WorldWideScience

Sample records for samarium 144 reactions

  1. Solar nebula heterogeneity in p-process samarium and neodymium isotopes.

    Science.gov (United States)

    Andreasen, Rasmus; Sharma, Mukul

    2006-11-03

    Bulk carbonaceous chondrites display a deficit of approximately 100 parts per million (ppm) in 144Sm with respect to other meteorites and terrestrial standards, leading to a decrease in their 142Nd/144Nd ratios by approximately 11 ppm. The data require that samarium and neodymium isotopes produced by the p process associated with photodisintegration reactions in supernovae were heterogeneously distributed in the solar nebula. Other samarium and neodymium isotopes produced by rapid neutron capture (r process) in supernovae and by slow neutron capture (s process) in red giants were homogeneously distributed. The supernovae sources supplying the p- and r-process nuclides to the solar nebula were thus disconnected or only weakly connected.

  2. Near-barrier transfer reactions in the sup 36 S+ sup 144,154 Sm systems

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez Niello, J.O.; Testoni, J.E.; di Tada, M.; Pacheco, A.J. (TANDAR, Departamento de Fisica, Comision Nacional de Energia Atomica, Avenida del Libertador 8250, 1429 Buenos Aires (Argentina)); Napoli, D.R.; Stefanini, A.M.; Corradi, L.; Million, B.; Narayanasamy, M.; Spolaore, P. (Istituto Nazionale di Fisica Nucleare, Laboratori Nazionali di Legnaro, Padova (Italy)); Beghini, S.; Montagnoli, G.; Scarlassara, F.; Segato, G.F.; Signorini, C.; Soramel, F. (Dipartimento di Fisica, Universita e Istituto Nazionale di Fisica Nucleare, Padova (Italy))

    1992-02-01

    Angular distributions and {ital Q}-value spectra for transfer reactions in the systems {sup 36}S+{sup 144,154}Sm have been measured at two energies close to the Coulomb barrier. Mass and charge identification was achieved using a time-of-flight system followed by an ionization chamber. Transfer probabilities were analyzed considering direct and sequential barrier penetration mechanisms. The dependence of the cross sections on the static quadrupole deformation of the targets was compared with the predictions of a semiclassical approach. The relative yields of the different channels were analyzed in the light of a random-walk approach based on the reaction {ital Q} values.

  3. Synthesis of Samarium Cobalt Nanoblades

    Energy Technology Data Exchange (ETDEWEB)

    Darren M. Steele

    2010-08-25

    As new portable particle acceleration technologies become feasible the need for small high performance permanent magnets becomes critical. With particle accelerating cavities of a few microns, the photonic crystal fiber (PCF) candidate demands magnets of comparable size. To address this need, samarium cobalt (SmCo) nanoblades were attempted to be synthesized using the polyol process. Since it is preferable to have blades of 1-2 {micro}m in length, key parameters affecting size and morphology including method of stirring, reaction temperature, reaction time and addition of hydroxide were examined. Nanoparticles consisting of 70-200 nm spherical clusters with a 3-5 nm polyvinylpyrrolidone (PVP) coating were synthesized at 285 C and found to be ferromagnetic. Nanoblades of 25nm in length were observed at the surface of the nanoclusters and appeared to suggest agglomeration was occurring even with PVP employed. Morphology and size were characterized using a transmission electron microscope (TEM). Powder X-Ray Diffraction (XRD) analysis was conducted to determine composition but no supportive evidence for any particular SmCo phase has yet been observed.

  4. Mechanism of the electrochemical deposition of samarium-based coatings

    Energy Technology Data Exchange (ETDEWEB)

    Ruiz, Edgar J. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Ortega-Borges, Raul [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Godinez, Luis A. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Chapman, Thomas W. [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico); Meas-Vong, Yunny [Electrochemistry Department, Centro de Investigacion y Desarrollo Tecnologico en Electroquimica, Parque Tecnologico Queretaro Sanfandila, P.O. Box 064, Pedro Escobedo, 76700 Queretaro (Mexico)]. E-mail: yunnymeas@cideteq.mx

    2006-11-12

    Samarium-based films have been shown to form from aqueous solutions on the surfaces of metallic substrates such as steel or aluminum, and their presence has been reported to decrease substantially the corresponding corrosion rate of the underlying metallic substrate. Based on previous reports on the deposition of oxides or hydroxides of the closely related element cerium, this work demonstrates that samarium films are formed following a similar mechanism, which involves as the fundamental step an increase in interfacial pH resulting from cathodic oxygen-reduction or hydrogen-evolution reactions. With cyclic voltammetry (CV), electrochemical quartz-crystal microbalance (EQCM) measurements, rotating-disk electrode (RDE) tests, and surface characterization techniques, namely, scanning electron microscopy (SEM) and X-ray surface microanalysis (EDX), the postulated mechanism was verified, and the surface morphology of the resulting films was correlated with the nature of the reduction reaction that triggers film formation.

  5. Lithium Bromide/Water as Additives in Dearomatizing Samarium-Ketyl (Hetero)Arene Cyclizations.

    Science.gov (United States)

    Rao, Chintada Nageswara; Bentz, Christoph; Reissig, Hans-Ulrich

    2015-11-02

    New conditions for dearomatizing samarium-ketyl (hetero)arene cyclizations are reported. In many examples of these samarium diiodide-mediated reactions, lithium bromide and water can be used as additives instead of the carcinogenic and mutagenic hexamethylphosphoramide (HMPA). The best results were obtained for the cyclizations of N-acylated indole derivatives delivering the expected indolines in good yields and excellent diastereoselectivities. A new type of cyclization delivering indolyl-substituted allene derivatives is also described. The scope and limitations of the lithium bromide/water system are discussed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Ionization of Samarium by Chemical Releases in the Upper Atmosphere

    Science.gov (United States)

    Siefring, C. L.; Bernhardt, P. A.; Holmes, J. M.; Pedersen, T. R.; Caton, R.; Miller, D.; Groves, K. M.

    2014-12-01

    The release of Samarium vapor into the upper atmosphere was studied using during the Air Force Research Laboratory sponsored Metal Oxide Space Cloud (MOSC) rocket launches in May 2009. The Naval Research Laboratory supported these experiments with 3-D photochemical modeling of the artificial plasma cloud including (1) reactions with atomic oxygen, (2) photo excitation, (3) photoionization, (4) dissociative recombination, and (5) ion and neutral diffusion. NRL provided the experimental diagnostic instrument on the rocket which was a dual frequency radio beacon on the rocket to measure changes in total electron content. The AFRL provided ground based diagnostics of incoherent scatter radar and optical spectroscopy and imagery. The NRL Chemical Release Model (CRM) has over 600 excited states of atomic Samarium neutrals, atomic ions, along with Samarium Oxide Ions and electrons. Diffusive transport of neutrals in cylindrical geometry and ions along magnetic field lines is computed along with the reactive flow to predict the concentrations of Sm, Sm-Ion, Sm0, and SmO Ion. Comparison of the CRM with observations demonstrates that Sm release into the upper atmosphere initially produces enhanced electron densities and SmO-Ions. The diatomic ions recombine with electrons to yield neutral Sm and O. Only the photo ionization of Sm yields a stable atomic ion that does not substantially recombine. The MOSC releases in sunlight yielded long duration ion clouds that can be replicated with the CRM. The CRM predicts that Sm releases in darkness would not produce long duration plasma clouds because of the lack of photo excitation and photoionization.

  7. Neutron and Charged-Particle Induced Cross Sections for Radiochemistry in the Region of Samarium, Europium, and Gadolinium

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, R D; Kelley, K; Dietrich, F S; Bauer, R; Mustafa, M

    2004-11-30

    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron and proton induced nuclear reaction cross sections in the mass region of samarium, europium and gadolinium (62 {le} Z {le} 64, 82 {le} N {le} 96).

  8. Excitation energy dependence of fragment-mass distributions from fission of 180,190Hg formed in fusion reactions of 36Ar + 144,154Sm

    Directory of Open Access Journals (Sweden)

    K. Nishio

    2015-09-01

    Full Text Available Mass distributions of fission fragments from the compound nuclei 180Hg and 190Hg formed in fusion reactions 36Ar + 144Sm and 36Ar + 154Sm, respectively, were measured at initial excitation energies of E⁎(Hg180=33–66 MeV and E⁎(Hg190=48–71 MeV. In the fission of 180Hg, the mass spectra were well reproduced by assuming only an asymmetric-mass division, with most probable light and heavy fragment masses A¯L/A¯H=79/101. The mass asymmetry for 180Hg agrees well with that obtained in the low-energy β+/EC-delayed fission of 180Tl, from our earlier ISOLDE(CERN experiment. Fission of 190Hg is found to proceed in a similar way, delivering the mass asymmetry of A¯L/A¯H=83/107, throughout the measured excitation energy range. The persistence as a function of excitation energy of the mass-asymmetric fission for both proton-rich Hg isotopes gives strong evidence for the survival of microscopic effects up to effective excitation energies of compound nuclei as high as 40 MeV. This behavior is different from fission of actinide nuclei and heavier mercury isotope 198Hg.

  9. Cross sections of the 144Sm(n,α141Nd and 66Zn(n,α63Ni reactions at 4.0, 5.0 and 6.0 MeV

    Directory of Open Access Journals (Sweden)

    Yury Gledenov

    2017-01-01

    Full Text Available Cross sections of the 144Sm(n,α141Nd and 66Zn(n,α63Ni reactions were measured at En = 4.0, 5.0 and 6.0 MeV performed at the 4.5-MV Van de Graaff Accelerator of Peking University, China. A double-section gridded ionization chamber was used to detect the alpha particles. The foil samples of 144Sm2O3 and enriched 66Zn were placed at the common cathode plate of the chamber. Monoenergetic neutrons were produced by a deuterium gas target through the 2H(d,n3He reaction. The neutron flux was monitored by a BF3 long counter. Cross sections of the 238U(n,f reaction were used as the standard to perform the (n,α reaction measurement. Present results are compared with existing measurements and evaluations. They are generally in agreement with TALYS-1.6 code calculations. For the 144Sm(n,α141Nd reaction our measurements support the data of JEF-2.2. For the 66Zn(n,α63Ni reaction present results support the data of EAF-2010 and TENDL-2015 data.

  10. Cross sections of the 144Sm(n,α)141Nd and 66Zn(n,α)63Ni reactions at 4.0, 5.0 and 6.0 MeV

    Science.gov (United States)

    Yury, Gledenov; Guohui, Zhang; Khuukhenkhuu, Gonchigdorj; Milana, Sedysheva; Lubos, Krupa; Sansarbayar, Enkhbold; Igor, Chuprakov; Zhimin, Wang; Xiao, Fan; Luyu, Zhang; Huaiyong, Bai

    2017-09-01

    Cross sections of the 144Sm(n,α)141Nd and 66Zn(n,α)63Ni reactions were measured at En = 4.0, 5.0 and 6.0 MeV performed at the 4.5-MV Van de Graaff Accelerator of Peking University, China. A double-section gridded ionization chamber was used to detect the alpha particles. The foil samples of 144Sm2O3 and enriched 66Zn were placed at the common cathode plate of the chamber. Monoenergetic neutrons were produced by a deuterium gas target through the 2H(d,n)3He reaction. The neutron flux was monitored by a BF3 long counter. Cross sections of the 238U(n,f) reaction were used as the standard to perform the (n,α) reaction measurement. Present results are compared with existing measurements and evaluations. They are generally in agreement with TALYS-1.6 code calculations. For the 144Sm(n,α)141Nd reaction our measurements support the data of JEF-2.2. For the 66Zn(n,α)63Ni reaction present results support the data of EAF-2010 and TENDL-2015 data.

  11. Electrochemical extraction of samarium from molten chlorides in pyrochemical processes

    Energy Technology Data Exchange (ETDEWEB)

    Castrillejo, Y., E-mail: ycastril@qa.uva.es [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Fernandez, P. [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Medina, J. [Dept Fisica Materia Condensada Cristalografia y Mineralogia, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain); Hernandez, P. [Centro de Investigaciones Quimicas, Universidad Autonoma del Estado de Hidalgo, Carr. Pachuca-Tulancingo Km. 4.5, C.P. 42076 Pachuca, Hidalgo (Mexico); Barrado, E. [QUIANE/Dept Quimica Analitica, F. de Ciencias, Universidad de Valladolid, Prado de la Magdalena s/n, 47005 Valladolid (Spain)

    2011-10-01

    This work concerns the electrochemical extraction of samarium from molten chlorides. In this way, the electrochemical behaviour of samarium ions has been investigated in the eutectic LiCl-KCl at the surface of tungsten, aluminium and aluminium coated tungsten electrodes. On a W inert electrode the electro-reduction of Sm(III) takes place in only one soluble-soluble electrochemical step Sm(III)/Sm(II). The electrochemical system Sm(II)/Sm(0) has not been observed within the electrochemical window, because of the prior reduction of Li(I) ions from the solvent, which inhibits the electro-extraction of Sm species from the salt on such a substrate. Sm metal in contact with the melt react to give Li(0) according to the reaction: Sm(0) + 2Li(I) {r_reversible} Sm(II) + 2Li(0). On the contrary, on reactive Al electrodes the electrochemical system Sm(II)/Sm(0) was observed within the electroactive range. The potential shift of the redox couple is caused by the decrease of Sm activity in the metal phase due to the formation of Sm-Al alloys at the interface. The formation mechanism of the intermetallic compounds was studied in a melt containing: (i) both Sm(III) and Al(III) ions, using W and Al coated tungsten electrodes, and (ii) Sm(III) ions using an Al electrode. Analysis of the samples after potentiostatic electrolysis by X-ray diffraction and scanning electron microscopy (SEM) with energy dispersive X-ray spectroscopy (EDS), allowed the identification of Al{sub 3}Sm and Al{sub 2}Sm.

  12. A temporal three-dimensional simulation of samarium release in the ionosphere

    Science.gov (United States)

    Zhao, Hai-Sheng; Feng, Jie; Xu, Zheng-Wen; Wu, Jian; Wu, Zhen-Sen; Xu, Bin; Xue, Kun; Xu, Tong; Hu, Yan-Li

    2016-10-01

    For understanding plasma processes of the ionosphere and magnetosphere, the alkali and alkaline-earth metals are usually released in space for artificially increasing the electron density. However, it is a limitation that these releases must be in sunlight where the photoionization can take place. In recent years, the lanthanide metals, such as samarium, have been released to produce electrons in reaction with atomic oxygen in the upper space. The reaction could proceed without sunlight so that the restriction on experimental periods is broken. Unfortunately, any sophisticated models even preliminary ones are unavailable yet in the literature. A temporal three-dimensional model is presented for the samarium release in detail with respect to various altitudes and mass. Especially, the plasma diffusion equation is remarkably extended from 2-D to 3-D by importing the influence of geomagnetic declination, which could be also useful for other chemical releases. The field-aligned terms are brought so as to the presented model can describe the diffusion along the geomagnetic field subtly. On the basis of the presented model, behaviors of radio waves propagating through the release area are simulated by using ray tracing. This model could be as the theoretical support for samarium releases, and it also helpful for the research on the generation and evolution of the ionosphere irregularities.

  13. Particle-Size-Induced Valence Changes in Samarium Clusters

    Energy Technology Data Exchange (ETDEWEB)

    Mason, M. G.; Lee, S. -T.; Apai, G.; Davis, R. F.; Shirley, D. A.; Franciosi, A.; Weaver, J. H.

    1981-09-01

    Samarium clusters exhibit mixed-valence behavior which is sensitive to particle size. XPS and UPS data show samarium to be primarily divalent (4f{sup 6} ) at small particle size. The trivalent state (4f{sup 5} ) becomes progressively more abundant with increasing s1ze, becoming the dominant state for the bulk metal. These results are interpreted using a model in which band narrowing, due to reduced surface coordination, is more dominant than surface tension effects in establishing the valence of small samarium clusters.

  14. Yellow-green electroluminescence of samarium complexes of 8-hydroxyquinoline

    Energy Technology Data Exchange (ETDEWEB)

    Behzad, Sara Karimi; Najafi, Ezzatollah [Department of Chemistry Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Amini, Mostafa M., E-mail: m-pouramini@sbu.ac.ir [Department of Chemistry Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Janghouri, Mohammad; Mohajerani, Ezeddin [Laser Research Institute Shahid Beheshti University G.C., Tehran 1983963113 (Iran, Islamic Republic of); Ng, Seik Weng [Department of Chemistry, University of Malaya, 50603 Kuala Lumpur (Malaysia)

    2014-12-15

    Four novel samarium complexes were prepared by reacting samarium(III) nitrate with 8-hydroxyquinoline, 2-methyl-8-hydroxyquinoline, and 1,10-phenanthroline and utilized as emitting materials in the electroluminescence device. All complexes were characterized by elemental analysis, infrared, UV–vis and {sup 1}H NMR spectroscopes and the molecular structure of a representative complex, [Sm{sub 2}(Me-HQ){sub 4}(NO{sub 3}){sub 6}] (1), was determined by single-crystal X-ray diffraction. Utilization of a π-conjugated (phenanthroline) ligand as a second ligand in the structure of the samarium complexes resulted in red shifts in both absorption and fluorescence spectra of complexes and moderately enhanced the photoluminescence intensity and the fluorescence quantum yield. The maximum emission peaks showed that a good correlation exists between the nature of the substituent group on the 8-hydroxyquinoline and the addition of the π-conjugated ligand in the structure of samarium complexes and emission wavelength. Devices with samarium(III) complexes with structure of ITO/PEDOT:PSS (90 nm)/PVK:PBD:Sm(III) complexes (75 nm)/Al (180 nm) were fabricated. In the electroluminescence (EL) spectra of the devices, a strong ligand-centered emission and narrow bands arising from the {sup 4}G{sub 5/2}→{sup 6}H{sub J} transitions (J=7/2, 9/2, and 11/2) of the samarium ion were observed for the complexes. The electroluminescent spectra of the samarium complexes were red-shifted as compared with the PVK:PBD blend. We believe that the electroluminescence performance of OLED devices based on samarium complexes relies on overlaps between the absorption of the samarium compounds and the emission of PVK:PBD. This revealed that it is possible to evaluate the electroluminescence performance of the samarium compounds-doped OLED devices based on the emission of PVK:PBD and the absorption of the dopants. - Highlights: • Four novel photoluminescence samarium complexes have been synthesized.

  15. Biodistribution of samarium-153-EDTMP in rats treated with docetaxel

    Energy Technology Data Exchange (ETDEWEB)

    Villarim Neto, Arthur; Acucena, Maria Kadja Meneses Torres; Pereira, Kercia Regina Santos Gomes; Rego, Amalia Cinthia Meneses [Universidade Federal do Rio Grande do Norte (UFRN), Natal, RN (Brazil). Postgraduate Program in Health Sciences; Azevedo, Italo Medeiros; Medeiros, Aldo Cunha [Universidade Federal do Rio Grande do Norte (UFRN), Natal, RN (Brazil). Dept. of Surgery; Bernardo-Filho, Mario [State University of Rio de Janeiro, RJ (Brazil). Dept. of Biophysics and Biometry

    2009-01-15

    Purpose: Many patients with metastatic bone disease have to use radiopharmaceuticals associated with chemotherapy to relieve bone pain. The aim of this study was to assess the influence of docetaxel on the biodistribution of samarium-153-EDTMP in bones and other organs of rats. Methods: Wistar male rats were randomly allocated into 2 groups of 6 rats each. The DS (docetaxel/samarium) group received docetaxel (15 mg/kg) intraperitoneally in two cycles 11 days apart. The S (samarium/control) group rats were not treated with docetaxel. Nine days after chemotherapy, all the rats were injected with 0.1 ml of samarium-153-EDTMP via orbital plexus (25 {mu} Ci. After 2 hours, the animals were killed and samples of the brain, thyroid, lung, heart, stomach, colon, liver, kidney and both femurs were removed. The percentage radioactivity of each sample (% ATI / g) was determined in an automatic gamma-counter (Wizard-1470, Perkin-Elmer, Finland). Results: On the ninth day after the administration of the second chemotherapy cycle, the rats had a significant weight loss (314.50 +- 22.09 g) compared (p<0.5) to pre-treatment weight (353.66 {+-} 22.8). The % ATI/g in the samples of rats treated with samarium-153-EDTMP had a significant reduction in the right femur, left femur, kidney, liver and lungs of animals treated with docetaxel, compared to the control rats. Conclusion: The combination of docetaxel and samarium-153-EDTMP was associated with a lower response rate in the biodistribution of the radiopharmaceutical to targeted tissues. Further investigation into the impact of docetaxel on biodistribution of samarium-153-EDTMP would complement the findings of this study. (author)

  16. The Basis for Developing Samarium AMS for Fuel Cycle Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Buchholz, B A; Biegalski, S R; Whitney, S M; Tumey, S J; Weaver, C J

    2008-10-13

    Modeling of nuclear reactor fuel burnup indicates that the production of samarium isotopes can vary significantly with reactor type and fuel cycle. The isotopic concentrations of {sup 146}Sm, {sup 149}Sm, and {sup 151}Sm are potential signatures of fuel reprocessing, if analytical techniques can overcome the inherent challenges of lanthanide chemistry, isobaric interferences, and mass/charge interferences. We review the current limitations in measurement of the target samarium isotopes and describe potential approaches for developing Sm-AMS. AMS sample form and preparation chemistry will be discussed as well as possible spectrometer operating conditions.

  17. Polypyrrole-coated samarium oxide nanobelts: fabrication, characterization, and application in supercapacitors

    Science.gov (United States)

    Liu, Peng; Wang, Yunjiao; Wang, Xue; Yang, Chao; Yi, Yanfeng

    2012-11-01

    Polypyrrole-coated samarium oxide nanobelts were synthesized by the in situ chemical oxidative surface polymerization technique based on the self-assembly of pyrrole on the surface of the amine-functionalized Sm2O3 nanobelts. The morphologies of the polypyrrole/samarium oxide (PPy/Sm2O3) nanocomposites were characterized using transmission electron microscope. The UV-vis absorbance of these samples was also investigated, and the remarkable enhancement was clearly observed. The electrochemical behaviors of the PPy/Sm2O3 composites were investigated by cyclic voltammetry, electrochemical impedance spectroscopy, and galvanostatic charge-discharge. The results indicated that the PPy/Sm2O3 composite electrode was fully reversible and achieved a very fast Faradaic reaction. After being corrected into the weight percentage of the PPy/Sm2O3 composite at a current density of 20 mA cm-2 in a 1.0 M NaNO3 electrolyte solution, a maximum discharge capacity of 771 F g-1 was achieved in a half-cell setup configuration for the PPy/Sm2O3 composites electrode with the potential application to electrode materials for electrochemical capacitors.

  18. Polypyrrole-coated samarium oxide nanobelts: fabrication, characterization, and application in supercapacitors

    Energy Technology Data Exchange (ETDEWEB)

    Liu Peng, E-mail: pliu@lzu.edu.cn; Wang Yunjiao; Wang Xue; Yang Chao; Yi Yanfeng [College of Chemistry and Chemical Engineering, Lanzhou University, Key Laboratory of Nonferrous Metal Chemistry and Resources Utilization of Gansu Province and State Key Laboratory of Applied Organic Chemistry (China)

    2012-11-15

    Polypyrrole-coated samarium oxide nanobelts were synthesized by the in situ chemical oxidative surface polymerization technique based on the self-assembly of pyrrole on the surface of the amine-functionalized Sm{sub 2}O{sub 3} nanobelts. The morphologies of the polypyrrole/samarium oxide (PPy/Sm{sub 2}O{sub 3}) nanocomposites were characterized using transmission electron microscope. The UV-vis absorbance of these samples was also investigated, and the remarkable enhancement was clearly observed. The electrochemical behaviors of the PPy/Sm{sub 2}O{sub 3} composites were investigated by cyclic voltammetry, electrochemical impedance spectroscopy, and galvanostatic charge-discharge. The results indicated that the PPy/Sm{sub 2}O{sub 3} composite electrode was fully reversible and achieved a very fast Faradaic reaction. After being corrected into the weight percentage of the PPy/Sm{sub 2}O{sub 3} composite at a current density of 20 mA cm{sup -2} in a 1.0 M NaNO{sub 3} electrolyte solution, a maximum discharge capacity of 771 F g{sup -1} was achieved in a half-cell setup configuration for the PPy/Sm{sub 2}O{sub 3} composites electrode with the potential application to electrode materials for electrochemical capacitors.

  19. Optical characteristics of transparent samarium oxide thin films ...

    Indian Academy of Sciences (India)

    Optical characteristics of transparent samarium oxide thin films deposited by the radio-frequency sputtering technique. A A ATTA M M EL-NAHASS KHALED M ELSABAWY M M ABD EL-RAHEEM A M HASSANIEN A ALHUTHALI ALI BADAWI AMAR MERAZGA. Regular Volume 87 Issue 5 November 2016 Article ID 72 ...

  20. Optical properties of zinc–vanadium glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Zinc–vanadium glasses doped with samarium oxide having the chemical composition Sm2O3() ZnO(40-)V2O5(60) (where = 0.1–0.5 mol%) were prepared by melt quenching method. The density of these glasses was measured by Archimedes method; the corresponding molar volumes have also been calculated.

  1. Optical properties of samarium doped zinc–tellurite glasses

    Indian Academy of Sciences (India)

    Unknown

    Optical properties of samarium doped zinc–tellurite glasses. B ERAIAH. Department of Physics, Karnatak University, Dharwad 580 003, India. Present address: Department of Physics, Bangalore University, Bangalore 560 056, India. MS received 20 March 2006; revised 13 June 2006. Abstract. Glasses with the composition, ...

  2. Effect of second ligand on the luminescence of Samarium (III ...

    Indian Academy of Sciences (India)

    Effect of second ligand on the luminescence of Samarium (III) dibenzoylmethane complexes: Syntheses, crystal structures, thermal analysis and luminescence study. MUHAMMAD IDIRIS SALEH, MIN YEE CHOO, TAI WEI CHAN and MOHD R RAZALI. ∗. School of Chemical Sciences, Universiti Sains Malaysia, Penang, ...

  3. Effect of second ligand on the luminescence of Samarium (III ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences; Volume 127; Issue 12. Effect of second ligand on the luminescence of Samarium (III) dibenzoylmethane complexes: ... Muhammad Idiris Saleh1 Min Yee Choo1 Tai Wei Chan1 Mohd R Razali1. School of Chemical Sciences, Universiti Sains Malaysia, Penang, Malaysia ...

  4. Chelating Ligand-Mediated Hydrothermal Synthesis of Samarium Orthovanadate with Decavanadate as Vanadium Source

    Directory of Open Access Journals (Sweden)

    Quanguo Li

    2013-01-01

    Full Text Available A new ethylenediaminetetraacetic acid- (EDTA- mediated hydrothermal route to prepare chrysanthemum-shaped samarium orthovanadate (SmVO4 nanocrystals with decavanadate (K6V10O28·9H2O as vanadium source has been developed. The present hydrothermal approach is simple and reproducible and employs a relatively mild reaction temperature. The EDTA, pH value, and temperature of the reaction systems play important roles in determining the morphologies and growth process of the SmVO4 products. The products have been characterized by X-ray diffraction (XRD, scanning electron microscopy (SEM, Fourier transform infrared spectroscopy (FT-IR, photoluminescence spectra (PL, and UV-Vis spectroscopy.

  5. Dependence of samarium-soil interaction on samarium concentration: Implications for environmental risk assessment.

    Science.gov (United States)

    Ramírez-Guinart, Oriol; Salaberria, Aitor; Vidal, Miquel; Rigol, Anna

    2018-03-01

    The sorption and desorption behaviour of samarium (Sm), an emerging contaminant, was examined in soil samples at varying Sm concentrations. The obtained sorption and desorption parameters revealed that soil possessed a high Sm retention capacity (sorption was higher than 99% and desorption lower than 2%) at low Sm concentrations, whereas at high Sm concentrations, the sorption-desorption behaviour varied among the soil samples tested. The fractionation of the Sm sorbed in soils, obtained by sequential extractions, allowed to suggest the soil properties (pH and organic matter solubility) and phases (organic matter, carbonates and clay minerals) governing the Sm-soil interaction. The sorption models constructed in the present work along with the sorption behaviour of Sm explained in terms of soil main characteristics will allow properly assessing the Sm-soil interaction depending on the contamination scenario under study. Moreover, the sorption and desorption K d values of radiosamarium in soils were strongly correlated with those of stable Sm at low concentrations (r = 0.98); indicating that the mobility of Sm radioisotopes and, thus, the risk of radioactive Sm contamination can be predicted using data from low concentrations of stable Sm. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Samarium Monosulfide (SmS): Reviewing Properties and Applications

    OpenAIRE

    Sousanis, Andreas; Smet, Philippe; Poelman, Dirk

    2017-01-01

    In this review, we give an overview of the properties and applications of samarium monosulfide, SmS, which has gained considerable interest as a switchable material. It shows a pressure-induced phase transition from the semiconducting to the metallic state by polishing, and it switches back to the semiconducting state by heating. The material also shows a magnetic transition, from the paramagnetic state to an antiferromagnetically ordered state. The switching behavior between the semiconducti...

  7. Optical properties of zinc–vanadium glasses doped with samarium ...

    Indian Academy of Sciences (India)

    Abstract. Zinc–vanadium glasses doped with samarium oxide having the chemical composition Sm2O3(x). ZnO(40−x)V2O5(60)(where x = 0·1–0·5 mol%) were prepared by melt quenching method. The density of these glasses was measured by Archimedes method; the corresponding molar volumes have also been ...

  8. Synthesis of nano-pore samarium (III)-imprinted polymer for preconcentrative separation of samarium ions from other lanthanide ions via solid phase extraction

    Energy Technology Data Exchange (ETDEWEB)

    Shirvani-Arani, Simindokht [Center of Excellence in Electrochemistry, Department of Chemistry, University of Tehran, P.O.Box:14155-6455, Tehran (Iran, Islamic Republic of); Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of); Ahmadi, Seyed Javad [Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of)], E-mail: sjahmadi@aeoi.org.ir; Bahrami-Samani, Ali [Nuclear Engineering and Physics Department, Amir Kabir University, P.O.Box: 15875-4413, Tehran (Iran, Islamic Republic of); Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of); Ghannadi-Maragheh, Mohammad [Jaber Ibne Hayan Research Laboratories, Nuclear Science and Technology Research Institute, P.O. Box: 11365-8486, Tehran (Iran, Islamic Republic of)

    2008-08-08

    A batch process was developed to separate samarium ions from some lanthanide ions by a novel solid phase which was prepared via the ion-imprinting technique. The samarium (III) ion-imprinted polymer (IIP) particles were synthesized by preparing the ternary complex of samarium ions with 5,7-dichloroquinoline-8-ol (DCQ) and 4-vinylpyridine (VP). Then, thermally copolymerization with styrene (functional monomer, STY) and divinylbenzene (cross-linking monomer, DVB) followed in the presence of 2-methoxy ethanol (porogen) and 2,2'-azobisisobutyronitrile (initiator, AIBN). The imprinted ion was removed by stirring the above particles with 50% (v/v) HCl to obtain the leached IIP particles. Moreover, control polymer (CP) particles were similarly prepared without the samarium ions. The unleached and leached IIP particles were characterized by X-ray diffraction (XRD), infra-red spectroscopy (IR), thermo gravimetric analysis (TGA) and scanning electron microscopy (SEM). Finally, preconcentration and selectivity studies for samarium and the other lanthanide ions were carried out. The preconcentration of the samarium (III) traces was studied during rebinding with the leached IIP particles as a function of pH, the weight of the polymer material, the preconcentration and the elution times, the eluent volume and the aqueous phase volume. These studies indicated that the samarium (III) amount as low as 1 {mu}g, present in 200 mL, could be preconcentrated into 25 mL of 1.0 M HCl.

  9. Reactive Materials for Evaporating Samarium (Pre-Print)

    Science.gov (United States)

    2016-04-15

    SUBJECT TERMS energetic materials, heat sources, pyrotechnic charges, easily ionized metals 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF...experiments.    Keywords:  energetic  materials, heat sources, pyrotechnic charges, easily ionized metals  1. Introduction Ejection of clouds of...results  were  negatively  affected  by  reduced  efficiency   of  release  and  ionization of samarium [8]. It is possible that not the entire charge of

  10. Implementation of an analytical technique for Samarium; Implementacion de una tecnica analitica para Samario

    Energy Technology Data Exchange (ETDEWEB)

    Garcia G, N. [ININ, Carretera Mexico-Toluca Km. 36.5, 52045 Estado de Mexico (Mexico)

    2004-07-01

    Since the Samarium presents the same chemical properties that the plutonium, it has been used as homologous in studies that allow us to know the behavior that the plutonium presents in solution, with the advantage of working with an inactive and not very dangerous element. At the moment studies of sorption of plutonium or samarium are made on some mineral matrices that present certain surface properties. Due to the low concentrations that are used in the studies of sorption of samarium on those reagent substrates, their detection becomes very difficult for the conventional analysis media. The luminescence is a technique that can detect lower concentrations, smaller at 1 X 10{sup -} {sup 2} M, but when fluorofors are used this limit of detection increases in several orders of magnitude. In this work it has been used the arsenazo-III as fluorofor agent since it reacts in a specific way with the samarium, forming a complex that presents a proportional luminescence to the concentration of the present samarium. The advantage of making the quantification of samarium by luminescence is that it can use the same instrumental equipment to determine the speciation of the samarium sipped in the zircon. (Author)

  11. Synthesis of samarium binding bleomycin - a possible NCT radiosensitizer

    Energy Technology Data Exchange (ETDEWEB)

    Mendes, B.M., E-mail: bmm@cdtn.b [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Mendes, T.M.; Campos, T.P.R., E-mail: campos@nuclear.ufmg.b [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil)

    2011-07-01

    Bleomycin (BLM) is a drug that has attractive features for the development of a new radiopharmaceutical, particularly with regard to neutron capture therapy (NCT) sensitized by Sm-149. It has the ability to chelate many metal ions. In vitro studies have shown that up to 78% of BLM present in a cell is accumulated inside the nucleus or in the nuclear membrane. In addition, this drug has higher affinity for tumor tissues than for normal tissues. Radioactive isotopes carried by this antibiotic would be taken preferentially to one important cellular targets DNA. Besides, BLM displays intrinsic anti-tumor activity - it is a chemotherapic antibiotic clinically used against some cancers. This study aimed to obtain bleomycin molecules bound to samarium (BLM-Sm) for NCT studies in vitro and in vivo. The binding technique employed in this work has great simplicity and low cost. Thin layer chromatography, high performance liquid chromatography, fast protein liquid chromatography and analysis by ICP-AES were applied to verify the binding molecule. ICP-AES results showed the presence of samarium in the sample peaks related to BLM-Sm. However, efficiency and stability of this bond needs to be investigated. (author)

  12. Luminescent solutions and powders of new samarium complexes with N,N',O,O'-chelating ligands

    Science.gov (United States)

    Kharcheva, Anastasia V.; Nikolskiy, Kirill S.; Borisova, Nataliya E.; Ivanov, Alexey V.; Reshetova, Marina D.; Yuzhakov, Viktor I.; Patsaeva, Svetlana V.

    2016-04-01

    Imaging techniques in biology and medicine are crucial tools to obtain information on structural and functional properties of living cells and organisms. To fulfill the requirements associated with application of these techniques it appears necessary to design markers with specific characteristics. Luminescent complexes of trivalent lanthanide ions with chelating ligands are of increasing importance in biomedical applications because of their millisecond luminescence lifetime, narrow emission band, high signal-to-noise ratio and minimal photodamage to biological samples. In order to extend the available emission wavelength range the luminescent samarium chelates are highly desirable. In this study the ligands with diamides of 2,2'-bipyridin-6,6'-dicarboxylic acid were used to improve photophysical characteristics of samarium complexes. We report the luminescence characteristics of samarium complexes with novel ligands. All complexes exhibited the characteristic emission of Sm (III) ion with the lines at 565, 597, 605, 645 and 654 nm, the intensity strongly depended on the ligand. Absorption and luminescence excitation spectra of Sm (III) complexes showed main peaks in the UV range demonstrating lanthanide coordination to the ligand. The absolute lumenescence quantum yield was measured for solutions in acetonitrile with excitation at 350 nm. The largest luminescence quantum yield was found for the samarium complex Bipy 6MePy Sm (3%) being much higher that for samarium complexes reported in the literature earlier. These results prove as well that samarium chelates are potential markers for multiparametric imaging techniques.

  13. Australian manufacture of Quadramet{sup TM} (Samarium-153 EDTMP)

    Energy Technology Data Exchange (ETDEWEB)

    Wood, N.R.; Whitwell, J. [Australian Nuclear Science and Technology Organisation (ANSTO), Lucas Heights, NSW (Australia). Australian Radioisotopes

    1997-10-01

    Quadramet{sup T} (Samarium-153 EDTMP) has been shown overseas to be potentially useful in the palliation of painful osteoblastic skeletal metastases and has been approved this year for general marketing in the USA. Australian Radioisotopes (ARI) has licensed this product from the Australian patent holders, Dow Chemical. Within the facilities of ARI, a hot cell has been dedicated to this product and fitted out to manufacture it weekly on a cycle related to the operating cycle of the Australian reactor HIFAR. Due to neutron flux limitations of HIFAR, the local formulation has an elemental Samarium content up to 200{mu}g/mL whereas the overseas formulation has a level of 20-46{mu}g/mL. All other specifications of the two products are essentially the same. In 1995 and 1996 a small clinical trial with 19 patients was held which demonstrated that the pharmacokinetic behaviour was also essentially the same by measuring blood clearance rates and skeletal uptake dynamics. Soft tissue uptake was also qualitatively determined. The ARI version is now the subject of an application for general marketing within Australia. Some useful characteristics of this agent are: almost complete excretion or fixation in the skeleton within 6 hours, rapid onset of clinical effect, applicability in most cases where an abnormal diagnostic bone scan correlates with painful sites, dosage can be tailored to individual patient uptake due to easy dose measurement and retreatment is quite possible. The use of this class of agents in pain palliation continues to increase. Australian manufacture of Quadramet{sup TM} provides a further option in the management of these difficult cases

  14. Pyroelectric properties and electrical conductivity in samarium doped BiFeO 3 ceramics

    KAUST Repository

    Yao, Yingbang

    2012-06-01

    Samarium (Sm 3+) doped BiFeO 3 (BFO) ceramics were prepared by a modified solid-state-reaction method which adopted a rapid heating as well as cooling during the sintering process. The pyroelectric coefficient increased from 93 to 137 μC/m 2 K as the Sm 3+ doping level increased from 1 mol% to 8 mol%. Temperature dependence of the pyroelectric coefficient showed an abrupt decrease above 80 °C in all samples, which was associated with the increase of electrical conductivity with temperature. This electrical conduction was attributed to oxygen vacancy existing in the samples. An activation energy of ∼0.7 eV for the conduction process was found to be irrespective of the Sm 3+ doping level. On the other hand, the magnetic Néel temperature (T N) decreased with increasing Sm 3+ doping level. On the basis of our results, the effects of Sm doping level on the pyroelectric and electrical properties of the BFO were revealed. © 2011 Elsevier Ltd. All rights reserved.

  15. 22 CFR 144.140 - Employment.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Employment. 144.140 Section 144.140 Foreign... PROGRAMS OR ACTIVITIES CONDUCTED BY THE UNITED STATES DEPARTMENT OF STATE § 144.140 Employment. No qualified handicapped person shall, on the basis of handicap, be subjected to discrimination in employment...

  16. Optical analysis of samarium doped sodium bismuth silicate glass.

    Science.gov (United States)

    Thomas, V; Sofin, R G S; Allen, M; Thomas, H; Biju, P R; Jose, G; Unnikrishnan, N V

    2017-01-15

    Samarium doped sodium bismuth silicate glass was synthesized using the melt quenching method. Detailed optical spectroscopic studies of the glassy material were carried out in the UV-Vis-NIR spectral range. Using the optical absorption spectra Judd-Ofelt (JO) parameters are derived. The calculated values of the JO parameters are utilized in evaluating the various radiative parameters such as electric dipole line strengths (Sed), radiative transition probabilities (Arad), radiative lifetimes (τrad), fluorescence branching ratios (β) and the integrated absorption cross- sections (σa) for stimulated emission from various excited states of Sm3+‡ ion. The principal fluorescence transitions are identified by recording the fluorescence spectrum. Our analysis revealed that the novel glassy system has the optimum values for the key parameters viz. spectroscopic quality factor, optical gain, stimulated emission cross section and quantum efficiency, which are required for a high performance optical amplifier. Calculated chromaticity co-ordinates (0.61, 0.38) also confirm its application potential in display devices. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Samarium Monosulfide (SmS): Reviewing Properties and Applications.

    Science.gov (United States)

    Sousanis, Andreas; Smet, Philippe F; Poelman, Dirk

    2017-08-16

    In this review, we give an overview of the properties and applications of samarium monosulfide, SmS, which has gained considerable interest as a switchable material. It shows a pressure-induced phase transition from the semiconducting to the metallic state by polishing, and it switches back to the semiconducting state by heating. The material also shows a magnetic transition, from the paramagnetic state to an antiferromagnetically ordered state. The switching behavior between the semiconducting and metallic states could be exploited in several applications, such as high density optical storage and memory materials, thermovoltaic devices, infrared sensors and more. We discuss the electronic, optical and magnetic properties of SmS, its switching behavior, as well as the thin film deposition techniques which have been used, such as e-beam evaporation and sputtering. Moreover, applications and possible ideas for future work on this material are presented. Our scope is to present the properties of SmS, which were mainly measured in bulk crystals, while at the same time we describe the possible deposition methods that will push the study of SmS to nanoscale dimensions, opening an intriguing range of applications for low-dimensional, pressure-induced semiconductor-metal transition compounds.

  18. 40 CFR 144.1 - Purpose and scope of part 144.

    Science.gov (United States)

    2010-07-01

    ... sections have been cleared by the Office of Management and Budget: Sections 144.11, 144.28(c)(d)(i), 144.31... or appropriate to carry out his functions” under SDWA. (e) Overview of the UIC program. An UIC... underground injections by five classes of wells (see definition of “well injection,” § 144.3). The five...

  19. Excitation induced spectroscopic study and quenching effect in cerium samarium codoped lithium aluminoborate glasses

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, Parvinder; Kaur, Simranpreet [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Singh, Gurinder Pal [Department of Physics, Khalsa College, Amritsar 143002 (India); Arora, Deepawali; Kumar, Sunil [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India); Singh, D.P., E-mail: dpsinghdr@yahoo.com [Department of Physics, Guru Nanak Dev University, Amritsar 143005 (India)

    2016-08-15

    Lithium aluminium borate host has been codoped with cerium and samarium to prepare glass by conventional melt quench technique. Their structural and spectroscopic investigation has been carried out using XRD, FTIR and density measurements. The UV‐Vis absorption spectra and fluorescence spectra (λ{sub exc}.=380 nm and 400 nm) have been studied for spectroscopic analysis. The amorphous nature of the prepared samples is shown by XRD. The density is increasing with addition of cerium at the expense of aluminium, keeping other components constant. FTIR study also shows the presence of compact and stable tetrahedral BO{sub 4} units thus supporting the density results. The UV‐ Vis absorption spectra show a shift of optical absorption edge towards longer wavelength along with an increase in intensity of peaks with rising samarium concentration. The fluorescence spectra show a blue shift and subsequent suppression of cerium peaks with addition of samarium.

  20. Effect of samarium doping on the dielectric behavior of barium zircomium titanate ceramic

    Energy Technology Data Exchange (ETDEWEB)

    Badapanda, T., E-mail: badapanda.tanmaya@gmail.com [Department of Physics, C.V. Raman College of Engineering, Bhubaneswar, Odisha-752054 (India); Sarangi, S.; Behera, B. [School of Physics, Sambalpur University, Jyoti Vihar Sambalpur, Odisha-768019 (India); Anwar, S. [Colloids and Materials Chemistry, Institute of Minerals and Materials Technology, Bhubaneswar, Odisha-751013 (India); Sinha, T. P. [Department of Physics, Bose Institute, Kolkata-700009 (India)

    2014-04-24

    Samarium doped Barium Zirconium Titanate ceramic with general formula Ba{sub 1−x}Sm{sub 2x/3}Zr{sub 0.05}Ti{sub 0.95}O{sub 3} [x=0.0,0.01,0.02,0.03,0.04] has been prepared by high energy ball milling. The X-ray diffraction (XRD) patterns confirmed that these ceramics have a single phase with perovskite-type upto x≤0.03 and a small secondary phase exist at x=0.04. The temperature dependent dielectric study shows a ferroelectric phase transition and transition temperature decreases with an increase in the Samarium content.

  1. Synthesis of samarium complexes with the derivative binder of Schiff Quinolinic base. Characterization and photophysical study; Sintesis de complejos de samario con el ligante derivado de base de Schiff Quinolinica. Caracterizacion y estudio fotofisico

    Energy Technology Data Exchange (ETDEWEB)

    Lucas H, J.

    2016-07-01

    In this work we determined the metal: binder stoichiometry of the species formed during the UV/Vis spectrophotometric titration of the derivative binder of Schiff quinolinic base, L1 with the samarium nitrate pentahydrate in methanol. Statistical analysis of the data allowed proposing the metal: binder stoichiometry for the synthesis of the complexes which was one mole of samarium salt by 2.5 moles of binder and thus favor the formation of complexes with 1M: 1L and 1M: 2L stoichiometries. They were synthesized in aqueous-organic medium (water-ethanol), isolated and purified two complexes with stoichiometry 1 Sm: 1 L1, complex 1 and 1 Sm: 2 L1, complex 2. The overall yield of the reaction was 76%. The characterization of the formed complexes was performed by visible ultraviolet spectrometry (UV/Vis), nuclear magnetic resonance, X-ray photoelectron spectroscopy (XP S), thermal gravimetric analysis with differential scanning calorimetry (TGA/DSC), and radial distribution function. These complexes were studied by fluorescence and emission phosphorescence at variable temperature. Spectroscopic techniques used in both solution and solid demonstrated the formation and stability of these complexes. In addition XP S indicated that in both complexes the samarium retains its oxidation state 3+. Luminescence studies indicated that there is intra-binding charge transfer which decreases the transfer of light energy from the binder to the samarium. Based on the experimental results, L1 binder molecules and complexes 1 and 2 were modeled that demonstrated the proposed Nc for each complex, as well as allowed to visualize the structural arrangement of the molecules, complexes and binder. (Author)

  2. One-step synthesis of samarium-doped ceria and its CO catalysis

    Indian Academy of Sciences (India)

    The samarium-doped ceria (SDC) nanospheres were prepared by the one-step hydrothermal method and characterized by transmission electron microscope, scanning electron microscope, powder X-ray diffraction, X-ray photoelectron spectroscopy, energy-dispersive spectrometer and Raman spectra. According to the ...

  3. A spectroscopic comparison of samarium-doped LiYF4 and KY3F10

    NARCIS (Netherlands)

    Wells, J. P. R.; Sugiyama, A.; Han, T. P. J.; Gallagher, H. G.

    2000-01-01

    Laser selective excitation and fluorescence has been performed on LiYF4 and KY3F10 doped with samarium ions. In LiYF4, a single, tetragonal symmetry center associated with isovalent substitution of Sm3+ with lattice yttrium ions is present. By contrast, three Sm2+ centres and a single, tetragonal

  4. 14 CFR 1260.144 - Procurement procedures.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Procurement procedures. 1260.144 Section 1260.144 Aeronautics and Space NATIONAL AERONAUTICS AND SPACE ADMINISTRATION GRANTS AND COOPERATIVE... dimensioned in the metric system of measurement. (vi) Preference, to the extent practicable and economically...

  5. The Use of a Flexible Calix[4]arene Template to Stabilize a Cyclooctatetraindiyl Samarium-Potassium Complex

    Directory of Open Access Journals (Sweden)

    Geoffroy Guillemot

    2013-01-01

    Full Text Available A sandwich compound of cyclooctatetraendiyl (COT2− samarium-potassium was synthesized and analyzed using a flexible calix[4]arene dianion. This compound, [p-tBu-calix[4]-(OMe2(O2]arenediyl-samarium-(η8-cyclooctatetraendiyl-potassium (tetrahydrofurane3, is constructed as a linear sequence L-Sm--K-, where L, , and are specific ligands with L = O,O-dimethyl-calix[4]arene2−, = cyclo-octatetraendiyl, and = tetrahydrofurane templates.

  6. Activation cross-sections of deuteron induced reactions on {sup nat}Sm up to 50 MeV

    Energy Technology Data Exchange (ETDEWEB)

    Tárkányi, F. [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Hermanne, A. [Cyclotron Laboratory, Vrije Universiteit Brussel (VUB), Laarbeeklaan 103, 1090 Brussels (Belgium); Takács, S. [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Ditrói, F., E-mail: ditroi@atomki.hu [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Csikai, J. [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Ignatyuk, A.V. [Institute of Physics and Power Engineering (IPPE), Obninsk 249020 (Russian Federation)

    2014-08-15

    Highlights: •Deuteron induced reactions on natural samarium up to 50 MeV. •Stacked foil irradiation at different energies and accelerators. •Comparison of experimental results with the ALICE-D, EMPIRE-D and TALYS theoretical codes. •Calculation and comparison of thick target integral yields. -- Abstract: Activation cross-sections for deuteron induced reactions on Sm are presented for the first time for {sup nat}Sm(d,xn){sup 155,154,152m2,152m1,152g,150m,150g,149,148,147,146}Eu, {sup nat}Sm(d,x) {sup 153,145}Sm and {sup nat}Sm(d,x){sup 151,150,149,145,144,143}Pm up to 50 MeV. The cross-sections were measured by the stacked-foil irradiation technique and high resolution γ-ray spectrometry. The results were compared with results of nuclear reaction codes ALICE-D, EMPIRE-D and TALYS (from TENDL libraries). Integral yields of the products were calculated from the excitation functions.

  7. Activation cross-sections of proton induced reactions on {sup nat}Sm up to 65 MeV

    Energy Technology Data Exchange (ETDEWEB)

    Tárkányi, F. [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Hermanne, A. [Cyclotron Laboratory, Vrije Universiteit Brussel (VUB), Laarbeeklaan 103, 1090 Brussels (Belgium); Takács, S. [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Ditrói, F., E-mail: ditroi@atomki.hu [Institute for Nuclear Research, Hungarian Academy of Sciences (ATOMKI), 4026 Debrecen (Hungary); Ignatyuk, A.V. [Institute of Physics and Power Engineering (IPPE), Obninsk 249020 (Russian Federation)

    2015-03-01

    Highlights: •Proton induced reactions on natural samarium up to 65 MeV. •Stacked foil irradiation technique. •Comparison of experimental results with the ALICE, EMPIRE and TALYS theoretical model codes. •Calculation and comparison of thick target integral yields. -- Abstract: Activation cross sections for proton induced reactions on Sm are presented for the first time for {sup nat}Sm(p,xn){sup 154,152m2,152m1,152g,150m,150g,149,148,147,146,145}Eu, {sup nat}Sm(p,x){sup 153,145}Sm, {sup nat}Sm(p,x){sup 151,150,149,148g,148m,146,144,143}Pm and {sup nat}Sm(p,x){sup 141}Nd up to 65 MeV. The cross sections were measured via activation method by using a stacked-foil irradiation technique and high resolution gamma ray spectroscopy. The results were compared with results of the nuclear reaction codes ALICE, EMPIRE and TALYS (results taken from TENDL libraries). Integral yields of the activation products were calculated from the excitation functions.

  8. Formation of a new adduct based on fullerene tris-malonate samarium salt C60-[C60(=C(COO)2)3]Sm2

    Science.gov (United States)

    Petrov, A. A.; Keskinov, V. A.; Semenov, K. N.; Charykov, N. A.; Letenko, D. G.; Nikitin, V. A.

    2017-03-01

    Gram quantities of a new adduct based on light fullerene tris-malonate samarium salt C60 [C60(=C(COO)2)3]Sm2 are obtained via the reaction of ion exchange. The obtained adduct is studied by means of electron and infrared spectroscopy, X-ray and elemental analysis, electron microscopy, and thermogravimetry. The polythermal solubility of [C60(=C(COO)2)3]Sm2 in water is determined in ampoules via saturation within 20-70°C. The composition of crystalline hydrate [C60(=C(COO)2)3]Sm2 · 36H2O, which exists in equilibrium with the saturated solution, is estimated.

  9. Samarium(II) iodide-mediated reductive annulations of ketones bearing a distal vinyl epoxide moiety

    Energy Technology Data Exchange (ETDEWEB)

    Molander, G.A.; Shakya, S.R. [Univ. of Colorado, Boulder, CO (United States)

    1996-08-23

    It was found that samarium (II) iodide promotes the intramolecular coupling of ketones with distal epoxy olefins while in the presence of hexamethylphosphoramide (HPMA). A number of epoxide compounds (1 a-k) fragment to form carbocycles with allylic alcohol side chains with high diastereoselectivity (2 a-k). Substituting tetramethylguanidine for HPMA reduces the diastereoselectivity. Adding Pd(0) as a catalyst reverses the diastereoselective sense. 40 refs., 1 tab.

  10. Dicty_cDB: CHF144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHF144 (Link to dictyBase) - - - Contig-U16411-1 | Contig-U16470-1 CHF...144P (Link to Original site) CHF144F 557 CHF144Z 781 CHF144P 1318 - - Show CHF144 Library CH (Link to library) Clone ID CHF...411-1 | Contig-U16470-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHF1-B/CHF...144Q.Seq.d/ Representative seq. ID CHF144P (Link to Original site) Representative DNA sequence >CHF144 (CHF...144Q) /CSM/CH/CHF1-B/CHF144Q.Seq.d/ TAATAAATAATAATTAAAATTTGCATATATAAAAGAAATAAAAATTTTTTATTTTTTGTA

  11. Liquid–liquid anion exchange extraction studies of samarium(III from salicylate media using high molecular weight amine

    Directory of Open Access Journals (Sweden)

    Aniruddha M. Mandhare

    2015-07-01

    Full Text Available Liquid–liquid extraction and separation of samarium(III were carried out by using 0.025 mol dm−3 2-octylaminopyridine(2-OAP in xylene at 298 K. The extraction behavior of samarium was studied as a function of pH, weak acid concentration, extractant concentration, diluent, and equilibration time. Samarium was quantitatively extracted at pH 7.5 to 10.0 from 0.01 mol dm−3 sodium salicylate solution with 0.025 mol dm−3 2-OAP. The possible composition of the extracted species in organic phase has been determined by using model of slope analysis method and extraction mechanism was found to proceed via an anion exchange mechanism. The stripping efficiency was found to be quantitative in HNO3, HCl and CH3COOH. The robustness of the procedure was demonstrated by the average recoveries obtained (>99.6% for samarium(III extraction in the presence of several cations and anions which are commonly associated with it. The proposed method facilitates the separation and determination of samarium(III from binary and synthetic mixtures. The various thermodynamic functions like free energy (ΔG, enthalpy (ΔH and entropy (ΔS of extraction mechanism were discussed.

  12. 9 CFR 381.144 - Packaging materials.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Packaging materials. 381.144 Section... Packaging materials. (a) Edible products may not be packaged in a container which is composed in whole or in... to health. All packaging materials must be safe for the intended use within the meaning of section...

  13. 27 CFR 44.144 - Opening.

    Science.gov (United States)

    2010-04-01

    ... PAYMENT OF TAX, OR WITH DRAWBACK OF TAX Operations by Export Warehouse Proprietors Inventories § 44.144 Opening. An opening inventory shall be made by the export warehouse proprietor at the time of commencing... permit issued under § 44.93. A similar inventory shall be made by the export warehouse proprietor when he...

  14. Ferrites Ni{sub 0,5}Zn{sub 0,5}Fe{sub 2}O{sub 4} doped with samarium: structural analysis, morphological and electromagnetic; Ferritas Ni{sub 0,5}Zn{sub 0,5}Fe{sub 2}O{sub 4} dopada com samario: analise estrutural, morfologica e eletromagnetica

    Energy Technology Data Exchange (ETDEWEB)

    Costa, A.C.F.M.; Diniz, A.P., E-mail: anacristina@dema.ufcg.edu.br [Universidade Federal de Campina Grande (UFCG), PB (Brazil). Unidade Academinca de Engenharia de Materiais; Viana, K.M.S. [Universidade Federal do Rio Grande do Norte (UFRN), Natal, PE (Brazil). Escola de Ciencias e Tecnologia; Cornejo, D.R. [Universidade de Sao Paulo (USP), SP (Brazil). Instituto de Fisica; Kiminami, R.H.G.A. [Universidade Federal de Sao Carlos (UFSCar), SP (Brazil). Departamento de Engenharia de Materiais

    2010-07-01

    This paper proposes to investigate the sintering at 1200 deg C/2h of Ni{sub 0.5}Zn{sub 0.5}Fe{sub 2-x}Sm{sub x}O{sub 4} ferrite doped with 0.05; 0.075 e 0.1 mol of Sm synthesized by combustion reaction to evaluate the performance materials as absorbers of electromagnetic radiation. The influence of the concentration of samarium on the structure, morphology and electromagnetic properties of ferrites was studied. The resulting samples were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), magnetic measurements and reflectivity measurements in the frequency range between 8-12 GHz. The results showed that increasing the concentration of samarium caused a decrease in particle size of the samples, encouraging, therefore, to obtain materials with better values of magnetization and reflectivity, allowing for use as absorbers in narrow-band frequency between 9-10 GHz. (author)

  15. 40 CFR 144.24 - Class V wells.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Class V wells. 144.24 Section 144.24... INJECTION CONTROL PROGRAM Authorization of Underground Injection by Rule § 144.24 Class V wells. (a) A Class V injection well is authorized by rule, subject to the conditions in § 144.84 (b) Duration of well...

  16. Dicty_cDB: SLF144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLF144 (Link to dictyBase) - - - Contig-U09670-1 SLF144E (Link... to Original site) - - - - - - SLF144E 390 Show SLF144 Library SL (Link to library) Clone ID SLF144 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLF1-B/SLF144Q.Seq.d/ Representative seq. ID SLF14...4E (Link to Original site) Representative DNA sequence >SLF144 (SLF144Q) /CSM/SL/SLF1-B/SLF144Q.Seq.d/ AGGCA...mino Acid sequence (All Frames) Frame A: rh*sch*flftf*l*nlctsywsyr*srcpryisfnslk*lfr*ygigw*fn*sltkirt rgsf*i

  17. Dicty_cDB: SLB144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLB144 (Link to dictyBase) - - - Contig-U16455-1 SLB144Z (Link... to Original site) - - SLB144Z 710 - - - - Show SLB144 Library SL (Link to library) Clone ID SLB144 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLB1-B/SLB144Q.Seq.d/ Representative seq. ID SLB14...4Z (Link to Original site) Representative DNA sequence >SLB144 (SLB144Q) /CSM/SL/SLB1-B/SLB144Q.Seq.d/ XXXXX...29 |pid:none) Acanthamoeba culbertsoni ef1a gene... 321 2e-86 AY643820_1( AY643820 |pid:none) Arcyria denuda

  18. Dicty_cDB: SHF144 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SH (Link to library) SHF144 (Link to dictyBase) - - - Contig-U16333-1 SHF144P (Link to Original site) SHF...144F 627 SHF144Z 547 SHF144P 1154 - - Show SHF144 Library SH (Link to library) Clone ID SHF...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SH/SHF1-B/SHF144Q.Seq.d/ Representative seq. ID SHF...144P (Link to Original site) Representative DNA sequence >SHF144 (SHF144Q) /CSM/SH/SHF1-B/SHF...iriisw*tsmcn*cf**ye*fw*f--- ---igisilstwsiikwcfrsv*xw*ckfqir**tf*rfsnyrvsiiq*lqsxhfndewy xryxsi*xfeiexxxps*s

  19. Samarium(II) iodide-mediated intramolecular conjugate additions of alpha,beta-unsaturated lactones.

    Science.gov (United States)

    Molander, Gary A; St Jean, David J

    2002-05-31

    Samarium(II) iodide, in the presence of catalytic amounts of nickel(II) iodide, has been used to promote intramolecular conjugate additions of alkyl halides onto alpha,beta-unsaturated lactones. This process has been shown to be applicable to a number of alpha,beta-unsaturated lactones, including tetrasubstituted olefins, and has been demonstrated to be quite general for the formation of saturated bicyclic and tricyclic lactones. The method presented herein provides a mild, efficient process to form structurally complex lactones from simple precursors.

  20. Sodium samarium tetrakis(polyphosphate, NaSm(PO34

    Directory of Open Access Journals (Sweden)

    Dan Zhao

    2010-07-01

    Full Text Available NaSm(PO34 has been prepared by solid state reactions. It belongs to type II of the structural family of MILnIII(PO34 compounds (MI = alkali metal and LnIII = rare earth metal and is composed of ∞(PO3n]n− polyphosphate chains with a repeating unit of four PO4 tetrahedra. The chains extend parallel to [100] and share O atoms with irregular SmO8 polyhedra, forming a three-dimensional framework which delimits tunnels occupied by Na+ cations in a distorted octahedral environment.

  1. Neutron Activated Samarium-153 Microparticles for Transarterial Radioembolization of Liver Tumour with Post-Procedure Imaging Capabilities

    Science.gov (United States)

    Hashikin, Nurul Ab. Aziz; Yeong, Chai-Hong; Abdullah, Basri Johan Jeet; Ng, Kwan-Hoong; Chung, Lip-Yong; Dahalan, Rehir; Perkins, Alan Christopher

    2015-01-01

    Introduction Samarium-153 (153Sm) styrene divinylbenzene microparticles were developed as a surrogate for Yttrium-90 (90Y) microspheres in liver radioembolization therapy. Unlike the pure beta emitter 90Y, 153Sm possess both therapeutic beta and diagnostic gamma radiations, making it possible for post-procedure imaging following therapy. Methods The microparticles were prepared using commercially available cation exchange resin, Amberlite IR-120 H+ (620–830 μm), which were reduced to 20–40 μm via ball mill grinding and sieve separation. The microparticles were labelled with 152Sm via ion exchange process with 152SmCl3, prior to neutron activation to produce radioactive 153Sm through 152Sm(n,γ)153Sm reaction. Therapeutic activity of 3 GBq was referred based on the recommended activity used in 90Y-microspheres therapy. The samples were irradiated in 1.494 x 1012 n.cm-2.s-1 neutron flux for 6 h to achieve the nominal activity of 3.1 GBq.g-1. Physicochemical characterisation of the microparticles, gamma spectrometry, and in vitro radiolabelling studies were carried out to study the performance and stability of the microparticles. Results Fourier Transform Infrared (FTIR) spectroscopy of the Amberlite IR-120 resins showed unaffected functional groups, following size reduction of the beads. However, as shown by the electron microscope, the microparticles were irregular in shape. The radioactivity achieved after 6 h neutron activation was 3.104 ± 0.029 GBq. The specific activity per microparticle was 53.855 ± 0.503 Bq. Gamma spectrometry and elemental analysis showed no radioactive impurities in the samples. Radiolabelling efficiencies of 153Sm-Amberlite in distilled water and blood plasma over 48 h were excellent and higher than 95%. Conclusion The laboratory work revealed that the 153Sm-Amberlite microparticles demonstrated superior characteristics for potential use in hepatic radioembolization. PMID:26382059

  2. Ekstraksi Pemisahan Neodimium dari Samarium, Itrium dan Praseodimium Memakai Tri Butil Fosfat

    Directory of Open Access Journals (Sweden)

    Maria Veronica Purwani

    2017-05-01

    Full Text Available The extraction of Nd(OH3 (neodymium hydroxide concentrate containing Y (yttrium, Sm (samarium and Pr (praseodymium as product of monazite processed has been done. The purpose of this study is to determine the separation of Nd from Y, Pr and Nd Sm in Nd concentrate. The aqueous phase was concentrated Nd (OH3 in HNO3 and extractant while organic phase was Tri Butyl Phosphate (TBP in kerosene. Parameters studied were pH and concentration feed, concentration of TBP in kerosene, extraction time and stirring speed. The result showed that the optimization of separation extraction neodymium from samarium, yttrium and praseodymium in Nd(OH3 concentrated with TBP, obtained the optimum condition of pH = 0.2, concentration of feed 100 g /L, concentration of TBP in kerosene 5%, extraction time 15 minutes and stirring speed 150 rpm. With the conditions, Separation Factor (SF obtained for Nd-Y, Nd-Pr, Nd-Sm are 2.242, 4.811, 4.002 respectively, while D and extraction efficiency of Nd are 0.236 and 19.07%.

  3. X-Band Microwave Reflection Properties of Samarium/Bismuth-Substituted Barium Lanthanum Titanate Ceramics

    Science.gov (United States)

    Bahel, Shalini; Pubby, Kunal; Narang, Sukhleen Bindra

    2017-03-01

    Samarium/bismuth-substituted barium lanthanum titanate ceramics with chemical composition Ba4 (La_{1 - y - z} Smy Biz )_{9.33} Ti_{18} O_{54} ( y = 0.5, 0.7; z = 0.05, 0.10, 0.15), intended as microwave reflecting materials, have been investigated in microwave X-band (8.2 GHz to 12.4 GHz) and the effect of substitution on their dielectric properties, i.e., dielectric constant and dielectric loss tangent, has been studied by vector network analyzer. Dielectric analysis showed that the dielectric constant increased with increasing samarium as well as bismuth content. Dielectric relaxation was observed for all samples in the scanned frequency range. Microwave reflection and transmission analysis of ceramic pellets of thickness 4 mm was carried out using two methods, i.e., open- and short-circuit approach, both indicating very high values of reflected power and very low values of transmitted power for all the doped materials in comparison with the base composition. The doped compositions are therefore potential microwave shielding materials for use in anechoic chambers, microwave laboratories, and radar equipment. Double-layer reflectors are also proposed, having better reflection properties (˜99% reflection) compared with single-layer reflectors.

  4. Microstructure and hysteresis curves of samarium-holmium-iron garnet synthesized by coprecipitation

    Directory of Open Access Journals (Sweden)

    Caffarena Valeska da Rocha

    2003-01-01

    Full Text Available An investigation was made into the synthesis and magnetic properties of Sm(3-xHo xFe5O12 (samarium-holmium-iron garnet ferrite, as yet absent from the literature. The material in question was synthesized by co-precipitation, starting from hydrated chlorides of rare-earth elements and ferrous sulfate, and the mixed hydroxide co-precipitate was calcined at 1000 °C. Using PVA as a binder, rectangular cross section-shaped compacts were produced by means of steel-die pressing, drying and sintering from 1200 to 1450 °C. The main conclusions of this study were that the coercive force decreases as the sintering temperature increases, and that the effect of substituting holmium for samarium in SmIG is entirely different from that provided by replacing yttrium by gadolinium in YIG, which is the most important result of this work. An in-depth investigation will be necessary to determine the correlation between microstructure/magnetic properties and ceramic processing variables.

  5. Bone-seeking radiopharmaceuticals as targeted agents of osteosarcoma: samarium-153-EDTMP and radium-223.

    Science.gov (United States)

    Anderson, Peter M; Subbiah, Vivek; Rohren, Eric

    2014-01-01

    Osteosarcoma is a cancer characterized by formation of bone by malignant cells. Routine bone scan imaging with Tc-99m-MDP is done at diagnosis to evaluate primary tumor uptake and check for bone metastases. At time of relapse the Tc-99m-MDP bone scan also provides a specific means to assess formation of bone by malignant osteosarcoma cells and the potential for bone-seeking radiopharmaceuticals to deliver radioactivity directly into osteoblastic osteosarcoma lesions. This chapter will review and compare a bone-seeking radiopharmaceutical that emits beta-particles, samarium-153-EDTMP, with an alpha-particle emitter, radium-223. The charged alpha particles from radium-223 have far more mass and energy than beta particles (electrons) from Sm-153-EDTMP. Because radium-223 has less marrow toxicity and more radiobiological effectiveness, especially if inside the bone forming cancer cell than samarium-153-EDTMP, radium-223 may have greater potential to become widely used against osteosarcoma as a targeted therapy. Radium-223 also has more potential to be used with chemotherapy against osteosarcoma and bone metastases. Because osteosarcoma makes bone and radium-223 acts like calcium, this radiopharmaceutical could possibly become a new targeted means to achieve safe and effective reduction of tumor burden as well as facilitate better surgery and/or radiotherapy for difficult to resect large, or metastatic tumors.

  6. Behavior of Samarium III during the sorption process; Comportamiento del Samario-III durante el proceso de sorcion

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez R, E.; Garcia G, N.; Garcia R, G. [ININ, Carr. Mexico-Toluca Km 36.5, Salazar, Estado de Mexico (Mexico)]. e-mail: edo@nuclear.inin.mx

    2004-07-01

    In this work the results of the behavior of samarium in solution are presented, in front of a fine powder of zirconium silicate (zircon). For that which is necessary to characterize the zircon, studying the crystallinity, the morphology, the surface area and the isoelectric point. The behavior of samarium in solution is studied by means of the elaboration of isotherm of sorption, using the technique by lots. One observes that to pH values of nearer to the isoelectric point (pH = 7.23) the process of sorption of the samarium begins, reaching a maximum to near pH at 9. The technique of luminescence is used to determine the concentration of the sipped samarium (phosphorescence) and also to make the speciation of the species formed in the surface of the zircon (phosphorescence). The results can be extrapolated with the plutonium when making the modeling of the migration of alpha emitting coming from the repositories of radioactive waste since both they have similar chemical properties (they are homologous). (Author)

  7. Pemisahan Unsur Samarium dan Yttrium dari Mineral Tanah Jarang dengan Teknik Membran Cair Berpendukung (Supported Liquid Membrane

    Directory of Open Access Journals (Sweden)

    Amri Amin

    2009-06-01

    Full Text Available he increasing use of rare earth elements in high technology industries needs to be supported by developmental work for the separation of elements. The research objective is fiercely attracting and challenging considering the similarity of bath physical and chemical properties among these elements. The rate separation of samarium and yttrium elements using supported liquid membrane has been studied. Polytetrafluoroethylene (PTFE with pore size of 0.45 µm has been used as the membrane and di(2-ethylhexyl phosphate (D2EHP in hexane has been used as a carrier and nitric acid solution has been used as receiving phase. Result of experiments showed that the best separation rate of samarium and yttrium elements could be obtained at feeding phase of pH 3.0, di(2-ethylhexyl phosphate (D2EHP concentration of 0.3 M, agitation rate of 700 rpm, agitation time of 2 hours, and nitric acid and its solution concentrations of 1.0 M and 0.1 M, respectively. At this condition, separation rates of samarium and yttrium were 64.4 and 67.6%, respectively.   Keywords: liquid membrane, rare earth elements, samarium, yttrium

  8. The 144Ce source for SOX

    Science.gov (United States)

    Durero, M.; Vivier, M.; Agostini, M.; Altenmüller, K.; Appel, S.; Bellini, G.; Benziger, J.; Berton, N.; Bick, D.; Bonfini, G.; Bravo, D.; Caccianiga, B.; Calaprice, F.; Caminata, A.; Cavalcante, P.; Chepurnov, A.; Choi, K.; Cribier, M.; D'Angelo, D.; Davini, S.; Derbin, A.; Di Noto, L.; Drachnev, I.; Etenko, A.; Farinon, S.; Fischer, V.; Fomenko, K.; Franco, D.; Gabriele, F.; Gaffiot, J.; Galbiati, C.; Ghiano, C.; Giammarchi, M.; Goeger-Neff, M.; Goretti, A.; Gromov, M.; Hagner, C.; Houdy, T.; Hungerford, E.; Ianni, Aldo; Ianni, Andrea; Jonqueres, N.; Jedrzejczak, K.; Kaiser, M.; Kobychev, V.; Korablev, D.; Korga, G.; Kornoukhov; Kryn, D.; Lachenmaier, T.; Lasserre, T.; Laubenstein, M.; Lehnert, B.; Link, J.; Litvinovich, E.; Lombardi, F.; Lombardi, P.; Ludhova, L.; Lukyanchenko, G.; Machulin, I.; Manecki, S.; Maneschg, W.; Marcocci, S.; Maricic, J.; Mention, G.; Meroni, E.; Meyer, M.; Miramonti, L.; Misiaszek, M.; Montuschi, M.; Muratova, V.; Musenich, R.; Neumair, B.; Oberauer, L.; Obolensky, M.; Ortica, F.; Pallavicini, M.; Papp, L.; Perasso, L.; Pocar, A.; Ranucci, G.; Razeto, A.; Re, A.; Romani, A.; Roncin, R.; Rossi, N.; Schönert, S.; Scola, L.; Semenov, D.; Simgen, H.; Skorokhvatov, M.; Smirnov, O.; Sotnikov, A.; Sukhotin, S.; Suvorov; Tartaglia, R.; Testera, G.; Thurn, J.; Toropova, M.; Veyssiére, C.; Unzhakov, E.; Vogelaar, R. B.; von Feilitzsch, F.; Wang, H.; Weinz, S.; Winter, J.; Wojcik, M.; Wurm, M.; Yokley, Z.; Zaimidoroga, O.; Zavatarelli, S.; Zuber, K.; Zuzel, G.

    2016-02-01

    The SOX (Short distance neutrino Oscillations with BoreXino) project aims at testing the light sterile neutrino hypothesis. To do so, two artificials sources of antineutrinos and neutrinos respectively will be consecutively deployed at the Laboratori Nazionali del Gran Sasso (LNGS) in close vicinity to Borexino, a large liquid scintillator detector. This document reports on the source production and transportation. The source should exhibit a long lifetime and a high decay energy, a requirement fullfilled by the 144Ce-144Pr pair at secular equilibrium. It will be produced at FSUE “Mayak” PA using spent nuclear fuel. It will then be shielded and packed according to international regulation and shipped to LNGS across Europe. Knowledge of the Cerium antineutrino generator (CeANG) parameters is crucial for SOX as it can strongly impact the experiment sensitivity. Several apparatuses are being used or designed to characterize CeANG activity, radioactive emission and content. An overview of the measurements performed so far is presented here.

  9. MicroRNA-144 inhibits hepatocellular carcinoma cell proliferation ...

    Indian Academy of Sciences (India)

    MicroRNA 144 (miR-144), a small non-coding RNA, is frequently dysregulated in human several tumour progression,but its role and the underlying mechanisms in hepatocellular carcinoma (HCC) is poorly investigated. In thepresent study, the expression of miR-144 was firstly analysed in datasets derived from GSE21362 ...

  10. 19 CFR 144.36 - Withdrawal for transportation.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Withdrawal for transportation. 144.36 Section 144... § 144.36 Withdrawal for transportation. (a) Time limit. Merchandise may be withdrawn from warehouse for transportation to another port of entry if withdrawal for consumption or exportation can be accomplished at the...

  11. 19 CFR 144.23 - Endorsement in blank.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Endorsement in blank. 144.23 Section 144.23 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE... Merchandise from Warehouse § 144.23 Endorsement in blank. If the transferor wishes to do so, he may endorse...

  12. 19 CFR 144.25 - Deposit of forms.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Deposit of forms. 144.25 Section 144.25 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY... Warehouse § 144.25 Deposit of forms. Either the transferor or the transferee may deposit the endorsed...

  13. 42 CFR 456.144 - Data sources for studies.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Data sources for studies. 456.144 Section 456.144 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL ASSISTANCE PROGRAMS UTILIZATION CONTROL Utilization Control: Hospitals Ur Plan: Medical Care Evaluation Studies § 456.144 Data sources...

  14. 9 CFR 319.144 - Whole hog sausage.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Whole hog sausage. 319.144 Section 319.144 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY... CERTIFICATION DEFINITIONS AND STANDARDS OF IDENTITY OR COMPOSITION Sausage Generally: Fresh Sausage § 319.144...

  15. 19 CFR 144.1 - Merchandise eligible for warehousing.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Merchandise eligible for warehousing. 144.1 Section 144.1 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY... § 144.1 Merchandise eligible for warehousing. (a) Types of merchandise. Any merchandise subject to duty...

  16. 17 CFR 14.4 - Violation of Commodity Exchange Act.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 1 2010-04-01 2010-04-01 false Violation of Commodity Exchange Act. 14.4 Section 14.4 Commodity and Securities Exchanges COMMODITY FUTURES TRADING COMMISSION RULES RELATING TO SUSPENSION OR DISBARMENT FROM APPEARANCE AND PRACTICE § 14.4 Violation of Commodity...

  17. 5 CFR 185.144 - Right to administrative offset.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Right to administrative offset. 185.144 Section 185.144 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PROGRAM FRAUD CIVIL REMEDIES § 185.144 Right to administrative offset. The amount of any penalty or assessment...

  18. 19 CFR 144.3 - Allowance for damage.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Allowance for damage. 144.3 Section 144.3 Customs... (CONTINUED) WAREHOUSE AND REWAREHOUSE ENTRIES AND WITHDRAWALS General Provisions § 144.3 Allowance for damage. No abatement or allowance of duties shall be made on account of damage, loss, or deterioration of the...

  19. Effects of the atomic environment on the electron binding energies in samarium

    Energy Technology Data Exchange (ETDEWEB)

    Inoyatov, A.Kh., E-mail: inoyatov@jinr.ru [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Institute of Applied Physics, National University, Tashkent, Republic of Uzbekistan (Uzbekistan); Kovalík, A. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Nuclear Physics Institute of the ASCR, CZ-25068 Řež near Prague (Czech Republic); Filosofov, D.V. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Ryšavý, M.; Vénos, D. [Nuclear Physics Institute of the ASCR, CZ-25068 Řež near Prague (Czech Republic); Yushkevich, Yu.V.; Perevoshchikov, L.L. [Laboratory of Nuclear Problems, JINR, Dubna, Moscow Region (Russian Federation); Zhdanov, V.S. [Nuclear Physics Institute, Almaty, Republic of Kazakhstan (Kazakhstan)

    2016-02-15

    Highlights: • Eight different matrices (evaporated and implanted at 30 keV) used. • The greatest average difference in the binding energies amounted to 3.1 ± 0.1 eV. • The presence of trivalent and divalent Sm ions found in some implanted samples. • No significant differences in Sm natural atomic level widths were observed. - Abstract: Effects of the atomic environment on the L{sub 1}, L{sub 2}, L{sub 3}, M{sub 1}, M{sub 2}, M{sub 3}, and N{sub 1} electron binding energies in samarium generated in the electron capture decay of radioactive {sup 149}Eu were investigated by means of the internal conversion electron spectroscopy using the conversion electron spectrum of the 22.5 keV M1 + E2 nuclear transition in the daughter {sup 149}Sm. In this investigation, four pairs of {sup 149}Eu sources prepared by vacuum evaporation deposition and by ion implantation at 30 keV with the use of four different source backing materials, namely polycrystalline carbon, aluminium, gadolinium and platinum foils, were employed. The greatest average difference of (3.1 ± 0.1) eV in the L{sub 1}, L{sub 2}, L{sub 3}, and M{sub 1} subshell electron binding energies was observed between the {sup 149}Eu sources prepared by ion implantation into the aluminium and platinum substrates. On the other hand, minimal differences in the electron binding energies were generally found between samarium generated in the evaporated layer and in the bulk for the individual investigated source backings with the exception of the gadolinium foil. A doublet structure of all investigated conversion electron lines with the average values of 8.1 ± 0.2 eV and 1.5 ± 0.1 for the separation energy and the intensity ratio of the low-energy to high-energy components, respectively, was observed for the {sup 149}Eu sources prepared by ion implantation into the aluminium and carbon foils. This structure was presumably caused by the presence of both the trivalent and divalent Sm ions in the sources. No

  20. Multiphoton laser wave-mixing absorption spectroscopy for samarium using a graphite furnace atomizer

    Energy Technology Data Exchange (ETDEWEB)

    Maniaci, Michael J.; Tong, William G. E-mail: william.tong@sdsu.edu

    2004-07-30

    Nonlinear laser wave-mixing optical technique is presented as a sensitive atomic spectroscopic method for the analysis of rare earth elements using an unmodified commercially available graphite furnace (GF) atomizer. A simple nonplanar backward-scattering degenerate four-wave mixing optical arrangement offers sub-picogram detection sensitivity with sub-Doppler Lorentzian-broadened resolution. Nonlinear wave mixing is an unusually sensitive absorption-based optical method that offers both excellent detection sensitivity and sub-Doppler spectral resolution. A mass detection limit of 0.7 pg and a concentration detection limit of 70 pg/ml are determined for a rare earth element, samarium, using the 429.7-nm excitation line.

  1. Samarium Doped Cerium Oxide Clusters: a Study on the Modulation of Electronic Structure

    Science.gov (United States)

    Topolski, Josey E.; Kafader, Jared O.; Marrero-Colon, Vicmarie; Chick Jarrold, Caroline

    2017-06-01

    Cerium oxide is known for its use in solid oxide fuel cells due to its high ionic conductivity. The doping of trivalent samarium atoms into cerium oxide is known to enhance the ionic conductivity through the generation of additional oxygen vacancies. This study probes the electronic structure of Sm_{x}Ce_{y}O_{z} (x+y=3, z=2-4) anion and neutral clusters. Anion photoelectron spectra of these mixed metal clusters exhibit additional spectral features not present in the previously studied cerium oxide clusters. Density functional theory calculations have been used to aid interpretation of collected spectra. The results of this work can be used to inform the design of materials used for solid oxide fuel cells.

  2. The Magnetocaloric Effect and Heat Capacity of Suspensions of High-Dispersity Samarium Ferrite

    Science.gov (United States)

    Korolev, V. V.; Aref'ev, I. M.; Ramazanova, A. G.

    2008-02-01

    The magnetocaloric effect and specific heat capacity of an aqueous suspension of samarium ferrite were determined calorimetrically over the temperature range 288-343 K in magnetic fields of 0-0.7 T. The data obtained were used to calculate changes in the magnetic component of the molar heat capacity and entropy of the magnetic phase and changes in the enthalpy of the process under an applied magnetic field. The magnetocaloric effect was found to increase nonlinearly as the magnetic field induction grew. The corresponding temperature dependences contained a maximum at 313 K related to the second-order magnetic phase transition at the Curie point. The field and temperature dependences of heat capacity contained a maximum in fields of 0.4 T and a minimum at the magnetic phase transition temperature.

  3. Preparation of hollow core/shell microspheres of hematite and its adsorption ability for samarium.

    Science.gov (United States)

    Yu, Sheng-Hui; Yao, Qi-Zhi; Zhou, Gen-Tao; Fu, Sheng-Quan

    2014-07-09

    Hollow core/shell hematite microspheres with diameter of ca. 1-2 μm have been successfully achieved by calcining the precursor composite microspheres of pyrite and polyvinylpyrrolidone (PVP) in air. The synthesized products were characterized by a wide range of techniques including powder X-ray diffraction (XRD), field-emission scanning electron microscopy (FESEM), energy-dispersive X-ray spectroscopy (EDX), transmission electron microscopy (TEM), high-resolution TEM (HRTEM), thermogravimetric analysis (TGA) and differential scanning calorimetry (DSC), and Brunauer-Emmett-Teller (BET) gas sorptometry. Temperature- and time-dependent experiments unveil that the precursor pyrite-PVP composite microspheres finally transform into hollow core/shell hematite microspheres in air through a multistep process including the oxidation and sulfation of pyrite, combustion of PVP occluded in the precursor, desulfation, aggregation, and fusion of nanosized hematite as well as mass transportation from the interior to the exterior of the microspheres. The formation of the hollow core/shell microspheres dominantly depends on the calcination temperature under current experimental conditions, and the aggregation of hematite nanocrystals and the core shrinking during the oxidation of pyrite are responsible for the formation of the hollow structures. Moreover, the adsorption ability of the hematite for Sm(III) was also tested. The results exhibit that the hematite microspheres have good adsorption activity for trivalent samarium, and that its adsorption capacity strongly depends on the pH of the solution, and the maximum adsorption capacity for Sm(III) is 14.48 mg/g at neutral pH. As samarium is a typical member of the lanthanide series, our results suggest that the hollow hematite microspheres have potential application in removal of rare earth elements (REEs) entering the water environment.

  4. The influence of the technological parameters on the ionic conductivity of samarium doped ceria thin films

    Directory of Open Access Journals (Sweden)

    Mantas Sriubas

    2015-03-01

    Full Text Available Sm0,20Ce0,80O2 powder was used for the formation of samarium doped cerium oxide (SDC thin films using e-beam. Surface area of powder was 34.9 m2/g and particle size – 0.3-0.5 μm. Thin films were deposited using physical vapor deposition system on SiO2 and Alloy 600 substrates. 2 Å/s – 16 Å/s growth rate and 20 °C – 600 °C substrate temperature were used during the deposition. Ionic conductivity investigation revealed that the maximum ionic conductivity (1.67 S/m has the thin film deposited on 300 °C temperature substrate using 4 Å/s growth rate. Minimum ionic conductivity (0.26 S/m has thin film which was deposited on 20 °C temperature substrate using 8 Å/s growth rate. Vacancy activation energies vary in 0.87 eV – 0.97 eV range. Furthermore the calculations of crystallite size revealed that crystallite size increases with increasing substrate temperature: from 7.50 nm to 46.23 nm on SiO2 substrate and from 9.30 nm to 44.62 nm on Alloy 600 substrate. Molar concentration of samarium in initial evaporated material is 19.38 mol% and varies from 11.37 mol% to 21 mol% in formed thin films depending on technological parameters.DOI: http://dx.doi.org/10.5755/j01.ms.21.1.5700

  5. Formation of Core-Shell Nanoparticles Composed of Magnetite and Samarium Oxide in Magnetospirillum magneticum Strain RSS-1.

    Science.gov (United States)

    Shimoshige, Hirokazu; Nakajima, Yoshikata; Kobayashi, Hideki; Yanagisawa, Keiichi; Nagaoka, Yutaka; Shimamura, Shigeru; Mizuki, Toru; Inoue, Akira; Maekawa, Toru

    2017-01-01

    Magnetotactic bacteria (MTB) synthesize magnetosomes composed of membrane-enveloped magnetite (Fe3O4) or greigite (Fe3S4) particles in the cells. Recently, several studies have shown some possibilities of controlling the biomineralization process and altering the magnetic properties of magnetosomes by adding some transition metals to the culture media under various environmental conditions. Here, we successfully grow Magnetospirillum magneticum strain RSS-1, which are isolated from a freshwater environment, and find that synthesis of magnetosomes are encouraged in RSS-1 in the presence of samarium and that each core magnetic crystal composed of magnetite is covered with a thin layer of samarium oxide (Sm2O3). The present results show some possibilities of magnetic recovery of transition metals and synthesis of some novel structures composed of magnetic particles and transition metals utilizing MTB.

  6. Co-reduction of aluminium and lanthanide ions in molten fluorides: Application to cerium and samarium extraction from nuclear wastes

    Energy Technology Data Exchange (ETDEWEB)

    Gibilaro, M. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France); Massot, L. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France)], E-mail: massot@chimie.ups-tlse.fr; Chamelot, P.; Taxil, P. [Laboratoire de Genie Chimique UMR 5503, Departement Procedes Electrochimiques, Universite de Toulouse, 31062 Toulouse Cedex 9 (France)

    2009-09-01

    This work concerns the method of co-reduction process with aluminium ions in LiF-CaF{sub 2} medium (79-21 mol.%) on tungsten electrode for cerium and samarium extraction. Electrochemical techniques such as cyclic and square wave voltammetries, and potentiostatic electrolyses were used to study the co-reduction of CeF{sub 3} and SmF{sub 3} with AlF{sub 3}. For each of these elements, specific peaks of Al-Ce and Al-Sm alloys formation were observed by voltammetry as well as peaks of pure cerium and aluminium, and pure samarium and aluminium respectively. The difference of potential measured between the solvent reduction and the alloy formation suggests expecting an extraction efficiency of 99.99% of each lanthanide by the process. Different intermetallic compounds were obtained for different potentiostatic electrolysis and were characterised by Scanning Electron Microscopy with EDS probe. The validity of the process was verified by carrying out cerium and samarium extractions in the form of Al-Ln alloy; the extraction efficiency was 99.5% for Ce(III) and 99.4% for Sm(III)

  7. 19 CFR 144.5 - Period of warehousing.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Period of warehousing. 144.5 Section 144.5 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY... warehousing. Merchandise must not remain in a bonded warehouse beyond 5 years from the date of importation or...

  8. 40 CFR 144.4 - Considerations under Federal law.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Considerations under Federal law. 144... (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM General Provisions § 144.4 Considerations under Federal law. The following is a list of Federal laws that may apply to the issuance of permits under these rules...

  9. 33 CFR 144.01-30 - First-aid kit.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false First-aid kit. 144.01-30 Section...) OUTER CONTINENTAL SHELF ACTIVITIES LIFESAVING APPLIANCES Manned Platforms § 144.01-30 First-aid kit. On each manned platform a first-aid kit approved by the Commandant or the U.S. Bureau of Mines shall be...

  10. MicroRNA-144 inhibits hepatocellular carcinoma cell proliferation ...

    Indian Academy of Sciences (India)

    2017-01-20

    Jan 20, 2017 ... present study, the expression of miR-144 was firstly analysed in datasets derived from GSE21362 and TCGA, and then detected in HCC tissues and cell lines by quantitative RT-PCR (qRT-PCR) analysis. MiR-144 was shown to be significantly down-regulated in HCC tissues and cell lines. Subsequently ...

  11. 24 CFR 100.144 - Scope of privilege.

    Science.gov (United States)

    2010-04-01

    ... DISCRIMINATORY CONDUCT UNDER THE FAIR HOUSING ACT Discrimination in Residential Real Estate-Related Transactions... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Scope of privilege. 100.144 Section 100.144 Housing and Urban Development Regulations Relating to Housing and Urban Development OFFICE OF...

  12. 21 CFR 522.144 - Arsenamide sodium aqueous injection.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Arsenamide sodium aqueous injection. 522.144 Section 522.144 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... evidence of reduced liver function, a more conservative dosage schedule of 0.1 milliliter per pound of body...

  13. 21 CFR 133.144 - Granular and stirred curd cheese.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Granular and stirred curd cheese. 133.144 Section... (CONTINUED) FOOD FOR HUMAN CONSUMPTION CHEESES AND RELATED CHEESE PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.144 Granular and stirred curd cheese. (a) Description. (1...

  14. 14 CFR 135.144 - Portable electronic devices.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Portable electronic devices. 135.144... Equipment § 135.144 Portable electronic devices. (a) Except as provided in paragraph (b) of this section, no... portable electronic device on any of the following U.S.-registered civil aircraft operating under this part...

  15. 27 CFR 20.144 - Packages of completely denatured alcohol.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Packages of completely denatured alcohol. 20.144 Section 20.144 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS DISTRIBUTION AND USE OF DENATURED ALCOHOL AND RUM Sale...

  16. 27 CFR 9.144 - Texas High Plains.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Texas High Plains. 9.144 Section 9.144 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT... Mexico; Texas” 1954, revised 1973. (2) “Brownfield, Texas; New Mexico” 1954, revised 1973. (3) “Hobbs...

  17. 49 CFR 572.144 - Thorax assembly and test procedure.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 7 2010-10-01 2010-10-01 false Thorax assembly and test procedure. 572.144...-year-Old Child Crash Test Dummy, Alpha Version § 572.144 Thorax assembly and test procedure. (a) Thorax (upper torso) assembly (refer to § 572.140(a)(1)(iv)). The thorax consists of the upper part of the torso...

  18. 40 CFR 61.144 - Standard for manufacturing.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Standard for manufacturing. 61.144... § 61.144 Standard for manufacturing. (a) Applicability. This section applies to the following manufacturing operations using commercial asbestos. (1) The manufacture of cloth, cord, wicks, tubing, tape...

  19. 10 CFR 1.44 - Office of New Reactors.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Office of New Reactors. 1.44 Section 1.44 Energy NUCLEAR... Office of New Reactors. The Office of New Reactors— (a) Develops, promulgates and implements regulations... safeguarding of nuclear reactor facilities licensed under part 52 of this chapter prior to initial commencement...

  20. 40 CFR 52.144 - Significant deterioration of air quality.

    Science.gov (United States)

    2010-07-01

    ... quality. 52.144 Section 52.144 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... deterioration of air quality. (a) The requirements of sections 160 through 165 of the Clean Act are not met... lands does not include approvable procedures for preventing the significant deterioration of air quality...

  1. 33 CFR 144.20-5 - Exposure suits.

    Science.gov (United States)

    2010-07-01

    ... § 144.20-5 Exposure suits. This section applies to each MODU except those operating south of 32 degrees... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Exposure suits. 144.20-5 Section... MODU must carry an exposure suit for each person on board. The exposure suit must be stowed in a...

  2. Structural and luminescence properties of samarium doped lead alumino borate glasses

    Science.gov (United States)

    Mohan, Shaweta; Kaur, Simranpreet; Singh, D. P.; Kaur, Puneet

    2017-11-01

    The study reports the effect of samarium concentration on the physical, structural and spectroscopic characteristics of samarium doped lead alumino borate glasses having composition 20PbO-(10-x)Al2O3-70B2O3-xSm2O3; x = 0.1, 0.5, 1.0 and 2.0 mol %. The glasses were fabricated by conventional melt-quenching technique and then characterized by XRD, FTIR, optical absorption and fluorescence spectra. X-ray diffraction studies confirmed the amorphous nature of the prepared glasses. FTIR spectra indicate the presence of BO3, BO4, AlO6 and a few other structural groups. Various physical properties such as density, molar volume, refractive index, rare earth ion concentration, boron-boron distance and polarizability etc. were determined using conventional methods and standard formulae. The Judd-Ofelt theory was applied on the optical absorption spectra of the glasses to evaluate the three phenomenological intensity parameters Ω2, Ω4 and Ω6. The value of Ω2 was found to be highest for glass with 1 mol% Sm2O3 and attributed to the asymmetry of the ligand field at the rare earth ion site and the rare earth oxygen (Sm-O) covalency. The calculated intensity parameters and fluorescence spectra were further used to predict the radiative transition probability (A), radiative lifetime (τR), branching ratio (βR), peak wavelength (λp), effective line widths (Δλeff) and stimulated emission cross-section (σ) for the characteristic 4G5/2 → 6H5/2, 6H7/2 and 6H9/2 transitions of the Sm3+ ion. Concentration quenching was observed for 2 mol% concentration of Sm2O3 and ascribed to energy transfer through various cross-relaxation channels between Sm3+ ions. Reasonably high values of branching ratios and stimulated emission cross-section for the prepared glasses points towards their utility in the development of visible lasers emitting in the reddish-orange spectral region. However, the glass with 1 mol% Sm2O3 was found to show better radiative properties.

  3. 144 Sanchita Hati and Dipankar Datta

    Indian Academy of Sciences (India)

    Lit is a hard (h) acid, Cs" a soft (s) acid, F a hard base and I a soft base. Li+ i + Cst F = Lit F + Cs"I AH = - 12.1 kcal mol. (1) h S S h h h s is. As indicated by the AH value, reaction (1) proceeds in a direction where h binds hand s binds s, in conformity with the HSAB principle. This principle can be said to be the first step ...

  4. X-ray Induced Luminescence Spectroscopy of Samarium Doped Barium Sulfate Prepared by Sintering Method

    Science.gov (United States)

    Kumeda, T.; Maeda, K.; Shirano, Y.; Fujiwara, K.; Sakai, K.; Ikari, T.

    2015-06-01

    X-ray induced luminescence (XL) properties of phosphor materials made of samarium doped barium sulfate have been investigated. The samples were prepared by sintering method heated at 900-1250 °C for 3 hours in air from the mixture of BaSO4 and Sm2O3. The concentration of Sm were prepared from 0.01-6 at.%. In as-prepared sample, the Sm3+ was detected by photoluminescence (PL). The PL intensity is maximum about 2 at.% with Sm, and then starts decreasing. The PL intensity showed concentration quenching. The XL observed Sm2+ and Sm3+ ions. The XL was shown from the sample sintered up to 1200 °C. The XL intensity increased with Sm concentration up to 1 at.%. The intensity was almost constant larger than 1 at.% Sm. These concentration dependences is different since the X-ray energy absorbed to the host material at once, and the energy transferred to both Sm3+ and Sm2+ ions. Sm doped BaSO4 is found a host for XL phosphor materials.

  5. High-κ Samarium-Based Metal-Organic Framework for Gate Dielectric Applications.

    Science.gov (United States)

    Pathak, Abhishek; Chiou, Guan Ru; Gade, Narsinga Rao; Usman, Muhammad; Mendiratta, Shruti; Luo, Tzuoo-Tsair; Tseng, Tien Wen; Chen, Jenq-Wei; Chen, Fu-Rong; Chen, Kuei-Hsien; Chen, Li-Chyong; Lu, Kuang-Lieh

    2017-07-05

    The self-assembly of a samarium-based metal-organic framework [Sm2(bhc)(H2O)6]n (1) in good yield was achieved by reacting Sm(NO3)3·6H2O with benzenehexacarboxylic acid (bhc) in a mixture of H2O-EtOH under hydrothermal conditions. A structural analysis showed that compound 1 crystallized in a space group of Pnmn and adopted a 3D structure with (4,8) connected nets. Temperature dependent dielectric measurements showed that compound 1 behaves as a high dielectric material with a high dielectric constant (κ = 45.1) at 5 kHz and 310 K, which is comparable to the values for some of the most commonly available dielectric inorganic metal oxides such as Sm2O3, Ta2O5, HfO2, and ZrO2. In addition, electrical measurements of 1 revealed an electrical conductivity of about 2.15 × 10-7 S/cm at a frequency of 5 kHz with a low leakage current (Ileakage = 8.13 × 10-12 Amm-2). Dielectric investigations of the Sm-based MOF provide an effective path for the development of high dielectric materials in the future.

  6. Characterization of luminescent samarium doped HfO{sub 2} coatings synthesized by spray pyrolysis technique

    Energy Technology Data Exchange (ETDEWEB)

    Chacon-Roa, C [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Guzman-Mendoza, J [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Aguilar-Frutis, M [Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada-IPN, Legaria 694, Col. Irrigacion, C.P. 11500, Mexico D.F. (Mexico); Garcia-Hipolito, M [Departamento de Materiales Metalicos y Ceramicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autonoma de Mexico, A.P. 70-360 Coyoacan 04510, Mexico, D.F. (Mexico); Alvarez-Fragoso, O [Departamento de Materiales Metalicos y Ceramicos, Instituto de Investigaciones en Materiales, Universidad Nacional Autonoma de Mexico, A.P. 70-360 Coyoacan 04510, Mexico, D.F. (Mexico); Falcony, C [Departamento de Fisica, CINVESTAV-IPN, A. P. 14-740, 07000 Mexico D.F. (Mexico)

    2008-01-07

    Trivalent samarium (Sm{sup 3+}) doped hafnium oxide (HfO{sub 2}) films were deposited using the spray pyrolysis deposition technique. The films were deposited on Corning glass substrates at temperatures ranging from 300 to 550 deg. C using chlorides as raw materials. Films, mostly amorphous, were obtained when deposition temperatures were below 350 deg. C. However, for temperatures higher than 400 deg. C, the films became polycrystalline, presenting the HfO{sub 2} monoclinic phase. Scanning electron microscopy of the films revealed a rough surface morphology with spherical particles. Also, electron energy dispersive analysis was performed on these films. The photoluminescence and cathodoluminescence characteristics of the HfO{sub 2} : SmCl{sub 3} films, measured at room temperature, exhibited four main bands centred at 570, 610, 652 and 716 nm, which are due to the well-known intra-4f transitions of the Sm{sup 3+} ion. It was found that the overall emission intensity rose as the deposition temperature was increased. Furthermore, a concentration quenching of the luminescence intensity was also observed.

  7. Samarium-153 EDTMP for metastatic bone pain palliation: the impact of europium impurities.

    Science.gov (United States)

    Kalef-Ezra, J A; Valakis, S T; Pallada, S

    2015-02-01

    To evaluate the impact on the radiation protection policies of the radiocontaminants in Samarium-153 ethylenediamine tetramethylene phosphonate ((153)Sm-EDTMP). The internal contamination of patients treated with (153)Sm-EDMTP for palliation of painful disseminated multiple bone metastases due to long-lived impurities was assessed by direct measurements. These measurements were coupled with dose-rate measurements close to their bodies and spectroscopic analysis of the residual activity in post-treatment radiopharmaceutical vials. Whole-body counting carried out in six patients showed a 30-81-kBq europium -152 plus europium-154 contamination. The 0.85 mean (152)Eu- to -(154)Eu activity ratio obtained by direct counting was similar to that assessed by analysis of post-treatment residual activities in twelve radiopharmaceutical vials following radiopharmaceutical injection. The long-lived radiocontaminants in the patient's bodies and the treatment wastes require modifications of the applicable radiation protection policies. Copyright © 2014 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  8. Luminescence of trivalent samarium ions in silver and tin co-doped aluminophosphate glass

    Science.gov (United States)

    Jiménez, José A.; Lysenko, Sergiy; Liu, Huimin; Sendova, Mariana

    2011-06-01

    This work presents the spectroscopic properties of trivalent samarium ions in a melt-quenched aluminophosphate glass containing silver and tin. Addition of 4 mol% of each Ag 2O and SnO into the glass system with 2 mol% Sm 2O 3 results in Sm 3+ ions luminescence under non-resonant UV excitation owing to energy transfer from single silver ions and/or twofold-coordinated Sn centers. Assessment of luminescence spectra and decay dynamics suggest the energy transfer mechanism to be essentially of the resonant radiative type. Moreover, a connection between the luminescent and structural properties of the rare-earth doped glass system was demonstrated. Raman spectroscopy characterization revealed that no significant variation in the glass matrix is induced by Sm 3+ doping at the concentration employed. A comparison was made with a structural study performed on the Eu 3+ doped system (containing 2 mol% Eu 2O 3 along with 4 mol% of each Ag 2O and SnO) where the radiative energy transfer mechanism was previously established. The data appears consistent regarding the lack of variation in glass structure upon the Eu 3+ and Sm 3+ doping in connection with the dominance of the radiative transfer in the matrix. Thermal treatment of the material leads to precipitation of Ag nanoparticles of a broad size range inside the dielectric as observed by transmission electron microspcopy. Assessment of 4G 5/2 excited state decay in Sm 3+ ions shows no influence from the silver particles.

  9. Samarium (III) adsorption on bentonite modified with N-(2-hydroxyethyl) ethylenediamine.

    Science.gov (United States)

    Li, Dandan; Chang, Xijun; Hu, Zheng; Wang, Qihui; Li, Ruijun; Chai, Xiaoli

    2011-02-15

    A new material has been synthesized using dry process to activate bentonite followed by N-(2-hydroxyethyl) ethylenediamine connecting chlorosilane coupling agent. The synthesized new material was characterized by elemental analysis, FT-IR and thermogravimetry which proved that bentonite was successfully modified. The most interesting trait of the new material was its selective adsorption for rare earth elements. A variety of conditions of the new material were investigated for adsorption. The optimal conditions were determined with respect to pH and shaking time. Samarium (Sm) was quantitatively adsorbed at pH 4 and shaking time of 2 min onto the new material. Under these conditions the maximum static adsorption capacity of Sm(III) was found to be 17.7 mg g(-1). The adsorbed Sm(III) ion were quantitatively eluted by 2.0 mL 0.1 mol L(-1) HCl and 5% CS (NH(2))(2) solution. According to IUPAC definition, the detection limit (3σ) of this method was 0.60 ng mL(-1). The relative standard deviation (RSD) under optimum conditions was less than 3% (n=8). The new material also was applied for the preconcentration of trace Sm(III) in environmental samples with satisfactory results. Copyright © 2010 Elsevier B.V. All rights reserved.

  10. Phenotype abnormality: 144 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 144 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u650i decreased efficiency... in organ named chloroplast during process named chloroplast fission ... decreased efficiency ...

  11. 7 CFR 58.144 - Pasteurization or ultra-pasteurization.

    Science.gov (United States)

    2010-01-01

    ... 58.144 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) REGULATIONS AND STANDARDS UNDER THE AGRICULTURAL MARKETING ACT OF 1946 AND THE EGG PRODUCTS INSPECTION ACT...

  12. Fabrication of catalytically active nanocrystalline samarium (Sm)-doped cerium oxide (CeO2) thin films using electron beam evaporation

    Science.gov (United States)

    Kundu, Subrata; Sutradhar, Narottam; Thangamuthu, R.; Subramanian, B.; Panda, Asit Baran; Jayachandran, M.

    2012-08-01

    Samarium (Sm)-doped cerium oxide (CeO2) thin films were fabricated using electron beam evaporation technique. The synthesized films were deposited either on glass or ITO substrates and studied their nature by annealing at different temperatures. The optical properties and other morphological studies were done by UV-Vis, XRD, XPS, SEM, EDS, and FT-IR analysis. XRD and XPS analysis clearly confirm the presence of Sm in the ceria site. From the SEM study, it was found that after annealing at high temperature ( 300 or 500 °C), the particles size was reduced due to breakdown of large aggregates of particles which is also confirmed from UV-Vis, XPS, and XRD analyses. The FT-IR study proves the presence of -COO-, -OH, or ammonium group on the particles surface. The deposition of Sm-doped CeO2 nanomaterials was found more feasible on ITO substrate compared to that of glass substrate in terms of stability and depth of film thickness. The Sm-doped CeO2 nanomaterial acts as a re-usable catalyst for the reduction of organic dye molecules in the presence of NaBH4. The catalysis rate was compared by considering the electron transfer process during the reduction. The synthesized Sm-doped CeO2 thin films might find wide variety of applications in various emerging fields like solid oxide fuel cells (SOFCs), oxygen sensor or as catalyst in different types of organic and inorganic catalytic reactions. The fabrication process is very simple, straightforward, less time consuming, and cost effective.

  13. Fabrication of catalytically active nanocrystalline samarium (Sm)-doped cerium oxide (CeO{sub 2}) thin films using electron beam evaporation

    Energy Technology Data Exchange (ETDEWEB)

    Kundu, Subrata, E-mail: skundu@cecri.res.in [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India); Sutradhar, Narottam [G. B. Marg, Central Salt and Marine Chemical Research Institute - CSIR (India); Thangamuthu, R.; Subramanian, B. [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India); Panda, Asit Baran [G. B. Marg, Central Salt and Marine Chemical Research Institute (CSIR) (India); Jayachandran, M., E-mail: mjayam54@yahoo.com [Council of Scientific and Industrial Research (CSIR), Electrochemical Materials Science (ECMS) Division, Central Electrochemical Research Institute - CECRI (India)

    2012-08-15

    Samarium (Sm)-doped cerium oxide (CeO{sub 2}) thin films were fabricated using electron beam evaporation technique. The synthesized films were deposited either on glass or ITO substrates and studied their nature by annealing at different temperatures. The optical properties and other morphological studies were done by UV-Vis, XRD, XPS, SEM, EDS, and FT-IR analysis. XRD and XPS analysis clearly confirm the presence of Sm in the ceria site. From the SEM study, it was found that after annealing at high temperature ({approx}300 or 500 Degree-Sign C), the particles size was reduced due to breakdown of large aggregates of particles which is also confirmed from UV-Vis, XPS, and XRD analyses. The FT-IR study proves the presence of -COO-, -OH, or ammonium group on the particles surface. The deposition of Sm-doped CeO{sub 2} nanomaterials was found more feasible on ITO substrate compared to that of glass substrate in terms of stability and depth of film thickness. The Sm-doped CeO{sub 2} nanomaterial acts as a re-usable catalyst for the reduction of organic dye molecules in the presence of NaBH{sub 4}. The catalysis rate was compared by considering the electron transfer process during the reduction. The synthesized Sm-doped CeO{sub 2} thin films might find wide variety of applications in various emerging fields like solid oxide fuel cells (SOFCs), oxygen sensor or as catalyst in different types of organic and inorganic catalytic reactions. The fabrication process is very simple, straightforward, less time consuming, and cost effective.Graphical Abstract.

  14. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Mandiwana, Vusani, E-mail: VMandiwana@csir.co.za; Kalombo, Lonji, E-mail: LKalombo@csir.co.za [Centre of Polymers and Composites, CSIR (South Africa); Venter, Kobus, E-mail: Kobus.Venter@mrc.ac.za [South African Medical Research Council (South Africa); Sathekge, Mike, E-mail: Mike.Sathekge@up.ac.za [University of Pretoria and Steve Biko Academic Hospital, Department of Nuclear Medicine (South Africa); Grobler, Anne, E-mail: Anne.Grobler@nwu.ac.za; Zeevaart, Jan Rijn, E-mail: zeevaart@necsa.co.za [North-West University, DST/NWU Preclinical Drug Development Platform (South Africa)

    2015-09-15

    Developing nanoparticulate delivery systems that will allow easy movement and localization of a drug to the target tissue and provide more controlled release of the drug in vivo is a challenge in nanomedicine. The aim of this study was to evaluate the biodistribution of poly(d,l-lactide-co-glycolide) (PLGA) nanoparticles containing samarium-153 oxide ([{sup 153}Sm]Sm{sub 2}O{sub 3}) in vivo to prove that orally administered nanoparticles alter the biodistribution of a drug. These were then activated in a nuclear reactor to produce radioactive {sup 153}Sm-loaded-PLGA nanoparticles. The nanoparticles were characterized for size, zeta potential, and morphology. The nanoparticles were orally and intravenously (IV) administered to rats in order to trace their uptake through imaging and biodistribution studies. The {sup 153}Sm-loaded-PLGA nanoparticles had an average size of 281 ± 6.3 nm and a PDI average of 0.22. The zeta potential ranged between 5 and 20 mV. The [{sup 153}Sm]Sm{sub 2}O{sub 3} loaded PLGA nanoparticles, orally administered were distributed to most organs at low levels, indicating that there was absorption of nanoparticles. While the IV injected [{sup 153}Sm]Sm{sub 2}O{sub 3}-loaded PLGA nanoparticles exhibited the highest localization of nanoparticles in the spleen (8.63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems would be suitable for improving permeability and thus the bioavailability of therapeutic compounds.

  15. Samarium oxide as a radiotracer to evaluate the in vivo biodistribution of PLGA nanoparticles

    Science.gov (United States)

    Mandiwana, Vusani; Kalombo, Lonji; Venter, Kobus; Sathekge, Mike; Grobler, Anne; Zeevaart, Jan Rijn

    2015-09-01

    Developing nanoparticulate delivery systems that will allow easy movement and localization of a drug to the target tissue and provide more controlled release of the drug in vivo is a challenge in nanomedicine. The aim of this study was to evaluate the biodistribution of poly( d, l-lactide- co-glycolide) (PLGA) nanoparticles containing samarium-153 oxide ([153Sm]Sm2O3) in vivo to prove that orally administered nanoparticles alter the biodistribution of a drug. These were then activated in a nuclear reactor to produce radioactive 153Sm-loaded-PLGA nanoparticles. The nanoparticles were characterized for size, zeta potential, and morphology. The nanoparticles were orally and intravenously (IV) administered to rats in order to trace their uptake through imaging and biodistribution studies. The 153Sm-loaded-PLGA nanoparticles had an average size of 281 ± 6.3 nm and a PDI average of 0.22. The zeta potential ranged between 5 and 20 mV. The [153Sm]Sm2O3 loaded PLGA nanoparticles, orally administered were distributed to most organs at low levels, indicating that there was absorption of nanoparticles. While the IV injected [153Sm]Sm2O3-loaded PLGA nanoparticles exhibited the highest localization of nanoparticles in the spleen (8.63 %ID/g) and liver (3.07 %ID/g), confirming that nanoparticles are rapidly removed from the blood by the RES, leading to rapid uptake in the liver and spleen. From the biodistribution data obtained, it is clear that polymeric nanoscale delivery systems would be suitable for improving permeability and thus the bioavailability of therapeutic compounds.

  16. Fabrication and properties of samarium doped calcium sulphate thin films using spray pyrolysis technique

    Energy Technology Data Exchange (ETDEWEB)

    Reghima, Meriem [Université Tunis El Manar, Faculté des Sciences de Tunis, Département de Physique, LR99ES13 Laboratoire de Physique de la Matière Condensée (LPMC), 2092 Tunis, Tunisie (Tunisia); Institut d' Electronique et des systèmes, Unité Mixte de Recherche 5214 UM2-CNRS (ST2i) – Université Montpellier, 860 rue de Saint Priest, Bâtiment 5, 34097 Montpellier (France); Faculté des Sciences de Bizerte, Université de Carthage, Zarzouna 7021 (Tunisia); Guasch, Cathy [Institut d' Electronique et des systèmes, Unité Mixte de Recherche 5214 UM2-CNRS (ST2i) – Université Montpellier, 860 rue de Saint Priest, Bâtiment 5, 34097 Montpellier (France); Azzaza, Sonia; Alleg, Safia [Laboratoire de Magnétisme et Spectroscopie des Solides (LM2S), Département de Physique, Faculté des Sciences, Université Badji Mokhtar Annaba, B.P. 12, 23000 Annaba (Algeria); Kamoun-Turki, Najoua [Université Tunis El Manar, Faculté des Sciences de Tunis, Département de Physique, LR99ES13 Laboratoire de Physique de la Matière Condensée (LPMC), 2092 Tunis, Tunisie (Tunisia)

    2016-10-01

    Using low cost spray pyrolysis technique, polycrystalline CaSO{sub 4} thin films were successfully grown on a glass substrate with a thickness of about 1 μm. Samarium doping has been performed on CaSO{sub 4} thin films to explore luminescence properties. The characterizations of these films were carried out using X-ray diffraction, Scanning Electron Microscopy and optical measurements. The structural analyses reveal the existence of hexagonal CaSO{sub 4} phase with a (200) preferred orientation belonging to CaS compound for substrate temperatures below 350 °C. It is shown that the crystallinity of the sprayed thin films can be improved by increasing substrate temperature up to 250 °C. Warren-Averbach analysis has been applied on X-ray diffractogram to determine structural parameters involving the phase with its amount, the grain size and the lattice parameters using Maud software. The surface topography shows a rough surface covered by densely packed agglomerated clusters having faceted and hexagonal shapes. Energy dispersive microscopy measurements confirm the presence of calcium and sulfur in equal proportions as well as high percentage of oxygen. Photoluminescence at room temperature revealed that luminescence peaks are attributed to the intrinsic emission of pure CaSO{sub 4} phase. - Highlights: • Warren Averbach analysis reveal the presence of hcp structure of CaSO{sub 4} phase. • A mixture of CaSO{sub 4} and CaHO{sub 4.5}S phases has been detected for lower T{sub s}. • For increasing T{sub s}, the CaHO{sub 4.5}S phase has been disappeared. • The origin of PL peaks has been identified.

  17. Au99(SPh)42 nanomolecules: aromatic thiolate ligand induced conversion of Au144(SCH2CH2Ph)60.

    Science.gov (United States)

    Nimmala, Praneeth Reddy; Dass, Amala

    2014-12-10

    A new aromatic thiolate protected gold nanomolecule Au99(SPh)42 has been synthesized by reacting the highly stable Au144(SCH2CH2Ph)60 with thiophenol, HSPh. The ubiquitous Au144(SR)60 is known for its high stability even at elevated temperature and in the presence of excess thiol. This report demonstrates for the first time the reactivity of the Au144(SCH2CH2Ph)60 with thiophenol to form a different 99-Au atom species. The resulting Au99(SPh)42 compound, however, is unreactive and highly stable in the presence of excess aromatic thiol. The molecular formula of the title compound is determined by high resolution electrospray mass spectrometry (ESI-MS) and confirmed by the preparation of the 99-atom nanomolecule using two ligands, namely, Au99(SPh)42 and Au99(SPh-OMe)42. This mass spectrometry study is an unprecedented advance in nanoparticle reaction monitoring, in studying the 144-atom to 99-atom size evolution at such high m/z (∼12k) and resolution. The optical and electrochemical properties of Au99(SPh)42 are reported. Other substituents on the phenyl group, HS-Ph-X, where X = -F, -CH3, -OCH3, also show the Au144 to Au99 core size conversion, suggesting minimal electronic effects for these substituents. Control experiments were conducted by reacting Au144(SCH2CH2Ph)60 with HS-(CH2)n-Ph (where n = 1 and 2), bulky ligands like adamantanethiol and cyclohexanethiol. It was observed that conversion of Au144 to Au99 occurs only when the phenyl group is directly attached to the thiol, suggesting that the formation of a 99-atom species is largely influenced by aromaticity of the ligand and less so on the bulkiness of the ligand.

  18. Optical properties and electronic transitions of zinc oxide, ferric oxide, cerium oxide, and samarium oxide in the ultraviolet and extreme ultraviolet

    DEFF Research Database (Denmark)

    Pauly, N; Yubero, F; Espinós, J P

    2017-01-01

    Optical properties and electronic transitions of four oxides, namely zinc oxide, ferric oxide, cerium oxide, and samarium oxide, are determined in the ultraviolet and extreme ultraviolet by reflection electron energy loss spectroscopy using primary electron energies in the range 0.3-2.0 keV. This...

  19. Optical response and magnetic characteristic of samarium doped zinc phosphate glasses containing nickel nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Azmi, Siti Amlah M.; Sahar, M.R., E-mail: mrahim057@gmail.com

    2015-11-01

    A magnetic glass of composition 40ZnO–(58−x) P{sub 2}O{sub 5}–1Sm{sub 2}O{sub 3}–xNiO, with x=0.0, 1.0, 1.5 and 2.0 mol% is prepared by melt-quenching technique. The glass is characterized by X-ray diffraction, high-resolution transmission electron microscope (HRTEM), photoluminescence (PL) spectroscopy and vibrating sample magnetometer (VSM) analysis. The X-rays diffraction confirms the amorphous nature of the glass while the HRTEM analysis reveals the presence of nickel nanoparticles in the glass samples. High-resolution TEM reveals that the lattice spacing of nickel nanoparticles is 0.35 nm at (100) plane. Photoluminescence emission shows the existence of four peaks that correspond to the transition from the upper level of {sup 4}G{sub 5/2} to the lower level of {sup 6}H{sub 5/2}, {sup 6}H{sub 7/2}, {sup 6}H{sub 9/2,} and {sup 6}H{sub 11/2.} It is observed that all peaks experience significant quenching effect with the increasing concentration of nickel nanoparticles, suggesting a strong energy transfer from excited samarium ions to the nickel ions. The glass magnetization and susceptibility at 12 kOe at room temperature are found to be in the range of (3.87±0.17×10{sup −2}–7.19±0.39×10{sup −2}) emu/g and (3.24±0.16×10{sup −6}–5.99±0.29×10{sup −6}) emu/Oe g respectively. The obtained hysteresis curve indicates that the glass samples are paramagnetic materials. The studied glass can be further used towards the development of magneto-optical functional glass. - Highlights: • Sm{sup 3+} doped zinc phosphate glass embedded with Ni NPs has been prepared. • The Laue pattern and lattice spacing of Ni NPs are confirmed by HRTEM image. • The magnetic response of glasses has been studied through VSM analysis. • Enhancement factor and decay half-lifetime are investigated.

  20. Treatment of bone pain secondary to metastases using samarium-153-EDTMP

    Directory of Open Access Journals (Sweden)

    Elba Cristina Sá de Camargo Etchebehere

    Full Text Available CONTEXT: More than 50% of patients with prostate, breast or lung cancer will develop painful bone metastases. The purpose of treating bone metastases is to relieve pain, reduce the use of steroids and to maintain motion. OBJECTIVE: To evaluate the use of samarium-153-EDTMP (153Sm-EDTMP for the treatment of bone pain secondary to metastases that is refractory to clinical management. TYPE OF STUDY: Retrospective. SETTING: Division of Nuclear Medicine, Universidade Estadual de Campinas (Unicamp. METHODS: Fifty-eight patients were studied (34 males with mean age 62 years; 31 patients had prostate cancer, 20 had breast cancer, three had lung cancer, one had lung hemangioendothelioma, one had parathyroid adenocarcinoma, one had osteosarcoma and one had an unknown primary tumor. All patients had multiple bone metastases demonstrated by bone scintigraphy using 99mTc-MDP,and were treated with 153Sm-EDTMP. Response to treatment was graded as good (pain reduction of 50-100%, intermediate (25-49% and poor (0-24%. RESULTS: All patients showed good uptake of 153Sm-EDTMP by bone metastases. Among the patients with prostate cancer, intermediate or good response to therapy occurred in 80.6% (25 patients and poor response in 19.4% (6. Among the patients with breast cancer, 85% (17 showed intermediate or good response to therapy while 15% (3 showed poor response. All three patients with lung cancer showed poor response to treatment. The lung hemangioendothelioma and unknown primary lesion patients showed intermediate response to treatment; the osteosarcoma and parathyroid adenocarcinoma patients showed good response to treatment. No significant myelotoxicity occurred. DISCUSSION: Pain control is important for improving the quality of life of patients with advanced cancers. The mechanism by which pain is relieved with the use of radionuclides is still not yet completely understood, however, the treatment is simple and provides a low risk of mielotoxicity

  1. Anchoring samarium oxide nanoparticles on reduced graphene oxide for high-performance supercapacitor

    Energy Technology Data Exchange (ETDEWEB)

    Dezfuli, Amin Shiralizadeh [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Ganjali, Mohammad Reza, E-mail: ganjali@khayam.ut.ac.ir [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Biosensor Research Center, Endocrinology & Metabolism Molecular-Cellular Sciences Institute, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Naderi, Hamid Reza [Center of Excellence in Electrochemistry, Faculty of Chemistry, University of Tehran, Tehran (Iran, Islamic Republic of)

    2017-04-30

    Highlights: • Samarium oxide nanoparticles have been anchored on the surface of reduced graphene oxide for the first time. • Sm{sub 2}O{sub 3}/RGO nanocomposite show high capacitance, good rate and cycling performance. • Sm{sub 2}O{sub 3}/RGO nanocomposite can serve as efficient electrode material for energy storage. • The best composite electrode exhibits specific capacitance of 321 F g{sup −1} in 2 mV s{sup −1}. - Abstract: We have synthesized Sm{sub 2}O{sub 3} nanoparticles (SmNs) and anchored them onto the surface of reduced graphene oxide (RGO) through a self-assembly thereof by utilizing a facile sonochemical procedure. The nanomaterials were characterized by means of powder X-ray diffraction (XRD), Field-emission scanning electron microscopy (FE-SEM), fourier transform infrared spectroscopy (FT-IR) spectra, and X-ray photoelectron spectroscopy (XPS). As the next step, the supercapacitive behavior of the resulting nanocomposites were investigated when used as electrode material, through with cyclic voltammetric (CV), galvanostatic charge-discharge and electrochemical impedance spectroscopy (EIS) techniques. The SmNs decorated RGO (SmN-RGO) nanocomposites were found to possess a specific capacitance (SC) of 321 F g{sup −1} when used in a 0.5 M Na{sub 2}SO{sub 4} solution as an electrolyte, in a scan rate of 2 mV s{sup −1}. The SC of the SmN-RGO based electrodes were also found to be 268 F g{sup −1} at a current density of 2 A g{sup −1} through galvanostatic charge-discharge tests. The outstanding properties of the SmN-RGOs were attributed to synergy of the high charge mobility of SmNs and the flexibility of the sheets of RGOs. Additionally, the nano-composite revealed a unique cycling durability (maintaining 99% of its SC even after 4000 cycles).

  2. 42 CFR 410.144 - Quality standards for deemed entities.

    Science.gov (United States)

    2010-10-01

    ... of continuing diabetes education concerning educational principles and behavior change strategies... dental care. (ix) Behavior change strategies, goal setting, risk factor reduction, and problem solving...-Management Training and Diabetes Outcome Measurements § 410.144 Quality standards for deemed entities. An...

  3. 40 CFR 144.11 - Prohibition of unauthorized injection.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Prohibition of unauthorized injection... PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM General Program Requirements § 144.11 Prohibition of unauthorized injection. Any underground injection, except into a well authorized by rule or...

  4. 40 CFR 144.5 - Confidentiality of information.

    Science.gov (United States)

    2010-07-01

    ... Section 144.5 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS... submissions, by stamping the words “confidential business information” on each page containing such... which deals with the existence, absence, or level of contaminants in drinking water. ...

  5. 19 CFR 144.37 - Withdrawal for exportation.

    Science.gov (United States)

    2010-04-01

    ... provided for by law. In any case, the port director may require a special report of weight, gauge, or... not applicable with respect to purchasers at airport duty-free enterprises; and (vi) A statement on... file. Editorial Note: For Federal Register citations affecting § 144.37, see the List of CFR Sections...

  6. 33 CFR 144.10-1 - Lifesaving equipment.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Lifesaving equipment. 144.10-1... equipment. (a) Except as allowed in paragraph (b) of this section, no person may be on an unmanned platform unless the following lifesaving equipment is readily accessible on the platform: (1) A life preserver or...

  7. 22 CFR 144.150 - Program accessibility: Existing facilities.

    Science.gov (United States)

    2010-04-01

    ... of achieving program accessibility include— (i) Using audio-visual materials and devices to depict... action that it can demonstrate would result in a fundamental alteration in the nature of a program or... § 144.150(a) would result in such alteration or burdens. The decision that compliance would result in...

  8. Effect of Current Density on Thermodynamic Properties of Nanocrystalline Palladium Capped Samarium Hydride Thin Film Switchable Mirrors

    Directory of Open Access Journals (Sweden)

    Pushpendra Kumar

    2007-01-01

    Full Text Available A 55 nm samarium film capped with a 10 nm palladium overlayer switched from a metallic reflecting to a semiconducting, transparent in visible state during ex-situ hydrogen loading via electrochemical means in 1 M KOH electrolytic aqueous solution at room temperature. The switching between metal to semiconductor was accompanied by measurement of transmittance during hydrogen loading/unloading. The effect of current density on switching and thermodynamic properties was studied between dihydride state (FCC phase and trihydride state (hexagonal phase. From the plateau of partial pressure of hydrogen at x=2.6, enthalpy of formation was calculated at different current densities. The diffusion coefficients and switching kinetics are shown to depend on applied current density.

  9. Targeted bone marrow radioablation with 153Samarium-lexidronam promotes allogeneic hematopoietic chimerism and donor-specific immunologic hyporesponsiveness.

    Science.gov (United States)

    Inverardi, Luca; Linetsky, Elina; Pileggi, Antonello; Molano, R Damaris; Serafini, Aldo; Paganelli, Giovanni; Ricordi, Camillo

    2004-03-15

    Transplantation tolerance, defined as acceptance of a graft by an otherwise fully immunocompetent host, has been an elusive goal. Although robust tolerance has been achieved by the induction of stable hematopoietic chimerism after bone marrow transplantation, lethal or sublethal radiation conditioning used to induce long-term chimerism precludes its clinical use. We studied whether targeted delivery of radiation to bone marrow could allow for bone marrow cell (BMC) engraftment, chimerism, and donor-specific tolerance in the absence of the side effects associated with external irradiation. We administered a radioactive bone-seeking compound (Samarium-Lexidronam, Quadramet, Berlex Laboratories, Wayne, NJ) together with transient T-cell costimulatory blockade to recipient mice. Allogeneic BMCs were given 7 or 14 days after preconditioning. Costimulatory blockade was obtained by the use of an anti-CD154 antibody for 4 weeks. Chimerism was assessed by flow cytometry. Mice then received donor-specific and third-party skin grafts. Graft survival was analyzed with mechanisms of donor-specific hyporesponsiveness. High levels of stable chimerism across an allogeneic barrier were achieved in mice by a single administration of Samarium-Lexidronam, transient T-cell costimulatory blockade, and BMC transplantation. A large percentage of chimeric animals retained donor-derived skin grafts for more than 120 days without requiring additional immunosuppression, suggesting that harsh cytotoxic preconditioning is not necessary to achieve stable chimerism and donor specific hyporesponsiveness. Analysis of the T-cell repertoire in chimeras indicates T-cell deletional mechanisms. These data broaden the potential use of BMC transplantation for tolerance induction and argue for its potential in treating autoimmune diseases.

  10. Sorption of samarium in soils: influence of soil properties and Sm concentration

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez-Guinart, Oriol; Salaberria, Aitor; Rigol, Anna; Vidal, Miquel [Analytical Chemistry department, Faculty of Chemistry, University of Barcelona, Marti i Franques 1-11, 08028, Barcelona (Spain)

    2014-07-01

    Due to the fact that barriers of Deep Geological Repositories (DGR) may lose efficiency before the radioisotopes present in the High Level Radioactive Waste (HLRW) completely decay, it is possible that, in the long-term, radioactive leachates may escape from the DGR and reach the soil and water compartments in the biosphere. Therefore, it is required to examine the interaction and mobility of radionuclides present in the HLRW, or their chemical analogues, to predict the impact of their eventual incorporation in the biosphere and to assess the derived risk. Although relevant data have been recently obtained for a few radionuclides in soils, there are still some important gaps for some radionuclides, such us for samarium (Sm). Sm is a lanthanide that, besides being considered as a natural analogue of actinides, may also be present in HLRW in the form of the radioactive isotope {sup 151}Sm. The main objective of this work was to obtain sorption data (K{sub d}) of {sup 151}Sm gathered from a set of soil samples physicochemical fully-characterized (pH, texture, cationic exchange capacity, soil solution cationic composition, organic matter, carbonate and metallic oxides content, etc.). Additionally, as an alternative for testing sorption capacity of radionuclides in soils is the use of the corresponding stable isotope or a chemical analogue, the influence of Sm concentration was also checked. To evaluate {sup 151}Sm sorption, batch assays were carried out for each soil sample, which consisted in a pre-equilibration step of 2 g of each soil with 50 ml of double deionised water, and a subsequent equilibration step with the same solution, but labelled with {sup 151}Sm. The activity of {sup 151}Sm in initial and final solutions was measured by liquid scintillation and K{sub d} ({sup 151}Sm) data were calculated. The reversibly sorbed fraction was estimated by the application of a single extraction test, with double deionised water, to soil residues coming from the previous

  11. Crystal growth of semiorganic complex- samarium chloride coordinated thiourea-L-tartaric acid and its studies on structure and optical characteristics

    Science.gov (United States)

    Slathia, Goldy; Singh, Harjinder; Ramya, E.; Rao, D. Narayana; Bamzai, K. K.

    2017-05-01

    The semi-organic complex of samarium chloride coordinated thiourea-L-tartaric acid (SCTLT) has been grown as a single crystal by slow evaporation technique at room temperature. For structural studies, the grown crystal was subjected to single crystal X-ray diffraction and Fourier transform infra-red (FTIR) spectroscopy. Low cut off wavelength and transparent characteristics were explored by UV-VIS optical characterization. Third-order nonlinear optical properties of grown crystal were investigated by Z-scan technique.

  12. Sorption of samarium in iron (II) and (III) phosphates in aqueous systems; Sorcion de samario en fosfatos de hierro (II) y (III) en sistemas acuosos

    Energy Technology Data Exchange (ETDEWEB)

    Diaz F, J.C

    2006-07-01

    The radioactive residues that are stored in the radioactive confinements its need to stay isolated of the environment while the radioactivity levels be noxious. An important mechanism by which the radioactive residues can to reach the environment, it is the migration of these through the underground water. That it makes necessary the investigation of reactive materials that interacting with those radionuclides and that its are able to remove them from the watery resources. The synthesis and characterization of materials that can be useful in Environmental Chemistry are very important because its characteristics are exposed and its behavior in chemical phenomena as the sorption watery medium is necessary to use it in the environmental protection. In this work it was carried out the sorption study of the samarium III ion in the iron (II) and (III) phosphate; obtaining the sorption isotherms in function of pH, of the phosphate mass and of the concentration of the samarium ion using UV-visible spectroscopy to determine the removal percentage. The developed experiments show that as much the ferrous phosphate as the ferric phosphate present a great affinity by the samarium III, for what it use like reactive material in contention walls can be very viable because it sorption capacity has overcome 90% to pH values similar to those of the underground and also mentioning that the form to obtain these materials is very economic and simple. (Author)

  13. Trace amounts of rare earth elements in high purity samarium oxide by sector field inductively coupled plasma mass spectrometry after separation by HPLC

    Energy Technology Data Exchange (ETDEWEB)

    Pedreira, W.R. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil) and Fundacao Jorge Duprat Figueiredo de Seguranca e Medicina do Trabalho (FUNDACENTRO), 05409-002 Sao Paulo, SP (Brazil)]. E-mail: walter.pedreira@fundacentro.gov.br; Queiroz, C.A. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Abrao, A. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Rocha, S.M. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Vasconcellos, M.E. de [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), 05508-900 Sao Paulo, SP (Brazil); Boaventura, G.R. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil); Pimentel, M.M. [Instituto de Geociencias, Universidade de Brasilia (UnB), 70910-900 Brasilia, DF (Brazil)

    2006-07-20

    Today there is an increasing need for high purity rare earth compounds in various fields, the optical, the electronics, the ceramic, the nuclear and geochemistry. Samarium oxide has special uses in glass, phosphors, lasers and thermoelectric devices. Calcium chloride crystals treated with samarium have been employed in lasers, which produce light beams intense enough to burn metal. In general, the inductively coupled plasma mass spectrometry (ICP-MS) presents some advantages for trace element analysis, due to high sensitivity and resolution, when compared with other analytical techniques such as ICP optical emission spectrometry (ICP-OES). In this work, sector field inductively coupled plasma mass spectrometry was used. Sixteen elements (Sc, Y and 14 lanthanides) were determined selectively with the ICP-MS system using a concentration gradient method. The detection limits with the ICP-MS system were about 0.2 (La) pg mL{sup -1} to 8 (Gd) pg mL{sup -1}. The %R.S.D. of the methods varying between 0.9 and 1.5% for a set of five (n = 5) replicates was found for the IPEN's material and for the certificate reference sample. Determination of trace REEs in two high pure samarium oxides samples (IPEN and JMC) was performed. IPEN's material is highly pure (>99.99%) and was successfully analyzed without spectral interference (MO{sup +} and MOH{sup +})

  14. Cross sections of deuteron induced reactions on $^{nat}$Sm for production of the therapeutic radionuclide $^{145}$Sm and $^{153}$Sm

    OpenAIRE

    Tárkányi, F.; Hermanne, A.; Takács, S.; Ditrói, F.; Csikai, J.; Ignatyuk, A. V.

    2014-01-01

    At present, targeted radiotherapy (TR) is acknowledged to have great potential in oncology. A large list of interesting radionuclides is identified, including several radioisotopes of lanthanides, amongst them $^{145}$Sm and $^{153}$Sm. In this work the possibility of their production at a cyclotron was investigated using a deuteron beam and a samarium target. The excitation functions of the $^{nat}$Sm(d,x)$^{145153}$Sm reactions were determined for deuteron energies up to 50 MeV using the st...

  15. 19 CFR 144.7 - Disposition of merchandise after expiration of warehousing period.

    Science.gov (United States)

    2010-04-01

    ... warehousing period. 144.7 Section 144.7 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF... General Provisions § 144.7 Disposition of merchandise after expiration of warehousing period. Merchandise remaining in a bonded warehouse after the expiration of the warehousing period shall be disposed of in...

  16. 40 CFR 144.81 - Does this subpart apply to me?

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Does this subpart apply to me? 144.81 Section 144.81 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS... Wells § 144.81 Does this subpart apply to me? This subpart applies to you if you own or operate a Class...

  17. 40 CFR 144.85 - Do these additional requirements apply to me?

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Do these additional requirements apply to me? 144.85 Section 144.85 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... of Class V Injection Wells § 144.85 Do these additional requirements apply to me? (a) Large-Capacity...

  18. 40 CFR 144.22 - Existing Class II enhanced recovery and hydrocarbon storage wells.

    Science.gov (United States)

    2010-07-01

    ... and hydrocarbon storage wells. 144.22 Section 144.22 Protection of Environment ENVIRONMENTAL... of Underground Injection by Rule § 144.22 Existing Class II enhanced recovery and hydrocarbon storage wells. (a) An existing Class II enhanced recovery or hydrocarbon storage injection well is authorized by...

  19. 38 CFR 21.144 - Vocational course in a sheltered workshop or rehabilitation facility.

    Science.gov (United States)

    2010-07-01

    ... sheltered workshop or rehabilitation facility. 21.144 Section 21.144 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS (CONTINUED) VOCATIONAL REHABILITATION AND EDUCATION Vocational Rehabilitation and Employment Under 38 U.S.C. Chapter 31 Special Rehabilitation Services § 21.144 Vocational course...

  20. 40 CFR 144.12 - Prohibition of movement of fluid into underground sources of drinking water.

    Science.gov (United States)

    2010-07-01

    ... underground sources of drinking water. 144.12 Section 144.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM General Program Requirements § 144.12 Prohibition of movement of fluid into underground sources of drinking water...

  1. 40 CFR 144.80 - What is a Class V injection well?

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false What is a Class V injection well? 144... PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM Requirements for Owners and Operators of Class V Injection Wells § 144.80 What is a Class V injection well? As described in § 144.6, injection wells are...

  2. 25 CFR 39.144 - What is the small high school adjustment?

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false What is the small high school adjustment? 39.144 Section 39.144 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR EDUCATION THE INDIAN SCHOOL EQUALIZATION PROGRAM Indian School Equalization Formula Small School Adjustment § 39.144 What is the small high school adjustment? (a) The small high...

  3. MicroRNA-144 dysregulates the transforming growth factor-β signaling cascade and contributes to the development of bronchiolitis obliterans syndrome after human lung transplantation.

    Science.gov (United States)

    Xu, Zhongping; Ramachandran, Sabarinathan; Gunasekaran, Muthukumar; Zhou, Fangyu; Trulock, Elbert; Kreisel, Daniel; Hachem, Ramsey; Mohanakumar, Thalachallour

    2015-09-01

    Bronchiolitis obliterans syndrome (BOS), chronic lung allograft rejection, remains an impediment for the function of the transplanted organ. In this study, we defined the role of the microRNA (miRNA) miR-144 in fibroproliferation leading to BOS. Biopsy specimens were obtained from 20 lung transplant recipients with BOS((+)) and 19 without BOS((-)). Expression of miR-144 and its target, transforming growth factor-β (TGF-β)-induced factor homeobox 1(TGIF1), were analyzed by real-time polymerase chain reaction and Western blot. Overexpression of miR-144 and luciferase reporter genes were performed to elucidate miRNA-target interactions. The function of miR-144 was evaluated by transfecting fibroblasts and determining the response to TGF-β by analyzing Sma- and Mad-related family (Smads), fibroblast growth factor, TGF-β, and vascular endothelial growth factor. Smooth muscle actin-α-positive stress fibers and F-actin filaments in lung fibroblasts were analyzed by immunofluorescence. Analysis of miR-144 in the biopsy specimens demonstrated 4.1 ± 0.8-fold increases in BOS(+) compared with BOS(-) patients, with a significant reduction in TGIF1 (3.6 ± 1.2-fold), a corepressor of Smads. In vitro transfection confirmed that over-expression of miR-144 results in a reduction in TGIF1 and an increase in SMAD2, SMAD4, fibroblast growth factor-6, TGF-β, and vascular endothelial growth factor. Increasing miR-144 by transfecting, increased smooth muscle actin-α and fibronectin, and knockdown of miR-144 diminished fibrogenesis in MRC-5 fibroblasts. miR-144 is a critical regulator of the TGF-β signaling cascade and is over-expressed in lungs with BOS. Therefore, miR-144 is a potential target toward preventing fibrosis leading to BOS after lung transplant. Copyright © 2015 International Society for Heart and Lung Transplantation. Published by Elsevier Inc. All rights reserved.

  4. Effectiveness of radiation synovectomy with samarium-{sup 153} particulate hydroxyapatite in rheumatoid arthritis patients with knee synovitis: a controlled randomized double-blind trial

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Marla Francisca dos; Furtado, Rita Nely Vilar; Konai, Monique Sayuri; Natour, Jamil, E-mail: jnatour@unifesp.b [Universidade Federal de Sao Paulo (UNIFESP-EPM), Sao Paulo, SP (Brazil). Divisao de Reumatologia; Castiglioni, Mario Luiz Vieira; Marchetti, Renata Rosa [Universidade Federal de Sao Paulo (UNIFESP-EPM), Sao Paulo, SP (Brazil). Divisao de Medicina Nuclear

    2009-07-01

    Objectives: the aim of the present study was to investigate the effectiveness of Samarium{sup 153}-particulate hydroxyapatite radiation synovectomy in rheumatoid arthritis patients with chronic knee synovitis. Methods: fifty-eight rheumatoid arthritis patients (60 knees) with chronic knee synovitis participated in a controlled double-blinded trial. Patients were randomized to receive either an intra-articular injection with 40 mg triamcinolone hexacetonide alone (TH group) or 40 mg triamcinolone hexacetonide combined with 15 mCi Samarium{sup 153}-particulate hydroxyapatite (Sm/TH group). Blinded examination at baseline (T0) and at 1 (T1), 4 (T4), 12 (T12), 32 (T32), and 48 (T48) weeks post-intervention were performed on all patients and included a visual analog scale for joint pain and swelling as well as data on morning stiffness, flexion, extension, knee circumference, Likert scale of improvement, percentage of improvement, SF-36 generic quality of life questionnaire, Stanford Health Assessment Questionnaire (HAQ), Lequesne index, use of non-steroidal anti-inflammatory drugs or oral corticosteroids, events and adverse effects, calls to the physician, and hospital visits. Results: the sample was homogeneous at baseline, and there were no withdrawals. Improvement was observed in both groups in relation to T0, but no statistically significant differences between groups were observed regarding all variables at the time points studied. The Sm/TH group exhibited more adverse effects at T1 (p<0.05), but these were mild and transitory. No severe adverse effects were reported during follow-up. Conclusion: intra-articular injection of Samarium{sup 153}-particulate hydroxyapatite (15 mCi) with 40 mg of triamcinolone hexacetonide is not superior to triamcinolone hexacetonide alone for the treatment of knee synovitis in patients with rheumatoid arthritis at 1 y of follow-up. (author)

  5. Investigations of the level scheme of {sup 144}Gd and lifetimes in the quadrupole bands

    Energy Technology Data Exchange (ETDEWEB)

    Lieder, R.M.; Gast, W.; Jaeger, H.M.; Mihailescu, L. [Institut fuer Kernphysik, Forschungszentrum Juelich, D-52425, Juelich (Germany); Pasternak, A.A.; Podsvirova, E.O. [Institut fuer Kernphysik, Forschungszentrum Juelich, D-52425, Juelich (Germany); A.F. Ioffe Physical Technical Institute RAS, RU-194021, St. Petersburg (Russian Federation); Efimov, A.D. [A.F. Ioffe Physical Technical Institute RAS, RU-194021, St. Petersburg (Russian Federation); Mikhajlov, V.M. [Physical Institute, St. Petersburg State University, RU-198904, St. Petersburg (Russian Federation); Wyss, R. [Royal Institute of Technology, Physics Department Frescati, S-10405, Stockholm (Sweden); Venkova, T. [Institute of Nuclear Research and Nuclear Energy, Bulgarian Academy of Sciences, BG-1784, Sofia (Bulgaria); Bazzacco, D.; Lunardi, S.; Menegazzo, R.; Rossi Alvarez, C. [Dipartimento di Fisica dell' Universita and Istituto Nazionale di Fisica Nucleare, Sezione di Padova, I-35131, Padova (Italy); Angelis, G. de; Napoli, D.R. [Istituto Nazionale di Fisica Nucleare, Laboratori Nazionali di Legnaro, I-35020, Legnaro (Italy); Rzaca-Urban, T.; Urban, W. [Institute of Experimental Physics, University of Warsaw, PL-00-681, Warszawa (Poland); Dewald, A. [Institut fuer Kernphysik, Universitaet zu Koeln, D-50937, Koeln (Germany)

    2004-07-01

    For a level scheme investigation of {sup 144}Gd an experiment with the {gamma}-spectrometer EUROBALL III has been carried out and lifetimes have been measured with the {gamma}-spectrometer GASP using the Doppler-shift attenuation method. The high-spin states have been populated in these experiments by means of the {sup 100}Mo({sup 48}Ti,4n) reaction at 215 MeV and the {sup 114}Cd({sup 36}S,6n) reaction at E=182 MeV, respectively. The known quadrupole band has been modified and a new one has been established. Reduced E2 transition probabilities B(E2) were determined for seven members of these quadrupole bands. They show values between {approx}60 and 130 W.u. and this considerable enhancement gives evidence for a significant nuclear deformation. A ({pi}h{sub 11/2}){sup 2} x ({nu}h{sub 11/2}){sup -2} configuration may be assigned to one of the quadrupole bands according to total Routhian surface calculations. The spin dependence of the B(E2) values has been explained by IBM calculations involving high-spin quasiparticle excitations. (orig.)

  6. The properties of samarium-doped zinc oxide/phthalocyanine structure for optoelectronics prepared by pulsed laser deposition and organic molecular evaporation

    Czech Academy of Sciences Publication Activity Database

    Novotný, Michal; Marešová, Eva; Fitl, Přemysl; Vlček, Jan; Bergmann, M.; Vondráček, Martin; Yatskiv, Roman; Bulíř, Jiří; Hubík, Pavel; Hruška, Petr; Drahokoupil, Jan; Abdellaoui, N.; Vrňata, M.; Lančok, Ján

    2016-01-01

    Roč. 122, č. 3 (2016), 1-8, č. článku 225. ISSN 0947-8396 R&D Projects: GA MŠk(CZ) LG15050; GA ČR(CZ) GAP108/11/0958; GA MŠk(CZ) LM2011029; GA ČR(CZ) GA14-10279S; GA MŠk(CZ) 7AMB14FR010 Institutional support: RVO:68378271 ; RVO:67985882 Keywords : samarium-doped zinc oxide zinc/phthalocyanine deposition * evaporation * pulsed laser deposition * thin films Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.455, year: 2016

  7. ULY JUP URAP RADIO ASTRONOMY REC AVERAGE E-FIELD 144 SEC

    Data.gov (United States)

    National Aeronautics and Space Administration — C USER'S GUIDE TO RAR 144 SECOND AVERAGED DATA FILES ---------------------------------------------------- This document describes the contents and format of the RAR...

  8. Preparation and examination of properties of samarium-153-EDTMP complex; Otrzymywanie chelatu kwasu etylenodiaminotetrametylenofosfonowego (EDTMP) z samarem-153 i badanie jego wlasciwosci

    Energy Technology Data Exchange (ETDEWEB)

    Nowak, M. [Institute of Atomic Energy, Otwock-Swierk (Poland); Garnuszek, P.; Lukasiewicz, A.; Wozniak, I.; Zulczyk, W. [Osrodek Badawczo-Rozwojowy Izotopow, Otwock-Swierk (Poland); Licinska, I. [Instytut Lekow, Warsaw (Poland)

    1995-12-31

    Preparation and properties of ethylenediaminetetramethylenephosphonic acid (EDTMP) as well as some properties of {sup 153}Sm-EDTMP chelate have been examined. The chelate formed by samarium-153 (46.3 h, {beta}{sup -}-decay) with EDTMP exhibits high bone uptake and can be used for treatment of disseminated, painful skeletal metastases. The purity and stability of solutions of {sup 153}Sm-EDTMP chelate were examined in a broad range of samarium concentration and {sup 153}Sm specific activity. The complex under study was examined by radio-TLC, -electrophoresis and radio-HPLC. The results obtained suggest the small size of molecules of {sup 153}Sm-EDTMP chelate as compared with molecules of ``free``EDTMP. The results of biodistribution of {sup 153}Sm-EDTMP determined in rats indicate the quick blood clearance, high deposition of radioactivity in bone and quick excretion of radioactivity into urine. No specific uptake of {sup 153}Sm-EDTMP in extra-skeletal organs was found. (author). 42 refs, 13 figs, 22 tabs.

  9. Nanostructured Samarium Doped Fluorapatites and Their Catalytic Activity towards Synthesis of 1,2,4-Triazoles

    Directory of Open Access Journals (Sweden)

    Kranthi Kumar Gangu

    2016-09-01

    Full Text Available An investigation was conducted into the influence of the amino acids as organic modifiers in the facile synthesis of metal incorporated fluorapatites (FAp and their properties. The nanostructured Sm doped fluorapatites (Sm-FAp were prepared by a co-precipitation method using four different amino acids, namely glutamic acid, aspartic acid, glycine and histidine. The materials were characterized by various techniques including X-ray diffraction (XRD, Fourier transform infra-red spectroscopy (FT-IR, field emission scanning electron microscopy (FE-SEM, energy-dispersive X-ray spectroscopy (EDX, high resolution transmission electron microscopy (HR-TEM, N2-adsorption/desorption isotherm, temperature programmed desorption (TPD and fluorescence spectrophotometry. Under similar conditions, Sm-FAp prepared using different amino acids exhibited distinctly different morphological structures, surface area and pore properties. Their activity as catalysts was assessed and Sm-FAp/Glycine displayed excellent efficiency in the synthesis of 1,2,4-triazole catalyzing the reaction between 2-nitrobenzaldehyde and thiosemicarbazide with exceptional selectivity and 98% yield in a short time interval (10 min. The study provides an insight into the role of organic modifiers as controllers of nucleation, growth and aggregation which significantly influence the nature and activity of the catalytic sites on Sm-FAp. Sm-FAp could also have potential as photoactive material.

  10. Potential diagnostic implications of miR-144 overexpression in human oesophageal cancer

    Directory of Open Access Journals (Sweden)

    Priyanka Sharma

    2016-01-01

    Full Text Available Background & objectives: Insidious symptomatology, late clinical presentation and poor prognosis of oesophageal cancer (EC highlight the pressing need for novel non-invasive biomarkers for early tumour diagnosis and better prognosis. The present study was carried out to evaluate the clinical significance of circulating and tissue miR-144 expression in oesophageal cancer. Methods: Clinical significance of miR-144 expression was evaluated in preneoplastic (12 and neoplastic (35 oesophageal cancer tissues as well as matched distant non-malignant tissues using real-time PCR (qPCR. Circulating levels of miR-144 were also analyzed in serum samples of EC patients as well as normal individuals to determine the diagnostic potential of miR-144. Further, targets of miR-144 were predicted using bioinformatic tools and their gene ontology (GO terms were assigned. Results: Real-time PCR analysis revealed significant upregulation of miR-144 in 29 of 35 (83% EC tissues as compared to matched distant non-malignant tissues (P=0.010. a0 ll the dysplastic tissues showed upregulation of miR-144 as compared to their matched distant non-malignant tissues. Relative levels of circulating miR-144 in serum significantly distinguished EC patients from normal controls (P=0.015; AUC = 0.731 with high sensitivity of 94.7 per cent. Bioinformatically predicted target, PUR-aplha (PURA was found to be significantly (P=0.018 downregulated in 81 per cent (26/32 EC patients and its expression was found to be significantly and negatively correlated with miR-144 expression at mRNA level. Interpretation & conclusions: Our findings showed significant upregulation of miR-144 in serum samples of EC patients indicating its potential as minimally invasive marker. Further studies need to be done to understand the role of miR-144 in the pathogenesis of EC.

  11. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints

    Directory of Open Access Journals (Sweden)

    Mohammed Najeeb Al Hallak

    2009-08-01

    Full Text Available 153Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate and Samarium-153 [1]. 153Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of 153Sm-EDTMP leads to contamination with 154Eu (Europium-154 [2]. A previous study only alluded to the retention of 154Eu in the bones after receiving treatment with 153Sm-EDTMP [2]. Activation of the alarm at security checkpoints after 153Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received 153Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing theAmerican-Canadian border. We assume that the 154Eu which remained in the patients’ bones activated the sensors. Methods: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received 153Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. Results: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of 154Eu emissions. Conclusion: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of 154Eu retained in patients who received 153Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of 153Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with 153Sm-EDTMP at Roger Maris Cancer Center

  12. The Level of Europium-154 Contaminating Samarium-153-EDTMP Activates the Radiation Alarm System at the US Homeland Security Checkpoints.

    Science.gov (United States)

    Najeeb Al Hallak, Mohammed; McCurdy, Matt; Zouain, Nicolas; Hayes, Justin

    2009-08-28

    (153)Sm-EDTMP is a radiopharmaceutical composed of EDTMP (ethylenediamine-tetramethylenephosphonate) and Samarium-153 [1]. (153)Sm-EDTMP has an affinity for skeletal tissue and concentrates in areas with increased bone turnover; thus, it is successfully used in relieving pain related to diffuse bone metastases [1]. The manufacturing process of (153)Sm-EDTMP leads to contamination with (154)Eu (Europium-154) [2]. A previous study only alluded to the retention of (154)Eu in the bones after receiving treatment with (153)Sm-EDTMP [2]. Activation of the alarm at security checkpoints after (153)Sm-EDTMP therapy has not been previously reported. Two out of 15 patients who received (153)Sm-EDTMP at Roger Maris Cancer Center (Fargo, N. Dak., USA) activated the radiation activity sensors while passing through checkpoints; one at a US airport and the other while crossing the American-Canadian border. We assume that the (154)Eu which remained in the patients' bones activated the sensors. METHODS: In order to investigate this hypothesis, we obtained the consent from 3 of our 15 patients who received (153)Sm-EDTMP within the previous 4 months to 2 years, including the patient who had activated the radiation alarm at the airport. The patients were scanned with a handheld detector and a gamma camera for energies from 511 keV to 1.3 MeV. RESULTS: All three patients exhibited identical spectral images, and further analysis showed that the observed spectra are the result of (154)Eu emissions. CONCLUSION: Depending on the detection thresholds and windows used by local and federal authorities, the remaining activity of (154)Eu retained in patients who received (153)Sm-EDTMP could be sufficient enough to increase the count rates above background levels and activate the sensors. At Roger Maris Cancer Center, patients are now informed of the potential consequences of (153)Sm-EDTMP therapy prior to initiating treatment. In addition, patients treated with (153)Sm-EDTMP at Roger Maris Cancer

  13. 50 CFR 14.4 - What terms do I have to understand?

    Science.gov (United States)

    2010-10-01

    ... domesticus; Cattle—Bos taurus; Dog (domestic)—Canis familiaris; European rabbit—Ortyctolagus cuniculus... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false What terms do I have to understand? 14.4 Section 14.4 Wildlife and Fisheries UNITED STATES FISH AND WILDLIFE SERVICE, DEPARTMENT OF THE INTERIOR...

  14. 7 CFR 457.144 - Northern potato crop insurance-processing quality endorsement.

    Science.gov (United States)

    2010-01-01

    ... endorsement. 457.144 Section 457.144 Agriculture Regulations of the Department of Agriculture (Continued... Northern potato crop insurance—processing quality endorsement. The Northern Potato Crop Insurance Processing Quality Endorsement Provisions for the 2008 and succeeding crop years are as follows: 1...

  15. 19 CFR 144.12 - Contents of entry summary; estimated duties.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Contents of entry summary; estimated duties. 144... Procedures for Warehouse Entry § 144.12 Contents of entry summary; estimated duties. The entry summary, Customs Form 7501, shall show the value, classification, and rate of duty as approved by the port director...

  16. 40 CFR 144.82 - What must I do to protect underground sources of drinking water?

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false What must I do to protect underground sources of drinking water? 144.82 Section 144.82 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM Requirements for Owners and...

  17. 26 CFR 1.4-4 - Short taxable year caused by death.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 1 2010-04-01 2010-04-01 true Short taxable year caused by death. 1.4-4 Section... Normal Taxes and Surtaxes § 1.4-4 Short taxable year caused by death. An individual making a return for a... results from the death of the taxpayer. Tax on Corporations ...

  18. 14 CFR 91.144 - Temporary restriction on flight operations during abnormally high barometric pressure conditions.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 2 2010-01-01 2010-01-01 false Temporary restriction on flight operations during abnormally high barometric pressure conditions. 91.144 Section 91.144 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED) AIR TRAFFIC AND GENERAL...

  19. 19 CFR 144.42 - Combined entry for rewarehouse and withdrawal for consumption.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 2 2010-04-01 2010-04-01 false Combined entry for rewarehouse and withdrawal for consumption. 144.42 Section 144.42 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND... applicable to this type of entry, with the following exceptions: (1) Form of entry. A combined entry for...

  20. Identification and expression analysis of miR-144-5p and miR-130b-5p in dairy cattle

    Directory of Open Access Journals (Sweden)

    Z. Li

    2017-07-01

    Full Text Available MicroRNAs (miRNAs can coordinate the main pathways involved in innate and adaptive immune responses by regulating gene expression. To explore the resistance to mastitis in cows, miR-144-5p and miR-130b-5p were identified in bovine mammary gland tissue and 14 potential target genes belonging to the chemokine signaling pathway, the arginine and proline metabolism pathway and the mRNA surveillance pathway were predicted. Subsequently, we estimated the relative expression of miR-144-5p and miR-130b-5p in cow mammary tissues by using stem-loop quantitative real-time polymerase chain reaction. The results showed that the relative expression of miR-144-5p and miR-130b-5p in the mastitis-infected mammary tissues (n = 5 was significantly downregulated 0.14-fold (p < 0. 01 and upregulated 3.34-fold (p < 0. 01, respectively, compared to healthy tissues (n = 5. Our findings reveal that miR-144-5p and miR-130b-5p may have important roles in resistance to mastitis in dairy cattle.

  1. Biodistribution of samarium-153-EDTMP in rats treated with docetaxel Biodistribuição de EDTMP-153-samário em ratos tratados com docetaxel

    Directory of Open Access Journals (Sweden)

    Arthur Villarim Neto

    2009-02-01

    Full Text Available PURPOSE: Many patients with metastatic bone disease have to use radiopharmaceuticals associated with chemotherapy to relieve bone pain. The aim of this study was to assess the influence of docetaxel on the biodistribution of samarium-153-EDTMP in bones and other organs of rats. METHODS: Wistar male rats were randomly allocated into 2 groups of 6 rats each. The DS (docetaxel/samarium group received docetaxel (15 mg/kg intraperitoneally in two cycles 11 days apart. The S (samarium/control group rats were not treated with docetaxel. Nine days after chemotherapy, all the rats were injected with 0.1ml of samarium-153-EDTMP via orbital plexus (25µCi. After 2 hours, the animals were killed and samples of the brain, thyroid, lung, heart, stomach, colon, liver, kidney and both femurs were removed. The percentage radioactivity of each sample (% ATI/g was determined in an automatic gamma-counter (Wizard-1470, Perkin-Elmer, Finland. RESULTS: On the 9th day after the administration of the 2nd chemotherapy cycle, the rats had a significant weight loss (314.50±22.09g compared (pOBJETIVO: Muitos pacientes com metástases ósseas são tratados com radiofármacos associados com quimioterapia para alívio da dor óssea. O objetivo do trabalho foi estudar a influência do docetaxel na biodistribuição do EDTMP-153-samário nos ossos e outros órgãos de ratos. MÉTODOS: Ratos Wistar foram aleatoriamente alocados em 2 grupos de 6 animais cada. O grupo DS (docetaxel/samário recebeu docetaxel (15 mg/kg intraperitoneal em dois ciclos com 11 dias de intervalo. Os ratos do grupo S (samário/controle não foram tratados com docetaxel. Nove dias após a quimioterapia, todos os animais receberam 0,1ml de EDTMP-153-samário via plexo orbital (25µCi. Após 2 horas, os animais foram mortos e feitas biópsias de cérebro, tireóide, pulmão, coração, estômago, cólon, fígado, rim e fêmures. O percentual de radioatividade por grama (%ATI/g de tecido de cada bi

  2. Marrow irradiation with high-dose 153Samarium-EDTMP followed by chemotherapy and hematopoietic stem cell infusion for acute myelogenous leukemia.

    Science.gov (United States)

    Rodriguez, Vilmarie; Anderson, Peter M; Litzow, Mark R; Erlandson, Linda; Trotz, Barbara A; Arndt, Carola A S; Khan, Shakila P; Wiseman, Gregory A

    2006-08-01

    In four patients, aged 15 - 20 years, with high-risk acute myeloid leukemia (AML), high-dose samarium 153-labelled ethylenediaminetetramethylenephosphonate (153Sm-EDTMP) was used for targeted marrow irradiation before preparative chemotherapy conditioning regimens and allogeneic (three patients) or autologous (one patient) hematopoietic stem cell transplantation. The dose of 153Sm-EDTMP was 703 MBq/kg (n = 1) or 1110 MBq/kg (n = 3). No side-effects occurred during the 30-min infusion of 153Sm-EDTMP. Samarium - melphalan regimens were given to three patients; one had 153Sm-EDTMP - busulfan + cyclophosphamide. Total body radioactivity was below the 133 MBq safe limit before infusion of stem cells (day 14 after 153Sm-EDTMP). No hemorrhagic cystitis, nephrotoxicity or serious infections occurred. Leukocyte engraftment (white blood cell count >0.5 x 10(9)/l) occurred between 12 and 23 days after stem cell infusion (mean of 17 days). Complete cytogenetic and morphologic remission of AML was evident on follow-up marrow aspirate and biopsy specimens from all patients. In two of the four study patients, the disease remains in complete remission and the patients have an excellent quality of life (Eastern Cooperative Oncology Group performance status 0; no medications) and no organ toxicity more than 2 years and more than 4 years, respectively, after their blood and bone marrow transplantations. Thus, in adolescents and adults, 153Sm-EDTMP may provide a relatively simple and effective means for using irradiation to eliminate AML within the marrow.

  3. Oyesiku et al., Afr J Tradit Complement Altern Med. (2013) 10(3):144 ...

    African Journals Online (AJOL)

    AJTCAM

    .doi.org/10.4314/ajtcam.v10i4.23. 144. MORPHOLOGICAL AND ANATOMICAL INVESTIGATIONS INTO THE MECHANISM OF LEAF. PAIR UNROLLING IN URARIA PICTA (JACQ.) DESV. EX DC. (PAPILIONACEAE), A. MEDICINAL PLANT IN ...

  4. NODC Standard Format Marine Toxic Substances and Pollutants (F144) chemical identification codes (NODC Accession 9200273)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This archival information package contains a listing of codes and chemical names that were used in NODC Standard Format Marine Toxic Substances and Pollutants (F144)...

  5. 40 CFR 144.83 - Do I need to notify anyone about my Class V injection well?

    Science.gov (United States)

    2010-07-01

    ... written request within the time frame specified. You can start injecting again only if you receive a... Class V injection well? 144.83 Section 144.83 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Operators of Class V Injection Wells § 144.83 Do I need to notify anyone about my Class V injection well...

  6. Coprecipitation experiment with Sm hydroxide using a multitracer produced by nuclear spallation reaction: A tool for chemical studies with superheavy elements.

    Science.gov (United States)

    Kasamatsu, Yoshitaka; Yokokita, Takuya; Toyomura, Keigo; Shigekawa, Yudai; Haba, Hiromitsu; Kanaya, Jumpei; Huang, Minghui; Ezaki, Yutaka; Yoshimura, Takashi; Morita, Kosuke; Shinohara, Atsushi

    2016-12-01

    To establish a new methodology for superheavy element chemistry, the coprecipitation behaviors of 34 elements with samarium hydroxide were investigated using multitracer produced by a spallation of Ta. The chemical reactions were rapidly equilibrated within 10s for many elements. In addition, these elements exhibited individual coprecipitation behaviors, and the behaviors were qualitatively related to their hydroxide precipitation behaviors. It was demonstrated that the ammine and hydroxide complex formations of superheavy elements could be investigated using the established method. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Pyrolysis of UR-144, a synthetic cannabinoid, augments an affinity to human CB1receptor and cannabimimetic effects in mice.

    Science.gov (United States)

    Kaizaki-Mitsumoto, Asuka; Hataoka, Kyoko; Funada, Masahiko; Odanaka, Yuki; Kumamoto, Hiroki; Numazawa, Satoshi

    2017-01-01

    Drug abusers most often smoke 'herbal incense' as a cigarette or inhale it using a smoking tool. Smoking may cause pyrolysis of the drug and produce decomposed products of which biological effect has never been investigated. The synthetic cannabinoid UR-144 is known to undergo thermal degradation, giving a ring-opened isomer, so-called UR-144 degradant. The present study demonstrates by using UR-144 as a model drug that the smoke of burned UR-144 contains the UR-144 degradant. The UR-144 degradant showed approximately four fold higher agonist activity to human CB 1 receptor and augmented hypothermic and akinetic actions in mice compared to UR-144. These results indicate that smoking behavior may increase psychological actions of the certain synthetic cannabinoids.

  8. Reaction Automata

    OpenAIRE

    Okubo, Fumiya; Kobayashi, Satoshi; YOKOMORI, Takashi

    2011-01-01

    Reaction systems are a formal model that has been introduced to investigate the interactive behaviors of biochemical reactions. Based on the formal framework of reaction systems, we propose new computing models called reaction automata that feature (string) language acceptors with multiset manipulation as a computing mechanism, and show that reaction automata are computationally Turing universal. Further, some subclasses of reaction automata with space complexity are investigated and their la...

  9. CDCC calculations of fusion of 6Li with targets 144Sm and 154Sm: effect of resonance states

    Science.gov (United States)

    Gómez Camacho, A.; Lubian, J.; Zhang, H. Q.; Zhou, Shan-Gui

    2017-12-01

    Continuum Discretized Coupled-Channel (CDCC) model calculations of total, complete and incomplete fusion cross sections for reactions of the weakly bound 6Li with 144,154Sm targets at energies around the Coulomb barrier are presented. In the cluster structure frame of 6Li→α+d, short-range absorption potentials are considered for the interactions between the ground state of the projectile 6Li and α-d fragments with the target. In order to separately calculate complete and incomplete fusion and to reduce double-counting, the corresponding absorption potentials are chosen to be of different range. Couplings to low-lying excited states 2+, 3‑ of 144Sm and 2+, 4+ of 154Sm are included. So, the effect on total fusion from the excited states of the target is investigated. Similarly, the effect on fusion due to couplings to resonance breakup states of 6Li, namely, l=2, J π =3+,2+,1+ is also calculated. The latter effect is determined by using two approaches, (a) by considering only resonance state couplings and (b) by omitting these states from the full discretized energy space. Among other things, it is found that both resonance and non-resonance continuum breakup couplings produce fusion suppression at all the energies considered. A. Gómez Camacho from CONACYT, México, J. Lubian from CNPq, FAPERJ, Pronex, Brazil. S.G.Z was partly supported by the NSF of China (11120101005, 11275248, 11525524, 11621131001, 11647601, 11711540016), 973 Program of China (2013CB834400) and the Key Research Program of Frontier Sciences of CAS. H.Q.Z. from NSF China (11375266)

  10. Retention Characteristics of CBTi144 Thin Films Explained by Means of X-Ray Photoemission Spectroscopy

    Directory of Open Access Journals (Sweden)

    G. Biasotto

    2010-01-01

    Full Text Available CaBi4Ti4O15 (CBTi144 thin films were grown on Pt/Ti/SiO2/Si substrates using a soft chemical solution and spin-coating method. Structure and morphology of the films were characterized by the X-ray Diffraction (XRD, Fourier-transform infrared spectroscopy (FT-IR, Raman analysis, X-ray photoemission spectroscopy (XPS, and transmission electron microscopy (TEM. The films present a single phase of layered-structured perovskite with polar axis orient. The a/b-axis orientation of the ferroelectric film is considered to be associated with the preferred orientation of the Pt bottom electrode. XPS measurements were employed to understand the nature of defects on the retention behavior of CBTi144 films. We have observed that the main source of retention-free characteristic of the capacitors is the oxygen environment in the CBTi144 lattice.

  11. Structural characterization of CYP144A1 - a cytochrome P450 enzyme expressed from alternative transcripts in Mycobacterium tuberculosis

    Science.gov (United States)

    Chenge, Jude; Kavanagh, Madeline E.; Driscoll, Max D.; McLean, Kirsty J.; Young, Douglas B.; Cortes, Teresa; Matak-Vinkovic, Dijana; Levy, Colin W.; Rigby, Stephen E. J.; Leys, David; Abell, Chris; Munro, Andrew W.

    2016-05-01

    Mycobacterium tuberculosis (Mtb) causes the disease tuberculosis (TB). The virulent Mtb H37Rv strain encodes 20 cytochrome P450 (CYP) enzymes, many of which are implicated in Mtb survival and pathogenicity in the human host. Bioinformatics analysis revealed that CYP144A1 is retained exclusively within the Mycobacterium genus, particularly in species causing human and animal disease. Transcriptomic annotation revealed two possible CYP144A1 start codons, leading to expression of (i) a “full-length” 434 amino acid version (CYP144A1-FLV) and (ii) a “truncated” 404 amino acid version (CYP144A1-TRV). Computational analysis predicted that the extended N-terminal region of CYP144A1-FLV is largely unstructured. CYP144A1 FLV and TRV forms were purified in heme-bound states. Mass spectrometry confirmed production of intact, His6-tagged forms of CYP144A1-FLV and -TRV, with EPR demonstrating cysteine thiolate coordination of heme iron in both cases. Hydrodynamic analysis indicated that both CYP144A1 forms are monomeric. CYP144A1-TRV was crystallized and the first structure of a CYP144 family P450 protein determined. CYP144A1-TRV has an open structure primed for substrate binding, with a large active site cavity. Our data provide the first evidence that Mtb produces two different forms of CYP144A1 from alternative transcripts, with CYP144A1-TRV generated from a leaderless transcript lacking a 5‧-untranslated region and Shine-Dalgarno ribosome binding site.

  12. Determination of Rigidity of Protein Bound Au(144) Clusters by Electron Cryomicroscopy.

    Science.gov (United States)

    Sexton, Jonathan Z; Ackerson, Christopher J

    2010-09-30

    A method for estimating the positional displacement of protein bound gold nanoparticles is presented and used to estimate the rigidity of linkage of Au(144) nanoparticles bound to a tetrameric model protein. We observe a distribution of displacement values where most Au(144) clusters are immobilized to within 3Å relative to the protein center of mass. The shape of the distribution suggests two physical processes of thermal motion and protein deformation. The application of this and similar rigid gold nanoparticle/protein conjugates in high resolution single particle electron cryo-microscopy is discussed.

  13. Pyrolysis result of polyethylene waste as fuel for solid oxide fuel cell with samarium doped-ceria (SDC)-carbonate as electrolyte

    Science.gov (United States)

    Syahputra, R. J. E.; Rahmawati, F.; Prameswari, A. P.; Saktian, R.

    2017-02-01

    In this research, the result of pyrolysis on polyethylene was used as fuel for a solid oxide fuel cell (SOFC). The pyrolysis result is a liquid which consists of hydrocarbon chains. According to GC-MS analysis, the hydrocarbons mainly consist of C7 to C20 hydrocarbon chain. Then, the liquid was applied to a single cell of NSDC-L | NSDC | NSDC-L. NSDC is a composite SDC (samarium doped-ceria) with sodium carbonate. Meanwhile, NSDC-L is a composite of NSDC with LiNiCuO (LNC). NSDC and LNC were analyzed by X-ray diffraction to understand their crystal structure. The result shows that presence of carbonate did not change the crystal structure of SDC. SEM EDX analysis for fuel cell before and after being loaded with polyethylene oil to get information of element diffusion to the electrolyte. Meanwhile, the conductivity properties were investigated through impedance measurement. The presence of carbonate even increases the electrical conductivity. The single cell test with the pyrolysis result of polyethylene at 300 - 600 °C, found that the highest power density is at 600 °C with the maximum power density of 0.14 mW/cm2 and open circuit voltage of 0.4 Volt. Elemental analysis at three point spots of single cell NDSC-L |NSDC|NSDC-L found that a migration of ions was occurred during fuel operation at 300 - 600 °C.

  14. Effects of some rare earth and carbonate-based co-dopants on structural and electrical properties of samarium doped ceria (SDC) electrolytes for solid oxide fuel cells

    Science.gov (United States)

    Anwar, Mustafa; Khan, Zuhair S.; Mustafa, Kamal; Rana, Akmal

    2015-09-01

    In the present study, samarium doped ceria (SDC) and SDC-based composite with the addition of K2CO3 were prepared by co-precipitation route and effects of pH of the solution and calcination temperature on microstructure of SDC and SDC-K2CO3, respectively, were investigated. Furthermore, experimentation was performed to investigate into the ionic conductivity of pure SDC by co-doping with yttrium i.e., YSDC, XRD and SEM studies show that the crystallite size and particle size of SDC increases with the increase in pH. The SEM images of all the samples of SDC synthesized at different pH values showed the irregular shaped and dispersed particles. SDC-K2CO3 was calcined at 600∘C, 700∘C and 800∘C for 4 h and XRD results showed that crystallite size increases while lattice strain, decreases with the increase in calcination temperature and no peaks were detected for K2CO3 as it is present in an amorphous form. The ionic conductivity of the electrolytes increases with the increase in temperature and SDC-K2CO3 shows the highest value of ionic conductivity as compared to SDC and YSDC. Chemical compatibility tests were performed between the co-doped electrolyte and lithiated NiO cathode at high temperature. It revealed that the couple could be used up to the temperature of 700∘C.

  15. Calculation of the Dose of Samarium-153-Ethylene Diamine Tetramethylene Phosphonate (153Sm-EDTMP as a Radiopharmaceutical for Pain Relief of bone Metastasis

    Directory of Open Access Journals (Sweden)

    Fatemeh Razghandi

    2016-04-01

    Full Text Available Introduction One of the important applications of nuclear physics in medicine is the use of radioactive elements as radiopharmaceuticals. Metastatic bone disease is the most common form of malignant bone tumors. Samarium-153-ethylene diamine tetramethylene phosphonate (153Sm-EDTMP as a radiopharmaceutical is used for pain palliation. This radiopharmaceutical usually emits beta particles, which have a high uptake in bone tissues. The purpose of this study was to calculate the radiation dose distribution of 153Sm-EDTMP in bone and other tissues, using MCNPX Monte Carlo code in the particle transport model. Materials and Methods Dose delivery to the bone was simulated by seeking radiopharmaceuticals on the bone surface. The phantom model had a simple cylindrical geometry and included bone, bone marrow, and soft tissue. Results The simulation results showed that a significant amount of radiation dose was delivered to the bone by the use of this radiopharmaceutical. Conclusion Thebone acted as a fine protective shield against rays for the bone marrow. Therefore, the trivial absorbed dose by the bone marrow caused less damage to bone-making cells. Also, the high absorbed dose of the bone could destroy cancer cells and relieve the pain in the bone.

  16. Synthesis, quality control and biological evaluation of tris[(1,10-phenanthroline)[{sup 153}Sm]samarium(III)]trithiocyanate complex as a therapeutic agent

    Energy Technology Data Exchange (ETDEWEB)

    Naseri, Z.; Kharat, A. Nemati [Tehran Univ. (Iran, Islamic Republic of). Inorganic Chemistry Dept.; Hakimi, A. [Islamic Azad Univ., Tehran (Iran, Islamic Republic of). Dept. of Nuclear Engineering, Science and Research Branch; Jalilian, A.R.; Shirvani-Arani, S.; Bahrami-Samani, A.; Ghannadi-Maragheh, M. [Nuclear Science and Technology Research Institute (NSTRI), Tehran (IR). Radiopharmaceutical Research and Development Lab (RRDL)

    2012-07-01

    Therapeutic radiopharmaceuticals are designed to deliver high doses of radiation to selected target organs or tissues with an aim of minimizing unwanted radiation to surrounding healthy tissue. In this work, [tris(1,10-phenanthroline)[{sup 153}Sm]samarium(III)]trithiocyanate ({sup 153}Sm-TPTTC) was developed for possible therapeutic properties. The cold compound, i.e. {sup nat}Sm-TPTTC was prepared and characterized by IR, UV, mass and {sup 1}H-NMR spectroscopy. {sup 153}Sm-TPTTC was prepared in two steps using [{sup 153}Sm]SmCl{sub 3}, obtained by neutron activation of an enriched {sup 152}Sm sample. Stability tests, partition coefficient determination, toxicity tests and biodistribution studies of the complex in wild-type and fibrosarcoma-bearing mice were determined. The radiolabeled complex was prepared in high radiochemical purity (> 99% precipitation method) and specific activity of 278 GBq/mmol and demonstrated significant stability at 4, 25 and 37 C (in presence of human serum). Initial complex biodistribution data showed significant liver accumulation in wild-type mice and significant tumor accumulation in fibrosarcoma-bearing mice with tumor:blood and tumor:muscle ratios of 3.55 (2 h) and 38.26 (96 h) respectively. {sup 153}Sm-TPTTC properties suggest an efficient tumor targeting agent with high tumor-avidity. Further investigation on the therapeutic properties must be conducted. (orig.)

  17. Sex Differences in Left-Handedness: A Meta-Analysis of 144 Studies

    Science.gov (United States)

    Papadatou-Pastou, Marietta; Martin, Maryanne; Munafo, Marcus R.; Jones, Gregory V.

    2008-01-01

    Human handedness, a marker for language lateralization in the brain, continues to attract great research interest. A widely reported but not universal finding is a greater male tendency toward left-handedness. Here the authors present a meta-analysis of k = 144 studies, totaling N = 1,787,629 participants, the results of which demonstrate that the…

  18. Crystal Structure of the Murine Cytomegalovirus MHC-I Homolog m144

    Energy Technology Data Exchange (ETDEWEB)

    Natarajan,K.; Hicks, A.; Mans, J.; Robinson, H.; Guan, R.; Mariuzza, R.; Margulies, D.

    2006-01-01

    Large DNA viruses of the herpesvirus family produce proteins that mimic host MHC-I molecules as part of their immunoevasive strategy. The m144 glycoprotein, expressed by murine cytomegalovirus, is thought to be an MHC-I homolog whose expression prolongs viral survival in vivo by preventing natural killer cell activation. To explore the structural basis of this m144 function, we have determined the three-dimensional structure of an m144/{beta}2-microglobulin ({beta}2m) complex at 1.9 {angstrom} resolution. This structure reveals the canonical features of MHC-I molecules including readily identifiable {alpha}1, {alpha}2, and {alpha}3 domains. A unique disulfide bond links the {alpha}1 helix to the {beta}-sheet floor, explaining the known thermal stability of m144. Close juxtaposition of the {alpha}1 and {alpha}2 helices and the lack of critical residues that normally contribute to anchoring the peptide N and C termini eliminates peptide binding. A region of 13 amino acid residues, corresponding to the amino-terminal portion of the {alpha}2 helix, is missing in the electron density map, suggesting an area of structural flexibility that may be involved in ligand binding.

  19. 40 CFR 144.7 - Identification of underground sources of drinking water and exempted aquifers.

    Science.gov (United States)

    2010-07-01

    ... PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) UNDERGROUND INJECTION CONTROL PROGRAM General Provisions § 144.7 Identification of underground sources of drinking water and exempted aquifers. (a) The..., except where exempted under paragraph (b) of this section, as an underground source of drinking water...

  20. 49 CFR 176.144 - Segregation of Class 1 (explosive) materials.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Segregation of Class 1 (explosive) materials. 176... VESSEL Detailed Requirements for Class 1 (Explosive) Materials Segregation § 176.144 Segregation of Class... any ferrous metal or aluminum alloy, unless separated by a partition. (e) Segregation on deck: When...

  1. Homozygosity Mapping and Genetic Analysis of Autosomal Recessive Retinal Dystrophies in 144 Consanguineous Pakistani Families

    Science.gov (United States)

    Li, Lin; Chen, Yabin; Jiao, Xiaodong; Jin, Chongfei; Jiang, Dan; Tanwar, Mukesh; Ma, Zhiwei; Huang, Li; Ma, Xiaoyin; Sun, Wenmin; Chen, Jianjun; Ma, Yan; M'hamdi, Oussama; Govindarajan, Gowthaman; Cabrera, Patricia E.; Li, Jiali; Gupta, Nikhil; Naeem, Muhammad Asif; Khan, Shaheen N.; Riazuddin, Sheikh; Akram, Javed; Ayyagari, Radha; Sieving, Paul A.; Riazuddin, S. Amer; Hejtmancik, J. Fielding

    2017-01-01

    Purpose The Pakistan Punjab population has been a rich source for identifying genes causing or contributing to autosomal recessive retinal degenerations (arRD). This study was carried out to delineate the genetic architecture of arRD in the Pakistani population. Methods The genetic origin of arRD in a total of 144 families selected only for having consanguineous marriages and multiple members affected with arRD was examined. Of these, causative mutations had been identified in 62 families while only the locus had been identified for an additional 15. The remaining 67 families were subjected to homozygosity exclusion mapping by screening of closely flanking microsatellite markers at 180 known candidate genes/loci followed by sequencing of the candidate gene for pathogenic changes. Results Of these 67 families subjected to homozygosity mapping, 38 showed homozygosity for at least one of the 180 regions, and sequencing of the corresponding genes showed homozygous cosegregating mutations in 27 families. Overall, mutations were detected in approximately 61.8 % (89/144) of arRD families tested, with another 10.4% (15/144) being mapped to a locus but without a gene identified. Conclusions These results suggest the involvement of unmapped novel genes in the remaining 27.8% (40/144) of families. In addition, this study demonstrates that homozygosity mapping remains a powerful tool for identifying the genetic defect underlying genetically heterogeneous arRD disorders in consanguineous marriages for both research and clinical applications. PMID:28418496

  2. 42 CFR 413.144 - Depreciation: Allowance for depreciation on fully depreciated or partially depreciated assets.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 2 2010-10-01 2010-10-01 false Depreciation: Allowance for depreciation on fully... SKILLED NURSING FACILITIES Capital-Related Costs § 413.144 Depreciation: Allowance for depreciation on fully depreciated or partially depreciated assets. (a) Principle. Depreciation on assets being used by a...

  3. Nanostructures via noncovalent synthesis: 144 hydrogen bonds bring together 27 components

    NARCIS (Netherlands)

    Paraschiv, V.; Crego Calama, Mercedes; Fokkens, R.H.; Padberg, Clemens J.; Timmerman, P.; Reinhoudt, David

    2001-01-01

    This paper describes the spontaneous and reversible assembly of 20 kDa synthetic hydrogen-bonded assemblies via the formation of 144 cooperative hydrogen bonds. These nanostructures (3.0 × 5.5 nm), consisting of 27 different components, have been carefully characterized using a combination of 1H NMR

  4. Cytochrome P450-mediated metabolism of the synthetic cannabinoids UR-144 and XLR-11

    DEFF Research Database (Denmark)

    Nielsen, Line Marie; Holm, Niels Bjerre; Olsen, Lars

    2016-01-01

    In recent years, synthetic cannabinoids have emerged in the illicit drug market, in particular via the Internet, leading to abuse of these drugs. There is currently limited knowledge about the specific enzymes involved in the metabolism of these drugs. In this study, we investigated the cytochrome...... of UR-144 and XLR-11, while inhibition of the other CYP enzymes in HLM had only minor effects. Thus, CYP3A4 is the major contributor to the CYP mediated metabolism of UR-144 and XLR-11 with minor contributions from CYP1A2. Users of UR-144 and XLR-11 are thus subject to the influence of potential drug-drug...... the specific CYP enzymes involved in the metabolism of UR-144 and XLR-11 utilizing a panel of nine recombinant enzymes (CYP1A2, 2B6, 2C8, 2C9, 2C18, 2C19, 2D6, 3A4, and 2E1). This is followed by an investigation of the effect of specific inhibitors targeted against CYP1A2, 2B6, 2C9, 2C19, 2D6 and 3A4 in human...

  5. Physical and genetic characterization of the IncI plasmid R144-drd3

    NARCIS (Netherlands)

    Hartskeerl, R.A.; Guchte, M. v.d.; Zuidweg, E.M.; Hoekstra, W.P.M.

    1984-01-01

    A physical and genetic map of the IncI plasmid R144-drd3 was obtained by determining restriction endonuclease sites and by physical and genetic analysis of cloned fragments, of TnI insertion mutants and of deletion mutants.

  6. Biological effects of inhaled {sup 144}CeCl{sub 3} in beagle dogs

    Energy Technology Data Exchange (ETDEWEB)

    Hahn, F.F.; Boecker, B.B.; Griffith, W.C.; Muggenburg, B.A. [Inhalation Toxicology Research Institute, Albuquerque, NM (United States)

    1997-01-01

    The biological effects of {sup 144}Ce were studied in beagle dogs that were exposed to graded activity levels of {sup 144}CeCl{sub 3} via a single, brief inhalation exposure and observed for their life span. The long-term retained body burdens ranged from 0.06 to 13 MBq/kg with a median of 1.2 MBq/kg. After a short residence time in the lung, most of the {sup 144}Ce was translocated to liver and skeleton, where the {sup 144}Ce was retained with a half-time approaching the physical half-life of {sup 144}Ce was retained with a half-time approaching the physical half-life of {sup 144}Ce, 284 days. Significant radiation doses were delivered to the lung, 28 Gy (median) and 2.5-370 Gy (range); liver, 68 Gy (median) and 6.1-250 Gy (range); and skeleton, 21 Gy (median) and 1.9-100 Gy (range). Lesions induced by the {beta}-particle radiation were noted in the lung, liver, skeleton, bone marrow, and oral and nasal mucosae closely associated with bond. Early deaths (within 2.5 years) were generally related to hematological dyscrasia, radiation pneumonitis, or hepatocellular degeneration and atrophy. Neoplasms that occurred relatively early, from 2.2-6.8 years after exposure, were noted in the liver, bone, bone marrow and oral mucosa closely associated with bone. Neoplasms that occurred later, beyond 7 years after exposure, were noted in the liver, lung and nasal mucosa closely associated with bone. Increased numbers of neoplasms were not found in two other organs that had relatively high radiation doses, namely the thyroid and kidney. Only one primary bone tumor was noted, but 11 tumors of bone-associated tissues (oral and nasal mucosae and bone marrow) were found. Radiation doses and effects in tissues adjacent to bone, especially those of epithelial or marrow origin, should be considered when determining risks from internally deposited bone-seeking radionuclides, such as {sup 144}Ce. 59 refs., 8 figs., 10 tabs.

  7. Structure of the Bacteriophage [phi]KZ Lytic Transglycosylase gp144

    Energy Technology Data Exchange (ETDEWEB)

    Fokine, Andrei; Miroshnikov, Konstantin A.; Shneider, Mikhail M.; Mesyanzhinov, Vadim V.; Rossmann, Michael G. (SOIBC); (Purdue)

    2008-04-02

    Lytic transglycosylases are enzymes that act on the peptidoglycan of bacterial cell walls. They cleave the glycosidic linkage between N-acetylmuramoyl and N-acetylglucosaminyl residues with the concomitant formation of a 1,6-anhydromuramoyl product. The x-ray structure of the lytic transglycosylase gp144 from the Pseudomonas bacteriophage {phi}KZ has been determined to 2.5-{angstrom} resolution. This protein is probably employed by the bacteriophage in the late stage of the virus reproduction cycle to destroy the bacterial cell wall to release the phage progeny. {phi}KZ gp144 is a 260-residue {alpha}-helical protein composed of a 70-residue N-terminal cell wall-binding domain and a C-terminal catalytic domain. The fold of the N-terminal domain is similar to the peptidoglycan-binding domain from Streptomyces albus G d-Ala-d-Ala carboxypeptidase and to the N-terminal prodomain of human metalloproteinases that act on extracellular matrices. The C-terminal catalytic domain of gp144 has a structural similarity to the catalytic domain of the transglycosylase Slt70 from Escherichia coli and to lysozymes. The gp144 catalytic domain has an elongated groove that can bind at least five sugar residues at sites A-E. As in other lysozymes, the peptidoglycan cleavage (catalyzed by Glu{sup 115} in gp144) occurs between sugar-binding subsites D and E. The x-ray structure of the {phi}KZ transglycosylase complexed with the chitotetraose (N-acetylglucosamine){sub 4} has been determined to 2.6-{angstrom} resolution. The N-acetylglucosamine residues of the chitotetraose bind in sites A-D.

  8. Drug Reactions

    Science.gov (United States)

    ... or diabetes. But medicines can also cause unwanted reactions. One problem is interactions, which may occur between ... more serious. Drug allergies are another type of reaction. They can be mild or life-threatening. Skin ...

  9. Retention capacity of samarium (III) in zircon for it possible use in retaining walls for confinement of nuclear residues; Capacidad de retencion de samario (III) en circon para su posible uso en barreras de contencion para confinamiento de residuos nucleares

    Energy Technology Data Exchange (ETDEWEB)

    Garcia G, N

    2006-07-01

    Mexico, as country that produces part of its electric power by nuclear means, should put special emphasis in the development of technologies guided to the sure and long term confinement of the high level nuclear residuals. This work studies the capacity that has the natural zircon to retain to the samarium (III) in solution, by what due, firstly, to characterize the zircon for technical instrumental to determine the purity and characteristic of the mineral in study. The instrumental techniques that were used to carry out the physicochemical characterization were the neutron activation analysis (NAA), the infrared spectroscopy (IS), the thermal gravimetric analysis (TGA), scanning electron microscopy (SEM), transmission electron microscopy (TEM), semiquantitative analysis, dispersive energy spectroscopy (EDS), X-ray diffraction (XRD) and luminescence technique. The characterization of the surface properties carries out by means of the determination of the surface area using the BET multipoint technique, acidity constants, hydration time, the determination of the point of null charge (pH{sub PCN}) and density of surface sites (D{sub s}). The luminescence techniques were useful to determine the optimal point hydration of the zircon and for the quantification of the samarium, for that here intends the development of both analysis techniques. With the adjustment of the titration curves in the FITEQL 4 package the constants of surface acidity in the solid/liquid interface were determined. To the finish of this study it was corroborated that the zircon is a mineral that presents appropriate characteristics to be proposed as a contention barrier for the deep geologic confinement. With regard to the study of adsorption that one carries out the samarium retention it is superior to 90% under the described conditions. This investigation could also be applicable in the confinement of dangerous industrial residuals. (Author)

  10. Effectiveness of antihypertensive therapy in HIV-positive patients: evaluation to 144 weeks

    Directory of Open Access Journals (Sweden)

    K Falasca

    2012-11-01

    Full Text Available Hypertension is more prevalent among HIV-infected subjects than in the general population, contributing to increased cardiovascular risk in HIV+ patients. The angiotensin II receptor blocker telmisartan is also a partial peroxisome proliferator activated receptor (PPAR-γ agonist, with documented effects on improving hypertension, lipid metabolism and renal function. Therefore telmisartan was found to be the first choice for treatment of HIV+ hypertensive patients. Aim of this study was to evaluate the durability on 144 weeks of treatment with telmisartan in HIV+ patients. 13 HIV+ Caucasian male patients treated with combined antiretroviral therapy (cART and discovered to be naïve hypertensive, were given 80 mg telmisartan daily. Systolic (SBP and diastolic (DBP blood pressure, viro-immunological, lipid and metabolic parameters, including triglycerides, cholesterol, insulin resistance (HOMA-IR, inflammatory markers, C-reactive protein (CRP, erythrocyte sedimentation rate (ESR, indexes of renal function and cardiovascular risk, microalbuminuria, cystatin C, were measured at baseline (T0, and after 24 (T24, 48 (T48, 72 (T72, 96 (T96, 120 (T120 and 144 (T144 weeks. Treatment with telmisartan decreased SBP and DBP levels during the 144 weeks of observation. We also observed improved HDL-cholesterol, HOMA-IR, microalbuminuria and cystatin C at the end of study. Triglycerides and total cholesterol significantly decreased and HDL-cholesterol significantly increased. Total cholesterol/HDL cholesterol ratio improved significantly. Throughout in the course of the trial our patients showed a significant improvement of the percentage of CD4+ and CD8+. Eventually in all 144 weeks of therapy with telmisartan 80 mg/day have not observed adverse events or dropouts. Telmisartan was effective in improving hypertension, lipid metabolism and renal function in 144 weeks of evaluation. It determines the improvement of cystatin C and microalbuminuria, markers of

  11. 40 CFR 144.21 - Existing Class I, II (except enhanced recovery and hydrocarbon storage) and III wells.

    Science.gov (United States)

    2010-07-01

    ... recovery and hydrocarbon storage) and III wells. 144.21 Section 144.21 Protection of Environment... hydrocarbon storage) and III wells. (a) An existing Class I, II (except enhanced recovery and hydrocarbon... decision; or (9) For Class II wells (except enhanced recovery and hydrocarbon storage), five years after...

  12. SU-C-201-06: Utility of Quantitative 3D SPECT/CT Imaging in Patient Specific Internal Dosimetry of 153-Samarium with GATE Monte Carlo Package

    Energy Technology Data Exchange (ETDEWEB)

    Fallahpoor, M; Abbasi, M [Tehran University of Medical Sciences, Vali-Asr Hospital, Tehran, Tehran (Iran, Islamic Republic of); Sen, A [University of Houston, Houston, TX (United States); Parach, A [Shahid Sadoughi University of Medical Sciences, Yazd, Yazd (Iran, Islamic Republic of); Kalantari, F [UT Southwestern Medical Center, Dallas, TX (United States)

    2015-06-15

    Purpose: Patient-specific 3-dimensional (3D) internal dosimetry in targeted radionuclide therapy is essential for efficient treatment. Two major steps to achieve reliable results are: 1) generating quantitative 3D images of radionuclide distribution and attenuation coefficients and 2) using a reliable method for dose calculation based on activity and attenuation map. In this research, internal dosimetry for 153-Samarium (153-Sm) was done by SPECT-CT images coupled GATE Monte Carlo package for internal dosimetry. Methods: A 50 years old woman with bone metastases from breast cancer was prescribed 153-Sm treatment (Gamma: 103keV and beta: 0.81MeV). A SPECT/CT scan was performed with the Siemens Simbia-T scanner. SPECT and CT images were registered using default registration software. SPECT quantification was achieved by compensating for all image degrading factors including body attenuation, Compton scattering and collimator-detector response (CDR). Triple energy window method was used to estimate and eliminate the scattered photons. Iterative ordered-subsets expectation maximization (OSEM) with correction for attenuation and distance-dependent CDR was used for image reconstruction. Bilinear energy mapping is used to convert Hounsfield units in CT image to attenuation map. Organ borders were defined by the itk-SNAP toolkit segmentation on CT image. GATE was then used for internal dose calculation. The Specific Absorbed Fractions (SAFs) and S-values were reported as MIRD schema. Results: The results showed that the largest SAFs and S-values are in osseous organs as expected. S-value for lung is the highest after spine that can be important in 153-Sm therapy. Conclusion: We presented the utility of SPECT-CT images and Monte Carlo for patient-specific dosimetry as a reliable and accurate method. It has several advantages over template-based methods or simplified dose estimation methods. With advent of high speed computers, Monte Carlo can be used for treatment planning

  13. Construct validity and reliability of automated body reaction test ...

    African Journals Online (AJOL)

    Automated Body Reaction Test (ABRT) is a new device for skills and physical assessment instrument to measure ability on react, move quickly and accurately in accordance with stimulus. A total of 474 subjects aged 7-17 years old were randomly selected for the construct validity (n=330) and reliability (n=144). The ABRT ...

  14. Machine learning methods enable predictive modeling of antibody feature:function relationships in RV144 vaccinees.

    Directory of Open Access Journals (Sweden)

    Ickwon Choi

    2015-04-01

    Full Text Available The adaptive immune response to vaccination or infection can lead to the production of specific antibodies to neutralize the pathogen or recruit innate immune effector cells for help. The non-neutralizing role of antibodies in stimulating effector cell responses may have been a key mechanism of the protection observed in the RV144 HIV vaccine trial. In an extensive investigation of a rich set of data collected from RV144 vaccine recipients, we here employ machine learning methods to identify and model associations between antibody features (IgG subclass and antigen specificity and effector function activities (antibody dependent cellular phagocytosis, cellular cytotoxicity, and cytokine release. We demonstrate via cross-validation that classification and regression approaches can effectively use the antibody features to robustly predict qualitative and quantitative functional outcomes. This integration of antibody feature and function data within a machine learning framework provides a new, objective approach to discovering and assessing multivariate immune correlates.

  15. Machine learning methods enable predictive modeling of antibody feature:function relationships in RV144 vaccinees.

    Science.gov (United States)

    Choi, Ickwon; Chung, Amy W; Suscovich, Todd J; Rerks-Ngarm, Supachai; Pitisuttithum, Punnee; Nitayaphan, Sorachai; Kaewkungwal, Jaranit; O'Connell, Robert J; Francis, Donald; Robb, Merlin L; Michael, Nelson L; Kim, Jerome H; Alter, Galit; Ackerman, Margaret E; Bailey-Kellogg, Chris

    2015-04-01

    The adaptive immune response to vaccination or infection can lead to the production of specific antibodies to neutralize the pathogen or recruit innate immune effector cells for help. The non-neutralizing role of antibodies in stimulating effector cell responses may have been a key mechanism of the protection observed in the RV144 HIV vaccine trial. In an extensive investigation of a rich set of data collected from RV144 vaccine recipients, we here employ machine learning methods to identify and model associations between antibody features (IgG subclass and antigen specificity) and effector function activities (antibody dependent cellular phagocytosis, cellular cytotoxicity, and cytokine release). We demonstrate via cross-validation that classification and regression approaches can effectively use the antibody features to robustly predict qualitative and quantitative functional outcomes. This integration of antibody feature and function data within a machine learning framework provides a new, objective approach to discovering and assessing multivariate immune correlates.

  16. The high precision measurement of the 144Ce activity in the SOX experiment

    Science.gov (United States)

    Di Noto, L.; Agostini, M.; Althenmüller, K.; Appel, S.; Bellini, G.; Benziger, J.; Berton, N.; Bick, D.; Bonfini, G.; Bravo—Berguño, D.; Caccianiga, B.; Calaprice, F.; Caminata, A.; Cavalcante, P.; Cereseto, R.; Chepurnov, A.; Choi, K.; Cribier, M.; DAngelo, D.; Davini, S.; Derbin, A.; Drachnev, I.; Durero, M.; Etenko, A.; Farinon, S.; Fischer, V.; Fomenko, K.; Franco, D.; Gabriele, F.; Gaffiot, J.; Galbiati, C.; Ghiano, C.; Giammarchi, M.; Göeger-Neff, M.; Goretti, A.; Gromov, M.; Hagner, C.; Houdy, Th; Hungerford, E.; Ianni, Aldo; Ianni, Andrea; Jonquères, N.; Jedrzejczak, K.; Kaiser, M.; Kobychev, V.; Korablev, D.; Korga, G.; Kornoukhov, V.; Kryn, D.; Lachenmaier, T.; Lasserre, T.; Laubenstein, M.; Lehnert, T.; Link, J.; Litvinovich, E.; Lombardi, F.; Lombardi, P.; Ludhova, L.; Lukyanchenko, G.; Machulin, I.; Manecki, S.; Maneschg, W.; Marcocci, S.; Maricic, J.; Mention, G.; Meroni, E.; Meyer, M.; Miramonti, L.; Misiaszek, M.; Montuschi, M.; Mosteiro, P.; Muratova, V.; Musenich, R.; Neumair, B.; Oberauer, L.; Obolensky, M.; Ortica, F.; Pallavicini, M.; Papp, L.; Perasso, L.; Pocar, A.; Ranucci, G.; Razeto, A.; Re, A.; Romani, A.; Roncin, R.; Rossi, C.; Rossi, N.; Schönert, S.; Scola, L.; Semenov, D.; Simgen, H.; Skorokhvatov, M.; Smirnov, O.; Sotnikov, A.; Sukhotin, S.; Suvorov, Y.; Tartaglia, R.; Testera, G.; Thurn, J.; Toropova, M.; Veyssière, C.; Vivier, M.; Unzhakov, E.; Vogelaar, R. B.; von Feilitzsch, F.; Wang, H.; Weinz, S.; Winter, J.; Wojcik, M.; Wurm, M.; Yokley, Z.; Zaimidoroga, O.; Zavatarelli, S.; Zuber, K.; Zuzel, G.

    2016-02-01

    In order to perform a resolutive measurement to clarify the neutrino anomalies and to observe possible short distance neutrino oscillations, the SOX (Short distance neutrino Oscillations with BoreXino) experiment is under construction. In the first phase, a 100 kCi 144Ce-144Pr antineutrino source will be placed under the Borexino detector at the Laboratori Nazionali del Gran Sasso (LNGS), in center of Italy, and the rate measurement of the antineutrino events, observed by the very low radioactive background Borexino detector, will be compared with the high precision (< 1%) activity measurement performed by two calorimeters. The source will be embedded in a 19 mm thick tungsten alloy shield and both the calorimeters have been conceived for measuring the thermal heat absorbed by a water flow. In this report the design of the calorimeters will be described in detail and very preliminary results will be also shown.

  17. Change of deformation at the backbending in the yrast superdeformed band of {sup 144}Gd

    Energy Technology Data Exchange (ETDEWEB)

    Ur, C.A.; Bolzonella, G.P.; Bazzacco, D. [dell`Universita, Padova (Italy)]|[INFN, Padova (Italy)] [and others

    1996-12-31

    A mean lifetime measurement using the Doppler shift attenuation method has been performed at GASP in order to extract the quadrupole moment of the yrast SD band of {sup 144}Gd. The extracted intrinsic quadrupole moments, being Q{sub 0}=13.7 eb above the backbending and Q{sub 0}=11.8 eb below the backbending, are consistent with a change of deformation from {beta}{sub 2}=0.51 (at {beta}{sub 4} {approx} 0.050) to {beta}{sub 2}=0.45 (at {beta}{sub 4} {approx}0.035). The experimental results are in nice agreement with the theoretical predictions, which revealed that the second well in {sup 144}Gd arises essentially from the very favored shell structure at N=80 and Z=64. The occupation at higher frequency of the aligned N=6 proton orbitals drives the nucleus to a slightly more deformed shape.

  18. Cross sections of deuteron induced reactions on $^{nat}$Sm for production of the therapeutic radionuclide $^{145}$Sm and $^{153}$Sm

    CERN Document Server

    Tárkányi, F; Takács, S; Ditrói, F; Csikai, J; Ignatyuk, A V

    2014-01-01

    At present, targeted radiotherapy (TR) is acknowledged to have great potential in oncology. A large list of interesting radionuclides is identified, including several radioisotopes of lanthanides, amongst them $^{145}$Sm and $^{153}$Sm. In this work the possibility of their production at a cyclotron was investigated using a deuteron beam and a samarium target. The excitation functions of the $^{nat}$Sm(d,x)$^{145153}$Sm reactions were determined for deuteron energies up to 50 MeV using the stacked-foil technique and high-resolution $\\gamma$-ray spectrometry. The measured cross sections and the contributing reactions were analyzed by comparison with results of the ALICE, EMPIRE and TALYS nuclear reaction codes. A short overview and comparison of possible production routes is given.

  19. Replication of JC Virus DNA in the G144 Oligodendrocyte Cell Line Is Dependent Upon Akt.

    Science.gov (United States)

    Peterson, Jesse N; Lin, Brian; Shin, Jong; Phelan, Paul J; Tsichlis, Philip; Schwob, James E; Bullock, Peter A

    2017-10-15

    Progressive multifocal leukoencephalopathy (PML) is an often-fatal demyelinating disease of the central nervous system. PML results when oligodendrocytes within immunocompromised individuals are infected with the human JC virus (JCV). We have identified an oligodendrocyte precursor cell line, termed G144, that supports robust levels of JCV DNA replication, a central part of the JCV life cycle. In addition, we have determined that JC virus readily infects G144 cells. Furthermore, we have determined that JCV DNA replication in G144 cells is stimulated by myristoylated (i.e., constitutively active) Akt and reduced by the Akt-specific inhibitor MK2206. Thus, this oligodendrocyte-based model system will be useful for a number of purposes, such as studies of JCV infection, establishing key pathways needed for the regulation of JCV DNA replication, and identifying inhibitors of this process.IMPORTANCE The disease progressive multifocal leukoencephalopathy (PML) is caused by the infection of particular brain cells, termed oligodendrocytes, by the JC virus. Studies of PML, however, have been hampered by the lack of an immortalized human cell line derived from oligodendrocytes. Here, we report that the G144 oligodendrocyte cell line supports both infection by JC virus and robust levels of JCV DNA replication. Moreover, we have established that the Akt pathway regulates JCV DNA replication and that JCV DNA replication can be inhibited by MK2206, a compound that is specific for Akt. These and related findings suggest that we have established a powerful oligodendrocyte-based model system for studies of JCV-dependent PML. Copyright © 2017 American Society for Microbiology.

  20. Gene expression analysis of embryonic stem cells expressing VE-cadherin (CD144 during endothelial differentiation

    Directory of Open Access Journals (Sweden)

    Libermann Towia

    2008-05-01

    Full Text Available Abstract Background Endothelial differentiation occurs during normal vascular development in the developing embryo. This process is recapitulated in the adult when endothelial progenitor cells are generated in the bone marrow and can contribute to vascular repair or angiogenesis at sites of vascular injury or ischemia. The molecular mechanisms of endothelial differentiation remain incompletely understood. Novel approaches are needed to identify the factors that regulate endothelial differentiation. Methods Mouse embryonic stem (ES cells were used to further define the molecular mechanisms of endothelial differentiation. By flow cytometry a population of VEGF-R2 positive cells was identified as early as 2.5 days after differentiation of ES cells, and a subset of VEGF-R2+ cells, that were CD41 positive at 3.5 days. A separate population of VEGF-R2+ stem cells expressing the endothelial-specific marker CD144 (VE-cadherin was also identified at this same time point. Channels lined by VE-cadherin positive cells developed within the embryoid bodies (EBs formed by differentiating ES cells. VE-cadherin and CD41 expressing cells differentiate in close proximity to each other within the EBs, supporting the concept of a common origin for cells of hematopoietic and endothelial lineages. Results Microarray analysis of >45,000 transcripts was performed on RNA obtained from cells expressing VEGF-R2+, CD41+, and CD144+ and VEGF-R2-, CD41-, and CD144-. All microarray experiments were performed in duplicate using RNA obtained from independent experiments, for each subset of cells. Expression profiling confirmed the role of several genes involved in hematopoiesis, and identified several putative genes involved in endothelial differentiation. Conclusion The isolation of CD144+ cells during ES cell differentiation from embryoid bodies provides an excellent model system and method for identifying genes that are expressed during endothelial differentiation and that

  1. Structure & bonding of the gold-subhalide cluster I-Au144Cl60[z].

    Science.gov (United States)

    Tlahuice-Flores, Alfredo; Black, David M; Bach, Stephan B H; Jose-Yacamán, Miguel; Whetten, Robert L

    2013-11-28

    The structure and bonding of the gold-subhalide compounds Au144Cl60([z]) are related to those of the ubiquitous thiolated gold clusters, or Faradaurates, by iso-electronic substitution of thiolate by chloride. Exact I-symmetry holds for the [z] = [2+,4+] charge-states, in accordance with new electrospray mass spectrometry measurements and the predicted electron shell filling. The high symmetry facilitates analysis of the global structure as well as the bonding network, with some striking results.

  2. Focusing of 3C144 Source Radiation by the Solar Corona

    Science.gov (United States)

    Galanin, V. V.; Derevjagin, V. G.; Kravetz, R. O.

    The research of solar corona by the compact cosmic source radiation was made on URAN-4 radio telescope. In the period from June 6 to June 20 2012 the flow of Crab nebula was measured on the 20 MHz and 25 MHz frequencies. During the eclipse we observe the great increase of 3C144 flow, which is compare with the flow of 3C461 source. Data and results of measurement analysis is presented.

  3. Inhibiting microRNA-144 abates oxidative stress and reduces apoptosis in hearts of streptozotocin-induced diabetic mice.

    Science.gov (United States)

    Yu, Manli; Liu, Yu; Zhang, Bili; Shi, Yicheng; Cui, Ling; Zhao, Xianxian

    2015-01-01

    Hyperglycemia-induced reactive oxygen species (ROS) generation contributes to the development of diabetic cardiomyopathy. However, little is known about the role of microRNAs in the regulation of ROS formation and myocardial apoptosis in streptozotocin (STZ)-induced diabetic mice. It was observed that microRNA-144 (miR-144) level was lower in heart tissues of STZ-induced diabetic mice. High glucose exposure also reduced miR-144 levels in cultured cardiomyocytes. Moreover, miR-144 modulated high glucose-induced oxidative stress in cultured cardiomyocytes by directly targeting nuclear factor-erythroid 2-related factor 2 (Nrf2), which was a central regulator of cellular response to oxidative stress. The miR-144 mimics aggravated high glucose-induced ROS formation and apoptosis in cardiomyocytes, which could be attenuated by treatment with Dh404, an activator of Nrf2. Meanwhile, inhibition of miR-144 suppressed ROS formation and apoptosis induced by high glucose in cultured cardiomyocytes. What was more important is that reduced myocardial oxidative stress and apoptosis and improved cardiac function were identified in STZ-induced diabetic mice when treated with miR-144 antagomir. Although miR-144 cannot explain the increased oxidative stress in STZ, therapeutic interventions directed at decreasing miR-144 may help to decrease oxidative stress in these hearts. Inhibition of miR-144 might have clinical potential to abate oxidative stress as well as to reduce cardiomyocyte apoptosis and improve cardiac function in diabetic cardiomyopathy. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Development of samarium [{sup 32}P] phosphate colloid for radiosynoviorthesis applications: Preparation, biological and preliminary clinical studies experience

    Energy Technology Data Exchange (ETDEWEB)

    Prabhakar, G. [Radiopharmaceuticals Programme, Board of Radiation and Isotope Technology (BRIT), BARC Vashi Complex, Sector-20, Navi Mumbai 400 705 (India)], E-mail: gantipk47@rediffmail.com; Sachdev, Satbir S.; Umamaheswari, S.; Sivaprasad, N.; Bhatia, Manohar H. [Radiopharmaceuticals Programme, Board of Radiation and Isotope Technology (BRIT), BARC Vashi Complex, Sector-20, Navi Mumbai 400 705 (India); Chaudhari, Pradip R. [Laboratory Nuclear Medicine Services, BARC, Mumbai 400 012 (India); Solav, Srikant V. [Spect Lab, Nuclear Medicine Services, Opposite Dinanath Mangeshkar Hospital, Pune 411004 (India)

    2007-12-15

    A new therapeutic radio colloid for radiosynoviorthesis (RS) applications is reported. The method of preparation involves the reaction of SmCl{sub 3} carrier with carrier added [{sup 32}P]H{sub 3}PO{sub 4} in the presence of gelatin. The pure colloid was recovered by dialysis purification leading to radiochemical yield of around 90%. The radiochemical purity of the pure colloid formulated in isotonic saline was over 98%, for the usage period of 14 days, as assessed by paper chromatography. Ninety percent of colloid particles were in the size of 1-10 {mu}m as evident from the laser diffraction particle size analysis, ideally suitable for the intended end use. Animal studies revealed complete retention of the radio colloid in the rabbit knee joint. The results of clinical trials in humans are satisfactory and encouraging, satisfactory retention of the colloid in the knee joint and negligible leakage into the systemic circulation.

  5. Polypropylene oil as fuel for solid oxide fuel cell with samarium doped-ceria (SDC)-carbonate as electrolyte

    Science.gov (United States)

    Syahputra, R. J. E.; Rahmawati, F.; Prameswari, A. P.; Saktian, R.

    2017-03-01

    The research focusses on converting polypropylene oil as pyrolysis product of polypropylene plastic into an electricity. The converter was a direct liquid fuel-solid oxide fuel cell (SOFC) with cerium oxide based material as electrolyte. The polypropylene vapor flowed into fuel cell, in the anode side and undergo oxidation reaction, meanwhile, the Oxygen in atmosphere reduced into oxygen ion at cathode. The fuel cell test was conducted at 400 - 600 °C. According to GC-MS analysis, the polypropylene oil consist of C8 to C27 hydrocarbon chain. The XRD analysis result shows that Na2CO3 did not change the crystal structure of SDC even increases the electrical conductivity. The maximum power density is 0.079 mW.cm-2 at 773 K. The open circuite voltage is 0.77 volt. Chemical stability test by analysing the single cell at before and after fuel cell test found that ionic migration occured during fuel cell operation. It is supported by the change of elemental composition in the point position of electrolyte and at the electrolyte-electrode interface

  6. Lanthanide(III) complexes are more active inhibitors of the Fenton reaction than pure ligands.

    Science.gov (United States)

    Martin, Jan; Mladěnka, Přemysl; Saso, Luciano; Kostova, Irena

    2016-03-01

    This study is an extension to our finding of direct anti-oxidant activities of lanthanide(III) complexes with the heterocyclic compound, 5-aminoorotic acid (AOA). In this experiment, we used AOA and coumarin-3-carboxylic acid as the two heterocyclic compounds with anti-oxidant potential, to produce the complexes with different lanthanides. Lanthanide(III) complexes were tested on the iron-driven Fenton reaction. The product of this reaction, the hydroxyl radical, was detected by HPLC. All complexes as well as their ligands had positive or neutral effect on the Fenton reaction but their behavior was different. Both pure ligands in low concentration ratio to iron were inefficient in contrast to some of their complexes. Complexes of neodymium, samarium, gadolinium, and partly of cerium blocked the Fenton reaction at very low ratios (in relation to iron) but the effect disappeared at higher ratios. In contrast, lanthanum complexes appeared to be the most promising. Both blocked the Fenton reaction in a dose-dependent manner. Lanthanide(III) complexes were proven to block the iron-driven production of the hydroxyl radical. Second, the lanthanide(III) element appears to be crucial for the anti-oxidant effect. Overall, lanthanum complexes may be promising direct anti-oxidants for future testing.

  7. Interest of uranium complexes for the mechanism study of the McMurry reaction; Interet des complexes de l`uranium pour l`etude du mecanisme de la reaction de McMurry

    Energy Technology Data Exchange (ETDEWEB)

    Maury, O

    1997-07-04

    The reducing coupling reactions of ketones in diols and olefins are generally carried out with titanium or samarium compounds. In this work uranium complexes have been used. They have allowed to study the chemical reaction mechanism. This thesis is divided into three parts: 1) the reduction mechanism of uranium tetrachloride by cyclic voltametry has been studied at first. It has been shown that this reduction is followed by a transfer reaction of chlorides between the reduced specie of the higher electronic density and UCl . 2) In the second part is described: the synthesis, the crystal structure, the reactivity of the chemical agents, the stereochemistry of diols and alkenes formation and the pinacolisation reaction catalysis. 3) In the last part, the limits of the McMurry reaction are given by the study of the aromatic ketones pinacolisation reaction by-products. The obtained results show that the complexes of the metals which present a high reducing and oxo-philic (Ti, Sm, U..) character react in a similar way with the carbonyl compounds. If the uranium compounds are less used than those of the titanium in the field of the organic synthesis applications, they are precious auxiliaries and excellent models for reactions mechanisms study and for the synthesis methods optimization. (O.M.). 284 refs.

  8. Comprehensive sieve analysis of breakthrough HIV-1 sequences in the RV144 vaccine efficacy trial.

    Directory of Open Access Journals (Sweden)

    Paul T Edlefsen

    2015-02-01

    Full Text Available The RV144 clinical trial showed the partial efficacy of a vaccine regimen with an estimated vaccine efficacy (VE of 31% for protecting low-risk Thai volunteers against acquisition of HIV-1. The impact of vaccine-induced immune responses can be investigated through sieve analysis of HIV-1 breakthrough infections (infected vaccine and placebo recipients. A V1/V2-targeted comparison of the genomes of HIV-1 breakthrough viruses identified two V2 amino acid sites that differed between the vaccine and placebo groups. Here we extended the V1/V2 analysis to the entire HIV-1 genome using an array of methods based on individual sites, k-mers and genes/proteins. We identified 56 amino acid sites or "signatures" and 119 k-mers that differed between the vaccine and placebo groups. Of those, 19 sites and 38 k-mers were located in the regions comprising the RV144 vaccine (Env-gp120, Gag, and Pro. The nine signature sites in Env-gp120 were significantly enriched for known antibody-associated sites (p = 0.0021. In particular, site 317 in the third variable loop (V3 overlapped with a hotspot of antibody recognition, and sites 369 and 424 were linked to CD4 binding site neutralization. The identified signature sites significantly covaried with other sites across the genome (mean = 32.1 more than did non-signature sites (mean = 0.9 (p < 0.0001, suggesting functional and/or structural relevance of the signature sites. Since signature sites were not preferentially restricted to the vaccine immunogens and because most of the associations were insignificant following correction for multiple testing, we predict that few of the genetic differences are strongly linked to the RV144 vaccine-induced immune pressure. In addition to presenting results of the first complete-genome analysis of the breakthrough infections in the RV144 trial, this work describes a set of statistical methods and tools applicable to analysis of breakthrough infection genomes in general vaccine

  9. Crystal structure of monoclinic samarium and cubic europium sesquioxides and bound coherent neutron scattering lengths of the isotopes {sup 154}Sm and {sup 153}Eu

    Energy Technology Data Exchange (ETDEWEB)

    Kohlmann, Holger [Leipzig Univ. (Germany). Inst. of Inorganic Chemistry; Hein, Christina; Kautenburger, Ralf [Saarland Univ., Saarbruecken (Germany). Inorganic Solid State Chemistry; Hansen, Thomas C.; Ritter, Clemens [Institut Laue-Langevin, Grenoble (France); Doyle, Stephen [Karlsruhe Institute of Technology, Eggenstein-Leopoldshafen (Germany). Inst. for Synchrotron Radiation (ISS)

    2016-11-01

    The crystal structures of monoclinic samarium and cubic europium sesquioxide, Sm{sub 2}O{sub 3} and Eu{sub 2}O{sub 3}, were reinvestigated by powder diffraction methods (laboratory X-ray, synchrotron, neutron). Rietveld analysis yields more precise structural parameters than previously known, especially for oxygen atoms. Interatomic distances d(Sm-O) in Sm{sub 2}O{sub 3} range from 226.3(4) to 275.9(2) pm [average 241.6(3) pm] for the monoclinic B type Sm{sub 2}O{sub 3} [space group C2/m, a = 1418.04(3) pm, b = 362.660(7) pm, c = 885.48(2) pm, β = 100.028(1) ], d(Eu-O) in Eu{sub 2}O{sub 3} from 229.9(2) to 238.8(2) pm for the cubic bixbyite (C) type [space group Ia anti 3, a = 1086.87(1) pm]. Neutron diffraction at 50 K and 2 K did not show any sign for magnetic ordering in Sm{sub 2}O{sub 3}. Isotopically enriched {sup 154}Sm{sub 2}O{sub 3} and {sup 153}Eu{sub 2}O{sub 3} were used for the neutron diffraction work because of the enormous absorption cross section of the natural isotopic mixtures for thermal neutrons. The isotopic purity was determined by inductively coupled plasma - mass spectrometry to be 98.9% for {sup 154}Sm and 99.8% for {sup 153}Eu. Advanced analysis of the neutron diffraction data suggest that the bound coherent scattering lengths of {sup 154}Sm and {sup 153}Eu need to be revised. We tentatively propose b{sub c}({sup 154}Sm) = 8.97(6) fm and b{sub c}({sup 153}Eu) = 8.85(3) fm for a neutron wavelength of 186.6 pm to be better values for these isotopes, showing up to 8% deviation from accepted literature values. It is shown that inaccurate scattering lengths may result in severe problems in crystal structure refinements causing erroneous structural details such as occupation parameters, which might be critically linked to physical properties like superconductivity in multinary oxides.

  10. MicroRNA-144 Regulates Hepatic ABCA1 and Plasma HDL Following Activation of the Nuclear Receptor FXR

    Science.gov (United States)

    de Aguiar Vallim, Thomas Q.; Tarling, Elizabeth J.; Kim, Tammy; Civelek, Mete; Baldán, Ángel; Esau, Christine; Edwards, Peter A.

    2014-01-01

    Rationale The bile acid receptor Farnesoid-X-Receptor (FXR) regulates many aspects of lipid metabolism by various complex and not fully understood molecular mechanisms. We set out to investigate the molecular mechanisms for FXR-dependent regulation of lipid and lipoprotein metabolism. Objective To identify FXR-regulated microRNAs that were subsequently involved in regulating lipid metabolism. Methods and Results ATP binding cassette transporter A1 (ABCA1) is a major determinant of plasma High Density Lipoprotein (HDL)-cholesterol levels. Here we show that activation of the nuclear receptor FXR in vivo increases hepatic levels of miR-144, which in turn lower hepatic ABCA1 and plasma HDL levels. We identified two complementary sequences to miR-144 in the 3′ untranslated region (UTR) of ABCA1 mRNA that are necessary for miR-144-dependent regulation. Overexpression of miR-144 in vitro decreased both cellular ABCA1 protein and cholesterol efflux to lipid-poor apolipoprotein A-I (ApoA-I) protein, whilst overexpression in vivo reduced hepatic ABCA1 protein and plasma HDL-cholesterol. Conversely, silencing miR-144 in mice increased hepatic ABCA1 protein and HDL-cholesterol. In addition, we utilized tissue-specific FXR deficient mice to show that induction of miR-144 and FXR-dependent hypolipidemia requires hepatic, but not intestinal FXR. Finally, we identified functional FXR response elements (FXREs) upstream of the miR-144 locus, consistent with direct FXR regulation. Conclusion We have identified a novel pathway involving FXR, miR-144 and ABCA1 that together regulate plasma HDL cholesterol. PMID:23519696

  11. miR-144 attenuates the host response to influenza virus by targeting the TRAF6-IRF7 signaling axis.

    Directory of Open Access Journals (Sweden)

    Carrie M Rosenberger

    2017-04-01

    Full Text Available Antiviral responses must rapidly defend against infection while minimizing inflammatory damage, but the mechanisms that regulate the magnitude of response within an infected cell are not well understood. miRNAs are small non-coding RNAs that suppress protein levels by binding target sequences on their cognate mRNA. Here, we identify miR-144 as a negative regulator of the host antiviral response. Ectopic expression of miR-144 resulted in increased replication of three RNA viruses in primary mouse lung epithelial cells: influenza virus, EMCV, and VSV. We identified the transcriptional network regulated by miR-144 and demonstrate that miR-144 post-transcriptionally suppresses TRAF6 levels. In vivo ablation of miR-144 reduced influenza virus replication in the lung and disease severity. These data suggest that miR-144 reduces the antiviral response by attenuating the TRAF6-IRF7 pathway to alter the cellular antiviral transcriptional landscape.

  12. MicroRNA-144-3p suppresses tumor growth and angiogenesis by targeting SGK3 in hepatocellular carcinoma.

    Science.gov (United States)

    Wu, Manya; Huang, Chaoyuan; Huang, Xinping; Liang, Rong; Feng, Yan; Luo, Xiaoling

    2017-10-01

    In our previous studies, the Illumine Soledad massively parallel signature sequencing of miRNomes in non‑tumor and hepatocellular carcinoma (HCC) tissues revealed that microRNA (miR)-144-3p was significantly downregulated in HCC, but its role in HCC development, especially angiogenesis, remains unclear. In this investigation, we found recovering miR‑144‑3p expression can significantly suppress the growth, migration and induced angiogenic capacity of HCC cells through both in vivo and in vitro experiments. Moreover, clinical correlation analysis showed that low expression of miR‑144‑3p was positively correlated to poor disease-free survival (DFS) of HCC patients. Mechanistically, serum and glucocorticoid kinase 3 (SGK3), the putative targets of miR‑144‑3p, was predicted by Target Scan database and identified to be suppressed by miR‑144‑3p so that inhibiting the activation of mTOR-VEGF downstream signals was activated by the phosphoinositide 3-kinase (PI3K)-independent pathway. Hence, we concluded that miR‑144‑3p, which is frequently downregulated in HCC, can inhibit proliferation, migration and repress angiogenesis by regulating SGK3 activation with PI3K independent signal pathway, and acts as a prognostic factor for HCC patients.

  13. Direct Evidence of Octupole Deformation in Neutron-Rich $^{144}$Ba

    CERN Document Server

    Bucher, B; Wu, C Y; Janssens, R V F; Cline, D; Hayes, A B; Albers, M; Ayangeakaa, A D; Butler, P A; Campbell, C M; Carpenter, M P; Chiara, C J; Clark, J A; Crawford, H L; Cromaz, M; David, H M; Dickerson, C; Gregor, E T; Harker, J; Hoffman, C R; Kay, B P; Kondev, F G; Korichi, A; Lauritsen, T; Macchiavelli, A O; Pardo, R C; Richard, A; Riley, M A; Savard, G; Scheck, M; Seweryniak, D; Smith, M K; Vondrasek, R; Wiens, A

    2016-01-01

    The neutron-rich nucleus $^{144}$Ba ($t_{1/2}$=11.5 s) is expected to exhibit some of the strongest octupole correlations among nuclei with mass numbers $A$ less than 200. Until now, indirect evidence for such strong correlations has been inferred from observations such as enhanced $E1$ transitions and interleaving positive- and negative-parity levels in the ground-state band. In this experiment, the octupole strength was measured directly by sub-barrier, multi-step Coulomb excitation of a post-accelerated 650-MeV $^{144}$Ba beam on a 1.0-mg/cm$^2$ $^{208}$Pb target. The measured value of the matrix element, $\\langle 3_1^- \\| \\mathcal{M}(E3) \\| 0_1^+ \\rangle=0.65(^{+17}_{-23})$ $e$b$^{3/2}$, corresponds to a reduced $B(E3)$ transition probability of 48($^{+25}_{-34}$) W.u. This result represents an unambiguous determination of the octupole collectivity, is larger than any available theoretical prediction, and is consistent with octupole deformation.

  14. 24 CFR 943.144 - What financial impact do operations of a subsidiary, affiliate, or joint venture have on a PHA?

    Science.gov (United States)

    2010-04-01

    ... of a subsidiary, affiliate, or joint venture have on a PHA? 943.144 Section 943.144 Housing and Urban... CONSORTIA AND JOINT VENTURES Subsidiaries, Affiliates, Joint Ventures in Public Housing § 943.144 What financial impact do operations of a subsidiary, affiliate, or joint venture have on a PHA? Income generated...

  15. Cross sections of deuteron induced reactions on (nat)Sm for production of the therapeutic radionuclide ¹⁴⁵Sm and ¹⁵³Sm.

    Science.gov (United States)

    Tárkányi, F; Hermanne, A; Takács, S; Ditrói, F; Csikai, J; Ignatyuk, A V

    2014-09-01

    At present, targeted radiotherapy (TR) is acknowledged to have great potential in oncology. A large list of interesting radionuclides is identified, including several radioisotopes of lanthanides, amongst them (145)Sm and (153)Sm. In this work the possibility of their production at a cyclotron was investigated using a deuteron beam and a samarium target. The excitation functions of the (nat)Sm(d,x)(145,153)Sm reactions were determined for deuteron energies up to 50 MeV using the stacked-foil technique and high-resolution γ-ray spectrometry. The measured cross sections and the contributing reactions were analyzed by comparison with results of the ALICE, EMPIRE and TALYS nuclear reaction codes. A short overview and comparison of possible production routes is given. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Highly CO2-Tolerant Cathode for Intermediate-Temperature Solid Oxide Fuel Cells: Samarium-Doped Ceria-Protected SrCo0.85Ta0.15O3-δ Hybrid.

    Science.gov (United States)

    Li, Mengran; Zhou, Wei; Zhu, Zhonghua

    2017-01-25

    Susceptibility to CO2 is one of the major challenges for the long-term stability of the alkaline-earth-containing cathodes for intermediate-temperature solid oxide fuel cells. To alleviate the adverse effects from CO2, we incorporated samarium-stabilized ceria (SDC) into a SrCo0.85Ta0.15O3-δ (SCT15) cathode by either mechanical mixing or a wet impregnation method and evaluated their cathode performance stability in the presence of a gas mixture of 10% CO2, 21% O2, and 69% N2. We observed that the CO2 tolerance of the hybrid cathode outperforms the pure SCT15 cathode by over 5 times at 550 °C. This significant enhancement is likely attributable to the low CO2 adsorption and reactivity of the SDC protective layer, which are demonstrated through thermogravimetric analysis, energy-dispersive spectroscopy, and electrical conductivity study.

  17. Atomistic Simulations of Functional Au-144(SR)(60) Gold Nanoparticles in Aqueous Environment

    DEFF Research Database (Denmark)

    Heikkila, E.; Gurtovenko, A. A.; Martinez-Seara, H.

    2012-01-01

    of the nanoparticle together with surrounding ions and water. We focus on Au-144 nanoparticles that comprise a nearly spherical Au core (diameter similar to 2 nm), a passivating Au-S interface, and functionalized alkanethiol chains. Cationic and anionic AuNPs have been modeled with amine and carboxyl terminal groups...... and Cl-/Na+ counterions, respectively. The radial distribution functions show that the side chains and terminal groups show significant flexibility. The orientation of water is distinct in the first solvation shell, and AuNPs cause a long-range effect in the solvent structure. The radial electrostatic...... in aqueous solutions. They suggest that electrostatics is one of the central factors in complexation of AuNPs with other nanomaterials and biological systems, and that effects of electrostatics as water-mediated interactions are relatively long-ranged, which likely plays a role in, e.g., the interplay...

  18. Lifetime tumor risk coefficients for beagle dogs that inhaled cerium-144 chloride

    Energy Technology Data Exchange (ETDEWEB)

    Boecker, B.B.; Hahn, F.F.; Griffith, W.C. [and others

    1995-12-01

    Reported here is one of the life-span radionuclide toxicology studies being conducted at ITRI in Beagle dogs. These studies are examining the life-span health risks of inhaled {Beta}-, {gamma}- and {alpha}-emitting radionuclides to expand available knowledge on these risks especially for the many cases for which human data are not available. The outcomes of these studies are providing important information on dosimetry and dose-response relationships for these inhaled radionuclides and the relative importance of a broad range of dose- and effect-modifying factors. A number of these studies are currently coming to completion. Much of the ITRI effort is being directed to final reviews of the dosimetric, clinical, and pathologic results and writing summary manuscripts. Radiation doses and effects in tissues adjacent to bone, specifically those of epithelial or marrow origin, should be considered when determining risks from internally deposited, bone-seeking radionuclides such as {sup 144}Ce.

  19. Identification of low-energy isovector octupole states in 144Nd

    Science.gov (United States)

    Thürauf, M.; Scheck, M.; Bernards, C.; Blanc, A.; Cooper, N.; Defrance, G.; Jentschel, M.; Jolie, J.; Kaleja, O.; Köster, U.; Kröll, T.; Mutti, P.; Simpson, G. S.; Soldner, T.; Tezgel, M.; Urban, W.; Vanhoy, J.; Werner, M.; Werner, V.; Zell, K. O.

    2016-06-01

    Recently, first candidates for low-lying isovector states in the octupole sector were suggested. The unambiguous identification of those states will contribute to the decomposition of the octupole-octupole residual interaction in an isoscalar and isovector part. This will help us understand the octupole degree of freedom. In 144Nd the 3- state at 2778 keV is a good candidate for such a “mixed-symmetry’' octupole state. In order to clarify the nature of this state, a 143Nd(n, γ)-experiment was conducted with the EXILL-setup. Following neutron capture the 3- states are populated and EXILL provides the opportunity to determine the multipole-mixing ratios of the 3i -→31 - transitions. For the transition from the “mixed-symmetry” octupole state to the symmetric 31 - state we expect a strong M1 component.

  20. cycloaddition reactions

    Indian Academy of Sciences (India)

    Unknown

    models of regioselectivity in pericyclic reactions. In addition, local hard and soft acid base (HSAB) princi- ples have been also employed to predict the observed regioselectivity.2 In recent years, the conceptual density functional theory has been remarkably successful in explaining the reactivity and site selectivity.3 The.

  1. The threshold anomaly from the simultaneous calculation of elastic scattering and fusion cross sections for the systems {sup 9}Be+{sup 144}Sm and {sup 9}Be+{sup 64}Zn for energies around the barrier

    Energy Technology Data Exchange (ETDEWEB)

    Camacho, A. G.; Aguilera, E. F.; Quiroz, E. M. [Departamento de Aceleradores, ININ, La Marquesa, 52750 Estado de Mexico (Mexico); Gomes, P. R. S.; Lubian, J. [Instituto de Fisica, Universidade Federal Fluminenese, Av. Litoranea s/n, Gragoata, Niteroi, 24210-340 Rio de Janeiro (Brazil)

    2008-12-15

    The energy dependence of the optical potential is used to study the threshold anomaly for reactions with the weakly bound projectile {sup 9}Be on {sup 144}Sm and {sup 64}Zn for energies around the Coulomb barrier. The energy dependent potential parameters are obtained from a simultaneous X{sup 2}-analysis of elastic scattering and fusion data. There are signatures that in fact, the so-called breakup threshold anomaly shows up for these systems. This finding is in agreement with other calculations involving weakly bound projectiles. (Author)

  2. A catalyst-free addition reaction of zinc amide enolates to N-sulfonyle imines

    Energy Technology Data Exchange (ETDEWEB)

    Joo, Seong Ryu; Im, Pyeong Won; Kim, Jong Sung; Kim, Seung Hoi [Dept. of Chemistry, Dankook University, Cheonan (Korea, Republic of); Park Soo Youl [Interface Chemistry and Engineering Research Team, Korea Research Institute of Chemical Technology, Daejon (Korea, Republic of)

    2016-12-15

    Despite the remarkable expansion of the imino-Reformatsky reaction, one interesting aspect is that, to the best of our knowledge, zinc enolates derived solely from α-halo esters have been mainly used in the recent progress. In contrast, a few limited examples have been reported concerning the application of zinc enolates derived from α-halo amide to the imino-Reformatsky reaction. In recent years, Rodriguez-Solla and co-workers reported the addition reaction of samarium enolates derived from both α-halo esters and amides to imines, resulting in the synthe- sis of β-amino esters or amides. In conclusion, we established a potential synthetic proto- col for the preparation of β-amino amides. This work was accomplished by the direct addition of zinc amide enolates to N-sulfonyl imines in the absence of any metal-catalyst under mild conditions. Due to the operational simplicity of the proposed method, it can be further utilized in synthetic organic chemistry. Further studies to elucidate the scope of this approach are currently underway in our laboratory.

  3. Samarium-neodymium chronology and rubidium-strontium systematics of an Allende calcium-aluminum-rich inclusion with implications for 146Sm half-life

    Science.gov (United States)

    Marks, N. E.; Borg, L. E.; Hutcheon, I. D.; Jacobsen, B.; Clayton, R. N.

    2014-11-01

    Calcium-aluminum-rich inclusions (CAIs) are primitive objects that formed within the protoplanetary disk surrounding the young Sun. Recent Pb-Pb chronologic studies have demonstrated that CAIs are the oldest solar system solids, crystallizing 4567 Ma ago (Amelin et al., 2002; Connelly et al., 2012). The isotope systematics of CAIs therefore provide critical insight into the earliest history of the Solar System. Although Sm-Nd and Rb-Sr geochronometers are highly effective tools for investigating cosmochemical evolution in the early Solar System, previous studies of CAIs have revealed evidence for isotopically disturbed systems. Here we report new age data for Allende CAI Al3S4 derived from both the long-lived (147Sm-143Nd) and short-lived (146Sm-142Nd) isotopic systems. The 147Sm-143Nd chronometer yields an age of 4560 ± 34 Ma that is concordant with 207Pb-206Pb ages for CAIs and indicates that the Sm-Nd system was not significantly disturbed by secondary alteration or nucleosynthetic processes. The slope of the 146Sm-142Nd isochron defines the Solar System initial 146Sm/144Sm of 0.00828 ± 0.00044. This value is significantly different from the value of 0.0094 determined by Kinoshita et al. (2012). Ages recalculated from all published 146Sm-142Nd isochron data using the traditional 103 Ma half-life and the initial 146Sm/144Sm value determined here closely match Pb-Pb and 147Sm-143Nd ages determined on the same samples. In contrast, ages recalculated using the 68 Ma half-life determined by Kinoshita et al. (2012) and either of the initial 146Sm/144Sm values are often anomalously old. This is particularly true for the youngest samples with 146Sm-142Nd isochron ages that are most sensitive to the choice of 146Sm half-life used in the age calculation. In contrast to the Sm-Nd isotope system, the Rb-Sr system is affected by alteration but yields an apparent isochron with a slope corresponding to a much younger age of 4247 ± 110 Ma. Although the Rb-Sr system in CAIs

  4. Loss of the miR-144/451 cluster impairs ischaemic preconditioning-mediated cardioprotection by targeting Rac-1

    Science.gov (United States)

    Wang, Xiaohong; Zhu, Hongyan; Zhang, Xiaowei; Liu, Yong; Chen, Jing; Medvedovic, Mario; Li, Hongliang; Weiss, Mitchell J.; Ren, Xiaoping; Fan, Guo-Chang

    2012-01-01

    Aims While a wealth of data has uncovered distinct microRNA (miR) expression alterations in hypertrophic and ischaemic/reperfused (I/R) hearts, little is known about miR regulation and response to ischaemic preconditioning (IPC). Methods and results We analysed miRs in murine hearts preconditioned with six cycles of 4 min ischaemia via coronary artery occlusion, followed by 4 min reperfusion in vivo. Both miRs within the miR-144/451 cluster were the most elevated among a cohort of 21 dysregulated miRs in preconditioned hearts, compared with shams. To investigate the significance of this finding, we examined IPC-mediated cardioprotection within a miR-144/451-knockout (KO) mouse model. Wild-type (WT) hearts exposed to IPC followed by I/R (30 min/24 h) showed a smaller infarction size compared with mice treated with I/R alone. In contrast, IPC failed to protect miR-144/451-KO hearts against infarct caused by I/R treatment. Thus, the miR-144/451 cluster is required for IPC-elicited cardioprotection. Rac-1, a key component of NADPH oxidase, was mostly up-regulated in KO hearts among three bona fide targets (Rac-1, 14-3-3ζ, and CUGBP2) for both miR-144 and miR-451. Accordingly, reactive oxygen species (ROS) levels were markedly increased in KO hearts upon IPC, compared with IPC-WT hearts. Pre-treatment of KO hearts with a Rac-1 inhibitor NSC23766 (20 mg/kg, ip) reduced IPC-triggered ROS levels and restored IPC-elicited cardioprotection. Using antagomiRs, we showed that miR-451 was largely responsible for IPC-mediated cardioprotection. Conclusion Loss of the miR-144/451 cluster limits IPC cardioprotection by up-regulating Rac-1-mediated oxidative stress signalling. PMID:22354898

  5. Utilizing assumption for project of stand for solid state targets activation on inner beams of AIC-144 cyclotron; Zalozenia uzytkowe do projektu stanowiska do aktywacji tarcz w stanie stalym na wiazce wewnetrznej cyklotronu AIC-144

    Energy Technology Data Exchange (ETDEWEB)

    Petelenz, B. [The H. Niewodniczanski Inst. of Nuclear Physics, Cracow (Poland)

    1997-09-01

    General assumptions for project of target activation stand at AIC-144 cyclotron are presented. The project predicts production of {sup 67}Ga, {sup 111}In, {sup 201}Tl, {sup 139}Ce, {sup 88}Y, {sup 123}I and {sup 211}At isotopes using various target backings. Directions concerning target cooling and beam parameters are also described 25 refs, 1 tab

  6. Theoretical study on production cross sections of exotic actinide nuclei in multinucleon transfer reactions

    Science.gov (United States)

    Zhu, Long

    2017-12-01

    Within the dinuclear system (DNS) model, the multinucleon transfer reactions 129,136Xe + 248Cm, 112Sn + 238U, and 144Xe + 248Cm are investigated. The production cross sections of primary fragments are calculated with the DNS model. By using a statistical model, we investigate the influence of charged particle evaporation channels on production cross sections of exotic nuclei. It is found that for excited neutron-deficient nuclei the charged particle evaporation competes with neutron emission and plays an important role in the cooling process. The production cross sections of several exotic actinide nuclei are predicted in the reactions 112Sn + 238U and 136,144Xe + 248Cm. Considering the beam intensities, the collisions of 136,144Xe projectiles with a 248Cm target for producing neutron-rich nuclei with Z=92‑96 are investigated. Supported by National Natural Science Foundation of China (11605296) and Natural Science Foundation of Guangdong Province, China (2016A030310208)

  7. Sleep Apnea and Hypoventilation in Patients with Down Syndrome: Analysis of 144 Polysomnogram Studies

    Directory of Open Access Journals (Sweden)

    Zheng Fan

    2017-06-01

    Full Text Available Patients with Down syndrome (DS are at risk for both obstructive sleep apnea (OSA and central sleep apnea (CSA; however, it is unclear how these components evolve as patients age and whether patients are also at risk for hypoventilation. A retrospective review of 144 diagnostic polysomnograms (PSG in a tertiary care facility over 10 years was conducted. Descriptive data and exploratory correlation analyses were performed. Sleep disordered breathing was common (seen in 78% of patients with an average apnea-hypopnea index (AHI = 10. The relative amount of obstructive apnea was positively correlated with age and body mass index (BMI. The relative amount of central sleep apnea was associated with younger age in the very youngest group (0–3 years. Hypoventilation was common occurring in more than 22% of patients and there was a positive correlation between the maximum CO2 and BMI. Sleep disordered breathing, including hypoventilation, was common in patients with DS. The obstructive component increased significantly with age and BMI, while the central component occurred most in the very young age group. Due to the high risk of hypoventilation, which has not been previously highlighted, it may be helpful to consider therapies to target both apnea and hypoventilation in this population.

  8. 143rd and 144th meetings of the Governing Board of the Pension Fund

    CERN Multimedia

    2006-01-01

    The Governing Board of the Pension Fund held its 143rd and 144th meetings on 16 May and 13 June respectively. At the first of these two meetings, the Board took note of the report by the Austrian Court of Audit on the 2005 financial year and of the associated comments by the Administration of the Fund. It also listened to a report by the Chairman of the Investment Committee on the latter's 10 May meeting, at which the two fund managers responsible for the "QUAM" and "Far East Ex-Japan" portfolios had been interviewed and their performances judged satisfactory. The Committee had also decided to commission ORTEC to carry out a full assets/liabilities modelling study during the current year. During the meeting, the Board also approved a document setting out its position on the CERN debt to the Pension Fund, which would be submitted to the Finance Committee and Council in June. It underlined that the reimbursement of the debt would be advantageous for the Fund as well as for the Laboratory and that it would re...

  9. Spatiotemporal structure of a laser beam over 144 km in a Canary Islands experiment.

    Science.gov (United States)

    Gurvich, Alexandre S; Gorbunov, Michael E; Fedorova, Olga V; Kirchengast, Gottfried; Proschek, Veronika; González Abad, Gonzalo; Tereszchuk, Keith A

    2012-10-20

    We analyzed the observations of scintillations in a laser beam (532 nm, ~200 mW power) traveling along a 144 km path at an altitude of 2.2-2.4 km above sea level, just above the atmospheric boundary layer, between the islands of La Palma and Tenerife. The observations were performed during nighttime on 18 July 2011, by means of a telescope with an aperture diameter of 1 m. Strong scintillations were observed. The estimates of spatial spectra and correlation functions indicated that the observed intensity fields possess, statistically, a locally isotropic structure, which agrees with the idea of a locally isotropic turbulence. The estimates of spatial autospectra and autocorrelation functions of the intensity field indicated that the characteristic scale of the internal structure of the observed clusters is 6.5-8 mm, while the characteristic size of the clusters is 4-5 cm. The major contribution to the observed scintillations comes from the inhomogeneities of the intensity field with scales from 1-2 cm up to 10-12 cm. The analysis of the cross-spectra indicated that the hypothesis of frozen turbulence introduced by Taylor can be used for the description of spatiotemporal structure of intensity fluctuations of laser beams traveling through long paths in the atmosphere.

  10. Fever of unknown origin in adults: evaluation of 144 cases in a non-university hospital.

    Science.gov (United States)

    Zenone, Thierry

    2006-01-01

    The spectrum of diseases found in series of fever of unknown origin shows variation in relation to selection bias; particularly, selection of the most difficult cases in tertiary reference university centres. We present a series of 144 patients presenting to a non-university hospital between 1999 and 2005 (secondary level of the health care system) with a community-acquired fever of unknown origin. In 37 cases (25.7%), the reason for fever could not be explained. Among the 107 patients with a final diagnosis (74.3%), non-infectious inflammatory disorders represented the most prevalent category (35.5%), surpassing infections (30.8%), miscellaneous causes (20.6%) and malignancies (13.5%). 13 entities accounted for over 68% of diagnoses (sinusitis and occult dental infections, Q fever, Epstein-Barr virus and cytomegalovirus infections, lymphoma, colo-rectal adenocarcinoma, adult-onset Still disease, systemic lupus erythematosus, giant cell arteritis and/or polymyalgia rheumatica, rheumatoid arthritis, polyarteritis nodosa, factitious fever and habitual hyperthermia). As demonstrated in other studies, non-infectious inflammatory diseases emerge as the most prevalent diagnostic category. Giant cell arteritis and polymyalgia rheumatica were particularly frequent in the elderly. Epstein-Barr virus and cytomegalovirus infections and habitual hyperthermia were particularly frequent in the youngest patients. There were no major differences in repartition of diagnostic categories between this series and historical university series.

  11. The high-affinity peptidoglycan binding domain of Pseudomonas phage endolysin KZ144

    Energy Technology Data Exchange (ETDEWEB)

    Briers, Yves [Division of Gene Technology, Department of Biosystems, Katholieke Universiteit Leuven, Kasteelpark Arenberg 21, B-3001 Leuven (Belgium); Schmelcher, Mathias; Loessner, Martin J. [Institute of Food Science and Nutrition, ETH Zuerich, Schmelzbergstrasse 7, CH-8092 Zuerich (Switzerland); Hendrix, Jelle; Engelborghs, Yves [Laboratory of Biomolecular Dynamics, Department of Chemistry, Katholieke Universiteit Leuven, Celestijnenlaan 200G, B-3001 Leuven (Belgium); Volckaert, Guido [Division of Gene Technology, Department of Biosystems, Katholieke Universiteit Leuven, Kasteelpark Arenberg 21, B-3001 Leuven (Belgium); Lavigne, Rob, E-mail: rob.lavigne@biw.kuleuven.be [Division of Gene Technology, Department of Biosystems, Katholieke Universiteit Leuven, Kasteelpark Arenberg 21, B-3001 Leuven (Belgium)

    2009-05-29

    The binding affinity of the N-terminal peptidoglycan binding domain of endolysin KZ144 (PBD{sub KZ}), originating from Pseudomonas aeruginosa bacteriophage {phi}KZ, has been examined using a fusion protein of PBD{sub KZ} and green fluorescent protein (PBD{sub KZ}-GFP). A fluorescence recovery after photobleaching analysis of bound PBD{sub KZ}-GFP molecules showed less than 10% fluorescence recovery in the bleached area within 15 min. Surface plasmon resonance analysis confirmed this apparent high binding affinity revealing an equilibrium affinity constant of 2.95 x 10{sup 7} M{sup -1} for the PBD{sub KZ}-peptidoglycan interaction. This unique domain, which binds to the peptidoglycan of all tested Gram-negative species, was harnessed to improve the specific activity of the peptidoglycan hydrolase domain KMV36C. The chimeric peptidoglycan hydrolase (PBD{sub KZ}-KMV36C) exhibits a threefold higher specific activity than the native catalytic domain (KMV36C). These results demonstrate that the modular assembly of functional domains is a rational approach to improve the specific activity of endolysins from phages infecting Gram-negatives.

  12. Stereotypical hand movements in 144 subjects with Rett syndrome from the population-based Australian database.

    Science.gov (United States)

    Carter, Philippa; Downs, Jenny; Bebbington, Ami; Williams, Simon; Jacoby, Peter; Kaufmann, Walter E; Leonard, Helen

    2010-02-15

    Stereotypic hand movements are a feature of Rett Syndrome but few studies have observed their nature systematically. Video data in familiar settings were obtained on subjects (n = 144) identified from an Australian population-based database. Hand stereotypies were demonstrated by most subjects (94.4%), 15 categories were observed and midline wringing was seen in approximately 60% of subjects. There was a median of two stereotypies per subject but this number decreased with age. Clapping and mouthing of hands were more prevalent in girls younger than 8 years and wringing was more prevalent in women 19 years or older. Clapping was commoner in those with p.R306C and early truncating mutations, and much rarer in those with p.R106W, p.R270X, p.R168X, and p.R255X. Stereotypies tended to be less frequent in those with more severe mutations. Otherwise, there were no clear relationships between our categories of stereotypies and mutation. Approximately a quarter each had predominantly right and left handed stereotypies and for the remaining half, no clear laterality was seen. Results were similar for all cases and when restricted to those with a pathogenic mutation. Hand stereotypies changed with increasing age but limited relationships with MECP2 mutations were identified. (c) 2009 Movement Disorder Society.

  13. Greenhouse gas measurements over a 144 km open path in the Canary Islands

    Directory of Open Access Journals (Sweden)

    J. S. A. Brooke

    2012-09-01

    Full Text Available A new technique for the satellite remote sensing of greenhouse gases in the atmosphere via the absorption of short-wave infrared laser signals transmitted between counter-rotating satellites in low Earth orbit has recently been proposed; this would enable the acquisition of a long-term, stable, global set of altitude-resolved concentration measurements. We present the first ground-based experimental demonstration of this new infrared-laser occultation method, in which the atmospheric absorption of CO2 near 2.1 μm was measured over a ~144 km path length between two peaks in the Canary Islands (at an altitude of ~2.4 km, using relatively low power diode lasers (~4 to 10 mW. The retrieved CO2 volume mixing ratio of 400 ppm (±15 ppm is consistent within experimental uncertainty with simultaneously recorded in situ validation measurements. We conclude that the new method has a sound basis for monitoring CO2 in the free atmosphere; other greenhouse gases such as methane, nitrous oxide and water vapour can be monitored in the same way.

  14. Identification of a novel homozygous mutation (S144I) in a Malay patient with maple syrup urine disease.

    Science.gov (United States)

    Ali, Ernie Zuraida; Yunus, Zabedah Md; Desa, Norsiah Md; Hock, Ngu Lock

    2013-01-01

    Maple syrup urine disease (MSUD) is a rare autosomal recessive metabolic disorder of branched-chain amino acid metabolism caused by the defective function of branched-chain α-ketoacid dehydrogenase complex (BCKDH). It is characterised by increased plasma leucine, isoleucine, and valine levels, and mutations can be detected in any one of the BCKDHA, BCKDHB, and DBT genes. In this study, we describe the molecular basis of a novel mutation found in one MSUD Malay patient from consanguineous parents. A homozygous mutation has been detected in this patient whose both parents carried a heterozygous mutation at DNA coding region c.431G>T in exon 4, which resulted in a substitution of serine to isoleucine at codon 144 (p.S144I). In silico analysis predicted S144I to be potentially damaging. The mutation was located on the alpha helical region of the BCKDHA protein, and it is predicted to affect the stability of protein due to the loss of various polar interactions between local secondary structures. Homology analysis revealed that this mutation occurred in a highly conserved region (100%). This result indicates that S144I mutation is likely pathogenic and may contribute to the classic form of MSUD in this patient.

  15. The potential impact of RV144-like vaccines in rural South Africa: a study using the STDSIM microsimulation model.

    NARCIS (Netherlands)

    Hontelez, J.A.; Nagelkerke, N.; Barnighausen, T.; Bakker, R.; Tanser, F.; Newell, M.L.; Lurie, M.N.; Baltussen, R.M.P.M.; Vlas, S.J. de

    2011-01-01

    BACKGROUND: The only successful HIV vaccine trial to date is the RV144 trial of the ALVAC/AIDSVAX vaccine in Thailand, which showed an overall incidence reduction of 31%. Most cases were prevented in the first year, suggesting a rapidly waning efficacy. Here, we predict the population level impact

  16. Met144Ala mutation of the copper-containing nitrite reductase from Alcaligenes xylosoxidans reverses the intramolecular electron transfer

    DEFF Research Database (Denmark)

    Farver, Ole; Eady, Robert R; Sawers, Gary

    2004-01-01

    Pulse radiolysis has been employed to investigate the intramolecular electron transfer (ET) between the type 1 (T1) and type 2 (T2) copper sites in the Met144Ala Alcaligenes xylosoxidans nitrite reductase (AxCuNiR) mutant. This mutation increases the reduction potential of the T1 copper center...

  17. Cosmic-ray history derived from the {sup 54}Mn, {sup 56}Ni and {sup 144}Pm chronometers

    Energy Technology Data Exchange (ETDEWEB)

    Zaerpoor, K.; Chan, Y.D.; DiGregorio, D.E.; Dragowsky, M.R.; Hindi, M.M.; Isaac, M.C.P.; Krane, K.S.; Larimer, R.-M.; Macchiavelli, A.O.; Macleod, R. W.; Miocinovic, P.; Norman, E.B.; Robinson, S.J

    1999-07-26

    Sources of {sup 54}Mn, {sup 56}Ni, and {sup 144}Pm were placed at the center of the Gammasphere array and searches were made for the astrophysically interesting {beta}{sup +} decay modes of these isotopes. The results of these searches are presented and the implications for cosmic-ray physics are discussed.

  18. Human cytomegalovirus UL55, UL144, and US28 genotype distribution in infants infected congenitally or postnatally.

    Science.gov (United States)

    Paradowska, Edyta; Studzińska, Mirosława; Suski, Patrycja; Kasztelewicz, Beata; Wiśniewska-Ligier, Małgorzata; Zawilińska, Barbara; Gaj, Zuzanna; Nowakowska, Dorota

    2015-10-01

    Cytomegalovirus (CMV) is the most common cause of congenital infection. This pathogen exhibits extensive genetic variability in the genes that encode structural envelope glycoproteins, regulatory proteins, and proteins that contribute to immune evasion. However, the role of specific viral strains in the outcome of congenital CMV infection is unclear. Variation in the UL55 gene encoding glycoprotein B (gB), the UL144 gene encoding TNF α-like receptor, and the US28 gene encoding β-chemokine receptor was determined in 60 newborn infants with congenital CMV infection and 90 infants with postnatal or undefined CMV infection. CMV polymorphisms were studied in relation to disease outcome and viral load. Genotyping was performed by a sequencing analysis of PCR-amplified fragments, and the viral load was measured by quantitative real-time PCR. The results demonstrated that (1) the UL55 and US28 genotype distributions were similar among the group of congenital and postnatal CMV infection; (2) the UL144 B1 genotype was more prevalent in congenital than in postnatal infection and was detected in 70% of newborns with asymptomatic congenital infection; and (3) none of the examined genotype was significantly linked with symptomatic CMV infection. No relationship was observed between genotype and viral load. The results revealed that UL55, UL144, and US28 polymorphisms are not associated with the outcome of CMV infection in infants, but the presence of UL144 B1 genotype might be virological marker of asymptomatic infection at birth. © 2015 Wiley Periodicals, Inc.

  19. Spallation reactions; Reactions de spallation

    Energy Technology Data Exchange (ETDEWEB)

    Cugon, J.

    1996-12-31

    Spallation reactions dominate the interactions of hadrons with nuclei in the GeV range (from {approx} 0.1 to {approx} 10 GeV). They correspond to a sometimes important ejection of light particles leaving most of the time a residue of mass commensurate with the target mass. The main features of the experimental data are briefly reviewed. The most successful theoretical model, namely the intranuclear cascade + evaporation model, is presented. Its physical content, results and possible improvements are critically discussed. Alternative approaches are shortly reviewed. (author). 84 refs.

  20. Theoretical study on production of heavy neutron-rich isotopes around the N=126 shell closure in radioactive beam induced transfer reactions

    Directory of Open Access Journals (Sweden)

    Long Zhu

    2017-04-01

    Full Text Available In order to produce more unknown neutron-rich nuclei around N=126, the transfer reactions 136Xe + 198Pt, 136–144Xe + 208Pb, and 132Sn + 208Pb are investigated within the framework of the dinuclear system (DNS model. The influence of neutron excess of projectile on production cross sections of target-like products is studied through the reactions 136,144Xe + 208Pb. We find that the radioactive projectile 144Xe with much larger neutron excess is favorable to produce neutron-rich nuclei with charge number less than the target rather than produce transtarget nuclei. The incident energy dependence of yield distributions of fragments in the reaction 132Sn + 208Pb are also studied. The production cross sections of neutron-rich nuclei with Z=72–77 are predicted in the reactions 136–144Xe + 208Pb and 132Sn + 208Pb. It is noticed that the production cross sections of unknown neutron-rich nuclei in the reaction 144Xe + 208Pb are at least two orders of magnitude larger than those in the reaction 136Xe + 208Pb. The radioactive beam induced transfer reactions 139,144Xe + 208Pb, considering beam intensities proposed in SPIRAL2 (Production System of Radioactive Ion and Acceleration On-Line project as well, for production of neutron-rich nuclei around the N=126 shell closure are investigated for the first time. It is found that, in comparison to the stable beam 136Xe, the radioactive beam 144Xe shows great advantages for producing neutron-rich nuclei with N=126 and the advantages get more obvious for producing nuclei with less charge number.

  1. Genotype by environment interaction for litter size in pigs as quantified by reaction norms analysis

    DEFF Research Database (Denmark)

    Knap, P W; Su, G

    2008-01-01

    A Bayesian procedure was used to estimate linear reaction norms (i.e. individual G × E plots) on 297 518 litter size records of 121 104 sows, daughters of 2040 sires, recorded on 144 farms in North and Latin America, Europe, Asia and Australia. The method allowed for simultaneous estimation of al...

  2. Trueperella pyogenes multispecies infections in domestic animals: a retrospective study of 144 cases (2002 to 2012).

    Science.gov (United States)

    Ribeiro, M G; Risseti, R M; Bolaños, C A D; Caffaro, K A; de Morais, A C B; Lara, G H B; Zamprogna, T O; Paes, A C; Listoni, F J P; Franco, M M J

    2015-06-01

    Formerly, Arcanobacterium pyogenes was recently renamed Trueperella pyogenes. This opportunistic bacterium is related to miscellaneous pyogenic infections in animals. Most studies involving T. pyogenes are case reports, whereas few surveys have focused the major aspects of T. pyogenes infections involving a case series study design. The aim of this study was to retrospectively evaluate selected epidemiological and clinical aspects, as well as the in vitro antimicrobial susceptibility pattern of 144 cases of T. pyogenes infections among domestic animals from 2002 to 2012. T. pyogenes was isolated from different clinical specimens from cattle, goats, sheep, pigs, horses, dogs, and buffaloes. Correlations were assessed by the Chi-square or Fisher's exact tests. Mastitis (45.1%), abscesses (18.0%), pneumonia (11.1%), and lymphadenitis (9.0%) were the most common clinical manifestations. In addition, the organism was also isolated from other miscellaneous clinical specimens from cases of septicemia, encephalitis, pyometra, prostatitis, orchitis, seminal vesiculitis, pericarditis, and omphalitis. No statistical association was observed between T. pyogenes infections and age, gender, or season across the study. The most effective drugs against the pathogen were florfenicol (99.1%), cefoperazone (96.0%), cephalexin (95.0%), and ceftiofur (94.8%). High resistance rates were observed against trimethoprim-sulfamethoxazole (49.3%), followed by norfloxacin (10.9%) and tetracycline (9.2%). This study highlights the diversity of clinical manifestations and the opportunistic behavior of T. pyogenes infections in domestic animals, with predominance of mastitis, abscesses, pneumonia, and lymphadenitis. It also reinforces the importance of knowing the susceptibility profile before initiating therapy, to improve antimicrobial therapy approaches.

  3. Modelling Chemical Reasoning to Predict and Invent Reactions.

    Science.gov (United States)

    Segler, Marwin H S; Waller, Mark P

    2017-05-02

    The ability to reason beyond established knowledge allows organic chemists to solve synthetic problems and invent novel transformations. Herein, we propose a model that mimics chemical reasoning, and formalises reaction prediction as finding missing links in a knowledge graph. We have constructed a knowledge graph containing 14.4 million molecules and 8.2 million binary reactions, which represents the bulk of all chemical reactions ever published in the scientific literature. Our model outperforms a rule-based expert system in the reaction prediction task for 180 000 randomly selected binary reactions. The data-driven model generalises even beyond known reaction types, and is thus capable of effectively (re-)discovering novel transformations (even including transition metal-catalysed reactions). Our model enables computers to infer hypotheses about reactivity and reactions by only considering the intrinsic local structure of the graph and because each single reaction prediction is typically achieved in a sub-second time frame, the model can be used as a high-throughput generator of reaction hypotheses for reaction discovery. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. CDCC calculations of elastic scattering for the systems 6Li+144Sm and 6Li+208Pb. Effect of resonances of 6Li on elastic scattering angular distributions

    Science.gov (United States)

    Gómez Camacho, A.

    2015-01-01

    Calculations of elastic scattering angular distributions for reactions of the weakly bound projectile 6Li with targets 144Sm and 208Pb at energies above the barrier, are performed with the Continuum Discretized Coupled-Channel method (CDCC). Ground, resonant and nonresonant continuum states of 6Li are included up to some maximum energy epsilonmax for which convergence is achieved. In the three-body system, global interactions are used for the α-target and d - target sub-systems. The effect of continuum resonant states of 6Li, i.e., l = 2, jπ = 3+, 2+ and 1+ on elastic scattering angular distributions is investigated by extracting these states from the continuum space. It is found that the calculated elastic scattering angular distributions are in good agreement with the measurements for most of the cases studied where consideration of couplings to continuum states is essential. It is also found that the resonance character of the continuum states is in some cases important to obtain agreement with the data.

  5. Collision-induced dissociation of monolayer protected clusters Au144 and Au130 in an electrospray time-of-flight mass spectrometer.

    Science.gov (United States)

    Black, David M; Bhattarai, Nabraj; Whetten, Robert L; Bach, Stephan B H

    2014-11-13

    Gas-phase reactions of larger gold clusters are poorly known because generation of the intact parent species for mass spectrometric analysis remains quite challenging. Herein we report in-source collision-induced dissociation (CID) results for the monolayer protected clusters (MPCs) Au144(SR)60 and Au130(SR)50, where R- = PhCH2CH2-, in a Bruker micrOTOF time-of-flight mass spectrometer. A sample mixture of the two clusters was introduced into the mass spectrometer by positive mode electrospray ionization. Standard source conditions were used to acquire a reference mass spectrum, exhibiting negligible fragmentation, and then the capillary-skimmer potential difference was increased to induce in-source CID within this low-pressure region (∼4 mbar). Remarkably, distinctive fragmentation patterns are observed for each MPC[3+] parent ion. An assignment of all the major dissociation products (ions and neutrals) is deduced and interpreted by using the distinguishing characteristics in the standard structure-models for the respective MPCs. Also, we propose a ring-forming elimination mechanism to explain R-H neutral loss, as separate from the channels leading to RS-SR or (AuSR)4 neutrals.

  6. Insight into 144 patients with ocular vascular events during VEGF antagonist injections

    Directory of Open Access Journals (Sweden)

    Shami M

    2012-03-01

    Full Text Available Ahmad M Mansour1, Maha Shahin2, Peter K Kofoed3, Maurizio B Parodi4, Michel Shami5, Stephen G Schwartz6, Collaborative Anti-VEGF Ocular Vascular Complications GroupDepartment of Ophthalmology, 1American University of Beirut, Beirut, Lebanon, Rafic Hariri University Hospital, Beirut, Lebanon; 2Mansoura University, Mansoura City, Egypt; 3Glostrup Hospital, University of Copenhagen, Denmark, National Eye Clinic, Kennedy Center, Glostrup, Denmark; 4University Vita-Salute, Scientific Institute San Raffaele, Milan, Italy; 5Texas Tech University Health Sciences Center, Lubbock, TX, USA; 6Bascom Palmer Eye Institute, University of Miami Miller School of Medicine, Naples and Miami, FL, USAAim: To record ocular vascular events following injections of vascular endothelium growth factor (VEGF antagonists.Methods: Collaborative multicenter case series (48 cases, literature reviews (32 cases, and reports to the FDA (64 cases of patients that had vascular occlusions during anti-VEGF therapy were collected and analyzed.Results: A total of 144 cases of ocular vascular events were identified, with these diagnosed a median of 15 days after anti-VEGF injection. The majority of patients had pre-existing risk factors for cardiovascular events and nine patients had a prior history of glaucoma. Mean visual acuity dropped by 6.4 lines with severe visual loss after injection to NLP (five eyes, LP (six eyes, and HM (two eyes. The overall risk of ocular vascular events following a VEGF antagonist injection was 0.108% in the general population and 2.61% in the diabetic population. Mean retinal arterial constriction after intravitreal bevacizumab in 13 eyes was 21% (standard deviation = 27%, and mean retinal venous constriction was 8% (standard deviation = 30%.Conclusion: Ocular vascular events are rare during anti-VEGF therapy, but can lead to severe visual loss and may be caused by a number of factors including the vasoconstrictor effect of the drug, a post-injection rise

  7. Kolejność obowiązku alimentacyjnego z art. 144 kodeksu rodzinnego i opiekuńczego

    OpenAIRE

    Szlęzak, Andrzej

    1982-01-01

    The problem of alimentary duties between step-parents and step-children has often been referred to in the works of legal writers. However, the question of the sequence of the said duties has not been satisfactorily explained. The authors, despite the wording of sec. 144, are unanimous that it should be determined with regardless of the principles of social coexistence. In the present paper, the author undertakes the task of proving that the adoption of the said principles in...

  8. 29 CFR 780.144 - “As an incident to or in conjunction with” the farming operations.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false âAs an incident to or in conjunction withâ the farming... in Conjunction Withâ the Farming Operations § 780.144 “As an incident to or in conjunction with” the farming operations. In order for practices other than actual farming operations to constitute “agriculture...

  9. Retrospective evaluation of bone pain palliation after samarium-153-EDTMP therapy Avaliação retrospectiva do tratamento da dor óssea metastática com Samário-153-EDTMP

    Directory of Open Access Journals (Sweden)

    Marcelo Tatit Sapienza

    2004-01-01

    Full Text Available PURPOSE: The aim of this study was to evaluate the degree of metastatic bone pain palliation and medullar toxicity associated with samarium-153-EDTMP treatment. METHODS: Seventy-three patients with metastatic bone pain having previously undergone therapy with samarium-153-EDTMP (1 mCi/kg were retrospectively evaluated. Routine follow-up included pain evaluation and blood counts for 2 months after treatment. Pain was evaluated using a subjective scale (from 0 to 10 before and for 8 weeks after the treatment. Blood counts were obtained before treatment and once a week for 2 months during follow-up. Dosimetry, based upon the urinary excretion of the isotope, was estimated in 41 individuals, and the resulting radiation absorbed doses were correlated with hematological data. RESULTS: Reduction in pain scores of 75% to 100% was obtained in 36 patients (49%, with a decrease of 50% to 75%, 25% to 50%, and 0% to 25% in, respectively, 20 (27%, 10 (14%, and 7 (10% patients. There was no significant relationship between the pain response and location of the primary tumor (breast or prostate cancer. Mild to moderate myelosuppression was noted in 75.3% of patients, usually with hematological recovery at 8 weeks. The mean bone marrow dose was 347 ± 65 cGy, and only a weak correlation was found between absorbed dose and myelosuppression (Pearson coefficient = .4. CONCLUSIONS: Samarium-153-EDTMP is a valuable method for metastatic bone pain palliation. A mild to moderate and transitory myelosuppression is the main toxicity observed after samarium therapy, showing a weak correlation with dosimetric measures.OBJETIVO: O presente trabalho teve por objetivo avaliar o efeito paliativo da dor e a toxicidade medular associados ao tratamento com Samário-153-EDTMP em pacientes com metástases ósseas. MÉTODOS: O estudo foi realizado de forma retrospectiva, a partir do levantamento de prontuário de 178 pacientes submetidos a tratamento com 1mCi/kg de 153Sm

  10. The dynamics of the laser-induced metal-semiconductor phase transition of samarium sulfide (SmS); Die Dynamik des laserinduzierten Metall-Halbleiter-Phasenuebergangs von Samariumsulfid (SmS)

    Energy Technology Data Exchange (ETDEWEB)

    Kaempfer, Tino

    2009-12-15

    The present thesis is dedicated to the experimental study of the metal-semiconductor phase transition of samarium sulfide (SmS): Temperature- and time-resolved experiments on the characterization of the phase transition of mixed-valence SmS samples (M-SmS) are presented. The measurement of the dynamics of the laser-induced phase transition pursues via time-resolved ultrashort-time microscopy and by X-ray diffraction with sub-picosecond time resolution. The electronic and structural processes, which follow an excitation of M-SmS with infrared femtosecond laser pulses, are physically interpreted on the base of the results obtained in this thesis and model imaginations. [German] Die vorliegende Arbeit ist der experimentellen Untersuchung des Metall-Halbleiter-Phasenuebergangs von Samariumsulfid (SmS) gewidmet. Es werden temperatur- und zeitaufgeloeste Experimente zur Charakterisierung des Phasenuebergangs gemischt-valenter SmS Proben (M-SmS) vorgestellt. Die Messung der Dynamik des laserinduzierten Phasenuebergangs erfolgt ueber zeitaufgeloeste Ultrakurzzeit-Mikroskopie und durch Roentgenbeugung mit subpikosekunden Zeitaufloesung. Die elektronischen und strukturellen Prozesse, welche einer Anregung von M-SmS mit infraroten Femtosekunden-Laserpulsen folgen, werden auf der Basis der in dieser Arbeit gewonnenen Ergebnisse und Modellvorstellungen physikalisch interpretiert. (orig.)

  11. Lanthanide derivatives comprising arylhydrazones of β-diketones: cooperative E/Z isomerization and catalytic activity in nitroaldol reaction.

    Science.gov (United States)

    Mahmudov, Kamran T; Guedes da Silva, M Fátima C; Sutradhar, Manas; Kopylovich, Maximilian N; Huseynov, Fatali E; Shamilov, Nazim T; Voronina, Anna A; Buslaeva, Tatyana M; Pombeiro, Armando J L

    2015-03-28

    Two complexes [KLa(HL(1))2{(CH3)2NCHO}2(H2O)3] (1) and [Sm(H2O)9](E-H2L(2))3·2H2O (2) were synthesized by the reaction of lanthanum(III) and samarium(III) nitrates with potassium 3-(2-(2,4-dioxopentan-3-ylidene)hydrazinyl)-2-hydroxy-5-nitrobenzenesulfonate (KH2L(1)) and potassium (E,Z)-5-chloro-3-(2-(1,3-dioxo-1-phenylbutan-2-ylidene)hydrazinyl)-2-hydroxybenzenesulfonate (KH2L(2)), respectively. Both complexes were fully characterized by elemental analysis, IR, (1)H and (13)C NMR spectroscopy, ESI-MS and single-crystal X-ray diffraction. Cooperative E,Z→E isomerization of KH2L(2), induced by resonance assisted hydrogen bonding and ionic interactions, occurs upon the interaction with Sm(III). Catalytic activities of KH2L(1,2) and their lanthanide derivatives were evaluated in the Henry reaction of nitroethane with a variety of aromatic and aliphatic aldehydes. Good yields (up to 91%) and diastereoselectivities (syn/anti 3 : 1) were observed in the reactions catalyzed by 1 in water.

  12. Effects of the dimeric PSD-95 inhibitor UCCB01-144 in mouse models of pain, cognition and motor function

    DEFF Research Database (Denmark)

    Andreasen, Jesper T; Nasser, Arafat; Caballero-Puntiverio, Maitane

    2016-01-01

    NMDAR antagonism shows analgesic action in humans and animal pain models, but disrupts cognitive and motor functions. NMDAR-dependent NO production requires tethering of the NMDAR to neuronal NO synthase (nNOS) by the postsynaptic density protein-95 (PSD-95). Perturbing the NMDAR/PSD-95/nNOS inte...... in the STFP test. Collectively, UCCB01-144 reversed both CFA and SNI-induced hypersensitivity, but the efficacy in the SNI model was only transient. This suggests that enhanced BBB permeability of PSD-95 inhibitors improves the analgesic action in neuropathic pain states.......NOS interaction has therefore been proposed as an alternative analgesic mechanism. We recently reported that UCCB01-125, a dimeric PSD-95 inhibitor with limited blood-brain-barrier permeability, reduced mechanical hypersensitivity in the complete Freund's adjuvant (CFA) inflammatory pain model, without disrupting...... of neuropathic pain. Potential cognitive effects of UCCB01-144 were examined using the social transmission of food preference (STFP) test and the V-maze test, and motor coordination was assessed with the rotarod test. UCCB01-144 (10mg/kg) reversed CFA-induced mechanical hypersensitivity after 1h, and completely...

  13. Reaction pathways of oxide-reduction-diffusion (ORD) synthesis of SmCo5 and in situ study of its hydrogen induced amorphization (HIA)

    Science.gov (United States)

    Belener, Kevin L. A.; Kohlmann, Holger

    2014-12-01

    A modified oxide-reduction-diffusion (ORD) method for the synthesis of single-phase SmCo5 is described. Samarium oxide, cobalt and calcium (20% excess) are heated in sealed niobium tubes following an optimized temperature programme. The reaction proceeds via Ca1-xSmxO as an intermediate and yields SmCo5, and CaO, which may be washed off with dilute acetic acid. Single-phase SmCo5 prepared by this route shows an enhanced reactivity towards hydrogen and reacts already at moderate conditions of p(H2)=0.1 MPa and TX-ray powder diffraction suggest the formation of ternary hydrides SmCo5Hx at temperatures around 473 and 573 K, and disproportionation into cobalt of poor crystallinity and probably an amorphous binary samarium hydride at 700 K, i.e. a hydrogen induced amorphization (HIA) of SmCo5. Neutron powder diffraction was carried out on a 154SmCo5 sample with the high-intensity neutron powder diffractometer D20 at the Institute Laue-Langevin, Grenoble, France. The CaCu5 type crystal structure was confirmed (space group P6/mmm, a=500.60 (2) pm, c=397.01 (2) pm at T=298 (1) K) and the magnetic moments along the crystallographic c axis, μ||c, were refined to be 0.15 (6), 2.02 (6) and 1.75 (5) μB for Sm, Co1 and Co2 atoms, respectively, in ferromagnetic SmCo5. The HIA process was confirmed by in situ neutron powder diffraction at higher pressures of 8.1 MPa deuterium gas.

  14. Methanol Adsorption and Reaction on Samaria Thin Films on Pt(111

    Directory of Open Access Journals (Sweden)

    Jin-Hao Jhang

    2015-09-01

    Full Text Available We investigated the adsorption and reaction of methanol on continuous and discontinuous films of samarium oxide (SmOx grown on Pt(111 in ultrahigh vacuum. The methanol decomposition was studied by temperature programmed desorption (TPD and infrared reflection absorption spectroscopy (IRRAS, while structural changes of the oxide surface were monitored by low-energy electron diffraction (LEED. Methanol dehydrogenates to adsorbed methoxy species on both the continuous and discontinuous SmOx films, eventually leading to the desorption of CO and H2 which desorbs at temperatures in the range 400–600 K. Small quantities of CO2 are also detected mainly on as-prepared Sm2O3 thin films, but the production of CO2 is limited during repeated TPD runs. The discontinuous film exhibits the highest reactivity compared to the continuous film and the Pt(111 substrate. The reactivity of methanol on reduced and reoxidized films was also investigated, revealing how SmOx structures influence the chemical behavior. Over repeated TPD experiments, a SmOx structural/chemical equilibrium condition is found which can be approached either from oxidized or reduced films. We also observed hydrogen absence in TPD which indicates that hydrogen is stored either in SmOx films or as OH groups on the SmOx surfaces.

  15. Anaphylaxis-Like Reactions

    Science.gov (United States)

    ... Home Conditions Anaphylaxis Anaphylaxis-Like Reactions Anaphylaxis-Like Reactions Make an Appointment Refer a Patient Ask a ... exposed to a foreign substance, some people suffer reactions identical to anaphylaxis, but no allergy (IgE antibody) ...

  16. Catalysis of Photochemical Reactions.

    Science.gov (United States)

    Albini, A.

    1986-01-01

    Offers a classification system of catalytic effects in photochemical reactions, contrasting characteristic properties of photochemical and thermal reactions. Discusses catalysis and sensitization, examples of catalyzed reactions of excepted states, complexing ground state substrates, and catalysis of primary photoproducts. (JM)

  17. Metabolic Profile of Synthetic Cannabinoids 5F-PB-22, PB-22, XLR-11 and UR-144 by Cunninghamella elegans.

    Science.gov (United States)

    Watanabe, Shimpei; Kuzhiumparambil, Unnikrishnan; Nguyen, My Ann; Cameron, Jane; Fu, Shanlin

    2017-07-01

    The knowledge of metabolic profile of synthetic cannabinoids is important for the detection of drugs in urinalysis due to the typical absence or low abundance of parent cannabinoids in human urine. The fungus Cunninghamella elegans has been reported to be a useful tool for metabolism study and thus applicability to synthetic cannabinoid metabolism was examined. In this study, 8-quinolinyl 1-(5-fluoropentyl)-1H-indole-3-carboxylate (5F-PB-22), 8-quinolinyl 1-pentyl-1H-indole-3-carboxylate (PB-22), [1-(5-fluoropentyl)-1H-indol-3-yl](2,2,3,3-tetramethylcyclopropyl)methanone (XLR-11) and (1-pentyl-1H-indol-3-yl)(2,2,3,3-tetramethylcyclopropyl)methanone (UR-144) were incubated with C. elegans and the metabolites were identified using liquid chromatography-quadrupole time-of-flight mass spectrometry. The obtained metabolites were compared with reported human metabolites to assess the suitability of the fungus to extrapolate human metabolism. 5F-PB-22 underwent dihydroxylation, dihydrodiol formation, oxidative defluorination, oxidative defluorination to carboxylic acid, ester hydrolysis and glucosidation, alone and/or in combination. The metabolites of PB-22 were generated by hydroxylation, dihydroxylation, trihydroxylation, dihydrodiol formation, ketone formation, carboxylation, ester hydrolysis and glucosidation, alone and/or in combination. XLR-11 was transformed through hydroxylation, dihydroxylation, aldehyde formation, carboxylation, oxidative defluorination, oxidative defluorination to carboxylic acid and glucosidation, alone and/or in combination. UR-144 was metabolised by hydroxylation, dihydroxylation, trihydroxylation, aldehyde formation, ketone formation, carboxylation, N-dealkylation and combinations. These findings were consistent with previously reported human metabolism except for the small extent of ester hydrolysis observed and the absence of glucuronidation. Despite the limitations, C. elegans demonstrated the capacity to produce a wide variety of

  18. On Thermonuclear Reaction Rates

    OpenAIRE

    Haubold, H. J.; Mathai, A. M.

    1996-01-01

    Nuclear reactions govern major aspects of the chemical evolution of galaxies and stars. Analytic study of the reaction rates and reaction probability integrals is attempted here. Exact expressions for the reaction rates and reaction probability integrals for nuclear reactions in the cases of nonresonant, modified nonresonant, screened nonresonant and resonant cases are given. These are expressed in terms of H-functions, G-functions and in computable series forms. Computational aspects are als...

  19. Novel ZnO:Ag nanocomposites induce significant oxidative stress in human fibroblast malignant melanoma (Ht144 cells

    Directory of Open Access Journals (Sweden)

    Syeda Arooj

    2015-02-01

    Full Text Available The use of photoactive nanoparticles (NPs such as zinc oxide (ZnO and its nanocomposites has become a promising anticancer strategy. However, ZnO has a low photocatalytic decomposition rate and the incorporation of metal ions such as silver (Ag improves their activity. Here different formulations of ZnO:Ag (1, 3, 5, 10, 20 and 30% Ag were synthesized by a simple co-precipitation method and characterized by powder X-ray diffraction, scanning electron microscopy, Rutherford back scattering and diffuse reflectance spectroscopy for their structure, morphology, composition and optical band gap. The NPs were investigated with regard to their different photocatalytic cytotoxic effects in human malignant melanoma (HT144 and normal (HCEC cells. The ZnO:Ag nanocomposites killed cancer cells more efficiently than normal cells under daylight exposure. Nanocomposites having higher Ag content (10, 20 and 30% were more toxic compared to low Ag content (1, 3 and 5%. For HT144, under daylight exposure, the IC50 values were ZnO:Ag (10%: 23.37 μg/mL, ZnO:Ag (20%: 19.95 μg/mL, and ZnO:Ag (30%: 15.78 μg/mL. ZnO:Ag (30% was toxic to HT144 (IC50: 23.34 μg/mL in dark as well. The three nanocomposites were further analyzed with regard to their ability to generate reactive oxygen species (ROS and induce lipid peroxidation. The particles led to an increase in levels of ROS at cytotoxic concentrations, but only HT144 showed strongly induced MDA level. Finally, NPs were investigated for the ROS species they generated in vitro. A highly significant increase of 1O2 in the samples exposed to daylight was observed. Hydroxyl radical species, HO•, were also generated to a lesser extent. Thus, the incorporation of Ag into ZnO NPs significantly improves their photo-oxidation capabilities. ZnO:Ag nanocomposites could provide a new therapeutic option to selectively target cancer cells.

  20. CeLAND: search for a 4th light neutrino state with a 3 PBq 144Ce-144Pr electron antineutrino generator in KamLAND

    Energy Technology Data Exchange (ETDEWEB)

    Gando, A; Gando, Y; Hayashida, S; Ikeda, H; Inoue, K; Ishidoshiro, K; Ishikawa, H; Koga, M; Matsuda, R; Matsuda, S; Mitsui, T; Motoki, D; Nakamura, K; Oki, Y; Otani, M; Shimizu, I; Shirai, J; Suekane, F; Suzuki, A; Takemoto, Y; Tamae, K; Ueshima, K; Watanabe, H; Xu, BD; Yamada, S; Yamauchi, Y; Yoshida, H; Cribier, M; Durero, M; Fischer, V; Gaffiot, J; Jonqueres, N; Kouchner, A; Lasserre, T; Leterme, D; Letourneau, A; Lhuillier, D; Mention, G; Rampal, G; Scola, L; Veyssiere, C; Vivier, M; Yala, P; Berger, BE; Kozlov, A; Banks, T; Dwyer, D; Fujikawa, BK; Han, K; Kolomensky, YG; Mei, Y; O' Donnell, T; Decowski, P; Markoff, DM; Yoshida, S; Kornoukhov, VN; Gelis, TVM; Tikhomirov, GV; Learned, JG; Maricic, J; Matsuno, S; Milincic, R; Karwowski, HJ; Efremenko, Y; Detwiler, A; Enomoto, S

    2017-05-12

    The reactor neutrino and gallium anomalies can be tested with a 3-4 PBq (75-100 kCi scale) 144Ce-144Pr antineutrino beta-source deployed at the center or next to a large low-background liquid scintillator detector. The antineutrino generator will be produced by the Russian reprocessing plant PA Mayak as early as 2014, transported to Japan, and deployed in the Kamioka Liquid Scintillator Anti-Neutrino Detector (KamLAND) as early as 2015. KamLAND's 13 m diameter target volume provides a suitable environment to measure the energy and position dependence of the detected neutrino flux. A characteristic oscillation pattern would be visible for a baseline of about 10 m or less, providing a very clean signal of neutrino disappearance into a yet-unknown, sterile neutrino state. This will provide a comprehensive test of the electron dissaperance neutrino anomalies and could lead to the discovery of a 4th neutrino state for Δm$2\\atop{new}$ ≳ 0.1 eV2 and sin2(2θnew) > 0.05.

  1. Atmospheric gas phase reactions

    Science.gov (United States)

    Platt, Ulrich

    This chapter introduces the underlying physicochemical principles and the relevance of atmospheric gas phase reactions. In particular, reaction orders, the concept of elementary reactions, definition of and factors determining reaction rates (kinetic theory of chemical reactions), and photochemical reactions are discussed. Sample applications of the pertinent reaction pathways in tropospheric chemistry are presented, particularly reactions involving free radicals (OH, NO3, halogen oxides) and their roles in the self-cleaning of the troposphere. The cycles of nitrogen and sulfur species as well as the principles of tropospheric ozone formation are introduced. Finally, the processes governing the stratospheric ozone layer (Chapman Cycle and extensions) are discussed.

  2. S-nitrosylation of TRIM72 at cysteine 144 is critical for protection against oxidation-induced protein degradation and cell death.

    Science.gov (United States)

    Kohr, Mark J; Evangelista, Alicia M; Ferlito, Marcella; Steenbergen, Charles; Murphy, Elizabeth

    2014-04-01

    Oxidative stress and membrane damage following myocardial ischemia/reperfusion injury are important contributors to cardiomyocyte death and the loss of myocardial function. Our previous study identified cysteine 144 (C144) of tripartite motif-containing protein 72 (TRIM72) as a potential site for S-nitrosylation (SNO). TRIM72 is a cardioprotective membrane repair protein that can be both activated and targeted for degradation by different oxidative modifications. Consistent with the potential regulation of TRIM72 by various oxidative modifications, we found that SNO levels increased at C144 of TRIM72 with ischemic preconditioning. Therefore, to investigate the role of C144 in the regulation of TRIM72 function, we mutated C144 of TRIM72 to a serine residue (TRIM72(C144S)), and expressed either TRIM72(WT) or TRIM72(C144S) in HEK-293 cells, which lack endogenous TRIM72, in order to examine the effect of this mutation on the functional stability of TRIM72 and on cell survival. We hypothesized that SNO of TRIM72 stabilizes the protein, thus allowing for membrane repair and enhanced cell survival. Upon treatment with hydrogen peroxide (H2O2), we found that TRIM72(WT) levels were decreased, but not TRIM72(C144S) and this correlated with increased H2O2-induced cell death in TRIM72(WT) cells. Additionally, we found that treatment with the cardioprotective S-nitrosylating agent S-nitrosoglutathione (GSNO), was able to preserve TRIM72(WT) protein levels and enhance TRIM72(WT)-mediated cell survival, but had no effect on TRIM72(C144S) levels. Consistent with our hypothesis, GSNO was also found to increase SNO levels and inhibit H2O2-induced irreversible oxidation for TRIM72(WT) without affecting TRIM72(C144S). In further support of our hypothesis, GSNO blocked the ischemia/reperfusion-induced decrease in TRIM72 levels and reduced infarct size in a Langendorff-perfused heart model. The results of these studies have important implications for cardioprotection and suggest that

  3. MicroRNA-144 regulates hepatic ATP binding cassette transporter A1 and plasma high-density lipoprotein after activation of the nuclear receptor farnesoid X receptor.

    Science.gov (United States)

    de Aguiar Vallim, Thomas Q; Tarling, Elizabeth J; Kim, Tammy; Civelek, Mete; Baldán, Ángel; Esau, Christine; Edwards, Peter A

    2013-06-07

    The bile acid receptor farnesoid X receptor (FXR) regulates many aspects of lipid metabolism by variouscomplex and incompletely understood molecular mechanisms. We set out to investigate the molecular mechanisms for FXR-dependent regulation of lipid and lipoprotein metabolism. To identify FXR-regulated microRNAs that were subsequently involved in regulating lipid metabolism. ATP binding cassette transporter A1 (ABCA1) is a major determinant of plasma high-density lipoprotein (HDL)-cholesterol levels. Here, we show that activation of the nuclear receptor FXR in vivo increases hepatic levels of miR-144, which in turn lowers hepatic ABCA1 and plasma HDL levels. We identified 2 complementary sequences to miR-144 in the 3' untranslated region of ABCA1 mRNA that are necessary for miR-144-dependent regulation. Overexpression of miR-144 in vitro decreased both cellular ABCA1 protein and cholesterol efflux to lipid-poor apolipoprotein A-I protein, whereas overexpression in vivo reduced hepatic ABCA1 protein and plasma HDL-cholesterol. Conversely, silencing miR-144 in mice increased hepatic ABCA1 protein and HDL-cholesterol. In addition, we used tissue-specific FXR-deficient mice to show that induction of miR-144 and FXR-dependent hypolipidemia requires hepatic, but not intestinal, FXR. Finally, we identified functional FXR response elements upstream of the miR-144 locus, consistent with direct FXR regulation. We have identified a novel pathway involving FXR, miR-144, and ABCA1 that together regulate plasma HDL-cholesterol.

  4. Preliminary evaluation of neutron capture cross sections for /sup 144/Sm, /sup 145/Sm and /sup 145/Pm

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, D.G.; Gardner, M.A.

    1986-02-13

    We have made preliminary neutron-capture cross-section calculations of the Hauser-Feshbach type for the isotopes /sup 144/Sm, /sup 145/Sm, and /sup 145/Pm to investigate the production of radioactive /sup 145/Pm by neutron capture on the stable isotope /sup 144/Sm. The calculations were made for incident neutron energies from 2.5 MeV to about 1/sup -4/ or 10/sup -5/ MeV, wherever the first unbound resonance was estimated to occur in each case. At that energy, the calculated value was reduced by a somewhat arbitrary factor, and the excitation function extended down to thermal energy using a (E/sub n/)/sup -1/2/ energy dependence. Since very large uncertainties are associated with the position and magnitude of the first unbound resonance and the subsequent extrapolation back to thermal energy, the cross sections in this low-energy region should not be considered more accurate than +- a factor of 10. For incident neutron energies above each step, the calculations represent an average through the separated and overlapping resonance regions and may be accurate to better than +- a factor of 2. 18 refs., 7 figs., 5 tabs.

  5. [Importance of haemovigilance and reports on transfusion reaction in blood component therapy].

    Science.gov (United States)

    Grujić, Jasmina; Gulan, Zdravko; Budakov, Zorana

    2012-01-01

    Application of blood and blood components throughout decades is very successful and mostly safe procedure in patients' therapy. However, it may lead to unfavourable effects, such as transfusion reactions. In the period from 2000 to 2009, 180 transfusion reactions were reported at the Department of Clinical Transfusion of the Service for Blood Transfusion of Vojvodina in Novi Sad. The aetiology of transfusion reactions was determined by examining pre-transfusion and post-transfusion sample of patient's blood and by examining the unit of blood component that induced reaction. Out of 180 reported transfusion reactions, 98 (54.4%) were febrile non-haemolytic transfusion reactions, 69 (38.3%) allergic reactions and 2 (1.11%) haemolytic reactions. Blood components that caused most of transfusion reactions were erythrocytes (62.4%), fresh frozen plasma (11.2%) and platelets (14.4%). All patients underwent multiple transfusions. The fact that only 0.13% transfusion reactions were reported, compared with data from literature (2-15%), points to the lack of regular reporting of transfusion reactions, as well as the fact that there is only one report of delayed transfusion reaction. To improve and make blood transfusion safer it is necessary to respect all pre-transfusion procedures, constant follow up of blood transfusion must be done and patients with diagnosed non-haemolytic transfusion reaction should be given leukocyte reduced blood components.

  6. Ultra-Sensitive Nano Optical Sensor Samarium-Doxycycline Doped in Sol Gel Matrix for Assessment of Glucose Oxidase Activity in Diabetics Disease.

    Science.gov (United States)

    Tharwat, Marwa M; Attia, M S; Alghamdi, M S; Mahros, Amr M

    2017-07-11

    A low cost and very sensitive method for the determination of the activity of glucose oxidase enzyme in different diabetics serum samples was developed. The method based on the assessment of the H2O2 concentration produced from the reaction of the glucose oxidase (GOx) enzyme with glucose as substrate in the serum of diabetics patients by nano optical sensor Sm-doxycycline doped in sol gel matrix. H2O2 enhances the luminescence intensity of all bands of the nano Sm-doxycycline complex [Sm-(DC)2](+) doped in sol-gel matrix, especially the 645 nm band at λex = 400 nm and pH 7.0 in water. The influence of the different analytical parameters that affect the luminescence intensity of the nano optical sensor, e.g. pH, H2O2 concentration and foreign ions concentrations were studied. The remarkable enhancement of the luminescence intensity of nano optical sensor [Sm-(DC)2](+) complex in water at 645 nm by the addition of various concentrations of H2O2 was successfully used as an optical sensor for the assessment of the activity of the glucose oxidase enzyme in different diabetics serum samples. The calibration plot was achieved over the activity range 0.1-240 U/L with a correlation coefficient of 0.999 and a detection limit of 0.05 U/L.

  7. Synthesis, spectroscopic, thermal and antimicrobial studies of neodymium(III) and samarium(III) complexes derived from tetradentate ligands containing N and S donor atoms

    Science.gov (United States)

    Ain, Qurratul; Pandey, S. K.; Pandey, O. P.; Sengupta, S. K.

    2015-04-01

    Trivalent lanthanide complexes of the type [Ln(L)Cl(H2O)2] (where Ln = Nd(III) or Sm(III) and LH2 = Schiff bases derived by the condensation of 3-(phenyl/substitutedphenyl)-4-amino-5-mercapto-1,2,4-triazole with diacetyl/benzil) have been synthesized by the reactions of anhydrous lanthanide(III) chloride with Schiff bases in methanol. The structures of the complexes have been proposed on the basis of elemental analysis, electrical conductance, magnetic moment, spectroscopic measurements (IR, 1H, 13C NMR and UV-vis spectra) and X-ray diffraction studies. The spectral data reveal that the Schiff base ligands behave as dibasic tetradentate chelating agents having coordination sites at two thiol sulfur atoms and two azomethine nitrogen atoms. The presence of coordinated water in metal complexes was confirmed by thermal and IR data of the complexes. All the Schiff bases and their metal complexes have also been screened for their antibacterial activity against Bacillus subtilis, Staphylococcus aureus and antifungal activities against Aspergillus niger, Curvularia pallescens and Colletotrichum capsici.

  8. A Brief Review of Past INL Work Assessing Radionuclide Content in TMI-2 Melted Fuel Debris: The Use of 144Ce as a Surrogate for Pu Accountancy

    Energy Technology Data Exchange (ETDEWEB)

    D. L. Chichester; S. J. Thompson

    2013-09-01

    This report serves as a literature review of prior work performed at Idaho National Laboratory, and its predecessor organizations Idaho National Engineering Laboratory (INEL) and Idaho National Engineering and Environmental Laboratory (INEEL), studying radionuclide partitioning within the melted fuel debris of the reactor of the Three Mile Island 2 (TMI-2) nuclear power plant. The purpose of this review is to document prior published work that provides supporting evidence of the utility of using 144Ce as a surrogate for plutonium within melted fuel debris. When the TMI-2 accident occurred no quantitative nondestructive analysis (NDA) techniques existed that could assay plutonium in the unconventional wastes from the reactor. However, unpublished work performed at INL by D. W. Akers in the late 1980s through the 1990s demonstrated that passive gamma-ray spectrometry of 144Ce could potentially be used to develop a semi-quantitative correlation for estimating plutonium content in these materials. The fate and transport of radioisotopes in fuel from different regions of the core, including uranium, fission products, and actinides, appear to be well characterized based on the maximum temperature reached by fuel in different parts of the core and the melting point, boiling point, and volatility of those radioisotopes. Also, the chemical interactions between fuel, fuel cladding, control elements, and core structural components appears to have played a large role in determining when and how fuel relocation occurred in the core; perhaps the most important of these reaction appears to be related to the formation of mixed-material alloys, eutectics, in the fuel cladding. Because of its high melting point, low volatility, and similar chemical behavior to plutonium, the element cerium appears to have behaved similarly to plutonium during the evolution of the TMI-2 accident. Anecdotal evidence extrapolated from open-source literature strengthens this logical feasibility for

  9. Mechanical 144 GHz beam steering with all-metallic epsilon-near-zero lens antenna

    Energy Technology Data Exchange (ETDEWEB)

    Pacheco-Peña, V., E-mail: victor.pacheco@unavarra.es; Torres, V., E-mail: victor.torres@unavarra.es; Orazbayev, B., E-mail: b.orazbayev@unavarra.es; Beruete, M., E-mail: miguel.beruete@unavarra.es; Sorolla, M. [Antennas Group-TERALAB, Universidad Pública de Navarra, Campus Arrosadía, 31006 Pamplona (Spain); Navarro-Cía, M., E-mail: m.navarro@imperial.ac.uk [Optical and Semiconductor Devices Group, Department of Electrical and Electronic Engineering, Imperial College London, London SW7 2BT (United Kingdom); Centre for Plasmonics and Metamaterials, Imperial College London, London SW7 2AZ (United Kingdom); Centre for Terahertz Science and Engineering, Imperial College London, London SW7 2AZ (United Kingdom); Engheta, N., E-mail: engheta@ee.upenn.edu [Department of Electrical and Systems Engineering, University of Pennsylvania, Philadelphia, Pennsylvania 19104 (United States)

    2014-12-15

    An all-metallic steerable beam antenna composed of an ε-near-zero (ENZ) metamaterial lens is experimentally demonstrated at 144 GHz (λ{sub 0} = 2.083 mm). The ENZ lens is realized by an array of narrow hollow rectangular waveguides working just near and above the cut-off of the TE{sub 10} mode. The lens focal arc on the xz-plane is initially estimated analytically as well as numerically and compared with experimental results demonstrating good agreement. Next, a flange-ended WR-6.5 waveguide is placed along the lens focal arc to evaluate the ENZ-lens antenna steerability. A gain scan loss below 3 dB is achieved for angles up to ±15°.

  10. [Adverse reactions to insulin].

    Science.gov (United States)

    Liñana, J J; Montoro, F J; Hernández, M D; Basomba, A

    1997-07-01

    The prevalence of allergic reactions to insuline has decreased during the last few years. Probably this is due to the use of the newly-developed recombinant human insuline. At present, adverse reactions to insuline occur in 5-10% of patients on therapy with insuline. Adverse reactions may be local (more frequent) or systemic (rare). Insuline resistance consists in a different type of immunological reaction. Diagnosis of allergy to insuline is based on clinical history and cutaneous and serological tests. Treatment depends upon the severity of the reaction. When insuline is indispensable despite a previous allergic reaction, a desensitization protocol may be implemented.

  11. N-terminal Prion Protein Peptides (PrP(120-144)) Form Parallel In-register β-Sheets via Multiple Nucleation-dependent Pathways.

    Science.gov (United States)

    Wang, Yiming; Shao, Qing; Hall, Carol K

    2016-10-14

    The prion diseases are a family of fatal neurodegenerative diseases associated with the misfolding and accumulation of normal prion protein (PrP(C)) into its pathogenic scrapie form (PrP(Sc)). Understanding the fundamentals of prion protein aggregation and the molecular architecture of PrP(Sc) is key to unraveling the pathology of prion diseases. Our work investigates the early-stage aggregation of three prion protein peptides, corresponding to residues 120-144 of human (Hu), bank vole (BV), and Syrian hamster (SHa) prion protein, from disordered monomers to β-sheet-rich fibrillar structures. Using 12 μs discontinuous molecular dynamics simulations combined with the PRIME20 force field, we find that the Hu-, BV-, and SHaPrP(120-144) aggregate via multiple nucleation-dependent pathways to form U-shaped, S-shaped, and Ω-shaped protofilaments. The S-shaped HuPrP(120-144) protofilament is similar to the amyloid core structure of HuPrP(112-141) predicted by Zweckstetter. HuPrP(120-144) has a shorter aggregation lag phase than BVPrP(120-144) followed by SHaPrP(120-144), consistent with experimental findings. Two amino acid substitutions I138M and I139M retard the formation of parallel in-register β-sheet dimers during the nucleation stage by increasing side chain-side chain association and reducing side chain interaction specificity. On average, HuPrP(120-144) aggregates contain more parallel β-sheet content than those formed by BV- and SHaPrP(120-144). Deletion of the C-terminal residues 138-144 prevents formation of fibrillar structures in agreement with the experiment. This work sheds light on the amyloid core structures underlying prion strains and how I138M, I139M, and S143N affect prion protein aggregation kinetics. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Processing of composites based on NiO, samarium-doped ceria and carbonates (NiO-SDCC as anode support for solid oxide fuel cells

    Directory of Open Access Journals (Sweden)

    Lily Siong Mahmud

    2017-09-01

    Full Text Available NiO-SDCC composites consisting of NiO mixed with Sm-doped ceria (SDC and carbonates (Li2CO3 and Na2CO3 were sintered at different temperatures and reduced at 550 °C. The influence of reduction on structure of the NiO-SDCC anode support for solid oxide fuel cells (SOFCs was investigated. Raman spectra of the NiO-SDCC samples sintered at 500, 600 and 700 °C showed that after reducing at 550 °C NiO was reduced to Ni. In addition, SDC and carbonates (Li2CO3 and Na2CO3 did not undergo chemical transformation after reduction and were still detected in the samples. However, no Raman modes of carbonates were identified in the NiO-SDCC pellet sintered at 1000 °C and reduced at 550 °C. It is suspected that carbonates were decomposed at high sintering temperature and eliminated due to the reaction between the CO32– and hydrogen ions during reduction in humidified gases at 550 °C. The carbonate decomposition increased porosity in the Ni-SDCC pellets and consequently caused formation of brittle and fragile structure unappropriated for SOFC application. Because of that composite NiO-SDC samples without carbonates were also analysed to determine the factors affecting the crack formation. In addition, it was shown that the different reduction temperatures also influenced the microstructure and porosity of the pellets. Thus, it was observed that Ni-SDC pellet reduced at 800 °C has higher electrical conductivity of well-connected microstructures and sufficient porosity than the pellet reduced at 550 °C.

  13. Transformation of Au144(SCH2CH2Ph)60 to Au133(SPh-tBu)52 Nanomolecules: Theoretical and Experimental Study.

    Science.gov (United States)

    Nimmala, Praneeth Reddy; Theivendran, Shevanuja; Barcaro, Giovanni; Sementa, Luca; Kumara, Chanaka; Jupally, Vijay Reddy; Apra, Edoardo; Stener, Mauro; Fortunelli, Alessandro; Dass, Amala

    2015-06-04

    Ultrastable gold nanomolecule Au144(SCH2CH2Ph)60 upon etching with excess tert-butylbenzenethiol undergoes a core-size conversion and compositional change to form an entirely new core of Au133(SPh-tBu)52. This conversion was studied using high-resolution electrospray mass spectrometry which shows that the core size conversion is initiated after 22 ligand exchanges, suggesting a relatively high stability of the Au144(SCH2CH2Ph)38(SPh-tBu)22 intermediate. The Au144 → Au133 core size conversion is surprisingly different from the Au144 → Au99 core conversion reported in the case of thiophenol, -SPh. Theoretical analysis and ab initio molecular dynamics simulations show that rigid p-tBu groups play a crucial role by reducing the cluster structural freedom, and protecting the cluster from adsorption of exogenous and reactive species, thus rationalizing the kinetic factors that stabilize the Au133 core size. This 144-atom to 133-atom nanomolecule's compositional change is reflected in optical spectroscopy and electrochemistry.

  14. Activating and sustaining c-Myc by depletion of miR-144/451 gene locus contributes to B-lymphomagenesis.

    Science.gov (United States)

    Ding, Lan; Zhang, Yanqing; Han, Lingling; Fu, Lei; Mei, Xia; Wang, Jijun; Itkow, Jacobi; Elabid, Afaf Elabid Ibrahim; Pang, Lei; Yu, Duonan

    2017-12-29

    Hyper activity of protooncogene c-Myc is one of the hallmarks of highly aggressive lymphomas. However, the mechanism of how c-Myc is subjected to activation and amplification is still not well defined. In this study, we use gene knockout strategy to show that targeted depletion of a well-conserved microRNA gene locus miR-144/451 initiates tumorigenesis including B-lymphoma development in aged mice. This is due, at least in part, to the direct activation of the c-Myc gene by loss of miR-144/451 expression in hematopoietic cells. Moreover, oncoprotein c-Myc inversely regulates miR-144/451 expression by directly binding to the miR-144/451 promoter region, forming a miRNA-Myc positive feedback loop to safeguard the high level of c-Myc in B-lymphocytes. We also demonstrate that this miRNA-Myc crosstalk is disrupted in human diffuse large B-cell lymphomas with aberrant c-Myc expression. Therefore, our findings provide strong evidence, for the first time, that deficiency of miR-144/451 expression may play a bona fide role in derepression of silenced c-Myc, which contributes to tumor development including B-lymphomagenesis.

  15. Potential energy surface for the reaction Sm+ + CO2 → SmO+ + CO: guided ion beam and theoretical studies.

    Science.gov (United States)

    Armentrout, P B; Cox, Richard M

    2017-05-10

    The potential energy surface (PES) for the oxidation of samarium cations by carbon dioxide is explored both experimentally and theoretically. Using guided ion beam tandem mass spectrometry, several reactions are examined as a function of kinetic energy. These include the title reaction as well as its reverse along with the collision-induced dissociation of Sm+(CO2) and OSm+(CO) with Xe. Analysis of the kinetic energy dependent cross sections yields barriers for the forward and reverse oxidation reaction of 1.77 ± 0.11 and 2.04 ± 0.13 eV, respectively, and Sm+-OCO and OSm+-CO bond dissociation energies (BDEs) of 0.42 ± 0.03 and 0.97 ± 0.07 eV, respectively. BDEs for Sm+(CO2)x for x = 2 and 3 are also determined as 0.40 ± 0.13 and 0.48 ± 0.12 eV, respectively. The PESs for the title reaction along the sextet and octet spin surfaces are also examined theoretically at the MP2 and CCSD(T) levels using both effective core potential and all-electron basis sets. Reasonable agreement between theory and experiment is obtained for the experimentally characterized intermediates, although all-electron basis sets and spin-orbit effects are needed for quantitative agreement. The observed barrier for oxidation is shown to likely correspond to the energy of the crossing between surfaces corresponding to the ground state electronic configuration of Sm+ (8F,4f66s1) and an excited surface having two electrons in the valence space (excluding 4f), which are needed to form the strong SmO+ bond.

  16. Microfluidic chemical reaction circuits

    Science.gov (United States)

    Lee, Chung-cheng [Irvine, CA; Sui, Guodong [Los Angeles, CA; Elizarov, Arkadij [Valley Village, CA; Kolb, Hartmuth C [Playa del Rey, CA; Huang, Jiang [San Jose, CA; Heath, James R [South Pasadena, CA; Phelps, Michael E [Los Angeles, CA; Quake, Stephen R [Stanford, CA; Tseng, Hsian-rong [Los Angeles, CA; Wyatt, Paul [Tipperary, IE; Daridon, Antoine [Mont-Sur-Rolle, CH

    2012-06-26

    New microfluidic devices, useful for carrying out chemical reactions, are provided. The devices are adapted for on-chip solvent exchange, chemical processes requiring multiple chemical reactions, and rapid concentration of reagents.

  17. Allergic reactions (image)

    Science.gov (United States)

    Allergic reaction can be provoked by skin contact with poison plants, chemicals and animal scratches, as well as ... mildew, dust, nuts and shellfish, may also cause allergic reaction. Medications such as penicillin and other antibiotics are ...

  18. Cosmetic tattoo pigment reaction

    National Research Council Canada - National Science Library

    Greywal, Tanya; Cohen, Philip R

    2016-01-01

    BackgroundCutaneous reactions to tattoos are most commonly granulomatous or lichenoid.PurposeWe describe a woman who developed a lymphocytic reaction following a cosmetic tattoo procedure with black dye...

  19. Chemical transport reactions

    CERN Document Server

    Schäfer, Harald

    2013-01-01

    Chemical Transport Reactions focuses on the processes and reactions involved in the transport of solid or liquid substances to form vapor phase reaction products. The publication first offers information on experimental and theoretical principles and the transport of solid substances and its special applications. Discussions focus on calculation of the transport effect of heterogeneous equilibria for a gas motion between equilibrium spaces; transport effect and the thermodynamic quantities of the transport reaction; separation and purification of substances by means of material transport; and

  20. Reaction Time (Polish language)

    OpenAIRE

    Iermakov, Sergii

    2014-01-01

    Reaction time is the interval time between the presentation of a stimulus and the initiation of the muscular response to that stimulus.If there is only one possible response (simple reaction time) it will only take a short time to react. If there are several possible responses (choice reaction time) then it will take longer to determine which response to carry out.

  1. Laser enhanced chemical reactions

    Science.gov (United States)

    Included is the discussion of infrared diode lasers used to study time dependent dynamic events. Also, hot atom excitation of vibrational states of polyatomic molecules, bimolecular quenching and reactions of O(sup 1)D, bimolecular reaction studies of the OH + CO yields H + CO2 system, and the chemical dynamics of the reaction between chlorine atoms and deuterated cyclohexane are covered briefly.

  2. (MIRC) reaction w

    Indian Academy of Sciences (India)

    Sudesh Kumari

    as eco-friendly reaction media in catalyst free organic synthesis.7 Ethylene glycol has promising physical ... these properties it is used as a promising green media in many catalysed/ uncatalysed organic reactions ..... Ruijter E, Scheffelaar R and Orru R V A 2011 Multi- component Reaction Design in the Quest for Molecular ...

  3. Cirurgia de revascularização do miocárdio no idoso: estudo descritivo de 144 casos Revascularization surgery of the myocardium in the elderly patients: descriptive study in 144 patients

    Directory of Open Access Journals (Sweden)

    Maurílio Onofre DEININGER

    1999-04-01

    Full Text Available Realizamos análise retrospectiva de todos os pacientes com idade igual ou superior a 70 anos, submetidos à operação de revascularização do miocárdio isolada, no período de janeiro de 1992 a dezembro de 1997, objetivando avaliar a morbimortalidade. Do total de 144 pacientes, 92 (63,9% eram do sexo masculino, idade entre 70 e 84 anos, média de 73,51 anos e desvio padrão de 2,82. A grande maioria encontrava-se com angina classe funcional III ou IV (79,16%. Tiveram relação com a ocorrência de maior mortalidade, a presença no período pré-operatório de: obesidade (p = 0,004, insuficiência cardíaca congestiva (classe III/IV - p = 0,03 e/ou infarto agudo do miocárdio (A retrospective analysis involving seventy-year-old patients as well as those over seventy who have undergone CABG as a single procedure, during Jannuary 1992 to December 1997, was carried out with the purpose of assessing their morbidity with mortality. Of the 144 patients, 92 (63.9% were males, aged 70 to 84 (average age 73.51 and standard deviation 2.82. Most of those, 114 (79.16%, suffered from angina belonging to the functional class III or IV. The occurrence in the pre-operative period of obesity (p = 0.004, heart failure (III/IV class - p = 0.03 and/or acute myocardial infection (less than 21 days - p = 0.01 demonstrated a definite relationship with mortality. There were 120 (83.34% patients with lesions in three or more vessels (average 3.48 anastomoses/patients.The pediculate internal mammary artery was employed in 126 patients (87.5% and that rate increased to 98.9% in the last two years. The main complications in the post-operation period leading to death were either infections (p < 0.0001, prolonged ventilatory support (p < 0.0001, renal failure with dialysis (p < 0.0001 and/or low cardiac output (p = 0.003. As to statistical analysis the Student T test, the Chi-square test and Fisher's exact test were used. Surgical mortality totalling 5.5% (8/144 in the

  4. Development of a computational model applied to a unitary 144 cm{sup 2} proton exchange membrane fuel cell; Desenvolvimento de um modelo numerico computacional aplicado a uma celula a combustivel unitaria de 144 CM{sup 2} tipo PEM

    Energy Technology Data Exchange (ETDEWEB)

    Robalinho, Eric

    2009-07-01

    This work presents the development of a numerical computer model and methodology to study and design polymeric exchange membrane fuel cell - PEM. For the validation of experimental results, a sequence of routines, appropriate to fit the data obtained in the laboratory, was described. At the computational implementation it was created a new strategy of coupling two 3-dimensional models to satisfy the requirements of the comprehensive model of the fuel cell, including its various geometries and materials, as well as the various physical and chemical processes simulated. To effective assessment of the real cell analogy with numerical model, numerical studies were carried out. Comparisons with values obtained in the literature, characterization of variables through laboratory experiments and estimates from models already tested in the literature were also performed. Regarding the experimental part, a prototype of a fuel cell unit of 144 cm of geometric area was designed, produced and operated at laboratory with the purpose of validating the numerical computer model proposed, with positive results. The results of simulations for the 2D and 3D geometries proposed are presented in the form of polarization curves, highlighting the catalytic layer model based on the geometry of agglomerates. Parametric and sensitivity studies are presented to illustrate the change in performance of the fuel cell studied. The final model is robust and useful as a tool for design and optimization of PEM type fuel cells in a wide range of operating conditions. (author)

  5. Development of a computational model applied to a unitary 144 CM{sup 2} proton exchange membrane fuel cell; Desenvolvimento de um modelo numerico computacional aplicado a uma celula a combustivel unitaria de 144 CM{sup 2} tipo PEM

    Energy Technology Data Exchange (ETDEWEB)

    Robalinho, Eric

    2009-07-01

    This work presents the development of a numerical computer model and methodology to study and design polymeric exchange membrane fuel cell - PEM. For the validation of experimental results, a sequence of routines, appropriate to fit the data obtained in the laboratory, was described. At the computational implementation it was created a new strategy of coupling two 3-dimensional models to satisfy the requirements of the comprehensive model of the fuel cell, including its various geometries and materials, as well as the various physical and chemical processes simulated. To effective assessment of the real cell analogy with numerical model, numerical studies were carried out. Comparisons with values obtained in the literature, characterization of variables through laboratory experiments and estimates from models already tested in the literature were also performed. Regarding the experimental part, a prototype of a fuel cell unit of 144 cm{sup 2} of geometric area was designed, produced and operated at laboratory with the purpose of validating the numerical computer model proposed, with positive results. The results of simulations for the 2D and 3D geometries proposed are presented in the form of polarization curves, highlighting the catalytic layer model based on the geometry of agglomerates. Parametric and sensitivity studies are presented to illustrate the change in performance of the fuel cell studied. The final model is robust and useful as a tool for design and optimization of PEM type fuel cells in a wide range of operating conditions. (author)

  6. Quantitative assessment of alkali silica reaction potential of quartz-rich aggregates: comparison of chemical test and accelerated mortar bar test improved by SEM-PIA

    Czech Academy of Sciences Publication Activity Database

    Šachlová, Š.; Kuchařová, A.; Pertold, Z.; Přikryl, R.; Fridrichová, Michaela

    2017-01-01

    Roč. 76, č. 1 (2017), s. 133-144 ISSN 1435-9529 R&D Projects: GA ČR(CZ) GAP104/12/0915 Institutional support: RVO:67985831 Keywords : accelerated mortar bar test * Alkali silica reaction * chemical test * electron microscopy * petrographic image analysis Subject RIV: DD - Geochemistry Impact factor: 1.901, year: 2016

  7. Ligand-modulated interactions between charged monolayer-protected Au144(SR)60 gold nanoparticles in physiological saline.

    Science.gov (United States)

    Villarreal, Oscar D; Chen, Liao Y; Whetten, Robert L; Yacaman, Miguel J

    2015-02-07

    In order to determine how functionalized gold nanoparticles (AuNPs) interact in a near-physiological environment, we performed all-atom molecular dynamics simulations on the icosahedral Au144 nanoparticles each coated with a homogeneous set of 60 thiolates selected from one of these five (5) types: 11-mercapto-1-undecanesulfonate -SC11H22(SO3(-)), 5-mercapto-1-pentanesulfonate -SC5H10(SO3(-)), 5-mercapto-1-pentaneamine -SC5H10(NH3(+)), 4-mercapto-benzoate -SPh(COO(-)), or 4-mercapto-benzamide -SPh(CONH3(+)). These thiolates were selected to elucidate how the aggregation behavior of AuNPs depends on ligand parameters, including the charge of the terminal group (anionic vs. cationic), and its length and conformational flexibility. For this purpose, each functionalized AuNP was paired with a copy of itself, placed in an aqueous cell, neutralized by 120 Na(+)/Cl(-) counter-ions and salinated with a 150 mM concentration of NaCl, to form five (5) systems of like-charged AuNPs pairs in a saline. We computed the potential of mean force (the reversible work of separation) as a function of the intra-pair distance and, based on which, the aggregation affinities. We found that the AuNPs coated with negatively charged, short ligands have very high affinities. Structurally, a significant number of Na(+) counter-ions reside on a plane between the AuNPs, mediating the interaction. Each such ion forms a "salt bridge" (or "ionic bonds") to both of the AuNPs when they are separated by its diameter plus 0.2-0.3 nm. The positively charged AuNPs have much weaker affinities, as Cl(-) counter-ions form fewer and weaker salt bridges between the AuNPs. In the case of Au144(SC11H22(SO3(-)))60 pair, the flexible ligands fluctuate much more than the other four cases. The large fluctuations disfavor the forming of salt bridges between two AuNPs, but enable hydrophobic contact between the exposed hydrocarbon chains of the two AuNPs, which are subject to an effective attraction at a separation

  8. Hypersensitivity reactions to heparins.

    Science.gov (United States)

    Gonzalez-Delgado, Purificación; Fernandez, Javier

    2016-08-01

    This article provides an update on hypersensitivity reactions to heparins and novel oral anticoagulants, with special emphasis on diagnostic methods and management of patients. Although heparins are drugs widely used, hypersensitivity reactions are uncommon. Cutaneous delayed hypersensitivity reactions after subcutaneous administration affects up to 7.5% of patients. Heparin-induced thrombocytopenia is another unusual but severe condition in which early recognition is crucial. Immediate hypersensitivity reactions to heparins have been also reported, but with the novel oral anticoagulants are much more uncommon, although reports of exanthemas have been notified.Skin tests and subcutaneous provocation test are useful tools in the diagnosis of hypersensitivity reactions, except in heparin-induced thrombocytopenia in which biopsy of lesional skin and in-vitro tests are the modalities of choice to confirm the diagnosis.Management of hypersensitivity reactions includes finding an alternative depending on the type of reaction. Fondaparinux and novel oral anticoagulants may be safe alternatives. Delayed skin lesions after subcutaneous heparin are the most common type of hypersensitivity reactions, followed by life-threatening heparin-induced thrombocytopenia. Immediate reactions are uncommon. Allergologic studies may be useful to find an alternative option in patients with skin lesions in which heparin-induced thrombocytopenia has been previously excluded, as well as in heparin immediate reactions.

  9. [Breast asymmetry of the teenager and the young adult. Stability of the result in time. About 144 patients].

    Science.gov (United States)

    Ellart, J; François, C; Calibre, C; Guerreschi, P; Duquennoy-Martinot, V

    2016-10-01

    Breast asymmetry is defined by a difference in breast shape and/or volume. The goal of this study was to assess the stability of the surgical results and to highlight predictive factors for deterioration in results. This retrospective and monocentric study included all patients presenting constitutional isolated asymmetry, Poland's syndrome, asymmetric tuberous breast or pectus excavatum treated between 1980 and 2015. The statistical analysis included 144 patients and contained two parts. The first analysis compared patients with or without breast implant. Results were significant only for symmetry of shape, with better outcomes without breast implant (P=0.0170). The second analysis compared the subgroups of patients with breast asymmetry, according to the etiology. Patients with tuberous breasts and constitutional isolated asymmetry have been compared. We found a significant difference only regarding the long-term results (P=0.0091). Patients with tuberous breasts had deteriorating in results over time. Patients with Poland's syndrome, compared to patients with constitutional isolated asymmetry, had significantly less good results for symmetry of volume, of shape, of areola, and for early results (Pbreast implant, weight variations, pregnancies and breast-feeding, the use of hormonal treatments, ageing and tuberous malformation. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  10. CT and MRI findings of 144 patients with West syndrome. Characterization of the cerebral lesion and its topography

    Energy Technology Data Exchange (ETDEWEB)

    Hamano, Shin-ichiro; Tanaka, Manabu; Mochizuki, Mika; Sugiyama, Nobuyoshi; Nara, Takahiro; Oguma, Eiji [Saitama Children' s Medical Center, Iwatsuki (Japan); Eto, Yoshikatsu [Jikei Univ., Tokyo (Japan). School of Medicine

    2002-09-01

    In West syndrome, although classified as a generalized epilepsy, there are some patients reported to have became seizure-free and have good outcomes in the developmental aspect after resections of localized lesions. We reviewed computed tomography and magnetic resonance imaging of 144 patients with West syndrome and classified them into four categories depending on the distribution of lesion: normal group, diffuse group, disseminated group, localized group. Thirty-three patients belong to the normal group after having reviewed images from computed tomography and magnetic resonance imaging. The diffuse group consisted of 83 patients presenting morphologic abnormalities such as, diffuse cerebral atrophy, periventricular leukomalesia or polycystic encephalomalesia; the disseminated group included 17 patients having a diagnosis of tuberoius sclerosis, multiple cortical dysplasia or multiple cortical heterotopias. The lesions of all eleven patients with localized cerebral lesions involved the temporal and/or occipital lobes. Nine of the eleven patients with localized cerebral lesions had the lesions on the right side. These results suggest that the specificity of lesion topography of temporo-occipital regions and the right-side in West syndrome will have a close correlation with normal brain maturation, from the viewpoint of development of myelination and cerebral blood flow, and related with the genesis of West syndrome. (author)

  11. Isoscalar giant dipole resonance in Zr-90, Sn-116, Sm-144 and Pb-208 excited by 240 MeV alpha particle scattering

    NARCIS (Netherlands)

    Clark, HL; Lui, YW; Youngblood, DH; Bachtr, K; Garg, U; Harakeh, MN; Kalantar-Nayestanaki, N

    1999-01-01

    The giant resonance regions of Zr-90, Sn-116, Sm-144 and (208)pb were investigated using 240 MeV a particle scattering at small angles including 0 degrees. E1 strengths corresponding to 91+/-11%, 89+/-10%, 105+/-12% and 95+/-13% of the isoscalar E1 energy-weighted sum rule were identified between 18

  12. Effects of the dimeric PSD-95 inhibitor UCCB01-144 on functional recovery after fimbria-fornix transection in rats

    DEFF Research Database (Denmark)

    Sommer, Jens Bak; Bach, Anders; Rytter, Hana Malá

    2017-01-01

    . UCCB01-144 or saline was injected into the lateral tail vein of rats immediately after sham surgery or FF-transection, and effects on spatial delayed alternation in a T-maze were assessed over a 28-day period. Task acquisition was significantly impaired in FF-transected animals, but there were...

  13. Reaction kinetics of polybutylene terephthalate polycondensation reaction

    NARCIS (Netherlands)

    Darda, P. J.; Hogendoorn, J. A.; Versteeg, G. F.; Souren, F.

    2005-01-01

    The kinetics of the forward polycondensation reaction of polybutylene terephthalate (PBT) has been investigated using thermogravimetric analysis (TGA). PBT - prepolymer with an initial degree of polymerization of 5.5 was used as starting material. The PBT prepolymer was prepared from dimethyl

  14. Reactions at Solid Surfaces

    CERN Document Server

    Ertl, Gerhard

    2009-01-01

    Expanding on the ideas first presented in Gerhard Ertl's acclaimed Baker Lectures at Cornell University, Reactions at Solid Surfaces comprises an authoritative, self-contained, book-length introduction to surface reactions for both professional chemists and students alike. Outlining our present understanding of the fundamental processes underlying reactions at solid surfaces, the book provides the reader with a complete view of how chemistry works at surfaces, and how to understand and probe the dynamics of surface reactions. Comparing traditional surface probes with more modern ones, and brin

  15. Desosamine in multicomponent reactions

    NARCIS (Netherlands)

    Achatz, Sepp; Dömling, Alexander

    2006-01-01

    Desosamine occurring ubiquitously in natural products is introduced into isocyanide based multicomponent reaction chemistry. Corresponding products are of potential interest for the design of novel antibiotics. © 2006.

  16. Genetic engineering of EcoRI mutants with altered amino acid residues in the DNA binding site: physicochemical investigations give evidence for an altered monomer/dimer equilibrium for the Gln144Lys145 and Gln144Lys145Lys200 mutants.

    Science.gov (United States)

    Geiger, R; Rüter, T; Alves, J; Fliess, A; Wolfes, H; Pingoud, V; Urbanke, C; Maass, G; Pingoud, A; Düsterhöft, A

    1989-03-21

    We have genetically engineered the Arg200----Lys mutant, the Glu144Arg145----GlnLys double mutant, and the Glu144Arg145Arg200----GlnLysLys triple mutant of the EcoRI endonuclease in extension of previously published work on site-directed mutagenesis of the EcoRI endonuclease in which Glu144 had been exchanged for Gln and Arg145 for Lys [Wolfes et al. (1986) Nucleic Acids Res. 14, 9063]. All these mutants carry modifications in the DNA binding site. Mutant EcoRI proteins were purified to homogeneity and characterized by physicochemical techniques. All mutants have a very similar secondary structure composition. However, whereas the Lys200 mutant is not impaired in its capacity to form a dimer, the Gln144Lys145 and Gln144Lys145Lys200 mutants have a very much decreased propensity to form a dimer or tetramer depending on concentration as shown by gel filtration and analytical ultracentrifugation. This finding may explain the results of isoelectric focusing experiments which show that these two mutants have a considerably more basic pI than expected for a protein in which an acidic amino acid was replaced by a neutral one. Furthermore, while wild-type EcoRI and the Lys200 mutant are denatured in an irreversible manner upon heating to 60 degrees C, the thermal denaturation process as shown by circular dichroism spectroscopy is fully reversible with the Gln144Lys145 double mutant and the Gln144Lys145Lys200 triple mutant. All EcoRI endonuclease mutants described here have a residual enzymatic activity with wild-type specificity, since Escherichia coli cells overexpressing the mutant proteins can only survive in the presence of EcoRI methylase. The detailed analysis of the enzymatic activity and specificity of the purified mutant proteins is the subject of the accompanying paper [Alves et al. (1989) Biochemistry (following paper in this issue)].

  17. Reactions to Attitudinal Deviancy.

    Science.gov (United States)

    Levine, John M.; Allen, Vernon L.

    This paper presents a critical review of empirical and theoretical treatments of group reaction to attitudinal deviancy. Inspired by Festinger's (1950) ideas on resolution of attitudinal discrepancies in groups, Schachter (1951) conducted an experiment that has greatly influenced subsequent research and theory concerning reaction to attitudinal…

  18. ORGANIC REACTION MECHANISM CONTROVERSY ...

    African Journals Online (AJOL)

    Preferred Customer

    Chemists, educators and students are entitled to their mental constructs about reaction mechanism in the classroom. What pedagogical implications have these knowledge claims for teaching and learning reaction mechanisms in organic chemistry? This is the main interest of the paper. Thus three questions were critically ...

  19. Hydrogen evolution reaction catalyst

    Science.gov (United States)

    Subbaraman, Ram; Stamenkovic, Vojislav; Markovic, Nenad; Tripkovic, Dusan

    2016-02-09

    Systems and methods for a hydrogen evolution reaction catalyst are provided. Electrode material includes a plurality of clusters. The electrode exhibits bifunctionality with respect to the hydrogen evolution reaction. The electrode with clusters exhibits improved performance with respect to the intrinsic material of the electrode absent the clusters.

  20. Applications of Reaction Rate

    Science.gov (United States)

    Cunningham, Kevin

    2007-01-01

    This article presents an assignment in which students are to research and report on a chemical reaction whose increased or decreased rate is of practical importance. Specifically, students are asked to represent the reaction they have chosen with an acceptable chemical equation, identify a factor that influences its rate and explain how and why it…

  1. A Whitham-Theory Sonic-Boom Analysis of the TU-144 Aircraft at a Mach Number of 2.2

    Science.gov (United States)

    Mack, Robert J.

    1999-01-01

    Officially, the Tu-144 was the first supersonic-cruise, passenger-carrying aircraft to enter commercial service. Design, construction, and testing were carried out by the Soviet Union, flight certification was by the Soviet Union, and the only regular passenger flights were scheduled and flown across the territory of the Soviet Union. Although it was not introduced to international passenger service, there were many significant engineering accomplishments achieved in the design, production, and flight of this aircraft. Development of the aircraft began with a prototype stage. Systematic testing and redesign led to a production aircraft in discrete stages that measurably improved the performance of the aircraft from the starting concept to final aircraft certification. It flew in competition with the English-French Concorde for a short time, but was withdrawn from national commercial service due to a lack of interest by airlines outside the Soviet Union. NASA became interested in the Tu- 144 aircraft when it was offered for use as a flying "testbed" in the study of operating characteristics of a supersonic-cruise commercial airplane. Since it had been in supersonic-cruise service, the Tu- 144 had operational characteris'tics similar to those anticipated in the conceptual aircraft designs being studied by the United States aircraft companies. In addition to the other operational tests being conducted on the Tu-144 aircraft, it was proposed that two sets of sonic-boom pressure signature measurements be made. The first set would be made on the ground, using techniques and devices similar to those in reference I and many other subsequent studies. A second set would be made in the air with an instrumented aircraft flying close under the Tu-144 in supersonic flight. Such in-flight measurements would require pressure gages that were capable of accurately recording the flow-field overpressures generated by the Tu- 144 at relatively close distances under the vehicle

  2. A NOVEL SAMARIUM COMPLEX WITH INTERESTING ...

    African Journals Online (AJOL)

    INTRODUCTION. Fluorescent materials, particularly blue fluorescent materials have gained strong interest because ... emitting complexes in different technical applications, such as emitting materials for organic light emitting ..... properties of three novel two-dimensional lanthanide coordination polymers with mixed aromatic ...

  3. Pyroelectric Ferroelectric and Resistivity Studies on Samarium ...

    African Journals Online (AJOL)

    Barium Strontium Sodium Niobate (Ba1-xSrx)2NaNb5O15 (BSNN) belongs to tungsten bronze ferroelectric morphotrophic phase boundary (MPB) system at x = 0.6, having large spontaneous polarisation, pyroelectric coefficient and low dielectic constant and is expected to be applicable for piezoceramic filter and ...

  4. A NOVEL SAMARIUM COMPLEX WITH INTERESTING ...

    African Journals Online (AJOL)

    emitting complexes in different technical applications, such as emitting materials for organic light emitting diodes, sensitizers in solar energy conversion, chemical sensors and so forth [6-9]. The ability of bipy to act as a rigid ..... properties of three-dimensional organic-inorganic hybrids based on α-metatungstate. Inorg. Chim.

  5. Respiratory transfusion reactions

    Directory of Open Access Journals (Sweden)

    Ivica Marić

    2017-11-01

    Full Text Available Respiratory transfusion-related reactions are not very frequent, partly also because recognition and reporting transfusion reactions is still underemphasized. Tis article describes the most important respiratory transfusion reactions, their pathophysiology, clinical picture and treatment strategies. Respiratory transfusion related reactions can be primary or secondary. The most important primary transfusion-related reactions are TRALI - transfusion-related acute lung injury, TACO – transfusion-associated circulatory overload, and TAD - transfusion-associated dyspnea. TRALI is immuneassociated injury of alveolar basal membrane, which becomes highly permeable and causes noncardiogenic pulmonary edema. Treatment of TRALI is mainly supportive with oxygen, fluids (in case of hypotension and in cases of severe acute respiratory failure also mechanic ventilation. TACO is caused by volume overload in predisposed individuals, such as patients with heart failure, the elderly, infants, patients with anemia and patients with positive fluid balance. Clinical picture is that of a typical pulmonary cardiogenic edema, and the therapy is classical: oxygen and diuretics, and in severe cases also non-invasive or invasive mechanical ventilation. TAD is usually a mild reaction of unknown cause and cannot be classified as TACO or TRALI, nor can it be ascribed to patient’s preexisting diseases. Although the transfusion-related reactions are not very common, knowledge about them can prevent serious consequences. On the one hand preventive measures should be sought, and on the other early recognition is beneficial, so that proper treatment can take place.

  6. Evaporation residue cross-section measurements for 48Ti-induced reactions

    Science.gov (United States)

    Sharma, Priya; Behera, B. R.; Mahajan, Ruchi; Thakur, Meenu; Kaur, Gurpreet; Kapoor, Kushal; Rani, Kavita; Madhavan, N.; Nath, S.; Gehlot, J.; Dubey, R.; Mazumdar, I.; Patel, S. M.; Dhibar, M.; Hosamani, M. M.; Khushboo, Kumar, Neeraj; Shamlath, A.; Mohanto, G.; Pal, Santanu

    2017-09-01

    Background: A significant research effort is currently aimed at understanding the synthesis of heavy elements. For this purpose, heavy ion induced fusion reactions are used and various experimental observations have indicated the influence of shell and deformation effects in the compound nucleus (CN) formation. There is a need to understand these two effects. Purpose: To investigate the effect of proton shell closure and deformation through the comparison of evaporation residue (ER) cross sections for the systems involving heavy compound nuclei around the ZCN=82 region. Methods: A systematic study of ER cross-section measurements was carried out for the 48Ti+Nd,150142 , 144Sm systems in the energy range of 140 -205 MeV . The measurement has been performed using the gas-filled mode of the hybrid recoil mass analyzer present at the Inter University Accelerator Centre (IUAC), New Delhi. Theoretical calculations based on a statistical model were carried out incorporating an adjustable barrier scaling factor to fit the experimental ER cross section. Coupled-channel calculations were also performed using the ccfull code to obtain the spin distribution of the CN, which was used as an input in the calculations. Results: Experimental ER cross sections for 48Ti+Nd,150142 were found to be considerably smaller than the statistical model predictions whereas experimental and statistical model predictions for 48Ti+144Sm were of comparable magnitudes. Conclusion: Though comparison of experimental ER cross sections with statistical model predictions indicate considerable non-compound-nuclear processes for 48Ti+Nd,150142 reactions, no such evidence is found for the 48Ti+144Sm system. Further investigations are required to understand the difference in fusion probabilities of 48Ti+142Nd and 48Ti+144Sm systems.

  7. Autocatalysis in Reaction Networks

    OpenAIRE

    Deshpande, Abhishek; Gopalkrishnan, Manoj

    2013-01-01

    The persistence conjecture is a long-standing open problem in chemical reaction network theory. It concerns the behavior of solutions to coupled ODE systems that arise from applying mass-action kinetics to a network of chemical reactions. The idea is that if all reactions are reversible in a weak sense, then no species can go extinct. A notion that has been found useful in thinking about persistence is that of "critical siphon." We explore the combinatorics of critical siphons, with a view to...

  8. The Reaction Wheel Pendulum

    CERN Document Server

    Block, Daniel J; Spong, Mark W

    2007-01-01

    This monograph describes the Reaction Wheel Pendulum, the newest inverted-pendulum-like device for control education and research. We discuss the history and background of the reaction wheel pendulum and other similar experimental devices. We develop mathematical models of the reaction wheel pendulum in depth, including linear and nonlinear models, and models of the sensors and actuators that are used for feedback control. We treat various aspects of the control problem, from linear control of themotor, to stabilization of the pendulum about an equilibrium configuration using linear control, t

  9. Electron transfer reactions

    CERN Document Server

    Cannon, R D

    2013-01-01

    Electron Transfer Reactions deals with the mechanisms of electron transfer reactions between metal ions in solution, as well as the electron exchange between atoms or molecules in either the gaseous or solid state. The book is divided into three parts. Part 1 covers the electron transfer between atoms and molecules in the gas state. Part 2 tackles the reaction paths of oxidation states and binuclear intermediates, as well as the mechanisms of electron transfer. Part 3 discusses the theories and models of the electron transfer process; theories and experiments involving bridged electron transfe

  10. Autocatalysis in reaction networks.

    Science.gov (United States)

    Deshpande, Abhishek; Gopalkrishnan, Manoj

    2014-10-01

    The persistence conjecture is a long-standing open problem in chemical reaction network theory. It concerns the behavior of solutions to coupled ODE systems that arise from applying mass-action kinetics to a network of chemical reactions. The idea is that if all reactions are reversible in a weak sense, then no species can go extinct. A notion that has been found useful in thinking about persistence is that of "critical siphon." We explore the combinatorics of critical siphons, with a view toward the persistence conjecture. We introduce the notions of "drainable" and "self-replicable" (or autocatalytic) siphons. We show that: Every minimal critical siphon is either drainable or self-replicable; reaction networks without drainable siphons are persistent; and nonautocatalytic weakly reversible networks are persistent. Our results clarify that the difficulties in proving the persistence conjecture are essentially due to competition between drainable and self-replicable siphons.

  11. [Adverse reactions to vaccines].

    Science.gov (United States)

    Ito Tsuchiya, F M; Rosas Vargas, M A; Zepeda Ortega, B; Río del Navarro, Blanca Estela; Sienra Monge, Juan José Luis

    2007-01-01

    Vaccination is one of the medicine's achievements to control and/or eradicate certain infectious diseases. Vaccines contain antigenic doses derived from microorganisms and/or its toxins, besides they are composed of other substances such as aluminum, gelatin, egg proteins, mercury components (as thimerosal), and antibiotics; therefore, these substances can produce hypersensitivity reactions. The above-mentioned reactions can be evidenced with itch, edema, hives, asthmatic crisis, hypotension and even anaphylactic shock. Due to the importance of vaccination, especially in childhood, it is essential to know the benefits of vaccines, their impact in morbidity and mortality decrease of certain infected-contagious diseases, as well as the adverse effects and the allergic reactions to their application. As immunizations prevent natural infections, they might contribute to a free infectious environment that would allow atopic response. This paper reviews the allergic reactions to vaccines and their influence on the development of atopic disease.

  12. Bad Reaction to Cosmetics?

    Science.gov (United States)

    ... Consumers Protect Yourself Health Fraud Bad Reactions to Cosmetics? Tell FDA! Share Tweet Linkedin Pin it More ... Radiation-Emitting Products Vaccines, Blood & Biologics Animal & Veterinary Cosmetics Tobacco Products

  13. Reactor for exothermic reactions

    Science.gov (United States)

    Smith, Jr., Lawrence A.; Hearn, Dennis; Jones, Jr., Edward M.

    1993-01-01

    A liquid phase process for oligomerization of C.sub.4 and C.sub.5 isoolefins or the etherification thereof with C.sub.1 to C.sub.6 alcohols wherein the reactants are contacted in a reactor with a fixed bed acid cation exchange resin catalyst at an LHSV of 5 to 20, pressure of 0 to 400 psig and temperature of 120.degree. to 300.degree. F. Wherein the improvement is the operation of the reactor at a pressure to maintain the reaction mixture at its boiling point whereby at least a portion but less than all of the reaction mixture is vaporized. By operating at the boiling point and allowing a portion of the reaction mixture to vaporize, the exothermic heat of reaction is dissipated by the formation of more boil up and the temperature in the reactor is controlled.

  14. Firefighter Nozzle Reaction

    DEFF Research Database (Denmark)

    Chin, Selena K.; Sunderland, Peter B.; Jomaas, Grunde

    2017-01-01

    to anchor forces, the hose becomes straight. The nozzle reaction is found to equal the jet momentum flow rate, and it does not change when an elbow connects the hose to the nozzle. A forward force must be exerted by a firefighter or another anchor that matches the forward force that the jet would exert...... on a perpendicular wall. Three reaction expressions are derived, allowing it to be determined in terms of hose diameter, jet diameter, flow rate, and static pressure upstream of the nozzle. The nozzle reaction predictions used by the fire service are 56% to 90% of those obtained here for typical firefighting hand......Nozzle reaction and hose tension are analyzed using conservation of fluid momentum and assuming steady, inviscid flow and a flexible hose in frictionless contact with the ground. An expression that is independent of the bend angle is derived for the hose tension. If this tension is exceeded owing...

  15. Chemical burn or reaction

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000059.htm Chemical burn or reaction To use the sharing features on ... the burned area from pressure and friction. Minor chemical burns will generally heal without further treatment. However, if ...

  16. Adverse reaction to tetrazepam.

    Science.gov (United States)

    Palacios Benito, R; Domínguez Ortega, J; Alonso Llamazares, A; Rodríguez Morales, A; Plaza Díaz, A; Chamorro Gómez, M; Martínez-Cócera, C

    2001-01-01

    Adverse reactions caused by benzodiazepines rarely occur. We present a case of a 70-year-old man who developed a maculopapular exanthema after the ingestion of tetrazepam. For his diagnosis, skin tests were performed, including prick and patch tests, not only with the benzodiazepine implicated in the reaction, but also with benzodiazepines of other groups. Single-blind oral challenge tests were also performed in the patient, in order to assess his tolerance to other benzodiazepines.

  17. Oxygen evolution reaction catalysis

    Science.gov (United States)

    Haber, Joel A.; Jin, Jian; Xiang, Chengxiang; Gregoire, John M.; Jones, Ryan J.; Guevarra, Dan W.; Shinde, Aniketa A.

    2016-09-06

    An Oxygen Evolution Reaction (OER) catalyst includes a metal oxide that includes oxygen, cerium, and one or more second metals. In some instances, the cerium is 10 to 80 molar % of the metals in the metal oxide and/or the catalyst includes two or more second metals. The OER catalyst can be included in or on an electrode. The electrode can be arranged in an oxygen evolution system such that the Oxygen Evolution Reaction occurs at the electrode.

  18. Photoinduced Multicomponent Reactions.

    Science.gov (United States)

    Garbarino, Silvia; Ravelli, Davide; Protti, Stefano; Basso, Andrea

    2016-12-12

    The combination of multicomponent approaches with light-driven processes opens up new scenarios in the area of synthetic organic chemistry, where the need for sustainable, atom- and energy-efficient reactions is increasingly urgent. Photoinduced multicomponent reactions are still in their infancy, but significant developments in this area are expected in the near future. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Compact Nd:YAG laser operating at 1.06, 1.32, and 1.44 μm for dental caries effective disinfection

    Science.gov (United States)

    Dostálová, Tat'jana; Jelínková, Helena; Kadlecová, Martina; Němec, Michal; Å ulc, Jan; Fibrich, Martin; Nejezchleb, Karel; Kapitch, Nickalai; Å koda, Václav

    2017-02-01

    The analysis of the disinfection effect of Nd:YAG laser radiation was investigated for patients with high concentration of Streptococcus mutans in saliva (positive result in Saliva-check mutans test). For the interaction the Nd:YAG laser system generated separate switchable wavelengths with the maximum output energies 1.1, 0.6, and 0.3 J for wavelength 1.06 μm, 1.32, μm and 1.44 μm, respectively, was used. Our study proved that after the laser irradiation the Saliva-check test showed negative presence of Streptococcus mutans. The disinfection effect was confirmed for all used radiation wavelength. For 1.44 μm this effect was reached with a smallest energy density.

  20. A Controlled and Retrospective Study of 144 Chronic Low Back Pain Patients to Evaluate the Effectiveness of an Intensive Functional Restoration Program in France

    OpenAIRE

    Isabelle Caby; Nicolas Olivier; Frédérick Janik; Jacques Vanvelcenaher; Patrick Pelayo

    2016-01-01

    Study Design: A controlled and retrospective study of 144 chronic low back pain patients to evaluate the effectiveness of an intensive functional restoration program in France. Objective: Evaluating the efficiency of an intensive, dynamic and multidisciplinary functional restoration program in patients with chronic low back pain (LBP), during 6 and 12 months follow up. Summary of background data: Chronic low back pain disease has a multifactor nature, involving physical, psychological profess...

  1. A novel arginine to tryptophan (R144W mutation in troponin T (cTnT gene in an indian multigenerational family with dilated cardiomyopathy (FDCM.

    Directory of Open Access Journals (Sweden)

    Deepa Selvi Rani

    Full Text Available Cardiomyopathy is a major cause of heart failure and sudden cardiac death; several mutations in sarcomeric protein genes have been associated with this disease. Our aim in the present study is to investigate the genetic variations in Troponin T (cTnT gene and its association with dilated cardiomyopathy (DCM in south-Indian patients. Analyses of all the exons and exon-intron boundaries of cTnT in 147 DCM and in 207 healthy controls had revealed a total of 15 SNPs and a 5 bp INDEL; of which, polymorphic SNPs were compared with the HapMap population data. Interestingly, a novel R144W mutation, that substitutes polar-neutral tryptophan for a highly conserved basic arginine in cTnT, altering the charge drastically, was identified in a DCM, with a family history of sudden-cardiac death (SCD. This mutation was found within the tropomyosin (TPM1 binding domain, and was evolutionarily conserved across species, therefore it is expected to have a significant impact on the structure and function of the protein. Family studies had revealed that the R144W is co-segregating with disease in the family as an autosomal dominant trait, but it was completely absent in 207 healthy controls and in 162 previously studied HCM patients. Further screening of the proband and three of his family members (positive for R144W mutant with eight other genes β-MYH7, MYBPC3, TPM1, TNNI3, TTN, ACTC, MYL2 and MYL3, did not reveal any disease causing mutation, proposing the absence of compound heterozygosity. Therefore, we strongly suggest that the novel R144W unique/private mutant identified in this study is associated with FDCM. This is furthermore signifying the unique genetic architecture of Indian population.

  2. Determination of the B(E3,0$^{+}$ $\\rightarrow$ 3$^{-}$) strength in the octupole correlated nuclei $^{142,144}$Ba using Coulomb excitation

    CERN Multimedia

    We propose to exploit the unique capability of ISOLDE to provide intense post-accelerated $^{142}$Ba and $^{144}$Ba ion beams from the HIE-ISOLDE facility to enable the Coulomb excitation of the first 3$^-$ state in these nuclei. By measuring the $\\gamma$-ray yields of the E1 decays from the 3$^-$ state using the MINIBALL array, we can obtain the interesting transition matrix element. The results will give quantitative information about octupole correlations in these nuclei.

  3. Subcellular co-localization of aluminum (III) phthalocyanine chloride tetrasulphonate with fluorescent markers in the human melanoma cell-line HT-144

    CSIR Research Space (South Africa)

    Ndhundhuma, I

    2011-08-01

    Full Text Available , and bladder cancer. Methyl- tetrahydroxyphenyl chlorin (Temoporfin) is approved in the European Union, Norway and Iceland for palliative treatment of head and neck cancer [8]. Other approved photosensitizers are 5-aminolevulinic acid (approved in USA..., NR) was purchased from Biochrom AG (Berlin, Germany) and used according to the manufacturer's instructions. Cell culture Cultures of human metastatic melanoma cell line (HT-144 cells, ATCC No HTB-63TM, LGC Standards GmbH, Wesel, Germany) were...

  4. Crystal structures of three 1-[4-(4-bromo-but-oxy)-phen-yl] chalcone derivatives: (E)-1-[4-(4-bromo-but-oxy)-phen-yl]-3-phenyl-prop-2-en-1-one, (E)-1-[4-(4-bromo-but-oxy)-phen-yl]-3-(4-meth-oxy-phen-yl)prop-2-en-1-one and (E)-1-[4-(4-bromo-but-oxy)-phen-yl]-3-(3,4-di-meth-oxy-phen-yl)prop-2-en-1-one.

    Science.gov (United States)

    Maragatham, Gunasekaran; Selvarani, Sivasamy; Rajakumar, Perumal; Lakshmi, Srinivasakannan

    2017-07-01

    The crystal structures of three chalcones with a bromo-substituted but-oxy side chain, viz. (E)-1-[4-(4-bromo-but-oxy)-phen-yl]-3-phenyl-prop-2-en-1-one, C19H19BrO2, (I), (E)-1-[4-(4-bromo-but-oxy)-phen-yl]-3-(4-meth-oxy-phen-yl)prop-2-en-1-one, C20H21BrO3, (II), and (E)-1-[4-(4-bromo-but-oxy)-phen-yl]-3-(3,4-di-meth-oxy-phen-yl)prop-2-en-1-one, C21H23BrO4, (III), are reported. In all mol-ecules, the conformation of the keto group with respect to the olefinic bond is s-cis. Mol-ecules of (I) and (II) are nearly planar, while mol-ecule (III) is not planar. In the crystal of compounds (I) and (II), mol-ecules are linked into chains parallel to the c axis by C-H⋯π inter-actions. In the crystal of compound (III), mol-ecules are linked by a pairs of C-H⋯O hydrogen bonds, forming inversion dimers. Weak C-Br⋯π inter-actions are also observed in (III).

  5. Mapping from quasi-elastic scattering to fusion reactions

    Directory of Open Access Journals (Sweden)

    Hagino K.

    2015-01-01

    Full Text Available The fusion barrier distribution has provided a nice representation for the channel coupling effects on heavy-ion fusion reactions at energies around the Coulomb barrier. Here we discuss how one can extract the same representation using the so called sum-of-differences (SOD method with quasi-elastic scattering cross sections. In contrast to the conventional quasi-elastic barrier distribution, the SOD barrier distribution has an advantage in that it can be applied both to non-symmetric and symmetric systems. It is also the case that the correspondence to the fusion barrier distribution is much better than the quasi-elastic barrier distribution. We demonstrate its usefulness by studying 16O+144Sm, 58Ni+58Ni, and 12C+12C systems.

  6. Medications and Drug Allergic Reactions

    Science.gov (United States)

    ... drug allergic reactions TTR Share | Medications and Drug Allergic Reactions This article has been reviewed by Thanai Pongdee, ... your symptoms are severe, seek medical help immediately. Allergic Reactions Allergy symptoms are the result of a chain ...

  7. Response by gender of HIV-1-infected subjects treated with abacavir/lamivudine plus atazanavir, with or without ritonavir, for 144 weeks

    Science.gov (United States)

    Squires, Kathleen E; Young, Benjamin; Santiago, Lizette; Dretler, Robin H; Walmsley, Sharon L; Zhao, Henry H; Pakes, Gary E; Ross, Lisa L; Shaefer, Mark S

    2017-01-01

    Purpose The 144-week results of the open-label, multicenter Atazanavir/Ritonavir Induction with Epzicom Study (ARIES) were stratified by gender to compare treatment responses. Methods A total of 369 HIV-infected, antiretroviral-naïve subjects receiving once-daily abacavir/lamivudine + atazanavir/ritonavir (ATV/r) whose HIV-1 RNA was <50 copies/mL by week 30 were randomized 1:1 at week 36 to maintain or discontinue ritonavir for 108 subsequent weeks. Between- and within-treatment gender-related efficacy and safety differences were analyzed. Results Subjects were 85% male; 64% white; and had a mean age of 39 years, baseline median HIV-1 RNA of 114,815 copies/mL, and median CD4+ cell count of 198 cells/mm3. Gender (ATV [n=189]: 29 females/160 males; ATV/r [n=180]: 25 females/155 males) and most other demographics were similar between groups; more females than males were black (65% vs 25%) and fewer females had baseline HIV-1 RNA ≥100,000 copies/mL (41% vs 58%). At week 144, no significant differences between genders were observed in proportion maintaining HIV-1 RNA <50 copies/mL (ATV, 79% vs 77%; ATV/r, 60% vs 75%) or <400 copies/mL (ATV, 83% vs 84%; ATV/r, 68% vs 82%) (intent-to-treat-exposed: time to loss of virologic response analysis); median CD4+ change from baseline (ATV, +365 vs +300 cells/mm3; ATV/r, +344 vs +301 cells/mm3); proportion with treatment-related grade 2–4 adverse events (baseline to week 144: ATV, 41% vs 31%; ATV/r, 36% vs 43%; weeks 36 to 144: ATV, 14% vs 13%; ATV/r, 24% vs 23%); or proportion developing fasting lipid changes. Female and male virologic failure rates (ATV, 0 vs 5; ATV/r, 2 vs 4) and proportions completing the study were similar during the extension phase. Primary withdrawal reasons were loss to follow-up and pregnancy for females and loss to follow-up and other for males. Conclusion Over 144 weeks, no significant gender differences were observed in efficacy, safety, or fasting lipid changes with abacavir/lamivudine +ATV or

  8. Assessment of adverse reaction rates during gadoteridol-enhanced MR imaging in 28,078 patients.

    Science.gov (United States)

    Morgan, Desiree E; Spann, J Stephen; Lockhart, Mark E; Winningham, Beth; Bolus, David N

    2011-04-01

    To determine adverse reaction rates in a tertiary care clinical setting after adoption of gadoteridol as the institutional routine magnetic resonance (MR) imaging contrast agent. With institutional review board approval, informed consent waiver, and HIPAA compliance, a prospective observational study of 28 078 patients who underwent intravenous gadoteridol-enhanced MR imaging from July 2007 to December 2009 was performed. Reactions were recorded by technologists who noted types of reactions, method of injection, and treatment. Reactions were classified as mild, moderate, or severe per American College of Radiology definitions. Comparisons of reaction rates with dose and method of injection were analyzed with the Fisher exact and χ(2) tests. Overall reaction rate was 0.666% (187 patients), including 177 mild, six moderate, and four severe reactions. Treatment was given in 27 patients (14.4%). The most frequent reaction was nausea (and/or vomiting) in 149 patients (79.7% of patients with any adverse reaction, 0.530% of overall population). Method of injection did not affect reaction rate or severity. There was no difference in type or severity of reactions in comparison of patients receiving half the dose versus patients receiving the standard dose (P = .33-.75). The observed adverse reaction rate to gadoteridol was lower than previously reported. Specifically, the rate of nausea (0.530%) was less than half the rate (1.4%) in clinical trials of 1251 patients, leading to FDA approval in 1992. Rates of adverse reactions for this macrocyclic contrast agent are comparable to those published for linear gadolinium-based contrast agents. © RSNA, 2011.

  9. Chemical kinetics of gas reactions

    CERN Document Server

    Kondrat'Ev, V N

    2013-01-01

    Chemical Kinetics of Gas Reactions explores the advances in gas kinetics and thermal, photochemical, electrical discharge, and radiation chemical reactions. This book is composed of 10 chapters, and begins with the presentation of general kinetic rules for simple and complex chemical reactions. The next chapters deal with the experimental methods for evaluating chemical reaction mechanisms and some theories of elementary chemical processes. These topics are followed by discussions on certain class of chemical reactions, including unimolecular, bimolecular, and termolecular reactions. The rema

  10. Association of Leisure-Time Physical Activity With Risk of 26 Types of Cancer in 1.44 Million Adults.

    Science.gov (United States)

    Moore, Steven C; Lee, I-Min; Weiderpass, Elisabete; Campbell, Peter T; Sampson, Joshua N; Kitahara, Cari M; Keadle, Sarah K; Arem, Hannah; Berrington de Gonzalez, Amy; Hartge, Patricia; Adami, Hans-Olov; Blair, Cindy K; Borch, Kristin B; Boyd, Eric; Check, David P; Fournier, Agnès; Freedman, Neal D; Gunter, Marc; Johannson, Mattias; Khaw, Kay-Tee; Linet, Martha S; Orsini, Nicola; Park, Yikyung; Riboli, Elio; Robien, Kim; Schairer, Catherine; Sesso, Howard; Spriggs, Michael; Van Dusen, Roy; Wolk, Alicja; Matthews, Charles E; Patel, Alpa V

    2016-06-01

    Leisure-time physical activity has been associated with lower risk of heart-disease and all-cause mortality, but its association with risk of cancer is not well understood. To determine the association of leisure-time physical activity with incidence of common types of cancer and whether associations vary by body size and/or smoking. We pooled data from 12 prospective US and European cohorts with self-reported physical activity (baseline, 1987-2004). We used multivariable Cox regression to estimate hazard ratios (HRs) and 95% confidence intervals for associations of leisure-time physical activity with incidence of 26 types of cancer. Leisure-time physical activity levels were modeled as cohort-specific percentiles on a continuous basis and cohort-specific results were synthesized by random-effects meta-analysis. Hazard ratios for high vs low levels of activity are based on a comparison of risk at the 90th vs 10th percentiles of activity. The data analysis was performed from January 1, 2014, to June 1, 2015. Leisure-time physical activity of a moderate to vigorous intensity. Incident cancer during follow-up. A total of 1.44 million participants (median [range] age, 59 [19-98] years; 57% female) and 186 932 cancers were included. High vs low levels of leisure-time physical activity were associated with lower risks of 13 cancers: esophageal adenocarcinoma (HR, 0.58; 95% CI, 0.37-0.89), liver (HR, 0.73; 95% CI, 0.55-0.98), lung (HR, 0.74; 95% CI, 0.71-0.77), kidney (HR, 0.77; 95% CI, 0.70-0.85), gastric cardia (HR, 0.78; 95% CI, 0.64-0.95), endometrial (HR, 0.79; 95% CI, 0.68-0.92), myeloid leukemia (HR, 0.80; 95% CI, 0.70-0.92), myeloma (HR, 0.83; 95% CI, 0.72-0.95), colon (HR, 0.84; 95% CI, 0.77-0.91), head and neck (HR, 0.85; 95% CI, 0.78-0.93), rectal (HR, 0.87; 95% CI, 0.80-0.95), bladder (HR, 0.87; 95% CI, 0.82-0.92), and breast (HR, 0.90; 95% CI, 0.87-0.93). Body mass index adjustment modestly attenuated associations for several cancers, but 10 of 13 inverse

  11. Reaction Qualifications Revisited

    DEFF Research Database (Denmark)

    Lippert-Rasmussen, Kasper

    2009-01-01

    of merit. Specifically, it preserves symmetry between negative evaluations of antimeritocratic bases of selection and negative evaluations of qualifications rooted in comparable antimeritocratic reactions. So if employers should not select among applicants on the basis of their (the employers') racial...... preferences, recipients should not respond to the applicant actually hired on the basis of their (the recipients') racial preferences. My account decomposes the meritocratic ideal into four separate norms, one of which applies to recipients rather than to selectors. Finally, it defends the view that reaction...... reaction-qualifications are entirely irrelevant from the point of view of merit, the view expounded here implies that the ideal of meritocracy and the norm of non-discrimination are less closely tied than theorists like Andrew Mason and David Miller believe.  ...

  12. Allergic reactions in anaesthesia

    DEFF Research Database (Denmark)

    Krøigaard, M; Garvey, L H; Menné, T

    2005-01-01

    BACKGROUND: The aim of this retrospective survey of possible allergic reactions during anaesthesia was to investigate whether the cause suspected by anaesthetists involved corresponded with the cause found on subsequent investigation in the Danish Anaesthesia Allergy Centre (DAAC). METHODS: Case...... notes and anaesthetic charts from 111 reactions in 107 patients investigated in the DAAC were scrutinized for either suspicions of or warnings against specific substances stated to be the cause of the supposed allergic reaction. RESULTS: In 67 cases, one or more substances were suspected. In 49...... of these (73%) the suspected cause did not match the results of subsequent investigation, either a different substance being the cause or no cause being found. Only five cases (7%) showed a complete match between suspected cause and investigation result. In the remaining 13 cases (19%) there was a partial...

  13. Hipersensitivity Reactions to Corticosteroids.

    Science.gov (United States)

    Berbegal, L; DeLeon, F J; Silvestre, J F

    2016-03-01

    Corticosteroids are widely used drugs in the clinical practice, especially by topic application in dermatology. These substances may act as allergens and produce immediate and delayed hypersensitivity reactions. Allergic contact dermatitis is the most frequent presentation of corticosteroid allergy and it should be studied by patch testing in specific units. The corticosteroids included in the Spanish standard battery are good markers but not ideal. Therefore, if those makers are positive, it is useful to apply a specific battery of corticosteroids and the drugs provided by patients. Immediate reactions are relatively rare but potentially severe, and it is important to confirm the sensitization profile and to guide the use of alternative corticosteroids, because they are often necessary in several diseases. In this article we review the main concepts regarding these two types of hypersensitivity reactions in corticosteroid allergy, as well as their approach in the clinical practice. Copyright © 2015 Elsevier España, S.L.U. and AEDV. All rights reserved.

  14. Nanoparticle Reactions on Chip

    Science.gov (United States)

    Köhler, J. M.; Kirner, Th.; Wagner, J.; Csáki, A.; Möller, R.; Fritzsche, W.

    The handling of heterogenous systems in micro reactors is difficult due to their adhesion and transport behaviour. Therefore, the formation of precipitates and gas bubbles has to be avoided in micro reaction technology, in most cases. But, micro channels and other micro reactors offer interesting possibilities for the control of reaction conditions and transport by diffusion and convection due to the laminar flow caused by small Reynolds numbers. This can be used for the preparation and modification of objects, which are much smaller than the cross section of microchannels. The formation of colloidal solutions and the change of surface states of nano particles are two important tasks for the application of chip reactors in nanoparticle technology. Some concepts for the preparation and reaction of nanoparticles in modular chip reactor arrangements will be discussed.

  15. Adverse reactions to cosmetics

    Directory of Open Access Journals (Sweden)

    Dogra A

    2003-03-01

    Full Text Available Adverse reaction to cosmetics constitute a small but significant number of cases of contact dermatitis with varied appearances. These can present as contact allergic dermatitis, photodermatitis, contact irritant dermatitis, contact urticaria, hypopigmentation, hyperpigmentotion or depigmentation, hair and nail breakage. Fifty patients were included for the study to assess the role of commonly used cosmetics in causing adverse reactions. It was found that hair dyes, lipsticks and surprisingly shaving creams caused more reaction as compared to other cosmetics. Overall incidence of contact allergic dermatitis seen was 3.3% with patients own cosmetics. Patch testing was also done with the basic ingredients and showed positive results in few cases where casual link could be established. It is recommended that labeling of the cosmetics should be done to help the dermatologists and the patients to identify the causative allergen in cosmetic preparation.

  16. Velocity pump reaction turbine

    Science.gov (United States)

    House, P.A.

    An expanding hydraulic/two-phase velocity pump reaction turbine including a dual concentric rotor configuration with an inter-rotor annular flow channel in which the inner rotor is mechanically driven by the outer rotor. In another embodiment, the inner rotor is immobilized and provided with gas recovery ports on its outer surface by means of which gas in solution may be recovered. This velocity pump reaction turbine configuration is capable of potential energy conversion efficiencies of up to 70%, and is particularly suited for geothermal applications.

  17. Knockout reactions: experimental aspects

    Energy Technology Data Exchange (ETDEWEB)

    Cortina Gil, D. [Santiago de Compostela Univ. (Spain)

    2007-07-01

    The availability of radioactive beams has given rise to intense activity in the field of direct reactions. The removal of one(two)-nucleon (referred to as nucleon knockout in this text) from a fast exotic projectile has been extensively investigated. This lecture provides a general overview of the experimental results achieved using this technique. The sensitivity of the method to different experimental aspects is illustrated with a few examples. Special attention is given to the application of nucleon-knockout reactions as a general purpose spectroscopic tool. (author)

  18. cyclopropanation reaction with ketene

    Indian Academy of Sciences (India)

    Administrator

    Smith. 15. This has motivated a large number of research groups to develop new and wide-range methods to produce cyclopropanated products. Methylene insertion by a carbenoid species into the. C=C bond is one of the most widely used methods since the recognition of the Simmons–Smith reac- tion, which is a reaction ...

  19. Reaction product imaging

    Energy Technology Data Exchange (ETDEWEB)

    Chandler, D.W. [Sandia National Laboratories, Livermore, CA (United States)

    1993-12-01

    Over the past few years the author has investigated the photochemistry of small molecules using the photofragment imaging technique. Bond energies, spectroscopy of radicals, dissociation dynamics and branching ratios are examples of information obtained by this technique. Along with extending the technique to the study of bimolecular reactions, efforts to make the technique as quantitative as possible have been the focus of the research effort. To this end, the author has measured the bond energy of the C-H bond in acetylene, branching ratios in the dissociation of HI, the energetics of CH{sub 3}Br, CD{sub 3}Br, C{sub 2}H{sub 5}Br and C{sub 2}H{sub 5}OBr dissociation, and the alignment of the CD{sub 3} fragment from CD{sub 3}I photolysis. In an effort to extend the technique to bimolecular reactions the author has studied the reaction of H with HI and the isotopic exchange reaction between H and D{sub 2}.

  20. Reaction Formulation: A Bibliography.

    Science.gov (United States)

    Pedrini, D. T.; Pedrini, Bonnie C.

    Reaction formation was studied by Sigmund Freud. This defense mechanism may be related to repression, substitution, reversal, and compensation (or over-compensation). Alfred Adler considered compensation a basic process in his individual psychology. Anna Freud discussed some defense mechanisms, and Bibring, Dwyer, Huntington, and Valenstein…

  1. Explaining competitive reaction effects

    NARCIS (Netherlands)

    Leeflang, P.S.H.; Wittink, D.R.

    Changes in promotional expenditure decisions for a brand, as in other marketing decisions, should be based on the expected impact on purchase and consumption behavior as well as on the likely reactions by competitors. Purchase behavior may be predicted from estimated demand functions. Competitive

  2. Cluster knockout reactions

    Indian Academy of Sciences (India)

    2014-04-07

    Apr 7, 2014 ... Cluster knockout reactions are expected to reveal the amount of clustering (such as that of , d and even of heavier clusters such as 12C, 16O etc.) in the target nucleus. In simple terms, incident medium high-energy nuclear projectile interacts strongly with the cluster (present in the target nucleus) as if it ...

  3. Transfer reactions with HELIOS

    Science.gov (United States)

    Wuosmaa, Alan H.

    2011-04-01

    Nucleon-transfer reactions have formed the backbone of nuclear-structure studies for several decades, providing a wealth of information about the energies, quantum numbers, and wave functions of single-particle states in nuclei throughout the nuclear chart. Current trends in nuclear-structure physics and the modern emphasis on properties of neutron-rich nuclei far from stability have renewed interest in such transfer reactions with radioactive beams. Here, the usual combination of light beam and heavy target cannot be used, and measurements must be performed in ``inverse kinematics,'' with a heavy, unstable beam incident on a light target. This arrangement introduces several technical difficulties, including the identification of the reaction products and the resolution of the states of interest in the residual nuclei. A new device, HELIOS (the HELIcal Orbit Spectrometer) at the ATLAS facility at Argonne National Laboratory, solves many of the problems encountered with inverse kinematics including particle identification and energy resolution in the center-of-mass frame. The device utilizes the uniform magnetic field of a large, superconducting solenoid to transport light reaction products from the target to a linear array of position-sensitive silicon detectors. The properties of HELIOS will be described, and examples from the initial research program that focuses on neutron transfer with the (d,p) reaction, using both stable and unstable beams with mass A = 11 to 136, will be presented. Work supported by the U. S. Department of Energy, Office of Nuclear Physics under contract numbers DE-FG02-04ER41320 (WMU) and DE-AC02-06CH11357 (ANL).

  4. Multicomponent reactions in polymer synthesis.

    Science.gov (United States)

    Kakuchi, Ryohei

    2014-01-03

    More participants, yet efficient reactions: Multicomponent reactions (MCRs) have found application in polymer chemistry both in the synthesis of multifunctional monomers and in post-polymerization modification. Examples include the Passerini three-component reaction, the Ugi four-component reaction, and the copper-catalyzed MCR. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Kinetics of Bio-Reactions

    DEFF Research Database (Denmark)

    Villadsen, John

    2015-01-01

    his chapter predicts the specific rates of reaction by means of a mathematical expression, the kinetics of the reaction. This expression can be derived through a mechanistic interpretation of an enzymatically catalyzed reaction, but it is essentially of empirical nature for cell reactions. The mo...

  6. What Is a Reaction Rate?

    Science.gov (United States)

    Schmitz, Guy

    2005-01-01

    The definition of reaction rate is derived and demonstrations are made for the care to be taken while using the term. Reaction rate can be in terms of a reaction property, the extent of reaction and thus it is possible to give a definition applicable in open and closed systems.

  7. A Controlled and Retrospective Study of 144 Chronic Low Back Pain Patients to Evaluate the Effectiveness of an Intensive Functional Restoration Program in France.

    Science.gov (United States)

    Caby, Isabelle; Olivier, Nicolas; Janik, Frédérick; Vanvelcenaher, Jacques; Pelayo, Patrick

    2016-04-27

    A controlled and retrospective study of 144 chronic low back pain patients to evaluate the effectiveness of an intensive functional restoration program in France. Evaluating the efficiency of an intensive, dynamic and multidisciplinary functional restoration program in patients with chronic low back pain (LBP), during 6 and 12 months follow up. Chronic low back pain disease has a multifactor nature, involving physical, psychological professional and social factors. A functional restoration program (FRP) has been included in a multidisciplinary training program which provides an efficient therapeutic solution. However, the effectiveness of an FRP has not been yet established. 144 subjects (71 males, 73 females) with chronic low back pain were included in a functional restoration program. The FRP includes physiotherapy and occupational therapy interventions together with psychological counselling. Patients participated as in- or outpatients 6 h per day, 5 days a week over 5 weeks. Pain intensity, trunk flexibility, trunk strength, lifting ability, quality of life and return to work were recorded before, immediately after, and at 6 months and 12 months after the treatment period. All outcome measures were significantly higher just after the FRP (144 patients) and at 6 and 12 months (from available data in 31 subjects) compared to pre-treatment values. This FRP for chronic low back pain maintained its benefits whatever the patient's activities. The effects reflected on all outcome measures, both on short and long term follow-up. The multidisciplinary FRP for chronic low back pain patients durably stopped the de-conditioning syndrome and involved new life-style habits for the patient, daily pain management and a return to work.

  8. A Controlled and Retrospective Study of 144 Chronic Low Back Pain Patients to Evaluate the Effectiveness of an Intensive Functional Restoration Program in France

    Directory of Open Access Journals (Sweden)

    Isabelle Caby

    2016-04-01

    Full Text Available Study Design: A controlled and retrospective study of 144 chronic low back pain patients to evaluate the effectiveness of an intensive functional restoration program in France. Objective: Evaluating the efficiency of an intensive, dynamic and multidisciplinary functional restoration program in patients with chronic low back pain (LBP, during 6 and 12 months follow up. Summary of background data: Chronic low back pain disease has a multifactor nature, involving physical, psychological professional and social factors. A functional restoration program (FRP has been included in a multidisciplinary training program which provides an efficient therapeutic solution. However, the effectiveness of an FRP has not been yet established. Methods: 144 subjects (71 males, 73 females with chronic low back pain were included in a functional restoration program. The FRP includes physiotherapy and occupational therapy interventions together with psychological counselling. Patients participated as in- or outpatients 6 h per day, 5 days a week over 5 weeks. Pain intensity, trunk flexibility, trunk strength, lifting ability, quality of life and return to work were recorded before, immediately after, and at 6 months and 12 months after the treatment period. Results: All outcome measures were significantly higher just after the FRP (144 patients and at 6 and 12 months (from available data in 31 subjects compared to pre-treatment values. This FRP for chronic low back pain maintained its benefits whatever the patient’s activities. Conclusions: The effects reflected on all outcome measures, both on short and long term follow-up. The multidisciplinary FRP for chronic low back pain patients durably stopped the de-conditioning syndrome and involved new life-style habits for the patient, daily pain management and a return to work.

  9. Effects of bioisosteric fluorine in synthetic cannabinoid designer drugs JWH-018, AM-2201, UR-144, XLR-11, PB-22, 5F-PB-22, APICA, and STS-135.

    Science.gov (United States)

    Banister, Samuel D; Stuart, Jordyn; Kevin, Richard C; Edington, Amelia; Longworth, Mitchell; Wilkinson, Shane M; Beinat, Corinne; Buchanan, Alexandra S; Hibbs, David E; Glass, Michelle; Connor, Mark; McGregor, Iain S; Kassiou, Michael

    2015-08-19

    Synthetic cannabinoid (SC) designer drugs featuring bioisosteric fluorine substitution are identified by forensic chemists and toxicologists with increasing frequency. Although terminal fluorination of N-pentyl indole SCs is sometimes known to improve cannabinoid type 1 (CB1) receptor binding affinity, little is known of the effects of fluorination on functional activity of SCs. This study explores the in vitro functional activities of SC designer drugs JWH-018, UR-144, PB-22, and APICA, and their respective terminally fluorinated analogues AM-2201, XLR-11, 5F-PB-22, and STS-135 at human CB1 and CB2 receptors using a FLIPR membrane potential assay. All compounds demonstrated agonist activity at CB1 (EC50 = 2.8-1959 nM) and CB2 (EC50 = 6.5-206 nM) receptors, with the fluorinated analogues generally showing increased CB1 receptor potency (∼2-5 times). Additionally, the cannabimimetic activities and relative potencies of JWH-018, AM-2201, UR-144, XLR-11, PB-22, 5F-PB-22, APICA, and STS-135 in vivo were evaluated in rats using biotelemetry. All SCs dose-dependently induced hypothermia and reduced heart rate at doses of 0.3-10 mg/kg. There was no consistent trend for increased potency of fluorinated SCs over the corresponding des-fluoro SCs in vivo. Based on magnitude and duration of hypothermia, the SCs were ranked for potency (PB-22 > 5F-PB-22 = JWH-018 > AM-2201 > APICA = STS-135 = XLR-11 > UR-144).

  10. Determination of the B(E3;0$^+\\!\\rightarrow$ 3$^{-}$) strength in the octupole correlated nucleus $^{144}$Ba using Coulomb excitation

    CERN Multimedia

    We propose to exploit the unique capability of ISOLDE to provide intense post-accelerated $^{144}$Ba ion beams from the REX facility to enable the Coulomb excitation of the first 3$^{-}$ state in this nucleus. By measuring the $\\gamma$-ray yields of the E1 decay connecting the 3$^{-}$ and 2$^{+}$ states using the MINIBALL array, we can obtain the interesting transition matrix element. The result will give quantitative information about octupole correlations in this nucleus. We require 27 shifts to fulfill the aims of the experiment.

  11. Design and Study of a DC/DC Converter for High Power, 14.4 V and 300 A for Automotive Applications

    OpenAIRE

    Julio Cesar Lopes de Oliveira; Carlos Henrique Gonc¸alves Treviso

    2014-01-01

    The shortage of the automotive market in relation to options for sources of high power car audio systems, led to development of this work. Thus, we developed a source with stabilized voltage with 4320 W effective power. Designed to the voltage of 14.4 V and a choice of two currents: 30 A load option in battery banks and 300 A at full load. This source can also be considered as a source of general use dedicated commercial with a simple control circuit in analog form based ...

  12. Estimation of continental 187Os/186Os values by using 187Os/186Os and 143Nd/144Nd ratios in marine manganese nodules

    OpenAIRE

    Turekian, Karl K.; Luck, Jean-Marc

    1984-01-01

    The relationship between 187Os/186Os and 143Nd/144Nd in different manganese nodule fields is used to determine the 187Os/186Os ratio of the continental terrains bounding the major ocean basins. The Atlantic Ocean drainages yield 187Os/186Os of about 11; the Pacific Ocean, between 25 and 36; and the western Indian Ocean, 20. By assuming a two-component continental crust composed of “ultramafic rocks” (high Os concentration, low 187Os/186Os) and “granite” with only radiogenic 187Os produced in ...

  13. Remaining Sites Verification Package for the 100-F-31, 144-F Sanitary Sewer System, Waste Site Reclassification Form 2006-033

    Energy Technology Data Exchange (ETDEWEB)

    L. M. Dittmer

    2006-08-24

    The 100-F-31 waste site is a former septic system that supported the inhalation laboratories, also referred to as the 144-F Particle Exposure Laboratory (132-F-2 waste site), which housed animals exposed to particulate material. The 100-F-31 waste site has been remediated to achieve the remedial action objectives specified in the Remaining Sites ROD. The results of verification sampling show that residual contaminant concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River.

  14. Reaction chemistry of cerium

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-01-01

    It is truly ironic that a synthetic organic chemist likely has far greater knowledge of the reaction chemistry of cerium(IV) than an inorganic colleague. Cerium(IV) reagents have long since been employed as oxidants in effecting a wide variety of organic transformations. Conversely, prior to the late 1980s, the number of well characterized cerium(IV) complexes did not extend past a handful of known species. Though in many other areas, interest in the molecular chemistry of the 4f-elements has undergone an explosive growth over the last twenty years, the chemistry of cerium(IV) has for the most part been overlooked. This report describes reactions of cerium complexes and structure.

  15. Reactions to dietary tartrazine.

    Science.gov (United States)

    David, T J

    1987-01-01

    Double blind challenges with tartrazine and benzoic acid were performed in hospital in 24 children whose parents gave a definite history of a purely behavioural immediate adverse reaction to one of these substances. The patients, whose ages ranged from 1.6 to 12.4 years, were on a diet that avoided these items, and in all there was a clear history that any lapse of the diet caused an obvious adverse behavioural reaction within two hours. In no patient was any change in behaviour noted either by the parents or the nursing staff after the administration of placebo or active substances. Twenty two patients returned to a normal diet without problems, but the parents of two children insisted on continuing the diet. While popular belief has it that additives may have harmful behavioural effects, objective verification is required to prevent overdiagnosis. PMID:3548601

  16. Enzyme catalysed tandem reactions.

    Science.gov (United States)

    Oroz-Guinea, Isabel; García-Junceda, Eduardo

    2013-04-01

    To transfer to the laboratory, the excellent efficiency shown by enzymes in Nature, biocatalysis, had to mimic several synthetic strategies used by the living organisms. Biosynthetic pathways are examples of tandem catalysis and may be assimilated in the biocatalysis field for the use of isolated multi-enzyme systems in the homogeneous phase. The concurrent action of several enzymes that work sequentially presents extraordinary advantages from the synthetic point of view, since it permits a reversible process to become irreversible, to shift the equilibrium reaction in such a way that enantiopure compounds can be obtained from prochiral or racemic substrates, reduce or eliminate problems due to product inhibition or prevent the shortage of substrates by dilution or degradation in the bulk media, etc. In this review we want to illustrate the developments of recent studies involving in vitro multi-enzyme reactions for the synthesis of different classes of organic compounds. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. CMLSnap : Animated reaction mechanisms

    OpenAIRE

    Holliday, Gemma L; Mitchell, John BO; Murray-Rust, Peter

    2004-01-01

    The authors thank the EPSRC for financial support of this project and Unilever for their support of the Centre for Molecular Science Informatics. Reactions with many steps can be represented by a single XML-based table of the atoms, bonds and electrons. For each step the complete Chemical Markup Language 1 representation of all components is obtained and a snapshot representing the end point of the step is generated. These snapshots can then be combined to give an animated description of t...

  18. Exclusive reactions in QCD

    OpenAIRE

    Pire, Bernard

    1996-01-01

    We review the theory of hard exclusive scattering in Quantum Chromodynamics. After recalling the classical counting rules which describe the leading scale dependence of form factors and exclusive cross-sections at fixed angle, the pedagogical example of the pion form factor is developped in some detail in order to show explicitely what factorization means in the QCD framework. The picture generalizes to many hard reactions which are at the heart of the ELFE project. We briefly present the con...

  19. Photochemical reaction dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Moore, B.C. [Lawrence Berkeley Laboratory, Livermore, CA (United States)

    1993-12-01

    The purpose of the program is to develop a fundamental understanding of unimolecular and bimolecular reaction dynamics with application in combustion and energy systems. The energy dependence in ketene isomerization, ketene dissociation dynamics, and carbonyl substitution on organometallic rhodium complexes in liquid xenon have been studied. Future studies concerning unimolecular processes in ketene as well as energy transfer and kinetic studies of methylene radicals are discussed.

  20. Cryochemical chain reactions

    Science.gov (United States)

    Barkalov, I. M.; Kiryukhin, D. P.

    The possibility of a chemical reaction near absolute zero has appeared doubtful since the beginning of the 1970s. The existing ideas must be revised after the radiation polymerization of formaldehyde at 4.2 K has been observed. In glassy systems, we have examined chain processes that occur under sharp (by five to six orders) changes in molecular mobility of the medium in the region of matrix devitrification. Quite unusual mechano-energetic chains of chemical conversion arise in the studied systems submerged in liquid helium. The chemical transformation initiated by local brittle fracture travels over the sample as an autowave. A series of experimental and theoretical investigations devoted to this interesting phenomenon are described. There is no generalization in this new region of chemistry up to this time. Many journal articles and reviews have been previously published only in Russian. The cycles of investigations of chain cryochemical reactions are the subject of this review. We hope that the investigation of the extraordinary peculiarities of chain cryochemical reactions should produce new ideas in chemical theory and industry.

  1. Adverse cutaneous drug reaction

    Directory of Open Access Journals (Sweden)

    Nayak Surajit

    2008-01-01

    Full Text Available In everyday clinical practice, almost all physicians come across many instances of suspected adverse cutaneous drug reactions (ACDR in different forms. Although such cutaneous reactions are common, comprehensive information regarding their incidence, severity and ultimate health effects are often not available as many cases go unreported. It is also a fact that in the present world, almost everyday a new drug enters market; therefore, a chance of a new drug reaction manifesting somewhere in some form in any corner of world is unknown or unreported. Although many a times, presentation is too trivial and benign, the early identification of the condition and identifying the culprit drug and omit it at earliest holds the keystone in management and prevention of a more severe drug rash. Therefore, not only the dermatologists, but all practicing physicians should be familiar with these conditions to diagnose them early and to be prepared to handle them adequately. However, we all know it is most challenging and practically difficult when patient is on multiple medicines because of myriad clinical symptoms, poorly understood multiple mechanisms of drug-host interaction, relative paucity of laboratory testing that is available for any definitive and confirmatory drug-specific testing. Therefore, in practice, the diagnosis of ACDR is purely based on clinical judgment. In this discussion, we will be primarily focusing on pathomechanism and approach to reach a diagnosis, which is the vital pillar to manage any case of ACDR.

  2. Modelling Tethered Enzymatic Reactions

    Science.gov (United States)

    Solis Salas, Citlali; Goyette, Jesse; Coker-Gordon, Nicola; Bridge, Marcus; Isaacson, Samuel; Allard, Jun; Maini, Philip; Dushek, Omer

    Enzymatic reactions are key to cell functioning, and whilst much work has been done in protein interaction in cases where diffusion is possible, interactions of tethered proteins are poorly understood. Yet, because of the large role cell membranes play in enzymatic reactions, several reactions may take place where one of the proteins is bound to a fixed point in space. We develop a model to characterize tethered signalling between the phosphatase SHP-1 interacting with a tethered, phosphorylated protein. We compare our model to experimental data obtained using surface plasmon resonance (SPR). We show that a single SPR experiment recovers 5 independent biophysical/biochemical constants. We also compare the results between a three dimensional model and a two dimensional model. The work gives the opportunity to use known techniques to learn more about signalling processes, and new insights into how enzyme tethering alters cellular signalling. With support from the Mexican Council for Science and Technology (CONACyT), the Public Education Secretariat (SEP), and the Mexican National Autonomous University's Foundation (Fundacion UNAM).

  3. Determination of specific radioactivity of samarium-153 product. 1. Quantitative determination of samarium by spectrophotometry

    Energy Technology Data Exchange (ETDEWEB)

    Izumo, Mishiroku [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Nemoto, Masahiro [Tokyo Nuclear Service Co., Ltd., Tokyo (Japan)

    2002-03-01

    On the specific radioactivity of Sm-153 for the radiotherapy of cancers, a simple method for determination of the amount of Sm was described. The method used Arsenazo III as a colorimetric reagent. The sample irradiated in the reactor was dissolved in 1M HCl solution. A small part of it was taken and mixed with Arsenazo III at pH 3.2, and the amount of Sm was determined by the spectrophotometric method at a wavelength of 652 nm. The molar absorptivity of Sm at 652 nm was 6.6x10{sup 3} m{sup -1}{center_dot}mm{sup -1}. The error of measurement in the partial different conditions was about 2% of the value determined. The effects of impurities, Fe, Zn and Cu mixing in the Sm during operation, were clarified. (author)

  4. Durability of Stavudine, Lamivudine and Nevirapine among Advanced HIV-1 Infected Patients with/without Prior Co-administration of Rifampicin: A 144-week Prospective Study

    Directory of Open Access Journals (Sweden)

    Prasithisirikul Wisit

    2008-10-01

    Full Text Available Abstract Background To date, data on the durability of a regimen of stavudine, lamivudine and nevirapine are very limited, particularly from the resource-limited settings. Methods A prospective cohort study was conducted among 140 antiretroviral-naïve patients who were enrolled to initiate d4T, 3TC and NVP between November 2004 and March 2005. The objectives were to determine immunological and virological responses after 144 weeks of antiretroviral therapy. Seventy patients with tuberculosis also received rifampicin during the early period of antiviral treatment (TB group. Results Of all, median (IQR baseline CD4 cell count was 31 (14–79 cells/mm3; median (IQR baseline HIV-1 RNA was 433,500 (169,000–750,000 copies/mL. The average body weight was 55 kilograms. By intention-to-treat analysis at 144 weeks, the overall percentage of patients who achieved plasma HIV-1 RNA P = 0.731. Eight (5.8% patients discontinued d4T due to neuropathy and/or symptomatic lactic acidosis. Conclusion The overall durability and efficacy of antiviral response of d4T, 3TC and NVP are satisfied and they are not different between HIV-1 infected patients with and without co-administration of rifampicin due to tuberculosis. However, stavudine-related adverse effects are concerns. Trial registration ClinicalTrials.gov Identifier NCT00703898

  5. Well sealing via thermite reactions

    Science.gov (United States)

    Lowry, William Edward; Dunn, Sandra Dalvit

    2016-11-15

    A platform is formed in a well below a target plug zone by lowering a thermite reaction charge into the well and igniting it, whereby the products of the reaction are allowed to cool and expand to form a platform or support in the well. A main thermite reaction charge is placed above the platform and ignited to form a main sealing plug for the well. In some embodiments an upper plug is formed by igniting an upper thermite reaction charge above the main thermite reaction charge. The upper plug confines the products of ignition of the main thermite reaction charge.

  6. Response by gender of HIV-1-infected subjects treated with abacavir/lamivudine plus atazanavir, with or without ritonavir, for 144 weeks

    Directory of Open Access Journals (Sweden)

    Squires KE

    2017-03-01

    Full Text Available Kathleen E Squires,1 Benjamin Young,2,3 Lizette Santiago,4 Robin H Dretler,5 Sharon L Walmsley,6 Henry H Zhao,7 Gary E Pakes,8 Lisa L Ross,8 Mark S Shaefer8 On behalf of the ARIES Study Team 1Thomas Jefferson University, Philadelphia, PA, 2Apex Family Medicine and Research, Denver, CO, 3International Association of Physicians in AIDS Care, Washington DC, USA; 4HOPE Clinic and Wellness Center, San Juan, Puerto Rico; 5ID Specialists of Atlanta, Decatur, GA, USA; 6University Health Network, Toronto, ON, Canada; 7GlaxoSmithKline, 8ViiV Healthcare, Research Triangle Park, NC, USA Purpose: The 144-week results of the open-label, multicenter Atazanavir/Ritonavir Induction with Epzicom Study (ARIES were stratified by gender to compare treatment responses.Methods: A total of 369 HIV-infected, antiretroviral-naïve subjects receiving once-daily abacavir/lamivudine + atazanavir/ritonavir (ATV/r whose HIV-1 RNA was <50 copies/mL by week 30 were randomized 1:1 at week 36 to maintain or discontinue ritonavir for 108 subsequent weeks. Between- and within-treatment gender-related efficacy and safety differences were analyzed.Results: Subjects were 85% male; 64% white; and had a mean age of 39 years, baseline median HIV-1 RNA of 114,815 copies/mL, and median CD4+ cell count of 198 cells/mm3. Gender (ATV [n=189]: 29 females/160 males; ATV/r [n=180]: 25 females/155 males and most other demographics were similar between groups; more females than males were black (65% vs 25% and fewer females had baseline HIV-1 RNA ≥100,000 copies/mL (41% vs 58%. At week 144, no significant differences between genders were observed in proportion maintaining HIV-1 RNA <50 copies/mL (ATV, 79% vs 77%; ATV/r, 60% vs 75% or <400 copies/mL (ATV, 83% vs 84%; ATV/r, 68% vs 82% (intent-to-treat-exposed: time to loss of virologic response analysis; median CD4+ change from baseline (ATV, +365 vs +300 cells/mm3; ATV/r, +344 vs +301 cells/mm3; proportion with treatment-related grade 2–4

  7. Insect bite reactions

    Directory of Open Access Journals (Sweden)

    Sanjay Singh

    2013-01-01

    Full Text Available Insects are a class of living creatures within the arthropods. Insect bite reactions are commonly seen in clinical practice. The present review touches upon the medically important insects and their places in the classification, the sparse literature on the epidemiology of insect bites in India, and different variables influencing the susceptibility of an individual to insect bites. Clinical features of mosquito bites, hypersensitivity to mosquito bites Epstein-Barr virus NK (HMB-EBV-NK disease, eruptive pseudoangiomatosis, Skeeter syndrome, papular pruritic eruption of HIV/AIDS, and clinical features produced by bed bugs, Mexican chicken bugs, assassin bugs, kissing bugs, fleas, black flies, Blandford flies, louse flies, tsetse flies, midges, and thrips are discussed. Brief account is presented of the immunogenic components of mosquito and bed bug saliva. Papular urticaria is discussed including its epidemiology, the 5 stages of skin reaction, the SCRATCH principle as an aid in diagnosis, and the recent evidence supporting participation of types I, III, and IV hypersensitivity reactions in its causation is summarized. Recent developments in the treatment of pediculosis capitis including spinosad 0.9% suspension, benzyl alcohol 5% lotion, dimethicone 4% lotion, isopropyl myristate 50% rinse, and other suffocants are discussed within the context of evidence derived from randomized controlled trials and key findings of a recent systematic review. We also touch upon a non-chemical treatment of head lice and the ineffectiveness of egg-loosening products. Knockdown resistance (kdr as the genetic mechanism making the lice nerves insensitive to permethrin is discussed along with the surprising contrary clinical evidence from Europe about efficacy of permethrin in children with head lice carrying kdr-like gene. The review also presents a brief account of insects as vectors of diseases and ends with discussion of prevention of insect bites and some

  8. Low Energy Nuclear Reactions?

    CERN Multimedia

    CERN. Geneva; Faccini, R.

    2014-01-01

    After an introduction to the controversial problem of Low Energy Nuclear Reactions (LENR) catalyzed by neutrons on metallic hydride surfaces we present the results of an experiment, made in collaboration with ENEA Labs in Frascati, to search neutrons from plasma discharges in electrolytic cells. The negative outcome of our experiment goes in the direction of ruling out those theoretical models expecting LENR to occur in condensed matter systems under specific conditions. Our criticism on the theoretical foundations of such models will also be presented.

  9. Towards a Microscopic Reaction Description Based on Energy Density Functionals

    Energy Technology Data Exchange (ETDEWEB)

    Nobre, G A; DIetrich, F S; Escher, J E; Thompson, I J; Dupuis, M; Terasaki, J; Engel, J

    2011-09-26

    A microscopic calculation of reaction cross sections for nucleon-nucleus scattering has been performed by explicitly coupling the elastic channel to all particle-hole excitations in the target and one-nucleon pickup channels. The particle-hole states may be regarded as doorway states through which the flux flows to more complicated configurations, and subsequently to long-lived compound nucleus resonances. Target excitations for {sup 40,48}Ca, {sup 58}Ni, {sup 90}Zr and {sup 144}Sm were described in a random-phase framework using a Skyrme functional. Reaction cross sections obtained agree very well with experimental data and predictions of a state-of-the-art fitted optical potential. Couplings between inelastic states were found to be negligible, while the pickup channels contribute significantly. The effect of resonances from higher-order channels was assessed. Elastic angular distributions were also calculated within the same method, achieving good agreement with experimental data. For the first time observed absorptions are completely accounted for by explicit channel coupling, for incident energies between 10 and 70 MeV, with consistent angular distribution results.

  10. Mass Transfer with Chemical Reaction.

    Science.gov (United States)

    DeCoursey, W. J.

    1987-01-01

    Describes the organization of a graduate course dealing with mass transfer, particularly as it relates to chemical reactions. Discusses the course outline, including mathematics models of mass transfer, enhancement of mass transfer rates by homogeneous chemical reaction, and gas-liquid systems with chemical reaction. (TW)

  11. Anaphylactic reactions to novel foods

    DEFF Research Database (Denmark)

    Ballardini, Natalia; Nopp, Anna; Hamsten, Carl

    2017-01-01

    an anaphylactic reaction. Cross-reactivity between chicken and crocodile meat was suspected to have triggered this reaction. Basophil activation and immunoglobulin E testing confirmed the boy's allergic reaction to crocodile meat proteins. Molecular analysis identified a crocodile a-parvalbumin, with extensive...

  12. Reactions inside nanoscale protein cages

    NARCIS (Netherlands)

    Bode, Saskia A.; Minten, Inge J.; Nolte, Roeland J.M.; Cornelissen, Jeroen Johannes Lambertus Maria

    2011-01-01

    Chemical reactions are traditionally carried out in bulk solution, but in nature confined spaces, like cell organelles, are used to obtain control in time and space of conversion. One way of studying these reactions in confinement is the development and use of small reaction vessels dispersed in

  13. CD8 and CD4 epitope predictions in RV144: no strong evidence of a T-cell driven sieve effect in HIV-1 breakthrough sequences from trial participants.

    Directory of Open Access Journals (Sweden)

    Kalpana Dommaraju

    Full Text Available The modest protection afforded by the RV144 vaccine offers an opportunity to evaluate its mechanisms of protection. Differences between HIV-1 breakthrough viruses from vaccine and placebo recipients can be attributed to the RV144 vaccine as this was a randomized and double-blinded trial. CD8 and CD4 T cell epitope repertoires were predicted in HIV-1 proteomes from 110 RV144 participants. Predicted Gag epitope repertoires were smaller in vaccine than in placebo recipients (p = 0.019. After comparing participant-derived epitopes to corresponding epitopes in the RV144 vaccine, the proportion of epitopes that could be matched differed depending on the protein conservation (only 36% of epitopes in Env vs 84-91% in Gag/Pol/Nef for CD8 predicted epitopes or on vaccine insert subtype (55% against CRF01_AE vs 7% against subtype B. To compare predicted epitopes to the vaccine, we analyzed predicted binding affinity and evolutionary distance measurements. Comparisons between the vaccine and placebo arm did not reveal robust evidence for a T cell driven sieve effect, although some differences were noted in Env-V2 (0.022≤p-value≤0.231. The paucity of CD8 T cell responses identified following RV144 vaccination, with no evidence for V2 specificity, considered together both with the association of decreased infection risk in RV 144 participants with V-specific antibody responses and a V2 sieve effect, lead us to hypothesize that this sieve effect was not T cell specific. Overall, our results did not reveal a strong differential impact of vaccine-induced T cell responses among breakthrough infections in RV144 participants.

  14. Communication: The Al + CO2 → AlO + CO reaction: Experiment vs. theory

    Science.gov (United States)

    Sun, Zhi; Moore, Kevin B.; Schaefer, Henry F.

    2017-11-01

    Based on their highly sophisticated crossed-beam experimental studies of the Al + CO2 → AlO + CO reaction, Honma and Hirata have directly challenged the results of earlier theoretical studies of this system. We report high level theoretical studies of this system. It is shown that, consistent with Honma-Hirata experimental conclusions, the previous theoretical prediction of a substantial barrier height for this reaction was incorrect. However, for the structures of the possible intermediates, in agreement with the 1992 theoretical study of Sakai, we find striking disagreement with the experimental conclusion that the O-C-O moiety is nearly linear. The energies of the three entrance channel intermediates lie 14.4, 15.2, and 16.4 kcal mol-1 below separated Al + CO2.

  15. Nuclear reactions an introduction

    CERN Document Server

    Paetz gen. Schieck, Hans

    2014-01-01

    Nuclei and nuclear reactions offer a unique setting for investigating three (and in some cases even all four) of the fundamental forces in nature. Nuclei have been shown – mainly by performing scattering experiments with electrons, muons, and neutrinos – to be extended objects with complex internal structures: constituent quarks; gluons, whose exchange binds the quarks together; sea-quarks, the ubiquitous virtual quark-antiquark pairs and, last but not least, clouds of virtual mesons, surrounding an inner nuclear region, their exchange being the source of the nucleon-nucleon interaction.   The interplay between the (mostly attractive) hadronic nucleon-nucleon interaction and the repulsive Coulomb force is responsible for the existence of nuclei; their degree of stability, expressed in the details and limits of the chart of nuclides; their rich structure and the variety of their interactions. Despite the impressive successes of the classical nuclear models and of ab-initio approaches, there is clearly no ...

  16. Reaction Time for Trimolecular Reactions in Compartment-based Reaction-Diffusion Models

    OpenAIRE

    Li, F; Chen, M; Erban, R; Cao, Y

    2016-01-01

    Trimolecular reaction models are investigated in the compartment-based (lattice-based) framework for stochastic reaction-diffusion modelling. The formulae for the first collision time and the mean reaction time are derived for the case where three molecules are present in the solution.

  17. The Glaser–Hay reaction

    DEFF Research Database (Denmark)

    Vilhelmsen, Mie Højer; Jensen, Jonas; Tortzen, Christian

    2013-01-01

    . This unfavorable change in reaction profile could be avoided by adding molecular sieves to the reaction mixture, thereby removing the water that is accumulated from the air and produced in the reaction in which dioxygen acts as the oxidizing agent. Not unexpectedly, the stirring rate, and hence uptake of air (O2......), was found to have a significant effect on the rate of the reaction: The percentage of alkyne remaining after a certain time decreased linearly with the rate of stirring. On the basis of systematic studies, the optimized conditions for the coupling reaction using CuCl/TMEDA as the catalyst system......The oxidative Glaser–Hay coupling of two terminal alkynes to furnish a butadiyne is a key reaction for acetylenic scaffolding. Although the reaction is performed under rather simple conditions [CuCl/TMEDA/O2 (air)], the mechanism is still under debate. Herein we present detailed studies...

  18. Ion-Molecule Reaction Dynamics.

    Science.gov (United States)

    Meyer, Jennifer; Wester, Roland

    2017-05-05

    We review the recent advances in the investigation of the dynamics of ion-molecule reactions. During the past decade, the combination of single-collision experiments in crossed ion and neutral beams with the velocity map ion imaging detection technique has enabled a wealth of studies on ion-molecule reactions. These methods, in combination with chemical dynamics simulations, have uncovered new and unexpected reaction mechanisms, such as the roundabout mechanism and the subtle influence of the leaving group in anion-molecule nucleophilic substitution reactions. For this important class of reactions, as well as for many fundamental cation-molecule reactions, the information obtained with crossed-beam imaging is discussed. The first steps toward understanding micro-solvation of ion-molecule reaction dynamics are presented. We conclude with the presentation of several interesting directions for future research.

  19. Search for 14.4 keV solar axions emitted in the M1-transition of $^{57}$Fe nuclei with CAST

    CERN Document Server

    Andriamonje, S; Autiero, D; Barth, K; Belov, A; Beltrán, B; Bräuninger, H; Carmona, J M; Cebrián, S; Collar, J I; Dafni, T; Davenport, M; Di Lella, L; Eleftheriadis, C; Englhauser, J; Fanourakis, G K; Ferrer-Ribas, E; Fischer, H; Franz, J; Friedrich, P; Geralis, T; Giomataris, Yu; Gninenko, S; Gómez, H; Hasinoff, M; Heinsius, F H; Hoffmann, D H H; Irastorza, I G; Jacoby, J; Jakovčić, K; Kang, D; Königsmann, K C; Kotthaus, R; Krčmar, M; Kousouris, K; Kuster, M; Lakić, B; Lasseur, C; Liolios, A; Ljubičić, A; Lutz, G; Luzón, G; Miller, D; Morales, J; Ortiz, A; Papaevangelou, T; Placci, A; Raffelt, G; Riege, H; Rodríguez, A; Ruz, J; Savvidis, I; Semertzidis, Y; Serpico, P; Stewart, L; Vieira, J; Villar, J; Vogel, J; Walckiers, L; Zioutas, K

    2009-01-01

    We have searched for 14.4 keV solar axions or more general axion-like particles (ALPs), that may be emitted in the M1 nuclear transition of 57Fe, by using the axion-to-photon conversion in the CERN Axion Solar Telescope (CAST) with evacuated magnet bores (Phase I). From the absence of excess of the monoenergetic X-rays when the magnet was pointing to the Sun, we set model-independent constraints on the coupling constants of pseudoscalar particles that couple to two photons and to a nucleon g_{a\\gamma} |-1.19 g_{aN}^{0}+g_{aN}^{3}|<1.36\\times 10^{-16} GeV^{-1} for m_{a}<0.03 eV at the 95% confidence level.

  20. Search for 14.4-KeV Solar Axions Emitted in the M1-Transition of Fe-57 Nuclei with CAST

    Energy Technology Data Exchange (ETDEWEB)

    Andriamonje, S.; Aune, S.; /DAPNIA, Saclay; Autiero, D.; /CERN /Lyon, IPN; Barth, K.; /CERN; Belov, A.; /Moscow, INR; Beltran, B.; /Zaragoza U. /Queen' s U., Kingston; Brauninger, H.; /Garching, Max Planck Inst., MPE; Carmona, J.M.; Cebrian, S.; /Zaragoza U.; Collar, J.I.; /Chicago U., EFI /Chicago U., KICP; Dafni, T.; /DAPNIA, Saclay /Darmstadt, Tech. Hochsch. /Zaragoza U.; Davenport, M.; /CERN; Di Lella, L.; /CERN /Pisa, Scuola Normale Superiore; Eleftheriadis, C.; /Aristotle U., Thessaloniki; Englhauser, J.; /Garching, Max Planck Inst., MPE; Fanourakis, G.; /Democritos Nucl. Res. Ctr.; Ferrer-Ribas, E.; /DAPNIA, Saclay; Fischer, H.; Franz, J.; /Freiburg U.; Friedrich, P.; /Garching, Max Planck Inst., MPE; Geralis, T.; /Democritos Nucl. Res. Ctr. /DAPNIA, Saclay /Moscow, INR /Zaragoza U. /British Columbia U. /Freiburg U. /Darmstadt, Tech. Hochsch. /DAPNIA, Saclay /Zaragoza U. /Frankfurt U. /Boskovic Inst., Zagreb /Freiburg U. /Munich, Max Planck Inst. /Boskovic Inst., Zagreb /Democritos Nucl. Res. Ctr. /Darmstadt, Tech. Hochsch. /Garching, Max Planck Inst., MPE /Boskovic Inst., Zagreb /CERN /Aristotle U., Thessaloniki /Boskovic Inst., Zagreb /Munich, Max Planck Inst. /Zaragoza U. /Chicago U., EFI /Chicago U., KICP /Stanford U., Phys. Dept. /SLAC /Zaragoza U. /CERN /DAPNIA, Saclay /CERN /Munich, Max Planck Inst. /Darmstadt, Tech. Hochsch. /Zaragoza U. /Aristotle U., Thessaloniki /Patras U. /Brookhaven /CERN /Munich, Max Planck Inst. /CERN /Chicago U., EFI /Chicago U., KICP /Zaragoza U. /Freiburg U. /CERN /CERN /Patras U.

    2011-12-02

    We have searched for 14.4 keV solar axions or more general axion-like particles (ALPs), that may be emitted in the M1 nuclear transition of 57Fe, by using the axion-to-photon conversion in the CERN Axion Solar Telescope (CAST) with evacuated magnet bores (Phase I). From the absence of excess of the monoenergetic X-rays when the magnet was pointing to the Sun, we set model-independent constraints on the coupling constants of pseudoscalar particles that couple to two photons and to a nucleon g{sub ay}|-1.19g{sub aN}{sup 0}+g{sub aN}{sup 3}| < 1.36 x 10{sup -16} GeV{sup -1} for ma < 0.03 eV at the 95% confidence level.

  1. STEM Electron Diffraction and High Resolution Images Used in the Determination of the Crystal Structure of Au144(SR)60Cluster.

    Science.gov (United States)

    Bahena, Daniel; Bhattarai, Nabraj; Santiago, Ulises; Tlahuice, Alfredo; Ponce, Arturo; Bach, Stephan B H; Yoon, Bokwon; Whetten, Robert L; Landman, Uzi; Jose-Yacaman, Miguel

    2013-03-07

    Determination of the total structure of molecular nanocrystals is an outstanding experimental challenge that has been met, in only a few cases, by single-crystal X-ray diffraction. Described here is an alternative approach that is of most general applicability and does not require the fabrication of a single crystal. The method is based on rapid, time-resolved nanobeam electron diffraction (NBD) combined with high-angle annular dark field scanning/transmission electron microscopy (HAADF-STEM) images in a probe corrected STEM microscope, operated at reduced voltages. The results are compared with theoretical simulations of images and diffraction patterns obtained from atomistic structural models derived through first-principles density functional theory (DFT) calculations. The method is demonstrated by application to determination of the structure of the Au 144 (SCH 2 CH 2 Ph) 60 cluster.

  2. Estimation of continental 187Os/186Os values by using 187Os/186Os and 143Nd/144Nd ratios in marine manganese nodules

    Science.gov (United States)

    Turekian, Karl K.; Luck, Jean-Marc

    1984-01-01

    The relationship between 187Os/186Os and 143Nd/144Nd in different manganese nodule fields is used to determine the 187Os/186Os ratio of the continental terrains bounding the major ocean basins. The Atlantic Ocean drainages yield 187Os/186Os of about 11; the Pacific Ocean, between 25 and 36; and the western Indian Ocean, 20. By assuming a two-component continental crust composed of “ultramafic rocks” (high Os concentration, low 187Os/186Os) and “granite” with only radiogenic 187Os produced in accessory Re-bearing molybdenite, the ultramafic contribution to weathering is about 0.2%. Some or most of this may come from the alteration of oceanic ultramafics. PMID:16578780

  3. Hidden Components in Aqueous "Gold-144" Fractionated by PAGE: High-Resolution Orbitrap ESI-MS Identifies the Gold-102 and Higher All-Aromatic Au-pMBA Cluster Compounds.

    Science.gov (United States)

    Alvarez, Marcos M; Chen, Jenny; Plascencia-Villa, Germán; Black, David M; Griffith, Wendell P; Garzón, Ignacio L; José-Yacamán, Miguel; Demeler, Borries; Whetten, Robert L

    2016-07-07

    Experimental and theoretical evidence reveals the resilience and stability of the larger aqueous gold clusters protected with p-mercaptobenzoic acid ligands (pMBA) of composition Aun(pMBA)p or (n, p). The Au144(pMBA)60, (144, 60), or gold-144 aqueous gold cluster is considered special because of its high symmetry, abundance, and icosahedral structure as well as its many potential uses in material and biological sciences. Yet, to this date, direct confirmation of its precise composition and total structure remains elusive. Results presented here from characterization via high-resolution electrospray ionization mass spectrometry on an Orbitrap instrument confirm Au102(pMBA)44 at isotopic resolution. Further, what usually appears as a single band for (144, 60) in electrophoresis (PAGE) is shown to also contain the (130, 50), recently determined to have a truncated-decahedral structure, and a (137, 56) component in addition to the dominant (144, 60) compound of chiral-icosahedral structure. This finding is significant in that it reveals the existence of structures never before observed in all-aromatic water-soluble species while pointing out the path toward elucidation of the thermodynamic control of protected gold nanocrystal formation.

  4. Preaggregation reactions of platelets.

    Science.gov (United States)

    Gear, A R

    1981-09-01

    Whether platelet volume increases during the morphological changes preceding aggregation has been investigated. Previous research is controversial; resistive-counting techniques reveal an increase, centrifugal methods do not. Platelets were sized with a computerized, resistive-particle counter before and after incubation with adenosine diphosphate (ADP). Resistive volume increased by 14% (p less than 0.001) in the absence of EDTA, and only 7% in its presence (ADP, 10 micro M). EDTA inhibited platelet volume changes, whether these were shrinking induced by warming or swelling by ADP. Handling of platelets, such as during centrifugation, also caused particle swelling. Particle density decreased after ADP exposure, without release of serotonin, suggesting uptake of water. Platelet shape was experimentally manipulated to test the hypothesis that resistive volume changes stem from artifacts of particle shape. Scanning electron microscopy confirmed that colchicine, chlorpromazine, and a temperature cycle of 0 degrees to 37 degrees all caused extensive alteration from the disc shape. Subsequent exposure to ADP increased resistive volume, and in the case of chlorpromazine, no long pseudopodia were extruded. It is concluded that preaggregation reactions of platelets can be associated with an increase in particle volume, and that earlier research based on centrifugation and the presence of ETA failed to reveal the increase because of inhibitory and apparent swelling effects.

  5. Adverse Reactions to Biologic Therapy.

    Science.gov (United States)

    Patel, Sheenal V; Khan, David A

    2017-05-01

    Biologic therapies are emerging as a significant therapeutic option for many with debilitating inflammatory and autoimmune conditions. As expansion in the number of FDA-approved agents continue to be seen, more unanticipated adverse reactions are likely to occur. Currently, the diagnostic tools, including skin testing and in vitro testing, to evaluate for immediate hypersensitivity reactions are insufficient. In this review, management strategies for common acute infusion reactions, injection site reactions, and immediate reactions suggestive of IgE-mediated mechanisms are discussed. Desensitization can be considered for reactions suggestive of IgE-mediated mechanisms, but allergists/immunologists should be involved in managing these patients. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. The Progression of Sequential Reactions

    Directory of Open Access Journals (Sweden)

    Jack McGeachy

    2010-01-01

    Full Text Available Sequential reactions consist of linked reactions in which the product of the first reaction becomes the substrate of a second reaction. Sequential reactions occur in industrially important processes, such as the chlorination of methane. A generalized series of three sequential reactions was analyzed in order to determine the times at which each chemical species reaches its maximum. To determine the concentration of each species as a function of time, the differential rate laws for each species were solved. The solution of each gave the concentration curve of the chemical species. The concentration curves of species A1 and A2 possessed discreet maxima, which were determined through slope-analysis. The concentration curve of the final product, A3, did not possess a discreet maximum, but rather approached a finite limit.

  7. The Paterno-Buchi reaction

    DEFF Research Database (Denmark)

    Brogaard, Rasmus Yding; Schalk, Oliver; Boguslavskiy, Andrey E.

    2012-01-01

    The Paternò-Büchi (PB) reaction between an excited carbonyl compound and an alkene has been widely studied, but so far little is known about the excited-state dynamics of the reaction. In this investigation, we used a compound in which a formyl and a vinyl group are attached to a [2.......2]paracyclophane in order to obtain a model system in pre-reactive conformation for the PB reaction. We studied the excited-state dynamics of the isolated molecule in a molecular beam using femtosecond time-resolved photoelectron spectroscopy and ab initio calculations. The results show that inter-system crossing...... within two picoseconds competes efficiently with the reaction in the singlet manifold. Thus, the PB reaction in this model system takes place in the triplet state on a time scale of nanoseconds. This result stresses the importance of triplet states in the excited-state pathway of the PB reaction...

  8. Drug related medical emergencies in the elderly: role of adverse drug reactions and non-compliance.

    Science.gov (United States)

    Malhotra, S; Karan, R S; Pandhi, P; Jain, S

    2001-11-01

    Adverse drug reactions and non-compliance are important causes of admissions in the elderly to medical clinics. The contribution of adverse drug reactions and non-compliance to admission by the medical emergency department was analysed. A total of 578 consecutive elderly patients admitted to the medical emergency department were interviewed to determine the percentage of admissions due to adverse drug reactions or non-compliance with medication regimens, their causes, consequences, and predictors. Eighty three (14.4%) of the 578 admissions were drug related: 39 (6.7%) caused by adverse drug reactions and 44 (7.6%) caused by non-compliance with medication. One hundred ninety two (33.2%) patients had a history of non-compliance. Factors associated with an increased risk of admission because of an adverse drug reaction were patients with diabetes or neoplasms, and patients using numerous different medications. Factors associated with a higher risk of hospitalisation because of non-compliance were poor recall of the medication regimen, seeing numerous physicians, female sex, polypharmacy, drug costs, and switching over to non-conventional forms of treatment. Many elderly admissions are drug related, with non-compliance accounting for a substantial fraction of these. Elderly people at high risk of suffering a drug related medical emergency are identified and suitable interventions may be planned by the healthcare policymakers to target them.

  9. Nuclear astrophysics from direct reactions

    Energy Technology Data Exchange (ETDEWEB)

    Bertulani, C. [Department of Physics, Texas A and M University, Commerce, TX 75429 (United States)]. e-mail: carlos_bertulani@tamu-commerce.edu

    2008-12-15

    Accurate nuclear reaction rates are needed for primordial nucleosynthesis and hydrostatic burning in stars. The relevant reactions are extremely difficult to measure directly in the laboratory at the small astrophysical energies. In recent years direct reactions have been developed and applied to extract low-energy astrophysical S-factors. These methods require a combination of new experimental techniques and theoretical efforts, which are the subject of this presentation. (Author)

  10. Stochastic Modeling Of Biochemical Reactions

    Science.gov (United States)

    2006-11-01

    STOCHASTIC MODELING OF BIOCHEMICAL REACTIONS Abhyudai Singh and João Pedro Hespanha* Department of Electrical and Computer Engineering University of...procedure for con- structing approximate stochastic models for chemical reactions used for modeling biochemical processes such as gene regulatory networks... biochemical reactions , the modeling tools developed in this paper can be applied to a very general class of stochastic systems, in particular

  11. [Situational reactions in suicidologic practice].

    Science.gov (United States)

    Ambrumova, A G; Vrono, E M

    1985-01-01

    The paper is devoted to the description of suicidal manifestations in mentally normal adolescents among typical behavioural disorders characteristic of situational reactions of this age. Three types of suicido-dangerous situational responses of adolescents were specified with regard to their age and auto-and heteaggressiveness ratio: reaction of deprivation, explosive reaction and reaction of auto-elimination. Suicidogenic conflicts were analyzed and spheres of age-specific suicidal conflicts were defined. It is advisable that outpatient management of mentally normal adolescents with a history of a suicidal attempt be conducted in a special room of presentive suicidological service.

  12. Dynamic Reaction Figures: An Integrative Vehicle for Understanding Chemical Reactions

    Science.gov (United States)

    Schultz, Emeric

    2008-01-01

    A highly flexible learning tool, referred to as a dynamic reaction figure, is described. Application of these figures can (i) yield the correct chemical equation by simply following a set of menu driven directions; (ii) present the underlying "mechanism" in chemical reactions; and (iii) help to solve quantitative problems in a number of different…

  13. Temperature Dependences for the Reactions of Ar+, O2+, and C7H7+ with Toluene and Ethylbenzene

    Science.gov (United States)

    2013-07-01

    June 2013 ccepted 21 June 2013 vailable online 1 July 2013 eywords: low-tube inetics lkylbenzenes ate constants a b s t r a c t We have studied the...found. The inetics for the two reactions are similar, which is not surprising iven the similarity between the neutral species. Thermal dissoci- tion would...of Chemical Research 27 (1994) 138–144. [ Approved for public release; d 6 ass Spectrometry 353 (2013) 60–66 65 [4] R.C. Dunbar, Nature of the C7H7

  14. Progress in microscopic direct reaction modeling of nucleon induced reactions

    Energy Technology Data Exchange (ETDEWEB)

    Dupuis, M.; Bauge, E.; Hilaire, S.; Lechaftois, F.; Peru, S.; Pillet, N.; Robin, C. [CEA, DAM, DIF, Arpajon (France)

    2015-12-15

    A microscopic nuclear reaction model is applied to neutron elastic and direct inelastic scatterings, and pre-equilibrium reaction. The JLM folding model is used with nuclear structure information calculated within the quasi-particle random phase approximation implemented with the Gogny D1S interaction. The folding model for direct inelastic scattering is extended to include rearrangement corrections stemming from both isoscalar and isovector density variations occurring during a transition. The quality of the predicted (n,n), (n,n{sup '}), (n,xn) and (n,n{sup '}γ) cross sections, as well as the generality of the present microscopic approach, shows that it is a powerful tool that can help improving nuclear reactions data quality. Short- and long-term perspectives are drawn to extend the present approach to more systems, to include missing reactions mechanisms, and to consistently treat both structure and reaction problems. (orig.)

  15. (γ, 2n)-Reaction cross-section calculations of several even-even lanthanide nuclei using different level density models

    Energy Technology Data Exchange (ETDEWEB)

    Kaplan, A., E-mail: abdullahkaplan@sdu.edu.tr [Süleyman Demirel Univesity, Faculty of Arts and Sciences, Department of Physics (Turkey); Sarpün, İ. H. [Afyon Kocatepe University, Faculty of Arts and Sciences, Department of Physics (Turkey); Aydın, A. [Kırıkkale University, Faculty of Arts and Sciences, Department of Physics (Turkey); Tel, E. [Osmaniye Korkut Ata University, Faculty of Arts and Sciences, Department of Physics (Turkey); Çapalı, V.; Özdoǧan, H. [Süleyman Demirel Univesity, Faculty of Arts and Sciences, Department of Physics (Turkey)

    2015-01-15

    There are several level density models that can be used to predict photo-neutron cross sections. Some of them are Constant Temperature + Fermi Gas Model (CTFGM), Back-Shifted Fermi Gas Model (BSFM), Generalized Superfluid Model (GSM), Hartree-Fock-Bogoliubov microscopic Model (HFBM). In this study, the theoretical photo-neutron cross sections produced by (γ, 2n) reactions for several eveneven lanthanide nuclei such as {sup 140,142}Ce, {sup 142,144,146,148,150}Nd, {sup 144,148,150,152,154}Sm, and {sup 160}Gd have been calculated on the different level density models as mentioned above by using TALYS 1.6 and EMPIRE 3.1 computer codes for incident photon energies up to 30 MeV. The obtained results have been compared with each other and available experimental data existing in the EXFOR database. Generally, at least one level density model cross-section calculations are in agreement with the experimental results for all reactions except {sup 144}Sm(γ, 2n){sup 142}Sm along the incident photon energy, TALYS 1.6 BSFM option for the level density model cross-section calculations can be chosen if the experimental data are not available or are improbable to be produced due to the experimental difficulty.

  16. Adverse Reactions to Hallucinogenic Drugs.

    Science.gov (United States)

    Meyer, Roger E. , Ed.

    This reports a conference of psychologists, psychiatrists, geneticists and others concerned with the biological and psychological effects of lysergic acid diethylamide and other hallucinogenic drugs. Clinical data are presented on adverse drug reactions. The difficulty of determining the causes of adverse reactions is discussed, as are different…

  17. Pharmacogenetics of hypersensitivity drug reactions.

    Science.gov (United States)

    Negrini, Simone; Becquemont, Laurent

    2017-04-01

    Adverse drug reactions are a significant cause of morbidity and mortality and represent a major burden on the healthcare system. Some of those reactions are immunologically mediated (hypersensitivity reactions) and can be clinically subdivided into two categories: immediate reactions (IgE-related) and delayed reactions (T-cell-mediated). Delayed hypersensitivity reactions include both systemic syndromes and organ-specific toxicities and can be triggered by a wide range of chemically diverse drugs. Recent studies have demonstrated a strong genetic association between human leukocyte antigen alleles and susceptibility to delayed drug hypersensitivity. Most notable examples include human leukocyte antigen (HLA)-B*57:01 allele and abacavir hypersensitivity syndrome or HLA-B*15:02 and HLA-B*58:01 alleles related to severe cutaneous reactions induced by carbamazepine and allopurinol, respectively. This review aims to explore our current understanding in the field of pharmacogenomics of HLA-associated drug hypersensitivities and its translation into clinical practice for predicting adverse drug reactions. Copyright © 2017 Société française de pharmacologie et de thérapeutique. Published by Elsevier Masson SAS. All rights reserved.

  18. Engineering reactors for catalytic reactions

    Indian Academy of Sciences (India)

    Extensive studies have been conducted to establish sound basis for design and engineering of reactors for practising such catalytic reactions and for realizing improvements in reactor performance. In this article, application of recent (and not so recent) developments in engineering reactors for catalytic reactions is ...

  19. Incomplete fusion reactions in Ho

    Indian Academy of Sciences (India)

    It is now generally recognized that several reaction mechanisms are operative in heavy- ion-induced reactions below 10 MeV/amu. Predominant among these are, complete fusion. (CF), deep-inelastic collision (DIC), and quasi-elastic collisions. As the projectile energy increases to 5–10 MeV/amu and above, it turns out that ...

  20. Free Radical Reactions in Food.

    Science.gov (United States)

    Taub, Irwin A.

    1984-01-01

    Discusses reactions of free radicals that determine the chemistry of many fresh, processed, and stored foods. Focuses on reactions involving ascorbic acid, myoglobin, and palmitate radicals as representative radicals derived from a vitamin, metallo-protein, and saturated lipid. Basic concepts related to free radical structure, formation, and…

  1. Limits for Stochastic Reaction Networks

    DEFF Research Database (Denmark)

    Cappelletti, Daniele

    Reaction systems have been introduced in the 70s to model biochemical systems. Nowadays their range of applications has increased and they are fruitfully used in dierent elds. The concept is simple: some chemical species react, the set of chemical reactions form a graph and a rate function...... of reactions. Let the rates of degradation of the intermediate species be functions of a parameter N that tends to innity. We consider a reduced system where the intermediate species have been eliminated, and nd conditions on the degradation rate of the intermediates such that the behaviour of the reduced...... is stated in the setting of multiscale reaction systems: the amounts of all the species and the rates of all the reactions of the original model can scale as powers of N. A similar result also holds for the deterministic case, as shown in Appendix IA. In Paper II, we focus on the stationary distributions...

  2. Reaction rates for reaction-diffusion kinetics on unstructured meshes

    Science.gov (United States)

    Hellander, Stefan; Petzold, Linda

    2017-02-01

    The reaction-diffusion master equation is a stochastic model often utilized in the study of biochemical reaction networks in living cells. It is applied when the spatial distribution of molecules is important to the dynamics of the system. A viable approach to resolve the complex geometry of cells accurately is to discretize space with an unstructured mesh. Diffusion is modeled as discrete jumps between nodes on the mesh, and the diffusion jump rates can be obtained through a discretization of the diffusion equation on the mesh. Reactions can occur when molecules occupy the same voxel. In this paper, we develop a method for computing accurate reaction rates between molecules occupying the same voxel in an unstructured mesh. For large voxels, these rates are known to be well approximated by the reaction rates derived by Collins and Kimball, but as the mesh is refined, no analytical expression for the rates exists. We reduce the problem of computing accurate reaction rates to a pure preprocessing step, depending only on the mesh and not on the model parameters, and we devise an efficient numerical scheme to estimate them to high accuracy. We show in several numerical examples that as we refine the mesh, the results obtained with the reaction-diffusion master equation approach those of a more fine-grained Smoluchowski particle-tracking model.

  3. Effective reaction rates for diffusion-limited reaction cycles.

    Science.gov (United States)

    Nałęcz-Jawecki, Paweł; Szymańska, Paulina; Kochańczyk, Marek; Miękisz, Jacek; Lipniacki, Tomasz

    2015-12-07

    Biological signals in cells are transmitted with the use of reaction cycles, such as the phosphorylation-dephosphorylation cycle, in which substrate is modified by antagonistic enzymes. An appreciable share of such reactions takes place in crowded environments of two-dimensional structures, such as plasma membrane or intracellular membranes, and is expected to be diffusion-controlled. In this work, starting from the microscopic bimolecular reaction rate constants and using estimates of the mean first-passage time for an enzyme-substrate encounter, we derive diffusion-dependent effective macroscopic reaction rate coefficients (EMRRC) for a generic reaction cycle. Each EMRRC was found to be half of the harmonic average of the microscopic rate constant (phosphorylation c or dephosphorylation d), and the effective (crowding-dependent) motility divided by a slowly decreasing logarithmic function of the sum of the enzyme concentrations. This implies that when c and d differ, the two EMRRCs scale differently with the motility, rendering the steady-state fraction of phosphorylated substrate molecules diffusion-dependent. Analytical predictions are verified using kinetic Monte Carlo simulations on the two-dimensional triangular lattice at the single-molecule resolution. It is demonstrated that the proposed formulas estimate the steady-state concentrations and effective reaction rates for different sets of microscopic reaction rates and concentrations of reactants, including a non-trivial example where with increasing diffusivity the fraction of phosphorylated substrate molecules changes from 10% to 90%.

  4. Reaction rates for reaction-diffusion kinetics on unstructured meshes.

    Science.gov (United States)

    Hellander, Stefan; Petzold, Linda

    2017-02-14

    The reaction-diffusion master equation is a stochastic model often utilized in the study of biochemical reaction networks in living cells. It is applied when the spatial distribution of molecules is important to the dynamics of the system. A viable approach to resolve the complex geometry of cells accurately is to discretize space with an unstructured mesh. Diffusion is modeled as discrete jumps between nodes on the mesh, and the diffusion jump rates can be obtained through a discretization of the diffusion equation on the mesh. Reactions can occur when molecules occupy the same voxel. In this paper, we develop a method for computing accurate reaction rates between molecules occupying the same voxel in an unstructured mesh. For large voxels, these rates are known to be well approximated by the reaction rates derived by Collins and Kimball, but as the mesh is refined, no analytical expression for the rates exists. We reduce the problem of computing accurate reaction rates to a pure preprocessing step, depending only on the mesh and not on the model parameters, and we devise an efficient numerical scheme to estimate them to high accuracy. We show in several numerical examples that as we refine the mesh, the results obtained with the reaction-diffusion master equation approach those of a more fine-grained Smoluchowski particle-tracking model.

  5. 144__Olukosi_drinking wate

    African Journals Online (AJOL)

    User

    Oxygen Demand (BOD5), Dissolved oxygen, Total Dissolved Solids (TDS), Nitrate, Electrical conductivity and pH using standard methods. The values for conductivity (441.57 ±. 107.13µhos/cm) and TDS (220.78 ± 53.56mg/l) were significantly higher for the borehole water samples (P<0.05), while the pH (7.27 ± 0.11) and ...

  6. 144 | P a g e

    African Journals Online (AJOL)

    Fr. Ikenga

    type is materialism. In its essential tenets, it holds that matter is the one and only kind of being - the primary substance and that the universe is a material world and all objects of experience are composed of matter.1 In its most ..... With the crisis of the concept of God, the galaxy of the ethical and spiritual values attendant to ...

  7. Hb San Cataldo [β144(HC1)Lys→Thr; HBB: C.434A > C]: A New Hemoglobin Variant with Increased Affinity for Oxygen.

    Science.gov (United States)

    Vinciguerra, Margherita; Passarello, Cristina; Cassarà, Filippo; Leto, Filippo; Cannata, Monica; Crivello, Anna; Di Salvo, Veronica; Maggio, Aurelio; Giambona, Antonino

    2016-08-01

    A 59-year-old Italian woman came to our center for revaluation of a previous diagnosis of polycythemia vera. The patient presented with a lifelong history of polycythemia, no increase in white blood cells (WBCs) and platelets, and a negative bone marrow biopsy. Analysis of hemoglobin (Hb) fractions showed an abnormal fast moving Hb component. We aimed to determine if this variant was the cause of polycythemia in this patient. A complete blood count (CBC) was performed by an automated cell counter and Hb fractions were determined by high performance liquid chromatography (HPLC). Standard stability tests and oxygen affinity evaluation were also performed. Genomic DNA was extracted from peripheral blood leukocytes using the phenol chloroform method and the entire β-globin gene was analyzed by direct sequencing. At the hematological level, no anemia or hemolysis was observed but an abnormal Hb fraction was detected using cation exchange HPLC. Molecular analysis of the β-globin gene showed heterozygosity for an AAG > ACG substitution at codon 144, resulting in a Lys→Thr amino acid replacement. We demonstrated that this is a new Hb variant with increased oxygen affinity. Its altered physiology is caused by the reduction of 2,3-diphosphoglycerate (2,3-DPG) effects, due to an amino acid substitution in the central pocket near the C-terminal of the β chain. We called this new variant Hb San Cataldo for the native city of proband.

  8. Site directed mutagenesis experiments suggest that Glu 111, Glu 144 and Arg 145 are essential for endonucleolytic activity of EcoRI.

    Science.gov (United States)

    Wolfes, H; Alves, J; Fliess, A; Geiger, R; Pingoud, A

    1986-11-25

    We have constructed a plasmid (pRIF 309+) carrying the EcoRI restriction endonuclease gene and the f1 origin of replication. Upon transformation of this plasmid into E. coli and infection with bacteriophage f1 single stranded plasmids are produced which can be used for sequencing and site directed mutagenesis. Using this single stranded DNA and synthetic oligodeoxynucleotides we have introduced point mutations at defined positions of the EcoRI gene. Since in pRIF309+ the EcoRI gene is under the control of the pL-promoter, high level expression of the mutated EcoRI gene could be obtained upon induction. Mutant EcoRI enzymes were purified to homogeneity and characterized in structural and functional terms. Our results demonstrate that the Glu 111----Gln, Glu 144----Gln and Arg 145----Lys -mutants adopt a very similar conformation as the wild type enzyme, but have by two orders of magnitude smaller specific activities than the wild type enzyme, mainly due to a reduction of the Vmax-value.

  9. 1 λ × 1.44 Tb/s free-space IM-DD transmission employing OAM multiplexing and PDM.

    Science.gov (United States)

    Zhu, Yixiao; Zou, Kaiheng; Zheng, Zhennan; Zhang, Fan

    2016-02-22

    We report the experimental demonstration of single wavelength terabit free-space intensity modulation direct detection (IM-DD) system employing both orbital angular momentum (OAM) multiplexing and polarization division multiplexing (PDM). In our experiment, 12 OAM modes with two orthogonal polarization states are used to generate 24 channels for transmission. Each channel carries 30 Gbaud Nyquist PAM-4 signal. Therefore an aggregate gross capacity record of 1.44 Tb/s (12 × 2 × 30 × 2 Gb/s) is acheived with a modulation efficiency of 48 bits/symbol. After 0.8m free-space transmission, the bit error rates (BERs) of all the channels are below the 20% hard-decision forward error correction (HD-FEC) threshold of 1.5 × 10(-2). After applying the decision directed recursive least square (DD-RLS) based filter and post filter, the BERs of two polarizations can be reduced from 5.3 × 10(-3) and 7.3 × 10(-3) to 2.2 × 10(-3) and 3.4 × 10(-3), respectively.

  10. Automatic determination of reaction mappings and reaction center information. 2. Validation on a biochemical reaction database.

    Science.gov (United States)

    Apostolakis, Joannis; Sacher, Oliver; Körner, Robert; Gasteiger, Johann

    2008-06-01

    The correct identification of the reacting bonds and atoms is a prerequisite for the analysis of the reaction mechanism. We have recently developed a method based on the Imaginary Transition State Energy Minimization approach for automatically determining the reaction center information and the atom-atom mapping numbers. We test here the accuracy of this ITSE approach by comparing the predictions of the method against more than 1500 manually annotated reactions from BioPath, a comprehensive database of biochemical reactions. The results show high agreement between manually annotated mappings and computational predictions (98.4%), with significant discrepancies in only 24 cases out of 1542 (1.6%). This result validates both the computational prediction and the database, at the same time, as the results of the former agree with expert knowledge and the latter appears largely self-consistent, and consistent with a simple principle. In 10 of the discrepant cases, simple chemical arguments or independent literature studies support the predicted reaction center. In five reaction instances the differences in the automatically and manually annotated mappings are described in detail. Finally, in approximately 200 cases the algorithm finds alternate reaction centers, which need to be studied on a case by case basis, as the exact choice of the alternative may depend on the enzyme catalyzing the reaction.

  11. Cyanide reaction with ninhydrin: elucidation of reaction and interference mechanisms.

    Science.gov (United States)

    Drochioiu, Gabi; Mangalagiu, Ionel; Avram, Ecaterina; Popa, Karin; Dirtu, Alin Constantin; Druta, Ioan

    2004-10-01

    A new sensitive spectrophotometric method has recently been developed for the trace determination of cyanide with ninhydrin. Cyanide ion was supposed to act as a specific base catalyst. Nevertheless, this paper demonstrates that the reported assay is based on a novel reaction of cyanide with 2,2-dihydroxy-1,3-indanedione, which affords purple or blue colored salts of 2-cyano-1,2,3-trihydroxy-2H indene. Hydrindantin is merely an intermediary of the reaction. The formation of a stable and isolable ninhydrin-cyanide compound has been confirmed by its preparation in crystalline form. Also, it is thoroughly characterized by elemental as well as MS, IR, UV/VIS and 1H NMR analyses. The Ruhemann's sequence of reactions of cyanide with ninhydrin has been reconsidered and an adequate mechanism of the reaction is proposed. As a consequence, the interference of oxidizers as well as copper, silver and mercury ions with the cyanide determination has been elucidated.

  12. Rapid biocatalytic polytransesterification: reaction kinetics in an exothermic reaction

    Science.gov (United States)

    Chaudhary; Beckman; Russell

    1998-08-20

    Biocatalytic polytransesterification at high concentrations of monomers proceeds rapidly and is accompanied by an increase in the temperature of the reaction mixture due to liberation of heat of reaction during the initial phase. We have used principles of reaction calorimetry to monitor the kinetics of polymerization during this initial phase, thus relating the temperature to the extent of polymerization. Rate of polymerization increases with the concentration of monomers. This is also reflected by the increase in the temperature of the reaction mixture. Using time-temperature-conversion contours, a differential method of kinetic analysis was used to calculate the energy of activation ( approximately 15.1 Kcal/mol). Copyright 1998 John Wiley & Sons, Inc.

  13. Efficacy and safety of a once-daily single-tablet regimen of tenofovir, lamivudine, and efavirenz assessed at 144 weeks among antiretroviral-naive and experienced HIV-1-infected Thai adults

    NARCIS (Netherlands)

    Avihingsanon, A.; Maek, A.N.W.; Gatechompol, S.; Sapsirisavat, V.; Thiansanguankul, W.; Sophonphan, J.; Thammajaruk, N.; Ubolyam, S.; Burger, D.M.; Ruxrungtham, K.

    2017-01-01

    OBJECTIVE: To assess the efficacy and safety of a new single-tablet regimen (STR) of tenofovir disoproxil fumarate (TDF) 300mg, lamivudine (3TC) 300mg, and efavirenz (EFV) 600mg in HIV-infected Thai patients. METHODS: This was a prospective study performed for 144 weeks among 51 treatment-naive

  14. Construction of All-Solid-State Batteries based on a Sulfur-Graphene Composite and Li9.54 Si1.74 P1.44 S11.7 Cl0.3 Solid Electrolyte.

    Science.gov (United States)

    Xu, Ruochen; Wu, Zhang; Zhang, Shenzhao; Wang, Xiuli; Xia, Yan; Xia, Xinhui; Huang, Xiaohua; Tu, Jiangping

    2017-10-09

    Herein an effective way for construction of all-solid-state lithium-sulfur batteries (LSBs) with sulfur/reduced graphene oxide (rGO) and Li9.54 Si1.74 P1.44 S11.7 Cl0.3 solid electrolyte is reported. In the composite cathode, the Li9.54 Si1.74 P1.44 S11.7 Cl0.3 powder is homogeneously mixed with the S/rGO composite to enhance the ionic conductivity. Coupled with a metallic Li anode and solid electrolyte, the designed S/rGO-Li9.54 Si1.74 P1.44 S11.7 Cl0.3 composite cathode exhibits a high specific capacity and good cycling stability. A high initial discharge capacity of 969 mAh g(-1) is achieved at a current density of 80 mA g(-1) at room temperature and the cell retains a reversible capacity of over 827 mAh g(-1) after 60 cycles. The enhanced performance is attributed to the intimate contact between the S/rGO and Li9.54 Si1.74 P1.44 S11.7 Cl0.3 electrolyte, and high electrical conductivity of rGO and high ionic conductivity of the solid electrolyte. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Immunopharmacology and adverse drug reactions.

    Science.gov (United States)

    Rieder, M J

    1993-04-01

    Adverse drug reactions are common and troublesome complications of contemporary pharmacotherapy. Adverse drug reactions are frequently, and often incorrectly, referred to as "allergy". Although there are multiple mechanisms for adverse drug reactions, adverse drug reactions mediated by the immune system account for a disproportionate number of fatal and serious adverse reactions, and constitute a major clinical problem for patients and physicians. The immune system has evolved in multicellular organisms as a defence against infection. Interactions between drugs and the immune system occur as inadvertent consequences of the protective function of the immune system, with drug molecules or drug-carrier haptens being recognized as "non-self" by the immune system. The classical mechanisms for drug hypersensitivity described by Gell and Coombs (Types 1 to 4) include IgE-mediated, cytotoxic, immune complex-mediated and delayed mechanism. These mechanisms provide elegant models for drug-immune interactions that can provide mechanistic explanations for events such as urticaria associated with penicillins. However, these mechanisms do not account for many of the immunologically mediated adverse reactions commonly encountered in clinical practice. Over the last two decades, there has been an increasing awareness of the importance of reactive drug metabolites and drug-protein interactions in the initiation of immunologic events mediating adverse drug reactions. Reactive drug metabolites may produce direct and profound effects on various functions of the immune system. Although some adverse reactions mediated by the immune system occur with equal frequency among adults and children, some of these reactions appear to be markedly more common among children than adults.(ABSTRACT TRUNCATED AT 250 WORDS)

  16. Explicit formulas for reaction probability in reaction-diffusion experiments

    OpenAIRE

    Feres, Renato; Wallace, Matthew; Stern, Ari; Yablonsky, Gregory

    2015-01-01

    A computational procedure is developed for determining the conversion probability for reaction-diffusion systems in which a first-order catalytic reaction is performed over active particles. We apply this general method to systems on metric graphs, which may be viewed as 1-dimensional approximations of 3-dimensional systems, and obtain explicit formulas for conversion. We then study numerically a class of 3-dimensional systems and test how accurately they are described by model formulas obtai...

  17. Direct reactions with exotic nuclei

    Directory of Open Access Journals (Sweden)

    Obertelli A.

    2014-03-01

    Full Text Available Direct reactions have been a unique tool to address the nuclear many-body problem from the experimental side. They are now routinely used in inverse kinematics with radioactive ion beams (RIB. However, weakly bound nuclei have recently raised questions on the applicability of reaction formalisms benchmarked on stable nuclei to the study of single-particle properties and correlations in these unstable systems. The study of the most exotic species produced at low intensity have triggered new technical developments to increase the sensitivity of the setup, with a focused attention to direct reactions such as transfer at low incident energy or knockout at intermediate energies.

  18. Palladium-catalyzed coupling reactions

    CERN Document Server

    Molnár, Árpád

    2013-01-01

    This handbook and ready reference brings together all significant issues of practical importance for interested readers in one single volume. While covering homogeneous and heterogeneous catalysis, the text is unique in focusing on such important aspects as using different reaction media, microwave techniques or catalyst recycling. It also provides a comprehensive treatment of modern-day coupling reactions and emphasizes those topics that show potential for future development, such as continuous flow systems, water as a reaction medium, and catalyst immobilization, among others. With i

  19. Photodisintegration average cross sections of dysprosium p-nuclei near (γ, n) reaction threshold

    Energy Technology Data Exchange (ETDEWEB)

    Vagena, E.; Stoulos, S. [Aristotle University of Thessaloniki, Nuclear Physics Lab., School of Physics, Thessaloniki (Greece)

    2017-05-15

    First measured cross section data on (γ, n) reaction of dysprosium proton-rich nuclei {sup 156}Dy and {sup 158}Dy was experimentally determined via activation methods using a bremsstrahlung photons beam delivered by an electron medical accelerator. An integrated cross section of 144±44 mb is calculated for the {sup 156}Dy (γ, n) reaction at the energy interval 9.4-14 MeV while for the {sup 158}Dy (γ, n) reaction at the energy interval 9.1-14 MeV is estimated as 168±42 mb. Moreover, theoretical calculations have been performed for all Dy isotopes employing the TALYS code. The effect of the nuclear-physics input parameters (γ-ray strength function, nuclear level densities) on the cross section calculations has been studied to successfully reproduce the experimental data. The effective cross section estimated using the TALYS code ranges between 115 and 206 mb for {sup 156}Dy (γ, n) and between 124 and 206mb for {sup 158}Dy (γ, n) reaction depending on the γ-ray strength function used. (orig.)

  20. Educational Stress: Sources, Reactions, Preventions.

    Science.gov (United States)

    Kaiser, Jeffrey S.; Polczynski, James J.

    1982-01-01

    Effects of stress on educators and efforts to understand and cope with stress are discussed. Sources of stress, common reactions to stress, the effects of stress on educator performance, and suggested preventive methods are examined. (JN)

  1. Reactions with light exotic nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Lichtenthäler, R.; Faria, P.N. de; Pires, K.C.C.; Lepine-Szily, A.; Guimaraes, V.; Mendes Junior, D.R.; Assuncao, M.; Barioni, A.; Morcelle, V.; Morais, M.C.; Camargo Junior, O.; Alcantara Nuñez, J. [Universidade de Sao Paulo (USP), Sao Paulo, SP (Brazil). Instituto de Fisica; Moro, A.M. [Departamento de FAMN, Universidad de Sevilla, Sevilla (Spain); Arazi, A. [Laboratorio Tandar, Departamento de Fisica, Comision Nacional de Energia Atomica (CNEA), Buenos Aires (Argentina); Rodriguez-Gallardo, M. [Instituto de Estructura de la Materia, CSIC, Madrid (Spain)

    2014-07-01

    Experimental cross sections for the {sup 6}He+{sup 120}Sn are analysed. Elastic scattering angular distributions and alpha particle production cross sections have been measured and are compared with the total reaction cross sections. (author)

  2. Fluctuations in catalytic surface reactions

    CERN Document Server

    Imbihl, R

    2003-01-01

    The internal reaction-induced fluctuations which occur in catalytic CO oxidation on a Pt field emitter tip have been studied using field electron microscopy (FEM) as a spatially resolving method. The structurally heterogeneous Pt tip consists of facets of different orientations with nanoscale dimensions. The FEM resolution of roughly 2 nm corresponds to a few hundred reacting adsorbed particles whose variations in the density are imaged as brightness fluctuations. In the bistable range of the reaction one finds fluctuation-induced transitions between the two stable branches of the reaction kinetics. The fluctuations exhibit a behaviour similar to that of an equilibrium phase transition, i.e. the amplitude diverges upon approaching the bifurcation point terminating the bistable range of the reaction. Simulations with a hybrid Monte Carlo/mean-field model reproduce the experimental observations. Fluctuations on different facets are typically uncorrelated but within a single facet a high degree of spatial cohere...

  3. Transfer reactions in nuclear astrophysics

    Science.gov (United States)

    Bardayan, D. W.

    2016-08-01

    To a high degree many aspects of the large-scale behavior of objects in the Universe are governed by the underlying nuclear physics. In fact the shell structure of nuclear physics is directly imprinted into the chemical abundances of the elements. The tranquility of the night sky is a direct result of the relatively slow rate of nuclear reactions that control and determines a star’s fate. Understanding the nuclear structure and reaction rates between nuclei is vital to understanding our Universe. Nuclear-transfer reactions make accessible a wealth of knowledge from which we can extract much of the required nuclear physics information. A review of transfer reactions for nuclear astrophysics is presented with an emphasis on the experimental challenges and opportunities for future development.

  4. Analysis of kinetic reaction mechanisms

    CERN Document Server

    Turányi, Tamás

    2014-01-01

    Chemical processes in many fields of science and technology, including combustion, atmospheric chemistry, environmental modelling, process engineering, and systems biology, can be described by detailed reaction mechanisms consisting of numerous reaction steps. This book describes methods for the analysis of reaction mechanisms that are applicable in all these fields. Topics addressed include: how sensitivity and uncertainty analyses allow the calculation of the overall uncertainty of simulation results and the identification of the most important input parameters, the ways in which mechanisms can be reduced without losing important kinetic and dynamic detail, and the application of reduced models for more accurate engineering optimizations. This monograph is invaluable for researchers and engineers dealing with detailed reaction mechanisms, but is also useful for graduate students of related courses in chemistry, mechanical engineering, energy and environmental science and biology.

  5. Method for conducting exothermic reactions

    Science.gov (United States)

    Smith, Jr., Lawrence; Hearn, Dennis; Jones, Jr., Edward M.

    1993-01-01

    A liquid phase process for oligomerization of C.sub.4 and C.sub.5 isoolefins or the etherification thereof with C.sub.1 to C.sub.6 alcohols wherein the reactants are contacted in a reactor with a fixed bed acid cation exchange resin catalyst at an LHSV of 5 to 20, pressure of 0 to 400 psig and temperature of 120.degree. to 300.degree. F. wherein the improvement is the operation of the reactor at a pressure to maintain the reaction mixture at its boiling point whereby at least a portion but less than all of the reaction mixture is vaporized. By operating at the boiling point and allowing a portion of the reaction mixture to vaporize, the exothermic heat of reaction is dissipated by the formation of more boil up and the temperature in the reactor is controlled.

  6. Engineering reactors for catalytic reactions

    Indian Academy of Sciences (India)

    Chemical Engineering and Process Development Division, CSIR - National Chemical Laboratory,. Pune 411 008, India ... Abstract. Catalytic reactions are ubiquitous in chemical and allied industries. ... strategies and recent advances in process intensification/ multifunctional reactors are discussed to illustrate the approach.

  7. Incidence of cetuximab-related infusion reactions in oncology patients treated at the University of North Carolina Cancer Hospital.

    Science.gov (United States)

    Keating, Karen; Walko, Christine; Stephenson, Briana; O'Neil, Bert H; Weiss, Jared

    2014-12-01

    The primary purpose of this study was to determine the rate of infusion reactions to cetuximab in oncology patients treated at the University of North Carolina Cancer Hospital. Secondarily, we sought to evaluate predictors of grade 3-4 hypersensitivity, including geography. Data were collected by retrospective chart review for patients treated with cetuximab at the University of North Carolina Cancer Hospital between 15 November 2006 and 31 December 2010. Data were analyzed for occurrence of hypersensitivity reaction in 125 patients with various cancer types. Of the 125 subjects, 31 (24.8%) experienced an infusion reaction of any grade. Of 125, 18 (14.4%) experienced a grade 3 or 4 reaction. The odds ratio for patients with an allergy history having a grade 3 or 4 reaction was 2.57 (95% CI 0.93 to 7.09, p = 0.07). Pretreatment with steroids was associated with absence of grade 3 or 4 reaction with an odds ratio of 0.21 (95% CI 0.05 to 0.83, p = 0.04). Mapping of reaction rates by county revealed higher rates in some of the more rural counties of North Carolina, however, statistical power was lacking. Rates of hypersensitivity reaction at UNC are similar to rates seen in other areas of the southeastern United States and higher than in other regions of the United States and Europe. Rates of both hypersensitivity reactions and grade 3 to 4 hypersensitivity reactions have not substantially changed over time. Geography, allergy history, and perhaps smoking or cancer type may help predict who will react to cetuximab. Steroids should be strongly considered as premedication in addition to diphenhydramine. © The Author(s) 2013 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  8. Thermodynamics of random reaction networks.

    Directory of Open Access Journals (Sweden)

    Jakob Fischer

    Full Text Available Reaction networks are useful for analyzing reaction systems occurring in chemistry, systems biology, or Earth system science. Despite the importance of thermodynamic disequilibrium for many of those systems, the general thermodynamic properties of reaction networks are poorly understood. To circumvent the problem of sparse thermodynamic data, we generate artificial reaction networks and investigate their non-equilibrium steady state for various boundary fluxes. We generate linear and nonlinear networks using four different complex network models (Erdős-Rényi, Barabási-Albert, Watts-Strogatz, Pan-Sinha and compare their topological properties with real reaction networks. For similar boundary conditions the steady state flow through the linear networks is about one order of magnitude higher than the flow through comparable nonlinear networks. In all networks, the flow decreases with the distance between the inflow and outflow boundary species, with Watts-Strogatz networks showing a significantly smaller slope compared to the three other network types. The distribution of entropy production of the individual reactions inside the network follows a power law in the intermediate region with an exponent of circa -1.5 for linear and -1.66 for nonlinear networks. An elevated entropy production rate is found in reactions associated with weakly connected species. This effect is stronger in nonlinear networks than in the linear ones. Increasing the flow through the nonlinear networks also increases the number of cycles and leads to a narrower distribution of chemical potentials. We conclude that the relation between distribution of dissipation, network topology and strength of disequilibrium is nontrivial and can be studied systematically by artificial reaction networks.

  9. Thermodynamics of Random Reaction Networks

    Science.gov (United States)

    Fischer, Jakob; Kleidon, Axel; Dittrich, Peter

    2015-01-01

    Reaction networks are useful for analyzing reaction systems occurring in chemistry, systems biology, or Earth system science. Despite the importance of thermodynamic disequilibrium for many of those systems, the general thermodynamic properties of reaction networks are poorly understood. To circumvent the problem of sparse thermodynamic data, we generate artificial reaction networks and investigate their non-equilibrium steady state for various boundary fluxes. We generate linear and nonlinear networks using four different complex network models (Erdős-Rényi, Barabási-Albert, Watts-Strogatz, Pan-Sinha) and compare their topological properties with real reaction networks. For similar boundary conditions the steady state flow through the linear networks is about one order of magnitude higher than the flow through comparable nonlinear networks. In all networks, the flow decreases with the distance between the inflow and outflow boundary species, with Watts-Strogatz networks showing a significantly smaller slope compared to the three other network types. The distribution of entropy production of the individual reactions inside the network follows a power law in the intermediate region with an exponent of circa −1.5 for linear and −1.66 for nonlinear networks. An elevated entropy production rate is found in reactions associated with weakly connected species. This effect is stronger in nonlinear networks than in the linear ones. Increasing the flow through the nonlinear networks also increases the number of cycles and leads to a narrower distribution of chemical potentials. We conclude that the relation between distribution of dissipation, network topology and strength of disequilibrium is nontrivial and can be studied systematically by artificial reaction networks. PMID:25723751

  10. Drug Reactions in Oral Mucosa

    Directory of Open Access Journals (Sweden)

    Emine Derviş

    2012-12-01

    Full Text Available Both immunologic and nonimmunologic drug reactions can be seen in oral mucosa. Since considerable number of these reactions heals spontaneously without being noticed by the patients, exact frequency of the lesions is unknown. Most common lesions are xerostomia, taste disorders, mucosal ulcerations and edema. In this article, oral lesions resulting from drug intake similar to those from oral lesions of local and systemic diseases, and diagnostic problems caused by these similarities, have been reviewed.

  11. Radiation reaction and relativistic hydrodynamics.

    Science.gov (United States)

    Berezhiani, V I; Hazeltine, R D; Mahajan, S M

    2004-05-01

    By invoking the radiation reaction force, first perturbatively derived by Landau and Lifschitz, and later shown by Rohrlich to be exact for a single particle, we construct a set of fluid equations obeyed by a relativistic plasma interacting with the radiation field. After showing that this approach reproduces the known results for a locally Maxwellian plasma, we derive and display the basic dynamical equations for a general magnetized plasma in which the radiation reaction force augments the direct Lorentz force.

  12. Late reaction, persistent reaction and doubtful allergic reaction: The problems of interpretation

    Directory of Open Access Journals (Sweden)

    Sarma Nilendu

    2009-01-01

    Full Text Available The standard method of patch test reading is to read the test site for any positive allergy at 48hr and then again at 72/96 hr. A late reading on the seventh day is also advised to exclude the irritant reaction (IR and to notice some delayed development of allergic reaction. However, multiple visits are often difficult for the patient; therefore, this late reading is sometimes omitted. Here a case of plantar hyperkeratosis, due to allergic contact dermatitis, is reported with some insight into interpretation of the patch test. The patient showed delayed patch test reaction to formaldehyde and colophony, which has never been reported before.

  13. Categorizing renal oncocytic neoplasms on core needle biopsy: a morphologic and immunophenotypic study of 144 cases with clinical follow-up.

    Science.gov (United States)

    Alderman, Megan A; Daignault, Stephanie; Wolf, J Stuart; Palapattu, Ganesh S; Weizer, Alon Z; Hafez, Khaled S; Kunju, Lakshmi P; Wu, Angela J

    2016-09-01

    There is limited literature on renal oncocytic neoplasms diagnosed on core biopsy. All renal oncocytic neoplasm core biopsies from 2006 to 2013 were retrospectively reviewed. Morphologic features and an immunohistochemical panel of CK7, c-KIT, and S100A1 were assessed. Concordance with resection diagnosis, statistical analysis including a random forest classification, and follow-up were recorded. The post-immunohistochemical diagnoses of 144 renal oncocytic core biopsies were favor oncocytoma (67%), favor renal cell carcinoma (RCC) (12%), and cannot exclude RCC (21%). Diagnosis was revised following immunohistochemistry in 7% of cases. The most common features for oncocytoma (excluding dense granular cytoplasm) were nested architecture, edematous stroma, binucleation and tubular architecture; the most common features for favor RCC were sheet-like architecture, nuclear pleomorphism, papillary architecture, and prominent cell borders. High nuclear grade, necrosis, extensive papillary architecture, raisinoid nuclei, and frequent mitoses were not seen in oncocytomas. Comparing the pathologist and random forest classification, the overall out-of-bag estimate of classification error dropped from 23% to 13% when favor RCC and cannot exclude RCC were combined into 1 category. Resection was performed in 19% (28 cases) with a 94% concordance (100% of favor RCC biopsies and 90% of cannot exclude RCC biopsies confirmed as RCC; 83% of favor oncocytomas confirmed); ablation in 23%; and surveillance in 46%. Follow-up was available in 92% (median follow-up, 33months) with no adverse outcomes. Renal oncocytic neoplasms comprise a significant subset (16%) of all core biopsies, and the majority (78%) can be classified as favor oncocytoma or favor RCC. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Regulation of plasma factor XIII levels in healthy individuals; a major impact by subunit B intron K c.1952+144 C>G polymorphism.

    Science.gov (United States)

    Mezei, Zoltán A; Katona, Éva; Kállai, Judit; Bereczky, Zsuzsanna; Molnár, Éva; Kovács, Bettina; Ajzner, Éva; Bagoly, Zsuzsa; Miklós, Tünde; Muszbek, László

    2016-12-01

    The regulation of plasma factor XIII (FXIII) levels in healthy individuals has been only partially explored. The identification of major non-genetic and genetic regulatory factors might provide important information on the contribution of FXIII to the risk of cardio/cerebrovascular diseases. To determine the effect of age, smoking, BMI, fibrinogen concentration on plasma FXIII activity, complex FXIII antigen (FXIII-A2B2) and total FXIII-B subunit (tFXIII-B) level, to correlate FXIII-B level with the other two FXIII parameters and to assess the variation of FXIII levels in carriers of major FXIII subunit polymorphisms. 268 healthy individuals were enrolled in the study. FXIII activity was measured by the ammonia release assay; FXIII-A2B2 and tFXIII-B were determined by ELISAs. FXIII-A p.Val34Leu, FXIII-B p.His95Arg and FXIII-B intron K c.1952+144 C>G polymorphisms were identified by RT-PCR using melting point analysis with fluorescence resonance energy transfer detection. All investigated FXIII parameters showed significant positive correlation with age and fibrinogen level; gender and BMI influenced only tFXIII-B. A highly significant positive correlation was demonstrated between tFXIII-B and the other FXIII parameters. FXIII-A p.Val34Leu polymorphism had only slight, if any effect on FXIII levels. The FXIII-B Arg95 allele moderately increased all three FXIII parameters, but the effect became statistically significant only after adjustment. The FXIII-B intron K G allele drastically decreased FXIII levels, and it seemed to be in synergism with the FXIII-A Leu34 allele. Plasma FXIII levels are subjected to multifactorial regulation, in which age, fibrinogen level and FXIII-B intron K polymorphism are major determinants. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Reaction rates for mesoscopic reaction-diffusion kinetics.

    Science.gov (United States)

    Hellander, Stefan; Hellander, Andreas; Petzold, Linda

    2015-02-01

    The mesoscopic reaction-diffusion master equation (RDME) is a popular modeling framework frequently applied to stochastic reaction-diffusion kinetics in systems biology. The RDME is derived from assumptions about the underlying physical properties of the system, and it may produce unphysical results for models where those assumptions fail. In that case, other more comprehensive models are better suited, such as hard-sphere Brownian dynamics (BD). Although the RDME is a model in its own right, and not inferred from any specific microscale model, it proves useful to attempt to approximate a microscale model by a specific choice of mesoscopic reaction rates. In this paper we derive mesoscopic scale-dependent reaction rates by matching certain statistics of the RDME solution to statistics of the solution of a widely used microscopic BD model: the Smoluchowski model with a Robin boundary condition at the reaction radius of two molecules. We also establish fundamental limits on the range of mesh resolutions for which this approach yields accurate results and show both theoretically and in numerical examples that as we approach the lower fundamental limit, the mesoscopic dynamics approach the microscopic dynamics. We show that for mesh sizes below the fundamental lower limit, results are less accurate. Thus, the lower limit determines the mesh size for which we obtain the most accurate results.

  16. Reaction rates for a generalized reaction-diffusion master equation.

    Science.gov (United States)

    Hellander, Stefan; Petzold, Linda

    2016-01-01

    It has been established that there is an inherent limit to the accuracy of the reaction-diffusion master equation. Specifically, there exists a fundamental lower bound on the mesh size, below which the accuracy deteriorates as the mesh is refined further. In this paper we extend the standard reaction-diffusion master equation to allow molecules occupying neighboring voxels to react, in contrast to the traditional approach, in which molecules react only when occupying the same voxel. We derive reaction rates, in two dimensions as well as three dimensions, to obtain an optimal match to the more fine-grained Smoluchowski model and show in two numerical examples that the extended algorithm is accurate for a wide range of mesh sizes, allowing us to simulate systems that are intractable with the standard reaction-diffusion master equation. In addition, we show that for mesh sizes above the fundamental lower limit of the standard algorithm, the generalized algorithm reduces to the standard algorithm. We derive a lower limit for the generalized algorithm which, in both two dimensions and three dimensions, is of the order of the reaction radius of a reacting pair of molecules.

  17. Radiolesão vascular como efeito deletério da braquiterapia intra-arterial com dose elevada de Samário-153 em coelhos hipercolesterolêmicos Vascular radiolesion as a deleterious effect of high-dose-rate intraarterial brachytherapy with Samarium-153 in hypercholesterolemic rabbits

    Directory of Open Access Journals (Sweden)

    Dalton Bertolim Précoma

    2006-10-01

    Full Text Available OBJETIVO: Este estudo tem por objetivo avaliar as alterações vasculares morfológicas e morfométricas induzidas pela braquiterapia com Samário-153 (153 Sm em coelhos hipercolesterolêmicos, com doses elevadas. MÉTODOS: Foram analisados 43 coelhos hipercolesterolêmicos, brancos, da raça New Zealand, e o total de 86 artérias ilíacas submetidas a lesão por balão de angioplastia. Divididos em três grupos: dois (GI irradiados com as doses de 15Gy (n=14 e 60Gy (n=36 e um grupo controle (n=36. Foram realizadas avaliação histológica morfométrica e análise histológica qualitativa para análise tecidual. RESULTADOS: Foram observadas uma redução significativa da neoproliferação intimal (NPI no GI 15 Gy (pOBJECTIVE: This study was designed to evaluate vascular morphological and morphometric changes induced by brachytherapy with samarium-153 (Sm-153 at high doses in hypercholesterolemic rabbits. METHODS: Forty-three New Zealand White hypercholesterolemic rabbits were analyzed, and the total of 86 iliac arteries underwent balloon angioplasty injury. The rabbits were divided into three different groups: two irradiation groups (IG assigned to 15 Gy (n=14 and 60 Gy (n=36 irradiation doses, respectively, and a control group (n = 36. Histomorphometric and qualitative histological analyses were performed for tissue evaluation. RESULTS: Significant reductions were found in neointimal proliferation (NIP (p< 0.0001, media area (MA (p<0.0001 and percent stenosis (p<0.0001 in the 15-Gy IG, compared to the other groups. The 60-Gy IG had the higher rate of NIP, increase in media and vessel areas (VA and percent stenosis. The 60-Gy IG also showed the greatest number of xanthomatous cells (60-Gy IG: 86.11% and 15-Gy IG: 14.29%, p<0.0001 and the highest amount of hyaline amorphous tissue (60-Gy IG:58.33% and 15-Gy IG:0%, p=0.0001 and vascular proliferation (60-Gy IG:30.56% and 15-Gy IG:0%, p=0.0221. No statistically significant differences were found

  18. Activation cross-sections of deuteron induced reactions on $^{nat}$Sm up to 50 MeV

    OpenAIRE

    Tárkányi, F.; Hermanne, A.; Takács, S.; Ditrói, F.; Csikai, J.; Ignatyuk, A. V.

    2014-01-01

    Activation cross-sections for deuteron induced reactions on Sm are presented for the first time for $^{nat}$Sm(d,xn)$^{155,154,152m2,152m1,152g,150m,150g,149,148,147,146}$Eu, $^{nat}$Sm(d,x)$^{153,145}$Sm and $^{nat}$Sm(d,x)$^{151,150,149,145,144,143}$Pm up to 50 MeV. The cross-sections were measured by the stacked-foil irradiation technique and high resolution $\\gamma$-ray spectrometry. The results were compared with results of nuclear reaction codes ALICE-D, EMPIRE-D and TALYS (from TENDL l...

  19. Activation cross-sections of proton induced reactions on natSm up to 65 MeV

    Science.gov (United States)

    Tárkányi, F.; Hermanne, A.; Takács, S.; Ditrói, F.; Ignatyuk, A. V.

    2015-03-01

    Activation cross sections for proton induced reactions on Sm are presented for the first time for natSm(p,xn)154,152m2,152m1,152g,150m,150g,149,148,147,146,145Eu, natSm(p,x)153,145Sm, natSm(p,x)151,150,149,148g,148m,146,144,143Pm and natSm(p,x)141Nd up to 65 MeV. The cross sections were measured via activation method by using a stacked-foil irradiation technique and high resolution gamma ray spectroscopy. The results were compared with results of the nuclear reaction codes ALICE, EMPIRE and TALYS (results taken from TENDL libraries). Integral yields of the activation products were calculated from the excitation functions.

  20. Activation cross-sections of deuteron induced reactions on natSm up to 50 MeV

    Science.gov (United States)

    Tárkányi, F.; Hermanne, A.; Takács, S.; Ditrói, F.; Csikai, J.; Ignatyuk, A. V.

    2014-08-01

    Activation cross-sections for deuteron induced reactions on Sm are presented for the first time for natSm(d,xn)155,154,152m2,152m1,152g,150m,150g,149,148,147,146Eu, natSm(d,x) 153,145Sm and natSm(d,x)151,150,149,145,144,143Pm up to 50 MeV. The cross-sections were measured by the stacked-foil irradiation technique and high resolution γ-ray spectrometry. The results were compared with results of nuclear reaction codes ALICE-D, EMPIRE-D and TALYS (from TENDL libraries). Integral yields of the products were calculated from the excitation functions.

  1. Activation cross-sections of deuteron induced reactions on $^{nat}$Sm up to 50 MeV

    CERN Document Server

    Tárkányi, F; Takács, S; Ditrói, F; Csikai, J; Ignatyuk, A V

    2014-01-01

    Activation cross-sections for deuteron induced reactions on Sm are presented for the first time for $^{nat}$Sm(d,xn)$^{155,154,152m2,152m1,152g,150m,150g,149,148,147,146}$Eu, $^{nat}$Sm(d,x)$^{153,145}$Sm and $^{nat}$Sm(d,x)$^{151,150,149,145,144,143}$Pm up to 50 MeV. The cross-sections were measured by the stacked-foil irradiation technique and high resolution $\\gamma$-ray spectrometry. The results were compared with results of nuclear reaction codes ALICE-D, EMPIRE-D and TALYS (from TENDL libraries). Integral yields of the products were calculated from the excitation functions.

  2. Activation cross-sections of proton induced reactions on $^{nat}$Sm up to 65 MeV

    CERN Document Server

    Tárkányi, F; Takács, S; Ditrói, F; Ignatyuk, A V

    2016-01-01

    Activation cross sections for proton induced reactions on Sm are presented for the first time for $^{nat}$Sm(p,xn)$^{154,152m2,152m1,152g,150m,150g,149,148,147,146,145}$Eu, $^{nat}$Sm(p,x)$^{153,145}$Sm, $^{nat}$Sm(p,x)$^{151,150,149,148g,148m,146,144,143}$Pm and $^{nat}$Sm(p,x)$^{141}$Nd up to 65 MeV. The cross sections were measured via activation method by using a stacked-foil irradiation technique and high resolution gamma ray spectroscopy. The results were compared with results of the nuclear reaction codes ALICE, EMPIRE and TALYS (results taken from TENDL libraries). Integral yields of the activation products were calculated from the excitation functions.

  3. Adverse drug reactions to CT contrast media in south Korea: Incidence and risk factors

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Kyung Soo; Jeon, Kyung Nyeo; Moon, Jin Il; Choi, Bo Hwa; Baek, Hye Jin; Cho, Soo Buem [Dept. of Radiology, Gyeongsang National University Changwon Hospital, Gyeongsang National University School of Medicine, Changwon (Korea, Republic of); Lee, Sang Min; Ha, Ji Young; Choi, Dae Seob; Cho, Jae Min; Na, Jae Beom [Dept. of Radiology, Gyeongsang National University Hospital, Gyeongsang National University School of Medicine, Jinju (Korea, Republic of)

    2016-07-15

    To evaluate the incidence, severity, and risk factors of adverse drug reactions (ADR) to intravenous administration of nonionic iodinated contrast media in computed tomography (CT), and to determine the recurrence rate after premedication in patients with a previous history of ADR. We prospectively recorded all ADR to intravenous CT contrast media in 32313 consecutive outpatients (54572 cases) who underwent contrast enhanced CT examinations. Clinical report forms and electronic medical records were reviewed to search for the incidence of ADR, treatment, and clinical outcome of patients. The risk factors of ADR to CT contrast media (age, sex, history of previous ADR, season) were evaluated using statistical analysis. Of the 54572 cases, a total of 191 (0.35%) had adverse reactions. Of the 191 cases, 157 (82%) were categorized as mild reactions, 29 (15%) were moderate, and 5 (3%) were severe. A total of 165 (86.4%) cases had acute adverse reactions (which occurred within 1 hour after administration), while 26 (13.6%) had delayed adverse reactions (occurred 1 hour after the administration). The rate of ADR was significantly higher in females [relative risk (RR) = 2.05, 95% confidence interval (CI) 1.53-2.75], patients under the age of 60 years (RR = 1.45, 95% CI 1.07-1.98), patients with a history of previous ADR (RR = 6.51, 95% CI 3.13-13.57), and in the spring season (RR = 1.44, 95% CI 1.07-1.95). The recurrence rate after premedication in patients with previous ADR to CT contrast media was 3.2% (8/247). No deaths occurred that were attributed to the contrast media. The incidence of ADR to nonionic CT contrast media was 0.35%; most of which were mild reactions. Risk factors for ADR included female gender, an age of under 60 years, a history of previous ADR, and spring season.

  4. Carbonitriding reactions of diatomaceous earth: phase evolution and reaction mechanisms

    Directory of Open Access Journals (Sweden)

    BRANKO MATOVIC

    2006-06-01

    Full Text Available The possibility of using diatomaceous earth as Si precursor for low temperature synthesis of non-oxide powders by carbothermal reduction-nitridation was studied. It was found that carbonitriding reactions produce phases of the Si–Al–O–N system. Already at 1300 °C, nanosized, non-oxide powders were obtained. The comparatively low reaction temperatures is attributred to the nano-porous nature of the raw material. The evolution of crystalline phases proceeded via many intermediate stages. The powders were characterized by X-ray and SEM investigations. The results showed that diatomaceous earth can be a very effective source for obtaining non-oxide powders.

  5. A comprehensive survey of nuclear reactions; Panorama des reactions nucleaires

    Energy Technology Data Exchange (ETDEWEB)

    Cugnon, J. [Liege Univ., IFPA, AGO Dept. (Belgium)

    2007-07-01

    The various mechanisms of nuclear reactions are surveyed and classified in different regimes, based on the notions of coherent mechanisms and hard versus soft processes. The emphasis is put on the concepts at the basis of the understanding of these regimes and on the elements of nuclear structure which are involved in these different regimes, as well as the on the possibility of extracting this information. Due to lack of space and for pedagogical reasons, the discussion is limited to nucleon-induced and light-ion-induced reactions. However, a few remarks are given concerning some specific probes, such as weakly bound projectiles or neutron-rich nuclei. (author)

  6. Biomarkers of adverse drug reactions.

    Science.gov (United States)

    Carr, Daniel F; Pirmohamed, Munir

    2017-01-01

    Adverse drug reactions can be caused by a wide range of therapeutics. Adverse drug reactions affect many bodily organ systems and vary widely in severity. Milder adverse drug reactions often resolve quickly following withdrawal of the casual drug or sometimes after dose reduction. Some adverse drug reactions are severe and lead to significant organ/tissue injury which can be fatal. Adverse drug reactions also represent a financial burden to both healthcare providers and the pharmaceutical industry. Thus, a number of stakeholders would benefit from development of new, robust biomarkers for the prediction, diagnosis, and prognostication of adverse drug reactions. There has been significant recent progress in identifying predictive genomic biomarkers with the potential to be used in clinical settings to reduce the burden of adverse drug reactions. These have included biomarkers that can be used to alter drug dose (for example, Thiopurine methyltransferase (TPMT) and azathioprine dose) and drug choice. The latter have in particular included human leukocyte antigen (HLA) biomarkers which identify susceptibility to immune-mediated injuries to major organs such as skin, liver, and bone marrow from a variety of drugs. This review covers both the current state of the art with regard to genomic adverse drug reaction biomarkers. We also review circulating biomarkers that have the potential to be used for both diagnosis and prognosis, and have the added advantage of providing mechanistic information. In the future, we will not be relying on single biomarkers (genomic/non-genomic), but on multiple biomarker panels, integrated through the application of different omics technologies, which will provide information on predisposition, early diagnosis, prognosis, and mechanisms. Impact statement • Genetic and circulating biomarkers present significant opportunities to personalize patient therapy to minimize the risk of adverse drug reactions. ADRs are a significant heath issue

  7. Fatal anaphylactic reaction during anesthesia

    Directory of Open Access Journals (Sweden)

    Izidor Kern

    2012-01-01

    Full Text Available Background: Incidence of anaphylactic reactions occuring during anesthesia is not known. They occur most often in the induction  phase and can present with different levels of severity, also as an anaphylactic shock. Neuromuscular blocking drugs are the most frequently involved substances.Case presentation: We  report a case of a 77-year old female patient with granulomatous inflammation of unknown etiology. Surgical  biopsy of a neck lymph node was indicated. During the induction of anesthesia using propofol and succinylcholine she developed severe anaphylactic reaction presented with bronchospasm and cardiac arrest. Despite 80 min continous cardiopulmonary resuscitation the patient died. Elevated tryptase level in the patient’s blood sample taken before death confirmed anaphylactic reaction. On autopsy we confirmed the tuberculous etiology of generalized granulomatous inflammation.Conclusions: It is important to recognize anaphylactic reaction during anesthesia early and to take adequate measures in order to prevent unfavorable outcome. Tryptase assay of a blood sample taken during life or postmortem may help to identify anaphylactic reaction.

  8. [Histopathology of cutaneous drug reactions].

    Science.gov (United States)

    Ortonne, Nicolas

    2018-02-01

    There are many different types of cutaneous adverse reactions. The most classical reactions are driven by T lymphocytes that specifically react towards a drug, with an individual genetic susceptibility linked to certain type I major histocompatibility complex alleles. These reactions are characterized by a wide variety of clinical and histopathological presentations, and a wide range of severity. The most frequent entity is the maculopapular rash, while the most aggressive forms are the Steven-Johnson syndrome and toxic epidermal necrolysis (SJS-TEN). The histopathological alterations associated to each of these syndromes have been better described in the literature during the past 10 years, encompassing non-specific lesions, as in most drug induced maculopapular rashes, to more specific inflammatory patterns. The finding of confluent apoptotic keratinocytes with epidermal detachment is the prototypical aspect of SJS-TEN. There are however numerous pitfalls, and a similar aspect to those observed in each cutaneous drug reactions entities can be found in other diseases. DRESS syndrome can indeed present with dense and epidermotropic T-cell infiltrate, sometimes with nuclear atypias, and thus can be difficult to distinguish from a primary or secondary cutaneous T-cell lymphoma. The diagnosis of cutaneous adverse reactions relies on a clinical-pathological confrontation and requires an accurate evaluation of drug imputability. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  9. Combustion kinetics and reaction pathways

    Energy Technology Data Exchange (ETDEWEB)

    Klemm, R.B.; Sutherland, J.W. [Brookhaven National Laboratory, Upton, NY (United States)

    1993-12-01

    This project is focused on the fundamental chemistry of combustion. The overall objectives are to determine rate constants for elementary reactions and to elucidate the pathways of multichannel reactions. A multitechnique approach that features three independent experiments provides unique capabilities in performing reliable kinetic measurements over an exceptionally wide range in temperature, 300 to 2500 K. Recent kinetic work has focused on experimental studies and theoretical calculations of the methane dissociation system (CH{sub 4} + Ar {yields} CH{sub 3} + H + Ar and H + CH{sub 4} {yields} CH{sub 3} + H{sub 2}). Additionally, a discharge flow-photoionization mass spectrometer (DF-PIMS) experiment is used to determine branching fractions for multichannel reactions and to measure ionization thresholds of free radicals. Thus, these photoionization experiments generate data that are relevant to both reaction pathways studies (reaction dynamics) and fundamental thermochemical research. Two distinct advantages of performing PIMS with high intensity, tunable vacuum ultraviolet light at the National Synchrotron Light Source are high detection sensitivity and exceptional selectivity in monitoring radical species.

  10. Electrocardiographic changes in lepra reaction.

    Science.gov (United States)

    Zawar, P B; Chawhan, R N; Swami, R M

    1983-04-01

    The electrocardiographic (E.C.G.) changes were evaluated in 54 patients of lepra reaction. Abnormalities of the E.C.G. observed were in the form of prolongation of QTc in 24 (44.44%), ST-T changes in a (16.66%), bundle branch block and ventricular extrasystoles in 2 each (3.70%). The mean QTc interval in 64 normal adults was 0.41 second (S.D. +/- 0.03, range 0.36 to 0.44 second). It was 0.44 second (S.D. +/- 0.05, range 0.38 to 0.52 second) in patients of lepra reaction. The difference in the QTc values in the two groups was statistically significant (P less than 0.01). The E.C.G. abnormalities in patients of lepra reaction appears to be due to myocardial involvement.

  11. Effective dynamics along given reaction coordinates, and reaction rate theory.

    Science.gov (United States)

    Zhang, Wei; Hartmann, Carsten; Schütte, Christof

    2016-12-22

    In molecular dynamics and related fields one considers dynamical descriptions of complex systems in full (atomic) detail. In order to reduce the overwhelming complexity of realistic systems (high dimension, large timescale spread, limited computational resources) the projection of the full dynamics onto some reaction coordinates is examined in order to extract statistical information like free energies or reaction rates. In this context, the effective dynamics that is induced by the full dynamics on the reaction coordinate space has attracted considerable attention in the literature. In this article, we contribute to this discussion: we first show that if we start with an ergodic diffusion process whose invariant measure is unique then these properties are inherited by the effective dynamics. Then, we give equations for the effective dynamics, discuss whether the dominant timescales and reaction rates inferred from the effective dynamics are accurate approximations of such quantities for the full dynamics, and compare our findings to results from approaches like Mori-Zwanzig, averaging, or homogenization. Finally, by discussing the algorithmic realization of the effective dynamics, we demonstrate that recent algorithmic techniques like the "equation-free" approach and the "heterogeneous multiscale method" can be seen as special cases of our approach.

  12. Miniaturized continuous flow reaction vessels: influence on chemical reactions

    NARCIS (Netherlands)

    Brivio, M.; Verboom, Willem; Reinhoudt, David

    2006-01-01

    This review offers an overview of the relatively young research area of continuous flow lab-on-a-chip for synthetic applications. A short introduction on the basic aspects of lab-on-a-chip is given in the first part. Subsequently, the effects of downscaling reaction vessels as well as the advantages

  13. Reaction rate of propene pyrolysis.

    Science.gov (United States)

    Han, Peipei; Su, Kehe; Liu, Yan; Wang, Yanli; Wang, Xin; Zeng, Qingfeng; Cheng, Laifei; Zhang, Litong

    2011-10-01

    The reaction rate of propene pyrolysis was investigated based on the elementary reactions proposed in Qu et al., J Comput Chem 2009, 31, 1421. The overall reaction rate was developed with the steady-state approximation and the rate constants of the elementary reactions were determined with the variational transition state theory. For the elementary reaction having transition state, the vibrational frequencies of the selected points along the minimum energy path were calculated with density functional theory at B3PW91/6-311G(d,p) level and the energies were improved with the accurate model chemistry method G3(MP2). For the elementary reaction without transition state, the frequencies were calculated with CASSCF/6-311G(d,p) and the energies were refined with the multireference configuration interaction method MRCISD/6-311G(d,p). The rate constants were evaluated within 200-2000 K and the fitted three-parameter expressions were obtained. The results are consistent with those in the literatures in most cases. For the overall rate, it was found that the logarithm of the rate and the reciprocal temperature have excellent linear relationship above 400 K, predicting that the rate follows a typical first-order law at high temperatures of 800-2000 K, which is also consistent with the experiments. The apparent activation energy in 800-2000 K is 317.3 kJ/mol from the potential energy surface of zero Kelvin. This value is comparable with the energy barriers, 365.4 and 403.7 kJ/mol, of the rate control steps. However, the apparent activation energy, 215.7 kJ/mol, developed with the Gibbs free energy surface at 1200 K is consistent with the most recent experimental result 201.9 ± 0.6 kJ/mol. Copyright © 2011 Wiley Periodicals, Inc.

  14. Vision 2020. Reaction Engineering Roadmap

    Energy Technology Data Exchange (ETDEWEB)

    Klipstein, David H. [Reaction Design, San Diego, CA (United States); Robinson, Sharon [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2001-01-01

    The Reaction Engineering Roadmap is a part of an industry- wide effort to create a blueprint of the research and technology milestones that are necessary to achieve longterm industry goals. This report documents the results of a workshop focused on the research needs, technology barriers, and priorities of the chemical industry as they relate to reaction engineering viewed first by industrial use (basic chemicals; specialty chemicals; pharmaceuticals; and polymers) and then by technology segment (reactor system selection, design, and scale-up; chemical mechanism development and property estimation; dealing with catalysis; and new, nonstandard reactor types).

  15. Neutron fluence and energy reconstruction with the IRSN recoil detector μ-TPC at 27 keV, 144 keV and 565 keV

    Energy Technology Data Exchange (ETDEWEB)

    Maire, D.; Lebreton, L.; Richer, J.P. [IRSN, PRP-HOM, SDE, LMDN, 13115 Saint Paul-Lez-Durance (France); Bosson, G.; Bourrion, O.; Guillaudin, O.; Riffard, Q.; Santos, D. [CNRS/IN2P3-UJF-INPG, LPSC, 38000 Grenoble (France)

    2015-07-01

    The French Institute for Radioprotection and Nuclear Safety (IRSN), associated to the French Metrology Institute (LNE), is developing a time projection chamber using a Micromegas anode: μ-TPC. This work is carried out in collaboration with the Laboratory of Subatomic Physics and Cosmology (LPSC). The aim is to characterize with a primary procedure the energy distribution of neutron fluence in the energy range 8 keV - 1 MeV. The time projection chambers are gaseous detectors, which are able to measure charged particles energy and to reconstruct their track if a pixelated anode is used. In our case, the gas is used as a (n, p) converter in order to detect neutrons down to few keV. Coming from elastic collisions with neutrons, recoil protons lose a part of their kinetic energy by ionizing the gas. The ionization electrons are drifted toward a pixelated anode (2D projection), read at 50 MHz by a self-triggered electronic system to obtain the third track dimension. The neutron energy is reconstructed event by event thanks to proton scattering angle and proton energy measurements. The scattering angle is deduced from the 3D track. The proton energy is obtained by charge collection measurements, knowing the ionization quenching factor (i.e. the part of proton kinetic energy lost by ionizing the gas). The fluence is calculated thanks to the detected events number and the simulated detector response. The μ-TPC is a new reliable detector which enables to measure energy distribution of the neutron fluence without deconvolution or neutron calibration contrary to usual gaseous counters. The μ-TPC is still being developed and measurements have been carried out at the AMANDE facility, with neutrons energies going from 8 keV to 565 keV. After the context and the μ-TPC working principle presentation, measurements of the neutron energy and fluence at 27.2 keV, 144 keV and 565 keV are shown and compared to the complete detector simulation. This work shows the first direct

  16. 87Sr/86Sr and 143Nd/144Nd for disentangling anthropogenic and natural REE contributions in river water during flood events.

    Science.gov (United States)

    Hissler, Christophe; Stille, Peter; Pfister, Laurent

    2017-04-01

    The sustainable management of water resources is one of the greatest challenges of the 21st century. Water is a vital resource that is increasingly put under pressure from multiple perspectives. While the global population is on the rise, socio-economic development makes equally rapid progress - eventually compromising access to clean water bodies. Multiple pollution sources constitute an immediate threat to aquatic ecosystems and are likely to cause long lasting contaminations of water bodies that are critical for drinking and/or irrigation water production. There is a pressing need for an adequate quantification of anthropogenic impacts on the critical zone of river basins and the identification of the temporal dynamics of these impacts. As an example, despite the work done to assess the environmental impact of REE pollutions in larger river systems, we are still lacking information on the dynamics of these anthropogenic compounds in relation to rapid hydrological changes. Filling these knowledge gaps is a pre-requisite for the design and implementation of sustainable water resources management strategies. In order to better constrain the relative contributions of both anthropogenic and geogenic trace element sources we propose using a multitracer approach combining elemental and 87Sr/86Sr, 143Nd/144Nd, and 206Pb/207Pb isotopic ratios. The use of these three separate isotopic systems together with REE concentrations is new in the field of anthropogenic source identification in river systems. We observed enrichments in Anthropogenic Rare Earth Elements (AREE) for dissolved Gd and suspended Nd loads of river water. With increasing discharge, AREE anomalies progressively disappeared and gave way to the geogenic chemical signature of the basin in both dissolved and suspended loads. The isotopic data confirm these observations and shed new light on the trace elements sources. On the one hand, dissolved loads have peculiar isotopic characteristics and carry mainly

  17. Profiling of Greenhouse Gases from Space by Infrared-Laser Occultation and Demonstration by a 144 km Crosslink Experiment at the Canary Islands

    Science.gov (United States)

    Kirchengast, G.; Schweitzer, S.; Proschek, V.; Bernath, P.; Thomas, B.; Wang, J.; Brooke, J.; Tereszchuk, K.; Gonzalez Abad, G.; Hargreaves, R.; Beale, C. A.; Martin, P.; Kasiutsich, V.; Gerbig, C.; Kolle, O.; Loescher, A.

    2011-12-01

    Low Earth Orbit (LEO) transmitter and receiver satellites provide the basis for LEO-LEO microwave and infrared-laser occultation (LMIO), a new active limb sounding method for climate benchmark profiling of greenhouse gases (GHGs), thermodynamic variables and wind in the free atmosphere (Kirchengast and Schweitzer, GRL, 38, L13701, 2011). The LEO-LEO infrared-laser occultation (LIO) part of LMIO can provide accurate profiles of all main GHGs, including CO2, CH4, N2O, H2O, O3, and isotopes 13CO2 and 18OCO, by exploiting differential absorption between carefully selected absorption ("on-line") and reference ("off-line") laser signals targeting suitable GHG absorption lines within 2 to 2.5 μm. This spectral range resides in the "hole" between the shortwave-solar and longwave-terrestrial Planck spectra so that natural background radiation is minimal to negligible. We present the fundamentals and discuss the estimated performance of LMIO-based GHG profiling, including from quasi-realistic end-to-end performance simulations considering also aerosols and clouds. We found monthly-mean GHG profiles, assuming 30 to 40 native profiles averaged per climatological "grid cell" per month, accurate to LIO sounding along a ~144 km link at ~2.4 km altitude between observatories at the islands of La Palma and Tenerife being part of the Canary Islands (ESA-funded experiment project by Bernath et al.; Univ. York, Univ. Graz, Univ. Manchester, MPI Jena). With transmitter and receiver breadboard equipment built for four infrared-laser signals we aimed in this campaign at CO2, CH4, and H2O measurements under field conditions somewhat akin to a LIO space-based link. Despite of the practical challenges of such long-range observations, especially related to the needed fine adjustments of laser beam pointing under windy high-altitude conditions, we achieved first good data for retrieving these GHGs so that the basic demonstration of the experimental feasibility of LIO was successful. We will

  18. Predicting live birth, preterm delivery, and low birth weight in infants born from in vitro fertilisation: a prospective study of 144,018 treatment cycles.

    Directory of Open Access Journals (Sweden)

    Scott M Nelson

    2011-01-01

    Full Text Available The extent to which baseline couple characteristics affect the probability of live birth and adverse perinatal outcomes after assisted conception is unknown.We utilised the Human Fertilisation and Embryology Authority database to examine the predictors of live birth in all in vitro fertilisation (IVF cycles undertaken in the UK between 2003 and 2007 (n = 144,018. We examined the potential clinical utility of a validated model that pre-dated the introduction of intracytoplasmic sperm injection (ICSI as compared to a novel model. For those treatment cycles that resulted in a live singleton birth (n = 24,226, we determined the associates of potential risk factors with preterm birth, low birth weight, and macrosomia. The overall rate of at least one live birth was 23.4 per 100 cycles (95% confidence interval [CI] 23.2-23.7. In multivariable models the odds of at least one live birth decreased with increasing maternal age, increasing duration of infertility, a greater number of previously unsuccessful IVF treatments, use of own oocytes, necessity for a second or third treatment cycle, or if it was not unexplained infertility. The association of own versus donor oocyte with reduced odds of live birth strengthened with increasing age of the mother. A previous IVF live birth increased the odds of future success (OR 1.58, 95% CI 1.46-1.71 more than that of a previous spontaneous live birth (OR 1.19, 95% CI 0.99-1.24; p-value for difference in estimate <0.001. Use of ICSI increased the odds of live birth, and male causes of infertility were associated with reduced odds of live birth only in couples who had not received ICSI. Prediction of live birth was feasible with moderate discrimination and excellent calibration; calibration was markedly improved in the novel compared to the established model. Preterm birth and low birth weight were increased if oocyte donation was required and ICSI was not used. Risk of macrosomia increased with advancing

  19. Enhancement of solubility in Escherichia coli and purification of an aminotransferase from Sphingopyxis sp. MTA144 for deamination of hydrolyzed fumonisin B1

    Directory of Open Access Journals (Sweden)

    Hartinger Doris

    2010-08-01

    Full Text Available Abstract Background Fumonisin B1 is a cancerogenic mycotoxin produced by Fusarium verticillioides and other fungi. Sphingopyxis sp. MTA144 can degrade fumonisin B1, and a key enzyme in the catabolic pathway is an aminotransferase which removes the C2-amino group from hydrolyzed fumonisin B1. In order to study this aminotransferase with respect to a possible future application in enzymatic fumonisin detoxification, we attempted expression of the corresponding fumI gene in E. coli and purification of the enzyme. Since the aminotransferase initially accumulated in inclusion bodies, we compared the effects of induction level, host strain, expression temperature, solubility enhancers and a fusion partner on enzyme solubility and activity. Results When expressed from a T7 promoter at 30°C, the aminotransferase accumulated invariably in inclusion bodies in DE3 lysogens of the E. coli strains BL21, HMS174, Rosetta 2, Origami 2, or Rosetta-gami. Omission of the isopropyl-beta-D-thiogalactopyranoside (IPTG used for induction caused a reduction of expression level, but no enhancement of solubility. Likewise, protein production but not solubility correlated with the IPTG concentration in E. coli Tuner(DE3. Addition of the solubility enhancers betaine and sorbitol or the co-enzyme pyridoxal phosphate showed no effect. Maltose-binding protein, used as an N-terminal fusion partner, promoted solubility at 30°C or less, but not at 37°C. Low enzyme activity and subsequent aggregation in the course of purification and cleavage indicated that the soluble fusion protein contained incorrectly folded aminotransferase. Expression in E. coli ArcticExpress(DE3, which co-expresses two cold-adapted chaperonins, at 11°C finally resulted in production of appreciable amounts of active enzyme. Since His tag-mediated affinity purification from this strain was hindered by co-elution of chaperonin, two steps of chromatography with optimized imidazole concentration in the

  20. Predicting Live Birth, Preterm Delivery, and Low Birth Weight in Infants Born from In Vitro Fertilisation: A Prospective Study of 144,018 Treatment Cycles

    Science.gov (United States)

    Nelson, Scott M.; Lawlor, Debbie A.

    2011-01-01

    Background The extent to which baseline couple characteristics affect the probability of live birth and adverse perinatal outcomes after assisted conception is unknown. Methods and Findings We utilised the Human Fertilisation and Embryology Authority database to examine the predictors of live birth in all in vitro fertilisation (IVF) cycles undertaken in the UK between 2003 and 2007 (n = 144,018). We examined the potential clinical utility of a validated model that pre-dated the introduction of intracytoplasmic sperm injection (ICSI) as compared to a novel model. For those treatment cycles that resulted in a live singleton birth (n = 24,226), we determined the associates of potential risk factors with preterm birth, low birth weight, and macrosomia. The overall rate of at least one live birth was 23.4 per 100 cycles (95% confidence interval [CI] 23.2–23.7). In multivariable models the odds of at least one live birth decreased with increasing maternal age, increasing duration of infertility, a greater number of previously unsuccessful IVF treatments, use of own oocytes, necessity for a second or third treatment cycle, or if it was not unexplained infertility. The association of own versus donor oocyte with reduced odds of live birth strengthened with increasing age of the mother. A previous IVF live birth increased the odds of future success (OR 1.58, 95% CI 1.46–1.71) more than that of a previous spontaneous live birth (OR 1.19, 95% CI 0.99–1.24); p-value for difference in estimate <0.001. Use of ICSI increased the odds of live birth, and male causes of infertility were associated with reduced odds of live birth only in couples who had not received ICSI. Prediction of live birth was feasible with moderate discrimination and excellent calibration; calibration was markedly improved in the novel compared to the established model. Preterm birth and low birth weight were increased if oocyte donation was required and ICSI was not used. Risk of macrosomia

  1. Reaction

    African Journals Online (AJOL)

    raoul

    12 janv. 2012 ... recours à la TEP-FDG couplée au scanner serait d'un grand apport, en différenciant masse splénique bénigne et maligne, et en identifiant d'autres sites métastatiques hypermétaboliques insoupçonnées sur l'imagerie conventionnelle. L'imagerie de la métastase splénique pourrait également bénéficier de ...

  2. Reaction

    African Journals Online (AJOL)

    raoul

    2011-05-11

    May 11, 2011 ... Open-heart surgery and coronary artery bypass grafting in Western Africa. Frank Edwin1,2,&, Kwabena Frimpong-Boateng1 .... Frimpong-Boateng K, Amoah AG, Barwasser HM, Kallen C. Cardiopulmonary bypass in sickle cell anaemia without exchange transfusion.Eur J Cardiothorac Surg. 1998 Nov ...

  3. Reactions

    DEFF Research Database (Denmark)

    Søndergaard, Morten

    2011-01-01

    ) museum. Augmentation, in this expanding digital field, is part of a production of new public spaces, as well as a new reality that affects and traverses art and institutions immanently and througout. The expanding digital field is transforming art and the art museum in a number of fundamental ways, a few...... of which I will look into in this paper. It has been suggested that ... we are in the midst of an explosion of emerging human-computer interaction techniques that redefine our understanding of both computers and interaction. We propose the notion of Reality-Based Interaction (RBI) as a unifying concept...... that ties together ... (Robert J.K. Jacob, 2008) I suggest that a negotiation between reality-based interaction and a digital dialectic (Lunenfeld, 1999)(Søndergaard M. o., 2008) is becoming still more evident, on two levels: 1) As an investigation into (the visuality of) a digital reality under...

  4. Reactions of young adults to September 11, 2001.

    Science.gov (United States)

    Ford, Carol A; Udry, J Richard; Gleiter, Karin; Chantala, Kim

    2003-06-01

    Wave III of the National Longitudinal Study of Adolescent Health provides opportunities to describe the reactions of young adults to September 11, 2001, and to increase understanding of the reactions among those who do not directly witness disasters. To compare the feelings, perceptions, and behaviors of respondents interviewed before with those of respondents interviewed within 9 weeks after September 11; and to test the influence of time and distance from terrorist sites on pre-post comparisons. Cross-sectional study, with comparison groups before and after September 11. In-home interviews. Seven thousand ninety-five respondents aged 18 to 26 years. Sadness, psychological distress, closeness to parents, importance of religion and spirituality, trust in government, and substance use. Male (adjusted odds ratio [aOR], 1.33; 95% confidence interval [CI], 1.08-1.65) and female (aOR, 1.44; 95% CI, 1.22-1.71) respondents interviewed after September 11 were more likely to report sadness and increased trust in government (aOR range, 2.11-3.30) than those interviewed before September 11. Proportions reporting sadness returned to baseline in 4 to 6 weeks; increased political trust persisted for the 9-week study period. Male respondents interviewed the second week afterwards were more likely to report religious faith (aOR, 2.06; 95% CI, 1.40-3.00) and spiritual life (aOR, 1.75; 95% CI, 1.18-2.60) as important than were those interviewed before the event. Female respondents interviewed afterwards were more likely to report higher levels of psychological distress (aOR, 1.40; 95% CI, 1.08-1.83) and closeness to fathers (aOR, 1.36; 95% CI, 1.08-1.72). There were no pre-post differences in substance use. Respondents closest to terrorist sites were most affected. Young adults who did not directly witness the events of September 11 experienced reactions that were multifaceted and transient--except for persisting trust in government.

  5. Humidity independent mass spectrometry for gas phase chemical analysis via ambient proton transfer reaction.

    Science.gov (United States)

    Zhu, Hongying; Huang, Guangming

    2015-03-31

    In this work, a humidity independent mass spectrometric method was developed for rapid analysis of gas phase chemicals. This method is based upon ambient proton transfer reaction between gas phase chemicals and charged water droplets, in a reaction chamber with nearly saturate humidity under atmospheric pressure. The humidity independent nature enables direct and rapid analysis of raw gas phase samples, avoiding time- and sample-consuming sample pretreatments in conventional mass spectrometry methods to control sample humidity. Acetone, benzene, toluene, ethylbenzene and meta-xylene were used to evaluate the analytical performance of present method. The limits of detection for benzene, toluene, ethylbenzene and meta-xylene are in the range of ∼0.1 to ∼0.3 ppbV; that of benzene is well below the present European Union permissible exposure limit for benzene vapor (5 μg m(-3), ∼1.44 ppbV), with linear ranges of approximately two orders of magnitude. The majority of the homemade device contains a stainless steel tube as reaction chamber and an ultrasonic humidifier as the source of charged water droplets, which makes this cheap device easy to assemble and facile to operate. In addition, potential application of this method was illustrated by the real time identification of raw gas phase chemicals released from plants at different physiological stages. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Combination of Hb Heze [β144(HC1)Lys→Arg; HBB: c.434A>G] and β0-Thalassemia in a Chinese Patient with β-Thalassemia Intermedia.

    Science.gov (United States)

    Li, Yan; Yan, Jin-Mei; Zhou, Jian-Ying; Lu, Yue-Cheng; Li, Dong-Zhi

    2017-01-01

    We first report a novel β chain variant, Hb Heze [β144(HC1)Lys→Arg; HBB: c.434A>G], in a Chinese family. Heterozygous inheritance of the mutation results in a mild β-thalassemia (β-thal) phenotype, whereas compound heterozygosity of Hb Heze with β0-thal appears as the cause of β-thal intermedia (β-TI) in our case.

  7. 2-{5-(1,3-Benzodioxol-5-yl-1-[4-(4-chlorophenyl-1,3-thiazol-2-yl]-4,5-dihydro-1H-pyrazol-3-yl}pyrazine

    Directory of Open Access Journals (Sweden)

    Suban Syed Shafi

    2010-03-01

    Full Text Available A simple method for the synthesis of a pyrazolyl thiazole derivative containing a piperonal moiety was developed. Thus, 2-{5-(1,3-benzodioxol-5-yl-1-[4-(4-chlorophenyl-1,3-thiazol-2-yl]-4,5-dihydro-1H-pyrazol-3-yl}pyrazine was synthesized using microwave irradiation and characterized by NMR, IR and LCMS data.

  8. Interference of N-(1-[4-(4-fluophenoxy)butyl]-piperidinyl)-N-methyl-2-benzothiazolamin e with Na+/H+exchange and Na+/Ca2+exchange in purified cardiac sarcolemmal membranes

    NARCIS (Netherlands)

    Scheufler, E.; Heers, C.; Wilffert, B.; Peters, Thies; Pierce, G.N.

    1993-01-01

    The effect of R 56865 (N-[1-[4-(4-fluorophenoxy) butyl]-piperidinyl]-N-methyl-2-benzothiazolamine, CAS 104606-13-5) on Na+/H+exchange and Na+/Ca2+exchange was studied in isolated cardiac sarcolemmal vesicles. R 56865 inhibited Na+/H+exchange with an ED50of 180 μmol/l at a concentration of 0.05

  9. Activation cross-sections of deuteron induced nuclear reactions on neodymium up to 50 MeV

    Energy Technology Data Exchange (ETDEWEB)

    Tárkányi, F.; Takács, S. [Institute for Nuclear Research of the Hungarian Academy of Sciences (ATOMKI), Debrecen (Hungary); Ditrói, F., E-mail: ditroi@atomki.hu [Institute for Nuclear Research of the Hungarian Academy of Sciences (ATOMKI), Debrecen (Hungary); Hermanne, A. [Cyclotron Laboratory, Vrije Universiteit Brussel (VUB), Brussels (Belgium); Yamazaki, H.; Baba, M.; Mohammadi, A. [Cyclotron Radioisotope Center (CYRIC), Tohoku University, Sendai (Japan); Ignatyuk, A.V. [Institute of Physics and Power Engineering (IPPE), Obninsk (Russian Federation)

    2014-04-01

    Highlights: • Experimental excitation function of deuteron induced reactions on natural Nd. • Model code calculations with EMPIRE-D, ALICE-D and TALYS (TENDL-2012). • Physical yield calculation and comparison. • Discussion of medical and industrial applications. - Abstract: In the frame of a systematic study of activation cross sections of deuteron induced nuclear reactions on rare earths, the reactions on neodymium for production of therapeutic radionuclides were measured for the first time. The excitation functions of the {sup nat}Nd(d,x) {sup 151,150,149,148m,148g,146,144,143}Pm, {sup 149,147,139m}Nd, {sup 142}Pr and {sup 139g}Ce nuclear reactions were assessed by using the stacked foil activation technique and high resolution γ-spectrometry. The experimental excitation functions were compared to the theoretical predictions calculated with the modified model codes ALICE-IPPE-D and EMPIRE-II-D and with the data in the TENDL-2012 library based on latest version of the TALYS code. The application of the data in the field of medical isotope production and nuclear reaction theory is discussed.

  10. Reactions of ethanol on Ru

    NARCIS (Netherlands)

    Sturm, Jacobus Marinus; Liu, Feng; Lee, Christopher James; Bijkerk, Frederik

    2012-01-01

    The adsorption and reactions of ethanol on Ru(0001) were studied with temperatureprogrammed desorption (TPD) and reflection-absorption infrared spectroscopy (RAIRS). Ethanol was found to adsorb intact onto Ru(0001) below 100 K. Heating to 250 K resulted in formation of ethoxy groups, which undergo

  11. Reaction modeling in geothermal systems

    Science.gov (United States)

    Stefansson, A.

    2012-12-01

    Natural volcanic geothermal systems are open systems in term of matter and energy. Such systems are complex to model in terms of fluid chemistry, fluid flow and energy budget. Reaction modeling may be used to gain insight and possibly quantify chemical processes occurring within a system, for example fluid-fluid and fluid-rock interaction. Methods have been developed within the WATCH (Bjarnason, 1994; Arnórsson et al., 2007) and PHREEQC (Parkhurst and Appelo, 1999) programs to simulate reactions of multicomponent and multiphase systems to 300°C. The models include boiling and phase segregation (open system boiling), fluid-fluid mixing and fluid-rock interaction (gas-water-rock interaction). The models have been applied to quantify processes within the Hellisheidi geothermal system, Iceland. Open system boiling and fluid-rock interaction were simulated as a function of temperature, initial fluid composition and extent of reaction (T-X-ξ). In addition the interactions of magmatic gases with geothermal fluids and rocks were modeled. In this way various component behavior has been traced within the geothermal system and compared with observations of fluid composition and mineralogy. In addition, the reaction models have been used to evaluate the geochemical feasibility and best conditions of gas (CO2 and H2S) and waste water injection into geothermal system.

  12. Isotachophoresis applied to biomolecular reactions.

    Science.gov (United States)

    Eid, C; Santiago, J G

    2017-12-19

    This review discusses research developments and applications of isotachophoresis (ITP) to the initiation, control, and acceleration of chemical reactions, emphasizing reactions involving biomolecular reactants such as nucleic acids, proteins, and live cells. ITP is a versatile technique which requires no specific geometric design or material, and is compatible with a wide range of microfluidic and automated platforms. Though ITP has traditionally been used as a purification and separation technique, recent years have seen its emergence as a method to automate and speed up chemical reactions. ITP has been used to demonstrate up to 14 000-fold acceleration of nucleic acid assays, and has been used to enhance lateral flow and other immunoassays, and even whole bacterial cell detection assays. We here classify these studies into two categories: homogeneous (all reactants in solution) and heterogeneous (at least one reactant immobilized on a solid surface) assay configurations. For each category, we review and describe physical modeling and scaling of ITP-aided reaction assays, and elucidate key principles in ITP assay design. We summarize experimental advances, and identify common threads and approaches which researchers have used to optimize assay performance. Lastly, we propose unaddressed challenges and opportunities that could further improve these applications of ITP.

  13. Teachers' Reactions to Children's Aggression

    Science.gov (United States)

    Nesdale, Drew; Pickering, Kaye

    2006-01-01

    Drawing on social schema theory (Fiske & Taylor, 1991) and social identity theory (Tajfel & Turner, 1979), this study examined the impact on teachers' reactions to children's aggression of three variables, two of which were related to the aggressors and one was related to the teachers. Experienced female elementary school teachers (N=90) each read…

  14. The Pitfalls of Precipitation Reactions.

    Science.gov (United States)

    Slade, Peter W.; Rayner-Canham, Geoffrey W.

    1990-01-01

    Described are some of the difficulties presented in these reactions by competing equilibria that are usually ignored. Situations involving acid-base equilibria, solubility product calculations, the use of ammonia as a complexing agent, and semiquantitative comparisons of solubility product values are discussed. (CW)

  15. Reactants encapsulation and Maillard Reaction

    NARCIS (Netherlands)

    Troise, A.D.; Fogliano, V.

    2013-01-01

    In the last decades many efforts have been addressed to the control of Maillard Reaction products in different foods with the aim to promote the formation of compounds having the desired color and flavor and to reduce the concentration of several potential toxic molecules. Encapsulation, already

  16. REACTIONS OF SOME CONFECTIONERY GROUNDNUT ...

    African Journals Online (AJOL)

    AGROSEARCH UIL

    some confectionery groundnut accessions reactions to plant parasitic nematodes infection. .... The soil samples, 200 cm3 per treatment were extracted using the ..... 15. Osei et al, 2013. Table 7.Days to maturity of Accessions at the four locations. Accessions. Fumesua. Wenchi. Ejura. Atebubu. ICGV 97040. 101a. 109a. 93 e.

  17. Apparent tunneling in chemical reactions

    DEFF Research Database (Denmark)

    Henriksen, Niels Engholm; Hansen, Flemming Yssing; Billing, G. D.

    2000-01-01

    A necessary condition for tunneling in a chemical reaction is that the probability of crossing a barrier is non-zero, when the energy of the reactants is below the potential energy of the barrier. Due to the non-classical nature (i.e, momentum uncertainty) of vibrational states this is, however...

  18. Allergic reactions to natural rubber.

    Science.gov (United States)

    Slater, J E

    1992-03-01

    Immediate hypersensitivity reactions to natural rubber pose a significant risk to patients with spina bifida and urogenital abnormalities, health care workers, and rubber industry workers. Other patients, outside of these high risk groups, have experienced severe allergic reactions to natural rubber as well. Awareness of this life-threatening condition by health care providers is essential if reactions are to be prevented. History alone is inadequate to identify all patients at risk, and reliable testing materials are not yet approved or widely available. Nonrubber medical devices are readily available for most uses; however, the only rubber-free condoms currently on the market do not prevent the transmission of sexually transmitted disease. The identification and detection of rubber antigens, along with mandated labeling for rubber antigen content, will contribute to the care of this growing population of patients. Efforts by the rubber industry to decrease the antigen content of natural rubber products will decrease the risk of reaction among sensitized patients and will, very likely, decrease the rate of sensitization in the future.

  19. Organic Reaction Mechanism Controversy: Pedagogical ...

    African Journals Online (AJOL)

    The paper investigated the pedagogical implications of the controversy generated by the nature of reaction mechanism in organic chemistry as to whether it can be proven or not. A conference of a chemist, chemical educator, a graduate chemistry teacher and a graduate assistant was organized. The conference lasted for ...

  20. Reaction rates when barriers fluctuate

    OpenAIRE

    Reimann, Peter

    1999-01-01

    Reaction rates when barriers fluctuate : a path integral approach / P. Hänggi and P. Reimann. - In: International Conference on Path Integrals from peV to TeV : Proceedings of the ... / eds.: R. Casalbuoni ... - Singapore u.a. : World Scientific, 1999. - S. 407-409

  1. Palladium-Catalysed Coupling Reactions

    NARCIS (Netherlands)

    de Vries, Johannes G.; Beller, M; Blaser, HU

    2012-01-01

    Palladium-catalysed coupling reactions have gained importance as a tool for the production of pharmaceutical intermediates and to a lesser extent also for the production of agrochemicals, flavours and fragrances, and monomers for polymers. In this review only these cases are discussed where it seems

  2. Molecular Reaction Dynamics and Solvation.

    Science.gov (United States)

    Kim, Seong Keun

    A potential energy surface was constructed for the triatomic molecule Li_2H using a semiempirical method akin to the diatomics-in-molecules theory. Valence bond configurations were chosen to include the major ionic contributions in the ground state potential energy. Quasiclassical trajectories were run on this potential energy surface. The results of these calculations are shown to be generally in accord with the experimental investigations of analogous reactions of H atoms with bigger alkali dimer molecules. Certain aspects of chemical reaction dynamics which have been largely overlooked were examined. These involve correlations of vector properties in chemical reactions. Specifically, the strong correlation between orbital and rotational angular momenta in the product channel of this reaction was shown to be the reason for a seemingly contradictory set of distributions of different angles. Gas phase solvation of nucleic acid base molecules was studied using clusters produced by supersonic expansion. Relative stabilities of the species with different numbers of solvent molecules were studied by varying the expansion conditions. The ionization potentials were measured as a function of the number of solvent molecules. Rather distinct effects of hydration were observed for the ionization potentials of adenine and thymine.

  3. FOREIGN BODY REACTION TO BIOMATERIALS

    Science.gov (United States)

    Anderson, James M.; Rodriguez, Analiz; Chang, David T.

    2008-01-01

    The foreign body reaction composed of macrophages and foreign body giant cells is the end-stage response of the inflammatory and wound healing responses following implantation of a medical device, prosthesis, or biomaterial. A brief, focused overview of events leading to the foreign body reaction is presented. The major focus of this review is on factors that modulate the interaction of macrophages and foreign body giant cells on synthetic surfaces where the chemical, physical, and morphological characteristics of the synthetic surface are considered to play a role in modulating cellular events. These events in the foreign body reaction include protein adsorption, monocyte/macrophage adhesion, macrophage fusion to form foreign body giant cells, consequences of the foreign body response on biomaterials, and cross-talk between macrophages/foreign body giant cells and inflammatory/wound healing cells. Biomaterial surface properties play an important role in modulating the foreign body reaction in the first two to four weeks following implantation of a medical device, even though the foreign body reaction at the tissue/material interface is present for the in vivo lifetime of the medical device. An understanding of the foreign body reaction is important as the foreign body reaction may impact the biocompatibility (safety) of the medical device, prosthesis, or implanted biomaterial and may significantly impact short- and long-term tissue responses with tissue-engineered constructs containing proteins, cells, and other biological components for use in tissue engineering and regenerative medicine. Our perspective has been on the inflammatory and wound healing response to implanted materials, devices, and tissue-engineered constructs. The incorporation of biological components of allogeneic or xenogeneic origin as well as stem cells into tissue-engineered or regenerative approaches opens up a myriad of other challenges. An in depth understanding of how the immune system

  4. Numerical modelling of hydration reactions

    Science.gov (United States)

    Vrijmoed, Johannes C.; John, Timm

    2017-04-01

    Mineral reactions are generally accompanied by volume changes. Observations in rocks and thin section indicate that this often occurred by replacement reactions involving a fluid phase. Frequently, the volume of the original rock or mineral seems to be conserved. If the density of the solid reaction products is higher than the reactants, the associated solid volume decrease generates space for a fluid phase. In other words, porosity is created. The opposite is true for an increase in solid volume during reaction, which leads to a porosity reduction. This slows down and may even stop the reaction if it needs fluid as a reactant. Understanding the progress of reactions and their rates is important because reaction generally changes geophysical and rock mechanical properties which will therefore affect geodynamical processes and seismic properties. We studied the case of hydration of eclogite to blueschist in a subduction zone setting. Eclogitized pillow basalt structures from the Tian-Shan orogeny are transformed to blueschist on the rims of the pillow (van der Straaten et al., 2008). Fluid pathways existed between the pillow structures. The preferred hypothesis of blueschist formation is to supply the fluid for hydration from the pillow margins progressing inward. Using numerical modelling we simulate this coupled reaction-diffusion process. Porosity and fluid pressure evolution are coupled to local thermodynamic equilibrium and density changes. The first rim of blueschist that forms around the eclogite pillow increases volume to such a degree that the system is clogged and the reaction stops. Nevertheless, the field evidence suggests the blueschist formation continued. To prevent the system from clogging, a high incoming pore fluid pressure on the pillow boundaries is needed along with removal of mass from the system to accommodate the volume changes. The only other possibility is to form blueschist from any remaining fluid stored in the core of the pillow

  5. Experimental Demonstrations in Teaching Chemical Reactions.

    Science.gov (United States)

    Hugerat, Muhamad; Basheer, Sobhi

    2001-01-01

    Presents demonstrations of chemical reactions by employing different features of various compounds that can be altered after a chemical change occurs. Experimental activities include para- and dia-magnetism in chemical reactions, aluminum reaction with base, reaction of acid with carbonates, use of electrochemical cells for demonstrating chemical…

  6. KINETICS AND MECHANISM OF REACTION OF ACIDIC ...

    African Journals Online (AJOL)

    For both Nile blue and Meldola\\'s blue reactions the rates have first-order dependence on each substrate, chlorite and acid. Both reactions showed negative salt effect indicating the reaction is between the oppositely charged species, likely the substrate cation and chlorite anion. The acidic chlorite reaction with MB+ was ...

  7. Validated spectrophotometric methods for determination of sodium valproate based on charge transfer complexation reactions.

    Science.gov (United States)

    Belal, Tarek S; El-Kafrawy, Dina S; Mahrous, Mohamed S; Abdel-Khalek, Magdi M; Abo-Gharam, Amira H

    2016-02-15

    This work presents the development, validation and application of four simple and direct spectrophotometric methods for determination of sodium valproate (VP) through charge transfer complexation reactions. The first method is based on the reaction of the drug with p-chloranilic acid (p-CA) in acetone to give a purple colored product with maximum absorbance at 524nm. The second method depends on the reaction of VP with dichlone (DC) in dimethylformamide forming a reddish orange product measured at 490nm. The third method is based upon the interaction of VP and picric acid (PA) in chloroform resulting in the formation of a yellow complex measured at 415nm. The fourth method involves the formation of a yellow complex peaking at 361nm upon the reaction of the drug with iodine in chloroform. Experimental conditions affecting the color development were studied and optimized. Stoichiometry of the reactions was determined. The proposed spectrophotometric procedures were effectively validated with respect to linearity, ranges, precision, accuracy, specificity, robustness, detection and quantification limits. Calibration curves of the formed color products with p-CA, DC, PA and iodine showed good linear relationships over the concentration ranges 24-144, 40-200, 2-20 and 1-8μg/mL respectively. The proposed methods were successfully applied to the assay of sodium valproate in tablets and oral solution dosage forms with good accuracy and precision. Assay results were statistically compared to a reference pharmacopoeial HPLC method where no significant differences were observed between the proposed methods and reference method. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Kinetics investigation of the hydrogen abstraction reaction between CH3SS and CN radicals.

    Science.gov (United States)

    Yan, Liu; Wenliang, Wang; Zhongwen, Liu; Hongjiang, Ren

    2016-01-01

    The reaction mechanisms and rates for the H abstraction reactions between CH3SS and CN radicals in the gas phase were investigated with density functional theory (DFT) methods. The geometries, harmonic vibrational frequencies, and energies of all stationary points were obtained at B3PW91/6-311G(d,p) level of theory. Relationships between the reactants, intermediates, transition states and products were confirmed, with the frequency and the intrinsic reaction coordinate (IRC) analysis at the same theoretical level. High accurate energy information was provided by the G3(MP2) method combined with the standard statistical thermodynamics. Gibbs free energies at 298.15 K for all of the reaction steps were reported, and were used to describe the profile diagrams of the potential energy surface. The rate constants were evaluated with both the classical transition state theory and the canonical variational transition state theory, in which the small-curvature tunneling correction was included. A total number of 9 intermediates (IMs) and 17 transition states (TSs) were obtained. It is shown that IM1 is the most stable intermediate by the largest energy release, and the channel of CH3SS + CN → IM3 → TS10  → P1(CH2SS + HCN) is the dominant reaction with the lowest energy barrier of 144.7 kJ mol(-1). The fitted Arrhenius expressions of the calculated CVT/SCT rate constants for the rate-determining step of the favorable channel is k =7.73 × 10(6)  T (1.40)exp(-14,423.8/T) s(-1) in the temperature range of 200-2000 K. The apparent activation energy E a(app.) for the main channel is -102.5 kJ mol(-1), which is comparable with the G3(MP2) energy barrier of -91.8 kJ mol(-1) of TS10 (relative to the reactants).

  9. Thermodynamics of Enzyme-Catalyzed Reactions Database

    Science.gov (United States)

    SRD 74 Thermodynamics of Enzyme-Catalyzed Reactions Database (Web, free access)   The Thermodynamics of Enzyme-Catalyzed Reactions Database contains thermodynamic data on enzyme-catalyzed reactions that have been recently published in the Journal of Physical and Chemical Reference Data (JPCRD). For each reaction the following information is provided: the reference for the data, the reaction studied, the name of the enzyme used and its Enzyme Commission number, the method of measurement, the data and an evaluation thereof.

  10. Electrochemical promotion of catalytic reactions

    Science.gov (United States)

    Imbihl, R.

    2010-05-01

    The electrochemical promotion of heterogeneously catalyzed reactions (EPOC) became feasible through the use of porous metal electrodes interfaced to a solid electrolyte. With the O 2- conducting yttrium stabilized zirconia (YSZ), the Na + conducting β″-Al 2O 3 (β-alumina), and several other types of solid electrolytes the EPOC effect has been demonstrated for about 100 reaction systems in studies conducted mainly in the mbar range. Surface science investigations showed that the physical basis for the EPOC effect lies in the electrochemically induced spillover of oxygen and alkali metal, respectively, onto the surface of the metal electrodes. For the catalytic promotion effect general concepts and mechanistic schemes were proposed but these concepts and schemes are largely speculative. Applying surface analytical tools to EPOC systems the proposed mechanistic schemes can be verified or invalidated. This report summarizes the progress which has been achieved in the mechanistic understanding of the EPOC effect.

  11. Theoretical aspects of surface reactions

    Science.gov (United States)

    Nørskov, J. K.; Stoltze, P.

    1987-10-01

    A short review is given of our present understanding of the trends in the chemisorption energies and activation energies for dissociation of simple gas molecules on the transition metals. The effect of adsorbed alkali atoms on the activation energy for dissociation is also discussed. This is then used to explain the trends in activity along the transition metal rows and the promoting effect of K for the ammonia synthesis reaction. The basis for the description is the development of a kinetic model for the ammonia synthesis which can describe quantitatively the macroscopic kinetics of a commercial catalyst under industrial conditions. The model relates the reaction rate directly to the properties of the chemisorbed reactants, intermediates and product as measured for model single crystal systems under ultrahigh vacuum conditions.

  12. Investigating Reaction-Driven Cracking

    Science.gov (United States)

    Kelemen, P. B.; Hirth, G.; Savage, H. M.

    2013-12-01

    Many metamorphic reactions lead to large volume changes, and potentially to reaction-driven cracking [1,2]. Large-scale hydration of mantle peridotite to produce serpentine or talc is invoked to explain the rheology of plate boundaries, the nature of earthquakes, and the seismic properties of slow-spread ocean crust and the 'mantle wedge' above subduction zones. Carbonation of peridotite may be an important sink in the global carbon cycle. Zones of 100% magnesite + quartz replacing peridotite, up to 200 m thick, formed where oceanic mantle was thrust over carbonate-bearing metasediments in Oman. Talc + carbonate is an important component of the matrix in subduction mélanges at Santa Catalina Island , California, and the Sanbagawa metamorphic belt, Japan. Engineered systems to emulate natural mineral carbonation could provide relatively inexpensive CO2 capture and storage [3]. More generally, engineered reaction-driven cracking could supplement or replace hydraulic fracture in geothermal systems, solution mining, and extraction of tight oil and gas. The controls on reaction-driven cracking are poorly understood. Hydration and carbonation reactions can be self-limiting, since they potentially reduce permeability and armor reactive surfaces [4]. Also, in some cases, hydration or carbonation may take place at constant volume. Small changes in volume due to precipitation of solid products increases stress, destabilizing solid reactants, until precipitation and dissolution rates become equal at a steady state stress [5]. In a third case, volume change due to precipitation of solid products causes brittle failure. This has been invoked on qualitative grounds to explain, e.g., complete serpentinization of mantle peridotite [6]. Below ~ 300°C, the available potential energy for hydration and carbonation of olivine could produce stresses of 100's of MPa [2], sufficient to fracture rocks to 10 km depth or more, causing brittle failure below the steady state stress required

  13. Partner reaction following ostomy surgery.

    Science.gov (United States)

    Gloeckner, M R

    1983-01-01

    This study was conducted to obtain information regarding sexual adjustment following ostomy surgery and to explore the spouse/partner's reaction upon resuming sexual activities following surgery. Home interviews were conducted with 40 subjects who had a permanent stoma, where the mean length of time since surgery averaged 4.6 years. Retrospective perceptions of the spouse/partner's reactions were varied. A majority reported that their spouses reacted positively to the first sexual experience following ostomy surgery. However a substantial number of subjects stated that their sexual partner reacted with caution ("fear of hurting me") or in a negative manner. This and previous studies indicate that the sexual partner plays a key role in helping the person adjust following ostomy surgery.

  14. Stickland reactions of dental plaque.

    Science.gov (United States)

    Curtis, M A; Kemp, C W; Robrish, S A; Bowen, W H

    1983-01-01

    Dental plaque samples from monkeys (Macaca fascicularis) were shown to contain proline reduction activity in coupled Stickland reactions with other amino acids and also with certain end products of bacterial glucose metabolism. The unusually high concentration of bound and free proline in the oral environment may be of importance in both the production of base and in the removal of acid from the tooth surface after dietary carbohydrate ingestion. PMID:6618673

  15. Siphons in chemical reaction networks.

    Science.gov (United States)

    Shiu, Anne; Sturmfels, Bernd

    2010-08-01

    Siphons in a chemical reaction system are subsets of the species that have the potential of being absent in a steady state. We present a characterization of minimal siphons in terms of primary decomposition of binomial ideals, we explore the underlying geometry, and we demonstrate the effective computation of siphons using computer algebra software. This leads to a new method for determining whether given initial concentrations allow for various boundary steady states.

  16. Modeling the enzyme kinetic reaction.

    Science.gov (United States)

    Atangana, Abdon

    2015-09-01

    The Enzymatic control reactions model was presented within the scope of fractional calculus. In order to accommodate the usual initial conditions, the fractional derivative used is in Caputo sense. The methodologies of the three analytical methods were used to derive approximate solution of the fractional nonlinear system of differential equations. Two methods use integral operator and the other one uses just an integral. Numerical results obtained exhibit biological behavior of real world problem.

  17. Multicomponent reactions in nucleoside chemistry

    Science.gov (United States)

    Buchowicz, Włodzimierz

    2014-01-01

    Summary This review covers sixty original publications dealing with the application of multicomponent reactions (MCRs) in the synthesis of novel nucleoside analogs. The reported approaches were employed for modifications of the parent nucleoside core or for de novo construction of a nucleoside scaffold from non-nucleoside substrates. The cited references are grouped according to the usually recognized types of the MCRs. Biochemical properties of the novel nucleoside analogs are also presented (if provided by the authors). PMID:25161730

  18. Tuberculin reaction and BCG scar

    DEFF Research Database (Denmark)

    Timmermann, Clara Amalie Gade; Biering-Sørensen, Sofie; Aaby, Peter

    2015-01-01

    rate ratio (MRR) comparing children with a BCG scar with those without was 0.42 (95% CI = 0.19; 0.93). There was a similar tendency for TST positivity: MRR = 0.47 (95% CI = 0.14; 1.54). For LBW children who had both a positive TST reaction and a scar, the MRR was 0.22 (95% CI = 0.05; 0.87). For NBW...

  19. Reaction Selectivity in Heterogeneous Catalysis

    Energy Technology Data Exchange (ETDEWEB)

    Somorjai, Gabor A.; Kliewer, Christopher J.

    2009-02-02

    The understanding of selectivity in heterogeneous catalysis is of paramount importance to our society today. In this review we outline the current state of the art in research on selectivity in heterogeneous catalysis. Current in-situ surface science techniques have revealed several important features of catalytic selectivity. Sum frequency generation vibrational spectroscopy has shown us the importance of understanding the reaction intermediates and mechanism of a heterogeneous reaction, and can readily yield information as to the effect of temperature, pressure, catalyst geometry, surface promoters, and catalyst composition on the reaction mechanism. DFT calculations are quickly approaching the ability to assist in the interpretation of observed surface spectra, thereby making surface spectroscopy an even more powerful tool. HP-STM has revealed three vitally important parameters in heterogeneous selectivity: adsorbate mobility, catalyst mobility, and selective site-blocking. The development of size controlled nanoparticles from 0.8 to 10 nm, of controlled shape, and of controlled bimetallic composition has revealed several important variables for catalytic selectivity. Lastly, DFT calculations may be paving the way to guiding the composition choice for multi-metallic heterogeneous catalysis for the intelligent design of catalysts incorporating the many factors of selectivity we have learned.

  20. Chlorination of Amino Acids: Reaction Pathways and Reaction Rates.

    Science.gov (United States)

    How, Zuo Tong; Linge, Kathryn L; Busetti, Francesco; Joll, Cynthia A

    2017-05-02

    Chlorination of amino acids can result in the formation of organic monochloramines or organic dichloramines, depending on the chlorine to amino acid ratio (Cl:AA). After formation, organic chloramines degrade into aldehydes, nitriles and N-chloraldimines. In this paper, the formation of organic chloramines from chlorination of lysine, tyrosine and valine were investigated. Chlorination of tyrosine and lysine demonstrated that the presence of a reactive secondary group can increase the Cl:AA ratio required for the formation of N,N-dichloramines, and potentially alter the reaction pathways between chlorine and amino acids, resulting in the formation of unexpected byproducts. In a detailed investigation, we report rate constants for all reactions in the chlorination of valine, for the first time, using experimental results and modeling. At Cl:AA = 2.8, the chlorine was found to first react quickly with valine (5.4 × 10 4 M -1 s -1 ) to form N-monochlorovaline, with a slower subsequent reaction with N-monochlorovaline to form N,N-dichlorovaline (4.9 × 10 2 M -1 s -1 ), although some N-monochlorovaline degraded into isobutyraldehyde (1.0 × 10 -4 s -1 ). The N,N-dichlorovaline then competitively degraded into isobutyronitrile (1.3 × 10 -4 s -1 ) and N-chloroisobutyraldimine (1.2 × 10 -4 s -1 ). In conventional drinking water disinfection, N-chloroisobutyraldimine can potentially be formed in concentrations higher than its odor threshold concentration, resulting in aesthetic challenges and an unknown health risk.