beta (TGFβ), a known inhibitor of myoblast's differentiation, as the increased activation and signaling of TGFβ by EMMPRIN was attenuated in the presence of marimastat. EMMPRIN inhibition may thus represent a novel strategy in the treatment of muscular degenerative disorders.

  4. Hepatitis B X-interacting protein promotes cisplatin resistance and regulates CD147 via Sp1 in ovarian cancer. (United States)

    Zou, Wei; Ma, Xiangdong; Yang, Hong; Hua, Wei; Chen, Biliang; Cai, Guoqing


    Ovarian cancer is the highest mortality rate of all female reproductive malignancies. Drug resistance is a major cause of treatment failure in malignant tumors. Hepatitis B X-interacting protein acts as an oncoprotein, regulates cell proliferation, and migration in breast cancer. We aimed to investigate the effects and mechanisms of hepatitis B X-interacting protein on resistance to cisplatin in human ovarian cancer cell lines. The mRNA and protein levels of hepatitis B X-interacting protein were detected using RT-PCR and Western blotting in cisplatin-resistant and cisplatin-sensitive tissues, cisplatin-resistant cell lines A2780/CP and SKOV3/CP, and cisplatin-sensitive cell lines A2780 and SKOV3. Cell viability and apoptosis were measured to evaluate cellular sensitivity to cisplatin in A2780/CP cells. Luciferase reporter gene assay was used to determine the relationship between hepatitis B X-interacting protein and CD147. The in vivo function of hepatitis B X-interacting protein on tumor burden was assessed in cisplatin-resistant xenograft models. The results showed that hepatitis B X-interacting protein was highly expressed in ovarian cancer of cisplatin-resistant tissues and cells. Notably, knockdown of hepatitis B X-interacting protein significantly reduced cell viability in A2780/CP compared with cisplatin treatment alone. Hepatitis B X-interacting protein and cisplatin cooperated to induce apoptosis and increase the expression of c-caspase 3 as well as the Bax/Bcl-2 ratio. We confirmed that hepatitis B X-interacting protein up-regulated CD147 at the protein expression and transcriptional levels. Moreover, we found that hepatitis B X-interacting protein was able to activate the CD147 promoter through Sp1. In vivo, depletion of hepatitis B X-interacting protein decreased the tumor volume and weight induced by cisplatin. Taken together, these results indicate that hepatitis B X-interacting protein promotes cisplatin resistance and regulated CD147 via Sp1 in

  5. Comparative study between NCRP-49 and NCRP-147 methodologies for shielding calculus to fluoroscopy rooms; Estudo comparativo entre as metodologias da NCRP-49 e da NCRP-147 para calculo de blindagem para salas de fluoroscopia

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, Christiano Eduardo Martins


    The walls of a fluoroscopy room must be shielded to prevent unnecessary exposures to technicians and public individuals. Thus this dissertation aims to describe the methodologies contained in two documents which are references for the calculation of shielding those rooms. They are the National Council on Radiation Protection and Measurements Report No. 49 (NCRP Report No. 49) and No. 147 (NCRP Report No. 147), the latter being more recent publication. And based on such description was made a comparative study between the two methodologies, using for this, as a benchmark, spreadsheets computer program developed by Wolfram Mathematica 6. With that we could reach the final thickness of the barriers to a Standard Plan for a fluoroscopy room (provided by Siemens) and noted that the NCRP-49 presents a methodology with results more conservative. (author)

  6. 40 CFR 147.1050 - State-administered program-Class I, II, III, IV, and V wells. (United States)


    ... CONTROL PROGRAMS Maryland § 147.1050 State-administered program—Class I, II, III, IV, and V wells. The UIC program for Class I, II, III, IV, and V wells in the State of Maryland, except those wells on Indian lands... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administered program-Class I, II...

  7. 40 CFR 147.650 - State-administrative program-Class I, II, III, IV, and V wells. (United States)


    ... CONTROL PROGRAMS Idaho § 147.650 State-administrative program—Class I, II, III, IV, and V wells. The UIC program for Class I, II, III, IV, and V wells in the State of Idaho, other than those on Indian lands, is... 40 Protection of Environment 22 2010-07-01 2010-07-01 false State-administrative program-Class I...

  8. Removal of a Guenther Tulip retrievable inferior vena cava filter after 147 days in a pediatric patient

    Energy Technology Data Exchange (ETDEWEB)

    Mody, Rekha N.; Stokes, LeAnn S.; Bream, Peter R.; Spottswood, Stephanie E. [Vanderbilt University Medical Center, Department of Radiology, Nashville, TN (United States)


    A Guenther Tulip retrievable inferior vena cava filter was placed in a 9-year-old boy with T-cell ALL who had both iliofemoral deep vein thrombosis (DVT) and acute intracranial hemorrhage. The filter was removed 147 days after placement, when the patient was no longer at increased risk for DVT or pulmonary embolus. Removal of the filter did not compromise flow through the vena cava. (orig.)

  9. EMMPRIN/CD147 deficiency disturbs ameloblast-odontoblast cross-talk and delays enamel mineralization. (United States)

    Khaddam, Mayssam; Huet, Eric; Vallée, Benoît; Bensidhoum, Morad; Le Denmat, Dominique; Filatova, Anna; Jimenez-Rojo, Lucia; Ribes, Sandy; Lorenz, Georg; Morawietz, Maria; Rochefort, Gael Y; Kiesow, Andreas; Mitsiadis, Thimios A; Poliard, Anne; Petzold, Matthias; Gabison, Eric E; Menashi, Suzanne; Chaussain, Catherine


    Tooth development is regulated by a series of reciprocal inductive signaling between the dental epithelium and mesenchyme, which culminates with the formation of dentin and enamel. EMMPRIN/CD147 is an Extracellular Matrix MetalloPRoteinase (MMP) INducer that mediates epithelial-mesenchymal interactions in cancer and other pathological processes and is expressed in developing teeth. Here we used EMMPRIN knockout (KO) mice to determine the functional role of EMMPRIN on dental tissue formation. We report a delay in enamel deposition and formation that is clearly distinguishable in the growing incisor and associated with a significant reduction of MMP-3 and MMP-20 expression in tooth germs of KO mice. Insufficient basement membrane degradation is evidenced by a persistent laminin immunostaining, resulting in a delay of both odontoblast and ameloblast differentiation. Consequently, enamel volume and thickness are decreased in adult mutant teeth but enamel maturation and tooth morphology are normal, as shown by micro-computed tomographic (micro-CT), nanoindentation, and scanning electron microscope analyses. In addition, the dentino-enamel junction appears as a rough calcified layer of approximately 10±5μm thick (mean±SD) in both molars and growing incisors of KO adult mice. These results indicate that EMMPRIN is involved in the epithelial-mesenchymal cross-talk during tooth development by regulating the expression of MMPs. The mild tooth phenotype observed in EMMPRIN KO mice suggests that the direct effect of EMMPRIN may be limited to a short time window, comprised between basement membrane degradation allowing direct cell contact and calcified matrix deposition. Copyright © 2014 Elsevier Inc. All rights reserved.


    African Journals Online (AJOL)

    INTRODUCTION. Fluorescent materials, particularly blue fluorescent materials have gained strong interest because ... emitting complexes in different technical applications, such as emitting materials for organic light emitting ..... properties of three novel two-dimensional lanthanide coordination polymers with mixed aromatic ...

  11. Pyroelectric Ferroelectric and Resistivity Studies on Samarium ...

    African Journals Online (AJOL)

    Barium Strontium Sodium Niobate (Ba1-xSrx)2NaNb5O15 (BSNN) belongs to tungsten bronze ferroelectric morphotrophic phase boundary (MPB) system at x = 0.6, having large spontaneous polarisation, pyroelectric coefficient and low dielectic constant and is expected to be applicable for piezoceramic filter and ...


    African Journals Online (AJOL)

    emitting complexes in different technical applications, such as emitting materials for organic light emitting diodes, sensitizers in solar energy conversion, chemical sensors and so forth [6-9]. The ability of bipy to act as a rigid ..... properties of three-dimensional organic-inorganic hybrids based on α-metatungstate. Inorg. Chim.

  13. MEET ISOLDE - Target Production

    CERN Multimedia


    MEET ISOLDE - Target Production. Everything at ISOLDE starts with a target and the target production team realise on more then 50 years of experience to build and develop new targets for ISOLDE’s wide physics program.

  14. A novel role of EMMPRIN/CD147 in transformation of quiescent fibroblasts to cancer-associated fibroblasts by breast cancer cells (United States)

    Xu, Jing; Lu, Yang; Qiu, Songbo; Chen, Zhi-Nan; Fan, Zhen


    We tested the novel hypothesis that EMMPRIN/CD147, a transmembrane glycoprotein overexpressed in breast cancer cells, has a previously unknown role in transforming fibroblasts to cancer-associated fibroblasts, and that cancer-associated fibroblasts in turn induce epithelial-to-mesenchymal transition of breast cancer cells. Co-culture of fibroblasts with breast cancer cells or treatment of fibroblasts with breast cancer cell conditioned culture medium or recombinant EMMPRIN/CD147 induced expression of α-SMA in the fibroblasts in an EMMPRIN/CD147-dependent manner and promoted epithelial-to-mesenchymal transition of breast cancer cells and enhanced cell migration potential. These findings support a novel role of EMMPRIN/CD147 in regulating the interaction between cancer and stroma. PMID:23474495

  15. Ovarian metastases resection from extragenital primary sites: outcome and prognostic factor analysis of 147 patients

    Directory of Open Access Journals (Sweden)

    Li Wenhua


    Full Text Available Abstract Background To explore the outcomes and prognostic factors of ovarian metastasectomy intervention on overall survival from extragenital primary cancer. Methods Patients with ovarian metastases from extragenital primary cancer confirmed by laparotomy surgery and ovarian metastases resection were retrospectively collected in a single institution during an 8-year period. A total of 147 cases were identified and primary tumor sites were colorectal region (49.0%, gastric (40.8%, breast (8.2%, biliary duct (1.4% and liver (0.7%. The pathological and clinical features were evaluated. Patients’ outcome with different primary tumor sites and predictive factors for overall survival were also investigated by univariate and multivariate analysis. Results Metachronous ovarian metastasis occurred in 92 (62.6% and synchronous in 55 (37.4% patients. Combined metastases occurred in 40 (27.2%. Bilateral metastasis was found in 97 (66% patients. The median ovarian metastasis tumor size was 9 cm. There were 39 (26.5% patients with massive ascites ≥ 1000 mL on intraoperative evaluation. With a median follow-up of 48 months, the median OS after ovarian metastasectomy for all patients was 8.2 months (95% CI 7.2-9.3 months. In univariate analyses, there is significant (8.0 months vs. 41.0 months, P = 0.000 difference in OS between patients with gastrointestinal cancer origin from breast origin, and between patients with gastric origin from colorectal origin (7.4 months vs. 8.8 months, P = 0.036. In univariate analyses, synchronous metastases, locally invasion, massive intraoperative ascites (≥ 1000 mL, and combined metastasis, were identified as significant poor prognostic factors. In multivariate analyses combined metastasis (RR, 1.72; 95% CI, 1.09-2.69, P = 0.018, locally invasion (RR, 1.62; 95% CI, 1.03-2.54, P = 0.038 and massive intraoperative ascites (RR, 1.58; 95% CI, 1.02-2.49, P = 0.04 were independent factors for predicting

  16. Ovarian metastases resection from extragenital primary sites: outcome and prognostic factor analysis of 147 patients. (United States)

    Li, Wenhua; Wang, Huaying; Wang, Jian; L V, Fangfang; Zhu, Xiaodong; Wang, Zhonghua


    To explore the outcomes and prognostic factors of ovarian metastasectomy intervention on overall survival from extragenital primary cancer. Patients with ovarian metastases from extragenital primary cancer confirmed by laparotomy surgery and ovarian metastases resection were retrospectively collected in a single institution during an 8-year period. A total of 147 cases were identified and primary tumor sites were colorectal region (49.0%), gastric (40.8%), breast (8.2%), biliary duct (1.4%) and liver (0.7%). The pathological and clinical features were evaluated. Patients' outcome with different primary tumor sites and predictive factors for overall survival were also investigated by univariate and multivariate analysis. Metachronous ovarian metastasis occurred in 92 (62.6%) and synchronous in 55 (37.4%) patients. Combined metastases occurred in 40 (27.2%). Bilateral metastasis was found in 97 (66%) patients. The median ovarian metastasis tumor size was 9 cm. There were 39 (26.5%) patients with massive ascites ≥ 1000 mL on intraoperative evaluation. With a median follow-up of 48 months, the median OS after ovarian metastasectomy for all patients was 8.2 months (95% CI 7.2-9.3 months). In univariate analyses, there is significant (8.0 months vs. 41.0 months, P = 0.000) difference in OS between patients with gastrointestinal cancer origin from breast origin, and between patients with gastric origin from colorectal origin (7.4 months vs. 8.8 months, P = 0.036). In univariate analyses, synchronous metastases, locally invasion, massive intraoperative ascites (≥ 1000 mL), and combined metastasis, were identified as significant poor prognostic factors. In multivariate analyses combined metastasis (RR, 1.72; 95% CI, 1.09-2.69, P = 0.018), locally invasion (RR, 1.62; 95% CI, 1.03-2.54, P = 0.038) and massive intraoperative ascites (RR, 1.58; 95% CI, 1.02-2.49, P = 0.04) were independent factors for predicting unfavorable overall survival. Ovarian

  17. Evaluation of the immunological profile of antibody-functionalized metal-filled single-walled carbon nanocapsules for targeted radiotherapy (United States)

    Perez Ruiz de Garibay, Aritz; Spinato, Cinzia; Klippstein, Rebecca; Bourgognon, Maxime; Martincic, Markus; Pach, Elzbieta; Ballesteros, Belén; Ménard-Moyon, Cécilia; Al-Jamal, Khuloud T.; Tobias, Gerard; Bianco, Alberto


    This study investigates the immune responses induced by metal-filled single-walled carbon nanotubes (SWCNT) under in vitro, ex vivo and in vivo settings. Either empty amino-functionalized CNTs [SWCNT-NH2 (1)] or samarium chloride-filled amino-functionalized CNTs with [SmCl3@SWCNT-mAb (3)] or without [SmCl3@SWCNT-NH2 (2)] Cetuximab functionalization were tested. Conjugates were added to RAW 264.7 or PBMC cells in a range of 1 μg/ml to 100 μg/ml for 24 h. Cell viability and IL-6/TNFα production were determined by flow cytometry and ELISA. Additionally, the effect of SWCNTs on the number of T lymphocytes, B lymphocytes and monocytes within the PBMC subpopulations was evaluated by immunostaining and flow cytometry. The effect on monocyte number in living mice was assessed after tail vein injection (150 μg of each conjugate per mouse) at 1, 7 and 13 days post-injection. Overall, our study showed that all the conjugates had no significant effect on cell viability of RAW 264.7 but conjugates 1 and 3 led to a slight increase in IL-6/TNFα. All the conjugates resulted in significant reduction in monocyte/macrophage cell numbers within PBMCs in a dose-dependent manner. Interestingly, monocyte depletion was not observed in vivo, suggesting their suitability for future testing in the field of targeted radiotherapy in mice.

  18. SU-D-304-02: Magnetically Focused Proton Irradiation of Small Field Targets

    Energy Technology Data Exchange (ETDEWEB)

    McAuley, GA; Slater, JM [Loma Linda University, Loma Linda, CA (United States); Slater, JD; Wroe, AJ [Loma Linda University Medical Center, Loma Linda, CA (United States)


    Purpose: To investigate the use of magnetic focusing for small field proton irradiations. It is hypothesized that magnetic focusing will provide significant dose distribution benefits over standard collimated beams for fields less than 10 mm diameter. Methods: Magnets consisting of 24 segments of radiation hard samarium-cobalt adhered into hollow cylinders were designed and manufactured. Two focusing magnets were placed on a positioning track on our Gantry 1 treatment table. Proton beams with energies of 127 and 157 MeV, 15 and 30 mm modulation, and 8 mm initial diameters were delivered to a water tank using single-stage scattering. Depth dose distributions were measured using a PTW PR60020 diode detector and transverse profiles were measured with Gafchromic EBT3 film. Monte Carlo simulations were also performed - both for comparison with experimental data and to further explore the potential of magnetic focusing in silica. For example, beam spot areas (based on the 90% dose contour) were matched at Bragg depth between simulated 100 MeV collimated beams and simulated beams focused by two 400 T/m gradient magnets. Results: Preliminary experimental results show 23% higher peak to entrance dose ratios and flatter spread out Bragg peak plateaus for 8 mm focused beams compared with uncollimated beams. Monte Carlo simulations showed 21% larger peak to entrance ratios and a ∼9 fold more efficient dose to target delivery compared to spot-sized matched collimated beams. Our latest results will be presented. Conclusion: Our results suggest that rare earth focusing magnet assemblies could reduce skin dose and beam number while delivering dose to nominally spherical radiosurgery targets over a much shorter time compared to unfocused beams. Immediate clinical applications include those associated with proton radiosurgery and functional radiosurgery of the brain and spine, however expanded treatment sites can be also envisaged.

  19. HAb18G/CD147 cell-cell contacts confer resistance of a HEK293 subpopulation to anoikis in an E-cadherin-dependent manner

    Directory of Open Access Journals (Sweden)

    Zhu Ping


    Full Text Available Abstract Background Acquisition of resistance to "anoikis" facilitates the survival of cells under independent matrix-deficient conditions, such as cells in tumor progression and the production of suspension culture cells for biomedical engineering. There is evidence suggesting that CD147, an adhesion molecule associated with survival of cells in tumor metastasis and cell-cell contacts, plays an important role in resistance to anoikis. However, information regarding the functions of CD147 in mediating cell-cell contacts and anoikis-resistance remains limited and even self-contradictory. Results An anoikis-resistant clone (HEK293ar, derived from anoikis-sensitive parental Human Embryonic Kidney 293 cells, survived anoikis by the formation of cell-cell contacts. The expression of HAb18G/CD147 (a member of the CD147 family was upregulated and the protein was located at cell-cell junctions. Upregulation of HAb18G/CD147 in suspended HEK293ar cells suppressed anoikis by mediating the formation of cell-cell adhesions. Anoikis resistance in HEK293ar cells also required E-cadherin-mediated cell-cell contacts. Knock-down of HAb18G/CD147 and E-cadherin inhibited cell-cell contacts formation and increased anoikis sensitivity respectively. When HAb18G/CD147 was downregulated, E-cadherin expression in HEK293ar cells was significantly suppressed; however, knockdown of E-cadherin by E-cadherin siRNA or blocking of E-cadherin binding activity with a specific antibody and EDTA had no significant effect on HAb18G/CD147 expression. Finally, pretreatment with LY294002, a phosphoinositide 3-kinase (PI3K/AKT inhibitor, disrupted cell-cell contacts and decreased cell number, but this was not the case in cells treated with the extracellular signal-regulated kinase (ERK inhibitor PD98059. Conclusions Our results provide new evidence that HAb18G/CD147-mediated cell-cell contact confers anoikis resistance in an E-cadherin-dependent manner; and cell-cell contact mediated

  20. Water in orthopyroxene from abyssal spinel peridotites of the East Pacific Rise (ODP Leg 147: Hess Deep) (United States)

    Hesse, Kirsten T.; Gose, Jürgen; Stalder, Roland; Schmädicke, Esther


    Abyssal spinel peridotites from Hess Deep, East Pacific Rise (ODP Leg 147) were investigated concerning their major, minor, and trace element mineral chemistry and the incorporation of structural water in orthopyroxene. The rocks are partially serpentinized harzburgites containing primary minerals of olivine, orthopyroxene, clinopyroxene, and spinel. Orthopyroxene is enstatitic with Mg# (Mg/(Mg + Fe)) between 0.90 and 0.92 and Al2O3 from 0.5 to 2.9 wt.%. The residual harzburgite experienced high degrees of melt removal in the spinel peridotite stability field. The average degree of partial melting was calculated to be 17.5% (range: 16.4-17.8%). Trace element data of ortho- and clinopyroxenes reflect this strong depletion, characteristic for the restitic nature of abyssal peridotites. Mantle re-equilibration temperatures around 1000 °C indicate that, after melt extraction and before exhumation to the ocean floor, the rocks experienced significant cooling in the spinel peridotite facies. Water contents of orthopyroxene range from 86 to 233 wt. ppm H2O with an average concentration of 142 wt. ppm H2O. These results represent the first data on water contents in the sub-pacific mantle obtained by direct measurements of sub-oceanic peridotite. The water contents are not related to mineral chemistry, stratigraphy, melting degree, mantle equilibrium conditions or oxidation state. Calculated post-melt peridotite water contents vary between 40 and 100 wt. ppm H2O. Compared to Mid-Atlantic Ridge peridotites, the East Pacific Rise samples of Leg 147 contain somewhat lower water concentrations than samples from Leg 153 and considerably higher contents than those of Leg 209 (Gose et al., 2009; Schmädicke et al., 2011). In Leg 147, the strongest OH absorbtion band occurs at 3420 cm- 1, wheras orthopyroxene from MAR peridotite (Legs 153 and 209) has its strongest absorbtion band at 3566 and 3522 cm- 1. The mantle equilibrium temperature of Leg 147 peridotites is lower than that

  1. Comparison of the binding behavior of several histidine-containing proteins with immobilized copper(II) complexes of 1,4,7-triazacyclononane and 1,4-bis(1,4,7-triazacyclononan-1-yl)butane. (United States)

    Graham, Bim; Spiccia, Leone; Hearn, Milton T W


    The protein binding characteristics of the immobilized binucleating chelate system, 1,4-bis(1,4,7-triazacyclononan-1-yl)butane (tacn(2)butane), complexed with Cu(2+) ions have been investigated with hen egg white lysozyme, horse skeletal muscle myoglobin and horse heart cytochrome C, as well as three histidine-rich proteins, serum albumin, transferrin, and α(2)-macroglobulin, present in partially fractionated human serum. The effects of pH, ionic strength and elution buffers on protein binding have been examined and compared with those of the analogous immobilized mononuclear copper complex of 1,4,7-triazacyclononane (tacn). The Cu(2+)-tacn(2)butane system was generally found to exhibit higher protein binding affinities than the Cu(2+)-tacn system, suggesting that the presence of immobilized binuclear copper(II) species leads to enhanced coordinative interaction with surface-exposed amino acid residues of the studied proteins. However, under some buffer conditions the dependencies of protein binding and elution on pH and ionic strength with these immobilized metal ion affinity chromatographic (IMAC) systems were consistent with electrostatic, hydrophobic and π-bonding interactions playing a significant secondary role in addition to the dominant coordinative interactions. As such, the results indicated that the selectivities were not solely dependent on the histidine content of the protein. In accord with this conclusion, differences in the selectivities of the Cu(2+)-tacn and Cu(2+)-tacn(2)butane adsorbents for serum albumin, transferrin, and α(2)-macroglobulin were observed depending on the choice of elution buffer. This attribute suggests that additional selectivity features can be realised for the separation of specific proteins with this new class of adsorbent. Copyright © 2011. Published by Elsevier B.V.

  2. Characterization of an Avipoxvirus From a Bald Eagle ( Haliaeetus leucocephalus ) Using Novel Consensus PCR Protocols for the rpo147 and DNA-Dependent DNA Polymerase Genes. (United States)

    Stephen, Alexa A; Leone, Angelique M; Toplon, David E; Archer, Linda L; Wellehan, James F X


    A juvenile female bald eagle ( Haliaeetus leucocephalus ) was presented with emaciation and proliferative periocular lesions. The eagle did not respond to supportive therapy and was euthanatized. Histopathologic examination of the skin lesions revealed plaques of marked epidermal hyperplasia parakeratosis, marked acanthosis and spongiosis, and eosinophilic intracytoplasmic inclusion bodies. Novel polymerase chain reaction (PCR) assays were done to amplify and sequence DNA polymerase and rpo147 genes. The 4b gene was also analyzed by a previously developed assay. Bayesian and maximum likelihood phylogenetic analyses of the obtained sequences found it to be poxvirus of the genus Avipoxvirus and clustered with other raptor isolates. Better phylogenetic resolution was found in rpo147 rather than the commonly used DNA polymerase. The novel consensus rpo147 PCR assay will create more accurate phylogenic trees and allow better insight into poxvirus history.

  3. Utilization, at hot temperature, of an ion exchange resin column. Application to the separation of {sup 91}Y - {sup 147}Pm; Utilisation, a chaud, dune colonne de resine echangeuse d'ions. Application a la separation {sup 91} Y - {sup 147} Pm

    Energy Technology Data Exchange (ETDEWEB)

    Bloch, G.; Cohen, P. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires


    The fission products with long period can be separate by fractional elution, to ambient temperature, on column of an ion exchange resin. The separation of the couple {sup 91}Y + {sup 147}Pm being particularly long, we tried to improve it while using a heated column. For this study, we specified the effect of the temperature on the factor of separation: {alpha}, ratio between the Kd partition coefficients of {sup 147}Pm and {sup 91}Y: {alpha}= Kd ({sup 147}Pm) / Kd ({sup 91}Y). (M.B.) [French] Les produits de fission a periode longue peuvent etre separes par elution fractionnee, a temperature ambiante, sur colonne de resine echangeuse d'ions. La separation du couple {sup 91}Y + {sup 147}Pm etant particulerement longue, nous avons cherche a l'ameliorer en utilisant une colonne chauffee. A l'occasion de cette etude, nous avons ete amenes a preciser l'effet de la temperature sur le facteur de separation: {alpha}, rapport entre les coefficients de partage Kd de {sup 147}Pm et {sup 91}Y: {alpha} = Kd({sup 147}Pm) / Kd({sup 91}Y). (M.B.)

  4. Determination of specific radioactivity of samarium-153 product. 1. Quantitative determination of samarium by spectrophotometry

    Energy Technology Data Exchange (ETDEWEB)

    Izumo, Mishiroku [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Nemoto, Masahiro [Tokyo Nuclear Service Co., Ltd., Tokyo (Japan)


    On the specific radioactivity of Sm-153 for the radiotherapy of cancers, a simple method for determination of the amount of Sm was described. The method used Arsenazo III as a colorimetric reagent. The sample irradiated in the reactor was dissolved in 1M HCl solution. A small part of it was taken and mixed with Arsenazo III at pH 3.2, and the amount of Sm was determined by the spectrophotometric method at a wavelength of 652 nm. The molar absorptivity of Sm at 652 nm was 6.6x10{sup 3} m{sup -1}{center_dot}mm{sup -1}. The error of measurement in the partial different conditions was about 2% of the value determined. The effects of impurities, Fe, Zn and Cu mixing in the Sm during operation, were clarified. (author)

  5. A new 147-56 hPa water vapor product from the UARS Microwave Limb Sounder (United States)

    Read, W. G.; Wu, D. L.; Waters, J. W.; Pumphrey, H. C.


    Measurements of H2O in the tropopause region have been obtained by production of a new data set from the Microwave Limb Sounder (MLS) on the Upper Atmosphere Research Satellite (UARS). A modified version of the retrieval scheme used to produce upper tropospheric humidity (UTH) from the MLS 203 GHz radiometer was applied to the MLS 183 GHz radiometer measurements to produce useful H2O data at 147, 121, 100, 83, 68, and 56 hPa. These new data, for the first 18 months of the UARS mission when the MLS 183 GHz radiometer was operational, fill an important "gap" around 100 hPa where previous MLS H2O data were generally not useful. Characteristics of the new data set are discussed and compared with National Oceanic and Atmospheric Administration (NOAA), Climate Monitoring and Diagnostics Laboratory (CMDL) frost-point hygrometer, and UARS Halogen Occultation Experiment (HALOE) measurements.

  6. OH(A 2Sigma(+) - X 2Pi) emission from dissociative excitation of HO2 at 147 nm (United States)

    Suto, M.; Lee, L. C.


    The photodissociation processes of the HO2 radical have been studied using the Xe resonance line at 147 nm as a light source. HO2 radical was produced by the reaction H + O2 + He HO2 + He in a flow tube, and the HO2 concentration was measured by a titration method HO2 + NO - OH + NO2. An observed emission in the 310 + or -10 nm region was found to be due solely to photodissociation and is attributed to the OH(A 2Sigma(+) - X 2Pi) system. This emission was studied as a function of O2 and H2 pressure added to the flow tube. Other possible photoemission processes were considered, including photoexcitation of OH, photodissociative excitation of H2O2, emission from the reaction O(D-1) + H, and metastable O2 produced from photodissociation of HO2. It is concluded that the emission intensities produced from these processes is negligible.

  7. Does a distal forearm fracture lead to evaluation for osteoporosis? A retrospective cohort study in 147 Danish women

    DEFF Research Database (Denmark)

    Rud, Bo; Greibe, Rasmus; Hyldstrup, Lars


    for a densitometry to estimate the prevalence of osteoporosis. From May 1, 2001 to April 30, 2002, 147 women presented with a low-trauma distal forearm fractures. According to the review of hospital records, none of the women was referred for bone densitometry or spine X-rays. One woman had calcium and vitamin D...... supplementation (CVDS) prescribed and two were recommended to consult their GPs for osteoporosis follow-up. In primary care, 12 women were referred for densitometry or spine X-rays, and 11 women started CVDS after the fracture. Women with risk factors for osteoporosis in addition to the forearm fracture were...... not more likely to be referred for densitometry or spine X-rays (p = 0.10). The prevalence of osteoporosis was 24% among the 79 women who underwent densitometry. Our study demonstrates a low use of available measures to reduce the risk of future fracture in women with a low-trauma distal forearm fracture...

  8. Does a distal forearm fracture lead to evaluation for osteoporosis? A retrospective cohort study in 147 Danish women

    DEFF Research Database (Denmark)

    Rud, Bo; Greibe, Rasmus; Hyldstrup, Lars


    for a densitometry to estimate the prevalence of osteoporosis. From May 1, 2001 to April 30, 2002, 147 women presented with a low-trauma distal forearm fractures. According to the review of hospital records, none of the women was referred for bone densitometry or spine X-rays. One woman had calcium and vitamin D......In postmenopausal women, a low-trauma distal forearm fracture is a risk factor for osteoporosis and future fracture, which indicates osteoporosis follow-up according to prevailing guidelines. We decided to determine how often women over 45 yr presenting with a low-trauma distal forearm fracture...... to a Danish emergency department during a 1-yr period were followed up for osteoporosis. We performed a retrospective review of hospital records and we sent the women and their general practitioners (GPs) questionnaires regarding the follow-up undertaken in primary care. Finally, we invited the women...

  9. Targeted therapies for cancer (United States)

    ... so they cannot spread. How Does Targeted Therapy Work? Targeted therapy drugs work in a few different ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  10. Reflectance Reference Targets (OTTER) (United States)

    National Aeronautics and Space Administration — ABSTRACT: Spectral reflectance measurements of flat field targets as reference points representative of pseudo-invariant targets as measured by Spectron SE590...

  11. Reflectance Reference Targets (OTTER) (United States)

    National Aeronautics and Space Administration — Spectral reflectance measurements of flat field targets as reference points representative of pseudo-invariant targets as measured by Spectron SE590 spectrophotometer

  12. Targets for Precision Measurements (United States)

    Loveland, W.; Yao, L.; Asner, D. M.; Baker, R. G.; Bundgaard, J.; Burgett, E.; Cunningham, M.; Deaven, J.; Duke, D. L.; Greife, U.; Grimes, S.; Heffner, M.; Hill, T.; Isenhower, D.; Klay, J. L.; Kleinrath, V.; Kornilov, N.; Laptev, A. B.; Massey, T. N.; Meharchand, R.; Qu, H.; Ruz, J.; Sangiorgio, S.; Selhan, B.; Snyder, L.; Stave, S.; Tatishvili, G.; Thornton, R. T.; Tovesson, F.; Towell, D.; Towell, R. S.; Watson, S.; Wendt, B.; Wood, L.


    The general properties needed in targets (sources) for high precision, high accuracy measurements are reviewed. The application of these principles to the problem of developing targets for the Fission TPC is described. Longer term issues, such as the availability of actinide materials, improved knowledge of energy losses and straggling and the stability of targets during irradiation are also discussed.

  13. Setting Asset Performance Targets

    NARCIS (Netherlands)

    Green, D.; Hodkiewicz, M.; Masschelein, S.; Schoenmaker, R.; Muruvan, S.


    Setting targets is a common way for organisations to establish performance expectations. However the validity of targets is challenged when performance is influenced by factors beyond the control of the manager. This project examines the issue of target setting for a single asset performance measure

  14. The two mayor warming phases of the last deglaciation at ~14.7 and ~11.5 kyr cal BP in Europe: climate reconstructions and AGCM experiments.

    NARCIS (Netherlands)

    Renssen, H.; Isarin, R.F.B.


    During the last deglaciation two distinct warming phases occurred in the N Atlantic region at ∼14.7 and ∼11.5 ka cal BP. These two shifts are the transitions from (1) GS-2a (Greenland Stadial 2a) to GI-1e (Greenland Interstadial 1e) and (2) GS-1 to the Preboreal. In this study we characterise these

  15. 40 CFR 147.2101 - EPA-administered program-Class I, III, IV and V wells and all wells on Indian lands. (United States)


    ... UNDERGROUND INJECTION CONTROL PROGRAMS South Dakota § 147.2101 EPA-administered program—Class I, III, IV and V wells and all wells on Indian lands. (a) Contents. The UIC program for all Class I, III, IV, and V wells... program for Class I, III, IV and V wells on all lands in South Dakota, including Indian lands, and for...

  16. Atmospheric variability over the 14,7 kyr BP stadial-interstadial transition in the North Atlantic region as simulated by an AGCM

    NARCIS (Netherlands)

    Renssen, H.; Bogaart, P.W.


    The ECHAM4-T42 atmospheric general circulation model was applied to study the change in atmospheric variability in the North Atlantic region over the similar to14.7 kyr cal BP climatic transition from Greenland Stadial 2a (GS-2a, end of Pleniglacial) to Greenland Interstadial le (GI-le, start Late

  17. Development of distributed target

    CERN Document Server

    Yu Hai Jun; Li Qin; Zhou Fu Xin; Shi Jin Shui; Ma Bing; Chen Nan; Jing Xiao Bing


    Linear introduction accelerator is expected to generate small diameter X-ray spots with high intensity. The interaction of the electron beam with plasmas generated at the X-ray converter will make the spot on target increase with time and debase the X-ray dose and the imaging resolving power. A distributed target is developed which has about 24 pieces of thin 0.05 mm tantalum films distributed over 1 cm. due to the structure adoption, the distributed target material over a large volume decreases the energy deposition per unit volume and hence reduces the temperature of target surface, then reduces the initial plasma formalizing and its expansion velocity. The comparison and analysis with two kinds of target structures are presented using numerical calculation and experiments, the results show the X-ray dose and normalized angle distribution of the two is basically the same, while the surface of the distributed target is not destroyed like the previous block target

  18. Involvement of CD147 in overexpression of MMP-2 and MMP-9 and enhancement of invasive potential of PMA-differentiated THP-1

    Directory of Open Access Journals (Sweden)

    Tang Hao


    Full Text Available Abstract Background During infection and inflammation, circulating blood monocytes migrate from the intravascular compartments to the extravascular compartments, where they mature into tissue macrophages. The maturation process prepares the cells to actively participate in the inflammatory and immune responses, and many factors have been reported to be involved in the process. We found in our study that CD147 played a very important role in this process. Results By using PMA-differentiated human monocyte cells line THP-1, we found that CD147 mediated matrix metalloproteinases (MMPs expression of the leukemic THP-1 cells and thus enhanced the invasiveness of THP-1 cells. After 24 hours of PMA-induced monocyte differentiation, the mean fluorescence intensity of CD147 in differentiated THP-1 cells (289.61 ± 31.63 was higher than that of the undifferentiated THP-1 cells (205.1 ± 19.25. There was a significant increase of the levels of proMMP-2, proMMP-9 and their activated forms in the differentiated THP-1 cells. Invasion assays using reconstituted basement membrane showed a good correlation between the invasiveness of THP-1 cells and the production of MMP-2 and MMP-9. The difference in the MMPs expression and the invasive ability was significantly blocked by HAb18G/CD147 antagonistic peptide AP-9. The inhibitory rate of the secretion of proMMP-9 in the undifferentiated THP-1 cells was 45.07%. The inhibitory rate of the secretion of proMMP-9, the activated MMP-9 and proMMP-2 in the differentiated THP-1 cells was 52.90%, 53.79% and 47.80%, respectively. The inhibitory rate of invasive potential in the undifferentiated cells and the differentiated THP-1 cells was 41.82 % and 25.15%, respectively. Conclusion The results suggest that the expression of CD147 is upregulated during the differentiation of monocyte THP-1 cells to macrophage cells, and CD147 induces the secretion and activation of MMP-2 and MMP-9 and enhances the invasive ability of THP-1

  19. Abnormalities in soluble CD147 / MMPs / TIMPs axis in Ankylosing Spondylitis patients with and without a history of Acute Anterior Uveitis / Anomalii ale axei CD147 solubil / MMPs / TIMPs la pacienții cu spondilită anchilozantă cu sau fără uveită acută anterioară

    Directory of Open Access Journals (Sweden)

    Mitulescu Traian Costin


    Full Text Available Spondilita Anchilozantă (SA este prototipul formei axiale a spondiloartritelor. În pofida studiilor extinse, sunt încă incomplet înțelese mecansimele complexe legate de procesele celulare și moleculare anormale din SA. Printre mediatorii inflamației, cum ar fi citokinele proinflamatoare, NOS-2, chemokinele, care conduc la inflamație, metaloproteinazele de matrice (MMPs joacă un rol important în procesele inflamatoare care caracterizează SA. De aceea, ne-am propus să evaluăm dacă perturbări ale homeostaziei inductorului extracelular de MMPs (EMMPRIN/CD147, MMPs și inhibitorilor tisulari ai MMPs (TIMPs joacă un rol în evoluția SA în special la pacienții care au în istoricul lor Uveită Acută Anterioară (UAA. În acest scop seruri de la pacienți cu SA și de la donatori sănătoși (DS au fost analizate pentru nivelurile de CD147 solubil (sCD147, MMP-3 și TIMP-1 prin tehnica imunoenzimatica ELISA și pentru activitatea gelatinazelor MMP-2 si MMP-9 folosind gelatin zimografia. Rezultatele experimentale au arătat că nivelurile de sCD147, MMP-3 si TIMP-1 sunt semnificativ crescute la pacienții cu SA comparativ cu DS. sCD147 ca și raportul MMP-2/sCD147 a diferențiat pacienții cu UAA de cei fără UAA în istoricul lor. La pacienții cu SA rapoartele MMP-2/sCD147, MMP-3/sCD147 și MMP-3/TIMP-1 au sugerat dezechilibrul dintre MMPs și reglatorii lor. Aceste rezultate sugerează că rapoartele MMPs/sCD147 pot deveni biomarkeri potențiali pentru întărirea caracterizării pacienților cu SA și pentru a prognoza evoluția bolii. Corelațiile pozitive și negative dintre anumite caracteristici experimentale și/sau clinice ale pacienților cu SA și terapie subliniază de asemenea utilitatea evaluării acestor biomarkeri pentru a identifica o terapie individualizată și eficientă.

  20. Inertial Confinement fusion targets (United States)

    Hendricks, C. D.


    Inertial confinement fusion (ICF) targets are made as simple flat discs, as hollow shells or as complicated multilayer structures. Many techniques were devised for producing the targets. Glass and metal shells are made by using drop and bubble techniques. Solid hydrogen shells are also produced by adapting old methods to the solution of modern problems. Some of these techniques, problems, and solutions are discussed. In addition, the applications of many of the techniques to fabrication of ICF targets is presented.

  1. Target Window Reliability

    Energy Technology Data Exchange (ETDEWEB)

    Woloshun, Keith Albert [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)


    The target window design implemented and tested in experiments at ANL have performed without failure for the available beam of 6 mm FWHM on a 12 mm diameter target. However, scaling that design to a 25 mm diameter target size for a 12 mm FWHM beam has proven problematic. Combined thermal and mechanical (pressure induced) stresses and strains are too high to maintain the small coolant gaps and provide adequate fatigue lifetime.

  2. The ISOLDE target robots

    CERN Multimedia

    Maximilein Brice


    ISOLDE targets need to be changed frequently, around 80 times per year. The high radiation levels do not permit this to be done by human hands and the target changes are effected by 2 industrial robots (picture _01). On the left, in the distance, the front-end of the GPS (General Purpose Separator) is seen, while the HRS (High Resolution Separator) is at the right. Also seen are the doors to the irradiated-target storage.

  3. Targeting the tumor microenvironment

    Energy Technology Data Exchange (ETDEWEB)

    Kenny, P.A.; Lee, G.Y.; Bissell, M.J.


    Despite some notable successes cancer remains, for the most part, a seemingly intractable problem. There is, however, a growing appreciation that targeting the tumor epithelium in isolation is not sufficient as there is an intricate mutually sustaining synergy between the tumor epithelial cells and their surrounding stroma. As the details of this dialogue emerge, new therapeutic targets have been proposed. The FDA has already approved drugs targeting microenvironmental components such as VEGF and aromatase and many more agents are in the pipeline. In this article, we describe some of the 'druggable' targets and processes within the tumor microenvironment and review the approaches being taken to disrupt these interactions.

  4. Target Assembly Facility (United States)

    Federal Laboratory Consortium — The Target Assembly Facility integrates new armor concepts into actual armored vehicles. Featuring the capability ofmachining and cutting radioactive materials, it...

  5. Evaluation of cellobiose dehydrogenase and laccase containing culture fluids of Termitomyces sp. OE147 for degradation of Reactive blue 21

    Directory of Open Access Journals (Sweden)

    Rishabh Gangwar


    Full Text Available This study evaluates culture filtrate, rich in cellobiose dehydrogenase and laccases, of Termitomyces sp. OE 147, in decolouration and degradation of Reactive blue (RB 21. About 35% decolouration was achieved at low volumes of the culture supernatant without addition of external redox mediators. An optimized dye to culture fluid ratio (75 ppm: 0.1 ml at a pH of 4–5 resulted in removal of colour by 60%. The degradation products of RB21 were analysed by Electron Spray Ionization-Mass Spectrometry and several small molecules (of m/z 106–199 were detected. These were concluded to be o-Xylene, 2,3-Dihydro-1H-isoindole, Isoindole-1,3-dione, 2,Benzenesulfonyl-ethanol, (4-Hydroxy-phenyl-sulfamic acid, 2,3-Dihydro-1H-isoindole-5-sulfonic acid and proposed to result from joint action of cellobiose dehydrogenase, laccase, peroxidases and unidentified oxidoreductases present in the culture fluids. Based on the products formed and the known reactions of these enzymes, a degradation pathway was proposed for RB21. The culture fluid was also effective in decolouration (by about 50% and detoxification (by ∼25% of the combined effluent collected from a local mill indicating a treatment process that bypasses use of H2O2 and toxic mediators.

  6. Inhaled /sup 147/Pm and/or total-body gamma radiation: Early mortality and morbidity in rats

    Energy Technology Data Exchange (ETDEWEB)

    Filipy, R.E.; Lauhala, K.E.; McGee, D.R.; Cannon, W.C.; Buschbom, R.L.; Decker, J.R.; Kuffel, E.G.; Park, J.F.; Ragan, H.A.; Yaniv, S.S.; Scott, B.R.


    Rats were given doses of /sup 60/Co gamma radiation and/or lung burdens of /sup 147/Pm (in fused aluminosilicate particles) within lethal ranges in an experiment to determine and compare morbidity and mortality responses for the radiation insults within 1 year after exposure. Radiation-induced morbidity was assessed by measuring changes in body weights, hematologic parameters, and pulmonary-function parameters. Acute mortality and morbidity from inhaled promethium were caused primarily by radiation pneumonitis and pulmonary fibrosis that occurred more than 53 days after exposure. Acute mortality and morbidity from total-body gamma irradiation occurred within 30 days of exposure and resulted from the bone-marrow radiation syndrome. Gamma radiation caused transient morbidity, reflected by immediately depressed blood cell levels and by reduced body weight gain in animals that survived the acute gamma radiation syndrome. Inhaled promethium caused a loss of body weight and diminished pulmonary function, but its only effect on blood cell levels was lymphocytopenia. Combined gamma irradiation and promethium lung burdens were synergistic, in that animals receiving both radiation insults had higher morbidity and mortality rates than would be predicted based on the effect of either kind of radiation alone. Promethium lung burdens enhanced the effect of gamma radiation in rats within the first 30 days of exposure, and gamma radiation enhanced the later effect of promethium lung burdens. 70 refs., 68 figs., 21 tabs.

  7. Deconvolution of [sup 204]Tl/[sup 36]Cl and [sup 147]Pm/[sup 45]Ca dual mixtures

    Energy Technology Data Exchange (ETDEWEB)

    Grau Carles, A. (Inst. de Investigacion Basica, CIEMAT, Madrid (Spain)); Rodriguez Barquero, L. (Inst. de Investigacion Basica, CIEMAT, Madrid (Spain)); Grau Malonda, A. (Inst. de Investigacion Basica, CIEMAT, Madrid (Spain))


    Technical characteristics of liquid scintillation counting include high counting efficiency, well-defined sample preparation procedures and a high capacity to measure a large number of samples. However, poor resolution and quenching limit the capability of measuring double-labeled samples when the maximum beta-ray energies are close. The simultaneous standardization of [sup 35]S and [sup 14]C was described in a previous paper, involving an improved spectrum unfolding method. This procedure has been tested with two other types of close maximum beta-energy nuclides: [sup 204]Tl and [sup 36]Cl have 710 and 763 keV maximum beta-energies respectively, and cannot be standardized simultaneously by double window methods. However, spectral shape differences permit their deconvolution with great accuracy. Both [sup 147]Pm and [sup 45]Ca (224 and 255 keV maximum beta-energies) have also been standardized. Samples with different quench values and activity ratios have been assayed, and the limitations have been determined. (orig.)

  8. Target visibility for multiple maneuvering target tracking (United States)

    Sabordo, Madeleine G.; Aboutanios, Elias


    We present a recursion of the probability of target visibility and its applications to analysis of track life and termination in the context of Global Nearest Neighbour (GNN) approach and Probability Hypothesis Density (PHD) filter. In the presence of uncertainties brought about by clutter; decisions to retain a track, terminate it or initialise a new track are based on probability, rather than on distance criterion or estimation error. The visibility concept is introduced into a conventional data-association-oriented multitarget tracker, the GNN; and a random finite set based-tracker, the PHD filter, to take into account instances when targets become invisible or occluded by obstacles. We employ the natural logarithmof the Dynamic Error Spectrum to assess the performance of the trackers with and without probability of visibility incorporated. Simulation results show that the performance of the GNN tracker with visibility concept incorporated is significantly enhanced.

  9. Frozen spin targets

    CERN Document Server

    Parsons, A S L


    Describes six projects which use the frozen-spin principle: Helium-3 R.M.S. and longitudinally polarized frozen spin targets at Rutherford Laboratory, and the frozen spin targets at KEK, Saclay and the one used by the CERN-Helsinki collaboration. (7 refs).

  10. Seedling root targets (United States)

    Diane L. Haase


    Roots are critical to seedling performance after outplanting. Although root quality is not as quick and simple to measure as shoot quality, target root characteristics should be included in any seedling quality assessment program. This paper provides a brief review of root characteristics most commonly targeted for operational seedling production. These are: root mass...

  11. Strategic Targeted Advertising

    NARCIS (Netherlands)

    A. Galeotti; J.L. Moraga-Gonzalez (José Luis)


    textabstractWe present a strategic game of pricing and targeted-advertising. Firms can simultaneously target price advertisements to different groups of customers, or to the entire market. Pure strategy equilibria do not exist and thus market segmentation cannot occur surely. Equilibria exhibit

  12. Segmented Target Design (United States)

    Merhi, Abdul Rahman; Frank, Nathan; Gueye, Paul; Thoennessen, Michael; MoNA Collaboration


    A proposed segmented target would improve decay energy measurements of neutron-unbound nuclei. Experiments like this have been performed at the National Superconducting Cyclotron Laboratory (NSCL) located at Michigan State University. Many different nuclei are produced in such experiments, some of which immediately decay into a charged particle and neutron. The charged particles are bent by a large magnet and measured by a suite of charged particle detectors. The neutrons are measured by the Modular Neutron Array (MoNA) and Large Multi-Institutional Scintillation Array (LISA). With the current target setup, a nucleus in a neutron-unbound state is produced with a radioactive beam impinged upon a beryllium target. The resolution of these measurements is very dependent on the target thickness since the nuclear interaction point is unknown. In a segmented target using alternating layers of silicon detectors and Be-targets, the Be-target in which the nuclear reaction takes place would be determined. Thus the experimental resolution would improve. This poster will describe the improvement over the current target along with the status of the design. Work supported by Augustana College and the National Science Foundation grant #0969173.

  13. The CNGS target

    CERN Multimedia

    Patrice Loïez


    The CERN Neutrinos to Gran Sasso (CNGS) target ‘magazine’ of five target units. Each unit contains a series of 10-cm long graphite rods distributed over a length of 2 m. It is designed to maximize the number of secondary particles produced and hence the number of neutrinos. One unit is used at a time to prevent over heating.

  14. Chemical and biological evaluation of {sup 153}Sm and {sup 46/47}Sc complexes of indazolebisphosphonates for targeted radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Neves, Maria, E-mail: mneves@itn.p [Instituto Tecnologico e Nuclear, Sacavem (Portugal); Teixeira, Fatima C.; Antunes, Ines [INETI-Departamento de Tecnologia de Industrias Quimicas, Lisboa (Portugal); Majkowska, Agnieszka [Institute of Nuclear Chemistry and Technology, Warsaw (Poland); Gano, Lurdes [Instituto Tecnologico e Nuclear, Sacavem (Portugal); Santos, Ana Cristina [IBB-Instituto de Biofisica e Biomatematica, Coimbra (Portugal)


    Introduction: Novel 1-hydroxy-1,1-bisphosphonates derived from indazole and substituted at the C-3 position were labeled with the radionuclides {sup 46}Sc and {sup 153}Sm. Several parameters such as molar ligand concentration, pH, reaction time and temperature were studied. The radiolabelling yield, reaction kinetics and stability were assessed and radiocomplexes were evaluated by in vitro and in vivo experiments. Methods: The radionuclides {sup 46}Sc and {sup 153}Sm were obtained by neutron irradiation of natural Sc{sub 2}O{sub 3} and enriched {sup 152}Sm{sub 2}O{sub 3} (98.4%) targets at the neutron flux of 3x10{sup 14} n cm{sup -2} s{sup -1}. The radiolabelling yield, reaction kinetics and stability were accomplished by ascending instant thin layer chromatography. The radiocomplexes were submitted to in vitro experiments (hydroxyapatite binding and lipophilicity) and biodistribution studies in animal models. Results: The radionuclides {sup 46}Sc and {sup 153}Sm were produced with specific activities of 100 and 430 MBq mg{sup -1}, respectively. High radiochemical yields were achieved and the hydrophilic radiocomplexes have shown high degree of binding to hydroxyapatite. Biodistribution studies at 1, 3 and 24 h of the 4 radiocomplexes under study, have showed a similar biodistribution profile with a relatively high bone uptake, slow clearance from blood and a very slow rate of total radioactivity excretion from the whole animal body. Conclusion: We have developed a new class of indazolebisphosphonates complexes with radioisotopes of samarium and scandium. All complexes have shown high degree of binding to hydroxyapatite, which could be attributed to the ionized phosphonate groups. The bone uptake and the bone-to-muscle ratios were relatively low.

  15. Targeted therapy in lymphoma

    Directory of Open Access Journals (Sweden)

    Cavalli Franco


    Full Text Available Abstract Discovery of new treatments for lymphoma that prolong survival and are less toxic than currently available agents represents an urgent unmet need. We now have a better understanding of the molecular pathogenesis of lymphoma, such as aberrant signal transduction pathways, which have led to the discovery and development of targeted therapeutics. The ubiquitin-proteasome and the Akt/mammalian target of rapamycin (mTOR pathways are examples of pathological mechanisms that are being targeted in drug development efforts. Bortezomib (a small molecule protease inhibitor and the mTOR inhibitors temsirolimus, everolimus, and ridaforolimus are some of the targeted therapies currently being studied in the treatment of aggressive, relapsed/refractory lymphoma. This review will discuss the rationale for and summarize the reported findings of initial and ongoing investigations of mTOR inhibitors and other small molecule targeted therapies in the treatment of lymphoma.

  16. Targets and teamwork

    DEFF Research Database (Denmark)

    Skinner, Timothy C; Lange, Karin S; Hoey, Hilary


    with less disagreement about recommended targets. Multiple regression analysis indicated that teams reporting higher HbA1c targets and more target disagreement had parents reporting higher treatment targets. This seemed to partially account for center differences in Hb1Ac. Conclusions: The diabetes care....... Research Design and Methods: Children, under the age of 11 with type 1 diabetes and their parents treated at the study centers participated. Clinical, medical, and demographic data were obtained, along with blood sample for centralized assay. Parents and all members of the diabetes care team completed...... questionnaires on treatment targets for hemoglobin A1c (HbA1c) and recommended frequency of blood glucose monitoring. Results: Totally 1113 (53% male) children (mean age 8.0±2.1years) from 18 centers in 17 countries, along with parents and 113 health-care professionals, participated. There were substantial...

  17. Poly(N-4-vinylbenzyl-1,4,7-triazacyclononane Copper Complex Grafted Solid Catalyst for Oxidative Polymerization of 2,6-Dimethylphenol

    Directory of Open Access Journals (Sweden)

    Kei Saito


    Full Text Available A new solid phase catalyst, poly(N-4-vinylbenzyl-1,4,7-triazacyclononane copper(I complex, grafted onto polystyrene particles, has been employed for the oxidative polymerization of 2,6-dimethylphenol using an aqueous biphasic (water/toluene solvent system. The solid catalyst was synthesized by first grafting N-(4-vinylbenzyl-1,4,7-triaza-cyclononane onto polystyrene particles using a radical mediated polymerization method and next by creating the polymer-metal complex of copper-triazacyclononane with these modified particles. Poly(2,6-dimethyl-1,4-phenylene oxide was successfully obtained from the polymerization of 2,6-dimethylphenol using this new metal-organic solid phase catalyst.

  18. AA antiproton production target

    CERN Multimedia

    CERN PhotoLab


    The first version of the antiproton production target was a tungsten rod, 11 cm long and 3 mm in diameter. The rod was embedded in graphite, pressure-seated into an outer casing of stainless steel. At the entrance to the target assembly was a scintillator screen, imprinted with circles every 5 mm in radius, which allowed to precisely aim the 26 GeV high-intensity proton beam from the PS onto the centre of the target rod. The scintillator screen was a 1 mm thick plate of Cr-doped alumina. See also 7903034 and 7905091.

  19. Psychotic spectrum symptoms across the lifespan are related to lifetime suicidality among 147 patients with bipolar I or major depressive disorder


    Gesi, C; Carmassi, C; Miniati, M; Benvenuti, A.; Massimetti, G; Dell'Osso, L.


    Background Conflicting evidence exists about the relationship between psychotic symptoms and suicidality in mood disorders. We aimed to investigate the lifetime suicidality and its relationship with dimensions of the psychotic spectrum over the lifespan among subjects with bipolar I (BD I) or major depressive disorder (MDD). Methods 147 Consecutive out- and inpatients with BD I or MDD presenting for treatment at 11 Italian Departments of Psychiatry were administered the Structured Clinical In...

  20. Radiometallurgical examination of 1.47 enriched I&E fuel elements for PT-IP-247-A

    Energy Technology Data Exchange (ETDEWEB)

    Teats, R.


    Under the conditions of PT-IP-247-A, four columns of self-supported and four columns of rib-supported I&E 1.47% enriched fuel elements were irradiated to determine their relative performance under severe operating conditions. Four of the self-supported and two of the rib-supported control elements were received for nation. The two rib-supported control pieces, which were classified as ``near failures`` had received average exposures of 353 and 359 MWD/T at average specific power levels of 91 and 108 KW/ft before they were discharged because of other ruptured pieces in the tubes. The nominal specified canned fuel dimensions of the rib supported elements was 1.445 in. OD, .310 in bore, and 7.640 in. long. The first two self-supported elements were selected for examination on the basis of high weight losses sustained during irradiation, and the second two were selected to determine the effect of specific power levels on the AlSi bonding. The average specific power levels of the four self-supported elements varied from 79 to 110 KW/ft and the exposure varied from 845 MWD/T to 949 MWD/T. The nominal canned dimensions of the self-supported elements, which were made oversize to attain high annular coolant temperatures with respect to the interior coolant channel, were 1.460 in. OD, .375 in. bore, and 7.640 in. long. The eight bridge rail supports were spot welded on and gave an effective rib outside diameter of 1.600 in. All of the components were X-8001 aluminum alloy.

  1. Performance, Return to Competition, and Reinjury After Tommy John Surgery in Major League Baseball Pitchers: A Review of 147 Cases. (United States)

    Makhni, Eric C; Lee, Randall W; Morrow, Zachary S; Gualtieri, Anthony P; Gorroochurn, Prakash; Ahmad, Christopher S


    Pitching performance metrics, durability, and reinjury after Tommy John surgery in professional baseball players have not been well described. The purpose of this study was to determine the likelihood of return to professional competition, reinjury rate, and change in performance after Tommy John surgery in Major League Baseball pitchers. The hypothesis was that performance metrics and durability will decline after surgery. Cohort study; Level of evidence, 3. Publicly available records were accessed to generate a list of all Major League Baseball pitchers from 1999 to 2011 who had undergone ulnar collateral ligament reconstruction at any point in their careers; those with multiple reconstructive procedures were excluded. Return to active (≥1 game) or established (≥10 games) competition and/or placement on the disabled list was documented for each player. Among established players, pitching performance was compared pre- and postoperatively, as well as with age-matched control pitchers. Of 147 pitchers included, 80% returned to pitch in at least 1 Major League Baseball game. Only 67% of established pitchers returned to the same level of competition postoperatively, and 57% of established players returned to the disabled list because of injuries to the throwing arm. Finally, performance declined across several metrics after surgery compared with preinjury levels, such as earned run average, batting average against, walks plus hits per inning pitched, percentage of pitches thrown in the strike zone, innings pitched, percentage fastballs thrown, and average fastball velocity (P 50%), and performance declines across several major metrics after surgery. Patients undergoing Tommy John surgery should be counseled appropriately regarding the likelihood of return to preinjury levels of competition and performance. © 2014 The Author(s).

  2. AGR-2 Final Data Qualification Report for U.S. Capsules - ATR Cycles 147A Through 154B

    Energy Technology Data Exchange (ETDEWEB)

    Pham, Binh T. [Idaho National Lab. (INL), Idaho Falls, ID (United States). Very High-Temperature Reactor Technology Development Office; Einerson, Jeffrey J. [Idaho National Lab. (INL), Idaho Falls, ID (United States). Very High-Temperature Reactor Technology Development Office


    This report provides the data qualification status of AGR-2 fuel irradiation experimental data in four U.S. capsules from all 15 Advanced Test Reactor (ATR) Cycles 147A, 148A, 148B, 149A, 149B, 150A, 150B, 151A, 151B, 152A, 152B, 153A, 153B, 154A, and 154B, as recorded in the Nuclear Data Management and Analysis System (NDMAS). Thus, this report covers data qualification status for the entire AGR-2 irradiation and will replace four previously issued AGR-2 data qualification reports (e.g., INL/EXT-11-22798, INL/EXT-12-26184, INL/EXT-13-29701, and INL/EXT-13-30750). During AGR-2 irradiation, two cycles, 152A and 153A, occurred when the ATR core was briefly at low power, so AGR-2 irradiation data are not used for physics and thermal calculations. Also, two cycles, 150A and 153B, are Power Axial Locator Mechanism (PALM) cycles when the ATR power is higher than during normal cycles. During the first PALM cycle, 150A, the experiment was temporarily moved from the B-12 location to the ATR water canal and during the second PALM cycle, 153B, the experiment was temporarily moved from the B-12 location to the I-24 location to avoid being overheated. During the “Outage” cycle, 153A, seven flow meters were installed downstream from seven Fission Product Monitoring System (FPMS) monitors to measure flows from the monitors and these data are included in the NDMAS database.

  3. 145 - 147 Chonoko

    African Journals Online (AJOL)

    DR. AMIN


    Jun 1, 2011 ... ABSTRACT. Phytochemical screening and antibacterial activity of the extracts of Cucurbita pepo (backpeel and seeds) against Staphylococcus aureus and Salmonella typhi were carried out using standard procedures. The extraction was achieved using percolation method with ethanol and methanol as.

  4. Euler systems (AM-147)

    CERN Document Server

    Rubin, Karl


    One of the most exciting new subjects in Algebraic Number Theory and Arithmetic Algebraic Geometry is the theory of Euler systems. Euler systems are special collections of cohomology classes attached to p-adic Galois representations. Introduced by Victor Kolyvagin in the late 1980s in order to bound Selmer groups attached to p-adic representations, Euler systems have since been used to solve several key problems. These include certain cases of the Birch and Swinnerton-Dyer Conjecture and the Main Conjecture of Iwasawa Theory. Because Selmer groups play a central role in Arithmetic Algebraic G

  5. Pages 140 -147.pmd

    African Journals Online (AJOL)


    Microalbuminuria was found in 1 of the 2 subjects who had features of DM and in one subject with sickle cell anemia. Conclusion: The .... Female. 316. 51.4. Age group. 10-14years 407 66.2. 15-17years 177. 28.8. 18-19years 31. 5.0. School type. Private. 366. 59.5. Public. 249. 40.5. Social class. I. 234. 38.1. II. 71. 11.5. III.

  6. Target Price Accuracy

    Directory of Open Access Journals (Sweden)

    Alexander G. Kerl


    Full Text Available This study analyzes the accuracy of forecasted target prices within analysts’ reports. We compute a measure for target price forecast accuracy that evaluates the ability of analysts to exactly forecast the ex-ante (unknown 12-month stock price. Furthermore, we determine factors that explain this accuracy. Target price accuracy is negatively related to analyst-specific optimism and stock-specific risk (measured by volatility and price-to-book ratio. However, target price accuracy is positively related to the level of detail of each report, company size and the reputation of the investment bank. The potential conflicts of interests between an analyst and a covered company do not bias forecast accuracy.

  7. Optimal exploration target zones

    CSIR Research Space (South Africa)

    Debba, Pravesh


    Full Text Available This research describes a quantitative methodology for deriving optimal exploration target zones based on a probabilistic mineral prospectivity map. In order to arrive at out objective, we provide a plausible answer to the following question: "Which...

  8. Delays in thick targets

    CERN Document Server

    Bennett, J R J


    The delays in the emission of radioactive particles from a thick target bombarded by high-energy protons is discussed in relation to the basic physical processes of diffusion and effusion through the target and ioniser. The delay time, relative to the decay time, is crucial to the efficiency of particle release at the exit of the ioniser. The principles of minimizing the delay times are discussed with reference to a mathematical model of the process, and some experimental examples are given.

  9. An ISOLDE target unit

    CERN Multimedia

    Maximilien Brice


    A good dozen different targets are available for ISOLDE, made of different materials and equipped with different kinds of ion-sources, according to the needs of the experiments. Each separator (GPS: general purpose; HRS: high resolution) has its own target. Because of the high radiation levels, robots effect the target changes, about 80 times per year. In the standard unit shown in picture _01, the target is the cylindrical object in the front. It contains uranium-carbide kept at a temperature of 2200 deg C, necessary for the isotopes to be able to escape. At either end, one sees the heater current leads, carrying 700 A. The Booster beam, some 3E13 protons per pulse, enters the target from left. The evaporated isotope atoms enter a hot-plasma ion source (the black object behind the target). The whole unit sits at 60 kV potential (pulsed in synchronism with the arrival of the Booster beam) which accelerates the ions (away from the viewer) towards one of the 2 separators.

  10. Burglar Target Selection (United States)

    Townsley, Michael; Bernasco, Wim; Ruiter, Stijn; Johnson, Shane D.; White, Gentry; Baum, Scott


    Objectives: This study builds on research undertaken by Bernasco and Nieuwbeerta and explores the generalizability of a theoretically derived offender target selection model in three cross-national study regions. Methods: Taking a discrete spatial choice approach, we estimate the impact of both environment- and offender-level factors on residential burglary placement in the Netherlands, the United Kingdom, and Australia. Combining cleared burglary data from all study regions in a single statistical model, we make statistical comparisons between environments. Results: In all three study regions, the likelihood an offender selects an area for burglary is positively influenced by proximity to their home, the proportion of easily accessible targets, and the total number of targets available. Furthermore, in two of the three study regions, juvenile offenders under the legal driving age are significantly more influenced by target proximity than adult offenders. Post hoc tests indicate the magnitudes of these impacts vary significantly between study regions. Conclusions: While burglary target selection strategies are consistent with opportunity-based explanations of offending, the impact of environmental context is significant. As such, the approach undertaken in combining observations from multiple study regions may aid criminology scholars in assessing the generalizability of observed findings across multiple environments. PMID:25866418

  11. The Sinuous Target

    Energy Technology Data Exchange (ETDEWEB)

    Zwaska, R. [Fermilab


    We report on the concept for a target material comprised of a multitude of interlaced wires of small dimension. This target material concept is primarily directed at high-power neutrino targets where the thermal shock is large due to small beam sizes and short durations; it also has applications to other high-power targets, particularly where the energy deposition is great or a high surface area is preferred. This approach ameliorates the problem of thermal shock by engineering a material with high strength on the micro-scale, but a very low modulus of elasticity on the meso-scale. The low modulus of elasticity is achieved by constructing the material of spring-like wire segments much smaller than the beam dimension. The intrinsic bends of the wires will allow them to absorb the strain of thermal shock with minimal stress. Furthermore, the interlaced nature of the wires provides containment of any segment that might become loose. We will discuss the progress on studies of analogue materials and fabrication techniques for sinuous target materials.

  12. Setting reference targets

    Energy Technology Data Exchange (ETDEWEB)

    Ruland, R.E.


    Reference Targets are used to represent virtual quantities like the magnetic axis of a magnet or the definition of a coordinate system. To explain the function of reference targets in the sequence of the alignment process, this paper will first briefly discuss the geometry of the trajectory design space and of the surveying space, then continue with an overview of a typical alignment process. This is followed by a discussion on magnet fiducialization. While the magnetic measurement methods to determine the magnetic centerline are only listed (they will be discussed in detail in a subsequent talk), emphasis is given to the optical/mechanical methods and to the task of transferring the centerline position to reference targets.

  13. Targeted Therapy of CLL. (United States)

    Al-Sawaf, Othman; Fischer, Kirsten; Eichhorst, Barbara; Hallek, Michael


    The landscape of chronic lymphocytic leukemia (CLL) has undergone profound changes in the past years. First, the addition of CD20-targeting antibodies to conventional chemotherapy has improved the therapeutic outcome in the majority of CLL patients. Since the establishment of the critical role of the B cell receptor signaling pathway in the pathogenesis of CLL, several agents have been developed to target this pathway. Ibrutinib and idelalisib, 2 potent kinase inhibitors, have both become available for CLL therapy in the first and second line. Additionally, the observation of high expression levels of the anti-apoptotic mitochondrial protein Bcl-2 in CLL has led to the development of venetoclax, a BH3 mimetic compound that inhibits Bcl-2 and has shown high efficacy in CLL. This short review summarizes preclinical and clinical data on currently available agents in CLL and provides an outlook on upcoming new challenges in the targeted therapy of CLL. © 2016 S. Karger GmbH, Freiburg.

  14. Modelling Recycling Targets

    DEFF Research Database (Denmark)

    Hill, Amanda Louise; Leinikka Dall, Ole; Andersen, Frits M.


    Within the European Union (EU) a paradigm shift is currently occurring in the waste sector, where EU waste directives and national waste strategies are placing emphasis on resource efficiency and recycling targets. The most recent Danish resource strategy calculates a national recycling rate of 22......% for household waste, and sets an ambitious goal of a 50% recycling rate by 2020. This study integrates the recycling target into the FRIDA model to project how much waste and from which streams should be diverted from incineration to recycling in order to achieve the target. Furthermore, it discusses how...... the existing technological, organizational and legislative frameworks may affect recycling activities. The results of the analysis show that with current best practice recycling rates, the 50% recycling rate cannot be reached without recycling of household biowaste. It also shows that all Danish municipalities...

  15. Radiolesão vascular como efeito deletério da braquiterapia intra-arterial com dose elevada de Samário-153 em coelhos hipercolesterolêmicos Vascular radiolesion as a deleterious effect of high-dose-rate intraarterial brachytherapy with Samarium-153 in hypercholesterolemic rabbits

    Directory of Open Access Journals (Sweden)

    Dalton Bertolim Précoma


    Full Text Available OBJETIVO: Este estudo tem por objetivo avaliar as alterações vasculares morfológicas e morfométricas induzidas pela braquiterapia com Samário-153 (153 Sm em coelhos hipercolesterolêmicos, com doses elevadas. MÉTODOS: Foram analisados 43 coelhos hipercolesterolêmicos, brancos, da raça New Zealand, e o total de 86 artérias ilíacas submetidas a lesão por balão de angioplastia. Divididos em três grupos: dois (GI irradiados com as doses de 15Gy (n=14 e 60Gy (n=36 e um grupo controle (n=36. Foram realizadas avaliação histológica morfométrica e análise histológica qualitativa para análise tecidual. RESULTADOS: Foram observadas uma redução significativa da neoproliferação intimal (NPI no GI 15 Gy (pOBJECTIVE: This study was designed to evaluate vascular morphological and morphometric changes induced by brachytherapy with samarium-153 (Sm-153 at high doses in hypercholesterolemic rabbits. METHODS: Forty-three New Zealand White hypercholesterolemic rabbits were analyzed, and the total of 86 iliac arteries underwent balloon angioplasty injury. The rabbits were divided into three different groups: two irradiation groups (IG assigned to 15 Gy (n=14 and 60 Gy (n=36 irradiation doses, respectively, and a control group (n = 36. Histomorphometric and qualitative histological analyses were performed for tissue evaluation. RESULTS: Significant reductions were found in neointimal proliferation (NIP (p< 0.0001, media area (MA (p<0.0001 and percent stenosis (p<0.0001 in the 15-Gy IG, compared to the other groups. The 60-Gy IG had the higher rate of NIP, increase in media and vessel areas (VA and percent stenosis. The 60-Gy IG also showed the greatest number of xanthomatous cells (60-Gy IG: 86.11% and 15-Gy IG: 14.29%, p<0.0001 and the highest amount of hyaline amorphous tissue (60-Gy IG:58.33% and 15-Gy IG:0%, p=0.0001 and vascular proliferation (60-Gy IG:30.56% and 15-Gy IG:0%, p=0.0221. No statistically significant differences were found

  16. Optimal exploration target zones

    CSIR Research Space (South Africa)

    Debba, Pravesh


    Full Text Available , Carranza, Stein, van der Meer Introduction to Remote Sensing Background and Objective of the study Methodology Results Optimal Exploration Target Zones Pravesh Debba1, Emmanual M.J. Carranza2, Alfred Stein2, Freek D. van der Meer2 1CSIR, Logistics... and Quantitative Methods, CSIR Built Environment 2International Institute for Geo-Information Science and Earth Observation (ITC), Hengelosestraat 99, P.O. Box 6, 7500AA Enschede, The Netherlands Optimal Exploration Target Zones Debba, Carranza, Stein, van der Meer...

  17. AA antiproton production target

    CERN Multimedia

    CERN PhotoLab


    The first version of the antiproton production target was a tungsten rod, 11 cm long (actually a row of 11 rods, each 1 cm long) and 3 mm in diameter. The rod was embedded in graphite, pressure-seated into an outer casing made of stainless steel. The casing had fins for forced-air cooling. In this picture, the 26 GeV high-intensity beam from the PS enters from the right, where a scintillator screen, with circles every 5 mm in radius, permits precise aim at the target centre. See also 7903034 and 7905094.

  18. Aquaporin-2 membrane targeting

    DEFF Research Database (Denmark)

    Olesen, Emma T B; Fenton, Robert A


    The targeting of the water channel aquaporin-2 (AQP2) to the apical plasma membrane of kidney collecting duct principal cells is regulated mainly by the antidiuretic peptide hormone arginine vasopressin (AVP). This process is of crucial importance for the maintenance of body water homeostasis...

  19. ISOLDE back on target

    CERN Multimedia

    Anaïs Schaeffer


    Today, Friday 1 August, the ISOLDE installation, supplied by the beams of the PS Booster, restarted its physics programme. After a shutdown of almost a year and a half, there was a real buzz in the air as the first beam of protons hit the target of the first post-LS1 ISOLDE experiment.   One of the new target-handling robots installed by ISOLDE during LS1. Many improvements have been made to the ISOLDE installation during LS1. One of the main projects was the installation of new robots for handling the targets (see photo 1). “Our targets are bombarded by protons from the PS Booster’s beams and become very radioactive,” explains Maria Jose Garcia Borge, spokesperson for the ISOLDE collaboration. “They therefore need to be handled carefully, which is where the robots come in. The robots we had until now were already over 20 years old and were starting to suffer from the effects of radiation. So LS1 was a perfect opportunity to replace them with more moder...

  20. Microenvironmental targets in sarcoma

    Directory of Open Access Journals (Sweden)

    Monika eEhnman


    Full Text Available Sarcomas are rare malignant tumors affecting all age groups. They are typically classified according to their resemblance to corresponding normal tissue. Their heterogeneous features, for example in terms of disease-driving genetic aberrations and body location, complicate both disease classification and development of novel treatment regimens. Many years of failure of improved patient outcome in clinical trials has lead to the conclusion that novel targeted therapies are likely needed in combination with current multimodality regimens. Sarcomas have not, in contrast to the common carcinomas, been the subject for larger systematic studies on how tumor behavior relates to characteristics of the tumor microenvironment. There is consequently an urgent need for identifying suitable molecular targets, not only in tumor cells, but also in the tumor microenvironment. This review discusses preclinical and clinical data about potential molecular targets in sarcomas. Studies on targeted therapies involving the tumor microenvironment are prioritized. A greater understanding of the biological context is expected to facilitate more successful design of future clinical trials in sarcoma.

  1. Target Heart Rates (United States)

    ... is your level of intensity? When is the best time of day to work out? Target Heart Rates Warm Up, Cool Down See More >> Getting Active Getting Started - Tips for Long-term Exercise Success Get Moving: Easy Tips to Get Active! ...

  2. Targeted Therapy for Melanoma

    Energy Technology Data Exchange (ETDEWEB)

    Quinn, Thomas [Alphamed, Jackson, TN (United States); Moore, Herbert [Alphamed, Jackson, TN (United States)


    The research project, entitled ”Targeted Therapy for Melanoma,” was focused on investigating the use of kidney protection measures to lower the non-specific kidney uptake of the radiolabeled Pb-DOTA-ReCCMSH peptide. Previous published work demonstrated that the kidney exhibited the highest non-target tissue uptake of the 212Pb/203Pb radiolabeled melanoma targeting peptide DOTA-ReCCMSH. The radiolabeled alpha-melanocyte stimulating hormone (α-MSH) peptide analog DOTA-Re(Arg11)CCMSH, which binds the melanocortin-1 receptor over-expressed on melanoma tumor cells, has shown promise as a PRRT agent in pre-clinical studies. High tumor uptake of 212Pb labeled DOTA-Re(Arg11)CCMSH resulted in tumor reduction or eradication in melanoma therapy studies. Of particular note was the 20-50% cure rate observed when melanoma mice were treated with alpha particle emitter 212Pb. However, as with most PRRT agents, high radiation doses to the kidneys where observed. To optimize tumor treatment efficacy and reduce nephrotoxicity, the tumor to kidney uptake ratio must be improved. Strategies to reduce kidney retention of the radiolabeled peptide, while not effecting tumor uptake and retention, can be broken into several categories including modification of the targeting peptide sequence and reducing proximal tubule reabsorption.

  3. Target Chamber Manipulator (United States)

    Tantillo, Anthony; Watson, Matthew


    A system has been developed to allow remote actuation of sensors in a high vacuum target chamber used with a particle accelerator. Typically, sensors of various types are placed into the target chamber at specific radial and angular positions relative to the beam line and target. The chamber is then evacuated and the experiments are performed for those sensor positions. Then, the chamber is opened, the sensors are repositioned to new angles or radii, and the process is repeated, with a separate pump-down cycle for each set of sensor positions. The new sensor positioning system allows scientists to pre-set the radii of up to a dozen sensors, and then remotely actuate their angular positions without breaking the vacuum of the target chamber. This reduces the time required to reposition sensors from 6 hours to 1 minute. The sensors are placed into one of two tracks that are separately actuated using vacuum-grade stepping motors. The positions of the sensors are verified using absolute optical rotary encoders, and the positions are accurate to 0.5 degrees. The positions of the sensors are electronically recorded and time-stamped after every change. User control is through a GUI using LabVIEW.

  4. Active Target Simulation (United States)

    Smith, Nathan; Draznik, Peter; Frank, Nathan


    We have simulated an existing experimental design to determine the resolution improvement upon energy measurements of neutron unbound nuclei. A number of experiments of this type have been performed at the National Superconducting Cyclotron Laboratory (NSCL), located at Michigan State University. An excited nucleus is typically produced with a radioactive beam interacting with a passive Beryllium target. Many different nuclei are produced in experiment, each of which immediately decays into a charged particle and neutron. The charged particles are detected and the neutrons interact in scintillation detectors such as the Modular Neutron Array (MoNA) and Large Multi-Institutional Scintillation Array (LISA). In our simulation, we have constructed an active target that provides additional information such that the point of nuclear interaction within the target may be determined. This information improves the resolution in decay energy measurements of neutron unbound isotopes. This presentation will cover some aspects of the simulation process, as well as showing some of the results that demonstrate the simulated improvement over a passive target.

  5. Lanthanide complexes of a picolinate ligand derived from 1,4,7-triazacyclononane with potential application in magnetic resonance imaging and time-resolved luminescence imaging. (United States)

    Nonat, Aline; Gateau, Christelle; Fries, Pascal H; Mazzanti, Marinella


    The new potentially octadentate ligand, 1-(carboxymethyl)-4,7-bis[(6-carboxypyridin-2-yl)methyl]-1,4,7-triazacyclononane (H(3)bpatcn), in which two picolinate arms and one acetate arm are connected to the 1,4,7-triazacyclonane core, has been prepared. Potentiometric studies show an increased stability of the Gd(III) complex of H(3)bpatcn (logK(GdL)=15.8(2)) with respect to the Gd(III) complex of the analogous ligand 1,4,7-triazacyclononane-N,N',N''-triacetic acid (H(3)nota) (logK(GdL)=13.7), associated with an increased selectivity of H(3)bpatcn for gadolinium over calcium. The H(3)bpatcn ligand sensitises the terbium ion very efficiently, leading to a long-lived and highly luminescent terbium complex (quantum yield=43 %), in spite of the presence of a coordinated water molecule. (1)H proton NMR studies indicate that the metal ion is rigidly encapsulated by the three arms of the octadentate ligand H(3)bpatcn and that the macrocycle framework remains bound (through the five nitrogen and the three oxygen atoms) even at high temperature. A new theoretical method for interpreting the water proton relaxivity is presented. It is based on recent progresses in the description of the electronic spin relaxation and on an auxiliary probe solute. It replaces the Solomon, Bloembergen and Morgan (SBM) framework, which is questionable at low field, while avoiding resorting to simulations and/or sophisticated theories with additional unknown zero-field splitting (ZFS) parameters. The inclusion of two picolinate groups on a triazacyclononane framework affords the mono-aquo gadolinium complex [Gd(bpatcn)(H(2)O)] with favourable electron-relaxation properties (tau(eff)(S0)=125 ps). The optimisation of the electronic relaxation by ligand design is especially important to achieve high relaxivity in the new generation macromolecular complexes with long rotational correlation times.

  6. Sex-specific effect of CPB2 Ala147Thr but not Thr325Ile variants on the risk of venous thrombosis: A comprehensive meta-analysis.

    Directory of Open Access Journals (Sweden)

    Nora Zwingerman

    Full Text Available Thrombin activatable fibrinolysis inhibitor (TAFI, encoded by the Carboxypeptidase B2 gene (CPB2, is an inhibitor of fibrinolysis and plays a role in the pathogenesis of venous thrombosis. Experimental findings support a functional role of genetic variants in CPB2, while epidemiological studies have been unable to confirm associations with risk of venous thrombosis. Sex-specific effects could underlie the observed inconsistent associations between CPB2 genetic variants and venous thrombosis.A comprehensive literature search was conducted for associations between Ala147Thr and Thr325Ile variants with venous thrombosis. Authors were contacted to provide sex-specific genotype counts from their studies. Combined and sex-specific random effects meta-analyses were used to estimate a pooled effect estimate for primary and secondary genetic models.A total of 17 studies met the inclusion criteria. A sex-specific meta-analysis applying a dominant model supported a protective effect of Ala147Thr on venous thrombosis in females (OR = 0.81, 95%CI: 0.68,0.97; p = 0.018, but not in males (OR = 1.06, 95%CI:0.96-1.16; p = 0.263. The Thr325Ile did not show a sex-specific effect but showed variation in allele frequencies by geographic region. A subgroup analysis of studies in European countries showed decreased risk, with a recessive model (OR = 0.83, 95%CI:0.71-0.97, p = 0.021 for venous thrombosis.A comprehensive literature review, including unpublished data, provided greater statistical power for the analyses and decreased the likelihood of publication bias influencing the results. Sex-specific analyses explained apparent discrepancies across genetic studies of Ala147Thr and venous thrombosis. While, careful selection of genetic models based on population genetics, evolutionary and biological knowledge can increase power by decreasing the need to adjust for testing multiple models.

  7. Achieving Target Voriconazole Concentrations More Accurately in Children and Adolescents (United States)

    Margol, Ashley; Fu, Xiaowei; van Guilder, Michael; Bayard, David; Schumitzky, Alan; Orbach, Regina; Liu, Siyu; Louie, Stan; Hope, William


    Despite the documented benefit of voriconazole therapeutic drug monitoring, nonlinear pharmacokinetics make the timing of steady-state trough sampling and appropriate dose adjustments unpredictable by conventional methods. We developed a nonparametric population model with data from 141 previously richly sampled children and adults. We then used it in our multiple-model Bayesian adaptive control algorithm to predict measured concentrations and doses in a separate cohort of 33 pediatric patients aged 8 months to 17 years who were receiving voriconazole and enrolled in a pharmacokinetic study. Using all available samples to estimate the individual Bayesian posterior parameter values, the median percent prediction bias relative to a measured target trough concentration in the patients was 1.1% (interquartile range, −17.1 to 10%). Compared to the actual dose that resulted in the target concentration, the percent bias of the predicted dose was −0.7% (interquartile range, −7 to 20%). Using only trough concentrations to generate the Bayesian posterior parameter values, the target bias was 6.4% (interquartile range, −1.4 to 14.7%; P = 0.16 versus the full posterior parameter value) and the dose bias was −6.7% (interquartile range, −18.7 to 2.4%; P = 0.15). Use of a sample collected at an optimal time of 4 h after a dose, in addition to the trough concentration, resulted in a nonsignificantly improved target bias of 3.8% (interquartile range, −13.1 to 18%; P = 0.32) and a dose bias of −3.5% (interquartile range, −18 to 14%; P = 0.33). With the nonparametric population model and trough concentrations, our control algorithm can accurately manage voriconazole therapy in children independently of steady-state conditions, and it is generalizable to any drug with a nonparametric pharmacokinetic model. (This study has been registered at under registration no. NCT01976078.) PMID:25779580

  8. Gulf of Mexico Sales 147 and 150: Central and Western planning areas. Final environmental impact statement, Volume 1: Sections 1 through 4.C

    Energy Technology Data Exchange (ETDEWEB)


    This Final Environmental Impact Statement (EIS) covers the proposed 1994 Gulf of Mexico OCS oil and gas lease sales [Central Gulf of Mexico Sale 147 (March 1994) and Western Gulf of Mexico Sale 150 (August 1994)]. This document includes the purpose and background of the proposed actions, the alternatives, the descriptions of the affected environment, and the potential environmental impacts of the proposed actions and alternatives. Proposed mitigating measures and their effects are analyzed, in addition to potential cumulative impacts resulting from proposed activities.

  9. Physics of polarized targets

    CERN Document Server

    Niinikoski, Tapio


    For developing, building and operating solid polarized targets we need to understand several fields of physics that have seen sub stantial advances during the last 50 years. W e shall briefly review a selection of those that are important today. These are: 1) quantum statistical methods to describe saturation and relaxation in magnetic resonance; 2) equal spin temperature model for dy namic nuclear polarization; 3 ) weak saturation during NMR polarization measurement; 4 ) refrigeration using the quantum fluid properties of helium isotopes. These, combined with superconducting magnet technologies, permit today to reach nearly complete pola rization of almost any nuclear spins. Targets can be operated in frozen spin mode in rather low and inhomogeneous field of any orientation, and in DNP mode in beams of high intensity. Beyond such experiments of nuclear and particle physics, applications a re also emerging in macromolecular chemistry and in magnetic resonance imaging. This talk is a tribute to Michel Borghini...

  10. Emerging Targets in Photopharmacology. (United States)

    Lerch, Michael M; Hansen, Mickel J; van Dam, Gooitzen M; Szymanski, Wiktor; Feringa, Ben L


    The field of photopharmacology uses molecular photoswitches to establish control over the action of bioactive molecules. It aims to reduce systemic drug toxicity and the emergence of resistance, while achieving unprecedented precision in treatment. By using small molecules, photopharmacology provides a viable alternative to optogenetics. We present here a critical overview of the different pharmacological targets in various organs and a survey of organ systems in the human body that can be addressed in a non-invasive manner. We discuss the prospects for the selective delivery of light to these organs and the specific requirements for light-activatable drugs. We also aim to illustrate the druggability of medicinal targets with recent findings and emphasize where conceptually new approaches have to be explored to provide photopharmacology with future opportunities to bring "smart" molecular design ultimately to the realm of clinical use. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Inflation Targeting: Provisional Results

    Directory of Open Access Journals (Sweden)

    Cerna, Silviu


    Full Text Available Inflation targeting monetary policy framework that requires the central bank to achieve a low inflation has contributed to price stability in industrialized countries. As well as the other developing countries, ex communist countries have also tried to apply this strategy, which was susceptible to increase monetary policy transparency and to determine authorities to make necessary reforms in order to pass from a planned to a market economy. In Romania, inflation targeting has contributed, to a large extent, to price increase smoothening, without affecting economic growth. Knowing the factors that have determined this unquestionable success allows for not only understanding the Romanian transition process, but also draw some useful conclusions in view of the necessary actions for adopting the euro.

  12. Foucault on targets. (United States)

    Lynch, John


    This paper seeks to gain an insight into the behavior of a large NHS trust, in its attempt to meet a 90 percent patient access target, in a week long national audit in March 2003. Why did individuals act in dramatically different ways to their norm over this period. The work of Michel Foucault is used to explore these issues. The discourses of power, knowledge, discipline and governmentality are identified as key foucaudian themes that offer an alternative interpretation of how individuals behave in their place of work. The importance of the historical context of discourse within the NHS cannot be underestimated in shaping the behavior of individuals and groups today. Power and knowledge permeate NHS organizations through disciplinary practices and dressage. Governmentality seeks to maintain the status quo through disciplinary processes such as national healthcare targets. The natural response of NHS organizations is therefore, to seek order and conformity rather than disorder and conflict.

  13. Antibodies Targeting EMT (United States)


    VLDL uptake and redistribution of lipids to cells for energy metabolism and cell signaling. ApoE overexpression has shown to be associated with a...involved in testosterone and estradiol biosynthesis, as well as prostaglandin F synthesis and has previously been implicated in cancer progression, involved in androgen metabolism and is a potential drug target for prostate cancer. AKR1C4 is involved in bile acid synthesis but has not yet

  14. Explosive Target Balances


    Potrafke, Niklas; Reischmann, Markus


    Using the new unit root test by Phillips et al. (2011) we show that the Target balances of the German Bundesbank have been exploding from the beginning of 2009 to the beginning of 2013. By implementing a full-allotment policy and reducing the required minimum quality of collaterals in October 2008, the European Central Bank (ECB) refinanced credits in the GIIPS countries to a large extent. Private capital flowed out of the GIIPS countries (Greece, Italy, Ireland, Portugal and Spain), and the ...

  15. Implementing Target Value Design. (United States)

    Alves, Thais da C L; Lichtig, Will; Rybkowski, Zofia K


    An alternative to the traditional way of designing projects is the process of target value design (TVD), which takes different departure points to start the design process. The TVD process starts with the client defining an allowable cost that needs to be met by the design and construction teams. An expected cost in the TVD process is defined through multiple interactions between multiple stakeholders who define wishes and others who define ways of achieving these wishes. Finally, a target cost is defined based on the expected profit the design and construction teams are expecting to make. TVD follows a series of continuous improvement efforts aimed at reaching the desired goals for the project and its associated target value cost. The process takes advantage of rapid cycles of suggestions, analyses, and implementation that starts with the definition of value for the client. In the traditional design process, the goal is to identify user preferences and find solutions that meet the needs of the client's expressed preferences. In the lean design process, the goal is to educate users about their values and advocate for a better facility over the long run; this way owners can help contractors and designers to identify better solutions. This article aims to inform the healthcare community about tools and techniques commonly used during the TVD process and how they can be used to educate and support project participants in developing better solutions to meet their needs now as well as in the future.

  16. Inflation targeting and core inflation


    Julie Smith


    This paper examines the interaction of core inflation and inflation targeting as a monetary policy regime. Interest in core inflation has grown because of inflation targeting. Core inflation is defined in numerous ways giving rise to many potential measures; this paper defines core inflation as the best forecaster of inflation. A cross-country study finds before the start of inflation targeting, but not after, core inflation differs between non-inflation targeters and inflation targeters. Thr...

  17. (Depth-dose curves of the beta reference fields (147)Pm, (85)Kr and (90)Sr/(90)Y produced by the beta secondary standard BSS2. (United States)

    Brunzendorf, Jens


    The most common reference fields in beta dosimetry are the ISO 6980 series 1 radiation fields produced by the beta secondary standard BSS2 and its predecessor BSS. These reference fields require sealed beta radiation sources ((147)Pm, (85)Kr or (90)Sr/(90)Y) in combination with a source-specific beam-flattening filter, and are defined only at a given distance from the source. Every radiation sources shipped with the BSS2 is sold with a calibration certificate of the Physikalisch-Technische Bundesanstalt. The calibration workflow also comprises regular depth-dose measurements. This work publishes complete depth-dose curves of the series 1 sources (147)Pm, (85)Kr and (90)Sr/(90)Y in ICRU tissue up to a depth of 11 mm,when all electrons are stopped. For this purpose, the individual depth-dose curves of all BSS2 sources calibrated so far have been determined, i.e. the complete datasets of all BSS2 beta sources have been re-evaluated. It includes 191 depth-dose curves of 116 different sources comprising more than 2200 data points in total. Appropriate analytical representations of the nuclide-specific depth-dose curves are provided for the first time.

  18. The Synthesis of 1,4,7-Triazacyclononane Conjugated Amyloid-phillic Compound and Its Binding Affinity to the β-Amyloid Fibril

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Jong Min; Jo, Jee Hye [Sejong University, Seoul (Korea, Republic of)


    The development of new compounds which have affinity for the β-amyloid fibril would lead to the new compounds that could have therapeutic effects on AD. Previously, we generated new amyloid-phillic amide derivative of Chrysamine G and found that this compound protect human astrocyte cells against Aβ-induced toxicity. As conjugation of amyloid-philic molecules with suitable metal chelating ligands could lead to new diagnostic molecules for in vivo quantification of amyloid deposition and new probes for amyloid structure, we designed the compound, which was conjugate of 1,4,7-triazacyclo-nonane and the amyloid-philic compound 1. Here, we would like to report the synthesis of compound 2 and its binding property of β-amyloid fibril. The synthesis of compound was achieved by combining three fragments the biphenyl amine, isophthalic acid 5 and 1,4,7-triazacyclononane. The synthesis of isophthalic acid part 5 commenced with esterfication of isophthalic acid in methanol with HCl to produce the monoester 4 in 38% yield. Treatment of the monoester 4 with oxalyl chloride afforded the acyl chloride 5 in 95% yield.

  19. Lentivirus mediated RNA interference of EMMPRIN (CD147) gene inhibits the proliferation, matrigel invasion and tumor formation of breast cancer cells. (United States)

    Yang, Jing; Wang, Rong; Li, Hongjiang; Lv, Qing; Meng, Wentong; Yang, Xiaoqin


    Overexpression of extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), a glycoprotein enriched on the plasma membrane of tumor cells, promotes proliferation, invasion, metastasis, and survival of malignant tumor cells. In this study, we sought to examine the expression of EMMPRIN in breast tumors, and to identify the potential roles of EMMPRIN on breast cancer cells. EMMPRIN expression in breast cancer tissues was assessed by immunohistochemistry. We used a lentivirus vector-based RNA interference (RNAi) approach expressing short hairpin RNA (shRNA) to knockdown EMMPRIN gene in breast cancer cell lines MDA-MB-231 and MCF-7. In vitro, Cell proliferative, invasive potential were determined by Cell Counting Kit (CCK-8), cell cycle analysis and matrigel invasion assay, respectively. In vivo, tumorigenicity was monitored by inoculating tumor cells into breast fat pad of female nude mice. EMMPRIN was over-expressed in breast tumors and breast cancer cell lines. Down-regulation of EMMPRIN by lentivirus vector-based RNAi led to decreased cell proliferative, decreased matrigel invasion in vitro, and attenuated tumor formation in vivo. High expression of EMMPRIN plays a crucial role in breast cancer cell proliferation, matrigel invasion and tumor formation.

  20. The first case of revealing of Klebsiella pneumoniae ST147, producing NDM-1 carbapenemase, in trauma and orthopedic hospital in Russia

    Directory of Open Access Journals (Sweden)

    V. V. Shabanova


    Full Text Available Present report describes the first case of isolation of NDM-1 carbapenemase-producing K. pneumoniae in a patient with wound infection after open tibial fracture. Identical isolates were twice detected in various microbial associations: first time during therapy with ampicillin/sulbactam, second time after the relapse of wound infection during therapy with cephoperazone/sulbactam with vancomycin. The strain of K. pneumoniae was resistant to all beta-lactams, aminoglycosides and fluoroquinolones, but retained susceptibility to tigecycline and polymyxin B. The presence of blaNDM-1 was detected by PCR and Sanger sequencing. On the basis of multilocus sequence typing K. pneumoniae isolate was classified as sequence-type 147 (ST147. Eradication of the pathogen, successful osteosynthesis of tibial bones and skin-muscle flap plasty of the extensive wound were completed together with combined dioxydin and phosphomycin therapy. Due to the danger of the emergence of nosocomial infection sources and of the development of the potentially incurable nosocomial implant-associated infection, detection of NDM-1 carbapenemase-producing K. pneumoniae strain in a trauma and orthopedic in-patient clinic is alarming.

  1. Evaluation of MCT1, MCT4 and CD147 Genes in Peripheral Blood Cells of Breast Cancer Patients and Their Potential Use as Diagnostic and Prognostic Markers. (United States)

    Luz, Maria Cláudia de B; Perez, Matheus M; Azzalis, Ligia A; Sousa, Luiz Vinícius de A; Adami, Fernando; Fonseca, Fernando L A; Alves, Beatriz da C A


    Patients with breast cancer-the deadliest cancer among women-are at constant risk of developing metastasis. Oxidative stress and hypoxia are common feature of tumor cells that can proliferate even in a resultant metabolic acidosis. Despite the low extracellular pH, intracellular pH of tumor cells remains relatively normal, or even more alkaline due to the action of a membrane protein family known as monocarboxylate transporters (MCTs). The objective of this study was to verify the diagnostic and prognostic value of MCT1, MCT4 and CD147 in tumor and peripheral blood samples of patients with breast cancer undergoing chemotherapic treatment. Differential expression of MCT1, MCT4 and CD147 obtained by qPCR was determined by 2-ΔΔCq method between biological samples (tumor and serial samples of peripheral) of patients (n = 125) and healthy women (n = 25). tumor samples with higher histological grades have shown higher expression of these markers; this higher expression was also observed in blood samples obtained at diagnosis of patients when compared to healthy women and in patients with positive progression of the disease (metastasis development). markers studied here could be a promising strategy in routine laboratory evaluations as breast cancer diagnosis and prognosis.

  2. Targeted therapy for sarcomas

    Directory of Open Access Journals (Sweden)

    Forscher C


    Full Text Available Charles Forscher,1 Monica Mita,2 Robert Figlin3 1Sarcoma Program, Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA, USA; 2Experimental Therapeutics Program, Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA, USA; 3Academic Development Program, Samuel Oschin Comprehensive Cancer Institute, and Division of Hematology/Oncology, Cedars-Sinai Medical Center, Los Angeles, CA, USA Abstract: Sarcomas are tumors of mesenchymal origin that make up approximately 1% of human cancers. They may arise as primary tumors in either bone or soft tissue, with approximately 11,280 soft tissue tumors and 2,650 bone tumors diagnosed each year in the United States. There are at least 50 different subtypes of soft tissue sarcoma, with new ones described with ever-increasing frequency. One way to look at sarcomas is to divide them into categories on the basis of their genetic make-up. One group of sarcomas has an identifiable, relatively simple genetic signature, such as the X:18 translocation seen in synovial sarcoma or the 11:22 translocation seen in Ewing's sarcoma. These specific abnormalities often lead to the presence of fusion proteins, such as EWS-FLI1 in Ewing's sarcoma, which are helpful as diagnostic tools and may become therapeutic targets in the future. Another group of sarcomas is characterized by complex genetic abnormalities as seen in leiomyosarcoma, osteosarcoma, and undifferentiated sarcoma. It is important to keep these distinctions in mind when contemplating the development of targeted agents for sarcomas. Different abnormalities in sarcoma could be divided by tumor subtype or by the molecular or pathway abnormality. However, some existing drugs or drugs in development may interfere with or alter more than one of the presented pathways. Keywords: sarcoma, targeted agents, tyrosine kinase inhibitors, mTor inhibition

  3. Meeting the Aichi targets

    DEFF Research Database (Denmark)

    Funk, Stephan M; Conde, Dalia Amor; Lamoreux, John


    &s), is an excellent opportunity to achieve the Aichi 2020 Targets T11 (protected areas) and T12 (preventing species extinctions). AZE taxa have small, single-site populations that are especially vulnerable to human-induced extinctions, particularly for the many amphibians. We show that AZEs&s can be protected...... feasibly and cost-effectively, but action is urgent. We argue that the Alliance, whose initial main aim was to identify AZEs&s, must be followed up by a second-generation initiative that directs and co-ordinates AZE conservation activities on the ground. The prominent role of zoos, conservation NGOs...

  4. Polarized scintillator targets (United States)

    van den Brandt, B.; Bunyatova, E. I.; Hautle, P.; Konter, J. A.; Mango, S.


    The hydrogen nuclei in an organic scintillator have been polarized to more than 80% and the deuterons in its fully deuterated version to 24%. The scintillator, doped with TEMPO, has been polarized dynamically in a field of 2.5 T in a vertical dilution refrigerator in which a plastic lightguide transports the scintillation light from the sample in the mixing chamber to a photomultiplier outside the cryostat. Sizeable solid samples with acceptable optical properties and light output have been prepared and successfully operated as "live" polarized targets in nuclear physics experiments.

  5. Polarized scintillator targets

    Energy Technology Data Exchange (ETDEWEB)

    Brandt, B. van den E-mail:; Bunyatova, E.I.; Hautle, P.; Konter, J.A.; Mango, S


    The hydrogen nuclei in an organic scintillator have been polarized to more than 80% and the deuterons in its fully deuterated version to 24%. The scintillator, doped with TEMPO, has been polarized dynamically in a field of 2.5 T in a vertical dilution refrigerator in which a plastic lightguide transports the scintillation light from the sample in the mixing chamber to a photomultiplier outside the cryostat. Sizeable solid samples with acceptable optical properties and light output have been prepared and successfully operated as 'live' polarized targets in nuclear physics experiments.

  6. Targeting Prostate Cancer Metastasis (United States)


    achieve this goal, we cultured high-invasive prostate cancer PC3 cells and treated them with the drugs/inhibitors that were proposed to target WASF3...groups (treated by DMSO), either treated by 100 μM CYT997 or 10 μM Dasatinib suppressed the cells to spread throughout the fish body (Fig. 4). As...have scr eened t he e f fect s o f mor e t han 40 drugs on invasion using cul tur ed prost ate cancer cells and f ound t hat tar geting multiple

  7. Targeting Nuclear Thymidylate Biosynthesis (United States)

    Chon, James; Stover, Patrick J.; Field, Martha S.


    Thymidylate (dTMP) biosynthesis plays an essential and exclusive function in DNA synthesis and proper cell division, and therefore has been an attractive therapeutic target. Folate analogues, known as antifolates, and nucleotide analogs that inhibit the enzymatic action of the de novo thymidylate biosynthesis pathway and are commonly used in cancer treatment. In this review, we examine the mechanisms by which the antifolate 5-fluorouracil, as well as other dTMP synthesis inhibitors, function in cancer treatment in light of emerging evidence that dTMP synthesis occurs in the nucleus. Nuclear localization of the de novo dTMP synthesis pathway requires modification of the pathway enzymes by the small ubiquitin-like modifier (SUMO) protein. SUMOylation is required for nuclear localization of the de novo dTMP biosynthesis pathway, and disruption in the SUMO pathway inhibits cell proliferation in several cancer models. We summarize evidence that the nuclear localization of the dTMP biosynthesis pathway is a critical factor in the efficacy of antifolate-based therapies that target dTMP synthesis. PMID:27876557

  8. Targeted corneal transplantation. (United States)

    Jhanji, Vishal; Mehta, Jod S; Sharma, Namrata; Sharma, Bhavana; Vajpayee, Rasik B


    Corneal transplantation surgery has moved from an era of conventional penetrating keratoplasty to selective replacement of the diseased corneal layer with complementary healthy donor corneal tissue. Anterior lamellar transplantation surgeries do not involve replacement of corneal endothelium, consequently eliminating the occurrence of endothelial rejection. Similarly, in diseases affecting the corneal endothelium, selective replacement with a lamellar lenticule bearing healthy endothelium provides better outcomes in terms of ocular surface, lesser astigmatism and quick visual recovery. In addition to the advantages of enhanced surgical outcomes, targeted corneal transplantation allows the use of one donor cornea for more than one recipient, thereby offering a viable solution to the problem of paucity of donor corneas. Evolving techniques of corneal transplantation have enabled better utilization of donor corneal tissue. Anterior lamellar as well as endothelial keratoplasty surgeries have become first-choice surgeries in appropriately selected cases. This review briefly discusses some of these novel surgical techniques. A better understanding of targeted corneal transplantation would lead to adaptation of the concept of component corneal surgery. This would further enable the corneal surgeons to circumvent the problem of donor corneal shortage especially in the developing world.

  9. Fixed target beams

    CERN Document Server

    Kain, V; Cettour-Cave, S; Cornelis, K; Fraser, M A; Gatignon, L; Goddard, B; Velotti, F


    The CERN SPS (Super Proton Synchrotron) serves asLHC injector and provides beam for the North Area fixedtarget experiments. At low energy, the vertical acceptancebecomes critical with high intensity large emittance fixed tar-get beams. Optimizing the vertical available aperture is a keyingredient to optimize transmission and reduce activationaround the ring. During the 2016 run a tool was developed toprovide an automated local aperture scan around the entirering.The flux of particles slow extracted with the1/3inte-ger resonance from the Super Proton Synchrotron at CERNshould ideally be constant over the length of the extractionplateau, for optimum use of the beam by the fixed target ex-periments in the North Area. The extracted intensity is con-trolled in feed-forward correction of the horizontal tune viathe main SPS quadrupoles. The Mains power supply noiseat 50 Hz and harmonics is also corrected in feed-forwardby small amplitude tune modulation at the respective fre-quencies with a dedicated additional quad...

  10. Old Drug, New Target (United States)

    Andrews, William J.; Panova, Tatiana; Normand, Christophe; Gadal, Olivier; Tikhonova, Irina G.; Panov, Konstantin I.


    Transcription by RNA polymerase I (Pol-I) is the main driving force behind ribosome biogenesis, a fundamental cellular process that requires the coordinated transcription of all three nuclear polymerases. Increased Pol-I transcription and the concurrent increase in ribosome biogenesis has been linked to the high rates of proliferation in cancers. The ellipticine family contains a number of potent anticancer therapeutic agents, some having progressed to stage I and II clinical trials; however, the mechanism by which many of the compounds work remains unclear. It has long been thought that inhibition of Top2 is the main reason behind the drugs antiproliferative effects. Here we report that a number of the ellipticines, including 9-hydroxyellipticine, are potent and specific inhibitors of Pol-I transcription, with IC50 in vitro and in cells in the nanomolar range. Essentially, the drugs did not affect Pol-II and Pol-III transcription, demonstrating a high selectivity. We have shown that Pol-I inhibition occurs by a p53-, ATM/ATR-, and Top2-independent mechanism. We discovered that the drug influences the assembly and stability of preinitiation complexes by targeting the interaction between promoter recognition factor SL1 and the rRNA promoter. Our findings will have an impact on the design and development of novel therapeutic agents specifically targeting ribosome biogenesis. PMID:23293027

  11. Quantum state targeting (United States)

    Rudolph, Terry; Spekkens, Robert W.


    We introduce a primitive for quantum cryptography that we term “state targeting.” We show that increasing one’s probability of success in this task above a minimum amount implies an unavoidable increase in the probability of a particular kind of failure. This is analogous to the unavoidable disturbance to a quantum state that results from gaining information about its identity, and can be shown to be a purely quantum effect. We solve various optimization problems for state targeting that are useful for the security analysis of two-party cryptographic tasks implemented between remote antagonistic parties. Although we focus on weak coin flipping, the results are significant for other two-party protocols, such as strong coin flipping, partially binding and concealing bit commitment, and bit escrow. Furthermore, the results have significance not only for the traditional notion of security in cryptography, that of restricting a cheater’s ability to bias the outcome of the protocol, but also for a different notion of security that arises only in the quantum context, that of cheat sensitivity. Finally, our analysis leads to some interesting secondary results, namely, a generalization of Uhlmann’s theorem and an operational interpretation of the fidelity between two mixed states.

  12. Target Housing Material Options

    Energy Technology Data Exchange (ETDEWEB)

    Woloshun, Keith Albert [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)


    With gas cooling, heat transfer coefficients are low compared to water. The benefit of gas from a heat transfer point of view is that there is really no upper temperature limit for the coolant, as compared to water, which is limited ultimately by the critical point, and in practice the critical heat flux. In our case with parallel flow channels, water is limited to even lower operating limits by nucleate boiling. So gas can get as hot as the containment material will allow, but to get the density and heat transfer up to something reasonable, we must also increase pressure, thus increasing stress on the containment, namely the front and back faces. We are designing to ASME BPVC, which, for most materials allows a maximum stress of UTS/3. So we want the highest possible UTS. For reference, the front face stress in the 12 mm target at 300 psi was about 90 MPa. The inconel 718 allowable stress at 900°C is 1/3 of 517 or 172 MPa. So we are in a very safe place, but the uTS is dropping rapidly with temperature above 900°C. As we increase target diameter, the challenge will be to keep the stress down. We are probably looking at keeping the allowable at or above the present value, and at as high a temperature as possible.

  13. Targeting adipose tissue

    Directory of Open Access Journals (Sweden)

    Haas Bodo


    Full Text Available Abstract Two different types of adipose tissues can be found in humans enabling them to respond to starvation and cold: white adipose tissue (WAT is generally known and stores excess energy in the form of triacylglycerol (TG, insulates against cold, and serves as a mechanical cushion. Brown adipose tissue (BAT helps newborns to cope with cold. BAT has the capacity to uncouple the mitochondrial respiratory chain, thereby generating heat rather than adenosine triphosphate (ATP. The previously widely held view was that BAT disappears rapidly after birth and is no longer present in adult humans. Using positron emission tomography (PET, however, it was recently shown that metabolically active BAT occurs in defined regions and scattered in WAT of the adult and possibly has an influence on whole-body energy homeostasis. In obese individuals adipose tissue is at the center of metabolic syndrome. Targeting of WAT by thiazolidinediones (TZDs, activators of peroxisome proliferator-activated receptor γ (PPARγ a ‘master’ regulator of fat cell biology, is a current therapy for the treatment of type 2 diabetes. Since its unique capacity to increase energy consumption of the body and to dissipate surplus energy as heat, BAT offers new perspectives as a therapeutic target for the treatment of obesity and associated diseases such as type 2 diabetes and metabolic syndrome. Recent discoveries of new signaling pathways of BAT development give rise to new therapeutic possibilities in order to influence BAT content and activity.

  14. Targeting adipose tissue. (United States)

    Haas, Bodo; Schlinkert, Paul; Mayer, Peter; Eckstein, Niels


    Two different types of adipose tissues can be found in humans enabling them to respond to starvation and cold: white adipose tissue (WAT) is generally known and stores excess energy in the form of triacylglycerol (TG), insulates against cold, and serves as a mechanical cushion. Brown adipose tissue (BAT) helps newborns to cope with cold. BAT has the capacity to uncouple the mitochondrial respiratory chain, thereby generating heat rather than adenosine triphosphate (ATP). The previously widely held view was that BAT disappears rapidly after birth and is no longer present in adult humans. Using positron emission tomography (PET), however, it was recently shown that metabolically active BAT occurs in defined regions and scattered in WAT of the adult and possibly has an influence on whole-body energy homeostasis. In obese individuals adipose tissue is at the center of metabolic syndrome. Targeting of WAT by thiazolidinediones (TZDs), activators of peroxisome proliferator-activated receptor γ (PPARγ) a 'master' regulator of fat cell biology, is a current therapy for the treatment of type 2 diabetes. Since its unique capacity to increase energy consumption of the body and to dissipate surplus energy as heat, BAT offers new perspectives as a therapeutic target for the treatment of obesity and associated diseases such as type 2 diabetes and metabolic syndrome. Recent discoveries of new signaling pathways of BAT development give rise to new therapeutic possibilities in order to influence BAT content and activity.

  15. Alopecia in patients treated with molecularly targeted anticancer therapies. (United States)

    Belum, V R; Marulanda, K; Ensslin, C; Gorcey, L; Parikh, T; Wu, S; Busam, K J; Gerber, P A; Lacouture, M E


    The introduction of molecularly targeted anticancer therapies presents new challenges, among which dermatologic adverse events are noteworthy. Alopecia in particular is frequently reported, but the true incidence is not known. We sought to ascertain the incidence and risk of developing alopecia during treatment with approved inhibitors of oncogenic pathways and molecules [anaplastic lymphoma kinase, breakpoint cluster region-abelson, B-rapidly accelerated fibrosarcoma, Bruton's tyrosine kinase, cytotoxic T-lymphocyte antigen-4, epidermal growth factor receptor, human epidermal growth factor receptor-2, Janus kinase, MAPK/ERK (extracellular signal-regulated kinase) Kinase, mammalian target of rapamycin, smoothened, vascular endothelial growth factor, vascular endothelial growth factor receptor, platelet derived growth factor receptor; proteasomes; CD20, CD30, CD52]. Electronic database (PubMed, Web of Science) and ASCO meeting abstract searches were conducted to identify clinical trials reporting alopecia. Meta-analysis was conducted utilizing fixed- or random-effects models. The calculated overall incidence of all-grade alopecia was 14.7% [95% confidence interval (CI) 12.6% to 17.2%]-lowest with bortezomib, 2.2% (95% CI 0.4% to 10.9%), and highest with vismodegib, 56.9% (95% CI 50.5% to 63.1%). There was an increased risk of all-grade alopecia [relative risk (RR), 7.9 (95% CI 6.2-10.09, P ≤ 0.01)] compared with placebo, but when compared with chemotherapy, the risk was lower [RR, 0.32 (95% CI 0.2-0.55, P ≤ 0.01)]. Targeted therapies are associated with an increased risk of alopecia. © The Author 2015. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email:

  16. Low intensity beam target unit

    CERN Multimedia

    CERN PhotoLab


    This is a wheel fitted with many targets around its periphery (each with three longitudinally arranged thin rods) of which one is placed into the beam via a rotation of the wheel. Upstream of each target is placed a luminescent screen, aligbed on each target axis and viewed with a TV camera, to make sure that one is hitting the target. This target unit was probably used to study target's behaviour (like beam heating). Gualtiero Del Torre stands on the left, Pierre Gerdil on the right.

  17. Issues in Target Tracking (United States)


    simulations we take as ground truth that the target moves at 10m/s heading west and 5m/s heading north, starting from ( 5000m , 35000m). The emitted frequency is... runs , the estimated initial and final positions fall into the 99% confidence region. −1 −0.8 −0.6 −0.4 −0.2 0 0.2 0.4 0.6 0.8 1 x 10 4 0 0.5 1 1.5 2 2.5...position of trajectories. “F”: final position of trajectories. Right: The true and estimated trajectories from 100 Monte Carlo runs for Johnson noise

  18. Bradycardia During Targeted Temperature Management

    DEFF Research Database (Denmark)

    Thomsen, Jakob Hartvig; Nielsen, Niklas; Hassager, Christian


    OBJECTIVES: Bradycardia is common during targeted temperature management, likely being a physiologic response to lower body temperature, and has recently been associated with favorable outcome following out-of-hospital cardiac arrest in smaller observational studies. The present study sought...... to confirm this finding in a large multicenter cohort of patients treated with targeted temperature management at 33°C and explore the response to targeted temperature management targeting 36°C. DESIGN: Post hoc analysis of a prospective randomized study. SETTING: Thirty-six ICUs in 10 countries. PATIENTS......: We studied 447 (targeted temperature management = 33°C) and 430 (targeted temperature management = 36°C) comatose out-of-hospital cardiac arrest patients with available heart rate data, randomly assigned in the targeted temperature management trial from 2010 to 2013. INTERVENTIONS: Targeted...

  19. Characterization of solid hydrogen targets

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, M.C. [British Columbia Univ., Vancouver, BC (Canada); Bailey, J.M.; Mulhauser, F. [Chester Technology (United Kingdom); Beer, G.A.; Douglas, J.L.; Knowles, P.E.; Maier, M.; Mason, G.R.; Olin, A.; Porcelli, T.A. [Victoria Univ., BC (Canada); Beveridge, J.L.; Marshall, G.M. [British Columbia Univ., Vancouver, BC (Canada). TRIUMF Facility; Huber, T.M. [Gustavus Adolphus Coll., St. Peter, MN (United States); Jacot-Guillarmod, R. [Fribourg Univ. (Switzerland); Kammel, P. [Lawrence Berkeley Lab., CA (United States); Kim, S.K. [Jeonbuk National Univ., Jeonju City (Korea, Republic of); Kunselman, A.R. [Wyoming Univ., Laramie, WY (United States); Martoff, C.J. [Temple Univ., Philadelphia, PA (United States); Petitjean, C. [Paul Scherrer Inst. (PSI), Villigen (Switzerland); Zmeskal, J. [Oesterreichische Akademie der Wissenschaften, Vienna (Austria)


    In experiments using the TRIUMF solid hydrogen target system, the knowledge of the target thickness and uniformity is often essential in order to extract physical parameters from the data. We have characterized the thickness and uniformity of frozen targets using the energy loss of alpha particles. An accuracy of {approx}5% was achieved, a limit imposed by the uncertainty in the stopping powers. The details of the method are described, and the thickness calibration of the target is presented. (orig.). 11 refs.

  20. Optical characteristics of transparent samarium oxide thin films ...

    Indian Academy of Sciences (India)


    Oct 7, 2016 ... 1Department of Physics, Faculty of Science, Taif University, Taif 888, Saudi Arabia. 2Department of Physics, Faculty of Education, Ain Shams University, Roxy 11757, Cairo, Egypt. 3Materials Science Unit, Department of Chemistry, Faculty of Science, Tanta University, 31725 Tanta, Egypt. 4Department of ...

  1. Optical properties of lead–tellurite glasses doped with samarium ...

    Indian Academy of Sciences (India)

    The optical properties of a new family of Sm2O3–(40–)PbO–60TeO2 glasses are investigated. The optical absorption spectra were recorded at ... The refractive index, molar refraction and polarizability of oxide ions have been calculated by using Lorentz–Lorentz relations. The non-linear variations of the above optical ...

  2. Optical properties of lead–tellurite glasses doped with samarium ...

    Indian Academy of Sciences (India)


    Abstract. The optical properties of a new family of xSm2O3–(40–x)PbO–60TeO2 glasses are investigated. The optical absorption spectra were recorded at room temperature in the UV-visible region. From the absorption edge studies, the values of optical bandgap energies have been evaluated. The refractive index, molar ...

  3. Measurement of radiative lifetime in atomic samarium using ...

    Indian Academy of Sciences (India)


    Feb 8, 2014 ... In this paper, we report the investigations of lifetime measurement of odd-parity energy level 19009.52 cm. −1 .... introduced by an electronic delay generator between the two Q-switch pulses of Nd-YAG laser. The slope of the .... Our values of the lifetimes are free from the common systematic errors. Thus ...

  4. A novel samarium complex with interesting photoluminescence and ...

    African Journals Online (AJOL)

    The 4,4'-Hbipy moieties, isolated nitrates and [Sm(H2O)4(NO3)3] species are held together via hydrogen bonds and p…p interactions to form a 3-D supramolecular framework. Luminescent investigation reveals a strong emission in blue region. Optical absorption spectrum of 1 reveals the presence of an optical gap of 3.60 ...

  5. Lithium samarium polyphosphate, LiSm(PO34

    Directory of Open Access Journals (Sweden)

    Dan Zhao


    Full Text Available The mixed-metal rare-earth polyphosphate LiSm(PO34 consists of a three-dimensional framework in which zigzag [(PO3n]n− chains with a periodicity of four PO4 tetrahedra are connected through Li+ and Sm3+ ions (both with 2. symmetry.

  6. Sodium samarium tetrakis(polyphosphate, NaSm(PO34

    Directory of Open Access Journals (Sweden)

    Dan Zhao


    Full Text Available NaSm(PO34 has been prepared by solid state reactions. It belongs to type II of the structural family of MILnIII(PO34 compounds (MI = alkali metal and LnIII = rare earth metal and is composed of ∞(PO3n]n− polyphosphate chains with a repeating unit of four PO4 tetrahedra. The chains extend parallel to [100] and share O atoms with irregular SmO8 polyhedra, forming a three-dimensional framework which delimits tunnels occupied by Na+ cations in a distorted octahedral environment.

  7. Isotopic Ratios of Samarium by TIMS for Nuclear Forensic Application

    Energy Technology Data Exchange (ETDEWEB)

    Louis Jean, James [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Inglis, Jeremy David [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)


    The isotopic ratio of Nd, Sm, and Gd can provide important information regarding fissile material (nuclear devices, reactors), neutron environment, and device yield. These studies require precise measurement of Sm isotope ratios, by either TIMS or MC-ICP-MS. There has been an increasing trend to measure smaller and smaller quantities of Sm bearing samples. In nuclear forensics 10-100 ng of Sm are needed for precise measurement. To measure sub-ng Sm samples using TIMS for nuclear forensic analysis.

  8. Synthesis of copper, silver, and samarium chalcogenides by mechanical alloying

    Energy Technology Data Exchange (ETDEWEB)

    Ohtani, T.; Maruyama, K.; Ohshima, K. [Okayama Univ. of Science (Japan). Lab. for Solid State Chemistry


    CuInX{sub 2} (X = S, Se, Te), Ag{sub 2}S, Ag{sub 2}Se, Ag{sub 3}Te{sub 2}, Ag{sub 1.9}Te, AgCuSe, Sm{sub 3}Se{sub 4}, Sm{sub 2}Se{sub 3}, and SmTe were synthesized by a mechanical alloying method, using a high-energy planetary ball mill. The compounds were obtained by milling mixtures of the elements with desired ratios in agate or Cu-Be vials for 60--180 min.

  9. Oriented growth of thin films of samarium oxide by MOCVD

    Indian Academy of Sciences (India)


    Abstract. Thin films of Sm2O3 have been grown on Si(100) and fused quartz by low-pressure chemical va- pour deposition using an adducted β-diketonate precursor. The films on quartz are cubic, with no preferred orientation at lower growth temperatures (~ 550°C), while they grow with a strong (111) orientation as the.

  10. 150 KVA Samarium Cobalt VSCF Starter Generator Electrical System (United States)


    considerable hand labor. Addition of a provision for suitable electrical connection by the SCR manufacturer wou;d be desirable for production runs. Predicted...licen- sing the holder or any other person or corporation, or conveying any rights or permission to manufacture , use, or sell any patented invent,’n...tesile strength to contain the magnets and pole pieces up through the overspeed rating of the rotor. The cho.;en process uses maraging steel as the

  11. Optical properties of samarium doped zinc–tellurite glasses

    Indian Academy of Sciences (India)

    Glasses with the composition, (Sm2O3)(ZnO)(40–)(TeO2)(60), were prepared by conventional melt quenching method. The density, molar volume, and optical energy band gap of these glasses have been measured. The refractive index, molar refraction and polarizability of oxide ion have been calculated by using ...

  12. CD147 is a regulatory subunit of the gamma-secretase complex inAlzheimer's disease amyloid beta-peptide production

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Shuxia; Zhou, Hua; Walian, Peter J.; Jap, Bing K.


    {gamma}-secretase is a membrane protein complex that cleaves the {beta}-amyloid precursor protein (APP) within the transmembrane region, following prior processing by {beta}-secretase, producing amyloid {beta}-peptides (A{beta}{sub 40} and A{beta}{sub 42}). Errant production of A{beta}-peptides that substantially increases A{beta}{sub 42} production has been associated with the formation of amyloid plaques in Alzheimer's disease patients. Biophysical and genetic studies indicate that presenilin-1 (Psn-1), which contains the proteolytic active site, and three other membrane proteins, nicastrin (Nct), APH-1, and PEN-2 are required to form the core of the active {gamma}-secretase complex. Here, we report the purification of the native {gamma}-secretase complexes from HeLa cell membranes and the identification of an additional {gamma}-secretase complex subunit, CD147, a transmembrane glycoprotein with two immunoglobulin-like domains. The presence of this subunit as an integral part of the complex itself was confirmed through co-immunoprecipitation studies of the purified protein from HeLa cells and solubilized complexes from other cell lines such as neural cell HCN-1A and HEK293. Depletion of CD147 by RNA interference was found to increase the production of A{beta} peptides without changing the expression level of the other {gamma}-secretase components or APP substrates while CD147 overexpression had no statistically significant effect on amyloid {beta}-peptide production, other {gamma}-secretase components or APP substrates, indicating that the presence of the CD147 subunit within the {gamma}-secretase complex directly down-modulates the production of A{beta}-peptides. {gamma}-secretase was first recognized through its role in the production of the A{beta} peptides that are pathogenic in Alzheimer's disease (AD) (1). {gamma}-secretase is a membrane protein complex with unusual aspartyl protease activity that cleaves a variety of type I membrane proteins

  13. Gadolinium(III) complexes of 1,4,7-triazacyclononane based picolinate ligands: simultaneous optimization of water exchange kinetics and electronic relaxation. (United States)

    Nonat, Aline; Giraud, Marion; Gateau, Christelle; Fries, Pascal H; Helm, Lothar; Mazzanti, Marinella


    The two new tripodal picolinate H(3)ebpatcn (1-carboxyethyl-4,7-bis((6-carboxypyridin-2-yl)methyl)-1,4,7-triazacyclononane) and H(4)pbpatcn (1-methylphosphonic-acid-4,7-bis((6-carboxypyridin-2-yl)methyl)-1,4,7-triazacyclononane) ligands based on the 1,4,7-triazacyclononane anchor were prepared and their lanthanide complexes were characterized by NMR, fluorescence and potentiometric studies. The [Gd(ebpatcn)(H(2)O)] complex displays a relaxivity of r(1) = 4.68 mM(-1) s(-1) at 45 MHz and 298 K, whereas r(1) = 4.55 mM(-1) s(-1) was measured for [Gd(Hpbpatcn)(H(2)O)] under the same conditions. The modified scaffold of the ligands with respect to the previously reported H(3)bpatcn (1-(carboxymethyl)-4,7-bis[(6-carboxypyridin-2-yl)methyl]-1,4,7-triazacyclononane) leads to an optimization of the properties of these gadolinium complexes. The replacement of an acetate binding group of the H(3)bpatcn ligand with a propionate group (H(3)ebpatcn) or a phosphonate group (H(4)pbpatcn) leads to a faster exchange rate of the coordinated water molecule in both mono-aquo gadolinium complexes. The resulting water exchange rate is optimized for the future design of high relaxivity macromolecular gadolinium based contrast agents with a value measured by O(17) NMRD of k(ex) = 34 x 10(6) s(-1) for [Gd(Hpbpatcn)(H(2)O)] falling in the range of optimum values of (30 to 50) x 10(6) s(-1) predicted by the SBM theory. The water exchange rate k(ex)(298) = 86 x 10(6) s(-1) of the complex [Gd(ebpatcn)(H(2)O)] is the fastest reported in the literature for a neutral complex with only one inner-sphere water molecule. The relatively high stability of these modified gadolinium complexes (pGd = 14.1 for Gd(pbpatcn) and 13.1 for Gd(ebpatcn)) is similar to that of the [Gd(bpatcn)(H(2)O)] complex (pGd = 13.6). The high luminescence efficiency is also retained for the terbium complex. However, whereas the longitudinal electronic spin relaxation time keeps a value for [Gd(ebpatcn)(H(2)O)], which is long

  14. Chemical separation of Nd from geological samples for chronological studies using (146)Sm-(142)Nd and (147)Sm-(143)Nd systematics. (United States)

    Kagami, Saya; Yokoyama, Tetsuya


    Sm-Nd dating, which involves long-lived (147)Sm-(143)Nd and short-lived (146)Sm-(142)Nd systematics, has been widely used in the field of geosciences. To obtain precise and accurate ages of geological samples, the determination of highly precise Nd isotope ratios with nearly complete removal of Ce and Sm is indispensable to avoid mass spectral interference. In this study, we developed a three-step column chemistry procedure for separating Nd from geological samples that includes cation exchange chromatography for separating major elements from rare earth elements (REEs), oxidative extraction chromatography using Ln Resin coupled with HNO3 + KBrO3 for separating tetravalent Ce from the remaining REEs, and final purification of Nd using Ln Resin. This method enables high recovery of Nd (>91%) with effective separation of Nd from Ce and Sm (Ce/Nd systematics, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. A study of nuclear structure for 244Cm, 241Am, 238Pu, 210Po, 147Pm, 137Cs, 90Sr and 63Ni nuclei used in nuclear battery (United States)

    Artun, Ozan


    In this paper, we intend to extend the nuclear data of 244Cm, 241Am, 238Pu, 210Po, 147Pm, 137Cs, 90Sr and 63Ni nuclei used in nuclear battery technology, because, these nuclei are quite important for space investigations in radioisotope thermoelectric generator (RTG) and for microelectronic technologies in betavoltaic batteries. Therefore, the nuclear structure properties of nuclei such as separation energies, neutron skin thicknesses, proton, charge and neutron density distributions as a function of radius, the root mean square (rms) proton, charge and neutron radii, binding energies per particle, have been investigated by Hartree-Fock with eight different Skyrme forces. The obtained results have been compared with the experimental data in literature and relativistic mean field theory (RMFT) results.

  16. Abnormal creatine transport of mutations in monocarboxylate transporter 12 (MCT12) found in patients with age-related cataract can be partially rescued by exogenous chaperone CD147. (United States)

    Stäubli, Andrina; Capatina, Nadejda; Fuhrer, Yvonne; Munier, Francis L; Labs, Stephan; Schorderet, Daniel F; Tiwari, Amit; Verrey, Francois; Heon, Elise; Cheng, Ching-Yu; Wong, Tien-Yin; Berger, Wolfgang; Camargo, Simone M R; Kloeckener-Gruissem, Barbara


    Membrane transporters influence biological functions in the ocular lens. Here, we investigate the monocarboxylate transporter 12 (MCT12), also called creatine transporter 2 (CRT2), which is found in the ocular lens and is involved in cataract. As the age-related form affects about half of the population world-wide, understanding relevant pathomechanisms is a prerequisite for exploring non-invasive treatments. We screened the coding exons of the gene SLC16A12 in 877 patients from five cohorts, including Caucasian and Asian ethnicities. A previously identified risk factor, SNP rs3740030, displayed different frequencies in the Asian cohorts but risk could not be established. In 15 patients 13 very rare heterozygous nucleotide substitutions were identified, of which eight led to non-synonymous and four to synonymous amino acid exchanges and one mapped to the canonical splice site in intron 3. Their impact on creatine transport was tested in Xenopus laevis oocytes and human HEK293T cells. Four variants (p.Ser158Pro, p.Gly205Val, p.Pro395Gln and p.Ser453Arg) displayed severe reduction in both model systems, indicating conserved function. Two of these, p.Gly205Val, and p.Ser453Arg, did not localize to the oocyte membrane, suggesting possible impacts on protein interactions for transporter processing. In support, exogenously supplied excess of MCT12's chaperone CD147 in HEK293T cells led to a partial recovery of the defective uptake activity from p.Gly205Val and also from mutant p.Pro395Gln, which did localize to the membrane. Our findings provide first insight in the molecular requirements of creatine transporter, with particular emphasis on rescuing effects by its chaperone CD147, which can provide useful pharmacological information for substrate delivery. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email:

  17. Target noise in overlay metrology (United States)

    Seligson, Joel L.; Adel, Mike E.; Izikson, Pavel; Levinski, Vladimir; Yaffe, Dan


    We have developed a method for calculating the statistical effects of spatial noise on the overlay measurement extracted from a given overlay target. The method has been applied to two kinds of overlay targets on three process layers, and the new metric, Target Noise, has been shown to correlate well to the random component of Overlay Mark Fidelity. A significant difference in terms of robustness has been observed between AIM targets and conventional Frame-in-Frame targets. The results fit well into the spatial noise hierarchy presented in this paper.

  18. EURISOL High Power Targets

    CERN Document Server

    Kadi, Y; Lindroos, M; Ridikas, D; Stora, T; Tecchio, L; CERN. Geneva. BE Department


    Modern Nuclear Physics requires access to higher yields of rare isotopes, that relies on further development of the In-flight and Isotope Separation On-Line (ISOL) production methods. The limits of the In-Flight method will be applied via the next generation facilities FAIR in Germany, RIKEN in Japan and RIBF in the USA. The ISOL method will be explored at facilities including ISAC-TRIUMF in Canada, SPIRAL-2 in France, SPES in Italy, ISOLDE at CERN and eventually at the very ambitious multi-MW EURISOL facility. ISOL and in-flight facilities are complementary entities. While in-flight facilities excel in the production of very short lived radioisotopes independently of their chemical nature, ISOL facilities provide high Radioisotope Beam (RIB) intensities and excellent beam quality for 70 elements. Both production schemes are opening vast and rich fields of nuclear physics research. In this article we will introduce the targets planned for the EURISOL facility and highlight some of the technical and safety cha...

  19. PACE4-Based Molecular Targeting of Prostate Cancer Using an Engineered 64Cu-Radiolabeled Peptide Inhibitor

    Directory of Open Access Journals (Sweden)

    Frédéric Couture


    Full Text Available The potential of PACE4 as a pharmacological target in prostate cancer has been demonstrated as this proprotein convertase is strongly overexpressed in human prostate cancer tissues and its inhibition, using molecular or pharmacological approaches, results in reduced cell proliferation and tumor progression in mouse tumor xenograft models. We developed a PACE4 high-affinity peptide inhibitor, namely, the multi-leucine (ML, and sought to determine whether this peptide could be exploited for the targeting of prostate cancer for diagnostic or molecular imaging purposes. We conjugated a bifunctional chelator 1,4,7-triazacyclononane-1,4,7- triacetic acid (NOTA to the ML peptide for copper-64 (64Cu labeling and positron emission tomography (PET– based prostate cancer detection. Enzyme kinetic assays against recombinant PACE4 showed that the NOTA-modified ML peptide displays identical inhibitory properties compared to the unmodified peptide. In vivo biodistribution of the 64Cu/NOTA-ML peptide evaluated in athymic nude mice bearing xenografts of two human prostate carcinoma cell lines showed a rapid and high uptake in PACE4-expressing LNCaP tumor at an early time point and in PACE4-rich organs. Co-injection of unlabeled peptide confirmed that tumor uptake was target-specific. PACE4-negative tumors displayed no tracer uptake 15 minutes after injection, while the kidneys, demonstrated high uptake due to rapid renal clearance of the peptide. The present study supports the feasibility of using a 64Cu/NOTA-ML peptide for PACE4-targeted prostate cancer detection and PACE4 status determination by PET imaging but also provides evidence that ML inhibitor–based drugs would readily reach tumor sites under in vivo conditions for pharmacological intervention or targeted radiation therapy.

  20. Stock assessment of fishery target species in Lake Koka, Ethiopia

    Directory of Open Access Journals (Sweden)

    Gashaw Tesfaye


    Full Text Available Effective management is essential for small-scale fisheries to continue providing food and livelihoods for households, particularly in developing countries where other options are often limited. Studies on the population dynamics and stock assessment on fishery target species are thus imperative to sustain their fisheries and the benefits for the society. In Lake Koka (Ethiopia, very little is known about the vital population parameters and exploitation status of the fishery target species: tilapia Oreochromis niloticus,common carp Cyprinus carpióand catfish Clarias gariepinus.Our study, therefore, aimed at determining the vital population parameters and assessing the status of these target species in Lake Koka using length frequency data collected quarterly from commercial catches from 2007-2012. A total of 20 097 fish specimens (distributed as 7 933 tilapia, 6 025 catfish and 6 139 common carp were measured for the analysis. Von Bertalanffy growth parameters and their confidence intervals were determined from modal progression analysis using ELEFAN I and applying the jackknife technique. Mortality parameters were determined from length-converted catch curves and empirical models. The exploitation status of these target species were then assessed by computing exploitation rates (E from mortality parameters as well as from size indicators i.e., assessing the size distribution of fish catches relative to the size at maturity (L m,the size that provides maximum cohort biomass (Lopt and the abundance of mega-spawners. The mean value of growth parameters L x, Kand the growth performance index 0' were 44.5 cm, 0.41/year and 2.90 for O. niloticus,74.1 cm, 0.28/year and 3.19 for C. carpioand 121.9 cm, 0.16/year and 3.36 for C. gariepinus,respectively. The 95 % confidence intervals of the estimates were also computed. Total mortality (Z estimates were 1.47, 0.83 and 0.72/year for O. niloticus, C. carpioand C. gariepinus,respectively. Our study suggest

  1. The target effect: visual memory for unnamed search targets. (United States)

    Thomas, Mark D; Williams, Carrick C


    Search targets are typically remembered much better than other objects even when they are viewed for less time. However, targets have two advantages that other objects in search displays do not have: They are identified categorically before the search, and finding them represents the goal of the search task. The current research investigated the contributions of both of these types of information to the long-term visual memory representations of search targets. Participants completed either a predefined search or a unique-object search in which targets were not defined with specific categorical labels before searching. Subsequent memory results indicated that search target memory was better than distractor memory even following ambiguously defined searches and when the distractors were viewed significantly longer. Superior target memory appears to result from a qualitatively different representation from those of distractor objects, indicating that decision processes influence visual memory.

  2. Guidance and targeting for the Strategic Target System (United States)

    White, John E.

    Guidance algorithms and targeting procedures for the Strategic Target System (STARS) launch vehicle are described. The STARS vehicle is a three stage booster, based partly upon retired Polaris A3 missile assets, which is intended to support development and testing of the Strategic Defense Initiative by delivering target payloads to the vicinity of the Kwajalein Atoll. STARS will be launched from the Kauai Test Facility located on Kauai, Hawaii. The STARS guidance objective is to deliver payloads to a prescribed target location with maximum accuracy at intercontinental ballistic missile velocities. Mission objectives are achieved with a combination of guidance algorithms.

  3. Oxide Fiber Targets at ISOLDE

    CERN Document Server

    Köster, U; Carminati, D; Catherall, R; Cederkäll, J; Correia, J G; Crepieux, B; Dietrich, M; Elder, K; Fedosseev, V; Fraile-Prieto, L M; Franchoo, S; Fynbo, H O U; Georg, U; Giles, T; Joinet, A; Jonsson, O C; Kirchner, R; Lau, C; Lettry, Jacques; Maier, H J; Mishin, V I; Oinonen, M; Peräjärvi, K; Ravn, H L; Rinaldi, T; Santana-Leitner, M; Wahl, U; Weissman, L


    Many elements are rapidly released from oxide matrices. Some oxide powder targets show a fast sintering, thus losing their favorable release characteristics. Loosely packed oxyde fiber targets are less critical since they may maintain their open structure even when starting to fuse together at some contact points. The experience with various oxyde fiber targets (titania, zirconia, ceria and thoria) used in the last years at ISOLDE is reviewed. For short-lived isotopes of Cu, Ga and Xe the zirconia and ceria targets respectively provided significantly higher yields than any other target (metal foils, oxide powders, etc.) tested before. Titania fibers, which were not commercially available, were produced in a relic process by impregnation of a rayon felt in a titanium chloride solution and subsequent calcination by heating the dried felt in air. Thoria fibers were obtained either by the same process or by burning commercial gas lantern mantle cloth. In the future a beryllia fiber target could be used to produce...

  4. Therapeutic Targeting of Telomerase

    Directory of Open Access Journals (Sweden)

    Kathrin Jäger


    Full Text Available Telomere length and cell function can be preserved by the human reverse transcriptase telomerase (hTERT, which synthesizes the new telomeric DNA from a RNA template, but is normally restricted to cells needing a high proliferative capacity, such as stem cells. Consequently, telomerase-based therapies to elongate short telomeres are developed, some of which have successfully reached the stage I in clinical trials. Telomerase is also permissive for tumorigenesis and 90% of all malignant tumors use telomerase to obtain immortality. Thus, reversal of telomerase upregulation in tumor cells is a potential strategy to treat cancer. Natural and small-molecule telomerase inhibitors, immunotherapeutic approaches, oligonucleotide inhibitors, and telomerase-directed gene therapy are useful treatment strategies. Telomerase is more widely expressed than any other tumor marker. The low expression in normal tissues, together with the longer telomeres in normal stem cells versus cancer cells, provides some degree of specificity with low risk of toxicity. However, long term telomerase inhibition may elicit negative effects in highly-proliferative cells which need telomerase for survival, and it may interfere with telomere-independent physiological functions. Moreover, only a few hTERT molecules are required to overcome senescence in cancer cells, and telomerase inhibition requires proliferating cells over a sufficient number of population doublings to induce tumor suppressive senescence. These limitations may explain the moderate success rates in many clinical studies. Despite extensive studies, only one vaccine and one telomerase antagonist are routinely used in clinical work. For complete eradication of all subpopulations of cancer cells a simultaneous targeting of several mechanisms will likely be needed. Possible technical improvements have been proposed including the development of more specific inhibitors, methods to increase the efficacy of vaccination

  5. Target Acquisition Methodology Enhancement (TAME) (United States)


    acquisition probability from COMINT, PCOM , against all communications type targets, is determined offline by a stochastic model for subsequent...of PN over all replications. F-4 f. Computes overall acquisition probability, PCOM , against all communications type targets as C: PCOM = (1. - PN...NNET where NNET denotes the number of nets which the target is in. F-6. TOTAL ACQUISITION PROBABILITY. With PNCj and PCOM computed as above, the

  6. Syntheses in Aqueous Solution and Crystal Structure of a Triamido-Bridged Dicobalt(III) Complex with the Ligands 1,4,7-Triazacyclononane and 3-Thiapentane-1,5-diamine

    DEFF Research Database (Denmark)

    Kofod, Pauli; Larsen, Erik; Larsen, Sine


    The reaction of Co(tacn)(daes)3+ [tacn = 1,4,7-triazacyclonane; daes = (3-thiapentane-1,5-diamine = di(2-aminoethyl)sulfide)] in 4 M NaOH yields nearly quantitively the triamido-bridged dicobalt(III) complex: 7--triazacyclononane-2kappa3N1,N4,N7-dicobalt(III) ion, in the following abbreviated as Co...

  7. Guidance system for laser targets (United States)

    Porter, Gary D.; Bogdanoff, Anatoly


    A system for guiding charged laser targets to a predetermined focal spot of a laser along generally arbitrary, and especially horizontal, directions which comprises a series of electrostatic sensors which provide inputs to a computer for real time calculation of position, velocity, and direction of the target along an initial injection trajectory, and a set of electrostatic deflection means, energized according to a calculated output of said computer, to change the target trajectory to intercept the focal spot of the laser which is triggered so as to illuminate the target of the focal spot.

  8. Targeted nanotechnology for cancer imaging. (United States)

    Toy, Randall; Bauer, Lisa; Hoimes, Christopher; Ghaghada, Ketan B; Karathanasis, Efstathios


    Targeted nanoparticle imaging agents provide many benefits and new opportunities to facilitate accurate diagnosis of cancer and significantly impact patient outcome. Due to the highly engineerable nature of nanotechnology, targeted nanoparticles exhibit significant advantages including increased contrast sensitivity, binding avidity and targeting specificity. Considering the various nanoparticle designs and their adjustable ability to target a specific site and generate detectable signals, nanoparticles can be optimally designed in terms of biophysical interactions (i.e., intravascular and interstitial transport) and biochemical interactions (i.e., targeting avidity towards cancer-related biomarkers) for site-specific detection of very distinct microenvironments. This review seeks to illustrate that the design of a nanoparticle dictates its in vivo journey and targeting of hard-to-reach cancer sites, facilitating early and accurate diagnosis and interrogation of the most aggressive forms of cancer. We will report various targeted nanoparticles for cancer imaging using X-ray computed tomography, ultrasound, magnetic resonance imaging, nuclear imaging and optical imaging. Finally, to realize the full potential of targeted nanotechnology for cancer imaging, we will describe the challenges and opportunities for the clinical translation and widespread adaptation of targeted nanoparticles imaging agents. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Targets and Secondary Beam Extraction (United States)

    Noah, Etam


    Several applications make use of secondary beams of particles generated by the interaction of a primary beam of particles with a target. Spallation neutrons, bremsstrahlung photon-produced neutrons, radioactive ions and neutrinos are available to users at state-of-the-art facilities worldwide. Plans for even higher secondary beam intensities place severe constraints on the design of targets. This article reports on the main targetry challenges and highlights a variety of solutions for targetry and secondary beam extraction. Issues related to target station layout, instrumentation at the beam-target interface, safety and radioprotection are also discussed.

  10. Achieving Plant CRISPR Targeting that Limits Off-Target Effects

    Directory of Open Access Journals (Sweden)

    Jeffrey D. Wolt


    Full Text Available The CRISPR-Cas9 system (clustered regularly interspaced short palindromic repeats with associated Cas9 protein has been used to generate targeted changes for direct modification of endogenous genes in an increasing number of plant species; but development of plant genome editing has not yet fully considered potential off-target mismatches that may lead to unintended changes within the genome. Assessing the specificity of CRISPR-Cas9 for increasing editing efficiency as well as the potential for unanticipated downstream effects from off-target mutations is an important regulatory consideration for agricultural applications. Increasing genome-editing specificity entails developing improved design methods that better predict the prevalence of off-target mutations as a function of genome composition and design of the engineered ribonucleoprotein (RNP. Early results from CRISPR-Cas9 genome editing in plant systems indicate that the incidence of off-target mutation frequencies is quite low; however, by analyzing CRISPR-edited plant lines and improving both computational tools and reagent design, it may be possible to further decrease unanticipated effects at potential mismatch sites within the genome. This will provide assurance that CRISPR-Cas9 reagents can be designed and targeted with a high degree of specificity. Improved and experimentally validated design tools for discriminating target and potential off-target positions that incorporate consideration of the designed nuclease fidelity and selectivity will help to increase confidence for regulatory decision making for genome-edited plants.

  11. Literature evidence in open targets - a target validation platform. (United States)

    Kafkas, Şenay; Dunham, Ian; McEntyre, Johanna


    We present the Europe PMC literature component of Open Targets - a target validation platform that integrates various evidence to aid drug target identification and validation. The component identifies target-disease associations in documents and ranks the documents based on their confidence from the Europe PMC literature database, by using rules utilising expert-provided heuristic information. The confidence score of a given document represents how valuable the document is in the scope of target validation for a given target-disease association by taking into account the credibility of the association based on the properties of the text. The component serves the platform regularly with the up-to-date data since December, 2015. Currently, there are a total number of 1168365 distinct target-disease associations text mined from >26 million PubMed abstracts and >1.2 million Open Access full text articles. Our comparative analyses on the current available evidence data in the platform revealed that 850179 of these associations are exclusively identified by literature mining. This component helps the platform's users by providing the most relevant literature hits for a given target and disease. The text mining evidence along with the other types of evidence can be explored visually through and all the evidence data is available for download in json format from .

  12. Transverse target spin asymmetries on a proton target at COMPASS

    CERN Document Server

    Richter, Andreas


    Transversity and transverse momentum-dependent parton distribution functions (TMDs) are been measured in semi-inclusive deep inelastic scattering (SIDIS) by using a transversely polarized target at the COMPASS experiment. COMPASS is a fixed target experiment at the CERN M2 beamline, which provides a 160GeV/c polarized m+ beam. In the years 2002-2004 COMPASS has collected data with a transversely polarized deuteron 6LiD target. In 2007, COMPASS has used for the first time a proton NH3 target. To access transversity COMPASS has used three different quark polarimeters: the Collins effect, responsible for an azimuthal asymmetry in the single hadron distribution, azimuthal target spin asymmetries of charged hadron pairs and the transverse polarisation of L hyperons. Beside this also the Sivers asymmetry arising from the correlation between the transverse nucleon spin and the quark intrinsic transverse momentum was measured. European

  13. Treating rheumatoid arthritis to target

    DEFF Research Database (Denmark)

    Smolen, Josef S; Aletaha, Daniel; Bijlsma, Johannes W J


    BACKGROUND: Aiming at therapeutic targets has reduced the risk of organ failure in many diseases such as diabetes or hypertension. Such targets have not been defined for rheumatoid arthritis (RA). OBJECTIVE: /st> To develop recommendations for achieving optimal therapeutic outcomes in RA. METHODS...

  14. Treating rheumatoid arthritis to target

    DEFF Research Database (Denmark)

    Smolen, Josef S; Breedveld, Ferdinand C; Burmester, Gerd R


    BACKGROUND: Reaching the therapeutic target of remission or low-disease activity has improved outcomes in patients with rheumatoid arthritis (RA) significantly. The treat-to-target recommendations, formulated in 2010, have provided a basis for implementation of a strategic approach towards this t...

  15. Saccadic adaptation to moving targets.

    Directory of Open Access Journals (Sweden)

    Katharina Havermann

    Full Text Available Saccades are so called ballistic movements which are executed without online visual feedback. After each saccade the saccadic motor plan is modified in response to post-saccadic feedback with the mechanism of saccadic adaptation. The post-saccadic feedback is provided by the retinal position of the target after the saccade. If the target moves after the saccade, gaze may follow the moving target. In that case, the eyes are controlled by the pursuit system, a system that controls smooth eye movements. Although these two systems have in the past been considered as mostly independent, recent lines of research point towards many interactions between them. We were interested in the question if saccade amplitude adaptation is induced when the target moves smoothly after the saccade. Prior studies of saccadic adaptation have considered intra-saccadic target steps as learning signals. In the present study, the intra-saccadic target step of the McLaughlin paradigm of saccadic adaptation was replaced by target movement, and a post-saccadic pursuit of the target. We found that saccadic adaptation occurred in this situation, a further indication of an interaction of the saccadic system and the pursuit system with the aim of optimized eye movements.

  16. Saccadic adaptation to moving targets. (United States)

    Havermann, Katharina; Volcic, Robert; Lappe, Markus


    Saccades are so called ballistic movements which are executed without online visual feedback. After each saccade the saccadic motor plan is modified in response to post-saccadic feedback with the mechanism of saccadic adaptation. The post-saccadic feedback is provided by the retinal position of the target after the saccade. If the target moves after the saccade, gaze may follow the moving target. In that case, the eyes are controlled by the pursuit system, a system that controls smooth eye movements. Although these two systems have in the past been considered as mostly independent, recent lines of research point towards many interactions between them. We were interested in the question if saccade amplitude adaptation is induced when the target moves smoothly after the saccade. Prior studies of saccadic adaptation have considered intra-saccadic target steps as learning signals. In the present study, the intra-saccadic target step of the McLaughlin paradigm of saccadic adaptation was replaced by target movement, and a post-saccadic pursuit of the target. We found that saccadic adaptation occurred in this situation, a further indication of an interaction of the saccadic system and the pursuit system with the aim of optimized eye movements.

  17. Target recognition by wavelet transform

    CERN Document Server

    Li Zheng Dong; He Wu Liang; Pei Chun Lan; Peng Wen; SongChen; Zheng Xiao Dong


    Wavelet transform has an important character of multi-resolution power, which presents pyramid structure, and this character coincides the way by which people distinguish object from coarse to fineness and from large to tiny. In addition to it, wavelet transform benefits to reducing image noise, simplifying calculation, and embodying target image characteristic point. A method of target recognition by wavelet transform is provided

  18. ISOLDE target zone control room

    CERN Multimedia


    Operating the ISOLDE target handling robots from the dedicated control room in building 197. Monitors showing the movements of the robots (GPS in this case) in the target zone. The footage shows the actual operation by the operator as well as the different equipment such as camera electronics, camera motor controls, camera monitors and Kuka robot controls touch panel.

  19. Mono- and Dinuclear Transition Metal Complexes of the Hexadentate Ligand Tris(4-tert-butyl-2-mercaptobenzyl)-1,4,7-triazacyclononane (L). (United States)

    Beissel, Thomas; Glaser, Thorsten; Kesting, Frank; Wieghardt, Karl; Nuber, Bernhard


    The hexadentate, pendant arm macrocycle 1,4,7-tris(4-tert-butyl-2-mercaptobenzyl)-1,4,7-triazacyclononane (H(3)L) has been synthesized and isolated as its trihydrochloride, H(3)L.3HCl, or sodium salt, Na(3)L, and its coordination chemistry with first-row transition metals has been studied. Mononuclear complexes of the type [LM(III)] (M = Ga (1), In (2), V (3), Cr (4), Mn (5), Fe,Co (6)) have been isolated as have the one-electron-oxidized forms [LM]PF(6) (M = V(IV) (3a), Mn(IV) (5a)). The crystal structure of 6 has been determined by single-crystal X-ray crystallography. Complex 6 crystallizes in the orthorhombic space group Iba2, with cell constants a = 14.206(8) Å, b = 22.53(1) Å, c = 26.07(1) Å, V = 8344.0(3) Å(3), and Z = 8. The cobalt(III) ion is in a distorted octahedral fac-N(3)S(3) donor set. The reaction of L with divalent metal chlorides in a 1:2 ratio in methanol affords the homodinuclear complexes [LM(II)(2)Cl] (M = Mn (7), Co (8), Ni (9), Zn (10), Cd (11)) where one metal is six- (N(3)MS(3)) and the other is four-coordinate (S(3)MCl); the two polyhedra are linked by three &mgr;(2)-thiolato bridges. Heterodinuclear complexes of the type [LM(1)M(2)Cl] have been obtained from [LM(2)Cl] species by abstraction of the four-coordinate metal ion and replacement by a different metal ion. The complexes [LZn(II)M(II)Cl] (M = Fe (12), Co (13), Ni (14)), [LNi(II)M(II)Cl] (M = Co (15), Zn (16)), and [LMn(II)M(II)Cl] (M = Fe (17), Co (18), Ni (19), Zn (20), Cd (21), Hg (22)) have been isolated as solid materials. The crystal structure of 14 has been determined by X-ray crystallography. Complex 14 crystallizes in the orthorhombic space group P2(1)2(1)2(1), with cell constants a = 15.45(1) Å, b = 17.77(1) Å, c = 17.58(1) Å, V = 4826.5(4) Å(3), and Z = 4. The linkage isomers 14 and 16 show characteristic electronic spectra for octahedrally and tetrahedrally coordinated Ni(II), respectively. The electronic structures of new complexes have been investigated by UV

  20. Sluggish Hadean geodynamics: Evidence from coupled 146,147Sm-142,143Nd systematics in Eoarchean supracrustal rocks of the Inukjuak domain (Québec) (United States)

    Caro, G.; Morino, P.; Mojzsis, S. J.; Cates, N. L.; Bleeker, W.


    The discovery of deficits in 142Nd/144Nd in mafic rocks of the Nuvvuagittuq supracrustal belt (NSB) has triggered a debate about the possible preservation of Hadean (pre-3.85 Ga) crustal remnants in the little-known but areally extensive Innuksuac complex (3.6-3.8 Ga, Inukjuak domain, Northeast Superior Province, Canada). Geochronological investigations in the NSB, however, are hampered by the poor preservation and highly disturbed isotopic record of various mafic (amphibolite) lithologies that host the 142Nd anomalies. Here we present 146Sm-142Nd and 147Sm-143Nd data for rocks of extrusive magmatic and sedimentary protoliths from the Ukaliq supracrustal belt, a newly discovered volcano-sedimentary enclave enclosed in granitoid gneisses of the Inukjuak domain. Our study also includes the first 146Sm-142Nd data for quartz-magnetite rocks (banded iron-formation; BIF) of the NSB and the Eoarchean Isua supracrustal belt (ISB) in southern West Greenland. We show that Ukaliq amphibolites carry variably negative 142Nd anomalies, ranging from 0 to -10 ppm, which are positively correlated with their Sm/Nd ratio. If considered as an isochron relationship, the 146Sm-142Nd array yields an apparent Hadean emplacement age of 4215-76+50 Ma. The negative 142Nd anomalies, however, appear to be mainly restricted to amphibolites with boninitic affinities, likely reflecting inheritance from an enriched mantle source. In contrast, tholeiitic and ultramafic lavas have normal μ142Nd regardless of their Sm/Nd ratio. Furthermore, BIF from Ukaliq and Nuvvuagittuq lack the negative 142Nd anomalies that should have been produced by in situ decay of 146Sm had these sediments been deposited prior to ca. 4.1 Ga. Instead, they exhibit μ142Nd identical to that measured in Isua BIF. Collectively, our results suggest that the 146Sm-142Nd array characterizing mafic lithologies of Ukaliq and Nuvvuagittuq is an inherited signature with doubtful chronological significance. We interpret the volcanic

  1. A nucleolin-targeted multimodal nanoparticle imaging probe for tracking cancer cells using an aptamer. (United States)

    Hwang, Do Won; Ko, Hae Young; Lee, Jung Hwan; Kang, Hyungu; Ryu, Sung Ho; Song, In Chan; Lee, Dong Soo; Kim, Soonhag


    The recent advances in molecular imaging techniques, using cancer-targeting nanoparticle probes, provide noninvasive tracking information on cancer cells in living subjects. Here, we report a multimodal cancer-targeted imaging system capable of concurrent fluorescence imaging, radionuclide imaging, and MRI in vivo. A cobalt-ferrite nanoparticle surrounded by fluorescent rhodamine (designated MF) within a silica shell matrix was synthesized with the AS1411 aptamer (MF-AS1411) that targets nucleolin (a cellular membrane protein highly expressed in cancer) using N-(3-dimethylaminopropyl)-N-ethylcarbodiimide (EDC). This purified MF-AS1411 particle was bound with 2-(p-isothio-cyanatobenzyl)-1,4,7-triazacyclonane-1,4,7-triacetic acid (p-SCN-bn-NOTA) chelating agent and further labeled with (67)Ga-citrate (MFR-AS1411). The shape and size distribution of MFR-AS1411 were characterized by transmission electron microscope (TEM). The cellular distribution of the nucleolin protein using the MFR-AS1411 nanoparticle was detected by fluorescence confocal microscopy. Phantom MR images were obtained as the concentration of MFR-AS1411 increased, using a 1.5-T MRI scanner. In vivo (67)Ga radionuclide imaging and MRI were performed using a gamma-camera and a 1.5-T MR imager, respectively. TEM imaging revealed MF and MFR-AS1411 to be spheric and well dispersed. The purified MFR-AS1411 nanoparticle showed specific fluorescence signals in nucleolin-expressing C6 cells, compared with MFR-AS1411 mutant (MFR-AS1411mt)-treated C6 cells. The rhodamine fluorescence intensity and (67)Ga activity of MFR-AS1411 were enhanced in a dose-dependent manner as the concentration of MFR-AS1411 was increased. The (67)Ga radionuclide was detected in both thighs of the mice injected with MFR-AS1411, whereas the MFR-AS1411 mutant (MFR-AS1411mt) administration revealed rapid clearance via the bloodstream, demonstrating that MFR-AS1411 specifically targeted cancer cells. Bioluminescence images in the C6 cells

  2. Targeted marketing and public health. (United States)

    Grier, Sonya A; Kumanyika, Shiriki


    Targeted marketing techniques, which identify consumers who share common needs or characteristics and position products or services to appeal to and reach these consumers, are now the core of all marketing and facilitate its effectiveness. However, targeted marketing, particularly of products with proven or potential adverse effects (e.g., tobacco, alcohol, entertainment violence, or unhealthful foods) to consumer segments defined as vulnerable raises complex concerns for public health. It is critical that practitioners, academics, and policy makers in marketing, public health, and other fields recognize and understand targeted marketing as a specific contextual influence on the health of children and adolescents and, for different reasons, ethnic minority populations and other populations who may benefit from public health protections. For beneficial products, such understanding can foster more socially productive targeting. For potentially harmful products, understanding the nature and scope of targeted marketing influences will support identification and implementation of corrective policies.

  3. Oxide fiber targets at ISOLDE

    DEFF Research Database (Denmark)

    Köster, U.; Bergmann, U.C.; Carminati, D.


    Many elements are rapidly released from oxide matrices. Some oxide powder targets show a fast sintering, thus losing their favorable release characteristics. Loosely packed oxide fiber targets are less critical since they may maintain their open structure even when starting to fuse together at some...... contact points. The experience with various oxide fiber targets (titania, zirconia, ceria and thoria) used in the last years at ISOLDE is reviewed. For short-lived isotopes of Cu, Ga and Xe the zirconia and ceria targets respectively provided significantly higher yields than any other target (metal foils......, oxide powders, etc.) tested before. Titania fibers, which were not commercially available, were produced in a relic process by impregnation of a rayon felt in a titanium chloride solution and subsequent calcination by heating the dried felt in air. Thoria fibers were obtained either by the same process...

  4. The Bering Target Tracking Instrumentation

    DEFF Research Database (Denmark)

    Denver, Troelz; Jørgensen, John Leif; Betto, Maurizio


    The key science instrument on the Bering satellite mission is a relative small telescope with an entrance aperture of 300 mm and a focal length between 500 and 1000 mm. The detection of potential targets is performed by one of the target scanning advanced stellar compasses (ASCs). This procedure...... results in a simple prioritized list of right ascension, declination, proper motion and intensity of each prospective target. The telescope itself has a dedicated ASC Camera Head Unit (CHU) mounted on the secondary mirror, largely co-aligned with the telescope. This CHU accurately determines the telescope......'s pointing direction. To achieve fast tracking over a large solid angle, the telescope pointing is achieved by means of a folding mirror in the optical pathway. When a prospective target approaches the telescope FOV, the ASC on the secondary will guide the folding mirror into position such that the target...

  5. High speed cryogenic monodisperse targets (United States)

    Boukharov, A.; Vishnevkii, E.


    The basic possibility of creation of high speed cryogenic monodisperse targets is shown. According to calculations at input of thin liquid cryogenic jets with a velocity of bigger 100 m/s in vacuum the jets don’t manage to freeze at distance to 1 mm and can be broken into monodisperse drops. Drops due to evaporation are cooled and become granules. High speed cryogenic monodisperse targets have the following advantages: direct input in vacuum (there is no need for a chamber of a triple point chamber and sluices), it is possible to use the equipment of a cluster target, it is possible to receive targets with a diameter of D 100m/s), exact synchronization of the target hitting moment in a beam with the moment of sensors turning on.

  6. Sex differences in the photoperiodic regulation of RF-Amide related peptide (RFRP) and its receptor GPR147 in the syrian hamster

    DEFF Research Database (Denmark)

    Henningsen, Jo B; Poirel, Vincent-Joseph; Mikkelsen, Jens D


    RF-(Arg-Phe) related peptides (RFRP-1 and -3) are considered to play a role in the seasonal regulation of reproduction; however, the effect of the peptides depends on species and gender. This study aimed at comparing the RFRP system in male and female Syrian hamsters over long and short photoperi......RF-(Arg-Phe) related peptides (RFRP-1 and -3) are considered to play a role in the seasonal regulation of reproduction; however, the effect of the peptides depends on species and gender. This study aimed at comparing the RFRP system in male and female Syrian hamsters over long and short...... photoperiods to investigate the neuroanatomical basis of these differential effects. The neuroanatomical distribution of RFRP neurons and fibers, revealed using an antiserum recognizing RFRP-1 and -3, as well as GPR147 mRNA, are similar in male and female Syrian hamsters. RFRP neurons are mainly found...... in the anteroventral-periventricular nucleus is higher only in females adjusted to a short photoperiod. Our results suggest that the RFRP system, which is strongly regulated by photoperiod in both male and female Syrian hamsters, is particularly important in females, with a distinct role in the anteroventral...

  7. Measurement of keV-neutron capture cross sections and capture gamma-ray spectra of {sup 147,148,149,150,152,154}Sm

    Energy Technology Data Exchange (ETDEWEB)

    Duamet, B.; Igashira, Masayuki; Mizumachi, Mari; Mizuno, Satoshi; Hori, Jun-ichi; Masuda, Koji; Ohsaki, Toshiro [Research Laboratory for Nuclear Reactors, Tokyo Institute of Technology, Tokyo (Japan)


    The neutron capture cross sections and capture {gamma}-ray spectra of {sup 147,148,149,150,152,154}Sm were measured in the neutron energy region of 10 to 90 keV and at 550 keV. A neutron time-of-flight method was adopted with a 1.5-ns pulsed neutron source by the {sup 7}Li(p, n){sup 7}Be reaction and with a large anti-Compton NaI(Tl) {gamma}-ray spectrometer. A pulse-height weighting technique was applied to observed capture {gamma}-ray pulse-height spectra to derive capture yields. The capture cross sections were obtained with the error of about 5% by using the standard capture cross sections of {sup 197}Au. The present results were compared with the evaluated values of JENDL-3.2 and previous measurements. The capture {gamma}-ray spectra were obtained by unfolding the observed capture {gamma}-ray pulse-height spectra. An anomalous shoulder was cleary observed around 3 MeV in the {gamma}-ray spectra of {sup 150,152,154}Sm, and the energy position of the shoulder was consistent with the systematics obtained in our previous work. (author)

  8. Dinuclear 1,4,7-triazacyclononane (tacn) complexes of cobalt(III) with amido and tacn bridges. Synthesis, characterization and reversible acid-accelerated bridge cleavage

    DEFF Research Database (Denmark)

    Andersen, Peter; Glerup, Jørgen; Gumm, Andreas


    Amido-bridged dinuclear cobalt(III) complexes with 1,4,7-triazacyclononane (tacn) were synthesized from [Co(tacn)(O3SCF3)3] by treatment with potassium amide in liquid ammonia at 100 degrees C. Two isomeric triply bridged complexes, [(tacn)Co(mu-NH2)3Co(tacn)]3+ and [(tacn)Co(mu-NH2)2[mu......-tacn(-H)]Co(NH3)]3+, were isolated as perchlorates, and the crystal structure of the perrhenate of the latter complex was determined by X-ray diffraction. In this compound a nitrogen atom (deprotonated) from one of the tacn ligands forms a third bridge together with two amido bridges. In 1.0 M (Na,H)ClO4 ([H+] 0......)]4+. An isolated perchlorate of this complex appeared to be the salt of the trans-ammineaqua isomer as determined by X-ray diffraction. Equilibration from both sides fits the first-order rate constant dependence k(obs)=6.2(3) x 10(-5)[H+] + 2.1(2) x 10(-5)(s(-1)) at 40 degrees C. Prolonged treatment of the two...


    Energy Technology Data Exchange (ETDEWEB)

    Van Weeren, R. J.; Jones, C.; Forman, W. R. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Intema, H. T. [National Radio Astronomy Observatory, 1003 Lopezville Road, Socorro, NM 87801-0387 (United States); Lal, D. V. [National Centre for Radio Astrophysics, TIFR, Pune University Campus, Post Bag 3, Pune 411 007 (India); Bonafede, A.; Brüggen, M.; De Gasperin, F. [Hamburger Sternwarte, Gojenbergsweg 112, D-21029 Hamburg (Germany); Röttgering, H. J. A.; Stroe, A. [Leiden Observatory, Leiden University, P.O. Box 9513, NL-2300 RA Leiden (Netherlands); Hoeft, M. [Thüringer Landessternwarte Tautenburg, Sternwarte 5, D-07778, Tautenburg (Germany); Nuza, S. E., E-mail: [Leibniz-Institut für Astrophysik Potsdam (AIP), An der Sternwarte 16, D-14482 Potsdam (Germany)


    Recent X-ray and Sunyaev-Zel'dovich (SZ) observations have dramatically increased the number of known distant galaxy clusters. In some merging, low-redshift (z < 0.4) clusters, centrally located, diffuse, extended radio emission (radio halos) has been found. Using the Giant Metrewave Radio Telescope (GMRT), we report the detection of diffuse radio emission in the binary-merging cluster PLCK G147.3–16.6 located at z = 0.65. We classify the emission as a giant radio halo due to its large physical extent of about 0.9 Mpc and its low-surface brightness. We measure an integrated flux density of 7.3 ± 1.1 mJy at 610 MHz for the radio halo, resulting in a 1.4 GHz radio power of 5.1 × 10{sup 24} W Hz{sup –1}. The radio halo power is consistent with that expected from the known correlation between X-ray luminosity or the cluster integrated SZ signal and radio power. Our observations also suggest that more of these distant radio halos could be discovered with the GMRT.

  10. A New Mechanism of Vitamin C Effects on A/FM/1/47(H1N1 Virus-Induced Pneumonia in Restraint-Stressed Mice

    Directory of Open Access Journals (Sweden)

    Ying Cai


    Full Text Available It is well known that vitamin C could protect against influenza infection, but little is known about the mechanisms. This study aimed to investigate the influence and possible mechanisms of vitamin C on pneumonia induced by influenza virus in stressed mice. Results showed that restraint stress significantly increased the mortality and the severity of pneumonia in mice caused by A/FM/1/47(H1N1 virus infection, which was attenuated by oral administration of vitamin C (125 and 250 mg/kg. Moreover, vitamin C administration significantly decreased expression of susceptibility genes, including mitochondrial antiviral signaling (MAVS and interferon regulatory factor 3 (IRF3, and increased expression of NF-κB. These work in conjunction to induce type I interferons (IFNs and elicit innate antiviral response as key factors in RIG-I-mediated signal transduction pathway. The above effects of vitamin C were further found to relate with inhibition of excess CORT synthesis by regulating steroid hydroxylating enzymes in adrenal gland. In conclusion, the protective effects of vitamin C on influenza virus-caused pneumonia might be related to its inhibition of CORT synthesis, which reduces the susceptibility to influenza viral infection in restraint-stressed mice. These findings provide a new mechanism for the effects of vitamin C on influenza virus-induced pneumonia in restraint-stressed mice.

  11. Psychotic spectrum symptoms across the lifespan are related to lifetime suicidality among 147 patients with bipolar I or major depressive disorder. (United States)

    Gesi, Camilla; Carmassi, Claudia; Miniati, Mario; Benvenuti, Antonella; Massimetti, Gabriele; Dell'Osso, Liliana


    Conflicting evidence exists about the relationship between psychotic symptoms and suicidality in mood disorders. We aimed to investigate the lifetime suicidality and its relationship with dimensions of the psychotic spectrum over the lifespan among subjects with bipolar I (BD I) or major depressive disorder (MDD). 147 Consecutive out- and inpatients with BD I or MDD presenting for treatment at 11 Italian Departments of Psychiatry were administered the Structured Clinical Interview for DSM-IV Axis I Disorders, the Structured Clinical Interview for the Psychotic Spectrum (SCI-PSY, lifetime version) and the Mood Spectrum Self-Report (MOODS-SR, lifetime version). Subjects with psychotic features did not differ from those without for MOODS-SR suicidality score. Controlling for age, gender and diagnosis (MDD/BD I), the SCI-PSY total score (p = .007) and Paranoid (p = .042), Schizoid (p = .007) and Interpersonal Sensitivity (p Schizoid symptoms, show a significant relationship with lifetime suicidality. Our findings highlight the potential usefulness of a spectrum approach in the assessment of psychotic symptoms and suicide risk among subjects with BD I or MDD.

  12. (44g)Sc production using a water target on a 13MeV cyclotron. (United States)

    Hoehr, Cornelia; Oehlke, Elisabeth; Benard, Francois; Lee, Chris Jaeil; Hou, Xinchi; Badesso, Brian; Ferguson, Simon; Miao, Qing; Yang, Hua; Buckley, Ken; Hanemaayer, Victoire; Zeisler, Stefan; Ruth, Thomas; Celler, Anna; Schaffer, Paul


    Access to promising radiometals as isotopes for novel molecular imaging agents requires that they are routinely available and inexpensive to obtain. Proximity to a cyclotron center outfitted with solid target hardware, or to an isotope generator for the metal of interest is necessary, both of which can introduce significant hurdles in development of less common isotopes. Herein, we describe the production of ⁴⁴Sc (t1/2=3.97 h, Eavg,β⁺=1.47MeV, branching ratio=94.27%) in a solution target and an automated loading system which allows a quick turn-around between different radiometallic isotopes and therefore greatly improves their availability for tracer development. Experimental yields are compared to theoretical calculations. Solutions containing a high concentration (1.44-1.55g/mL) of natural-abundance calcium nitrate tetrahydrate (Ca(NO₃)2·4 H₂O) were irradiated on a 13MeV proton-beam cyclotron using a standard liquid target. (44g)Sc was produced via the ⁴⁴Ca(p,n)(44g)Sc reaction. (44g)Sc was produced for the first time in a solution target with yields sufficient for early radiochemical studies. Saturation yields of up to 4.6 ± 0.3 MBq/μA were achieved using 7.6 ± 0.3 μA proton beams for 60.0 ± 0.2 minutes (number of runs n=3). Experimental data and calculation results are in fair agreement. Scandium was isolated from the target mixture via solid-phase extraction with 88 ± 6% (n=5) efficiency and successfully used for radiolabelling experiments. The demonstration of the production of ⁴⁴Sc in a liquid target greatly improves its availability for tracer development. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Tracking Target and Spiral Waves

    DEFF Research Database (Denmark)

    Jensen, Flemming G.; Sporring, Jon; Nielsen, Mads


    A new algorithm for analyzing the evolution of patterns of spiral and target waves in large aspect ratio chemical systems is introduced. The algorithm does not depend on finding the spiral tip but locates the center of the pattern by a new concept, called the spiral focus, which is defined...... by the evolutes of the actual spiral or target wave. With the use of Gaussian smoothing, a robust method is developed that permits the identification of targets and spirals foci independently of the wave profile. Examples of an analysis of long image sequences from experiments with the Belousov...

  14. Volume-Targeted Ventilation in the Neonate: Benchmarking Ventilators on an Active Lung Model. (United States)

    Krieger, Tobias J; Wald, Martin


    Mechanically ventilated neonates have been observed to receive substantially different ventilation after switching ventilator models, despite identical ventilator settings. This study aims at establishing the range of output variability among 10 neonatal ventilators under various breathing conditions. Relative benchmarking test of 10 neonatal ventilators on an active neonatal lung model. Neonatal ICU. Ten current neonatal ventilators. Ventilators were set identically to flow-triggered, synchronized, volume-targeted, pressure-controlled, continuous mandatory ventilation and connected to a neonatal lung model. The latter was configured to simulate three patients (500, 1,500, and 3,500 g) in three breathing modes each (passive breathing, constant active breathing, and variable active breathing). Averaged across all weight conditions, the included ventilators delivered between 86% and 110% of the target tidal volume in the passive mode, between 88% and 126% during constant active breathing, and between 86% and 120% under variable active breathing. The largest relative deviation occurred during the 500 g constant active condition, where the highest output machine produced 147% of the tidal volume of the lowest output machine. All machines deviate significantly in volume output and ventilation regulation. These differences depend on ventilation type, respiratory force, and patient behavior, preventing the creation of a simple conversion table between ventilator models. Universal neonatal tidal volume targets for mechanical ventilation cannot be transferred from one ventilator to another without considering necessary adjustments.

  15. Targeted intraoperative radiotherapy in oncology

    CERN Document Server

    Keshtgar, Mohammed; Wenz, Frederik


    Targeted intraoperative radiotherapy is a major advance in the management of cancer patients. With an emphasis on practical aspects, this book offers an ideal introduction to this innovative  technology for clinicians.

  16. Hyperspectral-Augmented Target Tracking

    National Research Council Canada - National Science Library

    Soliman, Neil A


    ... air with the capability to seek, monitor, and destroy mobile terrorist targets in hostile territory. One such capability recognizes and persistently tracks multiple moving vehicles in complex, highly ambiguous urban environments...

  17. After treat-to-target

    DEFF Research Database (Denmark)

    Wakefield, Richard J; D'Agostino, Maria Antonietta; Naredo, Esperanza


    have recently formed a research network - the Targeted Ultrasound Initiative (TUI) group. The statement proposes that targeting therapy to PD activity provides superior outcomes compared with treating to clinical targets alone and introduces the rationale for a new randomised trial using targeted...... defined by clinical remission criteria (disease activity score, simplified disease activity index, etc) does not always equate to the complete absence of inflammation as measured by new sensitive imaging techniques such as ultrasound (US) . There is evidence that imaging synovitis is frequently found...... in these patients and associated with adverse clinical and functional outcomes. This article reviews the data regarding remission, ultrasound imaging and outcomes in patients with RA to provide the background to a consensus statement from an international collaboration of ultrasonographers and rheumatologists who...

  18. After treat-to-target

    DEFF Research Database (Denmark)

    Wakefield, Richard J; D'Agostino, Maria Antonietta; Naredo, Esperanza


    have recently formed a research network--the Targeted Ultrasound Initiative (TUI) group. The statement proposes that targeting therapy to PD activity provides superior outcomes compared with treating to clinical targets alone and introduces the rationale for a new randomised trial using targeted...... defined by clinical remission criteria (disease activity score, simplified disease activity index, etc) does not always equate to the complete absence of inflammation as measured by new sensitive imaging techniques such as ultrasound (US) . There is evidence that imaging synovitis is frequently found...... in these patients and associated with adverse clinical and functional outcomes. This article reviews the data regarding remission, ultrasound imaging and outcomes in patients with RA to provide the background to a consensus statement from an international collaboration of ultrasonographers and rheumatologists who...

  19. Targeted therapy for pediatric glioma

    NARCIS (Netherlands)

    Olow, A.K.


    This thesis assesses molecular underpinnings of responses to promising targeted agents for pediatric tumors of Central Nervous System (CNS), incorporating preclinical testing of novel and translatable combination therapies to define the best therapy for each tumor cell specific molecular aberration.

  20. Physics of Automatic Target Recognition

    CERN Document Server

    Sadjadi, Firooz


    Physics of Automatic Target Recognition addresses the fundamental physical bases of sensing, and information extraction in the state-of-the art automatic target recognition field. It explores both passive and active multispectral sensing, polarimetric diversity, complex signature exploitation, sensor and processing adaptation, transformation of electromagnetic and acoustic waves in their interactions with targets, background clutter, transmission media, and sensing elements. The general inverse scattering, and advanced signal processing techniques and scientific evaluation methodologies being used in this multi disciplinary field will be part of this exposition. The issues of modeling of target signatures in various spectral modalities, LADAR, IR, SAR, high resolution radar, acoustic, seismic, visible, hyperspectral, in diverse geometric aspects will be addressed. The methods for signal processing and classification will cover concepts such as sensor adaptive and artificial neural networks, time reversal filt...

  1. National Ignition Facility Target Chamber

    Energy Technology Data Exchange (ETDEWEB)

    Wavrik, R W; Cox, J R; Fleming, P J


    On June 11, 1999 the Department of Energy dedicated the single largest piece of the National Ignition Facility (NIF) at Lawrence Livermore National Laboratory (LLNL) in Livermore, California. The ten (10) meter diameter aluminum target high vacuum chamber will serve as the working end of the largest laser in the world. The output of 192 laser beams will converge at the precise center of the chamber. The laser beams will enter the chamber in two by two arrays to illuminate 10 millimeter long gold cylinders called hohlraums enclosing 2 millimeter capsule containing deuterium, tritium and isotopes of hydrogen. The two isotopes will fuse, thereby creating temperatures and pressures resembling those found only inside stars and in detonated nuclear weapons, but on a minute scale. The NIF Project will serve as an essential facility to insure safety and reliability of our nation's nuclear arsenal as well as demonstrating inertial fusion's contribution to creating electrical power. The paper will discuss the requirements that had to be addressed during the design, fabrication and testing of the target chamber. A team from Sandia National Laboratories (SNL) and LLNL with input from industry performed the configuration and basic design of the target chamber. The method of fabrication and construction of the aluminum target chamber was devised by Pitt-Des Moines, Inc. (PDM). PDM also participated in the design of the chamber in areas such as the Target Chamber Realignment and Adjustment System, which would allow realignment of the sphere laser beams in the event of earth settlement or movement from a seismic event. During the fabrication of the target chamber the sphericity tolerances had to be addressed for the individual plates. Procedures were developed for forming, edge preparation and welding of individual plates. Construction plans were developed to allow the field construction of the target chamber to occur parallel to other NIF construction activities. This

  2. Theoretical aspects of inflation targeting

    Directory of Open Access Journals (Sweden)

    Obradović Jelena


    Full Text Available Inflation targeting is one of the possible strategies used by central banks during conducting monetary policy. The basic characteristics, advantages and disadvantages of inflation targeting will be presented in this paper. The focus is on the the presentation and interpretation of the understanding of this strategy from the perspective of monetarist and Keynesian theory, the theory of rational expectations, and methodological analysis of the strategy in light of the game theory using payoff matrix.

  3. Targeted immunotherapy in Hodgkin lymphoma

    DEFF Research Database (Denmark)

    Hutchings, Martin


    In this issue of Blood, Rothe et al introduce a new principle of targeted Hodgkin lymphoma (HL) immunotherapy in their report from a phase 1 study of the bispecific anti-CD30/CD16A antibody construct AFM13.......In this issue of Blood, Rothe et al introduce a new principle of targeted Hodgkin lymphoma (HL) immunotherapy in their report from a phase 1 study of the bispecific anti-CD30/CD16A antibody construct AFM13....

  4. Targeting the nuclear RNA exosome

    DEFF Research Database (Denmark)

    Meola, Nicola; Jensen, Torben Heick


    Centrally positioned in nuclear RNA metabolism, the exosome deals with virtually all transcript types. This 3'-5' exo- and endo-nucleolytic degradation machine is guided to its RNA targets by adaptor proteins that enable substrate recognition. Recently, the discovery of the 'Poly(A) tail exosome...... targeting (PAXT)' connection as an exosome adaptor to human nuclear polyadenylated transcripts has relighted the interest of poly(A) binding proteins (PABPs) in both RNA productive and destructive processes....

  5. Radiolabelled {sup 153}Sm-chelates of glycoconjugates: multivalence and topology effects on the targeting of the asialoglycoprotein receptor

    Energy Technology Data Exchange (ETDEWEB)

    Torres, S. [Centro de Quimica, Campus de Gualtar, Univ. do Minho, Braga (Portugal); Martins, J.A.; Andre, J.P.; Neves, M. [Inst. Tecnologico e Nuclear, Sacavem (Portugal); Santos, A.C.; Prata, M.I.M. [Servico de Biofisica, IBILI, Univ. de Coimbra (Portugal); Geraldes, C.F.G.C. [Dept. de Bioquimica, Centro de Espectroscopia RMN e Centro de Neurociencias e Biologia Celular, Univ. de Coimbra (Portugal)


    In this paper we report and discuss the biodistribution studies with Wistar rats of a series of {sup 153}Sm(III)-glycoconjugates, based on DO3A and DO2A(cis) scaffolds (DO3A = 1,4,7-tris(carboxymethyl)-1,4,7,10-tetraazacyclododecane; DO2A(cis) = 1,4-bis(carboxymethyl)-1,4,7,10-tetraazacyclododecane). The effects of changing the sugar type (galactose, lactose and glucose), valency (mono and divalent) and topology on the targeting ability of the liver asialoglycoprotein receptor (ASGPR) are evaluated. Divalent glycoconjugates with different topologies were generated by a pendant glycodendrimeric (generation 1) architecture on a DO3A scaffold and by a linear DO2A(cis)-bis derivative. The results show that the galactose conjugates are more target efficient than the lactose analogues, while the glucose conjugates have no liver targeting ability. Divalent galactose conjugates are more efficiently targeted to the liver than the monovalent ones, while the dendrimeric topology of DO3A-Gal{sub 2} has higher targeting efficiency than that of the DO2A(cis)-Gal{sub 2}. (orig.)

  6. Comparative study for 147 Candida spp. identification and echinocandins susceptibility in isolates obtained from blood cultures in 15 hospitals, Medellin, Colombia. (United States)

    Berrio, Indira; Maldonado, Natalia; De Bedout, Catalina; Arango, Karen; Cano, Luz Elena; Valencia, Yorlady; Jiménez-Ortigosa, Cristina; Perlin, David S; Gómez, Beatriz L; Robledo, Carlos; Robledo, Jaime


    Invasive candidiasis has high impact on morbidity and mortality in hospitalized patients. Accurate and timely methods for identification of Candida species and determination of equinocandins susceptibility become a priority for laboratories of clinical microbiology. A study was performed to compare MALDI-TOF MS identification to sequencing of D1/D2 region of rRNA gene complex 28 subunit, in 147 isolates obtained from patients with candidemia. Susceptibility testing was performed by broth microdilution method and Etest ® . DNA sequencing of FKS1 and FKS2 genes was performed. In this study, the most common species were C. albicans (40.8%), followed by C. parapsilosis (23.1%) and C. tropicalis (17.0%). Overall agreement between the results of identification by MALDI-TOF MS and molecular identification was 99.3%. Anidulafungin and caspofungin susceptibility by broth microdilution method were 98% and 88.4%, respectively. Susceptibility to anidulafungin and caspofungin by Etest was 93.9% and 98.6%. Categorical agreement between Etest and broth microdilution method was 91.8% for anidulafungin and 89.8% for caspofungin; with lower agreements in C. parapsilosis for anidulafungin (76.5%) and C. glabrata for caspofungin (40.0%). No mutations related to resistance were found in FKS genes, although 54 isolates presented synonymous polymorphisms in the hot spots sequenced. MALDI TOF MS is a good alternative for routine identification of Candida isolates. DNA sequencing of FKS genes suggests that isolates analyzed are susceptible to echinocandins; alternatively, unknown resistance mechanisms or limitations related to antifungal susceptibility tests may explain the resistance found in few isolates. Copyright © 2017. Published by Elsevier Ltd.

  7. Role of Xpert MTB/RIF in differentiating tuberculosis from sarcoidosis in patients with mediastinal lymphadenopathy undergoing EBUS-TBNA: a study of 147 patients. (United States)

    Dhooria, Sahajal; Gupta, Nalini; Bal, Amanjit; Sehgal, Inderpaul Singh; Aggarwal, Ashutosh Nath; Sethi, Sunil; Behera, Digambar; Agarwal, Ritesh


    In patients with intrathoracic lymphadenopathy, differentiating tuberculosis from sarcoidosis is often difficult. We hypothesized that Xpert MTB/RIF assay, a semi-automated hemi-nested PCR would help in this regard. To evaluate the performance of Xpert MTB/RIF in the differential diagnosis of tuberculosis and sarcoidosis. This was a retrospective analysis of patients with intrathoracic lymphadenopathy who underwent endobronchial ultrasound (EBUS)-guided transbronchial needle aspiration (TBNA), and were diagnosed as either tuberculosis or sarcoidosis. The results of Xpert MTB/RIF assay, tuberculin skin test and endosonographic characteristics (heterogeneous echotexture and coagulation necrosis sign) of the lymph nodes were compared between the two groups. During the study period, 465 EBUS procedures were performed and a diagnosis of sarcoidosis (n=94) or tuberculosis (n=53) was made in 147 patients. Xpert MTB/RIF was positive in 26 (49.1%) and two (2.1%) patients with tuberculosis and sarcoidosis, respectively. The sensitivity, specificity, positive and negative predictive values of Xpert MTB/RIF in the diagnosis of tuberculosis were 49.1 %, 97.9%, 92.9% and 77.3%, respectively. The presence of any of the four features namely positive Xpert MTB/RIF, positive tuberculin skin test, heterogeneous echotexture of the lymph nodes, or the presence of endosonographic coagulation necrosis sign yielded a sensitivity and negative predictive value of 83.0% and 88.0%, respectively in the diagnosis of tuberculosis versus sarcoidosis. Xpert MTB/RIF has good specificity and positive predictive value in the diagnosis of tuberculosis, and is a useful investigation in separating tuberculosis from sarcoidosis.

  8. Variable Stars in Local Group Galaxies. III. And VII, NGC 147, and NGC 185: Insight into the Building Blocks of the M31 Halo (United States)

    Monelli, M.; Fiorentino, G.; Bernard, E. J.; Martínez-Vázquez, C. E.; Bono, G.; Gallart, C.; Dall’Ora, M.; Stetson, P. B.


    We present the discovery of 1568 RR Lyrae stars in three of the most luminous M31 satellites: And VII (573), NGC 147 (177), and NGC 185 (818). We use their properties to study the formation history of Local Group spiral haloes, and in particular, to infer about the nature of their possible building blocks by comparison with available data for RR Lyrae stars in the halo and in a sample of satellites of M31 and the Milky Way. We find that the brightest satellites and the halos of both galaxies host a number of High Amplitude Short Period (HASP) RR Lyrae variable stars, which are missing in the faintest satellites. HASP variable stars have been shown by Fiorentino et al. to be tracers of a population of stars as metal-rich as [Fe/H] ≃ ‑1.5 and older than ≃ 10 {Gyr}. This suggests that the metal-rich M31 and MW halo component, which manifests through the HASP phenomenon, comes from massive dwarf galaxy building blocks, as the low-mass dwarfs did not chemically enrich fast enough to produce them. All detected variable stars are new discoveries; in particular, this work presents the first detections of RR Lyrae stars in And VII. Moreover, a number of candidate Anomalous Cepheids, and binary and long-period variable stars have been detected. We provide pulsation properties (period, amplitude, mean magnitude), light curves, and time series photometry for all of the variable stars in the three galaxies. Based on observations made with the NASA/ESA Hubble Space Telescope, obtained at the Space Telescope Science Institute, which is operated by the Association of Universities for Research in Astronomy, Inc., under NASA contract NAS 5-26555. These observations are associated with programs #10430 and #11724.

  9. Phase I Trial of the Pan-PI3K Inhibitor Pilaralisib (SAR245408/XL147) in Patients with Chronic Lymphocytic Leukemia (CLL) or Relapsed/Refractory Lymphoma. (United States)

    Brown, Jennifer R; Davids, Matthew S; Rodon, Jordi; Abrisqueta, Pau; Kasar, Siddha N; Lager, Joanne; Jiang, Jason; Egile, Coumaran; Awan, Farrukh T


    This phase I expansion-cohort study evaluated the safety, pharmacokinetics, pharmacodynamics, and preliminary efficacy of the pan-PI3K inhibitor pilaralisib (SAR245408/XL147) in patients with chronic lymphocytic leukemia (CLL) or relapsed or refractory lymphoma. Patients were treated with the maximum tolerated dose of pilaralisib previously determined in patients with solid tumors (600 mg capsules once daily). Adverse events (AE) and response were evaluated. Plasma pharmacokinetics and pharmacodynamic effects on cytokines and chemokines were also assessed. Twenty-five patients were included in the study: 10 with CLL and 15 with lymphoma. The most frequent AEs of any grade were diarrhea (92.0%), pyrexia (52.0%), and fatigue (44.0%). The most frequent grade ≥3 AEs were neutropenia (32.0%), diarrhea (20.0%), and anemia (16.0%). Pilaralisib exposure on cycle 1 day 28 was similar to exposure in patients with solid tumors. In patients with CLL, pilaralisib significantly reduced plasma levels of several cytokines and chemokines involved in B-cell trafficking. Five patients (50.0%) with CLL and 3 patients (20.0%) with lymphoma had a partial response. Six patients (60.0%) with CLL had nodal shrinkage ≥50%. Overall, 14 patients (56.0%; 7 patients with CLL and 7 patients with lymphoma) had progression-free survival ≥6 months. Pilaralisib demonstrated an acceptable safety profile in patients with CLL and lymphoma, generally consistent with findings in patients with solid tumors. Single-agent pilaralisib showed preliminary clinical activity in patients with CLL and lymphoma, supporting further development. ©2015 American Association for Cancer Research.

  10. Okiyo 147-154.pmd

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    Moisture stress and aluminium toxicity in sorghum production can be overcome by breeding for tolerance. This study was set up to determine the response of sorghum (Sorghum bicolor L.) genotypes to post- anthesis drought and aluminium toxicity. Sorghum inbred P1 with stay green drought tolerance was crossed with P2, ...

  11. 147__Sale_Cassava1

    African Journals Online (AJOL)


    plywood, confectionery, feed and pharmaceutical sectors (Moyo, et al. 2004; Kaaya and Eboku, 2010). However, poor drying during processing or storage, especially during the rainy season, often results in contamination by fungi such as Aspergillus, Fusarium and Penicillium that produce mycotoxins. Aflatoxins are among ...

  12. The Bering Autonomous Target Detection

    DEFF Research Database (Denmark)

    Jørgensen, John Leif; Denver, Troelz; Betto, Maurizio


    An autonomous asteroid target detection and tracking method has been developed. The method features near omnidirectionality and focus on high speed operations and completeness of search of the near space rather than the traditional faint object search methods, employed presently at the larger...... telescopes. The method has proven robust in operation and is well suited for use onboard spacecraft. As development target for the method and the associated instrumentation the asteroid research mission Bering has been used. Onboard a spacecraft, the autonomous detection is centered around the fully...... autonomous star tracker the Advanced Stellar Compass (ASC). One feature of this instrument is that potential targets are registered directly in terms of date, right ascension, declination, and intensity, which greatly facilitates both tracking search and registering. Results from ground and inflight tests...

  13. Pharmacogenomics of GPCR Drug Targets

    DEFF Research Database (Denmark)

    Hauser, Alexander Sebastian; Chavali, Sreenivas; Masuho, Ikuo


    Natural genetic variation in the human genome is a cause of individual differences in responses to medications and is an underappreciated burden on public health. Although 108 G-protein-coupled receptors (GPCRs) are the targets of 475 (∼34%) Food and Drug Administration (FDA)-approved drugs...... and account for a global sales volume of over 180 billion US dollars annually, the prevalence of genetic variation among GPCRs targeted by drugs is unknown. By analyzing data from 68,496 individuals, we find that GPCRs targeted by drugs show genetic variation within functional regions such as drug......- and effector-binding sites in the human population. We experimentally show that certain variants of μ-opioid and Cholecystokinin-A receptors could lead to altered or adverse drug response. By analyzing UK National Health Service drug prescription and sales data, we suggest that characterizing GPCR variants...


    Directory of Open Access Journals (Sweden)

    Laurian Lungu


    Full Text Available This paper addresses the inflation targeting approach in three transition economies, namely Hungary, Poland and the Czech Republic with the use of Taylor rules as benchmarks. The three economies considered have been successful at achieving disinflation, but deviations of inflation from its target have been persistent in all cases. Except for the Czech Republic, deviations from the Taylor rule are large and persistent, with Hungary displaying the largest fluctuations. Polish interest rates have consistently exceeded those suggested by the Taylor rule and given the prevalence of high unemployment, these undershootings do not augur well for the stability of monetary policy. Finally, the behaviour of Czech interest rates can be remarkably captured by the simple Taylor rule proposed in this paper, suggesting that the Czech National Bank has been the most successful at stabilising inflation and output around their target levels.

  15. Targeting Angiogenesis in Childhood Sarcomas

    Directory of Open Access Journals (Sweden)

    Hemant K. Bid


    Full Text Available Angiogenesis and vasculogenesis constitute two processes in the formation of new blood vessels and are essential for progression of solid tumors. Consequently, targeting angiogenesis, and to a lesser extent vasculogenesis, has become a major focus in cancer drug development. Angiogenesis inhibitors are now being tested in pediatric populations whereas inhibitors of vasculogenesis are in an earlier stage of development. Despite the initial enthusiasm for targeting angiogenesis for treatment of cancer, clinical trials have shown only incremental increases in survival, and agents have been largely cytostatic rather than inducing tumor regressions. Consequently, the role of such therapeutic approaches in the context of curative intent for childhood sarcomas is less clear. Here we review the literature on blood vessel formation in sarcomas with a focus on pediatric sarcomas and developments in targeting angiogenesis for treatment of these rare cancers.

  16. Ribosome Assembly as Antimicrobial Target

    Directory of Open Access Journals (Sweden)

    Rainer Nikolay


    Full Text Available Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors.

  17. Progress with developing a target for magnetized target fusion

    Energy Technology Data Exchange (ETDEWEB)

    Wysocki, F.J.; Chrien, R.E.; Idzorek, G.; Oona, H.; Whiteson, D.O.; Kirkpatrick, R.C.; Lindemuth, I.R.; Sheehey, P.T.


    Magnetized Target Fusion (MTF) is an approach to fusion where a preheated and magnetized plasma is adiabatically compressed to fusion conditions. Successful MTF requires a suitable initial target plasma with an embedded magnetic field of at least 5 T in a closed-field-line topology, a density of roughly 10{sup 18} cm{sup {minus}3}, a temperature of at least 50 eV, and must be free of impurities which would raise radiation losses. Target plasma generation experiments are underway at Los Alamos National Laboratory using the Colt facility; a 0.25 MJ, 2--3 {micro}s rise-time capacitor bank. The goal of these experiments is to demonstrate plasma conditions meeting the minimum requirements for a MTF initial target plasma. In the first experiments, a Z-pinch is produced in a 2 cm radius by 2 cm high conducting wall using a static gas-fill of hydrogen or deuterium gas in the range of 0.5 to 2 torr. Thus far, the diagnostics include an array of 12 B-dot probes, framing camera, gated OMA visible spectrometer, time-resolved monochrometer, filtered silicon photodiodes, neutron yield, and plasma-density interferometer. These diagnostics show that a plasma is produced in the containment region that lasts roughly 10 to 20 {micro}s with a maximum plasma density exceeding 10{sup 18} cm{sup {minus}3}. The experimental design and data are presented.

  18. Targeted Therapies for Pancreatic Cancer

    Directory of Open Access Journals (Sweden)

    Idoroenyi Amanam


    Full Text Available Pancreatic cancer is the third leading cause of cancer related death and by 2030, it will be second only to lung cancer. We have seen tremendous advances in therapies for lung cancer as well as other solid tumors using a molecular targeted approach but our progress in treating pancreatic cancer has been incremental with median overall survival remaining less than one year. There is an urgent need for improved therapies with better efficacy and less toxicity. Small molecule inhibitors, monoclonal antibodies and immune modulatory therapies have been used. Here we review the progress that we have made with these targeted therapies.

  19. Harnessing off-target effects

    DEFF Research Database (Denmark)

    Saginc, Gaye; Voellmy, Franziska; Linding, Rune


    The 'off-targets' of a drug are often poorly characterized yet could be harnessed in the treatment of complex diseases. A recent study used a small-molecule screening in non-small-cell lung cancer to repurpose an FDA-approved ALK/IGF1R inhibitor and uncover its mechanism of action.......The 'off-targets' of a drug are often poorly characterized yet could be harnessed in the treatment of complex diseases. A recent study used a small-molecule screening in non-small-cell lung cancer to repurpose an FDA-approved ALK/IGF1R inhibitor and uncover its mechanism of action....

  20. The OPERA experiment Target Tracker

    CERN Document Server

    Adam, T; Borer, K.; Campagne, Jean-Eric; Con-Sen, N.; de La Taille, C.; Dick, N.; Dracos, M.; Gaudiot, G.; Goeltzenlichter, T.; Gornushkin, Y.; Grapton, J.-N.; Guyonnet, J.-L.; Hess, M.; Igersheim, R.; Janicsko Csathy, J.; Jollet, C.; Juget, F.; Kocher, H.; Krasnoperov, A.; Krumstein, Z.; Martin-Chassard, G.; Moser, U.; Nozdrin, A.; Olchevski, A.; Porokhovoi, S.; Raux, L.; Sadovski, A.; Schuler, J.; Schutz, H.-U.; Schwab, C.; Smolnikov, A.; Van Beek, G.; Vilain, P.; Walchli, T.; Wilquet, G.; Wurtz, J.


    The main task of the Target Tracker detector of the long baseline neutrino oscillation OPERA experiment is to locate in which of the target elementary constituents, the lead/emulsion bricks, the neutrino interactions have occurred and also to give calorimetric information about each event. The technology used consists in walls of two planes of plastic scintillator strips, one per transverse direction. Wavelength shifting fibres collect the light signal emitted by the scintillator strips and guide it to both ends where it is read by multi-anode photomultiplier tubes. All the elements used in the construction of this detector and its main characteristics are described.