
Sample records for samarium 144

  1. Solar nebula heterogeneity in p-process samarium and neodymium isotopes. (United States)

    Andreasen, Rasmus; Sharma, Mukul


    Bulk carbonaceous chondrites display a deficit of approximately 100 parts per million (ppm) in 144Sm with respect to other meteorites and terrestrial standards, leading to a decrease in their 142Nd/144Nd ratios by approximately 11 ppm. The data require that samarium and neodymium isotopes produced by the p process associated with photodisintegration reactions in supernovae were heterogeneously distributed in the solar nebula. Other samarium and neodymium isotopes produced by rapid neutron capture (r process) in supernovae and by slow neutron capture (s process) in red giants were homogeneously distributed. The supernovae sources supplying the p- and r-process nuclides to the solar nebula were thus disconnected or only weakly connected.

  2. Synthesis of Samarium Cobalt Nanoblades

    Energy Technology Data Exchange (ETDEWEB)

    Darren M. Steele


    As new portable particle acceleration technologies become feasible the need for small high performance permanent magnets becomes critical. With particle accelerating cavities of a few microns, the photonic crystal fiber (PCF) candidate demands magnets of comparable size. To address this need, samarium cobalt (SmCo) nanoblades were attempted to be synthesized using the polyol process. Since it is preferable to have blades of 1-2 {micro}m in length, key parameters affecting size and morphology including method of stirring, reaction temperature, reaction time and addition of hydroxide were examined. Nanoparticles consisting of 70-200 nm spherical clusters with a 3-5 nm polyvinylpyrrolidone (PVP) coating were synthesized at 285 C and found to be ferromagnetic. Nanoblades of 25nm in length were observed at the surface of the nanoclusters and appeared to suggest agglomeration was occurring even with PVP employed. Morphology and size were characterized using a transmission electron microscope (TEM). Powder X-Ray Diffraction (XRD) analysis was conducted to determine composition but no supportive evidence for any particular SmCo phase has yet been observed.

  3. Particle-Size-Induced Valence Changes in Samarium Clusters

    Energy Technology Data Exchange (ETDEWEB)

    Mason, M. G.; Lee, S. -T.; Apai, G.; Davis, R. F.; Shirley, D. A.; Franciosi, A.; Weaver, J. H.


    Samarium clusters exhibit mixed-valence behavior which is sensitive to particle size. XPS and UPS data show samarium to be primarily divalent (4f{sup 6} ) at small particle size. The trivalent state (4f{sup 5} ) becomes progressively more abundant with increasing s1ze, becoming the dominant state for the bulk metal. These results are interpreted using a model in which band narrowing, due to reduced surface coordination, is more dominant than surface tension effects in establishing the valence of small samarium clusters.

  4. Yellow-green electroluminescence of samarium complexes of 8-hydroxyquinoline

    Energy Technology Data Exchange (ETDEWEB)

    Behzad, Sara Karimi; Najafi, Ezzatollah [Department of Chemistry Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Amini, Mostafa M., E-mail: [Department of Chemistry Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Janghouri, Mohammad; Mohajerani, Ezeddin [Laser Research Institute Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Ng, Seik Weng [Department of Chemistry, University of Malaya, 50603 Kuala Lumpur (Malaysia)


    Four novel samarium complexes were prepared by reacting samarium(III) nitrate with 8-hydroxyquinoline, 2-methyl-8-hydroxyquinoline, and 1,10-phenanthroline and utilized as emitting materials in the electroluminescence device. All complexes were characterized by elemental analysis, infrared, UV–vis and {sup 1}H NMR spectroscopes and the molecular structure of a representative complex, [Sm{sub 2}(Me-HQ){sub 4}(NO{sub 3}){sub 6}] (1), was determined by single-crystal X-ray diffraction. Utilization of a π-conjugated (phenanthroline) ligand as a second ligand in the structure of the samarium complexes resulted in red shifts in both absorption and fluorescence spectra of complexes and moderately enhanced the photoluminescence intensity and the fluorescence quantum yield. The maximum emission peaks showed that a good correlation exists between the nature of the substituent group on the 8-hydroxyquinoline and the addition of the π-conjugated ligand in the structure of samarium complexes and emission wavelength. Devices with samarium(III) complexes with structure of ITO/PEDOT:PSS (90 nm)/PVK:PBD:Sm(III) complexes (75 nm)/Al (180 nm) were fabricated. In the electroluminescence (EL) spectra of the devices, a strong ligand-centered emission and narrow bands arising from the {sup 4}G{sub 5/2}→{sup 6}H{sub J} transitions (J=7/2, 9/2, and 11/2) of the samarium ion were observed for the complexes. The electroluminescent spectra of the samarium complexes were red-shifted as compared with the PVK:PBD blend. We believe that the electroluminescence performance of OLED devices based on samarium complexes relies on overlaps between the absorption of the samarium compounds and the emission of PVK:PBD. This revealed that it is possible to evaluate the electroluminescence performance of the samarium compounds-doped OLED devices based on the emission of PVK:PBD and the absorption of the dopants. - Highlights: • Four novel photoluminescence samarium complexes have been synthesized.

  5. Biodistribution of samarium-153-EDTMP in rats treated with docetaxel

    Energy Technology Data Exchange (ETDEWEB)

    Villarim Neto, Arthur; Acucena, Maria Kadja Meneses Torres; Pereira, Kercia Regina Santos Gomes; Rego, Amalia Cinthia Meneses [Universidade Federal do Rio Grande do Norte (UFRN), Natal, RN (Brazil). Postgraduate Program in Health Sciences; Azevedo, Italo Medeiros; Medeiros, Aldo Cunha [Universidade Federal do Rio Grande do Norte (UFRN), Natal, RN (Brazil). Dept. of Surgery; Bernardo-Filho, Mario [State University of Rio de Janeiro, RJ (Brazil). Dept. of Biophysics and Biometry


    Purpose: Many patients with metastatic bone disease have to use radiopharmaceuticals associated with chemotherapy to relieve bone pain. The aim of this study was to assess the influence of docetaxel on the biodistribution of samarium-153-EDTMP in bones and other organs of rats. Methods: Wistar male rats were randomly allocated into 2 groups of 6 rats each. The DS (docetaxel/samarium) group received docetaxel (15 mg/kg) intraperitoneally in two cycles 11 days apart. The S (samarium/control) group rats were not treated with docetaxel. Nine days after chemotherapy, all the rats were injected with 0.1 ml of samarium-153-EDTMP via orbital plexus (25 {mu} Ci. After 2 hours, the animals were killed and samples of the brain, thyroid, lung, heart, stomach, colon, liver, kidney and both femurs were removed. The percentage radioactivity of each sample (% ATI / g) was determined in an automatic gamma-counter (Wizard-1470, Perkin-Elmer, Finland). Results: On the ninth day after the administration of the second chemotherapy cycle, the rats had a significant weight loss (314.50 +- 22.09 g) compared (p<0.5) to pre-treatment weight (353.66 {+-} 22.8). The % ATI/g in the samples of rats treated with samarium-153-EDTMP had a significant reduction in the right femur, left femur, kidney, liver and lungs of animals treated with docetaxel, compared to the control rats. Conclusion: The combination of docetaxel and samarium-153-EDTMP was associated with a lower response rate in the biodistribution of the radiopharmaceutical to targeted tissues. Further investigation into the impact of docetaxel on biodistribution of samarium-153-EDTMP would complement the findings of this study. (author)

  6. The Basis for Developing Samarium AMS for Fuel Cycle Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Buchholz, B A; Biegalski, S R; Whitney, S M; Tumey, S J; Weaver, C J


    Modeling of nuclear reactor fuel burnup indicates that the production of samarium isotopes can vary significantly with reactor type and fuel cycle. The isotopic concentrations of {sup 146}Sm, {sup 149}Sm, and {sup 151}Sm are potential signatures of fuel reprocessing, if analytical techniques can overcome the inherent challenges of lanthanide chemistry, isobaric interferences, and mass/charge interferences. We review the current limitations in measurement of the target samarium isotopes and describe potential approaches for developing Sm-AMS. AMS sample form and preparation chemistry will be discussed as well as possible spectrometer operating conditions.

  7. Optical characteristics of transparent samarium oxide thin films ...

    Indian Academy of Sciences (India)

    Optical characteristics of transparent samarium oxide thin films deposited by the radio-frequency sputtering technique. A A ATTA M M EL-NAHASS KHALED M ELSABAWY M M ABD EL-RAHEEM A M HASSANIEN A ALHUTHALI ALI BADAWI AMAR MERAZGA. Regular Volume 87 Issue 5 November 2016 Article ID 72 ...

  8. Optical properties of zinc–vanadium glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Zinc–vanadium glasses doped with samarium oxide having the chemical composition Sm2O3() ZnO(40-)V2O5(60) (where = 0.1–0.5 mol%) were prepared by melt quenching method. The density of these glasses was measured by Archimedes method; the corresponding molar volumes have also been calculated.

  9. Optical properties of samarium doped zinc–tellurite glasses

    Indian Academy of Sciences (India)


    Optical properties of samarium doped zinc–tellurite glasses. B ERAIAH. Department of Physics, Karnatak University, Dharwad 580 003, India. Present address: Department of Physics, Bangalore University, Bangalore 560 056, India. MS received 20 March 2006; revised 13 June 2006. Abstract. Glasses with the composition, ...

  10. Effect of second ligand on the luminescence of Samarium (III ...

    Indian Academy of Sciences (India)

    Effect of second ligand on the luminescence of Samarium (III) dibenzoylmethane complexes: Syntheses, crystal structures, thermal analysis and luminescence study. MUHAMMAD IDIRIS SALEH, MIN YEE CHOO, TAI WEI CHAN and MOHD R RAZALI. ∗. School of Chemical Sciences, Universiti Sains Malaysia, Penang, ...

  11. Effect of second ligand on the luminescence of Samarium (III ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences; Volume 127; Issue 12. Effect of second ligand on the luminescence of Samarium (III) dibenzoylmethane complexes: ... Muhammad Idiris Saleh1 Min Yee Choo1 Tai Wei Chan1 Mohd R Razali1. School of Chemical Sciences, Universiti Sains Malaysia, Penang, Malaysia ...

  12. Dependence of samarium-soil interaction on samarium concentration: Implications for environmental risk assessment. (United States)

    Ramírez-Guinart, Oriol; Salaberria, Aitor; Vidal, Miquel; Rigol, Anna


    The sorption and desorption behaviour of samarium (Sm), an emerging contaminant, was examined in soil samples at varying Sm concentrations. The obtained sorption and desorption parameters revealed that soil possessed a high Sm retention capacity (sorption was higher than 99% and desorption lower than 2%) at low Sm concentrations, whereas at high Sm concentrations, the sorption-desorption behaviour varied among the soil samples tested. The fractionation of the Sm sorbed in soils, obtained by sequential extractions, allowed to suggest the soil properties (pH and organic matter solubility) and phases (organic matter, carbonates and clay minerals) governing the Sm-soil interaction. The sorption models constructed in the present work along with the sorption behaviour of Sm explained in terms of soil main characteristics will allow properly assessing the Sm-soil interaction depending on the contamination scenario under study. Moreover, the sorption and desorption K d values of radiosamarium in soils were strongly correlated with those of stable Sm at low concentrations (r = 0.98); indicating that the mobility of Sm radioisotopes and, thus, the risk of radioactive Sm contamination can be predicted using data from low concentrations of stable Sm. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Mechanism of the electrochemical deposition of samarium-based coatings

    Energy Technology Data Exchange (ETDEWEB)

    Ruiz, Edgar J. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Ortega-Borges, Raul [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Godinez, Luis A. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Chapman, Thomas W. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Meas-Vong, Yunny [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico)]. E-mail:


    Samarium-based films have been shown to form from aqueous solutions on the surfaces of metallic substrates such as steel or aluminum, and their presence has been reported to decrease substantially the corresponding corrosion rate of the underlying metallic substrate. Based on previous reports on the deposition of oxides or hydroxides of the closely related element cerium, this work demonstrates that samarium films are formed following a similar mechanism, which involves as the fundamental step an increase in interfacial pH resulting from cathodic oxygen-reduction or hydrogen-evolution reactions. With cyclic voltammetry (CV), electrochemical quartz-crystal microbalance (EQCM) measurements, rotating-disk electrode (RDE) tests, and surface characterization techniques, namely, scanning electron microscopy (SEM) and X-ray surface microanalysis (EDX), the postulated mechanism was verified, and the surface morphology of the resulting films was correlated with the nature of the reduction reaction that triggers film formation.

  14. Samarium Monosulfide (SmS): Reviewing Properties and Applications


    Sousanis, Andreas; Smet, Philippe; Poelman, Dirk


    In this review, we give an overview of the properties and applications of samarium monosulfide, SmS, which has gained considerable interest as a switchable material. It shows a pressure-induced phase transition from the semiconducting to the metallic state by polishing, and it switches back to the semiconducting state by heating. The material also shows a magnetic transition, from the paramagnetic state to an antiferromagnetically ordered state. The switching behavior between the semiconducti...

  15. Optical properties of zinc–vanadium glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Abstract. Zinc–vanadium glasses doped with samarium oxide having the chemical composition Sm2O3(x). ZnO(40−x)V2O5(60)(where x = 0·1–0·5 mol%) were prepared by melt quenching method. The density of these glasses was measured by Archimedes method; the corresponding molar volumes have also been ...

  16. Synthesis of nano-pore samarium (III)-imprinted polymer for preconcentrative separation of samarium ions from other lanthanide ions via solid phase extraction

    Energy Technology Data Exchange (ETDEWEB)

    Shirvani-Arani, Simindokht [Center of Excellence in Electrochemistry, Department of Chemistry, University of Tehran, P.O.Box:14155-6455, Tehran (Iran, Islamic Republic of); Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of); Ahmadi, Seyed Javad [Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of)], E-mail:; Bahrami-Samani, Ali [Nuclear Engineering and Physics Department, Amir Kabir University, P.O.Box: 15875-4413, Tehran (Iran, Islamic Republic of); Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of); Ghannadi-Maragheh, Mohammad [Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of)


    A batch process was developed to separate samarium ions from some lanthanide ions by a novel solid phase which was prepared via the ion-imprinting technique. The samarium (III) ion-imprinted polymer (IIP) particles were synthesized by preparing the ternary complex of samarium ions with 5,7-dichloroquinoline-8-ol (DCQ) and 4-vinylpyridine (VP). Then, thermally copolymerization with styrene (functional monomer, STY) and divinylbenzene (cross-linking monomer, DVB) followed in the presence of 2-methoxy ethanol (porogen) and 2,2'-azobisisobutyronitrile (initiator, AIBN). The imprinted ion was removed by stirring the above particles with 50% (v/v) HCl to obtain the leached IIP particles. Moreover, control polymer (CP) particles were similarly prepared without the samarium ions. The unleached and leached IIP particles were characterized by X-ray diffraction (XRD), infra-red spectroscopy (IR), thermo gravimetric analysis (TGA) and scanning electron microscopy (SEM). Finally, preconcentration and selectivity studies for samarium and the other lanthanide ions were carried out. The preconcentration of the samarium (III) traces was studied during rebinding with the leached IIP particles as a function of pH, the weight of the polymer material, the preconcentration and the elution times, the eluent volume and the aqueous phase volume. These studies indicated that the samarium (III) amount as low as 1 {mu}g, present in 200 mL, could be preconcentrated into 25 mL of 1.0 M HCl.

  17. Ionization of Samarium by Chemical Releases in the Upper Atmosphere (United States)

    Siefring, C. L.; Bernhardt, P. A.; Holmes, J. M.; Pedersen, T. R.; Caton, R.; Miller, D.; Groves, K. M.


    The release of Samarium vapor into the upper atmosphere was studied using during the Air Force Research Laboratory sponsored Metal Oxide Space Cloud (MOSC) rocket launches in May 2009. The Naval Research Laboratory supported these experiments with 3-D photochemical modeling of the artificial plasma cloud including (1) reactions with atomic oxygen, (2) photo excitation, (3) photoionization, (4) dissociative recombination, and (5) ion and neutral diffusion. NRL provided the experimental diagnostic instrument on the rocket which was a dual frequency radio beacon on the rocket to measure changes in total electron content. The AFRL provided ground based diagnostics of incoherent scatter radar and optical spectroscopy and imagery. The NRL Chemical Release Model (CRM) has over 600 excited states of atomic Samarium neutrals, atomic ions, along with Samarium Oxide Ions and electrons. Diffusive transport of neutrals in cylindrical geometry and ions along magnetic field lines is computed along with the reactive flow to predict the concentrations of Sm, Sm-Ion, Sm0, and SmO Ion. Comparison of the CRM with observations demonstrates that Sm release into the upper atmosphere initially produces enhanced electron densities and SmO-Ions. The diatomic ions recombine with electrons to yield neutral Sm and O. Only the photo ionization of Sm yields a stable atomic ion that does not substantially recombine. The MOSC releases in sunlight yielded long duration ion clouds that can be replicated with the CRM. The CRM predicts that Sm releases in darkness would not produce long duration plasma clouds because of the lack of photo excitation and photoionization.

  18. Reactive Materials for Evaporating Samarium (Pre-Print) (United States)


    SUBJECT TERMS energetic materials, heat sources, pyrotechnic charges, easily ionized metals 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF...experiments.    Keywords:  energetic  materials, heat sources, pyrotechnic charges, easily ionized metals  1. Introduction Ejection of clouds of...results  were  negatively  affected  by  reduced  efficiency   of  release  and  ionization of samarium [8]. It is possible that not the entire charge of

  19. Implementation of an analytical technique for Samarium; Implementacion de una tecnica analitica para Samario

    Energy Technology Data Exchange (ETDEWEB)

    Garcia G, N. [ININ, Carretera Mexico-Toluca Km. 36.5, 52045 Estado de Mexico (Mexico)


    Since the Samarium presents the same chemical properties that the plutonium, it has been used as homologous in studies that allow us to know the behavior that the plutonium presents in solution, with the advantage of working with an inactive and not very dangerous element. At the moment studies of sorption of plutonium or samarium are made on some mineral matrices that present certain surface properties. Due to the low concentrations that are used in the studies of sorption of samarium on those reagent substrates, their detection becomes very difficult for the conventional analysis media. The luminescence is a technique that can detect lower concentrations, smaller at 1 X 10{sup -} {sup 2} M, but when fluorofors are used this limit of detection increases in several orders of magnitude. In this work it has been used the arsenazo-III as fluorofor agent since it reacts in a specific way with the samarium, forming a complex that presents a proportional luminescence to the concentration of the present samarium. The advantage of making the quantification of samarium by luminescence is that it can use the same instrumental equipment to determine the speciation of the samarium sipped in the zircon. (Author)

  20. Synthesis of samarium binding bleomycin - a possible NCT radiosensitizer

    Energy Technology Data Exchange (ETDEWEB)

    Mendes, B.M., E-mail: bmm@cdtn.b [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Mendes, T.M.; Campos, T.P.R., E-mail: campos@nuclear.ufmg.b [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil)


    Bleomycin (BLM) is a drug that has attractive features for the development of a new radiopharmaceutical, particularly with regard to neutron capture therapy (NCT) sensitized by Sm-149. It has the ability to chelate many metal ions. In vitro studies have shown that up to 78% of BLM present in a cell is accumulated inside the nucleus or in the nuclear membrane. In addition, this drug has higher affinity for tumor tissues than for normal tissues. Radioactive isotopes carried by this antibiotic would be taken preferentially to one important cellular targets DNA. Besides, BLM displays intrinsic anti-tumor activity - it is a chemotherapic antibiotic clinically used against some cancers. This study aimed to obtain bleomycin molecules bound to samarium (BLM-Sm) for NCT studies in vitro and in vivo. The binding technique employed in this work has great simplicity and low cost. Thin layer chromatography, high performance liquid chromatography, fast protein liquid chromatography and analysis by ICP-AES were applied to verify the binding molecule. ICP-AES results showed the presence of samarium in the sample peaks related to BLM-Sm. However, efficiency and stability of this bond needs to be investigated. (author)

  1. Luminescent solutions and powders of new samarium complexes with N,N',O,O'-chelating ligands (United States)

    Kharcheva, Anastasia V.; Nikolskiy, Kirill S.; Borisova, Nataliya E.; Ivanov, Alexey V.; Reshetova, Marina D.; Yuzhakov, Viktor I.; Patsaeva, Svetlana V.


    Imaging techniques in biology and medicine are crucial tools to obtain information on structural and functional properties of living cells and organisms. To fulfill the requirements associated with application of these techniques it appears necessary to design markers with specific characteristics. Luminescent complexes of trivalent lanthanide ions with chelating ligands are of increasing importance in biomedical applications because of their millisecond luminescence lifetime, narrow emission band, high signal-to-noise ratio and minimal photodamage to biological samples. In order to extend the available emission wavelength range the luminescent samarium chelates are highly desirable. In this study the ligands with diamides of 2,2'-bipyridin-6,6'-dicarboxylic acid were used to improve photophysical characteristics of samarium complexes. We report the luminescence characteristics of samarium complexes with novel ligands. All complexes exhibited the characteristic emission of Sm (III) ion with the lines at 565, 597, 605, 645 and 654 nm, the intensity strongly depended on the ligand. Absorption and luminescence excitation spectra of Sm (III) complexes showed main peaks in the UV range demonstrating lanthanide coordination to the ligand. The absolute lumenescence quantum yield was measured for solutions in acetonitrile with excitation at 350 nm. The largest luminescence quantum yield was found for the samarium complex Bipy 6MePy Sm (3%) being much higher that for samarium complexes reported in the literature earlier. These results prove as well that samarium chelates are potential markers for multiparametric imaging techniques.

  2. Australian manufacture of Quadramet{sup TM} (Samarium-153 EDTMP)

    Energy Technology Data Exchange (ETDEWEB)

    Wood, N.R.; Whitwell, J. [Australian Nuclear Science and Technology Organisation (ANSTO), Lucas Heights, NSW (Australia). Australian Radioisotopes


    Quadramet{sup T} (Samarium-153 EDTMP) has been shown overseas to be potentially useful in the palliation of painful osteoblastic skeletal metastases and has been approved this year for general marketing in the USA. Australian Radioisotopes (ARI) has licensed this product from the Australian patent holders, Dow Chemical. Within the facilities of ARI, a hot cell has been dedicated to this product and fitted out to manufacture it weekly on a cycle related to the operating cycle of the Australian reactor HIFAR. Due to neutron flux limitations of HIFAR, the local formulation has an elemental Samarium content up to 200{mu}g/mL whereas the overseas formulation has a level of 20-46{mu}g/mL. All other specifications of the two products are essentially the same. In 1995 and 1996 a small clinical trial with 19 patients was held which demonstrated that the pharmacokinetic behaviour was also essentially the same by measuring blood clearance rates and skeletal uptake dynamics. Soft tissue uptake was also qualitatively determined. The ARI version is now the subject of an application for general marketing within Australia. Some useful characteristics of this agent are: almost complete excretion or fixation in the skeleton within 6 hours, rapid onset of clinical effect, applicability in most cases where an abnormal diagnostic bone scan correlates with painful sites, dosage can be tailored to individual patient uptake due to easy dose measurement and retreatment is quite possible. The use of this class of agents in pain palliation continues to increase. Australian manufacture of Quadramet{sup TM} provides a further option in the management of these difficult cases

  3. Electrochemical extraction of samarium from molten chlorides in pyrochemical processes

    Energy Technology Data Exchange (ETDEWEB)

    Castrillejo, Y., E-mail: [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Fernandez, P. [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Medina, J. [Dept Fisica Materia Condensada Cristalografia y Mineralogia, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Hernandez, P. [Centro de Investigaciones Quimicas, Universidad Autonoma del Estado de Hidalgo, Carr. Pachuca-Tulancingo Km. 4.5, C.P. 42076 Pachuca, Hidalgo (Mexico); Barrado, E. [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain)


    This work concerns the electrochemical extraction of samarium from molten chlorides. In this way, the electrochemical behaviour of samarium ions has been investigated in the eutectic LiCl-KCl at the surface of tungsten, aluminium and aluminium coated tungsten electrodes. On a W inert electrode the electro-reduction of Sm(III) takes place in only one soluble-soluble electrochemical step Sm(III)/Sm(II). The electrochemical system Sm(II)/Sm(0) has not been observed within the electrochemical window, because of the prior reduction of Li(I) ions from the solvent, which inhibits the electro-extraction of Sm species from the salt on such a substrate. Sm metal in contact with the melt react to give Li(0) according to the reaction: Sm(0) + 2Li(I) {r_reversible} Sm(II) + 2Li(0). On the contrary, on reactive Al electrodes the electrochemical system Sm(II)/Sm(0) was observed within the electroactive range. The potential shift of the redox couple is caused by the decrease of Sm activity in the metal phase due to the formation of Sm-Al alloys at the interface. The formation mechanism of the intermetallic compounds was studied in a melt containing: (i) both Sm(III) and Al(III) ions, using W and Al coated tungsten electrodes, and (ii) Sm(III) ions using an Al electrode. Analysis of the samples after potentiostatic electrolysis by X-ray diffraction and scanning electron microscopy (SEM) with energy dispersive X-ray spectroscopy (EDS), allowed the identification of Al{sub 3}Sm and Al{sub 2}Sm.

  4. 22 CFR 144.140 - Employment. (United States)


    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Employment. 144.140 Section 144.140 Foreign... PROGRAMS OR ACTIVITIES CONDUCTED BY THE UNITED STATES DEPARTMENT OF STATE § 144.140 Employment. No qualified handicapped person shall, on the basis of handicap, be subjected to discrimination in employment...

  5. Optical analysis of samarium doped sodium bismuth silicate glass. (United States)

    Thomas, V; Sofin, R G S; Allen, M; Thomas, H; Biju, P R; Jose, G; Unnikrishnan, N V


    Samarium doped sodium bismuth silicate glass was synthesized using the melt quenching method. Detailed optical spectroscopic studies of the glassy material were carried out in the UV-Vis-NIR spectral range. Using the optical absorption spectra Judd-Ofelt (JO) parameters are derived. The calculated values of the JO parameters are utilized in evaluating the various radiative parameters such as electric dipole line strengths (Sed), radiative transition probabilities (Arad), radiative lifetimes (τrad), fluorescence branching ratios (β) and the integrated absorption cross- sections (σa) for stimulated emission from various excited states of Sm3+‡ ion. The principal fluorescence transitions are identified by recording the fluorescence spectrum. Our analysis revealed that the novel glassy system has the optimum values for the key parameters viz. spectroscopic quality factor, optical gain, stimulated emission cross section and quantum efficiency, which are required for a high performance optical amplifier. Calculated chromaticity co-ordinates (0.61, 0.38) also confirm its application potential in display devices. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Samarium Monosulfide (SmS): Reviewing Properties and Applications. (United States)

    Sousanis, Andreas; Smet, Philippe F; Poelman, Dirk


    In this review, we give an overview of the properties and applications of samarium monosulfide, SmS, which has gained considerable interest as a switchable material. It shows a pressure-induced phase transition from the semiconducting to the metallic state by polishing, and it switches back to the semiconducting state by heating. The material also shows a magnetic transition, from the paramagnetic state to an antiferromagnetically ordered state. The switching behavior between the semiconducting and metallic states could be exploited in several applications, such as high density optical storage and memory materials, thermovoltaic devices, infrared sensors and more. We discuss the electronic, optical and magnetic properties of SmS, its switching behavior, as well as the thin film deposition techniques which have been used, such as e-beam evaporation and sputtering. Moreover, applications and possible ideas for future work on this material are presented. Our scope is to present the properties of SmS, which were mainly measured in bulk crystals, while at the same time we describe the possible deposition methods that will push the study of SmS to nanoscale dimensions, opening an intriguing range of applications for low-dimensional, pressure-induced semiconductor-metal transition compounds.

  7. 40 CFR 144.1 - Purpose and scope of part 144. (United States)


    ... sections have been cleared by the Office of Management and Budget: Sections 144.11, 144.28(c)(d)(i), 144.31... or appropriate to carry out his functions” under SDWA. (e) Overview of the UIC program. An UIC... underground injections by five classes of wells (see definition of “well injection,” § 144.3). The five...

  8. Excitation induced spectroscopic study and quenching effect in cerium samarium codoped lithium aluminoborate glasses

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, Parvinder; Kaur, Simranpreet [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Singh, Gurinder Pal [Department of Physics, Khalsa College, Amritsar 143002 (India); Arora, Deepawali; Kumar, Sunil [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Singh, D.P., E-mail: [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India)


    Lithium aluminium borate host has been codoped with cerium and samarium to prepare glass by conventional melt quench technique. Their structural and spectroscopic investigation has been carried out using XRD, FTIR and density measurements. The UV‐Vis absorption spectra and fluorescence spectra (λ{sub exc}.=380 nm and 400 nm) have been studied for spectroscopic analysis. The amorphous nature of the prepared samples is shown by XRD. The density is increasing with addition of cerium at the expense of aluminium, keeping other components constant. FTIR study also shows the presence of compact and stable tetrahedral BO{sub 4} units thus supporting the density results. The UV‐ Vis absorption spectra show a shift of optical absorption edge towards longer wavelength along with an increase in intensity of peaks with rising samarium concentration. The fluorescence spectra show a blue shift and subsequent suppression of cerium peaks with addition of samarium.

  9. Effect of samarium doping on the dielectric behavior of barium zircomium titanate ceramic

    Energy Technology Data Exchange (ETDEWEB)

    Badapanda, T., E-mail: [Department of Physics, C.V. Raman College of Engineering, Bhubaneswar, Odisha-752054 (India); Sarangi, S.; Behera, B. [School of Physics, Sambalpur University, Jyoti Vihar Sambalpur, Odisha-768019 (India); Anwar, S. [Colloids and Materials Chemistry, Institute of Minerals and Materials Technology, Bhubaneswar, Odisha-751013 (India); Sinha, T. P. [Department of Physics, Bose Institute, Kolkata-700009 (India)


    Samarium doped Barium Zirconium Titanate ceramic with general formula Ba{sub 1−x}Sm{sub 2x/3}Zr{sub 0.05}Ti{sub 0.95}O{sub 3} [x=0.0,0.01,0.02,0.03,0.04] has been prepared by high energy ball milling. The X-ray diffraction (XRD) patterns confirmed that these ceramics have a single phase with perovskite-type upto x≤0.03 and a small secondary phase exist at x=0.04. The temperature dependent dielectric study shows a ferroelectric phase transition and transition temperature decreases with an increase in the Samarium content.

  10. Lithium Bromide/Water as Additives in Dearomatizing Samarium-Ketyl (Hetero)Arene Cyclizations. (United States)

    Rao, Chintada Nageswara; Bentz, Christoph; Reissig, Hans-Ulrich


    New conditions for dearomatizing samarium-ketyl (hetero)arene cyclizations are reported. In many examples of these samarium diiodide-mediated reactions, lithium bromide and water can be used as additives instead of the carcinogenic and mutagenic hexamethylphosphoramide (HMPA). The best results were obtained for the cyclizations of N-acylated indole derivatives delivering the expected indolines in good yields and excellent diastereoselectivities. A new type of cyclization delivering indolyl-substituted allene derivatives is also described. The scope and limitations of the lithium bromide/water system are discussed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. One-step synthesis of samarium-doped ceria and its CO catalysis

    Indian Academy of Sciences (India)

    The samarium-doped ceria (SDC) nanospheres were prepared by the one-step hydrothermal method and characterized by transmission electron microscope, scanning electron microscope, powder X-ray diffraction, X-ray photoelectron spectroscopy, energy-dispersive spectrometer and Raman spectra. According to the ...

  12. A spectroscopic comparison of samarium-doped LiYF4 and KY3F10

    NARCIS (Netherlands)

    Wells, J. P. R.; Sugiyama, A.; Han, T. P. J.; Gallagher, H. G.


    Laser selective excitation and fluorescence has been performed on LiYF4 and KY3F10 doped with samarium ions. In LiYF4, a single, tetragonal symmetry center associated with isovalent substitution of Sm3+ with lattice yttrium ions is present. By contrast, three Sm2+ centres and a single, tetragonal

  13. 14 CFR 1260.144 - Procurement procedures. (United States)


    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Procurement procedures. 1260.144 Section 1260.144 Aeronautics and Space NATIONAL AERONAUTICS AND SPACE ADMINISTRATION GRANTS AND COOPERATIVE... dimensioned in the metric system of measurement. (vi) Preference, to the extent practicable and economically...

  14. The Use of a Flexible Calix[4]arene Template to Stabilize a Cyclooctatetraindiyl Samarium-Potassium Complex

    Directory of Open Access Journals (Sweden)

    Geoffroy Guillemot


    Full Text Available A sandwich compound of cyclooctatetraendiyl (COT2− samarium-potassium was synthesized and analyzed using a flexible calix[4]arene dianion. This compound, [p-tBu-calix[4]-(OMe2(O2]arenediyl-samarium-(η8-cyclooctatetraendiyl-potassium (tetrahydrofurane3, is constructed as a linear sequence L-Sm--K-, where L, , and are specific ligands with L = O,O-dimethyl-calix[4]arene2−, = cyclo-octatetraendiyl, and = tetrahydrofurane templates.

  15. Samarium(II) iodide-mediated reductive annulations of ketones bearing a distal vinyl epoxide moiety

    Energy Technology Data Exchange (ETDEWEB)

    Molander, G.A.; Shakya, S.R. [Univ. of Colorado, Boulder, CO (United States)


    It was found that samarium (II) iodide promotes the intramolecular coupling of ketones with distal epoxy olefins while in the presence of hexamethylphosphoramide (HPMA). A number of epoxide compounds (1 a-k) fragment to form carbocycles with allylic alcohol side chains with high diastereoselectivity (2 a-k). Substituting tetramethylguanidine for HPMA reduces the diastereoselectivity. Adding Pd(0) as a catalyst reverses the diastereoselective sense. 40 refs., 1 tab.

  16. A temporal three-dimensional simulation of samarium release in the ionosphere (United States)

    Zhao, Hai-Sheng; Feng, Jie; Xu, Zheng-Wen; Wu, Jian; Wu, Zhen-Sen; Xu, Bin; Xue, Kun; Xu, Tong; Hu, Yan-Li


    For understanding plasma processes of the ionosphere and magnetosphere, the alkali and alkaline-earth metals are usually released in space for artificially increasing the electron density. However, it is a limitation that these releases must be in sunlight where the photoionization can take place. In recent years, the lanthanide metals, such as samarium, have been released to produce electrons in reaction with atomic oxygen in the upper space. The reaction could proceed without sunlight so that the restriction on experimental periods is broken. Unfortunately, any sophisticated models even preliminary ones are unavailable yet in the literature. A temporal three-dimensional model is presented for the samarium release in detail with respect to various altitudes and mass. Especially, the plasma diffusion equation is remarkably extended from 2-D to 3-D by importing the influence of geomagnetic declination, which could be also useful for other chemical releases. The field-aligned terms are brought so as to the presented model can describe the diffusion along the geomagnetic field subtly. On the basis of the presented model, behaviors of radio waves propagating through the release area are simulated by using ray tracing. This model could be as the theoretical support for samarium releases, and it also helpful for the research on the generation and evolution of the ionosphere irregularities.

  17. Dicty_cDB: CHF144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHF144 (Link to dictyBase) - - - Contig-U16411-1 | Contig-U16470-1 CHF...144P (Link to Original site) CHF144F 557 CHF144Z 781 CHF144P 1318 - - Show CHF144 Library CH (Link to library) Clone ID CHF...411-1 | Contig-U16470-1 Original site URL Representative seq. ID CHF144P (Link to Original site) Representative DNA sequence >CHF144 (CHF...144Q) /CSM/CH/CHF1-B/CHF144Q.Seq.d/ TAATAAATAATAATTAAAATTTGCATATATAAAAGAAATAAAAATTTTTTATTTTTTGTA

  18. Liquid–liquid anion exchange extraction studies of samarium(III from salicylate media using high molecular weight amine

    Directory of Open Access Journals (Sweden)

    Aniruddha M. Mandhare


    Full Text Available Liquid–liquid extraction and separation of samarium(III were carried out by using 0.025 mol dm−3 2-octylaminopyridine(2-OAP in xylene at 298 K. The extraction behavior of samarium was studied as a function of pH, weak acid concentration, extractant concentration, diluent, and equilibration time. Samarium was quantitatively extracted at pH 7.5 to 10.0 from 0.01 mol dm−3 sodium salicylate solution with 0.025 mol dm−3 2-OAP. The possible composition of the extracted species in organic phase has been determined by using model of slope analysis method and extraction mechanism was found to proceed via an anion exchange mechanism. The stripping efficiency was found to be quantitative in HNO3, HCl and CH3COOH. The robustness of the procedure was demonstrated by the average recoveries obtained (>99.6% for samarium(III extraction in the presence of several cations and anions which are commonly associated with it. The proposed method facilitates the separation and determination of samarium(III from binary and synthetic mixtures. The various thermodynamic functions like free energy (ΔG, enthalpy (ΔH and entropy (ΔS of extraction mechanism were discussed.

  19. 9 CFR 381.144 - Packaging materials. (United States)


    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Packaging materials. 381.144 Section... Packaging materials. (a) Edible products may not be packaged in a container which is composed in whole or in... to health. All packaging materials must be safe for the intended use within the meaning of section...

  20. 27 CFR 44.144 - Opening. (United States)


    ... PAYMENT OF TAX, OR WITH DRAWBACK OF TAX Operations by Export Warehouse Proprietors Inventories § 44.144 Opening. An opening inventory shall be made by the export warehouse proprietor at the time of commencing... permit issued under § 44.93. A similar inventory shall be made by the export warehouse proprietor when he...

  1. 40 CFR 144.24 - Class V wells. (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Class V wells. 144.24 Section 144.24... INJECTION CONTROL PROGRAM Authorization of Underground Injection by Rule § 144.24 Class V wells. (a) A Class V injection well is authorized by rule, subject to the conditions in § 144.84 (b) Duration of well...

  2. Dicty_cDB: SLF144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLF144 (Link to dictyBase) - - - Contig-U09670-1 SLF144E (Link... to Original site) - - - - - - SLF144E 390 Show SLF144 Library SL (Link to library) Clone ID SLF144 (Link Representative seq. ID SLF14...4E (Link to Original site) Representative DNA sequence >SLF144 (SLF144Q) /CSM/SL/SLF1-B/SLF144Q.Seq.d/ AGGCA...mino Acid sequence (All Frames) Frame A: rh*sch*flftf*l*nlctsywsyr*srcpryisfnslk*lfr*ygigw*fn*sltkirt rgsf*i

  3. Dicty_cDB: SLB144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLB144 (Link to dictyBase) - - - Contig-U16455-1 SLB144Z (Link... to Original site) - - SLB144Z 710 - - - - Show SLB144 Library SL (Link to library) Clone ID SLB144 (Link Representative seq. ID SLB14...4Z (Link to Original site) Representative DNA sequence >SLB144 (SLB144Q) /CSM/SL/SLB1-B/SLB144Q.Seq.d/ XXXXX...29 |pid:none) Acanthamoeba culbertsoni ef1a gene... 321 2e-86 AY643820_1( AY643820 |pid:none) Arcyria denuda

  4. Dicty_cDB: SHF144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SH (Link to library) SHF144 (Link to dictyBase) - - - Contig-U16333-1 SHF144P (Link to Original site) SHF...144F 627 SHF144Z 547 SHF144P 1154 - - Show SHF144 Library SH (Link to library) Clone ID SHF...e URL Representative seq. ID SHF...144P (Link to Original site) Representative DNA sequence >SHF144 (SHF144Q) /CSM/SH/SHF1-B/SHF...iriisw*tsmcn*cf**ye*fw*f--- ---igisilstwsiikwcfrsv*xw*ckfqir**tf*rfsnyrvsiiq*lqsxhfndewy xryxsi*xfeiexxxps*s

  5. Samarium(II) iodide-mediated intramolecular conjugate additions of alpha,beta-unsaturated lactones. (United States)

    Molander, Gary A; St Jean, David J


    Samarium(II) iodide, in the presence of catalytic amounts of nickel(II) iodide, has been used to promote intramolecular conjugate additions of alkyl halides onto alpha,beta-unsaturated lactones. This process has been shown to be applicable to a number of alpha,beta-unsaturated lactones, including tetrasubstituted olefins, and has been demonstrated to be quite general for the formation of saturated bicyclic and tricyclic lactones. The method presented herein provides a mild, efficient process to form structurally complex lactones from simple precursors.

  6. Ekstraksi Pemisahan Neodimium dari Samarium, Itrium dan Praseodimium Memakai Tri Butil Fosfat

    Directory of Open Access Journals (Sweden)

    Maria Veronica Purwani


    Full Text Available The extraction of Nd(OH3 (neodymium hydroxide concentrate containing Y (yttrium, Sm (samarium and Pr (praseodymium as product of monazite processed has been done. The purpose of this study is to determine the separation of Nd from Y, Pr and Nd Sm in Nd concentrate. The aqueous phase was concentrated Nd (OH3 in HNO3 and extractant while organic phase was Tri Butyl Phosphate (TBP in kerosene. Parameters studied were pH and concentration feed, concentration of TBP in kerosene, extraction time and stirring speed. The result showed that the optimization of separation extraction neodymium from samarium, yttrium and praseodymium in Nd(OH3 concentrated with TBP, obtained the optimum condition of pH = 0.2, concentration of feed 100 g /L, concentration of TBP in kerosene 5%, extraction time 15 minutes and stirring speed 150 rpm. With the conditions, Separation Factor (SF obtained for Nd-Y, Nd-Pr, Nd-Sm are 2.242, 4.811, 4.002 respectively, while D and extraction efficiency of Nd are 0.236 and 19.07%.

  7. X-Band Microwave Reflection Properties of Samarium/Bismuth-Substituted Barium Lanthanum Titanate Ceramics (United States)

    Bahel, Shalini; Pubby, Kunal; Narang, Sukhleen Bindra


    Samarium/bismuth-substituted barium lanthanum titanate ceramics with chemical composition Ba4 (La_{1 - y - z} Smy Biz )_{9.33} Ti_{18} O_{54} ( y = 0.5, 0.7; z = 0.05, 0.10, 0.15), intended as microwave reflecting materials, have been investigated in microwave X-band (8.2 GHz to 12.4 GHz) and the effect of substitution on their dielectric properties, i.e., dielectric constant and dielectric loss tangent, has been studied by vector network analyzer. Dielectric analysis showed that the dielectric constant increased with increasing samarium as well as bismuth content. Dielectric relaxation was observed for all samples in the scanned frequency range. Microwave reflection and transmission analysis of ceramic pellets of thickness 4 mm was carried out using two methods, i.e., open- and short-circuit approach, both indicating very high values of reflected power and very low values of transmitted power for all the doped materials in comparison with the base composition. The doped compositions are therefore potential microwave shielding materials for use in anechoic chambers, microwave laboratories, and radar equipment. Double-layer reflectors are also proposed, having better reflection properties (˜99% reflection) compared with single-layer reflectors.

  8. Microstructure and hysteresis curves of samarium-holmium-iron garnet synthesized by coprecipitation

    Directory of Open Access Journals (Sweden)

    Caffarena Valeska da Rocha


    Full Text Available An investigation was made into the synthesis and magnetic properties of Sm(3-xHo xFe5O12 (samarium-holmium-iron garnet ferrite, as yet absent from the literature. The material in question was synthesized by co-precipitation, starting from hydrated chlorides of rare-earth elements and ferrous sulfate, and the mixed hydroxide co-precipitate was calcined at 1000 °C. Using PVA as a binder, rectangular cross section-shaped compacts were produced by means of steel-die pressing, drying and sintering from 1200 to 1450 °C. The main conclusions of this study were that the coercive force decreases as the sintering temperature increases, and that the effect of substituting holmium for samarium in SmIG is entirely different from that provided by replacing yttrium by gadolinium in YIG, which is the most important result of this work. An in-depth investigation will be necessary to determine the correlation between microstructure/magnetic properties and ceramic processing variables.

  9. Bone-seeking radiopharmaceuticals as targeted agents of osteosarcoma: samarium-153-EDTMP and radium-223. (United States)

    Anderson, Peter M; Subbiah, Vivek; Rohren, Eric


    Osteosarcoma is a cancer characterized by formation of bone by malignant cells. Routine bone scan imaging with Tc-99m-MDP is done at diagnosis to evaluate primary tumor uptake and check for bone metastases. At time of relapse the Tc-99m-MDP bone scan also provides a specific means to assess formation of bone by malignant osteosarcoma cells and the potential for bone-seeking radiopharmaceuticals to deliver radioactivity directly into osteoblastic osteosarcoma lesions. This chapter will review and compare a bone-seeking radiopharmaceutical that emits beta-particles, samarium-153-EDTMP, with an alpha-particle emitter, radium-223. The charged alpha particles from radium-223 have far more mass and energy than beta particles (electrons) from Sm-153-EDTMP. Because radium-223 has less marrow toxicity and more radiobiological effectiveness, especially if inside the bone forming cancer cell than samarium-153-EDTMP, radium-223 may have greater potential to become widely used against osteosarcoma as a targeted therapy. Radium-223 also has more potential to be used with chemotherapy against osteosarcoma and bone metastases. Because osteosarcoma makes bone and radium-223 acts like calcium, this radiopharmaceutical could possibly become a new targeted means to achieve safe and effective reduction of tumor burden as well as facilitate better surgery and/or radiotherapy for difficult to resect large, or metastatic tumors.

  10. Polypyrrole-coated samarium oxide nanobelts: fabrication, characterization, and application in supercapacitors (United States)

    Liu, Peng; Wang, Yunjiao; Wang, Xue; Yang, Chao; Yi, Yanfeng


    Polypyrrole-coated samarium oxide nanobelts were synthesized by the in situ chemical oxidative surface polymerization technique based on the self-assembly of pyrrole on the surface of the amine-functionalized Sm2O3 nanobelts. The morphologies of the polypyrrole/samarium oxide (PPy/Sm2O3) nanocomposites were characterized using transmission electron microscope. The UV-vis absorbance of these samples was also investigated, and the remarkable enhancement was clearly observed. The electrochemical behaviors of the PPy/Sm2O3 composites were investigated by cyclic voltammetry, electrochemical impedance spectroscopy, and galvanostatic charge-discharge. The results indicated that the PPy/Sm2O3 composite electrode was fully reversible and achieved a very fast Faradaic reaction. After being corrected into the weight percentage of the PPy/Sm2O3 composite at a current density of 20 mA cm-2 in a 1.0 M NaNO3 electrolyte solution, a maximum discharge capacity of 771 F g-1 was achieved in a half-cell setup configuration for the PPy/Sm2O3 composites electrode with the potential application to electrode materials for electrochemical capacitors.

  11. Polypyrrole-coated samarium oxide nanobelts: fabrication, characterization, and application in supercapacitors

    Energy Technology Data Exchange (ETDEWEB)

    Liu Peng, E-mail:; Wang Yunjiao; Wang Xue; Yang Chao; Yi Yanfeng [College of Chemistry and Chemical Engineering, Lanzhou University, Key Laboratory of Nonferrous Metal Chemistry and Resources Utilization of Gansu Province and State Key Laboratory of Applied Organic Chemistry (China)


    Polypyrrole-coated samarium oxide nanobelts were synthesized by the in situ chemical oxidative surface polymerization technique based on the self-assembly of pyrrole on the surface of the amine-functionalized Sm{sub 2}O{sub 3} nanobelts. The morphologies of the polypyrrole/samarium oxide (PPy/Sm{sub 2}O{sub 3}) nanocomposites were characterized using transmission electron microscope. The UV-vis absorbance of these samples was also investigated, and the remarkable enhancement was clearly observed. The electrochemical behaviors of the PPy/Sm{sub 2}O{sub 3} composites were investigated by cyclic voltammetry, electrochemical impedance spectroscopy, and galvanostatic charge-discharge. The results indicated that the PPy/Sm{sub 2}O{sub 3} composite electrode was fully reversible and achieved a very fast Faradaic reaction. After being corrected into the weight percentage of the PPy/Sm{sub 2}O{sub 3} composite at a current density of 20 mA cm{sup -2} in a 1.0 M NaNO{sub 3} electrolyte solution, a maximum discharge capacity of 771 F g{sup -1} was achieved in a half-cell setup configuration for the PPy/Sm{sub 2}O{sub 3} composites electrode with the potential application to electrode materials for electrochemical capacitors.

  12. Behavior of Samarium III during the sorption process; Comportamiento del Samario-III durante el proceso de sorcion

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez R, E.; Garcia G, N.; Garcia R, G. [ININ, Carr. Mexico-Toluca Km 36.5, Salazar, Estado de Mexico (Mexico)]. e-mail:


    In this work the results of the behavior of samarium in solution are presented, in front of a fine powder of zirconium silicate (zircon). For that which is necessary to characterize the zircon, studying the crystallinity, the morphology, the surface area and the isoelectric point. The behavior of samarium in solution is studied by means of the elaboration of isotherm of sorption, using the technique by lots. One observes that to pH values of nearer to the isoelectric point (pH = 7.23) the process of sorption of the samarium begins, reaching a maximum to near pH at 9. The technique of luminescence is used to determine the concentration of the sipped samarium (phosphorescence) and also to make the speciation of the species formed in the surface of the zircon (phosphorescence). The results can be extrapolated with the plutonium when making the modeling of the migration of alpha emitting coming from the repositories of radioactive waste since both they have similar chemical properties (they are homologous). (Author)

  13. Neutron and Charged-Particle Induced Cross Sections for Radiochemistry in the Region of Samarium, Europium, and Gadolinium

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, R D; Kelley, K; Dietrich, F S; Bauer, R; Mustafa, M


    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron and proton induced nuclear reaction cross sections in the mass region of samarium, europium and gadolinium (62 {le} Z {le} 64, 82 {le} N {le} 96).

  14. Pemisahan Unsur Samarium dan Yttrium dari Mineral Tanah Jarang dengan Teknik Membran Cair Berpendukung (Supported Liquid Membrane

    Directory of Open Access Journals (Sweden)

    Amri Amin


    Full Text Available he increasing use of rare earth elements in high technology industries needs to be supported by developmental work for the separation of elements. The research objective is fiercely attracting and challenging considering the similarity of bath physical and chemical properties among these elements. The rate separation of samarium and yttrium elements using supported liquid membrane has been studied. Polytetrafluoroethylene (PTFE with pore size of 0.45 µm has been used as the membrane and di(2-ethylhexyl phosphate (D2EHP in hexane has been used as a carrier and nitric acid solution has been used as receiving phase. Result of experiments showed that the best separation rate of samarium and yttrium elements could be obtained at feeding phase of pH 3.0, di(2-ethylhexyl phosphate (D2EHP concentration of 0.3 M, agitation rate of 700 rpm, agitation time of 2 hours, and nitric acid and its solution concentrations of 1.0 M and 0.1 M, respectively. At this condition, separation rates of samarium and yttrium were 64.4 and 67.6%, respectively.   Keywords: liquid membrane, rare earth elements, samarium, yttrium

  15. The 144Ce source for SOX (United States)

    Durero, M.; Vivier, M.; Agostini, M.; Altenmüller, K.; Appel, S.; Bellini, G.; Benziger, J.; Berton, N.; Bick, D.; Bonfini, G.; Bravo, D.; Caccianiga, B.; Calaprice, F.; Caminata, A.; Cavalcante, P.; Chepurnov, A.; Choi, K.; Cribier, M.; D'Angelo, D.; Davini, S.; Derbin, A.; Di Noto, L.; Drachnev, I.; Etenko, A.; Farinon, S.; Fischer, V.; Fomenko, K.; Franco, D.; Gabriele, F.; Gaffiot, J.; Galbiati, C.; Ghiano, C.; Giammarchi, M.; Goeger-Neff, M.; Goretti, A.; Gromov, M.; Hagner, C.; Houdy, T.; Hungerford, E.; Ianni, Aldo; Ianni, Andrea; Jonqueres, N.; Jedrzejczak, K.; Kaiser, M.; Kobychev, V.; Korablev, D.; Korga, G.; Kornoukhov; Kryn, D.; Lachenmaier, T.; Lasserre, T.; Laubenstein, M.; Lehnert, B.; Link, J.; Litvinovich, E.; Lombardi, F.; Lombardi, P.; Ludhova, L.; Lukyanchenko, G.; Machulin, I.; Manecki, S.; Maneschg, W.; Marcocci, S.; Maricic, J.; Mention, G.; Meroni, E.; Meyer, M.; Miramonti, L.; Misiaszek, M.; Montuschi, M.; Muratova, V.; Musenich, R.; Neumair, B.; Oberauer, L.; Obolensky, M.; Ortica, F.; Pallavicini, M.; Papp, L.; Perasso, L.; Pocar, A.; Ranucci, G.; Razeto, A.; Re, A.; Romani, A.; Roncin, R.; Rossi, N.; Schönert, S.; Scola, L.; Semenov, D.; Simgen, H.; Skorokhvatov, M.; Smirnov, O.; Sotnikov, A.; Sukhotin, S.; Suvorov; Tartaglia, R.; Testera, G.; Thurn, J.; Toropova, M.; Veyssiére, C.; Unzhakov, E.; Vogelaar, R. B.; von Feilitzsch, F.; Wang, H.; Weinz, S.; Winter, J.; Wojcik, M.; Wurm, M.; Yokley, Z.; Zaimidoroga, O.; Zavatarelli, S.; Zuber, K.; Zuzel, G.


    The SOX (Short distance neutrino Oscillations with BoreXino) project aims at testing the light sterile neutrino hypothesis. To do so, two artificials sources of antineutrinos and neutrinos respectively will be consecutively deployed at the Laboratori Nazionali del Gran Sasso (LNGS) in close vicinity to Borexino, a large liquid scintillator detector. This document reports on the source production and transportation. The source should exhibit a long lifetime and a high decay energy, a requirement fullfilled by the 144Ce-144Pr pair at secular equilibrium. It will be produced at FSUE “Mayak” PA using spent nuclear fuel. It will then be shielded and packed according to international regulation and shipped to LNGS across Europe. Knowledge of the Cerium antineutrino generator (CeANG) parameters is crucial for SOX as it can strongly impact the experiment sensitivity. Several apparatuses are being used or designed to characterize CeANG activity, radioactive emission and content. An overview of the measurements performed so far is presented here.

  16. MicroRNA-144 inhibits hepatocellular carcinoma cell proliferation ...

    Indian Academy of Sciences (India)

    MicroRNA 144 (miR-144), a small non-coding RNA, is frequently dysregulated in human several tumour progression,but its role and the underlying mechanisms in hepatocellular carcinoma (HCC) is poorly investigated. In thepresent study, the expression of miR-144 was firstly analysed in datasets derived from GSE21362 ...

  17. 19 CFR 144.36 - Withdrawal for transportation. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Withdrawal for transportation. 144.36 Section 144... § 144.36 Withdrawal for transportation. (a) Time limit. Merchandise may be withdrawn from warehouse for transportation to another port of entry if withdrawal for consumption or exportation can be accomplished at the...

  18. 19 CFR 144.23 - Endorsement in blank. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Endorsement in blank. 144.23 Section 144.23 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE... Merchandise from Warehouse § 144.23 Endorsement in blank. If the transferor wishes to do so, he may endorse...

  19. 19 CFR 144.25 - Deposit of forms. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Deposit of forms. 144.25 Section 144.25 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY... Warehouse § 144.25 Deposit of forms. Either the transferor or the transferee may deposit the endorsed...

  20. 42 CFR 456.144 - Data sources for studies. (United States)


    ... 42 Public Health 4 2010-10-01 2010-10-01 false Data sources for studies. 456.144 Section 456.144 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL ASSISTANCE PROGRAMS UTILIZATION CONTROL Utilization Control: Hospitals Ur Plan: Medical Care Evaluation Studies § 456.144 Data sources...

  1. 9 CFR 319.144 - Whole hog sausage. (United States)


    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Whole hog sausage. 319.144 Section 319.144 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY... CERTIFICATION DEFINITIONS AND STANDARDS OF IDENTITY OR COMPOSITION Sausage Generally: Fresh Sausage § 319.144...

  2. 19 CFR 144.1 - Merchandise eligible for warehousing. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Merchandise eligible for warehousing. 144.1 Section 144.1 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY... § 144.1 Merchandise eligible for warehousing. (a) Types of merchandise. Any merchandise subject to duty...

  3. 17 CFR 14.4 - Violation of Commodity Exchange Act. (United States)


    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Violation of Commodity Exchange Act. 14.4 Section 14.4 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION RULES RELATING TO SUSPENSION OR DISBARMENT FROM APPEARANCE AND PRACTICE § 14.4 Violation of Commodity...

  4. 5 CFR 185.144 - Right to administrative offset. (United States)


    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Right to administrative offset. 185.144 Section 185.144 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PROGRAM FRAUD CIVIL REMEDIES § 185.144 Right to administrative offset. The amount of any penalty or assessment...

  5. 19 CFR 144.3 - Allowance for damage. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Allowance for damage. 144.3 Section 144.3 Customs... (CONTINUED) WAREHOUSE AND REWAREHOUSE ENTRIES AND WITHDRAWALS General Provisions § 144.3 Allowance for damage. No abatement or allowance of duties shall be made on account of damage, loss, or deterioration of the...

  6. Effects of the atomic environment on the electron binding energies in samarium

    Energy Technology Data Exchange (ETDEWEB)

    Inoyatov, A.Kh., E-mail: [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Institute of Applied Physics, National University, Tashkent, Republic of Uzbekistan (Uzbekistan); Kovalík, A. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Nuclear Physics Institute of the ASCR, CZ-25068 Řež near Prague (Czech Republic); Filosofov, D.V. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Ryšavý, M.; Vénos, D. [Nuclear Physics Institute of the ASCR, CZ-25068 Řež near Prague (Czech Republic); Yushkevich, Yu.V.; Perevoshchikov, L.L. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Zhdanov, V.S. [Nuclear Physics Institute, Almaty, Republic of Kazakhstan (Kazakhstan)


    Highlights: • Eight different matrices (evaporated and implanted at 30 keV) used. • The greatest average difference in the binding energies amounted to 3.1 ± 0.1 eV. • The presence of trivalent and divalent Sm ions found in some implanted samples. • No significant differences in Sm natural atomic level widths were observed. - Abstract: Effects of the atomic environment on the L{sub 1}, L{sub 2}, L{sub 3}, M{sub 1}, M{sub 2}, M{sub 3}, and N{sub 1} electron binding energies in samarium generated in the electron capture decay of radioactive {sup 149}Eu were investigated by means of the internal conversion electron spectroscopy using the conversion electron spectrum of the 22.5 keV M1 + E2 nuclear transition in the daughter {sup 149}Sm. In this investigation, four pairs of {sup 149}Eu sources prepared by vacuum evaporation deposition and by ion implantation at 30 keV with the use of four different source backing materials, namely polycrystalline carbon, aluminium, gadolinium and platinum foils, were employed. The greatest average difference of (3.1 ± 0.1) eV in the L{sub 1}, L{sub 2}, L{sub 3}, and M{sub 1} subshell electron binding energies was observed between the {sup 149}Eu sources prepared by ion implantation into the aluminium and platinum substrates. On the other hand, minimal differences in the electron binding energies were generally found between samarium generated in the evaporated layer and in the bulk for the individual investigated source backings with the exception of the gadolinium foil. A doublet structure of all investigated conversion electron lines with the average values of 8.1 ± 0.2 eV and 1.5 ± 0.1 for the separation energy and the intensity ratio of the low-energy to high-energy components, respectively, was observed for the {sup 149}Eu sources prepared by ion implantation into the aluminium and carbon foils. This structure was presumably caused by the presence of both the trivalent and divalent Sm ions in the sources. No

  7. Multiphoton laser wave-mixing absorption spectroscopy for samarium using a graphite furnace atomizer

    Energy Technology Data Exchange (ETDEWEB)

    Maniaci, Michael J.; Tong, William G. E-mail:


    Nonlinear laser wave-mixing optical technique is presented as a sensitive atomic spectroscopic method for the analysis of rare earth elements using an unmodified commercially available graphite furnace (GF) atomizer. A simple nonplanar backward-scattering degenerate four-wave mixing optical arrangement offers sub-picogram detection sensitivity with sub-Doppler Lorentzian-broadened resolution. Nonlinear wave mixing is an unusually sensitive absorption-based optical method that offers both excellent detection sensitivity and sub-Doppler spectral resolution. A mass detection limit of 0.7 pg and a concentration detection limit of 70 pg/ml are determined for a rare earth element, samarium, using the 429.7-nm excitation line.

  8. Samarium Doped Cerium Oxide Clusters: a Study on the Modulation of Electronic Structure (United States)

    Topolski, Josey E.; Kafader, Jared O.; Marrero-Colon, Vicmarie; Chick Jarrold, Caroline


    Cerium oxide is known for its use in solid oxide fuel cells due to its high ionic conductivity. The doping of trivalent samarium atoms into cerium oxide is known to enhance the ionic conductivity through the generation of additional oxygen vacancies. This study probes the electronic structure of Sm_{x}Ce_{y}O_{z} (x+y=3, z=2-4) anion and neutral clusters. Anion photoelectron spectra of these mixed metal clusters exhibit additional spectral features not present in the previously studied cerium oxide clusters. Density functional theory calculations have been used to aid interpretation of collected spectra. The results of this work can be used to inform the design of materials used for solid oxide fuel cells.

  9. Chelating Ligand-Mediated Hydrothermal Synthesis of Samarium Orthovanadate with Decavanadate as Vanadium Source

    Directory of Open Access Journals (Sweden)

    Quanguo Li


    Full Text Available A new ethylenediaminetetraacetic acid- (EDTA- mediated hydrothermal route to prepare chrysanthemum-shaped samarium orthovanadate (SmVO4 nanocrystals with decavanadate (K6V10O28·9H2O as vanadium source has been developed. The present hydrothermal approach is simple and reproducible and employs a relatively mild reaction temperature. The EDTA, pH value, and temperature of the reaction systems play important roles in determining the morphologies and growth process of the SmVO4 products. The products have been characterized by X-ray diffraction (XRD, scanning electron microscopy (SEM, Fourier transform infrared spectroscopy (FT-IR, photoluminescence spectra (PL, and UV-Vis spectroscopy.

  10. The Magnetocaloric Effect and Heat Capacity of Suspensions of High-Dispersity Samarium Ferrite (United States)

    Korolev, V. V.; Aref'ev, I. M.; Ramazanova, A. G.


    The magnetocaloric effect and specific heat capacity of an aqueous suspension of samarium ferrite were determined calorimetrically over the temperature range 288-343 K in magnetic fields of 0-0.7 T. The data obtained were used to calculate changes in the magnetic component of the molar heat capacity and entropy of the magnetic phase and changes in the enthalpy of the process under an applied magnetic field. The magnetocaloric effect was found to increase nonlinearly as the magnetic field induction grew. The corresponding temperature dependences contained a maximum at 313 K related to the second-order magnetic phase transition at the Curie point. The field and temperature dependences of heat capacity contained a maximum in fields of 0.4 T and a minimum at the magnetic phase transition temperature.

  11. Preparation of hollow core/shell microspheres of hematite and its adsorption ability for samarium. (United States)

    Yu, Sheng-Hui; Yao, Qi-Zhi; Zhou, Gen-Tao; Fu, Sheng-Quan


    Hollow core/shell hematite microspheres with diameter of ca. 1-2 μm have been successfully achieved by calcining the precursor composite microspheres of pyrite and polyvinylpyrrolidone (PVP) in air. The synthesized products were characterized by a wide range of techniques including powder X-ray diffraction (XRD), field-emission scanning electron microscopy (FESEM), energy-dispersive X-ray spectroscopy (EDX), transmission electron microscopy (TEM), high-resolution TEM (HRTEM), thermogravimetric analysis (TGA) and differential scanning calorimetry (DSC), and Brunauer-Emmett-Teller (BET) gas sorptometry. Temperature- and time-dependent experiments unveil that the precursor pyrite-PVP composite microspheres finally transform into hollow core/shell hematite microspheres in air through a multistep process including the oxidation and sulfation of pyrite, combustion of PVP occluded in the precursor, desulfation, aggregation, and fusion of nanosized hematite as well as mass transportation from the interior to the exterior of the microspheres. The formation of the hollow core/shell microspheres dominantly depends on the calcination temperature under current experimental conditions, and the aggregation of hematite nanocrystals and the core shrinking during the oxidation of pyrite are responsible for the formation of the hollow structures. Moreover, the adsorption ability of the hematite for Sm(III) was also tested. The results exhibit that the hematite microspheres have good adsorption activity for trivalent samarium, and that its adsorption capacity strongly depends on the pH of the solution, and the maximum adsorption capacity for Sm(III) is 14.48 mg/g at neutral pH. As samarium is a typical member of the lanthanide series, our results suggest that the hollow hematite microspheres have potential application in removal of rare earth elements (REEs) entering the water environment.

  12. The influence of the technological parameters on the ionic conductivity of samarium doped ceria thin films

    Directory of Open Access Journals (Sweden)

    Mantas Sriubas


    Full Text Available Sm0,20Ce0,80O2 powder was used for the formation of samarium doped cerium oxide (SDC thin films using e-beam. Surface area of powder was 34.9 m2/g and particle size – 0.3-0.5 μm. Thin films were deposited using physical vapor deposition system on SiO2 and Alloy 600 substrates. 2 Å/s – 16 Å/s growth rate and 20 °C – 600 °C substrate temperature were used during the deposition. Ionic conductivity investigation revealed that the maximum ionic conductivity (1.67 S/m has the thin film deposited on 300 °C temperature substrate using 4 Å/s growth rate. Minimum ionic conductivity (0.26 S/m has thin film which was deposited on 20 °C temperature substrate using 8 Å/s growth rate. Vacancy activation energies vary in 0.87 eV – 0.97 eV range. Furthermore the calculations of crystallite size revealed that crystallite size increases with increasing substrate temperature: from 7.50 nm to 46.23 nm on SiO2 substrate and from 9.30 nm to 44.62 nm on Alloy 600 substrate. Molar concentration of samarium in initial evaporated material is 19.38 mol% and varies from 11.37 mol% to 21 mol% in formed thin films depending on technological parameters.DOI:

  13. Formation of Core-Shell Nanoparticles Composed of Magnetite and Samarium Oxide in Magnetospirillum magneticum Strain RSS-1. (United States)

    Shimoshige, Hirokazu; Nakajima, Yoshikata; Kobayashi, Hideki; Yanagisawa, Keiichi; Nagaoka, Yutaka; Shimamura, Shigeru; Mizuki, Toru; Inoue, Akira; Maekawa, Toru


    Magnetotactic bacteria (MTB) synthesize magnetosomes composed of membrane-enveloped magnetite (Fe3O4) or greigite (Fe3S4) particles in the cells. Recently, several studies have shown some possibilities of controlling the biomineralization process and altering the magnetic properties of magnetosomes by adding some transition metals to the culture media under various environmental conditions. Here, we successfully grow Magnetospirillum magneticum strain RSS-1, which are isolated from a freshwater environment, and find that synthesis of magnetosomes are encouraged in RSS-1 in the presence of samarium and that each core magnetic crystal composed of magnetite is covered with a thin layer of samarium oxide (Sm2O3). The present results show some possibilities of magnetic recovery of transition metals and synthesis of some novel structures composed of magnetic particles and transition metals utilizing MTB.

  14. Co-reduction of aluminium and lanthanide ions in molten fluorides: Application to cerium and samarium extraction from nuclear wastes

    Energy Technology Data Exchange (ETDEWEB)

    Gibilaro, M. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France); Massot, L. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France)], E-mail:; Chamelot, P.; Taxil, P. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France)


    This work concerns the method of co-reduction process with aluminium ions in LiF-CaF{sub 2} medium (79-21 mol.%) on tungsten electrode for cerium and samarium extraction. Electrochemical techniques such as cyclic and square wave voltammetries, and potentiostatic electrolyses were used to study the co-reduction of CeF{sub 3} and SmF{sub 3} with AlF{sub 3}. For each of these elements, specific peaks of Al-Ce and Al-Sm alloys formation were observed by voltammetry as well as peaks of pure cerium and aluminium, and pure samarium and aluminium respectively. The difference of potential measured between the solvent reduction and the alloy formation suggests expecting an extraction efficiency of 99.99% of each lanthanide by the process. Different intermetallic compounds were obtained for different potentiostatic electrolysis and were characterised by Scanning Electron Microscopy with EDS probe. The validity of the process was verified by carrying out cerium and samarium extractions in the form of Al-Ln alloy; the extraction efficiency was 99.5% for Ce(III) and 99.4% for Sm(III)

  15. 19 CFR 144.5 - Period of warehousing. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Period of warehousing. 144.5 Section 144.5 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY... warehousing. Merchandise must not remain in a bonded warehouse beyond 5 years from the date of importation or...

  16. 40 CFR 144.4 - Considerations under Federal law. (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Considerations under Federal law. 144... (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM General Provisions § 144.4 Considerations under Federal law. The following is a list of Federal laws that may apply to the issuance of permits under these rules...

  17. 33 CFR 144.01-30 - First-aid kit. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false First-aid kit. 144.01-30 Section...) OUTER CONTINENTAL SHELF ACTIVITIES LIFESAVING APPLIANCES Manned Platforms § 144.01-30 First-aid kit. On each manned platform a first-aid kit approved by the Commandant or the U.S. Bureau of Mines shall be...

  18. MicroRNA-144 inhibits hepatocellular carcinoma cell proliferation ...

    Indian Academy of Sciences (India)


    Jan 20, 2017 ... present study, the expression of miR-144 was firstly analysed in datasets derived from GSE21362 and TCGA, and then detected in HCC tissues and cell lines by quantitative RT-PCR (qRT-PCR) analysis. MiR-144 was shown to be significantly down-regulated in HCC tissues and cell lines. Subsequently ...

  19. 24 CFR 100.144 - Scope of privilege. (United States)


    ... DISCRIMINATORY CONDUCT UNDER THE FAIR HOUSING ACT Discrimination in Residential Real Estate-Related Transactions... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Scope of privilege. 100.144 Section 100.144 Housing and Urban Development Regulations Relating to Housing and Urban Development OFFICE OF...

  20. 21 CFR 522.144 - Arsenamide sodium aqueous injection. (United States)


    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Arsenamide sodium aqueous injection. 522.144 Section 522.144 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... evidence of reduced liver function, a more conservative dosage schedule of 0.1 milliliter per pound of body...

  1. 21 CFR 133.144 - Granular and stirred curd cheese. (United States)


    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Granular and stirred curd cheese. 133.144 Section... (CONTINUED) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.144 Granular and stirred curd cheese. (a) Description. (1...

  2. 14 CFR 135.144 - Portable electronic devices. (United States)


    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Portable electronic devices. 135.144... Equipment § 135.144 Portable electronic devices. (a) Except as provided in paragraph (b) of this section, no... portable electronic device on any of the following U.S.-registered civil aircraft operating under this part...

  3. 27 CFR 20.144 - Packages of completely denatured alcohol. (United States)


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Packages of completely denatured alcohol. 20.144 Section 20.144 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS DISTRIBUTION AND USE OF DENATURED ALCOHOL AND RUM Sale...

  4. 27 CFR 9.144 - Texas High Plains. (United States)


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Texas High Plains. 9.144 Section 9.144 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT... Mexico; Texas” 1954, revised 1973. (2) “Brownfield, Texas; New Mexico” 1954, revised 1973. (3) “Hobbs...

  5. 49 CFR 572.144 - Thorax assembly and test procedure. (United States)


    ... 49 Transportation 7 2010-10-01 2010-10-01 false Thorax assembly and test procedure. 572.144...-year-Old Child Crash Test Dummy, Alpha Version § 572.144 Thorax assembly and test procedure. (a) Thorax (upper torso) assembly (refer to § 572.140(a)(1)(iv)). The thorax consists of the upper part of the torso...

  6. 40 CFR 61.144 - Standard for manufacturing. (United States)


    ... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Standard for manufacturing. 61.144... § 61.144 Standard for manufacturing. (a) Applicability. This section applies to the following manufacturing operations using commercial asbestos. (1) The manufacture of cloth, cord, wicks, tubing, tape...

  7. 10 CFR 1.44 - Office of New Reactors. (United States)


    ... 10 Energy 1 2010-01-01 2010-01-01 false Office of New Reactors. 1.44 Section 1.44 Energy NUCLEAR... Office of New Reactors. The Office of New Reactors— (a) Develops, promulgates and implements regulations... safeguarding of nuclear reactor facilities licensed under part 52 of this chapter prior to initial commencement...

  8. 40 CFR 52.144 - Significant deterioration of air quality. (United States)


    ... quality. 52.144 Section 52.144 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... deterioration of air quality. (a) The requirements of sections 160 through 165 of the Clean Act are not met... lands does not include approvable procedures for preventing the significant deterioration of air quality...

  9. 33 CFR 144.20-5 - Exposure suits. (United States)


    ... § 144.20-5 Exposure suits. This section applies to each MODU except those operating south of 32 degrees... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Exposure suits. 144.20-5 Section... MODU must carry an exposure suit for each person on board. The exposure suit must be stowed in a...

  10. Structural and luminescence properties of samarium doped lead alumino borate glasses (United States)

    Mohan, Shaweta; Kaur, Simranpreet; Singh, D. P.; Kaur, Puneet


    The study reports the effect of samarium concentration on the physical, structural and spectroscopic characteristics of samarium doped lead alumino borate glasses having composition 20PbO-(10-x)Al2O3-70B2O3-xSm2O3; x = 0.1, 0.5, 1.0 and 2.0 mol %. The glasses were fabricated by conventional melt-quenching technique and then characterized by XRD, FTIR, optical absorption and fluorescence spectra. X-ray diffraction studies confirmed the amorphous nature of the prepared glasses. FTIR spectra indicate the presence of BO3, BO4, AlO6 and a few other structural groups. Various physical properties such as density, molar volume, refractive index, rare earth ion concentration, boron-boron distance and polarizability etc. were determined using conventional methods and standard formulae. The Judd-Ofelt theory was applied on the optical absorption spectra of the glasses to evaluate the three phenomenological intensity parameters Ω2, Ω4 and Ω6. The value of Ω2 was found to be highest for glass with 1 mol% Sm2O3 and attributed to the asymmetry of the ligand field at the rare earth ion site and the rare earth oxygen (Sm-O) covalency. The calculated intensity parameters and fluorescence spectra were further used to predict the radiative transition probability (A), radiative lifetime (τR), branching ratio (βR), peak wavelength (λp), effective line widths (Δλeff) and stimulated emission cross-section (σ) for the characteristic 4G5/2 → 6H5/2, 6H7/2 and 6H9/2 transitions of the Sm3+ ion. Concentration quenching was observed for 2 mol% concentration of Sm2O3 and ascribed to energy transfer through various cross-relaxation channels between Sm3+ ions. Reasonably high values of branching ratios and stimulated emission cross-section for the prepared glasses points towards their utility in the development of visible lasers emitting in the reddish-orange spectral region. However, the glass with 1 mol% Sm2O3 was found to show better radiative properties.

  11. X-ray Induced Luminescence Spectroscopy of Samarium Doped Barium Sulfate Prepared by Sintering Method (United States)

    Kumeda, T.; Maeda, K.; Shirano, Y.; Fujiwara, K.; Sakai, K.; Ikari, T.


    X-ray induced luminescence (XL) properties of phosphor materials made of samarium doped barium sulfate have been investigated. The samples were prepared by sintering method heated at 900-1250 °C for 3 hours in air from the mixture of BaSO4 and Sm2O3. The concentration of Sm were prepared from 0.01-6 at.%. In as-prepared sample, the Sm3+ was detected by photoluminescence (PL). The PL intensity is maximum about 2 at.% with Sm, and then starts decreasing. The PL intensity showed concentration quenching. The XL observed Sm2+ and Sm3+ ions. The XL was shown from the sample sintered up to 1200 °C. The XL intensity increased with Sm concentration up to 1 at.%. The intensity was almost constant larger than 1 at.% Sm. These concentration dependences is different since the X-ray energy absorbed to the host material at once, and the energy transferred to both Sm3+ and Sm2+ ions. Sm doped BaSO4 is found a host for XL phosphor materials.

  12. High-κ Samarium-Based Metal-Organic Framework for Gate Dielectric Applications. (United States)

    Pathak, Abhishek; Chiou, Guan Ru; Gade, Narsinga Rao; Usman, Muhammad; Mendiratta, Shruti; Luo, Tzuoo-Tsair; Tseng, Tien Wen; Chen, Jenq-Wei; Chen, Fu-Rong; Chen, Kuei-Hsien; Chen, Li-Chyong; Lu, Kuang-Lieh


    The self-assembly of a samarium-based metal-organic framework [Sm2(bhc)(H2O)6]n (1) in good yield was achieved by reacting Sm(NO3)3·6H2O with benzenehexacarboxylic acid (bhc) in a mixture of H2O-EtOH under hydrothermal conditions. A structural analysis showed that compound 1 crystallized in a space group of Pnmn and adopted a 3D structure with (4,8) connected nets. Temperature dependent dielectric measurements showed that compound 1 behaves as a high dielectric material with a high dielectric constant (κ = 45.1) at 5 kHz and 310 K, which is comparable to the values for some of the most commonly available dielectric inorganic metal oxides such as Sm2O3, Ta2O5, HfO2, and ZrO2. In addition, electrical measurements of 1 revealed an electrical conductivity of about 2.15 × 10-7 S/cm at a frequency of 5 kHz with a low leakage current (Ileakage = 8.13 × 10-12 Amm-2). Dielectric investigations of the Sm-based MOF provide an effective path for the development of high dielectric materials in the future.

  13. Pyroelectric properties and electrical conductivity in samarium doped BiFeO 3 ceramics

    KAUST Repository

    Yao, Yingbang


    Samarium (Sm 3+) doped BiFeO 3 (BFO) ceramics were prepared by a modified solid-state-reaction method which adopted a rapid heating as well as cooling during the sintering process. The pyroelectric coefficient increased from 93 to 137 μC/m 2 K as the Sm 3+ doping level increased from 1 mol% to 8 mol%. Temperature dependence of the pyroelectric coefficient showed an abrupt decrease above 80 °C in all samples, which was associated with the increase of electrical conductivity with temperature. This electrical conduction was attributed to oxygen vacancy existing in the samples. An activation energy of ∼0.7 eV for the conduction process was found to be irrespective of the Sm 3+ doping level. On the other hand, the magnetic Néel temperature (T N) decreased with increasing Sm 3+ doping level. On the basis of our results, the effects of Sm doping level on the pyroelectric and electrical properties of the BFO were revealed. © 2011 Elsevier Ltd. All rights reserved.

  14. Characterization of luminescent samarium doped HfO{sub 2} coatings synthesized by spray pyrolysis technique

    Energy Technology Data Exchange (ETDEWEB)

    Chacon-Roa, C [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Guzman-Mendoza, J [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Aguilar-Frutis, M [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Garcia-Hipolito, M [Departamento de Materiales Metalicos y Ceramicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autonoma de Mexico, A.P. 70-360 Coyoacan 04510, Mexico, D.F. (Mexico); Alvarez-Fragoso, O [Departamento de Materiales Metalicos y Ceramicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autonoma de Mexico, A.P. 70-360 Coyoacan 04510, Mexico, D.F. (Mexico); Falcony, C [Departamento de Fisica, CINVESTAV-IPN, A. P. 14-740, 07000 Mexico D.F. (Mexico)


    Trivalent samarium (Sm{sup 3+}) doped hafnium oxide (HfO{sub 2}) films were deposited using the spray pyrolysis deposition technique. The films were deposited on Corning glass substrates at temperatures ranging from 300 to 550 deg. C using chlorides as raw materials. Films, mostly amorphous, were obtained when deposition temperatures were below 350 deg. C. However, for temperatures higher than 400 deg. C, the films became polycrystalline, presenting the HfO{sub 2} monoclinic phase. Scanning electron microscopy of the films revealed a rough surface morphology with spherical particles. Also, electron energy dispersive analysis was performed on these films. The photoluminescence and cathodoluminescence characteristics of the HfO{sub 2} : SmCl{sub 3} films, measured at room temperature, exhibited four main bands centred at 570, 610, 652 and 716 nm, which are due to the well-known intra-4f transitions of the Sm{sup 3+} ion. It was found that the overall emission intensity rose as the deposition temperature was increased. Furthermore, a concentration quenching of the luminescence intensity was also observed.

  15. Samarium-153 EDTMP for metastatic bone pain palliation: the impact of europium impurities. (United States)

    Kalef-Ezra, J A; Valakis, S T; Pallada, S


    To evaluate the impact on the radiation protection policies of the radiocontaminants in Samarium-153 ethylenediamine tetramethylene phosphonate ((153)Sm-EDTMP). The internal contamination of patients treated with (153)Sm-EDMTP for palliation of painful disseminated multiple bone metastases due to long-lived impurities was assessed by direct measurements. These measurements were coupled with dose-rate measurements close to their bodies and spectroscopic analysis of the residual activity in post-treatment radiopharmaceutical vials. Whole-body counting carried out in six patients showed a 30-81-kBq europium -152 plus europium-154 contamination. The 0.85 mean (152)Eu- to -(154)Eu activity ratio obtained by direct counting was similar to that assessed by analysis of post-treatment residual activities in twelve radiopharmaceutical vials following radiopharmaceutical injection. The long-lived radiocontaminants in the patient's bodies and the treatment wastes require modifications of the applicable radiation protection policies. Copyright © 2014 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  16. Luminescence of trivalent samarium ions in silver and tin co-doped aluminophosphate glass (United States)

    Jiménez, José A.; Lysenko, Sergiy; Liu, Huimin; Sendova, Mariana


    This work presents the spectroscopic properties of trivalent samarium ions in a melt-quenched aluminophosphate glass containing silver and tin. Addition of 4 mol% of each Ag 2O and SnO into the glass system with 2 mol% Sm 2O 3 results in Sm 3+ ions luminescence under non-resonant UV excitation owing to energy transfer from single silver ions and/or twofold-coordinated Sn centers. Assessment of luminescence spectra and decay dynamics suggest the energy transfer mechanism to be essentially of the resonant radiative type. Moreover, a connection between the luminescent and structural properties of the rare-earth doped glass system was demonstrated. Raman spectroscopy characterization revealed that no significant variation in the glass matrix is induced by Sm 3+ doping at the concentration employed. A comparison was made with a structural study performed on the Eu 3+ doped system (containing 2 mol% Eu 2O 3 along with 4 mol% of each Ag 2O and SnO) where the radiative energy transfer mechanism was previously established. The data appears consistent regarding the lack of variation in glass structure upon the Eu 3+ and Sm 3+ doping in connection with the dominance of the radiative transfer in the matrix. Thermal treatment of the material leads to precipitation of Ag nanoparticles of a broad size range inside the dielectric as observed by transmission electron microspcopy. Assessment of 4G 5/2 excited state decay in Sm 3+ ions shows no influence from the silver particles.

  17. Samarium (III) adsorption on bentonite modified with N-(2-hydroxyethyl) ethylenediamine. (United States)

    Li, Dandan; Chang, Xijun; Hu, Zheng; Wang, Qihui; Li, Ruijun; Chai, Xiaoli


    A new material has been synthesized using dry process to activate bentonite followed by N-(2-hydroxyethyl) ethylenediamine connecting chlorosilane coupling agent. The synthesized new material was characterized by elemental analysis, FT-IR and thermogravimetry which proved that bentonite was successfully modified. The most interesting trait of the new material was its selective adsorption for rare earth elements. A variety of conditions of the new material were investigated for adsorption. The optimal conditions were determined with respect to pH and shaking time. Samarium (Sm) was quantitatively adsorbed at pH 4 and shaking time of 2 min onto the new material. Under these conditions the maximum static adsorption capacity of Sm(III) was found to be 17.7 mg g(-1). The adsorbed Sm(III) ion were quantitatively eluted by 2.0 mL 0.1 mol L(-1) HCl and 5% CS (NH(2))(2) solution. According to IUPAC definition, the detection limit (3σ) of this method was 0.60 ng mL(-1). The relative standard deviation (RSD) under optimum conditions was less than 3% (n=8). The new material also was applied for the preconcentration of trace Sm(III) in environmental samples with satisfactory results. Copyright © 2010 Elsevier B.V. All rights reserved.

  18. Phenotype abnormality: 144 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 144 decreased efficiency... in organ named chloroplast during process named chloroplast fission ... decreased efficiency ...

  19. 7 CFR 58.144 - Pasteurization or ultra-pasteurization. (United States)



  20. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Mandiwana, Vusani, E-mail:; Kalombo, Lonji, E-mail: [Centre of Polymers and Composites, CSIR (South Africa); Venter, Kobus, E-mail: [South African Medical Research Council (South Africa); Sathekge, Mike, E-mail: [University of Pretoria and Steve Biko Academic Hospital, Department of Nuclear Medicine (South Africa); Grobler, Anne, E-mail:; Zeevaart, Jan Rijn, E-mail: [North-West University, DST/NWU Preclinical Drug Development Platform (South Africa)


    Developing nanoparticulate delivery systems that will allow easy movement and localization of a drug to the target tissue and provide more controlled release of the drug in vivo is a challenge in nanomedicine. The aim of this study was to evaluate the biodistribution of poly(d,l-lactide-co-glycolide) (PLGA) nanoparticles containing samarium-153 oxide ([{sup 153}Sm]Sm{sub 2}O{sub 3}) in vivo to prove that orally administered nanoparticles alter the biodistribution of a drug. These were then activated in a nuclear reactor to produce radioactive {sup 153}Sm-loaded-PLGA nanoparticles. The nanoparticles were characterized for size, zeta potential, and morphology. The nanoparticles were orally and intravenously (IV) administered to rats in order to trace their uptake through imaging and biodistribution studies. The {sup 153}Sm-loaded-PLGA nanoparticles had an average size of 281 ± 6.3 nm and a PDI average of 0.22. The zeta potential ranged between 5 and 20 mV. The [{sup 153}Sm]Sm{sub 2}O{sub 3} loaded PLGA nanoparticles, orally administered were distributed to most organs at low levels, indicating that there was absorption of nanoparticles. While the IV injected [{sup 153}Sm]Sm{sub 2}O{sub 3}-loaded PLGA nanoparticles exhibited the highest localization of nanoparticles in the spleen (8.63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems would be suitable for improving permeability and thus the bioavailability of therapeutic compounds.

  1. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles (United States)

    Mandiwana, Vusani; Kalombo, Lonji; Venter, Kobus; Sathekge, Mike; Grobler, Anne; Zeevaart, Jan Rijn


    Developing nanoparticulate delivery systems that will allow easy movement and localization of a drug to the target tissue and provide more controlled release of the drug in vivo is a challenge in nanomedicine. The aim of this study was to evaluate the biodistribution of poly( d, l-lactide- co-glycolide) (PLGA) nanoparticles containing samarium-153 oxide ([153Sm]Sm2O3) in vivo to prove that orally administered nanoparticles alter the biodistribution of a drug. These were then activated in a nuclear reactor to produce radioactive 153Sm-loaded-PLGA nanoparticles. The nanoparticles were characterized for size, zeta potential, and morphology. The nanoparticles were orally and intravenously (IV) administered to rats in order to trace their uptake through imaging and biodistribution studies. The 153Sm-loaded-PLGA nanoparticles had an average size of 281 ± 6.3 nm and a PDI average of 0.22. The zeta potential ranged between 5 and 20 mV. The [153Sm]Sm2O3 loaded PLGA nanoparticles, orally administered were distributed to most organs at low levels, indicating that there was absorption of nanoparticles. While the IV injected [153Sm]Sm2O3-loaded PLGA nanoparticles exhibited the highest localization of nanoparticles in the spleen (8.63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems would be suitable for improving permeability and thus the bioavailability of therapeutic compounds.

  2. Fabrication and properties of samarium doped calcium sulphate thin films using spray pyrolysis technique

    Energy Technology Data Exchange (ETDEWEB)

    Reghima, Meriem [Université Tunis El Manar, Faculté des Sciences de Tunis, Département de Physique, LR99ES13 Laboratoire de Physique de la Matière Condensée (LPMC), 2092 Tunis, Tunisie (Tunisia); Institut d' Electronique et des systèmes, Unité Mixte de Recherche 5214 UM2-CNRS (ST2i) – Université Montpellier, 860 rue de Saint Priest, Bâtiment 5, 34097 Montpellier (France); Faculté des Sciences de Bizerte, Université de Carthage, Zarzouna 7021 (Tunisia); Guasch, Cathy [Institut d' Electronique et des systèmes, Unité Mixte de Recherche 5214 UM2-CNRS (ST2i) – Université Montpellier, 860 rue de Saint Priest, Bâtiment 5, 34097 Montpellier (France); Azzaza, Sonia; Alleg, Safia [Laboratoire de Magnétisme et Spectroscopie des Solides (LM2S), Département de Physique, Faculté des Sciences, Université Badji Mokhtar Annaba, B.P. 12, 23000 Annaba (Algeria); Kamoun-Turki, Najoua [Université Tunis El Manar, Faculté des Sciences de Tunis, Département de Physique, LR99ES13 Laboratoire de Physique de la Matière Condensée (LPMC), 2092 Tunis, Tunisie (Tunisia)


    Using low cost spray pyrolysis technique, polycrystalline CaSO{sub 4} thin films were successfully grown on a glass substrate with a thickness of about 1 μm. Samarium doping has been performed on CaSO{sub 4} thin films to explore luminescence properties. The characterizations of these films were carried out using X-ray diffraction, Scanning Electron Microscopy and optical measurements. The structural analyses reveal the existence of hexagonal CaSO{sub 4} phase with a (200) preferred orientation belonging to CaS compound for substrate temperatures below 350 °C. It is shown that the crystallinity of the sprayed thin films can be improved by increasing substrate temperature up to 250 °C. Warren-Averbach analysis has been applied on X-ray diffractogram to determine structural parameters involving the phase with its amount, the grain size and the lattice parameters using Maud software. The surface topography shows a rough surface covered by densely packed agglomerated clusters having faceted and hexagonal shapes. Energy dispersive microscopy measurements confirm the presence of calcium and sulfur in equal proportions as well as high percentage of oxygen. Photoluminescence at room temperature revealed that luminescence peaks are attributed to the intrinsic emission of pure CaSO{sub 4} phase. - Highlights: • Warren Averbach analysis reveal the presence of hcp structure of CaSO{sub 4} phase. • A mixture of CaSO{sub 4} and CaHO{sub 4.5}S phases has been detected for lower T{sub s}. • For increasing T{sub s}, the CaHO{sub 4.5}S phase has been disappeared. • The origin of PL peaks has been identified.

  3. Optical properties and electronic transitions of zinc oxide, ferric oxide, cerium oxide, and samarium oxide in the ultraviolet and extreme ultraviolet

    DEFF Research Database (Denmark)

    Pauly, N; Yubero, F; Espinós, J P


    Optical properties and electronic transitions of four oxides, namely zinc oxide, ferric oxide, cerium oxide, and samarium oxide, are determined in the ultraviolet and extreme ultraviolet by reflection electron energy loss spectroscopy using primary electron energies in the range 0.3-2.0 keV. This...

  4. Optical response and magnetic characteristic of samarium doped zinc phosphate glasses containing nickel nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Azmi, Siti Amlah M.; Sahar, M.R., E-mail:


    A magnetic glass of composition 40ZnO–(58−x) P{sub 2}O{sub 5}–1Sm{sub 2}O{sub 3}–xNiO, with x=0.0, 1.0, 1.5 and 2.0 mol% is prepared by melt-quenching technique. The glass is characterized by X-ray diffraction, high-resolution transmission electron microscope (HRTEM), photoluminescence (PL) spectroscopy and vibrating sample magnetometer (VSM) analysis. The X-rays diffraction confirms the amorphous nature of the glass while the HRTEM analysis reveals the presence of nickel nanoparticles in the glass samples. High-resolution TEM reveals that the lattice spacing of nickel nanoparticles is 0.35 nm at (100) plane. Photoluminescence emission shows the existence of four peaks that correspond to the transition from the upper level of {sup 4}G{sub 5/2} to the lower level of {sup 6}H{sub 5/2}, {sup 6}H{sub 7/2}, {sup 6}H{sub 9/2,} and {sup 6}H{sub 11/2.} It is observed that all peaks experience significant quenching effect with the increasing concentration of nickel nanoparticles, suggesting a strong energy transfer from excited samarium ions to the nickel ions. The glass magnetization and susceptibility at 12 kOe at room temperature are found to be in the range of (3.87±0.17×10{sup −2}–7.19±0.39×10{sup −2}) emu/g and (3.24±0.16×10{sup −6}–5.99±0.29×10{sup −6}) emu/Oe g respectively. The obtained hysteresis curve indicates that the glass samples are paramagnetic materials. The studied glass can be further used towards the development of magneto-optical functional glass. - Highlights: • Sm{sup 3+} doped zinc phosphate glass embedded with Ni NPs has been prepared. • The Laue pattern and lattice spacing of Ni NPs are confirmed by HRTEM image. • The magnetic response of glasses has been studied through VSM analysis. • Enhancement factor and decay half-lifetime are investigated.

  5. Treatment of bone pain secondary to metastases using samarium-153-EDTMP

    Directory of Open Access Journals (Sweden)

    Elba Cristina Sá de Camargo Etchebehere

    Full Text Available CONTEXT: More than 50% of patients with prostate, breast or lung cancer will develop painful bone metastases. The purpose of treating bone metastases is to relieve pain, reduce the use of steroids and to maintain motion. OBJECTIVE: To evaluate the use of samarium-153-EDTMP (153Sm-EDTMP for the treatment of bone pain secondary to metastases that is refractory to clinical management. TYPE OF STUDY: Retrospective. SETTING: Division of Nuclear Medicine, Universidade Estadual de Campinas (Unicamp. METHODS: Fifty-eight patients were studied (34 males with mean age 62 years; 31 patients had prostate cancer, 20 had breast cancer, three had lung cancer, one had lung hemangioendothelioma, one had parathyroid adenocarcinoma, one had osteosarcoma and one had an unknown primary tumor. All patients had multiple bone metastases demonstrated by bone scintigraphy using 99mTc-MDP,and were treated with 153Sm-EDTMP. Response to treatment was graded as good (pain reduction of 50-100%, intermediate (25-49% and poor (0-24%. RESULTS: All patients showed good uptake of 153Sm-EDTMP by bone metastases. Among the patients with prostate cancer, intermediate or good response to therapy occurred in 80.6% (25 patients and poor response in 19.4% (6. Among the patients with breast cancer, 85% (17 showed intermediate or good response to therapy while 15% (3 showed poor response. All three patients with lung cancer showed poor response to treatment. The lung hemangioendothelioma and unknown primary lesion patients showed intermediate response to treatment; the osteosarcoma and parathyroid adenocarcinoma patients showed good response to treatment. No significant myelotoxicity occurred. DISCUSSION: Pain control is important for improving the quality of life of patients with advanced cancers. The mechanism by which pain is relieved with the use of radionuclides is still not yet completely understood, however, the treatment is simple and provides a low risk of mielotoxicity

  6. Anchoring samarium oxide nanoparticles on reduced graphene oxide for high-performance supercapacitor

    Energy Technology Data Exchange (ETDEWEB)

    Dezfuli, Amin Shiralizadeh [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Ganjali, Mohammad Reza, E-mail: [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Biosensor Research Center, Endocrinology & Metabolism Molecular-Cellular Sciences Institute, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Naderi, Hamid Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of)


    Highlights: • Samarium oxide nanoparticles have been anchored on the surface of reduced graphene oxide for the first time. • Sm{sub 2}O{sub 3}/RGO nanocomposite show high capacitance, good rate and cycling performance. • Sm{sub 2}O{sub 3}/RGO nanocomposite can serve as efficient electrode material for energy storage. • The best composite electrode exhibits specific capacitance of 321 F g{sup −1} in 2 mV s{sup −1}. - Abstract: We have synthesized Sm{sub 2}O{sub 3} nanoparticles (SmNs) and anchored them onto the surface of reduced graphene oxide (RGO) through a self-assembly thereof by utilizing a facile sonochemical procedure. The nanomaterials were characterized by means of powder X-ray diffraction (XRD), Field-emission scanning electron microscopy (FE-SEM), fourier transform infrared spectroscopy (FT-IR) spectra, and X-ray photoelectron spectroscopy (XPS). As the next step, the supercapacitive behavior of the resulting nanocomposites were investigated when used as electrode material, through with cyclic voltammetric (CV), galvanostatic charge-discharge and electrochemical impedance spectroscopy (EIS) techniques. The SmNs decorated RGO (SmN-RGO) nanocomposites were found to possess a specific capacitance (SC) of 321 F g{sup −1} when used in a 0.5 M Na{sub 2}SO{sub 4} solution as an electrolyte, in a scan rate of 2 mV s{sup −1}. The SC of the SmN-RGO based electrodes were also found to be 268 F g{sup −1} at a current density of 2 A g{sup −1} through galvanostatic charge-discharge tests. The outstanding properties of the SmN-RGOs were attributed to synergy of the high charge mobility of SmNs and the flexibility of the sheets of RGOs. Additionally, the nano-composite revealed a unique cycling durability (maintaining 99% of its SC even after 4000 cycles).

  7. 42 CFR 410.144 - Quality standards for deemed entities. (United States)


    ... of continuing diabetes education concerning educational principles and behavior change strategies... dental care. (ix) Behavior change strategies, goal setting, risk factor reduction, and problem solving...-Management Training and Diabetes Outcome Measurements § 410.144 Quality standards for deemed entities. An...

  8. 40 CFR 144.11 - Prohibition of unauthorized injection. (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Prohibition of unauthorized injection... PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM General Program Requirements § 144.11 Prohibition of unauthorized injection. Any underground injection, except into a well authorized by rule or...

  9. 40 CFR 144.5 - Confidentiality of information. (United States)


    ... Section 144.5 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS... submissions, by stamping the words “confidential business information” on each page containing such... which deals with the existence, absence, or level of contaminants in drinking water. ...

  10. 19 CFR 144.37 - Withdrawal for exportation. (United States)


    ... provided for by law. In any case, the port director may require a special report of weight, gauge, or... not applicable with respect to purchasers at airport duty-free enterprises; and (vi) A statement on... file. Editorial Note: For Federal Register citations affecting § 144.37, see the List of CFR Sections...

  11. 33 CFR 144.10-1 - Lifesaving equipment. (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Lifesaving equipment. 144.10-1... equipment. (a) Except as allowed in paragraph (b) of this section, no person may be on an unmanned platform unless the following lifesaving equipment is readily accessible on the platform: (1) A life preserver or...

  12. 22 CFR 144.150 - Program accessibility: Existing facilities. (United States)


    ... of achieving program accessibility include— (i) Using audio-visual materials and devices to depict... action that it can demonstrate would result in a fundamental alteration in the nature of a program or... § 144.150(a) would result in such alteration or burdens. The decision that compliance would result in...

  13. Effect of Current Density on Thermodynamic Properties of Nanocrystalline Palladium Capped Samarium Hydride Thin Film Switchable Mirrors

    Directory of Open Access Journals (Sweden)

    Pushpendra Kumar


    Full Text Available A 55 nm samarium film capped with a 10 nm palladium overlayer switched from a metallic reflecting to a semiconducting, transparent in visible state during ex-situ hydrogen loading via electrochemical means in 1 M KOH electrolytic aqueous solution at room temperature. The switching between metal to semiconductor was accompanied by measurement of transmittance during hydrogen loading/unloading. The effect of current density on switching and thermodynamic properties was studied between dihydride state (FCC phase and trihydride state (hexagonal phase. From the plateau of partial pressure of hydrogen at x=2.6, enthalpy of formation was calculated at different current densities. The diffusion coefficients and switching kinetics are shown to depend on applied current density.

  14. Targeted bone marrow radioablation with 153Samarium-lexidronam promotes allogeneic hematopoietic chimerism and donor-specific immunologic hyporesponsiveness. (United States)

    Inverardi, Luca; Linetsky, Elina; Pileggi, Antonello; Molano, R Damaris; Serafini, Aldo; Paganelli, Giovanni; Ricordi, Camillo


    Transplantation tolerance, defined as acceptance of a graft by an otherwise fully immunocompetent host, has been an elusive goal. Although robust tolerance has been achieved by the induction of stable hematopoietic chimerism after bone marrow transplantation, lethal or sublethal radiation conditioning used to induce long-term chimerism precludes its clinical use. We studied whether targeted delivery of radiation to bone marrow could allow for bone marrow cell (BMC) engraftment, chimerism, and donor-specific tolerance in the absence of the side effects associated with external irradiation. We administered a radioactive bone-seeking compound (Samarium-Lexidronam, Quadramet, Berlex Laboratories, Wayne, NJ) together with transient T-cell costimulatory blockade to recipient mice. Allogeneic BMCs were given 7 or 14 days after preconditioning. Costimulatory blockade was obtained by the use of an anti-CD154 antibody for 4 weeks. Chimerism was assessed by flow cytometry. Mice then received donor-specific and third-party skin grafts. Graft survival was analyzed with mechanisms of donor-specific hyporesponsiveness. High levels of stable chimerism across an allogeneic barrier were achieved in mice by a single administration of Samarium-Lexidronam, transient T-cell costimulatory blockade, and BMC transplantation. A large percentage of chimeric animals retained donor-derived skin grafts for more than 120 days without requiring additional immunosuppression, suggesting that harsh cytotoxic preconditioning is not necessary to achieve stable chimerism and donor specific hyporesponsiveness. Analysis of the T-cell repertoire in chimeras indicates T-cell deletional mechanisms. These data broaden the potential use of BMC transplantation for tolerance induction and argue for its potential in treating autoimmune diseases.

  15. Sorption of samarium in soils: influence of soil properties and Sm concentration

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez-Guinart, Oriol; Salaberria, Aitor; Rigol, Anna; Vidal, Miquel [Analytical Chemistry department, Faculty of Chemistry, University of Barcelona, Marti i Franques 1-11, 08028, Barcelona (Spain)


    Due to the fact that barriers of Deep Geological Repositories (DGR) may lose efficiency before the radioisotopes present in the High Level Radioactive Waste (HLRW) completely decay, it is possible that, in the long-term, radioactive leachates may escape from the DGR and reach the soil and water compartments in the biosphere. Therefore, it is required to examine the interaction and mobility of radionuclides present in the HLRW, or their chemical analogues, to predict the impact of their eventual incorporation in the biosphere and to assess the derived risk. Although relevant data have been recently obtained for a few radionuclides in soils, there are still some important gaps for some radionuclides, such us for samarium (Sm). Sm is a lanthanide that, besides being considered as a natural analogue of actinides, may also be present in HLRW in the form of the radioactive isotope {sup 151}Sm. The main objective of this work was to obtain sorption data (K{sub d}) of {sup 151}Sm gathered from a set of soil samples physicochemical fully-characterized (pH, texture, cationic exchange capacity, soil solution cationic composition, organic matter, carbonate and metallic oxides content, etc.). Additionally, as an alternative for testing sorption capacity of radionuclides in soils is the use of the corresponding stable isotope or a chemical analogue, the influence of Sm concentration was also checked. To evaluate {sup 151}Sm sorption, batch assays were carried out for each soil sample, which consisted in a pre-equilibration step of 2 g of each soil with 50 ml of double deionised water, and a subsequent equilibration step with the same solution, but labelled with {sup 151}Sm. The activity of {sup 151}Sm in initial and final solutions was measured by liquid scintillation and K{sub d} ({sup 151}Sm) data were calculated. The reversibly sorbed fraction was estimated by the application of a single extraction test, with double deionised water, to soil residues coming from the previous

  16. Crystal growth of semiorganic complex- samarium chloride coordinated thiourea-L-tartaric acid and its studies on structure and optical characteristics (United States)

    Slathia, Goldy; Singh, Harjinder; Ramya, E.; Rao, D. Narayana; Bamzai, K. K.


    The semi-organic complex of samarium chloride coordinated thiourea-L-tartaric acid (SCTLT) has been grown as a single crystal by slow evaporation technique at room temperature. For structural studies, the grown crystal was subjected to single crystal X-ray diffraction and Fourier transform infra-red (FTIR) spectroscopy. Low cut off wavelength and transparent characteristics were explored by UV-VIS optical characterization. Third-order nonlinear optical properties of grown crystal were investigated by Z-scan technique.

  17. Sorption of samarium in iron (II) and (III) phosphates in aqueous systems; Sorcion de samario en fosfatos de hierro (II) y (III) en sistemas acuosos

    Energy Technology Data Exchange (ETDEWEB)

    Diaz F, J.C


    The radioactive residues that are stored in the radioactive confinements its need to stay isolated of the environment while the radioactivity levels be noxious. An important mechanism by which the radioactive residues can to reach the environment, it is the migration of these through the underground water. That it makes necessary the investigation of reactive materials that interacting with those radionuclides and that its are able to remove them from the watery resources. The synthesis and characterization of materials that can be useful in Environmental Chemistry are very important because its characteristics are exposed and its behavior in chemical phenomena as the sorption watery medium is necessary to use it in the environmental protection. In this work it was carried out the sorption study of the samarium III ion in the iron (II) and (III) phosphate; obtaining the sorption isotherms in function of pH, of the phosphate mass and of the concentration of the samarium ion using UV-visible spectroscopy to determine the removal percentage. The developed experiments show that as much the ferrous phosphate as the ferric phosphate present a great affinity by the samarium III, for what it use like reactive material in contention walls can be very viable because it sorption capacity has overcome 90% to pH values similar to those of the underground and also mentioning that the form to obtain these materials is very economic and simple. (Author)

  18. Trace amounts of rare earth elements in high purity samarium oxide by sector field inductively coupled plasma mass spectrometry after separation by HPLC

    Energy Technology Data Exchange (ETDEWEB)

    Pedreira, W.R. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil) and Fundacao Jorge Duprat Figueiredo de Seguranca e Medicina do Trabalho (FUNDACENTRO), 05409-002 Sao Paulo, SP (Brazil)]. E-mail:; Queiroz, C.A. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Abrao, A. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Rocha, S.M. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Vasconcellos, M.E. de [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Boaventura, G.R. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil); Pimentel, M.M. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil)


    Today there is an increasing need for high purity rare earth compounds in various fields, the optical, the electronics, the ceramic, the nuclear and geochemistry. Samarium oxide has special uses in glass, phosphors, lasers and thermoelectric devices. Calcium chloride crystals treated with samarium have been employed in lasers, which produce light beams intense enough to burn metal. In general, the inductively coupled plasma mass spectrometry (ICP-MS) presents some advantages for trace element analysis, due to high sensitivity and resolution, when compared with other analytical techniques such as ICP optical emission spectrometry (ICP-OES). In this work, sector field inductively coupled plasma mass spectrometry was used. Sixteen elements (Sc, Y and 14 lanthanides) were determined selectively with the ICP-MS system using a concentration gradient method. The detection limits with the ICP-MS system were about 0.2 (La) pg mL{sup -1} to 8 (Gd) pg mL{sup -1}. The %R.S.D. of the methods varying between 0.9 and 1.5% for a set of five (n = 5) replicates was found for the IPEN's material and for the certificate reference sample. Determination of trace REEs in two high pure samarium oxides samples (IPEN and JMC) was performed. IPEN's material is highly pure (>99.99%) and was successfully analyzed without spectral interference (MO{sup +} and MOH{sup +})

  19. 19 CFR 144.7 - Disposition of merchandise after expiration of warehousing period. (United States)


    ... warehousing period. 144.7 Section 144.7 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF... General Provisions § 144.7 Disposition of merchandise after expiration of warehousing period. Merchandise remaining in a bonded warehouse after the expiration of the warehousing period shall be disposed of in...

  20. 40 CFR 144.81 - Does this subpart apply to me? (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Does this subpart apply to me? 144.81 Section 144.81 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS... Wells § 144.81 Does this subpart apply to me? This subpart applies to you if you own or operate a Class...

  1. 40 CFR 144.85 - Do these additional requirements apply to me? (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Do these additional requirements apply to me? 144.85 Section 144.85 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... of Class V Injection Wells § 144.85 Do these additional requirements apply to me? (a) Large-Capacity...

  2. 40 CFR 144.22 - Existing Class II enhanced recovery and hydrocarbon storage wells. (United States)


    ... and hydrocarbon storage wells. 144.22 Section 144.22 Protection of Environment ENVIRONMENTAL... of Underground Injection by Rule § 144.22 Existing Class II enhanced recovery and hydrocarbon storage wells. (a) An existing Class II enhanced recovery or hydrocarbon storage injection well is authorized by...

  3. 38 CFR 21.144 - Vocational course in a sheltered workshop or rehabilitation facility. (United States)


    ... sheltered workshop or rehabilitation facility. 21.144 Section 21.144 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS (CONTINUED) VOCATIONAL REHABILITATION AND EDUCATION Vocational Rehabilitation and Employment Under 38 U.S.C. Chapter 31 Special Rehabilitation Services § 21.144 Vocational course...

  4. 40 CFR 144.12 - Prohibition of movement of fluid into underground sources of drinking water. (United States)


    ... underground sources of drinking water. 144.12 Section 144.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM General Program Requirements § 144.12 Prohibition of movement of fluid into underground sources of drinking water...

  5. 40 CFR 144.80 - What is a Class V injection well? (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false What is a Class V injection well? 144... PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM Requirements for Owners and Operators of Class V Injection Wells § 144.80 What is a Class V injection well? As described in § 144.6, injection wells are...

  6. 25 CFR 39.144 - What is the small high school adjustment? (United States)


    ... 25 Indians 1 2010-04-01 2010-04-01 false What is the small high school adjustment? 39.144 Section 39.144 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR EDUCATION THE INDIAN SCHOOL EQUALIZATION PROGRAM Indian School Equalization Formula Small School Adjustment § 39.144 What is the small high school adjustment? (a) The small high...

  7. Effectiveness of radiation synovectomy with samarium-{sup 153} particulate hydroxyapatite in rheumatoid arthritis patients with knee synovitis: a controlled randomized double-blind trial

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Marla Francisca dos; Furtado, Rita Nely Vilar; Konai, Monique Sayuri; Natour, Jamil, E-mail: jnatour@unifesp.b [Universidade Federal de Sao Paulo (UNIFESP-EPM), Sao Paulo, SP (Brazil). Divisao de Reumatologia; Castiglioni, Mario Luiz Vieira; Marchetti, Renata Rosa [Universidade Federal de Sao Paulo (UNIFESP-EPM), Sao Paulo, SP (Brazil). Divisao de Medicina Nuclear


    Objectives: the aim of the present study was to investigate the effectiveness of Samarium{sup 153}-particulate hydroxyapatite radiation synovectomy in rheumatoid arthritis patients with chronic knee synovitis. Methods: fifty-eight rheumatoid arthritis patients (60 knees) with chronic knee synovitis participated in a controlled double-blinded trial. Patients were randomized to receive either an intra-articular injection with 40 mg triamcinolone hexacetonide alone (TH group) or 40 mg triamcinolone hexacetonide combined with 15 mCi Samarium{sup 153}-particulate hydroxyapatite (Sm/TH group). Blinded examination at baseline (T0) and at 1 (T1), 4 (T4), 12 (T12), 32 (T32), and 48 (T48) weeks post-intervention were performed on all patients and included a visual analog scale for joint pain and swelling as well as data on morning stiffness, flexion, extension, knee circumference, Likert scale of improvement, percentage of improvement, SF-36 generic quality of life questionnaire, Stanford Health Assessment Questionnaire (HAQ), Lequesne index, use of non-steroidal anti-inflammatory drugs or oral corticosteroids, events and adverse effects, calls to the physician, and hospital visits. Results: the sample was homogeneous at baseline, and there were no withdrawals. Improvement was observed in both groups in relation to T0, but no statistically significant differences between groups were observed regarding all variables at the time points studied. The Sm/TH group exhibited more adverse effects at T1 (p<0.05), but these were mild and transitory. No severe adverse effects were reported during follow-up. Conclusion: intra-articular injection of Samarium{sup 153}-particulate hydroxyapatite (15 mCi) with 40 mg of triamcinolone hexacetonide is not superior to triamcinolone hexacetonide alone for the treatment of knee synovitis in patients with rheumatoid arthritis at 1 y of follow-up. (author)

  8. The properties of samarium-doped zinc oxide/phthalocyanine structure for optoelectronics prepared by pulsed laser deposition and organic molecular evaporation

    Czech Academy of Sciences Publication Activity Database

    Novotný, Michal; Marešová, Eva; Fitl, Přemysl; Vlček, Jan; Bergmann, M.; Vondráček, Martin; Yatskiv, Roman; Bulíř, Jiří; Hubík, Pavel; Hruška, Petr; Drahokoupil, Jan; Abdellaoui, N.; Vrňata, M.; Lančok, Ján


    Roč. 122, č. 3 (2016), 1-8, č. článku 225. ISSN 0947-8396 R&D Projects: GA MŠk(CZ) LG15050; GA ČR(CZ) GAP108/11/0958; GA MŠk(CZ) LM2011029; GA ČR(CZ) GA14-10279S; GA MŠk(CZ) 7AMB14FR010 Institutional support: RVO:68378271 ; RVO:67985882 Keywords : samarium-doped zinc oxide zinc/phthalocyanine deposition * evaporation * pulsed laser deposition * thin films Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.455, year: 2016

  9. Neutron Activated Samarium-153 Microparticles for Transarterial Radioembolization of Liver Tumour with Post-Procedure Imaging Capabilities (United States)

    Hashikin, Nurul Ab. Aziz; Yeong, Chai-Hong; Abdullah, Basri Johan Jeet; Ng, Kwan-Hoong; Chung, Lip-Yong; Dahalan, Rehir; Perkins, Alan Christopher


    Introduction Samarium-153 (153Sm) styrene divinylbenzene microparticles were developed as a surrogate for Yttrium-90 (90Y) microspheres in liver radioembolization therapy. Unlike the pure beta emitter 90Y, 153Sm possess both therapeutic beta and diagnostic gamma radiations, making it possible for post-procedure imaging following therapy. Methods The microparticles were prepared using commercially available cation exchange resin, Amberlite IR-120 H+ (620–830 μm), which were reduced to 20–40 μm via ball mill grinding and sieve separation. The microparticles were labelled with 152Sm via ion exchange process with 152SmCl3, prior to neutron activation to produce radioactive 153Sm through 152Sm(n,γ)153Sm reaction. Therapeutic activity of 3 GBq was referred based on the recommended activity used in 90Y-microspheres therapy. The samples were irradiated in 1.494 x 1012 neutron flux for 6 h to achieve the nominal activity of 3.1 GBq.g-1. Physicochemical characterisation of the microparticles, gamma spectrometry, and in vitro radiolabelling studies were carried out to study the performance and stability of the microparticles. Results Fourier Transform Infrared (FTIR) spectroscopy of the Amberlite IR-120 resins showed unaffected functional groups, following size reduction of the beads. However, as shown by the electron microscope, the microparticles were irregular in shape. The radioactivity achieved after 6 h neutron activation was 3.104 ± 0.029 GBq. The specific activity per microparticle was 53.855 ± 0.503 Bq. Gamma spectrometry and elemental analysis showed no radioactive impurities in the samples. Radiolabelling efficiencies of 153Sm-Amberlite in distilled water and blood plasma over 48 h were excellent and higher than 95%. Conclusion The laboratory work revealed that the 153Sm-Amberlite microparticles demonstrated superior characteristics for potential use in hepatic radioembolization. PMID:26382059


    National Aeronautics and Space Administration — C USER'S GUIDE TO RAR 144 SECOND AVERAGED DATA FILES ---------------------------------------------------- This document describes the contents and format of the RAR...

  11. Preparation and examination of properties of samarium-153-EDTMP complex; Otrzymywanie chelatu kwasu etylenodiaminotetrametylenofosfonowego (EDTMP) z samarem-153 i badanie jego wlasciwosci

    Energy Technology Data Exchange (ETDEWEB)

    Nowak, M. [Institute of Atomic Energy, Otwock-Swierk (Poland); Garnuszek, P.; Lukasiewicz, A.; Wozniak, I.; Zulczyk, W. [Osrodek Badawczo-Rozwojowy Izotopow, Otwock-Swierk (Poland); Licinska, I. [Instytut Lekow, Warsaw (Poland)


    Preparation and properties of ethylenediaminetetramethylenephosphonic acid (EDTMP) as well as some properties of {sup 153}Sm-EDTMP chelate have been examined. The chelate formed by samarium-153 (46.3 h, {beta}{sup -}-decay) with EDTMP exhibits high bone uptake and can be used for treatment of disseminated, painful skeletal metastases. The purity and stability of solutions of {sup 153}Sm-EDTMP chelate were examined in a broad range of samarium concentration and {sup 153}Sm specific activity. The complex under study was examined by radio-TLC, -electrophoresis and radio-HPLC. The results obtained suggest the small size of molecules of {sup 153}Sm-EDTMP chelate as compared with molecules of ``free``EDTMP. The results of biodistribution of {sup 153}Sm-EDTMP determined in rats indicate the quick blood clearance, high deposition of radioactivity in bone and quick excretion of radioactivity into urine. No specific uptake of {sup 153}Sm-EDTMP in extra-skeletal organs was found. (author). 42 refs, 13 figs, 22 tabs.

  12. Potential diagnostic implications of miR-144 overexpression in human oesophageal cancer

    Directory of Open Access Journals (Sweden)

    Priyanka Sharma


    Full Text Available Background & objectives: Insidious symptomatology, late clinical presentation and poor prognosis of oesophageal cancer (EC highlight the pressing need for novel non-invasive biomarkers for early tumour diagnosis and better prognosis. The present study was carried out to evaluate the clinical significance of circulating and tissue miR-144 expression in oesophageal cancer. Methods: Clinical significance of miR-144 expression was evaluated in preneoplastic (12 and neoplastic (35 oesophageal cancer tissues as well as matched distant non-malignant tissues using real-time PCR (qPCR. Circulating levels of miR-144 were also analyzed in serum samples of EC patients as well as normal individuals to determine the diagnostic potential of miR-144. Further, targets of miR-144 were predicted using bioinformatic tools and their gene ontology (GO terms were assigned. Results: Real-time PCR analysis revealed significant upregulation of miR-144 in 29 of 35 (83% EC tissues as compared to matched distant non-malignant tissues (P=0.010. a0 ll the dysplastic tissues showed upregulation of miR-144 as compared to their matched distant non-malignant tissues. Relative levels of circulating miR-144 in serum significantly distinguished EC patients from normal controls (P=0.015; AUC = 0.731 with high sensitivity of 94.7 per cent. Bioinformatically predicted target, PUR-aplha (PURA was found to be significantly (P=0.018 downregulated in 81 per cent (26/32 EC patients and its expression was found to be significantly and negatively correlated with miR-144 expression at mRNA level. Interpretation & conclusions: Our findings showed significant upregulation of miR-144 in serum samples of EC patients indicating its potential as minimally invasive marker. Further studies need to be done to understand the role of miR-144 in the pathogenesis of EC.

  13. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints

    Directory of Open Access Journals (Sweden)

    Mohammed Najeeb Al Hallak


    Full Text Available 153Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate and Samarium-153 [1]. 153Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of 153Sm-EDTMP leads to contamination with 154Eu (Europium-154 [2]. A previous study only alluded to the retention of 154Eu in the bones after receiving treatment with 153Sm-EDTMP [2]. Activation of the alarm at security checkpoints after 153Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received 153Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing theAmerican-Canadian border. We assume that the 154Eu which remained in the patients’ bones activated the sensors. Methods: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received 153Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. Results: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of 154Eu emissions. Conclusion: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of 154Eu retained in patients who received 153Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of 153Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with 153Sm-EDTMP at Roger Maris Cancer Center

  14. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints. (United States)

    Najeeb Al Hallak, Mohammed; McCurdy, Matt; Zouain, Nicolas; Hayes, Justin


    (153)Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate) and Samarium-153 [1]. (153)Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of (153)Sm-EDTMP leads to contamination with (154)Eu (Europium-154) [2]. A previous study only alluded to the retention of (154)Eu in the bones after receiving treatment with (153)Sm-EDTMP [2]. Activation of the alarm at security checkpoints after (153)Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received (153)Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA) activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing the American-Canadian border. We assume that the (154)Eu which remained in the patients' bones activated the sensors. METHODS: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received (153)Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. RESULTS: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of (154)Eu emissions. CONCLUSION: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of (154)Eu retained in patients who received (153)Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of (153)Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with (153)Sm-EDTMP at Roger Maris Cancer

  15. 50 CFR 14.4 - What terms do I have to understand? (United States)


    ... domesticus; Cattle—Bos taurus; Dog (domestic)—Canis familiaris; European rabbit—Ortyctolagus cuniculus... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false What terms do I have to understand? 14.4 Section 14.4 Wildlife and Fisheries UNITED STATES FISH AND WILDLIFE SERVICE, DEPARTMENT OF THE INTERIOR...

  16. 7 CFR 457.144 - Northern potato crop insurance-processing quality endorsement. (United States)


    ... endorsement. 457.144 Section 457.144 Agriculture Regulations of the Department of Agriculture (Continued... Northern potato crop insurance—processing quality endorsement. The Northern Potato Crop Insurance Processing Quality Endorsement Provisions for the 2008 and succeeding crop years are as follows: 1...

  17. 19 CFR 144.12 - Contents of entry summary; estimated duties. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Contents of entry summary; estimated duties. 144... Procedures for Warehouse Entry § 144.12 Contents of entry summary; estimated duties. The entry summary, Customs Form 7501, shall show the value, classification, and rate of duty as approved by the port director...

  18. 40 CFR 144.82 - What must I do to protect underground sources of drinking water? (United States)


    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false What must I do to protect underground sources of drinking water? 144.82 Section 144.82 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM Requirements for Owners and...

  19. 26 CFR 1.4-4 - Short taxable year caused by death. (United States)


    ... 26 Internal Revenue 1 2010-04-01 2010-04-01 true Short taxable year caused by death. 1.4-4 Section... Normal Taxes and Surtaxes § 1.4-4 Short taxable year caused by death. An individual making a return for a... results from the death of the taxpayer. Tax on Corporations ...

  20. 14 CFR 91.144 - Temporary restriction on flight operations during abnormally high barometric pressure conditions. (United States)


    ... 14 Aeronautics and Space 2 2010-01-01 2010-01-01 false Temporary restriction on flight operations during abnormally high barometric pressure conditions. 91.144 Section 91.144 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED) AIR TRAFFIC AND GENERAL...

  1. 19 CFR 144.42 - Combined entry for rewarehouse and withdrawal for consumption. (United States)


    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Combined entry for rewarehouse and withdrawal for consumption. 144.42 Section 144.42 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND... applicable to this type of entry, with the following exceptions: (1) Form of entry. A combined entry for...

  2. Formation of a new adduct based on fullerene tris-malonate samarium salt C60-[C60(=C(COO)2)3]Sm2 (United States)

    Petrov, A. A.; Keskinov, V. A.; Semenov, K. N.; Charykov, N. A.; Letenko, D. G.; Nikitin, V. A.


    Gram quantities of a new adduct based on light fullerene tris-malonate samarium salt C60 [C60(=C(COO)2)3]Sm2 are obtained via the reaction of ion exchange. The obtained adduct is studied by means of electron and infrared spectroscopy, X-ray and elemental analysis, electron microscopy, and thermogravimetry. The polythermal solubility of [C60(=C(COO)2)3]Sm2 in water is determined in ampoules via saturation within 20-70°C. The composition of crystalline hydrate [C60(=C(COO)2)3]Sm2 · 36H2O, which exists in equilibrium with the saturated solution, is estimated.

  3. Biodistribution of samarium-153-EDTMP in rats treated with docetaxel Biodistribuição de EDTMP-153-samário em ratos tratados com docetaxel

    Directory of Open Access Journals (Sweden)

    Arthur Villarim Neto


    Full Text Available PURPOSE: Many patients with metastatic bone disease have to use radiopharmaceuticals associated with chemotherapy to relieve bone pain. The aim of this study was to assess the influence of docetaxel on the biodistribution of samarium-153-EDTMP in bones and other organs of rats. METHODS: Wistar male rats were randomly allocated into 2 groups of 6 rats each. The DS (docetaxel/samarium group received docetaxel (15 mg/kg intraperitoneally in two cycles 11 days apart. The S (samarium/control group rats were not treated with docetaxel. Nine days after chemotherapy, all the rats were injected with 0.1ml of samarium-153-EDTMP via orbital plexus (25µCi. After 2 hours, the animals were killed and samples of the brain, thyroid, lung, heart, stomach, colon, liver, kidney and both femurs were removed. The percentage radioactivity of each sample (% ATI/g was determined in an automatic gamma-counter (Wizard-1470, Perkin-Elmer, Finland. RESULTS: On the 9th day after the administration of the 2nd chemotherapy cycle, the rats had a significant weight loss (314.50±22.09g compared (pOBJETIVO: Muitos pacientes com metástases ósseas são tratados com radiofármacos associados com quimioterapia para alívio da dor óssea. O objetivo do trabalho foi estudar a influência do docetaxel na biodistribuição do EDTMP-153-samário nos ossos e outros órgãos de ratos. MÉTODOS: Ratos Wistar foram aleatoriamente alocados em 2 grupos de 6 animais cada. O grupo DS (docetaxel/samário recebeu docetaxel (15 mg/kg intraperitoneal em dois ciclos com 11 dias de intervalo. Os ratos do grupo S (samário/controle não foram tratados com docetaxel. Nove dias após a quimioterapia, todos os animais receberam 0,1ml de EDTMP-153-samário via plexo orbital (25µCi. Após 2 horas, os animais foram mortos e feitas biópsias de cérebro, tireóide, pulmão, coração, estômago, cólon, fígado, rim e fêmures. O percentual de radioatividade por grama (%ATI/g de tecido de cada bi

  4. Marrow irradiation with high-dose 153Samarium-EDTMP followed by chemotherapy and hematopoietic stem cell infusion for acute myelogenous leukemia. (United States)

    Rodriguez, Vilmarie; Anderson, Peter M; Litzow, Mark R; Erlandson, Linda; Trotz, Barbara A; Arndt, Carola A S; Khan, Shakila P; Wiseman, Gregory A


    In four patients, aged 15 - 20 years, with high-risk acute myeloid leukemia (AML), high-dose samarium 153-labelled ethylenediaminetetramethylenephosphonate (153Sm-EDTMP) was used for targeted marrow irradiation before preparative chemotherapy conditioning regimens and allogeneic (three patients) or autologous (one patient) hematopoietic stem cell transplantation. The dose of 153Sm-EDTMP was 703 MBq/kg (n = 1) or 1110 MBq/kg (n = 3). No side-effects occurred during the 30-min infusion of 153Sm-EDTMP. Samarium - melphalan regimens were given to three patients; one had 153Sm-EDTMP - busulfan + cyclophosphamide. Total body radioactivity was below the 133 MBq safe limit before infusion of stem cells (day 14 after 153Sm-EDTMP). No hemorrhagic cystitis, nephrotoxicity or serious infections occurred. Leukocyte engraftment (white blood cell count >0.5 x 10(9)/l) occurred between 12 and 23 days after stem cell infusion (mean of 17 days). Complete cytogenetic and morphologic remission of AML was evident on follow-up marrow aspirate and biopsy specimens from all patients. In two of the four study patients, the disease remains in complete remission and the patients have an excellent quality of life (Eastern Cooperative Oncology Group performance status 0; no medications) and no organ toxicity more than 2 years and more than 4 years, respectively, after their blood and bone marrow transplantations. Thus, in adolescents and adults, 153Sm-EDTMP may provide a relatively simple and effective means for using irradiation to eliminate AML within the marrow.

  5. Oyesiku et al., Afr J Tradit Complement Altern Med. (2013) 10(3):144 ...

    African Journals Online (AJOL)


  6. NODC Standard Format Marine Toxic Substances and Pollutants (F144) chemical identification codes (NODC Accession 9200273) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This archival information package contains a listing of codes and chemical names that were used in NODC Standard Format Marine Toxic Substances and Pollutants (F144)...

  7. 40 CFR 144.83 - Do I need to notify anyone about my Class V injection well? (United States)


    ... written request within the time frame specified. You can start injecting again only if you receive a... Class V injection well? 144.83 Section 144.83 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Operators of Class V Injection Wells § 144.83 Do I need to notify anyone about my Class V injection well...

  8. Synthesis of samarium complexes with the derivative binder of Schiff Quinolinic base. Characterization and photophysical study; Sintesis de complejos de samario con el ligante derivado de base de Schiff Quinolinica. Caracterizacion y estudio fotofisico

    Energy Technology Data Exchange (ETDEWEB)

    Lucas H, J.


    In this work we determined the metal: binder stoichiometry of the species formed during the UV/Vis spectrophotometric titration of the derivative binder of Schiff quinolinic base, L1 with the samarium nitrate pentahydrate in methanol. Statistical analysis of the data allowed proposing the metal: binder stoichiometry for the synthesis of the complexes which was one mole of samarium salt by 2.5 moles of binder and thus favor the formation of complexes with 1M: 1L and 1M: 2L stoichiometries. They were synthesized in aqueous-organic medium (water-ethanol), isolated and purified two complexes with stoichiometry 1 Sm: 1 L1, complex 1 and 1 Sm: 2 L1, complex 2. The overall yield of the reaction was 76%. The characterization of the formed complexes was performed by visible ultraviolet spectrometry (UV/Vis), nuclear magnetic resonance, X-ray photoelectron spectroscopy (XP S), thermal gravimetric analysis with differential scanning calorimetry (TGA/DSC), and radial distribution function. These complexes were studied by fluorescence and emission phosphorescence at variable temperature. Spectroscopic techniques used in both solution and solid demonstrated the formation and stability of these complexes. In addition XP S indicated that in both complexes the samarium retains its oxidation state 3+. Luminescence studies indicated that there is intra-binding charge transfer which decreases the transfer of light energy from the binder to the samarium. Based on the experimental results, L1 binder molecules and complexes 1 and 2 were modeled that demonstrated the proposed Nc for each complex, as well as allowed to visualize the structural arrangement of the molecules, complexes and binder. (Author)

  9. Pyrolysis of UR-144, a synthetic cannabinoid, augments an affinity to human CB1receptor and cannabimimetic effects in mice. (United States)

    Kaizaki-Mitsumoto, Asuka; Hataoka, Kyoko; Funada, Masahiko; Odanaka, Yuki; Kumamoto, Hiroki; Numazawa, Satoshi


    Drug abusers most often smoke 'herbal incense' as a cigarette or inhale it using a smoking tool. Smoking may cause pyrolysis of the drug and produce decomposed products of which biological effect has never been investigated. The synthetic cannabinoid UR-144 is known to undergo thermal degradation, giving a ring-opened isomer, so-called UR-144 degradant. The present study demonstrates by using UR-144 as a model drug that the smoke of burned UR-144 contains the UR-144 degradant. The UR-144 degradant showed approximately four fold higher agonist activity to human CB 1 receptor and augmented hypothermic and akinetic actions in mice compared to UR-144. These results indicate that smoking behavior may increase psychological actions of the certain synthetic cannabinoids.

  10. Retention Characteristics of CBTi144 Thin Films Explained by Means of X-Ray Photoemission Spectroscopy

    Directory of Open Access Journals (Sweden)

    G. Biasotto


    Full Text Available CaBi4Ti4O15 (CBTi144 thin films were grown on Pt/Ti/SiO2/Si substrates using a soft chemical solution and spin-coating method. Structure and morphology of the films were characterized by the X-ray Diffraction (XRD, Fourier-transform infrared spectroscopy (FT-IR, Raman analysis, X-ray photoemission spectroscopy (XPS, and transmission electron microscopy (TEM. The films present a single phase of layered-structured perovskite with polar axis orient. The a/b-axis orientation of the ferroelectric film is considered to be associated with the preferred orientation of the Pt bottom electrode. XPS measurements were employed to understand the nature of defects on the retention behavior of CBTi144 films. We have observed that the main source of retention-free characteristic of the capacitors is the oxygen environment in the CBTi144 lattice.

  11. Structural characterization of CYP144A1 - a cytochrome P450 enzyme expressed from alternative transcripts in Mycobacterium tuberculosis (United States)

    Chenge, Jude; Kavanagh, Madeline E.; Driscoll, Max D.; McLean, Kirsty J.; Young, Douglas B.; Cortes, Teresa; Matak-Vinkovic, Dijana; Levy, Colin W.; Rigby, Stephen E. J.; Leys, David; Abell, Chris; Munro, Andrew W.


    Mycobacterium tuberculosis (Mtb) causes the disease tuberculosis (TB). The virulent Mtb H37Rv strain encodes 20 cytochrome P450 (CYP) enzymes, many of which are implicated in Mtb survival and pathogenicity in the human host. Bioinformatics analysis revealed that CYP144A1 is retained exclusively within the Mycobacterium genus, particularly in species causing human and animal disease. Transcriptomic annotation revealed two possible CYP144A1 start codons, leading to expression of (i) a “full-length” 434 amino acid version (CYP144A1-FLV) and (ii) a “truncated” 404 amino acid version (CYP144A1-TRV). Computational analysis predicted that the extended N-terminal region of CYP144A1-FLV is largely unstructured. CYP144A1 FLV and TRV forms were purified in heme-bound states. Mass spectrometry confirmed production of intact, His6-tagged forms of CYP144A1-FLV and -TRV, with EPR demonstrating cysteine thiolate coordination of heme iron in both cases. Hydrodynamic analysis indicated that both CYP144A1 forms are monomeric. CYP144A1-TRV was crystallized and the first structure of a CYP144 family P450 protein determined. CYP144A1-TRV has an open structure primed for substrate binding, with a large active site cavity. Our data provide the first evidence that Mtb produces two different forms of CYP144A1 from alternative transcripts, with CYP144A1-TRV generated from a leaderless transcript lacking a 5‧-untranslated region and Shine-Dalgarno ribosome binding site.

  12. Determination of Rigidity of Protein Bound Au(144) Clusters by Electron Cryomicroscopy. (United States)

    Sexton, Jonathan Z; Ackerson, Christopher J


    A method for estimating the positional displacement of protein bound gold nanoparticles is presented and used to estimate the rigidity of linkage of Au(144) nanoparticles bound to a tetrameric model protein. We observe a distribution of displacement values where most Au(144) clusters are immobilized to within 3Å relative to the protein center of mass. The shape of the distribution suggests two physical processes of thermal motion and protein deformation. The application of this and similar rigid gold nanoparticle/protein conjugates in high resolution single particle electron cryo-microscopy is discussed.

  13. Pyrolysis result of polyethylene waste as fuel for solid oxide fuel cell with samarium doped-ceria (SDC)-carbonate as electrolyte (United States)

    Syahputra, R. J. E.; Rahmawati, F.; Prameswari, A. P.; Saktian, R.


    In this research, the result of pyrolysis on polyethylene was used as fuel for a solid oxide fuel cell (SOFC). The pyrolysis result is a liquid which consists of hydrocarbon chains. According to GC-MS analysis, the hydrocarbons mainly consist of C7 to C20 hydrocarbon chain. Then, the liquid was applied to a single cell of NSDC-L | NSDC | NSDC-L. NSDC is a composite SDC (samarium doped-ceria) with sodium carbonate. Meanwhile, NSDC-L is a composite of NSDC with LiNiCuO (LNC). NSDC and LNC were analyzed by X-ray diffraction to understand their crystal structure. The result shows that presence of carbonate did not change the crystal structure of SDC. SEM EDX analysis for fuel cell before and after being loaded with polyethylene oil to get information of element diffusion to the electrolyte. Meanwhile, the conductivity properties were investigated through impedance measurement. The presence of carbonate even increases the electrical conductivity. The single cell test with the pyrolysis result of polyethylene at 300 - 600 °C, found that the highest power density is at 600 °C with the maximum power density of 0.14 mW/cm2 and open circuit voltage of 0.4 Volt. Elemental analysis at three point spots of single cell NDSC-L |NSDC|NSDC-L found that a migration of ions was occurred during fuel operation at 300 - 600 °C.

  14. Effects of some rare earth and carbonate-based co-dopants on structural and electrical properties of samarium doped ceria (SDC) electrolytes for solid oxide fuel cells (United States)

    Anwar, Mustafa; Khan, Zuhair S.; Mustafa, Kamal; Rana, Akmal


    In the present study, samarium doped ceria (SDC) and SDC-based composite with the addition of K2CO3 were prepared by co-precipitation route and effects of pH of the solution and calcination temperature on microstructure of SDC and SDC-K2CO3, respectively, were investigated. Furthermore, experimentation was performed to investigate into the ionic conductivity of pure SDC by co-doping with yttrium i.e., YSDC, XRD and SEM studies show that the crystallite size and particle size of SDC increases with the increase in pH. The SEM images of all the samples of SDC synthesized at different pH values showed the irregular shaped and dispersed particles. SDC-K2CO3 was calcined at 600∘C, 700∘C and 800∘C for 4 h and XRD results showed that crystallite size increases while lattice strain, decreases with the increase in calcination temperature and no peaks were detected for K2CO3 as it is present in an amorphous form. The ionic conductivity of the electrolytes increases with the increase in temperature and SDC-K2CO3 shows the highest value of ionic conductivity as compared to SDC and YSDC. Chemical compatibility tests were performed between the co-doped electrolyte and lithiated NiO cathode at high temperature. It revealed that the couple could be used up to the temperature of 700∘C.

  15. Calculation of the Dose of Samarium-153-Ethylene Diamine Tetramethylene Phosphonate (153Sm-EDTMP as a Radiopharmaceutical for Pain Relief of bone Metastasis

    Directory of Open Access Journals (Sweden)

    Fatemeh Razghandi


    Full Text Available Introduction One of the important applications of nuclear physics in medicine is the use of radioactive elements as radiopharmaceuticals. Metastatic bone disease is the most common form of malignant bone tumors. Samarium-153-ethylene diamine tetramethylene phosphonate (153Sm-EDTMP as a radiopharmaceutical is used for pain palliation. This radiopharmaceutical usually emits beta particles, which have a high uptake in bone tissues. The purpose of this study was to calculate the radiation dose distribution of 153Sm-EDTMP in bone and other tissues, using MCNPX Monte Carlo code in the particle transport model. Materials and Methods Dose delivery to the bone was simulated by seeking radiopharmaceuticals on the bone surface. The phantom model had a simple cylindrical geometry and included bone, bone marrow, and soft tissue. Results The simulation results showed that a significant amount of radiation dose was delivered to the bone by the use of this radiopharmaceutical. Conclusion Thebone acted as a fine protective shield against rays for the bone marrow. Therefore, the trivial absorbed dose by the bone marrow caused less damage to bone-making cells. Also, the high absorbed dose of the bone could destroy cancer cells and relieve the pain in the bone.

  16. Synthesis, quality control and biological evaluation of tris[(1,10-phenanthroline)[{sup 153}Sm]samarium(III)]trithiocyanate complex as a therapeutic agent

    Energy Technology Data Exchange (ETDEWEB)

    Naseri, Z.; Kharat, A. Nemati [Tehran Univ. (Iran, Islamic Republic of). Inorganic Chemistry Dept.; Hakimi, A. [Islamic Azad Univ., Tehran (Iran, Islamic Republic of). Dept. of Nuclear Engineering, Science and Research Branch; Jalilian, A.R.; Shirvani-Arani, S.; Bahrami-Samani, A.; Ghannadi-Maragheh, M. [Nuclear Science and Technology Research Institute (NSTRI), Tehran (IR). Radiopharmaceutical Research and Development Lab (RRDL)


    Therapeutic radiopharmaceuticals are designed to deliver high doses of radiation to selected target organs or tissues with an aim of minimizing unwanted radiation to surrounding healthy tissue. In this work, [tris(1,10-phenanthroline)[{sup 153}Sm]samarium(III)]trithiocyanate ({sup 153}Sm-TPTTC) was developed for possible therapeutic properties. The cold compound, i.e. {sup nat}Sm-TPTTC was prepared and characterized by IR, UV, mass and {sup 1}H-NMR spectroscopy. {sup 153}Sm-TPTTC was prepared in two steps using [{sup 153}Sm]SmCl{sub 3}, obtained by neutron activation of an enriched {sup 152}Sm sample. Stability tests, partition coefficient determination, toxicity tests and biodistribution studies of the complex in wild-type and fibrosarcoma-bearing mice were determined. The radiolabeled complex was prepared in high radiochemical purity (> 99% precipitation method) and specific activity of 278 GBq/mmol and demonstrated significant stability at 4, 25 and 37 C (in presence of human serum). Initial complex biodistribution data showed significant liver accumulation in wild-type mice and significant tumor accumulation in fibrosarcoma-bearing mice with tumor:blood and tumor:muscle ratios of 3.55 (2 h) and 38.26 (96 h) respectively. {sup 153}Sm-TPTTC properties suggest an efficient tumor targeting agent with high tumor-avidity. Further investigation on the therapeutic properties must be conducted. (orig.)

  17. Sex Differences in Left-Handedness: A Meta-Analysis of 144 Studies (United States)

    Papadatou-Pastou, Marietta; Martin, Maryanne; Munafo, Marcus R.; Jones, Gregory V.


    Human handedness, a marker for language lateralization in the brain, continues to attract great research interest. A widely reported but not universal finding is a greater male tendency toward left-handedness. Here the authors present a meta-analysis of k = 144 studies, totaling N = 1,787,629 participants, the results of which demonstrate that the…

  18. Crystal Structure of the Murine Cytomegalovirus MHC-I Homolog m144

    Energy Technology Data Exchange (ETDEWEB)

    Natarajan,K.; Hicks, A.; Mans, J.; Robinson, H.; Guan, R.; Mariuzza, R.; Margulies, D.


    Large DNA viruses of the herpesvirus family produce proteins that mimic host MHC-I molecules as part of their immunoevasive strategy. The m144 glycoprotein, expressed by murine cytomegalovirus, is thought to be an MHC-I homolog whose expression prolongs viral survival in vivo by preventing natural killer cell activation. To explore the structural basis of this m144 function, we have determined the three-dimensional structure of an m144/{beta}2-microglobulin ({beta}2m) complex at 1.9 {angstrom} resolution. This structure reveals the canonical features of MHC-I molecules including readily identifiable {alpha}1, {alpha}2, and {alpha}3 domains. A unique disulfide bond links the {alpha}1 helix to the {beta}-sheet floor, explaining the known thermal stability of m144. Close juxtaposition of the {alpha}1 and {alpha}2 helices and the lack of critical residues that normally contribute to anchoring the peptide N and C termini eliminates peptide binding. A region of 13 amino acid residues, corresponding to the amino-terminal portion of the {alpha}2 helix, is missing in the electron density map, suggesting an area of structural flexibility that may be involved in ligand binding.

  19. 40 CFR 144.7 - Identification of underground sources of drinking water and exempted aquifers. (United States)


    ... PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM General Provisions § 144.7 Identification of underground sources of drinking water and exempted aquifers. (a) The..., except where exempted under paragraph (b) of this section, as an underground source of drinking water...

  20. 49 CFR 176.144 - Segregation of Class 1 (explosive) materials. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Segregation of Class 1 (explosive) materials. 176... VESSEL Detailed Requirements for Class 1 (Explosive) Materials Segregation § 176.144 Segregation of Class... any ferrous metal or aluminum alloy, unless separated by a partition. (e) Segregation on deck: When...

  1. Homozygosity Mapping and Genetic Analysis of Autosomal Recessive Retinal Dystrophies in 144 Consanguineous Pakistani Families (United States)

    Li, Lin; Chen, Yabin; Jiao, Xiaodong; Jin, Chongfei; Jiang, Dan; Tanwar, Mukesh; Ma, Zhiwei; Huang, Li; Ma, Xiaoyin; Sun, Wenmin; Chen, Jianjun; Ma, Yan; M'hamdi, Oussama; Govindarajan, Gowthaman; Cabrera, Patricia E.; Li, Jiali; Gupta, Nikhil; Naeem, Muhammad Asif; Khan, Shaheen N.; Riazuddin, Sheikh; Akram, Javed; Ayyagari, Radha; Sieving, Paul A.; Riazuddin, S. Amer; Hejtmancik, J. Fielding


    Purpose The Pakistan Punjab population has been a rich source for identifying genes causing or contributing to autosomal recessive retinal degenerations (arRD). This study was carried out to delineate the genetic architecture of arRD in the Pakistani population. Methods The genetic origin of arRD in a total of 144 families selected only for having consanguineous marriages and multiple members affected with arRD was examined. Of these, causative mutations had been identified in 62 families while only the locus had been identified for an additional 15. The remaining 67 families were subjected to homozygosity exclusion mapping by screening of closely flanking microsatellite markers at 180 known candidate genes/loci followed by sequencing of the candidate gene for pathogenic changes. Results Of these 67 families subjected to homozygosity mapping, 38 showed homozygosity for at least one of the 180 regions, and sequencing of the corresponding genes showed homozygous cosegregating mutations in 27 families. Overall, mutations were detected in approximately 61.8 % (89/144) of arRD families tested, with another 10.4% (15/144) being mapped to a locus but without a gene identified. Conclusions These results suggest the involvement of unmapped novel genes in the remaining 27.8% (40/144) of families. In addition, this study demonstrates that homozygosity mapping remains a powerful tool for identifying the genetic defect underlying genetically heterogeneous arRD disorders in consanguineous marriages for both research and clinical applications. PMID:28418496

  2. 42 CFR 413.144 - Depreciation: Allowance for depreciation on fully depreciated or partially depreciated assets. (United States)


    ... 42 Public Health 2 2010-10-01 2010-10-01 false Depreciation: Allowance for depreciation on fully... SKILLED NURSING FACILITIES Capital-Related Costs § 413.144 Depreciation: Allowance for depreciation on fully depreciated or partially depreciated assets. (a) Principle. Depreciation on assets being used by a...

  3. Nanostructures via noncovalent synthesis: 144 hydrogen bonds bring together 27 components

    NARCIS (Netherlands)

    Paraschiv, V.; Crego Calama, Mercedes; Fokkens, R.H.; Padberg, Clemens J.; Timmerman, P.; Reinhoudt, David


    This paper describes the spontaneous and reversible assembly of 20 kDa synthetic hydrogen-bonded assemblies via the formation of 144 cooperative hydrogen bonds. These nanostructures (3.0 × 5.5 nm), consisting of 27 different components, have been carefully characterized using a combination of 1H NMR

  4. Cytochrome P450-mediated metabolism of the synthetic cannabinoids UR-144 and XLR-11

    DEFF Research Database (Denmark)

    Nielsen, Line Marie; Holm, Niels Bjerre; Olsen, Lars


    In recent years, synthetic cannabinoids have emerged in the illicit drug market, in particular via the Internet, leading to abuse of these drugs. There is currently limited knowledge about the specific enzymes involved in the metabolism of these drugs. In this study, we investigated the cytochrome...... of UR-144 and XLR-11, while inhibition of the other CYP enzymes in HLM had only minor effects. Thus, CYP3A4 is the major contributor to the CYP mediated metabolism of UR-144 and XLR-11 with minor contributions from CYP1A2. Users of UR-144 and XLR-11 are thus subject to the influence of potential drug-drug...... the specific CYP enzymes involved in the metabolism of UR-144 and XLR-11 utilizing a panel of nine recombinant enzymes (CYP1A2, 2B6, 2C8, 2C9, 2C18, 2C19, 2D6, 3A4, and 2E1). This is followed by an investigation of the effect of specific inhibitors targeted against CYP1A2, 2B6, 2C9, 2C19, 2D6 and 3A4 in human...

  5. Physical and genetic characterization of the IncI plasmid R144-drd3

    NARCIS (Netherlands)

    Hartskeerl, R.A.; Guchte, M. v.d.; Zuidweg, E.M.; Hoekstra, W.P.M.


    A physical and genetic map of the IncI plasmid R144-drd3 was obtained by determining restriction endonuclease sites and by physical and genetic analysis of cloned fragments, of TnI insertion mutants and of deletion mutants.

  6. Biological effects of inhaled {sup 144}CeCl{sub 3} in beagle dogs

    Energy Technology Data Exchange (ETDEWEB)

    Hahn, F.F.; Boecker, B.B.; Griffith, W.C.; Muggenburg, B.A. [Inhalation Toxicology Research Institute, Albuquerque, NM (United States)


    The biological effects of {sup 144}Ce were studied in beagle dogs that were exposed to graded activity levels of {sup 144}CeCl{sub 3} via a single, brief inhalation exposure and observed for their life span. The long-term retained body burdens ranged from 0.06 to 13 MBq/kg with a median of 1.2 MBq/kg. After a short residence time in the lung, most of the {sup 144}Ce was translocated to liver and skeleton, where the {sup 144}Ce was retained with a half-time approaching the physical half-life of {sup 144}Ce was retained with a half-time approaching the physical half-life of {sup 144}Ce, 284 days. Significant radiation doses were delivered to the lung, 28 Gy (median) and 2.5-370 Gy (range); liver, 68 Gy (median) and 6.1-250 Gy (range); and skeleton, 21 Gy (median) and 1.9-100 Gy (range). Lesions induced by the {beta}-particle radiation were noted in the lung, liver, skeleton, bone marrow, and oral and nasal mucosae closely associated with bond. Early deaths (within 2.5 years) were generally related to hematological dyscrasia, radiation pneumonitis, or hepatocellular degeneration and atrophy. Neoplasms that occurred relatively early, from 2.2-6.8 years after exposure, were noted in the liver, bone, bone marrow and oral mucosa closely associated with bone. Neoplasms that occurred later, beyond 7 years after exposure, were noted in the liver, lung and nasal mucosa closely associated with bone. Increased numbers of neoplasms were not found in two other organs that had relatively high radiation doses, namely the thyroid and kidney. Only one primary bone tumor was noted, but 11 tumors of bone-associated tissues (oral and nasal mucosae and bone marrow) were found. Radiation doses and effects in tissues adjacent to bone, especially those of epithelial or marrow origin, should be considered when determining risks from internally deposited bone-seeking radionuclides, such as {sup 144}Ce. 59 refs., 8 figs., 10 tabs.

  7. Structure of the Bacteriophage [phi]KZ Lytic Transglycosylase gp144

    Energy Technology Data Exchange (ETDEWEB)

    Fokine, Andrei; Miroshnikov, Konstantin A.; Shneider, Mikhail M.; Mesyanzhinov, Vadim V.; Rossmann, Michael G. (SOIBC); (Purdue)


    Lytic transglycosylases are enzymes that act on the peptidoglycan of bacterial cell walls. They cleave the glycosidic linkage between N-acetylmuramoyl and N-acetylglucosaminyl residues with the concomitant formation of a 1,6-anhydromuramoyl product. The x-ray structure of the lytic transglycosylase gp144 from the Pseudomonas bacteriophage {phi}KZ has been determined to 2.5-{angstrom} resolution. This protein is probably employed by the bacteriophage in the late stage of the virus reproduction cycle to destroy the bacterial cell wall to release the phage progeny. {phi}KZ gp144 is a 260-residue {alpha}-helical protein composed of a 70-residue N-terminal cell wall-binding domain and a C-terminal catalytic domain. The fold of the N-terminal domain is similar to the peptidoglycan-binding domain from Streptomyces albus G d-Ala-d-Ala carboxypeptidase and to the N-terminal prodomain of human metalloproteinases that act on extracellular matrices. The C-terminal catalytic domain of gp144 has a structural similarity to the catalytic domain of the transglycosylase Slt70 from Escherichia coli and to lysozymes. The gp144 catalytic domain has an elongated groove that can bind at least five sugar residues at sites A-E. As in other lysozymes, the peptidoglycan cleavage (catalyzed by Glu{sup 115} in gp144) occurs between sugar-binding subsites D and E. The x-ray structure of the {phi}KZ transglycosylase complexed with the chitotetraose (N-acetylglucosamine){sub 4} has been determined to 2.6-{angstrom} resolution. The N-acetylglucosamine residues of the chitotetraose bind in sites A-D.

  8. Retention capacity of samarium (III) in zircon for it possible use in retaining walls for confinement of nuclear residues; Capacidad de retencion de samario (III) en circon para su posible uso en barreras de contencion para confinamiento de residuos nucleares

    Energy Technology Data Exchange (ETDEWEB)

    Garcia G, N


    Mexico, as country that produces part of its electric power by nuclear means, should put special emphasis in the development of technologies guided to the sure and long term confinement of the high level nuclear residuals. This work studies the capacity that has the natural zircon to retain to the samarium (III) in solution, by what due, firstly, to characterize the zircon for technical instrumental to determine the purity and characteristic of the mineral in study. The instrumental techniques that were used to carry out the physicochemical characterization were the neutron activation analysis (NAA), the infrared spectroscopy (IS), the thermal gravimetric analysis (TGA), scanning electron microscopy (SEM), transmission electron microscopy (TEM), semiquantitative analysis, dispersive energy spectroscopy (EDS), X-ray diffraction (XRD) and luminescence technique. The characterization of the surface properties carries out by means of the determination of the surface area using the BET multipoint technique, acidity constants, hydration time, the determination of the point of null charge (pH{sub PCN}) and density of surface sites (D{sub s}). The luminescence techniques were useful to determine the optimal point hydration of the zircon and for the quantification of the samarium, for that here intends the development of both analysis techniques. With the adjustment of the titration curves in the FITEQL 4 package the constants of surface acidity in the solid/liquid interface were determined. To the finish of this study it was corroborated that the zircon is a mineral that presents appropriate characteristics to be proposed as a contention barrier for the deep geologic confinement. With regard to the study of adsorption that one carries out the samarium retention it is superior to 90% under the described conditions. This investigation could also be applicable in the confinement of dangerous industrial residuals. (Author)

  9. Effectiveness of antihypertensive therapy in HIV-positive patients: evaluation to 144 weeks

    Directory of Open Access Journals (Sweden)

    K Falasca


    Full Text Available Hypertension is more prevalent among HIV-infected subjects than in the general population, contributing to increased cardiovascular risk in HIV+ patients. The angiotensin II receptor blocker telmisartan is also a partial peroxisome proliferator activated receptor (PPAR-γ agonist, with documented effects on improving hypertension, lipid metabolism and renal function. Therefore telmisartan was found to be the first choice for treatment of HIV+ hypertensive patients. Aim of this study was to evaluate the durability on 144 weeks of treatment with telmisartan in HIV+ patients. 13 HIV+ Caucasian male patients treated with combined antiretroviral therapy (cART and discovered to be naïve hypertensive, were given 80 mg telmisartan daily. Systolic (SBP and diastolic (DBP blood pressure, viro-immunological, lipid and metabolic parameters, including triglycerides, cholesterol, insulin resistance (HOMA-IR, inflammatory markers, C-reactive protein (CRP, erythrocyte sedimentation rate (ESR, indexes of renal function and cardiovascular risk, microalbuminuria, cystatin C, were measured at baseline (T0, and after 24 (T24, 48 (T48, 72 (T72, 96 (T96, 120 (T120 and 144 (T144 weeks. Treatment with telmisartan decreased SBP and DBP levels during the 144 weeks of observation. We also observed improved HDL-cholesterol, HOMA-IR, microalbuminuria and cystatin C at the end of study. Triglycerides and total cholesterol significantly decreased and HDL-cholesterol significantly increased. Total cholesterol/HDL cholesterol ratio improved significantly. Throughout in the course of the trial our patients showed a significant improvement of the percentage of CD4+ and CD8+. Eventually in all 144 weeks of therapy with telmisartan 80 mg/day have not observed adverse events or dropouts. Telmisartan was effective in improving hypertension, lipid metabolism and renal function in 144 weeks of evaluation. It determines the improvement of cystatin C and microalbuminuria, markers of

  10. 40 CFR 144.21 - Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells. (United States)


    ... recovery and hydrocarbon storage) and III wells. 144.21 Section 144.21 Protection of Environment... hydrocarbon storage) and III wells. (a) An existing Class I, II (except enhanced recovery and hydrocarbon... decision; or (9) For Class II wells (except enhanced recovery and hydrocarbon storage), five years after...

  11. SU-C-201-06: Utility of Quantitative 3D SPECT/CT Imaging in Patient Specific Internal Dosimetry of 153-Samarium with GATE Monte Carlo Package

    Energy Technology Data Exchange (ETDEWEB)

    Fallahpoor, M; Abbasi, M [Tehran University of Medical Sciences, Vali-Asr Hospital, Tehran, Tehran (Iran, Islamic Republic of); Sen, A [University of Houston, Houston, TX (United States); Parach, A [Shahid Sadoughi University of Medical Sciences, Yazd, Yazd (Iran, Islamic Republic of); Kalantari, F [UT Southwestern Medical Center, Dallas, TX (United States)


    Purpose: Patient-specific 3-dimensional (3D) internal dosimetry in targeted radionuclide therapy is essential for efficient treatment. Two major steps to achieve reliable results are: 1) generating quantitative 3D images of radionuclide distribution and attenuation coefficients and 2) using a reliable method for dose calculation based on activity and attenuation map. In this research, internal dosimetry for 153-Samarium (153-Sm) was done by SPECT-CT images coupled GATE Monte Carlo package for internal dosimetry. Methods: A 50 years old woman with bone metastases from breast cancer was prescribed 153-Sm treatment (Gamma: 103keV and beta: 0.81MeV). A SPECT/CT scan was performed with the Siemens Simbia-T scanner. SPECT and CT images were registered using default registration software. SPECT quantification was achieved by compensating for all image degrading factors including body attenuation, Compton scattering and collimator-detector response (CDR). Triple energy window method was used to estimate and eliminate the scattered photons. Iterative ordered-subsets expectation maximization (OSEM) with correction for attenuation and distance-dependent CDR was used for image reconstruction. Bilinear energy mapping is used to convert Hounsfield units in CT image to attenuation map. Organ borders were defined by the itk-SNAP toolkit segmentation on CT image. GATE was then used for internal dose calculation. The Specific Absorbed Fractions (SAFs) and S-values were reported as MIRD schema. Results: The results showed that the largest SAFs and S-values are in osseous organs as expected. S-value for lung is the highest after spine that can be important in 153-Sm therapy. Conclusion: We presented the utility of SPECT-CT images and Monte Carlo for patient-specific dosimetry as a reliable and accurate method. It has several advantages over template-based methods or simplified dose estimation methods. With advent of high speed computers, Monte Carlo can be used for treatment planning

  12. Fabrication of catalytically active nanocrystalline samarium (Sm)-doped cerium oxide (CeO2) thin films using electron beam evaporation (United States)

    Kundu, Subrata; Sutradhar, Narottam; Thangamuthu, R.; Subramanian, B.; Panda, Asit Baran; Jayachandran, M.


    Samarium (Sm)-doped cerium oxide (CeO2) thin films were fabricated using electron beam evaporation technique. The synthesized films were deposited either on glass or ITO substrates and studied their nature by annealing at different temperatures. The optical properties and other morphological studies were done by UV-Vis, XRD, XPS, SEM, EDS, and FT-IR analysis. XRD and XPS analysis clearly confirm the presence of Sm in the ceria site. From the SEM study, it was found that after annealing at high temperature ( 300 or 500 °C), the particles size was reduced due to breakdown of large aggregates of particles which is also confirmed from UV-Vis, XPS, and XRD analyses. The FT-IR study proves the presence of -COO-, -OH, or ammonium group on the particles surface. The deposition of Sm-doped CeO2 nanomaterials was found more feasible on ITO substrate compared to that of glass substrate in terms of stability and depth of film thickness. The Sm-doped CeO2 nanomaterial acts as a re-usable catalyst for the reduction of organic dye molecules in the presence of NaBH4. The catalysis rate was compared by considering the electron transfer process during the reduction. The synthesized Sm-doped CeO2 thin films might find wide variety of applications in various emerging fields like solid oxide fuel cells (SOFCs), oxygen sensor or as catalyst in different types of organic and inorganic catalytic reactions. The fabrication process is very simple, straightforward, less time consuming, and cost effective.

  13. Fabrication of catalytically active nanocrystalline samarium (Sm)-doped cerium oxide (CeO{sub 2}) thin films using electron beam evaporation

    Energy Technology Data Exchange (ETDEWEB)

    Kundu, Subrata, E-mail: [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India); Sutradhar, Narottam [G. B. Marg, Central Salt and Marine Chemical Research Institute - CSIR (India); Thangamuthu, R.; Subramanian, B. [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India); Panda, Asit Baran [G. B. Marg, Central Salt and Marine Chemical Research Institute (CSIR) (India); Jayachandran, M., E-mail: [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India)


    Samarium (Sm)-doped cerium oxide (CeO{sub 2}) thin films were fabricated using electron beam evaporation technique. The synthesized films were deposited either on glass or ITO substrates and studied their nature by annealing at different temperatures. The optical properties and other morphological studies were done by UV-Vis, XRD, XPS, SEM, EDS, and FT-IR analysis. XRD and XPS analysis clearly confirm the presence of Sm in the ceria site. From the SEM study, it was found that after annealing at high temperature ({approx}300 or 500 Degree-Sign C), the particles size was reduced due to breakdown of large aggregates of particles which is also confirmed from UV-Vis, XPS, and XRD analyses. The FT-IR study proves the presence of -COO-, -OH, or ammonium group on the particles surface. The deposition of Sm-doped CeO{sub 2} nanomaterials was found more feasible on ITO substrate compared to that of glass substrate in terms of stability and depth of film thickness. The Sm-doped CeO{sub 2} nanomaterial acts as a re-usable catalyst for the reduction of organic dye molecules in the presence of NaBH{sub 4}. The catalysis rate was compared by considering the electron transfer process during the reduction. The synthesized Sm-doped CeO{sub 2} thin films might find wide variety of applications in various emerging fields like solid oxide fuel cells (SOFCs), oxygen sensor or as catalyst in different types of organic and inorganic catalytic reactions. The fabrication process is very simple, straightforward, less time consuming, and cost effective.Graphical Abstract.

  14. Machine learning methods enable predictive modeling of antibody feature:function relationships in RV144 vaccinees.

    Directory of Open Access Journals (Sweden)

    Ickwon Choi


    Full Text Available The adaptive immune response to vaccination or infection can lead to the production of specific antibodies to neutralize the pathogen or recruit innate immune effector cells for help. The non-neutralizing role of antibodies in stimulating effector cell responses may have been a key mechanism of the protection observed in the RV144 HIV vaccine trial. In an extensive investigation of a rich set of data collected from RV144 vaccine recipients, we here employ machine learning methods to identify and model associations between antibody features (IgG subclass and antigen specificity and effector function activities (antibody dependent cellular phagocytosis, cellular cytotoxicity, and cytokine release. We demonstrate via cross-validation that classification and regression approaches can effectively use the antibody features to robustly predict qualitative and quantitative functional outcomes. This integration of antibody feature and function data within a machine learning framework provides a new, objective approach to discovering and assessing multivariate immune correlates.

  15. Machine learning methods enable predictive modeling of antibody feature:function relationships in RV144 vaccinees. (United States)

    Choi, Ickwon; Chung, Amy W; Suscovich, Todd J; Rerks-Ngarm, Supachai; Pitisuttithum, Punnee; Nitayaphan, Sorachai; Kaewkungwal, Jaranit; O'Connell, Robert J; Francis, Donald; Robb, Merlin L; Michael, Nelson L; Kim, Jerome H; Alter, Galit; Ackerman, Margaret E; Bailey-Kellogg, Chris


    The adaptive immune response to vaccination or infection can lead to the production of specific antibodies to neutralize the pathogen or recruit innate immune effector cells for help. The non-neutralizing role of antibodies in stimulating effector cell responses may have been a key mechanism of the protection observed in the RV144 HIV vaccine trial. In an extensive investigation of a rich set of data collected from RV144 vaccine recipients, we here employ machine learning methods to identify and model associations between antibody features (IgG subclass and antigen specificity) and effector function activities (antibody dependent cellular phagocytosis, cellular cytotoxicity, and cytokine release). We demonstrate via cross-validation that classification and regression approaches can effectively use the antibody features to robustly predict qualitative and quantitative functional outcomes. This integration of antibody feature and function data within a machine learning framework provides a new, objective approach to discovering and assessing multivariate immune correlates.

  16. The high precision measurement of the 144Ce activity in the SOX experiment (United States)

    Di Noto, L.; Agostini, M.; Althenmüller, K.; Appel, S.; Bellini, G.; Benziger, J.; Berton, N.; Bick, D.; Bonfini, G.; Bravo—Berguño, D.; Caccianiga, B.; Calaprice, F.; Caminata, A.; Cavalcante, P.; Cereseto, R.; Chepurnov, A.; Choi, K.; Cribier, M.; DAngelo, D.; Davini, S.; Derbin, A.; Drachnev, I.; Durero, M.; Etenko, A.; Farinon, S.; Fischer, V.; Fomenko, K.; Franco, D.; Gabriele, F.; Gaffiot, J.; Galbiati, C.; Ghiano, C.; Giammarchi, M.; Göeger-Neff, M.; Goretti, A.; Gromov, M.; Hagner, C.; Houdy, Th; Hungerford, E.; Ianni, Aldo; Ianni, Andrea; Jonquères, N.; Jedrzejczak, K.; Kaiser, M.; Kobychev, V.; Korablev, D.; Korga, G.; Kornoukhov, V.; Kryn, D.; Lachenmaier, T.; Lasserre, T.; Laubenstein, M.; Lehnert, T.; Link, J.; Litvinovich, E.; Lombardi, F.; Lombardi, P.; Ludhova, L.; Lukyanchenko, G.; Machulin, I.; Manecki, S.; Maneschg, W.; Marcocci, S.; Maricic, J.; Mention, G.; Meroni, E.; Meyer, M.; Miramonti, L.; Misiaszek, M.; Montuschi, M.; Mosteiro, P.; Muratova, V.; Musenich, R.; Neumair, B.; Oberauer, L.; Obolensky, M.; Ortica, F.; Pallavicini, M.; Papp, L.; Perasso, L.; Pocar, A.; Ranucci, G.; Razeto, A.; Re, A.; Romani, A.; Roncin, R.; Rossi, C.; Rossi, N.; Schönert, S.; Scola, L.; Semenov, D.; Simgen, H.; Skorokhvatov, M.; Smirnov, O.; Sotnikov, A.; Sukhotin, S.; Suvorov, Y.; Tartaglia, R.; Testera, G.; Thurn, J.; Toropova, M.; Veyssière, C.; Vivier, M.; Unzhakov, E.; Vogelaar, R. B.; von Feilitzsch, F.; Wang, H.; Weinz, S.; Winter, J.; Wojcik, M.; Wurm, M.; Yokley, Z.; Zaimidoroga, O.; Zavatarelli, S.; Zuber, K.; Zuzel, G.


    In order to perform a resolutive measurement to clarify the neutrino anomalies and to observe possible short distance neutrino oscillations, the SOX (Short distance neutrino Oscillations with BoreXino) experiment is under construction. In the first phase, a 100 kCi 144Ce-144Pr antineutrino source will be placed under the Borexino detector at the Laboratori Nazionali del Gran Sasso (LNGS), in center of Italy, and the rate measurement of the antineutrino events, observed by the very low radioactive background Borexino detector, will be compared with the high precision (< 1%) activity measurement performed by two calorimeters. The source will be embedded in a 19 mm thick tungsten alloy shield and both the calorimeters have been conceived for measuring the thermal heat absorbed by a water flow. In this report the design of the calorimeters will be described in detail and very preliminary results will be also shown.

  17. Change of deformation at the backbending in the yrast superdeformed band of {sup 144}Gd

    Energy Technology Data Exchange (ETDEWEB)

    Ur, C.A.; Bolzonella, G.P.; Bazzacco, D. [dell`Universita, Padova (Italy)]|[INFN, Padova (Italy)] [and others


    A mean lifetime measurement using the Doppler shift attenuation method has been performed at GASP in order to extract the quadrupole moment of the yrast SD band of {sup 144}Gd. The extracted intrinsic quadrupole moments, being Q{sub 0}=13.7 eb above the backbending and Q{sub 0}=11.8 eb below the backbending, are consistent with a change of deformation from {beta}{sub 2}=0.51 (at {beta}{sub 4} {approx} 0.050) to {beta}{sub 2}=0.45 (at {beta}{sub 4} {approx}0.035). The experimental results are in nice agreement with the theoretical predictions, which revealed that the second well in {sup 144}Gd arises essentially from the very favored shell structure at N=80 and Z=64. The occupation at higher frequency of the aligned N=6 proton orbitals drives the nucleus to a slightly more deformed shape.

  18. Replication of JC Virus DNA in the G144 Oligodendrocyte Cell Line Is Dependent Upon Akt. (United States)

    Peterson, Jesse N; Lin, Brian; Shin, Jong; Phelan, Paul J; Tsichlis, Philip; Schwob, James E; Bullock, Peter A


    Progressive multifocal leukoencephalopathy (PML) is an often-fatal demyelinating disease of the central nervous system. PML results when oligodendrocytes within immunocompromised individuals are infected with the human JC virus (JCV). We have identified an oligodendrocyte precursor cell line, termed G144, that supports robust levels of JCV DNA replication, a central part of the JCV life cycle. In addition, we have determined that JC virus readily infects G144 cells. Furthermore, we have determined that JCV DNA replication in G144 cells is stimulated by myristoylated (i.e., constitutively active) Akt and reduced by the Akt-specific inhibitor MK2206. Thus, this oligodendrocyte-based model system will be useful for a number of purposes, such as studies of JCV infection, establishing key pathways needed for the regulation of JCV DNA replication, and identifying inhibitors of this process.IMPORTANCE The disease progressive multifocal leukoencephalopathy (PML) is caused by the infection of particular brain cells, termed oligodendrocytes, by the JC virus. Studies of PML, however, have been hampered by the lack of an immortalized human cell line derived from oligodendrocytes. Here, we report that the G144 oligodendrocyte cell line supports both infection by JC virus and robust levels of JCV DNA replication. Moreover, we have established that the Akt pathway regulates JCV DNA replication and that JCV DNA replication can be inhibited by MK2206, a compound that is specific for Akt. These and related findings suggest that we have established a powerful oligodendrocyte-based model system for studies of JCV-dependent PML. Copyright © 2017 American Society for Microbiology.

  19. Gene expression analysis of embryonic stem cells expressing VE-cadherin (CD144 during endothelial differentiation

    Directory of Open Access Journals (Sweden)

    Libermann Towia


    Full Text Available Abstract Background Endothelial differentiation occurs during normal vascular development in the developing embryo. This process is recapitulated in the adult when endothelial progenitor cells are generated in the bone marrow and can contribute to vascular repair or angiogenesis at sites of vascular injury or ischemia. The molecular mechanisms of endothelial differentiation remain incompletely understood. Novel approaches are needed to identify the factors that regulate endothelial differentiation. Methods Mouse embryonic stem (ES cells were used to further define the molecular mechanisms of endothelial differentiation. By flow cytometry a population of VEGF-R2 positive cells was identified as early as 2.5 days after differentiation of ES cells, and a subset of VEGF-R2+ cells, that were CD41 positive at 3.5 days. A separate population of VEGF-R2+ stem cells expressing the endothelial-specific marker CD144 (VE-cadherin was also identified at this same time point. Channels lined by VE-cadherin positive cells developed within the embryoid bodies (EBs formed by differentiating ES cells. VE-cadherin and CD41 expressing cells differentiate in close proximity to each other within the EBs, supporting the concept of a common origin for cells of hematopoietic and endothelial lineages. Results Microarray analysis of >45,000 transcripts was performed on RNA obtained from cells expressing VEGF-R2+, CD41+, and CD144+ and VEGF-R2-, CD41-, and CD144-. All microarray experiments were performed in duplicate using RNA obtained from independent experiments, for each subset of cells. Expression profiling confirmed the role of several genes involved in hematopoiesis, and identified several putative genes involved in endothelial differentiation. Conclusion The isolation of CD144+ cells during ES cell differentiation from embryoid bodies provides an excellent model system and method for identifying genes that are expressed during endothelial differentiation and that

  20. Structure & bonding of the gold-subhalide cluster I-Au144Cl60[z]. (United States)

    Tlahuice-Flores, Alfredo; Black, David M; Bach, Stephan B H; Jose-Yacamán, Miguel; Whetten, Robert L


    The structure and bonding of the gold-subhalide compounds Au144Cl60([z]) are related to those of the ubiquitous thiolated gold clusters, or Faradaurates, by iso-electronic substitution of thiolate by chloride. Exact I-symmetry holds for the [z] = [2+,4+] charge-states, in accordance with new electrospray mass spectrometry measurements and the predicted electron shell filling. The high symmetry facilitates analysis of the global structure as well as the bonding network, with some striking results.

  1. Focusing of 3C144 Source Radiation by the Solar Corona (United States)

    Galanin, V. V.; Derevjagin, V. G.; Kravetz, R. O.

    The research of solar corona by the compact cosmic source radiation was made on URAN-4 radio telescope. In the period from June 6 to June 20 2012 the flow of Crab nebula was measured on the 20 MHz and 25 MHz frequencies. During the eclipse we observe the great increase of 3C144 flow, which is compare with the flow of 3C461 source. Data and results of measurement analysis is presented.

  2. Inhibiting microRNA-144 abates oxidative stress and reduces apoptosis in hearts of streptozotocin-induced diabetic mice. (United States)

    Yu, Manli; Liu, Yu; Zhang, Bili; Shi, Yicheng; Cui, Ling; Zhao, Xianxian


    Hyperglycemia-induced reactive oxygen species (ROS) generation contributes to the development of diabetic cardiomyopathy. However, little is known about the role of microRNAs in the regulation of ROS formation and myocardial apoptosis in streptozotocin (STZ)-induced diabetic mice. It was observed that microRNA-144 (miR-144) level was lower in heart tissues of STZ-induced diabetic mice. High glucose exposure also reduced miR-144 levels in cultured cardiomyocytes. Moreover, miR-144 modulated high glucose-induced oxidative stress in cultured cardiomyocytes by directly targeting nuclear factor-erythroid 2-related factor 2 (Nrf2), which was a central regulator of cellular response to oxidative stress. The miR-144 mimics aggravated high glucose-induced ROS formation and apoptosis in cardiomyocytes, which could be attenuated by treatment with Dh404, an activator of Nrf2. Meanwhile, inhibition of miR-144 suppressed ROS formation and apoptosis induced by high glucose in cultured cardiomyocytes. What was more important is that reduced myocardial oxidative stress and apoptosis and improved cardiac function were identified in STZ-induced diabetic mice when treated with miR-144 antagomir. Although miR-144 cannot explain the increased oxidative stress in STZ, therapeutic interventions directed at decreasing miR-144 may help to decrease oxidative stress in these hearts. Inhibition of miR-144 might have clinical potential to abate oxidative stress as well as to reduce cardiomyocyte apoptosis and improve cardiac function in diabetic cardiomyopathy. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Near-barrier transfer reactions in the sup 36 S+ sup 144,154 Sm systems

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez Niello, J.O.; Testoni, J.E.; di Tada, M.; Pacheco, A.J. (TANDAR, Departamento de Fisica, Comision Nacional de Energia Atomica, Avenida del Libertador 8250, 1429 Buenos Aires (Argentina)); Napoli, D.R.; Stefanini, A.M.; Corradi, L.; Million, B.; Narayanasamy, M.; Spolaore, P. (Istituto Nazionale di Fisica Nucleare, Laboratori Nazionali di Legnaro, Padova (Italy)); Beghini, S.; Montagnoli, G.; Scarlassara, F.; Segato, G.F.; Signorini, C.; Soramel, F. (Dipartimento di Fisica, Universita e Istituto Nazionale di Fisica Nucleare, Padova (Italy))


    Angular distributions and {ital Q}-value spectra for transfer reactions in the systems {sup 36}S+{sup 144,154}Sm have been measured at two energies close to the Coulomb barrier. Mass and charge identification was achieved using a time-of-flight system followed by an ionization chamber. Transfer probabilities were analyzed considering direct and sequential barrier penetration mechanisms. The dependence of the cross sections on the static quadrupole deformation of the targets was compared with the predictions of a semiclassical approach. The relative yields of the different channels were analyzed in the light of a random-walk approach based on the reaction {ital Q} values.

  4. Comprehensive sieve analysis of breakthrough HIV-1 sequences in the RV144 vaccine efficacy trial.

    Directory of Open Access Journals (Sweden)

    Paul T Edlefsen


    Full Text Available The RV144 clinical trial showed the partial efficacy of a vaccine regimen with an estimated vaccine efficacy (VE of 31% for protecting low-risk Thai volunteers against acquisition of HIV-1. The impact of vaccine-induced immune responses can be investigated through sieve analysis of HIV-1 breakthrough infections (infected vaccine and placebo recipients. A V1/V2-targeted comparison of the genomes of HIV-1 breakthrough viruses identified two V2 amino acid sites that differed between the vaccine and placebo groups. Here we extended the V1/V2 analysis to the entire HIV-1 genome using an array of methods based on individual sites, k-mers and genes/proteins. We identified 56 amino acid sites or "signatures" and 119 k-mers that differed between the vaccine and placebo groups. Of those, 19 sites and 38 k-mers were located in the regions comprising the RV144 vaccine (Env-gp120, Gag, and Pro. The nine signature sites in Env-gp120 were significantly enriched for known antibody-associated sites (p = 0.0021. In particular, site 317 in the third variable loop (V3 overlapped with a hotspot of antibody recognition, and sites 369 and 424 were linked to CD4 binding site neutralization. The identified signature sites significantly covaried with other sites across the genome (mean = 32.1 more than did non-signature sites (mean = 0.9 (p < 0.0001, suggesting functional and/or structural relevance of the signature sites. Since signature sites were not preferentially restricted to the vaccine immunogens and because most of the associations were insignificant following correction for multiple testing, we predict that few of the genetic differences are strongly linked to the RV144 vaccine-induced immune pressure. In addition to presenting results of the first complete-genome analysis of the breakthrough infections in the RV144 trial, this work describes a set of statistical methods and tools applicable to analysis of breakthrough infection genomes in general vaccine

  5. Crystal structure of monoclinic samarium and cubic europium sesquioxides and bound coherent neutron scattering lengths of the isotopes {sup 154}Sm and {sup 153}Eu

    Energy Technology Data Exchange (ETDEWEB)

    Kohlmann, Holger [Leipzig Univ. (Germany). Inst. of Inorganic Chemistry; Hein, Christina; Kautenburger, Ralf [Saarland Univ., Saarbruecken (Germany). Inorganic Solid State Chemistry; Hansen, Thomas C.; Ritter, Clemens [Institut Laue-Langevin, Grenoble (France); Doyle, Stephen [Karlsruhe Institute of Technology, Eggenstein-Leopoldshafen (Germany). Inst. for Synchrotron Radiation (ISS)


    The crystal structures of monoclinic samarium and cubic europium sesquioxide, Sm{sub 2}O{sub 3} and Eu{sub 2}O{sub 3}, were reinvestigated by powder diffraction methods (laboratory X-ray, synchrotron, neutron). Rietveld analysis yields more precise structural parameters than previously known, especially for oxygen atoms. Interatomic distances d(Sm-O) in Sm{sub 2}O{sub 3} range from 226.3(4) to 275.9(2) pm [average 241.6(3) pm] for the monoclinic B type Sm{sub 2}O{sub 3} [space group C2/m, a = 1418.04(3) pm, b = 362.660(7) pm, c = 885.48(2) pm, β = 100.028(1) ], d(Eu-O) in Eu{sub 2}O{sub 3} from 229.9(2) to 238.8(2) pm for the cubic bixbyite (C) type [space group Ia anti 3, a = 1086.87(1) pm]. Neutron diffraction at 50 K and 2 K did not show any sign for magnetic ordering in Sm{sub 2}O{sub 3}. Isotopically enriched {sup 154}Sm{sub 2}O{sub 3} and {sup 153}Eu{sub 2}O{sub 3} were used for the neutron diffraction work because of the enormous absorption cross section of the natural isotopic mixtures for thermal neutrons. The isotopic purity was determined by inductively coupled plasma - mass spectrometry to be 98.9% for {sup 154}Sm and 99.8% for {sup 153}Eu. Advanced analysis of the neutron diffraction data suggest that the bound coherent scattering lengths of {sup 154}Sm and {sup 153}Eu need to be revised. We tentatively propose b{sub c}({sup 154}Sm) = 8.97(6) fm and b{sub c}({sup 153}Eu) = 8.85(3) fm for a neutron wavelength of 186.6 pm to be better values for these isotopes, showing up to 8% deviation from accepted literature values. It is shown that inaccurate scattering lengths may result in severe problems in crystal structure refinements causing erroneous structural details such as occupation parameters, which might be critically linked to physical properties like superconductivity in multinary oxides.

  6. MicroRNA-144 Regulates Hepatic ABCA1 and Plasma HDL Following Activation of the Nuclear Receptor FXR (United States)

    de Aguiar Vallim, Thomas Q.; Tarling, Elizabeth J.; Kim, Tammy; Civelek, Mete; Baldán, Ángel; Esau, Christine; Edwards, Peter A.


    Rationale The bile acid receptor Farnesoid-X-Receptor (FXR) regulates many aspects of lipid metabolism by various complex and not fully understood molecular mechanisms. We set out to investigate the molecular mechanisms for FXR-dependent regulation of lipid and lipoprotein metabolism. Objective To identify FXR-regulated microRNAs that were subsequently involved in regulating lipid metabolism. Methods and Results ATP binding cassette transporter A1 (ABCA1) is a major determinant of plasma High Density Lipoprotein (HDL)-cholesterol levels. Here we show that activation of the nuclear receptor FXR in vivo increases hepatic levels of miR-144, which in turn lower hepatic ABCA1 and plasma HDL levels. We identified two complementary sequences to miR-144 in the 3′ untranslated region (UTR) of ABCA1 mRNA that are necessary for miR-144-dependent regulation. Overexpression of miR-144 in vitro decreased both cellular ABCA1 protein and cholesterol efflux to lipid-poor apolipoprotein A-I (ApoA-I) protein, whilst overexpression in vivo reduced hepatic ABCA1 protein and plasma HDL-cholesterol. Conversely, silencing miR-144 in mice increased hepatic ABCA1 protein and HDL-cholesterol. In addition, we utilized tissue-specific FXR deficient mice to show that induction of miR-144 and FXR-dependent hypolipidemia requires hepatic, but not intestinal FXR. Finally, we identified functional FXR response elements (FXREs) upstream of the miR-144 locus, consistent with direct FXR regulation. Conclusion We have identified a novel pathway involving FXR, miR-144 and ABCA1 that together regulate plasma HDL cholesterol. PMID:23519696

  7. miR-144 attenuates the host response to influenza virus by targeting the TRAF6-IRF7 signaling axis.

    Directory of Open Access Journals (Sweden)

    Carrie M Rosenberger


    Full Text Available Antiviral responses must rapidly defend against infection while minimizing inflammatory damage, but the mechanisms that regulate the magnitude of response within an infected cell are not well understood. miRNAs are small non-coding RNAs that suppress protein levels by binding target sequences on their cognate mRNA. Here, we identify miR-144 as a negative regulator of the host antiviral response. Ectopic expression of miR-144 resulted in increased replication of three RNA viruses in primary mouse lung epithelial cells: influenza virus, EMCV, and VSV. We identified the transcriptional network regulated by miR-144 and demonstrate that miR-144 post-transcriptionally suppresses TRAF6 levels. In vivo ablation of miR-144 reduced influenza virus replication in the lung and disease severity. These data suggest that miR-144 reduces the antiviral response by attenuating the TRAF6-IRF7 pathway to alter the cellular antiviral transcriptional landscape.

  8. MicroRNA-144-3p suppresses tumor growth and angiogenesis by targeting SGK3 in hepatocellular carcinoma. (United States)

    Wu, Manya; Huang, Chaoyuan; Huang, Xinping; Liang, Rong; Feng, Yan; Luo, Xiaoling


    In our previous studies, the Illumine Soledad massively parallel signature sequencing of miRNomes in non‑tumor and hepatocellular carcinoma (HCC) tissues revealed that microRNA (miR)-144-3p was significantly downregulated in HCC, but its role in HCC development, especially angiogenesis, remains unclear. In this investigation, we found recovering miR‑144‑3p expression can significantly suppress the growth, migration and induced angiogenic capacity of HCC cells through both in vivo and in vitro experiments. Moreover, clinical correlation analysis showed that low expression of miR‑144‑3p was positively correlated to poor disease-free survival (DFS) of HCC patients. Mechanistically, serum and glucocorticoid kinase 3 (SGK3), the putative targets of miR‑144‑3p, was predicted by Target Scan database and identified to be suppressed by miR‑144‑3p so that inhibiting the activation of mTOR-VEGF downstream signals was activated by the phosphoinositide 3-kinase (PI3K)-independent pathway. Hence, we concluded that miR‑144‑3p, which is frequently downregulated in HCC, can inhibit proliferation, migration and repress angiogenesis by regulating SGK3 activation with PI3K independent signal pathway, and acts as a prognostic factor for HCC patients.

  9. Direct Evidence of Octupole Deformation in Neutron-Rich $^{144}$Ba

    CERN Document Server

    Bucher, B; Wu, C Y; Janssens, R V F; Cline, D; Hayes, A B; Albers, M; Ayangeakaa, A D; Butler, P A; Campbell, C M; Carpenter, M P; Chiara, C J; Clark, J A; Crawford, H L; Cromaz, M; David, H M; Dickerson, C; Gregor, E T; Harker, J; Hoffman, C R; Kay, B P; Kondev, F G; Korichi, A; Lauritsen, T; Macchiavelli, A O; Pardo, R C; Richard, A; Riley, M A; Savard, G; Scheck, M; Seweryniak, D; Smith, M K; Vondrasek, R; Wiens, A


    The neutron-rich nucleus $^{144}$Ba ($t_{1/2}$=11.5 s) is expected to exhibit some of the strongest octupole correlations among nuclei with mass numbers $A$ less than 200. Until now, indirect evidence for such strong correlations has been inferred from observations such as enhanced $E1$ transitions and interleaving positive- and negative-parity levels in the ground-state band. In this experiment, the octupole strength was measured directly by sub-barrier, multi-step Coulomb excitation of a post-accelerated 650-MeV $^{144}$Ba beam on a 1.0-mg/cm$^2$ $^{208}$Pb target. The measured value of the matrix element, $\\langle 3_1^- \\| \\mathcal{M}(E3) \\| 0_1^+ \\rangle=0.65(^{+17}_{-23})$ $e$b$^{3/2}$, corresponds to a reduced $B(E3)$ transition probability of 48($^{+25}_{-34}$) W.u. This result represents an unambiguous determination of the octupole collectivity, is larger than any available theoretical prediction, and is consistent with octupole deformation.

  10. 24 CFR 943.144 - What financial impact do operations of a subsidiary, affiliate, or joint venture have on a PHA? (United States)


    ... of a subsidiary, affiliate, or joint venture have on a PHA? 943.144 Section 943.144 Housing and Urban... CONSORTIA AND JOINT VENTURES Subsidiaries, Affiliates, Joint Ventures in Public Housing § 943.144 What financial impact do operations of a subsidiary, affiliate, or joint venture have on a PHA? Income generated...

  11. Au99(SPh)42 nanomolecules: aromatic thiolate ligand induced conversion of Au144(SCH2CH2Ph)60. (United States)

    Nimmala, Praneeth Reddy; Dass, Amala


    A new aromatic thiolate protected gold nanomolecule Au99(SPh)42 has been synthesized by reacting the highly stable Au144(SCH2CH2Ph)60 with thiophenol, HSPh. The ubiquitous Au144(SR)60 is known for its high stability even at elevated temperature and in the presence of excess thiol. This report demonstrates for the first time the reactivity of the Au144(SCH2CH2Ph)60 with thiophenol to form a different 99-Au atom species. The resulting Au99(SPh)42 compound, however, is unreactive and highly stable in the presence of excess aromatic thiol. The molecular formula of the title compound is determined by high resolution electrospray mass spectrometry (ESI-MS) and confirmed by the preparation of the 99-atom nanomolecule using two ligands, namely, Au99(SPh)42 and Au99(SPh-OMe)42. This mass spectrometry study is an unprecedented advance in nanoparticle reaction monitoring, in studying the 144-atom to 99-atom size evolution at such high m/z (∼12k) and resolution. The optical and electrochemical properties of Au99(SPh)42 are reported. Other substituents on the phenyl group, HS-Ph-X, where X = -F, -CH3, -OCH3, also show the Au144 to Au99 core size conversion, suggesting minimal electronic effects for these substituents. Control experiments were conducted by reacting Au144(SCH2CH2Ph)60 with HS-(CH2)n-Ph (where n = 1 and 2), bulky ligands like adamantanethiol and cyclohexanethiol. It was observed that conversion of Au144 to Au99 occurs only when the phenyl group is directly attached to the thiol, suggesting that the formation of a 99-atom species is largely influenced by aromaticity of the ligand and less so on the bulkiness of the ligand.

  12. Highly CO2-Tolerant Cathode for Intermediate-Temperature Solid Oxide Fuel Cells: Samarium-Doped Ceria-Protected SrCo0.85Ta0.15O3-δ Hybrid. (United States)

    Li, Mengran; Zhou, Wei; Zhu, Zhonghua


    Susceptibility to CO2 is one of the major challenges for the long-term stability of the alkaline-earth-containing cathodes for intermediate-temperature solid oxide fuel cells. To alleviate the adverse effects from CO2, we incorporated samarium-stabilized ceria (SDC) into a SrCo0.85Ta0.15O3-δ (SCT15) cathode by either mechanical mixing or a wet impregnation method and evaluated their cathode performance stability in the presence of a gas mixture of 10% CO2, 21% O2, and 69% N2. We observed that the CO2 tolerance of the hybrid cathode outperforms the pure SCT15 cathode by over 5 times at 550 °C. This significant enhancement is likely attributable to the low CO2 adsorption and reactivity of the SDC protective layer, which are demonstrated through thermogravimetric analysis, energy-dispersive spectroscopy, and electrical conductivity study.

  13. Atomistic Simulations of Functional Au-144(SR)(60) Gold Nanoparticles in Aqueous Environment

    DEFF Research Database (Denmark)

    Heikkila, E.; Gurtovenko, A. A.; Martinez-Seara, H.


    of the nanoparticle together with surrounding ions and water. We focus on Au-144 nanoparticles that comprise a nearly spherical Au core (diameter similar to 2 nm), a passivating Au-S interface, and functionalized alkanethiol chains. Cationic and anionic AuNPs have been modeled with amine and carboxyl terminal groups...... and Cl-/Na+ counterions, respectively. The radial distribution functions show that the side chains and terminal groups show significant flexibility. The orientation of water is distinct in the first solvation shell, and AuNPs cause a long-range effect in the solvent structure. The radial electrostatic...... in aqueous solutions. They suggest that electrostatics is one of the central factors in complexation of AuNPs with other nanomaterials and biological systems, and that effects of electrostatics as water-mediated interactions are relatively long-ranged, which likely plays a role in, e.g., the interplay...

  14. Lifetime tumor risk coefficients for beagle dogs that inhaled cerium-144 chloride

    Energy Technology Data Exchange (ETDEWEB)

    Boecker, B.B.; Hahn, F.F.; Griffith, W.C. [and others


    Reported here is one of the life-span radionuclide toxicology studies being conducted at ITRI in Beagle dogs. These studies are examining the life-span health risks of inhaled {Beta}-, {gamma}- and {alpha}-emitting radionuclides to expand available knowledge on these risks especially for the many cases for which human data are not available. The outcomes of these studies are providing important information on dosimetry and dose-response relationships for these inhaled radionuclides and the relative importance of a broad range of dose- and effect-modifying factors. A number of these studies are currently coming to completion. Much of the ITRI effort is being directed to final reviews of the dosimetric, clinical, and pathologic results and writing summary manuscripts. Radiation doses and effects in tissues adjacent to bone, specifically those of epithelial or marrow origin, should be considered when determining risks from internally deposited, bone-seeking radionuclides such as {sup 144}Ce.

  15. Identification of low-energy isovector octupole states in 144Nd (United States)

    Thürauf, M.; Scheck, M.; Bernards, C.; Blanc, A.; Cooper, N.; Defrance, G.; Jentschel, M.; Jolie, J.; Kaleja, O.; Köster, U.; Kröll, T.; Mutti, P.; Simpson, G. S.; Soldner, T.; Tezgel, M.; Urban, W.; Vanhoy, J.; Werner, M.; Werner, V.; Zell, K. O.


    Recently, first candidates for low-lying isovector states in the octupole sector were suggested. The unambiguous identification of those states will contribute to the decomposition of the octupole-octupole residual interaction in an isoscalar and isovector part. This will help us understand the octupole degree of freedom. In 144Nd the 3- state at 2778 keV is a good candidate for such a “mixed-symmetry’' octupole state. In order to clarify the nature of this state, a 143Nd(n, γ)-experiment was conducted with the EXILL-setup. Following neutron capture the 3- states are populated and EXILL provides the opportunity to determine the multipole-mixing ratios of the 3i -→31 - transitions. For the transition from the “mixed-symmetry” octupole state to the symmetric 31 - state we expect a strong M1 component.

  16. Samarium-neodymium chronology and rubidium-strontium systematics of an Allende calcium-aluminum-rich inclusion with implications for 146Sm half-life (United States)

    Marks, N. E.; Borg, L. E.; Hutcheon, I. D.; Jacobsen, B.; Clayton, R. N.


    Calcium-aluminum-rich inclusions (CAIs) are primitive objects that formed within the protoplanetary disk surrounding the young Sun. Recent Pb-Pb chronologic studies have demonstrated that CAIs are the oldest solar system solids, crystallizing 4567 Ma ago (Amelin et al., 2002; Connelly et al., 2012). The isotope systematics of CAIs therefore provide critical insight into the earliest history of the Solar System. Although Sm-Nd and Rb-Sr geochronometers are highly effective tools for investigating cosmochemical evolution in the early Solar System, previous studies of CAIs have revealed evidence for isotopically disturbed systems. Here we report new age data for Allende CAI Al3S4 derived from both the long-lived (147Sm-143Nd) and short-lived (146Sm-142Nd) isotopic systems. The 147Sm-143Nd chronometer yields an age of 4560 ± 34 Ma that is concordant with 207Pb-206Pb ages for CAIs and indicates that the Sm-Nd system was not significantly disturbed by secondary alteration or nucleosynthetic processes. The slope of the 146Sm-142Nd isochron defines the Solar System initial 146Sm/144Sm of 0.00828 ± 0.00044. This value is significantly different from the value of 0.0094 determined by Kinoshita et al. (2012). Ages recalculated from all published 146Sm-142Nd isochron data using the traditional 103 Ma half-life and the initial 146Sm/144Sm value determined here closely match Pb-Pb and 147Sm-143Nd ages determined on the same samples. In contrast, ages recalculated using the 68 Ma half-life determined by Kinoshita et al. (2012) and either of the initial 146Sm/144Sm values are often anomalously old. This is particularly true for the youngest samples with 146Sm-142Nd isochron ages that are most sensitive to the choice of 146Sm half-life used in the age calculation. In contrast to the Sm-Nd isotope system, the Rb-Sr system is affected by alteration but yields an apparent isochron with a slope corresponding to a much younger age of 4247 ± 110 Ma. Although the Rb-Sr system in CAIs

  17. Loss of the miR-144/451 cluster impairs ischaemic preconditioning-mediated cardioprotection by targeting Rac-1 (United States)

    Wang, Xiaohong; Zhu, Hongyan; Zhang, Xiaowei; Liu, Yong; Chen, Jing; Medvedovic, Mario; Li, Hongliang; Weiss, Mitchell J.; Ren, Xiaoping; Fan, Guo-Chang


    Aims While a wealth of data has uncovered distinct microRNA (miR) expression alterations in hypertrophic and ischaemic/reperfused (I/R) hearts, little is known about miR regulation and response to ischaemic preconditioning (IPC). Methods and results We analysed miRs in murine hearts preconditioned with six cycles of 4 min ischaemia via coronary artery occlusion, followed by 4 min reperfusion in vivo. Both miRs within the miR-144/451 cluster were the most elevated among a cohort of 21 dysregulated miRs in preconditioned hearts, compared with shams. To investigate the significance of this finding, we examined IPC-mediated cardioprotection within a miR-144/451-knockout (KO) mouse model. Wild-type (WT) hearts exposed to IPC followed by I/R (30 min/24 h) showed a smaller infarction size compared with mice treated with I/R alone. In contrast, IPC failed to protect miR-144/451-KO hearts against infarct caused by I/R treatment. Thus, the miR-144/451 cluster is required for IPC-elicited cardioprotection. Rac-1, a key component of NADPH oxidase, was mostly up-regulated in KO hearts among three bona fide targets (Rac-1, 14-3-3ζ, and CUGBP2) for both miR-144 and miR-451. Accordingly, reactive oxygen species (ROS) levels were markedly increased in KO hearts upon IPC, compared with IPC-WT hearts. Pre-treatment of KO hearts with a Rac-1 inhibitor NSC23766 (20 mg/kg, ip) reduced IPC-triggered ROS levels and restored IPC-elicited cardioprotection. Using antagomiRs, we showed that miR-451 was largely responsible for IPC-mediated cardioprotection. Conclusion Loss of the miR-144/451 cluster limits IPC cardioprotection by up-regulating Rac-1-mediated oxidative stress signalling. PMID:22354898

  18. Ferrites Ni{sub 0,5}Zn{sub 0,5}Fe{sub 2}O{sub 4} doped with samarium: structural analysis, morphological and electromagnetic; Ferritas Ni{sub 0,5}Zn{sub 0,5}Fe{sub 2}O{sub 4} dopada com samario: analise estrutural, morfologica e eletromagnetica

    Energy Technology Data Exchange (ETDEWEB)

    Costa, A.C.F.M.; Diniz, A.P., E-mail: [Universidade Federal de Campina Grande (UFCG), PB (Brazil). Unidade Academinca de Engenharia de Materiais; Viana, K.M.S. [Universidade Federal do Rio Grande do Norte (UFRN), Natal, PE (Brazil). Escola de Ciencias e Tecnologia; Cornejo, D.R. [Universidade de Sao Paulo (USP), SP (Brazil). Instituto de Fisica; Kiminami, R.H.G.A. [Universidade Federal de Sao Carlos (UFSCar), SP (Brazil). Departamento de Engenharia de Materiais


    This paper proposes to investigate the sintering at 1200 deg C/2h of Ni{sub 0.5}Zn{sub 0.5}Fe{sub 2-x}Sm{sub x}O{sub 4} ferrite doped with 0.05; 0.075 e 0.1 mol of Sm synthesized by combustion reaction to evaluate the performance materials as absorbers of electromagnetic radiation. The influence of the concentration of samarium on the structure, morphology and electromagnetic properties of ferrites was studied. The resulting samples were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), magnetic measurements and reflectivity measurements in the frequency range between 8-12 GHz. The results showed that increasing the concentration of samarium caused a decrease in particle size of the samples, encouraging, therefore, to obtain materials with better values of magnetization and reflectivity, allowing for use as absorbers in narrow-band frequency between 9-10 GHz. (author)

  19. Utilizing assumption for project of stand for solid state targets activation on inner beams of AIC-144 cyclotron; Zalozenia uzytkowe do projektu stanowiska do aktywacji tarcz w stanie stalym na wiazce wewnetrznej cyklotronu AIC-144

    Energy Technology Data Exchange (ETDEWEB)

    Petelenz, B. [The H. Niewodniczanski Inst. of Nuclear Physics, Cracow (Poland)


    General assumptions for project of target activation stand at AIC-144 cyclotron are presented. The project predicts production of {sup 67}Ga, {sup 111}In, {sup 201}Tl, {sup 139}Ce, {sup 88}Y, {sup 123}I and {sup 211}At isotopes using various target backings. Directions concerning target cooling and beam parameters are also described 25 refs, 1 tab

  20. Investigations of the level scheme of {sup 144}Gd and lifetimes in the quadrupole bands

    Energy Technology Data Exchange (ETDEWEB)

    Lieder, R.M.; Gast, W.; Jaeger, H.M.; Mihailescu, L. [Institut fuer Kernphysik, Forschungszentrum Juelich, D-52425, Juelich (Germany); Pasternak, A.A.; Podsvirova, E.O. [Institut fuer Kernphysik, Forschungszentrum Juelich, D-52425, Juelich (Germany); A.F. Ioffe Physical Technical Institute RAS, RU-194021, St. Petersburg (Russian Federation); Efimov, A.D. [A.F. Ioffe Physical Technical Institute RAS, RU-194021, St. Petersburg (Russian Federation); Mikhajlov, V.M. [Physical Institute, St. Petersburg State University, RU-198904, St. Petersburg (Russian Federation); Wyss, R. [Royal Institute of Technology, Physics Department Frescati, S-10405, Stockholm (Sweden); Venkova, T. [Institute of Nuclear Research and Nuclear Energy, Bulgarian Academy of Sciences, BG-1784, Sofia (Bulgaria); Bazzacco, D.; Lunardi, S.; Menegazzo, R.; Rossi Alvarez, C. [Dipartimento di Fisica dell' Universita and Istituto Nazionale di Fisica Nucleare, Sezione di Padova, I-35131, Padova (Italy); Angelis, G. de; Napoli, D.R. [Istituto Nazionale di Fisica Nucleare, Laboratori Nazionali di Legnaro, I-35020, Legnaro (Italy); Rzaca-Urban, T.; Urban, W. [Institute of Experimental Physics, University of Warsaw, PL-00-681, Warszawa (Poland); Dewald, A. [Institut fuer Kernphysik, Universitaet zu Koeln, D-50937, Koeln (Germany)


    For a level scheme investigation of {sup 144}Gd an experiment with the {gamma}-spectrometer EUROBALL III has been carried out and lifetimes have been measured with the {gamma}-spectrometer GASP using the Doppler-shift attenuation method. The high-spin states have been populated in these experiments by means of the {sup 100}Mo({sup 48}Ti,4n) reaction at 215 MeV and the {sup 114}Cd({sup 36}S,6n) reaction at E=182 MeV, respectively. The known quadrupole band has been modified and a new one has been established. Reduced E2 transition probabilities B(E2) were determined for seven members of these quadrupole bands. They show values between {approx}60 and 130 W.u. and this considerable enhancement gives evidence for a significant nuclear deformation. A ({pi}h{sub 11/2}){sup 2} x ({nu}h{sub 11/2}){sup -2} configuration may be assigned to one of the quadrupole bands according to total Routhian surface calculations. The spin dependence of the B(E2) values has been explained by IBM calculations involving high-spin quasiparticle excitations. (orig.)

  1. Sleep Apnea and Hypoventilation in Patients with Down Syndrome: Analysis of 144 Polysomnogram Studies

    Directory of Open Access Journals (Sweden)

    Zheng Fan


    Full Text Available Patients with Down syndrome (DS are at risk for both obstructive sleep apnea (OSA and central sleep apnea (CSA; however, it is unclear how these components evolve as patients age and whether patients are also at risk for hypoventilation. A retrospective review of 144 diagnostic polysomnograms (PSG in a tertiary care facility over 10 years was conducted. Descriptive data and exploratory correlation analyses were performed. Sleep disordered breathing was common (seen in 78% of patients with an average apnea-hypopnea index (AHI = 10. The relative amount of obstructive apnea was positively correlated with age and body mass index (BMI. The relative amount of central sleep apnea was associated with younger age in the very youngest group (0–3 years. Hypoventilation was common occurring in more than 22% of patients and there was a positive correlation between the maximum CO2 and BMI. Sleep disordered breathing, including hypoventilation, was common in patients with DS. The obstructive component increased significantly with age and BMI, while the central component occurred most in the very young age group. Due to the high risk of hypoventilation, which has not been previously highlighted, it may be helpful to consider therapies to target both apnea and hypoventilation in this population.

  2. 143rd and 144th meetings of the Governing Board of the Pension Fund

    CERN Multimedia


    The Governing Board of the Pension Fund held its 143rd and 144th meetings on 16 May and 13 June respectively. At the first of these two meetings, the Board took note of the report by the Austrian Court of Audit on the 2005 financial year and of the associated comments by the Administration of the Fund. It also listened to a report by the Chairman of the Investment Committee on the latter's 10 May meeting, at which the two fund managers responsible for the "QUAM" and "Far East Ex-Japan" portfolios had been interviewed and their performances judged satisfactory. The Committee had also decided to commission ORTEC to carry out a full assets/liabilities modelling study during the current year. During the meeting, the Board also approved a document setting out its position on the CERN debt to the Pension Fund, which would be submitted to the Finance Committee and Council in June. It underlined that the reimbursement of the debt would be advantageous for the Fund as well as for the Laboratory and that it would re...

  3. Spatiotemporal structure of a laser beam over 144 km in a Canary Islands experiment. (United States)

    Gurvich, Alexandre S; Gorbunov, Michael E; Fedorova, Olga V; Kirchengast, Gottfried; Proschek, Veronika; González Abad, Gonzalo; Tereszchuk, Keith A


    We analyzed the observations of scintillations in a laser beam (532 nm, ~200 mW power) traveling along a 144 km path at an altitude of 2.2-2.4 km above sea level, just above the atmospheric boundary layer, between the islands of La Palma and Tenerife. The observations were performed during nighttime on 18 July 2011, by means of a telescope with an aperture diameter of 1 m. Strong scintillations were observed. The estimates of spatial spectra and correlation functions indicated that the observed intensity fields possess, statistically, a locally isotropic structure, which agrees with the idea of a locally isotropic turbulence. The estimates of spatial autospectra and autocorrelation functions of the intensity field indicated that the characteristic scale of the internal structure of the observed clusters is 6.5-8 mm, while the characteristic size of the clusters is 4-5 cm. The major contribution to the observed scintillations comes from the inhomogeneities of the intensity field with scales from 1-2 cm up to 10-12 cm. The analysis of the cross-spectra indicated that the hypothesis of frozen turbulence introduced by Taylor can be used for the description of spatiotemporal structure of intensity fluctuations of laser beams traveling through long paths in the atmosphere.

  4. Fever of unknown origin in adults: evaluation of 144 cases in a non-university hospital. (United States)

    Zenone, Thierry


    The spectrum of diseases found in series of fever of unknown origin shows variation in relation to selection bias; particularly, selection of the most difficult cases in tertiary reference university centres. We present a series of 144 patients presenting to a non-university hospital between 1999 and 2005 (secondary level of the health care system) with a community-acquired fever of unknown origin. In 37 cases (25.7%), the reason for fever could not be explained. Among the 107 patients with a final diagnosis (74.3%), non-infectious inflammatory disorders represented the most prevalent category (35.5%), surpassing infections (30.8%), miscellaneous causes (20.6%) and malignancies (13.5%). 13 entities accounted for over 68% of diagnoses (sinusitis and occult dental infections, Q fever, Epstein-Barr virus and cytomegalovirus infections, lymphoma, colo-rectal adenocarcinoma, adult-onset Still disease, systemic lupus erythematosus, giant cell arteritis and/or polymyalgia rheumatica, rheumatoid arthritis, polyarteritis nodosa, factitious fever and habitual hyperthermia). As demonstrated in other studies, non-infectious inflammatory diseases emerge as the most prevalent diagnostic category. Giant cell arteritis and polymyalgia rheumatica were particularly frequent in the elderly. Epstein-Barr virus and cytomegalovirus infections and habitual hyperthermia were particularly frequent in the youngest patients. There were no major differences in repartition of diagnostic categories between this series and historical university series.

  5. The high-affinity peptidoglycan binding domain of Pseudomonas phage endolysin KZ144

    Energy Technology Data Exchange (ETDEWEB)

    Briers, Yves [Division of Gene Technology, Department of Biosystems, Katholieke Universiteit Leuven, Kasteelpark Arenberg 21, B-3001 Leuven (Belgium); Schmelcher, Mathias; Loessner, Martin J. [Institute of Food Science and Nutrition, ETH Zuerich, Schmelzbergstrasse 7, CH-8092 Zuerich (Switzerland); Hendrix, Jelle; Engelborghs, Yves [Laboratory of Biomolecular Dynamics, Department of Chemistry, Katholieke Universiteit Leuven, Celestijnenlaan 200G, B-3001 Leuven (Belgium); Volckaert, Guido [Division of Gene Technology, Department of Biosystems, Katholieke Universiteit Leuven, Kasteelpark Arenberg 21, B-3001 Leuven (Belgium); Lavigne, Rob, E-mail: [Division of Gene Technology, Department of Biosystems, Katholieke Universiteit Leuven, Kasteelpark Arenberg 21, B-3001 Leuven (Belgium)


    The binding affinity of the N-terminal peptidoglycan binding domain of endolysin KZ144 (PBD{sub KZ}), originating from Pseudomonas aeruginosa bacteriophage {phi}KZ, has been examined using a fusion protein of PBD{sub KZ} and green fluorescent protein (PBD{sub KZ}-GFP). A fluorescence recovery after photobleaching analysis of bound PBD{sub KZ}-GFP molecules showed less than 10% fluorescence recovery in the bleached area within 15 min. Surface plasmon resonance analysis confirmed this apparent high binding affinity revealing an equilibrium affinity constant of 2.95 x 10{sup 7} M{sup -1} for the PBD{sub KZ}-peptidoglycan interaction. This unique domain, which binds to the peptidoglycan of all tested Gram-negative species, was harnessed to improve the specific activity of the peptidoglycan hydrolase domain KMV36C. The chimeric peptidoglycan hydrolase (PBD{sub KZ}-KMV36C) exhibits a threefold higher specific activity than the native catalytic domain (KMV36C). These results demonstrate that the modular assembly of functional domains is a rational approach to improve the specific activity of endolysins from phages infecting Gram-negatives.

  6. Stereotypical hand movements in 144 subjects with Rett syndrome from the population-based Australian database. (United States)

    Carter, Philippa; Downs, Jenny; Bebbington, Ami; Williams, Simon; Jacoby, Peter; Kaufmann, Walter E; Leonard, Helen


    Stereotypic hand movements are a feature of Rett Syndrome but few studies have observed their nature systematically. Video data in familiar settings were obtained on subjects (n = 144) identified from an Australian population-based database. Hand stereotypies were demonstrated by most subjects (94.4%), 15 categories were observed and midline wringing was seen in approximately 60% of subjects. There was a median of two stereotypies per subject but this number decreased with age. Clapping and mouthing of hands were more prevalent in girls younger than 8 years and wringing was more prevalent in women 19 years or older. Clapping was commoner in those with p.R306C and early truncating mutations, and much rarer in those with p.R106W, p.R270X, p.R168X, and p.R255X. Stereotypies tended to be less frequent in those with more severe mutations. Otherwise, there were no clear relationships between our categories of stereotypies and mutation. Approximately a quarter each had predominantly right and left handed stereotypies and for the remaining half, no clear laterality was seen. Results were similar for all cases and when restricted to those with a pathogenic mutation. Hand stereotypies changed with increasing age but limited relationships with MECP2 mutations were identified. (c) 2009 Movement Disorder Society.

  7. Greenhouse gas measurements over a 144 km open path in the Canary Islands

    Directory of Open Access Journals (Sweden)

    J. S. A. Brooke


    Full Text Available A new technique for the satellite remote sensing of greenhouse gases in the atmosphere via the absorption of short-wave infrared laser signals transmitted between counter-rotating satellites in low Earth orbit has recently been proposed; this would enable the acquisition of a long-term, stable, global set of altitude-resolved concentration measurements. We present the first ground-based experimental demonstration of this new infrared-laser occultation method, in which the atmospheric absorption of CO2 near 2.1 μm was measured over a ~144 km path length between two peaks in the Canary Islands (at an altitude of ~2.4 km, using relatively low power diode lasers (~4 to 10 mW. The retrieved CO2 volume mixing ratio of 400 ppm (±15 ppm is consistent within experimental uncertainty with simultaneously recorded in situ validation measurements. We conclude that the new method has a sound basis for monitoring CO2 in the free atmosphere; other greenhouse gases such as methane, nitrous oxide and water vapour can be monitored in the same way.

  8. Identification of a novel homozygous mutation (S144I) in a Malay patient with maple syrup urine disease. (United States)

    Ali, Ernie Zuraida; Yunus, Zabedah Md; Desa, Norsiah Md; Hock, Ngu Lock


    Maple syrup urine disease (MSUD) is a rare autosomal recessive metabolic disorder of branched-chain amino acid metabolism caused by the defective function of branched-chain α-ketoacid dehydrogenase complex (BCKDH). It is characterised by increased plasma leucine, isoleucine, and valine levels, and mutations can be detected in any one of the BCKDHA, BCKDHB, and DBT genes. In this study, we describe the molecular basis of a novel mutation found in one MSUD Malay patient from consanguineous parents. A homozygous mutation has been detected in this patient whose both parents carried a heterozygous mutation at DNA coding region c.431G>T in exon 4, which resulted in a substitution of serine to isoleucine at codon 144 (p.S144I). In silico analysis predicted S144I to be potentially damaging. The mutation was located on the alpha helical region of the BCKDHA protein, and it is predicted to affect the stability of protein due to the loss of various polar interactions between local secondary structures. Homology analysis revealed that this mutation occurred in a highly conserved region (100%). This result indicates that S144I mutation is likely pathogenic and may contribute to the classic form of MSUD in this patient.

  9. The potential impact of RV144-like vaccines in rural South Africa: a study using the STDSIM microsimulation model.

    NARCIS (Netherlands)

    Hontelez, J.A.; Nagelkerke, N.; Barnighausen, T.; Bakker, R.; Tanser, F.; Newell, M.L.; Lurie, M.N.; Baltussen, R.M.P.M.; Vlas, S.J. de


    BACKGROUND: The only successful HIV vaccine trial to date is the RV144 trial of the ALVAC/AIDSVAX vaccine in Thailand, which showed an overall incidence reduction of 31%. Most cases were prevented in the first year, suggesting a rapidly waning efficacy. Here, we predict the population level impact

  10. Met144Ala mutation of the copper-containing nitrite reductase from Alcaligenes xylosoxidans reverses the intramolecular electron transfer

    DEFF Research Database (Denmark)

    Farver, Ole; Eady, Robert R; Sawers, Gary


    Pulse radiolysis has been employed to investigate the intramolecular electron transfer (ET) between the type 1 (T1) and type 2 (T2) copper sites in the Met144Ala Alcaligenes xylosoxidans nitrite reductase (AxCuNiR) mutant. This mutation increases the reduction potential of the T1 copper center...

  11. Cosmic-ray history derived from the {sup 54}Mn, {sup 56}Ni and {sup 144}Pm chronometers

    Energy Technology Data Exchange (ETDEWEB)

    Zaerpoor, K.; Chan, Y.D.; DiGregorio, D.E.; Dragowsky, M.R.; Hindi, M.M.; Isaac, M.C.P.; Krane, K.S.; Larimer, R.-M.; Macchiavelli, A.O.; Macleod, R. W.; Miocinovic, P.; Norman, E.B.; Robinson, S.J


    Sources of {sup 54}Mn, {sup 56}Ni, and {sup 144}Pm were placed at the center of the Gammasphere array and searches were made for the astrophysically interesting {beta}{sup +} decay modes of these isotopes. The results of these searches are presented and the implications for cosmic-ray physics are discussed.

  12. Human cytomegalovirus UL55, UL144, and US28 genotype distribution in infants infected congenitally or postnatally. (United States)

    Paradowska, Edyta; Studzińska, Mirosława; Suski, Patrycja; Kasztelewicz, Beata; Wiśniewska-Ligier, Małgorzata; Zawilińska, Barbara; Gaj, Zuzanna; Nowakowska, Dorota


    Cytomegalovirus (CMV) is the most common cause of congenital infection. This pathogen exhibits extensive genetic variability in the genes that encode structural envelope glycoproteins, regulatory proteins, and proteins that contribute to immune evasion. However, the role of specific viral strains in the outcome of congenital CMV infection is unclear. Variation in the UL55 gene encoding glycoprotein B (gB), the UL144 gene encoding TNF α-like receptor, and the US28 gene encoding β-chemokine receptor was determined in 60 newborn infants with congenital CMV infection and 90 infants with postnatal or undefined CMV infection. CMV polymorphisms were studied in relation to disease outcome and viral load. Genotyping was performed by a sequencing analysis of PCR-amplified fragments, and the viral load was measured by quantitative real-time PCR. The results demonstrated that (1) the UL55 and US28 genotype distributions were similar among the group of congenital and postnatal CMV infection; (2) the UL144 B1 genotype was more prevalent in congenital than in postnatal infection and was detected in 70% of newborns with asymptomatic congenital infection; and (3) none of the examined genotype was significantly linked with symptomatic CMV infection. No relationship was observed between genotype and viral load. The results revealed that UL55, UL144, and US28 polymorphisms are not associated with the outcome of CMV infection in infants, but the presence of UL144 B1 genotype might be virological marker of asymptomatic infection at birth. © 2015 Wiley Periodicals, Inc.

  13. Trueperella pyogenes multispecies infections in domestic animals: a retrospective study of 144 cases (2002 to 2012). (United States)

    Ribeiro, M G; Risseti, R M; Bolaños, C A D; Caffaro, K A; de Morais, A C B; Lara, G H B; Zamprogna, T O; Paes, A C; Listoni, F J P; Franco, M M J


    Formerly, Arcanobacterium pyogenes was recently renamed Trueperella pyogenes. This opportunistic bacterium is related to miscellaneous pyogenic infections in animals. Most studies involving T. pyogenes are case reports, whereas few surveys have focused the major aspects of T. pyogenes infections involving a case series study design. The aim of this study was to retrospectively evaluate selected epidemiological and clinical aspects, as well as the in vitro antimicrobial susceptibility pattern of 144 cases of T. pyogenes infections among domestic animals from 2002 to 2012. T. pyogenes was isolated from different clinical specimens from cattle, goats, sheep, pigs, horses, dogs, and buffaloes. Correlations were assessed by the Chi-square or Fisher's exact tests. Mastitis (45.1%), abscesses (18.0%), pneumonia (11.1%), and lymphadenitis (9.0%) were the most common clinical manifestations. In addition, the organism was also isolated from other miscellaneous clinical specimens from cases of septicemia, encephalitis, pyometra, prostatitis, orchitis, seminal vesiculitis, pericarditis, and omphalitis. No statistical association was observed between T. pyogenes infections and age, gender, or season across the study. The most effective drugs against the pathogen were florfenicol (99.1%), cefoperazone (96.0%), cephalexin (95.0%), and ceftiofur (94.8%). High resistance rates were observed against trimethoprim-sulfamethoxazole (49.3%), followed by norfloxacin (10.9%) and tetracycline (9.2%). This study highlights the diversity of clinical manifestations and the opportunistic behavior of T. pyogenes infections in domestic animals, with predominance of mastitis, abscesses, pneumonia, and lymphadenitis. It also reinforces the importance of knowing the susceptibility profile before initiating therapy, to improve antimicrobial therapy approaches.

  14. Insight into 144 patients with ocular vascular events during VEGF antagonist injections

    Directory of Open Access Journals (Sweden)

    Shami M


    Full Text Available Ahmad M Mansour1, Maha Shahin2, Peter K Kofoed3, Maurizio B Parodi4, Michel Shami5, Stephen G Schwartz6, Collaborative Anti-VEGF Ocular Vascular Complications GroupDepartment of Ophthalmology, 1American University of Beirut, Beirut, Lebanon, Rafic Hariri University Hospital, Beirut, Lebanon; 2Mansoura University, Mansoura City, Egypt; 3Glostrup Hospital, University of Copenhagen, Denmark, National Eye Clinic, Kennedy Center, Glostrup, Denmark; 4University Vita-Salute, Scientific Institute San Raffaele, Milan, Italy; 5Texas Tech University Health Sciences Center, Lubbock, TX, USA; 6Bascom Palmer Eye Institute, University of Miami Miller School of Medicine, Naples and Miami, FL, USAAim: To record ocular vascular events following injections of vascular endothelium growth factor (VEGF antagonists.Methods: Collaborative multicenter case series (48 cases, literature reviews (32 cases, and reports to the FDA (64 cases of patients that had vascular occlusions during anti-VEGF therapy were collected and analyzed.Results: A total of 144 cases of ocular vascular events were identified, with these diagnosed a median of 15 days after anti-VEGF injection. The majority of patients had pre-existing risk factors for cardiovascular events and nine patients had a prior history of glaucoma. Mean visual acuity dropped by 6.4 lines with severe visual loss after injection to NLP (five eyes, LP (six eyes, and HM (two eyes. The overall risk of ocular vascular events following a VEGF antagonist injection was 0.108% in the general population and 2.61% in the diabetic population. Mean retinal arterial constriction after intravitreal bevacizumab in 13 eyes was 21% (standard deviation = 27%, and mean retinal venous constriction was 8% (standard deviation = 30%.Conclusion: Ocular vascular events are rare during anti-VEGF therapy, but can lead to severe visual loss and may be caused by a number of factors including the vasoconstrictor effect of the drug, a post-injection rise

  15. Kolejność obowiązku alimentacyjnego z art. 144 kodeksu rodzinnego i opiekuńczego


    Szlęzak, Andrzej


    The problem of alimentary duties between step-parents and step-children has often been referred to in the works of legal writers. However, the question of the sequence of the said duties has not been satisfactorily explained. The authors, despite the wording of sec. 144, are unanimous that it should be determined with regardless of the principles of social coexistence. In the present paper, the author undertakes the task of proving that the adoption of the said principles in...

  16. 29 CFR 780.144 - “As an incident to or in conjunction with” the farming operations. (United States)


    ... 29 Labor 3 2010-07-01 2010-07-01 false âAs an incident to or in conjunction withâ the farming... in Conjunction Withâ the Farming Operations § 780.144 “As an incident to or in conjunction with” the farming operations. In order for practices other than actual farming operations to constitute “agriculture...

  17. Retrospective evaluation of bone pain palliation after samarium-153-EDTMP therapy Avaliação retrospectiva do tratamento da dor óssea metastática com Samário-153-EDTMP

    Directory of Open Access Journals (Sweden)

    Marcelo Tatit Sapienza


    Full Text Available PURPOSE: The aim of this study was to evaluate the degree of metastatic bone pain palliation and medullar toxicity associated with samarium-153-EDTMP treatment. METHODS: Seventy-three patients with metastatic bone pain having previously undergone therapy with samarium-153-EDTMP (1 mCi/kg were retrospectively evaluated. Routine follow-up included pain evaluation and blood counts for 2 months after treatment. Pain was evaluated using a subjective scale (from 0 to 10 before and for 8 weeks after the treatment. Blood counts were obtained before treatment and once a week for 2 months during follow-up. Dosimetry, based upon the urinary excretion of the isotope, was estimated in 41 individuals, and the resulting radiation absorbed doses were correlated with hematological data. RESULTS: Reduction in pain scores of 75% to 100% was obtained in 36 patients (49%, with a decrease of 50% to 75%, 25% to 50%, and 0% to 25% in, respectively, 20 (27%, 10 (14%, and 7 (10% patients. There was no significant relationship between the pain response and location of the primary tumor (breast or prostate cancer. Mild to moderate myelosuppression was noted in 75.3% of patients, usually with hematological recovery at 8 weeks. The mean bone marrow dose was 347 ± 65 cGy, and only a weak correlation was found between absorbed dose and myelosuppression (Pearson coefficient = .4. CONCLUSIONS: Samarium-153-EDTMP is a valuable method for metastatic bone pain palliation. A mild to moderate and transitory myelosuppression is the main toxicity observed after samarium therapy, showing a weak correlation with dosimetric measures.OBJETIVO: O presente trabalho teve por objetivo avaliar o efeito paliativo da dor e a toxicidade medular associados ao tratamento com Samário-153-EDTMP em pacientes com metástases ósseas. MÉTODOS: O estudo foi realizado de forma retrospectiva, a partir do levantamento de prontuário de 178 pacientes submetidos a tratamento com 1mCi/kg de 153Sm

  18. The dynamics of the laser-induced metal-semiconductor phase transition of samarium sulfide (SmS); Die Dynamik des laserinduzierten Metall-Halbleiter-Phasenuebergangs von Samariumsulfid (SmS)

    Energy Technology Data Exchange (ETDEWEB)

    Kaempfer, Tino


    The present thesis is dedicated to the experimental study of the metal-semiconductor phase transition of samarium sulfide (SmS): Temperature- and time-resolved experiments on the characterization of the phase transition of mixed-valence SmS samples (M-SmS) are presented. The measurement of the dynamics of the laser-induced phase transition pursues via time-resolved ultrashort-time microscopy and by X-ray diffraction with sub-picosecond time resolution. The electronic and structural processes, which follow an excitation of M-SmS with infrared femtosecond laser pulses, are physically interpreted on the base of the results obtained in this thesis and model imaginations. [German] Die vorliegende Arbeit ist der experimentellen Untersuchung des Metall-Halbleiter-Phasenuebergangs von Samariumsulfid (SmS) gewidmet. Es werden temperatur- und zeitaufgeloeste Experimente zur Charakterisierung des Phasenuebergangs gemischt-valenter SmS Proben (M-SmS) vorgestellt. Die Messung der Dynamik des laserinduzierten Phasenuebergangs erfolgt ueber zeitaufgeloeste Ultrakurzzeit-Mikroskopie und durch Roentgenbeugung mit subpikosekunden Zeitaufloesung. Die elektronischen und strukturellen Prozesse, welche einer Anregung von M-SmS mit infraroten Femtosekunden-Laserpulsen folgen, werden auf der Basis der in dieser Arbeit gewonnenen Ergebnisse und Modellvorstellungen physikalisch interpretiert. (orig.)

  19. Effects of the dimeric PSD-95 inhibitor UCCB01-144 in mouse models of pain, cognition and motor function

    DEFF Research Database (Denmark)

    Andreasen, Jesper T; Nasser, Arafat; Caballero-Puntiverio, Maitane


    NMDAR antagonism shows analgesic action in humans and animal pain models, but disrupts cognitive and motor functions. NMDAR-dependent NO production requires tethering of the NMDAR to neuronal NO synthase (nNOS) by the postsynaptic density protein-95 (PSD-95). Perturbing the NMDAR/PSD-95/nNOS inte...... in the STFP test. Collectively, UCCB01-144 reversed both CFA and SNI-induced hypersensitivity, but the efficacy in the SNI model was only transient. This suggests that enhanced BBB permeability of PSD-95 inhibitors improves the analgesic action in neuropathic pain states.......NOS interaction has therefore been proposed as an alternative analgesic mechanism. We recently reported that UCCB01-125, a dimeric PSD-95 inhibitor with limited blood-brain-barrier permeability, reduced mechanical hypersensitivity in the complete Freund's adjuvant (CFA) inflammatory pain model, without disrupting...... of neuropathic pain. Potential cognitive effects of UCCB01-144 were examined using the social transmission of food preference (STFP) test and the V-maze test, and motor coordination was assessed with the rotarod test. UCCB01-144 (10mg/kg) reversed CFA-induced mechanical hypersensitivity after 1h, and completely...

  20. Metabolic Profile of Synthetic Cannabinoids 5F-PB-22, PB-22, XLR-11 and UR-144 by Cunninghamella elegans. (United States)

    Watanabe, Shimpei; Kuzhiumparambil, Unnikrishnan; Nguyen, My Ann; Cameron, Jane; Fu, Shanlin


    The knowledge of metabolic profile of synthetic cannabinoids is important for the detection of drugs in urinalysis due to the typical absence or low abundance of parent cannabinoids in human urine. The fungus Cunninghamella elegans has been reported to be a useful tool for metabolism study and thus applicability to synthetic cannabinoid metabolism was examined. In this study, 8-quinolinyl 1-(5-fluoropentyl)-1H-indole-3-carboxylate (5F-PB-22), 8-quinolinyl 1-pentyl-1H-indole-3-carboxylate (PB-22), [1-(5-fluoropentyl)-1H-indol-3-yl](2,2,3,3-tetramethylcyclopropyl)methanone (XLR-11) and (1-pentyl-1H-indol-3-yl)(2,2,3,3-tetramethylcyclopropyl)methanone (UR-144) were incubated with C. elegans and the metabolites were identified using liquid chromatography-quadrupole time-of-flight mass spectrometry. The obtained metabolites were compared with reported human metabolites to assess the suitability of the fungus to extrapolate human metabolism. 5F-PB-22 underwent dihydroxylation, dihydrodiol formation, oxidative defluorination, oxidative defluorination to carboxylic acid, ester hydrolysis and glucosidation, alone and/or in combination. The metabolites of PB-22 were generated by hydroxylation, dihydroxylation, trihydroxylation, dihydrodiol formation, ketone formation, carboxylation, ester hydrolysis and glucosidation, alone and/or in combination. XLR-11 was transformed through hydroxylation, dihydroxylation, aldehyde formation, carboxylation, oxidative defluorination, oxidative defluorination to carboxylic acid and glucosidation, alone and/or in combination. UR-144 was metabolised by hydroxylation, dihydroxylation, trihydroxylation, aldehyde formation, ketone formation, carboxylation, N-dealkylation and combinations. These findings were consistent with previously reported human metabolism except for the small extent of ester hydrolysis observed and the absence of glucuronidation. Despite the limitations, C. elegans demonstrated the capacity to produce a wide variety of

  1. Novel ZnO:Ag nanocomposites induce significant oxidative stress in human fibroblast malignant melanoma (Ht144 cells

    Directory of Open Access Journals (Sweden)

    Syeda Arooj


    Full Text Available The use of photoactive nanoparticles (NPs such as zinc oxide (ZnO and its nanocomposites has become a promising anticancer strategy. However, ZnO has a low photocatalytic decomposition rate and the incorporation of metal ions such as silver (Ag improves their activity. Here different formulations of ZnO:Ag (1, 3, 5, 10, 20 and 30% Ag were synthesized by a simple co-precipitation method and characterized by powder X-ray diffraction, scanning electron microscopy, Rutherford back scattering and diffuse reflectance spectroscopy for their structure, morphology, composition and optical band gap. The NPs were investigated with regard to their different photocatalytic cytotoxic effects in human malignant melanoma (HT144 and normal (HCEC cells. The ZnO:Ag nanocomposites killed cancer cells more efficiently than normal cells under daylight exposure. Nanocomposites having higher Ag content (10, 20 and 30% were more toxic compared to low Ag content (1, 3 and 5%. For HT144, under daylight exposure, the IC50 values were ZnO:Ag (10%: 23.37 μg/mL, ZnO:Ag (20%: 19.95 μg/mL, and ZnO:Ag (30%: 15.78 μg/mL. ZnO:Ag (30% was toxic to HT144 (IC50: 23.34 μg/mL in dark as well. The three nanocomposites were further analyzed with regard to their ability to generate reactive oxygen species (ROS and induce lipid peroxidation. The particles led to an increase in levels of ROS at cytotoxic concentrations, but only HT144 showed strongly induced MDA level. Finally, NPs were investigated for the ROS species they generated in vitro. A highly significant increase of 1O2 in the samples exposed to daylight was observed. Hydroxyl radical species, HO•, were also generated to a lesser extent. Thus, the incorporation of Ag into ZnO NPs significantly improves their photo-oxidation capabilities. ZnO:Ag nanocomposites could provide a new therapeutic option to selectively target cancer cells.

  2. CeLAND: search for a 4th light neutrino state with a 3 PBq 144Ce-144Pr electron antineutrino generator in KamLAND

    Energy Technology Data Exchange (ETDEWEB)

    Gando, A; Gando, Y; Hayashida, S; Ikeda, H; Inoue, K; Ishidoshiro, K; Ishikawa, H; Koga, M; Matsuda, R; Matsuda, S; Mitsui, T; Motoki, D; Nakamura, K; Oki, Y; Otani, M; Shimizu, I; Shirai, J; Suekane, F; Suzuki, A; Takemoto, Y; Tamae, K; Ueshima, K; Watanabe, H; Xu, BD; Yamada, S; Yamauchi, Y; Yoshida, H; Cribier, M; Durero, M; Fischer, V; Gaffiot, J; Jonqueres, N; Kouchner, A; Lasserre, T; Leterme, D; Letourneau, A; Lhuillier, D; Mention, G; Rampal, G; Scola, L; Veyssiere, C; Vivier, M; Yala, P; Berger, BE; Kozlov, A; Banks, T; Dwyer, D; Fujikawa, BK; Han, K; Kolomensky, YG; Mei, Y; O' Donnell, T; Decowski, P; Markoff, DM; Yoshida, S; Kornoukhov, VN; Gelis, TVM; Tikhomirov, GV; Learned, JG; Maricic, J; Matsuno, S; Milincic, R; Karwowski, HJ; Efremenko, Y; Detwiler, A; Enomoto, S


    The reactor neutrino and gallium anomalies can be tested with a 3-4 PBq (75-100 kCi scale) 144Ce-144Pr antineutrino beta-source deployed at the center or next to a large low-background liquid scintillator detector. The antineutrino generator will be produced by the Russian reprocessing plant PA Mayak as early as 2014, transported to Japan, and deployed in the Kamioka Liquid Scintillator Anti-Neutrino Detector (KamLAND) as early as 2015. KamLAND's 13 m diameter target volume provides a suitable environment to measure the energy and position dependence of the detected neutrino flux. A characteristic oscillation pattern would be visible for a baseline of about 10 m or less, providing a very clean signal of neutrino disappearance into a yet-unknown, sterile neutrino state. This will provide a comprehensive test of the electron dissaperance neutrino anomalies and could lead to the discovery of a 4th neutrino state for Δm$2\\atop{new}$ ≳ 0.1 eV2 and sin2(2θnew) > 0.05.

  3. S-nitrosylation of TRIM72 at cysteine 144 is critical for protection against oxidation-induced protein degradation and cell death. (United States)

    Kohr, Mark J; Evangelista, Alicia M; Ferlito, Marcella; Steenbergen, Charles; Murphy, Elizabeth


    Oxidative stress and membrane damage following myocardial ischemia/reperfusion injury are important contributors to cardiomyocyte death and the loss of myocardial function. Our previous study identified cysteine 144 (C144) of tripartite motif-containing protein 72 (TRIM72) as a potential site for S-nitrosylation (SNO). TRIM72 is a cardioprotective membrane repair protein that can be both activated and targeted for degradation by different oxidative modifications. Consistent with the potential regulation of TRIM72 by various oxidative modifications, we found that SNO levels increased at C144 of TRIM72 with ischemic preconditioning. Therefore, to investigate the role of C144 in the regulation of TRIM72 function, we mutated C144 of TRIM72 to a serine residue (TRIM72(C144S)), and expressed either TRIM72(WT) or TRIM72(C144S) in HEK-293 cells, which lack endogenous TRIM72, in order to examine the effect of this mutation on the functional stability of TRIM72 and on cell survival. We hypothesized that SNO of TRIM72 stabilizes the protein, thus allowing for membrane repair and enhanced cell survival. Upon treatment with hydrogen peroxide (H2O2), we found that TRIM72(WT) levels were decreased, but not TRIM72(C144S) and this correlated with increased H2O2-induced cell death in TRIM72(WT) cells. Additionally, we found that treatment with the cardioprotective S-nitrosylating agent S-nitrosoglutathione (GSNO), was able to preserve TRIM72(WT) protein levels and enhance TRIM72(WT)-mediated cell survival, but had no effect on TRIM72(C144S) levels. Consistent with our hypothesis, GSNO was also found to increase SNO levels and inhibit H2O2-induced irreversible oxidation for TRIM72(WT) without affecting TRIM72(C144S). In further support of our hypothesis, GSNO blocked the ischemia/reperfusion-induced decrease in TRIM72 levels and reduced infarct size in a Langendorff-perfused heart model. The results of these studies have important implications for cardioprotection and suggest that

  4. MicroRNA-144 regulates hepatic ATP binding cassette transporter A1 and plasma high-density lipoprotein after activation of the nuclear receptor farnesoid X receptor. (United States)

    de Aguiar Vallim, Thomas Q; Tarling, Elizabeth J; Kim, Tammy; Civelek, Mete; Baldán, Ángel; Esau, Christine; Edwards, Peter A


    The bile acid receptor farnesoid X receptor (FXR) regulates many aspects of lipid metabolism by variouscomplex and incompletely understood molecular mechanisms. We set out to investigate the molecular mechanisms for FXR-dependent regulation of lipid and lipoprotein metabolism. To identify FXR-regulated microRNAs that were subsequently involved in regulating lipid metabolism. ATP binding cassette transporter A1 (ABCA1) is a major determinant of plasma high-density lipoprotein (HDL)-cholesterol levels. Here, we show that activation of the nuclear receptor FXR in vivo increases hepatic levels of miR-144, which in turn lowers hepatic ABCA1 and plasma HDL levels. We identified 2 complementary sequences to miR-144 in the 3' untranslated region of ABCA1 mRNA that are necessary for miR-144-dependent regulation. Overexpression of miR-144 in vitro decreased both cellular ABCA1 protein and cholesterol efflux to lipid-poor apolipoprotein A-I protein, whereas overexpression in vivo reduced hepatic ABCA1 protein and plasma HDL-cholesterol. Conversely, silencing miR-144 in mice increased hepatic ABCA1 protein and HDL-cholesterol. In addition, we used tissue-specific FXR-deficient mice to show that induction of miR-144 and FXR-dependent hypolipidemia requires hepatic, but not intestinal, FXR. Finally, we identified functional FXR response elements upstream of the miR-144 locus, consistent with direct FXR regulation. We have identified a novel pathway involving FXR, miR-144, and ABCA1 that together regulate plasma HDL-cholesterol.

  5. Preliminary evaluation of neutron capture cross sections for /sup 144/Sm, /sup 145/Sm and /sup 145/Pm

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, D.G.; Gardner, M.A.


    We have made preliminary neutron-capture cross-section calculations of the Hauser-Feshbach type for the isotopes /sup 144/Sm, /sup 145/Sm, and /sup 145/Pm to investigate the production of radioactive /sup 145/Pm by neutron capture on the stable isotope /sup 144/Sm. The calculations were made for incident neutron energies from 2.5 MeV to about 1/sup -4/ or 10/sup -5/ MeV, wherever the first unbound resonance was estimated to occur in each case. At that energy, the calculated value was reduced by a somewhat arbitrary factor, and the excitation function extended down to thermal energy using a (E/sub n/)/sup -1/2/ energy dependence. Since very large uncertainties are associated with the position and magnitude of the first unbound resonance and the subsequent extrapolation back to thermal energy, the cross sections in this low-energy region should not be considered more accurate than +- a factor of 10. For incident neutron energies above each step, the calculations represent an average through the separated and overlapping resonance regions and may be accurate to better than +- a factor of 2. 18 refs., 7 figs., 5 tabs.

  6. MicroRNA-144 dysregulates the transforming growth factor-β signaling cascade and contributes to the development of bronchiolitis obliterans syndrome after human lung transplantation. (United States)

    Xu, Zhongping; Ramachandran, Sabarinathan; Gunasekaran, Muthukumar; Zhou, Fangyu; Trulock, Elbert; Kreisel, Daniel; Hachem, Ramsey; Mohanakumar, Thalachallour


    Bronchiolitis obliterans syndrome (BOS), chronic lung allograft rejection, remains an impediment for the function of the transplanted organ. In this study, we defined the role of the microRNA (miRNA) miR-144 in fibroproliferation leading to BOS. Biopsy specimens were obtained from 20 lung transplant recipients with BOS((+)) and 19 without BOS((-)). Expression of miR-144 and its target, transforming growth factor-β (TGF-β)-induced factor homeobox 1(TGIF1), were analyzed by real-time polymerase chain reaction and Western blot. Overexpression of miR-144 and luciferase reporter genes were performed to elucidate miRNA-target interactions. The function of miR-144 was evaluated by transfecting fibroblasts and determining the response to TGF-β by analyzing Sma- and Mad-related family (Smads), fibroblast growth factor, TGF-β, and vascular endothelial growth factor. Smooth muscle actin-α-positive stress fibers and F-actin filaments in lung fibroblasts were analyzed by immunofluorescence. Analysis of miR-144 in the biopsy specimens demonstrated 4.1 ± 0.8-fold increases in BOS(+) compared with BOS(-) patients, with a significant reduction in TGIF1 (3.6 ± 1.2-fold), a corepressor of Smads. In vitro transfection confirmed that over-expression of miR-144 results in a reduction in TGIF1 and an increase in SMAD2, SMAD4, fibroblast growth factor-6, TGF-β, and vascular endothelial growth factor. Increasing miR-144 by transfecting, increased smooth muscle actin-α and fibronectin, and knockdown of miR-144 diminished fibrogenesis in MRC-5 fibroblasts. miR-144 is a critical regulator of the TGF-β signaling cascade and is over-expressed in lungs with BOS. Therefore, miR-144 is a potential target toward preventing fibrosis leading to BOS after lung transplant. Copyright © 2015 International Society for Heart and Lung Transplantation. Published by Elsevier Inc. All rights reserved.

  7. Mechanical 144 GHz beam steering with all-metallic epsilon-near-zero lens antenna

    Energy Technology Data Exchange (ETDEWEB)

    Pacheco-Peña, V., E-mail:; Torres, V., E-mail:; Orazbayev, B., E-mail:; Beruete, M., E-mail:; Sorolla, M. [Antennas Group-TERALAB, Universidad Pública de Navarra, Campus Arrosadía, 31006 Pamplona (Spain); Navarro-Cía, M., E-mail: [Optical and Semiconductor Devices Group, Department of Electrical and Electronic Engineering, Imperial College London, London SW7 2BT (United Kingdom); Centre for Plasmonics and Metamaterials, Imperial College London, London SW7 2AZ (United Kingdom); Centre for Terahertz Science and Engineering, Imperial College London, London SW7 2AZ (United Kingdom); Engheta, N., E-mail: [Department of Electrical and Systems Engineering, University of Pennsylvania, Philadelphia, Pennsylvania 19104 (United States)


    An all-metallic steerable beam antenna composed of an ε-near-zero (ENZ) metamaterial lens is experimentally demonstrated at 144 GHz (λ{sub 0} = 2.083 mm). The ENZ lens is realized by an array of narrow hollow rectangular waveguides working just near and above the cut-off of the TE{sub 10} mode. The lens focal arc on the xz-plane is initially estimated analytically as well as numerically and compared with experimental results demonstrating good agreement. Next, a flange-ended WR-6.5 waveguide is placed along the lens focal arc to evaluate the ENZ-lens antenna steerability. A gain scan loss below 3 dB is achieved for angles up to ±15°.

  8. CDCC calculations of fusion of 6Li with targets 144Sm and 154Sm: effect of resonance states (United States)

    Gómez Camacho, A.; Lubian, J.; Zhang, H. Q.; Zhou, Shan-Gui


    Continuum Discretized Coupled-Channel (CDCC) model calculations of total, complete and incomplete fusion cross sections for reactions of the weakly bound 6Li with 144,154Sm targets at energies around the Coulomb barrier are presented. In the cluster structure frame of 6Li→α+d, short-range absorption potentials are considered for the interactions between the ground state of the projectile 6Li and α-d fragments with the target. In order to separately calculate complete and incomplete fusion and to reduce double-counting, the corresponding absorption potentials are chosen to be of different range. Couplings to low-lying excited states 2+, 3‑ of 144Sm and 2+, 4+ of 154Sm are included. So, the effect on total fusion from the excited states of the target is investigated. Similarly, the effect on fusion due to couplings to resonance breakup states of 6Li, namely, l=2, J π =3+,2+,1+ is also calculated. The latter effect is determined by using two approaches, (a) by considering only resonance state couplings and (b) by omitting these states from the full discretized energy space. Among other things, it is found that both resonance and non-resonance continuum breakup couplings produce fusion suppression at all the energies considered. A. Gómez Camacho from CONACYT, México, J. Lubian from CNPq, FAPERJ, Pronex, Brazil. S.G.Z was partly supported by the NSF of China (11120101005, 11275248, 11525524, 11621131001, 11647601, 11711540016), 973 Program of China (2013CB834400) and the Key Research Program of Frontier Sciences of CAS. H.Q.Z. from NSF China (11375266)

  9. N-terminal Prion Protein Peptides (PrP(120-144)) Form Parallel In-register β-Sheets via Multiple Nucleation-dependent Pathways. (United States)

    Wang, Yiming; Shao, Qing; Hall, Carol K


    The prion diseases are a family of fatal neurodegenerative diseases associated with the misfolding and accumulation of normal prion protein (PrP(C)) into its pathogenic scrapie form (PrP(Sc)). Understanding the fundamentals of prion protein aggregation and the molecular architecture of PrP(Sc) is key to unraveling the pathology of prion diseases. Our work investigates the early-stage aggregation of three prion protein peptides, corresponding to residues 120-144 of human (Hu), bank vole (BV), and Syrian hamster (SHa) prion protein, from disordered monomers to β-sheet-rich fibrillar structures. Using 12 μs discontinuous molecular dynamics simulations combined with the PRIME20 force field, we find that the Hu-, BV-, and SHaPrP(120-144) aggregate via multiple nucleation-dependent pathways to form U-shaped, S-shaped, and Ω-shaped protofilaments. The S-shaped HuPrP(120-144) protofilament is similar to the amyloid core structure of HuPrP(112-141) predicted by Zweckstetter. HuPrP(120-144) has a shorter aggregation lag phase than BVPrP(120-144) followed by SHaPrP(120-144), consistent with experimental findings. Two amino acid substitutions I138M and I139M retard the formation of parallel in-register β-sheet dimers during the nucleation stage by increasing side chain-side chain association and reducing side chain interaction specificity. On average, HuPrP(120-144) aggregates contain more parallel β-sheet content than those formed by BV- and SHaPrP(120-144). Deletion of the C-terminal residues 138-144 prevents formation of fibrillar structures in agreement with the experiment. This work sheds light on the amyloid core structures underlying prion strains and how I138M, I139M, and S143N affect prion protein aggregation kinetics. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Transformation of Au144(SCH2CH2Ph)60 to Au133(SPh-tBu)52 Nanomolecules: Theoretical and Experimental Study. (United States)

    Nimmala, Praneeth Reddy; Theivendran, Shevanuja; Barcaro, Giovanni; Sementa, Luca; Kumara, Chanaka; Jupally, Vijay Reddy; Apra, Edoardo; Stener, Mauro; Fortunelli, Alessandro; Dass, Amala


    Ultrastable gold nanomolecule Au144(SCH2CH2Ph)60 upon etching with excess tert-butylbenzenethiol undergoes a core-size conversion and compositional change to form an entirely new core of Au133(SPh-tBu)52. This conversion was studied using high-resolution electrospray mass spectrometry which shows that the core size conversion is initiated after 22 ligand exchanges, suggesting a relatively high stability of the Au144(SCH2CH2Ph)38(SPh-tBu)22 intermediate. The Au144 → Au133 core size conversion is surprisingly different from the Au144 → Au99 core conversion reported in the case of thiophenol, -SPh. Theoretical analysis and ab initio molecular dynamics simulations show that rigid p-tBu groups play a crucial role by reducing the cluster structural freedom, and protecting the cluster from adsorption of exogenous and reactive species, thus rationalizing the kinetic factors that stabilize the Au133 core size. This 144-atom to 133-atom nanomolecule's compositional change is reflected in optical spectroscopy and electrochemistry.

  11. Activating and sustaining c-Myc by depletion of miR-144/451 gene locus contributes to B-lymphomagenesis. (United States)

    Ding, Lan; Zhang, Yanqing; Han, Lingling; Fu, Lei; Mei, Xia; Wang, Jijun; Itkow, Jacobi; Elabid, Afaf Elabid Ibrahim; Pang, Lei; Yu, Duonan


    Hyper activity of protooncogene c-Myc is one of the hallmarks of highly aggressive lymphomas. However, the mechanism of how c-Myc is subjected to activation and amplification is still not well defined. In this study, we use gene knockout strategy to show that targeted depletion of a well-conserved microRNA gene locus miR-144/451 initiates tumorigenesis including B-lymphoma development in aged mice. This is due, at least in part, to the direct activation of the c-Myc gene by loss of miR-144/451 expression in hematopoietic cells. Moreover, oncoprotein c-Myc inversely regulates miR-144/451 expression by directly binding to the miR-144/451 promoter region, forming a miRNA-Myc positive feedback loop to safeguard the high level of c-Myc in B-lymphocytes. We also demonstrate that this miRNA-Myc crosstalk is disrupted in human diffuse large B-cell lymphomas with aberrant c-Myc expression. Therefore, our findings provide strong evidence, for the first time, that deficiency of miR-144/451 expression may play a bona fide role in derepression of silenced c-Myc, which contributes to tumor development including B-lymphomagenesis.

  12. Cirurgia de revascularização do miocárdio no idoso: estudo descritivo de 144 casos Revascularization surgery of the myocardium in the elderly patients: descriptive study in 144 patients

    Directory of Open Access Journals (Sweden)

    Maurílio Onofre DEININGER


    Full Text Available Realizamos análise retrospectiva de todos os pacientes com idade igual ou superior a 70 anos, submetidos à operação de revascularização do miocárdio isolada, no período de janeiro de 1992 a dezembro de 1997, objetivando avaliar a morbimortalidade. Do total de 144 pacientes, 92 (63,9% eram do sexo masculino, idade entre 70 e 84 anos, média de 73,51 anos e desvio padrão de 2,82. A grande maioria encontrava-se com angina classe funcional III ou IV (79,16%. Tiveram relação com a ocorrência de maior mortalidade, a presença no período pré-operatório de: obesidade (p = 0,004, insuficiência cardíaca congestiva (classe III/IV - p = 0,03 e/ou infarto agudo do miocárdio (A retrospective analysis involving seventy-year-old patients as well as those over seventy who have undergone CABG as a single procedure, during Jannuary 1992 to December 1997, was carried out with the purpose of assessing their morbidity with mortality. Of the 144 patients, 92 (63.9% were males, aged 70 to 84 (average age 73.51 and standard deviation 2.82. Most of those, 114 (79.16%, suffered from angina belonging to the functional class III or IV. The occurrence in the pre-operative period of obesity (p = 0.004, heart failure (III/IV class - p = 0.03 and/or acute myocardial infection (less than 21 days - p = 0.01 demonstrated a definite relationship with mortality. There were 120 (83.34% patients with lesions in three or more vessels (average 3.48 anastomoses/patients.The pediculate internal mammary artery was employed in 126 patients (87.5% and that rate increased to 98.9% in the last two years. The main complications in the post-operation period leading to death were either infections (p < 0.0001, prolonged ventilatory support (p < 0.0001, renal failure with dialysis (p < 0.0001 and/or low cardiac output (p = 0.003. As to statistical analysis the Student T test, the Chi-square test and Fisher's exact test were used. Surgical mortality totalling 5.5% (8/144 in the

  13. Development of a computational model applied to a unitary 144 cm{sup 2} proton exchange membrane fuel cell; Desenvolvimento de um modelo numerico computacional aplicado a uma celula a combustivel unitaria de 144 CM{sup 2} tipo PEM

    Energy Technology Data Exchange (ETDEWEB)

    Robalinho, Eric


    This work presents the development of a numerical computer model and methodology to study and design polymeric exchange membrane fuel cell - PEM. For the validation of experimental results, a sequence of routines, appropriate to fit the data obtained in the laboratory, was described. At the computational implementation it was created a new strategy of coupling two 3-dimensional models to satisfy the requirements of the comprehensive model of the fuel cell, including its various geometries and materials, as well as the various physical and chemical processes simulated. To effective assessment of the real cell analogy with numerical model, numerical studies were carried out. Comparisons with values obtained in the literature, characterization of variables through laboratory experiments and estimates from models already tested in the literature were also performed. Regarding the experimental part, a prototype of a fuel cell unit of 144 cm of geometric area was designed, produced and operated at laboratory with the purpose of validating the numerical computer model proposed, with positive results. The results of simulations for the 2D and 3D geometries proposed are presented in the form of polarization curves, highlighting the catalytic layer model based on the geometry of agglomerates. Parametric and sensitivity studies are presented to illustrate the change in performance of the fuel cell studied. The final model is robust and useful as a tool for design and optimization of PEM type fuel cells in a wide range of operating conditions. (author)

  14. Development of a computational model applied to a unitary 144 CM{sup 2} proton exchange membrane fuel cell; Desenvolvimento de um modelo numerico computacional aplicado a uma celula a combustivel unitaria de 144 CM{sup 2} tipo PEM

    Energy Technology Data Exchange (ETDEWEB)

    Robalinho, Eric


    This work presents the development of a numerical computer model and methodology to study and design polymeric exchange membrane fuel cell - PEM. For the validation of experimental results, a sequence of routines, appropriate to fit the data obtained in the laboratory, was described. At the computational implementation it was created a new strategy of coupling two 3-dimensional models to satisfy the requirements of the comprehensive model of the fuel cell, including its various geometries and materials, as well as the various physical and chemical processes simulated. To effective assessment of the real cell analogy with numerical model, numerical studies were carried out. Comparisons with values obtained in the literature, characterization of variables through laboratory experiments and estimates from models already tested in the literature were also performed. Regarding the experimental part, a prototype of a fuel cell unit of 144 cm{sup 2} of geometric area was designed, produced and operated at laboratory with the purpose of validating the numerical computer model proposed, with positive results. The results of simulations for the 2D and 3D geometries proposed are presented in the form of polarization curves, highlighting the catalytic layer model based on the geometry of agglomerates. Parametric and sensitivity studies are presented to illustrate the change in performance of the fuel cell studied. The final model is robust and useful as a tool for design and optimization of PEM type fuel cells in a wide range of operating conditions. (author)

  15. Ligand-modulated interactions between charged monolayer-protected Au144(SR)60 gold nanoparticles in physiological saline. (United States)

    Villarreal, Oscar D; Chen, Liao Y; Whetten, Robert L; Yacaman, Miguel J


    In order to determine how functionalized gold nanoparticles (AuNPs) interact in a near-physiological environment, we performed all-atom molecular dynamics simulations on the icosahedral Au144 nanoparticles each coated with a homogeneous set of 60 thiolates selected from one of these five (5) types: 11-mercapto-1-undecanesulfonate -SC11H22(SO3(-)), 5-mercapto-1-pentanesulfonate -SC5H10(SO3(-)), 5-mercapto-1-pentaneamine -SC5H10(NH3(+)), 4-mercapto-benzoate -SPh(COO(-)), or 4-mercapto-benzamide -SPh(CONH3(+)). These thiolates were selected to elucidate how the aggregation behavior of AuNPs depends on ligand parameters, including the charge of the terminal group (anionic vs. cationic), and its length and conformational flexibility. For this purpose, each functionalized AuNP was paired with a copy of itself, placed in an aqueous cell, neutralized by 120 Na(+)/Cl(-) counter-ions and salinated with a 150 mM concentration of NaCl, to form five (5) systems of like-charged AuNPs pairs in a saline. We computed the potential of mean force (the reversible work of separation) as a function of the intra-pair distance and, based on which, the aggregation affinities. We found that the AuNPs coated with negatively charged, short ligands have very high affinities. Structurally, a significant number of Na(+) counter-ions reside on a plane between the AuNPs, mediating the interaction. Each such ion forms a "salt bridge" (or "ionic bonds") to both of the AuNPs when they are separated by its diameter plus 0.2-0.3 nm. The positively charged AuNPs have much weaker affinities, as Cl(-) counter-ions form fewer and weaker salt bridges between the AuNPs. In the case of Au144(SC11H22(SO3(-)))60 pair, the flexible ligands fluctuate much more than the other four cases. The large fluctuations disfavor the forming of salt bridges between two AuNPs, but enable hydrophobic contact between the exposed hydrocarbon chains of the two AuNPs, which are subject to an effective attraction at a separation

  16. [Breast asymmetry of the teenager and the young adult. Stability of the result in time. About 144 patients]. (United States)

    Ellart, J; François, C; Calibre, C; Guerreschi, P; Duquennoy-Martinot, V


    Breast asymmetry is defined by a difference in breast shape and/or volume. The goal of this study was to assess the stability of the surgical results and to highlight predictive factors for deterioration in results. This retrospective and monocentric study included all patients presenting constitutional isolated asymmetry, Poland's syndrome, asymmetric tuberous breast or pectus excavatum treated between 1980 and 2015. The statistical analysis included 144 patients and contained two parts. The first analysis compared patients with or without breast implant. Results were significant only for symmetry of shape, with better outcomes without breast implant (P=0.0170). The second analysis compared the subgroups of patients with breast asymmetry, according to the etiology. Patients with tuberous breasts and constitutional isolated asymmetry have been compared. We found a significant difference only regarding the long-term results (P=0.0091). Patients with tuberous breasts had deteriorating in results over time. Patients with Poland's syndrome, compared to patients with constitutional isolated asymmetry, had significantly less good results for symmetry of volume, of shape, of areola, and for early results (Pbreast implant, weight variations, pregnancies and breast-feeding, the use of hormonal treatments, ageing and tuberous malformation. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  17. CT and MRI findings of 144 patients with West syndrome. Characterization of the cerebral lesion and its topography

    Energy Technology Data Exchange (ETDEWEB)

    Hamano, Shin-ichiro; Tanaka, Manabu; Mochizuki, Mika; Sugiyama, Nobuyoshi; Nara, Takahiro; Oguma, Eiji [Saitama Children' s Medical Center, Iwatsuki (Japan); Eto, Yoshikatsu [Jikei Univ., Tokyo (Japan). School of Medicine


    In West syndrome, although classified as a generalized epilepsy, there are some patients reported to have became seizure-free and have good outcomes in the developmental aspect after resections of localized lesions. We reviewed computed tomography and magnetic resonance imaging of 144 patients with West syndrome and classified them into four categories depending on the distribution of lesion: normal group, diffuse group, disseminated group, localized group. Thirty-three patients belong to the normal group after having reviewed images from computed tomography and magnetic resonance imaging. The diffuse group consisted of 83 patients presenting morphologic abnormalities such as, diffuse cerebral atrophy, periventricular leukomalesia or polycystic encephalomalesia; the disseminated group included 17 patients having a diagnosis of tuberoius sclerosis, multiple cortical dysplasia or multiple cortical heterotopias. The lesions of all eleven patients with localized cerebral lesions involved the temporal and/or occipital lobes. Nine of the eleven patients with localized cerebral lesions had the lesions on the right side. These results suggest that the specificity of lesion topography of temporo-occipital regions and the right-side in West syndrome will have a close correlation with normal brain maturation, from the viewpoint of development of myelination and cerebral blood flow, and related with the genesis of West syndrome. (author)

  18. Isoscalar giant dipole resonance in Zr-90, Sn-116, Sm-144 and Pb-208 excited by 240 MeV alpha particle scattering

    NARCIS (Netherlands)

    Clark, HL; Lui, YW; Youngblood, DH; Bachtr, K; Garg, U; Harakeh, MN; Kalantar-Nayestanaki, N


    The giant resonance regions of Zr-90, Sn-116, Sm-144 and (208)pb were investigated using 240 MeV a particle scattering at small angles including 0 degrees. E1 strengths corresponding to 91+/-11%, 89+/-10%, 105+/-12% and 95+/-13% of the isoscalar E1 energy-weighted sum rule were identified between 18

  19. Identification and expression analysis of miR-144-5p and miR-130b-5p in dairy cattle

    Directory of Open Access Journals (Sweden)

    Z. Li


    Full Text Available MicroRNAs (miRNAs can coordinate the main pathways involved in innate and adaptive immune responses by regulating gene expression. To explore the resistance to mastitis in cows, miR-144-5p and miR-130b-5p were identified in bovine mammary gland tissue and 14 potential target genes belonging to the chemokine signaling pathway, the arginine and proline metabolism pathway and the mRNA surveillance pathway were predicted. Subsequently, we estimated the relative expression of miR-144-5p and miR-130b-5p in cow mammary tissues by using stem-loop quantitative real-time polymerase chain reaction. The results showed that the relative expression of miR-144-5p and miR-130b-5p in the mastitis-infected mammary tissues (n = 5 was significantly downregulated 0.14-fold (p < 0. 01 and upregulated 3.34-fold (p < 0. 01, respectively, compared to healthy tissues (n = 5. Our findings reveal that miR-144-5p and miR-130b-5p may have important roles in resistance to mastitis in dairy cattle.

  20. Effects of the dimeric PSD-95 inhibitor UCCB01-144 on functional recovery after fimbria-fornix transection in rats

    DEFF Research Database (Denmark)

    Sommer, Jens Bak; Bach, Anders; Rytter, Hana Malá


    . UCCB01-144 or saline was injected into the lateral tail vein of rats immediately after sham surgery or FF-transection, and effects on spatial delayed alternation in a T-maze were assessed over a 28-day period. Task acquisition was significantly impaired in FF-transected animals, but there were...

  1. Genetic engineering of EcoRI mutants with altered amino acid residues in the DNA binding site: physicochemical investigations give evidence for an altered monomer/dimer equilibrium for the Gln144Lys145 and Gln144Lys145Lys200 mutants. (United States)

    Geiger, R; Rüter, T; Alves, J; Fliess, A; Wolfes, H; Pingoud, V; Urbanke, C; Maass, G; Pingoud, A; Düsterhöft, A


    We have genetically engineered the Arg200----Lys mutant, the Glu144Arg145----GlnLys double mutant, and the Glu144Arg145Arg200----GlnLysLys triple mutant of the EcoRI endonuclease in extension of previously published work on site-directed mutagenesis of the EcoRI endonuclease in which Glu144 had been exchanged for Gln and Arg145 for Lys [Wolfes et al. (1986) Nucleic Acids Res. 14, 9063]. All these mutants carry modifications in the DNA binding site. Mutant EcoRI proteins were purified to homogeneity and characterized by physicochemical techniques. All mutants have a very similar secondary structure composition. However, whereas the Lys200 mutant is not impaired in its capacity to form a dimer, the Gln144Lys145 and Gln144Lys145Lys200 mutants have a very much decreased propensity to form a dimer or tetramer depending on concentration as shown by gel filtration and analytical ultracentrifugation. This finding may explain the results of isoelectric focusing experiments which show that these two mutants have a considerably more basic pI than expected for a protein in which an acidic amino acid was replaced by a neutral one. Furthermore, while wild-type EcoRI and the Lys200 mutant are denatured in an irreversible manner upon heating to 60 degrees C, the thermal denaturation process as shown by circular dichroism spectroscopy is fully reversible with the Gln144Lys145 double mutant and the Gln144Lys145Lys200 triple mutant. All EcoRI endonuclease mutants described here have a residual enzymatic activity with wild-type specificity, since Escherichia coli cells overexpressing the mutant proteins can only survive in the presence of EcoRI methylase. The detailed analysis of the enzymatic activity and specificity of the purified mutant proteins is the subject of the accompanying paper [Alves et al. (1989) Biochemistry (following paper in this issue)].

  2. A Whitham-Theory Sonic-Boom Analysis of the TU-144 Aircraft at a Mach Number of 2.2 (United States)

    Mack, Robert J.


    Officially, the Tu-144 was the first supersonic-cruise, passenger-carrying aircraft to enter commercial service. Design, construction, and testing were carried out by the Soviet Union, flight certification was by the Soviet Union, and the only regular passenger flights were scheduled and flown across the territory of the Soviet Union. Although it was not introduced to international passenger service, there were many significant engineering accomplishments achieved in the design, production, and flight of this aircraft. Development of the aircraft began with a prototype stage. Systematic testing and redesign led to a production aircraft in discrete stages that measurably improved the performance of the aircraft from the starting concept to final aircraft certification. It flew in competition with the English-French Concorde for a short time, but was withdrawn from national commercial service due to a lack of interest by airlines outside the Soviet Union. NASA became interested in the Tu- 144 aircraft when it was offered for use as a flying "testbed" in the study of operating characteristics of a supersonic-cruise commercial airplane. Since it had been in supersonic-cruise service, the Tu- 144 had operational characteris'tics similar to those anticipated in the conceptual aircraft designs being studied by the United States aircraft companies. In addition to the other operational tests being conducted on the Tu-144 aircraft, it was proposed that two sets of sonic-boom pressure signature measurements be made. The first set would be made on the ground, using techniques and devices similar to those in reference I and many other subsequent studies. A second set would be made in the air with an instrumented aircraft flying close under the Tu-144 in supersonic flight. Such in-flight measurements would require pressure gages that were capable of accurately recording the flow-field overpressures generated by the Tu- 144 at relatively close distances under the vehicle


    African Journals Online (AJOL)

    INTRODUCTION. Fluorescent materials, particularly blue fluorescent materials have gained strong interest because ... emitting complexes in different technical applications, such as emitting materials for organic light emitting ..... properties of three novel two-dimensional lanthanide coordination polymers with mixed aromatic ...

  4. Pyroelectric Ferroelectric and Resistivity Studies on Samarium ...

    African Journals Online (AJOL)

    Barium Strontium Sodium Niobate (Ba1-xSrx)2NaNb5O15 (BSNN) belongs to tungsten bronze ferroelectric morphotrophic phase boundary (MPB) system at x = 0.6, having large spontaneous polarisation, pyroelectric coefficient and low dielectic constant and is expected to be applicable for piezoceramic filter and ...


    African Journals Online (AJOL)

    emitting complexes in different technical applications, such as emitting materials for organic light emitting diodes, sensitizers in solar energy conversion, chemical sensors and so forth [6-9]. The ability of bipy to act as a rigid ..... properties of three-dimensional organic-inorganic hybrids based on α-metatungstate. Inorg. Chim.

  6. Compact Nd:YAG laser operating at 1.06, 1.32, and 1.44 μm for dental caries effective disinfection (United States)

    Dostálová, Tat'jana; Jelínková, Helena; Kadlecová, Martina; Němec, Michal; Å ulc, Jan; Fibrich, Martin; Nejezchleb, Karel; Kapitch, Nickalai; Å koda, Václav


    The analysis of the disinfection effect of Nd:YAG laser radiation was investigated for patients with high concentration of Streptococcus mutans in saliva (positive result in Saliva-check mutans test). For the interaction the Nd:YAG laser system generated separate switchable wavelengths with the maximum output energies 1.1, 0.6, and 0.3 J for wavelength 1.06 μm, 1.32, μm and 1.44 μm, respectively, was used. Our study proved that after the laser irradiation the Saliva-check test showed negative presence of Streptococcus mutans. The disinfection effect was confirmed for all used radiation wavelength. For 1.44 μm this effect was reached with a smallest energy density.

  7. A Controlled and Retrospective Study of 144 Chronic Low Back Pain Patients to Evaluate the Effectiveness of an Intensive Functional Restoration Program in France


    Isabelle Caby; Nicolas Olivier; Frédérick Janik; Jacques Vanvelcenaher; Patrick Pelayo


    Study Design: A controlled and retrospective study of 144 chronic low back pain patients to evaluate the effectiveness of an intensive functional restoration program in France. Objective: Evaluating the efficiency of an intensive, dynamic and multidisciplinary functional restoration program in patients with chronic low back pain (LBP), during 6 and 12 months follow up. Summary of background data: Chronic low back pain disease has a multifactor nature, involving physical, psychological profess...

  8. A novel arginine to tryptophan (R144W mutation in troponin T (cTnT gene in an indian multigenerational family with dilated cardiomyopathy (FDCM.

    Directory of Open Access Journals (Sweden)

    Deepa Selvi Rani

    Full Text Available Cardiomyopathy is a major cause of heart failure and sudden cardiac death; several mutations in sarcomeric protein genes have been associated with this disease. Our aim in the present study is to investigate the genetic variations in Troponin T (cTnT gene and its association with dilated cardiomyopathy (DCM in south-Indian patients. Analyses of all the exons and exon-intron boundaries of cTnT in 147 DCM and in 207 healthy controls had revealed a total of 15 SNPs and a 5 bp INDEL; of which, polymorphic SNPs were compared with the HapMap population data. Interestingly, a novel R144W mutation, that substitutes polar-neutral tryptophan for a highly conserved basic arginine in cTnT, altering the charge drastically, was identified in a DCM, with a family history of sudden-cardiac death (SCD. This mutation was found within the tropomyosin (TPM1 binding domain, and was evolutionarily conserved across species, therefore it is expected to have a significant impact on the structure and function of the protein. Family studies had revealed that the R144W is co-segregating with disease in the family as an autosomal dominant trait, but it was completely absent in 207 healthy controls and in 162 previously studied HCM patients. Further screening of the proband and three of his family members (positive for R144W mutant with eight other genes β-MYH7, MYBPC3, TPM1, TNNI3, TTN, ACTC, MYL2 and MYL3, did not reveal any disease causing mutation, proposing the absence of compound heterozygosity. Therefore, we strongly suggest that the novel R144W unique/private mutant identified in this study is associated with FDCM. This is furthermore signifying the unique genetic architecture of Indian population.

  9. Determination of the B(E3,0$^{+}$ $\\rightarrow$ 3$^{-}$) strength in the octupole correlated nuclei $^{142,144}$Ba using Coulomb excitation

    CERN Multimedia

    We propose to exploit the unique capability of ISOLDE to provide intense post-accelerated $^{142}$Ba and $^{144}$Ba ion beams from the HIE-ISOLDE facility to enable the Coulomb excitation of the first 3$^-$ state in these nuclei. By measuring the $\\gamma$-ray yields of the E1 decays from the 3$^-$ state using the MINIBALL array, we can obtain the interesting transition matrix element. The results will give quantitative information about octupole correlations in these nuclei.

  10. Subcellular co-localization of aluminum (III) phthalocyanine chloride tetrasulphonate with fluorescent markers in the human melanoma cell-line HT-144

    CSIR Research Space (South Africa)

    Ndhundhuma, I


    Full Text Available , and bladder cancer. Methyl- tetrahydroxyphenyl chlorin (Temoporfin) is approved in the European Union, Norway and Iceland for palliative treatment of head and neck cancer [8]. Other approved photosensitizers are 5-aminolevulinic acid (approved in USA..., NR) was purchased from Biochrom AG (Berlin, Germany) and used according to the manufacturer's instructions. Cell culture Cultures of human metastatic melanoma cell line (HT-144 cells, ATCC No HTB-63TM, LGC Standards GmbH, Wesel, Germany) were...

  11. Crystal structures of three 1-[4-(4-bromo-but-oxy)-phen-yl] chalcone derivatives: (E)-1-[4-(4-bromo-but-oxy)-phen-yl]-3-phenyl-prop-2-en-1-one, (E)-1-[4-(4-bromo-but-oxy)-phen-yl]-3-(4-meth-oxy-phen-yl)prop-2-en-1-one and (E)-1-[4-(4-bromo-but-oxy)-phen-yl]-3-(3,4-di-meth-oxy-phen-yl)prop-2-en-1-one. (United States)

    Maragatham, Gunasekaran; Selvarani, Sivasamy; Rajakumar, Perumal; Lakshmi, Srinivasakannan


    The crystal structures of three chalcones with a bromo-substituted but-oxy side chain, viz. (E)-1-[4-(4-bromo-but-oxy)-phen-yl]-3-phenyl-prop-2-en-1-one, C19H19BrO2, (I), (E)-1-[4-(4-bromo-but-oxy)-phen-yl]-3-(4-meth-oxy-phen-yl)prop-2-en-1-one, C20H21BrO3, (II), and (E)-1-[4-(4-bromo-but-oxy)-phen-yl]-3-(3,4-di-meth-oxy-phen-yl)prop-2-en-1-one, C21H23BrO4, (III), are reported. In all mol-ecules, the conformation of the keto group with respect to the olefinic bond is s-cis. Mol-ecules of (I) and (II) are nearly planar, while mol-ecule (III) is not planar. In the crystal of compounds (I) and (II), mol-ecules are linked into chains parallel to the c axis by C-H⋯π inter-actions. In the crystal of compound (III), mol-ecules are linked by a pairs of C-H⋯O hydrogen bonds, forming inversion dimers. Weak C-Br⋯π inter-actions are also observed in (III).

  12. Response by gender of HIV-1-infected subjects treated with abacavir/lamivudine plus atazanavir, with or without ritonavir, for 144 weeks (United States)

    Squires, Kathleen E; Young, Benjamin; Santiago, Lizette; Dretler, Robin H; Walmsley, Sharon L; Zhao, Henry H; Pakes, Gary E; Ross, Lisa L; Shaefer, Mark S


    Purpose The 144-week results of the open-label, multicenter Atazanavir/Ritonavir Induction with Epzicom Study (ARIES) were stratified by gender to compare treatment responses. Methods A total of 369 HIV-infected, antiretroviral-naïve subjects receiving once-daily abacavir/lamivudine + atazanavir/ritonavir (ATV/r) whose HIV-1 RNA was <50 copies/mL by week 30 were randomized 1:1 at week 36 to maintain or discontinue ritonavir for 108 subsequent weeks. Between- and within-treatment gender-related efficacy and safety differences were analyzed. Results Subjects were 85% male; 64% white; and had a mean age of 39 years, baseline median HIV-1 RNA of 114,815 copies/mL, and median CD4+ cell count of 198 cells/mm3. Gender (ATV [n=189]: 29 females/160 males; ATV/r [n=180]: 25 females/155 males) and most other demographics were similar between groups; more females than males were black (65% vs 25%) and fewer females had baseline HIV-1 RNA ≥100,000 copies/mL (41% vs 58%). At week 144, no significant differences between genders were observed in proportion maintaining HIV-1 RNA <50 copies/mL (ATV, 79% vs 77%; ATV/r, 60% vs 75%) or <400 copies/mL (ATV, 83% vs 84%; ATV/r, 68% vs 82%) (intent-to-treat-exposed: time to loss of virologic response analysis); median CD4+ change from baseline (ATV, +365 vs +300 cells/mm3; ATV/r, +344 vs +301 cells/mm3); proportion with treatment-related grade 2–4 adverse events (baseline to week 144: ATV, 41% vs 31%; ATV/r, 36% vs 43%; weeks 36 to 144: ATV, 14% vs 13%; ATV/r, 24% vs 23%); or proportion developing fasting lipid changes. Female and male virologic failure rates (ATV, 0 vs 5; ATV/r, 2 vs 4) and proportions completing the study were similar during the extension phase. Primary withdrawal reasons were loss to follow-up and pregnancy for females and loss to follow-up and other for males. Conclusion Over 144 weeks, no significant gender differences were observed in efficacy, safety, or fasting lipid changes with abacavir/lamivudine +ATV or

  13. Association of Leisure-Time Physical Activity With Risk of 26 Types of Cancer in 1.44 Million Adults. (United States)

    Moore, Steven C; Lee, I-Min; Weiderpass, Elisabete; Campbell, Peter T; Sampson, Joshua N; Kitahara, Cari M; Keadle, Sarah K; Arem, Hannah; Berrington de Gonzalez, Amy; Hartge, Patricia; Adami, Hans-Olov; Blair, Cindy K; Borch, Kristin B; Boyd, Eric; Check, David P; Fournier, Agnès; Freedman, Neal D; Gunter, Marc; Johannson, Mattias; Khaw, Kay-Tee; Linet, Martha S; Orsini, Nicola; Park, Yikyung; Riboli, Elio; Robien, Kim; Schairer, Catherine; Sesso, Howard; Spriggs, Michael; Van Dusen, Roy; Wolk, Alicja; Matthews, Charles E; Patel, Alpa V


    Leisure-time physical activity has been associated with lower risk of heart-disease and all-cause mortality, but its association with risk of cancer is not well understood. To determine the association of leisure-time physical activity with incidence of common types of cancer and whether associations vary by body size and/or smoking. We pooled data from 12 prospective US and European cohorts with self-reported physical activity (baseline, 1987-2004). We used multivariable Cox regression to estimate hazard ratios (HRs) and 95% confidence intervals for associations of leisure-time physical activity with incidence of 26 types of cancer. Leisure-time physical activity levels were modeled as cohort-specific percentiles on a continuous basis and cohort-specific results were synthesized by random-effects meta-analysis. Hazard ratios for high vs low levels of activity are based on a comparison of risk at the 90th vs 10th percentiles of activity. The data analysis was performed from January 1, 2014, to June 1, 2015. Leisure-time physical activity of a moderate to vigorous intensity. Incident cancer during follow-up. A total of 1.44 million participants (median [range] age, 59 [19-98] years; 57% female) and 186 932 cancers were included. High vs low levels of leisure-time physical activity were associated with lower risks of 13 cancers: esophageal adenocarcinoma (HR, 0.58; 95% CI, 0.37-0.89), liver (HR, 0.73; 95% CI, 0.55-0.98), lung (HR, 0.74; 95% CI, 0.71-0.77), kidney (HR, 0.77; 95% CI, 0.70-0.85), gastric cardia (HR, 0.78; 95% CI, 0.64-0.95), endometrial (HR, 0.79; 95% CI, 0.68-0.92), myeloid leukemia (HR, 0.80; 95% CI, 0.70-0.92), myeloma (HR, 0.83; 95% CI, 0.72-0.95), colon (HR, 0.84; 95% CI, 0.77-0.91), head and neck (HR, 0.85; 95% CI, 0.78-0.93), rectal (HR, 0.87; 95% CI, 0.80-0.95), bladder (HR, 0.87; 95% CI, 0.82-0.92), and breast (HR, 0.90; 95% CI, 0.87-0.93). Body mass index adjustment modestly attenuated associations for several cancers, but 10 of 13 inverse

  14. A Controlled and Retrospective Study of 144 Chronic Low Back Pain Patients to Evaluate the Effectiveness of an Intensive Functional Restoration Program in France. (United States)

    Caby, Isabelle; Olivier, Nicolas; Janik, Frédérick; Vanvelcenaher, Jacques; Pelayo, Patrick


    A controlled and retrospective study of 144 chronic low back pain patients to evaluate the effectiveness of an intensive functional restoration program in France. Evaluating the efficiency of an intensive, dynamic and multidisciplinary functional restoration program in patients with chronic low back pain (LBP), during 6 and 12 months follow up. Chronic low back pain disease has a multifactor nature, involving physical, psychological professional and social factors. A functional restoration program (FRP) has been included in a multidisciplinary training program which provides an efficient therapeutic solution. However, the effectiveness of an FRP has not been yet established. 144 subjects (71 males, 73 females) with chronic low back pain were included in a functional restoration program. The FRP includes physiotherapy and occupational therapy interventions together with psychological counselling. Patients participated as in- or outpatients 6 h per day, 5 days a week over 5 weeks. Pain intensity, trunk flexibility, trunk strength, lifting ability, quality of life and return to work were recorded before, immediately after, and at 6 months and 12 months after the treatment period. All outcome measures were significantly higher just after the FRP (144 patients) and at 6 and 12 months (from available data in 31 subjects) compared to pre-treatment values. This FRP for chronic low back pain maintained its benefits whatever the patient's activities. The effects reflected on all outcome measures, both on short and long term follow-up. The multidisciplinary FRP for chronic low back pain patients durably stopped the de-conditioning syndrome and involved new life-style habits for the patient, daily pain management and a return to work.

  15. A Controlled and Retrospective Study of 144 Chronic Low Back Pain Patients to Evaluate the Effectiveness of an Intensive Functional Restoration Program in France

    Directory of Open Access Journals (Sweden)

    Isabelle Caby


    Full Text Available Study Design: A controlled and retrospective study of 144 chronic low back pain patients to evaluate the effectiveness of an intensive functional restoration program in France. Objective: Evaluating the efficiency of an intensive, dynamic and multidisciplinary functional restoration program in patients with chronic low back pain (LBP, during 6 and 12 months follow up. Summary of background data: Chronic low back pain disease has a multifactor nature, involving physical, psychological professional and social factors. A functional restoration program (FRP has been included in a multidisciplinary training program which provides an efficient therapeutic solution. However, the effectiveness of an FRP has not been yet established. Methods: 144 subjects (71 males, 73 females with chronic low back pain were included in a functional restoration program. The FRP includes physiotherapy and occupational therapy interventions together with psychological counselling. Patients participated as in- or outpatients 6 h per day, 5 days a week over 5 weeks. Pain intensity, trunk flexibility, trunk strength, lifting ability, quality of life and return to work were recorded before, immediately after, and at 6 months and 12 months after the treatment period. Results: All outcome measures were significantly higher just after the FRP (144 patients and at 6 and 12 months (from available data in 31 subjects compared to pre-treatment values. This FRP for chronic low back pain maintained its benefits whatever the patient’s activities. Conclusions: The effects reflected on all outcome measures, both on short and long term follow-up. The multidisciplinary FRP for chronic low back pain patients durably stopped the de-conditioning syndrome and involved new life-style habits for the patient, daily pain management and a return to work.

  16. Effects of bioisosteric fluorine in synthetic cannabinoid designer drugs JWH-018, AM-2201, UR-144, XLR-11, PB-22, 5F-PB-22, APICA, and STS-135. (United States)

    Banister, Samuel D; Stuart, Jordyn; Kevin, Richard C; Edington, Amelia; Longworth, Mitchell; Wilkinson, Shane M; Beinat, Corinne; Buchanan, Alexandra S; Hibbs, David E; Glass, Michelle; Connor, Mark; McGregor, Iain S; Kassiou, Michael


    Synthetic cannabinoid (SC) designer drugs featuring bioisosteric fluorine substitution are identified by forensic chemists and toxicologists with increasing frequency. Although terminal fluorination of N-pentyl indole SCs is sometimes known to improve cannabinoid type 1 (CB1) receptor binding affinity, little is known of the effects of fluorination on functional activity of SCs. This study explores the in vitro functional activities of SC designer drugs JWH-018, UR-144, PB-22, and APICA, and their respective terminally fluorinated analogues AM-2201, XLR-11, 5F-PB-22, and STS-135 at human CB1 and CB2 receptors using a FLIPR membrane potential assay. All compounds demonstrated agonist activity at CB1 (EC50 = 2.8-1959 nM) and CB2 (EC50 = 6.5-206 nM) receptors, with the fluorinated analogues generally showing increased CB1 receptor potency (∼2-5 times). Additionally, the cannabimimetic activities and relative potencies of JWH-018, AM-2201, UR-144, XLR-11, PB-22, 5F-PB-22, APICA, and STS-135 in vivo were evaluated in rats using biotelemetry. All SCs dose-dependently induced hypothermia and reduced heart rate at doses of 0.3-10 mg/kg. There was no consistent trend for increased potency of fluorinated SCs over the corresponding des-fluoro SCs in vivo. Based on magnitude and duration of hypothermia, the SCs were ranked for potency (PB-22 > 5F-PB-22 = JWH-018 > AM-2201 > APICA = STS-135 = XLR-11 > UR-144).

  17. Determination of the B(E3;0$^+\\!\\rightarrow$ 3$^{-}$) strength in the octupole correlated nucleus $^{144}$Ba using Coulomb excitation

    CERN Multimedia

    We propose to exploit the unique capability of ISOLDE to provide intense post-accelerated $^{144}$Ba ion beams from the REX facility to enable the Coulomb excitation of the first 3$^{-}$ state in this nucleus. By measuring the $\\gamma$-ray yields of the E1 decay connecting the 3$^{-}$ and 2$^{+}$ states using the MINIBALL array, we can obtain the interesting transition matrix element. The result will give quantitative information about octupole correlations in this nucleus. We require 27 shifts to fulfill the aims of the experiment.

  18. Design and Study of a DC/DC Converter for High Power, 14.4 V and 300 A for Automotive Applications


    Julio Cesar Lopes de Oliveira; Carlos Henrique Gonc¸alves Treviso


    The shortage of the automotive market in relation to options for sources of high power car audio systems, led to development of this work. Thus, we developed a source with stabilized voltage with 4320 W effective power. Designed to the voltage of 14.4 V and a choice of two currents: 30 A load option in battery banks and 300 A at full load. This source can also be considered as a source of general use dedicated commercial with a simple control circuit in analog form based ...

  19. Estimation of continental 187Os/186Os values by using 187Os/186Os and 143Nd/144Nd ratios in marine manganese nodules


    Turekian, Karl K.; Luck, Jean-Marc


    The relationship between 187Os/186Os and 143Nd/144Nd in different manganese nodule fields is used to determine the 187Os/186Os ratio of the continental terrains bounding the major ocean basins. The Atlantic Ocean drainages yield 187Os/186Os of about 11; the Pacific Ocean, between 25 and 36; and the western Indian Ocean, 20. By assuming a two-component continental crust composed of “ultramafic rocks” (high Os concentration, low 187Os/186Os) and “granite” with only radiogenic 187Os produced in ...

  20. Remaining Sites Verification Package for the 100-F-31, 144-F Sanitary Sewer System, Waste Site Reclassification Form 2006-033

    Energy Technology Data Exchange (ETDEWEB)

    L. M. Dittmer


    The 100-F-31 waste site is a former septic system that supported the inhalation laboratories, also referred to as the 144-F Particle Exposure Laboratory (132-F-2 waste site), which housed animals exposed to particulate material. The 100-F-31 waste site has been remediated to achieve the remedial action objectives specified in the Remaining Sites ROD. The results of verification sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River.

  1. Determination of specific radioactivity of samarium-153 product. 1. Quantitative determination of samarium by spectrophotometry

    Energy Technology Data Exchange (ETDEWEB)

    Izumo, Mishiroku [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Nemoto, Masahiro [Tokyo Nuclear Service Co., Ltd., Tokyo (Japan)


    On the specific radioactivity of Sm-153 for the radiotherapy of cancers, a simple method for determination of the amount of Sm was described. The method used Arsenazo III as a colorimetric reagent. The sample irradiated in the reactor was dissolved in 1M HCl solution. A small part of it was taken and mixed with Arsenazo III at pH 3.2, and the amount of Sm was determined by the spectrophotometric method at a wavelength of 652 nm. The molar absorptivity of Sm at 652 nm was 6.6x10{sup 3} m{sup -1}{center_dot}mm{sup -1}. The error of measurement in the partial different conditions was about 2% of the value determined. The effects of impurities, Fe, Zn and Cu mixing in the Sm during operation, were clarified. (author)

  2. Durability of Stavudine, Lamivudine and Nevirapine among Advanced HIV-1 Infected Patients with/without Prior Co-administration of Rifampicin: A 144-week Prospective Study

    Directory of Open Access Journals (Sweden)

    Prasithisirikul Wisit


    Full Text Available Abstract Background To date, data on the durability of a regimen of stavudine, lamivudine and nevirapine are very limited, particularly from the resource-limited settings. Methods A prospective cohort study was conducted among 140 antiretroviral-naïve patients who were enrolled to initiate d4T, 3TC and NVP between November 2004 and March 2005. The objectives were to determine immunological and virological responses after 144 weeks of antiretroviral therapy. Seventy patients with tuberculosis also received rifampicin during the early period of antiviral treatment (TB group. Results Of all, median (IQR baseline CD4 cell count was 31 (14–79 cells/mm3; median (IQR baseline HIV-1 RNA was 433,500 (169,000–750,000 copies/mL. The average body weight was 55 kilograms. By intention-to-treat analysis at 144 weeks, the overall percentage of patients who achieved plasma HIV-1 RNA P = 0.731. Eight (5.8% patients discontinued d4T due to neuropathy and/or symptomatic lactic acidosis. Conclusion The overall durability and efficacy of antiviral response of d4T, 3TC and NVP are satisfied and they are not different between HIV-1 infected patients with and without co-administration of rifampicin due to tuberculosis. However, stavudine-related adverse effects are concerns. Trial registration Identifier NCT00703898

  3. Response by gender of HIV-1-infected subjects treated with abacavir/lamivudine plus atazanavir, with or without ritonavir, for 144 weeks

    Directory of Open Access Journals (Sweden)

    Squires KE


    Full Text Available Kathleen E Squires,1 Benjamin Young,2,3 Lizette Santiago,4 Robin H Dretler,5 Sharon L Walmsley,6 Henry H Zhao,7 Gary E Pakes,8 Lisa L Ross,8 Mark S Shaefer8 On behalf of the ARIES Study Team 1Thomas Jefferson University, Philadelphia, PA, 2Apex Family Medicine and Research, Denver, CO, 3International Association of Physicians in AIDS Care, Washington DC, USA; 4HOPE Clinic and Wellness Center, San Juan, Puerto Rico; 5ID Specialists of Atlanta, Decatur, GA, USA; 6University Health Network, Toronto, ON, Canada; 7GlaxoSmithKline, 8ViiV Healthcare, Research Triangle Park, NC, USA Purpose: The 144-week results of the open-label, multicenter Atazanavir/Ritonavir Induction with Epzicom Study (ARIES were stratified by gender to compare treatment responses.Methods: A total of 369 HIV-infected, antiretroviral-naïve subjects receiving once-daily abacavir/lamivudine + atazanavir/ritonavir (ATV/r whose HIV-1 RNA was <50 copies/mL by week 30 were randomized 1:1 at week 36 to maintain or discontinue ritonavir for 108 subsequent weeks. Between- and within-treatment gender-related efficacy and safety differences were analyzed.Results: Subjects were 85% male; 64% white; and had a mean age of 39 years, baseline median HIV-1 RNA of 114,815 copies/mL, and median CD4+ cell count of 198 cells/mm3. Gender (ATV [n=189]: 29 females/160 males; ATV/r [n=180]: 25 females/155 males and most other demographics were similar between groups; more females than males were black (65% vs 25% and fewer females had baseline HIV-1 RNA ≥100,000 copies/mL (41% vs 58%. At week 144, no significant differences between genders were observed in proportion maintaining HIV-1 RNA <50 copies/mL (ATV, 79% vs 77%; ATV/r, 60% vs 75% or <400 copies/mL (ATV, 83% vs 84%; ATV/r, 68% vs 82% (intent-to-treat-exposed: time to loss of virologic response analysis; median CD4+ change from baseline (ATV, +365 vs +300 cells/mm3; ATV/r, +344 vs +301 cells/mm3; proportion with treatment-related grade 2–4

  4. CD8 and CD4 epitope predictions in RV144: no strong evidence of a T-cell driven sieve effect in HIV-1 breakthrough sequences from trial participants.

    Directory of Open Access Journals (Sweden)

    Kalpana Dommaraju

    Full Text Available The modest protection afforded by the RV144 vaccine offers an opportunity to evaluate its mechanisms of protection. Differences between HIV-1 breakthrough viruses from vaccine and placebo recipients can be attributed to the RV144 vaccine as this was a randomized and double-blinded trial. CD8 and CD4 T cell epitope repertoires were predicted in HIV-1 proteomes from 110 RV144 participants. Predicted Gag epitope repertoires were smaller in vaccine than in placebo recipients (p = 0.019. After comparing participant-derived epitopes to corresponding epitopes in the RV144 vaccine, the proportion of epitopes that could be matched differed depending on the protein conservation (only 36% of epitopes in Env vs 84-91% in Gag/Pol/Nef for CD8 predicted epitopes or on vaccine insert subtype (55% against CRF01_AE vs 7% against subtype B. To compare predicted epitopes to the vaccine, we analyzed predicted binding affinity and evolutionary distance measurements. Comparisons between the vaccine and placebo arm did not reveal robust evidence for a T cell driven sieve effect, although some differences were noted in Env-V2 (0.022≤p-value≤0.231. The paucity of CD8 T cell responses identified following RV144 vaccination, with no evidence for V2 specificity, considered together both with the association of decreased infection risk in RV 144 participants with V-specific antibody responses and a V2 sieve effect, lead us to hypothesize that this sieve effect was not T cell specific. Overall, our results did not reveal a strong differential impact of vaccine-induced T cell responses among breakthrough infections in RV144 participants.

  5. Search for 14.4 keV solar axions emitted in the M1-transition of $^{57}$Fe nuclei with CAST

    CERN Document Server

    Andriamonje, S; Autiero, D; Barth, K; Belov, A; Beltrán, B; Bräuninger, H; Carmona, J M; Cebrián, S; Collar, J I; Dafni, T; Davenport, M; Di Lella, L; Eleftheriadis, C; Englhauser, J; Fanourakis, G K; Ferrer-Ribas, E; Fischer, H; Franz, J; Friedrich, P; Geralis, T; Giomataris, Yu; Gninenko, S; Gómez, H; Hasinoff, M; Heinsius, F H; Hoffmann, D H H; Irastorza, I G; Jacoby, J; Jakovčić, K; Kang, D; Königsmann, K C; Kotthaus, R; Krčmar, M; Kousouris, K; Kuster, M; Lakić, B; Lasseur, C; Liolios, A; Ljubičić, A; Lutz, G; Luzón, G; Miller, D; Morales, J; Ortiz, A; Papaevangelou, T; Placci, A; Raffelt, G; Riege, H; Rodríguez, A; Ruz, J; Savvidis, I; Semertzidis, Y; Serpico, P; Stewart, L; Vieira, J; Villar, J; Vogel, J; Walckiers, L; Zioutas, K


    We have searched for 14.4 keV solar axions or more general axion-like particles (ALPs), that may be emitted in the M1 nuclear transition of 57Fe, by using the axion-to-photon conversion in the CERN Axion Solar Telescope (CAST) with evacuated magnet bores (Phase I). From the absence of excess of the monoenergetic X-rays when the magnet was pointing to the Sun, we set model-independent constraints on the coupling constants of pseudoscalar particles that couple to two photons and to a nucleon g_{a\\gamma} |-1.19 g_{aN}^{0}+g_{aN}^{3}|<1.36\\times 10^{-16} GeV^{-1} for m_{a}<0.03 eV at the 95% confidence level.

  6. Search for 14.4-KeV Solar Axions Emitted in the M1-Transition of Fe-57 Nuclei with CAST

    Energy Technology Data Exchange (ETDEWEB)

    Andriamonje, S.; Aune, S.; /DAPNIA, Saclay; Autiero, D.; /CERN /Lyon, IPN; Barth, K.; /CERN; Belov, A.; /Moscow, INR; Beltran, B.; /Zaragoza U. /Queen' s U., Kingston; Brauninger, H.; /Garching, Max Planck Inst., MPE; Carmona, J.M.; Cebrian, S.; /Zaragoza U.; Collar, J.I.; /Chicago U., EFI /Chicago U., KICP; Dafni, T.; /DAPNIA, Saclay /Darmstadt, Tech. Hochsch. /Zaragoza U.; Davenport, M.; /CERN; Di Lella, L.; /CERN /Pisa, Scuola Normale Superiore; Eleftheriadis, C.; /Aristotle U., Thessaloniki; Englhauser, J.; /Garching, Max Planck Inst., MPE; Fanourakis, G.; /Democritos Nucl. Res. Ctr.; Ferrer-Ribas, E.; /DAPNIA, Saclay; Fischer, H.; Franz, J.; /Freiburg U.; Friedrich, P.; /Garching, Max Planck Inst., MPE; Geralis, T.; /Democritos Nucl. Res. Ctr. /DAPNIA, Saclay /Moscow, INR /Zaragoza U. /British Columbia U. /Freiburg U. /Darmstadt, Tech. Hochsch. /DAPNIA, Saclay /Zaragoza U. /Frankfurt U. /Boskovic Inst., Zagreb /Freiburg U. /Munich, Max Planck Inst. /Boskovic Inst., Zagreb /Democritos Nucl. Res. Ctr. /Darmstadt, Tech. Hochsch. /Garching, Max Planck Inst., MPE /Boskovic Inst., Zagreb /CERN /Aristotle U., Thessaloniki /Boskovic Inst., Zagreb /Munich, Max Planck Inst. /Zaragoza U. /Chicago U., EFI /Chicago U., KICP /Stanford U., Phys. Dept. /SLAC /Zaragoza U. /CERN /DAPNIA, Saclay /CERN /Munich, Max Planck Inst. /Darmstadt, Tech. Hochsch. /Zaragoza U. /Aristotle U., Thessaloniki /Patras U. /Brookhaven /CERN /Munich, Max Planck Inst. /CERN /Chicago U., EFI /Chicago U., KICP /Zaragoza U. /Freiburg U. /CERN /CERN /Patras U.


    We have searched for 14.4 keV solar axions or more general axion-like particles (ALPs), that may be emitted in the M1 nuclear transition of 57Fe, by using the axion-to-photon conversion in the CERN Axion Solar Telescope (CAST) with evacuated magnet bores (Phase I). From the absence of excess of the monoenergetic X-rays when the magnet was pointing to the Sun, we set model-independent constraints on the coupling constants of pseudoscalar particles that couple to two photons and to a nucleon g{sub ay}|-1.19g{sub aN}{sup 0}+g{sub aN}{sup 3}| < 1.36 x 10{sup -16} GeV{sup -1} for ma < 0.03 eV at the 95% confidence level.

  7. STEM Electron Diffraction and High Resolution Images Used in the Determination of the Crystal Structure of Au144(SR)60Cluster. (United States)

    Bahena, Daniel; Bhattarai, Nabraj; Santiago, Ulises; Tlahuice, Alfredo; Ponce, Arturo; Bach, Stephan B H; Yoon, Bokwon; Whetten, Robert L; Landman, Uzi; Jose-Yacaman, Miguel


    Determination of the total structure of molecular nanocrystals is an outstanding experimental challenge that has been met, in only a few cases, by single-crystal X-ray diffraction. Described here is an alternative approach that is of most general applicability and does not require the fabrication of a single crystal. The method is based on rapid, time-resolved nanobeam electron diffraction (NBD) combined with high-angle annular dark field scanning/transmission electron microscopy (HAADF-STEM) images in a probe corrected STEM microscope, operated at reduced voltages. The results are compared with theoretical simulations of images and diffraction patterns obtained from atomistic structural models derived through first-principles density functional theory (DFT) calculations. The method is demonstrated by application to determination of the structure of the Au 144 (SCH 2 CH 2 Ph) 60 cluster.

  8. Estimation of continental 187Os/186Os values by using 187Os/186Os and 143Nd/144Nd ratios in marine manganese nodules (United States)

    Turekian, Karl K.; Luck, Jean-Marc


    The relationship between 187Os/186Os and 143Nd/144Nd in different manganese nodule fields is used to determine the 187Os/186Os ratio of the continental terrains bounding the major ocean basins. The Atlantic Ocean drainages yield 187Os/186Os of about 11; the Pacific Ocean, between 25 and 36; and the western Indian Ocean, 20. By assuming a two-component continental crust composed of “ultramafic rocks” (high Os concentration, low 187Os/186Os) and “granite” with only radiogenic 187Os produced in accessory Re-bearing molybdenite, the ultramafic contribution to weathering is about 0.2%. Some or most of this may come from the alteration of oceanic ultramafics. PMID:16578780

  9. Hidden Components in Aqueous "Gold-144" Fractionated by PAGE: High-Resolution Orbitrap ESI-MS Identifies the Gold-102 and Higher All-Aromatic Au-pMBA Cluster Compounds. (United States)

    Alvarez, Marcos M; Chen, Jenny; Plascencia-Villa, Germán; Black, David M; Griffith, Wendell P; Garzón, Ignacio L; José-Yacamán, Miguel; Demeler, Borries; Whetten, Robert L


    Experimental and theoretical evidence reveals the resilience and stability of the larger aqueous gold clusters protected with p-mercaptobenzoic acid ligands (pMBA) of composition Aun(pMBA)p or (n, p). The Au144(pMBA)60, (144, 60), or gold-144 aqueous gold cluster is considered special because of its high symmetry, abundance, and icosahedral structure as well as its many potential uses in material and biological sciences. Yet, to this date, direct confirmation of its precise composition and total structure remains elusive. Results presented here from characterization via high-resolution electrospray ionization mass spectrometry on an Orbitrap instrument confirm Au102(pMBA)44 at isotopic resolution. Further, what usually appears as a single band for (144, 60) in electrophoresis (PAGE) is shown to also contain the (130, 50), recently determined to have a truncated-decahedral structure, and a (137, 56) component in addition to the dominant (144, 60) compound of chiral-icosahedral structure. This finding is significant in that it reveals the existence of structures never before observed in all-aromatic water-soluble species while pointing out the path toward elucidation of the thermodynamic control of protected gold nanocrystal formation.

  10. 144__Olukosi_drinking wate

    African Journals Online (AJOL)


    Oxygen Demand (BOD5), Dissolved oxygen, Total Dissolved Solids (TDS), Nitrate, Electrical conductivity and pH using standard methods. The values for conductivity (441.57 ±. 107.13µhos/cm) and TDS (220.78 ± 53.56mg/l) were significantly higher for the borehole water samples (P<0.05), while the pH (7.27 ± 0.11) and ...

  11. 144 | P a g e

    African Journals Online (AJOL)

    Fr. Ikenga

    type is materialism. In its essential tenets, it holds that matter is the one and only kind of being - the primary substance and that the universe is a material world and all objects of experience are composed of matter.1 In its most ..... With the crisis of the concept of God, the galaxy of the ethical and spiritual values attendant to ...

  12. Hb San Cataldo [β144(HC1)Lys→Thr; HBB: C.434A > C]: A New Hemoglobin Variant with Increased Affinity for Oxygen. (United States)

    Vinciguerra, Margherita; Passarello, Cristina; Cassarà, Filippo; Leto, Filippo; Cannata, Monica; Crivello, Anna; Di Salvo, Veronica; Maggio, Aurelio; Giambona, Antonino


    A 59-year-old Italian woman came to our center for revaluation of a previous diagnosis of polycythemia vera. The patient presented with a lifelong history of polycythemia, no increase in white blood cells (WBCs) and platelets, and a negative bone marrow biopsy. Analysis of hemoglobin (Hb) fractions showed an abnormal fast moving Hb component. We aimed to determine if this variant was the cause of polycythemia in this patient. A complete blood count (CBC) was performed by an automated cell counter and Hb fractions were determined by high performance liquid chromatography (HPLC). Standard stability tests and oxygen affinity evaluation were also performed. Genomic DNA was extracted from peripheral blood leukocytes using the phenol chloroform method and the entire β-globin gene was analyzed by direct sequencing. At the hematological level, no anemia or hemolysis was observed but an abnormal Hb fraction was detected using cation exchange HPLC. Molecular analysis of the β-globin gene showed heterozygosity for an AAG > ACG substitution at codon 144, resulting in a Lys→Thr amino acid replacement. We demonstrated that this is a new Hb variant with increased oxygen affinity. Its altered physiology is caused by the reduction of 2,3-diphosphoglycerate (2,3-DPG) effects, due to an amino acid substitution in the central pocket near the C-terminal of the β chain. We called this new variant Hb San Cataldo for the native city of proband.

  13. Excitation energy dependence of fragment-mass distributions from fission of 180,190Hg formed in fusion reactions of 36Ar + 144,154Sm

    Directory of Open Access Journals (Sweden)

    K. Nishio


    Full Text Available Mass distributions of fission fragments from the compound nuclei 180Hg and 190Hg formed in fusion reactions 36Ar + 144Sm and 36Ar + 154Sm, respectively, were measured at initial excitation energies of E⁎(Hg180=33–66 MeV and E⁎(Hg190=48–71 MeV. In the fission of 180Hg, the mass spectra were well reproduced by assuming only an asymmetric-mass division, with most probable light and heavy fragment masses A¯L/A¯H=79/101. The mass asymmetry for 180Hg agrees well with that obtained in the low-energy β+/EC-delayed fission of 180Tl, from our earlier ISOLDE(CERN experiment. Fission of 190Hg is found to proceed in a similar way, delivering the mass asymmetry of A¯L/A¯H=83/107, throughout the measured excitation energy range. The persistence as a function of excitation energy of the mass-asymmetric fission for both proton-rich Hg isotopes gives strong evidence for the survival of microscopic effects up to effective excitation energies of compound nuclei as high as 40 MeV. This behavior is different from fission of actinide nuclei and heavier mercury isotope 198Hg.

  14. CDCC calculations of elastic scattering for the systems 6Li+144Sm and 6Li+208Pb. Effect of resonances of 6Li on elastic scattering angular distributions (United States)

    Gómez Camacho, A.


    Calculations of elastic scattering angular distributions for reactions of the weakly bound projectile 6Li with targets 144Sm and 208Pb at energies above the barrier, are performed with the Continuum Discretized Coupled-Channel method (CDCC). Ground, resonant and nonresonant continuum states of 6Li are included up to some maximum energy epsilonmax for which convergence is achieved. In the three-body system, global interactions are used for the α-target and d - target sub-systems. The effect of continuum resonant states of 6Li, i.e., l = 2, jπ = 3+, 2+ and 1+ on elastic scattering angular distributions is investigated by extracting these states from the continuum space. It is found that the calculated elastic scattering angular distributions are in good agreement with the measurements for most of the cases studied where consideration of couplings to continuum states is essential. It is also found that the resonance character of the continuum states is in some cases important to obtain agreement with the data.

  15. Collision-induced dissociation of monolayer protected clusters Au144 and Au130 in an electrospray time-of-flight mass spectrometer. (United States)

    Black, David M; Bhattarai, Nabraj; Whetten, Robert L; Bach, Stephan B H


    Gas-phase reactions of larger gold clusters are poorly known because generation of the intact parent species for mass spectrometric analysis remains quite challenging. Herein we report in-source collision-induced dissociation (CID) results for the monolayer protected clusters (MPCs) Au144(SR)60 and Au130(SR)50, where R- = PhCH2CH2-, in a Bruker micrOTOF time-of-flight mass spectrometer. A sample mixture of the two clusters was introduced into the mass spectrometer by positive mode electrospray ionization. Standard source conditions were used to acquire a reference mass spectrum, exhibiting negligible fragmentation, and then the capillary-skimmer potential difference was increased to induce in-source CID within this low-pressure region (∼4 mbar). Remarkably, distinctive fragmentation patterns are observed for each MPC[3+] parent ion. An assignment of all the major dissociation products (ions and neutrals) is deduced and interpreted by using the distinguishing characteristics in the standard structure-models for the respective MPCs. Also, we propose a ring-forming elimination mechanism to explain R-H neutral loss, as separate from the channels leading to RS-SR or (AuSR)4 neutrals.

  16. Site directed mutagenesis experiments suggest that Glu 111, Glu 144 and Arg 145 are essential for endonucleolytic activity of EcoRI. (United States)

    Wolfes, H; Alves, J; Fliess, A; Geiger, R; Pingoud, A


    We have constructed a plasmid (pRIF 309+) carrying the EcoRI restriction endonuclease gene and the f1 origin of replication. Upon transformation of this plasmid into E. coli and infection with bacteriophage f1 single stranded plasmids are produced which can be used for sequencing and site directed mutagenesis. Using this single stranded DNA and synthetic oligodeoxynucleotides we have introduced point mutations at defined positions of the EcoRI gene. Since in pRIF309+ the EcoRI gene is under the control of the pL-promoter, high level expression of the mutated EcoRI gene could be obtained upon induction. Mutant EcoRI enzymes were purified to homogeneity and characterized in structural and functional terms. Our results demonstrate that the Glu 111----Gln, Glu 144----Gln and Arg 145----Lys -mutants adopt a very similar conformation as the wild type enzyme, but have by two orders of magnitude smaller specific activities than the wild type enzyme, mainly due to a reduction of the Vmax-value.

  17. 1 λ × 1.44 Tb/s free-space IM-DD transmission employing OAM multiplexing and PDM. (United States)

    Zhu, Yixiao; Zou, Kaiheng; Zheng, Zhennan; Zhang, Fan


    We report the experimental demonstration of single wavelength terabit free-space intensity modulation direct detection (IM-DD) system employing both orbital angular momentum (OAM) multiplexing and polarization division multiplexing (PDM). In our experiment, 12 OAM modes with two orthogonal polarization states are used to generate 24 channels for transmission. Each channel carries 30 Gbaud Nyquist PAM-4 signal. Therefore an aggregate gross capacity record of 1.44 Tb/s (12 × 2 × 30 × 2 Gb/s) is acheived with a modulation efficiency of 48 bits/symbol. After 0.8m free-space transmission, the bit error rates (BERs) of all the channels are below the 20% hard-decision forward error correction (HD-FEC) threshold of 1.5 × 10(-2). After applying the decision directed recursive least square (DD-RLS) based filter and post filter, the BERs of two polarizations can be reduced from 5.3 × 10(-3) and 7.3 × 10(-3) to 2.2 × 10(-3) and 3.4 × 10(-3), respectively.

  18. Efficacy and safety of a once-daily single-tablet regimen of tenofovir, lamivudine, and efavirenz assessed at 144 weeks among antiretroviral-naive and experienced HIV-1-infected Thai adults

    NARCIS (Netherlands)

    Avihingsanon, A.; Maek, A.N.W.; Gatechompol, S.; Sapsirisavat, V.; Thiansanguankul, W.; Sophonphan, J.; Thammajaruk, N.; Ubolyam, S.; Burger, D.M.; Ruxrungtham, K.


    OBJECTIVE: To assess the efficacy and safety of a new single-tablet regimen (STR) of tenofovir disoproxil fumarate (TDF) 300mg, lamivudine (3TC) 300mg, and efavirenz (EFV) 600mg in HIV-infected Thai patients. METHODS: This was a prospective study performed for 144 weeks among 51 treatment-naive

  19. Construction of All-Solid-State Batteries based on a Sulfur-Graphene Composite and Li9.54 Si1.74 P1.44 S11.7 Cl0.3 Solid Electrolyte. (United States)

    Xu, Ruochen; Wu, Zhang; Zhang, Shenzhao; Wang, Xiuli; Xia, Yan; Xia, Xinhui; Huang, Xiaohua; Tu, Jiangping


    Herein an effective way for construction of all-solid-state lithium-sulfur batteries (LSBs) with sulfur/reduced graphene oxide (rGO) and Li9.54 Si1.74 P1.44 S11.7 Cl0.3 solid electrolyte is reported. In the composite cathode, the Li9.54 Si1.74 P1.44 S11.7 Cl0.3 powder is homogeneously mixed with the S/rGO composite to enhance the ionic conductivity. Coupled with a metallic Li anode and solid electrolyte, the designed S/rGO-Li9.54 Si1.74 P1.44 S11.7 Cl0.3 composite cathode exhibits a high specific capacity and good cycling stability. A high initial discharge capacity of 969 mAh g(-1) is achieved at a current density of 80 mA g(-1) at room temperature and the cell retains a reversible capacity of over 827 mAh g(-1) after 60 cycles. The enhanced performance is attributed to the intimate contact between the S/rGO and Li9.54 Si1.74 P1.44 S11.7 Cl0.3 electrolyte, and high electrical conductivity of rGO and high ionic conductivity of the solid electrolyte. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. A Brief Review of Past INL Work Assessing Radionuclide Content in TMI-2 Melted Fuel Debris: The Use of 144Ce as a Surrogate for Pu Accountancy

    Energy Technology Data Exchange (ETDEWEB)

    D. L. Chichester; S. J. Thompson


    This report serves as a literature review of prior work performed at Idaho National Laboratory, and its predecessor organizations Idaho National Engineering Laboratory (INEL) and Idaho National Engineering and Environmental Laboratory (INEEL), studying radionuclide partitioning within the melted fuel debris of the reactor of the Three Mile Island 2 (TMI-2) nuclear power plant. The purpose of this review is to document prior published work that provides supporting evidence of the utility of using 144Ce as a surrogate for plutonium within melted fuel debris. When the TMI-2 accident occurred no quantitative nondestructive analysis (NDA) techniques existed that could assay plutonium in the unconventional wastes from the reactor. However, unpublished work performed at INL by D. W. Akers in the late 1980s through the 1990s demonstrated that passive gamma-ray spectrometry of 144Ce could potentially be used to develop a semi-quantitative correlation for estimating plutonium content in these materials. The fate and transport of radioisotopes in fuel from different regions of the core, including uranium, fission products, and actinides, appear to be well characterized based on the maximum temperature reached by fuel in different parts of the core and the melting point, boiling point, and volatility of those radioisotopes. Also, the chemical interactions between fuel, fuel cladding, control elements, and core structural components appears to have played a large role in determining when and how fuel relocation occurred in the core; perhaps the most important of these reaction appears to be related to the formation of mixed-material alloys, eutectics, in the fuel cladding. Because of its high melting point, low volatility, and similar chemical behavior to plutonium, the element cerium appears to have behaved similarly to plutonium during the evolution of the TMI-2 accident. Anecdotal evidence extrapolated from open-source literature strengthens this logical feasibility for

  1. Categorizing renal oncocytic neoplasms on core needle biopsy: a morphologic and immunophenotypic study of 144 cases with clinical follow-up. (United States)

    Alderman, Megan A; Daignault, Stephanie; Wolf, J Stuart; Palapattu, Ganesh S; Weizer, Alon Z; Hafez, Khaled S; Kunju, Lakshmi P; Wu, Angela J


    There is limited literature on renal oncocytic neoplasms diagnosed on core biopsy. All renal oncocytic neoplasm core biopsies from 2006 to 2013 were retrospectively reviewed. Morphologic features and an immunohistochemical panel of CK7, c-KIT, and S100A1 were assessed. Concordance with resection diagnosis, statistical analysis including a random forest classification, and follow-up were recorded. The post-immunohistochemical diagnoses of 144 renal oncocytic core biopsies were favor oncocytoma (67%), favor renal cell carcinoma (RCC) (12%), and cannot exclude RCC (21%). Diagnosis was revised following immunohistochemistry in 7% of cases. The most common features for oncocytoma (excluding dense granular cytoplasm) were nested architecture, edematous stroma, binucleation and tubular architecture; the most common features for favor RCC were sheet-like architecture, nuclear pleomorphism, papillary architecture, and prominent cell borders. High nuclear grade, necrosis, extensive papillary architecture, raisinoid nuclei, and frequent mitoses were not seen in oncocytomas. Comparing the pathologist and random forest classification, the overall out-of-bag estimate of classification error dropped from 23% to 13% when favor RCC and cannot exclude RCC were combined into 1 category. Resection was performed in 19% (28 cases) with a 94% concordance (100% of favor RCC biopsies and 90% of cannot exclude RCC biopsies confirmed as RCC; 83% of favor oncocytomas confirmed); ablation in 23%; and surveillance in 46%. Follow-up was available in 92% (median follow-up, 33months) with no adverse outcomes. Renal oncocytic neoplasms comprise a significant subset (16%) of all core biopsies, and the majority (78%) can be classified as favor oncocytoma or favor RCC. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Regulation of plasma factor XIII levels in healthy individuals; a major impact by subunit B intron K c.1952+144 C>G polymorphism. (United States)

    Mezei, Zoltán A; Katona, Éva; Kállai, Judit; Bereczky, Zsuzsanna; Molnár, Éva; Kovács, Bettina; Ajzner, Éva; Bagoly, Zsuzsa; Miklós, Tünde; Muszbek, László


    The regulation of plasma factor XIII (FXIII) levels in healthy individuals has been only partially explored. The identification of major non-genetic and genetic regulatory factors might provide important information on the contribution of FXIII to the risk of cardio/cerebrovascular diseases. To determine the effect of age, smoking, BMI, fibrinogen concentration on plasma FXIII activity, complex FXIII antigen (FXIII-A2B2) and total FXIII-B subunit (tFXIII-B) level, to correlate FXIII-B level with the other two FXIII parameters and to assess the variation of FXIII levels in carriers of major FXIII subunit polymorphisms. 268 healthy individuals were enrolled in the study. FXIII activity was measured by the ammonia release assay; FXIII-A2B2 and tFXIII-B were determined by ELISAs. FXIII-A p.Val34Leu, FXIII-B p.His95Arg and FXIII-B intron K c.1952+144 C>G polymorphisms were identified by RT-PCR using melting point analysis with fluorescence resonance energy transfer detection. All investigated FXIII parameters showed significant positive correlation with age and fibrinogen level; gender and BMI influenced only tFXIII-B. A highly significant positive correlation was demonstrated between tFXIII-B and the other FXIII parameters. FXIII-A p.Val34Leu polymorphism had only slight, if any effect on FXIII levels. The FXIII-B Arg95 allele moderately increased all three FXIII parameters, but the effect became statistically significant only after adjustment. The FXIII-B intron K G allele drastically decreased FXIII levels, and it seemed to be in synergism with the FXIII-A Leu34 allele. Plasma FXIII levels are subjected to multifactorial regulation, in which age, fibrinogen level and FXIII-B intron K polymorphism are major determinants. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Radiolesão vascular como efeito deletério da braquiterapia intra-arterial com dose elevada de Samário-153 em coelhos hipercolesterolêmicos Vascular radiolesion as a deleterious effect of high-dose-rate intraarterial brachytherapy with Samarium-153 in hypercholesterolemic rabbits

    Directory of Open Access Journals (Sweden)

    Dalton Bertolim Précoma


    Full Text Available OBJETIVO: Este estudo tem por objetivo avaliar as alterações vasculares morfológicas e morfométricas induzidas pela braquiterapia com Samário-153 (153 Sm em coelhos hipercolesterolêmicos, com doses elevadas. MÉTODOS: Foram analisados 43 coelhos hipercolesterolêmicos, brancos, da raça New Zealand, e o total de 86 artérias ilíacas submetidas a lesão por balão de angioplastia. Divididos em três grupos: dois (GI irradiados com as doses de 15Gy (n=14 e 60Gy (n=36 e um grupo controle (n=36. Foram realizadas avaliação histológica morfométrica e análise histológica qualitativa para análise tecidual. RESULTADOS: Foram observadas uma redução significativa da neoproliferação intimal (NPI no GI 15 Gy (pOBJECTIVE: This study was designed to evaluate vascular morphological and morphometric changes induced by brachytherapy with samarium-153 (Sm-153 at high doses in hypercholesterolemic rabbits. METHODS: Forty-three New Zealand White hypercholesterolemic rabbits were analyzed, and the total of 86 iliac arteries underwent balloon angioplasty injury. The rabbits were divided into three different groups: two irradiation groups (IG assigned to 15 Gy (n=14 and 60 Gy (n=36 irradiation doses, respectively, and a control group (n = 36. Histomorphometric and qualitative histological analyses were performed for tissue evaluation. RESULTS: Significant reductions were found in neointimal proliferation (NIP (p< 0.0001, media area (MA (p<0.0001 and percent stenosis (p<0.0001 in the 15-Gy IG, compared to the other groups. The 60-Gy IG had the higher rate of NIP, increase in media and vessel areas (VA and percent stenosis. The 60-Gy IG also showed the greatest number of xanthomatous cells (60-Gy IG: 86.11% and 15-Gy IG: 14.29%, p<0.0001 and the highest amount of hyaline amorphous tissue (60-Gy IG:58.33% and 15-Gy IG:0%, p=0.0001 and vascular proliferation (60-Gy IG:30.56% and 15-Gy IG:0%, p=0.0221. No statistically significant differences were found

  4. Neutron fluence and energy reconstruction with the IRSN recoil detector μ-TPC at 27 keV, 144 keV and 565 keV

    Energy Technology Data Exchange (ETDEWEB)

    Maire, D.; Lebreton, L.; Richer, J.P. [IRSN, PRP-HOM, SDE, LMDN, 13115 Saint Paul-Lez-Durance (France); Bosson, G.; Bourrion, O.; Guillaudin, O.; Riffard, Q.; Santos, D. [CNRS/IN2P3-UJF-INPG, LPSC, 38000 Grenoble (France)


    The French Institute for Radioprotection and Nuclear Safety (IRSN), associated to the French Metrology Institute (LNE), is developing a time projection chamber using a Micromegas anode: μ-TPC. This work is carried out in collaboration with the Laboratory of Subatomic Physics and Cosmology (LPSC). The aim is to characterize with a primary procedure the energy distribution of neutron fluence in the energy range 8 keV - 1 MeV. The time projection chambers are gaseous detectors, which are able to measure charged particles energy and to reconstruct their track if a pixelated anode is used. In our case, the gas is used as a (n, p) converter in order to detect neutrons down to few keV. Coming from elastic collisions with neutrons, recoil protons lose a part of their kinetic energy by ionizing the gas. The ionization electrons are drifted toward a pixelated anode (2D projection), read at 50 MHz by a self-triggered electronic system to obtain the third track dimension. The neutron energy is reconstructed event by event thanks to proton scattering angle and proton energy measurements. The scattering angle is deduced from the 3D track. The proton energy is obtained by charge collection measurements, knowing the ionization quenching factor (i.e. the part of proton kinetic energy lost by ionizing the gas). The fluence is calculated thanks to the detected events number and the simulated detector response. The μ-TPC is a new reliable detector which enables to measure energy distribution of the neutron fluence without deconvolution or neutron calibration contrary to usual gaseous counters. The μ-TPC is still being developed and measurements have been carried out at the AMANDE facility, with neutrons energies going from 8 keV to 565 keV. After the context and the μ-TPC working principle presentation, measurements of the neutron energy and fluence at 27.2 keV, 144 keV and 565 keV are shown and compared to the complete detector simulation. This work shows the first direct

  5. 87Sr/86Sr and 143Nd/144Nd for disentangling anthropogenic and natural REE contributions in river water during flood events. (United States)

    Hissler, Christophe; Stille, Peter; Pfister, Laurent


    The sustainable management of water resources is one of the greatest challenges of the 21st century. Water is a vital resource that is increasingly put under pressure from multiple perspectives. While the global population is on the rise, socio-economic development makes equally rapid progress - eventually compromising access to clean water bodies. Multiple pollution sources constitute an immediate threat to aquatic ecosystems and are likely to cause long lasting contaminations of water bodies that are critical for drinking and/or irrigation water production. There is a pressing need for an adequate quantification of anthropogenic impacts on the critical zone of river basins and the identification of the temporal dynamics of these impacts. As an example, despite the work done to assess the environmental impact of REE pollutions in larger river systems, we are still lacking information on the dynamics of these anthropogenic compounds in relation to rapid hydrological changes. Filling these knowledge gaps is a pre-requisite for the design and implementation of sustainable water resources management strategies. In order to better constrain the relative contributions of both anthropogenic and geogenic trace element sources we propose using a multitracer approach combining elemental and 87Sr/86Sr, 143Nd/144Nd, and 206Pb/207Pb isotopic ratios. The use of these three separate isotopic systems together with REE concentrations is new in the field of anthropogenic source identification in river systems. We observed enrichments in Anthropogenic Rare Earth Elements (AREE) for dissolved Gd and suspended Nd loads of river water. With increasing discharge, AREE anomalies progressively disappeared and gave way to the geogenic chemical signature of the basin in both dissolved and suspended loads. The isotopic data confirm these observations and shed new light on the trace elements sources. On the one hand, dissolved loads have peculiar isotopic characteristics and carry mainly

  6. Profiling of Greenhouse Gases from Space by Infrared-Laser Occultation and Demonstration by a 144 km Crosslink Experiment at the Canary Islands (United States)

    Kirchengast, G.; Schweitzer, S.; Proschek, V.; Bernath, P.; Thomas, B.; Wang, J.; Brooke, J.; Tereszchuk, K.; Gonzalez Abad, G.; Hargreaves, R.; Beale, C. A.; Martin, P.; Kasiutsich, V.; Gerbig, C.; Kolle, O.; Loescher, A.


    Low Earth Orbit (LEO) transmitter and receiver satellites provide the basis for LEO-LEO microwave and infrared-laser occultation (LMIO), a new active limb sounding method for climate benchmark profiling of greenhouse gases (GHGs), thermodynamic variables and wind in the free atmosphere (Kirchengast and Schweitzer, GRL, 38, L13701, 2011). The LEO-LEO infrared-laser occultation (LIO) part of LMIO can provide accurate profiles of all main GHGs, including CO2, CH4, N2O, H2O, O3, and isotopes 13CO2 and 18OCO, by exploiting differential absorption between carefully selected absorption ("on-line") and reference ("off-line") laser signals targeting suitable GHG absorption lines within 2 to 2.5 μm. This spectral range resides in the "hole" between the shortwave-solar and longwave-terrestrial Planck spectra so that natural background radiation is minimal to negligible. We present the fundamentals and discuss the estimated performance of LMIO-based GHG profiling, including from quasi-realistic end-to-end performance simulations considering also aerosols and clouds. We found monthly-mean GHG profiles, assuming 30 to 40 native profiles averaged per climatological "grid cell" per month, accurate to LIO sounding along a ~144 km link at ~2.4 km altitude between observatories at the islands of La Palma and Tenerife being part of the Canary Islands (ESA-funded experiment project by Bernath et al.; Univ. York, Univ. Graz, Univ. Manchester, MPI Jena). With transmitter and receiver breadboard equipment built for four infrared-laser signals we aimed in this campaign at CO2, CH4, and H2O measurements under field conditions somewhat akin to a LIO space-based link. Despite of the practical challenges of such long-range observations, especially related to the needed fine adjustments of laser beam pointing under windy high-altitude conditions, we achieved first good data for retrieving these GHGs so that the basic demonstration of the experimental feasibility of LIO was successful. We will

  7. Predicting live birth, preterm delivery, and low birth weight in infants born from in vitro fertilisation: a prospective study of 144,018 treatment cycles.

    Directory of Open Access Journals (Sweden)

    Scott M Nelson


    Full Text Available The extent to which baseline couple characteristics affect the probability of live birth and adverse perinatal outcomes after assisted conception is unknown.We utilised the Human Fertilisation and Embryology Authority database to examine the predictors of live birth in all in vitro fertilisation (IVF cycles undertaken in the UK between 2003 and 2007 (n = 144,018. We examined the potential clinical utility of a validated model that pre-dated the introduction of intracytoplasmic sperm injection (ICSI as compared to a novel model. For those treatment cycles that resulted in a live singleton birth (n = 24,226, we determined the associates of potential risk factors with preterm birth, low birth weight, and macrosomia. The overall rate of at least one live birth was 23.4 per 100 cycles (95% confidence interval [CI] 23.2-23.7. In multivariable models the odds of at least one live birth decreased with increasing maternal age, increasing duration of infertility, a greater number of previously unsuccessful IVF treatments, use of own oocytes, necessity for a second or third treatment cycle, or if it was not unexplained infertility. The association of own versus donor oocyte with reduced odds of live birth strengthened with increasing age of the mother. A previous IVF live birth increased the odds of future success (OR 1.58, 95% CI 1.46-1.71 more than that of a previous spontaneous live birth (OR 1.19, 95% CI 0.99-1.24; p-value for difference in estimate <0.001. Use of ICSI increased the odds of live birth, and male causes of infertility were associated with reduced odds of live birth only in couples who had not received ICSI. Prediction of live birth was feasible with moderate discrimination and excellent calibration; calibration was markedly improved in the novel compared to the established model. Preterm birth and low birth weight were increased if oocyte donation was required and ICSI was not used. Risk of macrosomia increased with advancing

  8. Enhancement of solubility in Escherichia coli and purification of an aminotransferase from Sphingopyxis sp. MTA144 for deamination of hydrolyzed fumonisin B1

    Directory of Open Access Journals (Sweden)

    Hartinger Doris


    Full Text Available Abstract Background Fumonisin B1 is a cancerogenic mycotoxin produced by Fusarium verticillioides and other fungi. Sphingopyxis sp. MTA144 can degrade fumonisin B1, and a key enzyme in the catabolic pathway is an aminotransferase which removes the C2-amino group from hydrolyzed fumonisin B1. In order to study this aminotransferase with respect to a possible future application in enzymatic fumonisin detoxification, we attempted expression of the corresponding fumI gene in E. coli and purification of the enzyme. Since the aminotransferase initially accumulated in inclusion bodies, we compared the effects of induction level, host strain, expression temperature, solubility enhancers and a fusion partner on enzyme solubility and activity. Results When expressed from a T7 promoter at 30°C, the aminotransferase accumulated invariably in inclusion bodies in DE3 lysogens of the E. coli strains BL21, HMS174, Rosetta 2, Origami 2, or Rosetta-gami. Omission of the isopropyl-beta-D-thiogalactopyranoside (IPTG used for induction caused a reduction of expression level, but no enhancement of solubility. Likewise, protein production but not solubility correlated with the IPTG concentration in E. coli Tuner(DE3. Addition of the solubility enhancers betaine and sorbitol or the co-enzyme pyridoxal phosphate showed no effect. Maltose-binding protein, used as an N-terminal fusion partner, promoted solubility at 30°C or less, but not at 37°C. Low enzyme activity and subsequent aggregation in the course of purification and cleavage indicated that the soluble fusion protein contained incorrectly folded aminotransferase. Expression in E. coli ArcticExpress(DE3, which co-expresses two cold-adapted chaperonins, at 11°C finally resulted in production of appreciable amounts of active enzyme. Since His tag-mediated affinity purification from this strain was hindered by co-elution of chaperonin, two steps of chromatography with optimized imidazole concentration in the

  9. Predicting Live Birth, Preterm Delivery, and Low Birth Weight in Infants Born from In Vitro Fertilisation: A Prospective Study of 144,018 Treatment Cycles (United States)

    Nelson, Scott M.; Lawlor, Debbie A.


    Background The extent to which baseline couple characteristics affect the probability of live birth and adverse perinatal outcomes after assisted conception is unknown. Methods and Findings We utilised the Human Fertilisation and Embryology Authority database to examine the predictors of live birth in all in vitro fertilisation (IVF) cycles undertaken in the UK between 2003 and 2007 (n = 144,018). We examined the potential clinical utility of a validated model that pre-dated the introduction of intracytoplasmic sperm injection (ICSI) as compared to a novel model. For those treatment cycles that resulted in a live singleton birth (n = 24,226), we determined the associates of potential risk factors with preterm birth, low birth weight, and macrosomia. The overall rate of at least one live birth was 23.4 per 100 cycles (95% confidence interval [CI] 23.2–23.7). In multivariable models the odds of at least one live birth decreased with increasing maternal age, increasing duration of infertility, a greater number of previously unsuccessful IVF treatments, use of own oocytes, necessity for a second or third treatment cycle, or if it was not unexplained infertility. The association of own versus donor oocyte with reduced odds of live birth strengthened with increasing age of the mother. A previous IVF live birth increased the odds of future success (OR 1.58, 95% CI 1.46–1.71) more than that of a previous spontaneous live birth (OR 1.19, 95% CI 0.99–1.24); p-value for difference in estimate <0.001. Use of ICSI increased the odds of live birth, and male causes of infertility were associated with reduced odds of live birth only in couples who had not received ICSI. Prediction of live birth was feasible with moderate discrimination and excellent calibration; calibration was markedly improved in the novel compared to the established model. Preterm birth and low birth weight were increased if oocyte donation was required and ICSI was not used. Risk of macrosomia

  10. Combination of Hb Heze [β144(HC1)Lys→Arg; HBB: c.434A>G] and β0-Thalassemia in a Chinese Patient with β-Thalassemia Intermedia. (United States)

    Li, Yan; Yan, Jin-Mei; Zhou, Jian-Ying; Lu, Yue-Cheng; Li, Dong-Zhi


    We first report a novel β chain variant, Hb Heze [β144(HC1)Lys→Arg; HBB: c.434A>G], in a Chinese family. Heterozygous inheritance of the mutation results in a mild β-thalassemia (β-thal) phenotype, whereas compound heterozygosity of Hb Heze with β0-thal appears as the cause of β-thal intermedia (β-TI) in our case.

  11. 2-{5-(1,3-Benzodioxol-5-yl-1-[4-(4-chlorophenyl-1,3-thiazol-2-yl]-4,5-dihydro-1H-pyrazol-3-yl}pyrazine

    Directory of Open Access Journals (Sweden)

    Suban Syed Shafi


    Full Text Available A simple method for the synthesis of a pyrazolyl thiazole derivative containing a piperonal moiety was developed. Thus, 2-{5-(1,3-benzodioxol-5-yl-1-[4-(4-chlorophenyl-1,3-thiazol-2-yl]-4,5-dihydro-1H-pyrazol-3-yl}pyrazine was synthesized using microwave irradiation and characterized by NMR, IR and LCMS data.

  12. Interference of N-(1-[4-(4-fluophenoxy)butyl]-piperidinyl)-N-methyl-2-benzothiazolamin e with Na+/H+exchange and Na+/Ca2+exchange in purified cardiac sarcolemmal membranes

    NARCIS (Netherlands)

    Scheufler, E.; Heers, C.; Wilffert, B.; Peters, Thies; Pierce, G.N.


    The effect of R 56865 (N-[1-[4-(4-fluorophenoxy) butyl]-piperidinyl]-N-methyl-2-benzothiazolamine, CAS 104606-13-5) on Na+/H+exchange and Na+/Ca2+exchange was studied in isolated cardiac sarcolemmal vesicles. R 56865 inhibited Na+/H+exchange with an ED50of 180 μmol/l at a concentration of 0.05

  13. Cross sections of the 144Sm(n,α141Nd and 66Zn(n,α63Ni reactions at 4.0, 5.0 and 6.0 MeV

    Directory of Open Access Journals (Sweden)

    Yury Gledenov


    Full Text Available Cross sections of the 144Sm(n,α141Nd and 66Zn(n,α63Ni reactions were measured at En = 4.0, 5.0 and 6.0 MeV performed at the 4.5-MV Van de Graaff Accelerator of Peking University, China. A double-section gridded ionization chamber was used to detect the alpha particles. The foil samples of 144Sm2O3 and enriched 66Zn were placed at the common cathode plate of the chamber. Monoenergetic neutrons were produced by a deuterium gas target through the 2H(d,n3He reaction. The neutron flux was monitored by a BF3 long counter. Cross sections of the 238U(n,f reaction were used as the standard to perform the (n,α reaction measurement. Present results are compared with existing measurements and evaluations. They are generally in agreement with TALYS-1.6 code calculations. For the 144Sm(n,α141Nd reaction our measurements support the data of JEF-2.2. For the 66Zn(n,α63Ni reaction present results support the data of EAF-2010 and TENDL-2015 data.

  14. Cross sections of the 144Sm(n,α)141Nd and 66Zn(n,α)63Ni reactions at 4.0, 5.0 and 6.0 MeV (United States)

    Yury, Gledenov; Guohui, Zhang; Khuukhenkhuu, Gonchigdorj; Milana, Sedysheva; Lubos, Krupa; Sansarbayar, Enkhbold; Igor, Chuprakov; Zhimin, Wang; Xiao, Fan; Luyu, Zhang; Huaiyong, Bai


    Cross sections of the 144Sm(n,α)141Nd and 66Zn(n,α)63Ni reactions were measured at En = 4.0, 5.0 and 6.0 MeV performed at the 4.5-MV Van de Graaff Accelerator of Peking University, China. A double-section gridded ionization chamber was used to detect the alpha particles. The foil samples of 144Sm2O3 and enriched 66Zn were placed at the common cathode plate of the chamber. Monoenergetic neutrons were produced by a deuterium gas target through the 2H(d,n)3He reaction. The neutron flux was monitored by a BF3 long counter. Cross sections of the 238U(n,f) reaction were used as the standard to perform the (n,α) reaction measurement. Present results are compared with existing measurements and evaluations. They are generally in agreement with TALYS-1.6 code calculations. For the 144Sm(n,α)141Nd reaction our measurements support the data of JEF-2.2. For the 66Zn(n,α)63Ni reaction present results support the data of EAF-2010 and TENDL-2015 data.

  15. Optical characteristics of transparent samarium oxide thin films ...

    Indian Academy of Sciences (India)


    Oct 7, 2016 ... 1Department of Physics, Faculty of Science, Taif University, Taif 888, Saudi Arabia. 2Department of Physics, Faculty of Education, Ain Shams University, Roxy 11757, Cairo, Egypt. 3Materials Science Unit, Department of Chemistry, Faculty of Science, Tanta University, 31725 Tanta, Egypt. 4Department of ...

  16. Optical properties of lead–tellurite glasses doped with samarium ...

    Indian Academy of Sciences (India)

    The optical properties of a new family of Sm2O3–(40–)PbO–60TeO2 glasses are investigated. The optical absorption spectra were recorded at ... The refractive index, molar refraction and polarizability of oxide ions have been calculated by using Lorentz–Lorentz relations. The non-linear variations of the above optical ...

  17. Optical properties of lead–tellurite glasses doped with samarium ...

    Indian Academy of Sciences (India)


    Abstract. The optical properties of a new family of xSm2O3–(40–x)PbO–60TeO2 glasses are investigated. The optical absorption spectra were recorded at room temperature in the UV-visible region. From the absorption edge studies, the values of optical bandgap energies have been evaluated. The refractive index, molar ...

  18. Measurement of radiative lifetime in atomic samarium using ...

    Indian Academy of Sciences (India)


    Feb 8, 2014 ... In this paper, we report the investigations of lifetime measurement of odd-parity energy level 19009.52 cm. −1 .... introduced by an electronic delay generator between the two Q-switch pulses of Nd-YAG laser. The slope of the .... Our values of the lifetimes are free from the common systematic errors. Thus ...

  19. A novel samarium complex with interesting photoluminescence and ...

    African Journals Online (AJOL)

    The 4,4'-Hbipy moieties, isolated nitrates and [Sm(H2O)4(NO3)3] species are held together via hydrogen bonds and p…p interactions to form a 3-D supramolecular framework. Luminescent investigation reveals a strong emission in blue region. Optical absorption spectrum of 1 reveals the presence of an optical gap of 3.60 ...

  20. Lithium samarium polyphosphate, LiSm(PO34

    Directory of Open Access Journals (Sweden)

    Dan Zhao


    Full Text Available The mixed-metal rare-earth polyphosphate LiSm(PO34 consists of a three-dimensional framework in which zigzag [(PO3n]n− chains with a periodicity of four PO4 tetrahedra are connected through Li+ and Sm3+ ions (both with 2. symmetry.

  1. Sodium samarium tetrakis(polyphosphate, NaSm(PO34

    Directory of Open Access Journals (Sweden)

    Dan Zhao


    Full Text Available NaSm(PO34 has been prepared by solid state reactions. It belongs to type II of the structural family of MILnIII(PO34 compounds (MI = alkali metal and LnIII = rare earth metal and is composed of ∞(PO3n]n− polyphosphate chains with a repeating unit of four PO4 tetrahedra. The chains extend parallel to [100] and share O atoms with irregular SmO8 polyhedra, forming a three-dimensional framework which delimits tunnels occupied by Na+ cations in a distorted octahedral environment.

  2. Isotopic Ratios of Samarium by TIMS for Nuclear Forensic Application

    Energy Technology Data Exchange (ETDEWEB)

    Louis Jean, James [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Inglis, Jeremy David [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)


    The isotopic ratio of Nd, Sm, and Gd can provide important information regarding fissile material (nuclear devices, reactors), neutron environment, and device yield. These studies require precise measurement of Sm isotope ratios, by either TIMS or MC-ICP-MS. There has been an increasing trend to measure smaller and smaller quantities of Sm bearing samples. In nuclear forensics 10-100 ng of Sm are needed for precise measurement. To measure sub-ng Sm samples using TIMS for nuclear forensic analysis.

  3. Synthesis of copper, silver, and samarium chalcogenides by mechanical alloying

    Energy Technology Data Exchange (ETDEWEB)

    Ohtani, T.; Maruyama, K.; Ohshima, K. [Okayama Univ. of Science (Japan). Lab. for Solid State Chemistry


    CuInX{sub 2} (X = S, Se, Te), Ag{sub 2}S, Ag{sub 2}Se, Ag{sub 3}Te{sub 2}, Ag{sub 1.9}Te, AgCuSe, Sm{sub 3}Se{sub 4}, Sm{sub 2}Se{sub 3}, and SmTe were synthesized by a mechanical alloying method, using a high-energy planetary ball mill. The compounds were obtained by milling mixtures of the elements with desired ratios in agate or Cu-Be vials for 60--180 min.

  4. Oriented growth of thin films of samarium oxide by MOCVD

    Indian Academy of Sciences (India)


    Abstract. Thin films of Sm2O3 have been grown on Si(100) and fused quartz by low-pressure chemical va- pour deposition using an adducted β-diketonate precursor. The films on quartz are cubic, with no preferred orientation at lower growth temperatures (~ 550°C), while they grow with a strong (111) orientation as the.

  5. 150 KVA Samarium Cobalt VSCF Starter Generator Electrical System (United States)


    considerable hand labor. Addition of a provision for suitable electrical connection by the SCR manufacturer wou;d be desirable for production runs. Predicted...licen- sing the holder or any other person or corporation, or conveying any rights or permission to manufacture , use, or sell any patented invent,’n...tesile strength to contain the magnets and pole pieces up through the overspeed rating of the rotor. The cho.;en process uses maraging steel as the

  6. Optical properties of samarium doped zinc–tellurite glasses

    Indian Academy of Sciences (India)

    Glasses with the composition, (Sm2O3)(ZnO)(40–)(TeO2)(60), were prepared by conventional melt quenching method. The density, molar volume, and optical energy band gap of these glasses have been measured. The refractive index, molar refraction and polarizability of oxide ion have been calculated by using ...

  7. The threshold anomaly from the simultaneous calculation of elastic scattering and fusion cross sections for the systems {sup 9}Be+{sup 144}Sm and {sup 9}Be+{sup 64}Zn for energies around the barrier

    Energy Technology Data Exchange (ETDEWEB)

    Camacho, A. G.; Aguilera, E. F.; Quiroz, E. M. [Departamento de Aceleradores, ININ, La Marquesa, 52750 Estado de Mexico (Mexico); Gomes, P. R. S.; Lubian, J. [Instituto de Fisica, Universidade Federal Fluminenese, Av. Litoranea s/n, Gragoata, Niteroi, 24210-340 Rio de Janeiro (Brazil)


    The energy dependence of the optical potential is used to study the threshold anomaly for reactions with the weakly bound projectile {sup 9}Be on {sup 144}Sm and {sup 64}Zn for energies around the Coulomb barrier. The energy dependent potential parameters are obtained from a simultaneous X{sup 2}-analysis of elastic scattering and fusion data. There are signatures that in fact, the so-called breakup threshold anomaly shows up for these systems. This finding is in agreement with other calculations involving weakly bound projectiles. (Author)

  8. 29 CFR 14.4 - Definitions. (United States)


    ... security. (c) Courier—an individual designated by appropriate authority to protect classified and... the transaction of public business; this includes material preserved by an agency or its legitimate...

  9. GPCR Interaction: 144 [GRIPDB[Archive

    Lifescience Database Archive (English)

    Full Text Available RET (SRET) Radioligand binding, Measurement of cAMP accumulation, Immunoprecipitation, Western Immunoblottin...g, Immunocytochemistry Staining and Fluorescent Imaging, Measurement of ERK phosphorylation NP_057167.2 ...

  10. The real Fatou conjecture (AM-144)

    CERN Document Server

    Graczyk, Jacek


    In 1920, Pierre Fatou expressed the conjecture that--except for special cases--all critical points of a rational map of the Riemann sphere tend to periodic orbits under iteration. This conjecture remains the main open problem in the dynamics of iterated maps. For the logistic family x- ax(1-x), it can be interpreted to mean that for a dense set of parameters ""a,"" an attracting periodic orbit exists. The same question appears naturally in science, where the logistic family is used to construct models in physics, ecology, and economics. In this book, Jacek Graczyk and Grzegorz Swiatek provi

  11. 45 CFR 144.103 - Definitions. (United States)


    ....117. State means each of the several States, the District of Columbia, Puerto Rico, the Virgin Islands... vaccines), or Title XXII of the PHS Act. (4) Continuation coverage means coverage under a COBRA...

  12. Reference: 144 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available gulates lateral root development in Arabidopsis. 6 996-1006 15584963 2004 Dec The Plant journal Chakrabarty Pranjib K|Nodzon Lisa A|Pi Li-Ya|Song Wen-Yuan|Wang Yongsheng|Xu Wei-Hui

  13. 10 CFR 600.144 - Procurement procedures. (United States)


    ... practicable, of technical requirements in terms of functions to be performed or performance required... products and services dimensioned in the metric system of measurement. (vi) Preference, to the extent... small businesses, minority-owned firms, and women's business enterprises, whenever possible. Recipients...

  14. 40 CFR 144.3 - Definitions. (United States)


    ... or revisions. Appropriate Act and regulations means the Solid Waste Disposal Act, as amended by the... “drywell” that receives untreated sanitary waste containing human excreta, and which sometimes has an open... reissuance, or termination, as discussed in § 124.5 is not a “draft permit.” Drilling mud means a heavy...

  15. 7 CFR 1703.144 - Completed application. (United States)


    ... objectives and activities; and (4) A budget for capital expenditures reflecting the line item costs for the... toll charges, system maintenance, salaries, training, and any other general operating expenses, provide... the applicant is requesting a loan for telecommunications transmission facilities): (1) The...

  16. Publications | Page 144 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    IDRC works with developing-country researchers and institutions to build local capacity through funding, knowledge sharing, and training. Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. We share the results of our funded ...

  17. 144 Sanchita Hati and Dipankar Datta

    Indian Academy of Sciences (India)

    Lit is a hard (h) acid, Cs" a soft (s) acid, F a hard base and I a soft base. Li+ i + Cst F = Lit F + Cs"I AH = - 12.1 kcal mol. (1) h S S h h h s is. As indicated by the AH value, reaction (1) proceeds in a direction where h binds hand s binds s, in conformity with the HSAB principle. This principle can be said to be the first step ...

  18. 22 CFR 144.103 - Definitions. (United States)


    ..., auxiliary aids useful for persons with impaired vision include readers, brailled materials, audio recordings... hearing include telephone handset amplifiers, telephones compatible with hearing aids, telecommunication... person who is a member of a class of persons otherwise entitled by statute, regulation, or agency policy...

  19. Experimental test of a newly developed single-moderator, multi-detector, directional neutron spectrometer in reference monochromatic fields from 144 keV to 16.5 MeV

    Energy Technology Data Exchange (ETDEWEB)

    Bedogni, R., E-mail: [INFN – LNF, via E. Fermi n. 40, 00044 Frascati (Roma) (Italy); Gómez-Ros, J.M. [INFN – LNF, via E. Fermi n. 40, 00044 Frascati (Roma) (Italy); CIEMAT, Av. Complutense 40, 28040 Madrid (Spain); Pola, A.; Bortot, D. [Politecnico di Milano, Dipartimento di Energia, via La Masa 34, 20156 Milano (Italy); INFN – Milano, Via Celoria 16, 20133 Milano (Italy); Gentile, A. [INFN – LNF, via E. Fermi n. 40, 00044 Frascati (Roma) (Italy); Introini, M.V. [Politecnico di Milano, Dipartimento di Energia, via La Masa 34, 20156 Milano (Italy); INFN – Milano, Via Celoria 16, 20133 Milano (Italy); Buonomo, B. [INFN – LNF, via E. Fermi n. 40, 00044 Frascati (Roma) (Italy); Lorenzoli, M. [Politecnico di Milano, Dipartimento di Energia, via La Masa 34, 20156 Milano (Italy); INFN – Milano, Via Celoria 16, 20133 Milano (Italy); Mazzitelli, M. [INFN – LNF, via E. Fermi n. 40, 00044 Frascati (Roma) (Italy); Sacco, D. [INFN – LNF, via E. Fermi n. 40, 00044 Frascati (Roma) (Italy); INAIL – DPIA, Via di Fontana Candida n.1, 00040 Monteporzio Catone (Italy)


    A new directional neutron spectrometer called CYSP (CYlindrical SPectrometer) was developed within the NESCOFI@BTF (2011–2013) collaboration. The device, composed by seven active thermal neutron detectors located along the axis of a cylindrical moderator, was designed to simultaneously respond from the thermal domain up to hundreds of MeV neutrons. The new spectrometer condenses the performance of the Bonner Sphere Spectrometer in a single moderator; thus requiring only one exposure to determine the whole spectrum. The CYSP response matrix, determined with MCNP, has been experimentally evaluated with monochromatic reference neutron fields from 144 keV to 16.5 MeV, plus a {sup 252}Cf source, available at NPL (Teddington, UK). The results of the experiment confirmed the correctness of the response matrix within an overall uncertainty of ±2.5%. The new active spectrometer CYSP offers an innovative option for real-time monitoring of directional neutron fields as those produced in neutron beam-lines.

  20. The association of the effect of lithium in the maintenance treatment of bipolar disorder with lithium plasma levels : a post hoc analysis of a double-blind study comparing switching to lithium or placebo in patients who responded to quetiapine (Trial 144)

    NARCIS (Netherlands)

    Nolen, Willem A.; Weisler, Richard H.

    Nolen WA, Weisler RH. The association of the effect of lithium in the maintenance treatment of bipolar disorder with lithium plasma levels: a post hoc analysis of a double-blind study comparing switching to lithium or placebo in patients who responded to quetiapine (Trial 144). Bipolar Disord 2012:

  1. Design of the experimental apparatus to obtain a thermal neutron beam, intermediate-energy neutrons (2-144 keV) and high-energy photons (6 MeV) by means of the TRIGA reactor at the ENEA Casaccia center

    CERN Document Server

    Laitano, R F


    Design of the experimental apparatus to obtain a thermal neutron beam, intermediate-energy neutrons (2-144 keV) and high-energy photons (6 MeV) by means of the TRIGA reactor at the ENEA Casaccia center

  2. The effect of solid solution treatment on the hardness and microstructure of 0.6%wt C-10.8%wt Mn-1.44%wt Cr austenitic manganese steel (United States)

    Nurjaman, F.; Bahfie, F.; Astuti, W.; Shofi, A.


    Austenitic manganese steel is steel alloy that has high manganese content (10-14%wt Mn). The characteristics of austenitic manganese steel are good in toughness, ductility, and wear resistance. Effect of solid solution treatment on the hardness and microstructure of austenitic manganese steel was studied in this experiment. The solid solution treatment process of austenitic manganese steel, 0.6%wt C-10.8%wt Mn-1.44%wt Cr, was conducted by heating the material at varied temperatures (950°C, 1000°C, 1050°C) for an hour and then quenching it in two different quenching media, i.e. oil and water. Further, the samples were tempered at three different temperatures (300°C, 400°C, and 500°C) for 2 hours. The treated materials were analyzed by Rockwell Hardness Tester to obtain the information of materials hardness and by an optical microscope and XRD to investigate the microstructure phase of the treated materials. Heating the austenitic manganese steel at 950°C for an hour followed by water quenching dissolved all carbide in as-cast condition and resulted the fully austenitic on its microstructure. Carbide precipitation occurred due to the prolongation of soaking time in solid solution treatment and tempering process. The optimum hardness of sample was 53.3 HRC, which was resulted by heating this material until 1000°C for an hour, followed by water quenching and tempering at 400°C for 2 hours.

  3. Efficacy of initial antiretroviral therapy for HIV-1 infection in adults: a systematic review and meta-analysis of 114 studies with up to 144 weeks' follow-up.

    Directory of Open Access Journals (Sweden)

    Frederick J Lee

    Full Text Available BACKGROUND: A comprehensive assessment of initial HIV-1 treatment success may inform study design and treatment guidelines. METHODS: Group-based, systematic review and meta-analysis of initial antiretroviral therapy studies, in adults, of ≥ 48 weeks duration, reported through December 31, 2012. Size-weighted, intention-to-treat efficacy was calculated. Parameters of study design/eligibility, participant and treatment characteristics were abstracted. Multivariable, random effects, linear regression models with backwards, stepwise selection were then used to identify variables associated with efficacy. OUTCOME MEASURES: Antiviral efficacy (undetectable plasma viral load and premature cessation of therapy. RESULTS: 114 studies were included (216 treatment groups; 40,124 participants; mean CD4 count 248 cells/µL [SD 81]; mean HIV-1 plasma viral load log10 4.9 [SD 0.2]. Mean efficacy across all groups was 60% (SD 16 over a mean 82 weeks' follow-up (SD 38. Efficacy declined over time: 66% (SD 16 at 48 weeks, 60% (SD 16 at 96 weeks, 52% (SD 18 at 144 weeks. The most common reason for treatment cessation was participant decision (11%, SD 6.6. Efficacy was higher with 'Preferred' than 'Alternative' regimens (as defined by 2013 United States antiretroviral guidelines: 75% vs. 65%, respectively, difference 10%; 95%CI 7.6 to 15.4; p<0.001. In 98 groups (45% reporting efficacy stratified by pre-treatment viral load (< or ≥100,000 copies/mL, efficacy was greater for the lower stratum (70% vs. 62%, respectively, difference 8.4%; 95%CI 6.0 to 10.9; p<0.001. This difference persisted within 'Preferred' regimens. Greatest efficacy was associated with use of tenofovir-emtricitabine (vs. other nucleoside analogue backbones and integrase strand transfer inhibitors (vs. other third drug classes. CONCLUSION: Initial antiretroviral treatments for HIV-1 to date appear to have suboptimal long-term efficacy, but are more effective when commenced at plasma viral loads

  4. Appendix to Health and Safety Laboratory environmental quarterly, March 1, 1976--June 1, 1976. [Tabulated data on content of lead in surface air and /sup 7/Be, /sup 95/Zr, /sup 137/Cs, /sup 144/Ce, and /sup 90/Sr in surface air, milk, drinking water, and foods sampled in USA

    Energy Technology Data Exchange (ETDEWEB)

    Hardy, E.P. Jr.


    Tabulated data are presented on: the monthly deposition of /sup 89/Sr and /sup 90/Sr at some 100 world land sites; the content of lead and /sup 7/Be, /sup 95/Zr, /sup 137/Cs, and /sup 144/Ce in samples of surface air from various world sites; and the content of /sup 90/Sr in samples of milk, drinking water, and animal and human diets collected at various locations throughout the USA. (CH)

  5. Yeast Interacting Proteins Database: YGR144W, YGR144W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available mitochondrial genome stability in response to DNA damaging agents Rows with this bait as bait (1) Rows with...mitochondrial genome stability in response to DNA damaging agents Rows with this prey as prey (2) Rows with...mitochondrial genome stability in response to DNA damaging agents Rows with this bait as bait Rows with this...mitochondrial genome stability in response to DNA damaging agents Rows with this prey as prey Rows with this

  6. Contribution to the study of samarium-151 excited levels; Contribution a l'etude des niveaux excites du samarium-151

    Energy Technology Data Exchange (ETDEWEB)

    Locard, P. [Commissariat a l' Energie Atomique, Centre d' Etudes Nucleaires de Grenoble, 38 (France)


    The nucleus of {sup 151}Sm, which has 89 neutrons, happens to be on the lower edge of the deformed nuclei of region II. Therefore, the study of its levels is very interesting for the verification of the goodness of the collective models for deformed nuclei when the deformation is small (we introduce these models in the first chapter). {sup 151}Sm has often been studied, but the direct gamma spectrum measured with a lithium drift-germanium detector (chapter 3) shows many high energy transitions which did not appear in the previous level schemes. In order to settle these transitions, we have undertaken gamma-gamma coincidence spectra (as well as sum-coincidence spectra) experiments with a scintillation spectrometer designed in our laboratory (chapter 2). The investigation of the intensities of these coincidences leads us to modify the last proposed level schemes: we suppress the levels at 405,5 and 650 keV, we add levels at 245,6 - 306,6 - 522 - 952 and 962 keV. We have also verified the multipolarities of the main transitions and measured the half-lives of a few levels (chapter 3) (we find a half-life of 1.1 {+-} 0.5 nanosecond for the level at 167,7 keV). In chapter 4, we compare our results to the predictions of the models described in chapter 1. (author) [French] Le noyau de {sup 151}Sm, qui possede 89 neutrons, se trouve a la limite inferieure des noyaux deformes de la region II. L'etude de ses niveaux excites est donc d'un interet tout particulier pour la verification de la validite des differents modeles collectifs pour les noyaux deformes, lorsque la deformation est petite (nous introduisons ces modeles dans un premier chapitre). Le {sup 151}Sm a deja fait l'objet de nombreuses etudes, mais le spectre gamma direct fait avec une jonction de germanium compense au lithium (chapitre 3), nous a montre l'existence d'un grand nombre de transitions de hautes energies qui ne sont pas placees dans les schemas proposes jusqu'a ce jour. Pour preciser la place de ces transitions, nous avons donc entrepris des experiences de coincidences gamma-gamma (et de ''spectre de somme'') a l'aide d'un ensemble de spectrometrie a scintillation realise au laboratoire (chapitre 2). L'etude des intensites de ces coincidences (chapitre 3) nous amene a modifier le dernier schema propose: nous supprimons les niveaux a 405,5 et 650 keV, nous ajoutons des niveaux a 245,6 - 306,6 - 522 - 952 et 962 keV. Nous avons egalement verifie la multipolarite des principales transitions et mesure la duree de vie de certains des niveaux (chapitre 3) (nous trouvons une periode de 1,1 {+-} 0,5) nanoseconde pour le niveau a 167,7 keV). Le chapitre 4 est enfin consacre a la comparaison de nos resultats avec les predictions des differents modeles decrits au chapitre 1. (auteur)

  7. Monoclonal Antibodies, Derived from Humans Vaccinated with the RV144 HIV Vaccine Containing the HVEM Binding Domain of Herpes Simplex Virus (HSV) Glycoprotein D, Neutralize HSV Infection, Mediate Antibody-Dependent Cellular Cytotoxicity, and Protect Mice from Ocular Challenge with HSV-1. (United States)

    Wang, Kening; Tomaras, Georgia D; Jegaskanda, Sinthujan; Moody, M Anthony; Liao, Hua-Xin; Goodman, Kyle N; Berman, Phillip W; Rerks-Ngarm, Supachai; Pitisuttithum, Punnee; Nitayapan, Sorachai; Kaewkungwal, Jaranit; Haynes, Barton F; Cohen, Jeffrey I


    The RV144 HIV vaccine trial included a recombinant HIV glycoprotein 120 (gp120) construct fused to a small portion of herpes simplex virus 1 (HSV-1) glycoprotein D (gD) so that the first 40 amino acids of gp120 were replaced by the signal sequence and the first 27 amino acids of the mature form of gD. This region of gD contains most of the binding site for HVEM, an HSV receptor important for virus infection of epithelial cells and lymphocytes. RV144 induced antibodies to HIV that were partially protective against infection, as well as antibodies to HSV. We derived monoclonal antibodies (MAbs) from peripheral blood B cells of recipients of the RV144 HIV vaccine and showed that these antibodies neutralized HSV-1 infection in cells expressing HVEM, but not the other major virus receptor, nectin-1. The MAbs mediated antibody-dependent cellular cytotoxicity (ADCC), and mice that received the MAbs and were then challenged by corneal inoculation with HSV-1 had reduced eye disease, shedding, and latent infection. To our knowledge, this is the first description of MAbs derived from human recipients of a vaccine that specifically target the HVEM binding site of gD. In summary, we found that monoclonal antibodies derived from humans vaccinated with the HVEM binding domain of HSV-1 gD (i) neutralized HSV-1 infection in a cell receptor-specific manner, (ii) mediated ADCC, and (iii) reduced ocular disease in virus-infected mice. IMPORTANCE Herpes simplex virus 1 (HSV-1) causes cold sores and neonatal herpes and is a leading cause of blindness. Despite many trials, no HSV vaccine has been approved. Nectin-1 and HVEM are the two major cellular receptors for HSV. These receptors are expressed at different levels in various tissues, and the role of each receptor in HSV pathogenesis is not well understood. We derived human monoclonal antibodies from persons who received the HIV RV144 vaccine that contained the HVEM binding domain of HSV-1 gD fused to HIV gp120. These antibodies were

  8. One-step synthesis of samarium-doped ceria and its CO catalysis

    Indian Academy of Sciences (India)


    Key Laboratory for Special Functional Aggregate Materials of Education Ministry,. School of Chemistry and Chemical ... been flourishing since its excellent electric properties were discovered in the 1980s.1 At present SDC is ... absolute ethanol three times and dried in an electric oven at 60°C overnight, and then calcined at ...

  9. Trichloridotris{N-[phenyl(pyridin-2-ylmethylidene]hydroxylamine-κ2N,N′}samarium(III

    Directory of Open Access Journals (Sweden)

    Yahong Li


    Full Text Available The SmIII ion in the title compound, [SmCl3(C12H10N2O3], shows a coordination number of nine with a slightly distorted tricapped trigonal prismatic geometry based on a Cl3N6 donor set. The molecular structure is stabilized by three intramolecular O—H...Cl hydrogen bonds.

  10. Biological studies of samarium-153 bleomycin complex in human breast cancer murine xenografts for therapeutic applications

    Energy Technology Data Exchange (ETDEWEB)

    Bahrami-Samani, A. [Faculty of Nuclear Engineering and Physics, Amirkabir Univ. of Tech., Tehran (Iran); Ghannadi-Maragheh, M. [Faculty of Nuclear Engineering and Physics, Amirkabir Univ. of Tech., Tehran (Iran); Radiopharmaceutical Research and Development Lab. (RRDL), Nuclear Science and Technology Research Inst. (NSTRI), Tehran (Iran); Jalilian, A.R.; Mazidi, M. [Radiopharmaceutical Research and Development Lab. (RRDL), Nuclear Science and Technology Research Inst. (NSTRI), Tehran (Iran)


    In this work, a potential therapeutic DNA targeting agent, {sup 153}Sm-bleomycin complex ({sup 153}Sm-BLM), was developed and the tumor accumulation studies were performed using single photon emission computed tomography (SPECT) and scarification studies. {sup 153}Sm-BLM was prepared at optimized conditions (room temperature, 4-8 h, 0.1 mg bleomycin for 740-3700 MBq {sup 153}SmCl{sub 3}, radiochemical purity over 98%, HPLC, specific activity = 55 TBq/mmol). {sup 153}Sm-BLM was administered into human breast cancer murine xenografts and the biodistribution and imaging studies were performed up to 48 h. {sup 153}Sm-BLM demonstrated superior tumor accumulation properties in contrast with the other radiolabeled bleomycins with tumor:blood ratios of 41, 72 and 182 at 4, 24 and 48 h, respectively, and tumor:muscle ratios of 23, 33 and > 1490 at 4, 24 and 48 h, respectively, while administered intravenously. The SPECT images also demonstrated the obvious tumor uptake at the chest region of the breast-tumor bearing mice. These initial experiments demonstrate significant accumulation of {sup 153}Sm-BLM in tumor tissues. (orig.)

  11. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles

    CSIR Research Space (South Africa)

    Mandiwana, V


    Full Text Available .63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems...

  12. Nanostructured Samarium Doped Fluorapatites and Their Catalytic Activity towards Synthesis of 1,2,4-Triazoles

    National Research Council Canada - National Science Library

    Gangu, Kranthi Kumar; Maddila, Suresh; Maddila, Surya Narayana; Jonnalagadda, Sreekantha B


    ...) and their properties. The nanostructured Sm doped fluorapatites (Sm-FAp) were prepared by a co-precipitation method using four different amino acids, namely glutamic acid, aspartic acid, glycine and histidine...

  13. Samarium(III) picrate tetraethylene glycol complex: Photoluminescence study and active material in monolayer electroluminescent

    Energy Technology Data Exchange (ETDEWEB)

    Kusrini, Eny, E-mail: [Department of Chemical Engineering, Faculty of Engineering, Universitas Indonesia, 16424 Depok (Indonesia); Saleh, Muhammad I. [School of Chemical Sciences, Universiti Sains Malaysia, 11800 Penang (Malaysia); Yulizar, Yoki [Department of Chemistry, Faculty of Mathematics and Natural Sciences, Universitas Indonesia, 16424 Depok (Indonesia); Za' aba, Noor K.; Abd. Majid, W.H. [Solid State Research Laboratory, Department of Physics, Universiti Malaya, 50603 Kuala Lumpur (Malaysia)


    A mononuclear Sm(III) complex involving Pic and EO4 (where Pic=picrate anion and EO4=tetraethylene glycol) has been studied. It shows a bright-orange emission when used as active material in a monolayer electroluminescent device of ITO/EO4-Sm-Pic/Al. The crystal structure of the complex consists of [Sm(Pic){sub 2}(H{sub 2}O)(EO4)]{sup +} cation and [Pic]{sup -} anion. The Sm(III) ion is coordinated with nine oxygen atoms from one EO4 ligand in a pentadentate mode, two Pic anions each in bidentate and monodentate modes, and one water molecule. Both the terminal alcohol groups of the acyclic EO4 ligand were involved in the O-H...O hydrogen bonding by infinite one-dimensional (1D) chain within a symmetry direction [0 1 0]. The photoluminescence (PL) spectrum of the thin film shows the typical spectral features of the Sm(III) ion ({sup 4}G{sub 5/2}{yields}{sup 6}H{sub 7/2} transitions). The root-mean-square (rms) of the roughness of thin film is 30.605 nm and indicates that the formation of the monolayer electroluminescent device is not uniform and retains a high crystallinity. Typical semiconductor current-voltage (I-V) property was also observed in this device with threshold and turn voltages of 2.8 and 6.2 V, respectively. The [Sm(Pic){sub 2}(H{sub 2}O)(EO4)](Pic).H{sub 2}O complex can be applied as a luminescent center in OLED for bright-orange emission. - Highlights: > The [Sm(Pic){sub 2}(H{sub 2}O)(EO4)](Pic).H{sub 2}O complex is crystallized in triclinic with space group P-1. > The complex is applied as a emissive center in monolayer device structure of ITO/EO4-Sm-Pic/Al. > The photoluminescence spectrum of the crystalline and thin film shows a bright-orange emission. > The current-voltage property showed the turn on voltage of 6.2 V.

  14. Pulsed laser deposition and optical characterizations of the magnetic samarium orthoferrite

    Energy Technology Data Exchange (ETDEWEB)

    Berini, Bruno, E-mail: [Groupe d' Etude de la Matiere Condensee (GEMAC), CNRS, Universite de Versailles St. Quentin, 45, Av. des Etats-Unis, 78035 Versailles Cedex (France); Mistrik, Jan [Institute of Applied Physics and Mathematics, Faculty of Chemical Technology, University of Pardubice, Studentska 84, 532 10 Pardubice (Czech Republic); Dumont, Yves; Popova, Elena; Fouchet, Arnaud; Scola, Joseph; Keller, Niels [Groupe d' Etude de la Matiere Condensee (GEMAC), CNRS, Universite de Versailles St. Quentin, 45, Av. des Etats-Unis, 78035 Versailles Cedex (France)


    Pulsed Laser Deposition of magnetically ordered polycrystalline SmFeO{sub 3} films has been optimized onto SiO{sub 2} glass substrates as function of substrate temperature, oxygen pressure and pulsed laser fluency. Using a KrF excimer laser, crystallization temperature is found to be about 1048 K for a weak fluency of only 1.7 J cm{sup -2}. We show that this growth temperature can be reduced using higher fluency and that it is possible to obtain a film texturation along the c axis by reducing the oxygen pressure at given temperature and fluency. In a second part, we focus on the SmFeO{sub 3} optical constants determined by in situ ellipsometry using a stacking model and the Cauchy dispersion relation for SmFeO{sub 3} layer. We show a good correlation between the transmission and reflection calculated from these data and measured by ex situ spectrophotometry in the visible range.

  15. Nanostructured Samarium Doped Fluorapatites and Their Catalytic Activity towards Synthesis of 1,2,4-Triazoles

    Directory of Open Access Journals (Sweden)

    Kranthi Kumar Gangu


    Full Text Available An investigation was conducted into the influence of the amino acids as organic modifiers in the facile synthesis of metal incorporated fluorapatites (FAp and their properties. The nanostructured Sm doped fluorapatites (Sm-FAp were prepared by a co-precipitation method using four different amino acids, namely glutamic acid, aspartic acid, glycine and histidine. The materials were characterized by various techniques including X-ray diffraction (XRD, Fourier transform infra-red spectroscopy (FT-IR, field emission scanning electron microscopy (FE-SEM, energy-dispersive X-ray spectroscopy (EDX, high resolution transmission electron microscopy (HR-TEM, N2-adsorption/desorption isotherm, temperature programmed desorption (TPD and fluorescence spectrophotometry. Under similar conditions, Sm-FAp prepared using different amino acids exhibited distinctly different morphological structures, surface area and pore properties. Their activity as catalysts was assessed and Sm-FAp/Glycine displayed excellent efficiency in the synthesis of 1,2,4-triazole catalyzing the reaction between 2-nitrobenzaldehyde and thiosemicarbazide with exceptional selectivity and 98% yield in a short time interval (10 min. The study provides an insight into the role of organic modifiers as controllers of nucleation, growth and aggregation which significantly influence the nature and activity of the catalytic sites on Sm-FAp. Sm-FAp could also have potential as photoactive material.

  16. Body composition analysis by DEXA by using dynamically changing samarium filtration

    DEFF Research Database (Denmark)

    Gotfredsen, Arne; Baeksgaard, L; Hilsted, J


    , which depends on the current-absorber thickness. With this system we found a good agreement (r = 0.99) between reference and measured amounts of tissue or fat percentages in a plastic phantom and in smaller (approximately 0.5-4 kg) and larger (approximately 5-20 kg) piles of tissue (ox muscle and lard......). Scans of six healthy volunteers covered with combinations of beef and lard (approximately 5-15 kg) showed a good agreement (r = 0.99) between reference and DEXA values of added soft tissue mass and fat percentage. We conclude that the DEXA method (and, in particular, the Norland XR-36 using dynamic...

  17. Synthesis, thermal and photoluminescent properties of ZnSe- based oxyfluoride glasses doped with samarium (United States)

    Kostova, I.; Okada, G.; Pashova, T.; Tonchev, D.; Kasap, S.


    Rare earth (RE) doped glasses and glass ceramic materials have recently received considerable attention because of their potential or realized applications as X-ray intensifying screens, phosphors, detectors, waveguides, lasers etc. [1]. In this work, we present a new RE doped ZnO-ZnSe-SrF2-P2O5-B2O3-Sm2O3-SmF3 (ZSPB) glass system synthesized by melt quenching technique. The resulting glasses were visually fully transparent and stable with glass the transition temperatures around 530°C. The thermal properties of this glass system were characterized by Modulated Differential Scanning Calorimetry (MDSC) measurements before and after annealing at 650°C. We have characterized these glasses by Raman spectroscopy and photoluminescence (PL) measurements over the UV-VIS range using light emitting diodes (LED) and laser diodes (LD) excitation sources. We have also irradiated thermally treated and non-treated glass samples by X-rays and have studied the resulting PL. We discuss the results in terms of previously reported models for Sm-doped Zn-borophosphate oxide, oxyfluoride and oxyselenide glasses.

  18. Laser-Induced Luminescence Study of Samarium(III) Thiodiglycolate Complexes

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Dong Yong; Lee, Eil Hee [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Kimura, Takaumi [Japan Atomic Energy Research Institute, Ibaraki-ken (Japan)


    The hydration number of Sm(III) has been obtained by using the difference in the decay rate constants in H{sub 2}O and D{sub 2}O solutions. In general, k{sub obs}(H{sub 2}O) >> k{sub obs}(D{sub 2}O), k{sub obs}(D{sub 2}O) ≅ constant, and ligands are not as effective in causing non-radiative de-excitation of the excited state. For Sm(III), a relationship has been proposed in which the hydration number is related directly to the decay rate constant in H{sub 2}O. If there is no contribution from the ligand to the de-excitation of the luminescence excited state, the hydration of Sm(III) in the different complexes can be obtained directly from the values of k{sub obs} measured in H{sub 2}O. The number and the geometric distribution of solvent molecules around a metal ion in solution are an important factor in the structural and chemical behavior of cation. Indeed, such information has been utilized to design novel ionophores and receptors. However, there have been few studies of hydration structure for lanthanides. The fact that many f-element salts which have relatively large lattice energies are fairly soluble in water is a reflection of the strength of the interactions between the metal cations and water molecules.

  19. Oxygen Fugacity of the Martian Mantle from Pigeonite/Melt Partitioning of Samarium, Europium and Gadolinium (United States)

    Musselwhite, S.; Jones, J. H.; Shearer, C.


    This study is part of an ongoing effort to calibrate the pyroxene/melt Eu oxybarometer for conditions relevant to the martian meteorites. There is fairly good agreement between a determinations using equilibria between Fe-Ti oxides and the estimates from Eu anomalies in shergottite augites in tenns of which meteorites are more or less oxidized. The Eu calibration was for angrite composition pyroxenes which are rather extreme. However, application of a calibration for martian composition augites 113 does not significantly reduce the discrepancy between the two methods. One possible reason for this discrepancy is that augites are non-liquidus. The use of pigeonite rather than augite as the oxy-barometer phase is considered. We have conducted experiments on martian composition pigeonite/melt REE partitioning as a function of fO2.

  20. Doping controlled spin reorientation in dysprosium-samarium orthoferrite single crystals (United States)

    Cao, Shixun; Zhao, Weiyao; Kang, Baojuan; Zhang, Jincang; Ren, Wei


    As one of the most important phase transitions, spin reorientation (SR) in rare earth transition metal oxides draws much attention of emerging materials technologies. The origin of SR is the competition between different spin configurations which possess different free energy. We report the control of spin reorientation (SR) transition in perovskite rare earth orthoferrite Dy1-xSmxFeO3, a whole family of single crystals grown by optical floating zone method from x =0 to 1. Temperature dependence of the magnetizations under zero-field-cooling (ZFC) and field-cooling (FC) processes are studied. We have found a remarkable linear change of SR transition temperature in Sm-rich samples for x>0.2, which covers an extremely wide temperature range including room temperature. The a-axis magnetization curves under FCC process bifurcate from and then jump down to that of warming process (ZFC and FCW curves) in single crystals when x =0.5-0.9, suggesting complicated 4f-3d electron interactions among Dy3+-Sm3+, Dy3+-Fe3+, and Sm3+-Fe3+ sublattices of diverse magnetic configurations for materials physics and design. The magnetic properties and the doping effect on SR transition temperature in these single crystals might be useful in the spintronics device application. This work is supported by the National Key Basic Research Program of China (Grant No. 2015CB921600), and the National Natural Science Foundation of China (NSFC, Nos. 51372149, 50932003, 11274222).

  1. Synthesis, crystal structure and luminescent properties of a new samarium-fluorescein metal-organic framework (United States)

    Thomas, Jesty; Ambili, K. S.


    A new metal-organic framework with empirical formula C43H30NO12Sm was solvothermally synthesized using SmCl3, fluorescein and N, N-Dimethyl formamide (DMF) and characterized by single crystal X-ray diffraction, powder X-ray diffraction, infrared spectroscopy, UV-Visible spectroscopy, scanning electron microscopy, optical microscopy, photoluminescence spectroscopy, CHN elemental analysis and thermogravimetric analysis. Single crystal X-ray diffraction revealed that the crystal structure belongs to the triclinic system, P-1 space group with a = 12.113 (6) Å, b = 12.1734 (7) Å, c = 13.2760(8) Å, α = 67.930(3)⁰, β = 87.779(3)⁰, γ = 77.603(3)⁰ and V = 1769.71 (17) Å3. The photoluminescence spectrum showed emission peaks at 550 nm, 600 nm and 647 nm due to the characteristic transitions 4G5/2 to 6H5/2, 4G5/2 to 6H7/2 and 4G5/2 to 6H9/2 respectively, when excited at 398 nm.

  2. High-temperature heat capacity of samarium and erbium titanates with pyrochlore structure (United States)

    Denisova, L. T.; Chumilina, L. G.; Denisov, V. M.; Ryabov, V. V.


    Titanates Sm2Ti2O7 and Er2Ti2O7 with pyrochlore structure have been prepared by solid-phase synthesis in air from stoichiometric Sm2O3 (Er2O3)-TiO2 mixtures sequentially at 1673 and 1773 K. Hightemperature heat capacity of the oxide compounds has been determined by differential scanning calorimetry. Their thermodynamic properties have been calculated from experimental temperature dependence C p = f( T).

  3. pi --p Elastic Scattering at 1.44 Bev

    CERN Document Server

    Steinberger, J; Schwartz, M; Samios, Nicholas P; Leitner, Jack


    An investigation of pi -+p elastic scattering, made in a liquid propane bubble chamber, is reported. Identification of events is made on the basis of kinematics. The problem of contamination by pion scattering from protons bound in carbon is considered in some detail; it is shown that the latter requires a correction of only 4±2.5% of the total number of events. The angular distribution is presented. It shows a large diffraction peak at small angles and an approximately isotropic plateau over the backward hemisphere. The forward peak is fitted to a black-sphere diffraction pattern with a radius of (1.08±0.06) x 10-13 cm. The total elastic cross section is found to be sigma e=10.1±0.80 mb.

  4. South of Sahara | Page 144 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Selon les statistiques, 20 % des Ougandais présentent un handicap physique. Malgré tout, peu de recherches ont été menées dans le but de jeter un éclairage sur le vécu des personnes handicapées. Cette absence d'études officielles et de données concrètes fait en sorte les organismes de défense des droits des ...

  5. Dicty_cDB: VHJ144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ted Amino Acid sequence yifnlnhfflffiskklhfnnsnsy*nvwfyi*rpfsstsr*n*rwfkrpkntrwwwwww wwyfskwwcspww*RILNVVLTL...FCYNSIIIIKSNKIIIFGSSSILKKK--- ---YIFNLNHFFLFFISKKLHFNNSNSY*nvwfyi*rpfsstsr*n*rwfkrpkntrwww wwwww...plvvkdsqcsfnfillqfdnyy*snkiiilgs Frame B: yifnlnhfflffiskklhfnnsnsy*nvwfyi*rpfsstsr*n*rwfkrpkntrwwwwww wwyfs...kwwcspww*RILNVVLTLFCYNSIIIIKSNKIIIFGSSSILKKK--- ---YIFNLNHFFLFFISKKLHFNNSNSY*nvwfyi*rpfsstsr*n*rwfkrpkntrwww wwwww

  6. 40 CFR 144.52 - Establishing permit conditions. (United States)


    ... comply with the financial responsibility requirements of subpart F of this part. (8) Mechanical integrity... injection wells unless waived by the Regional Administrator. (7) Financial responsibility. (i) The permittee, including the transferor of a permit, is required to demonstrate and maintain financial responsibility and...

  7. South of Sahara | Page 144 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    This case study discusses the need for rural access to agro-meteorological forecasts and advice by establishing an early warning and agrometeorological information system. Through this project, researchers note the importance of using local knowledge in adjusting forecasts and advice to the realities of the region and ...

  8. 144 review article lassa fever: another infectious menace

    African Journals Online (AJOL)

    Dr Oboro VO

    final gene products- the nucleo protein (NP or. N) and the envelope glycol ... The virus is excreted in urine for three to nine weeks from .... 150. When Lassa fever infects pregnant women late in their third trimester, it is necessary to abort the pregnancy for the mother to have a good change of survival (20). This is because the ...

  9. 10 CFR 72.144 - Quality assurance program. (United States)


    ..., and applicant for a CoC shall take into account the need for special controls, processes, test... uniqueness of the item; (3) The need for special controls and surveillance over processes and equipment; (4... quality history and degree of standardization of the item. (d) The licensee, applicant for a license...

  10. What we do | Page 144 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Asian Partnership for Avian Influenza Research : Effectiveness of Control Measures. Highly pathogenic avian influenza (HPAI) caused by viruses of the H5N1 subtype is a major disease of poultry that affects humans at a low rate. China, Far East Asia, Thailand, Viet Nam, Central Asia, South Asia, Cambodia, Indonesia.

  11. Publications | Page 144 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Indonesia's Fires and Haze : The Cost of Catastrophe (mise à jour en 2006). De septembre à novembre 1997, les incendies qui ont fait rage en Indonésie ont rejeté suffisamment de fumée dans l'atmosphère pour recouvrir toutes les régions d'un brouillard qui a atteint le sud de la Thaïlande et les Philippines au nord, ...

  12. 34 CFR 668.144 - Application for test approval. (United States)


    ... EDUCATION, DEPARTMENT OF EDUCATION STUDENT ASSISTANCE GENERAL PROVISIONS Approval of Independently... defensible standard errors of the mean and were not disproportionately composed of any race or gender; and (B... statistically significant differences in performance; and (vii) Additional guidance on the interpretation of...

  13. 144 original article epidemiological significance of the colonization ...

    African Journals Online (AJOL)


    Knowledge of Group B Streptococcus (GBS) carriage and infections in Africa is very scanty but few cases have been reported in Nigeria in particular. Streptococcus agalactiae has been reported to cause infections and diseases in non-parturients and adults ranging from bacteremia, osteomylitis, arthritis, and endocarditis to ...

  14. 40 CFR 86.144-94 - Calculations; exhaust emissions. (United States)


    ... × (COconc/1,000,000) (4) Carbon dioxide mass: CO2mass=Vmix × DensityCO2 × (CO2conc/100) (5) Methanol mass... petroleum fuel with hydrogen to carbon ratio of 1.85:1. (C) COe= COem for methanol-fuel or natural gas-fuel...=Density of total hydrocarbon. (A) For gasoline-fuel, diesel-fuel and methanol fuel; DensityHC=16.33 g/ft3...

  15. Dicty_cDB: SFJ144 [Dicty_cDB

    Lifescience Database Archive (English)


  16. 40 CFR 144.70 - Wording of the instruments. (United States)


    ..., with a Federal Reserve bank, but the books and records of the Trustee shall at all times show that all... to hold any security in bearer form or in book entry, or to combine certificates representing such... of the Fund and all brokerage commissions incurred by the Fund shall be paid from the Fund. All other...

  17. Dicty_cDB: SSE144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 4e-77 (Q9NZK5) RecName: Full=Cat eye syndrome critical region protein ... 290 1e-76 AF190746_1( AF190746...1e-76 (Q5RC46) RecName: Full=Cat eye syndrome critical region protein ... 289 2e-76 AJ720326_1( AJ720326

  18. What we do | Page 144 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Impacts from rising sea levels, coastal flooding and storm surges are becoming a challenging policy issue for planners, local authorities and stakeholders in ... as a panacea for many of the ills afflicting society, as well as a means to improve service delivery and involve a greater percentage of the population in governance.

  19. Dicty_cDB: VSG144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ces producing significant alignments: (bits) Value VSJ115 (VSJ115Q) /CSM/VS/VSJ1-A/VSJ115Q.Seq.d/ 68 2e-11 V... 9 Homology vs DNA Score E Sequences producing significant alignments: (bits) Value

  20. 19 CFR 144.34 - Transfer to another warehouse. (United States)


    ... section is eligible to participate. (ii) The importer must have a centralized inventory control system... the port in which the applicant's centralized inventory control system exists, with copies to all... covered by the same centralized inventory control system. Only blanket exemption requests will be...

  1. 144 Food Security: Agriculture and Gender Relations in Post ...

    African Journals Online (AJOL)



    Oct 17, 2010 ... terms of resource distribution to produce food and purchasing power to buy food where it is not produced. Given women's crucial role in food production and provision, any set of strategies for sustainable food security must address their limited access to productive resources. Women's limited access to.

  2. Dicty_cDB: VFG144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 10 X02407 |X02407.1 D.discoideum mRNA for cysteine proteinase 1. 70 1e-18 3 AF250284 |AF250284.1 Amsacta moore...i entomopoxvirus, complete genome. 76 1e-10 3 U30297 |U30297.1 Amsacta moorei entomopoxvirus filament-asso

  3. Dicty_cDB: AFA144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available tial cds. 64 2e-09 2 CD450751 |CD450751.1 USDA-FP_102714 Adult Alate Brown Citrus Aphid..._100461 Adult Alate Brown Citrus Aphid Toxoptera citricida cDNA clone WHWTC-07_A07 5', mRNA sequence. 46 0.0

  4. 19 CFR 144.38 - Withdrawal for consumption. (United States)


    ... provided in § 141.61(e) of this chapter. (b) Withdrawal for exportation to Canada or Mexico. A withdrawal for exportation to Canada or Mexico or for entry into a duty-deferral program in Canada or Mexico is...) Textiles and textile products. Textiles and textile products subject to quota, visa or export license...

  5. 49 CFR 1.44 - Reservation of authority. (United States)


    ... intervene or appear before courts and administrative agencies to present the views of the Department. (e...)). (7) Authority to determine the maximum limit of age for appointment of air traffic controllers as... 5209, March 10, 1972) which are reserved to the head of the Department. (g) Procurement. Exercise of...

  6. 10 CFR 63.144 - Quality assurance program change. (United States)


    ... administrative improvements and clarifications, spelling corrections, punctuation, or editorial items, the... correct spelling, punctuation, or editorial items). (3) DOE shall maintain records of quality assurance...

  7. 30 CFR 14.4 - Application procedures and requirements. (United States)


    ... construction (number of plies, solid woven); (vii) Carcass fabric by textile type and weight (ounces per square... rationale must be included in the application. (f) Equivalent non-MSHA product safety standard. An applicant may request an equivalency determination to this part under § 6.20 of this chapter, for a non-MSHA...

  8. Cerium-144-induced lung gumors in two strains of mice

    Energy Technology Data Exchange (ETDEWEB)

    Hahn, F.F.; Griffith, W.C.


    A major problem in the extrapolation of radiation cancer risk factors from one species or population to another is the choice of the risk model to use, either absolute or relative. The purpose of this study was to compare absolute and relative risk models in predicting the lung-tumor risks between a low lung-tumor incidence strain of mice and a high-incidence strain of mice. The conclusion from this study is that absolute risk is more accurate than relative risk for predicting lung tumor risk from high to low lung-tumor incidence strains of mice.

  9. Dicty_cDB: VSI144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available (merA) gene... 49 9e-05 U75324_2( U75324 |pid:none) Cloning vector pJB3Tc20, complete sequ... 49 9e-05 AB114188_15(...c... 49 9e-05 AB027254_3( AB027254 |pid:none) Cloning vector pSB4 tetR, tetA, hy... 49 9e-05 protein

  10. Dicty_cDB: SFA144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available rerio chitobiase, di-N-acety... 111 2e-23 BC095064_1( BC095064 |pid:none) Danio rerio chitobiase, di-N-acety...BC072723_1( BC072723 |pid:none) Danio rerio chitobiase, di-N-acety... 111 2e-23 AK008791_1( AK008791 |pid:none)...107 2e-22 (Q8R242) RecName: Full=Di-N-acetylchitobiase; EC=3.2.1.... 107 2e-22 AC115592_28( AC115592 |pid:none)

  11. Dicty_cDB: VSB144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Botrytis cinerea strain T4 cDNA library under conditions of nitrogen deprivation. 72 4e-14 2 AL111854...Botrytis cinerea strain T4 cDNA library under conditions of nitrogen deprivation. 72 4e-14 2 AL111255...Botrytis cinerea strain T4 cDNA library under conditions of nitrogen deprivation. 72 5e-14 2 AL116832...Botrytis cinerea strain T4 cDNA library under conditions of nitrogen deprivation. 72 5e-14 2 AL116249...Botrytis cinerea strain T4 cDNA library under conditions of nitrogen deprivation. 72 5e-14 2 AL115920

  12. 33 CFR 144.01-25 - Ring life buoys. (United States)


    ... water light will pull free of the bracket. ... have a water light of an approved automatic electric type constructed in accordance with 46 CFR Subpart 161.010. A water light constructed in accordance with former 46 CFR Subpart 161.001 that was installed...

  13. 33 CFR 144.01-10 - Equipment for life floats. (United States)


    ... feet) nor more than 4 meters (12 feet) in length. The water light must be mounted on a bracket so that when the life float is launched, the water light will pull free of the bracket. (c) Two paddles shall... 1/2 inch in diameter. (b) Each life float must have a water light of an approved automatic electric...

  14. Dicty_cDB: VFL144 [Dicty_cDB

    Lifescience Database Archive (English)


  15. Dicty_cDB: AFJ144 [Dicty_cDB

    Lifescience Database Archive (English)


  16. Dicty_cDB: SFL144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available |pid:none) Pneumocystis carinii f. sp. carinii he... 320 5e-86 EU679414_1( EU679414 |pid:none) Tetranychus... cinnabarinus heat shoc... 318 2e-85 EU679412_1( EU679412 |pid:none) Tetranychus ci

  17. All projects related to | Page 144 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    A Rights-Based Approach to Internet Policy and Governance for the Advancement of Economic, Social, and Cultural Rights. Project. The debate on Internet freedom has intensified over the last few years as governments and civil society organizations explore policies to safeguard online civil liberties and online security.

  18. Dicty_cDB: SFC144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available protein, complete cds. 331 2e-87 1 CF644841 |CF644841.1 K26_B01 Filamentous WCFS1 complete genome; segment 9/11. 30 4.4 2 CF641582 |CF641582.1 D41_E10 Filamentous Forced Diploid Ust...ilago maydis cDNA 3', mRNA sequence. 34 4.6 2 CF643189 |CF643189.1 D60_G10 Filamentous Forced Diploid Ustila...go maydis cDNA 3', mRNA sequence. 34 4.6 2 CF643884 |CF643884.1 K13_G06 Filamentous Force

  19. What we do | Page 144 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Healthy and Sustainable Horticulture Production in the Central Andes. Horticultural production in mid-altitude Andean valleys uses substantial amounts of highly hazardous and mutagenic pesticides. North And Central America, South America. PROJECT ...

  20. Categorizing renal oncocytic neoplasms on core needle biopsy: a morphologic and immunophenotypic study of 144 cases with clinical follow-up. Alderman MA, Daignault S, Wolf JS Jr, Palapattu GS, Weizer AZ, Hafez KS, Kunju LP, Wu AJ. Hum Pathol.September 2016;55:1-10. (United States)

    Kryvenko, Oleksandr N


    There is limited literature on renal oncocytic neoplasms diagnosed on core biopsy. All renal oncocytic neoplasm core biopsies from 2006 to 2013 were, retrospectively, reviewed. Morphologic features and an immunohistochemical panel of CK7, c-KIT, and S100A1 were assessed. Concordance with resection diagnosis, statistical analysis including a random forest classification, and follow-up were recorded. The postimmunohistochemical diagnoses of 144 renal oncocytic core biopsies were favor oncocytoma (67%), favor renal cell carcinoma (RCC) (12%), and cannot exclude RCC (21%). Diagnosis was revised following immunohistochemistry in 7% of cases. The most common features for oncocytoma (excluding dense granular cytoplasm) were nested architecture, edematous stroma, binucleation and tubular architecture; the most common features for favor RCC were sheet-like architecture, nuclear pleomorphism, papillary architecture, and prominent cell borders. High nuclear grade, necrosis, extensive papillary architecture, raisinoid nuclei, and frequent mitoses were not seen in oncocytomas. Comparing the pathologist and random forest classification, the overall out-of-bag estimate of classification error dropped from 23% to 13% when favor RCC and cannot exclude RCC was combined into 1 category. Resection was performed in 19% (28 cases) with a 94% concordance (100% of favor RCC biopsies and 90% of cannot exclude RCC biopsies confirmed as RCC; 83% of favor oncocytomas confirmed); ablation in 23%; and surveillance in 46%. Follow-up was available in 92% (median follow-up, 33 months) with no adverse outcomes. Renal oncocytic neoplasms comprise a significant subset (16%) of all core biopsies, and the majority (78%) can be classified as favor oncocytoma or favor RCC. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Jaderné kolektivní stupně volnosti a Skyrme funkcionál


    Božík, Daniel


    Title: Energy functional theories in nuclear physics Author: Daniel Božík Department: Institute of Particle and Nuclear Physics of Charles University Supervisor: prof. RNDr. Jan Kvasil, DrSc. Supervisor's e-mail address: Abstract: In the present work we study the giant resonances of the chain of even-even samarium nuclei 144−154 Sm. The numerical calculations are provided by a chain of numer- ical codes. Mean field is calculated by the HFB method for the Skyrme d...

  2. Fluorescence enhancement of samarium (III) perchlorate by 1,10-phenanthroline on Phenylnaphthoylmethyl sulfoxide complex and luminescence mechanism

    Energy Technology Data Exchange (ETDEWEB)

    Li, Wen-Xian, E-mail:; Feng, Shu-Yan; Liu, Yu; Zhang, Jing; Xin, Xiao-Dong; Ao, Bo-Yang; Li, Ying-Jie


    A novel ligand, Phenylnaphthoylmethyl sulfoxide, was synthesized by a new method. Its novel binary complex, SmL{sub 5}·(ClO{sub 4}){sub 3}·2H{sub 2}O, and the ternary complex, SmL{sub 4}·L′(ClO{sub 4}){sub 3}·2H{sub 2}O, had been synthesized (using Phenylnaphthoylmethyl sulfoxide as the first ligand L, 1,10-phenanthroline as the second ligand L′). The complexes were characterized by element analysis, coordination titration, molar conductivity, IR, TG-DSC, {sup 1}HNMR and UV spectra. Their fluorescence emission mechanism, fluorescence intensities and phosphorescence spectra of the two ligands were also investigated by comparison. Fluorescent spectra illustrated that the ternary rare-earth complex presented stronger fluorescence intensity than the binary rare-earth complex in such material. The strongest characteristic fluorescence emission intensity of the ternary system was 1.81 times as strong as that of the binary system. By the analysis of fluorescence and phosphorescence spectra, it was found that the Phenylnaphthoylmethyl sulfoxide and phen had the advantage to absorb and transfer energy to Sm (III) ions effectively, and then the complexes emitted the characteristic fluorescence of Sm (III) ions. The phosphorescence spectra and fluorescence lifetime of the complexes were also measured. -- Highlights: • A novel ligand, Phenylnaphthoylmethyl sulfoxide, has been synthesized. • Its novel ternary complex and the binary complex have been synthesized. • The fluorescence emission intensity of ternary rare earth complex exhibit obvious enhancement. • The fluorescence emission mechanism and phosphorescence spectra are also investigated.

  3. Polypropylene oil as fuel for solid oxide fuel cell with samarium doped-ceria (SDC)-carbonate as electrolyte (United States)

    Syahputra, R. J. E.; Rahmawati, F.; Prameswari, A. P.; Saktian, R.


    The research focusses on converting polypropylene oil as pyrolysis product of polypropylene plastic into an electricity. The converter was a direct liquid fuel-solid oxide fuel cell (SOFC) with cerium oxide based material as electrolyte. The polypropylene vapor flowed into fuel cell, in the anode side and undergo oxidation reaction, meanwhile, the Oxygen in atmosphere reduced into oxygen ion at cathode. The fuel cell test was conducted at 400 - 600 °C. According to GC-MS analysis, the polypropylene oil consist of C8 to C27 hydrocarbon chain. The XRD analysis result shows that Na2CO3 did not change the crystal structure of SDC even increases the electrical conductivity. The maximum power density is 0.079 at 773 K. The open circuite voltage is 0.77 volt. Chemical stability test by analysing the single cell at before and after fuel cell test found that ionic migration occured during fuel cell operation. It is supported by the change of elemental composition in the point position of electrolyte and at the electrolyte-electrode interface

  4. A distribution pattern of cadmium, gadolinium and samarium in Phaseolus vulgaris (L) plants as assessed by dynamic neutron radiography (United States)

    Kőrösi, Ferenc; Balaskó, Márton; Sváb, Erzsébet


    The qualitative and semi-quantitative distributions, presumably apoplast transport patterns for the Gd, Sm and Cd were investigated in the primordial leaf tissues of the bean using dynamic neutron radiography. According to the applied 3D, 2D images and the pixel count distribution histograms of the considered gray levels, peculiar distribution patterns were postulated for the elements. Main and lateral vascular systems for Gd, the cell walls as well as intercellular spaces for Sm and the main leaf vein for Cd assumed to be the apoplast transport spaces and volumes.

  5. Ab initio calculation of the migration free energy of oxygen diffusion in pure and samarium-doped ceria (United States)

    Koettgen, Julius; Schmidt, Peter C.; Bučko, Tomáš; Martin, Manfred


    We have studied the free energy migration barriers Δ F‡ for oxygen diffusion in pure ceria and Sm-doped ceria for the temperatures 300, 700, and 1000 K. We used the density functional theory in the generalized gradient approximation and an additional Hubbard U parameter for the Ce 4 f electronic states. We compare the results for the free energy deduced from three different methods. First, a static harmonic approach is applied in which the temperature dependent vibrational contributions to energy and entropy are deduced from the phonon frequencies of supercells with a fixed volume. Second, a static quasiharmonic approach is used in which a part of the anharmonicity effect is introduced via an implicit dependence of the harmonic frequencies on the thermally expanding cell volume. Third, the free energy barriers are calculated using metadynamics and molecular dynamics in which anharmonicity effects are naturally taken into account. The three methods examined in this study lead to distinctly different results. According to the harmonic approximation, the migration free energy difference Δ F‡ increases with increasing temperature due to an increasing entropic contribution. According to the quasiharmonic approximation, the migration free energy is independent of temperature. Finally, molecular dynamics predicts a thermally induced increase in the migration free energy. We conclude that temperature dependent experimental lattice constants cancel out the increasing entropic contribution with increasing temperature in the static quasiharmonic approach. The full consideration of anharmonicity effects in the metadynamics method again leads to a temperature dependent migration free energy.

  6. Studies on the preparation and stability of samarium-153 propylene diamine tetramethylene phosphonate (PDTMP) complex as a bone seeker

    Energy Technology Data Exchange (ETDEWEB)

    Majali, M.A. E-mail:; Mathakar, A.R.; Shimpi, H.H.; Banerjee, Sharmila; Samuel, Grace


    Propylene diamine tetra methylene phosphonate (PDTMP) was synthesised by modifying a method reported for the synthesis of EDTMP. Complexation of the synthesised phosphonate ligand with {sup 153}Sm was carried out by varying the experimental parameters and the complex was radiochemically characterized. Biodistribution studies showed that the uptake by bone in rats was 2% per g of bone, which was retained up to 48 h. The uptake by other organs was insignificant, except by the liver which showed a slightly higher absorption.

  7. Crystal structure of a samarium(III nitrate chain cross-linked by a bis-carbamoylmethylphosphine oxide ligand

    Directory of Open Access Journals (Sweden)

    Julie A. Stoscup


    Full Text Available In the title compound poly[aquabis(μ-nitrato-κ4O,O′:O,O′′tetrakis(nitrato-κ2O,O′{μ4-tetraethyl [(ethane-1,2-diylbis(azanediylbis(2-oxoethane-2,1-diyl]diphosphonate-κ2O,O′}disamarium(III], [Sm2(NO36(C14H30N2O8P2(H2O]n, a 12-coordinate SmIII and a nine-coordinate SmIII cation are alternately linked via shared bis-bidentate nitrate anions into a corrugated chain extending parallel to the a axis. The nine-coordinate SmIII atom of this chain is also chelated by a bidentate, yet flexible, carbamoylmethylphoshine oxide (CMPO ligand and bears one water molecule. This water molecule is hydrogen bonded to nitrate groups bonded to the 12-coordinate SmIII cation. The CMPO ligand, which lies about an inversion center, links neighboring chains along the c axis, forming sheets parallel to the ac plane. Hydrogen bonds between the amide NH group and metal-bound nitrate anions are also present in these sheets. The sheets are packed along the b axis through only van der Waals interactions.

  8. Structure, reactivity, electronic configuration and magnetism of samarium atomic layers deposited on Si(0 0 1) by molecular beam epitaxy

    Energy Technology Data Exchange (ETDEWEB)

    Gheorghe, Nicoleta G.; Lungu, George A.; Husanu, Marius A.; Costescu, Ruxandra M.; Macovei, Dan [National Institute of Materials Physics, Atomistilor 105 b, 077125 Magurele-Ilfov (Romania); Teodorescu, Cristian M., E-mail: [National Institute of Materials Physics, Atomistilor 105 b, 077125 Magurele-Ilfov (Romania)


    The surface structure, interface reactivity, electron configuration and magnetic properties of Sm layers deposited on Si(0 0 1) at various temperatures are investigated by low-energy electron diffraction (LEED), X-ray photoelectron spectroscopy (XPS), X-ray absorption spectroscopy (XAS) and magneto-optical Kerr effect (MOKE). It is found that metal Sm is present on samples prepared at low temperature, with an interface layer containing SmSi{sub 2} and Sm{sub 4}Si{sub 3}. When samples are prepared at high temperature, much less metal Sm is found, with an increasing amount of SmSi{sub 2}. Room temperature ferromagnetism is observed for all prepared layers, with a decrease of the saturation magnetization when samples are prepared at high temperature. It is found that ferromagnetism implies mostly a compound with approximate stoichiometry Sm{sub 4}Si{sub 3}. Also, the decrease in the intensity of the XAS 2p{sub 3/2} → 3d white lines with the corresponding increasing amount of SmSi{sub 2} may be explained by assuming a higher occupancy of Sm 5d orbitals (5d{sup 2} configuration), most probably due to hybridation effects.

  9. Calculation and comparison of xenon and samarium reactivities of the HEU, LEU core in the low power research reactor. (United States)

    Dawahra, S; Khattab, K; Saba, G


    Comparative studies for the conversion of the fuel from HEU to LEU in the Miniature Neutron Source Reactor (MNSR) have been performed using the MCNP4C and GETERA codes. The precise calculations of (135)Xe and (149)Sm concentrations and reactivities were carried out and compared during the MNSR operation time and after shutdown for the existing HEU fuel (UAl4-Al, 90% enriched) and the potential LEU fuels (U3Si2-Al, U3Si-Al, U9Mo-Al, 19.75% enriched and UO2, 12.6% enriched) in this paper using the MCNP4C and GETERA codes. It was found that the (135)Xe and (149)Sm reactivities did not reach their equilibrium reactivities during the daily operating time of the reactor. The (149)Sm reactivities could be neglected compared to (135)Xe reactivities during the reactor operating time and after shutdown. The calculations for the UAl4-Al produced the highest (135)Xe reactivity in all the studied fuel group during the reactor operation (0.39 mk) and after the reactor shutdown (0.735 mk), It followed by U3Si-Al (0.34 mk, 0.653 mk), U3Si2-Al (0.33 mk, 0.634 mk), U9Mo-Al (0.3 mk, 0.568 mk) and UO2 (0.24 mk, 0.448 mk) fuels, respectively. Finally, the results showed that the UO2 was the best candidate for fuel conversion to LEU in the MNSR since it gave the lowest (135)Xe reactivity during the reactor operation and after shutdown. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Development of samarium [{sup 32}P] phosphate colloid for radiosynoviorthesis applications: Preparation, biological and preliminary clinical studies experience

    Energy Technology Data Exchange (ETDEWEB)

    Prabhakar, G. [Radiopharmaceuticals Programme, Board of Radiation and Isotope Technology (BRIT), BARC Vashi Complex, Sector-20, Navi Mumbai 400 705 (India)], E-mail:; Sachdev, Satbir S.; Umamaheswari, S.; Sivaprasad, N.; Bhatia, Manohar H. [Radiopharmaceuticals Programme, Board of Radiation and Isotope Technology (BRIT), BARC Vashi Complex, Sector-20, Navi Mumbai 400 705 (India); Chaudhari, Pradip R. [Laboratory Nuclear Medicine Services, BARC, Mumbai 400 012 (India); Solav, Srikant V. [Spect Lab, Nuclear Medicine Services, Opposite Dinanath Mangeshkar Hospital, Pune 411004 (India)


    A new therapeutic radio colloid for radiosynoviorthesis (RS) applications is reported. The method of preparation involves the reaction of SmCl{sub 3} carrier with carrier added [{sup 32}P]H{sub 3}PO{sub 4} in the presence of gelatin. The pure colloid was recovered by dialysis purification leading to radiochemical yield of around 90%. The radiochemical purity of the pure colloid formulated in isotonic saline was over 98%, for the usage period of 14 days, as assessed by paper chromatography. Ninety percent of colloid particles were in the size of 1-10 {mu}m as evident from the laser diffraction particle size analysis, ideally suitable for the intended end use. Animal studies revealed complete retention of the radio colloid in the rabbit knee joint. The results of clinical trials in humans are satisfactory and encouraging, satisfactory retention of the colloid in the knee joint and negligible leakage into the systemic circulation.

  11. Kaposi’s sarcoma in Brazilian AIDS patients: a study of 144 cases Sarcoma de Kaposi em pacientes com AIDS: estudo de 144 casos


    Birman, Esther G.; SILVEIRA, Fernando R. X.; GODOY, Luzia F.; Catalina R. COSTA


    One hundred and forty-four Brazilian AIDS patients presenting with Kaposi’s sarcoma (KS) were evaluated with respect to the frequency of oral neoplasms and their clinical features. The majority of the patients were young male adults (age range: 21-40 years old), from which 11.1 % presented with oral KS (OKS) exclusively. Oral and skin lesions were associated in 25% of the cases, while only four patients showed association between oral and visceral KS; 49.3% of the cases were exclusively derma...

  12. Kaposi’s sarcoma in Brazilian AIDS patients: a study of 144 cases Sarcoma de Kaposi em pacientes com AIDS: estudo de 144 casos

    Directory of Open Access Journals (Sweden)

    Esther G. BIRMAN


    Full Text Available One hundred and forty-four Brazilian AIDS patients presenting with Kaposi’s sarcoma (KS were evaluated with respect to the frequency of oral neoplasms and their clinical features. The majority of the patients were young male adults (age range: 21-40 years old, from which 11.1 % presented with oral KS (OKS exclusively. Oral and skin lesions were associated in 25% of the cases, while only four patients showed association between oral and visceral KS; 49.3% of the cases were exclusively dermatological. The hard palate was the main site affected, followed by the oropharynx. The localization of KS was found to be similarly frequent in the tongue, gingiva and other sites of the oral mucosa. Candidosis was the prevailing fungal disease; in 20% of the cases it was restricted to the oral mucosa and in 80% it was systemic. No high frequency of paracoccidioidomicosis and cryptococcosis was detected. The prevailing bacterial disease was Tuberculosis and there was only one case of syphilis. Among the viral diseases, the most frequently detected was herpes simplex, followed by molusco contagiosum, condiloma acuminatum and cytomegaloviroses at lower frequencies. Pneumonia caused by Pneumocystes carinii and toxoplasmosis were also identified. The authors emphasise the importance of oral examination in HIV-infected patients bearing in mind several aspects related especially to KS, and stress the need for an interdisciplinary team in the management of these patients, in order to provide better quality of life as well as rapid diagnosis and treatment.Foram estudados pacientes brasileiros portadores de SIDA apresentando sarcoma de Kaposi (SK. O perfil de idade mostrou um grupo com média de idade entre 21 e 40 anos, sendo que 11,1% da amostra apresentava SK exclusivamente na cavidade bucal, observando-se em 25% da amostra uma associação de lesões bucais e na pele. Somente quatro pacientes apresentaram associação de lesões bucais e viscerais, enquanto 49,3% eram portadores de lesões exclusivamente em pele. O palato duro foi a região intrabucal mais afetada, seguida de orofaringe, língua, gengiva entre outras localizações menos freqüentes. Doença fúngica, principalmente candidíase, foi observada exclusivamente na cavidade bucal. Paracoccidioidomicose e criptococose estavam presentes em menor escala. Doenças bacterianas foram representadas quase exclusivamente pela tuberculose, com apenas um caso de sífilis. Entre as doenças virais, herpes simples recidivante foi a mais encontrada, seguida de casos de molusco contagioso, condiloma acuminado e citomegaloviroses, em menor escala. Em relação às doenças causadas por protozoários foram identificados pneumonia por Pneumocystes carinii e toxoplasmose. É enfatizada pelos autores a necessidade de um exame bucal acurado nos portadores de SIDA, tendo em vista os vários aspectos clínicos, principalmente relacionados ao SK. Há uma necessidade de constante atuação interdisciplinar, com vistas não só à obtenção de maior qualidade de vida para esses pacientes bem como para maior rapidez no diagnóstico e tratamento.

  13. Caracterización morfológica de 144 accesiones de Tadehagi triquetrum Morphological charaterization of accessions 144 of Tadehagi triquetrum

    Directory of Open Access Journals (Sweden)

    Carlos Augusto Martínez Mamián


    Full Text Available Se realizó la caracterización morfológica de 114 accesiones de Tadehagi triquetrum provenientes de Tailandia, Vietnam, China, Indonesia y Papúa Nueva Guinea. Dicho material vegetal hace parte del banco de germoplasma del programa de forrajes del Centro Internacional de Agricultura Tropical (CIAT. Estas accesiones se utilizan en alimentación animal e inicialmente fueron sembradas en el invernadero del programa de forrajes del CIAT Palmira y después de 8 semanas se trasplantaron al sitio definitivo en los terrenos de la subestación experimental del CIAT Santander de Quilichao. Cada accesión fue sembrada en una hilera de tres plantas, a las cuales se les realizó descripciones cualitativas y cuantitativas de cada uno de los órganos de la planta (hojas, tallo, inflorescencia, flor, fruto y semilla. Se observaron tres tipos de hojas según la forma; oblongas, ovadas y entre oblongas y ovadas. También se hallaron tres tipos de hábito de crecimiento; erecto, ascendente y postrado. Además se encontró que la especie presenta hojas compuestas, pinnadas con terminación aguda, y peciolo alado, tallos con ramas simpondiales no leñosas, de crecimiento herbáceo, con inflorescencias de tipo racimosas simples axiales y terminales, flores completas con los cuatro verticilos, hermafroditas, de estambres cognados diadelfos y con un promedio de diez estambres por flor, los frutos son legumbres dehiscentes con un promedio de 4 semillas por vaina que se caracterizan por ser tridimensionales con un peso promedio de 0,37 g por 100 semillas.Morphological characterization was performed of 114 accessions of Tadehagi triquetrum from Thailand, Vietnam, China, Indonesia and Papua New Guinea. The plant material is part of genebank fodder program of the International Center for Tropical Agriculture (CIAT. These accessions are used in animal feed and initially were sown in the greenhouse of CIAT forage program Palmira and after 8 weeks were transplanted to the final location on the grounds of the CIAT experimental substation Santander de Quilichao. Each accession was planted in a row of three plants, which were subjected to qualitative and quantitative descriptions of each of the organs of the plant (leaves, stem, inflorescence, flower, fruit and seed. During the morphological description of the accessions were three types of leaves in the form, oblong, ovate and oblong, ovate between. There were also three types of growth habit, erect, ascending and prostrate. It was also found that the species Tadehagi triquetrum has compound leaves, pinnate with acute termination and winged petioles, stems with no branches simpondiales growing woody herb with simple racemose type inflorescences axial and terminal, complete with four flower whorls, hermaphrodites, stamens diadelphous cognates with an average of 10 per flower, the fruits are dehiscent legumes with an average of 4 seeds per pod which are characterized by three-dimensional with an average weight of 0.37 g per 100 seeds.

  14. Atomistic simulations of anionic Au-144(SR)(60) nanoparticles interacting with asymmetric model lipid membranes

    DEFF Research Database (Denmark)

    Heikkila, E.; Martinez-Seara, H.; Gurtovenko, A. A.


    , it forms relatively weak contacts with the zwitterionic head groups (in particular choline) of the phosphatidylcholine lipids. Consequently, AuNP- does not immerse deeply in the leaflet, enabling, e.g., lateral diffusion of the nanoparticle along the surface. On the cytosolic side, AuNP- remains...

  15. 40 CFR 421.144 - Standards of performance for new sources. (United States)


    ... 40 Protection of Environment 28 2010-07-01 2010-07-01 true Standards of performance for new... monthly average mg/kg (pounds per million pounds) of antimony contained in sodium antimonate product... (1) (1) 1 Within the range of 7.5 to 10.0 at all times. (b) Fouled Anolyte. NSPS for the Primary...

  16. Page 1 144 M S Raghunathan and A Ramanathan Proof. The ...

    Indian Academy of Sciences (India)

    trivialisation extending A, x T- H. The point in this is that the torus Twhich a priori k sits in T gets identified as a subtorus of G by evaluation at xo and the morphism of tori. Int #:T-S, when Tand S are considered as subtori of G coincides with the restriction of the inner automorphism Intºſ(x0) of G. This completes the proof of ...

  17. 76 FR 144 - Agency Information Collection Activities; Submission for OMB Review; Comment Request; Extension (United States)


    ... requirements described below has been submitted to the Office of Management and Budget (``OMB'') for review, as... requiring used car dealers to disclose information about warranty coverage, if any, and the mechanical... information about warranty coverage. Request for Comments Under the Paperwork Reduction Act (``PRA''), 44 U.S...

  18. 40 CFR 144.61 - Definitions of terms as used in this subpart. (United States)


    ... capital means current assets minus current liabilities. Net worth means total assets minus total... after deducting liabilities; such assets would not include intangibles such as goodwill and rights to...

  19. 28 CFR 14.4 - Administrative claims; evidence and information to be submitted. (United States)


    ... last employment or occupation. (3) Full names, addresses, birth dates, kinship, and marital status of... and suffering prior to death are claimed, a physician's detailed statement specifying the injuries... condition in the interval between injury and death. (8) Any other evidence or information which may have a...

  20. 17 CFR 230.144A - Private resales of securities to institutions. (United States)


    ... participations; repurchase agreements; securities owned but subject to a repurchase agreement; and currency, interest rate and commodity swaps. (3) The aggregate value of securities owned and invested on a...

  1. Timing Results Using an FPGA-Based TDC with Large Arrays of 144 SiPMs (United States)

    Aguilar, A.; González, A. J.; Torres, J.; García-Olcina, R.; Martos, J.; Soret, J.; Conde, P.; Hernández, L.; Sánchez, F.; Benlloch, J. M.


    Silicon photomultipliers (SiPMs) have become an alternative to traditional tubes due to several features. However, their implementation to form large arrays is still a challenge especially due to their relatively high intrinsic noise, depending on the chosen readout. In this contribution, two modules composed of 12 ×12 SiPMs with an area of roughly 50 mm×50 mm are used in coincidence. Coincidence resolving time (CRT) results with a field-programmable gate array, in combination with a time to digital converter, are shown as a function of both the sensor bias voltage and the digitizer threshold. The dependence of the CRT on the sensor matrix temperature, the amount of SiPM active area and the crystal type is also analyzed. Measurements carried out with a crystal array of 2 mm pixel size and 10 mm height have shown time resolutions for the entire 288 SiPM two-detector set-up as good as 800 ps full width at half maximum (FWHM).

  2. 40 CFR 144.86 - What are the definitions I need to know? (United States)


    ... approval a program that sets out how States will conduct local assessments, including: delineating the... Protection Program, States will begin to conduct local assessments for each public water system in their..., hospitals or nursing homes, office buildings, and other facilities. (f) Delineation. Once a State's Drinking...

  3. 49 CFR 173.144 - Other Regulated Materials (ORM)-Definitions. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Other Regulated Materials (ORM)-Definitions. 173... Materials (ORM)—Definitions. For the purpose of this subchapter, “ORM-D material” means a material such as a... which exceptions are provided in the § 172.101 table. Each ORM-D material and category of ORM-D material...

  4. 27 CFR 478.144 - Relief from disabilities under the Act. (United States)


    ..., TOBACCO, FIREARMS, AND EXPLOSIVES, DEPARTMENT OF JUSTICE FIREARMS AND AMMUNITION COMMERCE IN FIREARMS AND... record (Department of Defense Form 214), charge sheet (Department of Defense Form 458), and final court...

  5. Page 1 144 K. KonDAL REDDY AND N. V. SUBBA RAO N-benzyl ...

    Indian Academy of Sciences (India)

    In 5 (or 6)-nitro benzimidazoles, the electronegative nitro group should stabilise the ... reduced. And the tautomer (Ia) to the extent present, decidedly being more reactive ... N-methyl-2, 5-dinitro aniline-2, 5-dinitro aniline (10 g. with methyl ...

  6. 25 CFR 170.144 - What are eligible highway safety projects? (United States)


    ..., defensive driving, and Mothers Against Drunk Drivers; (h) Development of a highway safety plan designed to reduce traffic accidents and deaths, injuries, and property damage; (i) Collecting data on traffic-related deaths, injuries and accidents; (j) Impaired driver initiatives; (k) Child safety seat programs...

  7. 40 CFR 144.63 - Financial assurance for plugging and abandonment. (United States)


    ... and abandonment expenditures by submitting itemized bills to the Regional Administrator. Within 60 days after receiving bills for plugging and abandonment activities, the Regional Administrator will...) Notices of nonpayment as required by the trust agreement. (4) The bond must guarantee that the owner or...

  8. 40 CFR 98.144 - Monitoring and QA/QC requirements. (United States)


    ... testing method published by an industry consensus standards organization (e.g., ASTM, ASME, API, etc.). ... certified laboratory using ASTM D3682-01 (Reapproved 2006) Standard Test Method for Major and Minor Elements...

  9. Yeast Interacting Proteins Database: YMR032W, YER144C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available required for cytokinesis; regulates actomyosin ring dynamics and septin localization; interacts with the formins...required for cytokinesis; regulates actomyosin ring dynamics and septin localization; interacts with the formins

  10. Yeast Interacting Proteins Database: YER144C, YMR032W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available required for cytokinesis; regulates actomyosin ring dynamics and septin localization; interacts with the formins...required for cytokinesis; regulates actomyosin ring dynamics and septin localization; interacts with the formins

  11. 87Sr/ 86Sr, 143Nd/ 144Nd and REEs in Silurian phosphatic fossils (United States)

    Bertram, C. J.; Elderfield, H.; Aldridge, R. J.; Conway Morris, S.


    The feasibility of using the chemistry of phosphatic fossil material to trace palaeo-seawater composition for the Silurian has been evaluated. Contrary to Recent material, fossil fish are shown to be unreliable for Sr isotope stratigraphy. Conodonts, however, may be used by employing 0.2M HNO 3 dissolution, except for samples showing degrees of thermal maturation greater than colour alteration index (CAI) values of 2.5. Samples from the same stratigraphic levels from the U.K., Czechoslovakia, Gotland and the U.S.A. gave similar 87Sr/ 86Sr ratios, suggesting that they have recorded the original seawater value. Significant inter-specific differences occur in REE concentrations and Nd isotopic compositions of conodont elements, and Ce and Eu anomalies vary with REE content. This suggests that artefacts are introduced at the same time that large amounts of REEs are incorporated into the apatite. Preliminary results for the Sr isotopic composition of Silurian seawater are presented. Values are generally lower than previously suggested, showing an increase in 87Sr/ 86Sr from ˜ 0.70825 at 435 Ma rising to ˜ 0.70875 at 418 Ma and levelling off in the Late Silurian. The overall rate of increase in seawater ratio is about2-3 × 10 -5 Ma -1 and can be accounted for by the widespread decrease in volcanism compared with the Ordovician; a proportionally greater flux of Sr to the oceans from continental erosion of only ˜ 10% would account for the long-term increase in seawater 87Sr/ 86Sr ratio throughout the Silurian.

  12. The assessment of REE patterns and 143Nd/ 144Nd ratios in fish remains (United States)

    Grandjean, Patricia; Cappetta, Henri; Michard, Annie; Albarède, Francis


    The REE content and isotopic composition of Sr and Nd have been determined in fish teeth ranging in age from the Trias to the present and from various localities mostly around the Atlantic. These measurements have been carried out on Selachian and Teleost remains from the same locality in Togo and show no appreciable difference, which suggests, with the help of a mass balance calculation of the Ce anomaly, that diagenetic effects are not responsible for the REE enrichment of biogenic phosphates. One group of fossil teeth has about 3 times the REE abundances of shale and a shale-normalized pattern with a minimum at Sm: it is thought to reflect deposition in the open-sea environment. A second group has REE concentration about 10 times higher than the first group with either a regular light REE enrichment or, more frequently, a maximum in the middle REE, both being probably indicative of deposition in estuarine or near-shore conditions. The shape of the REE spectra and the size of the Ce anomaly can be used semi-quantitatively to determine the depth of deposition. The results presented here on Late Cretaceous/Eocene fish teeth samples from Morocco reflect an increasing influx of deep waters with a lowLa/Yb ratio and strong negative Ce anomaly, which agrees well with the evolution of sediment chemistry and microfauna associations. In contrast, ɛ Nd is typical of the water mass in which the fish debris decayed. Examples of nearly isolated basins identified with Nd isotopes include the South Atlantic prior to the Lutetian (ɛ Nd ≈ -13.5), the Miocene Persian Gulf (ɛ Nd = -3.1), and Bolivia during the Late Cretaceous (ɛ Nd = -12.8). Togo and Guinea-Bissau results suggest that, in the South Atlantic, the meridional oceanic circulation had not started before 45 Ma ago. Combination of REE andɛ Nd data suggests that the assignment of Jurassic-Cretaceous samples measured so far to open-sea water masses is still ambiguous.

  13. Yeast Interacting Proteins Database: YGR113W, YIL144W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available indle checkpoint activity, kinetochore assembly and clustering Rows with this prey as prey (2) Rows with thi...heckpoint activity, kinetochore assembly and clustering Rows with this prey as pr

  14. Yeast Interacting Proteins Database: YOL069W, YIL144W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available complex (Ndc80p-Nuf2p-Spc24p-Spc25p); involved in chromosome segregation, spindle checkpoint activity and kinetochore clustering...vity, kinetochore assembly and clustering Rows with this prey as prey (2) Rows with this prey as bait (0) 12...-Nuf2p-Spc24p-Spc25p); involved in chromosome segregation, spindle checkpoint activity and kinetochore clustering...d coiled-coil protein involved in chromosome segregation, spindle checkpoint activity, kinetochore assembly and clustering

  15. SU-F-J-144: Scatter and Leakage Survey of An Integrated MR-Linac System

    Energy Technology Data Exchange (ETDEWEB)

    Wang, J; Bosco, G; Darenbourg, B; Ibbott, G [UT MD Anderson Cancer Center, Houston, TX (United States)


    Purpose: To assess the scatter and leakage radiation of an integrated 1.5T MRI-Linac system. Methods: A 150cc chamber (model 96020C, Inovision) was used in all the scatter and leakage measurements, after being recalibrated for MV energy by the Accredited Dosimetry Calibration Laboratory at MD Anderson. The scatter radiation was measured by placing a 25 cm stack of solid-water materials at iso-center on the patient couch to simulate patient scatter. Gantry angles were positioned at 0 degree (beam pointing downward) and 270 (beam pointing laterally). Scatter radiation was measured at selective locations inside the RF room. Beam stopper leakage was measured at the exterior panel of the gantry. The head leakage was measured at 1 meter away from the Linac head in the direction which was determined to be the area of maximum leakage by wrapped films test. All measurements were repeated with the 1.5T magnetic field turned off to study the effect of magnetic field. Results: When the magnet was on (B=1.5T), the maximum head leakage at 1 meter was 191.6mR/1000MU. The scatter radiation at 1 meter from the iso-center was 1.091R/1000MU when the radiation beam was pointing downward, 1.296R/1000MU when the beam pointed laterally. The beam stopper leakage was measured as 299.4 mR/1000MU at the exterior panel of the gantry. When magnet was off (B=0), the head leakage was measured as 198.6mR/1000MU. The scatter radiation at 1 meter was 1.153R/1000MU when beam pointed downward, 1.287R/1000MU when beam pointed laterally. The beam stopper leakage was measured as 309.4 mR/1000MU at the exterior panel of the gantry. Conclusion: The measurements indicate that the scatter and leakage radiation from the integrated MR-Linac system are in-line with the expected values. The beam stopper leakage is approximately 300 mR/1000MU. The leakage and scatter difference with the magnetic field ON and OFF was within 5%. The authors received a corporate sponsored grant from Elekta which is the vendor of the MR-Linac system studied in this work.

  16. Insight into 144 patients with ocular vascular events during VEGF antagonist injections


    Shami M; Parodi MB; Mansour AM; Kofoed PK; Shahin M; Schwartz SG


    Ahmad M Mansour1, Maha Shahin2, Peter K Kofoed3, Maurizio B Parodi4, Michel Shami5, Stephen G Schwartz6, Collaborative Anti-VEGF Ocular Vascular Complications GroupDepartment of Ophthalmology, 1American University of Beirut, Beirut, Lebanon, Rafic Hariri University Hospital, Beirut, Lebanon; 2Mansoura University, Mansoura City, Egypt; 3Glostrup Hospital, University of Copenhagen, Denmark, National Eye Clinic, Kennedy Center, Glostrup, Denmark; 4University Vita-Salute, Scientific Institute San...

  17. SU-F-T-144: Analytical Closed Form Approximation for Carbon Ion Bragg Curves in Water

    Energy Technology Data Exchange (ETDEWEB)

    Tuomanen, S; Moskvin, V; Farr, J [St. Jude Children’s Research Hospital, Memphis, TN (United States)


    Purpose: Semi-empirical modeling is a powerful computational method in radiation dosimetry. A set of approximations exist for proton ion depth dose distribution (DDD) in water. However, the modeling is more complicated for carbon ions due to fragmentation. This study addresses this by providing and evaluating a new methodology for DDD modeling of carbon ions in water. Methods: The FLUKA, Monte Carlo (MC) general-purpose transport code was used for simulation of carbon DDDs for energies of 100–400 MeV in water as reference data model benchmarking. Based on Thomas Bortfeld’s closed form equation approximating proton Bragg Curves as a basis, we derived the critical constants for a beam of Carbon ions by applying models of radiation transport by Lee et. al. and Geiger to our simulated Carbon curves. We hypothesized that including a new exponential (κ) residual distance parameter to Bortfeld’s fluence reduction relation would improve DDD modeling for carbon ions. We are introducing an additional term to be added to Bortfeld’s equation to describe fragmentation tail. This term accounts for the pre-peak dose from nuclear fragments (NF). In the post peak region, the NF transport will be treated as new beams utilizing the Glauber model for interaction cross sections and the Abrasion- Ablation fragmentation model. Results: The carbon beam specific constants in the developed model were determined to be : p= 1.75, β=0.008 cm-1, γ=0.6, α=0.0007 cm MeV, σmono=0.08, and the new exponential parameter κ=0.55. This produced a close match for the plateau part of the curve (max deviation 6.37%). Conclusion: The derived semi-empirical model provides an accurate approximation of the MC simulated clinical carbon DDDs. This is the first direct semi-empirical simulation for the dosimetry of therapeutic carbon ions. The accurate modeling of the NF tail in the carbon DDD will provide key insight into distal edge dose deposition formation.

  18. Anexos PID 16/17_144_Santamaría et al.


    Santamaría Ciordia, Leticia



  19. 40 CFR 144.39 - Modification or revocation and reisssuance of permits. (United States)


    ... determines good cause exists for modification of a compliance schedule, such as an act of God, strike, flood... causes listed in paragraphs (a) and (b) of this section for modification or revocation and reissuance or both exist. If cause exists, the Director may modify or revoke and reissue the permit accordingly...

  20. 46 CFR 502.144 - Notice of time and place of hearing; postponement of hearing. (United States)


    ... 46 Shipping 9 2010-10-01 2010-10-01 false Notice of time and place of hearing; postponement of... and place of hearing; postponement of hearing. (a) Notice of hearing will designate the time and place..., or electronic mail. (b) Motions for postponement of any hearing date shall be filed in accordance...

  1. Measurement Instruments for Assessing the Performance of Professional Learning Communities. REL 2016-144 (United States)

    Blitz, Cynthia L.; Schulman, Rebecca


    For more than a decade education practitioners have promoted the professional learning community (PLC) as an effective way to provide professional development to teachers. As more PLCs are established in schools and districts nationwide, education stakeholders--researchers, practitioners, administrators, and policymakers--are interested in…

  2. Caracterización morfológica de 144 accesiones de Tadehagi triquetrum

    Directory of Open Access Journals (Sweden)

    Martínez Mamián Carlos Augusto


    Full Text Available

    Se realizó la caracterización morfológica de 114 accesiones de Tadehagi triquetrum provenientes de Tailandia, Vietnam, China, Indonesia y Papúa Nueva Guinea. Dicho material vegetal hace parte del banco de germoplasma del programa de forrajes del Centro Internacional de Agricultura Tropical (CIAT. Estas accesiones se utilizan en alimentación animal e inicialmente fueron sembradas en el invernadero del programa de forrajes del CIAT Palmira y después de 8 semanas se trasplantaron al sitio definitivo en los terrenos de la subestación experimental del CIAT Santander de Quilichao. Cada accesión fue sembrada en una hilera de tres plantas, a las cuales se les realizó descripciones cualitativas y cuantitativas de cada uno de los órganos de la planta (hojas, tallo, inflorescencia, flor, fruto y semilla.

    Se observaron tres tipos de hojas según la forma; oblongas, ovadas y entre oblongas y ovadas. También se hallaron tres tipos de hábito de crecimiento; erecto, ascendente y postrado. Además se encontró que la especie presenta hojas compuestas, pinnadas con terminación aguda, y peciolo alado, tallos con ramas simpondiales no leñosas, de crecimiento herbáceo, con inflorescencias de tipo racimosas simples axiales y terminales, flores completas con los cuatro verticilos, hermafroditas, de estambres cognados diadelfos y con un promedio de diez estambres por flor, los frutos son legumbres dehiscentes con un promedio de 4 semillas por vaina que se caracterizan por ser tridimensionales con un peso promedio de 0,37 g por 100 semillas.

  3. Caracterización morfológica de 144 accesiones de Tadehagi triquetrum

    Directory of Open Access Journals (Sweden)

    Carlos Augusto Martínez Mamián


    Full Text Available Se realizó la caracterización morfológica de 114 accesiones de Tadehagi triquetrum provenientes de Tailandia, Vietnam, China, Indonesia y Papúa Nueva Guinea. Dicho material vegetal hace parte del banco de germoplasma del programa de forrajes del Centro Internacional de Agricultura Tropical (CIAT. Estas accesiones se utilizan en alimentación animal e inicialmente fueron sembradas en el invernadero del programa de forrajes del CIAT Palmira y después de 8 semanas se trasplantaron al sitio definitivo en los terrenos de la subestación experimental del CIAT Santander de Quilichao. Cada accesión fue sembrada en una hilera de tres plantas, a las cuales se les realizó descripciones cualitativas y cuantitativas de cada uno de los órganos de la planta (hojas, tallo, inflorescencia, flor, fruto y semilla. Se observaron tres tipos de hojas según la forma; oblongas, ovadas y entre oblongas y ovadas. También se hallaron tres tipos de hábito de crecimiento; erecto, ascendente y postrado. Además se encontró que la especie presenta hojas compuestas, pinnadas con terminación aguda, y peciolo alado, tallos con ramas simpondiales no leñosas, de crecimiento herbáceo, con inflorescencias de tipo racimosas simples axiales y terminales, flores completas con los cuatro verticilos, hermafroditas, de estambres cognados diadelfos y con un promedio de diez estambres por flor, los frutos son legumbres dehiscentes con un promedio de 4 semillas por vaina que se caracterizan por ser tridimensionales con un peso promedio de 0,37 g por 100 semillas.

  4. 40 CFR 144.28 - Requirements for Class I, II, and III wells authorized by rule. (United States)


    ...; (iii) External pressure, internal pressure, and axial loading; (iv) Hole size; (v) Size and grade of... proposed test or measurement to be made; (D) The amount, size, and location (by depth) of casing to be left... casing and cementing requirements, the following factors shall be considered: (i) Depth to the injection...

  5. 40 CFR 144.89 - How do I close my Class V injection well? (United States)


    ... history and records showing proper waste disposal. The use of a semi-permanent plug as the means to... cesspool or motor vehicle waste disposal well, you must plug or otherwise close the well in a manner that...) of a motor vehicle waste disposal well to another type of Class V well. Motor vehicle wells may only...

  6. Page 1 144 V V Karisovnik et all links make a major contribution to ...

    Indian Academy of Sciences (India)

    links make a major contribution to the SQUID output noise. To improve the quality of ceramics, other methods of weak link preparation are required. This paper presents the results of our work on making If. HTSC SQUIDs and. SQUID-based magnetometers. 2. Weak link formation by scribing. Our first HTSC rif.

  7. Review: Diario de campo. Izquierdo Chaparro, R. (2013. Madrid: Caballo de Troya. 144 pp.

    Directory of Open Access Journals (Sweden)

    Soledad García Gómez


    Full Text Available The draft of a qualitative research report is the product of a hard and exciting task that involves a rigorous analysis of data  collected applying such techniques as the interview. To give sense to the textual data collected or to let the meanings of the data arise is a challenge, from the point of view of the scientific community that holds an interpretative or critical research paradigm. The later writing of the final report is also an important task because it will be the testimony or witness of the work done and of all the findings.

  8. 20 CFR 220.144 - Evaluation guides for a self-employed claimant. (United States)


    ... performed in making managerial decisions about the production of the crop, such as when to plant, cultivate... hours, skills, energy output, efficency, duties, and responsibilities, is comparable to that of... the claimant materially participates in the production or the management of the production of the...

  9. 14.4 ‘Innovation for speech language pathology’ - a new educational seminar


    Kogovšek, Damjana; Umanski, Daniil


    ‘Innovation for SLP’ is a semester-long educational seminar we have recently developed for advanced speech language pathology (SLP) students in Slovenia. The seminar is designed to provide students with tools for creative problem solving in their future professional environment.

  10. Tetrakis(μ-propanoato-κ2O:O′bis[(1,10-phenanthroline-κ2N,N′(propanoato-κ2O,O′samarium(III

    Directory of Open Access Journals (Sweden)

    Chun-Xiang Wang


    Full Text Available The title complex, [Sm2(C3H5O26(C12H8N22], is a dinuclear centrosymmetric molecule, in which two crystallographically equivalent Sm atoms, separated by 3.9502 (2 Å, are bridged by four propanoate anions. Each Sm atom is coordinated by two N atoms from one chelating phenanthroline ligand and seven carboxylate O atoms from five propanoate anions, to form a distorted tricapped trigonal prism.

  11. Processing of composites based on NiO, samarium-doped ceria and carbonates (NiO-SDCC as anode support for solid oxide fuel cells

    Directory of Open Access Journals (Sweden)

    Lily Siong Mahmud


    Full Text Available NiO-SDCC composites consisting of NiO mixed with Sm-doped ceria (SDC and carbonates (Li2CO3 and Na2CO3 were sintered at different temperatures and reduced at 550 °C. The influence of reduction on structure of the NiO-SDCC anode support for solid oxide fuel cells (SOFCs was investigated. Raman spectra of the NiO-SDCC samples sintered at 500, 600 and 700 °C showed that after reducing at 550 °C NiO was reduced to Ni. In addition, SDC and carbonates (Li2CO3 and Na2CO3 did not undergo chemical transformation after reduction and were still detected in the samples. However, no Raman modes of carbonates were identified in the NiO-SDCC pellet sintered at 1000 °C and reduced at 550 °C. It is suspected that carbonates were decomposed at high sintering temperature and eliminated due to the reaction between the CO32– and hydrogen ions during reduction in humidified gases at 550 °C. The carbonate decomposition increased porosity in the Ni-SDCC pellets and consequently caused formation of brittle and fragile structure unappropriated for SOFC application. Because of that composite NiO-SDC samples without carbonates were also analysed to determine the factors affecting the crack formation. In addition, it was shown that the different reduction temperatures also influenced the microstructure and porosity of the pellets. Thus, it was observed that Ni-SDC pellet reduced at 800 °C has higher electrical conductivity of well-connected microstructures and sufficient porosity than the pellet reduced at 550 °C.

  12. The single cell of low temperature solid oxide fuel cell with sodium carbonate-SDC (samarium-doped ceria) as electrolyte and biodiesel as fuel (United States)

    Rahmawati, F.; Nuryanto, A.; Nugrahaningtyas, K. D.


    In this research NSDC (composite of Na2CO3-SDC) was prepared by the sol-gel method to produce NSDC1 and also by the ceramic method to produce NSDC2. The prepared NSDC then were analyzed by XRD embedded with Le Bail refinement to study the change of characteristic peaks, their crystal structure, and their cell parameters. Meanwhile, the measurement of impedance was conducted to study the electrical conductivity of the prepared materials. A single cell was prepared by coating NSDC-L (a composite of NSDC with Li0.2Ni0.7Cu0.1O2) on both surfaces of NSDC. The NSDC-L was used as anode and cathode. The ionic conductivity of NSDC1 and NSDC2 at 400 oC are 4.1109 x 10-2 and 1.6231 x 10-2, respectively. Both electrolytes have ionic conductivity higher than 1 x 10-4, therefore, can be categorized as good electrolyte [1]. However, the NSDC1 shows electrodeelectrolyte conduction. It indicates the existence of electronic migration from electrolyte- electrode or vice versa. Those may cause a short circuit during fuel cell operation and will reduce the fuel cell performance fastly. The single cell tests were conducted at 300, 400, 500 and 600 °C. The single fuel cell with NSDC1 and NSDC2 as electrolyte show maximum power density at 400 °C with the power density of 3.736 x 10-2 and 2.245 x 10-2, respectively.

  13. Anthropogenic dissolved and colloid/nanoparticle-bound samarium, lanthanum and gadolinium in the Rhine River and the impending destruction of the natural rare earth element distribution in rivers (United States)

    Kulaksız, Serkan; Bau, Michael


    The strong increase in the consumption of rare earth elements (REE) in high-tech products and processes is accompanied by increasing amounts of REE released into the environment. Following the first report of Gd contamination of the hydrosphere in 1996, anthropogenic Gd originating from contrast agents has now been reported worldwide from river and estuarine waters, coastal seawater, groundwater and tap water. Recently, microcontamination with La, that is derived from a point source where catalysts for petroleum refining are produced, has been detected in the Rhine River in Germany and the Netherlands. Here we report the occurrence of yet another REE microcontamination of river water: in addition to anthropogenic Gd and La, the Rhine River now also shows significant amounts of anthropogenic Sm. The anthropogenic Sm, which enters the Rhine River north of Worms, Germany, with the same industrial wastewater that carries the anthropogenic La, can be traced through the Middle and Lower Rhine to the Netherlands. At Leverkusen, Germany, some 250 km downstream from the point source at Worms, anthropogenic Sm still contributes up to 87% of the total dissolved Sm concentration of the Rhine River. Results from ultrafiltration suggest that while the anthropogenic Gd is not particle-reactive and hence exclusively present in the truly dissolved REE pool (Worms get close to and well-above, respectively, the levels at which ecotoxicological effects have been documented. Because of the increasing use of REE and other formerly "exotic" trace elements in high-tech applications, these critical metals have now become emerging contaminants that should be monitored, and it appears that studies of their biogeochemical behavior in natural freshwaters might soon no longer be possible.

  14. Ultra-Sensitive Nano Optical Sensor Samarium-Doxycycline Doped in Sol Gel Matrix for Assessment of Glucose Oxidase Activity in Diabetics Disease. (United States)

    Tharwat, Marwa M; Attia, M S; Alghamdi, M S; Mahros, Amr M


    A low cost and very sensitive method for the determination of the activity of glucose oxidase enzyme in different diabetics serum samples was developed. The method based on the assessment of the H2O2 concentration produced from the reaction of the glucose oxidase (GOx) enzyme with glucose as substrate in the serum of diabetics patients by nano optical sensor Sm-doxycycline doped in sol gel matrix. H2O2 enhances the luminescence intensity of all bands of the nano Sm-doxycycline complex [Sm-(DC)2](+) doped in sol-gel matrix, especially the 645 nm band at λex = 400 nm and pH 7.0 in water. The influence of the different analytical parameters that affect the luminescence intensity of the nano optical sensor, e.g. pH, H2O2 concentration and foreign ions concentrations were studied. The remarkable enhancement of the luminescence intensity of nano optical sensor [Sm-(DC)2](+) complex in water at 645 nm by the addition of various concentrations of H2O2 was successfully used as an optical sensor for the assessment of the activity of the glucose oxidase enzyme in different diabetics serum samples. The calibration plot was achieved over the activity range 0.1-240 U/L with a correlation coefficient of 0.999 and a detection limit of 0.05 U/L.

  15. Effect of Mg doping and sintering temperature on structural and morphological properties of samarium-doped ceria for IT-SOFC electrolyte (United States)

    Ahmad, Syed Ismail; Mohammed, Tasneem; Bahafi, Amal; Suresh, Madireddy Buchi


    Samples of Sm and Mg co-doped ceria electrolyte of Ce1- x Sm x- y Mg y O2- δ ( x = 0.2; y = 0.00, 0.05, 0.1, 0.15, and 0.175) were synthesized by sol-gel process. The prepared samples were sintered at 1100 and 1400 °C for 4 h. The bulk densities were measured by Archimedes method. XRD measurements indicate that the synthesized samples were in single-phase cubic fluorite structure (space group Fm3m). The cell parameters decrease with the concentration of Mg, and 2 θ values slightly shift towards right. The particle sizes obtained were between 7.14 and 17.44 nm. The sintered sample achieved 95% of theoretical density. FTIR spectra of samples sintered at 1400 °C indicates weak interactions between 3550-3400 cm-1 and 1600-1300 cm-1 are attributed to O-H stretching modes and strong bonds 850-450 cm-1 are assigned to characteristic Ce-O vibrations. The surface morphology and chemical composition were analyzed by SEM and EDS, SEM micrographs show spherical faceted grains, and the samples were crack free, dense material with some pores on surface which are inconsistent with density results. The average grain size obtained was 0.5 μm. Particle size obtained by TEM was in agreement with that obtained by XRD. The high-density ceria co-doped ceramic can be used as electrolyte in SOFC.

  16. Synthesis, spectroscopic, thermal and antimicrobial studies of neodymium(III) and samarium(III) complexes derived from tetradentate ligands containing N and S donor atoms (United States)

    Ain, Qurratul; Pandey, S. K.; Pandey, O. P.; Sengupta, S. K.


    Trivalent lanthanide complexes of the type [Ln(L)Cl(H2O)2] (where Ln = Nd(III) or Sm(III) and LH2 = Schiff bases derived by the condensation of 3-(phenyl/substitutedphenyl)-4-amino-5-mercapto-1,2,4-triazole with diacetyl/benzil) have been synthesized by the reactions of anhydrous lanthanide(III) chloride with Schiff bases in methanol. The structures of the complexes have been proposed on the basis of elemental analysis, electrical conductance, magnetic moment, spectroscopic measurements (IR, 1H, 13C NMR and UV-vis spectra) and X-ray diffraction studies. The spectral data reveal that the Schiff base ligands behave as dibasic tetradentate chelating agents having coordination sites at two thiol sulfur atoms and two azomethine nitrogen atoms. The presence of coordinated water in metal complexes was confirmed by thermal and IR data of the complexes. All the Schiff bases and their metal complexes have also been screened for their antibacterial activity against Bacillus subtilis, Staphylococcus aureus and antifungal activities against Aspergillus niger, Curvularia pallescens and Colletotrichum capsici.

  17. Logarithmic temperature dependence of samarium ion valence in the heavy-fermion S mxL a1 -xO s4S b12 (United States)

    Fushiya, Kengo; Miyazaki, Ryoichi; Higashinaka, Ryuji; Yamada, Akira; Mizumaki, Masaichiro; Tsutsui, Satoshi; Nitta, Kiyofumi; Uruga, Tomoya; Suemitsu, Bunya; Sato, Hideyuki; Aoki, Yuji


    We have measured x-ray absorption spectra at the Sm L3 edge to investigate the Sm-ion valence of (S mxL a1 -x) O s4S b12 , in which field-insensitive heavy-fermion behavior appears at low temperatures for x =1 . It has been found that the Sm-ion valance shifts to 2 + with La ion substitution; from v =+2.78 (x =1 ) to v =+2.73 (x =0.2 ) at 10 K. For all x investigated, its temperature dependence shows a logT behavior, indicating that the valence change is caused by "an unconventional Kondo effect" associated with Sm 4 f -electron charge degrees of freedom. Almost x independence of "the associated Kondo temperature" (T˜K=56 ±10 K ) indicates that the Kondo effect has a local nature, attributable to the cage structure of the filled skutterudite.

  18. Rare earth elements in the aragonitic shell of freshwater mussel Corbicula fluminea and the bioavailability of anthropogenic lanthanum, samarium and gadolinium in river water

    Energy Technology Data Exchange (ETDEWEB)

    Merschel, Gila, E-mail:; Bau, Michael


    High-technology metals — such as the rare earth elements (REE) — have become emerging contaminants in the hydrosphere, yet little is known about their bioavailability. The Rhine River and the Weser River in Germany are two prime examples of rivers that are subjected to anthropogenic REE input. While both rivers carry significant loads of anthropogenic Gd, originating from contrast agents used for magnetic resonance imaging, the Rhine River also carries large amounts of anthropogenic La and lately Sm which are discharged into the river from an industrial point source. Here, we assess the bioavailability of these anthropogenic microcontaminants in these rivers by analyzing the aragonitic shells of the freshwater bivalve Corbicula fluminea. Concentrations of purely geogenic REE in shells of comparable size cover a wide range of about one order of magnitude between different sampling sites. At a given sampling site, geogenic REE concentrations depend on shell size, i.e. mussel age. Although both rivers show large positive Gd anomalies in their dissolved loads, no anomalous enrichment of Gd relative to the geogenic REE can be observed in any of the analyzed shells. This indicates that the speciations of geogenic and anthropogenic Gd in the river water differ from each other and that the geogenic, but not the anthropogenic Gd is incorporated into the shells. In contrast, all shells sampled at sites downstream of the industrial point source of anthropogenic La and Sm in the Rhine River show positive La and Sm anomalies, revealing that these anthropogenic REE are bioavailable. Only little is known about the effects of long-term exposure to dissolved REE and their general ecotoxicity, but considering that anthropogenic Gd and even La have already been identified in German tap water and that anthropogenic La and Sm are bioavailable, this should be monitored and investigated further. - Highlights: • Corbicula fluminea shells are bioarchives of dissolved geogenic REE in rivers. • Anthropogenic La and Sm in the Rhine River are bioavailable, hence incorporated. • Anthropogenic Gd from contrast agents is not incorporated, i.e. not bioavailable. • REE concentrations in Corbicula shells decrease with increasing size, i.e. age.

  19. Mechanically induced strong red emission in samarium ions doped piezoelectric semiconductor CaZnOS for dynamic pressure sensing and imaging (United States)

    Wang, Wei; Peng, Dengfeng; Zhang, Hanlu; Yang, Xiaohong; Pan, Caofeng


    Piezoelectric semiconductor with optical, electrical and mechanical multifunctions has great potential applications in future optoelectronic devices. The rich properties and applications mainly encompass the intrinsic structures and their coupling effects. Here, we report that lanthanide ions doped piezoelectric semiconductor CaZnOS:Sm3+ showing strong red emission induced by dynamic mechanical stress. Under moderate mechanical load, the doped piezoelectric semiconductor exhibits strong visible red emission to the naked eyes even under the day light. A flexible dynamic pressure sensor device is fabricated based on the prepared CaZnOS:Sm3+ powders. The mechanical-induced emission properties of the device are investigated by the optical fiber spectrometer. The linear characteristic emissions are attributed to the 4G5/2→6H5/2 (566 nm), 4G5/2→6H7/2 (580-632 nm), 4G5/2→6H9/2 (653-673 nm) and 4G5/2→6H11/2 (712-735 nm) f-f transitions of Sm3+ ions. The integral emission intensity is proportional to the value of applied pressure. By using the linear relationship between integrated emission intensity and the dynamic pressure, the real-time pressure distribution is visualized and recorded. Our results highlight that the incorporation of lanthanide luminescent ions into piezoelectric semiconductors as smart materials could be applied into the flexible mechanical-optical sensor device without additional auxiliary power, which has great potential for promising applications such as mapping of personalized handwriting, smart display, and human machine interface.

  20. Investigation of oxidative coupling of methane over bismuth oxychloride, samarium chloride, or manganese chloride supported on lithium carbonate-magnesia systems

    Energy Technology Data Exchange (ETDEWEB)

    Khan, A.Z.; Ruckenstein, E. (State Univ. of New York, Buffalo, NY (United States))


    The magnesia-supported bismuth oxychloride with lithium carbonate present is significantly more effective and stable with time-on-stream than the unsupported or supported systems free of Li[sub 2]CO[sub 3] in the oxidative coupling of methane at 750[degrees]C, P[sub CH[sub 4

  1. Rare earth elements in the aragonitic shell of freshwater mussel Corbicula fluminea and the bioavailability of anthropogenic lanthanum, samarium and gadolinium in river water. (United States)

    Merschel, Gila; Bau, Michael


    High-technology metals - such as the rare earth elements (REE) - have become emerging contaminants in the hydrosphere, yet little is known about their bioavailability. The Rhine River and the Weser River in Germany are two prime examples of rivers that are subjected to anthropogenic REE input. While both rivers carry significant loads of anthropogenic Gd, originating from contrast agents used for magnetic resonance imaging, the Rhine River also carries large amounts of anthropogenic La and lately Sm which are discharged into the river from an industrial point source. Here, we assess the bioavailability of these anthropogenic microcontaminants in these rivers by analyzing the aragonitic shells of the freshwater bivalve Corbicula fluminea. Concentrations of purely geogenic REE in shells of comparable size cover a wide range of about one order of magnitude between different sampling sites. At a given sampling site, geogenic REE concentrations depend on shell size, i.e. mussel age. Although both rivers show large positive Gd anomalies in their dissolved loads, no anomalous enrichment of Gd relative to the geogenic REE can be observed in any of the analyzed shells. This indicates that the speciations of geogenic and anthropogenic Gd in the river water differ from each other and that the geogenic, but not the anthropogenic Gd is incorporated into the shells. In contrast, all shells sampled at sites downstream of the industrial point source of anthropogenic La and Sm in the Rhine River show positive La and Sm anomalies, revealing that these anthropogenic REE are bioavailable. Only little is known about the effects of long-term exposure to dissolved REE and their general ecotoxicity, but considering that anthropogenic Gd and even La have already been identified in German tap water and that anthropogenic La and Sm are bioavailable, this should be monitored and investigated further. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Samario-153-Lexidronam (EDTMP) en el tratamiento de las metástasis óseas Samarium-153-Lexidronam (EDTMP) for the management of bone metastases


    F. Torre; C. Gómez-Vega; A. Callejo; J. Genolla


    Las metástasis óseas son una complicación frecuente en pacientes neoplásicos, en este sentido, el tejido óseo ocupa el tercer lugar de todos los órganos y sistemas con metástasis después del pulmón e hígado. Aproximadamente un 75% de los enfermos con metástasis óseas sufrirán dolor, siendo estas la causa más frecuente de dolor en pacientes con cáncer. El dolor óseo aumenta con los movimientos y a la presión, limitando la autonomía del enfermo y su calidad de vida. El tratamiento incluye vario...

  3. Morphology and orientation of β-BaB{sub 2}O{sub 4} crystals patterned by laser in the inside of samarium barium borate glass

    Energy Technology Data Exchange (ETDEWEB)

    Nishii, Akihito; Shinozaki, Kenji; Honma, Tsuyoshi; Komatsu, Takayuki, E-mail:


    Nonlinear optical β-BaB{sub 2}O{sub 4} crystal lines (β-BBO) were patterned in the inside of 8Sm{sub 2}O{sub 3}–42BaO–50B{sub 2}O{sub 3} glass by irradiations of continuous-wave Yb:YVO{sub 4} lasers with a wavelength of 1080 nm (power: P=0.8–1.0 W, scanning speed: S=0.2–2.5 μm/s), in which the laser focal position was moved gradually from the surface to the inside. The morphology, size, and orientation of β-BBO crystals were examined from polarization optical microscope and birefringence imaging observations. It was demonstrated that c-axis oriented β-BBO crystals with long lengths (e.g., 20 mm) were patterned in the inside of the glass. The morphology of β-BBO in the cross-section of lines was a rectangular shape with rounded corners, and the volume of β-BBO formed increased with increasing laser power and with decreasing laser scanning speed. The maximum depth in the inside from the surface for β-BBO patterning increased with increasing laser power, e.g., D{sub max}∼100 μm at P=0.8 W, D{sub max}∼170 μm at P=0.9 W, and D{sub max}∼200 μm at P=1 W. The present study proposes that the laser-induced crystallization opens a new door for applied engineering in glassy solids. - Graphical abstract: This figure shows the POM photographs for β-BaB{sub 2}O{sub 4} crystal lines patterned by cw Yb:YVO{sub 4} fiber laser irradiations with a laser power of P=0.8 W and a laser scanning speed S=2 μm/s in the glass. The laser focal point was moved gradually from the surface into the inside. The results shown in Fig. 1 demonstrate that it is possible to pattern highly oriented β-BaB{sub 2}O{sub 4} crystals even in the inside of glasses. - Highlights: • β-BaB{sub 2}O{sub 4} crystal lines were patterned in the inside of a glass by lasers. • Laser focal position was moved gradually from the surface to the inside. • Birefringence imaging was observed. • Morphology, size, and orientation of crystals were clarified. • Crystal lines with long lengths (e.g., 20 mm) were patterned at the depth of 200 μm.

  4. 10 CFR Appendix C to Part 20 - Quantities 1 of Licensed Material Requiring Labeling (United States)


    ... Samarium-151 10 Samarium-153 100 Samarium-155 1,000 Samarium-156 1,000 Europium-145 100 Europium-146 100 Europium-147 100 Europium-148 10 Europium-149 100 Europium-150 (12.62h) 100 Europium-150 (34.2y) 1 Europium-152m 100 Europium-152 1 Europium-154 1 Europium-155 10 Europium-156 100 Europium-157 100 Europium-158 1...

  5. An experiment using neutron activation analysis and a rare earth element to mark cotton plants and two insects that feed on them

    Energy Technology Data Exchange (ETDEWEB)

    Showler, Allan T. [USDA-ARS IFNRRU, Kika de la Garza Subtropical Agricultural Research Center, 2413 East Highway 83, Weslaco, TX 78596 (United States)]. E-mail:; James, William D. [Elemental Analysis Laboratory, 3144 Texas A and M University, College Station, TX 77843-3144 (United States); Armstrong, John S. [USDA-ARS BIRU, Kika de la Garza Subtropical Agricultural Research Center, 2413 East Highway 83, Weslaco, TX 78596 (United States); Westbrook, John K. [USDA-ARS APMRU, 2771 F and B Road, College Station, TX 77845-4966 (United States)


    Studies on insect dispersal and other behaviors can benefit from using markers that will not alter flight and fitness. Rare earth elements, such as samarium (Sm), have been used as ingested markers of some insects and detected using neutron activation analysis (NAA). In this study, samarium nitrate hexahydrate was mixed into artificial diet for boll weevils, Anthonomus grandis grandis Boheman (Coleoptera: Curculionidae), at different dosages and in water used to irrigate cotton, Gossypium hirsutum L. Samarium was detected in adult boll weevils fed on the samarium-labeled diet, but not after 5 or 10 days of being switched to non-labeled diet, even if the insects were given labeled diet for as long as 7 consecutive days. Introduced in irrigation water, 1% samarium (m/m) was detectable in cotton squares and leaf tissue. However, boll weevil adults fed samarium-labeled squares did not retain detectable levels of samarium, nor did boll weevil adults reared to adulthood from samarium-labeled squares. Fourth instar beet armyworms, Spodoptera exigua (Huebner) (Noctuidae: Lepidoptera), fed on samarium-labeled cotton leaves obtained enough samarium for NAA detection, but adult moths reared from them did not have detectable amounts of samarium. Although samarium can be useful as a marker when insects are presented with a continuous pulse of the label, elements that are assimilated by the insect would be more useful if a continuous infusion of the marker cannot be provided.

  6. Super-chondritic Sm/Nd ratios in Mars, the Earth and the Moon. (United States)

    Caro, Guillaume; Bourdon, Bernard; Halliday, Alex N; Quitté, Ghylaine


    Small isotopic differences in the atomic abundance of neodymium-142 (142Nd) in silicate rocks represent the time-averaged effect of decay of formerly live samarium-146 (146Sm) and provide constraints on the timescales and mechanisms by which planetary mantles first differentiated. This chronology, however, assumes that the composition of the total planet is identical to that of primitive undifferentiated meteorites called chondrites. The difference in the 142Nd/144Nd ratio between chondrites and terrestrial samples may therefore indicate very early isolation (Mars also has a non-chondritic composition. Meteorites belonging to the shergottite subgroup define a planetary isochron yielding an age of differentiation of 40 +/- 18 Myr for the martian mantle. This isochron does not pass through the chondritic reference value (100 x epsilon(142)Nd = -21 +/- 3; 147Sm/144Nd = 0.1966). The Earth, Moon and Mars all seem to have accreted in a portion of the inner Solar System with approximately 5 per cent higher Sm/Nd ratios than material accreted in the asteroid belt. Such chemical heterogeneities may have arisen from sorting of nebular solids or from impact erosion of crustal reservoirs in planetary precursors. The 143Nd composition of the primitive mantle so defined by 142Nd is strikingly similar to the putative endmember component 'FOZO' characterized by high 3He/4He ratios.

  7. 143rd and 144th meetings of the Governing Board of the Pension Fund

    CERN Multimedia


    During the meeting, the Board also approved a document setting out its position on the CERN debt to the Pension Fund, which would be submitted to the Finance Committee and Council in June. It underlined that the reimbursement of the debt would be advantageous for the Fund as well as for the Laboratory and that it would reduce the Fund's dependence on the employer, in line with international accounting practices. The second of the two meetings was essentially devoted to examining the actuary's report on the Fund's position with respect to its actuarial commitments as at 1st January 2006. The report, the first of its kind, follows the Board's decision to commission actuarial studies to check the Fund's position in open fund terms between three-yearly actuarial reviews. Based on the Fund's position as at the end of 2005 and taking account of the Council's decisions in December 2005, it reveals a net improvement in the Fund's long-term (30-year) financial balance. However, the actuary states in the conclusions t...

  8. Mineral X, a new thalcusite homologue from the Ilimaussaq complex, South Greenland Contribution to the mineralogy of Ilimaussaq, no. 144

    DEFF Research Database (Denmark)

    Karup-Møller, Sven; Makovicky, E.


    Mineral X is assumed to be a new member of the thalcusite homologous series with the structural formula TlCu2NS2N+1 with N=1.5. It was found in loose ussingite-analcime boulders on the Taseq slope towards the Narsaq Elv in the northern part of the Ilimaussaq complex in South Greenland in associat...

  9. KEA-144: Final Results of the Ground Operations Demonstration Unit for Liquid Hydrogen (GODU-LH2) Project (United States)

    Notardonato, William; Fesmire, James; Swanger, Adam; Jumper, Kevin; Johnson, Wesley; Tomsik, Thomas


    GODU-LH2 system has successfully met all test objectives at the 33%, 67%, and 100% tank fill level. Complete control over the state of the fluid has been demonstrated using Integrated Refrigeration and Storage (IRAS). Almost any desired point along the H2saturation curve can essentially be "dialed in" and maintained indefinitely. System can also be used to produce densified hydrogen in large quantities to the triple point. Exploring multiple technology infusion paths. Studying implementation of IRAS technology into new LH2sphere for EM-2 at LC39B. Technical interchange also occurring with STMD, LSP, ULA, DoE, KIST, Kawasaki, Shell Oil, SpaceX, US Coast Guard, and Virgin Galactic.

  10. NODC Standard Format Marine Toxic Substances and Pollutants (F144) Data (1971-1989) (NODC Accession 0014199) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data type contains data on ambient concentrations of toxic substances and other pollutants in the marine environment. The data derive from laboratory analyses...

  11. Machtsensible geographiedidaktische Konzepte des interkulturellen Lernens – Potenziale einer postkolonialen Perspektive. GW-Unterricht|GW-Unterricht 144


    Schröder, Birte


    Ziel dieses Beitrags ist es erstens, Potenziale einer postkolonialen Perspektive für eine Rekonzeptualisierung des interkulturellen Lernens im Geographieunterricht aufzuzeigen. Zweitens – und damit eng verbunden – geht es um eine Ausdifferenzierung des Machtverständnisses in der interkulturellen Geographiedidaktik. Drittens zeigt der Aufsatz anhand empirischer Daten auf, inwiefern der Blick auf heterogene lebensweltliche Zugehörigkeitserfahrungen und Wissensbestände von Schülerinnen und Schül...

  12. Interpersonal relationships between professionals and mothers of premature from Kangaroo-Unit - doi:10.5020/18061230.2010.p144

    Directory of Open Access Journals (Sweden)

    Fabiane Elpidio de Sá


    Full Text Available Objective: To understand the interpersonal relationships between professionals and mothers of premature newborns of the Kangaroo Unit. Methods: This was an exploratory study of qualitative approach. The interviews were conducted with 10 mothers and 7 professionals who joined in Kangaroo Program and then analyzed by the content analysis technique. The guiding questions used were related to feelings perceived in relation to the Kangaroo method, related to mother-child dyad and interpersonal relationships. Results: Mothers reported on their speeches: “safe to be with the baby in Kangaroo Method” and “sense of maternal feeling during breastfeeding”, while in the professionals’ discourses have emerged: “guidelines on caring for the babies”, “the embracement by the team” and “the importance of family support.” Conclusions: The interaction between professionals and mothers of Kangaroo Unit facilitates the permanence of the binomial in the method, therefore develops feelings of security, tranquility and confidence to take care of the baby. It is important that the team be aware of the difficulties, supporting them in the weakest moments and sharing their fears, doubts and concerns over the baby’s hospitalization.

  13. 47 CFR 25.144 - Licensing provisions for the 2.3 GHz satellite digital audio radio service. (United States)


    ... different regions within that satellite's coverage area. (6) Operators of SDARS terrestrial repeaters are... 47 Telecommunication 2 2010-10-01 2010-10-01 false Licensing provisions for the 2.3 GHz satellite... (CONTINUED) COMMON CARRIER SERVICES SATELLITE COMMUNICATIONS Applications and Licenses Space Stations § 25...

  14. Obtention of Samarium and Gadolinium concentrates by solvent extraction using mono-2-ethylhexyl ester of 2-ethylhexyl phosphonic acid; Obtencao de concentrados de samario e gadolinio via extracao por solventes com o ester mono-2-etilhexil do acido 2-etilhexilfosfonico

    Energy Technology Data Exchange (ETDEWEB)

    Miranda Junior, Pedro


    The rare earth chlorides solution employed in this study, which is constituted by medium and heavy fractions, is derived from monazite processing accomplished by NUCLEMON-Mineroquimica (SP). This solution shows an acidity about 1.18 M and 189 g/L of rare earth oxides, containing as main constituents: Sm(34.55%), Gd(23.85%), Dy (6.82%), and Y (24.45%). It was used, as organic phase, 2-ethylhexyl phosphonic acid, mono-2-ethylhexylester diluted to 1 M in isododecane. (author)

  15. Poly(dl)lactic acid/polyglycolic acid/iron and poly(dl)lactic acid/polyglycolic acid/samarium cobalt composites for use as a delivery mechanism for magnetically directed chondrogenesis (United States)

    Oppermann, Dean Alan

    Magnetically directed chondrogenesis (MDC) is a fundamental approach to articular cartilage repair. In MDC a magnet is implanted into the subchondral trabecular bone underlying a cartilage defect and used to attract chondrocytes, magnetically tagged with Fe nanoparticles, to the defect site. Pilot studies by Halpern, Crimp and Grande, using solid neodymium (Nd) magnets, indicated optimistic results by producing a hyaline-like articular cartilage after 8 weeks implantation. Since solid Nd magnets introduce long-term biocompatibility issues, the focus of this dissertation was to develop P(dl)A/PGA/Fe and P(dl)A/PGA/SmCo 5 implants for use in MDC. The effect of implant porosity, implant composition and magnetic material (Fe or SmCo5) on the initial and degraded magnetic properties were evaluated. The biocompatibility of P(dl)A/PGA/Fe implants were investigated by implantation into New Zealand white rabbits for 8 weeks. The effect of hydrogen peroxide (H2O2) and ethylene oxide (EO) sterilization techniques on the molecular weight and chemical structure of P(dl)A/PGA polymers were evaluated using gel permeation chromatography and Fourier transform infrared spectroscopy. The effect of implant morphology, size and number on the von Mises stress in the trabecular bone surrounding the implant was evaluated using a finite element model. In general, SmCo5 implants resulted in higher magnetic fields initially and after 8 weeks of degradation than comparable Fe implants. Increases in magnetic field strength were achieved by increasing the volume fraction of magnetic material and by increasing the PGA concentration. The magnetic field strength degradation rate decreased with increases in volume fraction of magnetic material and increases in PLA concentration. Implantation studies indicated that 50/50 P(dl)A/PGA were more bioactive than 75/25 P(dl)A/PGA with an increased cellular response that is specific to bone growth. The compressive strength and elastic modulus of porous implants were comparable to trabecular bone, and the compressive strength and elastic modulus of solid implants was higher than trabecular bone but less than cortical bone. Finite element modeling showed that the implantation of solid and porous P(dl)A/PGA/Fe implants did not significantly increase the von Mises stress concentration adjacent to the implant. The von Mises stress surrounding porous implants was higher than the solid implants which predicts faster bone remodeling. Comparing single implants to multiple implants indicated a significant decrease in von Mises stress between the implants. This would predict bone resorption in that area. H2O2 sterilization resulted in a gradual decrease in the molecular weight of P(dl)A/PGA polymers that was a result of hydrolytic scission of the ester bonds present between the individual monomers. The polymers were less affected by EO sterilization with only the 75/25 P(dl)A/PGA, indicating a decrease in molecular weight. From these results, it was concluded that solid 50/50 P(dl)A/PGA/SmCo 5 implants that span the entire width of the cartilage defect should be used to optimize the attraction potential and bioactivity of the implant. Also ethylene oxide, which caused less premature implant degradation, should be used for sterilization.

  16. Fabrication of a new samarium(III) ion-selective electrode based on 3-{l_brace}[2-oxo-1(2h)-acenaphthylenyliden]amino{r_brace}-2-thioxo -1,3-thiazolidin-4-one

    Energy Technology Data Exchange (ETDEWEB)

    Zamani, Hassan Ali [Islamic Azad University, Quchan (Iran, islamic Republic of). Quchan Branch. Dept. of Chemistry]. E-mail:; Ganjali, Mohammad Reza [Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of). Endocrine and Metabolism Research Center; Adib, Mehdi [University of Tehran, Tehran (Iran, Islamic Republic of). Faculty of Chemistry. Center of Excellence in Electrochemistry


    This paper introduces the development of an original PVC membrane electrode, based on 3-{l_brace}[2-oxo-1(2H)-acenaphthylenyliden]amino{r_brace}-2-thioxo-1,3-thiazolidin-4-one (ATTO) which has revealed to be a suitable carrier for Sm{sup 3+} ions. The resulting data illustrated that the electrode shows a Nernstian slope of 19.3 {+-} 0.6 mV per decade for Sm{sup 3+} ions over a broad working concentration range of 1.0 X 10{sup -6} to 1.0 X 10{sup -1} mol L{sup -1}. The lower detection limit was found to be equal to (5.5{+-} 0.3) X 10{sup -7} mol L{sup -}'1 in the pH range of 3.5-7.5, and the response time was very short ({approx}10 s). The potentiometric sensor displayed good selectivities for a number of cations such as alkali, alkaline earth, transition and heavy metal ions. (author)



  18. Activation cross-sections of deuteron induced reactions on {sup nat}Sm up to 50 MeV

    Energy Technology Data Exchange (ETDEWEB)

    Tárkányi, F. [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Hermanne, A. [Cyclotron Laboratory, Vrije Universiteit Brussel (VUB), Laarbeeklaan 103, 1090 Brussels (Belgium); Takács, S. [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Ditrói, F., E-mail: [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Csikai, J. [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Ignatyuk, A.V. [Institute of Physics and Power Engineering (IPPE), Obninsk 249020 (Russian Federation)


    Highlights: •Deuteron induced reactions on natural samarium up to 50 MeV. •Stacked foil irradiation at different energies and accelerators. •Comparison of experimental results with the ALICE-D, EMPIRE-D and TALYS theoretical codes. •Calculation and comparison of thick target integral yields. -- Abstract: Activation cross-sections for deuteron induced reactions on Sm are presented for the first time for {sup nat}Sm(d,xn){sup 155,154,152m2,152m1,152g,150m,150g,149,148,147,146}Eu, {sup nat}Sm(d,x) {sup 153,145}Sm and {sup nat}Sm(d,x){sup 151,150,149,145,144,143}Pm up to 50 MeV. The cross-sections were measured by the stacked-foil irradiation technique and high resolution γ-ray spectrometry. The results were compared with results of nuclear reaction codes ALICE-D, EMPIRE-D and TALYS (from TENDL libraries). Integral yields of the products were calculated from the excitation functions.

  19. Activation cross-sections of proton induced reactions on {sup nat}Sm up to 65 MeV

    Energy Technology Data Exchange (ETDEWEB)

    Tárkányi, F. [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Hermanne, A. [Cyclotron Laboratory, Vrije Universiteit Brussel (VUB), Laarbeeklaan 103, 1090 Brussels (Belgium); Takács, S. [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Ditrói, F., E-mail: [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Ignatyuk, A.V. [Institute of Physics and Power Engineering (IPPE), Obninsk 249020 (Russian Federation)


    Highlights: •Proton induced reactions on natural samarium up to 65 MeV. •Stacked foil irradiation technique. •Comparison of experimental results with the ALICE, EMPIRE and TALYS theoretical model codes. •Calculation and comparison of thick target integral yields. -- Abstract: Activation cross sections for proton induced reactions on Sm are presented for the first time for {sup nat}Sm(p,xn){sup 154,152m2,152m1,152g,150m,150g,149,148,147,146,145}Eu, {sup nat}Sm(p,x){sup 153,145}Sm, {sup nat}Sm(p,x){sup 151,150,149,148g,148m,146,144,143}Pm and {sup nat}Sm(p,x){sup 141}Nd up to 65 MeV. The cross sections were measured via activation method by using a stacked-foil irradiation technique and high resolution gamma ray spectroscopy. The results were compared with results of the nuclear reaction codes ALICE, EMPIRE and TALYS (results taken from TENDL libraries). Integral yields of the activation products were calculated from the excitation functions.

  20. Assessment of Non-Traditional Isotopic Ratios by Mass Spectrometry for Analysis of Nuclear Activities (United States)


    distinguish between commercial nuclear reactor fuel cycles, fuel cycles for weapons grade plutonium , and products from nuclear weapons explosions. Methods will...Isotopic ratios will be calculated for radionuclides produced in commercial nuclear reactor fuel cycles, fuel cycles for weapons grade plutonium , and... chemistry for analysis of samarium. The chemical form of samarium required for analysis varies for different mass spectrometry techniques

  1. Cellule État de l’Environnement Wallon (2003 Tableau de bord de l’environnement wallon 2003, Ed MRW –DGRNE, 144 p.

    Directory of Open Access Journals (Sweden)

    Emilie Thuillier


    Full Text Available Le Tableau de bord de l'environnement wallon 2003 fait suite au Rapport sur l’état de l'environnement wallon 2000 et constitue la première édition qui sera éditée annuellement. Cette initiative est le fruit d’une collaboration entre, d’une part, la Direction Générale des Ressources Naturelles et de l’Environnement du Ministère de la Région wallone et, d’autre part, une coordination inter-universitaire fondée sur une équipe scientifique pluridisciplinaire permanente coordonnée par Edwin ZACCAÏ...

  2. Copyright and Related Issues Relevant to Digital Preservation and Dissemination of Unpublished Pre-1972 Sound Recordings by Libraries and Archives. CLIR Publication No. 144 (United States)

    Besek, June M.


    This report addresses the question of what libraries and archives are legally empowered to do to preserve and make accessible for research their holdings of unpublished pre-1972 sound recordings. The report's author, June M. Besek, is executive director of the Kernochan Center for Law, Media and the Arts at Columbia Law School. Unpublished sound…

  3. Alaska Open-file Report 144 Assessment of Thermal Springs Sites Aleutian Arc, Atka Island to Becherof Lake -- Preliminary Results and Evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Motyka, R.J.; Moorman, M.A.; Liss, S.A.


    Twenty of more than 30 thermal spring areas reported to exist in the Aleutian arc extending from Atka Island to Becherof Lake were investigated during July and August, 1980. Thermal activity of three of these sites had diminished substantially or no longer existed. At least seven more sites where thermal-spring activity is probable or certain were not visited because of their remoteness or because of time constraints. The existence of several other reported thermal spring sites could not be verified; these sites are considered questionable. On the basis of geothermometry, subsurface reservoir temperatures in excess of 150 C are estimated for 10 of the thermal spring sites investigated. These sites all occur in or near regions of Recent volcanism. Five of the sites are characterized by fumaroles and steaming ground, indicating the presence of at least a shallow vapor-dominated zone. Two, the Makushin Valley and Glacier Valley thermal areas, occur on the flanks of active Mukushin Volcano located on Unalaska Island, and may be connected to a common source of heat. Gas geothermometry suggests that the reservoir feeding the Kliuchef thermal field, located on the flanks of Kliuchef volcano of northeast Atka Island, may be as high as 239 C.

  4. CRED Subsurface Temperature Recorder (STR); Guam; Long: 144.70392, Lat: 13.24217 (WGS84); Sensor Depth: 5.18m; Data Date Range: 20090410-20110507. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Subsurface Temperature Recorders (STR) provide a time series of...

  5. CRED Subsurface Temperature Recorder (STR); CNMI, FDP; Long: 144.90023, Lat: 20.53725 (WGS84); Sensor Depth: 31.70m; Data Range: 20070603-20090428. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Subsurface Temperature Recorders (STR) provide a time series of...

  6. Impact of sexual maturation on upper and lower limb strength on adolescents DOI:10.5007/1980-0037.2010v12n3p144

    Directory of Open Access Journals (Sweden)

    Diego Augusto Santos Silva


    Full Text Available Biological and sexual maturation is one of the most important variables for the interpretation of the results of performance and health studies analyzing upper (ULS and lower limb strength (LLS, with performance varying according to maturation stage. Since menarche is a marker of maturation, the aim of this study was to compare ULS and LLS between adoles-cents who already had their first menarche and those who did not. A cross-sectional study was conducted on 128 adolescents aged 11 to 14 years and divided into two groups: adolescents who did not report the presence of menarche (n=72, adolescents who reported menarche (n=56. ULS was evaluated by the hand grip test using a manual dynamometer. The vertical jump test was used for the evaluation of LLS. Descriptive statistics and covariance analysis (ANCOVA were used for data analysis, with age, body weight, height and BMI as covariables. The level of significance was set at 5% (p<0.05. ULS differed between G1 (17.8±4.4 kg/f and G2 (21.5±3.9 kg/f (p<0.05. However, no difference in LLS was observed between groups (G1 = 23.7±6.7 cm; G2 = 24.1±6.7 cm. The presence of menarche might be one of the events improving the performance in the ULS test, but the same cannot be inferred when analyzing LLS.

  7. 144. Evolución del manejo de la rotura traumática de aorta: 30 años de experiencia

    Directory of Open Access Journals (Sweden)

    V.X. Mosquera Rodríguez


    Conclusiones: El manejo conservador de la RTA puede ser una opción terapéutica en pacientes altamente seleccionados, y requiere un estricto seguimiento clinicorradiológico. El tratamiento quirúrgico, abierto o endovascular, tiene unos excelentes resultados tanto a corto como a largo plazo.

  8. FASBにおける長期性資産の減損-SFAS144を中心にして-




    米国の財務会計基準審議会(Financial Accounting Standards Board、以下:FASB)が、1995年3月に、長期性資産の減損および処分(the Impairment or Disposal of Long-Lived Assets)に関する財務会計基準書121号(Statement of Financial Accounting Standard No.121、以下:SFAS121)「長期性資産の減損および処分する長期性資産の会計」を公表した。SFAS121が公表された当初から、処分する長期性資産に関する会計において、既存の基準、すなわち、会計原則審議会意見書30号(Accounting Principles Board Opinion 30、以下:APBO30)「営業成績の報告―事業セグメントの処分ならびに異常、非経常、非反複的事象および取引の影響の報告」との整合性が問題となっていた。...

  9. The use of neoadjuvant platinum-based chemotherapy in locally advanced breast cancer that is triple negative: retrospective analysis of 144 patients. (United States)

    Hurley, Judith; Reis, Isildinha M; Rodgers, Steven E; Gomez-Fernandez, Carmen; Wright, Jean; Leone, Jose Pablo; Larrieu, Rene; Pegram, Mark D


    Triple-negative breast cancers comprise about 20 % of breast cancers. They have poor prognosis and have no standard therapy. The aim of this study was to evaluate pathologic complete response (pCR), progression-free survival (PFS), and overall survival (OS) in patients with TNBC treated with neoadjuvant platinum-based chemotherapy. This is a retrospective study of one hundred and forty-four women with TNBC treated with neoadjuvant platinum-containing chemotherapy for locally advanced breast cancer at the University of Miami between January 1, 1999, and January 1, 2011. The medical record was reviewed to obtain data on clinical characteristics, including ethnicity, race, age, clinical stage, treatment regimen, and vital status. This study was approved by the University of Miami IRB. All patients had locally advanced breast cancer with at least one of the following features at presentation: T3, T4, N2, and N3. The mean tumor size by palpation was 9.4 cm. The clinical T-stage at presentation was 1.4 % T1, 8.3 % T2, 52.8 % T3, and 37.5 % T4 (19.4 % T4d). The nodal status by physical exam at presentation was 23 % N0, 37.5 % N1, 34 % N2, and 5.5 % N3. pCR in breast and axilla was seen in 31 %. PFS and OS were 55 and 59 %, respectively, at 7 years. Cisplatin offered a survival advantage over carboplatin in both PFS (P = 0.007) and OS (P = 0.018). Node positivity was the most important predictor of survival. Cisplatin/docetaxel neoadjuvant therapy was well tolerated and an effective therapy in locally advanced TNB.

  10. Radiological evidence of femoroacetabular impingement in mild slipped capital femoral epiphysis: a mean follow-up of 14.4 years after pinning in situ. (United States)

    Fraitzl, C R; Käfer, W; Nelitz, M; Reichel, H


    Conventional treatment of mild slipped capital femoral epiphysis consists of fixation in situ with wires or screws. Recent contributions to the literature suggest that even a mild slip may lead to early damage of the acetabular labrum and adjacent cartilage by abutment of a prominent femoral metaphysis. It has been suggested that the appropriate treatment in mild slipped capital femoral epiphysis should not only prevent further slipping of the epiphysis, but also address potential femoroacetabular impingement by restoring the anatomy of the proximal femur. Between October 1984 and December 1995 we treated 16 patients for unilateral mild slipped capital femoral epiphysis by fixation in situ with Kirschner wires. In this study we have reviewed these patients for clinical and radiological evidence of femoroacetabular impingement. There was little clinical indication of impingement but radiological evaluation assessing the femoral head-neck ratio and measuring the Nötzli alpha angle on the anteroposterior and cross-table radiographs showed significant alterations in the proximal femur. None of the affected hips had a normal head-neck ratio and the mean alpha angle was 86 degrees (55 degrees to 99 degrees ) and 55 degrees (40 degrees to 94 degrees ) on the anteroposterior and lateral cross-table radiographs, respectively. While our clinical data favours conventional treatment, our radiological findings are in support of restoring the anatomy of the proximal femur to avoid or delay the development of femoroacetabular impingement following mild slipped capital femoral epiphysis.

  11. The time-like electromagnetic form factors of the charged pseudoscalar mesons from 144 to 90 GeV/sup 2/

    CERN Document Server

    Bernardini, M; Brunini, P L; Fiorentino, E; Massam, Thomas; Monari, L; Palmonari, F; Rimondi, F; Zichichi, A


    The study of 620 hadron pairs produced in the s-range (1.44-9.0) GeV /sup 2/, has yielded 110 collinear hadronic events. Their identification in terms of pi and K mesons allows the determination of the time-like electromagnetic from factors of these pseudoscalar mesons in the above time-like range. The total number of (e/sup +or-/e /sup -/) events observed in the same experimental conditions is 18048. (10 refs).

  12. Estudo genético-clínico de 144 pacientes portadores de deficiência auditiva não sindrômica\\".


    Nancy Mizue Kokitsu Nakata


    A deficiência auditiva constitui uma importante categoria de defeitos congênitos que podem se manifestar isoladamente ou fazer parte do espectro fenotípico de várias síndromes. O presente trabalho refere-se ao estudo genéticoclínico de pacientes portadores de deficiência auditiva não sindrômica, com os objetivos de estabelecer a razão sexual, tipo, grau, simetria, lateralidade e progressão da deficiência auditiva; determinar diagnósticos etiológicos prováveis da deficiência auditiva, estabele...

  13. The Critical Technologies Project Executive Summary (United States)


    Materials with the Not covered Chalcopyrite Structure 7.8.23 Rare Earth- Transition Metal Permanent Not covered I Magnets (exanple: samarium cobalt and... Transition Metal Permanent - Magnets (example: samarium cobalt I and substituted samarium cobalt) New 7.8.24 Gadolinium Gallium Garnet (GGG) - - and...III T i mm~ 1.W 8 Poesse Maclw Tools 1110 1129. 1131 133 1142 0 F -~, oO 16.qm P c Metals 1145, 1203, 1236 4203 1365 00, awm.wq *4 1303 1311

  14. sup 8 sup 9 Sr and sup 1 sup 5 sup 3 Sm-EDTMP therapy of disseminated skeletal metastasis

    CERN Document Server

    Zhang Jun Ning; Zhu Shou Peng


    A retrospective analysis was performed on 72 patients with disseminated skeletal metastasis to evaluate the effect of strontium-89 or samarium-153 EDTMP therapy. There existed 87.88% of clinical response, 12.12% of no response in the group treated with strontium-89 as compared with 90.24% of clinical response, 9.76% no response in one treated with samarium-153 EDTMP; and there were no correlation between the treatment results and the amounts of isotopes administrated. The results suggest that strontium-89 or samarium-153 EDTMP therapy is a method of first choice in the palliative treatment for disseminated skeletal metastasis

  15. General Information about Osteosarcoma and Malignant Fibrous Histiocytoma of Bone (United States)

    ... providers who are experts in treating cancer in children. Treatment for osteosarcoma or malignant fibrous histiocytoma may cause side effects. Four types of standard treatment are used: Surgery Chemotherapy Radiation therapy Samarium New types of treatment are ...

  16. Treatment Option Overview (Osteosarcoma and Malignant Fibrous Histiocytoma of Bone) (United States)

    ... providers who are experts in treating cancer in children. Treatment for osteosarcoma or malignant fibrous histiocytoma may cause side effects. Four types of standard treatment are used: Surgery Chemotherapy Radiation therapy Samarium New types of treatment are ...

  17. Maximum Permissible Concentrations and Negligible Concentrations for Rare Earth Elements (REEs)

    NARCIS (Netherlands)

    Sneller FEC; Kalf DF; Weltje L; Wezel AP van; CSR


    In dit rapport worden maximaal toelaatbare risiconiveaus (MTR) en verwaarloosbare risiconiveaus (VR) afgeleid voor zeldzame aardmetalen (ZAM). De geselecteerde ZAMs zijn Yttrium (Y), Lanthanum (La), Cerium (Ce), Praseodymium (Pr), Neodymium (Nd), Samarium (Sm), Gadolinium (Gd), en Dysprosium

  18. Bulletin of the Chemical Society of Ethiopia - Vol 31, No 3 (2017)

    African Journals Online (AJOL)

    A novel samarium complex with interesting photoluminescence and semiconductive properties · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. D. W. Zhang, W. T. Chen, Y. F.Wang, 435-444 ...

  19. Specialty Metals: DOD Dissemination of National Security Waiver Information Could Enhance Awareness and Compliance with Restrictions (United States)


    Restrictions Why GAO Did This Study Specialty metals—such as titanium, certain steel alloys , and samarium- cobalt alloy magnets—are essential to DOD...highly magnetic, lightweight, corrosion resistant, or having high durability. Among these metals are samarium- cobalt alloy magnets used to make radar...the following elements: aluminum, chromium , cobalt , columbium, molybdenum, nickel, titanium, tungsten, or vanadium. Specialty metals were added

  20. Development of a methodology for the separation of europium and samarium from a mixture of rare earth oxides by electroreduction/ precipitation; Desenvolvimento de uma metodologia para a separacao de samario e europio a partir de mistura de oxidos de terras raras por reducao eletroquimica/precipitacao

    Energy Technology Data Exchange (ETDEWEB)

    Chepcanoff, Vera


    The rare earths (RE) were first used in 1903, when Welsbach developed a lighter that is still used today. Nowadays, the RE are employed in many different fields, as in the production of super-alloys , as catalysts for petroleum industry, in the manufacture of non-ferrous alloys, color television tubes, x-ray screens, special glasses, ceramics, computer industries, nuclear medicine, lasers, pigments, etc., moving, in the last decade , a market of US$ 2 billions per year. Due to their similar properties, the RE elements are very difficult to separate, requiring complex processes, what make the products very expensive. Elements like Eu and Sm, which contents in the minerals are low (0.05% and 2.0%, respectively, in monazite) are extremely expensive, but their field of application justifies the research for looking for other processes, more simple and/or more effective. Trivalent state is a characteristic of all RE, but some of them presents oxidation state +2, like Ce, Eu, Sm and Yb. In the case of Eu and Sm, the focus of the present work, the divalent state is achieved by electro-reduction in the potentials -0.65 and -1.55 (SCE), respectively. This makes possible the separation of these elements from the other rare earths and from each other. Thus, making use of this characteristic, a process for the individual separation of Eu and Sm in (NH{sub 4}){sub 2}SO{sub 4} solution by electro-reduction/precipitation is proposed, where Sm is first separated from the solution as sulfate, and Eu, that remains in the solution, is precipitated after the decrease of temperature and potential applied. The process developed from a synthetic Eu and Sm solution was applied to a mixture of semi-heavy RE oxide, produced at IPEN-CNEN/SP, obtaining the separation of Sm. This product was analyzed by spectrophotometry, showing high purity. (author)

  1. Tetrakis[μ-2-(3,4-dimethoxyphenylacetato]-κ4O:O′;κ3O,O′:O;κ3O:O,O′-bis{[2-(3,4-dimethoxyphenylacetato-κ2O,O′](1,10-phenanthroline-κ2N,N′samarium(III}

    Directory of Open Access Journals (Sweden)

    Jia-Lu Liu


    Full Text Available In the centrosymmetric dinuclear title complex, [Sm2(C10H11O46(C12H8N22], the SmIII ion is nine-coordinated by seven O atoms of five 2-(3,4-dimethoxyphenylacetate (DMPA ligands and two N atoms of one bis-chelating 1,10-phenanthroline (phen ligand, forming a distorted tricapped trigonal-prismatic environment. The DMPA ligands coordinate in bis-chelate, bridging and bridging tridentate modes. An intramolecular C—H...O hydrogen bond occurs. Intermolecular C—H...O interactions are also present in the crystal.

  2. Efficacy and safety of a once-daily single-tablet regimen of tenofovir, lamivudine, and efavirenz assessed at 144 weeks among antiretroviral-naïve and experienced HIV-1-infected Thai adults

    Directory of Open Access Journals (Sweden)

    Anchalee Avihingsanon


    Conclusions: This generic STR TDF/3TC/EFV is effective and well-tolerated. These findings lend support to the use of this generic STR as first-line antiretroviral therapy in resource-limited settings.

  3. Physical data collected from Seaglider SG144 during Ocean Station PAPA June 2008 in the North Pacific Ocean, Gulf of Alaska deployed from 2008-06-08 to 2008-08-30 (NCEI Accession 0155762) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Seaglider is a buoyancy driven autonomous underwater vehicle (AUV) developed by scientists and engineers at the University of Washington's School of Oceanography and...

  4. (E-1-(4,4′′-Difluoro-5′-methoxy-1,1′:3′,1′′-terphenyl-4′-yl-3-(6-methoxynaphthalen-2-ylprop-2-en-1-one

    Directory of Open Access Journals (Sweden)

    Hoong-Kun Fun


    Full Text Available In the title compound, C33H24F2O3, the central benzene ring makes dihedral angles of 44.71 (10, 47.80 (10 and 63.68 (9° with the two fluoro-substituted benzene rings and the naphthalene ring system, respectively. In the crystal, molecules are connected via intermolecular C—H...F and C—H...O hydrogen bonds. Furthermore, the crystal structure is stabilized by weak C—H...π and π–π interactions [centroid–centroid distance = 3.6816 (13 Å].

  5. Talking Over the Years Sandra Evans Talking Over the Years and Jane Gamer (Eds) Brunner-Routledge 290 pp £17.99 158391 144 8 1583911448 [Formula: see text]. (United States)


    This book addresses a relatively neglected area in the care of older adults. Its theoretical position is from a psychodynamic perspective - often thought not to be relevant to older adults. The chapters in part one give a brief account of the theories of eminent psychotherapists such as Melanie Kline, Erik Erickson and Sigmund Freud. Within each of these chapters, however, is not only the theoretical frame but also clinical examples relevant to all professions caring for older adults.

  6. CRED Sea Surface Temperature (SST) Buoy; CNMI, GUA; Long: 144.79778, Lat: 13.51902 (WGS84); Sensor Depth: 0.33m; Data Range: 20030924-20040531. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Sea Surface Temperature (SST) Buoys provide a time series of...

  7. CRED Sea Surface Temperature (SST) Buoy; CNMI, GUA; Long: 144.80048, Lat: 13.52900 (WGS84); Sensor Depth: 0.19m; Data Range: 20070513-20090405. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Sea Surface Temperature (SST) Buoys provide a time series of...

  8. CRED Sea Surface Temperature (SST) Buoy; CNMI, GUA; Long: 144.80047, Lat: 13.52900 (WGS84); Sensor Depth: 0.33m; Data Range: 20051005-20070513. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Sea Surface Temperature (SST) Buoys provide a time series of...

  9. Geochemical and multi-isotopic (87Sr/86Sr, 143Nd/144Nd, 238U/235U) perspectives of sediment sources, depositional conditions, and diagenesis of the Marcellus Shale, Appalachian Basin, USA (United States)

    Phan, Thai T.; Gardiner, James B.; Capo, Rosemary C.; Stewart, Brian W.


    We investigate sediment sources, depositional conditions and diagenetic processes affecting the Middle Devonian Marcellus Shale in the Appalachian Basin, eastern USA, a major target of natural gas exploration. Multiple proxies, including trace metal contents, rare earth elements (REE), the Sm-Nd and Rb-Sr isotope systems, and U isotopes were applied to whole rock digestions and sequentially extracted fractions of the Marcellus shale and adjacent units from two locations in the Appalachian Basin. The narrow range of εNd values (from -7.8 to -6.4 at 390 Ma) is consistent with derivation of the clastic sedimentary component of the Marcellus Shale from a well-mixed source of fluvial and eolian material of the Grenville orogenic belt, and indicate minimal post-depositional alteration of the Sm-Nd system. While silicate minerals host >80% of the REE in the shale, data from sequentially extracted fractions reflect post-depositional modifications at the mineralogical scale, which is not observed in whole rock REE patterns. Limestone units thought to have formed under open ocean (oxic) conditions have δ238U values and REE patterns consistent with modern seawater. The δ238U values in whole rock shale and authigenic phases are greater than those of modern seawater and the upper crust. The δ238U values of reduced phases (the oxidizable fraction consisting of organics and sulfide minerals) are ∼0.6‰ greater than that of modern seawater. Bulk shale and carbonate cement extracted from the shale have similar δ238U values, and are greater than δ238U values of adjacent limestone units. We suggest these trends are due to the accumulation of chemically and, more likely, biologically reduced U from anoxic to euxinic bottom water as well as the influence of diagenetic reactions between pore fluids and surrounding sediment and organic matter during diagenesis and catagenesis.

  10. Multibeam collection for TN144: Multibeam data collected aboard Thomas G. Thompson from 2002-04-22 to 2002-04-26, departing from Seattle, WA and returning to Seattle, WA (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set is part of a larger set of data called the Multibeam Bathymetry Database (MBBDB) where other similar data can be found at...

  11. CRED Ocean Data Platform (ODP), Acoustic Doppler Profiler (ADP); Guam, SRR; Long: 144.41784, Lat: 12.83819 (WGS84); Sensor Depth: 20.40m; Data Range: 20030929-20050908. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Ocean Data Platform (ODP) is placed on the sea floor to measure water current profiles, waves, temperature and conductivity. The ODP consists of an upward...

  12. CRED Ocean Data Platform (ODP), Acoustic Doppler Profiler (ADP); Guam, SRR; Long: 144.41778, Lat: 12.83819 (WGS84); Sensor Depth: 20.42m; Data Range: 20051007-20070121. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Ocean Data Platform (ODP) is placed on the sea floor to measure water current profiles, waves, temperature and conductivity. The ODP consists of an upward...

  13. Physical data collected from Seaglider SG144 during Ocean Station PAPA June 2009 in the North Pacific Ocean, Gulf of Alaska deployed from 2009-06-14 to 2010-04-02 (NCEI Accession 0155879) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Seaglider is a buoyancy driven autonomous underwater vehicle (AUV) developed by scientists and engineers at the University of Washington's School of Oceanography and...

  14. A Review of Introducing Issues with Opposing Viewpoints: Animal Rights. By Lauri S. Friedman. Greenhaven Press: Farmington Hills, MI, USA, 2010; Hardcover, 144 pp; Price: $33.58; ISBN: 978-0737749373

    Directory of Open Access Journals (Sweden)

    Lee J. Markowitz


    Full Text Available Given the volatile nature of animal rights issues and the extensive array of writings on the topic, one might expect several introductory anthologies to be available. The only anthologies in print, however, are scholarly tomes (listed below geared towards more advanced readers. Fortunately, Lauri S. Friedman, author of dozens of anthologies on controversial topics such as gun control, national security, terrorism, fast food, sexually transmitted diseases, and many other topics, fills this void well with her volume titled Introducing Issues with Opposing Viewpoints: Animal Rights. She has included articles by influential authors in a diverse range of lay outlets such as The Wall Street Journal, Slate, Guardian, Christianity Today, Food & Wine, among others. Below, I describe the contents of the book, its strengths and weaknesses, and how educators might use the book in classroom settings.

  15. CRED Subsurface Temperature Recorder (STR); Farallon de Pajaros, Commonwealth of the Northern Mariana Islands; Long: 144.88559, Lat: 20.54514 (WGS84); Sensor Depth: 18.90m; Data Date Range: 20090428-20110417. (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Data from Coral Reef Ecosystem Division (CRED), NOAA Pacific Islands Fisheries Science Center (PIFSC) Subsurface Temperature Recorders (STR) provide a time series of...

  16. Users of Virtual Reference Are More Satisfied with the Service They Receive than the Providers of that Service Think They Are. A Review of: Hansen, D., Johnson, M., Norton, E., & McDonough, A. (2009. Virtual provider pessimism: Analysing instant messaging reference encounters with the pair perception comparison method. Information Research, 14(4. Retrieved from paper416.html

    Directory of Open Access Journals (Sweden)

    Carol D. Howe


    Full Text Available Objective – To examine provider pessimism by comparing user and provider perception of the same instant messaging reference transaction.Design – Instant messaging users and providers completed post-reference transaction surveys which were analyzed using the pair perception comparison method.Setting – A large research university in the United States.Subjects – Two hundred undergraduate journalism students (users of the instant messaging service and 51 Master of Library Science (MLS students enrolled in a reference services class (providers of the instant messaging service.Methods – The authors created a research help webpage from which users could access the instant messaging service. Prior to service availability, providers received reference instruction and demonstrated reference aptitude through in-class activities. The authors briefed providers on the project and provided a wiki containing resources they might need during reference transactions. Providers worked in two-hour shifts, and two providers were available during each shift. The service was available for one week while potential users completed a journalism assignment. The authors asked both users and providers of the service to complete an online survey at the conclusion of the reference transaction. Users and providers completed different surveys, but both types included the following four elements: questions to aid in matching a user to a provider; questions about satisfaction with the service based on guidelines put forth by the Reference and User Services Association (RUSA; open-ended questions about the reference transaction; and questions regarding demographics, prior reference service usage, and knowledge of instant messaging. There were 55 valid reference transactions, and from those, the authors matched 26 pairs of user and provider surveys. The authors analyzed paired surveys to (a compare the user’s perception of the reference transaction with the provider’s guess about the user’s perception and (b compare the provider’s self-perception of the reference transaction with the provider’s guess about the user’s perception. The authors introduced the pair perception comparison method for the analysis using two-tailed paired t-tests and Wilcoxon signed-rank tests.Main Results – Analysis of background information showed that users were younger on average than providers and used instant messaging more frequently. Even so, most users and providers felt comfortable with instant messaging.When providers were asked to guess how satisfied overall they thought the user was with the reference transaction, they reported on average that the user was less satisfied than the user actually was. These results were statistically significant. The authors found no significant difference between the providers’ overall satisfaction with the service they provided and their guesses about the users’ overall satisfaction.The authors also analyzed the matched pairs on 14 specific aspects of satisfaction gathered from surveys. When comparing the users’ satisfaction with the service they received and the providers’ guesses about the users’ satisfaction, the providers underestimated the users’ satisfaction on average for all 14 dimensions. The authors found statistically significant differences with regard to 7 of the 14 dimensions: tempo, ease of use, friendliness, understanding, accuracy, follow up, and spelling. When comparing the providers’ satisfaction with a given reference transaction and their guesses about the users’ satisfaction with the same reference transaction, the authors found significant differences for 3 of the 14 dimensions: interest, resource type, and accuracy.Conclusion – This study has shown for instant messaging reference what other studies have shown for face-to-face reference—that provider pessimism exists. Whatever the environment, providers of reference tend to judge themselves more harshly than the people they are helping judge them. Based on a review of the literature, the authors further note that both expert and novice reference providers experience such pessimism. The authors are hopeful that providers will view these results as evidence of their own competence during instant messaging reference transactions.The results of this study provide valuable information for training instant messaging providers. For example, the fact that providers thought users were less satisfied with the tempo of the reference transaction than they really were suggested to the authors that instant messaging providers need not be so concerned about giving a quick answer. An accurate answer is more desirable. In the same vein, providers thought that users were more concerned with spelling than they really were. Both of these cases, and others gleaned from the results, provide insight into what aspects of the reference transaction providers should spend their time and effort on.Finally, the authors introduced the pair perception comparison method to compare feedback from matched pairs on individual reference transactions, a methodology not used in any earlier studies. They deemed this method to be an effective way to uncover biases and false assumptions.

  17. Preparation, and Luminescence Properties of SiO2@Sm(MABA-Siphen Core-Shell Structure Nanometer Composite

    Directory of Open Access Journals (Sweden)

    Feng Li-Na


    Full Text Available A novel ternary samarium complex was prepared using HOOCC6H4N(CONH(CH23Si- (OCH2CH332 (MABA-Si as first ligand, and phen as second ligand. The corresponding SiO2@Sm(MABA-Siphen core-shell structure nanometer composite was synthesized as well, and the silica spheres was the core, and the ternary samarium complex was the shell layer. The ternary samarium complex has been characterized by element analysis, molar conductivity and IR spectra. The results show that the chemical formula of the complex is Sm(MABA-Si(phen2(ClO43·2H2O. The fluorescent spectra illustrat that the luminescence properties of the samarium complex are superior. The core-shell structure of SiO2@Sm(MABA-Siphen nanometer composite is characterized by SEM, TEM and IR spectra. The SiO2@Sm(MABA-Siphen core-shell structure composites exhibit stronger emission intensity than the ternary samarium complex. The fluorescence lifetime of the complex and core-shell structure composite is measured as well.

  18. Udvikling af materialer til brintpermeable membraner

    DEFF Research Database (Denmark)

    Bentzer, Henrik Karnøe

    Due to global warming as well as other factors, it is necessary to find alternatives to the current consumption of fossil fuels. Oxide materials with high protonic conductivity can potentially find application within many different technological fields in a society that is based on renewable energy...... doped samarium titanate, lanthanum magnesium titanate and strontium cerate doped with yttrium and nickel. Concentration cell measurements were used to estimate transport numbers for protons and oxide ions in yttrium doped strontium cerate and calcium doped samarium titanate. Furthermore, the voltage...

  19. {6,6′-Dimethoxy-2,2′-[ethane-1,2-diylbis(nitrilomethylidyne]diphenolato-1κ4O1,O1′,O6,O6′:2κ4O1,N,N′,O1′}(ethanol-1κO-μ-nitrato-1:2κ2O:O′-dinitrato-1κ4O,O′-samarium(IIIzinc(II

    Directory of Open Access Journals (Sweden)

    Qiang Huang


    Full Text Available In the title heteronuclear ZnII–SmIII complex, [SmZn(C18H18N2O4(NO33(CH3CH2OH], with the hexadentate Schiff base compartmental ligand N,N′-bis(3-methoxysalicylideneethylenediamine (H2L, the SmIII and ZnII ions are triply bridged by two phenolate O atoms from the Schiff base ligand and one nitrate anion. The five-coordinate ZnII ion is in a square-pyramidal geometry formed by the donor centers of two imine N atoms, two phenolate O atoms and one of the bridging nitrate O atoms. The SmIII center is in a ten-fold coordination of O atoms, involving the phenolate O atoms, two methoxy O atoms, one ethanol O atom, and two O atoms from two nitrate anions and one from the bridging nitrate anion. In the crystal, intermolecular O—H...O and C—H...O interactions generate a layer structure extending parallel to (101.

  20. The age of the martian meteorite Northwest Africa 1195 and the differentiation history of the shergottites

    Energy Technology Data Exchange (ETDEWEB)

    Symes, S; Borg, L; Shearer, C; Irving, A


    Samarium-neodymium isotopic analyses of unleached and acid-leached mineral fractions from the recently identified olivine-bearing shergottite Northwest Africa 1195 yield a crystallization age of 348 {+-} 19 Ma and an {var_epsilon}{sub Nd}{sup 143} value of +40.1 {+-} 1.3. Maskelynite fractions do not lie on the Sm-Nd isochron and appear to contain a martian surface component with low {sup 147}Sm/{sup 144}Nd and {sup 143}Nd/{sup 144}Nd ratios that was added during shock. The Rb-Sr system is disturbed and does not yield an isochron. Terrestrial Sr appears to have affected all of the mineral fractions, although a maximum initial {sup 87}Sr/{sup 86}Sr ratio of 0.701614 {+-} 16 is estimated by passing a 348 Ma reference isochron through the maskelynite fraction that is least affected by contamination. The high initial {var_epsilon}{sub Nd}{sup 143} value and the low initial {sup 87}Sr/{sup 86}Sr ratio, combined with the geologically young crystallization age, indicate that Northwest Africa 1195 is derived from a source region characterized by a long-term incompatible element depletion. The age and initial Sr and Nd isotopic compositions of Northwest Africa 1195 are very similar to those of Queen Alexandra Range 94201, indicating these samples were derived from source regions with nearly identical Sr-Nd isotopic systematics. These similarities suggest that these two meteorites share a close petrogenetic relationship and might have been erupted from a common volcano. The meteorites Yamato 980459, Dar al Gani 476, Sayh al Uhaymir 005/008, and Dhofar 019 also have relatively old ages between 474-575 Ma and trace element and/or isotopic systematics that are indicative of derivation from incompatible-element-depleted sources. This suggests that the oldest group of meteorites is more closely related to one another than they are to the younger meteorites that are derived from less incompatible-element-depleted sources. Closed-system fractional crystallization of this suite of