WorldWideScience

Sample records for samarium 144 target

  1. Bone-seeking radiopharmaceuticals as targeted agents of osteosarcoma: samarium-153-EDTMP and radium-223.

    Science.gov (United States)

    Anderson, Peter M; Subbiah, Vivek; Rohren, Eric

    2014-01-01

    Osteosarcoma is a cancer characterized by formation of bone by malignant cells. Routine bone scan imaging with Tc-99m-MDP is done at diagnosis to evaluate primary tumor uptake and check for bone metastases. At time of relapse the Tc-99m-MDP bone scan also provides a specific means to assess formation of bone by malignant osteosarcoma cells and the potential for bone-seeking radiopharmaceuticals to deliver radioactivity directly into osteoblastic osteosarcoma lesions. This chapter will review and compare a bone-seeking radiopharmaceutical that emits beta-particles, samarium-153-EDTMP, with an alpha-particle emitter, radium-223. The charged alpha particles from radium-223 have far more mass and energy than beta particles (electrons) from Sm-153-EDTMP. Because radium-223 has less marrow toxicity and more radiobiological effectiveness, especially if inside the bone forming cancer cell than samarium-153-EDTMP, radium-223 may have greater potential to become widely used against osteosarcoma as a targeted therapy. Radium-223 also has more potential to be used with chemotherapy against osteosarcoma and bone metastases. Because osteosarcoma makes bone and radium-223 acts like calcium, this radiopharmaceutical could possibly become a new targeted means to achieve safe and effective reduction of tumor burden as well as facilitate better surgery and/or radiotherapy for difficult to resect large, or metastatic tumors.

  2. Targeted bone marrow radioablation with 153Samarium-lexidronam promotes allogeneic hematopoietic chimerism and donor-specific immunologic hyporesponsiveness.

    Science.gov (United States)

    Inverardi, Luca; Linetsky, Elina; Pileggi, Antonello; Molano, R Damaris; Serafini, Aldo; Paganelli, Giovanni; Ricordi, Camillo

    2004-03-15

    Transplantation tolerance, defined as acceptance of a graft by an otherwise fully immunocompetent host, has been an elusive goal. Although robust tolerance has been achieved by the induction of stable hematopoietic chimerism after bone marrow transplantation, lethal or sublethal radiation conditioning used to induce long-term chimerism precludes its clinical use. We studied whether targeted delivery of radiation to bone marrow could allow for bone marrow cell (BMC) engraftment, chimerism, and donor-specific tolerance in the absence of the side effects associated with external irradiation. We administered a radioactive bone-seeking compound (Samarium-Lexidronam, Quadramet, Berlex Laboratories, Wayne, NJ) together with transient T-cell costimulatory blockade to recipient mice. Allogeneic BMCs were given 7 or 14 days after preconditioning. Costimulatory blockade was obtained by the use of an anti-CD154 antibody for 4 weeks. Chimerism was assessed by flow cytometry. Mice then received donor-specific and third-party skin grafts. Graft survival was analyzed with mechanisms of donor-specific hyporesponsiveness. High levels of stable chimerism across an allogeneic barrier were achieved in mice by a single administration of Samarium-Lexidronam, transient T-cell costimulatory blockade, and BMC transplantation. A large percentage of chimeric animals retained donor-derived skin grafts for more than 120 days without requiring additional immunosuppression, suggesting that harsh cytotoxic preconditioning is not necessary to achieve stable chimerism and donor specific hyporesponsiveness. Analysis of the T-cell repertoire in chimeras indicates T-cell deletional mechanisms. These data broaden the potential use of BMC transplantation for tolerance induction and argue for its potential in treating autoimmune diseases.

  3. MicroRNA-144-3p suppresses tumor growth and angiogenesis by targeting SGK3 in hepatocellular carcinoma.

    Science.gov (United States)

    Wu, Manya; Huang, Chaoyuan; Huang, Xinping; Liang, Rong; Feng, Yan; Luo, Xiaoling

    2017-10-01

    In our previous studies, the Illumine Soledad massively parallel signature sequencing of miRNomes in non‑tumor and hepatocellular carcinoma (HCC) tissues revealed that microRNA (miR)-144-3p was significantly downregulated in HCC, but its role in HCC development, especially angiogenesis, remains unclear. In this investigation, we found recovering miR‑144‑3p expression can significantly suppress the growth, migration and induced angiogenic capacity of HCC cells through both in vivo and in vitro experiments. Moreover, clinical correlation analysis showed that low expression of miR‑144‑3p was positively correlated to poor disease-free survival (DFS) of HCC patients. Mechanistically, serum and glucocorticoid kinase 3 (SGK3), the putative targets of miR‑144‑3p, was predicted by Target Scan database and identified to be suppressed by miR‑144‑3p so that inhibiting the activation of mTOR-VEGF downstream signals was activated by the phosphoinositide 3-kinase (PI3K)-independent pathway. Hence, we concluded that miR‑144‑3p, which is frequently downregulated in HCC, can inhibit proliferation, migration and repress angiogenesis by regulating SGK3 activation with PI3K independent signal pathway, and acts as a prognostic factor for HCC patients.

  4. miR-144 attenuates the host response to influenza virus by targeting the TRAF6-IRF7 signaling axis.

    Directory of Open Access Journals (Sweden)

    Carrie M Rosenberger

    2017-04-01

    Full Text Available Antiviral responses must rapidly defend against infection while minimizing inflammatory damage, but the mechanisms that regulate the magnitude of response within an infected cell are not well understood. miRNAs are small non-coding RNAs that suppress protein levels by binding target sequences on their cognate mRNA. Here, we identify miR-144 as a negative regulator of the host antiviral response. Ectopic expression of miR-144 resulted in increased replication of three RNA viruses in primary mouse lung epithelial cells: influenza virus, EMCV, and VSV. We identified the transcriptional network regulated by miR-144 and demonstrate that miR-144 post-transcriptionally suppresses TRAF6 levels. In vivo ablation of miR-144 reduced influenza virus replication in the lung and disease severity. These data suggest that miR-144 reduces the antiviral response by attenuating the TRAF6-IRF7 pathway to alter the cellular antiviral transcriptional landscape.

  5. Utilizing assumption for project of stand for solid state targets activation on inner beams of AIC-144 cyclotron; Zalozenia uzytkowe do projektu stanowiska do aktywacji tarcz w stanie stalym na wiazce wewnetrznej cyklotronu AIC-144

    Energy Technology Data Exchange (ETDEWEB)

    Petelenz, B. [The H. Niewodniczanski Inst. of Nuclear Physics, Cracow (Poland)

    1997-09-01

    General assumptions for project of target activation stand at AIC-144 cyclotron are presented. The project predicts production of {sup 67}Ga, {sup 111}In, {sup 201}Tl, {sup 139}Ce, {sup 88}Y, {sup 123}I and {sup 211}At isotopes using various target backings. Directions concerning target cooling and beam parameters are also described 25 refs, 1 tab

  6. Loss of the miR-144/451 cluster impairs ischaemic preconditioning-mediated cardioprotection by targeting Rac-1

    Science.gov (United States)

    Wang, Xiaohong; Zhu, Hongyan; Zhang, Xiaowei; Liu, Yong; Chen, Jing; Medvedovic, Mario; Li, Hongliang; Weiss, Mitchell J.; Ren, Xiaoping; Fan, Guo-Chang

    2012-01-01

    Aims While a wealth of data has uncovered distinct microRNA (miR) expression alterations in hypertrophic and ischaemic/reperfused (I/R) hearts, little is known about miR regulation and response to ischaemic preconditioning (IPC). Methods and results We analysed miRs in murine hearts preconditioned with six cycles of 4 min ischaemia via coronary artery occlusion, followed by 4 min reperfusion in vivo. Both miRs within the miR-144/451 cluster were the most elevated among a cohort of 21 dysregulated miRs in preconditioned hearts, compared with shams. To investigate the significance of this finding, we examined IPC-mediated cardioprotection within a miR-144/451-knockout (KO) mouse model. Wild-type (WT) hearts exposed to IPC followed by I/R (30 min/24 h) showed a smaller infarction size compared with mice treated with I/R alone. In contrast, IPC failed to protect miR-144/451-KO hearts against infarct caused by I/R treatment. Thus, the miR-144/451 cluster is required for IPC-elicited cardioprotection. Rac-1, a key component of NADPH oxidase, was mostly up-regulated in KO hearts among three bona fide targets (Rac-1, 14-3-3ζ, and CUGBP2) for both miR-144 and miR-451. Accordingly, reactive oxygen species (ROS) levels were markedly increased in KO hearts upon IPC, compared with IPC-WT hearts. Pre-treatment of KO hearts with a Rac-1 inhibitor NSC23766 (20 mg/kg, ip) reduced IPC-triggered ROS levels and restored IPC-elicited cardioprotection. Using antagomiRs, we showed that miR-451 was largely responsible for IPC-mediated cardioprotection. Conclusion Loss of the miR-144/451 cluster limits IPC cardioprotection by up-regulating Rac-1-mediated oxidative stress signalling. PMID:22354898

  7. Biodistribution of samarium-153-EDTMP in rats treated with docetaxel

    Energy Technology Data Exchange (ETDEWEB)

    Villarim Neto, Arthur; Acucena, Maria Kadja Meneses Torres; Pereira, Kercia Regina Santos Gomes; Rego, Amalia Cinthia Meneses [Universidade Federal do Rio Grande do Norte (UFRN), Natal, RN (Brazil). Postgraduate Program in Health Sciences; Azevedo, Italo Medeiros; Medeiros, Aldo Cunha [Universidade Federal do Rio Grande do Norte (UFRN), Natal, RN (Brazil). Dept. of Surgery; Bernardo-Filho, Mario [State University of Rio de Janeiro, RJ (Brazil). Dept. of Biophysics and Biometry

    2009-01-15

    Purpose: Many patients with metastatic bone disease have to use radiopharmaceuticals associated with chemotherapy to relieve bone pain. The aim of this study was to assess the influence of docetaxel on the biodistribution of samarium-153-EDTMP in bones and other organs of rats. Methods: Wistar male rats were randomly allocated into 2 groups of 6 rats each. The DS (docetaxel/samarium) group received docetaxel (15 mg/kg) intraperitoneally in two cycles 11 days apart. The S (samarium/control) group rats were not treated with docetaxel. Nine days after chemotherapy, all the rats were injected with 0.1 ml of samarium-153-EDTMP via orbital plexus (25 {mu} Ci. After 2 hours, the animals were killed and samples of the brain, thyroid, lung, heart, stomach, colon, liver, kidney and both femurs were removed. The percentage radioactivity of each sample (% ATI / g) was determined in an automatic gamma-counter (Wizard-1470, Perkin-Elmer, Finland). Results: On the ninth day after the administration of the second chemotherapy cycle, the rats had a significant weight loss (314.50 +- 22.09 g) compared (p<0.5) to pre-treatment weight (353.66 {+-} 22.8). The % ATI/g in the samples of rats treated with samarium-153-EDTMP had a significant reduction in the right femur, left femur, kidney, liver and lungs of animals treated with docetaxel, compared to the control rats. Conclusion: The combination of docetaxel and samarium-153-EDTMP was associated with a lower response rate in the biodistribution of the radiopharmaceutical to targeted tissues. Further investigation into the impact of docetaxel on biodistribution of samarium-153-EDTMP would complement the findings of this study. (author)

  8. The Basis for Developing Samarium AMS for Fuel Cycle Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Buchholz, B A; Biegalski, S R; Whitney, S M; Tumey, S J; Weaver, C J

    2008-10-13

    Modeling of nuclear reactor fuel burnup indicates that the production of samarium isotopes can vary significantly with reactor type and fuel cycle. The isotopic concentrations of {sup 146}Sm, {sup 149}Sm, and {sup 151}Sm are potential signatures of fuel reprocessing, if analytical techniques can overcome the inherent challenges of lanthanide chemistry, isobaric interferences, and mass/charge interferences. We review the current limitations in measurement of the target samarium isotopes and describe potential approaches for developing Sm-AMS. AMS sample form and preparation chemistry will be discussed as well as possible spectrometer operating conditions.

  9. CDCC calculations of fusion of 6Li with targets 144Sm and 154Sm: effect of resonance states

    Science.gov (United States)

    Gómez Camacho, A.; Lubian, J.; Zhang, H. Q.; Zhou, Shan-Gui

    2017-12-01

    Continuum Discretized Coupled-Channel (CDCC) model calculations of total, complete and incomplete fusion cross sections for reactions of the weakly bound 6Li with 144,154Sm targets at energies around the Coulomb barrier are presented. In the cluster structure frame of 6Li→α+d, short-range absorption potentials are considered for the interactions between the ground state of the projectile 6Li and α-d fragments with the target. In order to separately calculate complete and incomplete fusion and to reduce double-counting, the corresponding absorption potentials are chosen to be of different range. Couplings to low-lying excited states 2+, 3‑ of 144Sm and 2+, 4+ of 154Sm are included. So, the effect on total fusion from the excited states of the target is investigated. Similarly, the effect on fusion due to couplings to resonance breakup states of 6Li, namely, l=2, J π =3+,2+,1+ is also calculated. The latter effect is determined by using two approaches, (a) by considering only resonance state couplings and (b) by omitting these states from the full discretized energy space. Among other things, it is found that both resonance and non-resonance continuum breakup couplings produce fusion suppression at all the energies considered. A. Gómez Camacho from CONACYT, México, J. Lubian from CNPq, FAPERJ, Pronex, Brazil. S.G.Z was partly supported by the NSF of China (11120101005, 11275248, 11525524, 11621131001, 11647601, 11711540016), 973 Program of China (2013CB834400) and the Key Research Program of Frontier Sciences of CAS. H.Q.Z. from NSF China (11375266)

  10. Solar nebula heterogeneity in p-process samarium and neodymium isotopes.

    Science.gov (United States)

    Andreasen, Rasmus; Sharma, Mukul

    2006-11-03

    Bulk carbonaceous chondrites display a deficit of approximately 100 parts per million (ppm) in 144Sm with respect to other meteorites and terrestrial standards, leading to a decrease in their 142Nd/144Nd ratios by approximately 11 ppm. The data require that samarium and neodymium isotopes produced by the p process associated with photodisintegration reactions in supernovae were heterogeneously distributed in the solar nebula. Other samarium and neodymium isotopes produced by rapid neutron capture (r process) in supernovae and by slow neutron capture (s process) in red giants were homogeneously distributed. The supernovae sources supplying the p- and r-process nuclides to the solar nebula were thus disconnected or only weakly connected.

  11. Synthesis of Samarium Cobalt Nanoblades

    Energy Technology Data Exchange (ETDEWEB)

    Darren M. Steele

    2010-08-25

    As new portable particle acceleration technologies become feasible the need for small high performance permanent magnets becomes critical. With particle accelerating cavities of a few microns, the photonic crystal fiber (PCF) candidate demands magnets of comparable size. To address this need, samarium cobalt (SmCo) nanoblades were attempted to be synthesized using the polyol process. Since it is preferable to have blades of 1-2 {micro}m in length, key parameters affecting size and morphology including method of stirring, reaction temperature, reaction time and addition of hydroxide were examined. Nanoparticles consisting of 70-200 nm spherical clusters with a 3-5 nm polyvinylpyrrolidone (PVP) coating were synthesized at 285 C and found to be ferromagnetic. Nanoblades of 25nm in length were observed at the surface of the nanoclusters and appeared to suggest agglomeration was occurring even with PVP employed. Morphology and size were characterized using a transmission electron microscope (TEM). Powder X-Ray Diffraction (XRD) analysis was conducted to determine composition but no supportive evidence for any particular SmCo phase has yet been observed.

  12. Synthesis of samarium binding bleomycin - a possible NCT radiosensitizer

    Energy Technology Data Exchange (ETDEWEB)

    Mendes, B.M., E-mail: bmm@cdtn.b [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Mendes, T.M.; Campos, T.P.R., E-mail: campos@nuclear.ufmg.b [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil)

    2011-07-01

    Bleomycin (BLM) is a drug that has attractive features for the development of a new radiopharmaceutical, particularly with regard to neutron capture therapy (NCT) sensitized by Sm-149. It has the ability to chelate many metal ions. In vitro studies have shown that up to 78% of BLM present in a cell is accumulated inside the nucleus or in the nuclear membrane. In addition, this drug has higher affinity for tumor tissues than for normal tissues. Radioactive isotopes carried by this antibiotic would be taken preferentially to one important cellular targets DNA. Besides, BLM displays intrinsic anti-tumor activity - it is a chemotherapic antibiotic clinically used against some cancers. This study aimed to obtain bleomycin molecules bound to samarium (BLM-Sm) for NCT studies in vitro and in vivo. The binding technique employed in this work has great simplicity and low cost. Thin layer chromatography, high performance liquid chromatography, fast protein liquid chromatography and analysis by ICP-AES were applied to verify the binding molecule. ICP-AES results showed the presence of samarium in the sample peaks related to BLM-Sm. However, efficiency and stability of this bond needs to be investigated. (author)

  13. Particle-Size-Induced Valence Changes in Samarium Clusters

    Energy Technology Data Exchange (ETDEWEB)

    Mason, M. G.; Lee, S. -T.; Apai, G.; Davis, R. F.; Shirley, D. A.; Franciosi, A.; Weaver, J. H.

    1981-09-01

    Samarium clusters exhibit mixed-valence behavior which is sensitive to particle size. XPS and UPS data show samarium to be primarily divalent (4f{sup 6} ) at small particle size. The trivalent state (4f{sup 5} ) becomes progressively more abundant with increasing s1ze, becoming the dominant state for the bulk metal. These results are interpreted using a model in which band narrowing, due to reduced surface coordination, is more dominant than surface tension effects in establishing the valence of small samarium clusters.

  14. Yellow-green electroluminescence of samarium complexes of 8-hydroxyquinoline

    Energy Technology Data Exchange (ETDEWEB)

    Behzad, Sara Karimi; Najafi, Ezzatollah [Department of Chemistry Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Amini, Mostafa M., E-mail: m-pouramini@sbu.ac.ir [Department of Chemistry Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Janghouri, Mohammad; Mohajerani, Ezeddin [Laser Research Institute Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Ng, Seik Weng [Department of Chemistry, University of Malaya, 50603 Kuala Lumpur (Malaysia)

    2014-12-15

    Four novel samarium complexes were prepared by reacting samarium(III) nitrate with 8-hydroxyquinoline, 2-methyl-8-hydroxyquinoline, and 1,10-phenanthroline and utilized as emitting materials in the electroluminescence device. All complexes were characterized by elemental analysis, infrared, UV–vis and {sup 1}H NMR spectroscopes and the molecular structure of a representative complex, [Sm{sub 2}(Me-HQ){sub 4}(NO{sub 3}){sub 6}] (1), was determined by single-crystal X-ray diffraction. Utilization of a π-conjugated (phenanthroline) ligand as a second ligand in the structure of the samarium complexes resulted in red shifts in both absorption and fluorescence spectra of complexes and moderately enhanced the photoluminescence intensity and the fluorescence quantum yield. The maximum emission peaks showed that a good correlation exists between the nature of the substituent group on the 8-hydroxyquinoline and the addition of the π-conjugated ligand in the structure of samarium complexes and emission wavelength. Devices with samarium(III) complexes with structure of ITO/PEDOT:PSS (90 nm)/PVK:PBD:Sm(III) complexes (75 nm)/Al (180 nm) were fabricated. In the electroluminescence (EL) spectra of the devices, a strong ligand-centered emission and narrow bands arising from the {sup 4}G{sub 5/2}→{sup 6}H{sub J} transitions (J=7/2, 9/2, and 11/2) of the samarium ion were observed for the complexes. The electroluminescent spectra of the samarium complexes were red-shifted as compared with the PVK:PBD blend. We believe that the electroluminescence performance of OLED devices based on samarium complexes relies on overlaps between the absorption of the samarium compounds and the emission of PVK:PBD. This revealed that it is possible to evaluate the electroluminescence performance of the samarium compounds-doped OLED devices based on the emission of PVK:PBD and the absorption of the dopants. - Highlights: • Four novel photoluminescence samarium complexes have been synthesized.

  15. Optical characteristics of transparent samarium oxide thin films ...

    Indian Academy of Sciences (India)

    Optical characteristics of transparent samarium oxide thin films deposited by the radio-frequency sputtering technique. A A ATTA M M EL-NAHASS KHALED M ELSABAWY M M ABD EL-RAHEEM A M HASSANIEN A ALHUTHALI ALI BADAWI AMAR MERAZGA. Regular Volume 87 Issue 5 November 2016 Article ID 72 ...

  16. Optical properties of zinc–vanadium glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Zinc–vanadium glasses doped with samarium oxide having the chemical composition Sm2O3() ZnO(40-)V2O5(60) (where = 0.1–0.5 mol%) were prepared by melt quenching method. The density of these glasses was measured by Archimedes method; the corresponding molar volumes have also been calculated.

  17. Optical properties of samarium doped zinc–tellurite glasses

    Indian Academy of Sciences (India)

    Unknown

    Optical properties of samarium doped zinc–tellurite glasses. B ERAIAH. Department of Physics, Karnatak University, Dharwad 580 003, India. Present address: Department of Physics, Bangalore University, Bangalore 560 056, India. MS received 20 March 2006; revised 13 June 2006. Abstract. Glasses with the composition, ...

  18. Effect of second ligand on the luminescence of Samarium (III ...

    Indian Academy of Sciences (India)

    Effect of second ligand on the luminescence of Samarium (III) dibenzoylmethane complexes: Syntheses, crystal structures, thermal analysis and luminescence study. MUHAMMAD IDIRIS SALEH, MIN YEE CHOO, TAI WEI CHAN and MOHD R RAZALI. ∗. School of Chemical Sciences, Universiti Sains Malaysia, Penang, ...

  19. Effect of second ligand on the luminescence of Samarium (III ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences; Volume 127; Issue 12. Effect of second ligand on the luminescence of Samarium (III) dibenzoylmethane complexes: ... Muhammad Idiris Saleh1 Min Yee Choo1 Tai Wei Chan1 Mohd R Razali1. School of Chemical Sciences, Universiti Sains Malaysia, Penang, Malaysia ...

  20. Dependence of samarium-soil interaction on samarium concentration: Implications for environmental risk assessment.

    Science.gov (United States)

    Ramírez-Guinart, Oriol; Salaberria, Aitor; Vidal, Miquel; Rigol, Anna

    2018-03-01

    The sorption and desorption behaviour of samarium (Sm), an emerging contaminant, was examined in soil samples at varying Sm concentrations. The obtained sorption and desorption parameters revealed that soil possessed a high Sm retention capacity (sorption was higher than 99% and desorption lower than 2%) at low Sm concentrations, whereas at high Sm concentrations, the sorption-desorption behaviour varied among the soil samples tested. The fractionation of the Sm sorbed in soils, obtained by sequential extractions, allowed to suggest the soil properties (pH and organic matter solubility) and phases (organic matter, carbonates and clay minerals) governing the Sm-soil interaction. The sorption models constructed in the present work along with the sorption behaviour of Sm explained in terms of soil main characteristics will allow properly assessing the Sm-soil interaction depending on the contamination scenario under study. Moreover, the sorption and desorption K d values of radiosamarium in soils were strongly correlated with those of stable Sm at low concentrations (r = 0.98); indicating that the mobility of Sm radioisotopes and, thus, the risk of radioactive Sm contamination can be predicted using data from low concentrations of stable Sm. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Mechanism of the electrochemical deposition of samarium-based coatings

    Energy Technology Data Exchange (ETDEWEB)

    Ruiz, Edgar J. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Ortega-Borges, Raul [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Godinez, Luis A. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Chapman, Thomas W. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Meas-Vong, Yunny [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico)]. E-mail: yunnymeas@cideteq.mx

    2006-11-12

    Samarium-based films have been shown to form from aqueous solutions on the surfaces of metallic substrates such as steel or aluminum, and their presence has been reported to decrease substantially the corresponding corrosion rate of the underlying metallic substrate. Based on previous reports on the deposition of oxides or hydroxides of the closely related element cerium, this work demonstrates that samarium films are formed following a similar mechanism, which involves as the fundamental step an increase in interfacial pH resulting from cathodic oxygen-reduction or hydrogen-evolution reactions. With cyclic voltammetry (CV), electrochemical quartz-crystal microbalance (EQCM) measurements, rotating-disk electrode (RDE) tests, and surface characterization techniques, namely, scanning electron microscopy (SEM) and X-ray surface microanalysis (EDX), the postulated mechanism was verified, and the surface morphology of the resulting films was correlated with the nature of the reduction reaction that triggers film formation.

  2. Samarium Monosulfide (SmS): Reviewing Properties and Applications

    OpenAIRE

    Sousanis, Andreas; Smet, Philippe; Poelman, Dirk

    2017-01-01

    In this review, we give an overview of the properties and applications of samarium monosulfide, SmS, which has gained considerable interest as a switchable material. It shows a pressure-induced phase transition from the semiconducting to the metallic state by polishing, and it switches back to the semiconducting state by heating. The material also shows a magnetic transition, from the paramagnetic state to an antiferromagnetically ordered state. The switching behavior between the semiconducti...

  3. Optical properties of zinc–vanadium glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Abstract. Zinc–vanadium glasses doped with samarium oxide having the chemical composition Sm2O3(x). ZnO(40−x)V2O5(60)(where x = 0·1–0·5 mol%) were prepared by melt quenching method. The density of these glasses was measured by Archimedes method; the corresponding molar volumes have also been ...

  4. Synthesis of nano-pore samarium (III)-imprinted polymer for preconcentrative separation of samarium ions from other lanthanide ions via solid phase extraction

    Energy Technology Data Exchange (ETDEWEB)

    Shirvani-Arani, Simindokht [Center of Excellence in Electrochemistry, Department of Chemistry, University of Tehran, P.O.Box:14155-6455, Tehran (Iran, Islamic Republic of); Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of); Ahmadi, Seyed Javad [Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of)], E-mail: sjahmadi@aeoi.org.ir; Bahrami-Samani, Ali [Nuclear Engineering and Physics Department, Amir Kabir University, P.O.Box: 15875-4413, Tehran (Iran, Islamic Republic of); Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of); Ghannadi-Maragheh, Mohammad [Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of)

    2008-08-08

    A batch process was developed to separate samarium ions from some lanthanide ions by a novel solid phase which was prepared via the ion-imprinting technique. The samarium (III) ion-imprinted polymer (IIP) particles were synthesized by preparing the ternary complex of samarium ions with 5,7-dichloroquinoline-8-ol (DCQ) and 4-vinylpyridine (VP). Then, thermally copolymerization with styrene (functional monomer, STY) and divinylbenzene (cross-linking monomer, DVB) followed in the presence of 2-methoxy ethanol (porogen) and 2,2'-azobisisobutyronitrile (initiator, AIBN). The imprinted ion was removed by stirring the above particles with 50% (v/v) HCl to obtain the leached IIP particles. Moreover, control polymer (CP) particles were similarly prepared without the samarium ions. The unleached and leached IIP particles were characterized by X-ray diffraction (XRD), infra-red spectroscopy (IR), thermo gravimetric analysis (TGA) and scanning electron microscopy (SEM). Finally, preconcentration and selectivity studies for samarium and the other lanthanide ions were carried out. The preconcentration of the samarium (III) traces was studied during rebinding with the leached IIP particles as a function of pH, the weight of the polymer material, the preconcentration and the elution times, the eluent volume and the aqueous phase volume. These studies indicated that the samarium (III) amount as low as 1 {mu}g, present in 200 mL, could be preconcentrated into 25 mL of 1.0 M HCl.

  5. Ionization of Samarium by Chemical Releases in the Upper Atmosphere

    Science.gov (United States)

    Siefring, C. L.; Bernhardt, P. A.; Holmes, J. M.; Pedersen, T. R.; Caton, R.; Miller, D.; Groves, K. M.

    2014-12-01

    The release of Samarium vapor into the upper atmosphere was studied using during the Air Force Research Laboratory sponsored Metal Oxide Space Cloud (MOSC) rocket launches in May 2009. The Naval Research Laboratory supported these experiments with 3-D photochemical modeling of the artificial plasma cloud including (1) reactions with atomic oxygen, (2) photo excitation, (3) photoionization, (4) dissociative recombination, and (5) ion and neutral diffusion. NRL provided the experimental diagnostic instrument on the rocket which was a dual frequency radio beacon on the rocket to measure changes in total electron content. The AFRL provided ground based diagnostics of incoherent scatter radar and optical spectroscopy and imagery. The NRL Chemical Release Model (CRM) has over 600 excited states of atomic Samarium neutrals, atomic ions, along with Samarium Oxide Ions and electrons. Diffusive transport of neutrals in cylindrical geometry and ions along magnetic field lines is computed along with the reactive flow to predict the concentrations of Sm, Sm-Ion, Sm0, and SmO Ion. Comparison of the CRM with observations demonstrates that Sm release into the upper atmosphere initially produces enhanced electron densities and SmO-Ions. The diatomic ions recombine with electrons to yield neutral Sm and O. Only the photo ionization of Sm yields a stable atomic ion that does not substantially recombine. The MOSC releases in sunlight yielded long duration ion clouds that can be replicated with the CRM. The CRM predicts that Sm releases in darkness would not produce long duration plasma clouds because of the lack of photo excitation and photoionization.

  6. Reactive Materials for Evaporating Samarium (Pre-Print)

    Science.gov (United States)

    2016-04-15

    SUBJECT TERMS energetic materials, heat sources, pyrotechnic charges, easily ionized metals 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF...experiments.    Keywords:  energetic  materials, heat sources, pyrotechnic charges, easily ionized metals  1. Introduction Ejection of clouds of...results  were  negatively  affected  by  reduced  efficiency   of  release  and  ionization of samarium [8]. It is possible that not the entire charge of

  7. Implementation of an analytical technique for Samarium; Implementacion de una tecnica analitica para Samario

    Energy Technology Data Exchange (ETDEWEB)

    Garcia G, N. [ININ, Carretera Mexico-Toluca Km. 36.5, 52045 Estado de Mexico (Mexico)

    2004-07-01

    Since the Samarium presents the same chemical properties that the plutonium, it has been used as homologous in studies that allow us to know the behavior that the plutonium presents in solution, with the advantage of working with an inactive and not very dangerous element. At the moment studies of sorption of plutonium or samarium are made on some mineral matrices that present certain surface properties. Due to the low concentrations that are used in the studies of sorption of samarium on those reagent substrates, their detection becomes very difficult for the conventional analysis media. The luminescence is a technique that can detect lower concentrations, smaller at 1 X 10{sup -} {sup 2} M, but when fluorofors are used this limit of detection increases in several orders of magnitude. In this work it has been used the arsenazo-III as fluorofor agent since it reacts in a specific way with the samarium, forming a complex that presents a proportional luminescence to the concentration of the present samarium. The advantage of making the quantification of samarium by luminescence is that it can use the same instrumental equipment to determine the speciation of the samarium sipped in the zircon. (Author)

  8. Luminescent solutions and powders of new samarium complexes with N,N',O,O'-chelating ligands

    Science.gov (United States)

    Kharcheva, Anastasia V.; Nikolskiy, Kirill S.; Borisova, Nataliya E.; Ivanov, Alexey V.; Reshetova, Marina D.; Yuzhakov, Viktor I.; Patsaeva, Svetlana V.

    2016-04-01

    Imaging techniques in biology and medicine are crucial tools to obtain information on structural and functional properties of living cells and organisms. To fulfill the requirements associated with application of these techniques it appears necessary to design markers with specific characteristics. Luminescent complexes of trivalent lanthanide ions with chelating ligands are of increasing importance in biomedical applications because of their millisecond luminescence lifetime, narrow emission band, high signal-to-noise ratio and minimal photodamage to biological samples. In order to extend the available emission wavelength range the luminescent samarium chelates are highly desirable. In this study the ligands with diamides of 2,2'-bipyridin-6,6'-dicarboxylic acid were used to improve photophysical characteristics of samarium complexes. We report the luminescence characteristics of samarium complexes with novel ligands. All complexes exhibited the characteristic emission of Sm (III) ion with the lines at 565, 597, 605, 645 and 654 nm, the intensity strongly depended on the ligand. Absorption and luminescence excitation spectra of Sm (III) complexes showed main peaks in the UV range demonstrating lanthanide coordination to the ligand. The absolute lumenescence quantum yield was measured for solutions in acetonitrile with excitation at 350 nm. The largest luminescence quantum yield was found for the samarium complex Bipy 6MePy Sm (3%) being much higher that for samarium complexes reported in the literature earlier. These results prove as well that samarium chelates are potential markers for multiparametric imaging techniques.

  9. Australian manufacture of Quadramet{sup TM} (Samarium-153 EDTMP)

    Energy Technology Data Exchange (ETDEWEB)

    Wood, N.R.; Whitwell, J. [Australian Nuclear Science and Technology Organisation (ANSTO), Lucas Heights, NSW (Australia). Australian Radioisotopes

    1997-10-01

    Quadramet{sup T} (Samarium-153 EDTMP) has been shown overseas to be potentially useful in the palliation of painful osteoblastic skeletal metastases and has been approved this year for general marketing in the USA. Australian Radioisotopes (ARI) has licensed this product from the Australian patent holders, Dow Chemical. Within the facilities of ARI, a hot cell has been dedicated to this product and fitted out to manufacture it weekly on a cycle related to the operating cycle of the Australian reactor HIFAR. Due to neutron flux limitations of HIFAR, the local formulation has an elemental Samarium content up to 200{mu}g/mL whereas the overseas formulation has a level of 20-46{mu}g/mL. All other specifications of the two products are essentially the same. In 1995 and 1996 a small clinical trial with 19 patients was held which demonstrated that the pharmacokinetic behaviour was also essentially the same by measuring blood clearance rates and skeletal uptake dynamics. Soft tissue uptake was also qualitatively determined. The ARI version is now the subject of an application for general marketing within Australia. Some useful characteristics of this agent are: almost complete excretion or fixation in the skeleton within 6 hours, rapid onset of clinical effect, applicability in most cases where an abnormal diagnostic bone scan correlates with painful sites, dosage can be tailored to individual patient uptake due to easy dose measurement and retreatment is quite possible. The use of this class of agents in pain palliation continues to increase. Australian manufacture of Quadramet{sup TM} provides a further option in the management of these difficult cases

  10. Electrochemical extraction of samarium from molten chlorides in pyrochemical processes

    Energy Technology Data Exchange (ETDEWEB)

    Castrillejo, Y., E-mail: ycastril@qa.uva.es [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Fernandez, P. [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Medina, J. [Dept Fisica Materia Condensada Cristalografia y Mineralogia, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Hernandez, P. [Centro de Investigaciones Quimicas, Universidad Autonoma del Estado de Hidalgo, Carr. Pachuca-Tulancingo Km. 4.5, C.P. 42076 Pachuca, Hidalgo (Mexico); Barrado, E. [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain)

    2011-10-01

    This work concerns the electrochemical extraction of samarium from molten chlorides. In this way, the electrochemical behaviour of samarium ions has been investigated in the eutectic LiCl-KCl at the surface of tungsten, aluminium and aluminium coated tungsten electrodes. On a W inert electrode the electro-reduction of Sm(III) takes place in only one soluble-soluble electrochemical step Sm(III)/Sm(II). The electrochemical system Sm(II)/Sm(0) has not been observed within the electrochemical window, because of the prior reduction of Li(I) ions from the solvent, which inhibits the electro-extraction of Sm species from the salt on such a substrate. Sm metal in contact with the melt react to give Li(0) according to the reaction: Sm(0) + 2Li(I) {r_reversible} Sm(II) + 2Li(0). On the contrary, on reactive Al electrodes the electrochemical system Sm(II)/Sm(0) was observed within the electroactive range. The potential shift of the redox couple is caused by the decrease of Sm activity in the metal phase due to the formation of Sm-Al alloys at the interface. The formation mechanism of the intermetallic compounds was studied in a melt containing: (i) both Sm(III) and Al(III) ions, using W and Al coated tungsten electrodes, and (ii) Sm(III) ions using an Al electrode. Analysis of the samples after potentiostatic electrolysis by X-ray diffraction and scanning electron microscopy (SEM) with energy dispersive X-ray spectroscopy (EDS), allowed the identification of Al{sub 3}Sm and Al{sub 2}Sm.

  11. 22 CFR 144.140 - Employment.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Employment. 144.140 Section 144.140 Foreign... PROGRAMS OR ACTIVITIES CONDUCTED BY THE UNITED STATES DEPARTMENT OF STATE § 144.140 Employment. No qualified handicapped person shall, on the basis of handicap, be subjected to discrimination in employment...

  12. Optical analysis of samarium doped sodium bismuth silicate glass.

    Science.gov (United States)

    Thomas, V; Sofin, R G S; Allen, M; Thomas, H; Biju, P R; Jose, G; Unnikrishnan, N V

    2017-01-15

    Samarium doped sodium bismuth silicate glass was synthesized using the melt quenching method. Detailed optical spectroscopic studies of the glassy material were carried out in the UV-Vis-NIR spectral range. Using the optical absorption spectra Judd-Ofelt (JO) parameters are derived. The calculated values of the JO parameters are utilized in evaluating the various radiative parameters such as electric dipole line strengths (Sed), radiative transition probabilities (Arad), radiative lifetimes (τrad), fluorescence branching ratios (β) and the integrated absorption cross- sections (σa) for stimulated emission from various excited states of Sm3+‡ ion. The principal fluorescence transitions are identified by recording the fluorescence spectrum. Our analysis revealed that the novel glassy system has the optimum values for the key parameters viz. spectroscopic quality factor, optical gain, stimulated emission cross section and quantum efficiency, which are required for a high performance optical amplifier. Calculated chromaticity co-ordinates (0.61, 0.38) also confirm its application potential in display devices. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Samarium Monosulfide (SmS): Reviewing Properties and Applications.

    Science.gov (United States)

    Sousanis, Andreas; Smet, Philippe F; Poelman, Dirk

    2017-08-16

    In this review, we give an overview of the properties and applications of samarium monosulfide, SmS, which has gained considerable interest as a switchable material. It shows a pressure-induced phase transition from the semiconducting to the metallic state by polishing, and it switches back to the semiconducting state by heating. The material also shows a magnetic transition, from the paramagnetic state to an antiferromagnetically ordered state. The switching behavior between the semiconducting and metallic states could be exploited in several applications, such as high density optical storage and memory materials, thermovoltaic devices, infrared sensors and more. We discuss the electronic, optical and magnetic properties of SmS, its switching behavior, as well as the thin film deposition techniques which have been used, such as e-beam evaporation and sputtering. Moreover, applications and possible ideas for future work on this material are presented. Our scope is to present the properties of SmS, which were mainly measured in bulk crystals, while at the same time we describe the possible deposition methods that will push the study of SmS to nanoscale dimensions, opening an intriguing range of applications for low-dimensional, pressure-induced semiconductor-metal transition compounds.

  14. 40 CFR 144.1 - Purpose and scope of part 144.

    Science.gov (United States)

    2010-07-01

    ... sections have been cleared by the Office of Management and Budget: Sections 144.11, 144.28(c)(d)(i), 144.31... or appropriate to carry out his functions” under SDWA. (e) Overview of the UIC program. An UIC... underground injections by five classes of wells (see definition of “well injection,” § 144.3). The five...

  15. Excitation induced spectroscopic study and quenching effect in cerium samarium codoped lithium aluminoborate glasses

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, Parvinder; Kaur, Simranpreet [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Singh, Gurinder Pal [Department of Physics, Khalsa College, Amritsar 143002 (India); Arora, Deepawali; Kumar, Sunil [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Singh, D.P., E-mail: dpsinghdr@yahoo.com [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India)

    2016-08-15

    Lithium aluminium borate host has been codoped with cerium and samarium to prepare glass by conventional melt quench technique. Their structural and spectroscopic investigation has been carried out using XRD, FTIR and density measurements. The UV‐Vis absorption spectra and fluorescence spectra (λ{sub exc}.=380 nm and 400 nm) have been studied for spectroscopic analysis. The amorphous nature of the prepared samples is shown by XRD. The density is increasing with addition of cerium at the expense of aluminium, keeping other components constant. FTIR study also shows the presence of compact and stable tetrahedral BO{sub 4} units thus supporting the density results. The UV‐ Vis absorption spectra show a shift of optical absorption edge towards longer wavelength along with an increase in intensity of peaks with rising samarium concentration. The fluorescence spectra show a blue shift and subsequent suppression of cerium peaks with addition of samarium.

  16. Effect of samarium doping on the dielectric behavior of barium zircomium titanate ceramic

    Energy Technology Data Exchange (ETDEWEB)

    Badapanda, T., E-mail: badapanda.tanmaya@gmail.com [Department of Physics, C.V. Raman College of Engineering, Bhubaneswar, Odisha-752054 (India); Sarangi, S.; Behera, B. [School of Physics, Sambalpur University, Jyoti Vihar Sambalpur, Odisha-768019 (India); Anwar, S. [Colloids and Materials Chemistry, Institute of Minerals and Materials Technology, Bhubaneswar, Odisha-751013 (India); Sinha, T. P. [Department of Physics, Bose Institute, Kolkata-700009 (India)

    2014-04-24

    Samarium doped Barium Zirconium Titanate ceramic with general formula Ba{sub 1−x}Sm{sub 2x/3}Zr{sub 0.05}Ti{sub 0.95}O{sub 3} [x=0.0,0.01,0.02,0.03,0.04] has been prepared by high energy ball milling. The X-ray diffraction (XRD) patterns confirmed that these ceramics have a single phase with perovskite-type upto x≤0.03 and a small secondary phase exist at x=0.04. The temperature dependent dielectric study shows a ferroelectric phase transition and transition temperature decreases with an increase in the Samarium content.

  17. Lithium Bromide/Water as Additives in Dearomatizing Samarium-Ketyl (Hetero)Arene Cyclizations.

    Science.gov (United States)

    Rao, Chintada Nageswara; Bentz, Christoph; Reissig, Hans-Ulrich

    2015-11-02

    New conditions for dearomatizing samarium-ketyl (hetero)arene cyclizations are reported. In many examples of these samarium diiodide-mediated reactions, lithium bromide and water can be used as additives instead of the carcinogenic and mutagenic hexamethylphosphoramide (HMPA). The best results were obtained for the cyclizations of N-acylated indole derivatives delivering the expected indolines in good yields and excellent diastereoselectivities. A new type of cyclization delivering indolyl-substituted allene derivatives is also described. The scope and limitations of the lithium bromide/water system are discussed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Mandiwana, Vusani, E-mail: VMandiwana@csir.co.za; Kalombo, Lonji, E-mail: LKalombo@csir.co.za [Centre of Polymers and Composites, CSIR (South Africa); Venter, Kobus, E-mail: Kobus.Venter@mrc.ac.za [South African Medical Research Council (South Africa); Sathekge, Mike, E-mail: Mike.Sathekge@up.ac.za [University of Pretoria and Steve Biko Academic Hospital, Department of Nuclear Medicine (South Africa); Grobler, Anne, E-mail: Anne.Grobler@nwu.ac.za; Zeevaart, Jan Rijn, E-mail: zeevaart@necsa.co.za [North-West University, DST/NWU Preclinical Drug Development Platform (South Africa)

    2015-09-15

    Developing nanoparticulate delivery systems that will allow easy movement and localization of a drug to the target tissue and provide more controlled release of the drug in vivo is a challenge in nanomedicine. The aim of this study was to evaluate the biodistribution of poly(d,l-lactide-co-glycolide) (PLGA) nanoparticles containing samarium-153 oxide ([{sup 153}Sm]Sm{sub 2}O{sub 3}) in vivo to prove that orally administered nanoparticles alter the biodistribution of a drug. These were then activated in a nuclear reactor to produce radioactive {sup 153}Sm-loaded-PLGA nanoparticles. The nanoparticles were characterized for size, zeta potential, and morphology. The nanoparticles were orally and intravenously (IV) administered to rats in order to trace their uptake through imaging and biodistribution studies. The {sup 153}Sm-loaded-PLGA nanoparticles had an average size of 281 ± 6.3 nm and a PDI average of 0.22. The zeta potential ranged between 5 and 20 mV. The [{sup 153}Sm]Sm{sub 2}O{sub 3} loaded PLGA nanoparticles, orally administered were distributed to most organs at low levels, indicating that there was absorption of nanoparticles. While the IV injected [{sup 153}Sm]Sm{sub 2}O{sub 3}-loaded PLGA nanoparticles exhibited the highest localization of nanoparticles in the spleen (8.63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems would be suitable for improving permeability and thus the bioavailability of therapeutic compounds.

  19. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles

    Science.gov (United States)

    Mandiwana, Vusani; Kalombo, Lonji; Venter, Kobus; Sathekge, Mike; Grobler, Anne; Zeevaart, Jan Rijn

    2015-09-01

    Developing nanoparticulate delivery systems that will allow easy movement and localization of a drug to the target tissue and provide more controlled release of the drug in vivo is a challenge in nanomedicine. The aim of this study was to evaluate the biodistribution of poly( d, l-lactide- co-glycolide) (PLGA) nanoparticles containing samarium-153 oxide ([153Sm]Sm2O3) in vivo to prove that orally administered nanoparticles alter the biodistribution of a drug. These were then activated in a nuclear reactor to produce radioactive 153Sm-loaded-PLGA nanoparticles. The nanoparticles were characterized for size, zeta potential, and morphology. The nanoparticles were orally and intravenously (IV) administered to rats in order to trace their uptake through imaging and biodistribution studies. The 153Sm-loaded-PLGA nanoparticles had an average size of 281 ± 6.3 nm and a PDI average of 0.22. The zeta potential ranged between 5 and 20 mV. The [153Sm]Sm2O3 loaded PLGA nanoparticles, orally administered were distributed to most organs at low levels, indicating that there was absorption of nanoparticles. While the IV injected [153Sm]Sm2O3-loaded PLGA nanoparticles exhibited the highest localization of nanoparticles in the spleen (8.63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems would be suitable for improving permeability and thus the bioavailability of therapeutic compounds.

  20. One-step synthesis of samarium-doped ceria and its CO catalysis

    Indian Academy of Sciences (India)

    The samarium-doped ceria (SDC) nanospheres were prepared by the one-step hydrothermal method and characterized by transmission electron microscope, scanning electron microscope, powder X-ray diffraction, X-ray photoelectron spectroscopy, energy-dispersive spectrometer and Raman spectra. According to the ...

  1. A spectroscopic comparison of samarium-doped LiYF4 and KY3F10

    NARCIS (Netherlands)

    Wells, J. P. R.; Sugiyama, A.; Han, T. P. J.; Gallagher, H. G.

    2000-01-01

    Laser selective excitation and fluorescence has been performed on LiYF4 and KY3F10 doped with samarium ions. In LiYF4, a single, tetragonal symmetry center associated with isovalent substitution of Sm3+ with lattice yttrium ions is present. By contrast, three Sm2+ centres and a single, tetragonal

  2. 14 CFR 1260.144 - Procurement procedures.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Procurement procedures. 1260.144 Section 1260.144 Aeronautics and Space NATIONAL AERONAUTICS AND SPACE ADMINISTRATION GRANTS AND COOPERATIVE... dimensioned in the metric system of measurement. (vi) Preference, to the extent practicable and economically...

  3. The Use of a Flexible Calix[4]arene Template to Stabilize a Cyclooctatetraindiyl Samarium-Potassium Complex

    Directory of Open Access Journals (Sweden)

    Geoffroy Guillemot

    2013-01-01

    Full Text Available A sandwich compound of cyclooctatetraendiyl (COT2− samarium-potassium was synthesized and analyzed using a flexible calix[4]arene dianion. This compound, [p-tBu-calix[4]-(OMe2(O2]arenediyl-samarium-(η8-cyclooctatetraendiyl-potassium (tetrahydrofurane3, is constructed as a linear sequence L-Sm--K-, where L, , and are specific ligands with L = O,O-dimethyl-calix[4]arene2−, = cyclo-octatetraendiyl, and = tetrahydrofurane templates.

  4. Potential diagnostic implications of miR-144 overexpression in human oesophageal cancer

    Directory of Open Access Journals (Sweden)

    Priyanka Sharma

    2016-01-01

    Full Text Available Background & objectives: Insidious symptomatology, late clinical presentation and poor prognosis of oesophageal cancer (EC highlight the pressing need for novel non-invasive biomarkers for early tumour diagnosis and better prognosis. The present study was carried out to evaluate the clinical significance of circulating and tissue miR-144 expression in oesophageal cancer. Methods: Clinical significance of miR-144 expression was evaluated in preneoplastic (12 and neoplastic (35 oesophageal cancer tissues as well as matched distant non-malignant tissues using real-time PCR (qPCR. Circulating levels of miR-144 were also analyzed in serum samples of EC patients as well as normal individuals to determine the diagnostic potential of miR-144. Further, targets of miR-144 were predicted using bioinformatic tools and their gene ontology (GO terms were assigned. Results: Real-time PCR analysis revealed significant upregulation of miR-144 in 29 of 35 (83% EC tissues as compared to matched distant non-malignant tissues (P=0.010. a0 ll the dysplastic tissues showed upregulation of miR-144 as compared to their matched distant non-malignant tissues. Relative levels of circulating miR-144 in serum significantly distinguished EC patients from normal controls (P=0.015; AUC = 0.731 with high sensitivity of 94.7 per cent. Bioinformatically predicted target, PUR-aplha (PURA was found to be significantly (P=0.018 downregulated in 81 per cent (26/32 EC patients and its expression was found to be significantly and negatively correlated with miR-144 expression at mRNA level. Interpretation & conclusions: Our findings showed significant upregulation of miR-144 in serum samples of EC patients indicating its potential as minimally invasive marker. Further studies need to be done to understand the role of miR-144 in the pathogenesis of EC.

  5. Samarium(II) iodide-mediated reductive annulations of ketones bearing a distal vinyl epoxide moiety

    Energy Technology Data Exchange (ETDEWEB)

    Molander, G.A.; Shakya, S.R. [Univ. of Colorado, Boulder, CO (United States)

    1996-08-23

    It was found that samarium (II) iodide promotes the intramolecular coupling of ketones with distal epoxy olefins while in the presence of hexamethylphosphoramide (HPMA). A number of epoxide compounds (1 a-k) fragment to form carbocycles with allylic alcohol side chains with high diastereoselectivity (2 a-k). Substituting tetramethylguanidine for HPMA reduces the diastereoselectivity. Adding Pd(0) as a catalyst reverses the diastereoselective sense. 40 refs., 1 tab.

  6. A temporal three-dimensional simulation of samarium release in the ionosphere

    Science.gov (United States)

    Zhao, Hai-Sheng; Feng, Jie; Xu, Zheng-Wen; Wu, Jian; Wu, Zhen-Sen; Xu, Bin; Xue, Kun; Xu, Tong; Hu, Yan-Li

    2016-10-01

    For understanding plasma processes of the ionosphere and magnetosphere, the alkali and alkaline-earth metals are usually released in space for artificially increasing the electron density. However, it is a limitation that these releases must be in sunlight where the photoionization can take place. In recent years, the lanthanide metals, such as samarium, have been released to produce electrons in reaction with atomic oxygen in the upper space. The reaction could proceed without sunlight so that the restriction on experimental periods is broken. Unfortunately, any sophisticated models even preliminary ones are unavailable yet in the literature. A temporal three-dimensional model is presented for the samarium release in detail with respect to various altitudes and mass. Especially, the plasma diffusion equation is remarkably extended from 2-D to 3-D by importing the influence of geomagnetic declination, which could be also useful for other chemical releases. The field-aligned terms are brought so as to the presented model can describe the diffusion along the geomagnetic field subtly. On the basis of the presented model, behaviors of radio waves propagating through the release area are simulated by using ray tracing. This model could be as the theoretical support for samarium releases, and it also helpful for the research on the generation and evolution of the ionosphere irregularities.

  7. Dicty_cDB: CHF144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHF144 (Link to dictyBase) - - - Contig-U16411-1 | Contig-U16470-1 CHF...144P (Link to Original site) CHF144F 557 CHF144Z 781 CHF144P 1318 - - Show CHF144 Library CH (Link to library) Clone ID CHF...411-1 | Contig-U16470-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHF1-B/CHF...144Q.Seq.d/ Representative seq. ID CHF144P (Link to Original site) Representative DNA sequence >CHF144 (CHF...144Q) /CSM/CH/CHF1-B/CHF144Q.Seq.d/ TAATAAATAATAATTAAAATTTGCATATATAAAAGAAATAAAAATTTTTTATTTTTTGTA

  8. Liquid–liquid anion exchange extraction studies of samarium(III from salicylate media using high molecular weight amine

    Directory of Open Access Journals (Sweden)

    Aniruddha M. Mandhare

    2015-07-01

    Full Text Available Liquid–liquid extraction and separation of samarium(III were carried out by using 0.025 mol dm−3 2-octylaminopyridine(2-OAP in xylene at 298 K. The extraction behavior of samarium was studied as a function of pH, weak acid concentration, extractant concentration, diluent, and equilibration time. Samarium was quantitatively extracted at pH 7.5 to 10.0 from 0.01 mol dm−3 sodium salicylate solution with 0.025 mol dm−3 2-OAP. The possible composition of the extracted species in organic phase has been determined by using model of slope analysis method and extraction mechanism was found to proceed via an anion exchange mechanism. The stripping efficiency was found to be quantitative in HNO3, HCl and CH3COOH. The robustness of the procedure was demonstrated by the average recoveries obtained (>99.6% for samarium(III extraction in the presence of several cations and anions which are commonly associated with it. The proposed method facilitates the separation and determination of samarium(III from binary and synthetic mixtures. The various thermodynamic functions like free energy (ΔG, enthalpy (ΔH and entropy (ΔS of extraction mechanism were discussed.

  9. 9 CFR 381.144 - Packaging materials.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Packaging materials. 381.144 Section... Packaging materials. (a) Edible products may not be packaged in a container which is composed in whole or in... to health. All packaging materials must be safe for the intended use within the meaning of section...

  10. 27 CFR 44.144 - Opening.

    Science.gov (United States)

    2010-04-01

    ... PAYMENT OF TAX, OR WITH DRAWBACK OF TAX Operations by Export Warehouse Proprietors Inventories § 44.144 Opening. An opening inventory shall be made by the export warehouse proprietor at the time of commencing... permit issued under § 44.93. A similar inventory shall be made by the export warehouse proprietor when he...

  11. 40 CFR 144.24 - Class V wells.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Class V wells. 144.24 Section 144.24... INJECTION CONTROL PROGRAM Authorization of Underground Injection by Rule § 144.24 Class V wells. (a) A Class V injection well is authorized by rule, subject to the conditions in § 144.84 (b) Duration of well...

  12. Dicty_cDB: SLF144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLF144 (Link to dictyBase) - - - Contig-U09670-1 SLF144E (Link... to Original site) - - - - - - SLF144E 390 Show SLF144 Library SL (Link to library) Clone ID SLF144 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLF1-B/SLF144Q.Seq.d/ Representative seq. ID SLF14...4E (Link to Original site) Representative DNA sequence >SLF144 (SLF144Q) /CSM/SL/SLF1-B/SLF144Q.Seq.d/ AGGCA...mino Acid sequence (All Frames) Frame A: rh*sch*flftf*l*nlctsywsyr*srcpryisfnslk*lfr*ygigw*fn*sltkirt rgsf*i

  13. Dicty_cDB: SLB144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLB144 (Link to dictyBase) - - - Contig-U16455-1 SLB144Z (Link... to Original site) - - SLB144Z 710 - - - - Show SLB144 Library SL (Link to library) Clone ID SLB144 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLB1-B/SLB144Q.Seq.d/ Representative seq. ID SLB14...4Z (Link to Original site) Representative DNA sequence >SLB144 (SLB144Q) /CSM/SL/SLB1-B/SLB144Q.Seq.d/ XXXXX...29 |pid:none) Acanthamoeba culbertsoni ef1a gene... 321 2e-86 AY643820_1( AY643820 |pid:none) Arcyria denuda

  14. Dicty_cDB: SHF144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SH (Link to library) SHF144 (Link to dictyBase) - - - Contig-U16333-1 SHF144P (Link to Original site) SHF...144F 627 SHF144Z 547 SHF144P 1154 - - Show SHF144 Library SH (Link to library) Clone ID SHF...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SH/SHF1-B/SHF144Q.Seq.d/ Representative seq. ID SHF...144P (Link to Original site) Representative DNA sequence >SHF144 (SHF144Q) /CSM/SH/SHF1-B/SHF...iriisw*tsmcn*cf**ye*fw*f--- ---igisilstwsiikwcfrsv*xw*ckfqir**tf*rfsnyrvsiiq*lqsxhfndewy xryxsi*xfeiexxxps*s

  15. Marrow irradiation with high-dose 153Samarium-EDTMP followed by chemotherapy and hematopoietic stem cell infusion for acute myelogenous leukemia.

    Science.gov (United States)

    Rodriguez, Vilmarie; Anderson, Peter M; Litzow, Mark R; Erlandson, Linda; Trotz, Barbara A; Arndt, Carola A S; Khan, Shakila P; Wiseman, Gregory A

    2006-08-01

    In four patients, aged 15 - 20 years, with high-risk acute myeloid leukemia (AML), high-dose samarium 153-labelled ethylenediaminetetramethylenephosphonate (153Sm-EDTMP) was used for targeted marrow irradiation before preparative chemotherapy conditioning regimens and allogeneic (three patients) or autologous (one patient) hematopoietic stem cell transplantation. The dose of 153Sm-EDTMP was 703 MBq/kg (n = 1) or 1110 MBq/kg (n = 3). No side-effects occurred during the 30-min infusion of 153Sm-EDTMP. Samarium - melphalan regimens were given to three patients; one had 153Sm-EDTMP - busulfan + cyclophosphamide. Total body radioactivity was below the 133 MBq safe limit before infusion of stem cells (day 14 after 153Sm-EDTMP). No hemorrhagic cystitis, nephrotoxicity or serious infections occurred. Leukocyte engraftment (white blood cell count >0.5 x 10(9)/l) occurred between 12 and 23 days after stem cell infusion (mean of 17 days). Complete cytogenetic and morphologic remission of AML was evident on follow-up marrow aspirate and biopsy specimens from all patients. In two of the four study patients, the disease remains in complete remission and the patients have an excellent quality of life (Eastern Cooperative Oncology Group performance status 0; no medications) and no organ toxicity more than 2 years and more than 4 years, respectively, after their blood and bone marrow transplantations. Thus, in adolescents and adults, 153Sm-EDTMP may provide a relatively simple and effective means for using irradiation to eliminate AML within the marrow.

  16. Samarium(II) iodide-mediated intramolecular conjugate additions of alpha,beta-unsaturated lactones.

    Science.gov (United States)

    Molander, Gary A; St Jean, David J

    2002-05-31

    Samarium(II) iodide, in the presence of catalytic amounts of nickel(II) iodide, has been used to promote intramolecular conjugate additions of alkyl halides onto alpha,beta-unsaturated lactones. This process has been shown to be applicable to a number of alpha,beta-unsaturated lactones, including tetrasubstituted olefins, and has been demonstrated to be quite general for the formation of saturated bicyclic and tricyclic lactones. The method presented herein provides a mild, efficient process to form structurally complex lactones from simple precursors.

  17. Ekstraksi Pemisahan Neodimium dari Samarium, Itrium dan Praseodimium Memakai Tri Butil Fosfat

    Directory of Open Access Journals (Sweden)

    Maria Veronica Purwani

    2017-05-01

    Full Text Available The extraction of Nd(OH3 (neodymium hydroxide concentrate containing Y (yttrium, Sm (samarium and Pr (praseodymium as product of monazite processed has been done. The purpose of this study is to determine the separation of Nd from Y, Pr and Nd Sm in Nd concentrate. The aqueous phase was concentrated Nd (OH3 in HNO3 and extractant while organic phase was Tri Butyl Phosphate (TBP in kerosene. Parameters studied were pH and concentration feed, concentration of TBP in kerosene, extraction time and stirring speed. The result showed that the optimization of separation extraction neodymium from samarium, yttrium and praseodymium in Nd(OH3 concentrated with TBP, obtained the optimum condition of pH = 0.2, concentration of feed 100 g /L, concentration of TBP in kerosene 5%, extraction time 15 minutes and stirring speed 150 rpm. With the conditions, Separation Factor (SF obtained for Nd-Y, Nd-Pr, Nd-Sm are 2.242, 4.811, 4.002 respectively, while D and extraction efficiency of Nd are 0.236 and 19.07%.

  18. X-Band Microwave Reflection Properties of Samarium/Bismuth-Substituted Barium Lanthanum Titanate Ceramics

    Science.gov (United States)

    Bahel, Shalini; Pubby, Kunal; Narang, Sukhleen Bindra

    2017-03-01

    Samarium/bismuth-substituted barium lanthanum titanate ceramics with chemical composition Ba4 (La_{1 - y - z} Smy Biz )_{9.33} Ti_{18} O_{54} ( y = 0.5, 0.7; z = 0.05, 0.10, 0.15), intended as microwave reflecting materials, have been investigated in microwave X-band (8.2 GHz to 12.4 GHz) and the effect of substitution on their dielectric properties, i.e., dielectric constant and dielectric loss tangent, has been studied by vector network analyzer. Dielectric analysis showed that the dielectric constant increased with increasing samarium as well as bismuth content. Dielectric relaxation was observed for all samples in the scanned frequency range. Microwave reflection and transmission analysis of ceramic pellets of thickness 4 mm was carried out using two methods, i.e., open- and short-circuit approach, both indicating very high values of reflected power and very low values of transmitted power for all the doped materials in comparison with the base composition. The doped compositions are therefore potential microwave shielding materials for use in anechoic chambers, microwave laboratories, and radar equipment. Double-layer reflectors are also proposed, having better reflection properties (˜99% reflection) compared with single-layer reflectors.

  19. Microstructure and hysteresis curves of samarium-holmium-iron garnet synthesized by coprecipitation

    Directory of Open Access Journals (Sweden)

    Caffarena Valeska da Rocha

    2003-01-01

    Full Text Available An investigation was made into the synthesis and magnetic properties of Sm(3-xHo xFe5O12 (samarium-holmium-iron garnet ferrite, as yet absent from the literature. The material in question was synthesized by co-precipitation, starting from hydrated chlorides of rare-earth elements and ferrous sulfate, and the mixed hydroxide co-precipitate was calcined at 1000 °C. Using PVA as a binder, rectangular cross section-shaped compacts were produced by means of steel-die pressing, drying and sintering from 1200 to 1450 °C. The main conclusions of this study were that the coercive force decreases as the sintering temperature increases, and that the effect of substituting holmium for samarium in SmIG is entirely different from that provided by replacing yttrium by gadolinium in YIG, which is the most important result of this work. An in-depth investigation will be necessary to determine the correlation between microstructure/magnetic properties and ceramic processing variables.

  20. Polypyrrole-coated samarium oxide nanobelts: fabrication, characterization, and application in supercapacitors

    Science.gov (United States)

    Liu, Peng; Wang, Yunjiao; Wang, Xue; Yang, Chao; Yi, Yanfeng

    2012-11-01

    Polypyrrole-coated samarium oxide nanobelts were synthesized by the in situ chemical oxidative surface polymerization technique based on the self-assembly of pyrrole on the surface of the amine-functionalized Sm2O3 nanobelts. The morphologies of the polypyrrole/samarium oxide (PPy/Sm2O3) nanocomposites were characterized using transmission electron microscope. The UV-vis absorbance of these samples was also investigated, and the remarkable enhancement was clearly observed. The electrochemical behaviors of the PPy/Sm2O3 composites were investigated by cyclic voltammetry, electrochemical impedance spectroscopy, and galvanostatic charge-discharge. The results indicated that the PPy/Sm2O3 composite electrode was fully reversible and achieved a very fast Faradaic reaction. After being corrected into the weight percentage of the PPy/Sm2O3 composite at a current density of 20 mA cm-2 in a 1.0 M NaNO3 electrolyte solution, a maximum discharge capacity of 771 F g-1 was achieved in a half-cell setup configuration for the PPy/Sm2O3 composites electrode with the potential application to electrode materials for electrochemical capacitors.

  1. Polypyrrole-coated samarium oxide nanobelts: fabrication, characterization, and application in supercapacitors

    Energy Technology Data Exchange (ETDEWEB)

    Liu Peng, E-mail: pliu@lzu.edu.cn; Wang Yunjiao; Wang Xue; Yang Chao; Yi Yanfeng [College of Chemistry and Chemical Engineering, Lanzhou University, Key Laboratory of Nonferrous Metal Chemistry and Resources Utilization of Gansu Province and State Key Laboratory of Applied Organic Chemistry (China)

    2012-11-15

    Polypyrrole-coated samarium oxide nanobelts were synthesized by the in situ chemical oxidative surface polymerization technique based on the self-assembly of pyrrole on the surface of the amine-functionalized Sm{sub 2}O{sub 3} nanobelts. The morphologies of the polypyrrole/samarium oxide (PPy/Sm{sub 2}O{sub 3}) nanocomposites were characterized using transmission electron microscope. The UV-vis absorbance of these samples was also investigated, and the remarkable enhancement was clearly observed. The electrochemical behaviors of the PPy/Sm{sub 2}O{sub 3} composites were investigated by cyclic voltammetry, electrochemical impedance spectroscopy, and galvanostatic charge-discharge. The results indicated that the PPy/Sm{sub 2}O{sub 3} composite electrode was fully reversible and achieved a very fast Faradaic reaction. After being corrected into the weight percentage of the PPy/Sm{sub 2}O{sub 3} composite at a current density of 20 mA cm{sup -2} in a 1.0 M NaNO{sub 3} electrolyte solution, a maximum discharge capacity of 771 F g{sup -1} was achieved in a half-cell setup configuration for the PPy/Sm{sub 2}O{sub 3} composites electrode with the potential application to electrode materials for electrochemical capacitors.

  2. Behavior of Samarium III during the sorption process; Comportamiento del Samario-III durante el proceso de sorcion

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez R, E.; Garcia G, N.; Garcia R, G. [ININ, Carr. Mexico-Toluca Km 36.5, Salazar, Estado de Mexico (Mexico)]. e-mail: edo@nuclear.inin.mx

    2004-07-01

    In this work the results of the behavior of samarium in solution are presented, in front of a fine powder of zirconium silicate (zircon). For that which is necessary to characterize the zircon, studying the crystallinity, the morphology, the surface area and the isoelectric point. The behavior of samarium in solution is studied by means of the elaboration of isotherm of sorption, using the technique by lots. One observes that to pH values of nearer to the isoelectric point (pH = 7.23) the process of sorption of the samarium begins, reaching a maximum to near pH at 9. The technique of luminescence is used to determine the concentration of the sipped samarium (phosphorescence) and also to make the speciation of the species formed in the surface of the zircon (phosphorescence). The results can be extrapolated with the plutonium when making the modeling of the migration of alpha emitting coming from the repositories of radioactive waste since both they have similar chemical properties (they are homologous). (Author)

  3. Neutron and Charged-Particle Induced Cross Sections for Radiochemistry in the Region of Samarium, Europium, and Gadolinium

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, R D; Kelley, K; Dietrich, F S; Bauer, R; Mustafa, M

    2004-11-30

    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron and proton induced nuclear reaction cross sections in the mass region of samarium, europium and gadolinium (62 {le} Z {le} 64, 82 {le} N {le} 96).

  4. Pemisahan Unsur Samarium dan Yttrium dari Mineral Tanah Jarang dengan Teknik Membran Cair Berpendukung (Supported Liquid Membrane

    Directory of Open Access Journals (Sweden)

    Amri Amin

    2009-06-01

    Full Text Available he increasing use of rare earth elements in high technology industries needs to be supported by developmental work for the separation of elements. The research objective is fiercely attracting and challenging considering the similarity of bath physical and chemical properties among these elements. The rate separation of samarium and yttrium elements using supported liquid membrane has been studied. Polytetrafluoroethylene (PTFE with pore size of 0.45 µm has been used as the membrane and di(2-ethylhexyl phosphate (D2EHP in hexane has been used as a carrier and nitric acid solution has been used as receiving phase. Result of experiments showed that the best separation rate of samarium and yttrium elements could be obtained at feeding phase of pH 3.0, di(2-ethylhexyl phosphate (D2EHP concentration of 0.3 M, agitation rate of 700 rpm, agitation time of 2 hours, and nitric acid and its solution concentrations of 1.0 M and 0.1 M, respectively. At this condition, separation rates of samarium and yttrium were 64.4 and 67.6%, respectively.   Keywords: liquid membrane, rare earth elements, samarium, yttrium

  5. The 144Ce source for SOX

    Science.gov (United States)

    Durero, M.; Vivier, M.; Agostini, M.; Altenmüller, K.; Appel, S.; Bellini, G.; Benziger, J.; Berton, N.; Bick, D.; Bonfini, G.; Bravo, D.; Caccianiga, B.; Calaprice, F.; Caminata, A.; Cavalcante, P.; Chepurnov, A.; Choi, K.; Cribier, M.; D'Angelo, D.; Davini, S.; Derbin, A.; Di Noto, L.; Drachnev, I.; Etenko, A.; Farinon, S.; Fischer, V.; Fomenko, K.; Franco, D.; Gabriele, F.; Gaffiot, J.; Galbiati, C.; Ghiano, C.; Giammarchi, M.; Goeger-Neff, M.; Goretti, A.; Gromov, M.; Hagner, C.; Houdy, T.; Hungerford, E.; Ianni, Aldo; Ianni, Andrea; Jonqueres, N.; Jedrzejczak, K.; Kaiser, M.; Kobychev, V.; Korablev, D.; Korga, G.; Kornoukhov; Kryn, D.; Lachenmaier, T.; Lasserre, T.; Laubenstein, M.; Lehnert, B.; Link, J.; Litvinovich, E.; Lombardi, F.; Lombardi, P.; Ludhova, L.; Lukyanchenko, G.; Machulin, I.; Manecki, S.; Maneschg, W.; Marcocci, S.; Maricic, J.; Mention, G.; Meroni, E.; Meyer, M.; Miramonti, L.; Misiaszek, M.; Montuschi, M.; Muratova, V.; Musenich, R.; Neumair, B.; Oberauer, L.; Obolensky, M.; Ortica, F.; Pallavicini, M.; Papp, L.; Perasso, L.; Pocar, A.; Ranucci, G.; Razeto, A.; Re, A.; Romani, A.; Roncin, R.; Rossi, N.; Schönert, S.; Scola, L.; Semenov, D.; Simgen, H.; Skorokhvatov, M.; Smirnov, O.; Sotnikov, A.; Sukhotin, S.; Suvorov; Tartaglia, R.; Testera, G.; Thurn, J.; Toropova, M.; Veyssiére, C.; Unzhakov, E.; Vogelaar, R. B.; von Feilitzsch, F.; Wang, H.; Weinz, S.; Winter, J.; Wojcik, M.; Wurm, M.; Yokley, Z.; Zaimidoroga, O.; Zavatarelli, S.; Zuber, K.; Zuzel, G.

    2016-02-01

    The SOX (Short distance neutrino Oscillations with BoreXino) project aims at testing the light sterile neutrino hypothesis. To do so, two artificials sources of antineutrinos and neutrinos respectively will be consecutively deployed at the Laboratori Nazionali del Gran Sasso (LNGS) in close vicinity to Borexino, a large liquid scintillator detector. This document reports on the source production and transportation. The source should exhibit a long lifetime and a high decay energy, a requirement fullfilled by the 144Ce-144Pr pair at secular equilibrium. It will be produced at FSUE “Mayak” PA using spent nuclear fuel. It will then be shielded and packed according to international regulation and shipped to LNGS across Europe. Knowledge of the Cerium antineutrino generator (CeANG) parameters is crucial for SOX as it can strongly impact the experiment sensitivity. Several apparatuses are being used or designed to characterize CeANG activity, radioactive emission and content. An overview of the measurements performed so far is presented here.

  6. MicroRNA-144 inhibits hepatocellular carcinoma cell proliferation ...

    Indian Academy of Sciences (India)

    MicroRNA 144 (miR-144), a small non-coding RNA, is frequently dysregulated in human several tumour progression,but its role and the underlying mechanisms in hepatocellular carcinoma (HCC) is poorly investigated. In thepresent study, the expression of miR-144 was firstly analysed in datasets derived from GSE21362 ...

  7. 19 CFR 144.36 - Withdrawal for transportation.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Withdrawal for transportation. 144.36 Section 144... § 144.36 Withdrawal for transportation. (a) Time limit. Merchandise may be withdrawn from warehouse for transportation to another port of entry if withdrawal for consumption or exportation can be accomplished at the...

  8. 19 CFR 144.23 - Endorsement in blank.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Endorsement in blank. 144.23 Section 144.23 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE... Merchandise from Warehouse § 144.23 Endorsement in blank. If the transferor wishes to do so, he may endorse...

  9. 19 CFR 144.25 - Deposit of forms.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Deposit of forms. 144.25 Section 144.25 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY... Warehouse § 144.25 Deposit of forms. Either the transferor or the transferee may deposit the endorsed...

  10. 42 CFR 456.144 - Data sources for studies.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Data sources for studies. 456.144 Section 456.144 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL ASSISTANCE PROGRAMS UTILIZATION CONTROL Utilization Control: Hospitals Ur Plan: Medical Care Evaluation Studies § 456.144 Data sources...

  11. 9 CFR 319.144 - Whole hog sausage.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Whole hog sausage. 319.144 Section 319.144 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY... CERTIFICATION DEFINITIONS AND STANDARDS OF IDENTITY OR COMPOSITION Sausage Generally: Fresh Sausage § 319.144...

  12. 19 CFR 144.1 - Merchandise eligible for warehousing.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Merchandise eligible for warehousing. 144.1 Section 144.1 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY... § 144.1 Merchandise eligible for warehousing. (a) Types of merchandise. Any merchandise subject to duty...

  13. 17 CFR 14.4 - Violation of Commodity Exchange Act.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Violation of Commodity Exchange Act. 14.4 Section 14.4 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION RULES RELATING TO SUSPENSION OR DISBARMENT FROM APPEARANCE AND PRACTICE § 14.4 Violation of Commodity...

  14. 5 CFR 185.144 - Right to administrative offset.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Right to administrative offset. 185.144 Section 185.144 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PROGRAM FRAUD CIVIL REMEDIES § 185.144 Right to administrative offset. The amount of any penalty or assessment...

  15. 19 CFR 144.3 - Allowance for damage.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Allowance for damage. 144.3 Section 144.3 Customs... (CONTINUED) WAREHOUSE AND REWAREHOUSE ENTRIES AND WITHDRAWALS General Provisions § 144.3 Allowance for damage. No abatement or allowance of duties shall be made on account of damage, loss, or deterioration of the...

  16. Effects of the atomic environment on the electron binding energies in samarium

    Energy Technology Data Exchange (ETDEWEB)

    Inoyatov, A.Kh., E-mail: inoyatov@jinr.ru [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Institute of Applied Physics, National University, Tashkent, Republic of Uzbekistan (Uzbekistan); Kovalík, A. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Nuclear Physics Institute of the ASCR, CZ-25068 Řež near Prague (Czech Republic); Filosofov, D.V. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Ryšavý, M.; Vénos, D. [Nuclear Physics Institute of the ASCR, CZ-25068 Řež near Prague (Czech Republic); Yushkevich, Yu.V.; Perevoshchikov, L.L. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Zhdanov, V.S. [Nuclear Physics Institute, Almaty, Republic of Kazakhstan (Kazakhstan)

    2016-02-15

    Highlights: • Eight different matrices (evaporated and implanted at 30 keV) used. • The greatest average difference in the binding energies amounted to 3.1 ± 0.1 eV. • The presence of trivalent and divalent Sm ions found in some implanted samples. • No significant differences in Sm natural atomic level widths were observed. - Abstract: Effects of the atomic environment on the L{sub 1}, L{sub 2}, L{sub 3}, M{sub 1}, M{sub 2}, M{sub 3}, and N{sub 1} electron binding energies in samarium generated in the electron capture decay of radioactive {sup 149}Eu were investigated by means of the internal conversion electron spectroscopy using the conversion electron spectrum of the 22.5 keV M1 + E2 nuclear transition in the daughter {sup 149}Sm. In this investigation, four pairs of {sup 149}Eu sources prepared by vacuum evaporation deposition and by ion implantation at 30 keV with the use of four different source backing materials, namely polycrystalline carbon, aluminium, gadolinium and platinum foils, were employed. The greatest average difference of (3.1 ± 0.1) eV in the L{sub 1}, L{sub 2}, L{sub 3}, and M{sub 1} subshell electron binding energies was observed between the {sup 149}Eu sources prepared by ion implantation into the aluminium and platinum substrates. On the other hand, minimal differences in the electron binding energies were generally found between samarium generated in the evaporated layer and in the bulk for the individual investigated source backings with the exception of the gadolinium foil. A doublet structure of all investigated conversion electron lines with the average values of 8.1 ± 0.2 eV and 1.5 ± 0.1 for the separation energy and the intensity ratio of the low-energy to high-energy components, respectively, was observed for the {sup 149}Eu sources prepared by ion implantation into the aluminium and carbon foils. This structure was presumably caused by the presence of both the trivalent and divalent Sm ions in the sources. No

  17. Multiphoton laser wave-mixing absorption spectroscopy for samarium using a graphite furnace atomizer

    Energy Technology Data Exchange (ETDEWEB)

    Maniaci, Michael J.; Tong, William G. E-mail: william.tong@sdsu.edu

    2004-07-30

    Nonlinear laser wave-mixing optical technique is presented as a sensitive atomic spectroscopic method for the analysis of rare earth elements using an unmodified commercially available graphite furnace (GF) atomizer. A simple nonplanar backward-scattering degenerate four-wave mixing optical arrangement offers sub-picogram detection sensitivity with sub-Doppler Lorentzian-broadened resolution. Nonlinear wave mixing is an unusually sensitive absorption-based optical method that offers both excellent detection sensitivity and sub-Doppler spectral resolution. A mass detection limit of 0.7 pg and a concentration detection limit of 70 pg/ml are determined for a rare earth element, samarium, using the 429.7-nm excitation line.

  18. Samarium Doped Cerium Oxide Clusters: a Study on the Modulation of Electronic Structure

    Science.gov (United States)

    Topolski, Josey E.; Kafader, Jared O.; Marrero-Colon, Vicmarie; Chick Jarrold, Caroline

    2017-06-01

    Cerium oxide is known for its use in solid oxide fuel cells due to its high ionic conductivity. The doping of trivalent samarium atoms into cerium oxide is known to enhance the ionic conductivity through the generation of additional oxygen vacancies. This study probes the electronic structure of Sm_{x}Ce_{y}O_{z} (x+y=3, z=2-4) anion and neutral clusters. Anion photoelectron spectra of these mixed metal clusters exhibit additional spectral features not present in the previously studied cerium oxide clusters. Density functional theory calculations have been used to aid interpretation of collected spectra. The results of this work can be used to inform the design of materials used for solid oxide fuel cells.

  19. Chelating Ligand-Mediated Hydrothermal Synthesis of Samarium Orthovanadate with Decavanadate as Vanadium Source

    Directory of Open Access Journals (Sweden)

    Quanguo Li

    2013-01-01

    Full Text Available A new ethylenediaminetetraacetic acid- (EDTA- mediated hydrothermal route to prepare chrysanthemum-shaped samarium orthovanadate (SmVO4 nanocrystals with decavanadate (K6V10O28·9H2O as vanadium source has been developed. The present hydrothermal approach is simple and reproducible and employs a relatively mild reaction temperature. The EDTA, pH value, and temperature of the reaction systems play important roles in determining the morphologies and growth process of the SmVO4 products. The products have been characterized by X-ray diffraction (XRD, scanning electron microscopy (SEM, Fourier transform infrared spectroscopy (FT-IR, photoluminescence spectra (PL, and UV-Vis spectroscopy.

  20. The Magnetocaloric Effect and Heat Capacity of Suspensions of High-Dispersity Samarium Ferrite

    Science.gov (United States)

    Korolev, V. V.; Aref'ev, I. M.; Ramazanova, A. G.

    2008-02-01

    The magnetocaloric effect and specific heat capacity of an aqueous suspension of samarium ferrite were determined calorimetrically over the temperature range 288-343 K in magnetic fields of 0-0.7 T. The data obtained were used to calculate changes in the magnetic component of the molar heat capacity and entropy of the magnetic phase and changes in the enthalpy of the process under an applied magnetic field. The magnetocaloric effect was found to increase nonlinearly as the magnetic field induction grew. The corresponding temperature dependences contained a maximum at 313 K related to the second-order magnetic phase transition at the Curie point. The field and temperature dependences of heat capacity contained a maximum in fields of 0.4 T and a minimum at the magnetic phase transition temperature.

  1. Preparation of hollow core/shell microspheres of hematite and its adsorption ability for samarium.

    Science.gov (United States)

    Yu, Sheng-Hui; Yao, Qi-Zhi; Zhou, Gen-Tao; Fu, Sheng-Quan

    2014-07-09

    Hollow core/shell hematite microspheres with diameter of ca. 1-2 μm have been successfully achieved by calcining the precursor composite microspheres of pyrite and polyvinylpyrrolidone (PVP) in air. The synthesized products were characterized by a wide range of techniques including powder X-ray diffraction (XRD), field-emission scanning electron microscopy (FESEM), energy-dispersive X-ray spectroscopy (EDX), transmission electron microscopy (TEM), high-resolution TEM (HRTEM), thermogravimetric analysis (TGA) and differential scanning calorimetry (DSC), and Brunauer-Emmett-Teller (BET) gas sorptometry. Temperature- and time-dependent experiments unveil that the precursor pyrite-PVP composite microspheres finally transform into hollow core/shell hematite microspheres in air through a multistep process including the oxidation and sulfation of pyrite, combustion of PVP occluded in the precursor, desulfation, aggregation, and fusion of nanosized hematite as well as mass transportation from the interior to the exterior of the microspheres. The formation of the hollow core/shell microspheres dominantly depends on the calcination temperature under current experimental conditions, and the aggregation of hematite nanocrystals and the core shrinking during the oxidation of pyrite are responsible for the formation of the hollow structures. Moreover, the adsorption ability of the hematite for Sm(III) was also tested. The results exhibit that the hematite microspheres have good adsorption activity for trivalent samarium, and that its adsorption capacity strongly depends on the pH of the solution, and the maximum adsorption capacity for Sm(III) is 14.48 mg/g at neutral pH. As samarium is a typical member of the lanthanide series, our results suggest that the hollow hematite microspheres have potential application in removal of rare earth elements (REEs) entering the water environment.

  2. The influence of the technological parameters on the ionic conductivity of samarium doped ceria thin films

    Directory of Open Access Journals (Sweden)

    Mantas Sriubas

    2015-03-01

    Full Text Available Sm0,20Ce0,80O2 powder was used for the formation of samarium doped cerium oxide (SDC thin films using e-beam. Surface area of powder was 34.9 m2/g and particle size – 0.3-0.5 μm. Thin films were deposited using physical vapor deposition system on SiO2 and Alloy 600 substrates. 2 Å/s – 16 Å/s growth rate and 20 °C – 600 °C substrate temperature were used during the deposition. Ionic conductivity investigation revealed that the maximum ionic conductivity (1.67 S/m has the thin film deposited on 300 °C temperature substrate using 4 Å/s growth rate. Minimum ionic conductivity (0.26 S/m has thin film which was deposited on 20 °C temperature substrate using 8 Å/s growth rate. Vacancy activation energies vary in 0.87 eV – 0.97 eV range. Furthermore the calculations of crystallite size revealed that crystallite size increases with increasing substrate temperature: from 7.50 nm to 46.23 nm on SiO2 substrate and from 9.30 nm to 44.62 nm on Alloy 600 substrate. Molar concentration of samarium in initial evaporated material is 19.38 mol% and varies from 11.37 mol% to 21 mol% in formed thin films depending on technological parameters.DOI: http://dx.doi.org/10.5755/j01.ms.21.1.5700

  3. Synthesis, quality control and biological evaluation of tris[(1,10-phenanthroline)[{sup 153}Sm]samarium(III)]trithiocyanate complex as a therapeutic agent

    Energy Technology Data Exchange (ETDEWEB)

    Naseri, Z.; Kharat, A. Nemati [Tehran Univ. (Iran, Islamic Republic of). Inorganic Chemistry Dept.; Hakimi, A. [Islamic Azad Univ., Tehran (Iran, Islamic Republic of). Dept. of Nuclear Engineering, Science and Research Branch; Jalilian, A.R.; Shirvani-Arani, S.; Bahrami-Samani, A.; Ghannadi-Maragheh, M. [Nuclear Science and Technology Research Institute (NSTRI), Tehran (IR). Radiopharmaceutical Research and Development Lab (RRDL)

    2012-07-01

    Therapeutic radiopharmaceuticals are designed to deliver high doses of radiation to selected target organs or tissues with an aim of minimizing unwanted radiation to surrounding healthy tissue. In this work, [tris(1,10-phenanthroline)[{sup 153}Sm]samarium(III)]trithiocyanate ({sup 153}Sm-TPTTC) was developed for possible therapeutic properties. The cold compound, i.e. {sup nat}Sm-TPTTC was prepared and characterized by IR, UV, mass and {sup 1}H-NMR spectroscopy. {sup 153}Sm-TPTTC was prepared in two steps using [{sup 153}Sm]SmCl{sub 3}, obtained by neutron activation of an enriched {sup 152}Sm sample. Stability tests, partition coefficient determination, toxicity tests and biodistribution studies of the complex in wild-type and fibrosarcoma-bearing mice were determined. The radiolabeled complex was prepared in high radiochemical purity (> 99% precipitation method) and specific activity of 278 GBq/mmol and demonstrated significant stability at 4, 25 and 37 C (in presence of human serum). Initial complex biodistribution data showed significant liver accumulation in wild-type mice and significant tumor accumulation in fibrosarcoma-bearing mice with tumor:blood and tumor:muscle ratios of 3.55 (2 h) and 38.26 (96 h) respectively. {sup 153}Sm-TPTTC properties suggest an efficient tumor targeting agent with high tumor-avidity. Further investigation on the therapeutic properties must be conducted. (orig.)

  4. Inhibiting microRNA-144 abates oxidative stress and reduces apoptosis in hearts of streptozotocin-induced diabetic mice.

    Science.gov (United States)

    Yu, Manli; Liu, Yu; Zhang, Bili; Shi, Yicheng; Cui, Ling; Zhao, Xianxian

    2015-01-01

    Hyperglycemia-induced reactive oxygen species (ROS) generation contributes to the development of diabetic cardiomyopathy. However, little is known about the role of microRNAs in the regulation of ROS formation and myocardial apoptosis in streptozotocin (STZ)-induced diabetic mice. It was observed that microRNA-144 (miR-144) level was lower in heart tissues of STZ-induced diabetic mice. High glucose exposure also reduced miR-144 levels in cultured cardiomyocytes. Moreover, miR-144 modulated high glucose-induced oxidative stress in cultured cardiomyocytes by directly targeting nuclear factor-erythroid 2-related factor 2 (Nrf2), which was a central regulator of cellular response to oxidative stress. The miR-144 mimics aggravated high glucose-induced ROS formation and apoptosis in cardiomyocytes, which could be attenuated by treatment with Dh404, an activator of Nrf2. Meanwhile, inhibition of miR-144 suppressed ROS formation and apoptosis induced by high glucose in cultured cardiomyocytes. What was more important is that reduced myocardial oxidative stress and apoptosis and improved cardiac function were identified in STZ-induced diabetic mice when treated with miR-144 antagomir. Although miR-144 cannot explain the increased oxidative stress in STZ, therapeutic interventions directed at decreasing miR-144 may help to decrease oxidative stress in these hearts. Inhibition of miR-144 might have clinical potential to abate oxidative stress as well as to reduce cardiomyocyte apoptosis and improve cardiac function in diabetic cardiomyopathy. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Formation of Core-Shell Nanoparticles Composed of Magnetite and Samarium Oxide in Magnetospirillum magneticum Strain RSS-1.

    Science.gov (United States)

    Shimoshige, Hirokazu; Nakajima, Yoshikata; Kobayashi, Hideki; Yanagisawa, Keiichi; Nagaoka, Yutaka; Shimamura, Shigeru; Mizuki, Toru; Inoue, Akira; Maekawa, Toru

    2017-01-01

    Magnetotactic bacteria (MTB) synthesize magnetosomes composed of membrane-enveloped magnetite (Fe3O4) or greigite (Fe3S4) particles in the cells. Recently, several studies have shown some possibilities of controlling the biomineralization process and altering the magnetic properties of magnetosomes by adding some transition metals to the culture media under various environmental conditions. Here, we successfully grow Magnetospirillum magneticum strain RSS-1, which are isolated from a freshwater environment, and find that synthesis of magnetosomes are encouraged in RSS-1 in the presence of samarium and that each core magnetic crystal composed of magnetite is covered with a thin layer of samarium oxide (Sm2O3). The present results show some possibilities of magnetic recovery of transition metals and synthesis of some novel structures composed of magnetic particles and transition metals utilizing MTB.

  6. Co-reduction of aluminium and lanthanide ions in molten fluorides: Application to cerium and samarium extraction from nuclear wastes

    Energy Technology Data Exchange (ETDEWEB)

    Gibilaro, M. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France); Massot, L. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France)], E-mail: massot@chimie.ups-tlse.fr; Chamelot, P.; Taxil, P. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France)

    2009-09-01

    This work concerns the method of co-reduction process with aluminium ions in LiF-CaF{sub 2} medium (79-21 mol.%) on tungsten electrode for cerium and samarium extraction. Electrochemical techniques such as cyclic and square wave voltammetries, and potentiostatic electrolyses were used to study the co-reduction of CeF{sub 3} and SmF{sub 3} with AlF{sub 3}. For each of these elements, specific peaks of Al-Ce and Al-Sm alloys formation were observed by voltammetry as well as peaks of pure cerium and aluminium, and pure samarium and aluminium respectively. The difference of potential measured between the solvent reduction and the alloy formation suggests expecting an extraction efficiency of 99.99% of each lanthanide by the process. Different intermetallic compounds were obtained for different potentiostatic electrolysis and were characterised by Scanning Electron Microscopy with EDS probe. The validity of the process was verified by carrying out cerium and samarium extractions in the form of Al-Ln alloy; the extraction efficiency was 99.5% for Ce(III) and 99.4% for Sm(III)

  7. 19 CFR 144.5 - Period of warehousing.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Period of warehousing. 144.5 Section 144.5 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY... warehousing. Merchandise must not remain in a bonded warehouse beyond 5 years from the date of importation or...

  8. 40 CFR 144.4 - Considerations under Federal law.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Considerations under Federal law. 144... (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM General Provisions § 144.4 Considerations under Federal law. The following is a list of Federal laws that may apply to the issuance of permits under these rules...

  9. 33 CFR 144.01-30 - First-aid kit.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false First-aid kit. 144.01-30 Section...) OUTER CONTINENTAL SHELF ACTIVITIES LIFESAVING APPLIANCES Manned Platforms § 144.01-30 First-aid kit. On each manned platform a first-aid kit approved by the Commandant or the U.S. Bureau of Mines shall be...

  10. MicroRNA-144 inhibits hepatocellular carcinoma cell proliferation ...

    Indian Academy of Sciences (India)

    2017-01-20

    Jan 20, 2017 ... present study, the expression of miR-144 was firstly analysed in datasets derived from GSE21362 and TCGA, and then detected in HCC tissues and cell lines by quantitative RT-PCR (qRT-PCR) analysis. MiR-144 was shown to be significantly down-regulated in HCC tissues and cell lines. Subsequently ...

  11. 24 CFR 100.144 - Scope of privilege.

    Science.gov (United States)

    2010-04-01

    ... DISCRIMINATORY CONDUCT UNDER THE FAIR HOUSING ACT Discrimination in Residential Real Estate-Related Transactions... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Scope of privilege. 100.144 Section 100.144 Housing and Urban Development Regulations Relating to Housing and Urban Development OFFICE OF...

  12. 21 CFR 522.144 - Arsenamide sodium aqueous injection.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Arsenamide sodium aqueous injection. 522.144 Section 522.144 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... evidence of reduced liver function, a more conservative dosage schedule of 0.1 milliliter per pound of body...

  13. 21 CFR 133.144 - Granular and stirred curd cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Granular and stirred curd cheese. 133.144 Section... (CONTINUED) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.144 Granular and stirred curd cheese. (a) Description. (1...

  14. 14 CFR 135.144 - Portable electronic devices.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Portable electronic devices. 135.144... Equipment § 135.144 Portable electronic devices. (a) Except as provided in paragraph (b) of this section, no... portable electronic device on any of the following U.S.-registered civil aircraft operating under this part...

  15. 27 CFR 20.144 - Packages of completely denatured alcohol.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Packages of completely denatured alcohol. 20.144 Section 20.144 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS DISTRIBUTION AND USE OF DENATURED ALCOHOL AND RUM Sale...

  16. 27 CFR 9.144 - Texas High Plains.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Texas High Plains. 9.144 Section 9.144 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT... Mexico; Texas” 1954, revised 1973. (2) “Brownfield, Texas; New Mexico” 1954, revised 1973. (3) “Hobbs...

  17. 49 CFR 572.144 - Thorax assembly and test procedure.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 7 2010-10-01 2010-10-01 false Thorax assembly and test procedure. 572.144...-year-Old Child Crash Test Dummy, Alpha Version § 572.144 Thorax assembly and test procedure. (a) Thorax (upper torso) assembly (refer to § 572.140(a)(1)(iv)). The thorax consists of the upper part of the torso...

  18. 40 CFR 61.144 - Standard for manufacturing.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Standard for manufacturing. 61.144... § 61.144 Standard for manufacturing. (a) Applicability. This section applies to the following manufacturing operations using commercial asbestos. (1) The manufacture of cloth, cord, wicks, tubing, tape...

  19. 10 CFR 1.44 - Office of New Reactors.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Office of New Reactors. 1.44 Section 1.44 Energy NUCLEAR... Office of New Reactors. The Office of New Reactors— (a) Develops, promulgates and implements regulations... safeguarding of nuclear reactor facilities licensed under part 52 of this chapter prior to initial commencement...

  20. 40 CFR 52.144 - Significant deterioration of air quality.

    Science.gov (United States)

    2010-07-01

    ... quality. 52.144 Section 52.144 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... deterioration of air quality. (a) The requirements of sections 160 through 165 of the Clean Act are not met... lands does not include approvable procedures for preventing the significant deterioration of air quality...

  1. 33 CFR 144.20-5 - Exposure suits.

    Science.gov (United States)

    2010-07-01

    ... § 144.20-5 Exposure suits. This section applies to each MODU except those operating south of 32 degrees... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Exposure suits. 144.20-5 Section... MODU must carry an exposure suit for each person on board. The exposure suit must be stowed in a...

  2. Structural and luminescence properties of samarium doped lead alumino borate glasses

    Science.gov (United States)

    Mohan, Shaweta; Kaur, Simranpreet; Singh, D. P.; Kaur, Puneet

    2017-11-01

    The study reports the effect of samarium concentration on the physical, structural and spectroscopic characteristics of samarium doped lead alumino borate glasses having composition 20PbO-(10-x)Al2O3-70B2O3-xSm2O3; x = 0.1, 0.5, 1.0 and 2.0 mol %. The glasses were fabricated by conventional melt-quenching technique and then characterized by XRD, FTIR, optical absorption and fluorescence spectra. X-ray diffraction studies confirmed the amorphous nature of the prepared glasses. FTIR spectra indicate the presence of BO3, BO4, AlO6 and a few other structural groups. Various physical properties such as density, molar volume, refractive index, rare earth ion concentration, boron-boron distance and polarizability etc. were determined using conventional methods and standard formulae. The Judd-Ofelt theory was applied on the optical absorption spectra of the glasses to evaluate the three phenomenological intensity parameters Ω2, Ω4 and Ω6. The value of Ω2 was found to be highest for glass with 1 mol% Sm2O3 and attributed to the asymmetry of the ligand field at the rare earth ion site and the rare earth oxygen (Sm-O) covalency. The calculated intensity parameters and fluorescence spectra were further used to predict the radiative transition probability (A), radiative lifetime (τR), branching ratio (βR), peak wavelength (λp), effective line widths (Δλeff) and stimulated emission cross-section (σ) for the characteristic 4G5/2 → 6H5/2, 6H7/2 and 6H9/2 transitions of the Sm3+ ion. Concentration quenching was observed for 2 mol% concentration of Sm2O3 and ascribed to energy transfer through various cross-relaxation channels between Sm3+ ions. Reasonably high values of branching ratios and stimulated emission cross-section for the prepared glasses points towards their utility in the development of visible lasers emitting in the reddish-orange spectral region. However, the glass with 1 mol% Sm2O3 was found to show better radiative properties.

  3. X-ray Induced Luminescence Spectroscopy of Samarium Doped Barium Sulfate Prepared by Sintering Method

    Science.gov (United States)

    Kumeda, T.; Maeda, K.; Shirano, Y.; Fujiwara, K.; Sakai, K.; Ikari, T.

    2015-06-01

    X-ray induced luminescence (XL) properties of phosphor materials made of samarium doped barium sulfate have been investigated. The samples were prepared by sintering method heated at 900-1250 °C for 3 hours in air from the mixture of BaSO4 and Sm2O3. The concentration of Sm were prepared from 0.01-6 at.%. In as-prepared sample, the Sm3+ was detected by photoluminescence (PL). The PL intensity is maximum about 2 at.% with Sm, and then starts decreasing. The PL intensity showed concentration quenching. The XL observed Sm2+ and Sm3+ ions. The XL was shown from the sample sintered up to 1200 °C. The XL intensity increased with Sm concentration up to 1 at.%. The intensity was almost constant larger than 1 at.% Sm. These concentration dependences is different since the X-ray energy absorbed to the host material at once, and the energy transferred to both Sm3+ and Sm2+ ions. Sm doped BaSO4 is found a host for XL phosphor materials.

  4. High-κ Samarium-Based Metal-Organic Framework for Gate Dielectric Applications.

    Science.gov (United States)

    Pathak, Abhishek; Chiou, Guan Ru; Gade, Narsinga Rao; Usman, Muhammad; Mendiratta, Shruti; Luo, Tzuoo-Tsair; Tseng, Tien Wen; Chen, Jenq-Wei; Chen, Fu-Rong; Chen, Kuei-Hsien; Chen, Li-Chyong; Lu, Kuang-Lieh

    2017-07-05

    The self-assembly of a samarium-based metal-organic framework [Sm2(bhc)(H2O)6]n (1) in good yield was achieved by reacting Sm(NO3)3·6H2O with benzenehexacarboxylic acid (bhc) in a mixture of H2O-EtOH under hydrothermal conditions. A structural analysis showed that compound 1 crystallized in a space group of Pnmn and adopted a 3D structure with (4,8) connected nets. Temperature dependent dielectric measurements showed that compound 1 behaves as a high dielectric material with a high dielectric constant (κ = 45.1) at 5 kHz and 310 K, which is comparable to the values for some of the most commonly available dielectric inorganic metal oxides such as Sm2O3, Ta2O5, HfO2, and ZrO2. In addition, electrical measurements of 1 revealed an electrical conductivity of about 2.15 × 10-7 S/cm at a frequency of 5 kHz with a low leakage current (Ileakage = 8.13 × 10-12 Amm-2). Dielectric investigations of the Sm-based MOF provide an effective path for the development of high dielectric materials in the future.

  5. Pyroelectric properties and electrical conductivity in samarium doped BiFeO 3 ceramics

    KAUST Repository

    Yao, Yingbang

    2012-06-01

    Samarium (Sm 3+) doped BiFeO 3 (BFO) ceramics were prepared by a modified solid-state-reaction method which adopted a rapid heating as well as cooling during the sintering process. The pyroelectric coefficient increased from 93 to 137 μC/m 2 K as the Sm 3+ doping level increased from 1 mol% to 8 mol%. Temperature dependence of the pyroelectric coefficient showed an abrupt decrease above 80 °C in all samples, which was associated with the increase of electrical conductivity with temperature. This electrical conduction was attributed to oxygen vacancy existing in the samples. An activation energy of ∼0.7 eV for the conduction process was found to be irrespective of the Sm 3+ doping level. On the other hand, the magnetic Néel temperature (T N) decreased with increasing Sm 3+ doping level. On the basis of our results, the effects of Sm doping level on the pyroelectric and electrical properties of the BFO were revealed. © 2011 Elsevier Ltd. All rights reserved.

  6. Characterization of luminescent samarium doped HfO{sub 2} coatings synthesized by spray pyrolysis technique

    Energy Technology Data Exchange (ETDEWEB)

    Chacon-Roa, C [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Guzman-Mendoza, J [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Aguilar-Frutis, M [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Garcia-Hipolito, M [Departamento de Materiales Metalicos y Ceramicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autonoma de Mexico, A.P. 70-360 Coyoacan 04510, Mexico, D.F. (Mexico); Alvarez-Fragoso, O [Departamento de Materiales Metalicos y Ceramicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autonoma de Mexico, A.P. 70-360 Coyoacan 04510, Mexico, D.F. (Mexico); Falcony, C [Departamento de Fisica, CINVESTAV-IPN, A. P. 14-740, 07000 Mexico D.F. (Mexico)

    2008-01-07

    Trivalent samarium (Sm{sup 3+}) doped hafnium oxide (HfO{sub 2}) films were deposited using the spray pyrolysis deposition technique. The films were deposited on Corning glass substrates at temperatures ranging from 300 to 550 deg. C using chlorides as raw materials. Films, mostly amorphous, were obtained when deposition temperatures were below 350 deg. C. However, for temperatures higher than 400 deg. C, the films became polycrystalline, presenting the HfO{sub 2} monoclinic phase. Scanning electron microscopy of the films revealed a rough surface morphology with spherical particles. Also, electron energy dispersive analysis was performed on these films. The photoluminescence and cathodoluminescence characteristics of the HfO{sub 2} : SmCl{sub 3} films, measured at room temperature, exhibited four main bands centred at 570, 610, 652 and 716 nm, which are due to the well-known intra-4f transitions of the Sm{sup 3+} ion. It was found that the overall emission intensity rose as the deposition temperature was increased. Furthermore, a concentration quenching of the luminescence intensity was also observed.

  7. Samarium-153 EDTMP for metastatic bone pain palliation: the impact of europium impurities.

    Science.gov (United States)

    Kalef-Ezra, J A; Valakis, S T; Pallada, S

    2015-02-01

    To evaluate the impact on the radiation protection policies of the radiocontaminants in Samarium-153 ethylenediamine tetramethylene phosphonate ((153)Sm-EDTMP). The internal contamination of patients treated with (153)Sm-EDMTP for palliation of painful disseminated multiple bone metastases due to long-lived impurities was assessed by direct measurements. These measurements were coupled with dose-rate measurements close to their bodies and spectroscopic analysis of the residual activity in post-treatment radiopharmaceutical vials. Whole-body counting carried out in six patients showed a 30-81-kBq europium -152 plus europium-154 contamination. The 0.85 mean (152)Eu- to -(154)Eu activity ratio obtained by direct counting was similar to that assessed by analysis of post-treatment residual activities in twelve radiopharmaceutical vials following radiopharmaceutical injection. The long-lived radiocontaminants in the patient's bodies and the treatment wastes require modifications of the applicable radiation protection policies. Copyright © 2014 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  8. Luminescence of trivalent samarium ions in silver and tin co-doped aluminophosphate glass

    Science.gov (United States)

    Jiménez, José A.; Lysenko, Sergiy; Liu, Huimin; Sendova, Mariana

    2011-06-01

    This work presents the spectroscopic properties of trivalent samarium ions in a melt-quenched aluminophosphate glass containing silver and tin. Addition of 4 mol% of each Ag 2O and SnO into the glass system with 2 mol% Sm 2O 3 results in Sm 3+ ions luminescence under non-resonant UV excitation owing to energy transfer from single silver ions and/or twofold-coordinated Sn centers. Assessment of luminescence spectra and decay dynamics suggest the energy transfer mechanism to be essentially of the resonant radiative type. Moreover, a connection between the luminescent and structural properties of the rare-earth doped glass system was demonstrated. Raman spectroscopy characterization revealed that no significant variation in the glass matrix is induced by Sm 3+ doping at the concentration employed. A comparison was made with a structural study performed on the Eu 3+ doped system (containing 2 mol% Eu 2O 3 along with 4 mol% of each Ag 2O and SnO) where the radiative energy transfer mechanism was previously established. The data appears consistent regarding the lack of variation in glass structure upon the Eu 3+ and Sm 3+ doping in connection with the dominance of the radiative transfer in the matrix. Thermal treatment of the material leads to precipitation of Ag nanoparticles of a broad size range inside the dielectric as observed by transmission electron microspcopy. Assessment of 4G 5/2 excited state decay in Sm 3+ ions shows no influence from the silver particles.

  9. Samarium (III) adsorption on bentonite modified with N-(2-hydroxyethyl) ethylenediamine.

    Science.gov (United States)

    Li, Dandan; Chang, Xijun; Hu, Zheng; Wang, Qihui; Li, Ruijun; Chai, Xiaoli

    2011-02-15

    A new material has been synthesized using dry process to activate bentonite followed by N-(2-hydroxyethyl) ethylenediamine connecting chlorosilane coupling agent. The synthesized new material was characterized by elemental analysis, FT-IR and thermogravimetry which proved that bentonite was successfully modified. The most interesting trait of the new material was its selective adsorption for rare earth elements. A variety of conditions of the new material were investigated for adsorption. The optimal conditions were determined with respect to pH and shaking time. Samarium (Sm) was quantitatively adsorbed at pH 4 and shaking time of 2 min onto the new material. Under these conditions the maximum static adsorption capacity of Sm(III) was found to be 17.7 mg g(-1). The adsorbed Sm(III) ion were quantitatively eluted by 2.0 mL 0.1 mol L(-1) HCl and 5% CS (NH(2))(2) solution. According to IUPAC definition, the detection limit (3σ) of this method was 0.60 ng mL(-1). The relative standard deviation (RSD) under optimum conditions was less than 3% (n=8). The new material also was applied for the preconcentration of trace Sm(III) in environmental samples with satisfactory results. Copyright © 2010 Elsevier B.V. All rights reserved.

  10. Cytochrome P450-mediated metabolism of the synthetic cannabinoids UR-144 and XLR-11

    DEFF Research Database (Denmark)

    Nielsen, Line Marie; Holm, Niels Bjerre; Olsen, Lars

    2016-01-01

    In recent years, synthetic cannabinoids have emerged in the illicit drug market, in particular via the Internet, leading to abuse of these drugs. There is currently limited knowledge about the specific enzymes involved in the metabolism of these drugs. In this study, we investigated the cytochrome...... of UR-144 and XLR-11, while inhibition of the other CYP enzymes in HLM had only minor effects. Thus, CYP3A4 is the major contributor to the CYP mediated metabolism of UR-144 and XLR-11 with minor contributions from CYP1A2. Users of UR-144 and XLR-11 are thus subject to the influence of potential drug-drug...... the specific CYP enzymes involved in the metabolism of UR-144 and XLR-11 utilizing a panel of nine recombinant enzymes (CYP1A2, 2B6, 2C8, 2C9, 2C18, 2C19, 2D6, 3A4, and 2E1). This is followed by an investigation of the effect of specific inhibitors targeted against CYP1A2, 2B6, 2C9, 2C19, 2D6 and 3A4 in human...

  11. Phenotype abnormality: 144 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 144 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u650i decreased efficiency... in organ named chloroplast during process named chloroplast fission ... decreased efficiency ...

  12. 7 CFR 58.144 - Pasteurization or ultra-pasteurization.

    Science.gov (United States)

    2010-01-01

    ... 58.144 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) REGULATIONS AND STANDARDS UNDER THE AGRICULTURAL MARKETING ACT OF 1946 AND THE EGG PRODUCTS INSPECTION ACT...

  13. Fabrication and properties of samarium doped calcium sulphate thin films using spray pyrolysis technique

    Energy Technology Data Exchange (ETDEWEB)

    Reghima, Meriem [Université Tunis El Manar, Faculté des Sciences de Tunis, Département de Physique, LR99ES13 Laboratoire de Physique de la Matière Condensée (LPMC), 2092 Tunis, Tunisie (Tunisia); Institut d' Electronique et des systèmes, Unité Mixte de Recherche 5214 UM2-CNRS (ST2i) – Université Montpellier, 860 rue de Saint Priest, Bâtiment 5, 34097 Montpellier (France); Faculté des Sciences de Bizerte, Université de Carthage, Zarzouna 7021 (Tunisia); Guasch, Cathy [Institut d' Electronique et des systèmes, Unité Mixte de Recherche 5214 UM2-CNRS (ST2i) – Université Montpellier, 860 rue de Saint Priest, Bâtiment 5, 34097 Montpellier (France); Azzaza, Sonia; Alleg, Safia [Laboratoire de Magnétisme et Spectroscopie des Solides (LM2S), Département de Physique, Faculté des Sciences, Université Badji Mokhtar Annaba, B.P. 12, 23000 Annaba (Algeria); Kamoun-Turki, Najoua [Université Tunis El Manar, Faculté des Sciences de Tunis, Département de Physique, LR99ES13 Laboratoire de Physique de la Matière Condensée (LPMC), 2092 Tunis, Tunisie (Tunisia)

    2016-10-01

    Using low cost spray pyrolysis technique, polycrystalline CaSO{sub 4} thin films were successfully grown on a glass substrate with a thickness of about 1 μm. Samarium doping has been performed on CaSO{sub 4} thin films to explore luminescence properties. The characterizations of these films were carried out using X-ray diffraction, Scanning Electron Microscopy and optical measurements. The structural analyses reveal the existence of hexagonal CaSO{sub 4} phase with a (200) preferred orientation belonging to CaS compound for substrate temperatures below 350 °C. It is shown that the crystallinity of the sprayed thin films can be improved by increasing substrate temperature up to 250 °C. Warren-Averbach analysis has been applied on X-ray diffractogram to determine structural parameters involving the phase with its amount, the grain size and the lattice parameters using Maud software. The surface topography shows a rough surface covered by densely packed agglomerated clusters having faceted and hexagonal shapes. Energy dispersive microscopy measurements confirm the presence of calcium and sulfur in equal proportions as well as high percentage of oxygen. Photoluminescence at room temperature revealed that luminescence peaks are attributed to the intrinsic emission of pure CaSO{sub 4} phase. - Highlights: • Warren Averbach analysis reveal the presence of hcp structure of CaSO{sub 4} phase. • A mixture of CaSO{sub 4} and CaHO{sub 4.5}S phases has been detected for lower T{sub s}. • For increasing T{sub s}, the CaHO{sub 4.5}S phase has been disappeared. • The origin of PL peaks has been identified.

  14. SU-C-201-06: Utility of Quantitative 3D SPECT/CT Imaging in Patient Specific Internal Dosimetry of 153-Samarium with GATE Monte Carlo Package

    Energy Technology Data Exchange (ETDEWEB)

    Fallahpoor, M; Abbasi, M [Tehran University of Medical Sciences, Vali-Asr Hospital, Tehran, Tehran (Iran, Islamic Republic of); Sen, A [University of Houston, Houston, TX (United States); Parach, A [Shahid Sadoughi University of Medical Sciences, Yazd, Yazd (Iran, Islamic Republic of); Kalantari, F [UT Southwestern Medical Center, Dallas, TX (United States)

    2015-06-15

    Purpose: Patient-specific 3-dimensional (3D) internal dosimetry in targeted radionuclide therapy is essential for efficient treatment. Two major steps to achieve reliable results are: 1) generating quantitative 3D images of radionuclide distribution and attenuation coefficients and 2) using a reliable method for dose calculation based on activity and attenuation map. In this research, internal dosimetry for 153-Samarium (153-Sm) was done by SPECT-CT images coupled GATE Monte Carlo package for internal dosimetry. Methods: A 50 years old woman with bone metastases from breast cancer was prescribed 153-Sm treatment (Gamma: 103keV and beta: 0.81MeV). A SPECT/CT scan was performed with the Siemens Simbia-T scanner. SPECT and CT images were registered using default registration software. SPECT quantification was achieved by compensating for all image degrading factors including body attenuation, Compton scattering and collimator-detector response (CDR). Triple energy window method was used to estimate and eliminate the scattered photons. Iterative ordered-subsets expectation maximization (OSEM) with correction for attenuation and distance-dependent CDR was used for image reconstruction. Bilinear energy mapping is used to convert Hounsfield units in CT image to attenuation map. Organ borders were defined by the itk-SNAP toolkit segmentation on CT image. GATE was then used for internal dose calculation. The Specific Absorbed Fractions (SAFs) and S-values were reported as MIRD schema. Results: The results showed that the largest SAFs and S-values are in osseous organs as expected. S-value for lung is the highest after spine that can be important in 153-Sm therapy. Conclusion: We presented the utility of SPECT-CT images and Monte Carlo for patient-specific dosimetry as a reliable and accurate method. It has several advantages over template-based methods or simplified dose estimation methods. With advent of high speed computers, Monte Carlo can be used for treatment planning

  15. Optical properties and electronic transitions of zinc oxide, ferric oxide, cerium oxide, and samarium oxide in the ultraviolet and extreme ultraviolet

    DEFF Research Database (Denmark)

    Pauly, N; Yubero, F; Espinós, J P

    2017-01-01

    Optical properties and electronic transitions of four oxides, namely zinc oxide, ferric oxide, cerium oxide, and samarium oxide, are determined in the ultraviolet and extreme ultraviolet by reflection electron energy loss spectroscopy using primary electron energies in the range 0.3-2.0 keV. This...

  16. Optical response and magnetic characteristic of samarium doped zinc phosphate glasses containing nickel nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Azmi, Siti Amlah M.; Sahar, M.R., E-mail: mrahim057@gmail.com

    2015-11-01

    A magnetic glass of composition 40ZnO–(58−x) P{sub 2}O{sub 5}–1Sm{sub 2}O{sub 3}–xNiO, with x=0.0, 1.0, 1.5 and 2.0 mol% is prepared by melt-quenching technique. The glass is characterized by X-ray diffraction, high-resolution transmission electron microscope (HRTEM), photoluminescence (PL) spectroscopy and vibrating sample magnetometer (VSM) analysis. The X-rays diffraction confirms the amorphous nature of the glass while the HRTEM analysis reveals the presence of nickel nanoparticles in the glass samples. High-resolution TEM reveals that the lattice spacing of nickel nanoparticles is 0.35 nm at (100) plane. Photoluminescence emission shows the existence of four peaks that correspond to the transition from the upper level of {sup 4}G{sub 5/2} to the lower level of {sup 6}H{sub 5/2}, {sup 6}H{sub 7/2}, {sup 6}H{sub 9/2,} and {sup 6}H{sub 11/2.} It is observed that all peaks experience significant quenching effect with the increasing concentration of nickel nanoparticles, suggesting a strong energy transfer from excited samarium ions to the nickel ions. The glass magnetization and susceptibility at 12 kOe at room temperature are found to be in the range of (3.87±0.17×10{sup −2}–7.19±0.39×10{sup −2}) emu/g and (3.24±0.16×10{sup −6}–5.99±0.29×10{sup −6}) emu/Oe g respectively. The obtained hysteresis curve indicates that the glass samples are paramagnetic materials. The studied glass can be further used towards the development of magneto-optical functional glass. - Highlights: • Sm{sup 3+} doped zinc phosphate glass embedded with Ni NPs has been prepared. • The Laue pattern and lattice spacing of Ni NPs are confirmed by HRTEM image. • The magnetic response of glasses has been studied through VSM analysis. • Enhancement factor and decay half-lifetime are investigated.

  17. Treatment of bone pain secondary to metastases using samarium-153-EDTMP

    Directory of Open Access Journals (Sweden)

    Elba Cristina Sá de Camargo Etchebehere

    Full Text Available CONTEXT: More than 50% of patients with prostate, breast or lung cancer will develop painful bone metastases. The purpose of treating bone metastases is to relieve pain, reduce the use of steroids and to maintain motion. OBJECTIVE: To evaluate the use of samarium-153-EDTMP (153Sm-EDTMP for the treatment of bone pain secondary to metastases that is refractory to clinical management. TYPE OF STUDY: Retrospective. SETTING: Division of Nuclear Medicine, Universidade Estadual de Campinas (Unicamp. METHODS: Fifty-eight patients were studied (34 males with mean age 62 years; 31 patients had prostate cancer, 20 had breast cancer, three had lung cancer, one had lung hemangioendothelioma, one had parathyroid adenocarcinoma, one had osteosarcoma and one had an unknown primary tumor. All patients had multiple bone metastases demonstrated by bone scintigraphy using 99mTc-MDP,and were treated with 153Sm-EDTMP. Response to treatment was graded as good (pain reduction of 50-100%, intermediate (25-49% and poor (0-24%. RESULTS: All patients showed good uptake of 153Sm-EDTMP by bone metastases. Among the patients with prostate cancer, intermediate or good response to therapy occurred in 80.6% (25 patients and poor response in 19.4% (6. Among the patients with breast cancer, 85% (17 showed intermediate or good response to therapy while 15% (3 showed poor response. All three patients with lung cancer showed poor response to treatment. The lung hemangioendothelioma and unknown primary lesion patients showed intermediate response to treatment; the osteosarcoma and parathyroid adenocarcinoma patients showed good response to treatment. No significant myelotoxicity occurred. DISCUSSION: Pain control is important for improving the quality of life of patients with advanced cancers. The mechanism by which pain is relieved with the use of radionuclides is still not yet completely understood, however, the treatment is simple and provides a low risk of mielotoxicity

  18. Anchoring samarium oxide nanoparticles on reduced graphene oxide for high-performance supercapacitor

    Energy Technology Data Exchange (ETDEWEB)

    Dezfuli, Amin Shiralizadeh [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Ganjali, Mohammad Reza, E-mail: ganjali@khayam.ut.ac.ir [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Biosensor Research Center, Endocrinology & Metabolism Molecular-Cellular Sciences Institute, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Naderi, Hamid Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of)

    2017-04-30

    Highlights: • Samarium oxide nanoparticles have been anchored on the surface of reduced graphene oxide for the first time. • Sm{sub 2}O{sub 3}/RGO nanocomposite show high capacitance, good rate and cycling performance. • Sm{sub 2}O{sub 3}/RGO nanocomposite can serve as efficient electrode material for energy storage. • The best composite electrode exhibits specific capacitance of 321 F g{sup −1} in 2 mV s{sup −1}. - Abstract: We have synthesized Sm{sub 2}O{sub 3} nanoparticles (SmNs) and anchored them onto the surface of reduced graphene oxide (RGO) through a self-assembly thereof by utilizing a facile sonochemical procedure. The nanomaterials were characterized by means of powder X-ray diffraction (XRD), Field-emission scanning electron microscopy (FE-SEM), fourier transform infrared spectroscopy (FT-IR) spectra, and X-ray photoelectron spectroscopy (XPS). As the next step, the supercapacitive behavior of the resulting nanocomposites were investigated when used as electrode material, through with cyclic voltammetric (CV), galvanostatic charge-discharge and electrochemical impedance spectroscopy (EIS) techniques. The SmNs decorated RGO (SmN-RGO) nanocomposites were found to possess a specific capacitance (SC) of 321 F g{sup −1} when used in a 0.5 M Na{sub 2}SO{sub 4} solution as an electrolyte, in a scan rate of 2 mV s{sup −1}. The SC of the SmN-RGO based electrodes were also found to be 268 F g{sup −1} at a current density of 2 A g{sup −1} through galvanostatic charge-discharge tests. The outstanding properties of the SmN-RGOs were attributed to synergy of the high charge mobility of SmNs and the flexibility of the sheets of RGOs. Additionally, the nano-composite revealed a unique cycling durability (maintaining 99% of its SC even after 4000 cycles).

  19. 42 CFR 410.144 - Quality standards for deemed entities.

    Science.gov (United States)

    2010-10-01

    ... of continuing diabetes education concerning educational principles and behavior change strategies... dental care. (ix) Behavior change strategies, goal setting, risk factor reduction, and problem solving...-Management Training and Diabetes Outcome Measurements § 410.144 Quality standards for deemed entities. An...

  20. 40 CFR 144.11 - Prohibition of unauthorized injection.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Prohibition of unauthorized injection... PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM General Program Requirements § 144.11 Prohibition of unauthorized injection. Any underground injection, except into a well authorized by rule or...

  1. 40 CFR 144.5 - Confidentiality of information.

    Science.gov (United States)

    2010-07-01

    ... Section 144.5 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS... submissions, by stamping the words “confidential business information” on each page containing such... which deals with the existence, absence, or level of contaminants in drinking water. ...

  2. 19 CFR 144.37 - Withdrawal for exportation.

    Science.gov (United States)

    2010-04-01

    ... provided for by law. In any case, the port director may require a special report of weight, gauge, or... not applicable with respect to purchasers at airport duty-free enterprises; and (vi) A statement on... file. Editorial Note: For Federal Register citations affecting § 144.37, see the List of CFR Sections...

  3. 33 CFR 144.10-1 - Lifesaving equipment.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Lifesaving equipment. 144.10-1... equipment. (a) Except as allowed in paragraph (b) of this section, no person may be on an unmanned platform unless the following lifesaving equipment is readily accessible on the platform: (1) A life preserver or...

  4. 22 CFR 144.150 - Program accessibility: Existing facilities.

    Science.gov (United States)

    2010-04-01

    ... of achieving program accessibility include— (i) Using audio-visual materials and devices to depict... action that it can demonstrate would result in a fundamental alteration in the nature of a program or... § 144.150(a) would result in such alteration or burdens. The decision that compliance would result in...

  5. Near-barrier transfer reactions in the sup 36 S+ sup 144,154 Sm systems

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez Niello, J.O.; Testoni, J.E.; di Tada, M.; Pacheco, A.J. (TANDAR, Departamento de Fisica, Comision Nacional de Energia Atomica, Avenida del Libertador 8250, 1429 Buenos Aires (Argentina)); Napoli, D.R.; Stefanini, A.M.; Corradi, L.; Million, B.; Narayanasamy, M.; Spolaore, P. (Istituto Nazionale di Fisica Nucleare, Laboratori Nazionali di Legnaro, Padova (Italy)); Beghini, S.; Montagnoli, G.; Scarlassara, F.; Segato, G.F.; Signorini, C.; Soramel, F. (Dipartimento di Fisica, Universita e Istituto Nazionale di Fisica Nucleare, Padova (Italy))

    1992-02-01

    Angular distributions and {ital Q}-value spectra for transfer reactions in the systems {sup 36}S+{sup 144,154}Sm have been measured at two energies close to the Coulomb barrier. Mass and charge identification was achieved using a time-of-flight system followed by an ionization chamber. Transfer probabilities were analyzed considering direct and sequential barrier penetration mechanisms. The dependence of the cross sections on the static quadrupole deformation of the targets was compared with the predictions of a semiclassical approach. The relative yields of the different channels were analyzed in the light of a random-walk approach based on the reaction {ital Q} values.

  6. Effect of Current Density on Thermodynamic Properties of Nanocrystalline Palladium Capped Samarium Hydride Thin Film Switchable Mirrors

    Directory of Open Access Journals (Sweden)

    Pushpendra Kumar

    2007-01-01

    Full Text Available A 55 nm samarium film capped with a 10 nm palladium overlayer switched from a metallic reflecting to a semiconducting, transparent in visible state during ex-situ hydrogen loading via electrochemical means in 1 M KOH electrolytic aqueous solution at room temperature. The switching between metal to semiconductor was accompanied by measurement of transmittance during hydrogen loading/unloading. The effect of current density on switching and thermodynamic properties was studied between dihydride state (FCC phase and trihydride state (hexagonal phase. From the plateau of partial pressure of hydrogen at x=2.6, enthalpy of formation was calculated at different current densities. The diffusion coefficients and switching kinetics are shown to depend on applied current density.

  7. Sorption of samarium in soils: influence of soil properties and Sm concentration

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez-Guinart, Oriol; Salaberria, Aitor; Rigol, Anna; Vidal, Miquel [Analytical Chemistry department, Faculty of Chemistry, University of Barcelona, Marti i Franques 1-11, 08028, Barcelona (Spain)

    2014-07-01

    Due to the fact that barriers of Deep Geological Repositories (DGR) may lose efficiency before the radioisotopes present in the High Level Radioactive Waste (HLRW) completely decay, it is possible that, in the long-term, radioactive leachates may escape from the DGR and reach the soil and water compartments in the biosphere. Therefore, it is required to examine the interaction and mobility of radionuclides present in the HLRW, or their chemical analogues, to predict the impact of their eventual incorporation in the biosphere and to assess the derived risk. Although relevant data have been recently obtained for a few radionuclides in soils, there are still some important gaps for some radionuclides, such us for samarium (Sm). Sm is a lanthanide that, besides being considered as a natural analogue of actinides, may also be present in HLRW in the form of the radioactive isotope {sup 151}Sm. The main objective of this work was to obtain sorption data (K{sub d}) of {sup 151}Sm gathered from a set of soil samples physicochemical fully-characterized (pH, texture, cationic exchange capacity, soil solution cationic composition, organic matter, carbonate and metallic oxides content, etc.). Additionally, as an alternative for testing sorption capacity of radionuclides in soils is the use of the corresponding stable isotope or a chemical analogue, the influence of Sm concentration was also checked. To evaluate {sup 151}Sm sorption, batch assays were carried out for each soil sample, which consisted in a pre-equilibration step of 2 g of each soil with 50 ml of double deionised water, and a subsequent equilibration step with the same solution, but labelled with {sup 151}Sm. The activity of {sup 151}Sm in initial and final solutions was measured by liquid scintillation and K{sub d} ({sup 151}Sm) data were calculated. The reversibly sorbed fraction was estimated by the application of a single extraction test, with double deionised water, to soil residues coming from the previous

  8. Crystal growth of semiorganic complex- samarium chloride coordinated thiourea-L-tartaric acid and its studies on structure and optical characteristics

    Science.gov (United States)

    Slathia, Goldy; Singh, Harjinder; Ramya, E.; Rao, D. Narayana; Bamzai, K. K.

    2017-05-01

    The semi-organic complex of samarium chloride coordinated thiourea-L-tartaric acid (SCTLT) has been grown as a single crystal by slow evaporation technique at room temperature. For structural studies, the grown crystal was subjected to single crystal X-ray diffraction and Fourier transform infra-red (FTIR) spectroscopy. Low cut off wavelength and transparent characteristics were explored by UV-VIS optical characterization. Third-order nonlinear optical properties of grown crystal were investigated by Z-scan technique.

  9. Sorption of samarium in iron (II) and (III) phosphates in aqueous systems; Sorcion de samario en fosfatos de hierro (II) y (III) en sistemas acuosos

    Energy Technology Data Exchange (ETDEWEB)

    Diaz F, J.C

    2006-07-01

    The radioactive residues that are stored in the radioactive confinements its need to stay isolated of the environment while the radioactivity levels be noxious. An important mechanism by which the radioactive residues can to reach the environment, it is the migration of these through the underground water. That it makes necessary the investigation of reactive materials that interacting with those radionuclides and that its are able to remove them from the watery resources. The synthesis and characterization of materials that can be useful in Environmental Chemistry are very important because its characteristics are exposed and its behavior in chemical phenomena as the sorption watery medium is necessary to use it in the environmental protection. In this work it was carried out the sorption study of the samarium III ion in the iron (II) and (III) phosphate; obtaining the sorption isotherms in function of pH, of the phosphate mass and of the concentration of the samarium ion using UV-visible spectroscopy to determine the removal percentage. The developed experiments show that as much the ferrous phosphate as the ferric phosphate present a great affinity by the samarium III, for what it use like reactive material in contention walls can be very viable because it sorption capacity has overcome 90% to pH values similar to those of the underground and also mentioning that the form to obtain these materials is very economic and simple. (Author)

  10. Trace amounts of rare earth elements in high purity samarium oxide by sector field inductively coupled plasma mass spectrometry after separation by HPLC

    Energy Technology Data Exchange (ETDEWEB)

    Pedreira, W.R. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil) and Fundacao Jorge Duprat Figueiredo de Seguranca e Medicina do Trabalho (FUNDACENTRO), 05409-002 Sao Paulo, SP (Brazil)]. E-mail: walter.pedreira@fundacentro.gov.br; Queiroz, C.A. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Abrao, A. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Rocha, S.M. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Vasconcellos, M.E. de [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Boaventura, G.R. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil); Pimentel, M.M. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil)

    2006-07-20

    Today there is an increasing need for high purity rare earth compounds in various fields, the optical, the electronics, the ceramic, the nuclear and geochemistry. Samarium oxide has special uses in glass, phosphors, lasers and thermoelectric devices. Calcium chloride crystals treated with samarium have been employed in lasers, which produce light beams intense enough to burn metal. In general, the inductively coupled plasma mass spectrometry (ICP-MS) presents some advantages for trace element analysis, due to high sensitivity and resolution, when compared with other analytical techniques such as ICP optical emission spectrometry (ICP-OES). In this work, sector field inductively coupled plasma mass spectrometry was used. Sixteen elements (Sc, Y and 14 lanthanides) were determined selectively with the ICP-MS system using a concentration gradient method. The detection limits with the ICP-MS system were about 0.2 (La) pg mL{sup -1} to 8 (Gd) pg mL{sup -1}. The %R.S.D. of the methods varying between 0.9 and 1.5% for a set of five (n = 5) replicates was found for the IPEN's material and for the certificate reference sample. Determination of trace REEs in two high pure samarium oxides samples (IPEN and JMC) was performed. IPEN's material is highly pure (>99.99%) and was successfully analyzed without spectral interference (MO{sup +} and MOH{sup +})

  11. MicroRNA-144 dysregulates the transforming growth factor-β signaling cascade and contributes to the development of bronchiolitis obliterans syndrome after human lung transplantation.

    Science.gov (United States)

    Xu, Zhongping; Ramachandran, Sabarinathan; Gunasekaran, Muthukumar; Zhou, Fangyu; Trulock, Elbert; Kreisel, Daniel; Hachem, Ramsey; Mohanakumar, Thalachallour

    2015-09-01

    Bronchiolitis obliterans syndrome (BOS), chronic lung allograft rejection, remains an impediment for the function of the transplanted organ. In this study, we defined the role of the microRNA (miRNA) miR-144 in fibroproliferation leading to BOS. Biopsy specimens were obtained from 20 lung transplant recipients with BOS((+)) and 19 without BOS((-)). Expression of miR-144 and its target, transforming growth factor-β (TGF-β)-induced factor homeobox 1(TGIF1), were analyzed by real-time polymerase chain reaction and Western blot. Overexpression of miR-144 and luciferase reporter genes were performed to elucidate miRNA-target interactions. The function of miR-144 was evaluated by transfecting fibroblasts and determining the response to TGF-β by analyzing Sma- and Mad-related family (Smads), fibroblast growth factor, TGF-β, and vascular endothelial growth factor. Smooth muscle actin-α-positive stress fibers and F-actin filaments in lung fibroblasts were analyzed by immunofluorescence. Analysis of miR-144 in the biopsy specimens demonstrated 4.1 ± 0.8-fold increases in BOS(+) compared with BOS(-) patients, with a significant reduction in TGIF1 (3.6 ± 1.2-fold), a corepressor of Smads. In vitro transfection confirmed that over-expression of miR-144 results in a reduction in TGIF1 and an increase in SMAD2, SMAD4, fibroblast growth factor-6, TGF-β, and vascular endothelial growth factor. Increasing miR-144 by transfecting, increased smooth muscle actin-α and fibronectin, and knockdown of miR-144 diminished fibrogenesis in MRC-5 fibroblasts. miR-144 is a critical regulator of the TGF-β signaling cascade and is over-expressed in lungs with BOS. Therefore, miR-144 is a potential target toward preventing fibrosis leading to BOS after lung transplant. Copyright © 2015 International Society for Heart and Lung Transplantation. Published by Elsevier Inc. All rights reserved.

  12. Comprehensive sieve analysis of breakthrough HIV-1 sequences in the RV144 vaccine efficacy trial.

    Directory of Open Access Journals (Sweden)

    Paul T Edlefsen

    2015-02-01

    Full Text Available The RV144 clinical trial showed the partial efficacy of a vaccine regimen with an estimated vaccine efficacy (VE of 31% for protecting low-risk Thai volunteers against acquisition of HIV-1. The impact of vaccine-induced immune responses can be investigated through sieve analysis of HIV-1 breakthrough infections (infected vaccine and placebo recipients. A V1/V2-targeted comparison of the genomes of HIV-1 breakthrough viruses identified two V2 amino acid sites that differed between the vaccine and placebo groups. Here we extended the V1/V2 analysis to the entire HIV-1 genome using an array of methods based on individual sites, k-mers and genes/proteins. We identified 56 amino acid sites or "signatures" and 119 k-mers that differed between the vaccine and placebo groups. Of those, 19 sites and 38 k-mers were located in the regions comprising the RV144 vaccine (Env-gp120, Gag, and Pro. The nine signature sites in Env-gp120 were significantly enriched for known antibody-associated sites (p = 0.0021. In particular, site 317 in the third variable loop (V3 overlapped with a hotspot of antibody recognition, and sites 369 and 424 were linked to CD4 binding site neutralization. The identified signature sites significantly covaried with other sites across the genome (mean = 32.1 more than did non-signature sites (mean = 0.9 (p < 0.0001, suggesting functional and/or structural relevance of the signature sites. Since signature sites were not preferentially restricted to the vaccine immunogens and because most of the associations were insignificant following correction for multiple testing, we predict that few of the genetic differences are strongly linked to the RV144 vaccine-induced immune pressure. In addition to presenting results of the first complete-genome analysis of the breakthrough infections in the RV144 trial, this work describes a set of statistical methods and tools applicable to analysis of breakthrough infection genomes in general vaccine

  13. Direct Evidence of Octupole Deformation in Neutron-Rich $^{144}$Ba

    CERN Document Server

    Bucher, B; Wu, C Y; Janssens, R V F; Cline, D; Hayes, A B; Albers, M; Ayangeakaa, A D; Butler, P A; Campbell, C M; Carpenter, M P; Chiara, C J; Clark, J A; Crawford, H L; Cromaz, M; David, H M; Dickerson, C; Gregor, E T; Harker, J; Hoffman, C R; Kay, B P; Kondev, F G; Korichi, A; Lauritsen, T; Macchiavelli, A O; Pardo, R C; Richard, A; Riley, M A; Savard, G; Scheck, M; Seweryniak, D; Smith, M K; Vondrasek, R; Wiens, A

    2016-01-01

    The neutron-rich nucleus $^{144}$Ba ($t_{1/2}$=11.5 s) is expected to exhibit some of the strongest octupole correlations among nuclei with mass numbers $A$ less than 200. Until now, indirect evidence for such strong correlations has been inferred from observations such as enhanced $E1$ transitions and interleaving positive- and negative-parity levels in the ground-state band. In this experiment, the octupole strength was measured directly by sub-barrier, multi-step Coulomb excitation of a post-accelerated 650-MeV $^{144}$Ba beam on a 1.0-mg/cm$^2$ $^{208}$Pb target. The measured value of the matrix element, $\\langle 3_1^- \\| \\mathcal{M}(E3) \\| 0_1^+ \\rangle=0.65(^{+17}_{-23})$ $e$b$^{3/2}$, corresponds to a reduced $B(E3)$ transition probability of 48($^{+25}_{-34}$) W.u. This result represents an unambiguous determination of the octupole collectivity, is larger than any available theoretical prediction, and is consistent with octupole deformation.

  14. 19 CFR 144.7 - Disposition of merchandise after expiration of warehousing period.

    Science.gov (United States)

    2010-04-01

    ... warehousing period. 144.7 Section 144.7 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF... General Provisions § 144.7 Disposition of merchandise after expiration of warehousing period. Merchandise remaining in a bonded warehouse after the expiration of the warehousing period shall be disposed of in...

  15. 40 CFR 144.81 - Does this subpart apply to me?

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Does this subpart apply to me? 144.81 Section 144.81 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS... Wells § 144.81 Does this subpart apply to me? This subpart applies to you if you own or operate a Class...

  16. 40 CFR 144.85 - Do these additional requirements apply to me?

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Do these additional requirements apply to me? 144.85 Section 144.85 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... of Class V Injection Wells § 144.85 Do these additional requirements apply to me? (a) Large-Capacity...

  17. 40 CFR 144.22 - Existing Class II enhanced recovery and hydrocarbon storage wells.

    Science.gov (United States)

    2010-07-01

    ... and hydrocarbon storage wells. 144.22 Section 144.22 Protection of Environment ENVIRONMENTAL... of Underground Injection by Rule § 144.22 Existing Class II enhanced recovery and hydrocarbon storage wells. (a) An existing Class II enhanced recovery or hydrocarbon storage injection well is authorized by...

  18. 38 CFR 21.144 - Vocational course in a sheltered workshop or rehabilitation facility.

    Science.gov (United States)

    2010-07-01

    ... sheltered workshop or rehabilitation facility. 21.144 Section 21.144 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS (CONTINUED) VOCATIONAL REHABILITATION AND EDUCATION Vocational Rehabilitation and Employment Under 38 U.S.C. Chapter 31 Special Rehabilitation Services § 21.144 Vocational course...

  19. 40 CFR 144.12 - Prohibition of movement of fluid into underground sources of drinking water.

    Science.gov (United States)

    2010-07-01

    ... underground sources of drinking water. 144.12 Section 144.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM General Program Requirements § 144.12 Prohibition of movement of fluid into underground sources of drinking water...

  20. 40 CFR 144.80 - What is a Class V injection well?

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false What is a Class V injection well? 144... PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM Requirements for Owners and Operators of Class V Injection Wells § 144.80 What is a Class V injection well? As described in § 144.6, injection wells are...

  1. 25 CFR 39.144 - What is the small high school adjustment?

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false What is the small high school adjustment? 39.144 Section 39.144 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR EDUCATION THE INDIAN SCHOOL EQUALIZATION PROGRAM Indian School Equalization Formula Small School Adjustment § 39.144 What is the small high school adjustment? (a) The small high...

  2. S-nitrosylation of TRIM72 at cysteine 144 is critical for protection against oxidation-induced protein degradation and cell death.

    Science.gov (United States)

    Kohr, Mark J; Evangelista, Alicia M; Ferlito, Marcella; Steenbergen, Charles; Murphy, Elizabeth

    2014-04-01

    Oxidative stress and membrane damage following myocardial ischemia/reperfusion injury are important contributors to cardiomyocyte death and the loss of myocardial function. Our previous study identified cysteine 144 (C144) of tripartite motif-containing protein 72 (TRIM72) as a potential site for S-nitrosylation (SNO). TRIM72 is a cardioprotective membrane repair protein that can be both activated and targeted for degradation by different oxidative modifications. Consistent with the potential regulation of TRIM72 by various oxidative modifications, we found that SNO levels increased at C144 of TRIM72 with ischemic preconditioning. Therefore, to investigate the role of C144 in the regulation of TRIM72 function, we mutated C144 of TRIM72 to a serine residue (TRIM72(C144S)), and expressed either TRIM72(WT) or TRIM72(C144S) in HEK-293 cells, which lack endogenous TRIM72, in order to examine the effect of this mutation on the functional stability of TRIM72 and on cell survival. We hypothesized that SNO of TRIM72 stabilizes the protein, thus allowing for membrane repair and enhanced cell survival. Upon treatment with hydrogen peroxide (H2O2), we found that TRIM72(WT) levels were decreased, but not TRIM72(C144S) and this correlated with increased H2O2-induced cell death in TRIM72(WT) cells. Additionally, we found that treatment with the cardioprotective S-nitrosylating agent S-nitrosoglutathione (GSNO), was able to preserve TRIM72(WT) protein levels and enhance TRIM72(WT)-mediated cell survival, but had no effect on TRIM72(C144S) levels. Consistent with our hypothesis, GSNO was also found to increase SNO levels and inhibit H2O2-induced irreversible oxidation for TRIM72(WT) without affecting TRIM72(C144S). In further support of our hypothesis, GSNO blocked the ischemia/reperfusion-induced decrease in TRIM72 levels and reduced infarct size in a Langendorff-perfused heart model. The results of these studies have important implications for cardioprotection and suggest that

  3. Effectiveness of radiation synovectomy with samarium-{sup 153} particulate hydroxyapatite in rheumatoid arthritis patients with knee synovitis: a controlled randomized double-blind trial

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Marla Francisca dos; Furtado, Rita Nely Vilar; Konai, Monique Sayuri; Natour, Jamil, E-mail: jnatour@unifesp.b [Universidade Federal de Sao Paulo (UNIFESP-EPM), Sao Paulo, SP (Brazil). Divisao de Reumatologia; Castiglioni, Mario Luiz Vieira; Marchetti, Renata Rosa [Universidade Federal de Sao Paulo (UNIFESP-EPM), Sao Paulo, SP (Brazil). Divisao de Medicina Nuclear

    2009-07-01

    Objectives: the aim of the present study was to investigate the effectiveness of Samarium{sup 153}-particulate hydroxyapatite radiation synovectomy in rheumatoid arthritis patients with chronic knee synovitis. Methods: fifty-eight rheumatoid arthritis patients (60 knees) with chronic knee synovitis participated in a controlled double-blinded trial. Patients were randomized to receive either an intra-articular injection with 40 mg triamcinolone hexacetonide alone (TH group) or 40 mg triamcinolone hexacetonide combined with 15 mCi Samarium{sup 153}-particulate hydroxyapatite (Sm/TH group). Blinded examination at baseline (T0) and at 1 (T1), 4 (T4), 12 (T12), 32 (T32), and 48 (T48) weeks post-intervention were performed on all patients and included a visual analog scale for joint pain and swelling as well as data on morning stiffness, flexion, extension, knee circumference, Likert scale of improvement, percentage of improvement, SF-36 generic quality of life questionnaire, Stanford Health Assessment Questionnaire (HAQ), Lequesne index, use of non-steroidal anti-inflammatory drugs or oral corticosteroids, events and adverse effects, calls to the physician, and hospital visits. Results: the sample was homogeneous at baseline, and there were no withdrawals. Improvement was observed in both groups in relation to T0, but no statistically significant differences between groups were observed regarding all variables at the time points studied. The Sm/TH group exhibited more adverse effects at T1 (p<0.05), but these were mild and transitory. No severe adverse effects were reported during follow-up. Conclusion: intra-articular injection of Samarium{sup 153}-particulate hydroxyapatite (15 mCi) with 40 mg of triamcinolone hexacetonide is not superior to triamcinolone hexacetonide alone for the treatment of knee synovitis in patients with rheumatoid arthritis at 1 y of follow-up. (author)

  4. The properties of samarium-doped zinc oxide/phthalocyanine structure for optoelectronics prepared by pulsed laser deposition and organic molecular evaporation

    Czech Academy of Sciences Publication Activity Database

    Novotný, Michal; Marešová, Eva; Fitl, Přemysl; Vlček, Jan; Bergmann, M.; Vondráček, Martin; Yatskiv, Roman; Bulíř, Jiří; Hubík, Pavel; Hruška, Petr; Drahokoupil, Jan; Abdellaoui, N.; Vrňata, M.; Lančok, Ján

    2016-01-01

    Roč. 122, č. 3 (2016), 1-8, č. článku 225. ISSN 0947-8396 R&D Projects: GA MŠk(CZ) LG15050; GA ČR(CZ) GAP108/11/0958; GA MŠk(CZ) LM2011029; GA ČR(CZ) GA14-10279S; GA MŠk(CZ) 7AMB14FR010 Institutional support: RVO:68378271 ; RVO:67985882 Keywords : samarium-doped zinc oxide zinc/phthalocyanine deposition * evaporation * pulsed laser deposition * thin films Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.455, year: 2016

  5. Neutron Activated Samarium-153 Microparticles for Transarterial Radioembolization of Liver Tumour with Post-Procedure Imaging Capabilities

    Science.gov (United States)

    Hashikin, Nurul Ab. Aziz; Yeong, Chai-Hong; Abdullah, Basri Johan Jeet; Ng, Kwan-Hoong; Chung, Lip-Yong; Dahalan, Rehir; Perkins, Alan Christopher

    2015-01-01

    Introduction Samarium-153 (153Sm) styrene divinylbenzene microparticles were developed as a surrogate for Yttrium-90 (90Y) microspheres in liver radioembolization therapy. Unlike the pure beta emitter 90Y, 153Sm possess both therapeutic beta and diagnostic gamma radiations, making it possible for post-procedure imaging following therapy. Methods The microparticles were prepared using commercially available cation exchange resin, Amberlite IR-120 H+ (620–830 μm), which were reduced to 20–40 μm via ball mill grinding and sieve separation. The microparticles were labelled with 152Sm via ion exchange process with 152SmCl3, prior to neutron activation to produce radioactive 153Sm through 152Sm(n,γ)153Sm reaction. Therapeutic activity of 3 GBq was referred based on the recommended activity used in 90Y-microspheres therapy. The samples were irradiated in 1.494 x 1012 n.cm-2.s-1 neutron flux for 6 h to achieve the nominal activity of 3.1 GBq.g-1. Physicochemical characterisation of the microparticles, gamma spectrometry, and in vitro radiolabelling studies were carried out to study the performance and stability of the microparticles. Results Fourier Transform Infrared (FTIR) spectroscopy of the Amberlite IR-120 resins showed unaffected functional groups, following size reduction of the beads. However, as shown by the electron microscope, the microparticles were irregular in shape. The radioactivity achieved after 6 h neutron activation was 3.104 ± 0.029 GBq. The specific activity per microparticle was 53.855 ± 0.503 Bq. Gamma spectrometry and elemental analysis showed no radioactive impurities in the samples. Radiolabelling efficiencies of 153Sm-Amberlite in distilled water and blood plasma over 48 h were excellent and higher than 95%. Conclusion The laboratory work revealed that the 153Sm-Amberlite microparticles demonstrated superior characteristics for potential use in hepatic radioembolization. PMID:26382059

  6. Activating and sustaining c-Myc by depletion of miR-144/451 gene locus contributes to B-lymphomagenesis.

    Science.gov (United States)

    Ding, Lan; Zhang, Yanqing; Han, Lingling; Fu, Lei; Mei, Xia; Wang, Jijun; Itkow, Jacobi; Elabid, Afaf Elabid Ibrahim; Pang, Lei; Yu, Duonan

    2017-12-29

    Hyper activity of protooncogene c-Myc is one of the hallmarks of highly aggressive lymphomas. However, the mechanism of how c-Myc is subjected to activation and amplification is still not well defined. In this study, we use gene knockout strategy to show that targeted depletion of a well-conserved microRNA gene locus miR-144/451 initiates tumorigenesis including B-lymphoma development in aged mice. This is due, at least in part, to the direct activation of the c-Myc gene by loss of miR-144/451 expression in hematopoietic cells. Moreover, oncoprotein c-Myc inversely regulates miR-144/451 expression by directly binding to the miR-144/451 promoter region, forming a miRNA-Myc positive feedback loop to safeguard the high level of c-Myc in B-lymphocytes. We also demonstrate that this miRNA-Myc crosstalk is disrupted in human diffuse large B-cell lymphomas with aberrant c-Myc expression. Therefore, our findings provide strong evidence, for the first time, that deficiency of miR-144/451 expression may play a bona fide role in derepression of silenced c-Myc, which contributes to tumor development including B-lymphomagenesis.

  7. ULY JUP URAP RADIO ASTRONOMY REC AVERAGE E-FIELD 144 SEC

    Data.gov (United States)

    National Aeronautics and Space Administration — C USER'S GUIDE TO RAR 144 SECOND AVERAGED DATA FILES ---------------------------------------------------- This document describes the contents and format of the RAR...

  8. Preparation and examination of properties of samarium-153-EDTMP complex; Otrzymywanie chelatu kwasu etylenodiaminotetrametylenofosfonowego (EDTMP) z samarem-153 i badanie jego wlasciwosci

    Energy Technology Data Exchange (ETDEWEB)

    Nowak, M. [Institute of Atomic Energy, Otwock-Swierk (Poland); Garnuszek, P.; Lukasiewicz, A.; Wozniak, I.; Zulczyk, W. [Osrodek Badawczo-Rozwojowy Izotopow, Otwock-Swierk (Poland); Licinska, I. [Instytut Lekow, Warsaw (Poland)

    1995-12-31

    Preparation and properties of ethylenediaminetetramethylenephosphonic acid (EDTMP) as well as some properties of {sup 153}Sm-EDTMP chelate have been examined. The chelate formed by samarium-153 (46.3 h, {beta}{sup -}-decay) with EDTMP exhibits high bone uptake and can be used for treatment of disseminated, painful skeletal metastases. The purity and stability of solutions of {sup 153}Sm-EDTMP chelate were examined in a broad range of samarium concentration and {sup 153}Sm specific activity. The complex under study was examined by radio-TLC, -electrophoresis and radio-HPLC. The results obtained suggest the small size of molecules of {sup 153}Sm-EDTMP chelate as compared with molecules of ``free``EDTMP. The results of biodistribution of {sup 153}Sm-EDTMP determined in rats indicate the quick blood clearance, high deposition of radioactivity in bone and quick excretion of radioactivity into urine. No specific uptake of {sup 153}Sm-EDTMP in extra-skeletal organs was found. (author). 42 refs, 13 figs, 22 tabs.

  9. Biological studies of samarium-153 bleomycin complex in human breast cancer murine xenografts for therapeutic applications

    Energy Technology Data Exchange (ETDEWEB)

    Bahrami-Samani, A. [Faculty of Nuclear Engineering and Physics, Amirkabir Univ. of Tech., Tehran (Iran); Ghannadi-Maragheh, M. [Faculty of Nuclear Engineering and Physics, Amirkabir Univ. of Tech., Tehran (Iran); Radiopharmaceutical Research and Development Lab. (RRDL), Nuclear Science and Technology Research Inst. (NSTRI), Tehran (Iran); Jalilian, A.R.; Mazidi, M. [Radiopharmaceutical Research and Development Lab. (RRDL), Nuclear Science and Technology Research Inst. (NSTRI), Tehran (Iran)

    2010-07-01

    In this work, a potential therapeutic DNA targeting agent, {sup 153}Sm-bleomycin complex ({sup 153}Sm-BLM), was developed and the tumor accumulation studies were performed using single photon emission computed tomography (SPECT) and scarification studies. {sup 153}Sm-BLM was prepared at optimized conditions (room temperature, 4-8 h, 0.1 mg bleomycin for 740-3700 MBq {sup 153}SmCl{sub 3}, radiochemical purity over 98%, HPLC, specific activity = 55 TBq/mmol). {sup 153}Sm-BLM was administered into human breast cancer murine xenografts and the biodistribution and imaging studies were performed up to 48 h. {sup 153}Sm-BLM demonstrated superior tumor accumulation properties in contrast with the other radiolabeled bleomycins with tumor:blood ratios of 41, 72 and 182 at 4, 24 and 48 h, respectively, and tumor:muscle ratios of 23, 33 and > 1490 at 4, 24 and 48 h, respectively, while administered intravenously. The SPECT images also demonstrated the obvious tumor uptake at the chest region of the breast-tumor bearing mice. These initial experiments demonstrate significant accumulation of {sup 153}Sm-BLM in tumor tissues. (orig.)

  10. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints

    Directory of Open Access Journals (Sweden)

    Mohammed Najeeb Al Hallak

    2009-08-01

    Full Text Available 153Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate and Samarium-153 [1]. 153Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of 153Sm-EDTMP leads to contamination with 154Eu (Europium-154 [2]. A previous study only alluded to the retention of 154Eu in the bones after receiving treatment with 153Sm-EDTMP [2]. Activation of the alarm at security checkpoints after 153Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received 153Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing theAmerican-Canadian border. We assume that the 154Eu which remained in the patients’ bones activated the sensors. Methods: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received 153Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. Results: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of 154Eu emissions. Conclusion: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of 154Eu retained in patients who received 153Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of 153Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with 153Sm-EDTMP at Roger Maris Cancer Center

  11. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints.

    Science.gov (United States)

    Najeeb Al Hallak, Mohammed; McCurdy, Matt; Zouain, Nicolas; Hayes, Justin

    2009-08-28

    (153)Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate) and Samarium-153 [1]. (153)Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of (153)Sm-EDTMP leads to contamination with (154)Eu (Europium-154) [2]. A previous study only alluded to the retention of (154)Eu in the bones after receiving treatment with (153)Sm-EDTMP [2]. Activation of the alarm at security checkpoints after (153)Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received (153)Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA) activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing the American-Canadian border. We assume that the (154)Eu which remained in the patients' bones activated the sensors. METHODS: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received (153)Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. RESULTS: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of (154)Eu emissions. CONCLUSION: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of (154)Eu retained in patients who received (153)Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of (153)Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with (153)Sm-EDTMP at Roger Maris Cancer

  12. 50 CFR 14.4 - What terms do I have to understand?

    Science.gov (United States)

    2010-10-01

    ... domesticus; Cattle—Bos taurus; Dog (domestic)—Canis familiaris; European rabbit—Ortyctolagus cuniculus... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false What terms do I have to understand? 14.4 Section 14.4 Wildlife and Fisheries UNITED STATES FISH AND WILDLIFE SERVICE, DEPARTMENT OF THE INTERIOR...

  13. 7 CFR 457.144 - Northern potato crop insurance-processing quality endorsement.

    Science.gov (United States)

    2010-01-01

    ... endorsement. 457.144 Section 457.144 Agriculture Regulations of the Department of Agriculture (Continued... Northern potato crop insurance—processing quality endorsement. The Northern Potato Crop Insurance Processing Quality Endorsement Provisions for the 2008 and succeeding crop years are as follows: 1...

  14. 19 CFR 144.12 - Contents of entry summary; estimated duties.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Contents of entry summary; estimated duties. 144... Procedures for Warehouse Entry § 144.12 Contents of entry summary; estimated duties. The entry summary, Customs Form 7501, shall show the value, classification, and rate of duty as approved by the port director...

  15. 40 CFR 144.82 - What must I do to protect underground sources of drinking water?

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false What must I do to protect underground sources of drinking water? 144.82 Section 144.82 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM Requirements for Owners and...

  16. 26 CFR 1.4-4 - Short taxable year caused by death.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 1 2010-04-01 2010-04-01 true Short taxable year caused by death. 1.4-4 Section... Normal Taxes and Surtaxes § 1.4-4 Short taxable year caused by death. An individual making a return for a... results from the death of the taxpayer. Tax on Corporations ...

  17. 14 CFR 91.144 - Temporary restriction on flight operations during abnormally high barometric pressure conditions.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 2 2010-01-01 2010-01-01 false Temporary restriction on flight operations during abnormally high barometric pressure conditions. 91.144 Section 91.144 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED) AIR TRAFFIC AND GENERAL...

  18. 19 CFR 144.42 - Combined entry for rewarehouse and withdrawal for consumption.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Combined entry for rewarehouse and withdrawal for consumption. 144.42 Section 144.42 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND... applicable to this type of entry, with the following exceptions: (1) Form of entry. A combined entry for...

  19. Sleep Apnea and Hypoventilation in Patients with Down Syndrome: Analysis of 144 Polysomnogram Studies

    Directory of Open Access Journals (Sweden)

    Zheng Fan

    2017-06-01

    Full Text Available Patients with Down syndrome (DS are at risk for both obstructive sleep apnea (OSA and central sleep apnea (CSA; however, it is unclear how these components evolve as patients age and whether patients are also at risk for hypoventilation. A retrospective review of 144 diagnostic polysomnograms (PSG in a tertiary care facility over 10 years was conducted. Descriptive data and exploratory correlation analyses were performed. Sleep disordered breathing was common (seen in 78% of patients with an average apnea-hypopnea index (AHI = 10. The relative amount of obstructive apnea was positively correlated with age and body mass index (BMI. The relative amount of central sleep apnea was associated with younger age in the very youngest group (0–3 years. Hypoventilation was common occurring in more than 22% of patients and there was a positive correlation between the maximum CO2 and BMI. Sleep disordered breathing, including hypoventilation, was common in patients with DS. The obstructive component increased significantly with age and BMI, while the central component occurred most in the very young age group. Due to the high risk of hypoventilation, which has not been previously highlighted, it may be helpful to consider therapies to target both apnea and hypoventilation in this population.

  20. Identification and expression analysis of miR-144-5p and miR-130b-5p in dairy cattle

    Directory of Open Access Journals (Sweden)

    Z. Li

    2017-07-01

    Full Text Available MicroRNAs (miRNAs can coordinate the main pathways involved in innate and adaptive immune responses by regulating gene expression. To explore the resistance to mastitis in cows, miR-144-5p and miR-130b-5p were identified in bovine mammary gland tissue and 14 potential target genes belonging to the chemokine signaling pathway, the arginine and proline metabolism pathway and the mRNA surveillance pathway were predicted. Subsequently, we estimated the relative expression of miR-144-5p and miR-130b-5p in cow mammary tissues by using stem-loop quantitative real-time polymerase chain reaction. The results showed that the relative expression of miR-144-5p and miR-130b-5p in the mastitis-infected mammary tissues (n = 5 was significantly downregulated 0.14-fold (p < 0. 01 and upregulated 3.34-fold (p < 0. 01, respectively, compared to healthy tissues (n = 5. Our findings reveal that miR-144-5p and miR-130b-5p may have important roles in resistance to mastitis in dairy cattle.

  1. Formation of a new adduct based on fullerene tris-malonate samarium salt C60-[C60(=C(COO)2)3]Sm2

    Science.gov (United States)

    Petrov, A. A.; Keskinov, V. A.; Semenov, K. N.; Charykov, N. A.; Letenko, D. G.; Nikitin, V. A.

    2017-03-01

    Gram quantities of a new adduct based on light fullerene tris-malonate samarium salt C60 [C60(=C(COO)2)3]Sm2 are obtained via the reaction of ion exchange. The obtained adduct is studied by means of electron and infrared spectroscopy, X-ray and elemental analysis, electron microscopy, and thermogravimetry. The polythermal solubility of [C60(=C(COO)2)3]Sm2 in water is determined in ampoules via saturation within 20-70°C. The composition of crystalline hydrate [C60(=C(COO)2)3]Sm2 · 36H2O, which exists in equilibrium with the saturated solution, is estimated.

  2. Biodistribution of samarium-153-EDTMP in rats treated with docetaxel Biodistribuição de EDTMP-153-samário em ratos tratados com docetaxel

    Directory of Open Access Journals (Sweden)

    Arthur Villarim Neto

    2009-02-01

    Full Text Available PURPOSE: Many patients with metastatic bone disease have to use radiopharmaceuticals associated with chemotherapy to relieve bone pain. The aim of this study was to assess the influence of docetaxel on the biodistribution of samarium-153-EDTMP in bones and other organs of rats. METHODS: Wistar male rats were randomly allocated into 2 groups of 6 rats each. The DS (docetaxel/samarium group received docetaxel (15 mg/kg intraperitoneally in two cycles 11 days apart. The S (samarium/control group rats were not treated with docetaxel. Nine days after chemotherapy, all the rats were injected with 0.1ml of samarium-153-EDTMP via orbital plexus (25µCi. After 2 hours, the animals were killed and samples of the brain, thyroid, lung, heart, stomach, colon, liver, kidney and both femurs were removed. The percentage radioactivity of each sample (% ATI/g was determined in an automatic gamma-counter (Wizard-1470, Perkin-Elmer, Finland. RESULTS: On the 9th day after the administration of the 2nd chemotherapy cycle, the rats had a significant weight loss (314.50±22.09g compared (pOBJETIVO: Muitos pacientes com metástases ósseas são tratados com radiofármacos associados com quimioterapia para alívio da dor óssea. O objetivo do trabalho foi estudar a influência do docetaxel na biodistribuição do EDTMP-153-samário nos ossos e outros órgãos de ratos. MÉTODOS: Ratos Wistar foram aleatoriamente alocados em 2 grupos de 6 animais cada. O grupo DS (docetaxel/samário recebeu docetaxel (15 mg/kg intraperitoneal em dois ciclos com 11 dias de intervalo. Os ratos do grupo S (samário/controle não foram tratados com docetaxel. Nove dias após a quimioterapia, todos os animais receberam 0,1ml de EDTMP-153-samário via plexo orbital (25µCi. Após 2 horas, os animais foram mortos e feitas biópsias de cérebro, tireóide, pulmão, coração, estômago, cólon, fígado, rim e fêmures. O percentual de radioatividade por grama (%ATI/g de tecido de cada bi

  3. CeLAND: search for a 4th light neutrino state with a 3 PBq 144Ce-144Pr electron antineutrino generator in KamLAND

    Energy Technology Data Exchange (ETDEWEB)

    Gando, A; Gando, Y; Hayashida, S; Ikeda, H; Inoue, K; Ishidoshiro, K; Ishikawa, H; Koga, M; Matsuda, R; Matsuda, S; Mitsui, T; Motoki, D; Nakamura, K; Oki, Y; Otani, M; Shimizu, I; Shirai, J; Suekane, F; Suzuki, A; Takemoto, Y; Tamae, K; Ueshima, K; Watanabe, H; Xu, BD; Yamada, S; Yamauchi, Y; Yoshida, H; Cribier, M; Durero, M; Fischer, V; Gaffiot, J; Jonqueres, N; Kouchner, A; Lasserre, T; Leterme, D; Letourneau, A; Lhuillier, D; Mention, G; Rampal, G; Scola, L; Veyssiere, C; Vivier, M; Yala, P; Berger, BE; Kozlov, A; Banks, T; Dwyer, D; Fujikawa, BK; Han, K; Kolomensky, YG; Mei, Y; O' Donnell, T; Decowski, P; Markoff, DM; Yoshida, S; Kornoukhov, VN; Gelis, TVM; Tikhomirov, GV; Learned, JG; Maricic, J; Matsuno, S; Milincic, R; Karwowski, HJ; Efremenko, Y; Detwiler, A; Enomoto, S

    2017-05-12

    The reactor neutrino and gallium anomalies can be tested with a 3-4 PBq (75-100 kCi scale) 144Ce-144Pr antineutrino beta-source deployed at the center or next to a large low-background liquid scintillator detector. The antineutrino generator will be produced by the Russian reprocessing plant PA Mayak as early as 2014, transported to Japan, and deployed in the Kamioka Liquid Scintillator Anti-Neutrino Detector (KamLAND) as early as 2015. KamLAND's 13 m diameter target volume provides a suitable environment to measure the energy and position dependence of the detected neutrino flux. A characteristic oscillation pattern would be visible for a baseline of about 10 m or less, providing a very clean signal of neutrino disappearance into a yet-unknown, sterile neutrino state. This will provide a comprehensive test of the electron dissaperance neutrino anomalies and could lead to the discovery of a 4th neutrino state for Δm$2\\atop{new}$ ≳ 0.1 eV2 and sin2(2θnew) > 0.05.

  4. Oyesiku et al., Afr J Tradit Complement Altern Med. (2013) 10(3):144 ...

    African Journals Online (AJOL)

    AJTCAM

    .doi.org/10.4314/ajtcam.v10i4.23. 144. MORPHOLOGICAL AND ANATOMICAL INVESTIGATIONS INTO THE MECHANISM OF LEAF. PAIR UNROLLING IN URARIA PICTA (JACQ.) DESV. EX DC. (PAPILIONACEAE), A. MEDICINAL PLANT IN ...

  5. NODC Standard Format Marine Toxic Substances and Pollutants (F144) chemical identification codes (NODC Accession 9200273)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This archival information package contains a listing of codes and chemical names that were used in NODC Standard Format Marine Toxic Substances and Pollutants (F144)...

  6. Novel ZnO:Ag nanocomposites induce significant oxidative stress in human fibroblast malignant melanoma (Ht144 cells

    Directory of Open Access Journals (Sweden)

    Syeda Arooj

    2015-02-01

    Full Text Available The use of photoactive nanoparticles (NPs such as zinc oxide (ZnO and its nanocomposites has become a promising anticancer strategy. However, ZnO has a low photocatalytic decomposition rate and the incorporation of metal ions such as silver (Ag improves their activity. Here different formulations of ZnO:Ag (1, 3, 5, 10, 20 and 30% Ag were synthesized by a simple co-precipitation method and characterized by powder X-ray diffraction, scanning electron microscopy, Rutherford back scattering and diffuse reflectance spectroscopy for their structure, morphology, composition and optical band gap. The NPs were investigated with regard to their different photocatalytic cytotoxic effects in human malignant melanoma (HT144 and normal (HCEC cells. The ZnO:Ag nanocomposites killed cancer cells more efficiently than normal cells under daylight exposure. Nanocomposites having higher Ag content (10, 20 and 30% were more toxic compared to low Ag content (1, 3 and 5%. For HT144, under daylight exposure, the IC50 values were ZnO:Ag (10%: 23.37 μg/mL, ZnO:Ag (20%: 19.95 μg/mL, and ZnO:Ag (30%: 15.78 μg/mL. ZnO:Ag (30% was toxic to HT144 (IC50: 23.34 μg/mL in dark as well. The three nanocomposites were further analyzed with regard to their ability to generate reactive oxygen species (ROS and induce lipid peroxidation. The particles led to an increase in levels of ROS at cytotoxic concentrations, but only HT144 showed strongly induced MDA level. Finally, NPs were investigated for the ROS species they generated in vitro. A highly significant increase of 1O2 in the samples exposed to daylight was observed. Hydroxyl radical species, HO•, were also generated to a lesser extent. Thus, the incorporation of Ag into ZnO NPs significantly improves their photo-oxidation capabilities. ZnO:Ag nanocomposites could provide a new therapeutic option to selectively target cancer cells.

  7. 40 CFR 144.83 - Do I need to notify anyone about my Class V injection well?

    Science.gov (United States)

    2010-07-01

    ... written request within the time frame specified. You can start injecting again only if you receive a... Class V injection well? 144.83 Section 144.83 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Operators of Class V Injection Wells § 144.83 Do I need to notify anyone about my Class V injection well...

  8. Synthesis of samarium complexes with the derivative binder of Schiff Quinolinic base. Characterization and photophysical study; Sintesis de complejos de samario con el ligante derivado de base de Schiff Quinolinica. Caracterizacion y estudio fotofisico

    Energy Technology Data Exchange (ETDEWEB)

    Lucas H, J.

    2016-07-01

    In this work we determined the metal: binder stoichiometry of the species formed during the UV/Vis spectrophotometric titration of the derivative binder of Schiff quinolinic base, L1 with the samarium nitrate pentahydrate in methanol. Statistical analysis of the data allowed proposing the metal: binder stoichiometry for the synthesis of the complexes which was one mole of samarium salt by 2.5 moles of binder and thus favor the formation of complexes with 1M: 1L and 1M: 2L stoichiometries. They were synthesized in aqueous-organic medium (water-ethanol), isolated and purified two complexes with stoichiometry 1 Sm: 1 L1, complex 1 and 1 Sm: 2 L1, complex 2. The overall yield of the reaction was 76%. The characterization of the formed complexes was performed by visible ultraviolet spectrometry (UV/Vis), nuclear magnetic resonance, X-ray photoelectron spectroscopy (XP S), thermal gravimetric analysis with differential scanning calorimetry (TGA/DSC), and radial distribution function. These complexes were studied by fluorescence and emission phosphorescence at variable temperature. Spectroscopic techniques used in both solution and solid demonstrated the formation and stability of these complexes. In addition XP S indicated that in both complexes the samarium retains its oxidation state 3+. Luminescence studies indicated that there is intra-binding charge transfer which decreases the transfer of light energy from the binder to the samarium. Based on the experimental results, L1 binder molecules and complexes 1 and 2 were modeled that demonstrated the proposed Nc for each complex, as well as allowed to visualize the structural arrangement of the molecules, complexes and binder. (Author)

  9. Pyrolysis of UR-144, a synthetic cannabinoid, augments an affinity to human CB1receptor and cannabimimetic effects in mice.

    Science.gov (United States)

    Kaizaki-Mitsumoto, Asuka; Hataoka, Kyoko; Funada, Masahiko; Odanaka, Yuki; Kumamoto, Hiroki; Numazawa, Satoshi

    2017-01-01

    Drug abusers most often smoke 'herbal incense' as a cigarette or inhale it using a smoking tool. Smoking may cause pyrolysis of the drug and produce decomposed products of which biological effect has never been investigated. The synthetic cannabinoid UR-144 is known to undergo thermal degradation, giving a ring-opened isomer, so-called UR-144 degradant. The present study demonstrates by using UR-144 as a model drug that the smoke of burned UR-144 contains the UR-144 degradant. The UR-144 degradant showed approximately four fold higher agonist activity to human CB 1 receptor and augmented hypothermic and akinetic actions in mice compared to UR-144. These results indicate that smoking behavior may increase psychological actions of the certain synthetic cannabinoids.

  10. Retention Characteristics of CBTi144 Thin Films Explained by Means of X-Ray Photoemission Spectroscopy

    Directory of Open Access Journals (Sweden)

    G. Biasotto

    2010-01-01

    Full Text Available CaBi4Ti4O15 (CBTi144 thin films were grown on Pt/Ti/SiO2/Si substrates using a soft chemical solution and spin-coating method. Structure and morphology of the films were characterized by the X-ray Diffraction (XRD, Fourier-transform infrared spectroscopy (FT-IR, Raman analysis, X-ray photoemission spectroscopy (XPS, and transmission electron microscopy (TEM. The films present a single phase of layered-structured perovskite with polar axis orient. The a/b-axis orientation of the ferroelectric film is considered to be associated with the preferred orientation of the Pt bottom electrode. XPS measurements were employed to understand the nature of defects on the retention behavior of CBTi144 films. We have observed that the main source of retention-free characteristic of the capacitors is the oxygen environment in the CBTi144 lattice.

  11. Structural characterization of CYP144A1 - a cytochrome P450 enzyme expressed from alternative transcripts in Mycobacterium tuberculosis

    Science.gov (United States)

    Chenge, Jude; Kavanagh, Madeline E.; Driscoll, Max D.; McLean, Kirsty J.; Young, Douglas B.; Cortes, Teresa; Matak-Vinkovic, Dijana; Levy, Colin W.; Rigby, Stephen E. J.; Leys, David; Abell, Chris; Munro, Andrew W.

    2016-05-01

    Mycobacterium tuberculosis (Mtb) causes the disease tuberculosis (TB). The virulent Mtb H37Rv strain encodes 20 cytochrome P450 (CYP) enzymes, many of which are implicated in Mtb survival and pathogenicity in the human host. Bioinformatics analysis revealed that CYP144A1 is retained exclusively within the Mycobacterium genus, particularly in species causing human and animal disease. Transcriptomic annotation revealed two possible CYP144A1 start codons, leading to expression of (i) a “full-length” 434 amino acid version (CYP144A1-FLV) and (ii) a “truncated” 404 amino acid version (CYP144A1-TRV). Computational analysis predicted that the extended N-terminal region of CYP144A1-FLV is largely unstructured. CYP144A1 FLV and TRV forms were purified in heme-bound states. Mass spectrometry confirmed production of intact, His6-tagged forms of CYP144A1-FLV and -TRV, with EPR demonstrating cysteine thiolate coordination of heme iron in both cases. Hydrodynamic analysis indicated that both CYP144A1 forms are monomeric. CYP144A1-TRV was crystallized and the first structure of a CYP144 family P450 protein determined. CYP144A1-TRV has an open structure primed for substrate binding, with a large active site cavity. Our data provide the first evidence that Mtb produces two different forms of CYP144A1 from alternative transcripts, with CYP144A1-TRV generated from a leaderless transcript lacking a 5‧-untranslated region and Shine-Dalgarno ribosome binding site.

  12. Determination of Rigidity of Protein Bound Au(144) Clusters by Electron Cryomicroscopy.

    Science.gov (United States)

    Sexton, Jonathan Z; Ackerson, Christopher J

    2010-09-30

    A method for estimating the positional displacement of protein bound gold nanoparticles is presented and used to estimate the rigidity of linkage of Au(144) nanoparticles bound to a tetrameric model protein. We observe a distribution of displacement values where most Au(144) clusters are immobilized to within 3Å relative to the protein center of mass. The shape of the distribution suggests two physical processes of thermal motion and protein deformation. The application of this and similar rigid gold nanoparticle/protein conjugates in high resolution single particle electron cryo-microscopy is discussed.

  13. Pyrolysis result of polyethylene waste as fuel for solid oxide fuel cell with samarium doped-ceria (SDC)-carbonate as electrolyte

    Science.gov (United States)

    Syahputra, R. J. E.; Rahmawati, F.; Prameswari, A. P.; Saktian, R.

    2017-02-01

    In this research, the result of pyrolysis on polyethylene was used as fuel for a solid oxide fuel cell (SOFC). The pyrolysis result is a liquid which consists of hydrocarbon chains. According to GC-MS analysis, the hydrocarbons mainly consist of C7 to C20 hydrocarbon chain. Then, the liquid was applied to a single cell of NSDC-L | NSDC | NSDC-L. NSDC is a composite SDC (samarium doped-ceria) with sodium carbonate. Meanwhile, NSDC-L is a composite of NSDC with LiNiCuO (LNC). NSDC and LNC were analyzed by X-ray diffraction to understand their crystal structure. The result shows that presence of carbonate did not change the crystal structure of SDC. SEM EDX analysis for fuel cell before and after being loaded with polyethylene oil to get information of element diffusion to the electrolyte. Meanwhile, the conductivity properties were investigated through impedance measurement. The presence of carbonate even increases the electrical conductivity. The single cell test with the pyrolysis result of polyethylene at 300 - 600 °C, found that the highest power density is at 600 °C with the maximum power density of 0.14 mW/cm2 and open circuit voltage of 0.4 Volt. Elemental analysis at three point spots of single cell NDSC-L |NSDC|NSDC-L found that a migration of ions was occurred during fuel operation at 300 - 600 °C.

  14. Effects of some rare earth and carbonate-based co-dopants on structural and electrical properties of samarium doped ceria (SDC) electrolytes for solid oxide fuel cells

    Science.gov (United States)

    Anwar, Mustafa; Khan, Zuhair S.; Mustafa, Kamal; Rana, Akmal

    2015-09-01

    In the present study, samarium doped ceria (SDC) and SDC-based composite with the addition of K2CO3 were prepared by co-precipitation route and effects of pH of the solution and calcination temperature on microstructure of SDC and SDC-K2CO3, respectively, were investigated. Furthermore, experimentation was performed to investigate into the ionic conductivity of pure SDC by co-doping with yttrium i.e., YSDC, XRD and SEM studies show that the crystallite size and particle size of SDC increases with the increase in pH. The SEM images of all the samples of SDC synthesized at different pH values showed the irregular shaped and dispersed particles. SDC-K2CO3 was calcined at 600∘C, 700∘C and 800∘C for 4 h and XRD results showed that crystallite size increases while lattice strain, decreases with the increase in calcination temperature and no peaks were detected for K2CO3 as it is present in an amorphous form. The ionic conductivity of the electrolytes increases with the increase in temperature and SDC-K2CO3 shows the highest value of ionic conductivity as compared to SDC and YSDC. Chemical compatibility tests were performed between the co-doped electrolyte and lithiated NiO cathode at high temperature. It revealed that the couple could be used up to the temperature of 700∘C.

  15. Calculation of the Dose of Samarium-153-Ethylene Diamine Tetramethylene Phosphonate (153Sm-EDTMP as a Radiopharmaceutical for Pain Relief of bone Metastasis

    Directory of Open Access Journals (Sweden)

    Fatemeh Razghandi

    2016-04-01

    Full Text Available Introduction One of the important applications of nuclear physics in medicine is the use of radioactive elements as radiopharmaceuticals. Metastatic bone disease is the most common form of malignant bone tumors. Samarium-153-ethylene diamine tetramethylene phosphonate (153Sm-EDTMP as a radiopharmaceutical is used for pain palliation. This radiopharmaceutical usually emits beta particles, which have a high uptake in bone tissues. The purpose of this study was to calculate the radiation dose distribution of 153Sm-EDTMP in bone and other tissues, using MCNPX Monte Carlo code in the particle transport model. Materials and Methods Dose delivery to the bone was simulated by seeking radiopharmaceuticals on the bone surface. The phantom model had a simple cylindrical geometry and included bone, bone marrow, and soft tissue. Results The simulation results showed that a significant amount of radiation dose was delivered to the bone by the use of this radiopharmaceutical. Conclusion Thebone acted as a fine protective shield against rays for the bone marrow. Therefore, the trivial absorbed dose by the bone marrow caused less damage to bone-making cells. Also, the high absorbed dose of the bone could destroy cancer cells and relieve the pain in the bone.

  16. Sex Differences in Left-Handedness: A Meta-Analysis of 144 Studies

    Science.gov (United States)

    Papadatou-Pastou, Marietta; Martin, Maryanne; Munafo, Marcus R.; Jones, Gregory V.

    2008-01-01

    Human handedness, a marker for language lateralization in the brain, continues to attract great research interest. A widely reported but not universal finding is a greater male tendency toward left-handedness. Here the authors present a meta-analysis of k = 144 studies, totaling N = 1,787,629 participants, the results of which demonstrate that the…

  17. Crystal Structure of the Murine Cytomegalovirus MHC-I Homolog m144

    Energy Technology Data Exchange (ETDEWEB)

    Natarajan,K.; Hicks, A.; Mans, J.; Robinson, H.; Guan, R.; Mariuzza, R.; Margulies, D.

    2006-01-01

    Large DNA viruses of the herpesvirus family produce proteins that mimic host MHC-I molecules as part of their immunoevasive strategy. The m144 glycoprotein, expressed by murine cytomegalovirus, is thought to be an MHC-I homolog whose expression prolongs viral survival in vivo by preventing natural killer cell activation. To explore the structural basis of this m144 function, we have determined the three-dimensional structure of an m144/{beta}2-microglobulin ({beta}2m) complex at 1.9 {angstrom} resolution. This structure reveals the canonical features of MHC-I molecules including readily identifiable {alpha}1, {alpha}2, and {alpha}3 domains. A unique disulfide bond links the {alpha}1 helix to the {beta}-sheet floor, explaining the known thermal stability of m144. Close juxtaposition of the {alpha}1 and {alpha}2 helices and the lack of critical residues that normally contribute to anchoring the peptide N and C termini eliminates peptide binding. A region of 13 amino acid residues, corresponding to the amino-terminal portion of the {alpha}2 helix, is missing in the electron density map, suggesting an area of structural flexibility that may be involved in ligand binding.

  18. 40 CFR 144.7 - Identification of underground sources of drinking water and exempted aquifers.

    Science.gov (United States)

    2010-07-01

    ... PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM General Provisions § 144.7 Identification of underground sources of drinking water and exempted aquifers. (a) The..., except where exempted under paragraph (b) of this section, as an underground source of drinking water...

  19. 49 CFR 176.144 - Segregation of Class 1 (explosive) materials.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Segregation of Class 1 (explosive) materials. 176... VESSEL Detailed Requirements for Class 1 (Explosive) Materials Segregation § 176.144 Segregation of Class... any ferrous metal or aluminum alloy, unless separated by a partition. (e) Segregation on deck: When...

  20. Homozygosity Mapping and Genetic Analysis of Autosomal Recessive Retinal Dystrophies in 144 Consanguineous Pakistani Families

    Science.gov (United States)

    Li, Lin; Chen, Yabin; Jiao, Xiaodong; Jin, Chongfei; Jiang, Dan; Tanwar, Mukesh; Ma, Zhiwei; Huang, Li; Ma, Xiaoyin; Sun, Wenmin; Chen, Jianjun; Ma, Yan; M'hamdi, Oussama; Govindarajan, Gowthaman; Cabrera, Patricia E.; Li, Jiali; Gupta, Nikhil; Naeem, Muhammad Asif; Khan, Shaheen N.; Riazuddin, Sheikh; Akram, Javed; Ayyagari, Radha; Sieving, Paul A.; Riazuddin, S. Amer; Hejtmancik, J. Fielding

    2017-01-01

    Purpose The Pakistan Punjab population has been a rich source for identifying genes causing or contributing to autosomal recessive retinal degenerations (arRD). This study was carried out to delineate the genetic architecture of arRD in the Pakistani population. Methods The genetic origin of arRD in a total of 144 families selected only for having consanguineous marriages and multiple members affected with arRD was examined. Of these, causative mutations had been identified in 62 families while only the locus had been identified for an additional 15. The remaining 67 families were subjected to homozygosity exclusion mapping by screening of closely flanking microsatellite markers at 180 known candidate genes/loci followed by sequencing of the candidate gene for pathogenic changes. Results Of these 67 families subjected to homozygosity mapping, 38 showed homozygosity for at least one of the 180 regions, and sequencing of the corresponding genes showed homozygous cosegregating mutations in 27 families. Overall, mutations were detected in approximately 61.8 % (89/144) of arRD families tested, with another 10.4% (15/144) being mapped to a locus but without a gene identified. Conclusions These results suggest the involvement of unmapped novel genes in the remaining 27.8% (40/144) of families. In addition, this study demonstrates that homozygosity mapping remains a powerful tool for identifying the genetic defect underlying genetically heterogeneous arRD disorders in consanguineous marriages for both research and clinical applications. PMID:28418496

  1. 42 CFR 413.144 - Depreciation: Allowance for depreciation on fully depreciated or partially depreciated assets.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 2 2010-10-01 2010-10-01 false Depreciation: Allowance for depreciation on fully... SKILLED NURSING FACILITIES Capital-Related Costs § 413.144 Depreciation: Allowance for depreciation on fully depreciated or partially depreciated assets. (a) Principle. Depreciation on assets being used by a...

  2. Nanostructures via noncovalent synthesis: 144 hydrogen bonds bring together 27 components

    NARCIS (Netherlands)

    Paraschiv, V.; Crego Calama, Mercedes; Fokkens, R.H.; Padberg, Clemens J.; Timmerman, P.; Reinhoudt, David

    2001-01-01

    This paper describes the spontaneous and reversible assembly of 20 kDa synthetic hydrogen-bonded assemblies via the formation of 144 cooperative hydrogen bonds. These nanostructures (3.0 × 5.5 nm), consisting of 27 different components, have been carefully characterized using a combination of 1H NMR

  3. Physical and genetic characterization of the IncI plasmid R144-drd3

    NARCIS (Netherlands)

    Hartskeerl, R.A.; Guchte, M. v.d.; Zuidweg, E.M.; Hoekstra, W.P.M.

    1984-01-01

    A physical and genetic map of the IncI plasmid R144-drd3 was obtained by determining restriction endonuclease sites and by physical and genetic analysis of cloned fragments, of TnI insertion mutants and of deletion mutants.

  4. Biological effects of inhaled {sup 144}CeCl{sub 3} in beagle dogs

    Energy Technology Data Exchange (ETDEWEB)

    Hahn, F.F.; Boecker, B.B.; Griffith, W.C.; Muggenburg, B.A. [Inhalation Toxicology Research Institute, Albuquerque, NM (United States)

    1997-01-01

    The biological effects of {sup 144}Ce were studied in beagle dogs that were exposed to graded activity levels of {sup 144}CeCl{sub 3} via a single, brief inhalation exposure and observed for their life span. The long-term retained body burdens ranged from 0.06 to 13 MBq/kg with a median of 1.2 MBq/kg. After a short residence time in the lung, most of the {sup 144}Ce was translocated to liver and skeleton, where the {sup 144}Ce was retained with a half-time approaching the physical half-life of {sup 144}Ce was retained with a half-time approaching the physical half-life of {sup 144}Ce, 284 days. Significant radiation doses were delivered to the lung, 28 Gy (median) and 2.5-370 Gy (range); liver, 68 Gy (median) and 6.1-250 Gy (range); and skeleton, 21 Gy (median) and 1.9-100 Gy (range). Lesions induced by the {beta}-particle radiation were noted in the lung, liver, skeleton, bone marrow, and oral and nasal mucosae closely associated with bond. Early deaths (within 2.5 years) were generally related to hematological dyscrasia, radiation pneumonitis, or hepatocellular degeneration and atrophy. Neoplasms that occurred relatively early, from 2.2-6.8 years after exposure, were noted in the liver, bone, bone marrow and oral mucosa closely associated with bone. Neoplasms that occurred later, beyond 7 years after exposure, were noted in the liver, lung and nasal mucosa closely associated with bone. Increased numbers of neoplasms were not found in two other organs that had relatively high radiation doses, namely the thyroid and kidney. Only one primary bone tumor was noted, but 11 tumors of bone-associated tissues (oral and nasal mucosae and bone marrow) were found. Radiation doses and effects in tissues adjacent to bone, especially those of epithelial or marrow origin, should be considered when determining risks from internally deposited bone-seeking radionuclides, such as {sup 144}Ce. 59 refs., 8 figs., 10 tabs.

  5. Structure of the Bacteriophage [phi]KZ Lytic Transglycosylase gp144

    Energy Technology Data Exchange (ETDEWEB)

    Fokine, Andrei; Miroshnikov, Konstantin A.; Shneider, Mikhail M.; Mesyanzhinov, Vadim V.; Rossmann, Michael G. (SOIBC); (Purdue)

    2008-04-02

    Lytic transglycosylases are enzymes that act on the peptidoglycan of bacterial cell walls. They cleave the glycosidic linkage between N-acetylmuramoyl and N-acetylglucosaminyl residues with the concomitant formation of a 1,6-anhydromuramoyl product. The x-ray structure of the lytic transglycosylase gp144 from the Pseudomonas bacteriophage {phi}KZ has been determined to 2.5-{angstrom} resolution. This protein is probably employed by the bacteriophage in the late stage of the virus reproduction cycle to destroy the bacterial cell wall to release the phage progeny. {phi}KZ gp144 is a 260-residue {alpha}-helical protein composed of a 70-residue N-terminal cell wall-binding domain and a C-terminal catalytic domain. The fold of the N-terminal domain is similar to the peptidoglycan-binding domain from Streptomyces albus G d-Ala-d-Ala carboxypeptidase and to the N-terminal prodomain of human metalloproteinases that act on extracellular matrices. The C-terminal catalytic domain of gp144 has a structural similarity to the catalytic domain of the transglycosylase Slt70 from Escherichia coli and to lysozymes. The gp144 catalytic domain has an elongated groove that can bind at least five sugar residues at sites A-E. As in other lysozymes, the peptidoglycan cleavage (catalyzed by Glu{sup 115} in gp144) occurs between sugar-binding subsites D and E. The x-ray structure of the {phi}KZ transglycosylase complexed with the chitotetraose (N-acetylglucosamine){sub 4} has been determined to 2.6-{angstrom} resolution. The N-acetylglucosamine residues of the chitotetraose bind in sites A-D.

  6. Retention capacity of samarium (III) in zircon for it possible use in retaining walls for confinement of nuclear residues; Capacidad de retencion de samario (III) en circon para su posible uso en barreras de contencion para confinamiento de residuos nucleares

    Energy Technology Data Exchange (ETDEWEB)

    Garcia G, N

    2006-07-01

    Mexico, as country that produces part of its electric power by nuclear means, should put special emphasis in the development of technologies guided to the sure and long term confinement of the high level nuclear residuals. This work studies the capacity that has the natural zircon to retain to the samarium (III) in solution, by what due, firstly, to characterize the zircon for technical instrumental to determine the purity and characteristic of the mineral in study. The instrumental techniques that were used to carry out the physicochemical characterization were the neutron activation analysis (NAA), the infrared spectroscopy (IS), the thermal gravimetric analysis (TGA), scanning electron microscopy (SEM), transmission electron microscopy (TEM), semiquantitative analysis, dispersive energy spectroscopy (EDS), X-ray diffraction (XRD) and luminescence technique. The characterization of the surface properties carries out by means of the determination of the surface area using the BET multipoint technique, acidity constants, hydration time, the determination of the point of null charge (pH{sub PCN}) and density of surface sites (D{sub s}). The luminescence techniques were useful to determine the optimal point hydration of the zircon and for the quantification of the samarium, for that here intends the development of both analysis techniques. With the adjustment of the titration curves in the FITEQL 4 package the constants of surface acidity in the solid/liquid interface were determined. To the finish of this study it was corroborated that the zircon is a mineral that presents appropriate characteristics to be proposed as a contention barrier for the deep geologic confinement. With regard to the study of adsorption that one carries out the samarium retention it is superior to 90% under the described conditions. This investigation could also be applicable in the confinement of dangerous industrial residuals. (Author)

  7. Effectiveness of antihypertensive therapy in HIV-positive patients: evaluation to 144 weeks

    Directory of Open Access Journals (Sweden)

    K Falasca

    2012-11-01

    Full Text Available Hypertension is more prevalent among HIV-infected subjects than in the general population, contributing to increased cardiovascular risk in HIV+ patients. The angiotensin II receptor blocker telmisartan is also a partial peroxisome proliferator activated receptor (PPAR-γ agonist, with documented effects on improving hypertension, lipid metabolism and renal function. Therefore telmisartan was found to be the first choice for treatment of HIV+ hypertensive patients. Aim of this study was to evaluate the durability on 144 weeks of treatment with telmisartan in HIV+ patients. 13 HIV+ Caucasian male patients treated with combined antiretroviral therapy (cART and discovered to be naïve hypertensive, were given 80 mg telmisartan daily. Systolic (SBP and diastolic (DBP blood pressure, viro-immunological, lipid and metabolic parameters, including triglycerides, cholesterol, insulin resistance (HOMA-IR, inflammatory markers, C-reactive protein (CRP, erythrocyte sedimentation rate (ESR, indexes of renal function and cardiovascular risk, microalbuminuria, cystatin C, were measured at baseline (T0, and after 24 (T24, 48 (T48, 72 (T72, 96 (T96, 120 (T120 and 144 (T144 weeks. Treatment with telmisartan decreased SBP and DBP levels during the 144 weeks of observation. We also observed improved HDL-cholesterol, HOMA-IR, microalbuminuria and cystatin C at the end of study. Triglycerides and total cholesterol significantly decreased and HDL-cholesterol significantly increased. Total cholesterol/HDL cholesterol ratio improved significantly. Throughout in the course of the trial our patients showed a significant improvement of the percentage of CD4+ and CD8+. Eventually in all 144 weeks of therapy with telmisartan 80 mg/day have not observed adverse events or dropouts. Telmisartan was effective in improving hypertension, lipid metabolism and renal function in 144 weeks of evaluation. It determines the improvement of cystatin C and microalbuminuria, markers of

  8. 40 CFR 144.21 - Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells.

    Science.gov (United States)

    2010-07-01

    ... recovery and hydrocarbon storage) and III wells. 144.21 Section 144.21 Protection of Environment... hydrocarbon storage) and III wells. (a) An existing Class I, II (except enhanced recovery and hydrocarbon... decision; or (9) For Class II wells (except enhanced recovery and hydrocarbon storage), five years after...

  9. Fabrication of catalytically active nanocrystalline samarium (Sm)-doped cerium oxide (CeO2) thin films using electron beam evaporation

    Science.gov (United States)

    Kundu, Subrata; Sutradhar, Narottam; Thangamuthu, R.; Subramanian, B.; Panda, Asit Baran; Jayachandran, M.

    2012-08-01

    Samarium (Sm)-doped cerium oxide (CeO2) thin films were fabricated using electron beam evaporation technique. The synthesized films were deposited either on glass or ITO substrates and studied their nature by annealing at different temperatures. The optical properties and other morphological studies were done by UV-Vis, XRD, XPS, SEM, EDS, and FT-IR analysis. XRD and XPS analysis clearly confirm the presence of Sm in the ceria site. From the SEM study, it was found that after annealing at high temperature ( 300 or 500 °C), the particles size was reduced due to breakdown of large aggregates of particles which is also confirmed from UV-Vis, XPS, and XRD analyses. The FT-IR study proves the presence of -COO-, -OH, or ammonium group on the particles surface. The deposition of Sm-doped CeO2 nanomaterials was found more feasible on ITO substrate compared to that of glass substrate in terms of stability and depth of film thickness. The Sm-doped CeO2 nanomaterial acts as a re-usable catalyst for the reduction of organic dye molecules in the presence of NaBH4. The catalysis rate was compared by considering the electron transfer process during the reduction. The synthesized Sm-doped CeO2 thin films might find wide variety of applications in various emerging fields like solid oxide fuel cells (SOFCs), oxygen sensor or as catalyst in different types of organic and inorganic catalytic reactions. The fabrication process is very simple, straightforward, less time consuming, and cost effective.

  10. Fabrication of catalytically active nanocrystalline samarium (Sm)-doped cerium oxide (CeO{sub 2}) thin films using electron beam evaporation

    Energy Technology Data Exchange (ETDEWEB)

    Kundu, Subrata, E-mail: skundu@cecri.res.in [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India); Sutradhar, Narottam [G. B. Marg, Central Salt and Marine Chemical Research Institute - CSIR (India); Thangamuthu, R.; Subramanian, B. [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India); Panda, Asit Baran [G. B. Marg, Central Salt and Marine Chemical Research Institute (CSIR) (India); Jayachandran, M., E-mail: mjayam54@yahoo.com [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India)

    2012-08-15

    Samarium (Sm)-doped cerium oxide (CeO{sub 2}) thin films were fabricated using electron beam evaporation technique. The synthesized films were deposited either on glass or ITO substrates and studied their nature by annealing at different temperatures. The optical properties and other morphological studies were done by UV-Vis, XRD, XPS, SEM, EDS, and FT-IR analysis. XRD and XPS analysis clearly confirm the presence of Sm in the ceria site. From the SEM study, it was found that after annealing at high temperature ({approx}300 or 500 Degree-Sign C), the particles size was reduced due to breakdown of large aggregates of particles which is also confirmed from UV-Vis, XPS, and XRD analyses. The FT-IR study proves the presence of -COO-, -OH, or ammonium group on the particles surface. The deposition of Sm-doped CeO{sub 2} nanomaterials was found more feasible on ITO substrate compared to that of glass substrate in terms of stability and depth of film thickness. The Sm-doped CeO{sub 2} nanomaterial acts as a re-usable catalyst for the reduction of organic dye molecules in the presence of NaBH{sub 4}. The catalysis rate was compared by considering the electron transfer process during the reduction. The synthesized Sm-doped CeO{sub 2} thin films might find wide variety of applications in various emerging fields like solid oxide fuel cells (SOFCs), oxygen sensor or as catalyst in different types of organic and inorganic catalytic reactions. The fabrication process is very simple, straightforward, less time consuming, and cost effective.Graphical Abstract.

  11. Machine learning methods enable predictive modeling of antibody feature:function relationships in RV144 vaccinees.

    Directory of Open Access Journals (Sweden)

    Ickwon Choi

    2015-04-01

    Full Text Available The adaptive immune response to vaccination or infection can lead to the production of specific antibodies to neutralize the pathogen or recruit innate immune effector cells for help. The non-neutralizing role of antibodies in stimulating effector cell responses may have been a key mechanism of the protection observed in the RV144 HIV vaccine trial. In an extensive investigation of a rich set of data collected from RV144 vaccine recipients, we here employ machine learning methods to identify and model associations between antibody features (IgG subclass and antigen specificity and effector function activities (antibody dependent cellular phagocytosis, cellular cytotoxicity, and cytokine release. We demonstrate via cross-validation that classification and regression approaches can effectively use the antibody features to robustly predict qualitative and quantitative functional outcomes. This integration of antibody feature and function data within a machine learning framework provides a new, objective approach to discovering and assessing multivariate immune correlates.

  12. Machine learning methods enable predictive modeling of antibody feature:function relationships in RV144 vaccinees.

    Science.gov (United States)

    Choi, Ickwon; Chung, Amy W; Suscovich, Todd J; Rerks-Ngarm, Supachai; Pitisuttithum, Punnee; Nitayaphan, Sorachai; Kaewkungwal, Jaranit; O'Connell, Robert J; Francis, Donald; Robb, Merlin L; Michael, Nelson L; Kim, Jerome H; Alter, Galit; Ackerman, Margaret E; Bailey-Kellogg, Chris

    2015-04-01

    The adaptive immune response to vaccination or infection can lead to the production of specific antibodies to neutralize the pathogen or recruit innate immune effector cells for help. The non-neutralizing role of antibodies in stimulating effector cell responses may have been a key mechanism of the protection observed in the RV144 HIV vaccine trial. In an extensive investigation of a rich set of data collected from RV144 vaccine recipients, we here employ machine learning methods to identify and model associations between antibody features (IgG subclass and antigen specificity) and effector function activities (antibody dependent cellular phagocytosis, cellular cytotoxicity, and cytokine release). We demonstrate via cross-validation that classification and regression approaches can effectively use the antibody features to robustly predict qualitative and quantitative functional outcomes. This integration of antibody feature and function data within a machine learning framework provides a new, objective approach to discovering and assessing multivariate immune correlates.

  13. The high precision measurement of the 144Ce activity in the SOX experiment

    Science.gov (United States)

    Di Noto, L.; Agostini, M.; Althenmüller, K.; Appel, S.; Bellini, G.; Benziger, J.; Berton, N.; Bick, D.; Bonfini, G.; Bravo—Berguño, D.; Caccianiga, B.; Calaprice, F.; Caminata, A.; Cavalcante, P.; Cereseto, R.; Chepurnov, A.; Choi, K.; Cribier, M.; DAngelo, D.; Davini, S.; Derbin, A.; Drachnev, I.; Durero, M.; Etenko, A.; Farinon, S.; Fischer, V.; Fomenko, K.; Franco, D.; Gabriele, F.; Gaffiot, J.; Galbiati, C.; Ghiano, C.; Giammarchi, M.; Göeger-Neff, M.; Goretti, A.; Gromov, M.; Hagner, C.; Houdy, Th; Hungerford, E.; Ianni, Aldo; Ianni, Andrea; Jonquères, N.; Jedrzejczak, K.; Kaiser, M.; Kobychev, V.; Korablev, D.; Korga, G.; Kornoukhov, V.; Kryn, D.; Lachenmaier, T.; Lasserre, T.; Laubenstein, M.; Lehnert, T.; Link, J.; Litvinovich, E.; Lombardi, F.; Lombardi, P.; Ludhova, L.; Lukyanchenko, G.; Machulin, I.; Manecki, S.; Maneschg, W.; Marcocci, S.; Maricic, J.; Mention, G.; Meroni, E.; Meyer, M.; Miramonti, L.; Misiaszek, M.; Montuschi, M.; Mosteiro, P.; Muratova, V.; Musenich, R.; Neumair, B.; Oberauer, L.; Obolensky, M.; Ortica, F.; Pallavicini, M.; Papp, L.; Perasso, L.; Pocar, A.; Ranucci, G.; Razeto, A.; Re, A.; Romani, A.; Roncin, R.; Rossi, C.; Rossi, N.; Schönert, S.; Scola, L.; Semenov, D.; Simgen, H.; Skorokhvatov, M.; Smirnov, O.; Sotnikov, A.; Sukhotin, S.; Suvorov, Y.; Tartaglia, R.; Testera, G.; Thurn, J.; Toropova, M.; Veyssière, C.; Vivier, M.; Unzhakov, E.; Vogelaar, R. B.; von Feilitzsch, F.; Wang, H.; Weinz, S.; Winter, J.; Wojcik, M.; Wurm, M.; Yokley, Z.; Zaimidoroga, O.; Zavatarelli, S.; Zuber, K.; Zuzel, G.

    2016-02-01

    In order to perform a resolutive measurement to clarify the neutrino anomalies and to observe possible short distance neutrino oscillations, the SOX (Short distance neutrino Oscillations with BoreXino) experiment is under construction. In the first phase, a 100 kCi 144Ce-144Pr antineutrino source will be placed under the Borexino detector at the Laboratori Nazionali del Gran Sasso (LNGS), in center of Italy, and the rate measurement of the antineutrino events, observed by the very low radioactive background Borexino detector, will be compared with the high precision (< 1%) activity measurement performed by two calorimeters. The source will be embedded in a 19 mm thick tungsten alloy shield and both the calorimeters have been conceived for measuring the thermal heat absorbed by a water flow. In this report the design of the calorimeters will be described in detail and very preliminary results will be also shown.

  14. Change of deformation at the backbending in the yrast superdeformed band of {sup 144}Gd

    Energy Technology Data Exchange (ETDEWEB)

    Ur, C.A.; Bolzonella, G.P.; Bazzacco, D. [dell`Universita, Padova (Italy)]|[INFN, Padova (Italy)] [and others

    1996-12-31

    A mean lifetime measurement using the Doppler shift attenuation method has been performed at GASP in order to extract the quadrupole moment of the yrast SD band of {sup 144}Gd. The extracted intrinsic quadrupole moments, being Q{sub 0}=13.7 eb above the backbending and Q{sub 0}=11.8 eb below the backbending, are consistent with a change of deformation from {beta}{sub 2}=0.51 (at {beta}{sub 4} {approx} 0.050) to {beta}{sub 2}=0.45 (at {beta}{sub 4} {approx}0.035). The experimental results are in nice agreement with the theoretical predictions, which revealed that the second well in {sup 144}Gd arises essentially from the very favored shell structure at N=80 and Z=64. The occupation at higher frequency of the aligned N=6 proton orbitals drives the nucleus to a slightly more deformed shape.

  15. Replication of JC Virus DNA in the G144 Oligodendrocyte Cell Line Is Dependent Upon Akt.

    Science.gov (United States)

    Peterson, Jesse N; Lin, Brian; Shin, Jong; Phelan, Paul J; Tsichlis, Philip; Schwob, James E; Bullock, Peter A

    2017-10-15

    Progressive multifocal leukoencephalopathy (PML) is an often-fatal demyelinating disease of the central nervous system. PML results when oligodendrocytes within immunocompromised individuals are infected with the human JC virus (JCV). We have identified an oligodendrocyte precursor cell line, termed G144, that supports robust levels of JCV DNA replication, a central part of the JCV life cycle. In addition, we have determined that JC virus readily infects G144 cells. Furthermore, we have determined that JCV DNA replication in G144 cells is stimulated by myristoylated (i.e., constitutively active) Akt and reduced by the Akt-specific inhibitor MK2206. Thus, this oligodendrocyte-based model system will be useful for a number of purposes, such as studies of JCV infection, establishing key pathways needed for the regulation of JCV DNA replication, and identifying inhibitors of this process.IMPORTANCE The disease progressive multifocal leukoencephalopathy (PML) is caused by the infection of particular brain cells, termed oligodendrocytes, by the JC virus. Studies of PML, however, have been hampered by the lack of an immortalized human cell line derived from oligodendrocytes. Here, we report that the G144 oligodendrocyte cell line supports both infection by JC virus and robust levels of JCV DNA replication. Moreover, we have established that the Akt pathway regulates JCV DNA replication and that JCV DNA replication can be inhibited by MK2206, a compound that is specific for Akt. These and related findings suggest that we have established a powerful oligodendrocyte-based model system for studies of JCV-dependent PML. Copyright © 2017 American Society for Microbiology.

  16. Gene expression analysis of embryonic stem cells expressing VE-cadherin (CD144 during endothelial differentiation

    Directory of Open Access Journals (Sweden)

    Libermann Towia

    2008-05-01

    Full Text Available Abstract Background Endothelial differentiation occurs during normal vascular development in the developing embryo. This process is recapitulated in the adult when endothelial progenitor cells are generated in the bone marrow and can contribute to vascular repair or angiogenesis at sites of vascular injury or ischemia. The molecular mechanisms of endothelial differentiation remain incompletely understood. Novel approaches are needed to identify the factors that regulate endothelial differentiation. Methods Mouse embryonic stem (ES cells were used to further define the molecular mechanisms of endothelial differentiation. By flow cytometry a population of VEGF-R2 positive cells was identified as early as 2.5 days after differentiation of ES cells, and a subset of VEGF-R2+ cells, that were CD41 positive at 3.5 days. A separate population of VEGF-R2+ stem cells expressing the endothelial-specific marker CD144 (VE-cadherin was also identified at this same time point. Channels lined by VE-cadherin positive cells developed within the embryoid bodies (EBs formed by differentiating ES cells. VE-cadherin and CD41 expressing cells differentiate in close proximity to each other within the EBs, supporting the concept of a common origin for cells of hematopoietic and endothelial lineages. Results Microarray analysis of >45,000 transcripts was performed on RNA obtained from cells expressing VEGF-R2+, CD41+, and CD144+ and VEGF-R2-, CD41-, and CD144-. All microarray experiments were performed in duplicate using RNA obtained from independent experiments, for each subset of cells. Expression profiling confirmed the role of several genes involved in hematopoiesis, and identified several putative genes involved in endothelial differentiation. Conclusion The isolation of CD144+ cells during ES cell differentiation from embryoid bodies provides an excellent model system and method for identifying genes that are expressed during endothelial differentiation and that

  17. Structure & bonding of the gold-subhalide cluster I-Au144Cl60[z].

    Science.gov (United States)

    Tlahuice-Flores, Alfredo; Black, David M; Bach, Stephan B H; Jose-Yacamán, Miguel; Whetten, Robert L

    2013-11-28

    The structure and bonding of the gold-subhalide compounds Au144Cl60([z]) are related to those of the ubiquitous thiolated gold clusters, or Faradaurates, by iso-electronic substitution of thiolate by chloride. Exact I-symmetry holds for the [z] = [2+,4+] charge-states, in accordance with new electrospray mass spectrometry measurements and the predicted electron shell filling. The high symmetry facilitates analysis of the global structure as well as the bonding network, with some striking results.

  18. Focusing of 3C144 Source Radiation by the Solar Corona

    Science.gov (United States)

    Galanin, V. V.; Derevjagin, V. G.; Kravetz, R. O.

    The research of solar corona by the compact cosmic source radiation was made on URAN-4 radio telescope. In the period from June 6 to June 20 2012 the flow of Crab nebula was measured on the 20 MHz and 25 MHz frequencies. During the eclipse we observe the great increase of 3C144 flow, which is compare with the flow of 3C461 source. Data and results of measurement analysis is presented.

  19. Crystal structure of monoclinic samarium and cubic europium sesquioxides and bound coherent neutron scattering lengths of the isotopes {sup 154}Sm and {sup 153}Eu

    Energy Technology Data Exchange (ETDEWEB)

    Kohlmann, Holger [Leipzig Univ. (Germany). Inst. of Inorganic Chemistry; Hein, Christina; Kautenburger, Ralf [Saarland Univ., Saarbruecken (Germany). Inorganic Solid State Chemistry; Hansen, Thomas C.; Ritter, Clemens [Institut Laue-Langevin, Grenoble (France); Doyle, Stephen [Karlsruhe Institute of Technology, Eggenstein-Leopoldshafen (Germany). Inst. for Synchrotron Radiation (ISS)

    2016-11-01

    The crystal structures of monoclinic samarium and cubic europium sesquioxide, Sm{sub 2}O{sub 3} and Eu{sub 2}O{sub 3}, were reinvestigated by powder diffraction methods (laboratory X-ray, synchrotron, neutron). Rietveld analysis yields more precise structural parameters than previously known, especially for oxygen atoms. Interatomic distances d(Sm-O) in Sm{sub 2}O{sub 3} range from 226.3(4) to 275.9(2) pm [average 241.6(3) pm] for the monoclinic B type Sm{sub 2}O{sub 3} [space group C2/m, a = 1418.04(3) pm, b = 362.660(7) pm, c = 885.48(2) pm, β = 100.028(1) ], d(Eu-O) in Eu{sub 2}O{sub 3} from 229.9(2) to 238.8(2) pm for the cubic bixbyite (C) type [space group Ia anti 3, a = 1086.87(1) pm]. Neutron diffraction at 50 K and 2 K did not show any sign for magnetic ordering in Sm{sub 2}O{sub 3}. Isotopically enriched {sup 154}Sm{sub 2}O{sub 3} and {sup 153}Eu{sub 2}O{sub 3} were used for the neutron diffraction work because of the enormous absorption cross section of the natural isotopic mixtures for thermal neutrons. The isotopic purity was determined by inductively coupled plasma - mass spectrometry to be 98.9% for {sup 154}Sm and 99.8% for {sup 153}Eu. Advanced analysis of the neutron diffraction data suggest that the bound coherent scattering lengths of {sup 154}Sm and {sup 153}Eu need to be revised. We tentatively propose b{sub c}({sup 154}Sm) = 8.97(6) fm and b{sub c}({sup 153}Eu) = 8.85(3) fm for a neutron wavelength of 186.6 pm to be better values for these isotopes, showing up to 8% deviation from accepted literature values. It is shown that inaccurate scattering lengths may result in severe problems in crystal structure refinements causing erroneous structural details such as occupation parameters, which might be critically linked to physical properties like superconductivity in multinary oxides.

  20. MicroRNA-144 Regulates Hepatic ABCA1 and Plasma HDL Following Activation of the Nuclear Receptor FXR

    Science.gov (United States)

    de Aguiar Vallim, Thomas Q.; Tarling, Elizabeth J.; Kim, Tammy; Civelek, Mete; Baldán, Ángel; Esau, Christine; Edwards, Peter A.

    2014-01-01

    Rationale The bile acid receptor Farnesoid-X-Receptor (FXR) regulates many aspects of lipid metabolism by various complex and not fully understood molecular mechanisms. We set out to investigate the molecular mechanisms for FXR-dependent regulation of lipid and lipoprotein metabolism. Objective To identify FXR-regulated microRNAs that were subsequently involved in regulating lipid metabolism. Methods and Results ATP binding cassette transporter A1 (ABCA1) is a major determinant of plasma High Density Lipoprotein (HDL)-cholesterol levels. Here we show that activation of the nuclear receptor FXR in vivo increases hepatic levels of miR-144, which in turn lower hepatic ABCA1 and plasma HDL levels. We identified two complementary sequences to miR-144 in the 3′ untranslated region (UTR) of ABCA1 mRNA that are necessary for miR-144-dependent regulation. Overexpression of miR-144 in vitro decreased both cellular ABCA1 protein and cholesterol efflux to lipid-poor apolipoprotein A-I (ApoA-I) protein, whilst overexpression in vivo reduced hepatic ABCA1 protein and plasma HDL-cholesterol. Conversely, silencing miR-144 in mice increased hepatic ABCA1 protein and HDL-cholesterol. In addition, we utilized tissue-specific FXR deficient mice to show that induction of miR-144 and FXR-dependent hypolipidemia requires hepatic, but not intestinal FXR. Finally, we identified functional FXR response elements (FXREs) upstream of the miR-144 locus, consistent with direct FXR regulation. Conclusion We have identified a novel pathway involving FXR, miR-144 and ABCA1 that together regulate plasma HDL cholesterol. PMID:23519696

  1. 24 CFR 943.144 - What financial impact do operations of a subsidiary, affiliate, or joint venture have on a PHA?

    Science.gov (United States)

    2010-04-01

    ... of a subsidiary, affiliate, or joint venture have on a PHA? 943.144 Section 943.144 Housing and Urban... CONSORTIA AND JOINT VENTURES Subsidiaries, Affiliates, Joint Ventures in Public Housing § 943.144 What financial impact do operations of a subsidiary, affiliate, or joint venture have on a PHA? Income generated...

  2. Au99(SPh)42 nanomolecules: aromatic thiolate ligand induced conversion of Au144(SCH2CH2Ph)60.

    Science.gov (United States)

    Nimmala, Praneeth Reddy; Dass, Amala

    2014-12-10

    A new aromatic thiolate protected gold nanomolecule Au99(SPh)42 has been synthesized by reacting the highly stable Au144(SCH2CH2Ph)60 with thiophenol, HSPh. The ubiquitous Au144(SR)60 is known for its high stability even at elevated temperature and in the presence of excess thiol. This report demonstrates for the first time the reactivity of the Au144(SCH2CH2Ph)60 with thiophenol to form a different 99-Au atom species. The resulting Au99(SPh)42 compound, however, is unreactive and highly stable in the presence of excess aromatic thiol. The molecular formula of the title compound is determined by high resolution electrospray mass spectrometry (ESI-MS) and confirmed by the preparation of the 99-atom nanomolecule using two ligands, namely, Au99(SPh)42 and Au99(SPh-OMe)42. This mass spectrometry study is an unprecedented advance in nanoparticle reaction monitoring, in studying the 144-atom to 99-atom size evolution at such high m/z (∼12k) and resolution. The optical and electrochemical properties of Au99(SPh)42 are reported. Other substituents on the phenyl group, HS-Ph-X, where X = -F, -CH3, -OCH3, also show the Au144 to Au99 core size conversion, suggesting minimal electronic effects for these substituents. Control experiments were conducted by reacting Au144(SCH2CH2Ph)60 with HS-(CH2)n-Ph (where n = 1 and 2), bulky ligands like adamantanethiol and cyclohexanethiol. It was observed that conversion of Au144 to Au99 occurs only when the phenyl group is directly attached to the thiol, suggesting that the formation of a 99-atom species is largely influenced by aromaticity of the ligand and less so on the bulkiness of the ligand.

  3. Highly CO2-Tolerant Cathode for Intermediate-Temperature Solid Oxide Fuel Cells: Samarium-Doped Ceria-Protected SrCo0.85Ta0.15O3-δ Hybrid.

    Science.gov (United States)

    Li, Mengran; Zhou, Wei; Zhu, Zhonghua

    2017-01-25

    Susceptibility to CO2 is one of the major challenges for the long-term stability of the alkaline-earth-containing cathodes for intermediate-temperature solid oxide fuel cells. To alleviate the adverse effects from CO2, we incorporated samarium-stabilized ceria (SDC) into a SrCo0.85Ta0.15O3-δ (SCT15) cathode by either mechanical mixing or a wet impregnation method and evaluated their cathode performance stability in the presence of a gas mixture of 10% CO2, 21% O2, and 69% N2. We observed that the CO2 tolerance of the hybrid cathode outperforms the pure SCT15 cathode by over 5 times at 550 °C. This significant enhancement is likely attributable to the low CO2 adsorption and reactivity of the SDC protective layer, which are demonstrated through thermogravimetric analysis, energy-dispersive spectroscopy, and electrical conductivity study.

  4. Atomistic Simulations of Functional Au-144(SR)(60) Gold Nanoparticles in Aqueous Environment

    DEFF Research Database (Denmark)

    Heikkila, E.; Gurtovenko, A. A.; Martinez-Seara, H.

    2012-01-01

    of the nanoparticle together with surrounding ions and water. We focus on Au-144 nanoparticles that comprise a nearly spherical Au core (diameter similar to 2 nm), a passivating Au-S interface, and functionalized alkanethiol chains. Cationic and anionic AuNPs have been modeled with amine and carboxyl terminal groups...... and Cl-/Na+ counterions, respectively. The radial distribution functions show that the side chains and terminal groups show significant flexibility. The orientation of water is distinct in the first solvation shell, and AuNPs cause a long-range effect in the solvent structure. The radial electrostatic...... in aqueous solutions. They suggest that electrostatics is one of the central factors in complexation of AuNPs with other nanomaterials and biological systems, and that effects of electrostatics as water-mediated interactions are relatively long-ranged, which likely plays a role in, e.g., the interplay...

  5. Lifetime tumor risk coefficients for beagle dogs that inhaled cerium-144 chloride

    Energy Technology Data Exchange (ETDEWEB)

    Boecker, B.B.; Hahn, F.F.; Griffith, W.C. [and others

    1995-12-01

    Reported here is one of the life-span radionuclide toxicology studies being conducted at ITRI in Beagle dogs. These studies are examining the life-span health risks of inhaled {Beta}-, {gamma}- and {alpha}-emitting radionuclides to expand available knowledge on these risks especially for the many cases for which human data are not available. The outcomes of these studies are providing important information on dosimetry and dose-response relationships for these inhaled radionuclides and the relative importance of a broad range of dose- and effect-modifying factors. A number of these studies are currently coming to completion. Much of the ITRI effort is being directed to final reviews of the dosimetric, clinical, and pathologic results and writing summary manuscripts. Radiation doses and effects in tissues adjacent to bone, specifically those of epithelial or marrow origin, should be considered when determining risks from internally deposited, bone-seeking radionuclides such as {sup 144}Ce.

  6. Identification of low-energy isovector octupole states in 144Nd

    Science.gov (United States)

    Thürauf, M.; Scheck, M.; Bernards, C.; Blanc, A.; Cooper, N.; Defrance, G.; Jentschel, M.; Jolie, J.; Kaleja, O.; Köster, U.; Kröll, T.; Mutti, P.; Simpson, G. S.; Soldner, T.; Tezgel, M.; Urban, W.; Vanhoy, J.; Werner, M.; Werner, V.; Zell, K. O.

    2016-06-01

    Recently, first candidates for low-lying isovector states in the octupole sector were suggested. The unambiguous identification of those states will contribute to the decomposition of the octupole-octupole residual interaction in an isoscalar and isovector part. This will help us understand the octupole degree of freedom. In 144Nd the 3- state at 2778 keV is a good candidate for such a “mixed-symmetry’' octupole state. In order to clarify the nature of this state, a 143Nd(n, γ)-experiment was conducted with the EXILL-setup. Following neutron capture the 3- states are populated and EXILL provides the opportunity to determine the multipole-mixing ratios of the 3i -→31 - transitions. For the transition from the “mixed-symmetry” octupole state to the symmetric 31 - state we expect a strong M1 component.

  7. CDCC calculations of elastic scattering for the systems 6Li+144Sm and 6Li+208Pb. Effect of resonances of 6Li on elastic scattering angular distributions

    Science.gov (United States)

    Gómez Camacho, A.

    2015-01-01

    Calculations of elastic scattering angular distributions for reactions of the weakly bound projectile 6Li with targets 144Sm and 208Pb at energies above the barrier, are performed with the Continuum Discretized Coupled-Channel method (CDCC). Ground, resonant and nonresonant continuum states of 6Li are included up to some maximum energy epsilonmax for which convergence is achieved. In the three-body system, global interactions are used for the α-target and d - target sub-systems. The effect of continuum resonant states of 6Li, i.e., l = 2, jπ = 3+, 2+ and 1+ on elastic scattering angular distributions is investigated by extracting these states from the continuum space. It is found that the calculated elastic scattering angular distributions are in good agreement with the measurements for most of the cases studied where consideration of couplings to continuum states is essential. It is also found that the resonance character of the continuum states is in some cases important to obtain agreement with the data.

  8. Samarium-neodymium chronology and rubidium-strontium systematics of an Allende calcium-aluminum-rich inclusion with implications for 146Sm half-life

    Science.gov (United States)

    Marks, N. E.; Borg, L. E.; Hutcheon, I. D.; Jacobsen, B.; Clayton, R. N.

    2014-11-01

    Calcium-aluminum-rich inclusions (CAIs) are primitive objects that formed within the protoplanetary disk surrounding the young Sun. Recent Pb-Pb chronologic studies have demonstrated that CAIs are the oldest solar system solids, crystallizing 4567 Ma ago (Amelin et al., 2002; Connelly et al., 2012). The isotope systematics of CAIs therefore provide critical insight into the earliest history of the Solar System. Although Sm-Nd and Rb-Sr geochronometers are highly effective tools for investigating cosmochemical evolution in the early Solar System, previous studies of CAIs have revealed evidence for isotopically disturbed systems. Here we report new age data for Allende CAI Al3S4 derived from both the long-lived (147Sm-143Nd) and short-lived (146Sm-142Nd) isotopic systems. The 147Sm-143Nd chronometer yields an age of 4560 ± 34 Ma that is concordant with 207Pb-206Pb ages for CAIs and indicates that the Sm-Nd system was not significantly disturbed by secondary alteration or nucleosynthetic processes. The slope of the 146Sm-142Nd isochron defines the Solar System initial 146Sm/144Sm of 0.00828 ± 0.00044. This value is significantly different from the value of 0.0094 determined by Kinoshita et al. (2012). Ages recalculated from all published 146Sm-142Nd isochron data using the traditional 103 Ma half-life and the initial 146Sm/144Sm value determined here closely match Pb-Pb and 147Sm-143Nd ages determined on the same samples. In contrast, ages recalculated using the 68 Ma half-life determined by Kinoshita et al. (2012) and either of the initial 146Sm/144Sm values are often anomalously old. This is particularly true for the youngest samples with 146Sm-142Nd isochron ages that are most sensitive to the choice of 146Sm half-life used in the age calculation. In contrast to the Sm-Nd isotope system, the Rb-Sr system is affected by alteration but yields an apparent isochron with a slope corresponding to a much younger age of 4247 ± 110 Ma. Although the Rb-Sr system in CAIs

  9. Target Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — [Part of the ATLAS user facility.] The Physics Division operates a target development laboratory that produces targets and foils of various thickness and substrates,...

  10. Ferrites Ni{sub 0,5}Zn{sub 0,5}Fe{sub 2}O{sub 4} doped with samarium: structural analysis, morphological and electromagnetic; Ferritas Ni{sub 0,5}Zn{sub 0,5}Fe{sub 2}O{sub 4} dopada com samario: analise estrutural, morfologica e eletromagnetica

    Energy Technology Data Exchange (ETDEWEB)

    Costa, A.C.F.M.; Diniz, A.P., E-mail: anacristina@dema.ufcg.edu.br [Universidade Federal de Campina Grande (UFCG), PB (Brazil). Unidade Academinca de Engenharia de Materiais; Viana, K.M.S. [Universidade Federal do Rio Grande do Norte (UFRN), Natal, PE (Brazil). Escola de Ciencias e Tecnologia; Cornejo, D.R. [Universidade de Sao Paulo (USP), SP (Brazil). Instituto de Fisica; Kiminami, R.H.G.A. [Universidade Federal de Sao Carlos (UFSCar), SP (Brazil). Departamento de Engenharia de Materiais

    2010-07-01

    This paper proposes to investigate the sintering at 1200 deg C/2h of Ni{sub 0.5}Zn{sub 0.5}Fe{sub 2-x}Sm{sub x}O{sub 4} ferrite doped with 0.05; 0.075 e 0.1 mol of Sm synthesized by combustion reaction to evaluate the performance materials as absorbers of electromagnetic radiation. The influence of the concentration of samarium on the structure, morphology and electromagnetic properties of ferrites was studied. The resulting samples were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), magnetic measurements and reflectivity measurements in the frequency range between 8-12 GHz. The results showed that increasing the concentration of samarium caused a decrease in particle size of the samples, encouraging, therefore, to obtain materials with better values of magnetization and reflectivity, allowing for use as absorbers in narrow-band frequency between 9-10 GHz. (author)

  11. Cross sections of the 144Sm(n,α141Nd and 66Zn(n,α63Ni reactions at 4.0, 5.0 and 6.0 MeV

    Directory of Open Access Journals (Sweden)

    Yury Gledenov

    2017-01-01

    Full Text Available Cross sections of the 144Sm(n,α141Nd and 66Zn(n,α63Ni reactions were measured at En = 4.0, 5.0 and 6.0 MeV performed at the 4.5-MV Van de Graaff Accelerator of Peking University, China. A double-section gridded ionization chamber was used to detect the alpha particles. The foil samples of 144Sm2O3 and enriched 66Zn were placed at the common cathode plate of the chamber. Monoenergetic neutrons were produced by a deuterium gas target through the 2H(d,n3He reaction. The neutron flux was monitored by a BF3 long counter. Cross sections of the 238U(n,f reaction were used as the standard to perform the (n,α reaction measurement. Present results are compared with existing measurements and evaluations. They are generally in agreement with TALYS-1.6 code calculations. For the 144Sm(n,α141Nd reaction our measurements support the data of JEF-2.2. For the 66Zn(n,α63Ni reaction present results support the data of EAF-2010 and TENDL-2015 data.

  12. Cross sections of the 144Sm(n,α)141Nd and 66Zn(n,α)63Ni reactions at 4.0, 5.0 and 6.0 MeV

    Science.gov (United States)

    Yury, Gledenov; Guohui, Zhang; Khuukhenkhuu, Gonchigdorj; Milana, Sedysheva; Lubos, Krupa; Sansarbayar, Enkhbold; Igor, Chuprakov; Zhimin, Wang; Xiao, Fan; Luyu, Zhang; Huaiyong, Bai

    2017-09-01

    Cross sections of the 144Sm(n,α)141Nd and 66Zn(n,α)63Ni reactions were measured at En = 4.0, 5.0 and 6.0 MeV performed at the 4.5-MV Van de Graaff Accelerator of Peking University, China. A double-section gridded ionization chamber was used to detect the alpha particles. The foil samples of 144Sm2O3 and enriched 66Zn were placed at the common cathode plate of the chamber. Monoenergetic neutrons were produced by a deuterium gas target through the 2H(d,n)3He reaction. The neutron flux was monitored by a BF3 long counter. Cross sections of the 238U(n,f) reaction were used as the standard to perform the (n,α) reaction measurement. Present results are compared with existing measurements and evaluations. They are generally in agreement with TALYS-1.6 code calculations. For the 144Sm(n,α)141Nd reaction our measurements support the data of JEF-2.2. For the 66Zn(n,α)63Ni reaction present results support the data of EAF-2010 and TENDL-2015 data.

  13. Investigations of the level scheme of {sup 144}Gd and lifetimes in the quadrupole bands

    Energy Technology Data Exchange (ETDEWEB)

    Lieder, R.M.; Gast, W.; Jaeger, H.M.; Mihailescu, L. [Institut fuer Kernphysik, Forschungszentrum Juelich, D-52425, Juelich (Germany); Pasternak, A.A.; Podsvirova, E.O. [Institut fuer Kernphysik, Forschungszentrum Juelich, D-52425, Juelich (Germany); A.F. Ioffe Physical Technical Institute RAS, RU-194021, St. Petersburg (Russian Federation); Efimov, A.D. [A.F. Ioffe Physical Technical Institute RAS, RU-194021, St. Petersburg (Russian Federation); Mikhajlov, V.M. [Physical Institute, St. Petersburg State University, RU-198904, St. Petersburg (Russian Federation); Wyss, R. [Royal Institute of Technology, Physics Department Frescati, S-10405, Stockholm (Sweden); Venkova, T. [Institute of Nuclear Research and Nuclear Energy, Bulgarian Academy of Sciences, BG-1784, Sofia (Bulgaria); Bazzacco, D.; Lunardi, S.; Menegazzo, R.; Rossi Alvarez, C. [Dipartimento di Fisica dell' Universita and Istituto Nazionale di Fisica Nucleare, Sezione di Padova, I-35131, Padova (Italy); Angelis, G. de; Napoli, D.R. [Istituto Nazionale di Fisica Nucleare, Laboratori Nazionali di Legnaro, I-35020, Legnaro (Italy); Rzaca-Urban, T.; Urban, W. [Institute of Experimental Physics, University of Warsaw, PL-00-681, Warszawa (Poland); Dewald, A. [Institut fuer Kernphysik, Universitaet zu Koeln, D-50937, Koeln (Germany)

    2004-07-01

    For a level scheme investigation of {sup 144}Gd an experiment with the {gamma}-spectrometer EUROBALL III has been carried out and lifetimes have been measured with the {gamma}-spectrometer GASP using the Doppler-shift attenuation method. The high-spin states have been populated in these experiments by means of the {sup 100}Mo({sup 48}Ti,4n) reaction at 215 MeV and the {sup 114}Cd({sup 36}S,6n) reaction at E=182 MeV, respectively. The known quadrupole band has been modified and a new one has been established. Reduced E2 transition probabilities B(E2) were determined for seven members of these quadrupole bands. They show values between {approx}60 and 130 W.u. and this considerable enhancement gives evidence for a significant nuclear deformation. A ({pi}h{sub 11/2}){sup 2} x ({nu}h{sub 11/2}){sup -2} configuration may be assigned to one of the quadrupole bands according to total Routhian surface calculations. The spin dependence of the B(E2) values has been explained by IBM calculations involving high-spin quasiparticle excitations. (orig.)

  14. 143rd and 144th meetings of the Governing Board of the Pension Fund

    CERN Multimedia

    2006-01-01

    The Governing Board of the Pension Fund held its 143rd and 144th meetings on 16 May and 13 June respectively. At the first of these two meetings, the Board took note of the report by the Austrian Court of Audit on the 2005 financial year and of the associated comments by the Administration of the Fund. It also listened to a report by the Chairman of the Investment Committee on the latter's 10 May meeting, at which the two fund managers responsible for the "QUAM" and "Far East Ex-Japan" portfolios had been interviewed and their performances judged satisfactory. The Committee had also decided to commission ORTEC to carry out a full assets/liabilities modelling study during the current year. During the meeting, the Board also approved a document setting out its position on the CERN debt to the Pension Fund, which would be submitted to the Finance Committee and Council in June. It underlined that the reimbursement of the debt would be advantageous for the Fund as well as for the Laboratory and that it would re...

  15. Spatiotemporal structure of a laser beam over 144 km in a Canary Islands experiment.

    Science.gov (United States)

    Gurvich, Alexandre S; Gorbunov, Michael E; Fedorova, Olga V; Kirchengast, Gottfried; Proschek, Veronika; González Abad, Gonzalo; Tereszchuk, Keith A

    2012-10-20

    We analyzed the observations of scintillations in a laser beam (532 nm, ~200 mW power) traveling along a 144 km path at an altitude of 2.2-2.4 km above sea level, just above the atmospheric boundary layer, between the islands of La Palma and Tenerife. The observations were performed during nighttime on 18 July 2011, by means of a telescope with an aperture diameter of 1 m. Strong scintillations were observed. The estimates of spatial spectra and correlation functions indicated that the observed intensity fields possess, statistically, a locally isotropic structure, which agrees with the idea of a locally isotropic turbulence. The estimates of spatial autospectra and autocorrelation functions of the intensity field indicated that the characteristic scale of the internal structure of the observed clusters is 6.5-8 mm, while the characteristic size of the clusters is 4-5 cm. The major contribution to the observed scintillations comes from the inhomogeneities of the intensity field with scales from 1-2 cm up to 10-12 cm. The analysis of the cross-spectra indicated that the hypothesis of frozen turbulence introduced by Taylor can be used for the description of spatiotemporal structure of intensity fluctuations of laser beams traveling through long paths in the atmosphere.

  16. Fever of unknown origin in adults: evaluation of 144 cases in a non-university hospital.

    Science.gov (United States)

    Zenone, Thierry

    2006-01-01

    The spectrum of diseases found in series of fever of unknown origin shows variation in relation to selection bias; particularly, selection of the most difficult cases in tertiary reference university centres. We present a series of 144 patients presenting to a non-university hospital between 1999 and 2005 (secondary level of the health care system) with a community-acquired fever of unknown origin. In 37 cases (25.7%), the reason for fever could not be explained. Among the 107 patients with a final diagnosis (74.3%), non-infectious inflammatory disorders represented the most prevalent category (35.5%), surpassing infections (30.8%), miscellaneous causes (20.6%) and malignancies (13.5%). 13 entities accounted for over 68% of diagnoses (sinusitis and occult dental infections, Q fever, Epstein-Barr virus and cytomegalovirus infections, lymphoma, colo-rectal adenocarcinoma, adult-onset Still disease, systemic lupus erythematosus, giant cell arteritis and/or polymyalgia rheumatica, rheumatoid arthritis, polyarteritis nodosa, factitious fever and habitual hyperthermia). As demonstrated in other studies, non-infectious inflammatory diseases emerge as the most prevalent diagnostic category. Giant cell arteritis and polymyalgia rheumatica were particularly frequent in the elderly. Epstein-Barr virus and cytomegalovirus infections and habitual hyperthermia were particularly frequent in the youngest patients. There were no major differences in repartition of diagnostic categories between this series and historical university series.

  17. The high-affinity peptidoglycan binding domain of Pseudomonas phage endolysin KZ144

    Energy Technology Data Exchange (ETDEWEB)

    Briers, Yves [Division of Gene Technology, Department of Biosystems, Katholieke Universiteit Leuven, Kasteelpark Arenberg 21, B-3001 Leuven (Belgium); Schmelcher, Mathias; Loessner, Martin J. [Institute of Food Science and Nutrition, ETH Zuerich, Schmelzbergstrasse 7, CH-8092 Zuerich (Switzerland); Hendrix, Jelle; Engelborghs, Yves [Laboratory of Biomolecular Dynamics, Department of Chemistry, Katholieke Universiteit Leuven, Celestijnenlaan 200G, B-3001 Leuven (Belgium); Volckaert, Guido [Division of Gene Technology, Department of Biosystems, Katholieke Universiteit Leuven, Kasteelpark Arenberg 21, B-3001 Leuven (Belgium); Lavigne, Rob, E-mail: rob.lavigne@biw.kuleuven.be [Division of Gene Technology, Department of Biosystems, Katholieke Universiteit Leuven, Kasteelpark Arenberg 21, B-3001 Leuven (Belgium)

    2009-05-29

    The binding affinity of the N-terminal peptidoglycan binding domain of endolysin KZ144 (PBD{sub KZ}), originating from Pseudomonas aeruginosa bacteriophage {phi}KZ, has been examined using a fusion protein of PBD{sub KZ} and green fluorescent protein (PBD{sub KZ}-GFP). A fluorescence recovery after photobleaching analysis of bound PBD{sub KZ}-GFP molecules showed less than 10% fluorescence recovery in the bleached area within 15 min. Surface plasmon resonance analysis confirmed this apparent high binding affinity revealing an equilibrium affinity constant of 2.95 x 10{sup 7} M{sup -1} for the PBD{sub KZ}-peptidoglycan interaction. This unique domain, which binds to the peptidoglycan of all tested Gram-negative species, was harnessed to improve the specific activity of the peptidoglycan hydrolase domain KMV36C. The chimeric peptidoglycan hydrolase (PBD{sub KZ}-KMV36C) exhibits a threefold higher specific activity than the native catalytic domain (KMV36C). These results demonstrate that the modular assembly of functional domains is a rational approach to improve the specific activity of endolysins from phages infecting Gram-negatives.

  18. Stereotypical hand movements in 144 subjects with Rett syndrome from the population-based Australian database.

    Science.gov (United States)

    Carter, Philippa; Downs, Jenny; Bebbington, Ami; Williams, Simon; Jacoby, Peter; Kaufmann, Walter E; Leonard, Helen

    2010-02-15

    Stereotypic hand movements are a feature of Rett Syndrome but few studies have observed their nature systematically. Video data in familiar settings were obtained on subjects (n = 144) identified from an Australian population-based database. Hand stereotypies were demonstrated by most subjects (94.4%), 15 categories were observed and midline wringing was seen in approximately 60% of subjects. There was a median of two stereotypies per subject but this number decreased with age. Clapping and mouthing of hands were more prevalent in girls younger than 8 years and wringing was more prevalent in women 19 years or older. Clapping was commoner in those with p.R306C and early truncating mutations, and much rarer in those with p.R106W, p.R270X, p.R168X, and p.R255X. Stereotypies tended to be less frequent in those with more severe mutations. Otherwise, there were no clear relationships between our categories of stereotypies and mutation. Approximately a quarter each had predominantly right and left handed stereotypies and for the remaining half, no clear laterality was seen. Results were similar for all cases and when restricted to those with a pathogenic mutation. Hand stereotypies changed with increasing age but limited relationships with MECP2 mutations were identified. (c) 2009 Movement Disorder Society.

  19. Greenhouse gas measurements over a 144 km open path in the Canary Islands

    Directory of Open Access Journals (Sweden)

    J. S. A. Brooke

    2012-09-01

    Full Text Available A new technique for the satellite remote sensing of greenhouse gases in the atmosphere via the absorption of short-wave infrared laser signals transmitted between counter-rotating satellites in low Earth orbit has recently been proposed; this would enable the acquisition of a long-term, stable, global set of altitude-resolved concentration measurements. We present the first ground-based experimental demonstration of this new infrared-laser occultation method, in which the atmospheric absorption of CO2 near 2.1 μm was measured over a ~144 km path length between two peaks in the Canary Islands (at an altitude of ~2.4 km, using relatively low power diode lasers (~4 to 10 mW. The retrieved CO2 volume mixing ratio of 400 ppm (±15 ppm is consistent within experimental uncertainty with simultaneously recorded in situ validation measurements. We conclude that the new method has a sound basis for monitoring CO2 in the free atmosphere; other greenhouse gases such as methane, nitrous oxide and water vapour can be monitored in the same way.

  20. Identification of a novel homozygous mutation (S144I) in a Malay patient with maple syrup urine disease.

    Science.gov (United States)

    Ali, Ernie Zuraida; Yunus, Zabedah Md; Desa, Norsiah Md; Hock, Ngu Lock

    2013-01-01

    Maple syrup urine disease (MSUD) is a rare autosomal recessive metabolic disorder of branched-chain amino acid metabolism caused by the defective function of branched-chain α-ketoacid dehydrogenase complex (BCKDH). It is characterised by increased plasma leucine, isoleucine, and valine levels, and mutations can be detected in any one of the BCKDHA, BCKDHB, and DBT genes. In this study, we describe the molecular basis of a novel mutation found in one MSUD Malay patient from consanguineous parents. A homozygous mutation has been detected in this patient whose both parents carried a heterozygous mutation at DNA coding region c.431G>T in exon 4, which resulted in a substitution of serine to isoleucine at codon 144 (p.S144I). In silico analysis predicted S144I to be potentially damaging. The mutation was located on the alpha helical region of the BCKDHA protein, and it is predicted to affect the stability of protein due to the loss of various polar interactions between local secondary structures. Homology analysis revealed that this mutation occurred in a highly conserved region (100%). This result indicates that S144I mutation is likely pathogenic and may contribute to the classic form of MSUD in this patient.

  1. The potential impact of RV144-like vaccines in rural South Africa: a study using the STDSIM microsimulation model.

    NARCIS (Netherlands)

    Hontelez, J.A.; Nagelkerke, N.; Barnighausen, T.; Bakker, R.; Tanser, F.; Newell, M.L.; Lurie, M.N.; Baltussen, R.M.P.M.; Vlas, S.J. de

    2011-01-01

    BACKGROUND: The only successful HIV vaccine trial to date is the RV144 trial of the ALVAC/AIDSVAX vaccine in Thailand, which showed an overall incidence reduction of 31%. Most cases were prevented in the first year, suggesting a rapidly waning efficacy. Here, we predict the population level impact

  2. Met144Ala mutation of the copper-containing nitrite reductase from Alcaligenes xylosoxidans reverses the intramolecular electron transfer

    DEFF Research Database (Denmark)

    Farver, Ole; Eady, Robert R; Sawers, Gary

    2004-01-01

    Pulse radiolysis has been employed to investigate the intramolecular electron transfer (ET) between the type 1 (T1) and type 2 (T2) copper sites in the Met144Ala Alcaligenes xylosoxidans nitrite reductase (AxCuNiR) mutant. This mutation increases the reduction potential of the T1 copper center...

  3. Cosmic-ray history derived from the {sup 54}Mn, {sup 56}Ni and {sup 144}Pm chronometers

    Energy Technology Data Exchange (ETDEWEB)

    Zaerpoor, K.; Chan, Y.D.; DiGregorio, D.E.; Dragowsky, M.R.; Hindi, M.M.; Isaac, M.C.P.; Krane, K.S.; Larimer, R.-M.; Macchiavelli, A.O.; Macleod, R. W.; Miocinovic, P.; Norman, E.B.; Robinson, S.J

    1999-07-26

    Sources of {sup 54}Mn, {sup 56}Ni, and {sup 144}Pm were placed at the center of the Gammasphere array and searches were made for the astrophysically interesting {beta}{sup +} decay modes of these isotopes. The results of these searches are presented and the implications for cosmic-ray physics are discussed.

  4. Human cytomegalovirus UL55, UL144, and US28 genotype distribution in infants infected congenitally or postnatally.

    Science.gov (United States)

    Paradowska, Edyta; Studzińska, Mirosława; Suski, Patrycja; Kasztelewicz, Beata; Wiśniewska-Ligier, Małgorzata; Zawilińska, Barbara; Gaj, Zuzanna; Nowakowska, Dorota

    2015-10-01

    Cytomegalovirus (CMV) is the most common cause of congenital infection. This pathogen exhibits extensive genetic variability in the genes that encode structural envelope glycoproteins, regulatory proteins, and proteins that contribute to immune evasion. However, the role of specific viral strains in the outcome of congenital CMV infection is unclear. Variation in the UL55 gene encoding glycoprotein B (gB), the UL144 gene encoding TNF α-like receptor, and the US28 gene encoding β-chemokine receptor was determined in 60 newborn infants with congenital CMV infection and 90 infants with postnatal or undefined CMV infection. CMV polymorphisms were studied in relation to disease outcome and viral load. Genotyping was performed by a sequencing analysis of PCR-amplified fragments, and the viral load was measured by quantitative real-time PCR. The results demonstrated that (1) the UL55 and US28 genotype distributions were similar among the group of congenital and postnatal CMV infection; (2) the UL144 B1 genotype was more prevalent in congenital than in postnatal infection and was detected in 70% of newborns with asymptomatic congenital infection; and (3) none of the examined genotype was significantly linked with symptomatic CMV infection. No relationship was observed between genotype and viral load. The results revealed that UL55, UL144, and US28 polymorphisms are not associated with the outcome of CMV infection in infants, but the presence of UL144 B1 genotype might be virological marker of asymptomatic infection at birth. © 2015 Wiley Periodicals, Inc.

  5. Trueperella pyogenes multispecies infections in domestic animals: a retrospective study of 144 cases (2002 to 2012).

    Science.gov (United States)

    Ribeiro, M G; Risseti, R M; Bolaños, C A D; Caffaro, K A; de Morais, A C B; Lara, G H B; Zamprogna, T O; Paes, A C; Listoni, F J P; Franco, M M J

    2015-06-01

    Formerly, Arcanobacterium pyogenes was recently renamed Trueperella pyogenes. This opportunistic bacterium is related to miscellaneous pyogenic infections in animals. Most studies involving T. pyogenes are case reports, whereas few surveys have focused the major aspects of T. pyogenes infections involving a case series study design. The aim of this study was to retrospectively evaluate selected epidemiological and clinical aspects, as well as the in vitro antimicrobial susceptibility pattern of 144 cases of T. pyogenes infections among domestic animals from 2002 to 2012. T. pyogenes was isolated from different clinical specimens from cattle, goats, sheep, pigs, horses, dogs, and buffaloes. Correlations were assessed by the Chi-square or Fisher's exact tests. Mastitis (45.1%), abscesses (18.0%), pneumonia (11.1%), and lymphadenitis (9.0%) were the most common clinical manifestations. In addition, the organism was also isolated from other miscellaneous clinical specimens from cases of septicemia, encephalitis, pyometra, prostatitis, orchitis, seminal vesiculitis, pericarditis, and omphalitis. No statistical association was observed between T. pyogenes infections and age, gender, or season across the study. The most effective drugs against the pathogen were florfenicol (99.1%), cefoperazone (96.0%), cephalexin (95.0%), and ceftiofur (94.8%). High resistance rates were observed against trimethoprim-sulfamethoxazole (49.3%), followed by norfloxacin (10.9%) and tetracycline (9.2%). This study highlights the diversity of clinical manifestations and the opportunistic behavior of T. pyogenes infections in domestic animals, with predominance of mastitis, abscesses, pneumonia, and lymphadenitis. It also reinforces the importance of knowing the susceptibility profile before initiating therapy, to improve antimicrobial therapy approaches.

  6. Insight into 144 patients with ocular vascular events during VEGF antagonist injections

    Directory of Open Access Journals (Sweden)

    Shami M

    2012-03-01

    Full Text Available Ahmad M Mansour1, Maha Shahin2, Peter K Kofoed3, Maurizio B Parodi4, Michel Shami5, Stephen G Schwartz6, Collaborative Anti-VEGF Ocular Vascular Complications GroupDepartment of Ophthalmology, 1American University of Beirut, Beirut, Lebanon, Rafic Hariri University Hospital, Beirut, Lebanon; 2Mansoura University, Mansoura City, Egypt; 3Glostrup Hospital, University of Copenhagen, Denmark, National Eye Clinic, Kennedy Center, Glostrup, Denmark; 4University Vita-Salute, Scientific Institute San Raffaele, Milan, Italy; 5Texas Tech University Health Sciences Center, Lubbock, TX, USA; 6Bascom Palmer Eye Institute, University of Miami Miller School of Medicine, Naples and Miami, FL, USAAim: To record ocular vascular events following injections of vascular endothelium growth factor (VEGF antagonists.Methods: Collaborative multicenter case series (48 cases, literature reviews (32 cases, and reports to the FDA (64 cases of patients that had vascular occlusions during anti-VEGF therapy were collected and analyzed.Results: A total of 144 cases of ocular vascular events were identified, with these diagnosed a median of 15 days after anti-VEGF injection. The majority of patients had pre-existing risk factors for cardiovascular events and nine patients had a prior history of glaucoma. Mean visual acuity dropped by 6.4 lines with severe visual loss after injection to NLP (five eyes, LP (six eyes, and HM (two eyes. The overall risk of ocular vascular events following a VEGF antagonist injection was 0.108% in the general population and 2.61% in the diabetic population. Mean retinal arterial constriction after intravitreal bevacizumab in 13 eyes was 21% (standard deviation = 27%, and mean retinal venous constriction was 8% (standard deviation = 30%.Conclusion: Ocular vascular events are rare during anti-VEGF therapy, but can lead to severe visual loss and may be caused by a number of factors including the vasoconstrictor effect of the drug, a post-injection rise

  7. Kolejność obowiązku alimentacyjnego z art. 144 kodeksu rodzinnego i opiekuńczego

    OpenAIRE

    Szlęzak, Andrzej

    1982-01-01

    The problem of alimentary duties between step-parents and step-children has often been referred to in the works of legal writers. However, the question of the sequence of the said duties has not been satisfactorily explained. The authors, despite the wording of sec. 144, are unanimous that it should be determined with regardless of the principles of social coexistence. In the present paper, the author undertakes the task of proving that the adoption of the said principles in...

  8. 29 CFR 780.144 - “As an incident to or in conjunction with” the farming operations.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false âAs an incident to or in conjunction withâ the farming... in Conjunction Withâ the Farming Operations § 780.144 “As an incident to or in conjunction with” the farming operations. In order for practices other than actual farming operations to constitute “agriculture...

  9. Retrospective evaluation of bone pain palliation after samarium-153-EDTMP therapy Avaliação retrospectiva do tratamento da dor óssea metastática com Samário-153-EDTMP

    Directory of Open Access Journals (Sweden)

    Marcelo Tatit Sapienza

    2004-01-01

    Full Text Available PURPOSE: The aim of this study was to evaluate the degree of metastatic bone pain palliation and medullar toxicity associated with samarium-153-EDTMP treatment. METHODS: Seventy-three patients with metastatic bone pain having previously undergone therapy with samarium-153-EDTMP (1 mCi/kg were retrospectively evaluated. Routine follow-up included pain evaluation and blood counts for 2 months after treatment. Pain was evaluated using a subjective scale (from 0 to 10 before and for 8 weeks after the treatment. Blood counts were obtained before treatment and once a week for 2 months during follow-up. Dosimetry, based upon the urinary excretion of the isotope, was estimated in 41 individuals, and the resulting radiation absorbed doses were correlated with hematological data. RESULTS: Reduction in pain scores of 75% to 100% was obtained in 36 patients (49%, with a decrease of 50% to 75%, 25% to 50%, and 0% to 25% in, respectively, 20 (27%, 10 (14%, and 7 (10% patients. There was no significant relationship between the pain response and location of the primary tumor (breast or prostate cancer. Mild to moderate myelosuppression was noted in 75.3% of patients, usually with hematological recovery at 8 weeks. The mean bone marrow dose was 347 ± 65 cGy, and only a weak correlation was found between absorbed dose and myelosuppression (Pearson coefficient = .4. CONCLUSIONS: Samarium-153-EDTMP is a valuable method for metastatic bone pain palliation. A mild to moderate and transitory myelosuppression is the main toxicity observed after samarium therapy, showing a weak correlation with dosimetric measures.OBJETIVO: O presente trabalho teve por objetivo avaliar o efeito paliativo da dor e a toxicidade medular associados ao tratamento com Samário-153-EDTMP em pacientes com metástases ósseas. MÉTODOS: O estudo foi realizado de forma retrospectiva, a partir do levantamento de prontuário de 178 pacientes submetidos a tratamento com 1mCi/kg de 153Sm

  10. The dynamics of the laser-induced metal-semiconductor phase transition of samarium sulfide (SmS); Die Dynamik des laserinduzierten Metall-Halbleiter-Phasenuebergangs von Samariumsulfid (SmS)

    Energy Technology Data Exchange (ETDEWEB)

    Kaempfer, Tino

    2009-12-15

    The present thesis is dedicated to the experimental study of the metal-semiconductor phase transition of samarium sulfide (SmS): Temperature- and time-resolved experiments on the characterization of the phase transition of mixed-valence SmS samples (M-SmS) are presented. The measurement of the dynamics of the laser-induced phase transition pursues via time-resolved ultrashort-time microscopy and by X-ray diffraction with sub-picosecond time resolution. The electronic and structural processes, which follow an excitation of M-SmS with infrared femtosecond laser pulses, are physically interpreted on the base of the results obtained in this thesis and model imaginations. [German] Die vorliegende Arbeit ist der experimentellen Untersuchung des Metall-Halbleiter-Phasenuebergangs von Samariumsulfid (SmS) gewidmet. Es werden temperatur- und zeitaufgeloeste Experimente zur Charakterisierung des Phasenuebergangs gemischt-valenter SmS Proben (M-SmS) vorgestellt. Die Messung der Dynamik des laserinduzierten Phasenuebergangs erfolgt ueber zeitaufgeloeste Ultrakurzzeit-Mikroskopie und durch Roentgenbeugung mit subpikosekunden Zeitaufloesung. Die elektronischen und strukturellen Prozesse, welche einer Anregung von M-SmS mit infraroten Femtosekunden-Laserpulsen folgen, werden auf der Basis der in dieser Arbeit gewonnenen Ergebnisse und Modellvorstellungen physikalisch interpretiert. (orig.)

  11. Effects of the dimeric PSD-95 inhibitor UCCB01-144 in mouse models of pain, cognition and motor function

    DEFF Research Database (Denmark)

    Andreasen, Jesper T; Nasser, Arafat; Caballero-Puntiverio, Maitane

    2016-01-01

    NMDAR antagonism shows analgesic action in humans and animal pain models, but disrupts cognitive and motor functions. NMDAR-dependent NO production requires tethering of the NMDAR to neuronal NO synthase (nNOS) by the postsynaptic density protein-95 (PSD-95). Perturbing the NMDAR/PSD-95/nNOS inte...... in the STFP test. Collectively, UCCB01-144 reversed both CFA and SNI-induced hypersensitivity, but the efficacy in the SNI model was only transient. This suggests that enhanced BBB permeability of PSD-95 inhibitors improves the analgesic action in neuropathic pain states.......NOS interaction has therefore been proposed as an alternative analgesic mechanism. We recently reported that UCCB01-125, a dimeric PSD-95 inhibitor with limited blood-brain-barrier permeability, reduced mechanical hypersensitivity in the complete Freund's adjuvant (CFA) inflammatory pain model, without disrupting...... of neuropathic pain. Potential cognitive effects of UCCB01-144 were examined using the social transmission of food preference (STFP) test and the V-maze test, and motor coordination was assessed with the rotarod test. UCCB01-144 (10mg/kg) reversed CFA-induced mechanical hypersensitivity after 1h, and completely...

  12. Antiproton Target

    CERN Multimedia

    1980-01-01

    Antiproton target used for the AA (antiproton accumulator). The first type of antiproton production target used from 1980 to 1982 comprised a rod of copper 3mm diameter and 120mm long embedded in a graphite cylinder that was itself pressed into a finned aluminium container. This assembly was air-cooled and it was used in conjunction with the Van der Meer magnetic horn. In 1983 Fermilab provided us with lithium lenses to replace the horn with a view to increasing the antiproton yield by about 30%. These lenses needed a much shorter target made of heavy metal - iridium was chosen for this purpose. The 50 mm iridium rod was housed in an extension to the original finned target container so that it could be brought very close to the entrance to the lithium lens. Picture 1 shows this target assembly and Picture 2 shows it mounted together with the lithium lens. These target containers had a short lifetime due to a combination of beam heating and radiation damage. This led to the design of the water-cooled target in...

  13. Metabolic Profile of Synthetic Cannabinoids 5F-PB-22, PB-22, XLR-11 and UR-144 by Cunninghamella elegans.

    Science.gov (United States)

    Watanabe, Shimpei; Kuzhiumparambil, Unnikrishnan; Nguyen, My Ann; Cameron, Jane; Fu, Shanlin

    2017-07-01

    The knowledge of metabolic profile of synthetic cannabinoids is important for the detection of drugs in urinalysis due to the typical absence or low abundance of parent cannabinoids in human urine. The fungus Cunninghamella elegans has been reported to be a useful tool for metabolism study and thus applicability to synthetic cannabinoid metabolism was examined. In this study, 8-quinolinyl 1-(5-fluoropentyl)-1H-indole-3-carboxylate (5F-PB-22), 8-quinolinyl 1-pentyl-1H-indole-3-carboxylate (PB-22), [1-(5-fluoropentyl)-1H-indol-3-yl](2,2,3,3-tetramethylcyclopropyl)methanone (XLR-11) and (1-pentyl-1H-indol-3-yl)(2,2,3,3-tetramethylcyclopropyl)methanone (UR-144) were incubated with C. elegans and the metabolites were identified using liquid chromatography-quadrupole time-of-flight mass spectrometry. The obtained metabolites were compared with reported human metabolites to assess the suitability of the fungus to extrapolate human metabolism. 5F-PB-22 underwent dihydroxylation, dihydrodiol formation, oxidative defluorination, oxidative defluorination to carboxylic acid, ester hydrolysis and glucosidation, alone and/or in combination. The metabolites of PB-22 were generated by hydroxylation, dihydroxylation, trihydroxylation, dihydrodiol formation, ketone formation, carboxylation, ester hydrolysis and glucosidation, alone and/or in combination. XLR-11 was transformed through hydroxylation, dihydroxylation, aldehyde formation, carboxylation, oxidative defluorination, oxidative defluorination to carboxylic acid and glucosidation, alone and/or in combination. UR-144 was metabolised by hydroxylation, dihydroxylation, trihydroxylation, aldehyde formation, ketone formation, carboxylation, N-dealkylation and combinations. These findings were consistent with previously reported human metabolism except for the small extent of ester hydrolysis observed and the absence of glucuronidation. Despite the limitations, C. elegans demonstrated the capacity to produce a wide variety of

  14. MicroRNA-144 regulates hepatic ATP binding cassette transporter A1 and plasma high-density lipoprotein after activation of the nuclear receptor farnesoid X receptor.

    Science.gov (United States)

    de Aguiar Vallim, Thomas Q; Tarling, Elizabeth J; Kim, Tammy; Civelek, Mete; Baldán, Ángel; Esau, Christine; Edwards, Peter A

    2013-06-07

    The bile acid receptor farnesoid X receptor (FXR) regulates many aspects of lipid metabolism by variouscomplex and incompletely understood molecular mechanisms. We set out to investigate the molecular mechanisms for FXR-dependent regulation of lipid and lipoprotein metabolism. To identify FXR-regulated microRNAs that were subsequently involved in regulating lipid metabolism. ATP binding cassette transporter A1 (ABCA1) is a major determinant of plasma high-density lipoprotein (HDL)-cholesterol levels. Here, we show that activation of the nuclear receptor FXR in vivo increases hepatic levels of miR-144, which in turn lowers hepatic ABCA1 and plasma HDL levels. We identified 2 complementary sequences to miR-144 in the 3' untranslated region of ABCA1 mRNA that are necessary for miR-144-dependent regulation. Overexpression of miR-144 in vitro decreased both cellular ABCA1 protein and cholesterol efflux to lipid-poor apolipoprotein A-I protein, whereas overexpression in vivo reduced hepatic ABCA1 protein and plasma HDL-cholesterol. Conversely, silencing miR-144 in mice increased hepatic ABCA1 protein and HDL-cholesterol. In addition, we used tissue-specific FXR-deficient mice to show that induction of miR-144 and FXR-dependent hypolipidemia requires hepatic, but not intestinal, FXR. Finally, we identified functional FXR response elements upstream of the miR-144 locus, consistent with direct FXR regulation. We have identified a novel pathway involving FXR, miR-144, and ABCA1 that together regulate plasma HDL-cholesterol.

  15. Preliminary evaluation of neutron capture cross sections for /sup 144/Sm, /sup 145/Sm and /sup 145/Pm

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, D.G.; Gardner, M.A.

    1986-02-13

    We have made preliminary neutron-capture cross-section calculations of the Hauser-Feshbach type for the isotopes /sup 144/Sm, /sup 145/Sm, and /sup 145/Pm to investigate the production of radioactive /sup 145/Pm by neutron capture on the stable isotope /sup 144/Sm. The calculations were made for incident neutron energies from 2.5 MeV to about 1/sup -4/ or 10/sup -5/ MeV, wherever the first unbound resonance was estimated to occur in each case. At that energy, the calculated value was reduced by a somewhat arbitrary factor, and the excitation function extended down to thermal energy using a (E/sub n/)/sup -1/2/ energy dependence. Since very large uncertainties are associated with the position and magnitude of the first unbound resonance and the subsequent extrapolation back to thermal energy, the cross sections in this low-energy region should not be considered more accurate than +- a factor of 10. For incident neutron energies above each step, the calculations represent an average through the separated and overlapping resonance regions and may be accurate to better than +- a factor of 2. 18 refs., 7 figs., 5 tabs.

  16. Targeted Learning

    CERN Document Server

    van der Laan, Mark J

    2011-01-01

    The statistics profession is at a unique point in history. The need for valid statistical tools is greater than ever; data sets are massive, often measuring hundreds of thousands of measurements for a single subject. The field is ready to move towards clear objective benchmarks under which tools can be evaluated. Targeted learning allows (1) the full generalization and utilization of cross-validation as an estimator selection tool so that the subjective choices made by humans are now made by the machine, and (2) targeting the fitting of the probability distribution of the data toward the targe

  17. X-ray emission from Au-Sm alloy target irradiated with high power sub nanosecond laser

    Science.gov (United States)

    Chaurasia, S.; Munda, D. S.; Tripathi, S.; Kumar, M.; Gupta, N. K.; Dhareshwar, L. J.; Bajaj, P. N.

    2010-02-01

    The hohlraum cavity is generally made out of gold (Au) and recently it has been shown that laser-target coupling efficiency can be increased by using cocktail or mixed targets such as gold-samarium (Au-Sm). We report here results of experiments performed on Au-Sm alloy in various spectral regions for various compositions. In these experiments, a 12 Joule/500ps Nd:glass laser has been used. It is observed that the soft x-ray emission in the spectral region 0.7 -1.56 keV is enhanced by about 40-50% by using a composition of Au:Sm:: 3:7 as compared to pure Au .However, in case of hard x-ray emission (3.2 -5 keV), there is a reduction in x-ray emission from Au-Sm target as compared to pure gold. This behaviour, that enhancement occurs in soft x-rays in the case of mixed Au-Sm targets is desirable in the ICF scheme.

  18. Mechanical 144 GHz beam steering with all-metallic epsilon-near-zero lens antenna

    Energy Technology Data Exchange (ETDEWEB)

    Pacheco-Peña, V., E-mail: victor.pacheco@unavarra.es; Torres, V., E-mail: victor.torres@unavarra.es; Orazbayev, B., E-mail: b.orazbayev@unavarra.es; Beruete, M., E-mail: miguel.beruete@unavarra.es; Sorolla, M. [Antennas Group-TERALAB, Universidad Pública de Navarra, Campus Arrosadía, 31006 Pamplona (Spain); Navarro-Cía, M., E-mail: m.navarro@imperial.ac.uk [Optical and Semiconductor Devices Group, Department of Electrical and Electronic Engineering, Imperial College London, London SW7 2BT (United Kingdom); Centre for Plasmonics and Metamaterials, Imperial College London, London SW7 2AZ (United Kingdom); Centre for Terahertz Science and Engineering, Imperial College London, London SW7 2AZ (United Kingdom); Engheta, N., E-mail: engheta@ee.upenn.edu [Department of Electrical and Systems Engineering, University of Pennsylvania, Philadelphia, Pennsylvania 19104 (United States)

    2014-12-15

    An all-metallic steerable beam antenna composed of an ε-near-zero (ENZ) metamaterial lens is experimentally demonstrated at 144 GHz (λ{sub 0} = 2.083 mm). The ENZ lens is realized by an array of narrow hollow rectangular waveguides working just near and above the cut-off of the TE{sub 10} mode. The lens focal arc on the xz-plane is initially estimated analytically as well as numerically and compared with experimental results demonstrating good agreement. Next, a flange-ended WR-6.5 waveguide is placed along the lens focal arc to evaluate the ENZ-lens antenna steerability. A gain scan loss below 3 dB is achieved for angles up to ±15°.

  19. N-terminal Prion Protein Peptides (PrP(120-144)) Form Parallel In-register β-Sheets via Multiple Nucleation-dependent Pathways.

    Science.gov (United States)

    Wang, Yiming; Shao, Qing; Hall, Carol K

    2016-10-14

    The prion diseases are a family of fatal neurodegenerative diseases associated with the misfolding and accumulation of normal prion protein (PrP(C)) into its pathogenic scrapie form (PrP(Sc)). Understanding the fundamentals of prion protein aggregation and the molecular architecture of PrP(Sc) is key to unraveling the pathology of prion diseases. Our work investigates the early-stage aggregation of three prion protein peptides, corresponding to residues 120-144 of human (Hu), bank vole (BV), and Syrian hamster (SHa) prion protein, from disordered monomers to β-sheet-rich fibrillar structures. Using 12 μs discontinuous molecular dynamics simulations combined with the PRIME20 force field, we find that the Hu-, BV-, and SHaPrP(120-144) aggregate via multiple nucleation-dependent pathways to form U-shaped, S-shaped, and Ω-shaped protofilaments. The S-shaped HuPrP(120-144) protofilament is similar to the amyloid core structure of HuPrP(112-141) predicted by Zweckstetter. HuPrP(120-144) has a shorter aggregation lag phase than BVPrP(120-144) followed by SHaPrP(120-144), consistent with experimental findings. Two amino acid substitutions I138M and I139M retard the formation of parallel in-register β-sheet dimers during the nucleation stage by increasing side chain-side chain association and reducing side chain interaction specificity. On average, HuPrP(120-144) aggregates contain more parallel β-sheet content than those formed by BV- and SHaPrP(120-144). Deletion of the C-terminal residues 138-144 prevents formation of fibrillar structures in agreement with the experiment. This work sheds light on the amyloid core structures underlying prion strains and how I138M, I139M, and S143N affect prion protein aggregation kinetics. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Transformation of Au144(SCH2CH2Ph)60 to Au133(SPh-tBu)52 Nanomolecules: Theoretical and Experimental Study.

    Science.gov (United States)

    Nimmala, Praneeth Reddy; Theivendran, Shevanuja; Barcaro, Giovanni; Sementa, Luca; Kumara, Chanaka; Jupally, Vijay Reddy; Apra, Edoardo; Stener, Mauro; Fortunelli, Alessandro; Dass, Amala

    2015-06-04

    Ultrastable gold nanomolecule Au144(SCH2CH2Ph)60 upon etching with excess tert-butylbenzenethiol undergoes a core-size conversion and compositional change to form an entirely new core of Au133(SPh-tBu)52. This conversion was studied using high-resolution electrospray mass spectrometry which shows that the core size conversion is initiated after 22 ligand exchanges, suggesting a relatively high stability of the Au144(SCH2CH2Ph)38(SPh-tBu)22 intermediate. The Au144 → Au133 core size conversion is surprisingly different from the Au144 → Au99 core conversion reported in the case of thiophenol, -SPh. Theoretical analysis and ab initio molecular dynamics simulations show that rigid p-tBu groups play a crucial role by reducing the cluster structural freedom, and protecting the cluster from adsorption of exogenous and reactive species, thus rationalizing the kinetic factors that stabilize the Au133 core size. This 144-atom to 133-atom nanomolecule's compositional change is reflected in optical spectroscopy and electrochemistry.

  1. Cirurgia de revascularização do miocárdio no idoso: estudo descritivo de 144 casos Revascularization surgery of the myocardium in the elderly patients: descriptive study in 144 patients

    Directory of Open Access Journals (Sweden)

    Maurílio Onofre DEININGER

    1999-04-01

    Full Text Available Realizamos análise retrospectiva de todos os pacientes com idade igual ou superior a 70 anos, submetidos à operação de revascularização do miocárdio isolada, no período de janeiro de 1992 a dezembro de 1997, objetivando avaliar a morbimortalidade. Do total de 144 pacientes, 92 (63,9% eram do sexo masculino, idade entre 70 e 84 anos, média de 73,51 anos e desvio padrão de 2,82. A grande maioria encontrava-se com angina classe funcional III ou IV (79,16%. Tiveram relação com a ocorrência de maior mortalidade, a presença no período pré-operatório de: obesidade (p = 0,004, insuficiência cardíaca congestiva (classe III/IV - p = 0,03 e/ou infarto agudo do miocárdio (A retrospective analysis involving seventy-year-old patients as well as those over seventy who have undergone CABG as a single procedure, during Jannuary 1992 to December 1997, was carried out with the purpose of assessing their morbidity with mortality. Of the 144 patients, 92 (63.9% were males, aged 70 to 84 (average age 73.51 and standard deviation 2.82. Most of those, 114 (79.16%, suffered from angina belonging to the functional class III or IV. The occurrence in the pre-operative period of obesity (p = 0.004, heart failure (III/IV class - p = 0.03 and/or acute myocardial infection (less than 21 days - p = 0.01 demonstrated a definite relationship with mortality. There were 120 (83.34% patients with lesions in three or more vessels (average 3.48 anastomoses/patients.The pediculate internal mammary artery was employed in 126 patients (87.5% and that rate increased to 98.9% in the last two years. The main complications in the post-operation period leading to death were either infections (p < 0.0001, prolonged ventilatory support (p < 0.0001, renal failure with dialysis (p < 0.0001 and/or low cardiac output (p = 0.003. As to statistical analysis the Student T test, the Chi-square test and Fisher's exact test were used. Surgical mortality totalling 5.5% (8/144 in the

  2. Development of a computational model applied to a unitary 144 cm{sup 2} proton exchange membrane fuel cell; Desenvolvimento de um modelo numerico computacional aplicado a uma celula a combustivel unitaria de 144 CM{sup 2} tipo PEM

    Energy Technology Data Exchange (ETDEWEB)

    Robalinho, Eric

    2009-07-01

    This work presents the development of a numerical computer model and methodology to study and design polymeric exchange membrane fuel cell - PEM. For the validation of experimental results, a sequence of routines, appropriate to fit the data obtained in the laboratory, was described. At the computational implementation it was created a new strategy of coupling two 3-dimensional models to satisfy the requirements of the comprehensive model of the fuel cell, including its various geometries and materials, as well as the various physical and chemical processes simulated. To effective assessment of the real cell analogy with numerical model, numerical studies were carried out. Comparisons with values obtained in the literature, characterization of variables through laboratory experiments and estimates from models already tested in the literature were also performed. Regarding the experimental part, a prototype of a fuel cell unit of 144 cm of geometric area was designed, produced and operated at laboratory with the purpose of validating the numerical computer model proposed, with positive results. The results of simulations for the 2D and 3D geometries proposed are presented in the form of polarization curves, highlighting the catalytic layer model based on the geometry of agglomerates. Parametric and sensitivity studies are presented to illustrate the change in performance of the fuel cell studied. The final model is robust and useful as a tool for design and optimization of PEM type fuel cells in a wide range of operating conditions. (author)

  3. Development of a computational model applied to a unitary 144 CM{sup 2} proton exchange membrane fuel cell; Desenvolvimento de um modelo numerico computacional aplicado a uma celula a combustivel unitaria de 144 CM{sup 2} tipo PEM

    Energy Technology Data Exchange (ETDEWEB)

    Robalinho, Eric

    2009-07-01

    This work presents the development of a numerical computer model and methodology to study and design polymeric exchange membrane fuel cell - PEM. For the validation of experimental results, a sequence of routines, appropriate to fit the data obtained in the laboratory, was described. At the computational implementation it was created a new strategy of coupling two 3-dimensional models to satisfy the requirements of the comprehensive model of the fuel cell, including its various geometries and materials, as well as the various physical and chemical processes simulated. To effective assessment of the real cell analogy with numerical model, numerical studies were carried out. Comparisons with values obtained in the literature, characterization of variables through laboratory experiments and estimates from models already tested in the literature were also performed. Regarding the experimental part, a prototype of a fuel cell unit of 144 cm{sup 2} of geometric area was designed, produced and operated at laboratory with the purpose of validating the numerical computer model proposed, with positive results. The results of simulations for the 2D and 3D geometries proposed are presented in the form of polarization curves, highlighting the catalytic layer model based on the geometry of agglomerates. Parametric and sensitivity studies are presented to illustrate the change in performance of the fuel cell studied. The final model is robust and useful as a tool for design and optimization of PEM type fuel cells in a wide range of operating conditions. (author)

  4. Ligand-modulated interactions between charged monolayer-protected Au144(SR)60 gold nanoparticles in physiological saline.

    Science.gov (United States)

    Villarreal, Oscar D; Chen, Liao Y; Whetten, Robert L; Yacaman, Miguel J

    2015-02-07

    In order to determine how functionalized gold nanoparticles (AuNPs) interact in a near-physiological environment, we performed all-atom molecular dynamics simulations on the icosahedral Au144 nanoparticles each coated with a homogeneous set of 60 thiolates selected from one of these five (5) types: 11-mercapto-1-undecanesulfonate -SC11H22(SO3(-)), 5-mercapto-1-pentanesulfonate -SC5H10(SO3(-)), 5-mercapto-1-pentaneamine -SC5H10(NH3(+)), 4-mercapto-benzoate -SPh(COO(-)), or 4-mercapto-benzamide -SPh(CONH3(+)). These thiolates were selected to elucidate how the aggregation behavior of AuNPs depends on ligand parameters, including the charge of the terminal group (anionic vs. cationic), and its length and conformational flexibility. For this purpose, each functionalized AuNP was paired with a copy of itself, placed in an aqueous cell, neutralized by 120 Na(+)/Cl(-) counter-ions and salinated with a 150 mM concentration of NaCl, to form five (5) systems of like-charged AuNPs pairs in a saline. We computed the potential of mean force (the reversible work of separation) as a function of the intra-pair distance and, based on which, the aggregation affinities. We found that the AuNPs coated with negatively charged, short ligands have very high affinities. Structurally, a significant number of Na(+) counter-ions reside on a plane between the AuNPs, mediating the interaction. Each such ion forms a "salt bridge" (or "ionic bonds") to both of the AuNPs when they are separated by its diameter plus 0.2-0.3 nm. The positively charged AuNPs have much weaker affinities, as Cl(-) counter-ions form fewer and weaker salt bridges between the AuNPs. In the case of Au144(SC11H22(SO3(-)))60 pair, the flexible ligands fluctuate much more than the other four cases. The large fluctuations disfavor the forming of salt bridges between two AuNPs, but enable hydrophobic contact between the exposed hydrocarbon chains of the two AuNPs, which are subject to an effective attraction at a separation

  5. [Breast asymmetry of the teenager and the young adult. Stability of the result in time. About 144 patients].

    Science.gov (United States)

    Ellart, J; François, C; Calibre, C; Guerreschi, P; Duquennoy-Martinot, V

    2016-10-01

    Breast asymmetry is defined by a difference in breast shape and/or volume. The goal of this study was to assess the stability of the surgical results and to highlight predictive factors for deterioration in results. This retrospective and monocentric study included all patients presenting constitutional isolated asymmetry, Poland's syndrome, asymmetric tuberous breast or pectus excavatum treated between 1980 and 2015. The statistical analysis included 144 patients and contained two parts. The first analysis compared patients with or without breast implant. Results were significant only for symmetry of shape, with better outcomes without breast implant (P=0.0170). The second analysis compared the subgroups of patients with breast asymmetry, according to the etiology. Patients with tuberous breasts and constitutional isolated asymmetry have been compared. We found a significant difference only regarding the long-term results (P=0.0091). Patients with tuberous breasts had deteriorating in results over time. Patients with Poland's syndrome, compared to patients with constitutional isolated asymmetry, had significantly less good results for symmetry of volume, of shape, of areola, and for early results (Pbreast implant, weight variations, pregnancies and breast-feeding, the use of hormonal treatments, ageing and tuberous malformation. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  6. CT and MRI findings of 144 patients with West syndrome. Characterization of the cerebral lesion and its topography

    Energy Technology Data Exchange (ETDEWEB)

    Hamano, Shin-ichiro; Tanaka, Manabu; Mochizuki, Mika; Sugiyama, Nobuyoshi; Nara, Takahiro; Oguma, Eiji [Saitama Children' s Medical Center, Iwatsuki (Japan); Eto, Yoshikatsu [Jikei Univ., Tokyo (Japan). School of Medicine

    2002-09-01

    In West syndrome, although classified as a generalized epilepsy, there are some patients reported to have became seizure-free and have good outcomes in the developmental aspect after resections of localized lesions. We reviewed computed tomography and magnetic resonance imaging of 144 patients with West syndrome and classified them into four categories depending on the distribution of lesion: normal group, diffuse group, disseminated group, localized group. Thirty-three patients belong to the normal group after having reviewed images from computed tomography and magnetic resonance imaging. The diffuse group consisted of 83 patients presenting morphologic abnormalities such as, diffuse cerebral atrophy, periventricular leukomalesia or polycystic encephalomalesia; the disseminated group included 17 patients having a diagnosis of tuberoius sclerosis, multiple cortical dysplasia or multiple cortical heterotopias. The lesions of all eleven patients with localized cerebral lesions involved the temporal and/or occipital lobes. Nine of the eleven patients with localized cerebral lesions had the lesions on the right side. These results suggest that the specificity of lesion topography of temporo-occipital regions and the right-side in West syndrome will have a close correlation with normal brain maturation, from the viewpoint of development of myelination and cerebral blood flow, and related with the genesis of West syndrome. (author)

  7. Profiling of Greenhouse Gases from Space by Infrared-Laser Occultation and Demonstration by a 144 km Crosslink Experiment at the Canary Islands

    Science.gov (United States)

    Kirchengast, G.; Schweitzer, S.; Proschek, V.; Bernath, P.; Thomas, B.; Wang, J.; Brooke, J.; Tereszchuk, K.; Gonzalez Abad, G.; Hargreaves, R.; Beale, C. A.; Martin, P.; Kasiutsich, V.; Gerbig, C.; Kolle, O.; Loescher, A.

    2011-12-01

    Low Earth Orbit (LEO) transmitter and receiver satellites provide the basis for LEO-LEO microwave and infrared-laser occultation (LMIO), a new active limb sounding method for climate benchmark profiling of greenhouse gases (GHGs), thermodynamic variables and wind in the free atmosphere (Kirchengast and Schweitzer, GRL, 38, L13701, 2011). The LEO-LEO infrared-laser occultation (LIO) part of LMIO can provide accurate profiles of all main GHGs, including CO2, CH4, N2O, H2O, O3, and isotopes 13CO2 and 18OCO, by exploiting differential absorption between carefully selected absorption ("on-line") and reference ("off-line") laser signals targeting suitable GHG absorption lines within 2 to 2.5 μm. This spectral range resides in the "hole" between the shortwave-solar and longwave-terrestrial Planck spectra so that natural background radiation is minimal to negligible. We present the fundamentals and discuss the estimated performance of LMIO-based GHG profiling, including from quasi-realistic end-to-end performance simulations considering also aerosols and clouds. We found monthly-mean GHG profiles, assuming 30 to 40 native profiles averaged per climatological "grid cell" per month, accurate to LIO sounding along a ~144 km link at ~2.4 km altitude between observatories at the islands of La Palma and Tenerife being part of the Canary Islands (ESA-funded experiment project by Bernath et al.; Univ. York, Univ. Graz, Univ. Manchester, MPI Jena). With transmitter and receiver breadboard equipment built for four infrared-laser signals we aimed in this campaign at CO2, CH4, and H2O measurements under field conditions somewhat akin to a LIO space-based link. Despite of the practical challenges of such long-range observations, especially related to the needed fine adjustments of laser beam pointing under windy high-altitude conditions, we achieved first good data for retrieving these GHGs so that the basic demonstration of the experimental feasibility of LIO was successful. We will

  8. Isoscalar giant dipole resonance in Zr-90, Sn-116, Sm-144 and Pb-208 excited by 240 MeV alpha particle scattering

    NARCIS (Netherlands)

    Clark, HL; Lui, YW; Youngblood, DH; Bachtr, K; Garg, U; Harakeh, MN; Kalantar-Nayestanaki, N

    1999-01-01

    The giant resonance regions of Zr-90, Sn-116, Sm-144 and (208)pb were investigated using 240 MeV a particle scattering at small angles including 0 degrees. E1 strengths corresponding to 91+/-11%, 89+/-10%, 105+/-12% and 95+/-13% of the isoscalar E1 energy-weighted sum rule were identified between 18

  9. Effects of the dimeric PSD-95 inhibitor UCCB01-144 on functional recovery after fimbria-fornix transection in rats

    DEFF Research Database (Denmark)

    Sommer, Jens Bak; Bach, Anders; Rytter, Hana Malá

    2017-01-01

    . UCCB01-144 or saline was injected into the lateral tail vein of rats immediately after sham surgery or FF-transection, and effects on spatial delayed alternation in a T-maze were assessed over a 28-day period. Task acquisition was significantly impaired in FF-transected animals, but there were...

  10. Genetic engineering of EcoRI mutants with altered amino acid residues in the DNA binding site: physicochemical investigations give evidence for an altered monomer/dimer equilibrium for the Gln144Lys145 and Gln144Lys145Lys200 mutants.

    Science.gov (United States)

    Geiger, R; Rüter, T; Alves, J; Fliess, A; Wolfes, H; Pingoud, V; Urbanke, C; Maass, G; Pingoud, A; Düsterhöft, A

    1989-03-21

    We have genetically engineered the Arg200----Lys mutant, the Glu144Arg145----GlnLys double mutant, and the Glu144Arg145Arg200----GlnLysLys triple mutant of the EcoRI endonuclease in extension of previously published work on site-directed mutagenesis of the EcoRI endonuclease in which Glu144 had been exchanged for Gln and Arg145 for Lys [Wolfes et al. (1986) Nucleic Acids Res. 14, 9063]. All these mutants carry modifications in the DNA binding site. Mutant EcoRI proteins were purified to homogeneity and characterized by physicochemical techniques. All mutants have a very similar secondary structure composition. However, whereas the Lys200 mutant is not impaired in its capacity to form a dimer, the Gln144Lys145 and Gln144Lys145Lys200 mutants have a very much decreased propensity to form a dimer or tetramer depending on concentration as shown by gel filtration and analytical ultracentrifugation. This finding may explain the results of isoelectric focusing experiments which show that these two mutants have a considerably more basic pI than expected for a protein in which an acidic amino acid was replaced by a neutral one. Furthermore, while wild-type EcoRI and the Lys200 mutant are denatured in an irreversible manner upon heating to 60 degrees C, the thermal denaturation process as shown by circular dichroism spectroscopy is fully reversible with the Gln144Lys145 double mutant and the Gln144Lys145Lys200 triple mutant. All EcoRI endonuclease mutants described here have a residual enzymatic activity with wild-type specificity, since Escherichia coli cells overexpressing the mutant proteins can only survive in the presence of EcoRI methylase. The detailed analysis of the enzymatic activity and specificity of the purified mutant proteins is the subject of the accompanying paper [Alves et al. (1989) Biochemistry (following paper in this issue)].

  11. A Whitham-Theory Sonic-Boom Analysis of the TU-144 Aircraft at a Mach Number of 2.2

    Science.gov (United States)

    Mack, Robert J.

    1999-01-01

    Officially, the Tu-144 was the first supersonic-cruise, passenger-carrying aircraft to enter commercial service. Design, construction, and testing were carried out by the Soviet Union, flight certification was by the Soviet Union, and the only regular passenger flights were scheduled and flown across the territory of the Soviet Union. Although it was not introduced to international passenger service, there were many significant engineering accomplishments achieved in the design, production, and flight of this aircraft. Development of the aircraft began with a prototype stage. Systematic testing and redesign led to a production aircraft in discrete stages that measurably improved the performance of the aircraft from the starting concept to final aircraft certification. It flew in competition with the English-French Concorde for a short time, but was withdrawn from national commercial service due to a lack of interest by airlines outside the Soviet Union. NASA became interested in the Tu- 144 aircraft when it was offered for use as a flying "testbed" in the study of operating characteristics of a supersonic-cruise commercial airplane. Since it had been in supersonic-cruise service, the Tu- 144 had operational characteris'tics similar to those anticipated in the conceptual aircraft designs being studied by the United States aircraft companies. In addition to the other operational tests being conducted on the Tu-144 aircraft, it was proposed that two sets of sonic-boom pressure signature measurements be made. The first set would be made on the ground, using techniques and devices similar to those in reference I and many other subsequent studies. A second set would be made in the air with an instrumented aircraft flying close under the Tu-144 in supersonic flight. Such in-flight measurements would require pressure gages that were capable of accurately recording the flow-field overpressures generated by the Tu- 144 at relatively close distances under the vehicle

  12. A NOVEL SAMARIUM COMPLEX WITH INTERESTING ...

    African Journals Online (AJOL)

    INTRODUCTION. Fluorescent materials, particularly blue fluorescent materials have gained strong interest because ... emitting complexes in different technical applications, such as emitting materials for organic light emitting ..... properties of three novel two-dimensional lanthanide coordination polymers with mixed aromatic ...

  13. Pyroelectric Ferroelectric and Resistivity Studies on Samarium ...

    African Journals Online (AJOL)

    Barium Strontium Sodium Niobate (Ba1-xSrx)2NaNb5O15 (BSNN) belongs to tungsten bronze ferroelectric morphotrophic phase boundary (MPB) system at x = 0.6, having large spontaneous polarisation, pyroelectric coefficient and low dielectic constant and is expected to be applicable for piezoceramic filter and ...

  14. A NOVEL SAMARIUM COMPLEX WITH INTERESTING ...

    African Journals Online (AJOL)

    emitting complexes in different technical applications, such as emitting materials for organic light emitting diodes, sensitizers in solar energy conversion, chemical sensors and so forth [6-9]. The ability of bipy to act as a rigid ..... properties of three-dimensional organic-inorganic hybrids based on α-metatungstate. Inorg. Chim.

  15. MEET ISOLDE - Target Production

    CERN Multimedia

    2017-01-01

    MEET ISOLDE - Target Production. Everything at ISOLDE starts with a target and the target production team realise on more then 50 years of experience to build and develop new targets for ISOLDE’s wide physics program.

  16. Compact Nd:YAG laser operating at 1.06, 1.32, and 1.44 μm for dental caries effective disinfection

    Science.gov (United States)

    Dostálová, Tat'jana; Jelínková, Helena; Kadlecová, Martina; Němec, Michal; Å ulc, Jan; Fibrich, Martin; Nejezchleb, Karel; Kapitch, Nickalai; Å koda, Václav

    2017-02-01

    The analysis of the disinfection effect of Nd:YAG laser radiation was investigated for patients with high concentration of Streptococcus mutans in saliva (positive result in Saliva-check mutans test). For the interaction the Nd:YAG laser system generated separate switchable wavelengths with the maximum output energies 1.1, 0.6, and 0.3 J for wavelength 1.06 μm, 1.32, μm and 1.44 μm, respectively, was used. Our study proved that after the laser irradiation the Saliva-check test showed negative presence of Streptococcus mutans. The disinfection effect was confirmed for all used radiation wavelength. For 1.44 μm this effect was reached with a smallest energy density.

  17. A Controlled and Retrospective Study of 144 Chronic Low Back Pain Patients to Evaluate the Effectiveness of an Intensive Functional Restoration Program in France

    OpenAIRE

    Isabelle Caby; Nicolas Olivier; Frédérick Janik; Jacques Vanvelcenaher; Patrick Pelayo

    2016-01-01

    Study Design: A controlled and retrospective study of 144 chronic low back pain patients to evaluate the effectiveness of an intensive functional restoration program in France. Objective: Evaluating the efficiency of an intensive, dynamic and multidisciplinary functional restoration program in patients with chronic low back pain (LBP), during 6 and 12 months follow up. Summary of background data: Chronic low back pain disease has a multifactor nature, involving physical, psychological profess...

  18. A novel arginine to tryptophan (R144W mutation in troponin T (cTnT gene in an indian multigenerational family with dilated cardiomyopathy (FDCM.

    Directory of Open Access Journals (Sweden)

    Deepa Selvi Rani

    Full Text Available Cardiomyopathy is a major cause of heart failure and sudden cardiac death; several mutations in sarcomeric protein genes have been associated with this disease. Our aim in the present study is to investigate the genetic variations in Troponin T (cTnT gene and its association with dilated cardiomyopathy (DCM in south-Indian patients. Analyses of all the exons and exon-intron boundaries of cTnT in 147 DCM and in 207 healthy controls had revealed a total of 15 SNPs and a 5 bp INDEL; of which, polymorphic SNPs were compared with the HapMap population data. Interestingly, a novel R144W mutation, that substitutes polar-neutral tryptophan for a highly conserved basic arginine in cTnT, altering the charge drastically, was identified in a DCM, with a family history of sudden-cardiac death (SCD. This mutation was found within the tropomyosin (TPM1 binding domain, and was evolutionarily conserved across species, therefore it is expected to have a significant impact on the structure and function of the protein. Family studies had revealed that the R144W is co-segregating with disease in the family as an autosomal dominant trait, but it was completely absent in 207 healthy controls and in 162 previously studied HCM patients. Further screening of the proband and three of his family members (positive for R144W mutant with eight other genes β-MYH7, MYBPC3, TPM1, TNNI3, TTN, ACTC, MYL2 and MYL3, did not reveal any disease causing mutation, proposing the absence of compound heterozygosity. Therefore, we strongly suggest that the novel R144W unique/private mutant identified in this study is associated with FDCM. This is furthermore signifying the unique genetic architecture of Indian population.

  19. Determination of the B(E3,0$^{+}$ $\\rightarrow$ 3$^{-}$) strength in the octupole correlated nuclei $^{142,144}$Ba using Coulomb excitation

    CERN Multimedia

    We propose to exploit the unique capability of ISOLDE to provide intense post-accelerated $^{142}$Ba and $^{144}$Ba ion beams from the HIE-ISOLDE facility to enable the Coulomb excitation of the first 3$^-$ state in these nuclei. By measuring the $\\gamma$-ray yields of the E1 decays from the 3$^-$ state using the MINIBALL array, we can obtain the interesting transition matrix element. The results will give quantitative information about octupole correlations in these nuclei.

  20. Subcellular co-localization of aluminum (III) phthalocyanine chloride tetrasulphonate with fluorescent markers in the human melanoma cell-line HT-144

    CSIR Research Space (South Africa)

    Ndhundhuma, I

    2011-08-01

    Full Text Available , and bladder cancer. Methyl- tetrahydroxyphenyl chlorin (Temoporfin) is approved in the European Union, Norway and Iceland for palliative treatment of head and neck cancer [8]. Other approved photosensitizers are 5-aminolevulinic acid (approved in USA..., NR) was purchased from Biochrom AG (Berlin, Germany) and used according to the manufacturer's instructions. Cell culture Cultures of human metastatic melanoma cell line (HT-144 cells, ATCC No HTB-63TM, LGC Standards GmbH, Wesel, Germany) were...

  1. Evaluation of the immunological profile of antibody-functionalized metal-filled single-walled carbon nanocapsules for targeted radiotherapy

    Science.gov (United States)

    Perez Ruiz de Garibay, Aritz; Spinato, Cinzia; Klippstein, Rebecca; Bourgognon, Maxime; Martincic, Markus; Pach, Elzbieta; Ballesteros, Belén; Ménard-Moyon, Cécilia; Al-Jamal, Khuloud T.; Tobias, Gerard; Bianco, Alberto

    2017-02-01

    This study investigates the immune responses induced by metal-filled single-walled carbon nanotubes (SWCNT) under in vitro, ex vivo and in vivo settings. Either empty amino-functionalized CNTs [SWCNT-NH2 (1)] or samarium chloride-filled amino-functionalized CNTs with [SmCl3@SWCNT-mAb (3)] or without [SmCl3@SWCNT-NH2 (2)] Cetuximab functionalization were tested. Conjugates were added to RAW 264.7 or PBMC cells in a range of 1 μg/ml to 100 μg/ml for 24 h. Cell viability and IL-6/TNFα production were determined by flow cytometry and ELISA. Additionally, the effect of SWCNTs on the number of T lymphocytes, B lymphocytes and monocytes within the PBMC subpopulations was evaluated by immunostaining and flow cytometry. The effect on monocyte number in living mice was assessed after tail vein injection (150 μg of each conjugate per mouse) at 1, 7 and 13 days post-injection. Overall, our study showed that all the conjugates had no significant effect on cell viability of RAW 264.7 but conjugates 1 and 3 led to a slight increase in IL-6/TNFα. All the conjugates resulted in significant reduction in monocyte/macrophage cell numbers within PBMCs in a dose-dependent manner. Interestingly, monocyte depletion was not observed in vivo, suggesting their suitability for future testing in the field of targeted radiotherapy in mice.

  2. SU-D-304-02: Magnetically Focused Proton Irradiation of Small Field Targets

    Energy Technology Data Exchange (ETDEWEB)

    McAuley, GA; Slater, JM [Loma Linda University, Loma Linda, CA (United States); Slater, JD; Wroe, AJ [Loma Linda University Medical Center, Loma Linda, CA (United States)

    2015-06-15

    Purpose: To investigate the use of magnetic focusing for small field proton irradiations. It is hypothesized that magnetic focusing will provide significant dose distribution benefits over standard collimated beams for fields less than 10 mm diameter. Methods: Magnets consisting of 24 segments of radiation hard samarium-cobalt adhered into hollow cylinders were designed and manufactured. Two focusing magnets were placed on a positioning track on our Gantry 1 treatment table. Proton beams with energies of 127 and 157 MeV, 15 and 30 mm modulation, and 8 mm initial diameters were delivered to a water tank using single-stage scattering. Depth dose distributions were measured using a PTW PR60020 diode detector and transverse profiles were measured with Gafchromic EBT3 film. Monte Carlo simulations were also performed - both for comparison with experimental data and to further explore the potential of magnetic focusing in silica. For example, beam spot areas (based on the 90% dose contour) were matched at Bragg depth between simulated 100 MeV collimated beams and simulated beams focused by two 400 T/m gradient magnets. Results: Preliminary experimental results show 23% higher peak to entrance dose ratios and flatter spread out Bragg peak plateaus for 8 mm focused beams compared with uncollimated beams. Monte Carlo simulations showed 21% larger peak to entrance ratios and a ∼9 fold more efficient dose to target delivery compared to spot-sized matched collimated beams. Our latest results will be presented. Conclusion: Our results suggest that rare earth focusing magnet assemblies could reduce skin dose and beam number while delivering dose to nominally spherical radiosurgery targets over a much shorter time compared to unfocused beams. Immediate clinical applications include those associated with proton radiosurgery and functional radiosurgery of the brain and spine, however expanded treatment sites can be also envisaged.

  3. Crystal structures of three 1-[4-(4-bromo-but-oxy)-phen-yl] chalcone derivatives: (E)-1-[4-(4-bromo-but-oxy)-phen-yl]-3-phenyl-prop-2-en-1-one, (E)-1-[4-(4-bromo-but-oxy)-phen-yl]-3-(4-meth-oxy-phen-yl)prop-2-en-1-one and (E)-1-[4-(4-bromo-but-oxy)-phen-yl]-3-(3,4-di-meth-oxy-phen-yl)prop-2-en-1-one.

    Science.gov (United States)

    Maragatham, Gunasekaran; Selvarani, Sivasamy; Rajakumar, Perumal; Lakshmi, Srinivasakannan

    2017-07-01

    The crystal structures of three chalcones with a bromo-substituted but-oxy side chain, viz. (E)-1-[4-(4-bromo-but-oxy)-phen-yl]-3-phenyl-prop-2-en-1-one, C19H19BrO2, (I), (E)-1-[4-(4-bromo-but-oxy)-phen-yl]-3-(4-meth-oxy-phen-yl)prop-2-en-1-one, C20H21BrO3, (II), and (E)-1-[4-(4-bromo-but-oxy)-phen-yl]-3-(3,4-di-meth-oxy-phen-yl)prop-2-en-1-one, C21H23BrO4, (III), are reported. In all mol-ecules, the conformation of the keto group with respect to the olefinic bond is s-cis. Mol-ecules of (I) and (II) are nearly planar, while mol-ecule (III) is not planar. In the crystal of compounds (I) and (II), mol-ecules are linked into chains parallel to the c axis by C-H⋯π inter-actions. In the crystal of compound (III), mol-ecules are linked by a pairs of C-H⋯O hydrogen bonds, forming inversion dimers. Weak C-Br⋯π inter-actions are also observed in (III).

  4. Response by gender of HIV-1-infected subjects treated with abacavir/lamivudine plus atazanavir, with or without ritonavir, for 144 weeks

    Science.gov (United States)

    Squires, Kathleen E; Young, Benjamin; Santiago, Lizette; Dretler, Robin H; Walmsley, Sharon L; Zhao, Henry H; Pakes, Gary E; Ross, Lisa L; Shaefer, Mark S

    2017-01-01

    Purpose The 144-week results of the open-label, multicenter Atazanavir/Ritonavir Induction with Epzicom Study (ARIES) were stratified by gender to compare treatment responses. Methods A total of 369 HIV-infected, antiretroviral-naïve subjects receiving once-daily abacavir/lamivudine + atazanavir/ritonavir (ATV/r) whose HIV-1 RNA was <50 copies/mL by week 30 were randomized 1:1 at week 36 to maintain or discontinue ritonavir for 108 subsequent weeks. Between- and within-treatment gender-related efficacy and safety differences were analyzed. Results Subjects were 85% male; 64% white; and had a mean age of 39 years, baseline median HIV-1 RNA of 114,815 copies/mL, and median CD4+ cell count of 198 cells/mm3. Gender (ATV [n=189]: 29 females/160 males; ATV/r [n=180]: 25 females/155 males) and most other demographics were similar between groups; more females than males were black (65% vs 25%) and fewer females had baseline HIV-1 RNA ≥100,000 copies/mL (41% vs 58%). At week 144, no significant differences between genders were observed in proportion maintaining HIV-1 RNA <50 copies/mL (ATV, 79% vs 77%; ATV/r, 60% vs 75%) or <400 copies/mL (ATV, 83% vs 84%; ATV/r, 68% vs 82%) (intent-to-treat-exposed: time to loss of virologic response analysis); median CD4+ change from baseline (ATV, +365 vs +300 cells/mm3; ATV/r, +344 vs +301 cells/mm3); proportion with treatment-related grade 2–4 adverse events (baseline to week 144: ATV, 41% vs 31%; ATV/r, 36% vs 43%; weeks 36 to 144: ATV, 14% vs 13%; ATV/r, 24% vs 23%); or proportion developing fasting lipid changes. Female and male virologic failure rates (ATV, 0 vs 5; ATV/r, 2 vs 4) and proportions completing the study were similar during the extension phase. Primary withdrawal reasons were loss to follow-up and pregnancy for females and loss to follow-up and other for males. Conclusion Over 144 weeks, no significant gender differences were observed in efficacy, safety, or fasting lipid changes with abacavir/lamivudine +ATV or

  5. Association of Leisure-Time Physical Activity With Risk of 26 Types of Cancer in 1.44 Million Adults.

    Science.gov (United States)

    Moore, Steven C; Lee, I-Min; Weiderpass, Elisabete; Campbell, Peter T; Sampson, Joshua N; Kitahara, Cari M; Keadle, Sarah K; Arem, Hannah; Berrington de Gonzalez, Amy; Hartge, Patricia; Adami, Hans-Olov; Blair, Cindy K; Borch, Kristin B; Boyd, Eric; Check, David P; Fournier, Agnès; Freedman, Neal D; Gunter, Marc; Johannson, Mattias; Khaw, Kay-Tee; Linet, Martha S; Orsini, Nicola; Park, Yikyung; Riboli, Elio; Robien, Kim; Schairer, Catherine; Sesso, Howard; Spriggs, Michael; Van Dusen, Roy; Wolk, Alicja; Matthews, Charles E; Patel, Alpa V

    2016-06-01

    Leisure-time physical activity has been associated with lower risk of heart-disease and all-cause mortality, but its association with risk of cancer is not well understood. To determine the association of leisure-time physical activity with incidence of common types of cancer and whether associations vary by body size and/or smoking. We pooled data from 12 prospective US and European cohorts with self-reported physical activity (baseline, 1987-2004). We used multivariable Cox regression to estimate hazard ratios (HRs) and 95% confidence intervals for associations of leisure-time physical activity with incidence of 26 types of cancer. Leisure-time physical activity levels were modeled as cohort-specific percentiles on a continuous basis and cohort-specific results were synthesized by random-effects meta-analysis. Hazard ratios for high vs low levels of activity are based on a comparison of risk at the 90th vs 10th percentiles of activity. The data analysis was performed from January 1, 2014, to June 1, 2015. Leisure-time physical activity of a moderate to vigorous intensity. Incident cancer during follow-up. A total of 1.44 million participants (median [range] age, 59 [19-98] years; 57% female) and 186 932 cancers were included. High vs low levels of leisure-time physical activity were associated with lower risks of 13 cancers: esophageal adenocarcinoma (HR, 0.58; 95% CI, 0.37-0.89), liver (HR, 0.73; 95% CI, 0.55-0.98), lung (HR, 0.74; 95% CI, 0.71-0.77), kidney (HR, 0.77; 95% CI, 0.70-0.85), gastric cardia (HR, 0.78; 95% CI, 0.64-0.95), endometrial (HR, 0.79; 95% CI, 0.68-0.92), myeloid leukemia (HR, 0.80; 95% CI, 0.70-0.92), myeloma (HR, 0.83; 95% CI, 0.72-0.95), colon (HR, 0.84; 95% CI, 0.77-0.91), head and neck (HR, 0.85; 95% CI, 0.78-0.93), rectal (HR, 0.87; 95% CI, 0.80-0.95), bladder (HR, 0.87; 95% CI, 0.82-0.92), and breast (HR, 0.90; 95% CI, 0.87-0.93). Body mass index adjustment modestly attenuated associations for several cancers, but 10 of 13 inverse

  6. A Controlled and Retrospective Study of 144 Chronic Low Back Pain Patients to Evaluate the Effectiveness of an Intensive Functional Restoration Program in France.

    Science.gov (United States)

    Caby, Isabelle; Olivier, Nicolas; Janik, Frédérick; Vanvelcenaher, Jacques; Pelayo, Patrick

    2016-04-27

    A controlled and retrospective study of 144 chronic low back pain patients to evaluate the effectiveness of an intensive functional restoration program in France. Evaluating the efficiency of an intensive, dynamic and multidisciplinary functional restoration program in patients with chronic low back pain (LBP), during 6 and 12 months follow up. Chronic low back pain disease has a multifactor nature, involving physical, psychological professional and social factors. A functional restoration program (FRP) has been included in a multidisciplinary training program which provides an efficient therapeutic solution. However, the effectiveness of an FRP has not been yet established. 144 subjects (71 males, 73 females) with chronic low back pain were included in a functional restoration program. The FRP includes physiotherapy and occupational therapy interventions together with psychological counselling. Patients participated as in- or outpatients 6 h per day, 5 days a week over 5 weeks. Pain intensity, trunk flexibility, trunk strength, lifting ability, quality of life and return to work were recorded before, immediately after, and at 6 months and 12 months after the treatment period. All outcome measures were significantly higher just after the FRP (144 patients) and at 6 and 12 months (from available data in 31 subjects) compared to pre-treatment values. This FRP for chronic low back pain maintained its benefits whatever the patient's activities. The effects reflected on all outcome measures, both on short and long term follow-up. The multidisciplinary FRP for chronic low back pain patients durably stopped the de-conditioning syndrome and involved new life-style habits for the patient, daily pain management and a return to work.

  7. A Controlled and Retrospective Study of 144 Chronic Low Back Pain Patients to Evaluate the Effectiveness of an Intensive Functional Restoration Program in France

    Directory of Open Access Journals (Sweden)

    Isabelle Caby

    2016-04-01

    Full Text Available Study Design: A controlled and retrospective study of 144 chronic low back pain patients to evaluate the effectiveness of an intensive functional restoration program in France. Objective: Evaluating the efficiency of an intensive, dynamic and multidisciplinary functional restoration program in patients with chronic low back pain (LBP, during 6 and 12 months follow up. Summary of background data: Chronic low back pain disease has a multifactor nature, involving physical, psychological professional and social factors. A functional restoration program (FRP has been included in a multidisciplinary training program which provides an efficient therapeutic solution. However, the effectiveness of an FRP has not been yet established. Methods: 144 subjects (71 males, 73 females with chronic low back pain were included in a functional restoration program. The FRP includes physiotherapy and occupational therapy interventions together with psychological counselling. Patients participated as in- or outpatients 6 h per day, 5 days a week over 5 weeks. Pain intensity, trunk flexibility, trunk strength, lifting ability, quality of life and return to work were recorded before, immediately after, and at 6 months and 12 months after the treatment period. Results: All outcome measures were significantly higher just after the FRP (144 patients and at 6 and 12 months (from available data in 31 subjects compared to pre-treatment values. This FRP for chronic low back pain maintained its benefits whatever the patient’s activities. Conclusions: The effects reflected on all outcome measures, both on short and long term follow-up. The multidisciplinary FRP for chronic low back pain patients durably stopped the de-conditioning syndrome and involved new life-style habits for the patient, daily pain management and a return to work.

  8. Effects of bioisosteric fluorine in synthetic cannabinoid designer drugs JWH-018, AM-2201, UR-144, XLR-11, PB-22, 5F-PB-22, APICA, and STS-135.

    Science.gov (United States)

    Banister, Samuel D; Stuart, Jordyn; Kevin, Richard C; Edington, Amelia; Longworth, Mitchell; Wilkinson, Shane M; Beinat, Corinne; Buchanan, Alexandra S; Hibbs, David E; Glass, Michelle; Connor, Mark; McGregor, Iain S; Kassiou, Michael

    2015-08-19

    Synthetic cannabinoid (SC) designer drugs featuring bioisosteric fluorine substitution are identified by forensic chemists and toxicologists with increasing frequency. Although terminal fluorination of N-pentyl indole SCs is sometimes known to improve cannabinoid type 1 (CB1) receptor binding affinity, little is known of the effects of fluorination on functional activity of SCs. This study explores the in vitro functional activities of SC designer drugs JWH-018, UR-144, PB-22, and APICA, and their respective terminally fluorinated analogues AM-2201, XLR-11, 5F-PB-22, and STS-135 at human CB1 and CB2 receptors using a FLIPR membrane potential assay. All compounds demonstrated agonist activity at CB1 (EC50 = 2.8-1959 nM) and CB2 (EC50 = 6.5-206 nM) receptors, with the fluorinated analogues generally showing increased CB1 receptor potency (∼2-5 times). Additionally, the cannabimimetic activities and relative potencies of JWH-018, AM-2201, UR-144, XLR-11, PB-22, 5F-PB-22, APICA, and STS-135 in vivo were evaluated in rats using biotelemetry. All SCs dose-dependently induced hypothermia and reduced heart rate at doses of 0.3-10 mg/kg. There was no consistent trend for increased potency of fluorinated SCs over the corresponding des-fluoro SCs in vivo. Based on magnitude and duration of hypothermia, the SCs were ranked for potency (PB-22 > 5F-PB-22 = JWH-018 > AM-2201 > APICA = STS-135 = XLR-11 > UR-144).

  9. Determination of the B(E3;0$^+\\!\\rightarrow$ 3$^{-}$) strength in the octupole correlated nucleus $^{144}$Ba using Coulomb excitation

    CERN Multimedia

    We propose to exploit the unique capability of ISOLDE to provide intense post-accelerated $^{144}$Ba ion beams from the REX facility to enable the Coulomb excitation of the first 3$^{-}$ state in this nucleus. By measuring the $\\gamma$-ray yields of the E1 decay connecting the 3$^{-}$ and 2$^{+}$ states using the MINIBALL array, we can obtain the interesting transition matrix element. The result will give quantitative information about octupole correlations in this nucleus. We require 27 shifts to fulfill the aims of the experiment.

  10. Design and Study of a DC/DC Converter for High Power, 14.4 V and 300 A for Automotive Applications

    OpenAIRE

    Julio Cesar Lopes de Oliveira; Carlos Henrique Gonc¸alves Treviso

    2014-01-01

    The shortage of the automotive market in relation to options for sources of high power car audio systems, led to development of this work. Thus, we developed a source with stabilized voltage with 4320 W effective power. Designed to the voltage of 14.4 V and a choice of two currents: 30 A load option in battery banks and 300 A at full load. This source can also be considered as a source of general use dedicated commercial with a simple control circuit in analog form based ...

  11. Estimation of continental 187Os/186Os values by using 187Os/186Os and 143Nd/144Nd ratios in marine manganese nodules

    OpenAIRE

    Turekian, Karl K.; Luck, Jean-Marc

    1984-01-01

    The relationship between 187Os/186Os and 143Nd/144Nd in different manganese nodule fields is used to determine the 187Os/186Os ratio of the continental terrains bounding the major ocean basins. The Atlantic Ocean drainages yield 187Os/186Os of about 11; the Pacific Ocean, between 25 and 36; and the western Indian Ocean, 20. By assuming a two-component continental crust composed of “ultramafic rocks” (high Os concentration, low 187Os/186Os) and “granite” with only radiogenic 187Os produced in ...

  12. Remaining Sites Verification Package for the 100-F-31, 144-F Sanitary Sewer System, Waste Site Reclassification Form 2006-033

    Energy Technology Data Exchange (ETDEWEB)

    L. M. Dittmer

    2006-08-24

    The 100-F-31 waste site is a former septic system that supported the inhalation laboratories, also referred to as the 144-F Particle Exposure Laboratory (132-F-2 waste site), which housed animals exposed to particulate material. The 100-F-31 waste site has been remediated to achieve the remedial action objectives specified in the Remaining Sites ROD. The results of verification sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River.

  13. Monoclonal Antibodies, Derived from Humans Vaccinated with the RV144 HIV Vaccine Containing the HVEM Binding Domain of Herpes Simplex Virus (HSV) Glycoprotein D, Neutralize HSV Infection, Mediate Antibody-Dependent Cellular Cytotoxicity, and Protect Mice from Ocular Challenge with HSV-1.

    Science.gov (United States)

    Wang, Kening; Tomaras, Georgia D; Jegaskanda, Sinthujan; Moody, M Anthony; Liao, Hua-Xin; Goodman, Kyle N; Berman, Phillip W; Rerks-Ngarm, Supachai; Pitisuttithum, Punnee; Nitayapan, Sorachai; Kaewkungwal, Jaranit; Haynes, Barton F; Cohen, Jeffrey I

    2017-10-01

    The RV144 HIV vaccine trial included a recombinant HIV glycoprotein 120 (gp120) construct fused to a small portion of herpes simplex virus 1 (HSV-1) glycoprotein D (gD) so that the first 40 amino acids of gp120 were replaced by the signal sequence and the first 27 amino acids of the mature form of gD. This region of gD contains most of the binding site for HVEM, an HSV receptor important for virus infection of epithelial cells and lymphocytes. RV144 induced antibodies to HIV that were partially protective against infection, as well as antibodies to HSV. We derived monoclonal antibodies (MAbs) from peripheral blood B cells of recipients of the RV144 HIV vaccine and showed that these antibodies neutralized HSV-1 infection in cells expressing HVEM, but not the other major virus receptor, nectin-1. The MAbs mediated antibody-dependent cellular cytotoxicity (ADCC), and mice that received the MAbs and were then challenged by corneal inoculation with HSV-1 had reduced eye disease, shedding, and latent infection. To our knowledge, this is the first description of MAbs derived from human recipients of a vaccine that specifically target the HVEM binding site of gD. In summary, we found that monoclonal antibodies derived from humans vaccinated with the HVEM binding domain of HSV-1 gD (i) neutralized HSV-1 infection in a cell receptor-specific manner, (ii) mediated ADCC, and (iii) reduced ocular disease in virus-infected mice. IMPORTANCE Herpes simplex virus 1 (HSV-1) causes cold sores and neonatal herpes and is a leading cause of blindness. Despite many trials, no HSV vaccine has been approved. Nectin-1 and HVEM are the two major cellular receptors for HSV. These receptors are expressed at different levels in various tissues, and the role of each receptor in HSV pathogenesis is not well understood. We derived human monoclonal antibodies from persons who received the HIV RV144 vaccine that contained the HVEM binding domain of HSV-1 gD fused to HIV gp120. These antibodies were

  14. Determination of specific radioactivity of samarium-153 product. 1. Quantitative determination of samarium by spectrophotometry

    Energy Technology Data Exchange (ETDEWEB)

    Izumo, Mishiroku [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Nemoto, Masahiro [Tokyo Nuclear Service Co., Ltd., Tokyo (Japan)

    2002-03-01

    On the specific radioactivity of Sm-153 for the radiotherapy of cancers, a simple method for determination of the amount of Sm was described. The method used Arsenazo III as a colorimetric reagent. The sample irradiated in the reactor was dissolved in 1M HCl solution. A small part of it was taken and mixed with Arsenazo III at pH 3.2, and the amount of Sm was determined by the spectrophotometric method at a wavelength of 652 nm. The molar absorptivity of Sm at 652 nm was 6.6x10{sup 3} m{sup -1}{center_dot}mm{sup -1}. The error of measurement in the partial different conditions was about 2% of the value determined. The effects of impurities, Fe, Zn and Cu mixing in the Sm during operation, were clarified. (author)

  15. Durability of Stavudine, Lamivudine and Nevirapine among Advanced HIV-1 Infected Patients with/without Prior Co-administration of Rifampicin: A 144-week Prospective Study

    Directory of Open Access Journals (Sweden)

    Prasithisirikul Wisit

    2008-10-01

    Full Text Available Abstract Background To date, data on the durability of a regimen of stavudine, lamivudine and nevirapine are very limited, particularly from the resource-limited settings. Methods A prospective cohort study was conducted among 140 antiretroviral-naïve patients who were enrolled to initiate d4T, 3TC and NVP between November 2004 and March 2005. The objectives were to determine immunological and virological responses after 144 weeks of antiretroviral therapy. Seventy patients with tuberculosis also received rifampicin during the early period of antiviral treatment (TB group. Results Of all, median (IQR baseline CD4 cell count was 31 (14–79 cells/mm3; median (IQR baseline HIV-1 RNA was 433,500 (169,000–750,000 copies/mL. The average body weight was 55 kilograms. By intention-to-treat analysis at 144 weeks, the overall percentage of patients who achieved plasma HIV-1 RNA P = 0.731. Eight (5.8% patients discontinued d4T due to neuropathy and/or symptomatic lactic acidosis. Conclusion The overall durability and efficacy of antiviral response of d4T, 3TC and NVP are satisfied and they are not different between HIV-1 infected patients with and without co-administration of rifampicin due to tuberculosis. However, stavudine-related adverse effects are concerns. Trial registration ClinicalTrials.gov Identifier NCT00703898

  16. Response by gender of HIV-1-infected subjects treated with abacavir/lamivudine plus atazanavir, with or without ritonavir, for 144 weeks

    Directory of Open Access Journals (Sweden)

    Squires KE

    2017-03-01

    Full Text Available Kathleen E Squires,1 Benjamin Young,2,3 Lizette Santiago,4 Robin H Dretler,5 Sharon L Walmsley,6 Henry H Zhao,7 Gary E Pakes,8 Lisa L Ross,8 Mark S Shaefer8 On behalf of the ARIES Study Team 1Thomas Jefferson University, Philadelphia, PA, 2Apex Family Medicine and Research, Denver, CO, 3International Association of Physicians in AIDS Care, Washington DC, USA; 4HOPE Clinic and Wellness Center, San Juan, Puerto Rico; 5ID Specialists of Atlanta, Decatur, GA, USA; 6University Health Network, Toronto, ON, Canada; 7GlaxoSmithKline, 8ViiV Healthcare, Research Triangle Park, NC, USA Purpose: The 144-week results of the open-label, multicenter Atazanavir/Ritonavir Induction with Epzicom Study (ARIES were stratified by gender to compare treatment responses.Methods: A total of 369 HIV-infected, antiretroviral-naïve subjects receiving once-daily abacavir/lamivudine + atazanavir/ritonavir (ATV/r whose HIV-1 RNA was <50 copies/mL by week 30 were randomized 1:1 at week 36 to maintain or discontinue ritonavir for 108 subsequent weeks. Between- and within-treatment gender-related efficacy and safety differences were analyzed.Results: Subjects were 85% male; 64% white; and had a mean age of 39 years, baseline median HIV-1 RNA of 114,815 copies/mL, and median CD4+ cell count of 198 cells/mm3. Gender (ATV [n=189]: 29 females/160 males; ATV/r [n=180]: 25 females/155 males and most other demographics were similar between groups; more females than males were black (65% vs 25% and fewer females had baseline HIV-1 RNA ≥100,000 copies/mL (41% vs 58%. At week 144, no significant differences between genders were observed in proportion maintaining HIV-1 RNA <50 copies/mL (ATV, 79% vs 77%; ATV/r, 60% vs 75% or <400 copies/mL (ATV, 83% vs 84%; ATV/r, 68% vs 82% (intent-to-treat-exposed: time to loss of virologic response analysis; median CD4+ change from baseline (ATV, +365 vs +300 cells/mm3; ATV/r, +344 vs +301 cells/mm3; proportion with treatment-related grade 2–4

  17. Targeted therapies for cancer

    Science.gov (United States)

    ... so they cannot spread. How Does Targeted Therapy Work? Targeted therapy drugs work in a few different ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  18. Reflectance Reference Targets (OTTER)

    Data.gov (United States)

    National Aeronautics and Space Administration — ABSTRACT: Spectral reflectance measurements of flat field targets as reference points representative of pseudo-invariant targets as measured by Spectron SE590...

  19. Reflectance Reference Targets (OTTER)

    Data.gov (United States)

    National Aeronautics and Space Administration — Spectral reflectance measurements of flat field targets as reference points representative of pseudo-invariant targets as measured by Spectron SE590 spectrophotometer

  20. Targets for Precision Measurements

    Science.gov (United States)

    Loveland, W.; Yao, L.; Asner, D. M.; Baker, R. G.; Bundgaard, J.; Burgett, E.; Cunningham, M.; Deaven, J.; Duke, D. L.; Greife, U.; Grimes, S.; Heffner, M.; Hill, T.; Isenhower, D.; Klay, J. L.; Kleinrath, V.; Kornilov, N.; Laptev, A. B.; Massey, T. N.; Meharchand, R.; Qu, H.; Ruz, J.; Sangiorgio, S.; Selhan, B.; Snyder, L.; Stave, S.; Tatishvili, G.; Thornton, R. T.; Tovesson, F.; Towell, D.; Towell, R. S.; Watson, S.; Wendt, B.; Wood, L.

    2014-05-01

    The general properties needed in targets (sources) for high precision, high accuracy measurements are reviewed. The application of these principles to the problem of developing targets for the Fission TPC is described. Longer term issues, such as the availability of actinide materials, improved knowledge of energy losses and straggling and the stability of targets during irradiation are also discussed.

  1. Setting Asset Performance Targets

    NARCIS (Netherlands)

    Green, D.; Hodkiewicz, M.; Masschelein, S.; Schoenmaker, R.; Muruvan, S.

    2015-01-01

    Setting targets is a common way for organisations to establish performance expectations. However the validity of targets is challenged when performance is influenced by factors beyond the control of the manager. This project examines the issue of target setting for a single asset performance measure

  2. CD8 and CD4 epitope predictions in RV144: no strong evidence of a T-cell driven sieve effect in HIV-1 breakthrough sequences from trial participants.

    Directory of Open Access Journals (Sweden)

    Kalpana Dommaraju

    Full Text Available The modest protection afforded by the RV144 vaccine offers an opportunity to evaluate its mechanisms of protection. Differences between HIV-1 breakthrough viruses from vaccine and placebo recipients can be attributed to the RV144 vaccine as this was a randomized and double-blinded trial. CD8 and CD4 T cell epitope repertoires were predicted in HIV-1 proteomes from 110 RV144 participants. Predicted Gag epitope repertoires were smaller in vaccine than in placebo recipients (p = 0.019. After comparing participant-derived epitopes to corresponding epitopes in the RV144 vaccine, the proportion of epitopes that could be matched differed depending on the protein conservation (only 36% of epitopes in Env vs 84-91% in Gag/Pol/Nef for CD8 predicted epitopes or on vaccine insert subtype (55% against CRF01_AE vs 7% against subtype B. To compare predicted epitopes to the vaccine, we analyzed predicted binding affinity and evolutionary distance measurements. Comparisons between the vaccine and placebo arm did not reveal robust evidence for a T cell driven sieve effect, although some differences were noted in Env-V2 (0.022≤p-value≤0.231. The paucity of CD8 T cell responses identified following RV144 vaccination, with no evidence for V2 specificity, considered together both with the association of decreased infection risk in RV 144 participants with V-specific antibody responses and a V2 sieve effect, lead us to hypothesize that this sieve effect was not T cell specific. Overall, our results did not reveal a strong differential impact of vaccine-induced T cell responses among breakthrough infections in RV144 participants.

  3. Development of distributed target

    CERN Document Server

    Yu Hai Jun; Li Qin; Zhou Fu Xin; Shi Jin Shui; Ma Bing; Chen Nan; Jing Xiao Bing

    2002-01-01

    Linear introduction accelerator is expected to generate small diameter X-ray spots with high intensity. The interaction of the electron beam with plasmas generated at the X-ray converter will make the spot on target increase with time and debase the X-ray dose and the imaging resolving power. A distributed target is developed which has about 24 pieces of thin 0.05 mm tantalum films distributed over 1 cm. due to the structure adoption, the distributed target material over a large volume decreases the energy deposition per unit volume and hence reduces the temperature of target surface, then reduces the initial plasma formalizing and its expansion velocity. The comparison and analysis with two kinds of target structures are presented using numerical calculation and experiments, the results show the X-ray dose and normalized angle distribution of the two is basically the same, while the surface of the distributed target is not destroyed like the previous block target

  4. Search for 14.4 keV solar axions emitted in the M1-transition of $^{57}$Fe nuclei with CAST

    CERN Document Server

    Andriamonje, S; Autiero, D; Barth, K; Belov, A; Beltrán, B; Bräuninger, H; Carmona, J M; Cebrián, S; Collar, J I; Dafni, T; Davenport, M; Di Lella, L; Eleftheriadis, C; Englhauser, J; Fanourakis, G K; Ferrer-Ribas, E; Fischer, H; Franz, J; Friedrich, P; Geralis, T; Giomataris, Yu; Gninenko, S; Gómez, H; Hasinoff, M; Heinsius, F H; Hoffmann, D H H; Irastorza, I G; Jacoby, J; Jakovčić, K; Kang, D; Königsmann, K C; Kotthaus, R; Krčmar, M; Kousouris, K; Kuster, M; Lakić, B; Lasseur, C; Liolios, A; Ljubičić, A; Lutz, G; Luzón, G; Miller, D; Morales, J; Ortiz, A; Papaevangelou, T; Placci, A; Raffelt, G; Riege, H; Rodríguez, A; Ruz, J; Savvidis, I; Semertzidis, Y; Serpico, P; Stewart, L; Vieira, J; Villar, J; Vogel, J; Walckiers, L; Zioutas, K

    2009-01-01

    We have searched for 14.4 keV solar axions or more general axion-like particles (ALPs), that may be emitted in the M1 nuclear transition of 57Fe, by using the axion-to-photon conversion in the CERN Axion Solar Telescope (CAST) with evacuated magnet bores (Phase I). From the absence of excess of the monoenergetic X-rays when the magnet was pointing to the Sun, we set model-independent constraints on the coupling constants of pseudoscalar particles that couple to two photons and to a nucleon g_{a\\gamma} |-1.19 g_{aN}^{0}+g_{aN}^{3}|<1.36\\times 10^{-16} GeV^{-1} for m_{a}<0.03 eV at the 95% confidence level.

  5. Search for 14.4-KeV Solar Axions Emitted in the M1-Transition of Fe-57 Nuclei with CAST

    Energy Technology Data Exchange (ETDEWEB)

    Andriamonje, S.; Aune, S.; /DAPNIA, Saclay; Autiero, D.; /CERN /Lyon, IPN; Barth, K.; /CERN; Belov, A.; /Moscow, INR; Beltran, B.; /Zaragoza U. /Queen' s U., Kingston; Brauninger, H.; /Garching, Max Planck Inst., MPE; Carmona, J.M.; Cebrian, S.; /Zaragoza U.; Collar, J.I.; /Chicago U., EFI /Chicago U., KICP; Dafni, T.; /DAPNIA, Saclay /Darmstadt, Tech. Hochsch. /Zaragoza U.; Davenport, M.; /CERN; Di Lella, L.; /CERN /Pisa, Scuola Normale Superiore; Eleftheriadis, C.; /Aristotle U., Thessaloniki; Englhauser, J.; /Garching, Max Planck Inst., MPE; Fanourakis, G.; /Democritos Nucl. Res. Ctr.; Ferrer-Ribas, E.; /DAPNIA, Saclay; Fischer, H.; Franz, J.; /Freiburg U.; Friedrich, P.; /Garching, Max Planck Inst., MPE; Geralis, T.; /Democritos Nucl. Res. Ctr. /DAPNIA, Saclay /Moscow, INR /Zaragoza U. /British Columbia U. /Freiburg U. /Darmstadt, Tech. Hochsch. /DAPNIA, Saclay /Zaragoza U. /Frankfurt U. /Boskovic Inst., Zagreb /Freiburg U. /Munich, Max Planck Inst. /Boskovic Inst., Zagreb /Democritos Nucl. Res. Ctr. /Darmstadt, Tech. Hochsch. /Garching, Max Planck Inst., MPE /Boskovic Inst., Zagreb /CERN /Aristotle U., Thessaloniki /Boskovic Inst., Zagreb /Munich, Max Planck Inst. /Zaragoza U. /Chicago U., EFI /Chicago U., KICP /Stanford U., Phys. Dept. /SLAC /Zaragoza U. /CERN /DAPNIA, Saclay /CERN /Munich, Max Planck Inst. /Darmstadt, Tech. Hochsch. /Zaragoza U. /Aristotle U., Thessaloniki /Patras U. /Brookhaven /CERN /Munich, Max Planck Inst. /CERN /Chicago U., EFI /Chicago U., KICP /Zaragoza U. /Freiburg U. /CERN /CERN /Patras U.

    2011-12-02

    We have searched for 14.4 keV solar axions or more general axion-like particles (ALPs), that may be emitted in the M1 nuclear transition of 57Fe, by using the axion-to-photon conversion in the CERN Axion Solar Telescope (CAST) with evacuated magnet bores (Phase I). From the absence of excess of the monoenergetic X-rays when the magnet was pointing to the Sun, we set model-independent constraints on the coupling constants of pseudoscalar particles that couple to two photons and to a nucleon g{sub ay}|-1.19g{sub aN}{sup 0}+g{sub aN}{sup 3}| < 1.36 x 10{sup -16} GeV{sup -1} for ma < 0.03 eV at the 95% confidence level.

  6. STEM Electron Diffraction and High Resolution Images Used in the Determination of the Crystal Structure of Au144(SR)60Cluster.

    Science.gov (United States)

    Bahena, Daniel; Bhattarai, Nabraj; Santiago, Ulises; Tlahuice, Alfredo; Ponce, Arturo; Bach, Stephan B H; Yoon, Bokwon; Whetten, Robert L; Landman, Uzi; Jose-Yacaman, Miguel

    2013-03-07

    Determination of the total structure of molecular nanocrystals is an outstanding experimental challenge that has been met, in only a few cases, by single-crystal X-ray diffraction. Described here is an alternative approach that is of most general applicability and does not require the fabrication of a single crystal. The method is based on rapid, time-resolved nanobeam electron diffraction (NBD) combined with high-angle annular dark field scanning/transmission electron microscopy (HAADF-STEM) images in a probe corrected STEM microscope, operated at reduced voltages. The results are compared with theoretical simulations of images and diffraction patterns obtained from atomistic structural models derived through first-principles density functional theory (DFT) calculations. The method is demonstrated by application to determination of the structure of the Au 144 (SCH 2 CH 2 Ph) 60 cluster.

  7. Estimation of continental 187Os/186Os values by using 187Os/186Os and 143Nd/144Nd ratios in marine manganese nodules

    Science.gov (United States)

    Turekian, Karl K.; Luck, Jean-Marc

    1984-01-01

    The relationship between 187Os/186Os and 143Nd/144Nd in different manganese nodule fields is used to determine the 187Os/186Os ratio of the continental terrains bounding the major ocean basins. The Atlantic Ocean drainages yield 187Os/186Os of about 11; the Pacific Ocean, between 25 and 36; and the western Indian Ocean, 20. By assuming a two-component continental crust composed of “ultramafic rocks” (high Os concentration, low 187Os/186Os) and “granite” with only radiogenic 187Os produced in accessory Re-bearing molybdenite, the ultramafic contribution to weathering is about 0.2%. Some or most of this may come from the alteration of oceanic ultramafics. PMID:16578780

  8. Hidden Components in Aqueous "Gold-144" Fractionated by PAGE: High-Resolution Orbitrap ESI-MS Identifies the Gold-102 and Higher All-Aromatic Au-pMBA Cluster Compounds.

    Science.gov (United States)

    Alvarez, Marcos M; Chen, Jenny; Plascencia-Villa, Germán; Black, David M; Griffith, Wendell P; Garzón, Ignacio L; José-Yacamán, Miguel; Demeler, Borries; Whetten, Robert L

    2016-07-07

    Experimental and theoretical evidence reveals the resilience and stability of the larger aqueous gold clusters protected with p-mercaptobenzoic acid ligands (pMBA) of composition Aun(pMBA)p or (n, p). The Au144(pMBA)60, (144, 60), or gold-144 aqueous gold cluster is considered special because of its high symmetry, abundance, and icosahedral structure as well as its many potential uses in material and biological sciences. Yet, to this date, direct confirmation of its precise composition and total structure remains elusive. Results presented here from characterization via high-resolution electrospray ionization mass spectrometry on an Orbitrap instrument confirm Au102(pMBA)44 at isotopic resolution. Further, what usually appears as a single band for (144, 60) in electrophoresis (PAGE) is shown to also contain the (130, 50), recently determined to have a truncated-decahedral structure, and a (137, 56) component in addition to the dominant (144, 60) compound of chiral-icosahedral structure. This finding is significant in that it reveals the existence of structures never before observed in all-aromatic water-soluble species while pointing out the path toward elucidation of the thermodynamic control of protected gold nanocrystal formation.

  9. Inertial Confinement fusion targets

    Science.gov (United States)

    Hendricks, C. D.

    1982-01-01

    Inertial confinement fusion (ICF) targets are made as simple flat discs, as hollow shells or as complicated multilayer structures. Many techniques were devised for producing the targets. Glass and metal shells are made by using drop and bubble techniques. Solid hydrogen shells are also produced by adapting old methods to the solution of modern problems. Some of these techniques, problems, and solutions are discussed. In addition, the applications of many of the techniques to fabrication of ICF targets is presented.

  10. Target Window Reliability

    Energy Technology Data Exchange (ETDEWEB)

    Woloshun, Keith Albert [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-02-11

    The target window design implemented and tested in experiments at ANL have performed without failure for the available beam of 6 mm FWHM on a 12 mm diameter target. However, scaling that design to a 25 mm diameter target size for a 12 mm FWHM beam has proven problematic. Combined thermal and mechanical (pressure induced) stresses and strains are too high to maintain the small coolant gaps and provide adequate fatigue lifetime.

  11. The ISOLDE target robots

    CERN Multimedia

    Maximilein Brice

    2002-01-01

    ISOLDE targets need to be changed frequently, around 80 times per year. The high radiation levels do not permit this to be done by human hands and the target changes are effected by 2 industrial robots (picture _01). On the left, in the distance, the front-end of the GPS (General Purpose Separator) is seen, while the HRS (High Resolution Separator) is at the right. Also seen are the doors to the irradiated-target storage.

  12. Targeting the tumor microenvironment

    Energy Technology Data Exchange (ETDEWEB)

    Kenny, P.A.; Lee, G.Y.; Bissell, M.J.

    2006-11-07

    Despite some notable successes cancer remains, for the most part, a seemingly intractable problem. There is, however, a growing appreciation that targeting the tumor epithelium in isolation is not sufficient as there is an intricate mutually sustaining synergy between the tumor epithelial cells and their surrounding stroma. As the details of this dialogue emerge, new therapeutic targets have been proposed. The FDA has already approved drugs targeting microenvironmental components such as VEGF and aromatase and many more agents are in the pipeline. In this article, we describe some of the 'druggable' targets and processes within the tumor microenvironment and review the approaches being taken to disrupt these interactions.

  13. Target Assembly Facility

    Data.gov (United States)

    Federal Laboratory Consortium — The Target Assembly Facility integrates new armor concepts into actual armored vehicles. Featuring the capability ofmachining and cutting radioactive materials, it...

  14. Target visibility for multiple maneuvering target tracking

    Science.gov (United States)

    Sabordo, Madeleine G.; Aboutanios, Elias

    2015-05-01

    We present a recursion of the probability of target visibility and its applications to analysis of track life and termination in the context of Global Nearest Neighbour (GNN) approach and Probability Hypothesis Density (PHD) filter. In the presence of uncertainties brought about by clutter; decisions to retain a track, terminate it or initialise a new track are based on probability, rather than on distance criterion or estimation error. The visibility concept is introduced into a conventional data-association-oriented multitarget tracker, the GNN; and a random finite set based-tracker, the PHD filter, to take into account instances when targets become invisible or occluded by obstacles. We employ the natural logarithmof the Dynamic Error Spectrum to assess the performance of the trackers with and without probability of visibility incorporated. Simulation results show that the performance of the GNN tracker with visibility concept incorporated is significantly enhanced.

  15. Frozen spin targets

    CERN Document Server

    Parsons, A S L

    1976-01-01

    Describes six projects which use the frozen-spin principle: Helium-3 R.M.S. and longitudinally polarized frozen spin targets at Rutherford Laboratory, and the frozen spin targets at KEK, Saclay and the one used by the CERN-Helsinki collaboration. (7 refs).

  16. Seedling root targets

    Science.gov (United States)

    Diane L. Haase

    2011-01-01

    Roots are critical to seedling performance after outplanting. Although root quality is not as quick and simple to measure as shoot quality, target root characteristics should be included in any seedling quality assessment program. This paper provides a brief review of root characteristics most commonly targeted for operational seedling production. These are: root mass...

  17. Strategic Targeted Advertising

    NARCIS (Netherlands)

    A. Galeotti; J.L. Moraga-Gonzalez (José Luis)

    2003-01-01

    textabstractWe present a strategic game of pricing and targeted-advertising. Firms can simultaneously target price advertisements to different groups of customers, or to the entire market. Pure strategy equilibria do not exist and thus market segmentation cannot occur surely. Equilibria exhibit

  18. Segmented Target Design

    Science.gov (United States)

    Merhi, Abdul Rahman; Frank, Nathan; Gueye, Paul; Thoennessen, Michael; MoNA Collaboration

    2013-10-01

    A proposed segmented target would improve decay energy measurements of neutron-unbound nuclei. Experiments like this have been performed at the National Superconducting Cyclotron Laboratory (NSCL) located at Michigan State University. Many different nuclei are produced in such experiments, some of which immediately decay into a charged particle and neutron. The charged particles are bent by a large magnet and measured by a suite of charged particle detectors. The neutrons are measured by the Modular Neutron Array (MoNA) and Large Multi-Institutional Scintillation Array (LISA). With the current target setup, a nucleus in a neutron-unbound state is produced with a radioactive beam impinged upon a beryllium target. The resolution of these measurements is very dependent on the target thickness since the nuclear interaction point is unknown. In a segmented target using alternating layers of silicon detectors and Be-targets, the Be-target in which the nuclear reaction takes place would be determined. Thus the experimental resolution would improve. This poster will describe the improvement over the current target along with the status of the design. Work supported by Augustana College and the National Science Foundation grant #0969173.

  19. The CNGS target

    CERN Multimedia

    Patrice Loïez

    2005-01-01

    The CERN Neutrinos to Gran Sasso (CNGS) target ‘magazine’ of five target units. Each unit contains a series of 10-cm long graphite rods distributed over a length of 2 m. It is designed to maximize the number of secondary particles produced and hence the number of neutrinos. One unit is used at a time to prevent over heating.

  20. Chemical and biological evaluation of {sup 153}Sm and {sup 46/47}Sc complexes of indazolebisphosphonates for targeted radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Neves, Maria, E-mail: mneves@itn.p [Instituto Tecnologico e Nuclear, Sacavem (Portugal); Teixeira, Fatima C.; Antunes, Ines [INETI-Departamento de Tecnologia de Industrias Quimicas, Lisboa (Portugal); Majkowska, Agnieszka [Institute of Nuclear Chemistry and Technology, Warsaw (Poland); Gano, Lurdes [Instituto Tecnologico e Nuclear, Sacavem (Portugal); Santos, Ana Cristina [IBB-Instituto de Biofisica e Biomatematica, Coimbra (Portugal)

    2011-01-15

    Introduction: Novel 1-hydroxy-1,1-bisphosphonates derived from indazole and substituted at the C-3 position were labeled with the radionuclides {sup 46}Sc and {sup 153}Sm. Several parameters such as molar ligand concentration, pH, reaction time and temperature were studied. The radiolabelling yield, reaction kinetics and stability were assessed and radiocomplexes were evaluated by in vitro and in vivo experiments. Methods: The radionuclides {sup 46}Sc and {sup 153}Sm were obtained by neutron irradiation of natural Sc{sub 2}O{sub 3} and enriched {sup 152}Sm{sub 2}O{sub 3} (98.4%) targets at the neutron flux of 3x10{sup 14} n cm{sup -2} s{sup -1}. The radiolabelling yield, reaction kinetics and stability were accomplished by ascending instant thin layer chromatography. The radiocomplexes were submitted to in vitro experiments (hydroxyapatite binding and lipophilicity) and biodistribution studies in animal models. Results: The radionuclides {sup 46}Sc and {sup 153}Sm were produced with specific activities of 100 and 430 MBq mg{sup -1}, respectively. High radiochemical yields were achieved and the hydrophilic radiocomplexes have shown high degree of binding to hydroxyapatite. Biodistribution studies at 1, 3 and 24 h of the 4 radiocomplexes under study, have showed a similar biodistribution profile with a relatively high bone uptake, slow clearance from blood and a very slow rate of total radioactivity excretion from the whole animal body. Conclusion: We have developed a new class of indazolebisphosphonates complexes with radioisotopes of samarium and scandium. All complexes have shown high degree of binding to hydroxyapatite, which could be attributed to the ionized phosphonate groups. The bone uptake and the bone-to-muscle ratios were relatively low.

  1. Targeted therapy in lymphoma

    Directory of Open Access Journals (Sweden)

    Cavalli Franco

    2010-11-01

    Full Text Available Abstract Discovery of new treatments for lymphoma that prolong survival and are less toxic than currently available agents represents an urgent unmet need. We now have a better understanding of the molecular pathogenesis of lymphoma, such as aberrant signal transduction pathways, which have led to the discovery and development of targeted therapeutics. The ubiquitin-proteasome and the Akt/mammalian target of rapamycin (mTOR pathways are examples of pathological mechanisms that are being targeted in drug development efforts. Bortezomib (a small molecule protease inhibitor and the mTOR inhibitors temsirolimus, everolimus, and ridaforolimus are some of the targeted therapies currently being studied in the treatment of aggressive, relapsed/refractory lymphoma. This review will discuss the rationale for and summarize the reported findings of initial and ongoing investigations of mTOR inhibitors and other small molecule targeted therapies in the treatment of lymphoma.

  2. Targets and teamwork

    DEFF Research Database (Denmark)

    Skinner, Timothy C; Lange, Karin S; Hoey, Hilary

    2017-01-01

    with less disagreement about recommended targets. Multiple regression analysis indicated that teams reporting higher HbA1c targets and more target disagreement had parents reporting higher treatment targets. This seemed to partially account for center differences in Hb1Ac. Conclusions: The diabetes care....... Research Design and Methods: Children, under the age of 11 with type 1 diabetes and their parents treated at the study centers participated. Clinical, medical, and demographic data were obtained, along with blood sample for centralized assay. Parents and all members of the diabetes care team completed...... questionnaires on treatment targets for hemoglobin A1c (HbA1c) and recommended frequency of blood glucose monitoring. Results: Totally 1113 (53% male) children (mean age 8.0±2.1years) from 18 centers in 17 countries, along with parents and 113 health-care professionals, participated. There were substantial...

  3. AA antiproton production target

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    The first version of the antiproton production target was a tungsten rod, 11 cm long and 3 mm in diameter. The rod was embedded in graphite, pressure-seated into an outer casing of stainless steel. At the entrance to the target assembly was a scintillator screen, imprinted with circles every 5 mm in radius, which allowed to precisely aim the 26 GeV high-intensity proton beam from the PS onto the centre of the target rod. The scintillator screen was a 1 mm thick plate of Cr-doped alumina. See also 7903034 and 7905091.

  4. 144__Olukosi_drinking wate

    African Journals Online (AJOL)

    User

    Oxygen Demand (BOD5), Dissolved oxygen, Total Dissolved Solids (TDS), Nitrate, Electrical conductivity and pH using standard methods. The values for conductivity (441.57 ±. 107.13µhos/cm) and TDS (220.78 ± 53.56mg/l) were significantly higher for the borehole water samples (P<0.05), while the pH (7.27 ± 0.11) and ...

  5. 144 | P a g e

    African Journals Online (AJOL)

    Fr. Ikenga

    type is materialism. In its essential tenets, it holds that matter is the one and only kind of being - the primary substance and that the universe is a material world and all objects of experience are composed of matter.1 In its most ..... With the crisis of the concept of God, the galaxy of the ethical and spiritual values attendant to ...

  6. Hb San Cataldo [β144(HC1)Lys→Thr; HBB: C.434A > C]: A New Hemoglobin Variant with Increased Affinity for Oxygen.

    Science.gov (United States)

    Vinciguerra, Margherita; Passarello, Cristina; Cassarà, Filippo; Leto, Filippo; Cannata, Monica; Crivello, Anna; Di Salvo, Veronica; Maggio, Aurelio; Giambona, Antonino

    2016-08-01

    A 59-year-old Italian woman came to our center for revaluation of a previous diagnosis of polycythemia vera. The patient presented with a lifelong history of polycythemia, no increase in white blood cells (WBCs) and platelets, and a negative bone marrow biopsy. Analysis of hemoglobin (Hb) fractions showed an abnormal fast moving Hb component. We aimed to determine if this variant was the cause of polycythemia in this patient. A complete blood count (CBC) was performed by an automated cell counter and Hb fractions were determined by high performance liquid chromatography (HPLC). Standard stability tests and oxygen affinity evaluation were also performed. Genomic DNA was extracted from peripheral blood leukocytes using the phenol chloroform method and the entire β-globin gene was analyzed by direct sequencing. At the hematological level, no anemia or hemolysis was observed but an abnormal Hb fraction was detected using cation exchange HPLC. Molecular analysis of the β-globin gene showed heterozygosity for an AAG > ACG substitution at codon 144, resulting in a Lys→Thr amino acid replacement. We demonstrated that this is a new Hb variant with increased oxygen affinity. Its altered physiology is caused by the reduction of 2,3-diphosphoglycerate (2,3-DPG) effects, due to an amino acid substitution in the central pocket near the C-terminal of the β chain. We called this new variant Hb San Cataldo for the native city of proband.

  7. Excitation energy dependence of fragment-mass distributions from fission of 180,190Hg formed in fusion reactions of 36Ar + 144,154Sm

    Directory of Open Access Journals (Sweden)

    K. Nishio

    2015-09-01

    Full Text Available Mass distributions of fission fragments from the compound nuclei 180Hg and 190Hg formed in fusion reactions 36Ar + 144Sm and 36Ar + 154Sm, respectively, were measured at initial excitation energies of E⁎(Hg180=33–66 MeV and E⁎(Hg190=48–71 MeV. In the fission of 180Hg, the mass spectra were well reproduced by assuming only an asymmetric-mass division, with most probable light and heavy fragment masses A¯L/A¯H=79/101. The mass asymmetry for 180Hg agrees well with that obtained in the low-energy β+/EC-delayed fission of 180Tl, from our earlier ISOLDE(CERN experiment. Fission of 190Hg is found to proceed in a similar way, delivering the mass asymmetry of A¯L/A¯H=83/107, throughout the measured excitation energy range. The persistence as a function of excitation energy of the mass-asymmetric fission for both proton-rich Hg isotopes gives strong evidence for the survival of microscopic effects up to effective excitation energies of compound nuclei as high as 40 MeV. This behavior is different from fission of actinide nuclei and heavier mercury isotope 198Hg.

  8. Collision-induced dissociation of monolayer protected clusters Au144 and Au130 in an electrospray time-of-flight mass spectrometer.

    Science.gov (United States)

    Black, David M; Bhattarai, Nabraj; Whetten, Robert L; Bach, Stephan B H

    2014-11-13

    Gas-phase reactions of larger gold clusters are poorly known because generation of the intact parent species for mass spectrometric analysis remains quite challenging. Herein we report in-source collision-induced dissociation (CID) results for the monolayer protected clusters (MPCs) Au144(SR)60 and Au130(SR)50, where R- = PhCH2CH2-, in a Bruker micrOTOF time-of-flight mass spectrometer. A sample mixture of the two clusters was introduced into the mass spectrometer by positive mode electrospray ionization. Standard source conditions were used to acquire a reference mass spectrum, exhibiting negligible fragmentation, and then the capillary-skimmer potential difference was increased to induce in-source CID within this low-pressure region (∼4 mbar). Remarkably, distinctive fragmentation patterns are observed for each MPC[3+] parent ion. An assignment of all the major dissociation products (ions and neutrals) is deduced and interpreted by using the distinguishing characteristics in the standard structure-models for the respective MPCs. Also, we propose a ring-forming elimination mechanism to explain R-H neutral loss, as separate from the channels leading to RS-SR or (AuSR)4 neutrals.

  9. Site directed mutagenesis experiments suggest that Glu 111, Glu 144 and Arg 145 are essential for endonucleolytic activity of EcoRI.

    Science.gov (United States)

    Wolfes, H; Alves, J; Fliess, A; Geiger, R; Pingoud, A

    1986-11-25

    We have constructed a plasmid (pRIF 309+) carrying the EcoRI restriction endonuclease gene and the f1 origin of replication. Upon transformation of this plasmid into E. coli and infection with bacteriophage f1 single stranded plasmids are produced which can be used for sequencing and site directed mutagenesis. Using this single stranded DNA and synthetic oligodeoxynucleotides we have introduced point mutations at defined positions of the EcoRI gene. Since in pRIF309+ the EcoRI gene is under the control of the pL-promoter, high level expression of the mutated EcoRI gene could be obtained upon induction. Mutant EcoRI enzymes were purified to homogeneity and characterized in structural and functional terms. Our results demonstrate that the Glu 111----Gln, Glu 144----Gln and Arg 145----Lys -mutants adopt a very similar conformation as the wild type enzyme, but have by two orders of magnitude smaller specific activities than the wild type enzyme, mainly due to a reduction of the Vmax-value.

  10. 1 λ × 1.44 Tb/s free-space IM-DD transmission employing OAM multiplexing and PDM.

    Science.gov (United States)

    Zhu, Yixiao; Zou, Kaiheng; Zheng, Zhennan; Zhang, Fan

    2016-02-22

    We report the experimental demonstration of single wavelength terabit free-space intensity modulation direct detection (IM-DD) system employing both orbital angular momentum (OAM) multiplexing and polarization division multiplexing (PDM). In our experiment, 12 OAM modes with two orthogonal polarization states are used to generate 24 channels for transmission. Each channel carries 30 Gbaud Nyquist PAM-4 signal. Therefore an aggregate gross capacity record of 1.44 Tb/s (12 × 2 × 30 × 2 Gb/s) is acheived with a modulation efficiency of 48 bits/symbol. After 0.8m free-space transmission, the bit error rates (BERs) of all the channels are below the 20% hard-decision forward error correction (HD-FEC) threshold of 1.5 × 10(-2). After applying the decision directed recursive least square (DD-RLS) based filter and post filter, the BERs of two polarizations can be reduced from 5.3 × 10(-3) and 7.3 × 10(-3) to 2.2 × 10(-3) and 3.4 × 10(-3), respectively.

  11. Target Price Accuracy

    Directory of Open Access Journals (Sweden)

    Alexander G. Kerl

    2011-04-01

    Full Text Available This study analyzes the accuracy of forecasted target prices within analysts’ reports. We compute a measure for target price forecast accuracy that evaluates the ability of analysts to exactly forecast the ex-ante (unknown 12-month stock price. Furthermore, we determine factors that explain this accuracy. Target price accuracy is negatively related to analyst-specific optimism and stock-specific risk (measured by volatility and price-to-book ratio. However, target price accuracy is positively related to the level of detail of each report, company size and the reputation of the investment bank. The potential conflicts of interests between an analyst and a covered company do not bias forecast accuracy.

  12. Optimal exploration target zones

    CSIR Research Space (South Africa)

    Debba, Pravesh

    2008-09-01

    Full Text Available This research describes a quantitative methodology for deriving optimal exploration target zones based on a probabilistic mineral prospectivity map. In order to arrive at out objective, we provide a plausible answer to the following question: "Which...

  13. Delays in thick targets

    CERN Document Server

    Bennett, J R J

    2002-01-01

    The delays in the emission of radioactive particles from a thick target bombarded by high-energy protons is discussed in relation to the basic physical processes of diffusion and effusion through the target and ioniser. The delay time, relative to the decay time, is crucial to the efficiency of particle release at the exit of the ioniser. The principles of minimizing the delay times are discussed with reference to a mathematical model of the process, and some experimental examples are given.

  14. An ISOLDE target unit

    CERN Multimedia

    Maximilien Brice

    2002-01-01

    A good dozen different targets are available for ISOLDE, made of different materials and equipped with different kinds of ion-sources, according to the needs of the experiments. Each separator (GPS: general purpose; HRS: high resolution) has its own target. Because of the high radiation levels, robots effect the target changes, about 80 times per year. In the standard unit shown in picture _01, the target is the cylindrical object in the front. It contains uranium-carbide kept at a temperature of 2200 deg C, necessary for the isotopes to be able to escape. At either end, one sees the heater current leads, carrying 700 A. The Booster beam, some 3E13 protons per pulse, enters the target from left. The evaporated isotope atoms enter a hot-plasma ion source (the black object behind the target). The whole unit sits at 60 kV potential (pulsed in synchronism with the arrival of the Booster beam) which accelerates the ions (away from the viewer) towards one of the 2 separators.

  15. Efficacy and safety of a once-daily single-tablet regimen of tenofovir, lamivudine, and efavirenz assessed at 144 weeks among antiretroviral-naive and experienced HIV-1-infected Thai adults

    NARCIS (Netherlands)

    Avihingsanon, A.; Maek, A.N.W.; Gatechompol, S.; Sapsirisavat, V.; Thiansanguankul, W.; Sophonphan, J.; Thammajaruk, N.; Ubolyam, S.; Burger, D.M.; Ruxrungtham, K.

    2017-01-01

    OBJECTIVE: To assess the efficacy and safety of a new single-tablet regimen (STR) of tenofovir disoproxil fumarate (TDF) 300mg, lamivudine (3TC) 300mg, and efavirenz (EFV) 600mg in HIV-infected Thai patients. METHODS: This was a prospective study performed for 144 weeks among 51 treatment-naive

  16. Construction of All-Solid-State Batteries based on a Sulfur-Graphene Composite and Li9.54 Si1.74 P1.44 S11.7 Cl0.3 Solid Electrolyte.

    Science.gov (United States)

    Xu, Ruochen; Wu, Zhang; Zhang, Shenzhao; Wang, Xiuli; Xia, Yan; Xia, Xinhui; Huang, Xiaohua; Tu, Jiangping

    2017-10-09

    Herein an effective way for construction of all-solid-state lithium-sulfur batteries (LSBs) with sulfur/reduced graphene oxide (rGO) and Li9.54 Si1.74 P1.44 S11.7 Cl0.3 solid electrolyte is reported. In the composite cathode, the Li9.54 Si1.74 P1.44 S11.7 Cl0.3 powder is homogeneously mixed with the S/rGO composite to enhance the ionic conductivity. Coupled with a metallic Li anode and solid electrolyte, the designed S/rGO-Li9.54 Si1.74 P1.44 S11.7 Cl0.3 composite cathode exhibits a high specific capacity and good cycling stability. A high initial discharge capacity of 969 mAh g(-1) is achieved at a current density of 80 mA g(-1) at room temperature and the cell retains a reversible capacity of over 827 mAh g(-1) after 60 cycles. The enhanced performance is attributed to the intimate contact between the S/rGO and Li9.54 Si1.74 P1.44 S11.7 Cl0.3 electrolyte, and high electrical conductivity of rGO and high ionic conductivity of the solid electrolyte. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Burglar Target Selection

    Science.gov (United States)

    Townsley, Michael; Bernasco, Wim; Ruiter, Stijn; Johnson, Shane D.; White, Gentry; Baum, Scott

    2015-01-01

    Objectives: This study builds on research undertaken by Bernasco and Nieuwbeerta and explores the generalizability of a theoretically derived offender target selection model in three cross-national study regions. Methods: Taking a discrete spatial choice approach, we estimate the impact of both environment- and offender-level factors on residential burglary placement in the Netherlands, the United Kingdom, and Australia. Combining cleared burglary data from all study regions in a single statistical model, we make statistical comparisons between environments. Results: In all three study regions, the likelihood an offender selects an area for burglary is positively influenced by proximity to their home, the proportion of easily accessible targets, and the total number of targets available. Furthermore, in two of the three study regions, juvenile offenders under the legal driving age are significantly more influenced by target proximity than adult offenders. Post hoc tests indicate the magnitudes of these impacts vary significantly between study regions. Conclusions: While burglary target selection strategies are consistent with opportunity-based explanations of offending, the impact of environmental context is significant. As such, the approach undertaken in combining observations from multiple study regions may aid criminology scholars in assessing the generalizability of observed findings across multiple environments. PMID:25866418

  18. The Sinuous Target

    Energy Technology Data Exchange (ETDEWEB)

    Zwaska, R. [Fermilab

    2015-06-01

    We report on the concept for a target material comprised of a multitude of interlaced wires of small dimension. This target material concept is primarily directed at high-power neutrino targets where the thermal shock is large due to small beam sizes and short durations; it also has applications to other high-power targets, particularly where the energy deposition is great or a high surface area is preferred. This approach ameliorates the problem of thermal shock by engineering a material with high strength on the micro-scale, but a very low modulus of elasticity on the meso-scale. The low modulus of elasticity is achieved by constructing the material of spring-like wire segments much smaller than the beam dimension. The intrinsic bends of the wires will allow them to absorb the strain of thermal shock with minimal stress. Furthermore, the interlaced nature of the wires provides containment of any segment that might become loose. We will discuss the progress on studies of analogue materials and fabrication techniques for sinuous target materials.

  19. A Brief Review of Past INL Work Assessing Radionuclide Content in TMI-2 Melted Fuel Debris: The Use of 144Ce as a Surrogate for Pu Accountancy

    Energy Technology Data Exchange (ETDEWEB)

    D. L. Chichester; S. J. Thompson

    2013-09-01

    This report serves as a literature review of prior work performed at Idaho National Laboratory, and its predecessor organizations Idaho National Engineering Laboratory (INEL) and Idaho National Engineering and Environmental Laboratory (INEEL), studying radionuclide partitioning within the melted fuel debris of the reactor of the Three Mile Island 2 (TMI-2) nuclear power plant. The purpose of this review is to document prior published work that provides supporting evidence of the utility of using 144Ce as a surrogate for plutonium within melted fuel debris. When the TMI-2 accident occurred no quantitative nondestructive analysis (NDA) techniques existed that could assay plutonium in the unconventional wastes from the reactor. However, unpublished work performed at INL by D. W. Akers in the late 1980s through the 1990s demonstrated that passive gamma-ray spectrometry of 144Ce could potentially be used to develop a semi-quantitative correlation for estimating plutonium content in these materials. The fate and transport of radioisotopes in fuel from different regions of the core, including uranium, fission products, and actinides, appear to be well characterized based on the maximum temperature reached by fuel in different parts of the core and the melting point, boiling point, and volatility of those radioisotopes. Also, the chemical interactions between fuel, fuel cladding, control elements, and core structural components appears to have played a large role in determining when and how fuel relocation occurred in the core; perhaps the most important of these reaction appears to be related to the formation of mixed-material alloys, eutectics, in the fuel cladding. Because of its high melting point, low volatility, and similar chemical behavior to plutonium, the element cerium appears to have behaved similarly to plutonium during the evolution of the TMI-2 accident. Anecdotal evidence extrapolated from open-source literature strengthens this logical feasibility for

  20. Setting reference targets

    Energy Technology Data Exchange (ETDEWEB)

    Ruland, R.E.

    1997-04-01

    Reference Targets are used to represent virtual quantities like the magnetic axis of a magnet or the definition of a coordinate system. To explain the function of reference targets in the sequence of the alignment process, this paper will first briefly discuss the geometry of the trajectory design space and of the surveying space, then continue with an overview of a typical alignment process. This is followed by a discussion on magnet fiducialization. While the magnetic measurement methods to determine the magnetic centerline are only listed (they will be discussed in detail in a subsequent talk), emphasis is given to the optical/mechanical methods and to the task of transferring the centerline position to reference targets.

  1. Targeted Therapy of CLL.

    Science.gov (United States)

    Al-Sawaf, Othman; Fischer, Kirsten; Eichhorst, Barbara; Hallek, Michael

    2016-01-01

    The landscape of chronic lymphocytic leukemia (CLL) has undergone profound changes in the past years. First, the addition of CD20-targeting antibodies to conventional chemotherapy has improved the therapeutic outcome in the majority of CLL patients. Since the establishment of the critical role of the B cell receptor signaling pathway in the pathogenesis of CLL, several agents have been developed to target this pathway. Ibrutinib and idelalisib, 2 potent kinase inhibitors, have both become available for CLL therapy in the first and second line. Additionally, the observation of high expression levels of the anti-apoptotic mitochondrial protein Bcl-2 in CLL has led to the development of venetoclax, a BH3 mimetic compound that inhibits Bcl-2 and has shown high efficacy in CLL. This short review summarizes preclinical and clinical data on currently available agents in CLL and provides an outlook on upcoming new challenges in the targeted therapy of CLL. © 2016 S. Karger GmbH, Freiburg.

  2. Modelling Recycling Targets

    DEFF Research Database (Denmark)

    Hill, Amanda Louise; Leinikka Dall, Ole; Andersen, Frits M.

    2014-01-01

    Within the European Union (EU) a paradigm shift is currently occurring in the waste sector, where EU waste directives and national waste strategies are placing emphasis on resource efficiency and recycling targets. The most recent Danish resource strategy calculates a national recycling rate of 22......% for household waste, and sets an ambitious goal of a 50% recycling rate by 2020. This study integrates the recycling target into the FRIDA model to project how much waste and from which streams should be diverted from incineration to recycling in order to achieve the target. Furthermore, it discusses how...... the existing technological, organizational and legislative frameworks may affect recycling activities. The results of the analysis show that with current best practice recycling rates, the 50% recycling rate cannot be reached without recycling of household biowaste. It also shows that all Danish municipalities...

  3. Categorizing renal oncocytic neoplasms on core needle biopsy: a morphologic and immunophenotypic study of 144 cases with clinical follow-up.

    Science.gov (United States)

    Alderman, Megan A; Daignault, Stephanie; Wolf, J Stuart; Palapattu, Ganesh S; Weizer, Alon Z; Hafez, Khaled S; Kunju, Lakshmi P; Wu, Angela J

    2016-09-01

    There is limited literature on renal oncocytic neoplasms diagnosed on core biopsy. All renal oncocytic neoplasm core biopsies from 2006 to 2013 were retrospectively reviewed. Morphologic features and an immunohistochemical panel of CK7, c-KIT, and S100A1 were assessed. Concordance with resection diagnosis, statistical analysis including a random forest classification, and follow-up were recorded. The post-immunohistochemical diagnoses of 144 renal oncocytic core biopsies were favor oncocytoma (67%), favor renal cell carcinoma (RCC) (12%), and cannot exclude RCC (21%). Diagnosis was revised following immunohistochemistry in 7% of cases. The most common features for oncocytoma (excluding dense granular cytoplasm) were nested architecture, edematous stroma, binucleation and tubular architecture; the most common features for favor RCC were sheet-like architecture, nuclear pleomorphism, papillary architecture, and prominent cell borders. High nuclear grade, necrosis, extensive papillary architecture, raisinoid nuclei, and frequent mitoses were not seen in oncocytomas. Comparing the pathologist and random forest classification, the overall out-of-bag estimate of classification error dropped from 23% to 13% when favor RCC and cannot exclude RCC were combined into 1 category. Resection was performed in 19% (28 cases) with a 94% concordance (100% of favor RCC biopsies and 90% of cannot exclude RCC biopsies confirmed as RCC; 83% of favor oncocytomas confirmed); ablation in 23%; and surveillance in 46%. Follow-up was available in 92% (median follow-up, 33months) with no adverse outcomes. Renal oncocytic neoplasms comprise a significant subset (16%) of all core biopsies, and the majority (78%) can be classified as favor oncocytoma or favor RCC. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Regulation of plasma factor XIII levels in healthy individuals; a major impact by subunit B intron K c.1952+144 C>G polymorphism.

    Science.gov (United States)

    Mezei, Zoltán A; Katona, Éva; Kállai, Judit; Bereczky, Zsuzsanna; Molnár, Éva; Kovács, Bettina; Ajzner, Éva; Bagoly, Zsuzsa; Miklós, Tünde; Muszbek, László

    2016-12-01

    The regulation of plasma factor XIII (FXIII) levels in healthy individuals has been only partially explored. The identification of major non-genetic and genetic regulatory factors might provide important information on the contribution of FXIII to the risk of cardio/cerebrovascular diseases. To determine the effect of age, smoking, BMI, fibrinogen concentration on plasma FXIII activity, complex FXIII antigen (FXIII-A2B2) and total FXIII-B subunit (tFXIII-B) level, to correlate FXIII-B level with the other two FXIII parameters and to assess the variation of FXIII levels in carriers of major FXIII subunit polymorphisms. 268 healthy individuals were enrolled in the study. FXIII activity was measured by the ammonia release assay; FXIII-A2B2 and tFXIII-B were determined by ELISAs. FXIII-A p.Val34Leu, FXIII-B p.His95Arg and FXIII-B intron K c.1952+144 C>G polymorphisms were identified by RT-PCR using melting point analysis with fluorescence resonance energy transfer detection. All investigated FXIII parameters showed significant positive correlation with age and fibrinogen level; gender and BMI influenced only tFXIII-B. A highly significant positive correlation was demonstrated between tFXIII-B and the other FXIII parameters. FXIII-A p.Val34Leu polymorphism had only slight, if any effect on FXIII levels. The FXIII-B Arg95 allele moderately increased all three FXIII parameters, but the effect became statistically significant only after adjustment. The FXIII-B intron K G allele drastically decreased FXIII levels, and it seemed to be in synergism with the FXIII-A Leu34 allele. Plasma FXIII levels are subjected to multifactorial regulation, in which age, fibrinogen level and FXIII-B intron K polymorphism are major determinants. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Radiolesão vascular como efeito deletério da braquiterapia intra-arterial com dose elevada de Samário-153 em coelhos hipercolesterolêmicos Vascular radiolesion as a deleterious effect of high-dose-rate intraarterial brachytherapy with Samarium-153 in hypercholesterolemic rabbits

    Directory of Open Access Journals (Sweden)

    Dalton Bertolim Précoma

    2006-10-01

    Full Text Available OBJETIVO: Este estudo tem por objetivo avaliar as alterações vasculares morfológicas e morfométricas induzidas pela braquiterapia com Samário-153 (153 Sm em coelhos hipercolesterolêmicos, com doses elevadas. MÉTODOS: Foram analisados 43 coelhos hipercolesterolêmicos, brancos, da raça New Zealand, e o total de 86 artérias ilíacas submetidas a lesão por balão de angioplastia. Divididos em três grupos: dois (GI irradiados com as doses de 15Gy (n=14 e 60Gy (n=36 e um grupo controle (n=36. Foram realizadas avaliação histológica morfométrica e análise histológica qualitativa para análise tecidual. RESULTADOS: Foram observadas uma redução significativa da neoproliferação intimal (NPI no GI 15 Gy (pOBJECTIVE: This study was designed to evaluate vascular morphological and morphometric changes induced by brachytherapy with samarium-153 (Sm-153 at high doses in hypercholesterolemic rabbits. METHODS: Forty-three New Zealand White hypercholesterolemic rabbits were analyzed, and the total of 86 iliac arteries underwent balloon angioplasty injury. The rabbits were divided into three different groups: two irradiation groups (IG assigned to 15 Gy (n=14 and 60 Gy (n=36 irradiation doses, respectively, and a control group (n = 36. Histomorphometric and qualitative histological analyses were performed for tissue evaluation. RESULTS: Significant reductions were found in neointimal proliferation (NIP (p< 0.0001, media area (MA (p<0.0001 and percent stenosis (p<0.0001 in the 15-Gy IG, compared to the other groups. The 60-Gy IG had the higher rate of NIP, increase in media and vessel areas (VA and percent stenosis. The 60-Gy IG also showed the greatest number of xanthomatous cells (60-Gy IG: 86.11% and 15-Gy IG: 14.29%, p<0.0001 and the highest amount of hyaline amorphous tissue (60-Gy IG:58.33% and 15-Gy IG:0%, p=0.0001 and vascular proliferation (60-Gy IG:30.56% and 15-Gy IG:0%, p=0.0221. No statistically significant differences were found

  6. Optimal exploration target zones

    CSIR Research Space (South Africa)

    Debba, Pravesh

    2008-09-01

    Full Text Available , Carranza, Stein, van der Meer Introduction to Remote Sensing Background and Objective of the study Methodology Results Optimal Exploration Target Zones Pravesh Debba1, Emmanual M.J. Carranza2, Alfred Stein2, Freek D. van der Meer2 1CSIR, Logistics... and Quantitative Methods, CSIR Built Environment 2International Institute for Geo-Information Science and Earth Observation (ITC), Hengelosestraat 99, P.O. Box 6, 7500AA Enschede, The Netherlands Optimal Exploration Target Zones Debba, Carranza, Stein, van der Meer...

  7. AA antiproton production target

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    The first version of the antiproton production target was a tungsten rod, 11 cm long (actually a row of 11 rods, each 1 cm long) and 3 mm in diameter. The rod was embedded in graphite, pressure-seated into an outer casing made of stainless steel. The casing had fins for forced-air cooling. In this picture, the 26 GeV high-intensity beam from the PS enters from the right, where a scintillator screen, with circles every 5 mm in radius, permits precise aim at the target centre. See also 7903034 and 7905094.

  8. Aquaporin-2 membrane targeting

    DEFF Research Database (Denmark)

    Olesen, Emma T B; Fenton, Robert A

    2017-01-01

    The targeting of the water channel aquaporin-2 (AQP2) to the apical plasma membrane of kidney collecting duct principal cells is regulated mainly by the antidiuretic peptide hormone arginine vasopressin (AVP). This process is of crucial importance for the maintenance of body water homeostasis...

  9. ISOLDE back on target

    CERN Multimedia

    Anaïs Schaeffer

    2014-01-01

    Today, Friday 1 August, the ISOLDE installation, supplied by the beams of the PS Booster, restarted its physics programme. After a shutdown of almost a year and a half, there was a real buzz in the air as the first beam of protons hit the target of the first post-LS1 ISOLDE experiment.   One of the new target-handling robots installed by ISOLDE during LS1. Many improvements have been made to the ISOLDE installation during LS1. One of the main projects was the installation of new robots for handling the targets (see photo 1). “Our targets are bombarded by protons from the PS Booster’s beams and become very radioactive,” explains Maria Jose Garcia Borge, spokesperson for the ISOLDE collaboration. “They therefore need to be handled carefully, which is where the robots come in. The robots we had until now were already over 20 years old and were starting to suffer from the effects of radiation. So LS1 was a perfect opportunity to replace them with more moder...

  10. Microenvironmental targets in sarcoma

    Directory of Open Access Journals (Sweden)

    Monika eEhnman

    2015-11-01

    Full Text Available Sarcomas are rare malignant tumors affecting all age groups. They are typically classified according to their resemblance to corresponding normal tissue. Their heterogeneous features, for example in terms of disease-driving genetic aberrations and body location, complicate both disease classification and development of novel treatment regimens. Many years of failure of improved patient outcome in clinical trials has lead to the conclusion that novel targeted therapies are likely needed in combination with current multimodality regimens. Sarcomas have not, in contrast to the common carcinomas, been the subject for larger systematic studies on how tumor behavior relates to characteristics of the tumor microenvironment. There is consequently an urgent need for identifying suitable molecular targets, not only in tumor cells, but also in the tumor microenvironment. This review discusses preclinical and clinical data about potential molecular targets in sarcomas. Studies on targeted therapies involving the tumor microenvironment are prioritized. A greater understanding of the biological context is expected to facilitate more successful design of future clinical trials in sarcoma.

  11. Target Heart Rates

    Science.gov (United States)

    ... is your level of intensity? When is the best time of day to work out? Target Heart Rates Warm Up, Cool Down See More >> Getting Active Getting Started - Tips for Long-term Exercise Success Get Moving: Easy Tips to Get Active! ...

  12. Targeted Therapy for Melanoma

    Energy Technology Data Exchange (ETDEWEB)

    Quinn, Thomas [Alphamed, Jackson, TN (United States); Moore, Herbert [Alphamed, Jackson, TN (United States)

    2016-12-05

    The research project, entitled ”Targeted Therapy for Melanoma,” was focused on investigating the use of kidney protection measures to lower the non-specific kidney uptake of the radiolabeled Pb-DOTA-ReCCMSH peptide. Previous published work demonstrated that the kidney exhibited the highest non-target tissue uptake of the 212Pb/203Pb radiolabeled melanoma targeting peptide DOTA-ReCCMSH. The radiolabeled alpha-melanocyte stimulating hormone (α-MSH) peptide analog DOTA-Re(Arg11)CCMSH, which binds the melanocortin-1 receptor over-expressed on melanoma tumor cells, has shown promise as a PRRT agent in pre-clinical studies. High tumor uptake of 212Pb labeled DOTA-Re(Arg11)CCMSH resulted in tumor reduction or eradication in melanoma therapy studies. Of particular note was the 20-50% cure rate observed when melanoma mice were treated with alpha particle emitter 212Pb. However, as with most PRRT agents, high radiation doses to the kidneys where observed. To optimize tumor treatment efficacy and reduce nephrotoxicity, the tumor to kidney uptake ratio must be improved. Strategies to reduce kidney retention of the radiolabeled peptide, while not effecting tumor uptake and retention, can be broken into several categories including modification of the targeting peptide sequence and reducing proximal tubule reabsorption.

  13. Target Chamber Manipulator

    Science.gov (United States)

    Tantillo, Anthony; Watson, Matthew

    2015-11-01

    A system has been developed to allow remote actuation of sensors in a high vacuum target chamber used with a particle accelerator. Typically, sensors of various types are placed into the target chamber at specific radial and angular positions relative to the beam line and target. The chamber is then evacuated and the experiments are performed for those sensor positions. Then, the chamber is opened, the sensors are repositioned to new angles or radii, and the process is repeated, with a separate pump-down cycle for each set of sensor positions. The new sensor positioning system allows scientists to pre-set the radii of up to a dozen sensors, and then remotely actuate their angular positions without breaking the vacuum of the target chamber. This reduces the time required to reposition sensors from 6 hours to 1 minute. The sensors are placed into one of two tracks that are separately actuated using vacuum-grade stepping motors. The positions of the sensors are verified using absolute optical rotary encoders, and the positions are accurate to 0.5 degrees. The positions of the sensors are electronically recorded and time-stamped after every change. User control is through a GUI using LabVIEW.

  14. Active Target Simulation

    Science.gov (United States)

    Smith, Nathan; Draznik, Peter; Frank, Nathan

    2012-10-01

    We have simulated an existing experimental design to determine the resolution improvement upon energy measurements of neutron unbound nuclei. A number of experiments of this type have been performed at the National Superconducting Cyclotron Laboratory (NSCL), located at Michigan State University. An excited nucleus is typically produced with a radioactive beam interacting with a passive Beryllium target. Many different nuclei are produced in experiment, each of which immediately decays into a charged particle and neutron. The charged particles are detected and the neutrons interact in scintillation detectors such as the Modular Neutron Array (MoNA) and Large Multi-Institutional Scintillation Array (LISA). In our simulation, we have constructed an active target that provides additional information such that the point of nuclear interaction within the target may be determined. This information improves the resolution in decay energy measurements of neutron unbound isotopes. This presentation will cover some aspects of the simulation process, as well as showing some of the results that demonstrate the simulated improvement over a passive target.

  15. Neutron fluence and energy reconstruction with the IRSN recoil detector μ-TPC at 27 keV, 144 keV and 565 keV

    Energy Technology Data Exchange (ETDEWEB)

    Maire, D.; Lebreton, L.; Richer, J.P. [IRSN, PRP-HOM, SDE, LMDN, 13115 Saint Paul-Lez-Durance (France); Bosson, G.; Bourrion, O.; Guillaudin, O.; Riffard, Q.; Santos, D. [CNRS/IN2P3-UJF-INPG, LPSC, 38000 Grenoble (France)

    2015-07-01

    The French Institute for Radioprotection and Nuclear Safety (IRSN), associated to the French Metrology Institute (LNE), is developing a time projection chamber using a Micromegas anode: μ-TPC. This work is carried out in collaboration with the Laboratory of Subatomic Physics and Cosmology (LPSC). The aim is to characterize with a primary procedure the energy distribution of neutron fluence in the energy range 8 keV - 1 MeV. The time projection chambers are gaseous detectors, which are able to measure charged particles energy and to reconstruct their track if a pixelated anode is used. In our case, the gas is used as a (n, p) converter in order to detect neutrons down to few keV. Coming from elastic collisions with neutrons, recoil protons lose a part of their kinetic energy by ionizing the gas. The ionization electrons are drifted toward a pixelated anode (2D projection), read at 50 MHz by a self-triggered electronic system to obtain the third track dimension. The neutron energy is reconstructed event by event thanks to proton scattering angle and proton energy measurements. The scattering angle is deduced from the 3D track. The proton energy is obtained by charge collection measurements, knowing the ionization quenching factor (i.e. the part of proton kinetic energy lost by ionizing the gas). The fluence is calculated thanks to the detected events number and the simulated detector response. The μ-TPC is a new reliable detector which enables to measure energy distribution of the neutron fluence without deconvolution or neutron calibration contrary to usual gaseous counters. The μ-TPC is still being developed and measurements have been carried out at the AMANDE facility, with neutrons energies going from 8 keV to 565 keV. After the context and the μ-TPC working principle presentation, measurements of the neutron energy and fluence at 27.2 keV, 144 keV and 565 keV are shown and compared to the complete detector simulation. This work shows the first direct

  16. 87Sr/86Sr and 143Nd/144Nd for disentangling anthropogenic and natural REE contributions in river water during flood events.

    Science.gov (United States)

    Hissler, Christophe; Stille, Peter; Pfister, Laurent

    2017-04-01

    The sustainable management of water resources is one of the greatest challenges of the 21st century. Water is a vital resource that is increasingly put under pressure from multiple perspectives. While the global population is on the rise, socio-economic development makes equally rapid progress - eventually compromising access to clean water bodies. Multiple pollution sources constitute an immediate threat to aquatic ecosystems and are likely to cause long lasting contaminations of water bodies that are critical for drinking and/or irrigation water production. There is a pressing need for an adequate quantification of anthropogenic impacts on the critical zone of river basins and the identification of the temporal dynamics of these impacts. As an example, despite the work done to assess the environmental impact of REE pollutions in larger river systems, we are still lacking information on the dynamics of these anthropogenic compounds in relation to rapid hydrological changes. Filling these knowledge gaps is a pre-requisite for the design and implementation of sustainable water resources management strategies. In order to better constrain the relative contributions of both anthropogenic and geogenic trace element sources we propose using a multitracer approach combining elemental and 87Sr/86Sr, 143Nd/144Nd, and 206Pb/207Pb isotopic ratios. The use of these three separate isotopic systems together with REE concentrations is new in the field of anthropogenic source identification in river systems. We observed enrichments in Anthropogenic Rare Earth Elements (AREE) for dissolved Gd and suspended Nd loads of river water. With increasing discharge, AREE anomalies progressively disappeared and gave way to the geogenic chemical signature of the basin in both dissolved and suspended loads. The isotopic data confirm these observations and shed new light on the trace elements sources. On the one hand, dissolved loads have peculiar isotopic characteristics and carry mainly

  17. Predicting live birth, preterm delivery, and low birth weight in infants born from in vitro fertilisation: a prospective study of 144,018 treatment cycles.

    Directory of Open Access Journals (Sweden)

    Scott M Nelson

    2011-01-01

    Full Text Available The extent to which baseline couple characteristics affect the probability of live birth and adverse perinatal outcomes after assisted conception is unknown.We utilised the Human Fertilisation and Embryology Authority database to examine the predictors of live birth in all in vitro fertilisation (IVF cycles undertaken in the UK between 2003 and 2007 (n = 144,018. We examined the potential clinical utility of a validated model that pre-dated the introduction of intracytoplasmic sperm injection (ICSI as compared to a novel model. For those treatment cycles that resulted in a live singleton birth (n = 24,226, we determined the associates of potential risk factors with preterm birth, low birth weight, and macrosomia. The overall rate of at least one live birth was 23.4 per 100 cycles (95% confidence interval [CI] 23.2-23.7. In multivariable models the odds of at least one live birth decreased with increasing maternal age, increasing duration of infertility, a greater number of previously unsuccessful IVF treatments, use of own oocytes, necessity for a second or third treatment cycle, or if it was not unexplained infertility. The association of own versus donor oocyte with reduced odds of live birth strengthened with increasing age of the mother. A previous IVF live birth increased the odds of future success (OR 1.58, 95% CI 1.46-1.71 more than that of a previous spontaneous live birth (OR 1.19, 95% CI 0.99-1.24; p-value for difference in estimate <0.001. Use of ICSI increased the odds of live birth, and male causes of infertility were associated with reduced odds of live birth only in couples who had not received ICSI. Prediction of live birth was feasible with moderate discrimination and excellent calibration; calibration was markedly improved in the novel compared to the established model. Preterm birth and low birth weight were increased if oocyte donation was required and ICSI was not used. Risk of macrosomia increased with advancing

  18. Enhancement of solubility in Escherichia coli and purification of an aminotransferase from Sphingopyxis sp. MTA144 for deamination of hydrolyzed fumonisin B1

    Directory of Open Access Journals (Sweden)

    Hartinger Doris

    2010-08-01

    Full Text Available Abstract Background Fumonisin B1 is a cancerogenic mycotoxin produced by Fusarium verticillioides and other fungi. Sphingopyxis sp. MTA144 can degrade fumonisin B1, and a key enzyme in the catabolic pathway is an aminotransferase which removes the C2-amino group from hydrolyzed fumonisin B1. In order to study this aminotransferase with respect to a possible future application in enzymatic fumonisin detoxification, we attempted expression of the corresponding fumI gene in E. coli and purification of the enzyme. Since the aminotransferase initially accumulated in inclusion bodies, we compared the effects of induction level, host strain, expression temperature, solubility enhancers and a fusion partner on enzyme solubility and activity. Results When expressed from a T7 promoter at 30°C, the aminotransferase accumulated invariably in inclusion bodies in DE3 lysogens of the E. coli strains BL21, HMS174, Rosetta 2, Origami 2, or Rosetta-gami. Omission of the isopropyl-beta-D-thiogalactopyranoside (IPTG used for induction caused a reduction of expression level, but no enhancement of solubility. Likewise, protein production but not solubility correlated with the IPTG concentration in E. coli Tuner(DE3. Addition of the solubility enhancers betaine and sorbitol or the co-enzyme pyridoxal phosphate showed no effect. Maltose-binding protein, used as an N-terminal fusion partner, promoted solubility at 30°C or less, but not at 37°C. Low enzyme activity and subsequent aggregation in the course of purification and cleavage indicated that the soluble fusion protein contained incorrectly folded aminotransferase. Expression in E. coli ArcticExpress(DE3, which co-expresses two cold-adapted chaperonins, at 11°C finally resulted in production of appreciable amounts of active enzyme. Since His tag-mediated affinity purification from this strain was hindered by co-elution of chaperonin, two steps of chromatography with optimized imidazole concentration in the

  19. Predicting Live Birth, Preterm Delivery, and Low Birth Weight in Infants Born from In Vitro Fertilisation: A Prospective Study of 144,018 Treatment Cycles

    Science.gov (United States)

    Nelson, Scott M.; Lawlor, Debbie A.

    2011-01-01

    Background The extent to which baseline couple characteristics affect the probability of live birth and adverse perinatal outcomes after assisted conception is unknown. Methods and Findings We utilised the Human Fertilisation and Embryology Authority database to examine the predictors of live birth in all in vitro fertilisation (IVF) cycles undertaken in the UK between 2003 and 2007 (n = 144,018). We examined the potential clinical utility of a validated model that pre-dated the introduction of intracytoplasmic sperm injection (ICSI) as compared to a novel model. For those treatment cycles that resulted in a live singleton birth (n = 24,226), we determined the associates of potential risk factors with preterm birth, low birth weight, and macrosomia. The overall rate of at least one live birth was 23.4 per 100 cycles (95% confidence interval [CI] 23.2–23.7). In multivariable models the odds of at least one live birth decreased with increasing maternal age, increasing duration of infertility, a greater number of previously unsuccessful IVF treatments, use of own oocytes, necessity for a second or third treatment cycle, or if it was not unexplained infertility. The association of own versus donor oocyte with reduced odds of live birth strengthened with increasing age of the mother. A previous IVF live birth increased the odds of future success (OR 1.58, 95% CI 1.46–1.71) more than that of a previous spontaneous live birth (OR 1.19, 95% CI 0.99–1.24); p-value for difference in estimate <0.001. Use of ICSI increased the odds of live birth, and male causes of infertility were associated with reduced odds of live birth only in couples who had not received ICSI. Prediction of live birth was feasible with moderate discrimination and excellent calibration; calibration was markedly improved in the novel compared to the established model. Preterm birth and low birth weight were increased if oocyte donation was required and ICSI was not used. Risk of macrosomia

  20. Peptide Targeted by Human Antibodies Associated with HIV Vaccine-Associated Protection Assumes a Dynamic α-Helical Structure.

    Science.gov (United States)

    Aiyegbo, Mohammed S; Shmelkov, Evgeny; Dominguez, Lorenzo; Goger, Michael; Battacharya, Shibani; deCamp, Allan C; Gilbert, Peter B; Berman, Phillip W; Cardozo, Timothy

    2017-01-01

    The only evidence of vaccine-induced protection from HIV acquisition in humans was obtained in the RV144 HIV vaccine clinical trial. One immune correlate of risk in RV144 was observed to be higher titers of vaccine-induced antibodies (Abs) reacting with a 23-mer non-glycosylated peptide with the same amino acid sequence as a segment in the second variable (V2) loop of the MN strain of HIV. We used NMR to analyze the dynamic 3D structure of this peptide. Distance restraints between spatially proximate inter-residue protons were calculated from NOE cross peak intensities and used to constrain a thorough search of all possible conformations of the peptide. α-helical folding was strongly preferred by part of the peptide. A high-throughput structure prediction of this segment in all circulating HIV strains demonstrated that α-helical conformations are preferred by this segment almost universally across all subtypes. Notably, α-helical conformations of this segment of the V2 loop cluster cross-subtype-conserved amino acids on one face of the helix and the variable amino acid positions on the other in a semblance of an amphipathic α-helix. Accordingly, some Abs that protected against HIV in RV144 may have targeted a specific, conserved α-helical peptide epitope in the V2 loop of HIV's surface envelope glycoprotein.

  1. Physics of polarized targets

    CERN Document Server

    Niinikoski, Tapio

    2014-01-01

    For developing, building and operating solid polarized targets we need to understand several fields of physics that have seen sub stantial advances during the last 50 years. W e shall briefly review a selection of those that are important today. These are: 1) quantum statistical methods to describe saturation and relaxation in magnetic resonance; 2) equal spin temperature model for dy namic nuclear polarization; 3 ) weak saturation during NMR polarization measurement; 4 ) refrigeration using the quantum fluid properties of helium isotopes. These, combined with superconducting magnet technologies, permit today to reach nearly complete pola rization of almost any nuclear spins. Targets can be operated in frozen spin mode in rather low and inhomogeneous field of any orientation, and in DNP mode in beams of high intensity. Beyond such experiments of nuclear and particle physics, applications a re also emerging in macromolecular chemistry and in magnetic resonance imaging. This talk is a tribute to Michel Borghini...

  2. Emerging Targets in Photopharmacology.

    Science.gov (United States)

    Lerch, Michael M; Hansen, Mickel J; van Dam, Gooitzen M; Szymanski, Wiktor; Feringa, Ben L

    2016-09-05

    The field of photopharmacology uses molecular photoswitches to establish control over the action of bioactive molecules. It aims to reduce systemic drug toxicity and the emergence of resistance, while achieving unprecedented precision in treatment. By using small molecules, photopharmacology provides a viable alternative to optogenetics. We present here a critical overview of the different pharmacological targets in various organs and a survey of organ systems in the human body that can be addressed in a non-invasive manner. We discuss the prospects for the selective delivery of light to these organs and the specific requirements for light-activatable drugs. We also aim to illustrate the druggability of medicinal targets with recent findings and emphasize where conceptually new approaches have to be explored to provide photopharmacology with future opportunities to bring "smart" molecular design ultimately to the realm of clinical use. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Inflation Targeting: Provisional Results

    Directory of Open Access Journals (Sweden)

    Cerna, Silviu

    2010-06-01

    Full Text Available Inflation targeting monetary policy framework that requires the central bank to achieve a low inflation has contributed to price stability in industrialized countries. As well as the other developing countries, ex communist countries have also tried to apply this strategy, which was susceptible to increase monetary policy transparency and to determine authorities to make necessary reforms in order to pass from a planned to a market economy. In Romania, inflation targeting has contributed, to a large extent, to price increase smoothening, without affecting economic growth. Knowing the factors that have determined this unquestionable success allows for not only understanding the Romanian transition process, but also draw some useful conclusions in view of the necessary actions for adopting the euro.

  4. Foucault on targets.

    Science.gov (United States)

    Lynch, John

    2004-01-01

    This paper seeks to gain an insight into the behavior of a large NHS trust, in its attempt to meet a 90 percent patient access target, in a week long national audit in March 2003. Why did individuals act in dramatically different ways to their norm over this period. The work of Michel Foucault is used to explore these issues. The discourses of power, knowledge, discipline and governmentality are identified as key foucaudian themes that offer an alternative interpretation of how individuals behave in their place of work. The importance of the historical context of discourse within the NHS cannot be underestimated in shaping the behavior of individuals and groups today. Power and knowledge permeate NHS organizations through disciplinary practices and dressage. Governmentality seeks to maintain the status quo through disciplinary processes such as national healthcare targets. The natural response of NHS organizations is therefore, to seek order and conformity rather than disorder and conflict.

  5. Antibodies Targeting EMT

    Science.gov (United States)

    2017-10-01

    VLDL uptake and redistribution of lipids to cells for energy metabolism and cell signaling. ApoE overexpression has shown to be associated with a...involved in testosterone and estradiol biosynthesis, as well as prostaglandin F synthesis and has previously been implicated in cancer progression, AKR1C2...is involved in androgen metabolism and is a potential drug target for prostate cancer. AKR1C4 is involved in bile acid synthesis but has not yet

  6. Explosive Target Balances

    OpenAIRE

    Potrafke, Niklas; Reischmann, Markus

    2013-01-01

    Using the new unit root test by Phillips et al. (2011) we show that the Target balances of the German Bundesbank have been exploding from the beginning of 2009 to the beginning of 2013. By implementing a full-allotment policy and reducing the required minimum quality of collaterals in October 2008, the European Central Bank (ECB) refinanced credits in the GIIPS countries to a large extent. Private capital flowed out of the GIIPS countries (Greece, Italy, Ireland, Portugal and Spain), and the ...

  7. Implementing Target Value Design.

    Science.gov (United States)

    Alves, Thais da C L; Lichtig, Will; Rybkowski, Zofia K

    2017-04-01

    An alternative to the traditional way of designing projects is the process of target value design (TVD), which takes different departure points to start the design process. The TVD process starts with the client defining an allowable cost that needs to be met by the design and construction teams. An expected cost in the TVD process is defined through multiple interactions between multiple stakeholders who define wishes and others who define ways of achieving these wishes. Finally, a target cost is defined based on the expected profit the design and construction teams are expecting to make. TVD follows a series of continuous improvement efforts aimed at reaching the desired goals for the project and its associated target value cost. The process takes advantage of rapid cycles of suggestions, analyses, and implementation that starts with the definition of value for the client. In the traditional design process, the goal is to identify user preferences and find solutions that meet the needs of the client's expressed preferences. In the lean design process, the goal is to educate users about their values and advocate for a better facility over the long run; this way owners can help contractors and designers to identify better solutions. This article aims to inform the healthcare community about tools and techniques commonly used during the TVD process and how they can be used to educate and support project participants in developing better solutions to meet their needs now as well as in the future.

  8. Combination of Hb Heze [β144(HC1)Lys→Arg; HBB: c.434A>G] and β0-Thalassemia in a Chinese Patient with β-Thalassemia Intermedia.

    Science.gov (United States)

    Li, Yan; Yan, Jin-Mei; Zhou, Jian-Ying; Lu, Yue-Cheng; Li, Dong-Zhi

    2017-01-01

    We first report a novel β chain variant, Hb Heze [β144(HC1)Lys→Arg; HBB: c.434A>G], in a Chinese family. Heterozygous inheritance of the mutation results in a mild β-thalassemia (β-thal) phenotype, whereas compound heterozygosity of Hb Heze with β0-thal appears as the cause of β-thal intermedia (β-TI) in our case.

  9. 2-{5-(1,3-Benzodioxol-5-yl-1-[4-(4-chlorophenyl-1,3-thiazol-2-yl]-4,5-dihydro-1H-pyrazol-3-yl}pyrazine

    Directory of Open Access Journals (Sweden)

    Suban Syed Shafi

    2010-03-01

    Full Text Available A simple method for the synthesis of a pyrazolyl thiazole derivative containing a piperonal moiety was developed. Thus, 2-{5-(1,3-benzodioxol-5-yl-1-[4-(4-chlorophenyl-1,3-thiazol-2-yl]-4,5-dihydro-1H-pyrazol-3-yl}pyrazine was synthesized using microwave irradiation and characterized by NMR, IR and LCMS data.

  10. Interference of N-(1-[4-(4-fluophenoxy)butyl]-piperidinyl)-N-methyl-2-benzothiazolamin e with Na+/H+exchange and Na+/Ca2+exchange in purified cardiac sarcolemmal membranes

    NARCIS (Netherlands)

    Scheufler, E.; Heers, C.; Wilffert, B.; Peters, Thies; Pierce, G.N.

    1993-01-01

    The effect of R 56865 (N-[1-[4-(4-fluorophenoxy) butyl]-piperidinyl]-N-methyl-2-benzothiazolamine, CAS 104606-13-5) on Na+/H+exchange and Na+/Ca2+exchange was studied in isolated cardiac sarcolemmal vesicles. R 56865 inhibited Na+/H+exchange with an ED50of 180 μmol/l at a concentration of 0.05

  11. Inflation targeting and core inflation

    OpenAIRE

    Julie Smith

    2005-01-01

    This paper examines the interaction of core inflation and inflation targeting as a monetary policy regime. Interest in core inflation has grown because of inflation targeting. Core inflation is defined in numerous ways giving rise to many potential measures; this paper defines core inflation as the best forecaster of inflation. A cross-country study finds before the start of inflation targeting, but not after, core inflation differs between non-inflation targeters and inflation targeters. Thr...

  12. Targeted therapy for sarcomas

    Directory of Open Access Journals (Sweden)

    Forscher C

    2014-03-01

    Full Text Available Charles Forscher,1 Monica Mita,2 Robert Figlin3 1Sarcoma Program, Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA, USA; 2Experimental Therapeutics Program, Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA, USA; 3Academic Development Program, Samuel Oschin Comprehensive Cancer Institute, and Division of Hematology/Oncology, Cedars-Sinai Medical Center, Los Angeles, CA, USA Abstract: Sarcomas are tumors of mesenchymal origin that make up approximately 1% of human cancers. They may arise as primary tumors in either bone or soft tissue, with approximately 11,280 soft tissue tumors and 2,650 bone tumors diagnosed each year in the United States. There are at least 50 different subtypes of soft tissue sarcoma, with new ones described with ever-increasing frequency. One way to look at sarcomas is to divide them into categories on the basis of their genetic make-up. One group of sarcomas has an identifiable, relatively simple genetic signature, such as the X:18 translocation seen in synovial sarcoma or the 11:22 translocation seen in Ewing's sarcoma. These specific abnormalities often lead to the presence of fusion proteins, such as EWS-FLI1 in Ewing's sarcoma, which are helpful as diagnostic tools and may become therapeutic targets in the future. Another group of sarcomas is characterized by complex genetic abnormalities as seen in leiomyosarcoma, osteosarcoma, and undifferentiated sarcoma. It is important to keep these distinctions in mind when contemplating the development of targeted agents for sarcomas. Different abnormalities in sarcoma could be divided by tumor subtype or by the molecular or pathway abnormality. However, some existing drugs or drugs in development may interfere with or alter more than one of the presented pathways. Keywords: sarcoma, targeted agents, tyrosine kinase inhibitors, mTor inhibition

  13. Meeting the Aichi targets

    DEFF Research Database (Denmark)

    Funk, Stephan M; Conde, Dalia Amor; Lamoreux, John

    2017-01-01

    &s), is an excellent opportunity to achieve the Aichi 2020 Targets T11 (protected areas) and T12 (preventing species extinctions). AZE taxa have small, single-site populations that are especially vulnerable to human-induced extinctions, particularly for the many amphibians. We show that AZEs&s can be protected...... feasibly and cost-effectively, but action is urgent. We argue that the Alliance, whose initial main aim was to identify AZEs&s, must be followed up by a second-generation initiative that directs and co-ordinates AZE conservation activities on the ground. The prominent role of zoos, conservation NGOs...

  14. Polarized scintillator targets

    Science.gov (United States)

    van den Brandt, B.; Bunyatova, E. I.; Hautle, P.; Konter, J. A.; Mango, S.

    2000-05-01

    The hydrogen nuclei in an organic scintillator have been polarized to more than 80% and the deuterons in its fully deuterated version to 24%. The scintillator, doped with TEMPO, has been polarized dynamically in a field of 2.5 T in a vertical dilution refrigerator in which a plastic lightguide transports the scintillation light from the sample in the mixing chamber to a photomultiplier outside the cryostat. Sizeable solid samples with acceptable optical properties and light output have been prepared and successfully operated as "live" polarized targets in nuclear physics experiments.

  15. Polarized scintillator targets

    Energy Technology Data Exchange (ETDEWEB)

    Brandt, B. van den E-mail: vandenbrandt@psi.ch; Bunyatova, E.I.; Hautle, P.; Konter, J.A.; Mango, S

    2000-05-21

    The hydrogen nuclei in an organic scintillator have been polarized to more than 80% and the deuterons in its fully deuterated version to 24%. The scintillator, doped with TEMPO, has been polarized dynamically in a field of 2.5 T in a vertical dilution refrigerator in which a plastic lightguide transports the scintillation light from the sample in the mixing chamber to a photomultiplier outside the cryostat. Sizeable solid samples with acceptable optical properties and light output have been prepared and successfully operated as 'live' polarized targets in nuclear physics experiments.

  16. Targeting Prostate Cancer Metastasis

    Science.gov (United States)

    2015-09-01

    achieve this goal, we cultured high-invasive prostate cancer PC3 cells and treated them with the drugs/inhibitors that were proposed to target WASF3...groups (treated by DMSO), either treated by 100 μM CYT997 or 10 μM Dasatinib suppressed the cells to spread throughout the fish body (Fig. 4). As...have scr eened t he e f fect s o f mor e t han 40 drugs on invasion using cul tur ed prost ate cancer cells and f ound t hat tar geting multiple

  17. Targeting Nuclear Thymidylate Biosynthesis

    Science.gov (United States)

    Chon, James; Stover, Patrick J.; Field, Martha S.

    2016-01-01

    Thymidylate (dTMP) biosynthesis plays an essential and exclusive function in DNA synthesis and proper cell division, and therefore has been an attractive therapeutic target. Folate analogues, known as antifolates, and nucleotide analogs that inhibit the enzymatic action of the de novo thymidylate biosynthesis pathway and are commonly used in cancer treatment. In this review, we examine the mechanisms by which the antifolate 5-fluorouracil, as well as other dTMP synthesis inhibitors, function in cancer treatment in light of emerging evidence that dTMP synthesis occurs in the nucleus. Nuclear localization of the de novo dTMP synthesis pathway requires modification of the pathway enzymes by the small ubiquitin-like modifier (SUMO) protein. SUMOylation is required for nuclear localization of the de novo dTMP biosynthesis pathway, and disruption in the SUMO pathway inhibits cell proliferation in several cancer models. We summarize evidence that the nuclear localization of the dTMP biosynthesis pathway is a critical factor in the efficacy of antifolate-based therapies that target dTMP synthesis. PMID:27876557

  18. Targeted corneal transplantation.

    Science.gov (United States)

    Jhanji, Vishal; Mehta, Jod S; Sharma, Namrata; Sharma, Bhavana; Vajpayee, Rasik B

    2012-07-01

    Corneal transplantation surgery has moved from an era of conventional penetrating keratoplasty to selective replacement of the diseased corneal layer with complementary healthy donor corneal tissue. Anterior lamellar transplantation surgeries do not involve replacement of corneal endothelium, consequently eliminating the occurrence of endothelial rejection. Similarly, in diseases affecting the corneal endothelium, selective replacement with a lamellar lenticule bearing healthy endothelium provides better outcomes in terms of ocular surface, lesser astigmatism and quick visual recovery. In addition to the advantages of enhanced surgical outcomes, targeted corneal transplantation allows the use of one donor cornea for more than one recipient, thereby offering a viable solution to the problem of paucity of donor corneas. Evolving techniques of corneal transplantation have enabled better utilization of donor corneal tissue. Anterior lamellar as well as endothelial keratoplasty surgeries have become first-choice surgeries in appropriately selected cases. This review briefly discusses some of these novel surgical techniques. A better understanding of targeted corneal transplantation would lead to adaptation of the concept of component corneal surgery. This would further enable the corneal surgeons to circumvent the problem of donor corneal shortage especially in the developing world.

  19. Fixed target beams

    CERN Document Server

    Kain, V; Cettour-Cave, S; Cornelis, K; Fraser, M A; Gatignon, L; Goddard, B; Velotti, F

    2017-01-01

    The CERN SPS (Super Proton Synchrotron) serves asLHC injector and provides beam for the North Area fixedtarget experiments. At low energy, the vertical acceptancebecomes critical with high intensity large emittance fixed tar-get beams. Optimizing the vertical available aperture is a keyingredient to optimize transmission and reduce activationaround the ring. During the 2016 run a tool was developed toprovide an automated local aperture scan around the entirering.The flux of particles slow extracted with the1/3inte-ger resonance from the Super Proton Synchrotron at CERNshould ideally be constant over the length of the extractionplateau, for optimum use of the beam by the fixed target ex-periments in the North Area. The extracted intensity is con-trolled in feed-forward correction of the horizontal tune viathe main SPS quadrupoles. The Mains power supply noiseat 50 Hz and harmonics is also corrected in feed-forwardby small amplitude tune modulation at the respective fre-quencies with a dedicated additional quad...

  20. Old Drug, New Target

    Science.gov (United States)

    Andrews, William J.; Panova, Tatiana; Normand, Christophe; Gadal, Olivier; Tikhonova, Irina G.; Panov, Konstantin I.

    2013-01-01

    Transcription by RNA polymerase I (Pol-I) is the main driving force behind ribosome biogenesis, a fundamental cellular process that requires the coordinated transcription of all three nuclear polymerases. Increased Pol-I transcription and the concurrent increase in ribosome biogenesis has been linked to the high rates of proliferation in cancers. The ellipticine family contains a number of potent anticancer therapeutic agents, some having progressed to stage I and II clinical trials; however, the mechanism by which many of the compounds work remains unclear. It has long been thought that inhibition of Top2 is the main reason behind the drugs antiproliferative effects. Here we report that a number of the ellipticines, including 9-hydroxyellipticine, are potent and specific inhibitors of Pol-I transcription, with IC50 in vitro and in cells in the nanomolar range. Essentially, the drugs did not affect Pol-II and Pol-III transcription, demonstrating a high selectivity. We have shown that Pol-I inhibition occurs by a p53-, ATM/ATR-, and Top2-independent mechanism. We discovered that the drug influences the assembly and stability of preinitiation complexes by targeting the interaction between promoter recognition factor SL1 and the rRNA promoter. Our findings will have an impact on the design and development of novel therapeutic agents specifically targeting ribosome biogenesis. PMID:23293027

  1. Quantum state targeting

    Science.gov (United States)

    Rudolph, Terry; Spekkens, Robert W.

    2004-11-01

    We introduce a primitive for quantum cryptography that we term “state targeting.” We show that increasing one’s probability of success in this task above a minimum amount implies an unavoidable increase in the probability of a particular kind of failure. This is analogous to the unavoidable disturbance to a quantum state that results from gaining information about its identity, and can be shown to be a purely quantum effect. We solve various optimization problems for state targeting that are useful for the security analysis of two-party cryptographic tasks implemented between remote antagonistic parties. Although we focus on weak coin flipping, the results are significant for other two-party protocols, such as strong coin flipping, partially binding and concealing bit commitment, and bit escrow. Furthermore, the results have significance not only for the traditional notion of security in cryptography, that of restricting a cheater’s ability to bias the outcome of the protocol, but also for a different notion of security that arises only in the quantum context, that of cheat sensitivity. Finally, our analysis leads to some interesting secondary results, namely, a generalization of Uhlmann’s theorem and an operational interpretation of the fidelity between two mixed states.

  2. Target Housing Material Options

    Energy Technology Data Exchange (ETDEWEB)

    Woloshun, Keith Albert [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-02-11

    With gas cooling, heat transfer coefficients are low compared to water. The benefit of gas from a heat transfer point of view is that there is really no upper temperature limit for the coolant, as compared to water, which is limited ultimately by the critical point, and in practice the critical heat flux. In our case with parallel flow channels, water is limited to even lower operating limits by nucleate boiling. So gas can get as hot as the containment material will allow, but to get the density and heat transfer up to something reasonable, we must also increase pressure, thus increasing stress on the containment, namely the front and back faces. We are designing to ASME BPVC, which, for most materials allows a maximum stress of UTS/3. So we want the highest possible UTS. For reference, the front face stress in the 12 mm target at 300 psi was about 90 MPa. The inconel 718 allowable stress at 900°C is 1/3 of 517 or 172 MPa. So we are in a very safe place, but the uTS is dropping rapidly with temperature above 900°C. As we increase target diameter, the challenge will be to keep the stress down. We are probably looking at keeping the allowable at or above the present value, and at as high a temperature as possible.

  3. Targeting adipose tissue

    Directory of Open Access Journals (Sweden)

    Haas Bodo

    2012-10-01

    Full Text Available Abstract Two different types of adipose tissues can be found in humans enabling them to respond to starvation and cold: white adipose tissue (WAT is generally known and stores excess energy in the form of triacylglycerol (TG, insulates against cold, and serves as a mechanical cushion. Brown adipose tissue (BAT helps newborns to cope with cold. BAT has the capacity to uncouple the mitochondrial respiratory chain, thereby generating heat rather than adenosine triphosphate (ATP. The previously widely held view was that BAT disappears rapidly after birth and is no longer present in adult humans. Using positron emission tomography (PET, however, it was recently shown that metabolically active BAT occurs in defined regions and scattered in WAT of the adult and possibly has an influence on whole-body energy homeostasis. In obese individuals adipose tissue is at the center of metabolic syndrome. Targeting of WAT by thiazolidinediones (TZDs, activators of peroxisome proliferator-activated receptor γ (PPARγ a ‘master’ regulator of fat cell biology, is a current therapy for the treatment of type 2 diabetes. Since its unique capacity to increase energy consumption of the body and to dissipate surplus energy as heat, BAT offers new perspectives as a therapeutic target for the treatment of obesity and associated diseases such as type 2 diabetes and metabolic syndrome. Recent discoveries of new signaling pathways of BAT development give rise to new therapeutic possibilities in order to influence BAT content and activity.

  4. Targeting adipose tissue.

    Science.gov (United States)

    Haas, Bodo; Schlinkert, Paul; Mayer, Peter; Eckstein, Niels

    2012-10-27

    Two different types of adipose tissues can be found in humans enabling them to respond to starvation and cold: white adipose tissue (WAT) is generally known and stores excess energy in the form of triacylglycerol (TG), insulates against cold, and serves as a mechanical cushion. Brown adipose tissue (BAT) helps newborns to cope with cold. BAT has the capacity to uncouple the mitochondrial respiratory chain, thereby generating heat rather than adenosine triphosphate (ATP). The previously widely held view was that BAT disappears rapidly after birth and is no longer present in adult humans. Using positron emission tomography (PET), however, it was recently shown that metabolically active BAT occurs in defined regions and scattered in WAT of the adult and possibly has an influence on whole-body energy homeostasis. In obese individuals adipose tissue is at the center of metabolic syndrome. Targeting of WAT by thiazolidinediones (TZDs), activators of peroxisome proliferator-activated receptor γ (PPARγ) a 'master' regulator of fat cell biology, is a current therapy for the treatment of type 2 diabetes. Since its unique capacity to increase energy consumption of the body and to dissipate surplus energy as heat, BAT offers new perspectives as a therapeutic target for the treatment of obesity and associated diseases such as type 2 diabetes and metabolic syndrome. Recent discoveries of new signaling pathways of BAT development give rise to new therapeutic possibilities in order to influence BAT content and activity.

  5. Analytical specificity and sensitivity of the novel dual-target GeneProof Neisseria gonorrhoeae PCR kit for detection of N. gonorrhoeae.

    Science.gov (United States)

    Golparian, Daniel; Hellmark, Bengt; Unemo, Magnus

    2015-11-01

    Detection of Neisseria gonorrhoeae relies increasingly on nucleic acid amplification tests (NAATs). The specificity of many gonococcal NAATs has been suboptimal and supplementary testing remains recommended in Europe and several additional countries. The novel dual-target GeneProof Neisseria gonorrhoeae PCR kit, targeting porA pseudogene and 16S rRNA gene, showed a high specificity and sensitivity when isolates of non-gonococcal Neisseria and related species (n = 144), and gonococci (n = 104) were tested. However, rare gonococcal porA mutants were only detected in the 16S rRNA gene target and two non-gonococcal isolates showed a low-level cross-reactivity in the 16S rRNA gene target. The detection limit for both targets was 1.5 copies per reaction. © 2015 APMIS. Published by John Wiley & Sons Ltd.

  6. Low intensity beam target unit

    CERN Multimedia

    CERN PhotoLab

    1976-01-01

    This is a wheel fitted with many targets around its periphery (each with three longitudinally arranged thin rods) of which one is placed into the beam via a rotation of the wheel. Upstream of each target is placed a luminescent screen, aligbed on each target axis and viewed with a TV camera, to make sure that one is hitting the target. This target unit was probably used to study target's behaviour (like beam heating). Gualtiero Del Torre stands on the left, Pierre Gerdil on the right.

  7. Issues in Target Tracking

    Science.gov (United States)

    2010-05-01

    simulations we take as ground truth that the target moves at 10m/s heading west and 5m/s heading north, starting from ( 5000m , 35000m). The emitted frequency is... runs , the estimated initial and final positions fall into the 99% confidence region. −1 −0.8 −0.6 −0.4 −0.2 0 0.2 0.4 0.6 0.8 1 x 10 4 0 0.5 1 1.5 2 2.5...position of trajectories. “F”: final position of trajectories. Right: The true and estimated trajectories from 100 Monte Carlo runs for Johnson noise

  8. Bradycardia During Targeted Temperature Management

    DEFF Research Database (Denmark)

    Thomsen, Jakob Hartvig; Nielsen, Niklas; Hassager, Christian

    2016-01-01

    OBJECTIVES: Bradycardia is common during targeted temperature management, likely being a physiologic response to lower body temperature, and has recently been associated with favorable outcome following out-of-hospital cardiac arrest in smaller observational studies. The present study sought...... to confirm this finding in a large multicenter cohort of patients treated with targeted temperature management at 33°C and explore the response to targeted temperature management targeting 36°C. DESIGN: Post hoc analysis of a prospective randomized study. SETTING: Thirty-six ICUs in 10 countries. PATIENTS......: We studied 447 (targeted temperature management = 33°C) and 430 (targeted temperature management = 36°C) comatose out-of-hospital cardiac arrest patients with available heart rate data, randomly assigned in the targeted temperature management trial from 2010 to 2013. INTERVENTIONS: Targeted...

  9. Characterization of solid hydrogen targets

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, M.C. [British Columbia Univ., Vancouver, BC (Canada); Bailey, J.M.; Mulhauser, F. [Chester Technology (United Kingdom); Beer, G.A.; Douglas, J.L.; Knowles, P.E.; Maier, M.; Mason, G.R.; Olin, A.; Porcelli, T.A. [Victoria Univ., BC (Canada); Beveridge, J.L.; Marshall, G.M. [British Columbia Univ., Vancouver, BC (Canada). TRIUMF Facility; Huber, T.M. [Gustavus Adolphus Coll., St. Peter, MN (United States); Jacot-Guillarmod, R. [Fribourg Univ. (Switzerland); Kammel, P. [Lawrence Berkeley Lab., CA (United States); Kim, S.K. [Jeonbuk National Univ., Jeonju City (Korea, Republic of); Kunselman, A.R. [Wyoming Univ., Laramie, WY (United States); Martoff, C.J. [Temple Univ., Philadelphia, PA (United States); Petitjean, C. [Paul Scherrer Inst. (PSI), Villigen (Switzerland); Zmeskal, J. [Oesterreichische Akademie der Wissenschaften, Vienna (Austria)

    1996-10-01

    In experiments using the TRIUMF solid hydrogen target system, the knowledge of the target thickness and uniformity is often essential in order to extract physical parameters from the data. We have characterized the thickness and uniformity of frozen targets using the energy loss of alpha particles. An accuracy of {approx}5% was achieved, a limit imposed by the uncertainty in the stopping powers. The details of the method are described, and the thickness calibration of the target is presented. (orig.). 11 refs.

  10. Optical characteristics of transparent samarium oxide thin films ...

    Indian Academy of Sciences (India)

    2016-10-07

    Oct 7, 2016 ... 1Department of Physics, Faculty of Science, Taif University, Taif 888, Saudi Arabia. 2Department of Physics, Faculty of Education, Ain Shams University, Roxy 11757, Cairo, Egypt. 3Materials Science Unit, Department of Chemistry, Faculty of Science, Tanta University, 31725 Tanta, Egypt. 4Department of ...

  11. Optical properties of lead–tellurite glasses doped with samarium ...

    Indian Academy of Sciences (India)

    The optical properties of a new family of Sm2O3–(40–)PbO–60TeO2 glasses are investigated. The optical absorption spectra were recorded at ... The refractive index, molar refraction and polarizability of oxide ions have been calculated by using Lorentz–Lorentz relations. The non-linear variations of the above optical ...

  12. Optical properties of lead–tellurite glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Administrator

    Abstract. The optical properties of a new family of xSm2O3–(40–x)PbO–60TeO2 glasses are investigated. The optical absorption spectra were recorded at room temperature in the UV-visible region. From the absorption edge studies, the values of optical bandgap energies have been evaluated. The refractive index, molar ...

  13. Measurement of radiative lifetime in atomic samarium using ...

    Indian Academy of Sciences (India)

    2014-02-08

    Feb 8, 2014 ... In this paper, we report the investigations of lifetime measurement of odd-parity energy level 19009.52 cm. −1 .... introduced by an electronic delay generator between the two Q-switch pulses of Nd-YAG laser. The slope of the .... Our values of the lifetimes are free from the common systematic errors. Thus ...

  14. A novel samarium complex with interesting photoluminescence and ...

    African Journals Online (AJOL)

    The 4,4'-Hbipy moieties, isolated nitrates and [Sm(H2O)4(NO3)3] species are held together via hydrogen bonds and p…p interactions to form a 3-D supramolecular framework. Luminescent investigation reveals a strong emission in blue region. Optical absorption spectrum of 1 reveals the presence of an optical gap of 3.60 ...

  15. Lithium samarium polyphosphate, LiSm(PO34

    Directory of Open Access Journals (Sweden)

    Dan Zhao

    2010-02-01

    Full Text Available The mixed-metal rare-earth polyphosphate LiSm(PO34 consists of a three-dimensional framework in which zigzag [(PO3n]n− chains with a periodicity of four PO4 tetrahedra are connected through Li+ and Sm3+ ions (both with 2. symmetry.

  16. Sodium samarium tetrakis(polyphosphate, NaSm(PO34

    Directory of Open Access Journals (Sweden)

    Dan Zhao

    2010-07-01

    Full Text Available NaSm(PO34 has been prepared by solid state reactions. It belongs to type II of the structural family of MILnIII(PO34 compounds (MI = alkali metal and LnIII = rare earth metal and is composed of ∞(PO3n]n− polyphosphate chains with a repeating unit of four PO4 tetrahedra. The chains extend parallel to [100] and share O atoms with irregular SmO8 polyhedra, forming a three-dimensional framework which delimits tunnels occupied by Na+ cations in a distorted octahedral environment.

  17. Isotopic Ratios of Samarium by TIMS for Nuclear Forensic Application

    Energy Technology Data Exchange (ETDEWEB)

    Louis Jean, James [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Inglis, Jeremy David [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-08-08

    The isotopic ratio of Nd, Sm, and Gd can provide important information regarding fissile material (nuclear devices, reactors), neutron environment, and device yield. These studies require precise measurement of Sm isotope ratios, by either TIMS or MC-ICP-MS. There has been an increasing trend to measure smaller and smaller quantities of Sm bearing samples. In nuclear forensics 10-100 ng of Sm are needed for precise measurement. To measure sub-ng Sm samples using TIMS for nuclear forensic analysis.

  18. Synthesis of copper, silver, and samarium chalcogenides by mechanical alloying

    Energy Technology Data Exchange (ETDEWEB)

    Ohtani, T.; Maruyama, K.; Ohshima, K. [Okayama Univ. of Science (Japan). Lab. for Solid State Chemistry

    1997-03-01

    CuInX{sub 2} (X = S, Se, Te), Ag{sub 2}S, Ag{sub 2}Se, Ag{sub 3}Te{sub 2}, Ag{sub 1.9}Te, AgCuSe, Sm{sub 3}Se{sub 4}, Sm{sub 2}Se{sub 3}, and SmTe were synthesized by a mechanical alloying method, using a high-energy planetary ball mill. The compounds were obtained by milling mixtures of the elements with desired ratios in agate or Cu-Be vials for 60--180 min.

  19. Oriented growth of thin films of samarium oxide by MOCVD

    Indian Academy of Sciences (India)

    Unknown

    Abstract. Thin films of Sm2O3 have been grown on Si(100) and fused quartz by low-pressure chemical va- pour deposition using an adducted β-diketonate precursor. The films on quartz are cubic, with no preferred orientation at lower growth temperatures (~ 550°C), while they grow with a strong (111) orientation as the.

  20. 150 KVA Samarium Cobalt VSCF Starter Generator Electrical System

    Science.gov (United States)

    1978-12-01

    considerable hand labor. Addition of a provision for suitable electrical connection by the SCR manufacturer wou;d be desirable for production runs. Predicted...licen- sing the holder or any other person or corporation, or conveying any rights or permission to manufacture , use, or sell any patented invent,’n...tesile strength to contain the magnets and pole pieces up through the overspeed rating of the rotor. The cho.;en process uses maraging steel as the

  1. Optical properties of samarium doped zinc–tellurite glasses

    Indian Academy of Sciences (India)

    Glasses with the composition, (Sm2O3)(ZnO)(40–)(TeO2)(60), were prepared by conventional melt quenching method. The density, molar volume, and optical energy band gap of these glasses have been measured. The refractive index, molar refraction and polarizability of oxide ion have been calculated by using ...

  2. Target noise in overlay metrology

    Science.gov (United States)

    Seligson, Joel L.; Adel, Mike E.; Izikson, Pavel; Levinski, Vladimir; Yaffe, Dan

    2004-05-01

    We have developed a method for calculating the statistical effects of spatial noise on the overlay measurement extracted from a given overlay target. The method has been applied to two kinds of overlay targets on three process layers, and the new metric, Target Noise, has been shown to correlate well to the random component of Overlay Mark Fidelity. A significant difference in terms of robustness has been observed between AIM targets and conventional Frame-in-Frame targets. The results fit well into the spatial noise hierarchy presented in this paper.

  3. EURISOL High Power Targets

    CERN Document Server

    Kadi, Y; Lindroos, M; Ridikas, D; Stora, T; Tecchio, L; CERN. Geneva. BE Department

    2009-01-01

    Modern Nuclear Physics requires access to higher yields of rare isotopes, that relies on further development of the In-flight and Isotope Separation On-Line (ISOL) production methods. The limits of the In-Flight method will be applied via the next generation facilities FAIR in Germany, RIKEN in Japan and RIBF in the USA. The ISOL method will be explored at facilities including ISAC-TRIUMF in Canada, SPIRAL-2 in France, SPES in Italy, ISOLDE at CERN and eventually at the very ambitious multi-MW EURISOL facility. ISOL and in-flight facilities are complementary entities. While in-flight facilities excel in the production of very short lived radioisotopes independently of their chemical nature, ISOL facilities provide high Radioisotope Beam (RIB) intensities and excellent beam quality for 70 elements. Both production schemes are opening vast and rich fields of nuclear physics research. In this article we will introduce the targets planned for the EURISOL facility and highlight some of the technical and safety cha...

  4. The threshold anomaly from the simultaneous calculation of elastic scattering and fusion cross sections for the systems {sup 9}Be+{sup 144}Sm and {sup 9}Be+{sup 64}Zn for energies around the barrier

    Energy Technology Data Exchange (ETDEWEB)

    Camacho, A. G.; Aguilera, E. F.; Quiroz, E. M. [Departamento de Aceleradores, ININ, La Marquesa, 52750 Estado de Mexico (Mexico); Gomes, P. R. S.; Lubian, J. [Instituto de Fisica, Universidade Federal Fluminenese, Av. Litoranea s/n, Gragoata, Niteroi, 24210-340 Rio de Janeiro (Brazil)

    2008-12-15

    The energy dependence of the optical potential is used to study the threshold anomaly for reactions with the weakly bound projectile {sup 9}Be on {sup 144}Sm and {sup 64}Zn for energies around the Coulomb barrier. The energy dependent potential parameters are obtained from a simultaneous X{sup 2}-analysis of elastic scattering and fusion data. There are signatures that in fact, the so-called breakup threshold anomaly shows up for these systems. This finding is in agreement with other calculations involving weakly bound projectiles. (Author)

  5. The target effect: visual memory for unnamed search targets.

    Science.gov (United States)

    Thomas, Mark D; Williams, Carrick C

    2014-01-01

    Search targets are typically remembered much better than other objects even when they are viewed for less time. However, targets have two advantages that other objects in search displays do not have: They are identified categorically before the search, and finding them represents the goal of the search task. The current research investigated the contributions of both of these types of information to the long-term visual memory representations of search targets. Participants completed either a predefined search or a unique-object search in which targets were not defined with specific categorical labels before searching. Subsequent memory results indicated that search target memory was better than distractor memory even following ambiguously defined searches and when the distractors were viewed significantly longer. Superior target memory appears to result from a qualitatively different representation from those of distractor objects, indicating that decision processes influence visual memory.

  6. Guidance and targeting for the Strategic Target System

    Science.gov (United States)

    White, John E.

    Guidance algorithms and targeting procedures for the Strategic Target System (STARS) launch vehicle are described. The STARS vehicle is a three stage booster, based partly upon retired Polaris A3 missile assets, which is intended to support development and testing of the Strategic Defense Initiative by delivering target payloads to the vicinity of the Kwajalein Atoll. STARS will be launched from the Kauai Test Facility located on Kauai, Hawaii. The STARS guidance objective is to deliver payloads to a prescribed target location with maximum accuracy at intercontinental ballistic missile velocities. Mission objectives are achieved with a combination of guidance algorithms.

  7. Oxide Fiber Targets at ISOLDE

    CERN Document Server

    Köster, U; Carminati, D; Catherall, R; Cederkäll, J; Correia, J G; Crepieux, B; Dietrich, M; Elder, K; Fedosseev, V; Fraile-Prieto, L M; Franchoo, S; Fynbo, H O U; Georg, U; Giles, T; Joinet, A; Jonsson, O C; Kirchner, R; Lau, C; Lettry, Jacques; Maier, H J; Mishin, V I; Oinonen, M; Peräjärvi, K; Ravn, H L; Rinaldi, T; Santana-Leitner, M; Wahl, U; Weissman, L

    2003-01-01

    Many elements are rapidly released from oxide matrices. Some oxide powder targets show a fast sintering, thus losing their favorable release characteristics. Loosely packed oxyde fiber targets are less critical since they may maintain their open structure even when starting to fuse together at some contact points. The experience with various oxyde fiber targets (titania, zirconia, ceria and thoria) used in the last years at ISOLDE is reviewed. For short-lived isotopes of Cu, Ga and Xe the zirconia and ceria targets respectively provided significantly higher yields than any other target (metal foils, oxide powders, etc.) tested before. Titania fibers, which were not commercially available, were produced in a relic process by impregnation of a rayon felt in a titanium chloride solution and subsequent calcination by heating the dried felt in air. Thoria fibers were obtained either by the same process or by burning commercial gas lantern mantle cloth. In the future a beryllia fiber target could be used to produce...

  8. Therapeutic Targeting of Telomerase

    Directory of Open Access Journals (Sweden)

    Kathrin Jäger

    2016-07-01

    Full Text Available Telomere length and cell function can be preserved by the human reverse transcriptase telomerase (hTERT, which synthesizes the new telomeric DNA from a RNA template, but is normally restricted to cells needing a high proliferative capacity, such as stem cells. Consequently, telomerase-based therapies to elongate short telomeres are developed, some of which have successfully reached the stage I in clinical trials. Telomerase is also permissive for tumorigenesis and 90% of all malignant tumors use telomerase to obtain immortality. Thus, reversal of telomerase upregulation in tumor cells is a potential strategy to treat cancer. Natural and small-molecule telomerase inhibitors, immunotherapeutic approaches, oligonucleotide inhibitors, and telomerase-directed gene therapy are useful treatment strategies. Telomerase is more widely expressed than any other tumor marker. The low expression in normal tissues, together with the longer telomeres in normal stem cells versus cancer cells, provides some degree of specificity with low risk of toxicity. However, long term telomerase inhibition may elicit negative effects in highly-proliferative cells which need telomerase for survival, and it may interfere with telomere-independent physiological functions. Moreover, only a few hTERT molecules are required to overcome senescence in cancer cells, and telomerase inhibition requires proliferating cells over a sufficient number of population doublings to induce tumor suppressive senescence. These limitations may explain the moderate success rates in many clinical studies. Despite extensive studies, only one vaccine and one telomerase antagonist are routinely used in clinical work. For complete eradication of all subpopulations of cancer cells a simultaneous targeting of several mechanisms will likely be needed. Possible technical improvements have been proposed including the development of more specific inhibitors, methods to increase the efficacy of vaccination

  9. Target Acquisition Methodology Enhancement (TAME)

    Science.gov (United States)

    1989-03-01

    acquisition probability from COMINT, PCOM , against all communications type targets, is determined offline by a stochastic model for subsequent...of PN over all replications. F-4 f. Computes overall acquisition probability, PCOM , against all communications type targets as C: PCOM = (1. - PN...NNET where NNET denotes the number of nets which the target is in. F-6. TOTAL ACQUISITION PROBABILITY. With PNCj and PCOM computed as above, the

  10. Guidance system for laser targets

    Science.gov (United States)

    Porter, Gary D.; Bogdanoff, Anatoly

    1978-01-01

    A system for guiding charged laser targets to a predetermined focal spot of a laser along generally arbitrary, and especially horizontal, directions which comprises a series of electrostatic sensors which provide inputs to a computer for real time calculation of position, velocity, and direction of the target along an initial injection trajectory, and a set of electrostatic deflection means, energized according to a calculated output of said computer, to change the target trajectory to intercept the focal spot of the laser which is triggered so as to illuminate the target of the focal spot.

  11. Targeted nanotechnology for cancer imaging.

    Science.gov (United States)

    Toy, Randall; Bauer, Lisa; Hoimes, Christopher; Ghaghada, Ketan B; Karathanasis, Efstathios

    2014-09-30

    Targeted nanoparticle imaging agents provide many benefits and new opportunities to facilitate accurate diagnosis of cancer and significantly impact patient outcome. Due to the highly engineerable nature of nanotechnology, targeted nanoparticles exhibit significant advantages including increased contrast sensitivity, binding avidity and targeting specificity. Considering the various nanoparticle designs and their adjustable ability to target a specific site and generate detectable signals, nanoparticles can be optimally designed in terms of biophysical interactions (i.e., intravascular and interstitial transport) and biochemical interactions (i.e., targeting avidity towards cancer-related biomarkers) for site-specific detection of very distinct microenvironments. This review seeks to illustrate that the design of a nanoparticle dictates its in vivo journey and targeting of hard-to-reach cancer sites, facilitating early and accurate diagnosis and interrogation of the most aggressive forms of cancer. We will report various targeted nanoparticles for cancer imaging using X-ray computed tomography, ultrasound, magnetic resonance imaging, nuclear imaging and optical imaging. Finally, to realize the full potential of targeted nanotechnology for cancer imaging, we will describe the challenges and opportunities for the clinical translation and widespread adaptation of targeted nanoparticles imaging agents. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Targets and Secondary Beam Extraction

    Science.gov (United States)

    Noah, Etam

    2014-02-01

    Several applications make use of secondary beams of particles generated by the interaction of a primary beam of particles with a target. Spallation neutrons, bremsstrahlung photon-produced neutrons, radioactive ions and neutrinos are available to users at state-of-the-art facilities worldwide. Plans for even higher secondary beam intensities place severe constraints on the design of targets. This article reports on the main targetry challenges and highlights a variety of solutions for targetry and secondary beam extraction. Issues related to target station layout, instrumentation at the beam-target interface, safety and radioprotection are also discussed.

  13. Achieving Plant CRISPR Targeting that Limits Off-Target Effects

    Directory of Open Access Journals (Sweden)

    Jeffrey D. Wolt

    2016-11-01

    Full Text Available The CRISPR-Cas9 system (clustered regularly interspaced short palindromic repeats with associated Cas9 protein has been used to generate targeted changes for direct modification of endogenous genes in an increasing number of plant species; but development of plant genome editing has not yet fully considered potential off-target mismatches that may lead to unintended changes within the genome. Assessing the specificity of CRISPR-Cas9 for increasing editing efficiency as well as the potential for unanticipated downstream effects from off-target mutations is an important regulatory consideration for agricultural applications. Increasing genome-editing specificity entails developing improved design methods that better predict the prevalence of off-target mutations as a function of genome composition and design of the engineered ribonucleoprotein (RNP. Early results from CRISPR-Cas9 genome editing in plant systems indicate that the incidence of off-target mutation frequencies is quite low; however, by analyzing CRISPR-edited plant lines and improving both computational tools and reagent design, it may be possible to further decrease unanticipated effects at potential mismatch sites within the genome. This will provide assurance that CRISPR-Cas9 reagents can be designed and targeted with a high degree of specificity. Improved and experimentally validated design tools for discriminating target and potential off-target positions that incorporate consideration of the designed nuclease fidelity and selectivity will help to increase confidence for regulatory decision making for genome-edited plants.

  14. Literature evidence in open targets - a target validation platform.

    Science.gov (United States)

    Kafkas, Şenay; Dunham, Ian; McEntyre, Johanna

    2017-06-06

    We present the Europe PMC literature component of Open Targets - a target validation platform that integrates various evidence to aid drug target identification and validation. The component identifies target-disease associations in documents and ranks the documents based on their confidence from the Europe PMC literature database, by using rules utilising expert-provided heuristic information. The confidence score of a given document represents how valuable the document is in the scope of target validation for a given target-disease association by taking into account the credibility of the association based on the properties of the text. The component serves the platform regularly with the up-to-date data since December, 2015. Currently, there are a total number of 1168365 distinct target-disease associations text mined from >26 million PubMed abstracts and >1.2 million Open Access full text articles. Our comparative analyses on the current available evidence data in the platform revealed that 850179 of these associations are exclusively identified by literature mining. This component helps the platform's users by providing the most relevant literature hits for a given target and disease. The text mining evidence along with the other types of evidence can be explored visually through https://www.targetvalidation.org and all the evidence data is available for download in json format from https://www.targetvalidation.org/downloads/data .

  15. Transverse target spin asymmetries on a proton target at COMPASS

    CERN Document Server

    Richter, Andreas

    2009-01-01

    Transversity and transverse momentum-dependent parton distribution functions (TMDs) are been measured in semi-inclusive deep inelastic scattering (SIDIS) by using a transversely polarized target at the COMPASS experiment. COMPASS is a fixed target experiment at the CERN M2 beamline, which provides a 160GeV/c polarized m+ beam. In the years 2002-2004 COMPASS has collected data with a transversely polarized deuteron 6LiD target. In 2007, COMPASS has used for the first time a proton NH3 target. To access transversity COMPASS has used three different quark polarimeters: the Collins effect, responsible for an azimuthal asymmetry in the single hadron distribution, azimuthal target spin asymmetries of charged hadron pairs and the transverse polarisation of L hyperons. Beside this also the Sivers asymmetry arising from the correlation between the transverse nucleon spin and the quark intrinsic transverse momentum was measured. European

  16. Treating rheumatoid arthritis to target

    DEFF Research Database (Denmark)

    Smolen, Josef S; Aletaha, Daniel; Bijlsma, Johannes W J

    2010-01-01

    BACKGROUND: Aiming at therapeutic targets has reduced the risk of organ failure in many diseases such as diabetes or hypertension. Such targets have not been defined for rheumatoid arthritis (RA). OBJECTIVE: /st> To develop recommendations for achieving optimal therapeutic outcomes in RA. METHODS...

  17. Treating rheumatoid arthritis to target

    DEFF Research Database (Denmark)

    Smolen, Josef S; Breedveld, Ferdinand C; Burmester, Gerd R

    2016-01-01

    BACKGROUND: Reaching the therapeutic target of remission or low-disease activity has improved outcomes in patients with rheumatoid arthritis (RA) significantly. The treat-to-target recommendations, formulated in 2010, have provided a basis for implementation of a strategic approach towards this t...

  18. Saccadic adaptation to moving targets.

    Directory of Open Access Journals (Sweden)

    Katharina Havermann

    Full Text Available Saccades are so called ballistic movements which are executed without online visual feedback. After each saccade the saccadic motor plan is modified in response to post-saccadic feedback with the mechanism of saccadic adaptation. The post-saccadic feedback is provided by the retinal position of the target after the saccade. If the target moves after the saccade, gaze may follow the moving target. In that case, the eyes are controlled by the pursuit system, a system that controls smooth eye movements. Although these two systems have in the past been considered as mostly independent, recent lines of research point towards many interactions between them. We were interested in the question if saccade amplitude adaptation is induced when the target moves smoothly after the saccade. Prior studies of saccadic adaptation have considered intra-saccadic target steps as learning signals. In the present study, the intra-saccadic target step of the McLaughlin paradigm of saccadic adaptation was replaced by target movement, and a post-saccadic pursuit of the target. We found that saccadic adaptation occurred in this situation, a further indication of an interaction of the saccadic system and the pursuit system with the aim of optimized eye movements.

  19. Saccadic adaptation to moving targets.

    Science.gov (United States)

    Havermann, Katharina; Volcic, Robert; Lappe, Markus

    2012-01-01

    Saccades are so called ballistic movements which are executed without online visual feedback. After each saccade the saccadic motor plan is modified in response to post-saccadic feedback with the mechanism of saccadic adaptation. The post-saccadic feedback is provided by the retinal position of the target after the saccade. If the target moves after the saccade, gaze may follow the moving target. In that case, the eyes are controlled by the pursuit system, a system that controls smooth eye movements. Although these two systems have in the past been considered as mostly independent, recent lines of research point towards many interactions between them. We were interested in the question if saccade amplitude adaptation is induced when the target moves smoothly after the saccade. Prior studies of saccadic adaptation have considered intra-saccadic target steps as learning signals. In the present study, the intra-saccadic target step of the McLaughlin paradigm of saccadic adaptation was replaced by target movement, and a post-saccadic pursuit of the target. We found that saccadic adaptation occurred in this situation, a further indication of an interaction of the saccadic system and the pursuit system with the aim of optimized eye movements.

  20. Target recognition by wavelet transform

    CERN Document Server

    Li Zheng Dong; He Wu Liang; Pei Chun Lan; Peng Wen; SongChen; Zheng Xiao Dong

    2002-01-01

    Wavelet transform has an important character of multi-resolution power, which presents pyramid structure, and this character coincides the way by which people distinguish object from coarse to fineness and from large to tiny. In addition to it, wavelet transform benefits to reducing image noise, simplifying calculation, and embodying target image characteristic point. A method of target recognition by wavelet transform is provided

  1. ISOLDE target zone control room

    CERN Multimedia

    2016-01-01

    Operating the ISOLDE target handling robots from the dedicated control room in building 197. Monitors showing the movements of the robots (GPS in this case) in the target zone. The footage shows the actual operation by the operator as well as the different equipment such as camera electronics, camera motor controls, camera monitors and Kuka robot controls touch panel.

  2. Targeted marketing and public health.

    Science.gov (United States)

    Grier, Sonya A; Kumanyika, Shiriki

    2010-01-01

    Targeted marketing techniques, which identify consumers who share common needs or characteristics and position products or services to appeal to and reach these consumers, are now the core of all marketing and facilitate its effectiveness. However, targeted marketing, particularly of products with proven or potential adverse effects (e.g., tobacco, alcohol, entertainment violence, or unhealthful foods) to consumer segments defined as vulnerable raises complex concerns for public health. It is critical that practitioners, academics, and policy makers in marketing, public health, and other fields recognize and understand targeted marketing as a specific contextual influence on the health of children and adolescents and, for different reasons, ethnic minority populations and other populations who may benefit from public health protections. For beneficial products, such understanding can foster more socially productive targeting. For potentially harmful products, understanding the nature and scope of targeted marketing influences will support identification and implementation of corrective policies.

  3. Oxide fiber targets at ISOLDE

    DEFF Research Database (Denmark)

    Köster, U.; Bergmann, U.C.; Carminati, D.

    2003-01-01

    Many elements are rapidly released from oxide matrices. Some oxide powder targets show a fast sintering, thus losing their favorable release characteristics. Loosely packed oxide fiber targets are less critical since they may maintain their open structure even when starting to fuse together at some...... contact points. The experience with various oxide fiber targets (titania, zirconia, ceria and thoria) used in the last years at ISOLDE is reviewed. For short-lived isotopes of Cu, Ga and Xe the zirconia and ceria targets respectively provided significantly higher yields than any other target (metal foils......, oxide powders, etc.) tested before. Titania fibers, which were not commercially available, were produced in a relic process by impregnation of a rayon felt in a titanium chloride solution and subsequent calcination by heating the dried felt in air. Thoria fibers were obtained either by the same process...

  4. The Bering Target Tracking Instrumentation

    DEFF Research Database (Denmark)

    Denver, Troelz; Jørgensen, John Leif; Betto, Maurizio

    2003-01-01

    The key science instrument on the Bering satellite mission is a relative small telescope with an entrance aperture of 300 mm and a focal length between 500 and 1000 mm. The detection of potential targets is performed by one of the target scanning advanced stellar compasses (ASCs). This procedure...... results in a simple prioritized list of right ascension, declination, proper motion and intensity of each prospective target. The telescope itself has a dedicated ASC Camera Head Unit (CHU) mounted on the secondary mirror, largely co-aligned with the telescope. This CHU accurately determines the telescope......'s pointing direction. To achieve fast tracking over a large solid angle, the telescope pointing is achieved by means of a folding mirror in the optical pathway. When a prospective target approaches the telescope FOV, the ASC on the secondary will guide the folding mirror into position such that the target...

  5. High speed cryogenic monodisperse targets

    Science.gov (United States)

    Boukharov, A.; Vishnevkii, E.

    2017-11-01

    The basic possibility of creation of high speed cryogenic monodisperse targets is shown. According to calculations at input of thin liquid cryogenic jets with a velocity of bigger 100 m/s in vacuum the jets don’t manage to freeze at distance to 1 mm and can be broken into monodisperse drops. Drops due to evaporation are cooled and become granules. High speed cryogenic monodisperse targets have the following advantages: direct input in vacuum (there is no need for a chamber of a triple point chamber and sluices), it is possible to use the equipment of a cluster target, it is possible to receive targets with a diameter of D 100m/s), exact synchronization of the target hitting moment in a beam with the moment of sensors turning on.

  6. Topological studies of hSVCT1, the human sodium-dependent vitamin C transporter and the influence of N-glycosylation on its intracellular targeting

    Energy Technology Data Exchange (ETDEWEB)

    Velho, Albertina M. [Department of Biosciences University of Kent, CT2 7NJ (United Kingdom); Jarvis, Simon M., E-mail: S.M.Jarvis@westminster.ac.uk [Department of Biosciences University of Kent, CT2 7NJ (United Kingdom); University of Westminster, School of Biosciences, London W1W 6UW (United Kingdom)

    2009-08-01

    The Na{sup +}-dependent transporters, hSVCT1 and hSVCT2, were assessed in COS-1 cells for their membrane topology. Antibodies to N- and C-termini of hSVCT1 and C-terminus of hSVCT2 identified positive immunofluorescence only after permeabilisation, suggesting these regions are intracellular. PNGase F treatment confirmed that WT hSVCT1 ({approx} 70-100 kDa) is glycosylated and site-directed mutagenesis of the three putative N-glycosylation sites, Asn138, Asn144, Asn230, demonstrated that mutants N138Q and N144Q were glycosylated ({approx} 68-90 kDa) with only 31-65% of WT L-ascorbic acid (AA) uptake while the glycosylation profile of N230Q remained unaltered ({approx} 98% of WT activity). However, the N138Q/N144Q double mutant displayed barely detectable membrane expression at {approx} 65 kDa, no apparent glycosylation and minimal AA uptake (< 10%) with no discernible improvement in expression or activity when cultured at 28 {sup o}C or 37 {sup o}C. Marker protein immunocytochemistry with N138Q/N144Q identified intracellular aggregates with hSVCT1 localised at the nuclear membrane but absent at the plasma membrane thus implicating its role as a possible intracellular transporter and suggesting N-glycosylation is required for hSVCT1 membrane targeting. Also, Lys242 on the same putative hydrophilic loop as Asn230 after biotinylation was inaccessible from the extracellular side when analysed by MALDI-TOF MS. A new hSVCT1 secondary structure model supporting these findings is proposed.

  7. Tracking Target and Spiral Waves

    DEFF Research Database (Denmark)

    Jensen, Flemming G.; Sporring, Jon; Nielsen, Mads

    2002-01-01

    A new algorithm for analyzing the evolution of patterns of spiral and target waves in large aspect ratio chemical systems is introduced. The algorithm does not depend on finding the spiral tip but locates the center of the pattern by a new concept, called the spiral focus, which is defined...... by the evolutes of the actual spiral or target wave. With the use of Gaussian smoothing, a robust method is developed that permits the identification of targets and spirals foci independently of the wave profile. Examples of an analysis of long image sequences from experiments with the Belousov...

  8. Targeted intraoperative radiotherapy in oncology

    CERN Document Server

    Keshtgar, Mohammed; Wenz, Frederik

    2014-01-01

    Targeted intraoperative radiotherapy is a major advance in the management of cancer patients. With an emphasis on practical aspects, this book offers an ideal introduction to this innovative  technology for clinicians.

  9. Hyperspectral-Augmented Target Tracking

    National Research Council Canada - National Science Library

    Soliman, Neil A

    2008-01-01

    ... air with the capability to seek, monitor, and destroy mobile terrorist targets in hostile territory. One such capability recognizes and persistently tracks multiple moving vehicles in complex, highly ambiguous urban environments...

  10. After treat-to-target

    DEFF Research Database (Denmark)

    Wakefield, Richard J; D'Agostino, Maria Antonietta; Naredo, Esperanza

    2012-01-01

    have recently formed a research network - the Targeted Ultrasound Initiative (TUI) group. The statement proposes that targeting therapy to PD activity provides superior outcomes compared with treating to clinical targets alone and introduces the rationale for a new randomised trial using targeted...... defined by clinical remission criteria (disease activity score, simplified disease activity index, etc) does not always equate to the complete absence of inflammation as measured by new sensitive imaging techniques such as ultrasound (US) . There is evidence that imaging synovitis is frequently found...... in these patients and associated with adverse clinical and functional outcomes. This article reviews the data regarding remission, ultrasound imaging and outcomes in patients with RA to provide the background to a consensus statement from an international collaboration of ultrasonographers and rheumatologists who...

  11. After treat-to-target

    DEFF Research Database (Denmark)

    Wakefield, Richard J; D'Agostino, Maria Antonietta; Naredo, Esperanza

    2012-01-01

    have recently formed a research network--the Targeted Ultrasound Initiative (TUI) group. The statement proposes that targeting therapy to PD activity provides superior outcomes compared with treating to clinical targets alone and introduces the rationale for a new randomised trial using targeted...... defined by clinical remission criteria (disease activity score, simplified disease activity index, etc) does not always equate to the complete absence of inflammation as measured by new sensitive imaging techniques such as ultrasound (US) . There is evidence that imaging synovitis is frequently found...... in these patients and associated with adverse clinical and functional outcomes. This article reviews the data regarding remission, ultrasound imaging and outcomes in patients with RA to provide the background to a consensus statement from an international collaboration of ultrasonographers and rheumatologists who...

  12. Targeted therapy for pediatric glioma

    NARCIS (Netherlands)

    Olow, A.K.

    2015-01-01

    This thesis assesses molecular underpinnings of responses to promising targeted agents for pediatric tumors of Central Nervous System (CNS), incorporating preclinical testing of novel and translatable combination therapies to define the best therapy for each tumor cell specific molecular aberration.

  13. Physics of Automatic Target Recognition

    CERN Document Server

    Sadjadi, Firooz

    2007-01-01

    Physics of Automatic Target Recognition addresses the fundamental physical bases of sensing, and information extraction in the state-of-the art automatic target recognition field. It explores both passive and active multispectral sensing, polarimetric diversity, complex signature exploitation, sensor and processing adaptation, transformation of electromagnetic and acoustic waves in their interactions with targets, background clutter, transmission media, and sensing elements. The general inverse scattering, and advanced signal processing techniques and scientific evaluation methodologies being used in this multi disciplinary field will be part of this exposition. The issues of modeling of target signatures in various spectral modalities, LADAR, IR, SAR, high resolution radar, acoustic, seismic, visible, hyperspectral, in diverse geometric aspects will be addressed. The methods for signal processing and classification will cover concepts such as sensor adaptive and artificial neural networks, time reversal filt...

  14. National Ignition Facility Target Chamber

    Energy Technology Data Exchange (ETDEWEB)

    Wavrik, R W; Cox, J R; Fleming, P J

    2000-10-05

    On June 11, 1999 the Department of Energy dedicated the single largest piece of the National Ignition Facility (NIF) at Lawrence Livermore National Laboratory (LLNL) in Livermore, California. The ten (10) meter diameter aluminum target high vacuum chamber will serve as the working end of the largest laser in the world. The output of 192 laser beams will converge at the precise center of the chamber. The laser beams will enter the chamber in two by two arrays to illuminate 10 millimeter long gold cylinders called hohlraums enclosing 2 millimeter capsule containing deuterium, tritium and isotopes of hydrogen. The two isotopes will fuse, thereby creating temperatures and pressures resembling those found only inside stars and in detonated nuclear weapons, but on a minute scale. The NIF Project will serve as an essential facility to insure safety and reliability of our nation's nuclear arsenal as well as demonstrating inertial fusion's contribution to creating electrical power. The paper will discuss the requirements that had to be addressed during the design, fabrication and testing of the target chamber. A team from Sandia National Laboratories (SNL) and LLNL with input from industry performed the configuration and basic design of the target chamber. The method of fabrication and construction of the aluminum target chamber was devised by Pitt-Des Moines, Inc. (PDM). PDM also participated in the design of the chamber in areas such as the Target Chamber Realignment and Adjustment System, which would allow realignment of the sphere laser beams in the event of earth settlement or movement from a seismic event. During the fabrication of the target chamber the sphericity tolerances had to be addressed for the individual plates. Procedures were developed for forming, edge preparation and welding of individual plates. Construction plans were developed to allow the field construction of the target chamber to occur parallel to other NIF construction activities. This

  15. Theoretical aspects of inflation targeting

    Directory of Open Access Journals (Sweden)

    Obradović Jelena

    2014-01-01

    Full Text Available Inflation targeting is one of the possible strategies used by central banks during conducting monetary policy. The basic characteristics, advantages and disadvantages of inflation targeting will be presented in this paper. The focus is on the the presentation and interpretation of the understanding of this strategy from the perspective of monetarist and Keynesian theory, the theory of rational expectations, and methodological analysis of the strategy in light of the game theory using payoff matrix.

  16. Targeted immunotherapy in Hodgkin lymphoma

    DEFF Research Database (Denmark)

    Hutchings, Martin

    2015-01-01

    In this issue of Blood, Rothe et al introduce a new principle of targeted Hodgkin lymphoma (HL) immunotherapy in their report from a phase 1 study of the bispecific anti-CD30/CD16A antibody construct AFM13.......In this issue of Blood, Rothe et al introduce a new principle of targeted Hodgkin lymphoma (HL) immunotherapy in their report from a phase 1 study of the bispecific anti-CD30/CD16A antibody construct AFM13....

  17. Targeting the nuclear RNA exosome

    DEFF Research Database (Denmark)

    Meola, Nicola; Jensen, Torben Heick

    2017-01-01

    Centrally positioned in nuclear RNA metabolism, the exosome deals with virtually all transcript types. This 3'-5' exo- and endo-nucleolytic degradation machine is guided to its RNA targets by adaptor proteins that enable substrate recognition. Recently, the discovery of the 'Poly(A) tail exosome...... targeting (PAXT)' connection as an exosome adaptor to human nuclear polyadenylated transcripts has relighted the interest of poly(A) binding proteins (PABPs) in both RNA productive and destructive processes....

  18. Chalcogenide thin films deposited by rfMS technique using a single quaternary target

    Science.gov (United States)

    Prepelita, P.; Stavarache, I.; Negrila, C.; Garoi, F.; Craciun, V.

    2017-12-01

    Thin films of chalcogenide, Cu(In,Ga)Se2 have been obtained using a single quaternary target by radio frequency magnetron sputtering method, with thickness in the range 750 nm to 1200 nm. X-ray photoelectron spectroscopy investigations showed, that the composition of Cu(In,Ga)Se2 thin films was very similar to that of the used target CuIn0.75Ga0.25Se2. Identification of the chemical composition of Cu(In,Ga)Se2 thin films by XPS performed in high vacuum, emphasized that the samples exhibit surface features suitable to be integrated into the structure of solar cells. Atomic Force Microscopy and Scanning Electron Microscopy investigations showed that surface morphology was influenced by the increase in thickness of the Cu(In,Ga)Se2 layer. From X-Ray Diffraction investigations it was found that all films were polycrystalline, having a tetragonal lattice with a preferential orientation along the (112) direction. The optical reflectance as a function of wavelength was measured for the studied samples. The increase in thickness of the Cu(In,Ga)Se2 absorber determined a decrease of its optical bandgap value from 1.53 eV to 1.44 eV. The results presented in this paper showed an excellent alternative of obtaining Cu(In,Ga)Se2 compound thin films from a single target.

  19. Design and production of color calibration targets for digital input devices

    Science.gov (United States)

    Wen, ChaoHua; Lee, Jyh-Jiun

    2000-06-01

    This paper presents the design and production of calibration targets for digital input color devices. By experimentally determined gamut of surface color, this study redesigns the aim values based on ISO/FDIS 12641 and to meet process specifications of Noritsu QSS23-HRCRT photographic printer with silver halide photography. The calibration target includes four components: a set of 144 color patches (3 levels in lightness and 4 levels in chroma at 12 different hue angles) within printing gamut, a neutral scale containing 22 steps based on visual perception, a set of C- M-Y-K-R-G-B dye scales showing characteristics of photographic materials, and a series of facial colors ranked by red. This research will describe the meaning of each element, the use of colorimetric mapping to CIELCH for each element, the conversion of these patch into a RGB-mode electronic image file, and how to control the processing of color photographic materials. And we proposed an approach of dynamic subgroup linear interpolation to achieve high process quality of manufacturing calibration targets and cost-down. Finally, statistic results revealed that 99% of the patches are within 10 delta Eab of the aim values specified in this study from long-term test and 99% of the patches in the manufacturing batch are within 5 delta Eab of the mean values from short-term test.

  20. Effect of a Targeted Women's Health Intervention in an Inner-City Emergency Department

    Directory of Open Access Journals (Sweden)

    Debra Houry

    2011-01-01

    Full Text Available Objective. To evaluate the effect of an Emergency Department (ED based, educational intervention for at-risk health behaviors. Methods. A randomized trial over a one-year period. African American women, aged 21–55, presenting to the ED waiting room were eligible. Each participant took a computer-based survey on health risk behaviors. Participants who screened positive on any of four validated scales (for IPV, nicotine, alcohol, or drug dependence were randomized to standard information about community resources (control or to targeted educational handouts based upon their screening results (intervention. Participants were surveyed at 3 months regarding contacts with community resources and harm-reduction actions. Results. 610 women were initially surveyed; 326 screened positive (13.7% for IPV, 40.1% for nicotine addiction, 26.6% for alcohol abuse, and 14.4% for drug abuse. 157 women were randomized to intervention and 169 to control. Among women who completed follow-up (=71, women in the Intervention Group were significantly more likely to have contacted local resources (37% versus 9%, =0.04 and were more likely to have taken risk-reducing action (97% versus 79%, =0.04. Conclusion. Targeted, brief educational interventions may be an effective method for targeting risk behaviors among vulnerable ED populations.

  1. The Bering Autonomous Target Detection

    DEFF Research Database (Denmark)

    Jørgensen, John Leif; Denver, Troelz; Betto, Maurizio

    2003-01-01

    An autonomous asteroid target detection and tracking method has been developed. The method features near omnidirectionality and focus on high speed operations and completeness of search of the near space rather than the traditional faint object search methods, employed presently at the larger...... telescopes. The method has proven robust in operation and is well suited for use onboard spacecraft. As development target for the method and the associated instrumentation the asteroid research mission Bering has been used. Onboard a spacecraft, the autonomous detection is centered around the fully...... autonomous star tracker the Advanced Stellar Compass (ASC). One feature of this instrument is that potential targets are registered directly in terms of date, right ascension, declination, and intensity, which greatly facilitates both tracking search and registering. Results from ground and inflight tests...

  2. Pharmacogenomics of GPCR Drug Targets

    DEFF Research Database (Denmark)

    Hauser, Alexander Sebastian; Chavali, Sreenivas; Masuho, Ikuo

    2017-01-01

    Natural genetic variation in the human genome is a cause of individual differences in responses to medications and is an underappreciated burden on public health. Although 108 G-protein-coupled receptors (GPCRs) are the targets of 475 (∼34%) Food and Drug Administration (FDA)-approved drugs...... and account for a global sales volume of over 180 billion US dollars annually, the prevalence of genetic variation among GPCRs targeted by drugs is unknown. By analyzing data from 68,496 individuals, we find that GPCRs targeted by drugs show genetic variation within functional regions such as drug......- and effector-binding sites in the human population. We experimentally show that certain variants of μ-opioid and Cholecystokinin-A receptors could lead to altered or adverse drug response. By analyzing UK National Health Service drug prescription and sales data, we suggest that characterizing GPCR variants...

  3. INFLATION TARGETING IN EASTERN EUROPE

    Directory of Open Access Journals (Sweden)

    Laurian Lungu

    2006-05-01

    Full Text Available This paper addresses the inflation targeting approach in three transition economies, namely Hungary, Poland and the Czech Republic with the use of Taylor rules as benchmarks. The three economies considered have been successful at achieving disinflation, but deviations of inflation from its target have been persistent in all cases. Except for the Czech Republic, deviations from the Taylor rule are large and persistent, with Hungary displaying the largest fluctuations. Polish interest rates have consistently exceeded those suggested by the Taylor rule and given the prevalence of high unemployment, these undershootings do not augur well for the stability of monetary policy. Finally, the behaviour of Czech interest rates can be remarkably captured by the simple Taylor rule proposed in this paper, suggesting that the Czech National Bank has been the most successful at stabilising inflation and output around their target levels.

  4. Targeting Angiogenesis in Childhood Sarcomas

    Directory of Open Access Journals (Sweden)

    Hemant K. Bid

    2011-01-01

    Full Text Available Angiogenesis and vasculogenesis constitute two processes in the formation of new blood vessels and are essential for progression of solid tumors. Consequently, targeting angiogenesis, and to a lesser extent vasculogenesis, has become a major focus in cancer drug development. Angiogenesis inhibitors are now being tested in pediatric populations whereas inhibitors of vasculogenesis are in an earlier stage of development. Despite the initial enthusiasm for targeting angiogenesis for treatment of cancer, clinical trials have shown only incremental increases in survival, and agents have been largely cytostatic rather than inducing tumor regressions. Consequently, the role of such therapeutic approaches in the context of curative intent for childhood sarcomas is less clear. Here we review the literature on blood vessel formation in sarcomas with a focus on pediatric sarcomas and developments in targeting angiogenesis for treatment of these rare cancers.

  5. Ribosome Assembly as Antimicrobial Target

    Directory of Open Access Journals (Sweden)

    Rainer Nikolay

    2016-05-01

    Full Text Available Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors.

  6. Progress with developing a target for magnetized target fusion

    Energy Technology Data Exchange (ETDEWEB)

    Wysocki, F.J.; Chrien, R.E.; Idzorek, G.; Oona, H.; Whiteson, D.O.; Kirkpatrick, R.C.; Lindemuth, I.R.; Sheehey, P.T.

    1997-09-01

    Magnetized Target Fusion (MTF) is an approach to fusion where a preheated and magnetized plasma is adiabatically compressed to fusion conditions. Successful MTF requires a suitable initial target plasma with an embedded magnetic field of at least 5 T in a closed-field-line topology, a density of roughly 10{sup 18} cm{sup {minus}3}, a temperature of at least 50 eV, and must be free of impurities which would raise radiation losses. Target plasma generation experiments are underway at Los Alamos National Laboratory using the Colt facility; a 0.25 MJ, 2--3 {micro}s rise-time capacitor bank. The goal of these experiments is to demonstrate plasma conditions meeting the minimum requirements for a MTF initial target plasma. In the first experiments, a Z-pinch is produced in a 2 cm radius by 2 cm high conducting wall using a static gas-fill of hydrogen or deuterium gas in the range of 0.5 to 2 torr. Thus far, the diagnostics include an array of 12 B-dot probes, framing camera, gated OMA visible spectrometer, time-resolved monochrometer, filtered silicon photodiodes, neutron yield, and plasma-density interferometer. These diagnostics show that a plasma is produced in the containment region that lasts roughly 10 to 20 {micro}s with a maximum plasma density exceeding 10{sup 18} cm{sup {minus}3}. The experimental design and data are presented.

  7. Targeted Therapies for Pancreatic Cancer

    Directory of Open Access Journals (Sweden)

    Idoroenyi Amanam

    2018-01-01

    Full Text Available Pancreatic cancer is the third leading cause of cancer related death and by 2030, it will be second only to lung cancer. We have seen tremendous advances in therapies for lung cancer as well as other solid tumors using a molecular targeted approach but our progress in treating pancreatic cancer has been incremental with median overall survival remaining less than one year. There is an urgent need for improved therapies with better efficacy and less toxicity. Small molecule inhibitors, monoclonal antibodies and immune modulatory therapies have been used. Here we review the progress that we have made with these targeted therapies.

  8. Harnessing off-target effects

    DEFF Research Database (Denmark)

    Saginc, Gaye; Voellmy, Franziska; Linding, Rune

    2017-01-01

    The 'off-targets' of a drug are often poorly characterized yet could be harnessed in the treatment of complex diseases. A recent study used a small-molecule screening in non-small-cell lung cancer to repurpose an FDA-approved ALK/IGF1R inhibitor and uncover its mechanism of action.......The 'off-targets' of a drug are often poorly characterized yet could be harnessed in the treatment of complex diseases. A recent study used a small-molecule screening in non-small-cell lung cancer to repurpose an FDA-approved ALK/IGF1R inhibitor and uncover its mechanism of action....

  9. The OPERA experiment Target Tracker

    CERN Document Server

    Adam, T; Borer, K.; Campagne, Jean-Eric; Con-Sen, N.; de La Taille, C.; Dick, N.; Dracos, M.; Gaudiot, G.; Goeltzenlichter, T.; Gornushkin, Y.; Grapton, J.-N.; Guyonnet, J.-L.; Hess, M.; Igersheim, R.; Janicsko Csathy, J.; Jollet, C.; Juget, F.; Kocher, H.; Krasnoperov, A.; Krumstein, Z.; Martin-Chassard, G.; Moser, U.; Nozdrin, A.; Olchevski, A.; Porokhovoi, S.; Raux, L.; Sadovski, A.; Schuler, J.; Schutz, H.-U.; Schwab, C.; Smolnikov, A.; Van Beek, G.; Vilain, P.; Walchli, T.; Wilquet, G.; Wurtz, J.

    2007-01-01

    The main task of the Target Tracker detector of the long baseline neutrino oscillation OPERA experiment is to locate in which of the target elementary constituents, the lead/emulsion bricks, the neutrino interactions have occurred and also to give calorimetric information about each event. The technology used consists in walls of two planes of plastic scintillator strips, one per transverse direction. Wavelength shifting fibres collect the light signal emitted by the scintillator strips and guide it to both ends where it is read by multi-anode photomultiplier tubes. All the elements used in the construction of this detector and its main characteristics are described.

  10. Target-Centric Network Modeling

    DEFF Research Database (Denmark)

    Mitchell, Dr. William L.; Clark, Dr. Robert M.

    In Target-Centric Network Modeling: Case Studies in Analyzing Complex Intelligence Issues, authors Robert Clark and William Mitchell take an entirely new approach to teaching intelligence analysis. Unlike any other book on the market, it offers case study scenarios using actual intelligence......, and collaborative sharing in the process of creating a high-quality, actionable intelligence product. The case studies reflect the complexity of twenty-first century intelligence issues by dealing with multi-layered target networks that cut across political, economic, social, technological, and military issues....... Working through these cases, students will learn to manage and evaluate realistic intelligence accounts....

  11. Analysis of miRNAs and their target genes associated with lipid metabolism in duck liver.

    Science.gov (United States)

    He, Jun; Wang, Weiqun; Lu, Lizhi; Tian, Yong; Niu, Dong; Ren, Jindong; Dong, Liyan; Sun, Siwei; Zhao, Yan; Chen, Li; Shen, Jianliang; Li, Xiuhong

    2016-06-08

    Fat character is an important index in duck culture that linked to local flavor, feed cost and fat intake for costumers. Since the regulation networks in duck lipid metabolism had not been reported very clearly, we aimed to explore the potential miRNA-mRNA pairs and their regulatory roles in duck lipid metabolism. Here, Cherry-Valley ducks were selected and treated with/without 5% oil added in feed for 2 weeks, and then fat content determination was performed on. The data showed that the fat contents and the fatty acid ratios of C17:1 and C18:2 were up-regulated in livers of oil-added ducks, while the C12:0 ratio was down-regulated. Then 21 differential miRNAs, including 10 novel miRNAs, were obtain from the livers by sequencing, and 73 target genes involved in lipid metabolic processes of these miRNAs were found, which constituted 316 miRNA-mRNA pairs. Two miRNA-mRNA pairs including one novel miRNA and one known miRNA, N-miR-16020-FASN and gga-miR-144-ELOVL6, were selected to validate the miRNA-mRNA negative relation. And the results showed that N-mir-16020 and gga-miR-144 could respectively bind the 3'-UTRs of FASN and ELOVL6 to control their expressions. This study provides new sights and useful information for future research on regulation network in duck lipid metabolism.

  12. TARGET Imbalances at Record Levels

    DEFF Research Database (Denmark)

    Hallett, Andrew Hughes

    TARGET is the payments system for making settlements between euro area economies and five other EU economies. Cross-border transactions generate claims/surpluses and liabilities/deficits among national central banks which “net out” for the system as a whole. These imbalances are manageable in rel...

  13. Targeted nanoparticles for colorectal cancer

    DEFF Research Database (Denmark)

    Cisterna, Bruno A.; Kamaly, Nazila; Choi, Won Il

    2016-01-01

    Colorectal cancer (CRC) is highly prevalent worldwide, and despite notable progress in treatment still leads to significant morbidity and mortality. The use of nanoparticles as a drug delivery system has become one of the most promising strategies for cancer therapy. Targeted nanoparticles could...

  14. Communicating to heterogeneous target groups

    DEFF Research Database (Denmark)

    Pedersen, Karsten

    very often have to communicate to rather heterogeneous target groups that have little more in common than a certain geographical habitat. That goes against most schoolbook teaching in the field of communication, but is none the less the terms with which that kind of communication has to live...

  15. Emerging targets in treating pain.

    Science.gov (United States)

    Chang, David S; Raghavan, Rahul; Christiansen, Sandy; Cohen, Steven P

    2015-08-01

    To provide an overview on drug targets and emerging pharmacological treatment options for chronic pain. Chronic pain poses an enormous socioeconomic burden for the more than 30% of people who suffer from it, costing over $600 billion per year in the USA. In recent years, there has been a surge in preclinical and clinical research endeavors to try to stem this epidemic. Preclinical studies have identified a wide array of potential targets, with some of the most promising translational research being performed on novel opioid receptors, cannabinoid receptors, selective ion channel blockers, cytokine inhibitors, nerve growth factor inhibitors, N-methyl-D-aspartate receptor antagonists, glial cell inhibitors, and bisphosphonates. There are many obstacles for the development of effective medications to treat chronic pain, including the inherent challenges in identifying pathophysiological mechanisms, the overlap and multiplicity of pain pathways, and off-target adverse effects stemming from the ubiquity of drug target receptor sites and the lack of highly selective receptor ligands. Despite these barriers, the number and diversity of potential therapies have continued to grow, to include disease-modifying and individualized drug treatments.

  16. Tumor targeting via integrin ligands

    Directory of Open Access Journals (Sweden)

    Udaya Kiran eMarelli

    2013-08-01

    Full Text Available Selective and targeted delivery of drugs to tumors is a major challenge for an effective cancer therapy and also to overcome the side effects associated with current treatments. Overexpression of various receptors on tumor cells is a characteristic structural and biochemical aspect of tumors and distinguishes them from physiologically normal cells. This abnormal feature is therefore suitable for selectively directing anticancer molecules to tumors by using ligands that can preferentially recognize such receptors. Several subtypes of integrin receptors that are crucial for cell adhesion, cell signaling, cell viability and motility have been shown to have an upregulated expression on cancer cells. Thus, ligands that recognize specific integrin subtypes represent excellent candidates to be conjugated to drugs or drug carrier systems and be targeted to tumors. In this regard, integrins recognizing the RGD cell adhesive sequence have been extensively targeted for tumor specific drug delivery. Here we review key recent examples on the presentation of RGD-based integrin ligands by means of distinct drug delivery systems, and discuss the prospects of such therapies to specifically target tumor cells.

  17. How are inflation targets set?

    Czech Academy of Sciences Publication Activity Database

    Horváth, R.; Matějů, Jakub

    -, č. 426 (2010), s. 1-35 ISSN 1211-3298 Grant - others:MŠk(CZ) SVV-2010-261801 Institutional research plan: CEZ:MSM0021620846 Keywords : inflation targeting * central bank * credibility Subject RIV: AH - Economics http://www.cerge-ei.cz/pdf/wp/Wp426.pdf

  18. High power neutron production targets

    Energy Technology Data Exchange (ETDEWEB)

    Wender, S. [Los Alamos National Lab., NM (United States)

    1996-06-01

    The author describes issues of concern in the design of targets and associated systems for high power neutron production facilities. The facilities include uses for neutron scattering, accelerator driven transmutation, accelerator production of tritium, short pulse spallation sources, and long pulse spallation sources. Each of these applications requires a source with different design needs and consequently different implementation in practise.

  19. Targeted nanoparticles for colorectal cancer

    DEFF Research Database (Denmark)

    Cisterna, Bruno A.; Kamaly, Nazila; Choi, Won Il

    2016-01-01

    Colorectal cancer (CRC) is highly prevalent worldwide, and despite notable progress in treatment still leads to significant morbidity and mortality. The use of nanoparticles as a drug delivery system has become one of the most promising strategies for cancer therapy. Targeted nanoparticles could ...

  20. Targeted Therapies in Endometrial Cancer

    Directory of Open Access Journals (Sweden)

    Selen Dogan

    2014-04-01

    Full Text Available Endometrial cancer is the most common genital cancer in developed world. It is generally diagnosed in early stage and it has a favorable prognosis. However, advanced staged disease and recurrences are difficult to manage. There are some common genetic alterations related to endometrial carcinogenesis in similar fashion to other cancers. Personalized medicine, which means selection of best suited treatment for an individual, has gain attention in clinical care of patients in recent years. Targeted therapies were developed as a part of personalized or %u201Ctailored%u201D medicine and specifically acts on a target or biologic pathway. There are quite a number of molecular alteration points in endometrial cancer such as PTEN tumor suppressor genes, DNA mismatch repair genes, PI3K/AKT/mTOR pathway and p53 oncogene which all might be potential candidates for tailored targeted therapy. In recent years targeted therapies has clinical application in ovarian cancer patients and in near future with the advent of new agents these %u201Ctailored%u201D drugs will be in market for routine clinical practice in endometrial cancer patients, in primary disease and recurrences as well.

  1. The Automatic Measurement of Targets

    DEFF Research Database (Denmark)

    Höhle, Joachim

    1997-01-01

    The automatic measurement of targets is demonstrated by means of a theoretical example and by an interactive measuring program for real imagery from a réseau camera. The used strategy is a combination of two methods: the maximum correlation coefficient and the correlation in the subpixel range...

  2. Polarized Scintillating Targets at Psi

    Science.gov (United States)

    van den Brandt, B.; Bunyatova, E. I.; Hautle, P.; Konter, J. A.; Mango, S.

    2001-02-01

    Scintillating polarized targets are now routinely available: blocks of 18×18×5 mm scintillating organic polymer, doped with TEMPO, polarized dynamically in a field of 2.5 T in a vertical 3He-4He dilution refrigerator. A 19 mm diameter plastic lightguide transports the scintillation light from the sample in the mixing chamber to a photomultiplier outside the cryostat.

  3. Aptamers for Targeted Drug Delivery

    Directory of Open Access Journals (Sweden)

    Partha Ray

    2010-05-01

    Full Text Available Aptamers are a class of therapeutic oligonucleotides that form specific three-dimensional structures that are dictated by their sequences. They are typically generated by an iterative screening process of complex nucleic acid libraries employing a process termed Systemic Evolution of Ligands by Exponential Enrichment (SELEX. SELEX has traditionally been performed using purified proteins, and cell surface receptors may be challenging to purify in their properly folded and modified conformations. Therefore, relatively few aptamers have been generated that bind cell surface receptors. However, improvements in recombinant fusion protein technology have increased the availability of receptor extracellular domains as purified protein targets, and the development of cell-based selection techniques has allowed selection against surface proteins in their native configuration on the cell surface. With cell-based selection, a specific protein target is not always chosen, but selection is performed against a target cell type with the goal of letting the aptamer choose the target. Several studies have demonstrated that aptamers that bind cell surface receptors may have functions other than just blocking receptor-ligand interactions. All cell surface proteins cycle intracellularly to some extent, and many surface receptors are actively internalized in response to ligand binding. Therefore, aptamers that bind cell surface receptors have been exploited for the delivery of a variety of cargoes into cells. This review focuses on recent progress and current challenges in the field of aptamer-mediated delivery.

  4. Targeted Advertising and Social Status

    NARCIS (Netherlands)

    N. Vikander (Nick)

    2010-01-01

    textabstractThis paper shows how a firm can use non-targeted advertising to exploit consumers' desire for social status. A monopolist sells multiple varieties of a good to consumers who each care about what others believe about his wealth. Advertising allows consumers both to buy different varieties

  5. Polarimetric imaging of underwater targets

    Science.gov (United States)

    Gilerson, Alex; Carrizo, Carlos; Tonizzo, Alberto; Ibrahim, Amir; El-Habashi, Ahmed; Foster, Robert; Ahmed, Samir

    2013-06-01

    Underwater imaging is challenging because of the significant attenuation of light due to absorption and scattering of light in water. Using polarization properties of light is one of the options for improving image quality. We present results of imaging of a polarized target in open ocean (Curacao) and coastal (NY Bight) waters. The target in the shape of a square is divided into several smaller squares, each of which is covered with a polarizing film with different polarization orientations or transmission coefficients was placed on a mirror and imaged under water by a green-band full-Stokes polarimetric video camera at the full range of azimuth angles against the Sun. The values of the Stokes vector components from the images are compared with the modeled image of the target using radiative transfer code for the atmosphere-ocean system combined with the simple imaging model. It is shown that even in clear water the impact of the water body on the polarized underwater image is very significant and retrieval of target polarization characteristics from the image is extremely challenging.

  6. Target selection for direct marketing.

    NARCIS (Netherlands)

    Bult, Jan Roelf

    1993-01-01

    In this thesis we concentrated on the use ol direct mail for targeting potential buyers. The major characteristics that influences the success of a plomotional direct mail campaign are the of-fbr,the communication elements, the timing or sequence of these communication elements, and the list of

  7. Uranium briquettes for irradiation target

    Energy Technology Data Exchange (ETDEWEB)

    Saliba-Silva, Adonis Marcelo; Garcia, Rafael Henrique Lazzari; Martins, Ilson Carlos; Carvalho, Elita Fontenele Urano de; Durazzo, Michelangelo, E-mail: saliba@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

    2011-07-01

    Direct irradiation on targets inside nuclear research or multiple purpose reactors is a common route to produce {sup 99}Mo-{sup 99m}Tc radioisotopes. Nevertheless, since the imposed limits to use LEU uranium to prevent nuclear armament production, the amount of uranium loaded in target meats has physically increased and new processes have been proposed for production. Routes using metallic uranium thin film and UAl{sub x} dispersion have been used for this purpose. Both routes have their own issues, either by bringing difficulties to disassemble the aluminum case inside hot cells or by generating great amount of alkaline radioactive liquid rejects. A potential route might be the dispersion of powders of LEU metallic uranium and nickel, which are pressed as a blend inside a die and followed by pulse electroplating of nickel. The electroplating provides more strength to the briquettes and creates a barrier for gas evolution during neutronic disintegration of {sup 235}U. A target briquette platted with nickel encapsulated in an aluminum case to be irradiated may be an alternative possibility to replace other proposed targets. This work uses pulse Ni-electroplating over iron powder briquette to simulate the covering of uranium by nickel. The following parameters were applied 10 times for each sample: 900Hz, -0.84A/square centimeters with duty cycle of 0.1 in Watts Bath. It also presented the optical microscopy analysis of plated microstructure section. (author)

  8. Collisional disruptions of rotating targets

    Science.gov (United States)

    Ševeček, Pavel; Broz, Miroslav

    2017-10-01

    Collisions are key processes in the evolution of the Main Asteroid Belt and impact events - i.e. target fragmentation and gravitational reaccumulation - are commonly studied by numerical simulations, namely by SPH and N-body methods. In our work, we extend the previous studies by assuming rotating targets and we study the dependence of resulting size-distributions on the pre-impact rotation of the target. To obtain stable initial conditions, it is also necessary to include the self-gravity already in the fragmentation phase which was previously neglected.To tackle this problem, we developed an SPH code, accelerated by SSE/AVX instruction sets and parallelized. The code solves the standard set of hydrodynamic equations, using the Tillotson equation of state, von Mises criterion for plastic yielding and scalar Grady-Kipp model for fragmentation. We further modified the velocity gradient by a correction tensor (Schäfer et al. 2007) to ensure a first-order conservation of the total angular momentum. As the intact target is a spherical body, its gravity can be approximated by a potential of a homogeneous sphere, making it easy to set up initial conditions. This is however infeasible for later stages of the disruption; to this point, we included the Barnes-Hut algorithm to compute the gravitational accelerations, using a multipole expansion of distant particles up to hexadecapole order.We tested the code carefully, comparing the results to our previous computations obtained with the SPH5 code (Benz and Asphaug 1994). Finally, we ran a set of simulations and we discuss the difference between the synthetic families created by rotating and static targets.

  9. Cellular Targets of Dietary Polyphenol Resveratrol

    National Research Council Canada - National Science Library

    Wu, Joseph M

    2006-01-01

    To test the hypothesis that resveratrol, a grape derived polyphenol, exerts its chemopreventive properties against prostate cancer by interacting with specific cellular targets, denoted resveratrol targeting proteins (RTPs...

  10. North Pacific Targets Program Environmental Assessment

    National Research Council Canada - National Science Library

    2001-01-01

    .... The STPO would provide the Strategic Target System launch vehicle for strategic target launch services from Kodiak Launch Complex, Kodiak Island, Alaska, a commercial rocket launch facility operated...

  11. Targeted nanosystems: Advances in targeted dendrimers for cancer therapy.

    Science.gov (United States)

    Yang, Hu

    2016-02-01

    Dendrimers possess discrete highly compact nanostructures constituted of successive branched layers. Soon after the inception of dendrimers, recognition of their tunable structures and biologically favorable properties provoked a great enthusiasm in delving deeply into the utility of dendrimers for biomedical and pharmaceutical applications. One of the most important nanotechnology applications is the development of nanomedicines for targeted cancer therapies. Tremendous success in targeted therapies has been achieved with the use of dendrimer-based nanomedicines. This article provides a concise review on latest advances in the utility of dendrimers in immunotherapies and hormone therapies. Much basic and clinical research has been done since the invention of dendrimers, which are highly branched nano-sized molecules with the ability to act as carriers in nanomedicine. In this concise review article, the authors highlighted the current use of dendrimers in immunotherapies and hormone therapies in the fight against cancers. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Emerging targets in human lymphoma: targeting the MYD88 mutation

    Directory of Open Access Journals (Sweden)

    Wang JQ

    2013-08-01

    Full Text Available James Q Wang,* Yogesh S Jeelall,* Keisuke Horikawa* Department of Immunology, The John Curtin School of Medical Research, Australian National University, Canberra, ACT, Australia *All authors contributed equally to this manuscript Abstract: B cell neoplasms co-opt the molecular machinery of normal B cells for their survival. Technological advances in cancer genomics has significantly contributed to uncovering the root cause of aggressive lymphomas, revealing a previously unknown link between TLR signaling and B cell neoplasm. Recurrent oncogenic mutations in MYD88 have been found in 39% of the activated B cell-like subtype of diffuse large B cell lymphoma (ABC DLBCL. Interestingly, 29% of ABC DLBCL have a single amino acid substitution of proline for the leucine at position 265 (L265P, and the exact same variant has also been identified in a number of lymphoid malignancies. The MYD88 L265P variant was recently identified in 90% of Wadenstrom's macroglobulinemia patients. These recent developments warrant the need for novel diagnostic tools as well as targeted therapeutics. In this review, we discuss the physiological functions of MYD88 and focus on its role in B cell lymphomas, evaluating the potential for targeting oncogenic MYD88 in lymphoma. Keywords: MYD88, L265P mutation, lymphoma, targeted therapy

  13. 29 CFR 14.4 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... security. (c) Courier—an individual designated by appropriate authority to protect classified and... the transaction of public business; this includes material preserved by an agency or its legitimate...

  14. GPCR Interaction: 144 [GRIPDB[Archive

    Lifescience Database Archive (English)

    Full Text Available RET (SRET) Radioligand binding, Measurement of cAMP accumulation, Immunoprecipitation, Western Immunoblottin...g, Immunocytochemistry Staining and Fluorescent Imaging, Measurement of ERK phosphorylation NP_057167.2 ...

  15. The real Fatou conjecture (AM-144)

    CERN Document Server

    Graczyk, Jacek

    2014-01-01

    In 1920, Pierre Fatou expressed the conjecture that--except for special cases--all critical points of a rational map of the Riemann sphere tend to periodic orbits under iteration. This conjecture remains the main open problem in the dynamics of iterated maps. For the logistic family x- ax(1-x), it can be interpreted to mean that for a dense set of parameters ""a,"" an attracting periodic orbit exists. The same question appears naturally in science, where the logistic family is used to construct models in physics, ecology, and economics. In this book, Jacek Graczyk and Grzegorz Swiatek provi

  16. 45 CFR 144.103 - Definitions.

    Science.gov (United States)

    2010-10-01

    ....117. State means each of the several States, the District of Columbia, Puerto Rico, the Virgin Islands... vaccines), or Title XXII of the PHS Act. (4) Continuation coverage means coverage under a COBRA...

  17. Reference: 144 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available gulates lateral root development in Arabidopsis. 6 996-1006 15584963 2004 Dec The Plant journal Chakrabarty Pranjib K|Nodzon Lisa A|Pi Li-Ya|Song Wen-Yuan|Wang Yongsheng|Xu Wei-Hui

  18. 10 CFR 600.144 - Procurement procedures.

    Science.gov (United States)

    2010-01-01

    ... practicable, of technical requirements in terms of functions to be performed or performance required... products and services dimensioned in the metric system of measurement. (vi) Preference, to the extent... small businesses, minority-owned firms, and women's business enterprises, whenever possible. Recipients...

  19. 40 CFR 144.3 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... or revisions. Appropriate Act and regulations means the Solid Waste Disposal Act, as amended by the... “drywell” that receives untreated sanitary waste containing human excreta, and which sometimes has an open... reissuance, or termination, as discussed in § 124.5 is not a “draft permit.” Drilling mud means a heavy...

  20. 7 CFR 1703.144 - Completed application.

    Science.gov (United States)

    2010-01-01

    ... objectives and activities; and (4) A budget for capital expenditures reflecting the line item costs for the... toll charges, system maintenance, salaries, training, and any other general operating expenses, provide... the applicant is requesting a loan for telecommunications transmission facilities): (1) The...

  1. Publications | Page 144 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    IDRC works with developing-country researchers and institutions to build local capacity through funding, knowledge sharing, and training. Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. We share the results of our funded ...

  2. 144 Sanchita Hati and Dipankar Datta

    Indian Academy of Sciences (India)

    Lit is a hard (h) acid, Cs" a soft (s) acid, F a hard base and I a soft base. Li+ i + Cst F = Lit F + Cs"I AH = - 12.1 kcal mol. (1) h S S h h h s is. As indicated by the AH value, reaction (1) proceeds in a direction where h binds hand s binds s, in conformity with the HSAB principle. This principle can be said to be the first step ...

  3. 22 CFR 144.103 - Definitions.

    Science.gov (United States)

    2010-04-01

    ..., auxiliary aids useful for persons with impaired vision include readers, brailled materials, audio recordings... hearing include telephone handset amplifiers, telephones compatible with hearing aids, telecommunication... person who is a member of a class of persons otherwise entitled by statute, regulation, or agency policy...

  4. Targeting an efficient target-to-target interval for P300 speller brain–computer interfaces

    Science.gov (United States)

    Sellers, Eric W.; Wang, Xingyu

    2013-01-01

    Longer target-to-target intervals (TTI) produce greater P300 event-related potential amplitude, which can increase brain–computer interface (BCI) classification accuracy and decrease the number of flashes needed for accurate character classification. However, longer TTIs requires more time for each trial, which will decrease the information transfer rate of BCI. In this paper, a P300 BCI using a 7 × 12 matrix explored new flash patterns (16-, 18- and 21-flash pattern) with different TTIs to assess the effects of TTI on P300 BCI performance. The new flash patterns were designed to minimize TTI, decrease repetition blindness, and examine the temporal relationship between each flash of a given stimulus by placing a minimum of one (16-flash pattern), two (18-flash pattern), or three (21-flash pattern) non-target flashes between each target flashes. Online results showed that the 16-flash pattern yielded the lowest classification accuracy among the three patterns. The results also showed that the 18-flash pattern provides a significantly higher information transfer rate (ITR) than the 21-flash pattern; both patterns provide high ITR and high accuracy for all subjects. PMID:22350331

  5. Experimental test of a newly developed single-moderator, multi-detector, directional neutron spectrometer in reference monochromatic fields from 144 keV to 16.5 MeV

    Energy Technology Data Exchange (ETDEWEB)

    Bedogni, R., E-mail: roberto.bedogni@lnf.infn.it [INFN – LNF, via E. Fermi n. 40, 00044 Frascati (Roma) (Italy); Gómez-Ros, J.M. [INFN – LNF, via E. Fermi n. 40, 00044 Frascati (Roma) (Italy); CIEMAT, Av. Complutense 40, 28040 Madrid (Spain); Pola, A.; Bortot, D. [Politecnico di Milano, Dipartimento di Energia, via La Masa 34, 20156 Milano (Italy); INFN – Milano, Via Celoria 16, 20133 Milano (Italy); Gentile, A. [INFN – LNF, via E. Fermi n. 40, 00044 Frascati (Roma) (Italy); Introini, M.V. [Politecnico di Milano, Dipartimento di Energia, via La Masa 34, 20156 Milano (Italy); INFN – Milano, Via Celoria 16, 20133 Milano (Italy); Buonomo, B. [INFN – LNF, via E. Fermi n. 40, 00044 Frascati (Roma) (Italy); Lorenzoli, M. [Politecnico di Milano, Dipartimento di Energia, via La Masa 34, 20156 Milano (Italy); INFN – Milano, Via Celoria 16, 20133 Milano (Italy); Mazzitelli, M. [INFN – LNF, via E. Fermi n. 40, 00044 Frascati (Roma) (Italy); Sacco, D. [INFN – LNF, via E. Fermi n. 40, 00044 Frascati (Roma) (Italy); INAIL – DPIA, Via di Fontana Candida n.1, 00040 Monteporzio Catone (Italy)

    2015-05-11

    A new directional neutron spectrometer called CYSP (CYlindrical SPectrometer) was developed within the NESCOFI@BTF (2011–2013) collaboration. The device, composed by seven active thermal neutron detectors located along the axis of a cylindrical moderator, was designed to simultaneously respond from the thermal domain up to hundreds of MeV neutrons. The new spectrometer condenses the performance of the Bonner Sphere Spectrometer in a single moderator; thus requiring only one exposure to determine the whole spectrum. The CYSP response matrix, determined with MCNP, has been experimentally evaluated with monochromatic reference neutron fields from 144 keV to 16.5 MeV, plus a {sup 252}Cf source, available at NPL (Teddington, UK). The results of the experiment confirmed the correctness of the response matrix within an overall uncertainty of ±2.5%. The new active spectrometer CYSP offers an innovative option for real-time monitoring of directional neutron fields as those produced in neutron beam-lines.

  6. Quetiapine Nanoemulsion for Intranasal Drug Delivery: Evaluation of Brain-Targeting Efficiency.

    Science.gov (United States)

    Boche, Mithila; Pokharkar, Varsha

    2017-04-01

    To evaluate the possibility of improved drug delivery of quetiapine fumarate (QTP), a nanoemulsion system was developed for intranasal delivery. Effects of different HLBs of Emalex LWIS 10, PEG 400 and Transcutol P, as co-surfactants, were studied on isotropic region of pseudoternary-phase diagrams of nanoemulsion system composed of capmul MCM (CPM) as oil phase, Tween 80 as surfactant and water. Phase behaviour, globule size, transmission electron microscope (TEM) photographs and brain-targeting efficiency of quetiapine nanoemulsion were investigated. In vitro dissolution study of optimised nanoemulsion formulation, with mean diameter 144 ± 0.5 nm, showed more than twofold increase in drug release as compared with pure drug. According to results of in vivo tissue distribution study in Wistar rats, intranasal administration of QTP-loaded nanoemulsion had shorter T max compared with that of intravenous administration. Higher drug transport efficiency (DTE%) and direct nose-to-brain drug transport (DTP%) was achieved by nanoemulsion. The nanoemulsion system may be a promising strategy for brain-targeted delivery of QTP.

  7. Comprehensive molecular diagnosis of Bardet-Biedl syndrome by high-throughput targeted exome sequencing.

    Directory of Open Access Journals (Sweden)

    Dong-Jun Xing

    Full Text Available Bardet-Biedl syndrome (BBS is an autosomal recessive disorder with significant genetic heterogeneity. BBS is linked to mutations in 17 genes, which contain more than 200 coding exons. Currently, BBS is diagnosed by direct DNA sequencing for mutations in these genes, which because of the large genomic screening region is both time-consuming and expensive. In order to develop a practical method for the clinic diagnosis of BBS, we have developed a high-throughput targeted exome sequencing (TES for genetic diagnosis. Five typical BBS patients were recruited and screened for mutations in a total of 144 known genes responsible for inherited retinal diseases, a hallmark symptom of BBS. The genomic DNA of these patients and their families were subjected to high-throughput DNA re-sequencing. Deep bioinformatics analysis was carried out to filter the massive sequencing data, which were further confirmed through co-segregation analysis. TES successfully revealed mutations in BBS genes in each patient and family member. Six pathological mutations, including five novel mutations, were revealed in the genes BBS2, MKKS, ARL6, MKS1. This study represents the first report of targeted exome sequencing in BBS patients and demonstrates that high-throughput TES is an accurate and rapid method for the genetic diagnosis of BBS.

  8. Newer targeted therapies in psoriasis

    Directory of Open Access Journals (Sweden)

    Sujay Khandpur

    2013-01-01

    Full Text Available Psoriasis is a common, chronic, inflammatory skin disease that can have a significant impact on the quality of life of those who are afflicted due to chronicity of the disease and frequent remissions and relapses. Many available systemic therapies, however, are unsuitable for chronic administration due to the risk of cumulative toxicity. Recent advances in the understanding of the pathophysiology of psoriasis have led to the development of new, genetically engineered, targeted therapies for this disease. These include approaches targeting antigen presentation and co-stimulation, T-cell activation and leukocyte adhesion, action on pro-inflammatory mediators, and modulating the cytokine balance. Although only preliminary data are available so far and there is limited data supporting their use, these trials contribute to a further understanding of the disease and will eventually lead to new therapeutic options for psoriasis.

  9. Moulding calixarenes for biomacromolecule targeting.

    Science.gov (United States)

    Giuliani, Marta; Morbioli, Ilaria; Sansone, Francesco; Casnati, Alessandro

    2015-09-28

    After their successful use as a preorganized platform for the preparation of receptors for metal ions and small neutral molecules over the last 15 years, calixarenes are enjoying a renaissance of popularity as scaffolds for ligands that are able to efficiently and selectively target macromolecules such as proteins/enzymes, nucleic acids and lipids. This feature article summarizes the peculiar factors characterizing the calixarene structure and properties, as well as outlines the main rules that can be used to turn such macrocycles into efficient and successful ligands for these classes of biomacromolecules. Factors that affect the multivalent properties of calixarenes, such as the size, conformation and stereochemical presentation of binding groups or their amphiphilicity and hybrid character, are described in detail with the use of a few selected examples from the literature. Perspectives and applications of these ligands in bionanotechnology and nanomedicine, such as protein sensing and inhibition, gene-delivery, targeted drug-delivery and cell imaging, are also discussed.

  10. Swimbladder on Fish Target Strength

    Directory of Open Access Journals (Sweden)

    Sunardi

    2008-08-01

    Full Text Available This paper discusses of target strength (TS for the Selar boops (Oxeye scad and Megalaspis cordyla (Torpedo scad, the most commercially fish in Malaysia. TS can be determined from in situ measurements and acoustic calculation of fish model. TS value, depth, and position (x-y-z of targeted fish can be viewed from echogram using FQ-80 Analyzer by in situ measurement. X-ray imaged can be deployed to develop the acoustic fish model. The percentage of length and upper surface area for swimbladder to body fish of Selar boops more than Megalaspis cordyla can be measured after X-ray process. The percentage of width and volume of swimbladders to its each body are no significantly difference for both fish. These data of swimbladder physic support the result of in situ measurement which TS of Megalaspis cordyla stronger Selar boops.

  11. Recurring Utterances - Targeting a Breakthrough

    Directory of Open Access Journals (Sweden)

    Jacqueline Stark

    2014-05-01

    The most interesting phenomenon is KB’s production of words from former sessions indicating that they are still ‘active’ and the production of completely novel incorrect words. The observable features indicate that immediate auditory processing is possible in the form of repeating target words. However, as soon as KB must retrieve information from the (semantic lexicon, even after being able to correctly ‘repeat’ the target word several times, he responds with a RU, perseveration, or paraphasia. Several of his productions can be characterized as aphasic confabulations which stem from a memory gap. Thus, although KB’s language impairment is severe, his responses across time indicate that step-by-step a breakthrough is being made.

  12. Remote moving target indication assessment

    Energy Technology Data Exchange (ETDEWEB)

    Canavan, G.H.

    1996-10-01

    The objective of this project was to design and test key components of a sensor to be used on remotely piloted vehicles, aircraft, or satellites for the detection of moving vehicles in cluttered backgrounds. The proposed sensor uses modern large-array focal planes to provide multiple infrared observations of moving targets and capable on-board computers to integrate multiple observations to detect moving targets in background clutter. This combination reduces the size, weight, and cost of the sensor to levels that can be flown on many small unmanned platforms. This effort selected the actual components, integrated them into a test bed, tested the performance of the sensor against realistic generated scenes, and designed a proof-of-concept prototype.

  13. Targeting vaccines to dendritic cells

    DEFF Research Database (Denmark)

    Foged, Camilla; Sundblad, Anne; Hovgaard, Lars

    2002-01-01

    to be far superior to that of B-cells and macrophages. DC are localized at strategic places in the body at sites used by pathogens to enter the organism, and are thereby in an optimal position to capture antigens. In general, vaccination strategies try to mimic the invasiveness of the pathogens. DC...... are considered to play a central role for the provocation of primary immune responses by vaccination. A rational way of improving the potency and safety of new and already existing vaccines could therefore be to direct vaccines specifically to DC. There is a need for developing multifunctional vaccine drug...... delivery systems (DDS) with adjuvant effect that target DC directly and induce optimal immune responses. This paper will review the current knowledge of DC physiology as well as the progress in the field of novel vaccination strategies that directly or indirectly aim at targeting DC....

  14. Poverty, inequality, and geographic targeting

    OpenAIRE

    Simler, Kenneth R.; Nhate, Virgulino

    2005-01-01

    "This paper applies small area estimation techniques to Mozambican data to develop high resolution (subdistrictlevel) poverty and inequality maps...The picture that emerges is one of considerable local-level economic heterogeneity, with the poor living alongside the nonpoor. Rather than finding stark pockets of intense poverty traps in one part of the country and a relative absence of poverty in other parts, the situation is much more nuanced. This suggests that targeting antipoverty efforts ...

  15. Targeting phenotypically tolerant Mycobacterium tuberculosis

    Science.gov (United States)

    Gold, Ben; Nathan, Carl

    2016-01-01

    While the immune system is credited with averting tuberculosis in billions of individuals exposed to Mycobacterium tuberculosis, the immune system is also culpable for tempering the ability of antibiotics to deliver swift and durable cure of disease. In individuals afflicted with tuberculosis, host immunity produces diverse microenvironmental niches that support suboptimal growth, or complete growth arrest, of M. tuberculosis. The physiological state of nonreplication in bacteria is associated with phenotypic drug tolerance. Many of these host microenvironments, when modeled in vitro by carbon starvation, complete nutrient starvation, stationary phase, acidic pH, reactive nitrogen intermediates, hypoxia, biofilms, and withholding streptomycin from the streptomycin-addicted strain SS18b, render M. tuberculosis profoundly tolerant to many of the antibiotics that are given to tuberculosis patients in a clinical setting. Targeting nonreplicating persisters is anticipated to reduce the duration of antibiotic treatment and rate of post-treatment relapse. Some promising drugs to treat tuberculosis, such as rifampicin and bedaquiline, only kill nonreplicating M. tuberculosis in vitro at concentrations far greater than their minimal inhibitory concentrations against replicating bacilli. There is an urgent demand to identify which of the currently used antibiotics, and which of the molecules in academic and corporate screening collections, have potent bactericidal action on nonreplicating M. tuberculosis. With this goal, we review methods of high throughput screening to target nonreplicating M. tuberculosis and methods to progress candidate molecules. A classification based on structures and putative targets of molecules that have been reported to kill nonreplicating M. tuberculosis revealed a rich diversity in pharmacophores. However, few of these compounds were tested under conditions that would exclude the impact of adsorbed compound acting during the recovery phase of

  16. Medium size polarised deuteron target

    Energy Technology Data Exchange (ETDEWEB)

    Kiselev, Yu.F.; Polyakov, V.V.; Kovalev, A.I.; Bunyatova, E.I.; Borisov, N.S.; Trautman, V.Yu.; Werner, K.; Kozlenko, N.G.

    1984-03-01

    A frozen polarised deuteron target based on ethanediol with a high percentage of deuterium is described. Analytical expressions for the NMR spectrum correction for non-linearity of the Q-meter are obtained and a method for the determination of the asymmetry is developed. Experimental results confirm the thermal mixing theory for deuteron and proton spin systems with a dipole-dipole reservoir of electron spins.

  17. Peptide-targeted polymer cancerostatics

    Czech Academy of Sciences Publication Activity Database

    Böhmová, Eliška; Pola, Robert

    2016-01-01

    Roč. 65, Suppl. 2 (2016), S153-S164 ISSN 0862-8408 R&D Projects: GA MŠk(CZ) LO1507 Institutional support: RVO:61389013 Keywords : HPMA copolymers * tumor targeting * peptides Subject RIV: CD - Macromolecular Chemistry Impact factor: 1.461, year: 2016 http://www.biomed.cas.cz/physiolres/pdf/65%20Suppl%202/65_S153.pdf

  18. Coherent Communications, Imaging and Targeting

    Energy Technology Data Exchange (ETDEWEB)

    Stappaerts, E; Baker, K; Gavel, D; Wilks, S; Olivier, S; Brase, J; Olivier, S; Brase, J

    2003-10-03

    Laboratory and field demonstration results obtained as part of the DARPA-sponsored Coherent Communications, Imaging and Targeting (CCIT) program are reviewed. The CCIT concept uses a Phase Conjugation Engine based on a quadrature receiver array, a hologram processor and a spatial light modulator (SLM) for high-speed, digital beam control. Progress on the enabling MEMS SLM, being developed by a consortium consisting of LLNL, academic institutions and small businesses, is presented.

  19. Theranostics Targeting Metastatic Breast Cancer

    Science.gov (United States)

    2016-10-01

    What opportunities for training and professional development has the project provided? Two graduate students and one postdoctoral research associate...hostile immune reaction toward FR-expressing tumors. A series of vaccinations with hapten fluorescein (EC90 vaccine ) admin- istrated with an adjuvant...FITC-conjugated (FITC is flu - orescein isothiocyanate) CA inhibitor acetalozamide (AAZ) targeted CA-IX positive cells (Kd = 12.6 nM). The biodistribution

  20. Targeting inflammation in metabolic syndrome.

    Science.gov (United States)

    Welty, Francine K; Alfaddagh, Abdulhamied; Elajami, Tarec K

    2016-01-01

    The metabolic syndrome (MetS) is comprised of a cluster of closely related risk factors, including visceral adiposity, insulin resistance, hypertension, high triglyceride, and low high-density lipoprotein cholesterol; all of which increase the risk for the development of type 2 diabetes and cardiovascular disease. A chronic state of inflammation appears to be a central mechanism underlying the pathophysiology of insulin resistance and MetS. In this review, we summarize recent research which has provided insight into the mechanisms by which inflammation underlies the pathophysiology of the individual components of MetS including visceral adiposity, hyperglycemia and insulin resistance, dyslipidemia, and hypertension. On the basis of these mechanisms, we summarize therapeutic modalities to target inflammation in the MetS and its individual components. Current therapeutic modalities can modulate the individual components of MetS and have a direct anti-inflammatory effect. Lifestyle modifications including exercise, weight loss, and diets high in fruits, vegetables, fiber, whole grains, and low-fat dairy and low in saturated fat and glucose are recommended as a first line therapy. The Mediterranean and dietary approaches to stop hypertension diets are especially beneficial and have been shown to prevent development of MetS. Moreover, the Mediterranean diet has been associated with reductions in total and cardiovascular mortality. Omega-3 fatty acids and peroxisome proliferator-activated receptor α agonists lower high levels of triglyceride; their role in targeting inflammation is reviewed. Angiotensin-converting enzyme inhibitors, angiotensin receptor blockers, and aldosterone blockers comprise pharmacologic therapies for hypertension but also target other aspects of MetS including inflammation. Statin drugs target many of the underlying inflammatory pathways involved in MetS. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Targeting distress in rheumatic diseases

    OpenAIRE

    Vriezekolk, J.E.

    2011-01-01

    Psychological distress is highly prevalent in patients with rheumatic diseases. It is associated with a variety of negative outcomes, including pain, fatigue, disability, and maladaptive cognitive behavioural coping strategies. In this thesis, psychological distress was studied both as an outcome measure and as a therapeutic target in the context of multidisciplinary rehabilitation. The longitudinal role of coping in psychological distress was systematically reviewed, a questionnaire to asses...

  2. The association of the effect of lithium in the maintenance treatment of bipolar disorder with lithium plasma levels : a post hoc analysis of a double-blind study comparing switching to lithium or placebo in patients who responded to quetiapine (Trial 144)

    NARCIS (Netherlands)

    Nolen, Willem A.; Weisler, Richard H.

    Nolen WA, Weisler RH. The association of the effect of lithium in the maintenance treatment of bipolar disorder with lithium plasma levels: a post hoc analysis of a double-blind study comparing switching to lithium or placebo in patients who responded to quetiapine (Trial 144). Bipolar Disord 2012:

  3. Design of the experimental apparatus to obtain a thermal neutron beam, intermediate-energy neutrons (2-144 keV) and high-energy photons (6 MeV) by means of the TRIGA reactor at the ENEA Casaccia center

    CERN Document Server

    Laitano, R F

    1987-01-01

    Design of the experimental apparatus to obtain a thermal neutron beam, intermediate-energy neutrons (2-144 keV) and high-energy photons (6 MeV) by means of the TRIGA reactor at the ENEA Casaccia center

  4. Novel therapies targeting vascular endothelium.

    Science.gov (United States)

    Tousoulis, Dimitris; Antoniades, Charalambos; Koumallos, Nikolaos; Marinou, Kyriakoula; Stefanadi, Elli; Latsios, George; Stefanadis, Christodoulos

    2006-01-01

    Endothelial dysfunction has been identified as a major mechanism involved in all the stages of atherogenesis. Evaluation of endothelial function seems to have a predictive role in humans, and therapeutic interventions improving nitric oxide bioavailability in the vasculature may improve the long-term outcome in healthy individuals, high-risk subjects, or patients with advanced atherosclerosis. Several therapeutic strategies are now available, targeting both the synthesis and oxidative inactivation of nitric oxide (NO) in human vasculature. Statins seem to be currently the most powerful category of these agents, improving endothelial function and decreasing cardiovascular risk after long-term administration. Other cardiovascular agents improving endothelial function in humans are angiotensin-converting enzyme inhibitors/angiotensin receptors blockers, which increase NO bioavailability by modifying the rennin-angiotensin-aldosterone system. Newer therapeutic approaches targeting endothelial dysfunction in specific disease states include insulin sensitizers, L-arginine (the substrate for endothelial NO synthase [eNOS]) as well as substances that target eNOS "coupling," such as folates or tetrahydrobiopterin. Although there are a variety of strategies to improve NO bioavailability in human endothelium, it is still unclear whether they have any direct benefit at a clinical level.

  5. Targeted gene flow for conservation.

    Science.gov (United States)

    Kelly, Ella; Phillips, Ben L

    2016-04-01

    Anthropogenic threats often impose strong selection on affected populations, causing rapid evolutionary responses. Unfortunately, these adaptive responses are rarely harnessed for conservation. We suggest that conservation managers pay close attention to adaptive processes and geographic variation, with an eye to using them for conservation goals. Translocating pre-adapted individuals into recipient populations is currently considered a potentially important management tool in the face of climate change. Targeted gene flow, which involves moving individuals with favorable traits to areas where these traits would have a conservation benefit, could have a much broader application in conservation. Across a species' range there may be long-standing geographic variation in traits or variation may have rapidly developed in response to a threatening process. Targeted gene flow could be used to promote natural resistance to threats to increase species resilience. We suggest that targeted gene flow is a currently underappreciated strategy in conservation that has applications ranging from the management of invasive species and their impacts to controlling the impact and virulence of pathogens. © 2015 Society for Conservation Biology.

  6. Targeted Treatment Options in Mastocytosis

    Directory of Open Access Journals (Sweden)

    Mélanie Vaes

    2017-07-01

    Full Text Available Mastocytosis refers to a heterogeneous group of disorders resulting from the clonal proliferation of abnormal mast cells and their accumulation in the skin (cutaneous mastocytosis when only in the skin, CM or in various organs (systemic mastocytosis, SM. This leads to a wide variety of clinical manifestations resulting from excessive mediator release in CM and benign forms of SM (indolent SM, ISM and from tissue mast cell infiltration causing multiorgan dysfunction and failure in more aggressive subtypes (aggressive SM, ASM, or mast cell leukemia. In addition, SM may be associated with hematological neoplasms (AHN. While treatment of ISM primarily aims at symptom management with anti-mediator therapies, cytoreductive and targeted therapies are needed to control the expansion of neoplastic mast cells in advanced forms of SM, in order to improve overall survival. Mast cell accumulation results from a gain-of-function mutation (mostly the D816V mutation within the KIT tyrosine kinase domain expressed by mast cells and additional genetic and epigenetic mutations may further determine the features of the disease (ASM and AHN. Consequently, tyrosine kinase inhibitors and targeted therapies directed against the oncogenic signaling machinery downstream of KIT are attractive therapeutic approaches. A better understanding of the relative contribution of these genetic and epigenetic events to the molecular pathogenesis of mastocytosis is of particular interest for the development of targeted therapies and therefore to better choose patient subgroups that would best benefit from a given therapeutic strategy.

  7. Reinforcement learning of targeted movement in a spiking neuronal model of motor cortex.

    Science.gov (United States)

    Chadderdon, George L; Neymotin, Samuel A; Kerr, Cliff C; Lytton, William W

    2012-01-01

    Sensorimotor control has traditionally been considered from a control theory perspective, without relation to neurobiology. In contrast, here we utilized a spiking-neuron model of motor cortex and trained it to perform a simple movement task, which consisted of rotating a single-joint "forearm" to a target. Learning was based on a reinforcement mechanism analogous to that of the dopamine system. This provided a global reward or punishment signal in response to decreasing or increasing distance from hand to target, respectively. Output was partially driven by Poisson motor babbling, creating stochastic movements that could then be shaped by learning. The virtual forearm consisted of a single segment rotated around an elbow joint, controlled by flexor and extensor muscles. The model consisted of 144 excitatory and 64 inhibitory event-based neurons, each with AMPA, NMDA, and GABA synapses. Proprioceptive cell input to this model encoded the 2 muscle lengths. Plasticity was only enabled in feedforward connections between input and output excitatory units, using spike-timing-dependent eligibility traces for synaptic credit or blame assignment. Learning resulted from a global 3-valued signal: reward (+1), no learning (0), or punishment (-1), corresponding to phasic increases, lack of change, or phasic decreases of dopaminergic cell firing, respectively. Successful learning only occurred when both reward and punishment were enabled. In this case, 5 target angles were learned successfully within 180 s of simulation time, with a median error of 8 degrees. Motor babbling allowed exploratory learning, but decreased the stability of the learned behavior, since the hand continued moving after reaching the target. Our model demonstrated that a global reinforcement signal, coupled with eligibility traces for synaptic plasticity, can train a spiking sensorimotor network to perform goal-directed motor behavior.

  8. Reinforcement learning of targeted movement in a spiking neuronal model of motor cortex.

    Directory of Open Access Journals (Sweden)

    George L Chadderdon

    Full Text Available Sensorimotor control has traditionally been considered from a control theory perspective, without relation to neurobiology. In contrast, here we utilized a spiking-neuron model of motor cortex and trained it to perform a simple movement task, which consisted of rotating a single-joint "forearm" to a target. Learning was based on a reinforcement mechanism analogous to that of the dopamine system. This provided a global reward or punishment signal in response to decreasing or increasing distance from hand to target, respectively. Output was partially driven by Poisson motor babbling, creating stochastic movements that could then be shaped by learning. The virtual forearm consisted of a single segment rotated around an elbow joint, controlled by flexor and extensor muscles. The model consisted of 144 excitatory and 64 inhibitory event-based neurons, each with AMPA, NMDA, and GABA synapses. Proprioceptive cell input to this model encoded the 2 muscle lengths. Plasticity was only enabled in feedforward connections between input and output excitatory units, using spike-timing-dependent eligibility traces for synaptic credit or blame assignment. Learning resulted from a global 3-valued signal: reward (+1, no learning (0, or punishment (-1, corresponding to phasic increases, lack of change, or phasic decreases of dopaminergic cell firing, respectively. Successful learning only occurred when both reward and punishment were enabled. In this case, 5 target angles were learned successfully within 180 s of simulation time, with a median error of 8 degrees. Motor babbling allowed exploratory learning, but decreased the stability of the learned behavior, since the hand continued moving after reaching the target. Our model demonstrated that a global reinforcement signal, coupled with eligibility traces for synaptic plasticity, can train a spiking sensorimotor network to perform goal-directed motor behavior.

  9. Expression patterns of microRNAs associated with CML phases and their disease related targets

    Directory of Open Access Journals (Sweden)

    Trněný Marek

    2011-04-01

    Full Text Available Abstract Background MicroRNAs are important regulators of transcription in hematopoiesis. Their expression deregulations were described in association with pathogenesis of some hematological malignancies. This study provides integrated microRNA expression profiling at different phases of chronic myeloid leukemia (CML with the aim to identify microRNAs associated with CML pathogenesis. The functions of in silico filtered targets are in this report annotated and discussed in relation to CML pathogenesis. Results Using microarrays we identified differential expression profiles of 49 miRNAs in CML patients at diagnosis, in hematological relapse, therapy failure, blast crisis and major molecular response. The expression deregulation of miR-150, miR-20a, miR-17, miR-19a, miR-103, miR-144, miR-155, miR-181a, miR-221 and miR-222 in CML was confirmed by real-time quantitative PCR. In silico analyses identified targeted genes of these miRNAs encoding proteins that are involved in cell cycle and growth regulation as well as several key signaling pathways such as of mitogen activated kinase-like protein (MAPK, epidermal growth factor receptor (EGFR, ERBB, transforming growth factor beta (TGFB1 and tumor protein p53 that are all related to CML. Decreased levels of miR-150 were detected in patients at diagnosis, in blast crisis and 67% of hematological relapses and showed significant negative correlation with miR-150 proved target MYB and with BCR-ABL transcript level. Conclusions This study uncovers microRNAs that are potentially involved in CML and the annotated functions of in silico filtered targets of selected miRNAs outline mechanisms whereby microRNAs may be involved in CML pathogenesis.

  10. Unmanned Aircraft Systems (UAS) Sensor and Targeting

    Science.gov (United States)

    2010-07-27

    mission, a pre-determined number of different targets should be shuffled between the target locations in the array. Example targets for this subtest are...UNFOV Ultra Narrow Field of View UTM Universal Transverse Mercator VBLSS Video-Based Laser Scoring System VRT Vertical Reference Target WFOV

  11. Progress with developing a target for magnetized target fusion

    Energy Technology Data Exchange (ETDEWEB)

    Wysocki, F.J.; Chrien, B.E.; Idzorek, G.; Oona, H.; Whiteson, D.O.; Kirkpatrick, R.C.; Lindemuth, I.R.; Sheehey, P.T. [Los Alamos National Lab., NM (United States)

    1997-12-31

    Magnetized Target Fusion (MTF) is an approach to fusion where a preheated and magnetized plasma is adiabatically compressed to fusion conditions. Successful MTF requires a suitable initial target plasma with an embedded magnetic field of at least 5 T in a closed-field-line topology, a density of roughly 10{sup 18} cm{sup {minus}3}, a temperature of at least 50 eV, and must be free of impurities which would raise radiation losses. Target plasma generation experiments are underway at Los Alamos National Laboratory using the Colt facility; a 0.25 MJ, 2--3 {micro}s rise-time capacitor bank. In the first experiments, a Z-pinch is produced in a 2 cm radius by 2 cm high conducting wall using a static gas-fill of hydrogen or deuterium gas in the range of 0.5 to 2 torr. Follow-on experiments will use a frozen deuterium fiber along the axis (without a gas-fill). The diagnostics include B-dot probes, framing camera, gated OMA visible spectrometer, time-resolved monochrometer, silicon photodiodes, neutron yield, and plasma-density interferometer. Operation to date has been with drive current ranging from 0.8 MA to 1.9 MA. Optical diagnostics show that the plasma produced in the containment region lasts roughly 20 to 30 {micro}s, and the B-dot probes show a broad current-profile in the containment region. The experimental design and data will be presented.

  12. Targeted advertising, platform competition and privacy

    OpenAIRE

    Henk Kox; Bas Straathof; Gijsbert Zwart

    2014-01-01

    Targeted advertising can benefit consumers through lower prices for access to websites. Yet, if consumers dislike that websites collect their personal information, their welfare may go down. We study competition for consumers between websites that can show targeted advertisements. We find that more targeting increases competition and reduces the websites' profits, but yet in equilibrium websites choose maximum targeting as they cannot credibly commit to low targeting. A privacy protection pol...

  13. Hospitals: Soft Target for Terrorism?

    Science.gov (United States)

    De Cauwer, Harald; Somville, Francis; Sabbe, Marc; Mortelmans, Luc J

    2017-02-01

    In recent years, the world has been rocked repeatedly by terrorist attacks. Arguably, the most remarkable were: the series of four coordinated suicide plane attacks on September 11, 2001 on buildings in New York, Virginia, and Pennsylvania, USA; and the recent series of two coordinated attacks in Brussels (Belgium), on March 22, 2016, involving two bombings at the departure hall of Brussels International Airport and a bombing at Maalbeek Metro Station located near the European Commission headquarters in the center of Brussels. This statement paper deals with different aspects of hospital policy and disaster response planning that interface with terrorism. Research shows that the availability of necessary equipment and facilities (eg, personal protective clothing, decontamination rooms, antidotes, and anti-viral drugs) in hospitals clearly is insufficient. Emergency teams are insufficiently prepared: adequate and repetitive training remain necessary. Unfortunately, there are many examples of health care workers and physicians or hospitals being targeted in both political or religious conflicts and wars. Many health workers were kidnapped and/or killed by insurgents of various ideology. Attacks on hospitals also could cause long-term effects: hospital units could be unavailable for a long time and replacing staff could take several months, further compounding hospital operations. Both physical and psychological (eg, posttraumatic stress disorder [PTSD]) after-effects of a terrorist attack can be detrimental to health care services. On the other hand, physicians and other hospital employees have shown to be involved in terrorism. As data show that some offenders had a previous history with the location of the terror incident, the possibility of hospitals or other health care services being targeted by insiders is discussed. The purpose of this report was to consider how past terrorist incidents can inform current hospital preparedness and disaster response planning

  14. Targeted Therapy in Systemic Sclerosis

    Directory of Open Access Journals (Sweden)

    Murray Baron

    2016-10-01

    Full Text Available Targeted therapies use an understanding of the pathophysiology of a disease in an individual patient. Although targeted therapy for systemic sclerosis (SSc, scleroderma has not yet reached the level of patient-specific treatments, recent developments in the understanding of the global pathophysiology of the disease have led to new treatments based on the cells and pathways that have been shown to be involved in the disease pathogenesis. The presence of a B cell signature in skin biopsies has led to the trial of rituximab, an anti-CD20 antibody, in SSc. The well-known properties of transforming growth factor (TGF-β in promoting collagen synthesis and secretion has led to a small trial of fresolimumab, a human IgG4 monoclonal antibody capable of neutralizing TGF-β. Evidence supporting important roles for interleukin-6 in the pathogenesis of SSc have led to a large trial of tocilizumab in SSc. Soluble guanylate cyclase (sGC is an enzyme that catalyzes the production of cyclic guanosine monophosphate (cGMP upon binding of nitric oxide (NO to the sGC molecule. Processes such as cell growth and proliferation are regulated by cGMP. Evidence that sGC may play a role in SSc has led to a trial of riociguat, a molecule that sensitizes sGC to endogenous NO. Tyrosine kinases (TKs are involved in a wide variety of physiologic and pathological processes including vascular remodeling and fibrogenesis such as occurs in SSc. This has led to a trial of nintedanib, a next-generation tyrosine-kinase (TK inhibitor which targets multiple TKs, in SSc.

  15. Downstream targets of WRKY33

    DEFF Research Database (Denmark)

    Petersen, Klaus; Fiil, Berthe Katrine; Mundy, John

    2008-01-01

    Innate immunity signaling pathways in both animals and plants are regulated by mitogen-activated protein kinase (MAPK) cascades. In a recent publication we show that MPK4 and its substrate MKS1 interact with WRKY33 in vivo, and that WRKY33 is released from complexes with MPK4 upon infection. Tran...... immunoprecipitation confirmed that WRKY33 bound the promoter of PAD3 when plants were inoculated with pathogens. Here we further discuss the involvement of two other targets of WRKY33, NUDT6 and ROF2 in defense responses against invading pathogens....

  16. Performance Targets and External Benchmarking

    DEFF Research Database (Denmark)

    Friis, Ivar; Hansen, Allan; Vámosi, Tamás S.

    Research on relative performance measures, transfer pricing, beyond budgeting initiatives, target costing, piece rates systems and value based management has for decades underlined the importance of external benchmarking in performance management. Research conceptualises external benchmarking...... of the ‘inside’ costs of the sub-component, technical specifications of the product, opportunistic behavior from the suppliers and cognitive limitation. These are all aspects that easily can dismantle the market mechanism and make it counter-productive in the organization. Thus, by directing more attention...

  17. The challenge of targeting metastasis.

    Science.gov (United States)

    Fidler, Isaiah J; Kripke, Margaret L

    2015-12-01

    Metastases that are resistant to conventional therapy are the major cause of death from cancer. In most patients, metastasis has already occurred by the time of diagnosis. Thus, the prevention of metastasis is unlikely to be of therapeutic benefit. The biological heterogeneity of metastases presents a major obstacle to treatment. However, the growth and survival of metastases depend on interactions between tumor cells and host homeostatic mechanisms. Targeting these interactions, in addition to the tumor cells, can produce synergistic therapeutic effects against existing metastases.

  18. Introduction to radar target recognition

    CERN Document Server

    Tait, P

    2006-01-01

    This new text provides an overview of the radar target recognition process and covers the key techniques being developed for operational systems. It is based on the fundamental scientific principles of high resolution radar, and explains how the techniques can be used in real systems, taking into account the characteristics of practical radar system designs and component limitations. It also addresses operational aspects, such as how high resolution modes would fit in with other functions such as detection and tracking. Mathematics is kept to a minimum and the complex techniques and issues are

  19. Targeting α-synuclein oligomers

    DEFF Research Database (Denmark)

    van Diggelen, Femke

    2017-01-01

    Parkinson’s Disease (PD) is a complex disease, characterised by degeneration of neocortical, limbic and nigrostriatal neurons. It is unknown what initiates neurodegeneration, but soluble oligomers of the protein α-synuclein (αSn) seem to be particularly toxic, compared to insoluble fibrils....... Although there is currently no cure for PD, αSn oligomers (αSOs) are a potential therapeutic target, but a major drawback it that little is known about the nature of PD-associated αSOs. The scientific literature describes a wide variety of protocols to generate αSOs in vitro, with a subsequent...

  20. The effect of solid solution treatment on the hardness and microstructure of 0.6%wt C-10.8%wt Mn-1.44%wt Cr austenitic manganese steel

    Science.gov (United States)

    Nurjaman, F.; Bahfie, F.; Astuti, W.; Shofi, A.

    2017-04-01

    Austenitic manganese steel is steel alloy that has high manganese content (10-14%wt Mn). The characteristics of austenitic manganese steel are good in toughness, ductility, and wear resistance. Effect of solid solution treatment on the hardness and microstructure of austenitic manganese steel was studied in this experiment. The solid solution treatment process of austenitic manganese steel, 0.6%wt C-10.8%wt Mn-1.44%wt Cr, was conducted by heating the material at varied temperatures (950°C, 1000°C, 1050°C) for an hour and then quenching it in two different quenching media, i.e. oil and water. Further, the samples were tempered at three different temperatures (300°C, 400°C, and 500°C) for 2 hours. The treated materials were analyzed by Rockwell Hardness Tester to obtain the information of materials hardness and by an optical microscope and XRD to investigate the microstructure phase of the treated materials. Heating the austenitic manganese steel at 950°C for an hour followed by water quenching dissolved all carbide in as-cast condition and resulted the fully austenitic on its microstructure. Carbide precipitation occurred due to the prolongation of soaking time in solid solution treatment and tempering process. The optimum hardness of sample was 53.3 HRC, which was resulted by heating this material until 1000°C for an hour, followed by water quenching and tempering at 400°C for 2 hours.