GLASS COMPOSITION-TCLP RESPONSE MODEL FOR WASTE GLASSES

International Nuclear Information System (INIS)

Kim, Dong-Sang; Vienna, John D.

2004-01-01

A first-order property model for normalized Toxicity Characteristic Leaching Procedure (TCLP) release as a function of glass composition was developed using data collected from various studies. The normalized boron release is used to estimate the release of toxic elements based on the observation that the boron release represents the conservative release for those constituents of interest. The current TCLP model has two targeted application areas: (1) delisting of waste-glass product as radioactive (not mixed) waste and (2) designating the glass wastes generated from waste-glass research activities as hazardous or non-hazardous. This paper describes the data collection and model development for TCLP releases and discusses the issues related to the application of the model

Slag-based saltstone formulations

International Nuclear Information System (INIS)

Langton, C.A.

1987-01-01

Approximately 400 x 10 6 liters of low-level alkaline salt solution will be treated at the Savannah River Plant (SRP) Defense Waste Processing Facility (DWPF) prior to disposal in concrete vaults at SRP. Treatment involves removal of CS + and Sr +2 followed by solidification and stabilization of potential contaminants in saltstone, a hydrated ceramic waste form. Chromium, technetium, and nitrate releases from saltstone can be significantly reduced by substituting hydraulic blast furnace slag for portland cement in the formulation designs. Slag-based mixes are also compatible with Class F fly ash used in saltstone as a functional extender to control heat of hydration and reduce permeability. A monolithic waste form is produced by the hydration of the slag and fly ash. Soluble ion release (NO 3 - ) is controlled by the saltstone microstructure. Chromium and technetium are less leachable from slag mixes compared to cement-based waste forms because these species are chemically reduced to a lower valence state by ferrous iron in the slag and precipitated as relatively insoluble phases, such as CR(OH) 3 and TcO 2 . 5 refs., 4 figs., 4 tabs

Slag-based saltstone formulations

International Nuclear Information System (INIS)

Langton, C.A.

1987-08-01

Approximately 400 x 10 6 L of low-level alkaline salt solution will be treated at the Savannah River Plant (SRP) Defense Waste Processing Facility (DWPF) prior to disposal in concrete vaults at SRP. Treatment involves removal of Cs + and Sr +2 , followed by solidification and stabilization of potential contaminants in saltstone, a hydrated ceramic wasteform. Chromium, technetium, and nitrate releases from saltstone can be significantly reduced by substituting hydraulic blast furnace slag for portland cement in the formulation designs. Slag-based mixes are also compatible with the Class F flyash used in saltstone as a functional extender to control heat of hydration and reduce permeability. (Class F flyash is also locally available at SRP.) A monolithic wasteform is produced by the hydration of the slag and flyash. Soluble ion release (NO 3- ) is controlled by the saltstone microstructure. Chromium and technetium are less leachable from slag mixes because these species are chemically reduced to a lower valence state by ferrous iron in the slag and are precipitated as relatively insoluble phases, such as Cr(OH) 3 and TcO 2 . 3 refs., 3 figs., 2 tabs

Leaching of saltstone: Laboratory and field testing and mathematical modeling

International Nuclear Information System (INIS)

Grant, M.W.; Langton, C.A.; Oblath, S.B.; Pepper, D.W.; Wallace, R.M.; Wilhite, E.L.; Yau, W.W.F.

1987-01-01

A low-level alkaline salt solution will be a byproduct in the processing of high-level waste at the Savannah River Plant (SRP). This solution will be incorporated into a wasteform, saltstone, and disposed of in surface vaults. Laboratory and field leach testing and mathematical modeling have demonstrated the predictability of contaminant release from cement wasteforms. Saltstone disposal in surface vaults will meet the design objective, which is to meet drinking water standards in shallow groundwater at the disposal area boundary. Diffusion is the predominant mechanism for release of contaminants to the environment. Leach testing in unsaturated soil, at soil moisture levels above 1 wt %, has shown no difference in leach rate compared to leaching in distilled water. Field leach testing of three thirty-ton blocks of saltstone in lysimeters has been underway since January 1984. Mathematical models were applied to assess design features for saltstone disposal. One dimensional infinite-composite and semi-infinite analytical models were developed for assessing diffusion of nitrate from saltstone through a cement barrier. Numerical models, both finite element and finite difference, were validated by comparison of model predictions with the saltstone lysimeter results. Validated models were used to assess the long-term performance of the saltstone stored in surface vaults. The maximum concentrations of all contaminants released from saltstone to shallow groundwater are predicted to be below drinking water standards at the disposal area boundary. 5 refs., 11 figs., 5 tabs

EVALUATION OF SULFATE ATTACK ON SALTSTONE VAULT CONCRETE AND SALTSTONESIMCO TECHNOLOGIES, INC. PART1 FINAL REPORT

International Nuclear Information System (INIS)

Langton, C.

2008-01-01

This report summarizes the preliminary results of a durability analysis performed by SIMCO Technologies Inc. to assess the effects of contacting saltstone Vaults 1/4 and Disposal Unit 2 concretes with highly alkaline solutions containing high concentrations of dissolved sulfate. The STADIUM(reg s ign) code and data from two surrogate concretes which are similar to the Vaults 1/4 and Disposal Unit 2 concretes were used in the preliminary durability analysis. Simulation results for these surrogate concrete mixes are provided in this report. The STADIUM(reg s ign) code will be re-run using transport properties measured for the SRS Vaults 1/4 and Disposal Unit 2 concrete samples after SIMCO personnel complete characterization testing on samples of these materials. Simulation results which utilize properties measured for samples of Vaults 1/4 and Disposal Unit 2 concretes will be provided in Revision 1 of this report after property data become available. The modeling performed to date provided the following information on two concrete mixes that will be used to support the Saltstone PA: (1) Relationship between the rate of advancement of the sulfate front (depth of sulfate ion penetration into the concrete) and the rate of change of the concrete permeability and diffusivity. (2) Relationship between the sulfate ion concentration in the corrosive leachate and the rate of the sulfate front progression. (3) Equation describing the change in hydraulic properties (hydraulic conductivity and diffusivity) as a function of sulfate ion concentration in the corrosive leachate. These results have been incorporated into the current Saltstone PA analysis by G. Flach (Flach, 2008). In addition, samples of the Saltstone Vaults 1/4 and Disposal Unit 2 concretes have been prepared by SIMCO Technologies, Inc. Transport and physical properties for these materials are currently being measured and sulfate exposure testing to three high alkaline, high sulfate leachates provided by SRNL is

MEASUREMENT OF WASTE LOADING IN SALTSTONE

International Nuclear Information System (INIS)

Harbour, J; Vickie Williams, V

2008-01-01

One of the goals of the Saltstone variability study is to identify the operational and compositional variables that control or influence the important processing and performance properties of Saltstone grout mixtures. One of those properties of importance is the Waste Loading (WL) of the decontaminated salt solution (DSS) in the Saltstone waste form. Waste loading is a measure of the amount of waste that can be incorporated within a waste form. The value of the Saltstone waste loading ultimately determines the number of vaults that will be required to disposition all of the DSS. In this report, the waste loading is defined as the volume in milliliters of DSS per liter of Saltstone waste form. The two most important parameters that determine waste loading for Saltstone are water to cementitious material (w/cm) ratio and the cured grout density. Data are provided that show the dependence of waste loading on the w/cm ratio for a fixed DSS composition using the current premix material (45% Blast Furnace Slag (BFS), 45% Fly Ash (FA) and 10% Ordinary Portland Cement (OPC)). The impact of cured grout density on waste loading was also demonstrated. Mixes (at 0.60 w/cm) made with a Modular Caustic side extraction Unit (MCU) simulant and either OPC or BFS have higher cured grout densities than mixes made with premix and increase the WL to 709 mL/L for the OPC mix and 689 mL/L for the BFS mix versus the value of 653 mL/L for MCU in premix at 0.60 w/cm ratio. Bleed liquid reduces the waste loading and lowers the effective w/cm ratio of Saltstone. A method is presented (and will be used in future tasks) for correcting the waste loading and the w/cm ratio of the as-batched mixes in those cases where bleed liquid is present. For example, the Deliquification, Dissolution and Adjustment (DDA) mix at an as-batched 0.60 w/cm ratio, when corrected for % bleed, gives a mix with a 0.55 w/cm ratio and a WL that has been reduced from 662 to 625 mL/L. An example is provided that

Lysimeter study of vegetative uptake from saltstone

Energy Technology Data Exchange (ETDEWEB)

Murphy, C.E. Jr.

1990-06-08

At the Savannah River Site, liquid, low-level nuclear waste will be disposed of by incorporating the waste in concrete, a wasteform called saltstone. Saltstone monoliths will then be buried in the earth. To study the potential uptake of radionuclides by trees and other plants growing in the soil in the area containing buried saltstone, a lysimeter study has been in progress since 1984. Thirty two lysimeters were designed, constructed, and filled with soil. Saltstone samples, containing the liquid, low-level supernate from the tank 50 in-tank precipitation demonstration, were buried in some of the lysimeters. Other lysimeters, not containing saltstone, were used as controls. Crops, grass, and trees were planted in the lysimeters and sampled periodically to determine radionuclide concentrations. Water samples were also collected from the lysimeter sumps and analyzed for radionuclide content. This report documents the results of vegetative and lysimeter sump water measurements from the beginning of the project in November of 1984 through September of 1989. 6 refs., 22 figs., 6 tabs.

Process Formulations And Curing Conditions That Affect Saltstone Properties

Energy Technology Data Exchange (ETDEWEB)

Reigel, M. M.; Pickenheim, B. R.; Daniel, W. E.

2012-09-28

The first objective of this study was to analyze saltstone fresh properties to determine the feasibility of reducing the formulation water to premix (w/p) ratio while varying the amount of extra water and admixtures used during processing at the Saltstone Production Facility (SPF). The second part of this study was to provide information for understanding the impact of curing conditions (cure temperature, relative humidity (RH)) and processing formulation on the performance properties of cured saltstone.

Concept development for saltstone and low level waste disposal

International Nuclear Information System (INIS)

Wilhite, E.L.

1987-03-01

A low-level alkaline salt solution will be a byproduct in the processing of high-level waste at the Savannah River Plant (SRP). This solution will be incorporated into a cement wasteform, saltstone, and placed in surface vaults. Laboratory and field testing and mathematical modeling have demonstrated the predictability of contaminant release from cement wasteforms. Saltstone disposal in surface vaults will meet drinking water standards in shallow groundwater at the disposal area boundary. Planning for new Low-Level Waste (LLW) disposal could incorporate concepts developed for saltstone disposal

Key Factors That Influence The Performance Properties Of ARP/MCU Saltstone Mixes

International Nuclear Information System (INIS)

Harbour, J.; Edwards, T.; Williams, V.

2009-01-01

At the Saltstone Production Facility (SPF), decontaminated salt solution (DSS) is combined with premix (a cementitious mixture of portland cement (PC), blast furnace slag (BFS) and Class F fly ash (FA)) in a Readco mixer to produce fresh (uncured) Saltstone. After transfer to the Saltstone Disposal Facility (SDF) the hydration reactions initiated during the contact of the premix and salt solution continue during the curing period to produce the hardened waste form product. The amount of heat generated from hydration and the resultant temperature increase in the vaults depend on the composition of the decontaminated salt solution being dispositioned as well as the grout formulation (mix design). This report details the results from Task 3 of the Saltstone Variability Study for FY09 which was performed to identify, and quantify when possible, those factors that drive the performance properties of the projected ARP/MCU Batches. A baseline ARP/MCU mix (at 0.60 water to cementitious materials (w/cm) ratio) was established and consisted of the normal premix composition and a salt solution that was an average of the projected compositions of the last three ARP/MCU batches developed by T. A. Le. This task introduced significant variation in (1) wt % slag, w/cm ratio, and wt % portland cement about the baseline mix and (2) the temperature of curing in order to better assess the dependence of the performance properties on these factors. Two separate campaigns, designated Phase 10 and Phase 11, were carried out under Task 3. Experimental designs and statistical analyses were used to search for correlation among properties and to develop linear models to predict property values based on factors such as w/cm ratio, slag concentration, and portland cement concentration. It turns out that the projected salt compositions contained relatively high amounts of aluminate (0.22 M) even though no aluminate was introduced due to caustic aluminate removal from High Level Waste. Previous

Saltstone studies using the scaled continuous processing facility

Energy Technology Data Exchange (ETDEWEB)

Fowley, M. D. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Cozzi, A. D. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Hansen, E. K. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2015-08-01

The Savannah River National Laboratory (SRNL) has supported the Saltstone Facility since its conception with bench-scale laboratory experiments, mid-scale testing at vendor facilities, and consultations and testing at the Saltstone Facility. There have been minimal opportunities for the measurement of rheological properties of the grout slurry at the Saltstone Production Facility (SPF); thus, the Scaled Continuous Processing Facility (SCPF), constructed to provide processing data related to mixing, transfer, and other operations conducted in the SPF, is the most representative process data for determining the expected rheological properties in the SPF. These results can be used to verify the laboratory scale experiments that support the SPF using conventional mixing processes that appropriately represent the shear imparted to the slurry in the SPF.

Leaching of saltstones containing fly ash

International Nuclear Information System (INIS)

Barnes, M.W.; Roy, D.M.; Langton, C.A.

1985-01-01

Two types of fly ash were incorporated in saltstones designed for potential encapsulation of Savannah River Plant low level defense waste. These fly ashes have some cementitious properties while at the same time their presence in substitution for cement slows early hydration. Class C fly ash has a high calcium content and is considered cementitious; Class F fly ash has a low calcium content and is not classified as cementitious. Leach tests were performed and physical properties were measured for saltstones containing each class, to see the differences in the effect of the fly ashes. The four waste ions nitrate, nitrite, sodium and sulfate were shown to leach by diffusion. Effective diffusivities were determined for these ions. Data for nitrate, the most important species from the environmental point of view, are shown in Table A. Saltstones made with Class C fly ash have substantially lower leach rates than those made with Class F fly ash. The leach rates, and therefore the square roots of the effective diffusivities, have been found to be proportional to the pore surface area per unit volume (or the ratio of pore volume to pore radius), to the fraction of waste containing solution, and to the inverse of the fraction of calcium in the saltstone. Rates and diffusivities are not proportional to the water to cement ratio, because this number depends on whether the fly ash is counted as cementitious, as in Class C cement, or not cementitious, as in Class F cement. In fact the relatively small amount of calcium in Class F cement contributes to the cementitious properties overall, though not so much as Class C cement. 4 refs., 2 figs., 6 tabs

Large-scale demonstration of waste solidification in saltstone

International Nuclear Information System (INIS)

McIntyre, P.F.; Oblath, S.B.; Wilhite, E.L.

1988-05-01

The saltstone lysimeters are a large scale demonstration of a disposal concept for decontaminated salt solution resulting from in-tank processing of defense waste. The lysimeter experiment has provided data on the leaching behavior of large saltstone monoliths under realistic field conditions. The results also will be used to compare the effect of capping the wasteform on contaminant release. Biweekly monitoring of sump leachate from three lysimeters has continued on a routine basis for approximately 3 years. An uncapped lysimeter has shown the highest levels of nitrate and 99 Tc release. Gravel and clay capped lysimeters have shown levels equivalent to or slightly higher than background rainwater levels. Mathematical model predictions have been compared to lysimeter results. The models will be applied to predict the impact of saltstone disposal on groundwater quality. 9 refs., 5 figs., 3 tabs

Technical Insights for Saltstone PA Maintenance

International Nuclear Information System (INIS)

Flach, G.; Sarkar, S.; Mahadevan, S.; Kosson, D.

2011-01-01

The Cementitious Barriers Partnership (CBP) is a collaborative program sponsored by the US DOE Office of Waste Processing. The objective of the CBP is to develop a set of computational tools to improve understanding and prediction of the long-term structural, hydraulic, and chemical performance of cementitious barriers and waste forms used in nuclear applications. CBP tools are expected to better characterize and reduce the uncertainties of current methodologies for assessing cementitious barrier performance and increase the consistency and transparency of the assessment process, as the five-year program progresses. In September 2009, entering its second year of funded effort, the CBP sought opportunities to provide near-term tangible support to DOE Performance Assessments (PAs). The Savannah River Saltstone Disposal Facility (SDF) was selected for the initial PA support effort because (1) cementitious waste forms and barriers play a prominent role in the performance of the facility, (2) certain important long-term behaviors of cementitious materials composing the facility are uncertain, (3) review of the SDF PA by external stakeholders is ongoing, and (4) the DOE contractor responsible for the SDF PA is open to receiving technical assistance from the CBP. A review of the current (SRR Closure and Waste Disposal Authority 2009) and prior Saltstone PAs (e.g., Cook et al. 2005) suggested five potential opportunities for improving predictions. The candidate topics considered were (1) concrete degradation from external sulfate attack, (2) impact of atmospheric exposure to concrete and grout before closure, such as accelerated slag and Tc-99 oxidation, (3) mechanistic prediction of geochemical conditions, (4) concrete degradation from rebar corrosion due to carbonation, and (5) early age cracking from drying and/or thermal shrinkage. The candidate topics were down-selected considering the feasibility of addressing each issue within approximately six months, and

Technical Insights for Saltstone PA Maintenance

Energy Technology Data Exchange (ETDEWEB)

Flach, G.; Sarkar, S.; Mahadevan, S.; Kosson, D.

2011-07-20

The Cementitious Barriers Partnership (CBP) is a collaborative program sponsored by the US DOE Office of Waste Processing. The objective of the CBP is to develop a set of computational tools to improve understanding and prediction of the long-term structural, hydraulic, and chemical performance of cementitious barriers and waste forms used in nuclear applications. CBP tools are expected to better characterize and reduce the uncertainties of current methodologies for assessing cementitious barrier performance and increase the consistency and transparency of the assessment process, as the five-year program progresses. In September 2009, entering its second year of funded effort, the CBP sought opportunities to provide near-term tangible support to DOE Performance Assessments (PAs). The Savannah River Saltstone Disposal Facility (SDF) was selected for the initial PA support effort because (1) cementitious waste forms and barriers play a prominent role in the performance of the facility, (2) certain important long-term behaviors of cementitious materials composing the facility are uncertain, (3) review of the SDF PA by external stakeholders is ongoing, and (4) the DOE contractor responsible for the SDF PA is open to receiving technical assistance from the CBP. A review of the current (SRR Closure & Waste Disposal Authority 2009) and prior Saltstone PAs (e.g., Cook et al. 2005) suggested five potential opportunities for improving predictions. The candidate topics considered were (1) concrete degradation from external sulfate attack, (2) impact of atmospheric exposure to concrete and grout before closure, such as accelerated slag and Tc-99 oxidation, (3) mechanistic prediction of geochemical conditions, (4) concrete degradation from rebar corrosion due to carbonation, and (5) early age cracking from drying and/or thermal shrinkage. The candidate topics were down-selected considering the feasibility of addressing each issue within approximately six months, and

Benzene Evolution Rates from Saltstone Prepared with 2X ITP Flowsheet Concentrations of Phenylborates and Heated to 85 Degrees C

International Nuclear Information System (INIS)

Poirier, M.R.

2000-01-01

The Saltstone Facility provides the final treatment and disposal of low level liquid wastes streams. At the Saltstone Facility, the waste is mixed with cement, flyash, and slag to form a grout, which is pumped into large concrete vaults where it cures. The facility started radioactive operations in June 1990. High Level Waste Engineering requested Savannah River Technology Center to determine the effect of TPB and its decomposition products (i.e., 3PB, 2PB, and 1PB) on the saltstone process. Previous testing performed by SRTC determined saltstone benzene evolution rates a function of ITP filtrate composition. Testing by the Thermal Fluids Laboratory has shown at design operation, the temperature in the Z-area vaults could reach 85 degrees Celsius. Saltstone asked SRTC to perform additional testing to determine whether curing at 85 degrees Celsius could change saltstone benzene evolution rates. This document describes the test performed to determine the effect of curing temperature on the benzene evolution rates

Investigations of metal leaching from mobile phone parts using TCLP and WET methods.

Science.gov (United States)

Yadav, Satyamanyu; Yadav, Sudesh

2014-11-01

Metal leaching from landfills containing end-of-life or otherwise discarded mobile phones poses a threat to the environment as well as public health. In the present study, the metal toxicity of printed wire boards (PWBs), plastics, liquid crystal displays (LCDs) and batteries of mobile phones was assessed using the Toxicity Characteristics Leaching Procedures (TCLP) and the Waste Extraction Test (WET). The PWBs failed TCLP for Pb and Se, and WET for Pb and Zn. In WET, the two PWB samples for Pb and Zn and the battery samples for Co and Cu failed the test. Furthermore, the PWBS for Ni and the battery samples for Ni and Co failed the WET in their TCLP leachates. Both, Ni and Co are the regulatory metals in only WET and not covered under TCLP. These observations indicate that the TCLP seems to be a more aggressive test than the WET for the metal leaching from the mobile phone parts. The compositional variations, nature of leaching solution (acetate in TCLP and citrate in WET) and the redox conditions in the leaching solution of the PWBs resulted in different order of metals with respect to their amounts of leaching from PWBs in TCLP (Fe > Pb > Zn > Ni > Co > Cu) and WET (Zn > Fe > Ni > Pb > Cu). The metal leaching also varied with the make, manufacturing year and part of the mobile phone tested. PWBs, plastics and batteries should be treated as hazardous waste. Metal leaching, particularly of Se and Pb, from mobile phones can be harmful to the environment and human health. Therefore, a scientifically sound and environmentally safe handling and disposal management system needs to be evolved for the mobile phone disposal. Copyright © 2014 Elsevier Ltd. All rights reserved.

Development and Implementation of a Scaled Saltstone Facility at Savannah River National Laboratory - 13346

International Nuclear Information System (INIS)

Reigel, Marissa M.; Fowley, Mark D.; Hansen, Erich K.; Hera, Kevin R.; Marzolf, Athneal D.; Cozzi, Alex D.

2013-01-01

The Savannah River National Laboratory (SRNL) has supported the Saltstone Production Facility (SPF) since its conception. However, bench scaled tests have not always provided process or performance data related to the mixing, transfer, and other operations utilized in the SPF. A need was identified to better understand the SPF processes and to have the capabilities at SRNL to simulate the SPF unit operations to support an active low-level radioactive waste (LLW) processing facility. At the SPF, the dry premix is weighed, mixed and transferred to the Readco '10-inch' continuous mixer where it is mixed with the LLW salt solution from the Salt Feed Tank (SFT) to produce fresh Saltstone slurry. The slurry is discharged from the mixer into a hopper. The hopper feeds the grout pump that transfers the slurry through at least 457.2 meters of piping and discharges it into the Saltstone Disposal Units (SDU) for permanent disposal. In conjunction with testing individual SPF processes over several years, SRNL has designed and fabricated a scaled Saltstone Facility. Scaling of the system is primarily based on the volume capacity of the mixer and maintaining the same shear rate and total shear at the wall of the transfer line. At present, SRNL is utilizing the modular capabilities of the scaled Saltstone Facility to investigate the erosion issues related to the augers and paddles inside the SPF mixer. Full implementation of the scaled Saltstone Facility is still ongoing, but it is proving to be a valuable resource for testing alternate Saltstone formulations, cleaning sequences, the effect of pumping Saltstone to farther SDU's, optimization of the SPF mixer, and other operational variables before they are implemented in the SPF. (authors)

Leaching Behavior of Heavy Metals from Cement Pastes Using a Modified Toxicity Characteristic Leaching Procedure (TCLP).

Science.gov (United States)

Huang, Minrui; Feng, Huajun; Shen, Dongsheng; Li, Na; Chen, Yingqiang; Shentu, Jiali

2016-03-01

As the standard toxicity characteristic leaching procedure (TCLP) can not exhaust the acid neutralizing capacity of the cement rotary kiln co-processing solid wastes products which is particularly important for the assessment of the leaching concentrations of heavy metals. A modified TCLP was proposed. The extent of leaching of heavy metals is low using the TCLP and the leaching performance of the different metals can not be differentiated. Using the modified TCLP, however, Zn leaching was negligible during the first 180 h and then sharply increased (2.86 ± 0.18 to 3.54 ± 0.26 mg/L) as the acidity increased (pH leaching is enhanced using the modified TCLP. While Pb leached readily during the first 126 h and then leachate concentrations decreased to below the analytical detection limit. To conclude, this modified TCLP is a more suitable method for these cement rotary kiln co-processing products.

Degradation Of Cementitious Materials Associated With Saltstone Disposal Units

International Nuclear Information System (INIS)

Flach, G. P; Smith, F. G. III

2013-01-01

The Saltstone facilities at the DOE Savannah River Site (SRS) stabilize and dispose of low-level radioactive salt solution originating from liquid waste storage tanks at the site. The Saltstone Production Facility (SPF) receives treated salt solution and mixes the aqueous waste with dry cement, blast furnace slag, and fly ash to form a grout slurry which is mechanically pumped into concrete disposal cells that compose the Saltstone Disposal Facility (SDF). The solidified grout is termed ''saltstone''. Cementitious materials play a prominent role in the design and long-term performance of the SDF. The saltstone grout exhibits low permeability and diffusivity, and thus represents a physical barrier to waste release. The waste form is also reducing, which creates a chemical barrier to waste release for certain key radionuclides, notably Tc-99. Similarly, the concrete shell of an SDF disposal unit (SDU) represents an additional physical and chemical barrier to radionuclide release to the environment. Together the waste form and the SDU compose a robust containment structure at the time of facility closure. However, the physical and chemical state of cementitious materials will evolve over time through a variety of phenomena, leading to degraded barrier performance over Performance Assessment (PA) timescales of thousands to tens of thousands of years. Previous studies of cementitious material degradation in the context of low-level waste disposal have identified sulfate attack, carbonation influenced steel corrosion, and decalcification (primary constituent leaching) as the primary chemical degradation phenomena of most relevance to SRS exposure conditions. In this study, degradation time scales for each of these three degradation phenomena are estimated for saltstone and concrete associated with each SDU type under conservative, nominal, and best estimate assumptions. The nominal value (NV) is an intermediate result that is more probable than the conservative estimate

Savannah River Site - Salt-stone Disposal Facility Performance Assessment Update

International Nuclear Information System (INIS)

Newman, J.L.

2009-01-01

The Savannah River Site (SRS) Salt-stone Facility is currently in the midst of a Performance Assessment revision to estimate the effect on human health and the environment of adding new disposal units to the current Salt-stone Disposal Facility (SDF). These disposal units continue the ability to safely process the salt component of the radioactive liquid waste stored in the underground storage tanks at SRS, and is a crucial prerequisite for completion of the overall SRS waste disposition plan. Removal and disposal of low activity salt waste from the SRS liquid waste system is required in order to empty tanks for future tank waste processing and closure operations. The Salt-stone Production Facility (SPF) solidifies a low-activity salt stream into a grout matrix, known as salt-stone, suitable for disposal at the SDF. The ability to dispose of the low-activity salt stream in the SDF required a waste determination pursuant to Section 3116 of the Ronald Reagan National Defense Authorization Act of 2005 and was approved in January 2006. One of the requirements of Section 3116 of the NDAA is to demonstrate compliance with the performance objectives set out in Subpart C of Part 61 of Title 10, Code of Federal Regulations. The PA is the document that is used to ensure ongoing compliance. (authors)

Modified TCLP test for evaluating the leachability of site-specific wastes

International Nuclear Information System (INIS)

Pier, J.

1996-01-01

The Weldon Spring Site Remedial Action Project (WSSRAP) has developed a site-specific test to assess the leachability of wastes that will be placed in its on-site disposal cell. This test is modelled after the TCLP, but examines an expanded list of parameters and uses an extraction solution that is representative of conditions that are expected to exist in the disposal facility. Following the same logic that guided development of TCLP protocols, the WSSRAP developed concentration guidelines for non-TCLP parameters that were contaminants of concern in its wastes. Response actions, specific to the WSSRAP cell and wastes, were also developed to address constituents that failed to meet these guides. From 1955 to 1966, the US Atomic Energy Commission operated a uranium feed materials plant on this site. Nitroaromatic, and later, radiological wastes were disposed of in the quarry from 1945 until 1970. This paper describes testing to determine whether contaminant concentrations in leachates derived from the major waste-types that will be placed in its on-site disposal cell conform with the Department of Energy's (DOE) as low as reasonably achievable (ALARA) policy. Although the WSSRAP will continue to use the TCLP test to determine if any waste is classified RCRA-hazardous, the site-specific test described in this paper will be used to further assess whether leachate from any waste-type has the potential to adversely impact groundwater

TCLP Preparation and Analysis of K East Basin Composite Sludge Samples

International Nuclear Information System (INIS)

Silvers, K.L.; Wagner, J.J.; Steele, R.T.

2000-01-01

Sludge samples from the Hanford K East Basin were analyzed by the Toxicity Characterization Leaching Procedure (TCLP) to assist in the appropriate Resource Conservation and Recovery Act (RCIL4) designation of this material. Sludge samples were collected by Fluor Hanford, Inc. using the consolidated sludge sampling system (system that allows collection of a single sample from multiple sample locations). These samples were shipped to the Postirradiation Testing Laboratory (PTL, 327 Building) and then transferred to the Pacific Northwest National Laboratory (PNNL) Radiochemical Processing Laboratory (RPL, 325 Building) for recovery and testing. Two sludge composites were prepared, using the consolidated sludge samples, to represent K East canister sludge (sample KC Can Comp) and K East floor sludge (sample KC Floor Comp). Each composite was extracted in duplicate and analyzed in duplicate following pre-approved(a) TCLP extraction and analyses procedures. In addition, these samples and duplicates were analyzed for total RCRA metals (via acid digestion preparation). The work was conducted in accordance with the requirements of the Hanford Analytical Quality Assurance Requirements Document (HASQARD). A PNNL Quality Assurance Program compliant with J HASQARD was implemented for this effort. The results from the TCLP analyses showed that all RCRA metal concentrations were less than the TCLP limits for both the canister and floor composite samples and their respective duplicates

Method Evaluation And Field Sample Measurements For The Rate Of Movement Of The Oxidation Front In Saltstone

Energy Technology Data Exchange (ETDEWEB)

Almond, P. M. [Savannah River Site (SRS), Aiken, SC (United States); Kaplan, D. I. [Savannah River Site (SRS), Aiken, SC (United States); Langton, C. A. [Savannah River Site (SRS), Aiken, SC (United States); Stefanko, D. B. [Savannah River Site (SRS), Aiken, SC (United States); Spencer, W. A. [Savannah River Site (SRS), Aiken, SC (United States); Hatfield, A. [Clemson University, Clemson, SC (United States); Arai, Y. [Clemson University, Clemson, SC (United States)

2012-08-23

The objective of this work was to develop and evaluate a series of methods and validate their capability to measure differences in oxidized versus reduced saltstone. Validated methods were then applied to samples cured under field conditions to simulate Performance Assessment (PA) needs for the Saltstone Disposal Facility (SDF). Four analytical approaches were evaluated using laboratory-cured saltstone samples. These methods were X-ray absorption spectroscopy (XAS), diffuse reflectance spectroscopy (DRS), chemical redox indicators, and thin-section leaching methods. XAS and thin-section leaching methods were validated as viable methods for studying oxidation movement in saltstone. Each method used samples that were spiked with chromium (Cr) as a tracer for oxidation of the saltstone. The two methods were subsequently applied to field-cured samples containing chromium to characterize the oxidation state of chromium as a function of distance from the exposed air/cementitious material surface.

Special Analysis: Revision of Saltstone Vault 4 Disposal Limits (U)

Energy Technology Data Exchange (ETDEWEB)

Cook, J

2005-05-26

New disposal limits have been computed for Vault 4 of the Saltstone Disposal Facility based on several revisions to the models in the existing Performance Assessment and the Special Analysis issued in 2002. The most important changes are the use of a more rigorous groundwater flow and transport model, and consideration of radon emanation. Other revisions include refinement of the aquifer mesh to more accurately model the footprint of the vault, a new plutonium chemistry model accounting for the different transport properties of oxidation states III/IV and V/VI, use of variable infiltration rates to simulate degradation of the closure system, explicit calculation of gaseous releases and consideration of the effects of settlement and seismic activity on the vault structure. The disposal limits have been compared with the projected total inventory expected to be disposed in Vault 4. The resulting sum-of-fractions of the 1000-year disposal limits is 0.2, which indicates that the performance objectives and requirements of DOE 435.1 will not be exceeded. This SA has not altered the conceptual model (i.e., migration of radionuclides from the Saltstone waste form and Vault 4 to the environment via the processes of diffusion and advection) of the Saltstone PA (MMES 1992) nor has it altered the conclusions of the PA (i.e., disposal of the proposed waste in the SDF will meet DOE performance measures). Thus a PA revision is not required and this SA serves to update the disposal limits for Vault 4. In addition, projected doses have been calculated for comparison with the performance objectives laid out in 10 CFR 61. These doses are 0.05 mrem/year to a member of the public and 21.5 mrem/year to an inadvertent intruder in the resident scenario over a 10,000-year time-frame, which demonstrates that the 10 CFR 61 performance objectives will not be exceeded. This SA supplements the Saltstone PA and supersedes the two previous SAs (Cook et al. 2002; Cook and Kaplan 2003).

Degradation Of Cementitious Materials Associated With Saltstone Disposal Units

Energy Technology Data Exchange (ETDEWEB)

Flach, G. P; Smith, F. G. III

2013-03-19

The Saltstone facilities at the DOE Savannah River Site (SRS) stabilize and dispose of low-level radioactive salt solution originating from liquid waste storage tanks at the site. The Saltstone Production Facility (SPF) receives treated salt solution and mixes the aqueous waste with dry cement, blast furnace slag, and fly ash to form a grout slurry which is mechanically pumped into concrete disposal cells that compose the Saltstone Disposal Facility (SDF). The solidified grout is termed “saltstone”. Cementitious materials play a prominent role in the design and long-term performance of the SDF. The saltstone grout exhibits low permeability and diffusivity, and thus represents a physical barrier to waste release. The waste form is also reducing, which creates a chemical barrier to waste release for certain key radionuclides, notably Tc-99. Similarly, the concrete shell of an SDF disposal unit (SDU) represents an additional physical and chemical barrier to radionuclide release to the environment. Together the waste form and the SDU compose a robust containment structure at the time of facility closure. However, the physical and chemical state of cementitious materials will evolve over time through a variety of phenomena, leading to degraded barrier performance over Performance Assessment (PA) timescales of thousands to tens of thousands of years. Previous studies of cementitious material degradation in the context of low-level waste disposal have identified sulfate attack, carbonation influenced steel corrosion, and decalcification (primary constituent leaching) as the primary chemical degradation phenomena of most relevance to SRS exposure conditions. In this study, degradation time scales for each of these three degradation phenomena are estimated for saltstone and concrete associated with each SDU type under conservative, nominal, and best estimate assumptions. The nominal value (NV) is an intermediate result that is more probable than the conservative

Verification of Sulfate Attack Penetration Rates for Saltstone Disposal Unit Modeling

Energy Technology Data Exchange (ETDEWEB)

Flach, G. P. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2015-05-12

Recent Special Analysis modeling of Saltstone Disposal Units consider sulfate attack on concrete and utilize degradation rates estimated from Cementitious Barriers Partnership software simulations. This study provides an independent verification of those simulation results using an alternative analysis method and an independent characterization data source. The sulfate penetration depths estimated herein are similar to the best-estimate values in SRNL-STI-2013-00118 Rev. 2 and well below the nominal values subsequently used to define Saltstone Special Analysis base cases.

Lessons Learned from an External Review of the Savannah River Site Saltstone Performance Assessment Program

International Nuclear Information System (INIS)

Cook, J.R.

2006-01-01

The Savannah River National Laboratory is actively working on a total revision of the Saltstone Performance Assessment. 'Lessons Learned' from the review are being applied to this effort. Examples of the areas in which significant new work is being done are development of a methodology to do probabilistic uncertainty analyses, employing quantitative analytical tools to represent long-term chemical degradation of both concrete and the Saltstone wasteform, and then using those tools to come to a better understanding of how changes in the vault and Saltstone will affect the performance of the overall disposal system over long periods of time. (authors)

Saltstone processing startup at the Savannah River Plant

International Nuclear Information System (INIS)

Wilhite, E.L.; Langton, C.A.; Sturm, H.F.; Hooker, R.L.; Occhipinti, E.S.

1988-01-01

High-level nuclear wastes are stored in large underground tanks at the Savannah River Plant. Processing of this waste in preparation for ultimate disposal will begin in 1988. The waste will be processed to separate the high-level radioactive fraction from the low-level radioactive fraction. The separation will be made in existing waste tanks by a process combining precipitation, adsorption, and filtration. The high-level fraction will be vitrified into borosilicate glass in the Defense Waste Processing Facility (DWPF) for permanent disposal in a federal repository. The low-level fraction (decontaminated salt solution) will be mixed with a cementitious slag-flyash blend. The resulting wasteform, saltstone, will be disposed of onsite by emplacement in an engineered facility. Waste properties, disposal facility details, and wasteform characteristics are discussed. In particular, details of saltstone processing, focusing on experience obtained from facility startup, are presented

Waste Incidental to Reprocessing Evaluation for Disposing Saltcake to Saltstone

International Nuclear Information System (INIS)

Jones, R.T.

2002-01-01

This Waste Incidental to Reprocessing Evaluation is performed in accordance with Department of Energy Order 435.1, Radioactive Waste Management. This evaluation is performed in order to determine whether saltcake currently stored in the Tank Farms, when separated from supernate, meets WIR requirements and can therefore be managed as Low Level Waste and disposed in the Saltstone Production and Disposal Facility in Z-Area

Evaluation of Proposed New LLW Disposal Activity: Disposal of Aqueous PUREX Waste Stream in the Saltstone Disposal Facility

International Nuclear Information System (INIS)

Cook, J.R.

2003-01-01

The Aqueous PUREX waste stream from Tanks 33 and 35, which have been blended in Tank 34, has been identified for possible processing through the Saltstone Processing Facility for disposal in the Saltstone Disposal Facility

Estimated release from the saltstone landfill effect of landfill caps and landfill-cap/monolith-liner combinations

International Nuclear Information System (INIS)

Wilhite, E.L.

1985-01-01

The effect of capping the entire saltstone landfill is dependent on the effectiveness of the clay cap in preventing infiltration. A cap that is 99% effective will reduce releases from the saltstone landfill by a factor of 7.7. Several combinations of landfill design alterations will result in meeting ground water standards

Nitrate Diffusional Releases from the Saltstone Facility, Vault 2, with Respect to Different Concrete Wall Thicknesses

International Nuclear Information System (INIS)

ROBERT, HIERGESELL

2005-01-01

To assist the Saltstone Vault 2 Design Team, an investigation was conducted to evaluate the effectiveness of alternative concrete wall thicknesses in limiting nitrate diffusion away from the planned facility. While the current design calls for 18-inch concrete walls, alternative thicknesses of 12-in, 8-in, and 6-in were evaluated using a simplified 1-D numerical model. To serve as a guide for Saltstone Vault 2 conceptual design, the results of this investigation were applied to Saltstone Vault 4 to determine what the hypothetical limits would be for concrete wall thicknesses thinner than the planned 18-inches. This was accomplished by adjusting the Vault 4 Limits, based on the increased nitrate diffusion rates through the thinner concrete walls, such that the 100-m well limit of 44 mg/L of nitrate as nitrate was not exceeded. The implication of these preliminary results is that as thinner vault walls are implemented there is a larger release of nitrate, thus necessitating optimal vault placement to minimize the number of vaults placed along a single groundwater flow path leading to the discharge zone

SALTSTONE VARIABILITY STUDY - MEASUREMENT OF POROSITY

International Nuclear Information System (INIS)

Harbour, J; Vickie Williams, V; Tommy Edwards, T; Russell Eibling, R; Ray Schumacher, R

2007-01-01

One of the goals of the Saltstone Variability Study is to identify the operational and compositional variables that control or influence the important processing and performance properties of Saltstone mixes. One of the key performance properties is porosity which is a measure of the volume percent of a cured grout that is occupied by salt solution (for the saturated case). This report presents (1) the results of efforts to develop a method for the measurement of porosity of grout samples and (2) initial results of porosity values for samples that have been previously produced as part of the Saltstone Variability Study. A cost effective measurement method for porosity was developed that provides reproducible results, is relatively fast (30 to 60 minutes per sample) and uses a Mettler Toledo HR83 Moisture Analyzer that is already operational and routinely calibrated at Aiken County Technology Laboratory. The method involves the heating of the sample at 105 C until no further mass loss is observed. This mass loss value, which is due to water evaporation, is then used to calculate the volume percent porosity of the mix. The results of mass loss for mixes at 105 C were equivalent to the results obtained using thermal gravimetric analysis. The method was validated by comparing measurements of mass loss at 105 C for cured portland cement in water mixes to values presented in the literature for this system. A stereopycnometer from Quantachrome Instruments was selected to measure the cured grout bulk densities. Density is a property that is required to calculate the porosities. A stereopycnometer was already operational at Aiken County Technology Laboratory, has been calibrated using a solid stainless steel sphere of known volume, is cost effective and fast (∼15 minutes per sample). Cured grout densities are important in their own right because they can be used to project the volume of waste form produced from a given amount of salt feed of known composition. For mixes

Composite analysis E-area vaults and saltstone disposal facilities

Energy Technology Data Exchange (ETDEWEB)

Cook, J.R.

1997-09-01

This report documents the Composite Analysis (CA) performed on the two active Savannah River Site (SRS) low-level radioactive waste (LLW) disposal facilities. The facilities are the Z-Area Saltstone Disposal Facility and the E-Area Vaults (EAV) Disposal Facility. The analysis calculated potential releases to the environment from all sources of residual radioactive material expected to remain in the General Separations Area (GSA). The GSA is the central part of SRS and contains all of the waste disposal facilities, chemical separations facilities and associated high-level waste storage facilities as well as numerous other sources of radioactive material. The analysis considered 114 potential sources of radioactive material containing 115 radionuclides. The results of the CA clearly indicate that continued disposal of low-level waste in the saltstone and EAV facilities, consistent with their respective radiological performance assessments, will have no adverse impact on future members of the public.

Composite analysis E-area vaults and saltstone disposal facilities

International Nuclear Information System (INIS)

Cook, J.R.

1997-09-01

This report documents the Composite Analysis (CA) performed on the two active Savannah River Site (SRS) low-level radioactive waste (LLW) disposal facilities. The facilities are the Z-Area Saltstone Disposal Facility and the E-Area Vaults (EAV) Disposal Facility. The analysis calculated potential releases to the environment from all sources of residual radioactive material expected to remain in the General Separations Area (GSA). The GSA is the central part of SRS and contains all of the waste disposal facilities, chemical separations facilities and associated high-level waste storage facilities as well as numerous other sources of radioactive material. The analysis considered 114 potential sources of radioactive material containing 115 radionuclides. The results of the CA clearly indicate that continued disposal of low-level waste in the saltstone and EAV facilities, consistent with their respective radiological performance assessments, will have no adverse impact on future members of the public

FOAM FORMATION IN THE SALTSTONE PRODUCTION FACILITY: EVALUATION OF SOURCES AND MITIGATION

Energy Technology Data Exchange (ETDEWEB)

Cozzi, A.

2011-01-18

The Saltstone Production Facility receives waste from Tank 50H for treatment. Influents into Tank 50H include the Effluent Treatment Project waste concentrate, H-Canyon low activity waste and General Purpose Evaporator bottoms, Modular Caustic Side Solvent Extraction Unit decontaminated salt solution, and salt solution from the Deliquification, Dissolution and Adjust campaign. Using the Waste Characterization System (WCS), this study tracks the relative amounts of each influent into Tank 50H, as well as the total content of Tank 50H, in an attempt to identify the source of foaming observed in the Saltstone Production Facility hopper. Saltstone has been using antifoam as part of routine processing with the restart of the facility in December 2006. It was determined that the maximum admix usage in the Saltstone Production Facility, both antifoam and set retarder, corresponded with the maximum concentration of H-Canyon low activity waste in Tank 50H. This paper also evaluates archived salt solutions from Waste Acceptance Criteria analysis for propensity to foam and the antifoam dosage required to mitigate foaming. It was determined that Effluent Treatment Project contributed to the expansion factor (foam formation) and General Purpose Evaporator contributed to foaminess (persistence). It was also determined that undissolved solids contribute to foam persistence. It was shown that additions of Dow Corning Q2-1383a antifoam reduced both the expansion factor and foaminess of salt solutions. The evaluation of foaming in the grout hopper during the transition from water to salt solution indicated that higher water-to-premix ratios tended to produce increased foaming. It was also shown that additions of Dow Corning Q2-1383a antifoam reduced foam formation and persistence.

PORFLOW Simulations Supporting Saltstone Disposal Unit Design Optimization

Energy Technology Data Exchange (ETDEWEB)

Flach, G. P. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Hang, T. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Taylor, G. A. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2015-12-10

SRNL was requested by SRR to perform PORFLOW simulations to support potential cost-saving design modifications to future Saltstone Disposal Units in Z-Area (SRR-CWDA-2015-00120). The design sensitivity cases are defined in a modeling input specification document SRR-CWDA-2015-00133 Rev. 1. A high-level description of PORFLOW modeling and interpretation of results are provided in SRR-CWDA-2015-00169. The present report focuses on underlying technical issues and details of PORFLOW modeling not addressed by the input specification and results interpretation documents. Design checking of PORFLOW modeling is documented in SRNL-L3200-2015-00146.

UK-Nuclear decommissioning authority and US Salt-stone waste management issues

International Nuclear Information System (INIS)

Lawless, William; Whitton, John

2007-01-01

Available in abstract form only. Full text of publication follows: We update two case studies of stakeholder issues in the UK and US. Earlier versions were reported at Waste Management 2006 and 2007 and at ICEM 2005. UK: The UK nuclear industry has begun to consult stakeholders more widely in recent years. Historically, methods of engagement within the industry have varied, however, recent discussions have generally been carried out with the explicit understanding that engagement with stakeholders will be 'dialogue based' and will 'inform' the final decision made by the decision maker. Engagement is currently being carried out at several levels within the industry; at the national level (via the Nuclear Decommissioning Authority's (NDA) National Stakeholder Group (NSG)); at a local site level (via Site Stakeholder Groups) and at a project level (usually via the Best Practicable Environmental Option process (BPEO)). This paper updates earlier results by the co-author with findings from a second questionnaire issued to the NSG in Phase 2 of the engagement process. An assessment is made regarding the development of stakeholder perceptions since Phase 1 towards the NDA process. US: The US case study reviews the resolution of issues on salt-stone by Department of Energy's (DOE) Savannah River Site (SRS) Citizens Advisory Board (CAB), in Aiken, SC. Recently, SRS-CAB encouraged DOE and South Carolina's regulatory Department of Health and Environmental Control (SC-DHEC) to resolve a conflict preventing SC-DHEC from releasing a draft permit to allow SRS to restart salt-stone operations. It arose with a letter sent from DOE blaming the Governor of South Carolina for delay in restarting salt processing. In reply, the Governor blamed DOE for failing to assure that Salt Waste Processing Facility (SWPF) would be built. SWPF is designed to remove most of the radioactivity from HLW prior to vitrification, the remaining fraction destined for salt-stone. (authors)

Groundwater Monitoring Plan for the Z-Area Saltstone Disposal Facility, Revision 3

International Nuclear Information System (INIS)

WELLS, DANIEL

2005-01-01

Groundwater monitoring has been conducted at the Z-Area Saltstone Disposal Facility since 1987. At that time, groundwater monitoring was not required by the industrial landfill regulations, but a modest monitoring program was required by the operating permit. At the time of the 1996 permit renewal, it was determined that a more robust monitoring program was needed. The draft permit required new monitoring wells within 25 feet of each active disposal cell. As an alternative, SRS proposed a program based on direct push sampling. This program called for biennial direct push sampling within 25 feet of each waste-containing cell with additional samples being taken in areas where excessive cracking had been observed. The direct push proposal was accepted by The South Carolina Department of Health and Environmental Control (SCDHEC), and was incorporated by reference into the Z-Area Saltstone Industrial Solid Waste Permit, No.025500-1603. The Industrial Solid Waste Landfill Regulations were revised in 1998 and now include specific requirements for groundwater monitoring. SRS's plan for complying with those regulations is discussed below. The plan calls for a return to traditional monitoring with permanent wells. It also proposes a more technically sound monitoring list based on the actual composition of saltstone

Special Analysis: Revised 14C Disposal Limits for the Saltstone Disposal Facility

International Nuclear Information System (INIS)

Kaplan, D.I.

2004-01-01

The Saltstone Special Analysis calculated a limit for 14C based on the atmospheric pathway of 52 pCi/mL using some very conservative assumptions. This was compared to the estimated Low Curie Salt concentration of 0.45 pCi/mL and since the limit was two orders of magnitude greater than the estimated concentration, the decision was made that no further analysis was needed. The 14C concentration in Tank 41 has been found to be much greater than the estimated concentration and to exceed the limit derived in the Special Analysis. A rigorous analysis of the release of 14C via the air pathway that considers the chemical effects of the Saltstone system has shown that the flux of 14C is significantly less than that assumed in the Special Analysis. The net result is an inventory limit for 14C that is significantly higher than that derived in the Special Analysis that will also meet the performance objectives of DOE Order 435.1

GAS MIXING ANALYSIS IN A LARGE-SCALED SALTSTONE FACILITY

Energy Technology Data Exchange (ETDEWEB)

Lee, S

2008-05-28

Computational fluid dynamics (CFD) methods have been used to estimate the flow patterns mainly driven by temperature gradients inside vapor space in a large-scaled Saltstone vault facility at Savannah River site (SRS). The purpose of this work is to examine the gas motions inside the vapor space under the current vault configurations by taking a three-dimensional transient momentum-energy coupled approach for the vapor space domain of the vault. The modeling calculations were based on prototypic vault geometry and expected normal operating conditions as defined by Waste Solidification Engineering. The modeling analysis was focused on the air flow patterns near the ventilated corner zones of the vapor space inside the Saltstone vault. The turbulence behavior and natural convection mechanism used in the present model were benchmarked against the literature information and theoretical results. The verified model was applied to the Saltstone vault geometry for the transient assessment of the air flow patterns inside the vapor space of the vault region using the potential operating conditions. The baseline model considered two cases for the estimations of the flow patterns within the vapor space. One is the reference nominal case. The other is for the negative temperature gradient between the roof inner and top grout surface temperatures intended for the potential bounding condition. The flow patterns of the vapor space calculated by the CFD model demonstrate that the ambient air comes into the vapor space of the vault through the lower-end ventilation hole, and it gets heated up by the Benard-cell type circulation before leaving the vault via the higher-end ventilation hole. The calculated results are consistent with the literature information. Detailed results and the cases considered in the calculations will be discussed here.

Design of saltstone vaults

International Nuclear Information System (INIS)

Aiyar, G.S.; Hsiu, F.J.

1987-01-01

Radioactive waste from processed spent nuclear fuel at the Savannah River Plant, South Carolina, are stored in underground tanks. The wastes consist of sludge and supernate. Most of the radionuclides and some nonradioactive constituents are removed from the supernate. These along with the sludge are converted into a glass-crystallite matrix and cast into stainless steel cansisters for future disposal in a geological repository. The decontaminated salt solution is mixed with cement, fly ash, and a set-retarding agent, and the resulting grout is transferred to reinforced concrete vaults where it sets into a monolith termed saltstone. The vault is then capped with concrete. A total of 21 vaults measuring 600 x 100 x 27 ft are planned for disposal of the existing supernate plus any additional supernate generated up to the year 2000

Atmospheric Pathway Screening Analysis for Saltstone Disposal Facility Vault 4

International Nuclear Information System (INIS)

COOK, JAMES

2004-01-01

A sequential screening process using a methodology developed by the National Council on Radiation Protection and Measurements, professional judgment and process knowledge has been used to produce a list of radionuclides requiring detailed analysis to derive disposal limits for the Saltstone Disposal Facility based on the atmospheric pathway

Computational Fluid Dynamics Model for Saltstone Vault 4 Vapor Space

International Nuclear Information System (INIS)

Lee, Si Young

2005-01-01

Computational fluid dynamics (CFD) methods have been used to estimate the flow patterns for vapor space inside the Saltstone Vault No.4 under different operating scenarios. The purpose of this work is to examine the gas motions inside the vapor space under the current vault configurations. A CFD model took three-dimensional transient momentum-energy coupled approach for the vapor space domain of the vault. The modeling calculations were based on prototypic vault geometry and expected normal operating conditions as defined by Waste Solidification Engineering. The modeling analysis was focused on the air flow patterns near the ventilated corner zones of the vapor space inside the Saltstone vault. The turbulence behavior and natural convection mechanism used in the present model were benchmarked against the literature information and theoretical results. The verified model was applied to the Saltstone vault geometry for the transient assessment of the air flow patterns inside the vapor space of the vault region using the boundary conditions as provided by the customer. The present model considered two cases for the estimations of the flow patterns within the vapor space. One is the reference baseline case. The other is for the negative temperature gradient between the roof inner and top grout surface temperatures intended for the potential bounding condition. The flow patterns of the vapor space calculated by the CFD model demonstrate that the ambient air comes into the vapor space of the vault through the lower-end ventilation hole, and it gets heated up by the Benard-cell type circulation before leaving the vault via the higher-end ventilation hole. The calculated results are consistent with the literature information

IMPACT OF INCREASED ALUMINATE CONCENTRATIONS ON PROPERTIES OF SALTSTONE MIXES

International Nuclear Information System (INIS)

Harbour, J; Tommy Edwards, T; Erich Hansen, E; Vickie Williams, V

2007-01-01

trends observed as the aluminate concentration increased in the salt solution were decreased Bingham Plastic yield stress and plastic viscosity, greater flowability of the grout, and reduced gel times and bleed volume for SWPF based mixes. On the other hand, the set times increased significantly with increasing aluminate concentration in the salt solutions. For the SWPF mixes, the set time increased from 1 to 4 days and for the Tank 11 mixes, the set time increased from 1 to 2 days. Heat of hydration measurements were consistent with the increased set times with extended induction periods (2 to 4 days) as aluminate concentration increased in the salt solution. This extended induction period of heat evolution observed with increasing aluminate concentrations must be addressed for Saltstone operations to avoid exceeding temperature limits. It is anticipated that the induction period will be temperature dependent and should be measured for future projections and included in the thermal modeling. The overall heat generation was greater in the mixes containing higher concentrations of aluminate. In fact, for the total heat release values calculated using curve fitting for longer times, the amount of heat was increased by 33% for SWPF based solutions and by 46% for Tank 11 based solutions. The larger amount of heat from mixes containing higher aluminate concentration must be accounted for in the modeling effort which determines the pour schedule for Saltstone. The increased induction periods were shown to be associated with hydration reactions of the blast furnace slag. The rate of heat generation with high aluminate solutions and Portland cement were only accelerated whereas high aluminate mixes containing blast furnace slag only showed the characteristic increase in induction time that was observed with mixes prepared using the premix blend of cementitious materials. It was shown that fly ash does not react significantly during the first seven days of curing but then

Lysimeter study of vegetative uptake from saltstone. Part I. Design, installation, and data collection plan

International Nuclear Information System (INIS)

Johnson, T.L.

1986-02-01

A field test facility has been designed and installed to obtain data on the vegetative uptake of radionuclides from buried low-level radioactive waste. The waste is a cement-like, solidified salt solution known as saltstone. The facility consists of 32 lysimeters (containers 6 feet in diameter and 6 to 10 feet in depth) holding buried saltstone at varying depths, and with varying types of vegetation grown at the surface. Vegetation, soil, and groundwater samples will be analyzed for Tc-99, Sr-90, I-129, Cs-137, and other radionuclides. Groundwater will also be analyzed for other water quality parameters, including nitrates

Adaptation of the TCLP and SW-846 methods to radioactive mixed waste

International Nuclear Information System (INIS)

Griest, W.H.; Schenley, R.L.; Caton, J.E.; Wolfe, P.F.

1994-01-01

Modifications of conventional sample preparation and analytical methods are necessary to provide radiation protection and to meet sensitivity requirements for regulated constituents when working with radioactive samples. Adaptations of regulatory methods for determining ''total'' Toxicity Characteristic Leaching Procedure (TCLP) volatile and semivolatile organics and pesticides, and for conducting aqueous leaching are presented

Performance Properties Of Saltstone Produced Using SWPF Simulants

International Nuclear Information System (INIS)

Harbour, J.; Edwards, T.

2010-01-01

The overwhelming majority of waste to be immobilized at the Saltstone Production Facility will come from the waste stream exiting the Salt Waste Processing Facility (SWPF). These SWPF batches are salt solutions that result from pretreatment of the High Level Waste (HLW) supernate by an Actinide Removal Process followed by Caustic Side Solvent Extraction. The concentration of aluminate within these streams will vary and be determined by (1) the concentration in the incoming salt waste stream, (2) the degree of aluminum leaching from the HLW, (3) the method for introducing the aluminate into the waste stream (continuous or batch) and (4) and any operational or regulatory limitations. The overall Performance Assessment outcome for the Saltstone Disposal Facility will depend significantly on the performance properties of the SWPF Saltstone grouts. This report identifies and quantifies, when possible, those factors that drive the performance properties of the projected SWPF grouts. Previous work has identified aluminate concentration in the salt waste stream as a key factor in determining performance. Consequently, significant variation in the aluminate concentration to a maximum level of 0.65 M was investigated in this report. The SWPF baseline grout is a mix with a 0.60 water to cementitious ratio and a premix composition of 45 wt % slag, 45 wt % fly ash and 10 wt % portland cement. The key factors that drive performance of the SWPF mixes were determined to be (1) the time/temperature profile for curing, (2) water to cementitious materials ratio, (3) aluminate concentration in the waste stream, and (4) wt % slag in the premix. An increase in the curing temperature for mixes with 45 wt % slag resulted in a 2.5 times decrease in Young's modulus. The reduction of Young's modulus measured at 60 C versus 22 C was mitigated by an increase in the aluminate concentration but was still significant. For mixes containing 60 wt % slag, the reduction in Young's modulus between

[Evaluation of phosphate-containing amendments on remediation effect and influential factors in a lead/zinc mining tailings contaminated soil using TCLP and forms].

Science.gov (United States)

Chen, Jian-Jun; Yu, Tian-Ming; Wang, Bi-Ling; Xie, Zheng-Miao

2010-01-01

A pot experiment was conducted to evaluate the effects of phosphate-containing (P) amendments on the toxicity and bioavailability of Pb and Zn in a soil contaminated by mining tailings using toxicity characteristic leaching procedure (TCLP) and water soluble, exchangeable leaching procedures in order to find out the appropriate P application rates to reduce the soil TCLP extractable Pb to below the USA EPA's regulatory limit levels. The results showed that TCLP extractable Pb concentrations were significantly decreased by up to 93.3% for MPP treatments and up to 68.5% for SSP treatments after P application. The dose required to reduce leachable Pb below the EPA's regulatory limit level was found to be around the molar ratio of v(P/Pb) = 0.6 for MPP and 1.8 for SSP. It was also found both MPP and SSP could reduce the exchangeable Pb and Zn concentrations that all bio-available Zn forms including water soluble, exchangeable, and TCLP extractable forms in soil were significantly and negatively correlated to soil pH values, indicating that the content of Zn in the soil was mostly controlled by soil pH value even after P application. These results suggest that P as MPP and SSP could successfully decrease the toxicity and bioavailability of Pb and Zn in the contaminated soil.

Addendum to the composite analysis for the E-Area Vaults and Saltstone Disposal Facilities

Energy Technology Data Exchange (ETDEWEB)

Cook, J.R.

2000-03-13

This report documents the composite analysis performed on the two active SRS low-level radioactive waste disposal facilities. The facilities are the Z-Area Saltstone Disposal Facility and the E-Area Vaults Disposal Facility.

Addendum to the composite analysis for the E-Area Vaults and Saltstone Disposal Facilities

International Nuclear Information System (INIS)

Cook, J.R.

2000-01-01

This report documents the composite analysis performed on the two active SRS low-level radioactive waste disposal facilities. The facilities are the Z-Area Saltstone Disposal Facility and the E-Area Vaults Disposal Facility

PHYSICAL PROPERTY MEASUREMENTS OF LABORATORY PREPARED SALTSTONE GROUT

Energy Technology Data Exchange (ETDEWEB)

Hansen, E.; Cozzi, A.; Edwards, T.

2014-05-05

The Saltstone Production Facility (SPF) built two new Saltstone Disposal Units (SDU), SDU 3 and SDU 5, in 2013. The variable frequency drive (VFD) for the grout transfer hose pump tripped due to high current demand by the motor during the initial radioactive saltstone transfer to SDU 5B on 12/5/2013. This was not observed during clean cap processing on July 5, 2013 to SDU 3A, which is a slightly longer distance from the SPF than is SDU 5B. Saltstone Design Authority (SDA) is evaluating the grout pump performance and capabilities to transfer the grout processed in SPF to SDU 3/5. To assist in this evaluation, grout physical properties are required. At this time, there are no rheological data from the actual SPF so the properties of laboratory prepared samples using simulated salt solution or Tank 50 salt solution will be measured. The physical properties of grout prepared in the laboratory with de-ionized water (DI) and salt solutions were obtained at 0.60 and 0.59 water to premix (W/P) ratios, respectively. The yield stress of the DI grout was greater than any salt grout. The plastic viscosity of the DI grout was lower than all of the salt grouts (including salt grout with admixture). When these physical data were used to determine the pressure drop and fluid horsepower for steady state conditions, the salt grouts without admixture addition required a higher pressure drop and higher fluid horsepower to transport. When 0.00076 g Daratard 17/g premix was added, both the pressure drop and fluid horsepower were below that of the DI grout. Higher concentrations of Daratard 17 further reduced the pressure drop and fluid horsepower. The uncertainty in the single point Bingham Plastic parameters is + 4% of the reported values and is the bounding uncertainty. Two different mechanical agitator mixing protocols were followed for the simulant salt grout, one having a total mixing time of three minutes and the other having a time of 10 minutes. The Bingham Plastic parameters

AcEST: DK950587 [AcEST

Lifescience Database Archive (English)

Full Text Available e uncharacterized protein OS=Oryza... 35 0.050 tr|Q68LQ2|Q68LQ2_9ROSI Maturase (Fragment) OS=Sapria himalaya...na ... 37 0.50 tr|Q5QCI0|Q5QCI0_9ROSI Maturase (Fragment) OS=Sapria himalayana ... 37 0.50 tr|Q6FQH7|Q6FQH7_...C Sbjct: 115 LSRTCGDVDFLLVMGDESDATRELC 139 >tr|Q68LQ2|Q68LQ2_9ROSI Maturase (Fragment) OS=Sapria himalayana ...ase (Fragment) OS=Sapria himalayana GN=matR PE=4 SV=1 Length = 584 Score = 37.4 b

SENSITIVITY ANALYSIS FOR SALTSTONE DISPOSAL UNIT COLUMN DEGRADATION ANALYSES

Energy Technology Data Exchange (ETDEWEB)

Flach, G.

2014-10-28

PORFLOW related analyses supporting a Sensitivity Analysis for Saltstone Disposal Unit (SDU) column degradation were performed. Previous analyses, Flach and Taylor 2014, used a model in which the SDU columns degraded in a piecewise manner from the top and bottom simultaneously. The current analyses employs a model in which all pieces of the column degrade at the same time. Information was extracted from the analyses which may be useful in determining the distribution of Tc-99 in the various SDUs throughout time and in determining flow balances for the SDUs.

Comparative Study on the Leaching Characteristics of Industrial Sludge and Fly Ash using KSLP and TCLP Techniques

International Nuclear Information System (INIS)

Lee, B.K.; Hwang, H.W.

2010-01-01

Leaching characteristics of industrial sludge and fly ash using Korean Standard Leaching Procedure (KSLP) and Toxicity Characteristics Leaching Procedure (TCLP) were studied. Possibilities of re-adsorption of heavy metal ions on the surface of sludge and ash during the course of leaching were also investigated. KSLP looked relatively more aggressive than the TCLP in leaching heavy metal ions. Concentrations of metal ions leached in both the methods, however, were found very low in comparison to the concentration of ions present in the original samples. In case of sludge, heavy metal ions showed relatively high rate of leaching at fourth and fifth stages of sequential extraction while ash showed high rate of leaching at the first three stages of extraction. Some of the concentrations of heavy metal ions leached out in the tests also found to be adsorbed on the surface of sludge and ash. Heavy metal ions present in high concentrations in the sample showed lower rate of adsorption than their leaching rate. No distinct difference in the results of KSLP and TCLP was observed. However, variations in the leaching results could be due to the different nature of hazardous waste and leaching conditions. More information like kinetics of leaching, mineralogical characteristics of waste and site characteristics of landfill were required to predict more accurate leaching behavior of ions in natural conditions. (author)

Z-Area Saltstone Disposal Facility Groundwater Monitoring Report. 1997 Annual Report

International Nuclear Information System (INIS)

Roach, J.L. Jr.

1997-12-01

Samples from the ZBG wells at the Z-Area Saltstone Disposal Facility are analyzed for constituents required by South Carolina Department of Health and Environmental Control (SCDHEC) Industrial Solid Waste Permit number-sign 025500-1603 (formerly IWP-217). No constituents were reported above SCDHEC-proposed groundwater monitoring standards or final Primary Drinking Water Standards during first or third quareters 1997. No constituents were detected above SRS flagging criteria during first or third quarters 1997

Stabilization of inorganic mixed waste to pass the TCLP and STLC tests using clay and pH-insensitive additives

Energy Technology Data Exchange (ETDEWEB)

Bowers, J.S.; Anson, J.R.; Painter, S.M. [Lawrence Livermore National Lab., CA (United States)] [and others

1995-12-31

Stabilization is a best demonstrated available technology, or BDAT. This technology traps toxic contaminants in a matrix so that they do not leach into the environment. The stabilization process routinely uses pozzolanic materials. Portland cement, fly ash-lime mixes, gypsum cements, and clays are some of the most common materials. In many instances, materials that can pass the Toxicity Characteristic Leaching Procedure (TCLP the federal leach test) or the Soluble Threshold Leachate Concentration (STLC the California leach test) must have high concentrations of lime or other caustic material because of the low pH of the leaching media. Both leaching media, California`s and EPA`s, have a pH of 5.0. California uses citric acid and sodium citrate while EPA uses acetic acid and sodium acetate. The concentration in the leachate is approximately ten times higher for the STLC procedure than the TCLP. These media can form ligands that provide excellent metal leaching. Because of the aggressive nature of the leaching medium, stabilized wastes in many cases will not pass the leaching tests. At the Lawrence Livermore National Laboratory (LLNL), additives such as dithiocarbamates and thiocarbonates, which are pH-insensitive and provide resistance to ligand formation, are used in the waste stabilization process. Attapulgite, montmorillonite, and sepiolite clays are used because they are forgiving (recipe can be adjusted before the matrix hardens) when formulating a stabilization matrix, and they have a neutral pH. By using these clays and additives, LLNL`s highly concentrated wastewater treatment sludges have passed the TCLP and STLC tests. The most frequently used stabilization process consists of a customized recipe involving waste sludge, clay and dithiocarbamate salt, mixed with a double planetary mixer into a pasty consistency. TCLP and STLC data on this waste matrix have shown that the process matrix meets land disposal requirements.

Saltstone: cement-based waste form for disposal of Savannah River Plant low-level radioactive salt waste

International Nuclear Information System (INIS)

Langton, C.A.

1984-01-01

Defense waste processing at the Savannah River Plant will include decontamination and disposal of approximately 400 million liters of waste containing NaNO 3 , NaOH, Na 2 SO 4 , and NaNO 2 . After decontamination, the salt solution is classified as low-level waste. A cement-based waste form, saltstone, has been designed for disposal of Savannah River Plant low-level radioactive salt waste. Bulk properties of this material have been tailored with respect to salt leach rate, permeability, and compressive strength. Microstructure and mineralogy of leached and unleached specimens were characterized by SEM and x-ray diffraction analyses. The disposal system for the DWPF salt waste includes reconstitution of the crystallized salt as a solution containing 32 wt % solids. This solution will be decontaminated to remove 137 Cs and 90 Sr and then stabilized in a cement-based waste form. Laboratory and field tests indicate that this stabilization process greatly reduces the mobility of all of the waste constitutents in the surface and near-surface environment. Engineered trenches for subsurface burial of the saltstone have been designed to ensure compatibility between the waste form and the environment. The total disposal sytem, saltstone-trench-surrounding soil, has been designed to contain radionuclides, Cr, and Hg by both physical encapsulation and chemical fixation mechanisms. Physical encapsulation of the salts is the mechanism employed for controlling N and OH releases. In this way, final disposal of the SRP low-level waste can be achieved and the quality of the groundwater at the perimeter of the disposal site meets EPA drinking water standards

Radiological performance assessment for the Z-Area Saltstone Disposal Facility

Energy Technology Data Exchange (ETDEWEB)

Cook, J.R.; Fowler, J.R. [Westinghouse Savannah River Co., Aiken, SC (United States)

1992-12-18

This radiological performance assessment (RPA) for the Savannah River Site (SRS) Saltstone Disposal Facility (SDF) was prepared in accordance with the requirements of Chapter III of the US Department of Energy Order 5820.2A. The Order specifies that an RPA should provide reasonable assurance that a low-level waste (LLW) disposal facility will comply with the performance objectives of the Order. The performance objectives require that: (1) exposures of the general public to radioactivity in the waste or released from the waste will not result in an effective dose equivalent of 25 mrem per year; (2) releases to the atmosphere will meet the requirements of 40 CFR 61; (3) inadvertent intruders will not be committed to an excess of an effective dose equivalent of 100 mrem per year from chronic exposure, or 500 mrem from a single acute exposure; and (4) groundwater resources will be protected in accordance with Federal, State and local requirements.

Radiological performance assessment for the Z-Area Saltstone Disposal Facility

International Nuclear Information System (INIS)

Cook, J.R.; Fowler, J.R.

1992-01-01

This radiological performance assessment (RPA) for the Savannah River Site (SRS) Saltstone Disposal Facility (SDF) was prepared in accordance with the requirements of Chapter III of the US Department of Energy Order 5820.2A. The Order specifies that an RPA should provide reasonable assurance that a low-level waste (LLW) disposal facility will comply with the performance objectives of the Order. The performance objectives require that: (1) exposures of the general public to radioactivity in the waste or released from the waste will not result in an effective dose equivalent of 25 mrem per year; (2) releases to the atmosphere will meet the requirements of 40 CFR 61; (3) inadvertent intruders will not be committed to an excess of an effective dose equivalent of 100 mrem per year from chronic exposure, or 500 mrem from a single acute exposure; and (4) groundwater resources will be protected in accordance with Federal, State and local requirements

Delisting petition for 300-M saltstone (treated F006 sludge) from the 300-M liquid effluent treatment facility

Energy Technology Data Exchange (ETDEWEB)

1989-04-04

This petition seeks exclusion for stabilized and solidified sludge material generated by treatment of wastewater from the 300-M aluminum forming and metal finishing processes. The waste contains both hazardous and radioactive components and is classified as a mixed waste. The objective of this petition is to demonstrate that the stabilized sludge material (saltstone), when properly disposed, will not exceed the health-based standards for the hazardous constituents. This petition contains sampling and analytical data which justify the request for exclusion. The results show that when the data are applied to the EPA Vertical and Horizontal Spread (VHS) Model, health-based standards for all hazardous waste constituents will not be exceeded during worst case operating and environmental conditions. Disposal of the stabilized sludge material in concrete vaults will meet the requirements pertaining to Waste Management Activities for Groundwater Protection at the Savannah River Site in Aiken, S.C. Documents set forth performance objectives and disposal options for low-level radioactive waste disposal. Concrete vaults specified for disposal of 300-M saltstone (treated F006 sludge) assure that these performance objectives will be met.

Groundwater Monitoring Plan for the Z-Area Saltstone Facility

International Nuclear Information System (INIS)

Wells, D.

2002-01-01

Groundwater monitoring has been conducted at the Z-Area Saltstone Disposal Facility since 1987. At that time, groundwater monitoring was not required by the industrial landfill regulations, but a modest monitoring program was required by the operating permit. In 1996 SRS proposed a program based on direct push sampling. This program called for biennial direct push sampling within 25 feet of each waste-containing cell with additional samples being taken in areas where excessive cracking had been observed. The direct push proposal was accepted by The South Carolina Department of Health and Environmental Control (SCDHEC). The Industrial Solid Waste Landfill Regulations were revised in 1998 and now include requirements for groundwater monitoring. The major elements of those regulations and their application at Z-Area are discussed. These are a point of compliance, groundwater protection standards, the groundwater monitoring system, sampling and analysis, and data evaluation and reporting

Structural, magnetic and transport properties of Mn3.1Sn0.9 and Mn3.1Sn0.9N compounds

International Nuclear Information System (INIS)

Feng, W.J.; Li, D.; Ren, W.J.; Li, Y.B.; Li, W.F.; Li, J.; Zhang, Y.Q.; Zhang, Z.D.

2007-01-01

The cubic anti-perovskite Mn 3.1 Sn 0.9 N compound is prepared via nitrogenation of the hexagonal Mn 3.1 Sn 0.9 compound. A magnetic phase diagram of Mn 3.1 Sn 0.9 compound is constructed by analysis of data of its magnetic properties. For Mn 3.1 Sn 0.9 N compound, parasitic ferromagnetism exists in the temperature range of 5-370 K, besides a spin-reorientation at about 280 K. Mn 3.1 Sn 0.9 compound exhibits a metallic conducting behavior, while Mn 3.1 Sn 0.9 N displays a metal-nonmetal transition due to the electron localization caused by the static disorder. The differences of the physical properties between the both compounds, are discussed, in terms of the correlation of the hexagonal DO 19 and the cubic anti-perovskite structures, the reduction of the distances between Mn atoms, and the spin-pairing or charge transfer effect due to the electron donation by N 2p to Mn 3d states after introduction of N atoms into the interstitial sites of Mn 3.1 Sn 0.9 compound

Benzene TCLP results from saltstone prepared with 2X ITP flowsheet concentrations of phenylborates

International Nuclear Information System (INIS)

Poirier, M.R.

2000-01-01

The Savannah River Site (SRS) teamed with the Pacific Northwest National Laboratory (PNNL), Oak Ridge National Laboratory (ORNL), and ITT Flygt Corporation to conduct a test program evaluating shrouded axial propeller mixers (Flygt mixers) for heel removal in SRS Tank 19. SRS is identifying and investigating techniques to remove sludge heels from waste tanks such as Tank 19

Addendum to the Composite Analysis for the E-Area Vaults and Saltstone Disposal Facilities

International Nuclear Information System (INIS)

Cook, J.R.

2002-01-01

Revision 1 of the Composite Analysis (CA) Addendum has been prepared to respond to the U.S. Department of Energy (DOE) Low-Level Waste Disposal Facilities Federal Review Group review of the CA. This addendum to the composite analysis responds to the conditions of approval. The composite analysis was performed on the two active SRS low-level radioactive waste disposal facilities. The facilities are the Z-Area Saltstone Disposal Facility and the E-Area Vaults Disposal Facility. The analysis calculated potential releases to the environment from all sources of residual radioactive material expected to remain in the General Separations Area (GSA). The GSA is the central part of the Savannah River Site and contains all of the waste disposal facilities, the chemical separation facilities and associated high-level waste storage facilities, as well as numerous other sources of radioactive material

Evaluation of ISDP Batch 2 Qualification Compliance to 512-S, DWPF, Tank Farm, and Saltstone Waste Acceptance Criteria

Energy Technology Data Exchange (ETDEWEB)

Shafer, A.

2010-05-05

The purpose of this report is to document the acceptability of the second macrobatch (Salt Batch 2) of Tank 49H waste to H Tank Farm, DWPF, and Saltstone for operation of the Interim Salt Disposition Project (ISDP). Tank 49 feed meets the Waste Acceptance Criteria (WAC) requirements specified by References 11, 12, and 13. Salt Batch 2 material is qualified and ready to be processed through ARP/MCU to the final disposal facilities.

Large-scale demonstration of disposal of decontaminated salt as saltstone. Part I. Construction, loading, and capping of lysimeters

International Nuclear Information System (INIS)

Wolf, H.C.

1984-06-01

The installation phase of a large-scale demonstration of the disposal concept for decontaminated, low-level radioactive salt waste at the Savannah River Plant was completed in December 1983 and January 1984. The installation entailed immobilizing 7500 gallons of decontaminated salt solution with a blended cement formulation and pouring the resulting grout, saltstone, into three specially designed lysimeters for extended in-field leaching tests under natural conditions. 4 references, 35 figures, 4 tables

Miscibility Evaluation Of The Next Generation Solvent With Polymers Currently Used At DWPF, MCU, And Saltstone

Energy Technology Data Exchange (ETDEWEB)

Fondeur, F. F.

2013-04-17

The Office of Waste Processing, within the Office of Technology Innovation and Development, funded the development of an enhanced Caustic-Side Solvent Extraction (CSSX) solvent for deployment at the Savannah River Site for removal of cesium from High Level Waste. This effort lead to the development of the Next Generation Solvent (NGS) with Tris (3,7-dimethyl octyl) guanidine (TiDG). The first deployment target for the NGS solvent is within the Modular CSSX Unit (MCU). Deployment of a new chemical within an existing facility requires verification that the new chemical components are compatible with the installed equipment. In the instance of a new organic solvent, the primary focus is on compatibility of the solvent with organic polymers used in the affected facility. This report provides the calculated data from exposing these polymers to the Next Generation Solvent. An assessment of the dimensional stability of polymers known to be used or present in the MCU, Defense Waste Processing Facility (DWPF), and Saltstone facilities that will be exposed to the NGS showed that TiDG could selectively affect the elastomers and some thermoplastics to varying extents, but the typical use of these polymers in a confined geometry will likely prevent the NGS from impacting component performance. The polymers identified as of primary concern include Grafoil® (flexible graphite), Tefzel®, Isolast®, ethylene-propylene-diene monomer (EPDM) rubber, nitrile-butadiene rubber (NBR), styrene-butadiene rubber (SBR), ultra high molecular weight polyethylene (UHMWPE), and fluorocarbon rubber (FKM). Certain polymers like NBR and EPDM were found to interact mildly with NGS but their calculated swelling and the confined geometry will impede interaction with NGS. In addition, it was found that Vellumoid (cellulose fibers-reinforced glycerin and protein) may leach protein and Polyvinyl Chloride (PVC) may leach plasticizer (such as Bis-Ethylhexyl-Phthalates) into the NGS solvent. Either case

Data Package for Secondary Waste Form Down-Selection-Cast Stone

International Nuclear Information System (INIS)

Serne, R. Jeffrey; Westsik, Joseph H.

2011-01-01

Available literature on Cast Stone and Saltstone was reviewed with an emphasis on determining how Cast Stone and related grout waste forms performed in relationship to various criteria that will be used to decide whether a specific type of waste form meets acceptance criteria for disposal in the Integrated Disposal Facility (IDF) at Hanford. After the critical review of the Cast Stone/Saltstone literature, we conclude that Cast Stone is a good candidate waste form for further consideration. Cast stone meets the target IDF acceptance criteria for compressive strength, no free liquids, TCLP leachate are below the UTS permissible concentrations and leach rates for Na and Tc-99 are suiteably low. The cost of starting ingredients and equipment necessary to generate Cast Stone waste forms with secondary waste streams are low and the Cast Stone dry blend formulation can be tailored to accommodate variations in liquid waste stream compositions. The database for Cast Stone short-term performance is quite extensive compared to the other three candidate waste solidification processes. The solidification of liquid wastes in Cast Stone is a mature process in comparison to the other three candidates. Successful production of Cast Stone or Saltstone has been demonstrated from lab-scale monoliths with volumes of cm3 through m3 sized blocks to 210-liter sized drums all the way to the large pours into vaults at Savannah River. To date over 9 million gallons of low activity liquid waste has been solidified and disposed in concrete vaults at Savannah River.

Data Package for Secondary Waste Form Down-Selection—Cast Stone

Energy Technology Data Exchange (ETDEWEB)

Serne, R. Jeffrey; Westsik, Joseph H.

2011-09-05

Available literature on Cast Stone and Saltstone was reviewed with an emphasis on determining how Cast Stone and related grout waste forms performed in relationship to various criteria that will be used to decide whether a specific type of waste form meets acceptance criteria for disposal in the Integrated Disposal Facility (IDF) at Hanford. After the critical review of the Cast Stone/Saltstone literature, we conclude that Cast Stone is a good candidate waste form for further consideration. Cast stone meets the target IDF acceptance criteria for compressive strength, no free liquids, TCLP leachate are below the UTS permissible concentrations and leach rates for Na and Tc-99 are suiteably low. The cost of starting ingredients and equipment necessary to generate Cast Stone waste forms with secondary waste streams are low and the Cast Stone dry blend formulation can be tailored to accommodate variations in liquid waste stream compositions. The database for Cast Stone short-term performance is quite extensive compared to the other three candidate waste solidification processes. The solidification of liquid wastes in Cast Stone is a mature process in comparison to the other three candidates. Successful production of Cast Stone or Saltstone has been demonstrated from lab-scale monoliths with volumes of cm3 through m3 sized blocks to 210-liter sized drums all the way to the large pours into vaults at Savannah River. To date over 9 million gallons of low activity liquid waste has been solidified and disposed in concrete vaults at Savannah River.

Stabilization of inorganic mixed waste to pass the TCLP and STLC tests using clay and pH-insensitive additives

International Nuclear Information System (INIS)

Bowers, J.S.; Anson, J.R.; Painter, S.M.; Maitino, R.E.

1995-03-01

Stabilization traps toxic contaminants (usually both chemically and physically) in a matrix so that they do not leach into the environment. Typical contaminants are metals (mostly transition metals) that exhibit the characteristic of toxicity. The stabilization process routinely uses pozzolanic materials. Portland cement, fly ash-lime mixes, gypsum cements, and clays are some of the most common materials. In many instances, materials that can pass the Toxicity Characteristic Leaching Procedure (TCLP-the federal leach test) or the Soluble Threshold Leachate Concentration (STLC-the California leach test) must have high concentrations of lime or other caustic material because of the low pH of the leaching media. Both leaching media, California's and EPA's, have a pH of 5.0. California uses citric acid and sodium citrate while EPA uses acetic acid and sodium acetate. These media can form ligands that provide excellent metal leaching. Because of the aggressive nature of the leaching medium, stabilized wastes in many cases will not pass the leaching tests. At the Lawrence Livermore National Laboratory, additives such as dithiocarbamates and thiocarbonates, which are pH-insensitive and provide resistance to ligand formation, are used in the waste stabilization process. Attapulgite, montmorillonite, and sepiolite clays are used because they are forgiving (recipe can be adjusted before the matrix hardens). The most frequently used stabilization process consists of a customized recipe involving waste sludge, clay and dithiocarbamate salt, mixed with a double planetary mixer into a pasty consistency. TCLP and STLC data on this waste matrix have shown that the process matrix meets land disposal requirements

NUMERICAL FLOW AND TRANSPORT SIMULATIONS SUPPORTING THE SALTSTONE FACILITY PERFORMANCE ASSESSMENT

Energy Technology Data Exchange (ETDEWEB)

Flach, G.

2009-02-28

The Saltstone Disposal Facility Performance Assessment (PA) is being revised to incorporate requirements of Section 3116 of the Ronald W. Reagan National Defense Authorization Act for Fiscal Year 2005 (NDAA), and updated data and understanding of vault performance since the 1992 PA (Cook and Fowler 1992) and related Special Analyses. A hybrid approach was chosen for modeling contaminant transport from vaults and future disposal cells to exposure points. A higher resolution, largely deterministic, analysis is performed on a best-estimate Base Case scenario using the PORFLOW numerical analysis code. a few additional sensitivity cases are simulated to examine alternative scenarios and parameter settings. Stochastic analysis is performed on a simpler representation of the SDF system using the GoldSim code to estimate uncertainty and sensitivity about the Base Case. This report describes development of PORFLOW models supporting the SDF PA, and presents sample results to illustrate model behaviors and define impacts relative to key facility performance objectives. The SDF PA document, when issued, should be consulted for a comprehensive presentation of results.

Tunable exchange bias effect in magnetic Bi0.9Gd0.1Fe0.9Ti0.1O3 nanoparticles at temperatures up to 250K

DEFF Research Database (Denmark)

Basith, M. A.; Khan, F. A.; Ahmmad, Bashir

2015-01-01

that the strength of the exchange bias effect is tunable by the field cooling. The HEB values are also found to be dependent on the temperature. This magnetically tunable exchange bias obtained at temperatures up to 250K in Bi0.9Gd0.1Fe0.9Ti0.1O3 nanoparticles may be worthwhile for potential applications.......The exchange bias (EB) effect has been observed in magnetic Bi0.9Gd0.1Fe0.9Ti0.1O3 nanoparticles.The influence of magnetic field cooling on the exchange bias effect has also been investigated. The magnitude of the exchange bias field (HEB) increases with the cooling magnetic field, showing...

Evaluation of Mobility, Bioavailability and Toxicity of Pb and Cd in Contaminated Soil Using TCLP, BCR and Earthworms

Science.gov (United States)

Kede, Maria Luiza F. M.; Correia, Fabio V.; Conceição, Paulo F.; Salles Junior, Sidney F.; Marques, Marcia; Moreira, Josino C.; Pérez, Daniel V.

2014-01-01

The objective of the present study was to investigate the reduction of mobility, availability and toxicity found in soil contaminated with lead (Pb) and cadmium (Cd) from Santo Amaro Municipality, Bahia, Brazil using two combined methods, commonly tested separately according to the literature: metal mobilization with phosphates and phytoextraction. The strategy applied was the treatment with two sources of phosphates (separately and mixed) followed by phytoremediation with vetiver grass (Vetiveria zizanioides (L.)). The treatments applied (in triplicates) were: T1—potassium dihydrogen phosphate (KH2PO4); T2—reactive natural phosphate fertilizer (NRP) and; T3—a mixture 1:1 of KH2PO4 and NRP. After this step, untreated and treated soils were planted with vetiver grass. The extraction procedures and assays applied to contaminated soil before and after the treatments included metal mobility test (TCLP); sequential extraction with BCR method; toxicity assays with Eisenia andrei. The soil-to-plant transfer factors (TF) for Pb and Cd were estimated in all cases. All treatments with phosphates followed by phytoremediation reduced the mobility and availability of Pb and Cd, being KH2PO4 (T1) plus phytoremediation the most effective one. Soil toxicity however, remained high after all treatments. PMID:25386955

Evaluation of Mobility, Bioavailability and Toxicity of Pb and Cd in Contaminated Soil Using TCLP, BCR and Earthworms

Directory of Open Access Journals (Sweden)

Maria Luiza F. M. Kede

2014-11-01

Full Text Available The objective of the present study was to investigate the reduction of mobility, availability and toxicity found in soil contaminated with lead (Pb and cadmium (Cd from Santo Amaro Municipality, Bahia, Brazil using two combined methods, commonly tested separately according to the literature: metal mobilization with phosphates and phytoextraction. The strategy applied was the treatment with two sources of phosphates (separately and mixed followed by phytoremediation with vetiver grass (Vetiveria zizanioides (L.. The treatments applied (in triplicates were: T1—potassium dihydrogen phosphate (KH2PO4; T2—reactive natural phosphate fertilizer (NRP and; T3—a mixture 1:1 of KH2PO4 and NRP. After this step, untreated and treated soils were planted with vetiver grass. The extraction procedures and assays applied to contaminated soil before and after the treatments included metal mobility test (TCLP; sequential extraction with BCR method; toxicity assays with Eisenia andrei. The soil-to-plant transfer factors (TF for Pb and Cd were estimated in all cases. All treatments with phosphates followed by phytoremediation reduced the mobility and availability of Pb and Cd, being KH2PO4 (T1 plus phytoremediation the most effective one. Soil toxicity however, remained high after all treatments.

Altered response to A(H1N1)pnd09 vaccination in pregnant women

DEFF Research Database (Denmark)

Bischoff, Anne Louise; Følsgaard, Nilofar Vahman; Carson, Charlotte Giwercman

2013-01-01

BACKGROUND: Pregnant women were suspected to be at particular risk when H1N1pnd09 influenza became pandemic in 2009. Our primary objective was to compare the immune responses conferred by MF59®-adjuvanted vaccine (Focetria®) in H1N1pnd09-naïve pregnant and non-pregnant women. The secondary aims...... were to compare influences of dose and adjuvant on the immune response. METHODS: The study was nested in the Copenhagen Prospective Studies on Asthma in Childhood (COPSAC2010) pregnancy cohort in 2009-2010 and conducted as a single-blinded block-randomised [1∶1∶1] controlled clinical trial in pregnant...... women after gestational week 20: (1) 7.5 µg H1N1pnd09 antigen with MF59-adjuvant (Pa7.5 µg); (2) 3.75 µg antigen half MF59-adjuvanted (Pa3.75 µg); (3) 15 µg antigen unadjuvanted (P15 µg); and in non-pregnant women receiving (4) 7.5 µg antigen full adjuvanted (NPa7.5 µg). Blood samples were collected...

Energy Auditor and Quality Control Inspector Competency Model

Energy Technology Data Exchange (ETDEWEB)

Head, Heather R [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Kurnik, Charles W [National Renewable Energy Laboratory (NREL), Golden, CO (United States); Schroeder, Derek [U.S. Department of Energy; Cutchin, Kelly [Simonson Management Services

2018-05-02

The Energy Auditor (EA) and Quality Control Inspector (QCI) Competency model was developed to identify the soft skills, foundational competencies and define the levels of Knowledge, Skills, and Abilities (KSAs) required to successfully perform the tasks defined in the EA and QCI Job Task Analysis (JTAs), the U.S. Department of Energy (DOE) used the U.S. Department of Labor's (DOL) Competency Model Clearinghouse resources to develop a QCI and EA Competency Model. To keep the QCI and EA competency model consistent with other construction and energy management competency models, DOE and the National Renewable Energy Laboratory used the existing 'Residential Construction Competency Model' and the 'Advanced Commercial Building Competency Model' where appropriate.

A non-toxic fluorogenic dye for mitochondria labeling.

Science.gov (United States)

Han, Junyan; Han, Myung Shin; Tung, Ching-Hsuan

2013-11-01

Mitochondria, powerhouses of cells, are responsible for many critical cellular functions, such as cell energy metabolism, reactive oxygen species production, and apoptosis regulation. Monitoring mitochondria morphology in live cells temporally and spatially could help with the understanding of the mechanisms of mitochondrial functional regulation and the pathogenesis of mitochondria-related diseases. A novel non-cytotoxic fluorogenic compound, AcQCy7, was developed as a mitochondria-specific dye. AcQCy7 emitted no fluorescent signal outside of cells, but it became fluorescent after intracellular hydrolysis of the acetyl group. The hydrolyzed fluorescent product was well retained in mitochondria, enabling long-lasting fluorescence imaging of mitochondria without cell washing. A 2-day culture study using AcQCy7 showed no sign of cytotoxicity, whereas a commonly used mitochondria-staining probe, Mitochondria Tracker Green, caused significant cell death even at a much lower concentration. Apoptosis-causing mitochondria fission was monitored clearly in real time by AcQCy7. A simple add-and-read mitochondria specific dye AcQCy7 has been validated in various cell models. Bright mitochondria specific fluorescent signal in treated cells lasted several days without noticeable toxicity. The probe AcQCy7 has been proofed to be a non-toxic agent for long-term mitochondria imaging. © 2013.

QCI Common

Energy Technology Data Exchange (ETDEWEB)

2016-11-18

There are many common software patterns and utilities for the ORNL Quantum Computing Institute that can and should be shared across projects. Otherwise we find duplication of code which adds unwanted complexity. This is a software product seeks to alleviate this by providing common utilities such as object factories, graph data structures, parameter input mechanisms, etc., for other software products within the ORNL Quantum Computing Institute. This work enables pure basic research, has no export controlled utilities, and has no real commercial value.

Outcomes of influenza A(H1N1)pdm09 virus infection

DEFF Research Database (Denmark)

Lynfield, Ruth; Davey, Richard; Dwyer, Dominic E

2014-01-01

BACKGROUND: Data from prospectively planned cohort studies on risk of major clinical outcomes and prognostic factors for patients with influenza A(H1N1)pdm09 virus are limited. In 2009, in order to assess outcomes and evaluate risk factors for progression of illness, two cohort studies were...

Coinfection with influenza A(H1N1)pdm09 and dengue virus in fatal cases.

Science.gov (United States)

Perdigão, Anne Carolinne Bezerra; Ramalho, Izabel Letícia Cavalcante; Guedes, Maria Izabel Florindo; Braga, Deborah Nunes Melo; Cavalcanti, Luciano Pamplona Góes; Melo, Maria Elisabeth Lisboa de; Araújo, Rafael Montenegro de Carvalho; Lima, Elza Gadelha; Silva, Luciene Alexandre Bié da; Araújo, Lia de Carvalho; Araújo, Fernanda Montenegro de Carvalho

2016-09-01

We report on four patients with fatal influenza A(H1N1)pdm09 and dengue virus coinfections. Clinical, necropsy and histopathologic findings presented in all cases were characteristic of influenza-dengue coinfections, and all were laboratory-confirmed for both infections. The possibility of influenza and dengue coinfection should be considered in locations where these two viruses' epidemic periods coincide to avoid fatal outcomes. Dengue is a mosquito-borne viral infection caused by one of the four dengue viruses (DENV-1 to 4). Each of these viruses is capable of causing nonspecific febrile illnesses, classic dengue fever and dengue haemorrhagic fever (Gubler 1998). As a result, dengue is often difficult to diagnose clinically, especially because peak dengue season often coincides with that of other common febrile illnesses in tropical regions (Chacon et al. 2015). In April 2009, a new virus, influenza A/H1N1/pandemic (FluA/H1N1/09pdm), caused a severe outbreak in Mexico. The virus quickly spread throughout the world, and in June 2009, the World Health Organization declared a pandemic (WHO 2010). In Brazil, the first laboratory confirmed case of FluA/H1N1/09pdm was in July 2009 (Pires Neto et al. 2013). The state of Ceará, in Northeast Brazil, is a dengue endemic area. In this state, the virus influenza A(H1N1)pdm09 has circulated since 2009, and through the first half of 2012, 11 deaths caused by the virus were confirmed (Pires Neto et al. 2013). The influenza and dengue seasons in Ceará overlap, which led to diagnostic difficulties. We report four cases of laboratory-confirmed coinfection of deadly influenza A(H1N1)pdm09 with DENV, which occurred during the dengue and influenza season in 2012 and 2013 in Ceará.

Coinfection with influenza A(H1N1pdm09 and dengue virus in fatal cases

Directory of Open Access Journals (Sweden)

Anne Carolinne Bezerra Perdigão

2016-01-01

Full Text Available Abstract We report on four patients with fatal influenza A(H1N1pdm09 and dengue virus coinfections. Clinical, necropsy and histopathologic findings presented in all cases were characteristic of influenza-dengue coinfections, and all were laboratory-confirmed for both infections. The possibility of influenza and dengue coinfection should be considered in locations where these two viruses’ epidemic periods coincide to avoid fatal outcomes. Dengue is a mosquito-borne viral infection caused by one of the four dengue viruses (DENV-1 to 4. Each of these viruses is capable of causing nonspecific febrile illnesses, classic dengue fever and dengue haemorrhagic fever (Gubler 1998. As a result, dengue is often difficult to diagnose clinically, especially because peak dengue season often coincides with that of other common febrile illnesses in tropical regions (Chacon et al. 2015. In April 2009, a new virus, influenza A/H1N1/pandemic (FluA/H1N1/09pdm, caused a severe outbreak in Mexico. The virus quickly spread throughout the world, and in June 2009, the World Health Organization declared a pandemic (WHO 2010. In Brazil, the first laboratory confirmed case of FluA/H1N1/09pdm was in July 2009 (Pires Neto et al. 2013. The state of Ceará, in Northeast Brazil, is a dengue endemic area. In this state, the virus influenza A(H1N1pdm09 has circulated since 2009, and through the first half of 2012, 11 deaths caused by the virus were confirmed (Pires Neto et al. 2013. The influenza and dengue seasons in Ceará overlap, which led to diagnostic difficulties. We report four cases of laboratory-confirmed coinfection of deadly influenza A(H1N1pdm09 with DENV, which occurred during the dengue and influenza season in 2012 and 2013 in Ceará.

Kaasaaitamine. Riigikohtu kriminaalkolleegiumi otsus asjas 3-1-1-97-09 / Jaan Sootak

Index Scriptorium Estoniae

Sootak, Jaan, 1948-

2009-01-01

Riigikohtu lahendist 3-1-1-97-09: I. V. kaitsja vandeadvokaat Aivar Ennoki kassatsioon Tallinna Ringkonnakohtu 15. juuni 2009. a kohtuotsuse peale kriminaalasjas I. V. süüdistuses KarS § 200 lg 2 p 7 - § 22 lg 3; § 215 lg 2 p 3 - § 22 lg 3 järgi

Emergence of influenza A (H1N1) PDM09 in the remote Islands of India--a molecular approach.

Science.gov (United States)

Muruganandam, N; Bhattacharya, D; Chaaithanya, I K; Bhattacharya, H; Reesu, R; Maile, A; Bharathi, G S J; Sugunan, A P; Vijayachari, P

2015-01-01

A disease outbreak of A (H1N1) PDM09 was reported in Andaman and Nicobar islands in 2009 with an attack rate of 33.5% among settler population and 26.3% among the aboriginal Nicobarese tribe. During the ongoing outbreak of A (H1N1) PDM09 disease in different parts of the world, a subject working in Dubai city of Saudi Arabia, came to Port Blair, following which the pandemic triggered for the first time in these Islands. During the period August 2009 to January 2011, 30 confirmed cases of Influenza A (H1N1) PDM09 virus infection was detected. To understand the genetic relationship, the NA gene sequences of the viruses were phylogenetically analysed together along with the virus sequence isolated from other parts of the world. Formation of multiple clusters were observed, with the sequences of Andaman Islands, mainland India, Mexico, Saudi Arabia and few other counties clustering together. The sequence analysis data revealed that there was no specific mutation conferring resistance to oseltamivir among the Andaman A (H1N1) PDM09 virus isolates. The result of phylogenetic analysis have also revealed that the A (H1N1) PDM09 virus might have spread in these remote Islands of India via the subject from Saudi Arabia/Dubai. A (H1N1) PDM09 Influenza outbreak have highlighted the need to strengthen the region-specific pandemic preparedness plans and surveillance strategies.

Effectiveness of A(H1N1)pdm09 influenza vaccine in adults recommended for annual influenza vaccination.

NARCIS (Netherlands)

Gefenaite, G.; Tacken, M.; Bos, J.; Stirbu-Wagner, I.; Korevaar, J.C.; Stolk, R.P.; Wolters, B.; Bijl, M.; Postma, M.J.; Wilschut, J.; Nichol, K.L.; Hak, E.

2013-01-01

Introduction: Because of variability in published A(H1N1)pdm09 influenza vaccine effectiveness estimates, we conducted a study in the adults belonging to the risk groups to assess the A(H1N1)pdm09 MF59-adjuvanted influenza vaccine effectiveness. Methods: VE against influenza and/or pneumonia was

CD206+ Cell Number Differentiates Influenza A (H1N1pdm09 from Seasonal Influenza A Virus in Fatal Cases

Directory of Open Access Journals (Sweden)

Heidi G. Rodriguez-Ramirez

2014-01-01

Full Text Available In 2009, a new influenza A (H1N1 virus affected many persons around the world. There is an urgent need for finding biomarkers to distinguish between influenza A (H1N1pdm09 and seasonal influenza virus. We investigated these possible biomarkers in the lung of fatal cases of confirmed influenza A (H1N1pdm09. Cytokines (inflammatory and anti-inflammatory and cellular markers (macrophages and lymphocytes subpopulation markers were analyzed in lung tissue from both influenza A (H1N1pdm09 and seasonal influenza virus. High levels of IL-17, IFN-γ, and TNF-α positive cells were identical in lung tissue from the influenza A (H1N1pdm09 and seasonal cases when compared with healthy lung tissue (P<0.05. Increased IL-4+ cells, and CD4+ and CD14+ cells were also found in high levels in both influenza A (H1N1pdm09 and seasonal influenza virus (P<0.05. Low levels of CD206+ cells (marker of alternatively activated macrophages marker in lung were found in influenza A (H1N1pdm09 when compared with seasonal influenza virus (P<0.05, and the ratio of CD206/CD14+ cells was 2.5-fold higher in seasonal and noninfluenza group compared with influenza A (H1N1pdm09 (P<0.05. In conclusion, CD206+ cells differentiate between influenza A (H1N1pdm09 and seasonal influenza virus in lung tissue of fatal cases.

Microstructural evolution of nanostructured Ti0.9Al0.1N prepared by reactive ball-milling

International Nuclear Information System (INIS)

Bhaskar, U.K.; Bid, S.; Pradhan, S.K.

2011-01-01

Research highlights: → Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N powder has been prepared by ball-milling the 0.9 mol fraction of α-Ti (hcp) and 0.1 mol fraction of aluminum (fcc) powders under N 2 at room temperature. Initially, α-Ti phase partially transformed to the transient β-Ti phase and Ti 0.9 Al 0.1 N (fcc) phase is noticed to form after 3 h of milling. Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N phase is formed after 7 h of milling. The main features which are observed in the present study are stated below: 1.During ball-milling of α-Ti, the α-Ti phase partially converted to transient cubic β-Ti phase within 1 h of milling. 2.Ti 0.9 Al 0.1 N (fcc) phase is noticed to form after 3 h of milling. Complete formation of Ti 0.9 Al 0.1 N (fcc) is obtained at 7 h of milling which is lesser than complete formation time (9 h) of TiN. Doping Al atoms accelerates the formation of (TiAl)N phase. 3.The particle size of Ti 0.9 Al 0.1 N decrease rapidly up to 3 h and then increase slightly due to agglomeration effect. 4.The particle size of Ti 0.9 Al 0.1 N estimated from X-ray is in good agreement with that measured from HRTEM. - Abstract: Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N powder has been prepared by ball-milling the α-Ti (hcp) and aluminum (fcc) powders under N 2 at room temperature. Initially, α-Ti phase partially transformed to the transient cubic β-Ti phase and Ti 0.9 Al 0.1 N (fcc) phase is noticed to form after 3 h of milling. Nanocrystalline stoichiometric Ti 0.9 Al 0.1 N phase is formed after 7 h of milling. After 1 h of milling, all Al atoms are diffused into the α-Ti matrix. The transient β-Ti phase is noticed to form after 1 h of milling and disappears completely after 7 h of milling. Microstructure characterization of unmilled and ball-milled powders by analyzing XRD patterns employing the Rietveld structure refinement reveals the inclusion of Al and nitrogen atoms into the Ti lattice on the way to formation of Ti 0.9 Al 0.1 N

Emergence of influenza A (H1N1 PDM09 in the remote Islands of India - A molecular approach

Directory of Open Access Journals (Sweden)

N Muruganandam

2015-01-01

Full Text Available Background: A disease outbreak of A (H1N1 PDM09 was reported in Andaman and Nicobar islands in 2009 with an attack rate of 33.5% among settler population and 26.3% among the aboriginal Nicobarese tribe. During the ongoing outbreak of A (H1N1 PDM09 disease in different parts of the world, a subject working in Dubai city of Saudi Arabia, came to Port Blair, following which the pandemic triggered for the first time in these Islands. Materials and Methods: During the period August 2009 to January 2011, 30 confirmed cases of Influenza A (H1N1 PDM09 virus infection was detected. To understand the genetic relationship, the NA gene sequences of the viruses were phylogenetically analysed together along with the virus sequence isolated from other parts of the world. Result: Formation of multiple clusters were observed, with the sequences of Andaman Islands, mainland India, Mexico, Saudi Arabia and few other counties clustering together. The sequence analysis data revealed that there was no specific mutation conferring resistance to oseltamivir among the Andaman A (H1N1 PDM09 virus isolates. The result of phylogenetic analysis have also revealed that the A (H1N1 PDM09 virus might have spread in these remote Islands of India via the subject from Saudi Arabia/Dubai. Conclusion: A (H1N1 PDM09 Influenza outbreak have highlighted the need to strengthen the region-specific pandemic preparedness plans and surveillance strategies.

HIV-1 and its gp120 inhibits the influenza A(H1N1)pdm09 life cycle in an IFITM3-dependent fashion.

Science.gov (United States)

Mesquita, Milene; Fintelman-Rodrigues, Natalia; Sacramento, Carolina Q; Abrantes, Juliana L; Costa, Eduardo; Temerozo, Jairo R; Siqueira, Marilda M; Bou-Habib, Dumith Chequer; Souza, Thiago Moreno L

2014-01-01

HIV-1-infected patients co-infected with A(H1N1)pdm09 surprisingly presented benign clinical outcome. The knowledge that HIV-1 changes the host homeostatic equilibrium, which may favor the patient resistance to some co-pathogens, prompted us to investigate whether HIV-1 infection could influence A(H1N1)pdm09 life cycle in vitro. We show here that exposure of A(H1N1)pdm09-infected epithelial cells to HIV-1 viral particles or its gp120 enhanced by 25% the IFITM3 content, resulting in a decrease in influenza replication. This event was dependent on toll-like receptor 2 and 4. Moreover, knockdown of IFITM3 prevented HIV-1 ability to inhibit A(H1N1)pdm09 replication. HIV-1 infection also increased IFITM3 levels in human primary macrophages by almost 100%. Consequently, the arrival of influenza ribonucleoproteins (RNPs) to nucleus of macrophages was inhibited, as evaluated by different approaches. Reduction of influenza RNPs entry into the nucleus tolled A(H1N1)pdm09 life cycle in macrophages earlier than usual, limiting influenza's ability to induce TNF-α. As judged by analysis of the influenza hemagglutin (HA) gene from in vitro experiments and from samples of HIV-1/A(H1N1)pdm09 co-infected individuals, the HIV-1-induced reduction of influenza replication resulted in delayed viral evolution. Our results may provide insights on the mechanisms that may have attenuated the clinical course of Influenza in HIV-1/A(H1N1)pdm09 co-infected patients during the recent influenza form 2009/2010.

HIV-1 and its gp120 inhibits the influenza A(H1N1pdm09 life cycle in an IFITM3-dependent fashion.

Directory of Open Access Journals (Sweden)

Milene Mesquita

Full Text Available HIV-1-infected patients co-infected with A(H1N1pdm09 surprisingly presented benign clinical outcome. The knowledge that HIV-1 changes the host homeostatic equilibrium, which may favor the patient resistance to some co-pathogens, prompted us to investigate whether HIV-1 infection could influence A(H1N1pdm09 life cycle in vitro. We show here that exposure of A(H1N1pdm09-infected epithelial cells to HIV-1 viral particles or its gp120 enhanced by 25% the IFITM3 content, resulting in a decrease in influenza replication. This event was dependent on toll-like receptor 2 and 4. Moreover, knockdown of IFITM3 prevented HIV-1 ability to inhibit A(H1N1pdm09 replication. HIV-1 infection also increased IFITM3 levels in human primary macrophages by almost 100%. Consequently, the arrival of influenza ribonucleoproteins (RNPs to nucleus of macrophages was inhibited, as evaluated by different approaches. Reduction of influenza RNPs entry into the nucleus tolled A(H1N1pdm09 life cycle in macrophages earlier than usual, limiting influenza's ability to induce TNF-α. As judged by analysis of the influenza hemagglutin (HA gene from in vitro experiments and from samples of HIV-1/A(H1N1pdm09 co-infected individuals, the HIV-1-induced reduction of influenza replication resulted in delayed viral evolution. Our results may provide insights on the mechanisms that may have attenuated the clinical course of Influenza in HIV-1/A(H1N1pdm09 co-infected patients during the recent influenza form 2009/2010.

A review on economic emission dispatch problems using quantum computational intelligence

Science.gov (United States)

Mahdi, Fahad Parvez; Vasant, Pandian; Kallimani, Vish; Abdullah-Al-Wadud, M.

2016-11-01

Economic emission dispatch (EED) problems are one of the most crucial problems in power systems. Growing energy demand, limitation of natural resources and global warming make this topic into the center of discussion and research. This paper reviews the use of Quantum Computational Intelligence (QCI) in solving Economic Emission Dispatch problems. QCI techniques like Quantum Genetic Algorithm (QGA) and Quantum Particle Swarm Optimization (QPSO) algorithm are discussed here. This paper will encourage the researcher to use more QCI based algorithm to get better optimal result for solving EED problems.

Influenza A (H1N1pdm09)-Related Critical Illness and Mortality in Mexico and Canada, 2014.

Science.gov (United States)

Dominguez-Cherit, Guillermo; De la Torre, Alethse; Rishu, Asgar; Pinto, Ruxandra; Ñamendys-Silva, Silvio A; Camacho-Ortiz, Adrián; Silva-Medina, Marco Antonio; Hernández-Cárdenas, Carmen; Martínez-Franco, Michel; Quesada-Sánchez, Alejandro; López-Gallegos, Guadalupe Celia; Mosqueda-Gómez, Juan L; Rivera-Martinez, Norma E; Campos-Calderón, Fernando; Rivero-Sigarroa, Eduardo; Hernández-Gilsoul, Thierry; Espinosa-Pérez, Lourdes; Macías, Alejandro E; Lue-Martínez, Dolores M; Buelna-Cano, Christian; Ramírez-García Luna, Ana-Sofía; Cruz-Ruiz, Nestor G; Poblano-Morales, Manuel; Molinar-Ramos, Fernando; Hernandez-Torre, Martin; León-Gutiérrez, Marco Antonio; Rosaldo-Abundis, Oscar; Baltazar-Torres, José Ángel; Stelfox, Henry T; Light, Bruce; Jouvet, Philippe; Reynolds, Steve; Hall, Richard; Shindo, Nikki; Daneman, Nick; Fowler, Robert A

2016-10-01

The 2009-2010 influenza A (H1N1pdm09) pandemic caused substantial morbidity and mortality among young patients; however, mortality estimates have been confounded by regional differences in eligibility criteria and inclusion of selected populations. In 2013-2014, H1N1pdm09 became North America's dominant seasonal influenza strain. Our objective was to compare the baseline characteristics, resources, and treatments with outcomes among critically ill patients with influenza A (H1N1pdm09) in Mexican and Canadian hospitals in 2014 using consistent eligibility criteria. Observational study and a survey of available healthcare setting resources. Twenty-one hospitals, 13 in Mexico and eight in Canada. Critically ill patients with confirmed H1N1pdm09 during 2013-2014 influenza season. None. The main outcome measures were 90-day mortality and independent predictors of mortality. Among 165 adult patients with H1N1pdm09-related critical illness between September 2013 and March 2014, mean age was 48.3 years, 64% were males, and nearly all influenza was community acquired. Patients were severely hypoxic (median PaO2-to-FIO2 ratio, 83 mm Hg), 97% received mechanical ventilation, with mean positive end-expiratory pressure of 14 cm H2O at the onset of critical illness and 26.7% received rescue oxygenation therapy with prone ventilation, extracorporeal life support, high-frequency oscillatory ventilation, or inhaled nitric oxide. At 90 days, mortality was 34.6% (13.9% in Canada vs 50.5% in Mexico, p Mexico (odds ratio, 7.76 [95% CI, 2.02-27.35]). ICUs in Canada generally had more beds, ventilators, healthcare personnel, and rescue oxygenation therapies. Influenza A (H1N1pdm09)-related critical illness still predominantly affects relatively young to middle-aged patients and is associated with severe hypoxemic respiratory failure. The local critical care system and available resources may be influential determinants of patient outcome.

Piezoresistance of Silicon and Strained Si0.9Ge0.1

DEFF Research Database (Denmark)

Richter, Jacob; Hansen, Ole; Larsen, A. Nylandsted

2005-01-01

We present experimentally obtained results of the piezoresistive effect in p-type silicon and strained Si0.9Ge0.1. Today, strained Si1-xGex is used for high speed electronic devices. This paper investigates if this area of use can be expanded to also cover piezoresistive micro electro mechanical...... systems (MEMS) devices. The measurements are performed on microfabricated test chips where resistors are defined in layers grown by molecular beam epitaxy on (0 0 1) silicon substrates. A uniaxial stress along the [1 1 0] direction is applied to the chip, with the use of a four point bending fixture....... The investigation covers materials with doping levels of N-A = 10(18) cm(-3) and NA = 1019 cm(-3), respectively. The results show that the pi(66) piezoresistive coefficient in strained Si0.9Ge0.1 is approximately 30% larger than the comparable pi(44) piezoresistive coefficient in silicon at a doping level of N...

Effectiveness of the influenza a(H1N1)PDM09 vaccine in adults recommended for annual influenza vaccination : A case-control study

NARCIS (Netherlands)

Gefenaite, Giedre; Tacken, Margot; Bos, Jens; Stirbu-Wagner, Irina; Korevaar, Joke C.; Stolk, Ronald P.; Wolters, Bert; Bijl, Marc; Postma, Maarten J.; Wilschut, Jan; Nichol, Kristin L.; Hak, Eelko

Background: Because of variability in published A(H1N1)pdm09 influenza vaccine effectiveness estimates, we aimed to assess the effectiveness of MF59-adjuvanted A(H1N1)pdm09 vaccine in a matched case-control study. Objectives: We aimed to assess the effectiveness of MF59- adjuvanted A(H1N1)pdm09

Enhanced Performance of Mg0.1Zn0.9O UV Photodetectors Using Photoelectrochemical Treatment and Silica Nanospheres

Directory of Open Access Journals (Sweden)

Hsin-Ying Lee

2014-01-01

Full Text Available The Mg0.1Zn0.9O films were grown using atomic layer deposition (ALD system and applied to metal-semiconductor-metal ultraviolet photodetectors (MSM-UPDs as an active layer. To suppress the dangling bonds on the Mg0.1Zn0.9O surface, the photoelectrochemical (PEC treatment was used to passivate the Mg0.1Zn0.9O surface, which could reduce the dark current of the MSM-UPDs about one order. Beside, to increase more incident light into the Mg0.1Zn0.9O active layer of the MSM-UPDs, the 500-nm-diameter silica nanospheres were spin-coated on the Mg0.1Zn0.9O active layer to improve the antireflection capability at the wavelength of 340 nm. The reflectivity of the Mg0.1Zn0.9O films with silica nanospheres antireflection layer decreased about 7.0% in comparison with the Mg0.1Zn0.9O films without silica nanospheres. The photocurrent and UV-visible ratio of the passivated Mg0.1Zn0.9O MSM-UPDs with antireflection layer were enhanced to 5.85 μA and 1.44×104, respectively, at the bias voltage of 5 V. Moreover, the noise equivalent power and the specific detectivity of the passivated Mg0.1Zn0.9O MSM-UPDs with antireflection layer were decreased to 2.60×10-13 W and increased to 1.21×1012 cmHz1/2W−1, respectively, at the bias voltage of 5 V. According to the above mentions, the PEC treatment and silica nanospheres antireflection layer could effectively enhance the performance of Mg0.1Zn0.9O MSM-UPDs.

XRD and HRTEM characterization of mechanosynthesized Ti{sub 0.9}W{sub 0.1}C cermet

Energy Technology Data Exchange (ETDEWEB)

Bandyopadhyay, S. [Department of Physics, The University of Burdwan, Golapbag, Burdwan 713104, West Bengal (India); Dutta, H. [Department of Physics, Vivekananda College, Burdwan 713103, West Bengal (India); Pradhan, S.K., E-mail: skp_bu@yahoo.com [Department of Physics, The University of Burdwan, Golapbag, Burdwan 713104, West Bengal (India)

2013-12-25

Highlights: •Cubic Ti{sub 0.9}W{sub 0.1}C is formed after 50 min of milling of α-Ti, W and graphite powders. •Nanocrystalline Ti{sub 0.9}W{sub 0.1}C with particle size ∼11 nm is obtained after 8 h milling. •Average particle size of Ti{sub 0.9}W{sub 0.1}C from XRD analysis and HRTEM is very close. •Formation of Ti{sub 0.9}W{sub 0.1}C is hindered as compared with TiC. -- Abstract: Elemental powder mixture of titanium, tungsten and graphite is milled by high energy planetary ball mill at a fixed ball to powder mass ratio (BPMR) for different duration to produce nanosized particles of Ti{sub 0.9}W{sub 0.1}C hard metal. Microstructure characterization in terms of lattice imperfections and phase quantification of ball-milled samples has been done primarily by analyzing the XRD pattern and employing Rietveld method of structure and microstructure refinement. After 8 h of ball-milling full formation of Ti{sub 0.9}W{sub 0.1}C is noticed without any contamination of other phase or milling media. TEM study of 8 h ball-milled sample gives direct supportive evidence of structural and microstructural evaluation by XRD pattern analysis. A comparative study of microstructural changes between TiC and Ti{sub 0.9}W{sub 0.1}C helps to understand the effect of addition of W as solute in Ti–C metal matrix.

Perovskite-based heterostructures integrating ferromagnetic-insulating La0.1Bi0.9MnO3

Science.gov (United States)

Gajek, M.; Bibes, M.; Barthélémy, A.; Varela, M.; Fontcuberta, J.

2005-05-01

We report on the growth of thin films and heterostructures of the ferromagnetic-insulating perovskite La0.1Bi0.9MnO3. We show that the La0.1Bi0.9MnO3 perovskite grows single phased, epitaxially, and with a single out-of-plane orientation either on SrTiO3 substrates or onto strained La2/3Sr1/3MnO3 and SrRuO3 ferromagnetic-metallic buffer layers. We discuss the magnetic properties of the La0.1Bi0.9MnO3 films and heterostructures in view of their possible potential as magnetoelectric or spin-dependent tunneling devices.

Room temperature mechanosynthesis and microstructure characterization of nanocrystalline Si{sub 0.9}Al{sub 0.1}C

Energy Technology Data Exchange (ETDEWEB)

Bandyopadhyay, S. [Department of Physics, The University of Burdwan, Golapbag, Burdwan, 713104, West Bengal (India); Dutta, H. [Department of Physics, Vivekananda College, Burdwan, 713103, West Bengal (India); Kar, T. [Department of Materials Science, Indian Association for the Cultivation of Science, Jadavpur, Kolkata, 700032, West Bengal (India); Pradhan, S.K., E-mail: skp_bu@yahoo.com [Department of Physics, The University of Burdwan, Golapbag, Burdwan, 713104, West Bengal (India)

2016-02-01

This article reports the synthesis and microstructure characterization of nanocrystalline Si{sub 0.9}Al{sub 0.1}C powder obtained by mechanical milling the mixture of Si, Al and graphite powders at room temperature under inert atmosphere. XRD patterns of ball-milled powders clearly reveal the nucleation of Si{sub 0.9}Al{sub 0.1}C phase after 5 h of milling and the stoichiometric cubic Si{sub 0.9}Al{sub 0.1}C is formed after 10 h of milling with crystallite size of ∼3 nm. Microstructure of ball-milled powders in terms of different lattice imperfections is characterized by employing both Rietveld's method of structure refinement using XRD data and high resolution transmission electron microscope (HRTEM). HRTEM micrographs of 10 h milled powder substantiate the formation of nanocrystalline Si{sub 0.9}Al{sub 0.1}C compound without any contamination and confirm the findings of Rietveld analysis using XRD data. - Highlights: • Cubic Si{sub 0.9}Al{sub 0.1}C is formed after 5 h of milling of Si, Al and graphite powders. • Nanocrystalline Si{sub 0.9}Al{sub 0.1}C with particle size ∼3 nm is obtained after 10 h milling. • Average particle size of Si{sub 0.9}Al{sub 0.1}C from XRD analysis and HRTEM is very close.

Mortality, severe acute respiratory infection, and influenza-like illness associated with influenza A(H1N1pdm09 in Argentina, 2009.

Directory of Open Access Journals (Sweden)

Eduardo Azziz-Baumgartner

Full Text Available INTRODUCTION: While there is much information about the burden of influenza A(H1N1pdm09 in North America, little data exist on its burden in South America. METHODS: During April to December 2009, we actively searched for persons with severe acute respiratory infection and influenza-like illness (ILI in three sentinel cities. A proportion of case-patients provided swabs for influenza testing. We estimated the number of case-patients that would have tested positive for influenza by multiplying the number of untested case-patients by the proportion who tested positive. We estimated rates by dividing the estimated number of case-patients by the census population after adjusting for the proportion of case-patients with missing illness onset information and ILI case-patients who visited physicians multiple times for one illness event. RESULTS: We estimated that the influenza A(H1N1pdm09 mortality rate per 100,000 person-years (py ranged from 1.5 among persons aged 5-44 years to 5.6 among persons aged ≥ 65 years. A(H1N1pdm09 hospitalization rates per 100,000 py ranged between 26.9 among children aged <5 years to 41.8 among persons aged ≥ 65 years. Influenza A(H1N1pdm09 ILI rates per 100 py ranged between 1.6 among children aged <5 to 17.1 among persons aged 45-64 years. While 9 (53% of 17 influenza A(H1N1pdm09 decedents with available data had obesity and 7 (17% of 40 had diabetes, less than 4% of surviving influenza A(H1N1pdm09 case-patients had these pre-existing conditions (p ≤ 0.001. CONCLUSION: Influenza A(H1N1pdm09 caused a similar burden of disease in Argentina as in other countries. Such disease burden suggests the potential value of timely influenza vaccinations.

Magnetic-entropy change in Mn1.1Fe0.9P0.7As0.3-xGe x

International Nuclear Information System (INIS)

Tegus, O.; Fuquan, B.; Dagula, W.; Zhang, L.; Brueck, E.; Si, P.Z.; Boer, F.R. de; Buschow, K.H.J.

2005-01-01

We have studied the magnetic properties and magnetic-entropy changes of Mn 1.1 Fe 0.9 P 0.7 As 0.3-x Ge x compounds with x = 0, 0.05, 0.1, 0.15 and 0.3. X-ray diffraction (XRD) study shows all the compounds crystallize in the Fe 2 P-type structure. Magnetic measurements show that the Curie temperature increases from 150 K for Mn 1.1 Fe 0.9 P 0.7 As 0.3 to 380 K for Mn 1.1 Fe 0.9 P 0.7 Ge 0.3 . A field-induced first-order magnetic phase transition is observed above the Curie temperature for the compounds with x up to 0.15. There exists an optimal composition in which the first-order phase transition is the sharpest. The optimal composition for this system is x = 0.1. The maximal magnetic-entropy change derived from the magnetization data is about 40 J/(kg K) for a field change from 0 to 3 T

Alternate paddle configuration for improved wear resistance in the saltstone mixer

Energy Technology Data Exchange (ETDEWEB)

Reigel, M. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Fowley, M. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2013-09-23

The Saltstone Production Facility has a 10-inch Readco-Kurimoto continuous mixer that mixes the premix dry feeds and low-level waste salt solution to make fresh (uncured) saltstone. Inspection of the mixer in January 2013 showed significant wear on the third, fourth and fifth paddle pairs after the conveying augers. A 2-inch Readco-Kurimoto continuous mixer was used to test alternate paddle configurations for use in the 10-inch mixer to decrease the wear rate on the paddles. Two wear tests were conducted to investigate a method of reducing wear on the mixer paddles. The first test (wear test 2a) had a paddle configuration similar to the currently installed 10-inch mixer in the SPF. This test established baseline wear. The second test (wear test 2b) had a reconfigured paddle arrangement that replaced the flat paddles with helical paddles for paddle pairs 2 - 6 and aligned paddle pair 1 with the augers. The intent of the reconfiguration was to more effectively convey the partially wetted dry feeds through the transition region and into the liquid feed where paddle wear is reduced due to dry feeds and salt solution being mixed at the intended water to premix ratio. The design of the helical paddles provides conveyance through the transition region to the liquid feed inlet. The alignment with the auger is aimed to provide a smoother transition (minimizing the discontinuity between the auger and paddle pair 1) into the downstream paddles. A soft metal with low wear resistance (6000 series aluminum) was used for the wear testing paddles to determine wear patterns while minimizing run time and maximizing wear rate. For the two paddle configurations tested using the scaled 2-inch Readco-Kurimoto continuous mixer, with the first six paddles after the augers replaced by the wear paddles and the remaining paddles were stainless steel. Since the 10-inch SPF mixer is designed with the liquid inlet centered over paddle pairs 5 and 6, the scaled 2-inch mixer was configured the

A study of analysis PB1-F2 protein of Influenza Viruses A/H1N1pdm09, A/ H3N2, and A/H5N1

Directory of Open Access Journals (Sweden)

Hana Apsari Pawestri

2016-07-01

Full Text Available Abstrak Tujuan. Protein PB1-F2 (polymerase basic 1-frame 2 adalah protein terbaru yang ditemukan pada virus Influenza dan telah terbukti berperan dalam induksi kematian sel dan patogenitas. Tujuan dari tulisan ini adalah untuk menganalisis protein PB1-F2 pada virus Influenza A/H5N1 dan A/H1N1pdm09. Metode. Kami melakukan pencarian data yang relevan yaitu sekuens gen virus Influenza A/H5N1 dan A/H1N1pdm09 dari Gen Bank National Center for Biotechnology Information (NCBI selama tahun 1997-2015. Data yang digunakan adalah data sekuens nukleotida gen PB1 (polymerase basic1 virus influenza A/H5N1 dan A/H1N1pdm09. Kemudian dilakukan analisis alignment untuk mengetahui variasi protein dan mutasi yang berhubungan dengan patogenitas dan virulensi. Hasil. Kami melakukan penelitian terhadap sekuens PB1-F2 sebanyak 3262 influenza A/H5N1 dan 2472 Influenza A/H1N1pdm09. Hasil analisis menunjukkan bahwa semua sekuens A/H5N1 memiliki panjang yang penuh sebanyak 90 asam amino, kecuali influenza pandemi 2009 hanya memiliki panjang 87 asam amino. Kemudian, ditemukan mutasi yang berhubungan dengan virulensi yang ditunjukan dengan perubahan asam amino Asparagin (N menjadi Serin (S. Mutasi tersebut terjadi pada Influenza A/H5N1 sebanyak 8.5% dan Influenza A/H1N1pdm09 sebanyak 0.5%. Kesimpulan. Ditemukan beberapa variasi panjang asam amino dan mutasi penting pada sekuens PB1-F2 dari subtipe yang berbeda yaitu influenza A/H5N1 dan A/H1N1pdm09  yang mengindikasikan seleksi spesifik karena introduksi dan adaptasi terhadap inang yang berbeda. Diperlukan penelitian lanjutan untuk lebih memahami variasi dan kontribusi protein PB1-F2 tersebut terhadap virulensi dan patogenitas virus Influenza. Kata kunci : Patogenesis, Virus Influenza, Protein  PB1-F2 Abstract Aim. Influenza virus PB1-F2 (polymerase basic 1-frame 2 protein is a novel protein previously shown to be involved in cell death induction and pathogenesis. Here we analysis the PB1-F2 protein of Influenza virus A

A study of analysis PB1-F2 protein of Influenza Viruses A/H1N1pdm09, A/ H3N2, and A/H5N1

Directory of Open Access Journals (Sweden)

Hana Apsari Pawestri

2016-07-01

Full Text Available Abstrak Tujuan. Protein PB1-F2 (polymerase basic 1-frame 2 adalah protein terbaru yang ditemukan pada virus Influenza dan telah terbukti berperan dalam induksi kematian sel dan patogenitas. Tujuan dari tulisan ini adalah untuk menganalisis protein PB1-F2 pada virus Influenza A/H5N1 dan A/H1N1pdm09. Metode. Kami melakukan pencarian data yang relevan yaitu sekuens gen virus Influenza A/H5N1 dan A/H1N1pdm09 dari Gen Bank National Center for Biotechnology Information (NCBI selama tahun 1997-2015. Data yang digunakan adalah data sekuens nukleotida gen PB1 (polymerase basic1 virus influenza A/H5N1 dan A/H1N1pdm09. Kemudian dilakukan analisis alignment untuk mengetahui variasi protein dan mutasi yang berhubungan dengan patogenitas dan virulensi. Hasil. Kami melakukan penelitian terhadap sekuens PB1-F2 sebanyak 3262 influenza A/H5N1 dan 2472 Influenza A/H1N1pdm09. Hasil analisis menunjukkan bahwa semua sekuens A/H5N1 memiliki panjang yang penuh sebanyak 90 asam amino, kecuali influenza pandemi 2009 hanya memiliki panjang 87 asam amino. Kemudian, ditemukan mutasi yang berhubungan dengan virulensi yang ditunjukan dengan perubahan asam amino Asparagin (N menjadi Serin (S. Mutasi tersebut terjadi pada Influenza A/H5N1 sebanyak 8.5% dan Influenza A/H1N1pdm09 sebanyak 0.5%. Kesimpulan. Ditemukan beberapa variasi panjang asam amino dan mutasi penting pada sekuens PB1-F2 dari subtipe yang berbeda yaitu influenza A/H5N1 dan A/H1N1pdm09  yang mengindikasikan seleksi spesifik karena introduksi dan adaptasi terhadap inang yang berbeda. Diperlukan penelitian lanjutan untuk lebih memahami variasi dan kontribusi protein PB1-F2 tersebut terhadap virulensi dan patogenitas virus Influenza. Kata kunci : Patogenesis, Virus Influenza, Protein  PB1-F2 Abstract Aim. Influenza virus PB1-F2 (polymerase basic 1-frame 2 protein is a novel protein previously shown to be involved in cell death induction and pathogenesis. Here we analysis the PB1-F2 protein of Influenza virus A

Screening for Influenza A(H1N1)pdm09, Auckland International Airport, New Zealand

Science.gov (United States)

Hale, Michael J.; Baker, Michael G.

2012-01-01

Entry screening for influenza A(H1N1)pdm09 at Auckland International Airport, New Zealand, detected 4 cases, which were later confirmed, among 456,518 passengers arriving April 27–June 22, 2009. On the basis of national influenza surveillance data, which suggest that ≈69 infected travelers passed through the airport, sensitivity for screening was only 5.8%. PMID:22516105

Structural analysis, optical and dielectric function of [Ba{sub 0.9}Ca{sub 0.1}](Ti{sub 0.9}Zr{sub 0.1})O{sub 3} nanocrystals

Energy Technology Data Exchange (ETDEWEB)

Herrera-Pérez, G., E-mail: guillermo.herrera@cimav.edu.mx, E-mail: damasio.morales@cimav.edu.mx [Centro de Investigación en Materiales Avanzados (CIMAV), S. C. Miguel de Cervantes 120, Chihuahua 31136, Chihuahua (Mexico); Physics of Materials Department, Centro de Investigación en Materiales Avanzados (CIMAV), S. C. Miguel de Cervantes 120, Chihuahua 31136, Chihuahua (Mexico); Morales, D., E-mail: guillermo.herrera@cimav.edu.mx, E-mail: damasio.morales@cimav.edu.mx; Paraguay-Delgado, F.; Reyes-Rojas, A.; Fuentes-Cobas, L. E. [Physics of Materials Department, Centro de Investigación en Materiales Avanzados (CIMAV), S. C. Miguel de Cervantes 120, Chihuahua 31136, Chihuahua (Mexico); Borja-Urby, R. [Centro de Nanociencias Micro y Nanotecnologías, Instituto Politécnico Nacional, 07300 México City (Mexico)

2016-09-07

This work presents the identification of inter-band transitions in the imaginary part of the dielectric function (ε{sub 2}) derived from the Kramers–Kronig analysis for [Ba{sub 0.9}Ca{sub 0.1}](Ti{sub 0.9}Zr{sub 0.1})O{sub 3} (BCZT) nanocrystals synthesized by the modified Pechini method. The analysis started with the chemical identification of the atoms that conform BCZT in the valence loss energy region of a high energy-resolution of electron energy loss spectroscopy. The indirect band energy (E{sub g}) was determined in the dielectric response function. This result is in agreement with the UV-Vis technique, and it obtained an optical band gap of 3.16 eV. The surface and volume plasmon peaks were observed at 13.1 eV and 26.2 eV, respectively. The X-ray diffraction pattern and the Rietveld refinement data of powders heat treated at 700 °C for 1 h suggest a tetragonal structure with a space group (P4 mm) with the average crystal size of 35 nm. The average particle size was determined by transmission electron microscopy.

16 CFR 0.9 - Organization structure.

Science.gov (United States)

2010-01-01

... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Organization structure. 0.9 Section 0.9 Commercial Practices FEDERAL TRADE COMMISSION ORGANIZATION, PROCEDURES AND RULES OF PRACTICE ORGANIZATION § 0.9 Organization structure. The Federal Trade Commission comprises the following principal units...

BENCH SCALE SALTSTONE PROCESS DEVELOPMENT MIXING STUDY

Energy Technology Data Exchange (ETDEWEB)

Cozzi, A.; Hansen, E.

2011-08-03

The Savannah River National Laboratory (SRNL) was requested to develop a bench scale test facility, using a mixer, transfer pump, and transfer line to determine the impact of conveying the grout through the transfer lines to the vault on grout properties. Bench scale testing focused on the effect the transfer line has on the rheological property of the grout as it was processed through the transfer line. Rheological and other physical properties of grout samples were obtained prior to and after pumping through a transfer line. The Bench Scale Mixing Rig (BSMR) consisted of two mixing tanks, grout feed tank, transfer pump and transfer hose. The mixing tanks were used to batch the grout which was then transferred into the grout feed tank. The contents of the feed tank were then pumped through the transfer line (hose) using a progressive cavity pump. The grout flow rate and pump discharge pressure were monitored. Four sampling stations were located along the length of the transfer line at the 5, 105 and 205 feet past the transfer pump and at 305 feet, the discharge of the hose. Scaling between the full scale piping at Saltstone to bench scale testing at SRNL was performed by maintaining the same shear rate and total shear at the wall of the transfer line. The results of scaling down resulted in a shorter transfer line, a lower average velocity, the same transfer time and similar pressure drops. The condition of flow in the bench scale transfer line is laminar. The flow in the full scale pipe is in the transition region, but is more laminar than turbulent. The resulting plug in laminar flow in the bench scale results in a region of no-mixing. Hence mixing, or shearing, at the bench scale should be less than that observed in the full scale, where this plug is non existent due to the turbulent flow. The bench scale tests should be considered to be conservative due to the highly laminar condition of flow that exists. Two BSMR runs were performed. In both cases, wall

Characterization of Ce0.9Gd0.1O1.95 powders synthesized by spray drying

DEFF Research Database (Denmark)

Blennow Tullmar, Peter; Chen, Weiwu; Lundberg, Mats

2009-01-01

Ce0.9Gd0.1O1.95 powders were synthesized by spray drying and successive calcinations. The phase purity, BET surface area, and particle morphology of as-sprayed and calcined powders were characterized. After calcination above 300 °C, the powders were single phase and showed a BET surface area of 68...

First reported detection of influenza A (H1N1)pdm09 in turkeys in the United Kingdom.

Science.gov (United States)

Reid, Scott M; Cox, William J; Ceeraz, Vanessa; Sutton, David; Essen, Steve C; Howard, Wendy A; Slomka, Marek J; Irvine, Richard M; Brown, Ian H

2012-12-01

We report the first occurrence of pandemic (H1N1) 2009 virus [A(H1N1)pdm09] infection on two epidemiologically linked turkey breeder premises in the United Kingdom during December 2010 and January 2011. Clinically, the birds showed only mild signs of disease, with the major presenting sign being an acute and marked reduction in egg production, leading to the prompt reporting of suspected avian notifiable disease for official investigation. Presence of A(H1N1)pdm09 infection in the United Kingdom turkey breeder flocks was confirmed by detailed laboratory investigations including virus isolation in embryonated specific pathogen-free fowls' eggs, two validated real-time reverse transcription-PCR tests, and nucleotide sequencing of the hemagglutinin and neuraminidase genes. These investigations revealed high nucleotide identity with currently circulating human A(H1N1)pdm09 strains, suggesting that human-to-poultry transmission (reverse zoonosis) was the most likely route of infection. Peak levels of human influenza-like illness community transmission also coincided with the onset of clinical signs in both affected turkey breeder flocks. This case demonstrated the value of the existing passive surveillance framework and associated veterinary and laboratory infrastructure that enables the detection and management of both exotic and new and emerging disease hazards and risks. The case also presents further evidence of the susceptibility of turkeys to infection with influenza A viruses of nonavian origin.

Oxygen permeation in thin, dense Ce0.9Gd0.1O 1.95- membranes II. experimental determination

DEFF Research Database (Denmark)

Chatzichristodoulou, Christodoulos; Søgaard, Martin; Glasscock, Julie

2011-01-01

Thin (∼30 m), dense Ce0.9Gd0.1O1.95- (CGO10) membranes (5 5 cm2+) supported on a porous NiO/YSZ substrate were fabricated by tape casting, wet powder spraying and lamination. A La 0.58Sr0.4Co0.2Fe0.8O 3-δ/Ce0.9Gd0.1O1.95- (LSCF/CGO10) composite cathode was applied by screen printing. Oxygen...... compartment. The performance of the membrane was also investigated under varying CH 4 and H2O gas mixtures at 1106 K. The oxygen flux increased with decreasing steam to carbon ratio and was found to exceed 10 N mL min-1 cm-2 of O2 for steam to carbon ratios below 4:3. Post-test analysis of the tested membrane...

A structural, magnetic and Moessbauer spectral study of the magnetocaloric Mn1.1Fe0.9P1-xGex compounds

International Nuclear Information System (INIS)

Sougrati, Moulay T; Hermann, Raphael P; Grandjean, Fernande; Long, Gary J; Brueck, E; Tegus, O; Trung, N T; Buschow, K H J

2008-01-01

The structural, magnetic and Moessbauer spectral properties of the magnetocaloric Mn 1.1 Fe 0.9 P 1-x Ge x compounds, with 0.19 1.1 Fe 0.9 P 0.74 Ge 0.26 . The temperature dependence of the magnetization reveals a ferromagnetic to paramagnetic transition with a Curie temperature between approximately 250 and 330 K and hysteresis width of 10 to 4 K, for 0.19 1.1 Fe 0.9 P 0.78 Ge 0.22 shows the largest isothermal entropy change of approximately 10 J/(kgKT) at 290 K. The Moessbauer spectra have been analysed with a binomial distribution of hyperfine fields correlated with a change in isomer shift and quadrupole shift, a distribution that results from the distribution of phosphorus and germanium among the near neighbours of the iron. The coexistence of paramagnetic and magnetically ordered phases in ranges of temperature of up to 50 K around the Curie temperature is observed in the Moessbauer spectra and is associated with the first-order character of the ferromagnetic to paramagnetic transition. The temperature dependence of the weighted average hyperfine field is well fitted within the magnetostrictive model of Bean and Rodbell. Good fits of the Moessbauer spectra could only be achieved by introducing a difference between the isomer shifts in the paramagnetic and ferromagnetic phases, a difference that is related to the magnetostriction and electronic structure change.

Influenza A (H1N1)pnd09 Vaccination of Pregnant Women and Immunological Consequences for Their Offspring

DEFF Research Database (Denmark)

Bischoff, Anne Louise

2013-01-01

against H1N1pnd09 according to the EMEA criteria with a HI titre of 40 or greater. Women receiving the non-adjuvanted vaccine had significantly fewer local reactions but similar rates of systemic reactions as women receiving the adjuvanted vaccine. There were no reports of serious adverse events in any......Pregnant women experience increased influenza related morbidity and mortality during seasonal influenza epidemics, and even graver outcomes during influenza pandemics. Thus, even though the huge amount of data on clinical efficacy and effectiveness of influenza vaccine in pregnant women......, there is limited information on the details of the immunological responses to influenza immunization in pregnant versus non-pregnant. We had the unique opportunity to study the H1N1pnd09 vaccination of pregnant and non-pregnant women in our unselected, prospective, clinical pregnancy-cohort: the Copenhagen...

Synthesis, Magnetization, and Electrical Transport Properties of Mn3Zn0.9Cu0.1N

Directory of Open Access Journals (Sweden)

Y. Yin

2013-01-01

Full Text Available We synthesized Mn3Zn0.9Cu0.1N by solid state reaction, and magnetic as well as electrical transport properties were investigated. It is found that Mn3Zn0.9Cu0.1N exhibits a first-order antiferromagnetism (AFM to paramagnetic (PM transition with the Néel temperature TN ~163 K, and substitution of Cu for Zn would favor ferromagnetism (FM state and weaken AFM ground state, leading to a convex curvature character of M(T curve. With high external fields 10 kOe–50 kOe, magnetic transition remains a robust AFM-PM feature while FM phase is completely suppressed. Thermal hysteresis of M(T under 500 Oe is also suppressed when the magnetic field exceeds 10 kOe. Mn3Zn0.9Cu0.1N exhibits a good metallic behavior except for a slope change around TN, which is closely related to AFM-PM magnetic transition. Compared with the first differential of resistivity with respect to temperature for (dρ/dTMn3ZnN in transition temperature range, the absolute value of (dρ/dTMn3Zn0.9Cu0.1N is much lower which is close to zero.

Diversity of the murine antibody response targeting influenza A(H1N1pdm09) hemagglutinin.

Science.gov (United States)

Wilson, Jason R; Tzeng, Wen-Pin; Spesock, April; Music, Nedzad; Guo, Zhu; Barrington, Robert; Stevens, James; Donis, Ruben O; Katz, Jacqueline M; York, Ian A

2014-06-01

We infected mice with the 2009 influenza A pandemic virus (H1N1pdm09), boosted with an inactivated vaccine, and cloned immunoglobulins (Igs) from HA-specific B cells. Based on the redundancy in germline gene utilization, we inferred that between 72-130 unique IgH VDJ and 35 different IgL VJ combinations comprised the anti-HA recall response. The IgH VH1 and IgL VK14 variable gene families were employed most frequently. A representative panel of antibodies were cloned and expressed to confirm reactivity with H1N1pdm09 HA. The majority of the recombinant antibodies were of high avidity and capable of inhibiting H1N1pdm09 hemagglutination. Three of these antibodies were subtype-specific cross-reactive, binding to the HA of A/South Carolina/1/1918(H1N1), and one further reacted with A/swine/Iowa/15/1930(H1N1). These results help to define the genetic diversity of the influenza anti-HA antibody repertoire profile induced following infection and vaccination, which may facilitate the development of influenza vaccines that are more protective and broadly neutralizing. Protection against influenza viruses is mediated mainly by antibodies, and in most cases this antibody response is narrow, only providing protection against closely related viruses. In spite of this limited range of protection, recent findings indicate that individuals immune to one influenza virus may contain antibodies (generally a minority of the overall response) that are more broadly reactive. These findings have raised the possibility that influenza vaccines could induce a more broadly protective response, reducing the need for frequent vaccine strain changes. However, interpretation of these observations is hampered by the lack of quantitative characterization of the antibody repertoire. In this study, we used single-cell cloning of influenza HA-specific B cells to assess the diversity and nature of the antibody response to influenza hemagglutinin in mice. Our findings help to put bounds on the

Oxygen permeation in thin, dense Ce0.9Gd0.1O 1.95- membranes I. Model study

DEFF Research Database (Denmark)

Chatzichristodoulou, Christodoulos; Søgaard, Martin; Hendriksen, Peter Vang

2011-01-01

at the feed and permeate side of the membrane, related to the gaseous oxygen reduction and fuel oxidation, respectively, as well as the gas conversion and gas diffusion resistances in the porous support structure at the permeate side. The temperature and oxygen activity dependence of the oxide ionic...... was analyzed by a separation of the various losses. The chemical expansion of Ce 0.9Gd0.1O1.95-δ under operation was estimated from the calculated oxygen activity and nonstoichiometry profiles inside the membrane. © 2011 The Electrochemical Society.......A model of a supported planar Ce0.9Gd0.1O 1.95-δ oxygen membrane in a plug-flow setup was constructed and a sensitivity analysis of its performance under varying operating conditions and membrane parameters was performed. The model takes into account the driving force losses at the catalysts...

Mechanisms of contaminant migration from grouted waste

International Nuclear Information System (INIS)

Magnuson, S.O.; Yu, A.D.

1992-01-01

Low-level radioactive decontaminated salt solution is generated at the Savannah River Site (SRS) from the In-Tank Precipitation process. The solution is mixed with cement, slag, and fly ash, to form a grout, termed ''Saltstone'', that will be disposed in concrete vaults at the Saltstone Disposal Facility (SDF) [1]. Of the contaminants in the Saltstone, the greatest concern to SRS is the potential release of nitrate to the groundwater because of the high initial nitrate concentration (0.25 g/cm 3 ) in the Saltstone and the low Safe Drinking Water Act (SDWA) maximum contaminant level (MCL) of 44 mg/L. The SDF is designed to allow a slow, controlled release over thousands of years. This paper addresses a modeling study of nitrate migration from intact non-degraded concrete vaults in the unsaturated zone for the Radiological Performance Assessment (PA) of the SRS Saltstone Disposal Facility [3]. The PA addresses the performance requirements mandated by DOE Order 5820.2A [4

New genetic variants of influenza A(H1N1)pdm09 detected in Cuba during 2011-2013.

Science.gov (United States)

Arencibia, Amely; Acosta, Belsy; Muné, Mayra; Valdés, Odalys; Fernandez, Leandro; Medina, Isel; Savón, Clara; Oropesa, Suset; Gonzalez, Grehete; Roque, Rosmery; Gonzalez, Guelsys; Hernández, Bárbara; Goyenechea, Angel; Piñón, Alexander

2015-06-01

Influenza A(H1N1)pdm09 virus has evolved continually since its emergence in 2009. For influenza virus strains, genetic changes occurring in HA1 domain of the hemagglutinin cause the emergence of new variants. The aim of our study is to establish genetic associations between 35 A(H1N1)pdm09 viruses circulating in Cuba in 2011-2012 and 2012-2013 seasons, and A/California/07/2009 strain recommended by WHO as the H1N1 component of the influenza vaccine. The phylogenetic analysis revealed the circulation of clades 3, 6A, 6B, 6C and 7. Mutations were detected in the antigenic site or in the receptor-binding domains of HA1 segment, including S174P, S179N, K180Q, S202T, S220T and R222K. Substitutions S174P, S179N, K180Q and R222K were detected in Cuban strains for the first time. Copyright © 2015 Elsevier B.V. All rights reserved.

Molecular epidemiology of influenza A(H1N1PDM09 hemagglutinin gene circulating in São Paulo State , Brazil: 2016 anticipated influenza season

Directory of Open Access Journals (Sweden)

Katia Corrêa de Oliveira Santos

Full Text Available ABSTRACT Compared to previous years, seasonal influenza activity commenced early in São Paulo State, Brazil, Southern hemisphere during the 2016 year. In order to investigate the genetic pattern of influenza A(H1N1pdm09 in the State of Sao Paulo a total of 479 respiratory samples, collected in January by Sentinel Surveillance Units, were screened by real-time RT-PCR. A total of 6 Influenza viruses A(H1N1pdm09 presenting ct values ≤ 30 were sequenced following phylogenetic analysis. The present study identified the circulation of the new 6B.1 subgroup (A/Sao Paulo/10-118/2016 and A/Sao Paulo/3032/2016. In addition, influenza A(H1N1pdm09 group 6B has also been identified during January in the State of Sao Paulo. Despite amino acid changes and changes in potential glycosylation motifs, 6B.1 viruses were well inhibited by the reference ferret antiserum against A/California/07/2009 virus, the A(H1N1pdm09 component of the vaccine for the 2016 influenza season.

Postoperative impairment of motor function at train-of-four ratio ≥0.9 cannot be improved by sugammadex (1 mg kg-1).

Science.gov (United States)

Baumüller, E; Schaller, S J; Chiquito Lama, Y; Frick, C G; Bauhofer, T; Eikermann, M; Fink, H; Blobner, M

2015-05-01

A train-of-four ratio (TOFR) ≥0.9 measured by quantitative neuromuscular monitoring is accepted as an indication of sufficient neuromuscular recovery for extubation, even though many postsynaptic acetylcholine receptors may still be inhibited. We investigated whether antagonism with sugammadex after spontaneous recovery to TOFR≥0.9 further improves muscle function or subjective well-being. Following recovery to TOFR≥0.9 and emergence from anaesthesia, 300 patients randomly received either sugammadex 1.0 mg kg(-1) or placebo. Fine motor function (Purdue Pegboard Test) and maximal voluntary grip strength were measured before and after surgery (before and after test drug administration). At discharge from the postanaesthesia care unit, well-being was assessed with numerical analogue scales and the Quality-of-Recovery Score 40 (QoR-40). Patients' fine motor function [6 (sd 4) vs 15 (3) pegs (30 s)(-1), Psugammadex or placebo, motor function was significantly improved in both groups but did not reach the preoperative level. There was no difference between groups at any time. Global well-being was unaffected (QoR-40: placebo, 174 vs 185; sugammadex, 175 vs 186, P>0.05). Antagonizing rocuronium at TOF≥0.9 with sugammadex 1.0 mg kg(-) (1) did not improve patients' motor function or well-being when compared with placebo. Our data support the view that TOFR≥0.9 measured by electromyography signifies sufficient recovery of neuromuscular function. The trial is registered at ClinicalTrials.gov (NCT01101139). © The Author 2014. Published by Oxford University Press on behalf of the British Journal of Anaesthesia. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Household transmission of influenza A(H1N1pdm09 in the pandemic and post-pandemic seasons.

Directory of Open Access Journals (Sweden)

Itziar Casado

Full Text Available The transmission of influenza viruses occurs person to person and is facilitated by contacts within enclosed environments such as households. The aim of this study was to evaluate secondary attack rates and factors associated with household transmission of laboratory-confirmed influenza A(H1N1pdm09 in the pandemic and post-pandemic seasons.During the 2009-2010 and 2010-2011 influenza seasons, 76 sentinel physicians in Navarra, Spain, took nasopharyngeal and pharyngeal swabs from patients diagnosed with influenza-like illness. A trained nurse telephoned households of those patients who were laboratory-confirmed for influenza A(H1N1pdm09 to ask about the symptoms, risk factors and vaccination status of each household member.In the 405 households with a patient laboratory-confirmed for influenza A(H1N1pdm09, 977 susceptible contacts were identified; 16% of them (95% CI 14-19% presented influenza-like illness and were considered as secondary cases. The secondary attack rate was 14% in 2009-2010 and 19% in the 2010-2011 season (p=0.049, an increase that mainly affected persons with major chronic conditions. In the multivariate logistic regression analysis, the risk of being a secondary case was higher in the 2010-2011 season than in the 2009-2010 season (adjusted odds ratio: 1.72; 95% CI 1.17-2.54, and in children under 5 years, with a decreasing risk in older contacts. Influenza vaccination was associated with lesser incidence of influenza-like illness near to statistical significance (adjusted odds ratio: 0.29; 95% CI 0.08-1.03.The secondary attack rate in households was higher in the second season than in the first pandemic season. Children had a greater risk of infection. Preventive measures should be maintained in the second pandemic season, especially in high-risk persons.

Synthesis and electrical characterization of BaZr0.9Ho0.1O3-δ electrolyte ceramic for IT - SOFCs

Science.gov (United States)

Saini, Deepash S.; Singh, Lalit K.; Bhattacharya, D.

2018-04-01

A cost-effective modified combustion method using citric acid and glycine has recently been developed to synthesize high quality, and nanosized BaZr0.9Ho0.1O3 ceramic powder. BaZr0.9Ho0.1O3-δ ceramic powder was characterized by X-ray diffraction (XRD), high-resolution transmission electron microscopy (HRTEM) and field emission scanning electron microscopy (FESEM). XRD pattern of BaZr0.9Ho0.1O3-δ ceramic sintered at 1600 °C has shown that pure phase of BaZr0.9Ho0.1O3-δ with cubic Pm3¯m space group symmetry. The transmission electron microscopic investigation has shown that the particle size of the powder calcined at 1100 °C was in the range 30-80 nm. The FESEM image of sintered pellet at 1600 °C for 4 h reveals porous nature of BaZr0.9Ho0.1O3-δ with 83.7 relative density. Impedance analysis reveal three type relaxations in the temperature range 250 °C to 500 °C as studied at different frequencies over 100 Hz to 1 MHz in air. The grain boundary conductivity of BaZr0.9Ho0.1O3-δ ceramic is found lower then grain (bulk) conductivity due to core-space charge layer behavior in grain boundary.

Mõtteid tegevusetusdeliktist Riigikohtu praktika valguses. Riigikohtu kriminaalkolleegiumi otsus väärteoasjas 3-1-1-104-09 / Erkki Hirsnik

Index Scriptorium Estoniae

Hirsnik, Erkki, 1982-

2010-01-01

Riigikohtu lahendist 3-1-1-104-09: Edelaraudtee Infrastruktuuri AS kaitsja vandeadvokaat Leonid Tolstovi kassatsioon Pärnu Maakohtu 4. juuni 2009. a kohtuotsuse peale Edelaraudtee Infrastruktuuri AS väärteoasjas looduskaitseseaduse § 71 lg 2 järgi

Dicty_cDB: FC-AI09 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available FC (Link to library) FC-AI09 (Link to dictyBase) - - - Contig-U16149-1 FC-AI09Z (Li...nk to Original site) - - FC-AI09Z 591 - - - - Show FC-AI09 Library FC (Link to library) Clone ID FC-AI09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AI/FC-AI09Q.Seq.d/ Representative seq. ID FC-AI...09Z (Link to Original site) Representative DNA sequence >FC-AI09 (FC-AI09Q) /CSM/FC/FC-AI/FC-AI09Q.Seq....*tkl ik*ilifykiknnkkkkkk Frame B: ---gt*kvpeflailfkrmasrsvlwy*rcltkakkglkapqtltik

Electronic structure of Rh-based CuRh0.9Mg0.1O2 oxide thermoelectrics

Science.gov (United States)

Vilmercati, P.; Martin, E.; Cheney, C. Parks; Bondino, F.; Magnano, E.; Parmigiani, F.; Sasagawa, T.; Mannella, N.

2013-03-01

The electronic structure of the Rh-based CuRh0.9Mg0.1O2 oxide thermoelectric compound has been studied with a multitechnique approach consisting of photoemission, x-ray absorption, and x-ray emission spectroscopies. The data indicate that the region of the valence band in the proximity of the Fermi level is dominated by Rh-derived states. These findings outline the importance of the electronic structure of the Rh ions for the large thermoelectric power in CuRh0.9Mg0.1O2 at high temperature.

The association between serum biomarkers and disease outcome in influenza A(H1N1)pdm09 virus infection

DEFF Research Database (Denmark)

Davey, Richard T; Lynfield, Ruth; Dwyer, Dominic E

2013-01-01

Prospective studies establishing the temporal relationship between the degree of inflammation and human influenza disease progression are scarce. To assess predictors of disease progression among patients with influenza A(H1N1)pdm09 infection, 25 inflammatory biomarkers measured at enrollment wer...

Saltstone SDU6 Modeling Study

International Nuclear Information System (INIS)

Lee, Si Y.; Hyun, Sinjae

2013-01-01

A new disposal unit, designated as Saltstone Disposal Unit 6 (SDU6), is being designed for support of site accelerated closure goals and salt waste projections identified in the new Liquid Waste System Plan. The unit is a cylindrical disposal cell of 375 ft in diameter and 43 ft in height, and it has a minimum 30 million gallons of capacity. SRNL was requested to evaluate the impact of an increased grout placement height on the flow patterns radially spread on the floor and to determine whether grout quality is impacted by the height. The primary goals of the work are to develop the baseline Computational Fluid Dynamics (CFD) model and to perform the evaluations for the flow patterns of grout material in SDU6 as a function of elevation of grout discharge port and grout rheology. Two transient grout models have been developed by taking a three-dimensional multiphase CFD approach to estimate the domain size of the grout materials radially spread on the facility floor and to perform the sensitivity analysis with respect to the baseline design and operating conditions such as elevation height of the discharge port and fresh grout properties. For the CFD modeling calculations, air-grout Volume of Fluid (VOF) method combined with Bingham plastic and time-dependent grout models were used for examining the impact of fluid spread performance for the initial baseline configurations and to evaluate the impact of grout pouring height on grout quality. The grout quality was estimated in terms of the air volume fraction for the grout layer formed on the SDU6 floor, resulting in the change of grout density. The study results should be considered as preliminary scoping analyses since benchmarking analysis is not included in this task scope. Transient analyses with the Bingham plastic model were performed with the FLUENTTM code on the high performance parallel computing platform in SRNL. The analysis coupled with a transient grout aging model was performed by using ANSYS-CFX code

Some observations on the synthesis and electrolytic properties of (Ba1-xCax (M0.9Y0.1O3, M = Ce, Zr-based samples modified with calcium

Directory of Open Access Journals (Sweden)

Dudek Magdalena

2016-03-01

Full Text Available In this paper, the impact of partial substitution of calcium for barium in (Ba1-xCax (M0.9Y0.1 O3, M = Ce, Zr on physicochemical properties of the powders and sintered samples was investigated. The powders, with various contents of calcium (x = 0, 0.02, 0.05, 0.1, were prepared by means of thermal decomposition of organometallic precursors containing EDTA. All of the BaCeO3-based powders synthesised at 1100 °C were monophasic with a rhombohedral structure, however, completely cubic BaZrO3-based solid solutions were obtained at 1200 °C. A study of the sinterability of BaZr0.9Y0.1O3 and BaCe0.9Y0.1O3-based pellets was performed under non-isothermal conditions within a temperature range of 25 to 1200 °C. The partial substitution of barium for calcium in the (Ba1-xCax (M0.9Y0.1 O3, M = Ce, Zr solid solution improved the sinterability of the samples in comparison to the initial BaCe0.9Y0.1O3 or BaZr0.9Y0.1O3. The relative density of calcium-modified BaCe0.9Y0.1O3-based samples reached approximately 95 to 97 % after sintering at 1500 °C for 2 h in air. The same level of relative density was achieved after sintering calcium-modified BaZr0.9Y0.1O3 at 1600 °C for 2 h. Analysis of the electrical conductivity from both series of investigated materials showed that the highest ionic conductivity, in air and wet 5 % H2 in Ar, was attained for the compositions of x = 0.02 to 0.05 (Ba1-xCax(M0.9Y0.1O3, M = Zr, Ce. The oxygen reduction reaction on the interface Pt│BaM0.9Y0.1O3, M = Ce, Zr was investigated using Pt microelectrodes. Selected samples of (Ba1-xCax (M0.9Y0.1O3, M = Zr, Ce were tested as ceramic electrolytes in hydrogen-oxygen solid oxide fuel cells operating at temperatures of 700 to 850 °C.

Dicty_cDB: FC-BS09 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available FC (Link to library) FC-BS09 (Link to dictyBase) - - - Contig-U16215-1 FC-BS09Z (Li...nk to Original site) - - FC-BS09Z 626 - - - - Show FC-BS09 Library FC (Link to library) Clone ID FC-BS09 (Li.../dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-BS/FC-BS09Q.Seq.d/ Representative seq. ID FC-BS...09Z (Link to Original site) Representative DNA sequence >FC-BS09 (FC-BS09Q) /CSM/FC/FC-BS/FC-BS09Q.Seq....ignments: (bits) Value SSF360 (SSF360Q) /CSM/SS/SSF3-C/SSF360Q.Seq.d/ 854 0.0 FC-BS09 (FC-BS09Q) /CSM/FC/FC-BS/FC-BS

Results for the Third Quarter 2014 Tank 50 WAC slurry sample: Chemical and radionuclide contaminants

Energy Technology Data Exchange (ETDEWEB)

Crawford, Charles L. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2015-01-08

This report details the chemical and radionuclide contaminant results for the characterization of the 2014 Third Quarter sampling of Tank 50 for the Saltstone Waste Acceptance Criteria (WAC) in effect at that time.¹ Information from this characterization will be used by DWPF & Saltstone Facility Engineering (DSFE) to support the transfer of low-level aqueous waste from Tank 50 to the Salt Feed in the Saltstone Facility in Z-Area, where the waste will be immobilized. This information is also used to update the Tank 50 Waste Characterization System.

Pandemic vaccination strategies and influenza severe outcomes during the influenza A(H1N1)pdm09 pandemic and the post-pandemic influenza season

DEFF Research Database (Denmark)

Gil Cuesta, Julita; Aavitsland, Preben; Englund, Hélène

2016-01-01

During the 2009/10 influenza A(H1N1)pdm09 pandemic, the five Nordic countries adopted different approaches to pandemic vaccination. We compared pandemic vaccination strategies and severe influenza outcomes, in seasons 2009/10 and 2010/11 in these countries with similar influenza surveillance...... systems. We calculated the cumulative pandemic vaccination coverage in 2009/10 and cumulative incidence rates of laboratory confirmed A(H1N1)pdm09 infections, intensive care unit (ICU) admissions and deaths in 2009/10 and 2010/11. We estimated incidence risk ratios (IRR) in a Poisson regression model...... with the other countries. In 2010/11 Denmark had a significantly higher cumulative incidence of A(H1N1)pdm09 ICU admissions (IRR: 2.4; 95% confidence interval (CI): 1.9-3.0) and deaths (IRR: 8.3; 95% CI: 5.1-13.5). Compared with Denmark, the other countries had higher pandemic vaccination coverage...

(Z)-dimethylamino-1-(4-bromophenyl)-1-(3-pyridyl) propene (H 102/09), a new selective inhibitor of the neuronal 5-hydroxytryptamine uptake

International Nuclear Information System (INIS)

Ross, S.B.; Oegren, S.-O.; Renyi, A.L.

1976-01-01

The inhibition of the uptake of 3 H-(-)-noradrenaline (NA), 3 H-dopamine and 14 C-5-hydroxytryptamine (5-HT) in mouse brain slices by (Z)-3-dimethylamino-1-(4-bromophenyl)-1-(3-pyridyl)propene(H 102/09), desipramine and chlorimipramine and their releasing effect on the 3 H-amines previously accumulated in the slices were examined. The interactions with reserpine produced hypothermia and sedation and the 5-hydroxytryptophan (5-HTP) syndrome in mice were also studied. Due to the poor inhibitory activity on the NA uptake H 102/09 was a more selective inhii.or of the 5-HT uptake than was chlorimipramine, particularly after administration in vivo, where it was as potent as chlorimipramine (ED50=19μmol/kg intraperitoneally). In vitro chlorimipramine was 6 to 12 times more active than H 102/09. Desipramine was a very selective inhibitor of the NA uptake in vitro and in vivo. The compounds were generally more potent in inhibiting the uptake than in releasing the amines. However, in striatal slices the inhibition of DA uptake could be due to the releasing effect since the difference in potencies were small. The effect of desipramine on 5-HT uptake and that of H102/09 on NA uptake could also involve a release component. The 5-HTP syndrome was potentiated by H 102/09 and chlorimipramine but not by desipramine. The reserpine hypothermia but not the sedation was potently antagonized and reversed by desipramine and by chlorimipramine at high doses but not by H 102/09, suggested that NA but not 5-HT is involved in the hypothermic action of reserpine. (author)

Incidence and Epidemiology of Hospitalized Influenza Cases in Rural Thailand during the Influenza A (H1N1)pdm09 Pandemic, 2009–2010

Science.gov (United States)

Baggett, Henry C.; Chittaganpitch, Malinee; Thamthitiwat, Somsak; Prapasiri, Prabda; Naorat, Sathapana; Sawatwong, Pongpun; Ditsungnoen, Darunee; Olsen, Sonja J.; Simmerman, James M.; Srisaengchai, Prasong; Chantra, Somrak; Peruski, Leonard F.; Sawanpanyalert, Pathom; Maloney, Susan A.; Akarasewi, Pasakorn

2012-01-01

Background Data on the burden of the 2009 influenza pandemic in Asia are limited. Influenza A(H1N1)pdm09 was first reported in Thailand in May 2009. We assessed incidence and epidemiology of influenza-associated hospitalizations during 2009–2010. Methods We conducted active, population-based surveillance for hospitalized cases of acute lower respiratory infection (ALRI) in all 20 hospitals in two rural provinces. ALRI patients were sampled 1∶2 for participation in an etiology study in which nasopharyngeal swabs were collected for influenza virus testing by PCR. Results Of 7,207 patients tested, 902 (12.5%) were influenza-positive, including 190 (7.8%) of 2,436 children aged incidence of hospitalized influenza cases was 136 per 100,000, highest in ages 75 years (407 per 100,000). The incidence of influenza A(H1N1)pdm09 was 62 per 100,000 (214 per 100,000 in children <5 years). Eleven influenza-infected patients required mechanical ventilation, and four patients died, all adults with influenza A(H1N1)pdm09 (1) or H3N2 (3). Conclusions Influenza-associated hospitalization rates in Thailand during 2009–10 were substantial and exceeded rates described in western countries. Influenza A(H1N1)pdm09 predominated, but H3N2 also caused notable morbidity. Expanded influenza vaccination coverage could have considerable public health impact, especially in young children. PMID:23139802

Dielectric and magnetic properties of Ba-, La- and Pb-doped Bi0.8Gd0.1M0.1Fe0.9Ti0.1O3 perovskite ceramics

Directory of Open Access Journals (Sweden)

Radheshyam Rai

2014-04-01

Full Text Available The multiferroic Bi0.8Gd0.1M0.1Fe0.9Ti0.1O3, (where M = Ba (DB, La (DL and Pb (DP has been synthesized by using solid-state reaction technique. Effects of Ba, La and Pb substitution on the structure, electrical and ferroelectric properties of Bi0.8Gd0.1M0.1Fe0.9Ti0.1O3 samples have been studied by performing X-ray diffraction, dielectric and magnetic measurements. The crystal structures of the ceramic samples have a tetragonal phase. The vibrating sample magnetometer (VSM measurement shows a significant change in the magnetic properties of Ba-doped Bi0.8Gd0.1M0.1Fe0.9Ti0.1O3 as compared to La- and Pb-doped ceramics. It is seen that coercive field (HC and remanent magnetization (MR increases with Ba-doped ceramics but decreases for La- and Pb-doped ceramics.

Magnetocaloric response of La 0.70 Ca 0.1 Sr 0.2 Fe 0.1 Mn 0.9 O 3 ...

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science; Volume 38; Issue 1. Magnetocaloric response of La0.70Ca0.1Sr0.2Fe0.1Mn0.9O3 pervoskite for magnetic refrigeration. M S Anwar Faheem Ahmed Bon Heun Koo. Volume 38 Issue 1 February 2015 pp 101-104 ...

Whole genome characterization of human influenza A(H1N1)pdm09 viruses isolated from Kenya during the 2009 pandemic.

Science.gov (United States)

Gachara, George; Symekher, Samuel; Otieno, Michael; Magana, Japheth; Opot, Benjamin; Bulimo, Wallace

2016-06-01

An influenza pandemic caused by a novel influenza virus A(H1N1)pdm09 spread worldwide in 2009 and is estimated to have caused between 151,700 and 575,400 deaths globally. While whole genome data on new virus enables a deeper insight in the pathogenesis, epidemiology, and drug sensitivities of the circulating viruses, there are relatively limited complete genetic sequences available for this virus from African countries. We describe herein the full genome analysis of influenza A(H1N1)pdm09 viruses isolated in Kenya between June 2009 and August 2010. A total of 40 influenza A(H1N1)pdm09 viruses isolated during the pandemic were selected. The segments from each isolate were amplified and directly sequenced. The resulting sequences of individual gene segments were concatenated and used for subsequent analysis. These were used to infer phylogenetic relationships and also to reconstruct the time of most recent ancestor, time of introduction into the country, rates of substitution and to estimate a time-resolved phylogeny. The Kenyan complete genome sequences clustered with globally distributed clade 2 and clade 7 sequences but local clade 2 viruses did not circulate beyond the introductory foci while clade 7 viruses disseminated country wide. The time of the most recent common ancestor was estimated between April and June 2009, and distinct clusters circulated during the pandemic. The complete genome had an estimated rate of nucleotide substitution of 4.9×10(-3) substitutions/site/year and greater diversity in surface expressed proteins was observed. We show that two clades of influenza A(H1N1)pdm09 virus were introduced into Kenya from the UK and the pandemic was sustained as a result of importations. Several closely related but distinct clusters co-circulated locally during the peak pandemic phase but only one cluster dominated in the late phase of the pandemic suggesting that it possessed greater adaptability. Copyright © 2016 Elsevier B.V. All rights reserved.

Socioeconomic Factors Influencing Hospitalized Patients with Pneumonia Due to Influenza A(H1N1)pdm09 in Mexico

Science.gov (United States)

Manabe, Toshie; Higuera Iglesias, Anjarath Lorena; Vazquez Manriquez, Maria Eugenia; Martinez Valadez, Eduarda Leticia; Ramos, Leticia Alfaro; Izumi, Shinyu; Takasaki, Jin; Kudo, Koichiro

2012-01-01

Background In addition to clinical aspects and pathogen characteristics, people's health-related behavior and socioeconomic conditions can affect the occurrence and severity of diseases including influenza A(H1N1)pdm09. Methodology and Principal Findings A face-to-face interview survey was conducted in a hospital in Mexico City at the time of follow-up consultation for hospitalized patients with pneumonia due to influenza virus infection. In all, 302 subjects were enrolled and divided into two groups based on the period of hospitalization. Among them, 211 tested positive for influenza A(H1N1)pdm09 virus by real-time reverse-transcriptase-polymerase-chain-reaction during the pandemic period (Group-pdm) and 91 tested positive for influenza A virus in the post-pandemic period (Group-post). All subjects were treated with oseltamivir. Data on the demographic characteristics, socioeconomic status, living environment, and information relating to A(H1N1)pdm09, and related clinical data were compared between subjects in Group-pdm and those in Group-post. The ability of household income to pay for utilities, food, and health care services as well as housing quality in terms of construction materials and number of rooms revealed a significant difference: Group-post had lower socioeconomic status than Group-pdm. Group-post had lower availability of information regarding H1N1 influenza than Group-pdm. These results indicate that subjects in Group-post had difficulty receiving necessary information relating to influenza and were more likely to be impoverished than those in Group-pdm. Possible factors influencing time to seeking health care were number of household rooms, having received information on the necessity of quick access to health care, and house construction materials. Conclusions Health-care-seeking behavior, poverty level, and the distribution of information affect the occurrence and severity of pneumonia due to H1N1 virus from a socioeconomic point of view. These

Doping effects on the relaxation of frustration and magnetic properties of YMn0.9Cu0.1O3

Science.gov (United States)

Xiao, L. X.; Xia, Z. C.; Wang, X.; Ni, Y.; Yu, W.; Shi, L. R.; Jin, Z.; Xiao, G. L.

2017-12-01

The crystal structure and magnetic properties of hexagonal YMn0.9Cu0.1O3 single crystal are systematically investigated. The refinement results of XRD show the lattice constant decreases, which is unusually due to the doped Cu2+ ion has a larger ionic radius than the Mn3+ ions. The XPS results show that the coexistence of Mn2+, Mn3+ and Mn4+ ions in YMn0.9Cu0.1O3 single crystal. Magnetization measurements show that Cu doped YMn0.9Cu0.1O3 and parent YMnO3 have almost the same antiferromagnetic transition temperature TN, which indicates the AFM interaction is robust in the geometry frustrated system. Because doping directly destroy some of the Mn3+ ions nets, the relaxation of frustration of Mn in-plane 2D triangular geometry network leads to the significantly decrease of Mn3+ ions AFM interaction. In addition, the coexistence and competition between the ferromagnetic and antiferromagnetic interactions among the Mn2+, Mn3+ and Mn4+ ions lead to a complicated and irreversible magnetization behavior in YMn0.9Cu0.1O3 single crystal.

Molecular epidemiology of influenza A(H1N1pdm09 viruses from Pakistan in 2009-2010.

Directory of Open Access Journals (Sweden)

Uzma Bashir Aamir

Full Text Available In early 2009, a novel influenza A(H1N1 virus that emerged in Mexico and United States rapidly disseminated worldwide. The spread of this virus caused considerable morbidity with over 18000 recorded deaths. The new virus was found to be a reassortant containing gene segments from human, avian and swine influenza viruses.The first case of human infection with A(H1N1pdm09 in Pakistan was detected on 18(th June 2009. Since then, 262 laboratory-confirmed cases have been detected during various outbreaks with 29 deaths (as of 31(st August 2010. The peak of the epidemic was observed in December with over 51% of total respiratory cases positive for influenza. Representative isolates from Pakistan viruses were sequenced and analyzed antigenically. Sequence analysis of genes coding for surface glycoproteins HA and NA showed high degree of high levels of sequence identity with corresponding genes of regional viruses circulating South East Asia. All tested viruses were sensitive to Oseltamivir in the Neuraminidase Inhibition assays.Influenza A(H1N1pdm09 viruses from Pakistan form a homogenous group of viruses. Their HA genes belong to clade 7 and show antigenic profile similar to the vaccine strain A/California/07/2009. These isolates do not show any amino acid changes indicative of high pathogenicity and virulence. It is imperative to continue monitoring of these viruses for identification of potential variants of high virulence or drug resistance.

Enhanced Electrochemical Activity and Chromium Tolerance of the Nucleation-Agent-Free La2Ni0.9Fe0.1O4+δ Cathode by Gd0.1Ce0.9O1.95 Incorporation

Science.gov (United States)

Ling, Yihan; Xie, Huixin; Liu, Zijing; Du, Xiaoni; Chen, Hui; Ou, Xuemei; Zhao, Ling; Budiman, Riyan Achmad

2018-03-01

For the sake of improving the electrochemical activity and chromium tolerance of the K2NiF4-type oxide, La2NiO4+δ (LNO), with nonnucleation agents like Mn and Sr elements, the electrochemical performance and degradation were comparatively studied at two cathodes La2Ni0.9Fe0.1O4+δ (LNF) and LNF-40wt%Gd0.1Ce0.9O1.95 (LNF-GDC) on the GDC electrolyte, where 5wt%Cr2O3 incorporation provides Cr-containing atmosphere. Compared with non-doped LNO, LNF shows a higher interstitial oxygen concentration (δ = 0.298) and a lower electrical conductivity, where bivalent Ni ion, {Ni}_{Ni}^{ × } , and trivalent Ni ion, {Ni}_{Ni}^{ \\cdot } , and trivalent Fe ion on Ni-site, {Fe}_{Ni}^{ \\cdot } , were observed from the XPS measurements. LNF-GDC shows greatly reduced interfacial polarization resistances (Rp), which are only half of those of LNF, indicating a better electrochemical performance. More importantly, no significant degradation of LNF-GDC in performance has been observed under exposure of Cr-containing atmosphere at 700 °C for 350 h, while Rp of LNF increased by nearly 20%, suggesting LNF by GDC incorporation can enhance the electrochemical performance as well as chromium tolerance for intermediate temperature solid oxide fuel cells (IT-SOFCs).

Riigikohtu kriminaalkolleegiumi 24. aprilli 2009. a otsus kriminaalasjas 3-1-1-10-09 / Margus Mõttus

Index Scriptorium Estoniae

Mõttus, Margus

2009-01-01

Riigikohtu otsusest 3-1-1-10-09: Livio Karro kaitsjate A. Pilve ja R. Otsa, Margus Nei kaitsja T. Pilve, Vladimir Kudrjavtsevi kaitsja A. Lubergi, M. Loorpuu kaitsja T. Ploomipuu, R. Väinoja kaitsja H. Tombergi ja K. Kaunispaiga kaitsja A. Gorkini kassatsioonid kriminaalasjas L. Karro süüdistuses KarS § 294 lg 2 p-de 1 ja 3; § 294 lg 2 p-de 1 ja 3 ja § 22 lg 2 ning § 296 lg 2 p-de 1 ja 2 järgi, M. Nei ja V. Kudrjavtsevi süüdistuses KarS § 294 lg 2 p 3 järgi, R. Väinoja süüdistuses KarS § 298 lg 1 järgi ja K. Kaunispaiga süüdistuses KarS § 298 lg 1 ja § 22 lg 2 järgi

Socioeconomic factors influencing hospitalized patients with pneumonia due to influenza A(H1N1pdm09 in Mexico.

Directory of Open Access Journals (Sweden)

Toshie Manabe

Full Text Available BACKGROUND: In addition to clinical aspects and pathogen characteristics, people's health-related behavior and socioeconomic conditions can affect the occurrence and severity of diseases including influenza A(H1N1pdm09. METHODOLOGY AND PRINCIPAL FINDINGS: A face-to-face interview survey was conducted in a hospital in Mexico City at the time of follow-up consultation for hospitalized patients with pneumonia due to influenza virus infection. In all, 302 subjects were enrolled and divided into two groups based on the period of hospitalization. Among them, 211 tested positive for influenza A(H1N1pdm09 virus by real-time reverse-transcriptase-polymerase-chain-reaction during the pandemic period (Group-pdm and 91 tested positive for influenza A virus in the post-pandemic period (Group-post. All subjects were treated with oseltamivir. Data on the demographic characteristics, socioeconomic status, living environment, and information relating to A(H1N1pdm09, and related clinical data were compared between subjects in Group-pdm and those in Group-post. The ability of household income to pay for utilities, food, and health care services as well as housing quality in terms of construction materials and number of rooms revealed a significant difference: Group-post had lower socioeconomic status than Group-pdm. Group-post had lower availability of information regarding H1N1 influenza than Group-pdm. These results indicate that subjects in Group-post had difficulty receiving necessary information relating to influenza and were more likely to be impoverished than those in Group-pdm. Possible factors influencing time to seeking health care were number of household rooms, having received information on the necessity of quick access to health care, and house construction materials. CONCLUSIONS: Health-care-seeking behavior, poverty level, and the distribution of information affect the occurrence and severity of pneumonia due to H1N1 virus from a socioeconomic

Novel reassortant influenza A(H1N2) virus derived from A(H1N1)pdm09 virus isolated from swine, Japan, 2012.

Science.gov (United States)

Kobayashi, Miho; Takayama, Ikuyo; Kageyama, Tsutomu; Tsukagoshi, Hiroyuki; Saitoh, Mika; Ishioka, Taisei; Yokota, Yoko; Kimura, Hirokazu; Tashiro, Masato; Kozawa, Kunihisa

2013-12-01

We isolated a novel influenza virus A(H1N2) strain from a pig on January 13, 2012, in Gunma Prefecture, Japan. Phylogenetic analysis showed that the strain was a novel type of double-reassortant virus derived from the swine influenza virus strains H1N1pdm09 and H1N2, which were prevalent in Gunma at that time.

Influenza risk management: lessons learned from an A(H1N1) pdm09 outbreak investigation in an operational military setting.

Science.gov (United States)

Farrell, Margaret; Sebeny, Peter; Klena, John D; Demattos, Cecilia; Pimentel, Guillermo; Turner, Mark; Joseph, Antony; Espiritu, Jennifer; Zumwalt, John; Dueger, Erica

2013-01-01

At the onset of an influenza pandemic, when the severity of a novel strain is still undetermined and there is a threat of introduction into a new environment, e.g., via the deployment of military troops, sensitive screening criteria and conservative isolation practices are generally recommended. In response to elevated rates of influenza-like illness among U.S. military base camps in Kuwait, U.S. Naval Medical Research Unit No. 3 partnered with local U.S. Army medical units to conduct an A(H1N1) pdm09 outbreak investigation. Initial clinical data and nasal specimens were collected via the existent passive surveillance system and active surveillance was conducted using a modified version of the World Health Organization/U.S. Centers for Disease Control and Prevention influenza-like illness case definition [fever (T > 100.5˚F/38˚C) in addition to cough and/or sore throat in the previous 72 hours] as the screening criteria. Samples were tested via real-time reverse-transcription PCR and sequenced for comparison to global A(H1N1) pdm09 viruses from the same time period. The screening criteria used in Kuwait proved insensitive, capturing only 16% of A(H1N1) pdm09-positive individuals. While still not ideal, using cough as the sole screening criteria would have increased sensitivity to 73%. The results of and lessons learned from this outbreak investigation suggest that pandemic influenza risk management should be a dynamic process (as information becomes available regarding true attack rates and associated mortality, screening and isolation criteria should be re-evaluated and revised as appropriate), and that military operational environments present unique challenges to influenza surveillance.

Clinical and Immune Responses to Inactivated Influenza A(H1N1)pdm09 Vaccine in Children

Science.gov (United States)

Kotloff, Karen L.; Halasa, Natasha B.; Harrison, Christopher J.; Englund, Janet A.; Walter, Emmanuel B.; King, James C.; Creech, C. Buddy; Healy, Sara A.; Dolor, Rowena J.; Stephens, Ina; Edwards, Kathryn M.; Noah, Diana L.; Hill, Heather; Wolff, Mark

2014-01-01

Background As the influenza AH1N1 pandemic emerged in 2009, children were found to experience high morbidity and mortality and were prioritized for vaccination. This multicenter, randomized, double-blind, age-stratified trial assessed the safety and immunogenicity of inactivated influenza A(H1N1)pdm09 vaccine in healthy children aged 6 months to 17 years. Methods Children received two doses of approximately 15 μg or 30 μg hemagglutin antigen 21 days apart. Reactogenicity was assessed for 8 days after each dose, adverse events through day 42, and serious adverse events or new-onset chronic illnesses through day 201. Serum hemagglutination inhibition (HAI) titers were measured on days 0 (pre-vaccination), 8, 21, 29, and 42. Results A total of 583 children received the first dose and 571 received the second dose of vaccine. Vaccinations were generally well-tolerated and no related serious adverse events were observed. The 15 μg dosage elicited a seroprotective HAI (≥1:40) in 20%, 47%, and 93% of children in the 6-35 month, 3-9 year, and 10-17 year age strata 21 days after dose 1 and in 78%, 82%, and 98% of children 21 days after dose 2, respectively. The 30 μg vaccine dosage induced similar responses. Conclusions The inactivated influenza A(H1N1)pdm09 vaccine exhibited a favorable safety profile at both dosage levels. While a single 15 or 30 μg dose induced seroprotective antibody responses in most 10-17 year olds, younger children required 2 doses, even when receiving dosages 4-6 fold higher than recommended. Well-tolerated vaccines are needed that induce immunity after a single dose for use in young children during influenza pandemics. PMID:25222307

Enrichment of variations in KIR3DL1/S1 and KIR2DL2/L3 among H1N1/09 ICU patients: an exploratory study.

Directory of Open Access Journals (Sweden)

David La

Full Text Available BACKGROUND: Infection by the pandemic influenza A (H1N1/09 virus resulted in significant pathology among specific ethnic groups worldwide. Natural Killer (NK cells are important in early innate immune responses to viral infections. Activation of NK cells, in part, depend on killer-cell immunoglobulin-like receptors (KIR and HLA class I ligand interactions. To study factors involved in NK cell dysfunction in overactive immune responses to H1N1 infection, KIR3DL1/S1 and KIR2DL2/L3 allotypes and cognate HLA ligands of H1N1/09 intensive-care unit (ICU patients were determined. METHODOLOGY AND FINDINGS: KIR3DL1/S1, KIR2DL2/L3, and HLA -B and -C of 51 H1N1/09 ICU patients and 105 H1N1-negative subjects (St. Theresa Point, Manitoba were characterized. We detected an increase of 3DL1 ligand-negative pairs (3DL1/S1(+ Bw6(+ Bw4(-, and a lack of 2DL1 HLA-C2 ligands, among ICU patients. They were also significantly enriched for 2DL2/L3 ligand-positive pairs (PVA, P=0.024, Pc=0.047; Odds Ratio:2.563, CI95%:1.109-5.923, 3DL1*00101 (Ab>VA, PSTh, P=0.034, Pc=0.268, and 3DL1*029 (Ab>STh, P=0.039, Pc=0.301. Aboriginal patients ligand-positive for 3DL1/S1 and 2DL1 had the lowest probabilities of death (R(d (R(d=28%, compared to patients that were 3DL1/S1 ligand-negative (R(d=52% or carried 3DL1*029 (R(d=52%. Relative to Caucasoids (CA, two allotypes were enriched among non-aboriginal ICU patients (NAb: 3DL1*00401 (NAb>CA, P<0.001, Pc<0.001 and 3DL1*01502 (CA1/S1, 2DL2/L3, and 2DL1 had the lowest probabilities of death (R(d=36%, compared to subjects with 3DL1*01502 (R(d=48% and/or 3DL1*00401 (R(d=58%. CONCLUSIONS: Specific KIR3DL1/S1 allotypes, 3DL1/S1 and 2DL1 ligand-negative pairs, and 2DL2/L3 ligand-positive pairs were enriched among ICU patients. This suggests a possible association with NK cell dysfunction in patients with overactive immune responses to H1N1/09, leading to

NS Segment of a 1918 Influenza A Virus-Descendent Enhances Replication of H1N1pdm09 and Virus-Induced Cellular Immune Response in Mammalian and Avian Systems

Science.gov (United States)

Petersen, Henning; Mostafa, Ahmed; Tantawy, Mohamed A.; Iqbal, Azeem A.; Hoffmann, Donata; Tallam, Aravind; Selvakumar, Balachandar; Pessler, Frank; Beer, Martin; Rautenschlein, Silke; Pleschka, Stephan

2018-01-01

The 2009 pandemic influenza A virus (IAV) H1N1 strain (H1N1pdm09) has widely spread and is circulating in humans and swine together with other human and avian IAVs. This fact raises the concern that reassortment between H1N1pdm09 and co-circulating viruses might lead to an increase of H1N1pdm09 pathogenicity in different susceptible host species. Herein, we explored the potential of different NS segments to enhance the replication dynamics, pathogenicity and host range of H1N1pdm09 strain A/Giessen/06/09 (Gi-wt). The NS segments were derived from (i) human H1N1- and H3N2 IAVs, (ii) highly pathogenic- (H5- or H7-subtypes) or (iii) low pathogenic avian influenza viruses (H7- or H9-subtypes). A significant increase of growth kinetics in A549 (human lung epithelia) and NPTr (porcine tracheal epithelia) cells was only noticed in vitro for the reassortant Gi-NS-PR8 carrying the NS segment of the 1918-descendent A/Puerto Rico/8/34 (PR8-wt, H1N1), whereas all other reassortants showed either reduced or comparable replication efficiencies. Analysis using ex vivo tracheal organ cultures of turkeys (TOC-Tu), a species susceptible to IAV H1N1 infection, demonstrated increased replication of Gi-NS-PR8 compared to Gi-wt. Also, Gi-NS-PR8 induced a markedly higher expression of immunoregulatory and pro-inflammatory cytokines, chemokines and interferon-stimulated genes in A549 cells, THP-1-derived macrophages (dHTP) and TOC-Tu. In vivo, Gi-NS-PR8 induced an earlier onset of mortality than Gi-wt in mice, whereas, 6-week-old chickens were found to be resistant to both viruses. These data suggest that the specific characteristics of the PR8 NS segments can impact on replication, virus induced cellular immune responses and pathogenicity of the H1N1pdm09 in different avian and mammalian host species. PMID:29623073

The comparative clinical course of pregnant and non-pregnant women hospitalised with influenza A(H1N1pdm09 infection.

Directory of Open Access Journals (Sweden)

Gayle P Dolan

Full Text Available The Influenza Clinical Information Network (FLU-CIN was established to gather detailed clinical and epidemiological information about patients with laboratory confirmed A(H1N1pdm09 infection in UK hospitals. This report focuses on the clinical course and outcomes of infection in pregnancy.A standardised data extraction form was used to obtain detailed clinical information from hospital case notes and electronic records, for patients with PCR-confirmed A(H1N1pdm09 infection admitted to 13 sentinel hospitals in five clinical 'hubs' and a further 62 non-sentinel hospitals, between 11th May 2009 and 31st January 2010.Outcomes were compared for pregnant and non-pregnant women aged 15-44 years, using univariate and multivariable techniques.Of the 395 women aged 15-44 years, 82 (21% were pregnant; 73 (89% in the second or third trimester. Pregnant women were significantly less likely to exhibit severe respiratory distress at initial assessment (OR = 0.49 (95% CI: 0.30-0.82, require supplemental oxygen on admission (OR = 0.40 (95% CI: 0.20-0.80, or have underlying co-morbidities (p-trend <0.001. However, they were equally likely to be admitted to high dependency (Level 2 or intensive care (Level 3 and/or to die, after adjustment for potential confounders (adj. OR = 0.93 (95% CI: 0.46-1.92. Of 11 pregnant women needing Level 2/3 care, 10 required mechanical ventilation and three died.Since the expected prevalence of pregnancy in the source population was 6%, our data suggest that pregnancy greatly increased the likelihood of hospital admission with A(H1N1pdm09. Pregnant women were less likely than non-pregnant women to have respiratory distress on admission, but severe outcomes were equally likely in both groups.

Kuritegeliku ühenduse mõiste : ne bis in idem põhimõte. Riigikohtu kriminaalkolleegiumi otsus asjas 3-1-1-57-09 / Anneli Soo

Index Scriptorium Estoniae

Soo, Anneli, 1984-

2010-01-01

Riigikohtu otsusest asjas 3-1-1-57-09: N. Kohtovi kaitsja vandeadvokaat Tarmo Pilve kassatsioon Tartu Ringkonnakohtu 18. veebruari 2009. a kohtuotsuse peale kriminaalasi N. Kohtovi süüdistuses KarS § 256 lg 1, § 120 ja § 121 järgi

Densification and Grain Growth during Early-stage Sintering of Ce0.9Gd0.1O1.95-δ in Reducing Atmosphere

DEFF Research Database (Denmark)

He, Zeming; Yuan, Hao; Glasscock, Julie

2010-01-01

The present work investigates the processes of densification and grain growth of Ce0.9Gd0.1O1.95-δ (CGO10) during sintering in reducing atmosphere. Sintering variables were experimentally characterized and analyzed using defect chemistry and sintering constitutive laws. Based on the achieved...

Association between the 2008-09 seasonal influenza vaccine and pandemic H1N1 illness during Spring-Summer 2009: four observational studies from Canada.

Directory of Open Access Journals (Sweden)

Danuta M Skowronski

2010-04-01

Full Text Available In late spring 2009, concern was raised in Canada that prior vaccination with the 2008-09 trivalent inactivated influenza vaccine (TIV was associated with increased risk of pandemic influenza A (H1N1 (pH1N1 illness. Several epidemiologic investigations were conducted through the summer to assess this putative association.(1 test-negative case-control design based on Canada's sentinel vaccine effectiveness monitoring system in British Columbia, Alberta, Ontario, and Quebec; (2 conventional case-control design using population controls in Quebec; (3 test-negative case-control design in Ontario; and (4 prospective household transmission (cohort study in Quebec. Logistic regression was used to estimate odds ratios for TIV effect on community- or hospital-based laboratory-confirmed seasonal or pH1N1 influenza cases compared to controls with restriction, stratification, and adjustment for covariates including combinations of age, sex, comorbidity, timeliness of medical visit, prior physician visits, and/or health care worker (HCW status. For the prospective study risk ratios were computed. Based on the sentinel study of 672 cases and 857 controls, 2008-09 TIV was associated with statistically significant protection against seasonal influenza (odds ratio 0.44, 95% CI 0.33-0.59. In contrast, estimates from the sentinel and three other observational studies, involving a total of 1,226 laboratory-confirmed pH1N1 cases and 1,505 controls, indicated that prior receipt of 2008-09 TIV was associated with increased risk of medically attended pH1N1 illness during the spring-summer 2009, with estimated risk or odds ratios ranging from 1.4 to 2.5. Risk of pH1N1 hospitalization was not further increased among vaccinated people when comparing hospitalized to community cases.Prior receipt of 2008-09 TIV was associated with increased risk of medically attended pH1N1 illness during the spring-summer 2009 in Canada. The occurrence of bias (selection, information or

Areva: 1. quarter 2015 revenue down, at euros 1.762 bn: -1.1% vs. March 2014 (-0.9% like for like)

International Nuclear Information System (INIS)

Repaire, Philippine du

2015-01-01

In the 1. quarter of 2015, AREVA generated consolidated revenue of 1.762 billion euros, representing a decrease of 1.1% (-0.9% like for like) compared with the same period in 2014. Foreign exchange had a positive impact of 36 million euros over the period, while consolidation scope had a negative impact of 39 million euros. At March 31, 2015, the group had 47.520 billion euros in backlog, a 1.4% increase in relation to December 31, 2014 (46.866 billion euros) reflecting a favorable foreign exchange impact. It should be noted that the backlog does not include the amount from agreements signed with EDF in October 2013 for the EPR reactors project at Hinkley Point in the United Kingdom or for the related fuel. The order intake totaled 881 million euros in the 1. quarter of 2015, an increase compared with the 1. quarter of 2014 (668 million euros)

A subregional analysis of epidemiologic and genetic characteristics of influenza A(H1N1)pdm09 in Africa: Senegal, Cape Verde, Mauritania, and Guinea, 2009-2010.

Science.gov (United States)

Dia, Ndongo; Ndiaye, Mbayame Niang; Monteiro, Maria de Lourdes; Koivogui, Lamine; Bara, Mohamed Ould; Diop, Ousmane M

2013-05-01

During the pandemic 2009 episode, we conducted laboratory-based surveillance in four countries from West Africa: Senegal, Mauritania, Cape Verde, and Guinea. Specimens were obtained from 3,155 patients: 2,264 patients from Senegal, 498 patients from Cape Verde, 227 patients from Mauritania, and 166 patients from Guinea; 911 (28.9%) patients were positive for influenza, 826 (90.7%) patients were positive for influenza A, and 85 (9.3%) patients were positive for influenza B. Among the influenza A positives, 503 (60.9%) positives were H1N1pdm09, 314 (38.0%) positives were H3N2, and 9 (1.1%) positives were seasonal H1N1. The highest detection rate for seasonal influenza viruses (17.1%) occurred in the 5-14 years age group. However, for A(H1N1)pdm09, the detection rate was highest in the 15-24 years age group (35.8%). Based on the present study data, the timeline of detection of A(H1N1)pdm09 viruses in these four countries should be Cape Verde, Guinea, Mauritania, and finally, Senegal. Genetic and antigenic analyses were performed in some isolates.

Electrochemical Activity of a La0.9Ca0.1Co1−xFexO3 Catalyst for a Zinc Air Battery Electrode

Directory of Open Access Journals (Sweden)

Seungwook Eom

2015-01-01

Full Text Available The optimum composition of cathode catalyst has been studied for rechargeable zinc air battery application. La0.9Ca0.1Co1−xFexO3  (x=0–0.4 perovskite powders were prepared using the citrate method. The substitution ratio of Co2+ with Fe3+ cations was controlled in the range of 0–0.4. The optimum substitution ratio of Fe3+ cations was determined by electrochemical measurement of the air cathode composed of the catalyst, polytetrafluoroethylene (PTFE binder, and Vulcan XC-72 carbon. The substitution by Fe enhanced the electrochemical performances of the catalysts. Considering oxygen reduction/evolution reactions and cyclability, we achieved optimum substitution level of x=0.1 in La0.9Ca0.1Co1−xFexO3.

ICU-treated influenza A(H1N1 pdm09 infections more severe post pandemic than during 2009 pandemic: a retrospective analysis

Directory of Open Access Journals (Sweden)

Pekka Ylipalosaari

2017-11-01

Full Text Available Abstract Background We compared in a single mixed intensive care unit (ICU patients with influenza A(H1N1 pdm09 between pandemic and postpandemic periods. Methods Retrospective analysis of prospectively collected data in 2009–2016. Data are expressed as median (25th–75th percentile or number (percentile. Results Seventy-six influenza A(H1N1 pdm09 patients were admitted to the ICU: 16 during the pandemic period and 60 during the postpandemic period. Postpandemic patients were significantly older (60 years vs. 43 years, p < 0.001 and less likely to have epilepsy or other neurological diseases compared with pandemic patients (5 [8.3%] vs. 6 [38%], respectively; p = 0.009. Postpandemic patients were more likely than pandemic patients to have cardiovascular disease (24 [40%] vs. 1 [6%], respectively; p = 0.015, and they had higher scores on APACHE II (17 [13–22] vs. 14 [10–17], p = 0.002 and SAPS II (40 [31–51] vs. 31 [25–35], p = 0.002 upon admission to the ICU. Postpandemic patients had higher maximal SOFA score (9 [5–12] vs. 5 [4–9], respectively; p = 0.03 during their ICU stay. Postpandemic patients had more often septic shock (40 [66.7%] vs. 8 [50.0%], p = 0.042, and longer median hospital stays (15.0 vs. 8.0 days, respectively; p = 0.006. During 2015–2016, only 18% of the ICU- treated patients had received seasonal influenza vaccination. Conclusions Postpandemic ICU-treated A(H1N1 pdm09 influenza patients were older and developed more often septic shock and had longer hospital stays than influenza patients during the 2009 pandemic.

Correlation between thermal vibration and conductivity in La0.9Sr0.1B0.9Mg0.1O3-δ, B=Al, Ga and Sc

DEFF Research Database (Denmark)

Lybye, Dorthe; Nielsen, K.

2004-01-01

In order to obtain abetter understanding of the oxide ion conductivity in perovskites, the structure of La(0.9)Sr(0.1)Bo(9)Mg(0.1)O(3 - delta), B=Al, Ga and Sc, have been investigated by time-of-flight powder neutron diffraction at room temperature, 270, 470, 750, 850 and 950 degreesC. For all...... compounds, at all temperatures, structural and anisotropic thermal parameters were refined by full profile Rietveld methods to weighted profile R values less than 0.063. The changes in difference nuclear densities, Deltarho, due to changes in temperature are illustrated by difference density maps around...... the atoms. The observed difference densities are described mainly by zeroth- and second-order spherical harmonics (quadrupolar functions), the nature of which vary with atomic site. The difference density maps provide a direct picture of the average in space and time of changes in atomic thermal vibrations...

Natural co-infection of influenza A/H3N2 and A/H1N1pdm09 viruses resulting in a reassortant A/H3N2 virus.

Science.gov (United States)

Rith, Sareth; Chin, Savuth; Sar, Borann; Y, Phalla; Horm, Srey Viseth; Ly, Sovann; Buchy, Philippe; Dussart, Philippe; Horwood, Paul F

2015-12-01

Despite annual co-circulation of different subtypes of seasonal influenza, co-infections between different viruses are rarely detected. These co-infections can result in the emergence of reassortant progeny. We document the detection of an influenza co-infection, between influenza A/H3N2 with A/H1N1pdm09 viruses, which occurred in a 3 year old male in Cambodia during April 2014. Both viruses were detected in the patient at relatively high viral loads (as determined by real-time RT-PCR CT values), which is unusual for influenza co-infections. As reassortment can occur between co-infected influenza A strains we isolated plaque purified clonal viral populations from the clinical material of the patient infected with A/H3N2 and A/H1N1pdm09. Complete genome sequences were completed for 7 clonal viruses to determine if any reassorted viruses were generated during the influenza virus co-infection. Although most of the viral sequences were consistent with wild-type A/H3N2 or A/H1N1pdm09, one reassortant A/H3N2 virus was isolated which contained an A/H1N1pdm09 NS1 gene fragment. The reassortant virus was viable and able to infect cells, as judged by successful passage in MDCK cells, achieving a TCID50 of 10(4)/ml at passage number two. There is no evidence that the reassortant virus was transmitted further. The co-infection occurred during a period when co-circulation of A/H3N2 and A/H1N1pdm09 was detected in Cambodia. It is unclear how often influenza co-infections occur, but laboratories should consider influenza co-infections during routine surveillance activities. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

Polymorphism of HLA class I and class II alleles in influenza A(H1N1)pdm09 virus infected population of Assam, Northeast India.

Science.gov (United States)

Dutta, Mousumi; Dutta, Prafulla; Medhi, Subhash; Borkakoty, Biswajyoti; Biswas, Dipankar

2018-05-01

Human leucocyte antigen (HLA) represents one of the most highly polymorphic systems which plays a central role in the immune response. Genetic polymorphism of HLA in influenza A(H1N1)pdm09 infected population may be an important factor in disease progression and severity that needs further probing. In this study, a total of 110 Influenza like illness patients were recruited from the population of Assam, Northeast India, from which 35 cases infected by A(H1N1)pdm09 viruses and 35 controls were typed for HLA-A, B and DRB1 locus by PCR-SSP method. A total of seven alleles of HLA-A, 16 alleles of HLA-B, and 11 alleles of HLA-DRB1 locus were identified. The most common alleles within each locus in cases were HLA-A*11 (85.71%, P = 0.046), HLA-B*35 (25%, P = 0.0001), and HLA-DRB1*15 (49.35%,  P = 0.133) as compared to the controls, HLA-A*11 (40.82%), HLA-B*35 (0.00%), and HLA-DRB1*15 (67.53%). The frequency of HLA-A*11 and HLA-B*35 were significantly higher in cases as compared to the controls. In DRB1 locus, HLA-DRB1*10 was significantly higher in cases (20.78%, P = 0.005) than that of controls (0.00%). Whereas, HLA-DRB1*15 showed a higher frequency in controls than in cases. In addition, HLA-DRB3*01 (P = 0.053), DRB4*01 (P = 1.000), and DRB5*01(P = 0.591) were also identified along with HLA-DRB1 haplotype. From this preliminary study, it is suspected that there may be a role of HLA-A*11, HLA-B*35 and HLA-DRB1*10 in conferring susceptibility to influenza A(H1N1)pdm09 infection in the study population. A larger extended study on HLA polymorphism may explain the association between HLA and influenza A(H1N1)pdm09 infection and provide insights for HLA restricted peptide based vaccines. © 2018 Wiley Periodicals, Inc.

Predominance of HA-222D/G polymorphism in influenza A(H1N1pdm09 viruses associated with fatal and severe outcomes recently circulating in Germany.

Directory of Open Access Journals (Sweden)

Marianne Wedde

Full Text Available Influenza A(H1N1pdm09 viruses cause sporadically very severe disease including fatal clinical outcomes associated with pneumonia, viremia and myocarditis. A mutation characterized by the substitution of aspartic acid (wild-type to glycine at position 222 within the haemagglutinin gene (HA-D222G was recorded during the 2009 H1N1 pandemic in Germany and other countries with significant frequency in fatal and severe cases. Additionally, A(H1N1pdm09 viruses exhibiting the polymorphism HA-222D/G/N were detected both in the respiratory tract and in blood. Specimens from mild, fatal and severe cases were collected to study the heterogeneity of HA-222 in A(H1N1pdm09 viruses circulating in Germany between 2009 and 2011. In order to enable rapid and large scale analysis we designed a pyrosequencing (PSQ assay. In 2009/2010, the 222D wild-type of A(H1N1pdm09 viruses predominated in fatal and severe outcomes. Moreover, co-circulating virus mutants exhibiting a D222G or D222E substitution (8/6% as well as HA-222 quasispecies were identified (10%. Both the 222D/G and the 222D/G/N/V/Y polymorphisms were confirmed by TA cloning. PSQ analyses of viruses associated with mild outcomes revealed mainly the wild-type 222D and no D222G change in both seasons. However, an increase of variants with 222D/G polymorphism (60% was characteristic for A(H1N1pdm09 viruses causing fatal and severe cases in the season 2010/2011. Pure 222G viruses were not observed. Our results support the hypothesis that the D222G change may result from adaptation of viral receptor specificity to the lower respiratory tract. This could explain why transmission of the 222G variant is less frequent among humans. Thus, amino acid changes at HA position 222 may be the result of viral intra-host evolution leading to the generation of variants with an altered viral tropism.

Erratum!- in paper volume 19, Supplement 1, Year 2015, pp. S109-S115, DOI:10.2298/TSCI15S1S09C

Directory of Open Access Journals (Sweden)

Editorial

2015-01-01

Full Text Available In the paper published in THERMAL SCIENCE Volume 19, Supplement 1, YEAR 2015, pp. S109-S115, DOI REFERENCE: 10.2298/TSCI15S1S09C Names and affiliations of the authors has been incorrectly written Istead of: THE DIFFUSION MODEL OF FRACTAL HEAT AND MASS TRANSFER IN FLUIDIZED BED A Local Fractional Arbitrary Euler-Lagrange Formula by Xu CHENG∗ and Xiao-Xun MA School of Chemical Engineering, Northwest University, Xi'an, Shaanxi, China Correctly has to be written: THE DIFFUSION MODEL OF FRACTAL HEAT AND MASS TRANSFER IN FLUIDIZED BED A Local Fractional Arbitrary Euler-Lagrange Formula by Xu CHENG1∗ and Lin Wang2 - 1School of Chemical Engineering, Northwest University, Xi'an, Shaanxi, China - 2Xi'an Modern Chemistry Research Institute, Xi'an, Shaanxi, China Link to the corrected article 10.2298/TSCI15S1S09C

A Subregional Analysis of Epidemiologic and Genetic Characteristics of Influenza A(H1N1)pdm09 in Africa: Senegal, Cape Verde, Mauritania, and Guinea, 2009–2010

Science.gov (United States)

Dia, Ndongo; Ndiaye, Mbayame Niang; Monteiro, Maria de Lourdes; Koivogui, Lamine; Bara, Mohamed Ould; Diop, Ousmane M.

2013-01-01

During the pandemic 2009 episode, we conducted laboratory-based surveillance in four countries from West Africa: Senegal, Mauritania, Cape Verde, and Guinea. Specimens were obtained from 3,155 patients: 2,264 patients from Senegal, 498 patients from Cape Verde, 227 patients from Mauritania, and 166 patients from Guinea; 911 (28.9%) patients were positive for influenza, 826 (90.7%) patients were positive for influenza A, and 85 (9.3%) patients were positive for influenza B. Among the influenza A positives, 503 (60.9%) positives were H1N1pdm09, 314 (38.0%) positives were H3N2, and 9 (1.1%) positives were seasonal H1N1. The highest detection rate for seasonal influenza viruses (17.1%) occurred in the 5–14 years age group. However, for A(H1N1)pdm09, the detection rate was highest in the 15–24 years age group (35.8%). Based on the present study data, the timeline of detection of A(H1N1)pdm09 viruses in these four countries should be Cape Verde, Guinea, Mauritania, and finally, Senegal. Genetic and antigenic analyses were performed in some isolates. PMID:23509122

Immunogenicity and Safety of a Trivalent Inactivated Influenza Vaccine in Children 6 Months to 17 Years of Age, Previously Vaccinated with an AS03-Adjuvanted A(H1N1)Pdm09 Vaccine: Two Open-label, Randomized Trials.

Science.gov (United States)

Vesikari, Timo; Richardus, Jan Hendrik; Berglund, Johan; Korhonen, Tiina; Flodmark, Carl-Erik; Lindstrand, Ann; Silfverdal, Sven Arne; Bambure, Vinod; Caplanusi, Adrian; Dieussaert, Ilse; Roy-Ghanta, Sumita; Vaughn, David W

2015-07-01

During the influenza pandemic 2009-2010, an AS03-adjuvanted A(H1N1)pdm09 vaccine was used extensively in children 6 months of age and older, and during the 2010-2011 influenza season, the A(H1N1)pdm09 strain was included in the seasonal trivalent inactivated influenza vaccine (TIV) without adjuvant. We evaluated the immunogenicity and safety of TIV in children previously vaccinated with the AS03-adjuvanted A(H1N1)pdm09 vaccine. Healthy children were randomized (1:1) to receive TIV or a control vaccine. Children were aged 6 months to 9 years (n = 154) and adolescents 10-17 years (n = 77) when they received AS03-adjuvanted A(H1N1)pdm09 vaccine at least 6 months before study enrolment. Hemagglutination inhibition (HI) and neutralizing antibody responses against the A(H1N1)pdm09 strain were evaluated before (day 0) and at day 28 and month 6 after study vaccination. Reactogenicity was assessed during the 7 day postvaccination period, and safety was assessed for 6 months. At day 0, >93.9% of all children had HI titers ≥1:40 for the A(H1N1)pdm09 strain, which increased to 100% at both day 28 and month 6 in the TIV group. Between days 0 and 28, HI antibody geometric mean titers against A(H1N1)pdm09 increased by 9-fold and 4-fold in children 6 months to 9 years of age and 10-17 years of age, respectively. AS03-adjuvanted A(H1N1)pdm09 vaccine-induced robust immune responses in children that persisted into the next season, yet were still boosted by TIV containing A(H1N1)pdm09. The reactogenicity and safety profile of TIV did not appear compromised by prior receipt of AS03-adjuvanted A(H1N1)pdm09 vaccine.

Airway Mucosal Immune-suppression in Neonates of Mothers Receiving A(H1N1)pnd09 Vaccination During Pregnancy

DEFF Research Database (Denmark)

Pedersen, Susanne Brix; Bischoff, Anne L.; Folsgaard, Nilofar V.

2015-01-01

, IL-5, IL-13, eotaxin-1, eotaxin-3, TARC, MDC, IL-17, IL-1 beta, IL-8, transforming growth factor beta (TGF)-beta 1, IL-10 and IL-2. Infections were monitored the first year of life by daily diary cards and clinical controls. Results: Neonates of mothers vaccinated during pregnancy had significant up...... significant and positive association to up-regulation of TGF-beta 1 levels (P = 0.0003) and significant negative association to other mediators. The study was not powered to study differences in the incidence of infections in early infancy which did not differ between the study groups. Conclusion: Influenza A......(H1N1) pnd09 vaccination during pregnancy up-regulates TGF-beta 1 and down-regulates key mediators of the protective immunity....

17 CFR 210.12-09 - Valuation and qualifying accounts.

Science.gov (United States)

2010-04-01

... period Column C—Additions (1)—Charged to costs and expenses (2)—Charged to other accounts—describe Column... qualifying accounts and reserves by descriptive title. Group (a) those valuation and qualifying accounts... accounts. 210.12-09 Section 210.12-09 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION...

Shape-Control of a 0D/1D NaFe0.9Mn0.1PO4 Nano-Complex by Electrospinning

Science.gov (United States)

Shin, Mi-Ra; Son, Jong-Tae

2018-03-01

NaFePO4 with a maricite structure was one of the most promising candidates for sodium ion batteries (SIBs) due to its advantages of environmental friendly and having low cost. However, it has low electrochemical conductivity and energy density, which impose limitations on its application as commercial cathode materials. In this study, other transition-metal ions such as Mn2+ were substituted into the iron (Fe2+) site in NaFePO4 to increase the surface area and the number of nanofibers in the prepared one-dimensional (1D) nano-sized material with 0D/1D dimensions to enhance the energy density. Also, the 0D/1D NaFe0.9Mn0.1PO4 cathode material has increased electrochemical conductivity because the fiber size was reduced to the nano-scale level by using the electrospinning method in order to decrease the diffusion path of Na-ions. The morphology of the 0D/1D nanofiber was evaluated by Field-emission scanning electron microscope and atomic force microscope analyses. The NaFe0.9Mn0.1PO4 nanofibers had a diameter of approximately 180 nm, while the spherical particle had a diameter 1 μm. The 0D/1D nano-sized cathode material show a discharge capacity of 27 mAhg -1 at a 0.05 C rate within the 2.0 4.5 V voltage range and a low R ct of 110 Ω.

Stability of tranexamic acid in 0.9% sodium chloride, stored in type 1 glass vials and ethylene/propylene copolymer plastic containers.

Science.gov (United States)

McCluskey, Susan V; Sztajnkrycer, Matthew D; Jenkins, Donald A; Zietlow, Scott P; Berns, Kathleen S; Park, Myung S

2014-01-01

Tranexamic acid has recently been demonstrated to decrease all-cause mortality and deaths due to hemorrhage in trauma patients. The optimal administration of tranexamic acid is within one hour of injury, but not more than three hours from the time of injury. To aid with timely administration, a premixed solution of 1 gram tranexamic acid and 0.9% sodium chloride was proposed to be stocked as a medication in both the aeromedical transport helicopters and Emergency Department at Mayo Clinic Hospital--Rochester Saint Marys Campus. Since no published stability data exists for tranexamic acid diluted with 0.9% sodium chloride, this study was undertaken to determine the stability of tranexamic acid diluted with 0.9% sodium chloride while being stored in two types of containers. Stability was determined through the use of a stability-indicating high-performance liquid reverse phase chromatography assay, pH, and visual tests. Tranexamic acid solutions of 1 gram in 0.9% sodium chloride 65 mL were studied at predetermined intervals for 90 days in ethylene/propylene copolymer plastic containers, protected from light, and at both controlled room and refrigerated temperatures. Tranexamic acid solutions of 1 gram in 0.9% sodium chloride 50 mL were studied at predetermined intervals for 180 days in clear Type 1 borosilicate glass vials sealed with intact elastomeric, Flourotec-coated stoppers, stored protected from light at controlled room temperature. Solutions stored in the ethylene/propylene copolymer plastic containers at both storage temperatures maintained at least 98% of initial potency throughout the 90-day study period. Solutions stored in glass vials at controlled room temperature maintained at least 92% of initial potency throughout the 180-day study period. Visual and pH tests revealed stable, clear, colorless, and particulate-free solutions throughout the respective study periods.

Interrelation of transport properties, defect structure and spin state of Ni3+ in La1.2Sr0.8Ni0.9Fe0.1O4+δ

Science.gov (United States)

Gilev, A. R.; Kiselev, E. A.; Zakharov, D. M.; Cherepanov, V. A.

2017-10-01

The total conductivity, Seebeck coefficient and oxygen non-stoichiometry for La1.2Sr0.8Ni0.9Fe0.1O4+δ have been measured vs temperature and oxygen partial pressure P(O2). The measurements were carried out at 800, 850, 900 and 950 °C within the P(O2) range of 10-5-0.21 atm. La1.2Sr0.8Ni0.9Fe0.1O4+δ was shown to be oxygen deficient in all temperature and P(O2) ranges studied. The calculated values of the partial molar enthalpy of oxygen depend very slightly on oxygen content (δ), indicating that La1.2Sr0.8Ni0.9Fe0.1O4+δ with the oxygen deficiency can be considered an ideal solution. The model of point defect equilibria in La1.2Sr0.8Ni0.9Fe0.1O4+δ has been proposed and fitted to experimental dependencies. Subsequent joint analysis of the defect structure and transport properties revealed that electron holes can coexist in both localized and quasi-delocalized states in the oxide: the former corresponded to high-spin state Ni3+ and the latter - to low-spin state Ni3+. The mobilities of localized electron holes were shown to be significantly lower in comparison to quasi-delocalized ones. The behavior of localized electron holes was explained in terms of a small polaron conduction mechanism; in contrast, quasi-delocalized electron holes were described in terms of a band conduction approach. The small polaron conduction mechanism was shown to be predominant in the Sr- and Fe-co-doped lanthanum nickelate.

Catastrophic dechanneling resonance study of In0.1Ga0.9As/GaAs multilayers

International Nuclear Information System (INIS)

Siddiqui, A.M.; Pathak, A.P.

1998-10-01

Catastrophic Dechanneling Resonance (CDR) has bee used for probing important properties of Strained Layer Superlattices (SLS). We have undertaken a systematic study on strain and strain revealing mechanisms in technologically important SLS using ion channeling methods. Here we present the theoretical calculations on CDR for a 4 He ion beam along the (110) plane in In 0.1 Ga 0.9 As/GaAs superlattice using Moliere potential. CDR is found to have occurred at 1.2 MeV. Also the most regular feature of CDR, the Incident Angle Asymmetry has been observed. (author)

META-ANALYSIS OF THE RESEARCH OF IL-6 IN PERIPHERAL BLOOD OF PATIENTS WITH INFLUENZA A(H1N1pdm09

Directory of Open Access Journals (Sweden)

M. V. Shipilov

2017-01-01

Full Text Available Interleukin-6 (IL-6 is a potent proinflammatory cytokine, which level is increased in the peripheral blood in many infectious diseases, including the flu A(H1N1pdm09, in some cases (when the excess of his development of immune cells, resulting not only to strengthen the immune system, but also to the development of a “cytokine storm” is characterized by multi-organ failure and often followed by death. To reduce errors, increase the statistical power and increase the reliability of the results according to different researchers, as well as on the results of their own research was conducted a meta-analysis (a quantitative systematic review of IL-6 studies in peripheral blood of patients with influenza A(H1N1 pdm09. Question: to determine with a high level of confidence, whether IL-6, a marker of the severity and prognosis of the disease. Searches were carried out research work on this subject in a variety of electronic databases (Medline, EMBASE, the Cochrane Controlled Trials Register, and others, reviews, theses, magazines, conference proceedings, and others. In the process of carrying out a meta-analysis of 5 scientific papers were selected that meet the criteria for inclusion/noninclusion in the study (characteristic of scientific papers, diagnostic criteria, age of patients, comparable groups of patients, the presence of self-control, research methodology, statistical criterion and the total number of independent stu dies. Selected studies have shown sufficient uniformity (homogeneity comparison groups. The results of the meta-analysis are presented in tables, charts and blobogramme, meta-analysis of 5 scientific papers showed that in moderate and severe influenza A(H1N1pdm09 noted a significant increase in the concentration of IL-6 in peripheral blood of patients compared with the control a group of individuals (healthy. Severe influenza A(H1N1pdm09 with a high probability of death is characterized by an even greater

4U 1907+09: an HMXB running away from the Galactic plane

Science.gov (United States)

Gvaramadze, V. V.; Röser, S.; Scholz, R.-D.; Schilbach, E.

2011-05-01

We report the discovery of a bow shock around the high-mass X-ray binary (HMXB) 4U 1907+09 using the Spitzer Space Telescope 24 μm data (after Vela X-1 the second example of bow shocks associated with HMXBs). The detection of the bow shock implies that 4U 1907+09 is moving through space with a high (supersonic) peculiar velocity. To confirm the runaway nature of 4U 1907+09, we measured its proper motion, which for an adopted distance to the system of 4 kpc corresponds to a peculiar transverse velocity of ≃ 160 ± 115 km s-1, meaning that 4U 1907+09 is indeed a runaway system. This also supports the general belief that most HMXBs possess high space velocities. The direction of motion of 4U 1907+09 inferred from the proper motion measurement is consistent with the orientation of the symmetry axis of the bow shock, and shows that the HMXB is running away from the Galactic plane. We also present the Spitzer images of the bow shock around Vela X-1 (a system similar to 4U 1907+09) and compare it with the bow shock generated by 4U 1907+09.

Neptunium sorption and co-precipitation of strontium in simulated DWPF salt solution

International Nuclear Information System (INIS)

McIntyre, P.F.; Orebaugh, E.G.; King, C.M.

1988-01-01

Batch experiments performed using crushed slag saltstone (∼40 mesh) removed >80% of 237 Np from simulated Defense Waste Processing Facility (DWPF) salt solution. The concentration of 237 Np (110 pCi/ml) used was 1000x greater than levels in actual DWPF solutions. Neptunium-239 was used as a tracer and was formed by neutron activation of uranyl nitrate. Results showed that small amounts of crushed saltstone (as little as 0.05 grams), removed >80% of neptunium from 15 ml of simulated DWPF solution after several hours equilibration. The neptunium is sorbed on insoluble carbonates formed in and on the saltstone matrix. Further testing showed that addition of 0.01 and 0.10 ml of 1 molar Ca +2 (ie. Ca (NO 3 ) 2 , CaCl 2 ) into 15 ml of simulated DWPF solution yielded a white carbonate precipitate which also removed >80% of the neptunium after 1 hour equilibration. Further experiments were performed to determine the effectiveness of this procedure to co-precipitate strontium

Effect of electrolyte additives in improving the cycle and calendar life of graphite/Li{sub 1.1}[Ni{sub 1/3}Co{sub 1/3}Mn{sub 1/3}]{sub 0.9}O{sub 2} Li-ion cells

Energy Technology Data Exchange (ETDEWEB)

Liu, Jun; Chen, Zonghai; Busking, Sara; Belharouak, Ilias; Amine, Khalil [Chemical Engineering Division, Argonne National Laboratory, 9700 S. Cass Avenue, IL 60439 (United States)

2007-12-06

Lithium-rich layered metal oxide Li{sub 1.1}[Ni{sub 1/3}Co{sub 1/3}Mn{sub 1/3}]{sub 0.9}O{sub 2} was investigated as a potential positive electrode material for high-power batteries for hybrid electric vehicle (HEV) applications. In order to evaluate the power and life characteristics of the graphite/Li{sub 1.1}[Ni{sub 1/3}Co{sub 1/3}Mn{sub 1/3}]{sub 0.9}O{sub 2} cell chemistry, hybrid pulse power characterization (HPPC) and accelerated calendar life tests were conducted on several pouch cells containing electrolytes with and without additives. The data show that the cells containing 0.5 wt% lithium bis(oxalate)borate (LiBOB) or vinyl ethyl carbonate (VEC) additives, or the novel lithium difluoro(oxalato)borate (LiDFOB) additive, have much improved cycle and calendar life performance. (author)

High Level Antibody Response to Pandemic Influenza H1N1/09 Virus Is Associated With Interferon-Induced Transmembrane Protein-3 rs12252-CC in Young Adults

Directory of Open Access Journals (Sweden)

Ling Qin

2018-05-01

Full Text Available Background: The C allele of the interferon-induced transmembrane protein-3 (IFITM3 SNP rs12252, a common allele in South East Asia and China, is strongly associated with severe influenza infection. However, despite the high occurrence of rs12252-CC genotype in Chinese population (~25%, severe influenza infection is rare. The aim of study is to determine whether rs12252-CC individuals have pre-existing antibody responses to previous seasonal influenza infections.Cohort and Method: A total 99 young healthy volunteers (18–20 years were recruited and received an influenza seasonal Vaccination [A/Switzerland/9715293/2013(H3N2, A/California/7/2009 (pdm09H1N1 and B/Jeep/3073/2013-like virus (Flu-B]. Plasma and gDNA was isolated from each volunteer before, and 14, 28, 180, 360, and 540 days after vaccination. Additionally, 68 elderlies (>65 years were also recruited as a control group to compare the levels of antibodies at baseline between the young adults and the elderly. For each sample IFITM3 rs12252 genotype was determined and antibody levels in response to pdmH1N1, H3N2 and Influenza B infection were measured for each time point.Results: We found a significantly higher level of pre-existing antibodies to pandemic influenza H1N1/09 virus (pdm09H1N1 but not to H3N2 or FluB in CC donors in comparison with CT/TT donors prior to vaccination. No impact of IFITM3 genotype in boosting influenza specific antibodies in young adults within 1 year after receiving seasonal influenza vaccination was observed. In addition, there was no difference in pdm09H1N1 specific antibody levels observed in the elderly cohort between volunteers carrying different IFITM3 genotypes. Higher levels of antibodies to pdmH1N1 were observed in elderly CC carriers when compared to the young CC carriers, but this trend was not replicated in TT carriers.Conclusion:IFITM3-rs12252 CC carriers exhibit a high level of pre-existing immunity to pdm09H1N1 compared to TT carriers in the

SPEEDUP simulation of liquid waste batch processing. Revision 1

International Nuclear Information System (INIS)

Shannahan, K.L.; Aull, J.E.; Dimenna, R.A.

1994-01-01

The Savannah River Site (SRS) has accumulated radioactive hazardous waste for over 40 years during the time SRS made nuclear materials for the United States Department of Energy (DOE) and its predecessors. This waste is being stored as caustic slurry in a large number of 1 million gallon steel tanks, some of which were initially constructed in the early 1950's. SRS and DOE intend to clean up the Site and convert this waste into stable forms which then can be safely stored. The liquid waste will be separated into a partially decontaminated low-level and radioactive high-level waste in one feed preparation operation, In-Tank Precipitation. The low-level waste will be used to make a concrete product called saltstone in the Saltstone Facility, a part of the Defense Waste Processing Facility (DWPF). The concrete will be poured into large vaults, where it will be permanently stored. The high-level waste will be added to glass-formers and waste slurry solids from another feed preparation operation, Extended Sludge Processing. The mixture will then be converted to a stable borosilicate glass by a vitrification process that is the other major part of the DWPF. This glass will be poured into stainless steel canisters and sent to a temporary storage facility prior to delivery to a permanent underground storage site

Impedance spectroscopy studies on lead free Ba1-xMgx(Ti0.9Zr0.1)O3 ceramics

Science.gov (United States)

Ben Moumen, S.; Neqali, A.; Asbani, B.; Mezzane, D.; Amjoud, M.; Choukri, E.; Gagou, Y.; El Marssi, M.; Luk'yanchuk, Igor A.

2018-06-01

Ba1-xMgx(Ti0.9Zr0.1)O3 (x = 0.01 and 0.02) ceramics were prepared using the conventional solid state reaction. Rietveld refinement performed on X-ray diffraction patterns indicates that the samples are tetragonal crystal structure with P4mm space group. By increasing Mg content from 1 to 2% the unit cell volume decreased. Likewise, the grains size is greatly reduced from 10 μm to 4 μm. The temperature dependence of dielectric constants at different frequencies exhibited typical relaxor ferroelectric characteristic, with sensitive dependence in frequency and temperature for ac conductivity. The obtained activation energy values were correlated to the proposed conduction mechanisms.

Effects of minor Zr and Sr on as-cast microstructure and mechanical properties of Mg-3Ce-1.2Mn-0.9Sc (wt.%) magnesium alloy

International Nuclear Information System (INIS)

Pan Fusheng; Yang Mingbo; Shen Jia; Wu Lu

2011-01-01

Research highlights: → Minor Zr and/or Sr additions can effectively refine the grains of the Mg-3Ce-1.2Mn-0.9Sc alloy. → Minor Zr and/or Sr additions can improve the tensile properties of the Mg-3Ce-1.2Mn-0.9Sc alloy. → Minor Zr and/or Sr additions can improve the creep properties of the Mg-3Ce-1.2Mn-0.9Sc alloy. - Abstract: The effects of minor Zr and Sr on the as-cast microstructure and mechanical properties of the Mg-3Ce-1.2Mn-0.9Sc (wt.%) alloy were investigated by using optical and electron microscopies, differential scanning calorimetry (DSC) analysis, and tensile and creep tests. The results indicate that adding minor Zr and/or Sr to the Mg-3Ce-1.2Mn-0.9Sc alloy does not cause an obvious change in the morphology and distribution of the Mg 12 Ce phase. However, the grains of the Zr and/or Sr-containing alloys are effectively refined. Among the Zr and/or Sr-containing alloys, the grains of the alloy with the addition of 0.5 wt.%Zr + 0.1 wt.%Sr are the finest, followed by the alloys with the additions of 0.5 wt.%Zr and 0.1 wt.%Sr, respectively. In addition, small additions of Zr and/or Sr can improve the tensile and creep properties of the Mg-3Ce-1.2Mn-0.9Sc alloy. Among the Zr and/or Sr-containing alloys, the alloy with the addition of 0.5 wt.%Zr + 0.1 wt.%Sr obtains the optimum tensile and creep properties.

A Novel Hydroxamate-Based Compound WMJ-J-09 Causes Head and Neck Squamous Cell Carcinoma Cell Death via LKB1-AMPK-p38MAPK-p63-Survivin Cascade.

Science.gov (United States)

Yen, Chia-Sheng; Choy, Cheuk-Sing; Huang, Wei-Jan; Huang, Shiu-Wen; Lai, Pin-Ye; Yu, Meng-Chieh; Shiue, Ching; Hsu, Ya-Fen; Hsu, Ming-Jen

2018-01-01

Growing evidence shows that hydroxamate-based compounds exhibit broad-spectrum pharmacological properties including anti-tumor activity. However, the precise mechanisms underlying hydroxamate derivative-induced cancer cell death remain incomplete understood. In this study, we explored the anti-tumor mechanisms of a novel aliphatic hydroxamate-based compound, WMJ-J-09, in FaDu head and neck squamous cell carcinoma (HNSCC) cells. WMJ-J-09 induced G2/M cell cycle arrest and apoptosis in FaDu cells. These actions were associated with liver kinase B1 (LKB1), AMP-activated protein kinase (AMPK) and p38 mitogen-activated protein kinase (p38MAPK) activation, transcription factor p63 phosphorylation, as well as modulation of p21 and survivin. LKB1-AMPK-p38MAPK signaling blockade reduced WMJ-J-09's enhancing effects in p63 phosphorylation, p21 elevation and survivin reduction. Moreover, WMJ-J-09 caused an increase in α-tubulin acetylation and interfered with microtubule assembly. Furthermore, WMJ-J-09 suppressed the growth of subcutaneous FaDu xenografts in vivo . Taken together, WMJ-J-09-induced FaDu cell death may involve LKB1-AMPK-p38MAPK-p63-survivin signaling cascade. HDACs inhibition and disruption of microtubule assembly may also contribute to WMJ-J-09's actions in FaDu cells. This study suggests that WMJ-J-09 may be a potential lead compound and warrant the clinical development in the treatment of HNSCC.

Assessment of cement kiln dust (CKD) for stabilization/solidification (S/S) of arsenic contaminated soils.

Science.gov (United States)

Moon, Deok Hyun; Wazne, Mahmoud; Yoon, In-Ho; Grubb, Dennis G

2008-11-30

A stabilization/solidification (S/S) process for arsenic (As) contaminated soils was evaluated using cement kiln dust (CKD). Laboratory-prepared slurries, made of either kaolinite or montmorillonite, and field soils spiked with either As(3+) or As(5+) were prepared and treated with CKD ranging from 10 to 25 wt%. Sodium arsenite and sodium arsenate at 0.1 wt% were used to simulate arsenite (As(3+)) and arsenate (As(5+)) source contamination in soils, respectively. The effectiveness of treatment was evaluated at curing periods of 1- and 7-days based on the toxicity characteristic leaching procedure (TCLP). As-CKD and As-clay-CKD slurries were also spiked at 10 wt% to evaluate As immobilization mechanism using X-ray powder diffraction (XRPD) analyses. Overall, the TCLP results showed that only the As(5+) concentrations in kaolinite amended with 25 wt% CKD after 1 day of curing were less than the TCLP regulatory limit of 5mg/L. Moreover, at 7 days of curing, all As(3+) and As(5+) concentrations obtained from kaolinite soils were less than the TCLP criteria. However, none of the CKD-amended montmorillonite samples satisfied the TCLP-As criteria at 7 days. Only field soil samples amended with 20 wt% CKD complied with the TCLP criteria within 1 day of curing, where the source contamination was As(5+). XRPD and scanning electron microscopy (SEM)-energy dispersive X-ray spectroscopy (EDX) results showed that Ca-As-O and NaCaAsO(4).7.5H(2)O were the primary phases responsible for As(3+) and As(5+) immobilization in the soils, respectively.

Assessment of cement kiln dust (CKD) for stabilization/solidification (S/S) of arsenic contaminated soils

International Nuclear Information System (INIS)

Moon, Deok Hyun; Wazne, Mahmoud; Yoon, In-Ho; Grubb, Dennis G.

2008-01-01

A stabilization/solidification (S/S) process for arsenic (As) contaminated soils was evaluated using cement kiln dust (CKD). Laboratory-prepared slurries, made of either kaolinite or montmorillonite, and field soils spiked with either As 3+ or As 5+ were prepared and treated with CKD ranging from 10 to 25 wt%. Sodium arsenite and sodium arsenate at 0.1 wt% were used to simulate arsenite (As 3+ ) and arsenate (As 5+ ) source contamination in soils, respectively. The effectiveness of treatment was evaluated at curing periods of 1- and 7-days based on the toxicity characteristic leaching procedure (TCLP). As-CKD and As-clay-CKD slurries were also spiked at 10 wt% to evaluate As immobilization mechanism using X-ray powder diffraction (XRPD) analyses. Overall, the TCLP results showed that only the As 5+ concentrations in kaolinite amended with 25 wt% CKD after 1 day of curing were less than the TCLP regulatory limit of 5 mg/L. Moreover, at 7 days of curing, all As 3+ and As 5+ concentrations obtained from kaolinite soils were less than the TCLP criteria. However, none of the CKD-amended montmorillonite samples satisfied the TCLP-As criteria at 7 days. Only field soil samples amended with 20 wt% CKD complied with the TCLP criteria within 1 day of curing, where the source contamination was As 5+ . XRPD and scanning electron microscopy (SEM)-energy dispersive X-ray spectroscopy (EDX) results showed that Ca-As-O and NaCaAsO 4 .7.5H 2 O were the primary phases responsible for As 3+ and As 5+ immobilization in the soils, respectively

Innovative fossil fuel fired vitrification technology for soil remediation. Phase 1

Energy Technology Data Exchange (ETDEWEB)

1994-01-01

Vortec has successfully completed Phase 1 of the ``Innovative Fossil Fuel Fired Vitrification Technology for Soil Remediation`` program. The Combustion and Melting System (CMS) has processed 7000 pounds of material representative of contaminated soil that is found at DOE sites. The soil was spiked with Resource Conservation and Recovery Act (RCRA) metals surrogates, an organic contaminant, and a surrogate radionuclide. The samples taken during the tests confirmed that virtually all of the radionuclide was retained in the glass and that it did not leach to the environment-as confirmed by both ANS 16.1 and Toxicity Characteristic Leaching Procedure (TCLP) testing. The organic contaminant, anthracene, was destroyed during the test with a Destruction and Removal Efficiency (DRE) of at least 99.99%. RCRA metal surrogates, that were in the vitrified product, were retained and did not leach to the environment as confirmed by the TCLP testing. Semi-volatile RCRA metal surrogates were captured by the Air Pollution Control (APC) system, and data on the amount of metal oxide particulate and the chemical composition of the particulate were established for use in the Phase 2 APC subsystem design.

Development of new systems of nano-disperse Pt-(2%Pt-Ce0.9W0.1O2)/C electrocatalysts tolerant to carbon monoxide (CO) for PEMFC anodes

NARCIS (Netherlands)

Nandenha, J.; Isidoro, R.A.; Dresch, M.A.; Fernandes, V.C.; Aricó, B.; Santiago, E.I.; Rothenberg, G.; Oliveira, W.S.; Linardi, M.

2012-01-01

The nanophase material (powder) of Ce0.9W0.1O2 was synthesized via coprecipitation of oxalates of cerium (IV) and tungsten cations. Pt-Ce0.9W0.1O2 (2 wt% Pt) was prepared by an alcohol-reduction process using H2PtCl6.6H2O as source of Pt, Ce0.9W0.1O2 as support and ethylene glycol as solvent and

Results For The Third Quarter Calendar Year 2016 Tank 50H Salt Solution Sample

Energy Technology Data Exchange (ETDEWEB)

Crawford, C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2016-10-13

In this memorandum, the chemical and radionuclide contaminant results from the Third Quarter Calendar Year 2016 (CY16) sample of Tank 50H salt solution are presented in tabulated form. The Third Quarter CY16 Tank 50H samples (a 200 mL sample obtained 6” below the surface (HTF-5-16-63) and a 1 L sample obtained 66” from the tank bottom (HTF-50-16-64)) were obtained on July 14, 2016 and received at Savannah River National Laboratory (SRNL) on the same day. Prior to obtaining the samples from Tank 50H, a single pump was run at least 4.4 hours, and the samples were pulled immediately after pump shut down. The information from this characterization will be used by Defense Waste Processing Facility (DWPF) & Saltstone Facility Engineering for the transfer of aqueous waste from Tank 50H to the Saltstone Production Facility, where the waste will be treated and disposed of in the Saltstone Disposal Facility. This memorandum compares results, where applicable, to Saltstone Waste Acceptance Criteria (WAC) limits and targets. Data pertaining to the regulatory limits for Resource Conservation and Recovery Act (RCRA) metals will be documented at a later time per the Task Technical and Quality Assurance Plan (TTQAP) for the Tank 50H saltstone task. The chemical and radionuclide contaminant results from the characterization of the Third Quarter CY16 sampling of Tank 50H were requested by Savannah River Remediation (SRR) personnel and details of the testing are presented in the SRNL TTQAP.

The magnetic transition temperature tuned by strain in YMn0.9Ru0.1O3 thin films

Directory of Open Access Journals (Sweden)

L. P. Yang

2018-05-01

Full Text Available Epitaxial orthorhombic YMn0.9Ru0.1O3 films with different thickness have been grown on (001-SrTiO3 substrates by pulsed laser deposition (PLD. The crystal structure is well investigated by X-ray Diffraction. It is found that the out-of-plane parameter c slowly increases with decreasing thickness of samples because of the tensile strain between the films and substrates along c axis. The lengths of in-plane Mn-O bonds expand with the enhancement of strains, which is proved by Raman scatting. The magnetic measurements reveal that there exist two magnetic transition temperatures TN1 and TN2. The TN1 is close to that of orthorhombic YMnO3 bulk. With decreasing thickness of the films, TN1 keeps almost constant because of the small stain along c-axis. TN2, however, obviously increases from 117 K to 134 K, which could be related to the expansion of in-plane Mn-O bonds. Results show that the magnetic transition temperature of YMn0.9Ru0.1O3 films can be sensitively manipulated by the strain of the films.

Literature review of the potential impact of glycolic acid on the technetium chemistry of srs tank waste

International Nuclear Information System (INIS)

Nash, Charles A.; McCabe, Daniel J.

2017-01-01

This document presents a literature study of the impact of glycolate on technetium chemistry in the Savannah River Site (SRS) waste system and specifically Saltstone. A predominant portion of the Tc at SRS will be sent to the Saltstone Facility where it will be immobilized. The Tc in the tank waste is in the highly soluble chemical form of pertechnetate ion (TcO 4 - ) which is reduced by blast furnace slag (BFS) in Saltstone, rendering it highly insoluble and resistant to leaching.

NCBI nr-aa BLAST: CBRC-HSAP-09-0006 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-HSAP-09-0006 ref|ZP_00960995.1| pyruvate carboxylase [Roseovarius nubinhibens ...ISM] gb|EAP76566.1| pyruvate carboxylase [Roseovarius nubinhibens ISM] ZP_00960995.1 1.2 28% ...

Unigene BLAST: CBRC-GGAL-09-0012 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-GGAL-09-0012 gnl|UG|Gga#S6698203 pnl1s.pk003.f8 chicken liver cDNA library Gallus gallus cDNA clone pnl...1s.pk003.f8 5' similar to histidine-rich glycoprotein - bovine (fragments), mRNA sequence /clone=pnl

33 CFR 151.09 - Applicability.

Science.gov (United States)

2010-07-01

....09 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) POLLUTION... Pertains to Pollution from Ships Oil Pollution § 151.09 Applicability. (a) Except as provided in paragraph... the United States and is certificated for ocean service; (3) Is operated under the authority of the...

Literature review of the potential impact of glycolic acid on the technetium chemistry of srs tank waste

Energy Technology Data Exchange (ETDEWEB)

Nash, Charles A. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); McCabe, Daniel J. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2017-10-09

This document presents a literature study of the impact of glycolate on technetium chemistry in the Savannah River Site (SRS) waste system and specifically Saltstone. A predominant portion of the Tc at SRS will be sent to the Saltstone Facility where it will be immobilized. The Tc in the tank waste is in the highly soluble chemical form of pertechnetate ion (TcO₄ ^-) which is reduced by blast furnace slag (BFS) in Saltstone, rendering it highly insoluble and resistant to leaching.

Quantum control for initiation and detection of explosives

International Nuclear Information System (INIS)

Greenfield, Margo T.; McGrane, Shawn D.; Scharff, R. Jason; Moore, David S.

2010-01-01

We employ quantum control methods towards detection and quantum controlled initiation (QCI) of energetic materials. Ultrafast pulse shaping of broadband Infrared (∼750 nm to 850 run) and ultraviolet (266 nm, 400 nm) light is utilized for control. The underlying principals behind optimal control can be utilized to both detect and initiate explosives. In each case, time dependent phase shaped electric fields drive the chemical systems towards a desired state. For optimal dynamic detection of explosives (ODD-Ex) a phase specific broadband infrared pulse is created which increases not only the sensitivity of detection but also the selectivity of an explosive's spectral signatures in a background of interferents. QCI on the other hand, seeks to initiate explosives by employing shaped ultraviolet light. QCI is ideal for use with explosive detonators as it removes the possibility of unintentional initiation from an electrical source while adding an additional safety feature, initiation only with the proper pulse shape. Quantum control experiments require: (1) the ability to phase and amplitude shape the laser pulse and (2) the ability to effectively search for the pulse shape which controls the reaction. In these adaptive experiments we utilize both global and local optimization search routines such as genetic algorithm, differential evolution, and downhill simplex. Pulse shaping the broadband IR light, produced by focusing 800 nm light through a pressurized tube of Argon, is straightforward as commercial pulse shapers are available at and around 800 nm. Pulse shaping in the UV requires a home built shaper. Our system is an acoustic optical modulator (AOM) pulse shaper in which consists of a fused silica AOM crystal placed in the Fourier plane of a 4-f zero dispersion compressor.

Low toxicity binder systems for tape cast Ce0.9Gd0.1O1.95 laminates

DEFF Research Database (Denmark)

Klemensø, Trine; Menon, Mohan; Ramousse, Severine

2010-01-01

Conventional binder systems for tape casting contain toxic phthalate plasticizers and butanone (MEK) as part of the solvent. The effects of exchanging the phthalate with a non-toxic alternative, and butanone with ethanol, were studied on laminates of high-green density CGO (Ce0.9Gd0.1O1.95) tapes....... Samples were prepared with a binder system containing DBP (dibutyl phthalate) plasticizer and MEK solvent, and with a binder system based on a non-toxic non-phthalate plasticizer and ethanol. In both systems, the weight ratio of plasticizer to the PVB (polyvinyl butyral) binder was varied between 0.......4 and 0.7. Substitution to the less toxic binder system had no adverse impacts on the microstructure. In fact, denser packing and improved homogeneity were observed with the non-phthalate-based system at ratio 0.5 indicating improved dispersion in this system. The denser packing also coincided...

Thermoelectric properties of Ca1-xYxMnO3 and Ca0.9Y0.1-yFeyMnO3 perovskite compounds

DEFF Research Database (Denmark)

Thuy, Nguyen Thi; Minh, Dang Le; Van Nong, Ngo

2012-01-01

Polycrystalline Ca1-xYxMnO3 (x = 0.0; 0.1; 0.3; 0.5; 0.7) and Ca0.9Y0.1-yFeyMnO3 (y = 0.00; 0.01; 0.03; 0.05) compounds were prepared by solid-state reaction. X-ray diffraction (XRD) analysis revealed all XRD peaks of all the samples as identical to the orthorhombic structure. The thermoelectric ...

NCBI nr-aa BLAST: CBRC-RMAC-09-0022 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-RMAC-09-0022 ref|YP_026083.1| NADH dehydrogenase subunit 2 [Steinernema carpoc...apsae] gb|AAT00526.1| NADH dehydrogenase subunit 2 [Steinernema carpocapsae] YP_026083.1 1e-05 30% ...

NCBI nr-aa BLAST: CBRC-GACU-09-0002 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-GACU-09-0002 ref|YP_594114.1| amidohydrolase [Deinococcus geothermalis DSM 113...00] gb|ABF44040.1| amidohydrolase [Deinococcus geothermalis DSM 11300] YP_594114.1 5.5 28% ...

Densification and grain growth during sintering of porous Ce0.9Gd0.1O1.95tape cast layers: A comprehensive study on heuristic methods

DEFF Research Database (Denmark)

Ni, De Wei; Schmidt, Cristine Grings; Teocoli, Francesca

2013-01-01

The sintering behavior of porous Ce0.9Gd0.1O1.95(CGO10) tape cast layers was systematically investigated to establish fundamental kinetic parameters associated to densification and grain growth. Densification and grain growth were characterized by a set of different methods to determine the domin...... and grain boundary mobility in the porous body was estimated around 10−18–10−16m3N−1s−1 at the investigated temperature range.© 2013 Elsevier Ltd. All rights reserved.......The sintering behavior of porous Ce0.9Gd0.1O1.95(CGO10) tape cast layers was systematically investigated to establish fundamental kinetic parameters associated to densification and grain growth. Densification and grain growth were characterized by a set of different methods to determine...... the dominant sintering mechanisms and kinetics, both in isothermal and at constant heating rate (iso-rate) conditions. Densification of porous CGO10 tape is thermally activated with typical activation energy which was estimated around 440–470 kJ mol−1. Grain growth showed similar thermal activation energy...

Magnetic properties of Nd-deficient manganites Nd0.9-xCaxMnOy

International Nuclear Information System (INIS)

Troyanchuk, I.O.; Khomchenko, V.A.; Pastushonok, S.N.; Novitsky, O.A.; Pavlov, V.I.; Szymczak, H.

2006-01-01

X-ray diffraction and magnetic studies of neodymium deficient Nd 0.9-x Ca x MnO y (0= 0.9 MnO y samples have been prepared in the 2.85= g -orbitals of manganese ions. Composition with y=2.85 is antiferromagnet with T N =85K, whereas for more oxidized Nd 0.9 MnO y samples a coexistence of antiferromagnetic and ferromagnetic phases is suggested. Low-temperature magnetic phase transition which is accompanied by a negative magnetization appearance has been found in the Nd 0.9 MnO 2.90 compound. Magnetic behavior of Nd 0.9-x Ca x MnO y (0.1= 1-x Ca x MnO 3 series. Properties of the Nd 0.9-x Ca x MnO y (0=< x=<0.4) solid solutions are in agreement with a hypothesis according to which a part of Nd ions can be substituted by Mn ions

NCBI nr-aa BLAST: CBRC-TGUT-09-0014 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-TGUT-09-0014 ref|NP_000675.1| beta-1-adrenergic receptor [Homo sapiens] gb|AAA51667.1| beta-1-adrenergi...c receptor emb|CAI16920.1| adrenergic, beta-1-, receptor [Homo sapiens] NP_000675.1 1e-144 67% ...

NCBI nr-aa BLAST: CBRC-GGAL-09-0008 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-GGAL-09-0008 ref|XP_001568166.1| proteophosphoglycan ppg4 [Leishmania brazilie...nsis] emb|CAM43270.1| proteophosphoglycan ppg4 [Leishmania braziliensis] XP_001568166.1 5e-61 23% ...

Power Systems Development Facility Gasification Test Run TC09

Energy Technology Data Exchange (ETDEWEB)

Southern Company Services

2002-09-30

This report discusses Test Campaign TC09 of the Kellogg Brown & Root, Inc. (KBR) Transport Gasifier train with a Siemens Westinghouse Power Corporation (Siemens Westinghouse) particle filter system at the Power Systems Development Facility (PSDF) located in Wilsonville, Alabama. The Transport Gasifier is an advanced circulating fluidized-bed gasifier designed to operate as either a combustor or a gasifier in air- or oxygen-blown mode of operation using a particulate control device (PCD). The Transport Gasifier was operated as a pressurized gasifier during TC09 in air- and oxygen-blown modes. Test Run TC09 was started on September 3, 2002, and completed on September 26, 2002. Both gasifier and PCD operations were stable during the test run, with a stable baseline pressure drop. The oxygen feed supply system worked well and the transition from air to oxygen was smooth. The gasifier temperature varied between 1,725 and 1,825 F at pressures from 125 to 270 psig. The gasifier operates at lower pressure during oxygen-blown mode due to the supply pressure of the oxygen system. In TC09, 414 hours of solid circulation and over 300 hours of coal feed were attained with almost 80 hours of pure oxygen feed.

Synthesis and electrochemical properties of xLiMn0.9Fe0.1PO4·yLi3V2(PO4)3/C composite cathode materials for lithium–ion batteries

International Nuclear Information System (INIS)

Wu, Ling; Lu, JiaJia; Wei, Gui; Wang, Pengfei; Ding, Hao; Zheng, Junwei; Li, Xiaowei; Zhong, Shengkui

2014-01-01

Highlights: • xLiMn 0.9 Fe 0.1 PO4·yLi 3 V 2 (PO 4 ) 3 /C composites are prepared by a solid-state method. • The addition of Li 3 V 2 (PO 4 ) 3 can improve the properties of LiMn 0.9 Fe 0.1 PO 4 . • Mutual doping occurrs between the LiMn 0.9 Fe 0.1 PO 4 and Li 3 V 2 (PO 4 ) 3 phases. • 5LiMn 0.9 Fe 0.1 PO 4 ·Li 3 V 2 (PO 4 ) 3 /C shows the best electrochemical properties. - Abstract: The xLiMn 0.9 Fe 0.1 PO 4 ·yLi 3 V 2 (PO 4 ) 3 /C (x:y=1:0, 9:1 5:1, 3:1, 1:1 and 0:1) cathode materials are synthesized by a ball–milling and post–calcination method. XRD results reveal that the xLiMn 0.9 Fe 0.1 PO 4 ·yLi 3 V 2 (PO 4 ) 3 /C (x,y≠0) composites are composed of LiMn 0.9 Fe 0.1 PO 4 and Li 3 V 2 (PO 4 ) 3 phases, and no impurities are detected. In LiMn 0.9 Fe 0.1 PO 4 –Li 3 V 2 (PO 4 ) 3 system, most of the manganese, iron and vanadium elements in the raw materials tend to form the two major phases, and only small amounts of V, Mn and Fe as dopants enter into the lattice of LiMn 0.9 Fe 0.1 PO 4 and Li 3 V 2 (PO 4 ) 3 . Electrochemical tests show that the xLiMn 0.9 Fe 0.1 PO 4 ·yLi 3 V 2 (PO 4 ) 3 /C (x,y≠0) composites exhibit much better performance than the single LiMn 0.9 Fe 0.1 PO 4 /C. Among the samples, 5LiMn 0.9 Fe 0.1 PO 4 ·Li 3 V 2 (PO 4 ) 3 /C shows the best electrochemical performance. The sample delivers the specific capacities of 158.1, 140.7 and 100.2 mAh g −1 at 0.05, 1 and 4 C rates in the potential range of 2.5–4.5 V, and exhibits very long and flat discharge plateau around 4.0 V up to 1 C rate. The sample also shows good cycling performance at various C–rates

Magnetic Properties of La0.9Ag0.1(Mn1-xCoxO3 under Pressure

Directory of Open Access Journals (Sweden)

Mihalik M.

2013-01-01

Full Text Available In our paper we report on magnetic properties of La0.90Ag0.10(CoxMn1-xO3 ferromagnetic ceramics (x = 0.00 and0.03 which were studied in pressures up to 0.9 GPa. Magnetic transition at the Curie temperature TC is accompanied with metal insulator transition with a maximum at T* which is shifted to lower temperature with applied magnetic field. The Curie temperature is decreasing with substitution of Co for Mn and is ranging from 178 K to 126.5 K. Hydrostatic pressure increases TC for sample with x = 0.03 nearly linearly with the pressure coefficient dTc/dp = 5.7 K/GPa. Hysteresis loop is affected marginally; µs increases and Hc decreases with pressure.

NCBI nr-aa BLAST: CBRC-TNIG-09-0033 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-TNIG-09-0033 ref|YP_001510423.1| hypothetical protein Franean1_6173 [Frankia s...p. EAN1pec] gb|ABW15517.1| hypothetical protein Franean1_6173 [Frankia sp. EAN1pec] YP_001510423.1 0.097 29% ...

NCBI nr-aa BLAST: CBRC-RMAC-09-0031 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-RMAC-09-0031 ref|NP_000675.1| beta-1-adrenergic receptor [Homo sapiens] gb|AAA51667.1| beta-1-adrenergi...c receptor emb|CAI16920.1| adrenergic, beta-1-, receptor [Homo sapiens] NP_000675.1 0.0 97% ...

NCBI nr-aa BLAST: CBRC-MMUS-09-0186 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MMUS-09-0186 ref|XP_001213909.1| predicted protein [Aspergillus terreus NIH262...4] gb|EAU35178.1| predicted protein [Aspergillus terreus NIH2624] XP_001213909.1 0.076 27% ...

NCBI nr-aa BLAST: CBRC-HSAP-09-0074 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-HSAP-09-0074 ref|XP_001564659.1| dynein heavy chain, putative [Leishmania brazil...iensis] emb|CAM38725.1| dynein heavy chain, putative [Leishmania braziliensis] XP_001564659.1 7.8 31% ...

Influenza A(H1N1)pdm09 vaccination policies and coverage in Europe.

Science.gov (United States)

Mereckiene, J; Cotter, S; Weber, J T; Nicoll, A; D'Ancona, F; Lopalco, P L; Johansen, K; Wasley, A M; Jorgensen, P; Lévy-Bruhl, D; Giambi, C; Stefanoff, P; Dematte, L; O'Flanagan, D

2012-01-26

In August 2010 the Vaccine European New Integrated Collaboration Effort (VENICE) project conducted a survey to collect information on influenza A(H1N1)pdm09 vaccination policies and vaccination coverage in the European Union (EU), Norway and Iceland. Of 29 responding countries, 26 organised national pandemic influenza vaccination and one country had recommendations for vaccination but did not have a specific programme. Of the 27 countries with vaccine recommendations, all recommended it for healthcare workers and pregnant women. Twelve countries recommended vaccine for all ages. Six and three countries had recommendations for specific age groups in children and in adults, countries for specific adult age groups. Most countries recommended vaccine for those in new risk groups identified early in the pandemic such as morbid obese and people with neurologic diseases. Two thirds of countries started their vaccination campaigns within a four week period after week 40/2009. The reported vaccination coverage varied between countries from 0.4% to 59% for the entire population (22 countries); 3% to 68% for healthcare workers (13 countries); 0% to 58% for pregnant women (12 countries); 0.2% to 74% for children (12 countries). Most countries identified similar target groups for pandemic vaccine, but substantial variability in vaccination coverage was seen. The recommendations were in accordance with policy advice from the EU Health Security Committee and the World Health Organization.

Influenza A(H1N1)pdm09 vaccination policies and coverage in Europe.

LENUS (Irish Health Repository)

Mereckiene, J

2012-06-01

In August 2010 the Vaccine European New Integrated Collaboration Effort (VENICE) project conducted a survey to collect information on influenza A(H1N1)pdm09 vaccination policies and vaccination coverage in the European Union (EU), Norway and Iceland. Of 29 responding countries, 26 organised national pandemic influenza vaccination and one country had recommendations for vaccination but did not have a specific programme. Of the 27 countries with vaccine recommendations, all recommended it for healthcare workers and pregnant women. Twelve countries recommended vaccine for all ages. Six and three countries had recommendations for specific age groups in children and in adults, countries for specific adult age groups. Most countries recommended vaccine for those in new risk groups identified early in the pandemic such as morbid obese and people with neurologic diseases. Two thirds of countries started their vaccination campaigns within a four week period after week 40\\/2009. The reported vaccination coverage varied between countries from 0.4% to 59% for the entire population (22 countries); 3% to 68% for healthcare workers (13 countries); 0% to 58% for pregnant women (12 countries); 0.2% to 74% for children (12 countries). Most countries identified similar target groups for pandemic vaccine, but substantial variability in vaccination coverage was seen. The recommendations were in accordance with policy advice from the EU Health Security Committee and the World Health Organization.

Deformed lattice states in a Zn{sub 0.9}V{sub 0.1}Se cubic crystal

Energy Technology Data Exchange (ETDEWEB)

Maksimov, V. I., E-mail: kokailo@rambler.ru; Dubinin, S. F.; Surkova, T. P.; Parkhomenko, V. D. [Russian Academy of Sciences, Institute of Metal Physics, Ural Branch (Russian Federation)

2016-01-15

Neutron scattering patterns have been recorded for a bulk Zn{sub 0.9}V{sub 0.1}Se cubic crystal at room temperature; they are indicative of macroscopic deformation in the material and its significant inhomogeneity. Specific features of the previously found state, preceding the fcc ↔ hcp structural transformation of the sphalerite lattice upon strong destabilization induced by vanadium ions in the doped ZnSe matrix, are discussed taking into account the data obtained.

High activity of Ag-doped Cd0.1Zn0.9S photocatalyst prepared by the hydrothermal method for hydrogen production under visible-light irradiation

Directory of Open Access Journals (Sweden)

Leny Yuliati

2014-05-01

Full Text Available Background: The hydrothermal method was used as a new approach to prepare a series of Ag-doped Cd0.1Zn0.9S photocatalysts. The effect of Ag doping on the properties and photocatalytic activity of Cd0.1Zn0.9S was studied for the hydrogen production from water reduction under visible light irradiation.Results: Compared to the series prepared by the co-precipitation method, samples prepared by the hydrothermal method performed with a better photocatalytic activity. The sample with the optimum amount of Ag doping showed the highest hydrogen production rate of 3.91 mmol/h, which was 1.7 times higher than that of undoped Cd0.1Zn0.9S. With the Ag doping, a red shift in the optical response was observed, leading to a larger portion of the visible light absorption than that of without doping. In addition to the larger absorption in the visible-light region, the increase in photocatalytic activity of samples with Ag doping may also come from the Ag species facilitating electron–hole separation.Conclusion: This study demonstrated that Ag doping is a promising way to enhance the activity of Cd0.1Zn0.9S photocatalyst.

Characterization of Laboratory Prepared Concrete Pastes Exposed to High Alkaline and High Sodium Salt Solutions

Energy Technology Data Exchange (ETDEWEB)

Langton, C. A. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2016-06-30

The objective of this study was to identify potential chemical degradation mechanisms for the Saltstone Disposal Unit (SDU) concretes, which over the performance life of the structures may be exposed to highly alkaline sodium salt solutions containing sulfate, hydroxide, and other potentially corrosive chemicals in salt solution and saltstone flush water, drain water, leachate and / or pore solution. The samples analyzed in this study were cement pastes prepared in the SIMCO Technologies, Inc. concrete laboratory. They were based on the paste fractions of the concretes used to construct the Saltstone Disposal Units (SDUs). SDU 1 and 4 concrete pastes were represented by the PV1 test specimens. The paste in the SDU 2, 3, 5, and 6 concrete was represented by the PV2 test specimens. SIMCO Technologies, Inc. selected the chemicals and proportions in the aggressive solutions to approximate proportions in the saltstone pore solution [2, 3, 5, and 6]. These test specimens were cured for 56 days in curing chamber before being immersed in aggressive solutions. After exposure, the samples were frozen to prevent additional chemical transport and reaction. Selected archived (retrieved from the freezer) samples were sent to the Savannah River National Laboratory (SRNL) for additional characterization using x-ray diffraction (XRD), scanning electron microscopy (SEM), and energy dispersive x-ray (EDX) spectroscopy. Characterization results are summarized in this report. In addition, a correlation between the oxide composition of the pastes and their chemical durability in the alkaline salt solutions is provided.

Ac conductivity and relaxation mechanism in Ba0.9Sr0.1TiO3

International Nuclear Information System (INIS)

Singh, A.K.; Barik, Subrat K.; Choudhary, R.N.P.; Mahapatra, P.K.

2009-01-01

The ac conductivity and relaxation mechanism in Ba 0.9 Sr 0.1 TiO 3 ceramics have been investigated systematically. A high-temperature solid-state reaction technique was used to synthesize the compound. The formation of the compound was checked by an X-ray diffraction (XRD) technique. The dielectric permittivity and the loss tangent of the sample were measured in a frequency range from 1 kHz to 1 MHz at different temperatures (30-500 deg. C). A study on dielectric properties reveals the electrical relaxation phenomenon occurs in the material. The activation energy was calculated from the temperature variation of dc conductivity. Studies of frequency and temperature dependence of ac conductivity of the compound suggest that conduction process in the material is thermally activated.

Results for the second quarter 2014 tank 50 WAC slurry sample chemical and radionuclide contaminants

International Nuclear Information System (INIS)

Bannochie, C.

2014-01-01

This report details the chemical and radionuclide contaminant results for the characterization of the 2014 Second Quarter sampling of Tank 50 for the Saltstone Waste Acceptance Criteria (WAC) in effect at that time. Information from this characterization will be used by DWPF & Saltstone Facility Engineering (DSFE) to support the transfer of low-level aqueous waste from Tank 50 to the Salt Feed Tank in the Saltstone Facility in Z-Area, where the waste will be immobilized. This information is also used to update the Tank 50 Waste Characterization System

Results For The Fourth Quarter 2014 Tank 50 WAC Slurry Sample: Chemical And Radionuclide Contaminants

Energy Technology Data Exchange (ETDEWEB)

Crawford, C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2015-09-30

This report details the chemical and radionuclide contaminant results for the characterization of the Calendar Year (CY) 2014 Fourth Quarter sampling of Tank 50 for the Saltstone Waste Acceptance Criteria (WAC) in effect at that time. Information from this characterization will be used by DWPF & Saltstone Facility Engineering (DSFE) to support the transfer of low-level aqueous waste from Tank 50 to the Salt Feed Tank in the Saltstone Facility in Z-Area, where the waste will be immobilized. This information is also used to update the Tank 50 Waste Characterization System.

Results For The Third Quarter 2013 Tank 50 WAC Slurry Sample

Energy Technology Data Exchange (ETDEWEB)

Bannochie, Christopher J.

2013-11-26

This report details the chemical and radionuclide contaminant results for the characterization of the 2013 Third Quarter sampling of Tank 50 for the Saltstone Waste Acceptance Criteria (WAC) in effect at that time. Information from this characterization will be used by DWPF & Saltstone Facility Engineering (DSFE) to support the transfer of low-level aqueous waste from Tank 50 to the Salt Feed Tank in the Saltstone Facility in Z-Area, where the waste will be immobilized. This information is also used to update the Tank 50 Waste Characterization System.

Results For The Second Quarter 2013 Tank 50 WAC Slurry Sample: Chemical And Radionuclide Contaminants

Energy Technology Data Exchange (ETDEWEB)

Bannochie, Christopher J.

2013-07-31

This report details the chemical and radionuclide contaminant results for the characterization of the 2013 Second Quarter sampling of Tank 50 for the Saltstone Waste Acceptance Criteria (WAC) in effect at that time. Information from this characterization will be used by Saltstone Facility Engineering (SFE) to support the transfer of low-level aqueous waste from Tank 50 to the Salt Feed Tank in the Saltstone Facility in Z-Area, where the waste will be immobilized. This information is also used to update the Tank 50 Waste Characterization System.

Weak antilocalization effect due to topological surface states in Bi2Se2.1Te0.9

Science.gov (United States)

Shrestha, K.; Graf, D.; Marinova, V.; Lorenz, B.; Chu, C. W.

2017-10-01

We have investigated the weak antilocalization (WAL) effect in the p-type Bi2Se2.1Te0.9 topological system. The magnetoconductance shows a cusp-like feature at low magnetic fields, indicating the presence of the WAL effect. The WAL curves measured at different tilt angles merge together when they are plotted as a function of the normal field components, showing that surface states dominate the magnetoconductance in the Bi2Se2.1Te0.9 crystal. We have calculated magnetoconductance per conduction channel and applied the Hikami-Larkin-Nagaoka formula to determine the physical parameters that characterize the WAL effect. The number of conduction channels and the phase coherence length do not change with temperature up to T = 5 K. In addition, the sample shows a large positive magnetoresistance that reaches 1900% under a magnetic field of 35 T at T = 0.33 K with no sign of saturation. The magnetoresistance value decreases with both increasing temperature and tilt angle of the sample surface with respect to the magnetic field. The large magnetoresistance of topological insulators can be utilized in future technology such as sensors and memory devices.

Influence of Cobalt Doping on the Physical Properties of Zn0.9Cd0.1S Nanoparticles

Directory of Open Access Journals (Sweden)

Gupta Hari Om

2009-01-01

Full Text Available Abstract Zn0.9Cd0.1S nanoparticles doped with 0.005–0.24 M cobalt have been prepared by co-precipitation technique in ice bath at 280 K. For the cobalt concentration >0.18 M, XRD pattern shows unidentified phases along with Zn0.9Cd0.1S sphalerite phase. For low cobalt concentration (≤0.05 M particle size, d XRDis ~3.5 nm, while for high cobalt concentration (>0.05 M particle size decreases abruptly (~2 nm as detected by XRD. However, TEM analysis shows the similar particle size (~3.5 nm irrespective of the cobalt concentration. Local strain in the alloyed nanoparticles with cobalt concentration of 0.18 M increases ~46% in comparison to that of 0.05 M. Direct to indirect energy band-gap transition is obtained when cobalt concentration goes beyond 0.05 M. A red shift in energy band gap is also observed for both the cases. Nanoparticles with low cobalt concentrations were found to have paramagnetic nature with no antiferromagnetic coupling. A negative Curie–Weiss temperature of −75 K with antiferromagnetic coupling was obtained for the high cobalt concentration.

Preparation and electrochemical properties of homogeneous carbon-coated LiFe0.9Mn0.1PO4 as cathode material for lithium-ion batteries

International Nuclear Information System (INIS)

Xu, Yang; Yu, Jingang; Peng, Sui; Liu, Suqin; Wei, Zhongqiang; Li, Xianhong; Li, Yajuan

2012-01-01

Homogeneous carbon-coated LiFe 0.9 Mn 0.1 PO 4 cathode material was synthesized by one-step solid-state reaction using glucose as carbon source. Powder X-ray diffractometry (XRD), transmission electron microscopy (TEM), cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS) and galvanostatic measurements were employed to characterize the samples. Mn-doping and carbon co-modification did not affect the olivine structure of LiFePO 4 , but improved its kinetics in terms of capacity delivery, polarization and rate capability. When compared with the undoped LiFePO 4 /C, the LiFe 0.9 Mn 0.1 PO 4 /C sample presented good size distribution - around 100-200 nm - and better electrochemical performance. At current rates of 0.1, 1.0, 3.0 and 10.0 C (C = 170 mA g -1 ), the LiFe 0.9 Mn 0.1 PO 4 /C electrode delivered discharge capacities of 154.1, 138.8, 120.0 and 94.0 mA h g -1 , respectively. Results obtained by cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS) indicated that the polarization and charge transfer resistance of the sample were greatly decreased by Mn-doping. (author)

NCBI nr-aa BLAST: CBRC-GACU-09-0004 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-GACU-09-0004 ref|XP_747491.1| K+ homeostasis protein Kha1, putative [Aspergill...us fumigatus Af293] gb|EAL85453.1| K+ homeostasis protein Kha1, putative [Aspergillus fumigatus Af293] XP_747491.1 0.53 28% ...

Frequency of respiratory virus infections and next-generation analysis of influenza A/H1N1pdm09 dynamics in the lower respiratory tract of patients admitted to the ICU.

Directory of Open Access Journals (Sweden)

Antonio Piralla

Full Text Available Recent molecular diagnostic methods have significantly improved the diagnosis of viral pneumonia in intensive care units (ICUs. It has been observed that 222G/N changes in the HA gene of H1N1pdm09 are associated with increased lower respiratory tract (LRT replication and worse clinical outcome. In the present study, the frequency of respiratory viruses was assessed in respiratory samples from 88 patients admitted to 16 ICUs during the 2014-2015 winter-spring season in Lombardy. Sixty-nine out of 88 (78.4% patients were positive for a respiratory viral infection at admission. Of these, 57/69 (82.6% were positive for influenza A (41 A/H1N1pdm09 and 15 A/H3N2, 8/69 (11.6% for HRV, 2/69 (2.9% for RSV and 2/69 (2.9% for influenza B. Phylogenetic analysis of influenza A/H1N1pdm09 strains from 28/41 ICU-patients and 21 patients with mild respiratory syndrome not requiring hospitalization, showed the clear predominance of subgroup 6B strains. The median influenza A load in LRT samples of ICU patients was higher than that observed in the upper respiratory tract (URT (p<0.05. Overall, a greater number of H1N1pdm09 virus variants were observed using next generation sequencing on partial HA sequences (codons 180-286 in clinical samples from the LRT as compared to URT. In addition, 222G/N/A mutations were observed in 30% of LRT samples from ICU patients. Finally, intra-host evolution analysis showed the presence of different dynamics of viral population in LRT of patients hospitalized in ICU with a severe influenza infection.

Influenza A Viruses of Swine (IAV-S) in Vietnam from 2010 to 2015: Multiple Introductions of A(H1N1)pdm09 Viruses into the Pig Population and Diversifying Genetic Constellations of Enzootic IAV-S.

Science.gov (United States)

Takemae, Nobuhiro; Harada, Michiyo; Nguyen, Phuong Thanh; Nguyen, Tung; Nguyen, Tien Ngoc; To, Thanh Long; Nguyen, Tho Dang; Pham, Vu Phong; Le, Vu Tri; Do, Hoa Thi; Vo, Hung Van; Le, Quang Vinh Tin; Tran, Tan Minh; Nguyen, Thanh Duy; Thai, Phuong Duy; Nguyen, Dang Hoang; Le, Anh Quynh Thi; Nguyen, Diep Thi; Uchida, Yuko; Saito, Takehiko

2017-01-01

Active surveillance of influenza A viruses of swine (IAV-S) involving 262 farms and 10 slaughterhouses in seven provinces in northern and southern Vietnam from 2010 to 2015 yielded 388 isolates from 32 farms; these viruses were classified into H1N1, H1N2, and H3N2 subtypes. Whole-genome sequencing followed by phylogenetic analysis revealed that the isolates represented 15 genotypes, according to the genetic constellation of the eight segments. All of the H1N1 viruses were entirely A(H1N1)pdm09 viruses, whereas all of the H1N2 and H3N2 viruses were reassortants among 5 distinct ancestral viruses: H1 and H3 triple-reassortant (TR) IAV-S that originated from North American pre-2009 human seasonal H1, human seasonal H3N2, and A(H1N1)pdm09 viruses. Notably, 93% of the reassortant IAV-S retained M genes that were derived from A(H1N1)pdm09, suggesting some advantage in terms of their host adaptation. Bayesian Markov chain Monte Carlo analysis revealed that multiple introductions of A(H1N1)pdm09 and TR IAV-S into the Vietnamese pig population have driven the genetic diversity of currently circulating Vietnamese IAV-S. In addition, our results indicate that a reassortant IAV-S with human-like H3 and N2 genes and an A(H1N1)pdm09 origin M gene likely caused a human case in Ho Chi Minh City in 2010. Our current findings indicate that human-to-pig transmission as well as cocirculation of different IAV-S have contributed to diversifying the gene constellations of IAV-S in Vietnam. This comprehensive genetic characterization of 388 influenza A viruses of swine (IAV-S) isolated through active surveillance of Vietnamese pig farms from 2010 through 2015 provides molecular epidemiological insight into the genetic diversification of IAV-S in Vietnam after the emergence of A(H1N1)pdm09 viruses. Multiple reassortments among A(H1N1)pdm09 viruses and enzootic IAV-S yielded 14 genotypes, 9 of which carried novel gene combinations. The reassortants that carried M genes derived from A(H1N1

Effect of Sb{sub 2}O{sub 3} on the electrical properties of Ba{sub 0.9}Ca{sub 0.1}Zr{sub 0.1}Ti{sub 0.9}O{sub 3} ceramics fabricated using nanocrystals seed

Energy Technology Data Exchange (ETDEWEB)

Parjansri, P. [Rajamangala University of Technology Krungthep, Physics Division, Faculty of Science and Technology, Bangkok (Thailand); Intatha, U. [Mae Fah Luang University, School of Science, Chiang Rai (Thailand); Guo, R.; Bhalla, A.S. [University of Texas at San Antonio, Department of Electrical and Computer Engineering, Faculty of Engineering, San Antonio, TX (United States); Eitssayeam, S. [Chiang Mai University, Department of Physics and Materials Science, Faculty of Science, Chiang Mai (Thailand); Chiang Mai University, Materials Science Research Center, Faculty of Science, Chiang Mai (Thailand)

2016-09-15

This work was to investigate the effects of antimony oxide (Sb{sub 2}O{sub 3}) on the electrical properties of Ba{sub 0.9}Ca{sub 0.1}Zr{sub 0.1}Ti{sub 0.9}O{sub 3} (BCZT) ceramics and was prepared by adding 1 mol% of BCZT nanocrystals. The seed is nanocrystals of BCZT which was synthesized by the molten salt method. The ceramics powders were prepared by the mixed oxide method using BaCO{sub 3}, CaCO{sub 3}, ZrO{sub 2}, TiO{sub 2} as starting materials, and the BCZT seed was added as nanocrystal for induce phase transition. They were doped with x mol% Sb{sub 2}O{sub 3} (x = 0.0-0.5). Results indicated that all samples show pure perovskite phase. The Sb{sub 2}O{sub 3} enhanced the electrical properties of the ceramic systems. Excellent values of a dielectric constant (ε {sub r}) at room temperature (T{sub r}) were 4086 with sample of x = 0.5, and at Curie temperature (T{sub c}) was 15,485 for samples with x = 0.1. The highest remnant polarization (P{sub r}), piezoelectric charge coefficient (d{sub 33}), piezoelectric voltage coefficient (g{sub 33}), electromechanical coefficient for planar mode (k{sub p}) and thickness mode (k{sub t}) values were 6.3 μC/cm{sup 2}, 346 pC/N, 15.6 x 10{sup -3} Vm/N, 42 and 41 %, respectively, which were obtained for the sample of x = 0.2 mol% Sb. (orig.)

NCBI nr-aa BLAST: CBRC-HSAP-09-0074 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-HSAP-09-0074 ref|XP_001558290.1| hypothetical protein BC1G_02954 [Botryotinia fuck...eliana B05.10] gb|EDN18805.1| hypothetical protein BC1G_02954 [Botryotinia fuckeliana B05.10] XP_001558290.1 2.7 34% ...

NCBI nr-aa BLAST: CBRC-TNIG-09-0017 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-TNIG-09-0017 ref|NP_001079227.1| shaker-like potassium channel subunit Kv1.3B ...[Xenopus laevis] gb|AAK83378.1|AF395810_1 shaker-like potassium channel subunit Kv1.3B [Xenopus laevis] NP_001079227.1 0.0 86% ...

NCBI nr-aa BLAST: CBRC-TNIG-09-0017 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-TNIG-09-0017 ref|NP_001025549.1| potassium voltage-gated channel, shaker-relat...ed subfamily, member 3 [Gallus gallus] gb|AAP94028.1| shaker subfamily potassium channel Kv1.3 [Gallus gallus] NP_001025549.1 0.0 83% ...

NCBI nr-aa BLAST: CBRC-GACU-09-0056 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-GACU-09-0056 sp|P48766|NAC1_CAVPO Sodium/calcium exchanger 1 precursor (Na(+)/Ca(2+)-exchange... protein 1) gb|AAA73904.1| sodium-calcium exchanger prf||2108269A Na/Ca exchanger P48766 0.0 68% ...

NCBI nr-aa BLAST: CBRC-PTRO-09-0001 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-PTRO-09-0001 ref|ZP_01444684.1| hypothetical protein R2601_22801 [Roseovarius ...sp. HTCC2601] gb|EAU45065.1| hypothetical protein R2601_22801 [Roseovarius sp. HTCC2601] ZP_01444684.1 0.32 34% ...

NCBI nr-aa BLAST: CBRC-MDOM-09-0050 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MDOM-09-0050 ref|NP_001017377.1| progestin and adipoQ receptor family member I...V [Rattus norvegicus] gb|AAH92635.1| Progestin and adipoQ receptor family member IV [Rattus norvegicus] gb|EDM03772.1| progesti

NCBI nr-aa BLAST: CBRC-MMUS-09-0186 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MMUS-09-0186 ref|ZP_01510169.1| ABC-2 type transporter, NodJ family [Burkholderia phytofirm...ans PsJN] gb|EAV05032.1| ABC-2 type transporter, NodJ family [Burkholderia phytofirmans PsJN] ZP_01510169.1 1.4 31% ...

Magnetic transitions in double perovskite Sr2FeRe1-xSbxO6 (0≤x≤0.9)

International Nuclear Information System (INIS)

Jung, Alexandra; Ksenofontov, Vadim; Reiman, Sergey; Therese, Helen Annal; Felser, Claudia; Tremel, Wolfgang; Kolb, Ute

2006-01-01

The double perovskites Sr 2 FeMO 6 (M=Re,Mo) belong to the important class of half-metallic magnetic materials. In this study we explore the effect of replacing the electronic 5d buffer element Re with variable valency by the main group element Sb with fixed valency. X-ray diffraction reveals Sr 2 FeRe 1-x Sb x O 6 (0 2 FeReO 6 changes to antiferromagnetic upon Sb substitution as was determined by magnetic susceptibility measurements. Samples up to a doping level of 0.3 are ferrimagnetic, while Sb contents higher than 0.6 result in an overall antiferromagnetic behavior. 57 Fe and 121 Sb Moessbauer spectroscopy specifies the valence state of Sb to be +5 within the whole range of substitution whereas the Fe valence state changes from +2.7 for the parent compound to +2.9 for Sr 2 FeRe 0.1 Sb 0.9 O 6 . Accordingly, Fe adopts the role of an electronic buffer element from Re upon heavy Sb doping. Additionally, 57 Fe Moessbauer results show a coexistence of ferri- and antiferromagnetic clusters within the same perovskite-type crystal structure in the Sb substitution range 0.3 2 FeReO 6 and Sr 2 FeRe 0.9 Sb 0.1 O 6 are ''purely'' ferrimagnetic and Sr 2 FeRe 0.1 Sb 0.9 O 6 contains antiferromagnetically ordered Fe sites only. Consequently, a replacement of the Re atoms by a nonmagnetic main group element such as Sb blocks the superexchange pathways -Fe-O-Re(Sb)-O-Fe- along the crystallographic axis of the perovskite unit cell and destroys the itinerant magnetism of the parent compound

Vacuum decay container/closure integrity testing technology. Part 1. ASTM F2338-09 precision and bias studies.

Science.gov (United States)

Wolf, Heinz; Stauffer, Tony; Chen, Shu-Chen Y; Lee, Yoojin; Forster, Ronald; Ludzinski, Miron; Kamat, Madhav; Godorov, Phillip; Guazzo, Dana Morton

2009-01-01

ASTM F2338-09 Standard Test Method for Nondestructive Detection of Leaks in Packages by Vacuum Decay Method is applicable for leak-testing rigid and semi-rigid non-lidded trays; trays or cups sealed with porous barrier lidding materials; rigid, nonporous packages; and flexible, nonporous packages. Part 1 of this series describes the precision and bias studies performed in 2008 to expand this method's scope to include rigid, nonporous packages completely or partially filled with liquid. Round robin tests using three VeriPac 325/LV vacuum decay leak testers (Packaging Technologies & Inspection, LLC, Tuckahoe, NY) were performed at three test sites. Test packages were 1-mL glass syringes. Positive controls had laser-drilled holes in the barrel ranging from about 5 to 15 microm in nominal diameter. Two different leak tests methods were performed at each site: a "gas leak test" performed at 250 mbar (absolute) and a "liquid leak test" performed at about 1 mbar (absolute). The gas leak test was used to test empty, air-filled syringes. All defects with holes > or = 5.0 microm and all no-defect controls were correctly identified. The only false negative result was attributed to a single syringe with a ASTM F2338-09 test method and the precision and bias study report are available by contacting ASTM International in West Conshohocken, PA, USA (www.astm.org).

NCBI nr-aa BLAST: CBRC-PABE-09-0037 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-PABE-09-0037 ref|YP_890142.1| hypothetical protein MSMEG_5916 [Mycobacterium sme...gmatis str. MC2 155] gb|ABK71889.1| hypothetical protein MSMEG_5916 [Mycobacterium smegmatis str. MC2 155] YP_890142.1 0.033 36% ...

Predominance of influenza A(H1N1)pdm09 virus genetic subclade 6B.1 and influenza B/Victoria lineage viruses at the start of the 2015/16 influenza season in Europe

DEFF Research Database (Denmark)

Broberg, Eeva; Melidou, Angeliki; Prosenc, Katarina

2016-01-01

Influenza A(H1N1)pdm09 viruses predominated in the European influenza 2015/16 season. Most analysed viruses clustered in a new genetic subclade 6B.1, antigenically similar to the northern hemisphere vaccine component A/California/7/2009. The predominant influenza B lineage was Victoria compared...

Results for the Fourth Quarter Calendar Year 2015 Tank 50H Salt Solution Sample

Energy Technology Data Exchange (ETDEWEB)

Crawford, C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2016-01-11

In this memorandum, the chemical and radionuclide contaminant results from the Fourth Quarter Calendar Year 2015 (CY15) sample of Tank 50H salt solution are presented in tabulated form. The Fourth Quarter CY15 Tank 50H samples were obtained on October 29, 2015 and received at Savannah River National Laboratory (SRNL) on October 30, 2015. The information from this characterization will be used by Defense Waste Processing Facility (DWPF) & Saltstone Facility Engineering for the transfer of aqueous waste from Tank 50H to the Salt Feed Tank in the Saltstone Production Facility, where the waste will be treated and disposed of in the Saltstone Disposal Facility. This memorandum compares results, where applicable, to Saltstone Waste Acceptance Criteria (WAC) limits and targets. Data pertaining to the regulatory limits for Resource Conservation and Recovery Act (RCRA) metals will be documented at a later time per the Task Technical and Quality Assurance Plan (TTQAP) for the Tank 50H saltstone task. The chemical and radionuclide contaminant results from the characterization of the Fourth Quarter Calendar Year 2015 (CY15) sampling of Tank 50H were requested by SRR personnel and details of the testing are presented in the SRNL Task Technical and Quality Assurance Plan.

Systemic corticosteroids and early administration of antiviral agents for pneumonia with acute wheezing due to influenza A(H1N1pdm09 in Japan.

Directory of Open Access Journals (Sweden)

Koichiro Kudo

Full Text Available BACKGROUND: Pneumonia patients with wheezing due to influenza A(H1N1pdm09 were frequently treated with systemic corticosteroids in Japan although systemic corticosteroid for critically ill patients with pneumonia caused by influenza A(H1N1pdm09 has been controversial. Applicability of systemic corticosteroid treatment needs to be evaluated. METHODS/PRINCIPAL FINDINGS: We retrospectively reviewed 89 subjects who were diagnosed with influenza A(H1N1pdm09 and admitted to a national hospital, Tokyo during the pandemic period. The median age of subjects (45 males was 8 years (range, 0-71. All subjects were treated with antiviral agents and the median time from symptom onset to initiation of antiviral agents was 2 days (range, 0-7. Subjects were classified into four groups: upper respiratory tract infection, wheezing illness, pneumonia with wheezing, and pneumonia without wheezing. The characteristics of each group was evaluated. A history of asthma was found more frequently in the wheezing illness (55.6% and pneumonia with wheezing (43.3% groups than in the other two groups (p = 0.017. Corticosteroid treatment was assessed among subjects with pneumonia. Oxygen saturation was lower in subjects receiving corticosteroids (steroid group than in subjects not receiving corticosteroids (no-steroid group (p<0.001. The steroid group required greater oxygen supply than the no-steroid group (p<0.001. No significant difference was found by the Kaplan-Meier method between the steroid and the no-steroid groups in hours to fever alleviation from the initiation of antiviral agents and hospitalization days. In logistic regression analysis, wheezing, pneumonia and oxygen saturation were independent factors associated with using systemic corticosteroids. CONCLUSION: Patients with wheezing and a history of asthma were frequently found in the study subjects. Systemic corticosteroids together with early administration of antiviral agents to pneumonia with wheezing and

E119D Neuraminidase Mutation Conferring Pan-Resistance to Neuraminidase Inhibitors in an A(H1N1)pdm09 Isolate From a Stem-Cell Transplant Recipient.

Science.gov (United States)

L'Huillier, Arnaud G; Abed, Yacine; Petty, Tom J; Cordey, Samuel; Thomas, Yves; Bouhy, Xavier; Schibler, Manuel; Simon, Audrey; Chalandon, Yves; van Delden, Christian; Zdobnov, Evgeny; Boquete-Suter, Patricia; Boivin, Guy; Kaiser, Laurent

2015-12-01

An influenza A(H1N1)pdm09 infection was diagnosed in a hematopoietic stem cell transplant recipient during conditioning regimen. He was treated with oral oseltamivir, later combined with intravenous zanamivir. The H275Y neuraminidase (NA) mutation was first detected, and an E119D NA mutation was identified during zanamivir therapy. Recombinant wild-type (WT) E119D and E119D/H275Y A(H1N1)pdm09 NA variants were generated by reverse genetics. Susceptibility to NA inhibitors (NAIs) was evaluated with a fluorometric assay using the 2'-(4-methylumbelliferyl)-α-D-N-acetylneuraminic acid (MUNANA) substrate. Susceptibility to favipiravir (T-705) was assessed using plaque reduction assays. The NA affinity and velocity values were determined with NA enzymatic studies. We identified an influenza A(H1N1)pdm09 E119D mutant that exhibited a marked increase in the 50% inhibitory concentrations against all tested NAIs (827-, 25-, 286-, and 702-fold for zanamivir, oseltamivir, peramivir, and laninamivir, respectively). The double E119D/H275Y mutation further increased oseltamivir and peramivir 50% inhibitory concentrations by 790- and >5000-fold, respectively, compared with the WT. The mutant viruses remained susceptible to favipiravir. The NA affinity and velocity values of the E119D variant decreased by 8.1-fold and 4.5-fold, respectively, compared with the WT. The actual emergence of a single NA mutation conferring pan-NAI resistance in the clinical setting reinforces the pressing need to develop new anti-influenza strategies. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

3D network single-phase Ni0.9Zn0.1O as anode materials for lithium-ion batteries

DEFF Research Database (Denmark)

Huang, Guoyong; Guo, Xueyi; Cao, Xiao

2016-01-01

A novel 3D network single-phase Ni0.9Zn0.1O has been designed and synthesized by calcining a special metal-organic precursor (MOP) (MeO2C3H6, Me=Ni and Zn, the molar ratio of Ni: Zn=9:1) as the self-sacrificing template for the first time. Comparing with NiO or the mixture of NiO and ZnO, the new...

Alteraciones morfológicas en pulmón por la influenza A H1N1/v09 en autopsias, Colombia, 2009

OpenAIRE

Jorge Rivera; Ladys Sarmiento; Edgar Parra; Gabriel Toro; Marcela Neira; Jairo Méndez; Juliana Barbosa; María Leonor Caldas

2011-01-01

Introducción. La influenza es una infección respiratoria aguda que se presenta de forma estacional y pandémica. En el 2009, la Organización Mundial de Salud (OMS) declaró una pandemia por influenza de tipo A en la que se reportaron en Colombia 3.876 casos de infección, de los cuales 239 fallecieron. Objetivo. Describir los cambios morfológicos asociados a la infección por el virus A H1N1/v09 en tejido pulmonar de autopsias de la pandemia de 2009 en Colombia. Materiales y métodos. Se est...

NCBI nr-aa BLAST: CBRC-TNIG-09-0033 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-TNIG-09-0033 ref|ZP_01901905.1| hypothetical protein RAZWK3B_08726 [Roseobacte...r sp. AzwK-3b] gb|EDM72321.1| hypothetical protein RAZWK3B_08726 [Roseobacter sp. AzwK-3b] ZP_01901905.1 0.13 31% ...

Neutron Diffraction Study On Gamma To Alpha Phase Transition In Ce0.9th0.1 Alloy

Energy Technology Data Exchange (ETDEWEB)

Lashley, Jason C1 [Los Alamos National Laboratory; Heffner, Robert H [Los Alamos National Laboratory; Llobet, A [Los Alamos National Laboratory; Darling, T W [U OF NEVADA; Jeong, I K [PUSAN NATL UNIV

2008-01-01

Comprehensive neutron diffraction measurements were performed to study the isostructural {gamma} {leftrightarrow} {alpha} phase transition in Ce{sub 0.9}Th{sub 0.1} alloy. Using Rietveld refinements, we obtained lattice and thermal parameters as a function of temperature. From the temperature slope of the thermal parameters, we determined Debye temperatures {Theta}{sup {gamma}}{sub D} = 133(1) K and {Theta}{sup {alpha}}{sub D} = 140(1) K for the {gamma} phase and the {alpha} phase, respectively. This result implies that the vibrational entropy change is not significant at the {gamma} {leftrightarrow} {alpha} transition, contrary to that from elemental Cerium [Phys. Rev. Lett. 92, 105702, 2004].

Molecular findings from influenza A(H1N1pdm09 detected in patients from a Brazilian equatorial region during the pandemic period

Directory of Open Access Journals (Sweden)

Maria José Couto Oliveira

2014-11-01

Full Text Available After the World Health Organization officially declared the end of the first pandemic of the XXI century in August 2010, the influenza A(H1N1pdm09 virus has been disseminated in the human population. In spite of its sustained circulation, very little on phylogenetic data or oseltamivir (OST resistance is available for the virus in equatorial regions of South America. In order to shed more light on this topic, we analysed the haemagglutinin (HA and neuraminidase (NA genes of influenza A(H1N1pdm09 positive samples collected during the pandemic period in the Pernambuco (PE, a northeastern Brazilian state. Complete HA sequences were compared and amino acid changes were related to clinical outcome. In addition, the H275Y substitution in NA, associated with OST resistance, was investigated by pyrosequencing. Samples from PE were grouped in phylogenetic clades 6 and 7, being clustered together with sequences from South and Southeast Brazil. The D222N/G HA gene mutation, associated with severity, was found in one deceased patient that was pregnant. Additionally, the HA mutation K308E, which appeared in Brazil in 2010 and was only detected worldwide the following year, was identified in samples from hospitalised cases. The resistance marker H275Y was not identified in samples tested. However, broader studies are needed to establish the real frequency of resistance in this Brazilian region.

NCBI nr-aa BLAST: CBRC-PABE-09-0018 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-PABE-09-0018 ref|NP_005276.2| G protein-coupled receptor 7 [Homo sapiens] gb|AAH69117.1| Neuropeptides... B/W receptor 1 [Homo sapiens] gb|AAI07102.1| Neuropeptides B/W receptor 1 [Homo sap...iens] gb|EAW86722.1| neuropeptides B/W receptor 1 [Homo sapiens] NP_005276.2 0.0 100% ...

A theoretical study of the complexes of N2O with H+, Li+, and HF using various correlation methods

International Nuclear Information System (INIS)

Del Bene, J.E.; Stahlberg, E.A.; Shavitt, I.

1990-01-01

Binding energies for complexes of N 2 O with the acids H + , Li + , and HF have been computed using the following correlation methods: many-body (Moller-Plesset) perturbation theory at second (MP2), third (MP3), and fourth (MP4) order; the quadratic CI method with single and double excitations (QCISD) and with noniterative inclusion of triple excitations (QCISD(T)); the linearized coupled-cluster method (LCCM); the averaged coupled-pair functional (ACPF); configuration interaction with all single and double excitations (CISD); and CISD with the Davidson and Pople corrections. The convergence of the Moller-Plesset expansion is erratic, predicting that the terminal nitrogen is the preferred binding site for the complexes at the MP2 and MP4 levels, in disagreement with Hartree-Fock and MP3 and all other models (including the infinite-order QCI). The effect of triple excitations at MP4 and QCI is to destabilize complexes bound at O and stabilize those bound at N, but this effect is greatly overestimated at MP4 relative to QCI. Except for the LCCM result for N-protonated N 2 O, ACPF and LCCM binding energies are similar to the QCISD values. The size-consistency error in the ACPF binding energies of the complexes of N 2 O with HF is about 0.5 kcal/mol. The CISD size-consistency error for these complexes is 23 kcal/mol, leading to negative binding energies when computed relative to isolated N 2 O and HF

NCBI nr-aa BLAST: CBRC-MDOM-09-0050 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MDOM-09-0050 gb|EAW85442.1| progestin and adipoQ receptor family member IV, is...oform CRA_b [Homo sapiens] gb|EAW85444.1| progestin and adipoQ receptor family member IV, isoform CRA_b [Homo sapiens] EAW85442.1 3e-94 65% ...

Registration of 'CP 09-2392' Sugarcane

Science.gov (United States)

CP 09-2392’ (Reg. No.____; PI _____) sugarcane, a complex hybrid of Saccharum spp, was developed through cooperative research conducted by the USDA-ARS, the University of Florida, and the Florida Sugar Cane League, Inc., and was released to growers in June 2016. ‘CP 09-2392’ was selected from a cro...

Seasonal Influenza A H1N1pdm09 Virus and Severe Outcomes: A Reason for Broader Vaccination in Non-Elderly, At-Risk People.

Directory of Open Access Journals (Sweden)

Elisa Minchole

Full Text Available Recent pandemics of influenza A H1N1pdm09 virus have caused severe illness, especially in young people. Very few studies on influenza A H1N1pdm09 in post-pandemic periods exist, and there is no information on the severity of both seasonal influenza A(H1N1 and A(H3N2 from the same season, adjusting for potential confounders, including vaccine.We performed a retrospective observational study of adults hospitalized during the 2014 season with influenza A(H1N1 or A(H3N2. All patients underwent the same diagnostic and therapeutic protocol in a single hospital, including early Oseltamivir therapy. We included 234 patients: 146 (62.4% influenza A(H1N1 and 88 (37.6% A(H3N2. A(H1N1 patients were younger (p<0.01, developed more pneumonia (p<0.01, respiratory complications (p = 0.015, ARDS (p = 0.047, and septic shock (p = 0.049, were more frequently admitted to the ICU (p = 0.022, required IMV (p = 0.049, and were less frequently vaccinated (p = 0.008. After adjusting for age, comorbidities, time from onset of illness, and vaccine status, influenza A(H1N1 (OR, 2.525, coinfection (OR, 2.821, and no vaccination (OR, 3.086 were independent risk factors for severe disease.Hospitalized patients with influenza A(H1N1 were more than twice as likely to have severe influenza. They were younger and most had not received the vaccine. Our findings suggest that seasonal influenza A(H1N1 maintains some features of pandemic viruses, and recommend wider use of vaccination in younger adult high-risk patients.

Corrosion of Dental Au-Ag-Cu-Pd Alloys in 0.9 % Sodium Chloride Solution

International Nuclear Information System (INIS)

Chiba, Atsushi; Kusayanagi, Yukiharu

2005-01-01

Two Au-Ag-Cu-Pd dental casting alloys (Au:12% and 20%) used. The test solutions used 0.9 % NaCl solution (isotonic sodium chloride solution), 0.9 % NaCl solution containing 1 % lactic acid, and 0.9 % NaCl solution containing 1 % lactic acid and 0.1 mol dm -3 Na 2 S. The surface of two samples in three sample solutions was not natural discoloration during one year. The alloy containing 12 % gold was easily alloyed and the composition was uniform comparing with the alloy containing 20 % gold. The rest potentials have not a little effect after three months. The kinds of metals could not definitely from the oxidation and reduction waves of metal on the cyclic voltammograms. The dissolutions of gold and palladium were 12 % Au sample in the 0.9 % NaCl solution containing 1 % lactic acid and 0.1 mol dm -3 Na 2 S. The pH of solution had an affect on dissolution of copper, and sulfur ion had an affect on dissolution of silver. The copper dissolved amount from 20 % gold sample was about 26 times comparing with that of 12 % gold sample in the 0.9 % solution containing 1 % lactic acid. Corrosion products were silver chloride and copper chloride in NaCl solution, and silver sulfide and copper sulfide in NaCl solution containing Na 2 S

THE STELLAR INITIAL MASS FUNCTION AT 0.9 < z < 1.5

Energy Technology Data Exchange (ETDEWEB)

Martín-Navarro, Ignacio; Trujillo, Ignacio; Vazdekis, Alexandre [Instituto de Astrofísica de Canarias, c/Vía Láctea s/n, E38205 - La Laguna, Tenerife (Spain); Pérez-González, Pablo G.; Esquej, Pilar; Sánchez, Helena Domínguez; Espino, Néstor [Departamento de Astrofísica, Facultad de CC. Físicas, Universidad Complutense de Madrid, E-28040 Madrid (Spain); Barro, Guillermo [UCO/Lick Observatory, Department of Astronomy and Astrophysics, University of California, Santa Cruz, CA 95064 (United States); Bruzual, Gustavo [Centro de Radioastronomía y Astrofísica, UNAM, Campus Morelia, México (Mexico); Charlot, Stéphane [UPMC-CNRS, UMR7095, Institut d' Astrophysique de Paris, F-75014 Paris (France); Cava, Antonio [Observatoire de Genève, Université de Genève, 51 Ch. des Maillettes, 1290 Versoix (Switzerland); Ferreras, Ignacio [Mullard Space Science Laboratory, University College London, Holmbury St. Mary, Dorking, Surrey RH5 6NT (United Kingdom); Barbera, Francesco La [INAF-Osservatorio Astronomico di Capodimonte, Napoli (Italy); Koekemoer, Anton M. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Cenarro, A. Javier, E-mail: imartin@iac [Centro de Estudios de Física del Cosmos de Aragǿn, Plaza San Juan 1, E-44001 Teruel (Spain)

2015-01-01

We explore the stellar initial mass function (IMF) of a sample of 49 massive quiescent galaxies (MQGs) at 0.9 < z < 1.5. We base our analysis on intermediate resolution spectro-photometric data in the GOODS-N field taken in the near-infrared and optical with the Hubble Space Telescope Wide Field Camera 3 G141 grism and the Survey for High-z Absorption Red and Dead Sources. To constrain the slope of the IMF, we have measured the TiO{sub 2} spectral feature, whose strength depends strongly on the content of low-mass stars, as well as on stellar age. Using ultraviolet to near-infrared individual and stacked spectral energy distributions, we have independently estimated the stellar ages of our galaxies. Knowing the age of the stellar population, we interpret the strong differences in the TiO{sub 2} feature as an IMF variation. In particular, for the heaviest z ∼ 1 MQGs (M > 10{sup 11} M {sub ☉}), we find an average age of 1.7 ± 0.3 Gyr and a bottom-heavy IMF (Γ {sub b} = 3.2 ± 0.2). Lighter MQGs (2 × 10{sup 10} < M < 10{sup 11} M {sub ☉}) at the same redshift are younger on average (1.0 ± 0.2 Gyr) and present a shallower IMF slope (Γ{sub b}=2.7{sub −0.4}{sup +0.3}). Our results are in good agreement with the findings about the IMF slope in early-type galaxies of similar mass in the present-day universe. This suggests that the IMF, a key characteristic of the stellar populations in galaxies, is bottom-heavier for more massive galaxies and has remained unchanged in the last ∼8 Gyr.

THE SUBLUMINOUS AND PECULIAR TYPE Ia SUPERNOVA PTF 09dav

International Nuclear Information System (INIS)

Sullivan, M.; Ofek, E. O.; Blake, S.; Podsiadlowski, P.; Kasliwal, M. M.; Cooke, J.; Quimby, R.; Kulkarni, S. R.; Nugent, P. E.; Thomas, R. C.; Poznanski, D.; Howell, D. A.; Arcavi, I.; Gal-Yam, A.; Hook, I. M.; Mazzali, P.; Bildsten, L.; Bloom, J. S.; Cenko, S. B.; Law, N.

2011-01-01

PTF 09dav is a peculiar subluminous Type Ia supernova (SN) discovered by the Palomar Transient Factory (PTF). Spectroscopically, it appears superficially similar to the class of subluminous SN1991bg-like SNe, but it has several unusual features which make it stand out from this population. Its peak luminosity is fainter than any previously discovered SN1991bg-like SN Ia (M B ∼ -15.5), but without the unusually red optical colors expected if the faint luminosity were due to extinction. The photospheric optical spectra have very unusual strong lines of Sc II and Mg I, with possible Sr II, together with stronger than average Ti II and low velocities of ∼6000 km s -1 . The host galaxy of PTF09dav is ambiguous. The SN lies either on the extreme outskirts (∼41 kpc) of a spiral galaxy or in an very faint (M R ≥ -12.8) dwarf galaxy, unlike other 1991bg-like SNe which are invariably associated with massive, old stellar populations. PTF 09dav is also an outlier on the light-curve-width-luminosity and color-luminosity relations derived for other subluminous SNe Ia. The inferred 56 Ni mass is small (0.019 ± 0.003 M sun ), as is the estimated ejecta mass of 0.36 M sun . Taken together, these properties make PTF 09dav a remarkable event. We discuss various physical models that could explain PTF 09dav. Helium shell detonation or deflagration on the surface of a CO white dwarf can explain some of the features of PTF 09dav, including the presence of Sc and the low photospheric velocities, but the observed Si and Mg are not predicted to be very abundant in these models. We conclude that no single model is currently capable of explaining all of the observed signatures of PTF 09dav.

Characterization of influenza A(H1N1)pdm09 viruses isolated from Nepalese and Indian outbreak patients in early 2015.

Science.gov (United States)

Nakamura, Kazuya; Shirakura, Masayuki; Fujisaki, Seiichiro; Kishida, Noriko; Burke, David F; Smith, Derek J; Kuwahara, Tomoko; Takashita, Emi; Takayama, Ikuyo; Nakauchi, Mina; Chadha, Mandeep; Potdar, Varsha; Bhushan, Arvind; Upadhyay, Bishnu Prasad; Shakya, Geeta; Odagiri, Takato; Kageyama, Tsutomu; Watanabe, Shinji

2017-09-01

We characterized influenza A(H1N1)pdm09 isolates from large-scale outbreaks that occurred in Nepal and India in early 2015. Although no specific viral features, which may have caused the outbreaks, were identified, an S84N substitution in hemagglutinin was frequently observed. Chronological phylogenetic analysis revealed that these Nepalese and Indian viruses possessing the S84N substitution constitute potential ancestors of the novel genetic subclade 6B.1 virus that spread globally in the following (2015/16) influenza season. Thus, active surveillance of circulating influenza viruses in the Southern Asia region, including Nepal and India, would be beneficial for detecting novel variant viruses prior to their worldwide spread. © 2017 The Authors. Influenza and Other Respiratory Viruses Published by John Wiley & Sons Ltd.

NCBI nr-aa BLAST: CBRC-OLAT-09-0016 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-OLAT-09-0016 sp|P43141|ADB4C_MELGA Beta-4C adrenergic receptor (Beta-4C adreno...ceptor) (Beta-4C adrenoreceptor) gb|AAA62151.1| beta-4C-adrenergic receptor gb|AAA62150.1| adrenergic beta-4c receptor P43141 1e-107 51% ...

Hydrostatic pressure effect on Tsub(c) of Basub(0.9)Ksub(0.1)Pbsub(0.75)Bisub(0.25)O3

International Nuclear Information System (INIS)

Chu, C.W.; Huang, S.; Sleight, A.W.

1976-01-01

The superconducting transition temperature of Basub(0.9)Ksub(0.1)Pbsub(0.75)Bisub(0.25)O 3 has been found to be suppressed smoothly by the application of hydrostatic pressure at a rate of -(2.9 +- 0.2) x 10 -5 kbar -1 up to 15 kbar. The implications of these results are discussed. (author)

Unusual effects of manual grinding and subsequent annealing process observed in Gd5.09Ge2.03Si1.88 compound

Science.gov (United States)

Carvalho, A. M. G.; Alves, C. S.; Trevizoli, P. V.; dos Santos, A. O.; Gama, S.; Coelho, A. A.

2018-03-01

The Gd5.09Ge2.03Si1.88 compound, as well as other magnetocaloric materials, certainly will not be used in their un-manufactured as-cast condition in future magnetic refrigeration applications or other devices. In this work, we have studied the Gd5.09Ge2.03Si1.88 compound processed in different ways, mainly, the as-cast powder, the annealed powder, and the pressed and sintered powder. The annealed powder (1370 K/20 h) does not present the monoclinic phase and the first-order magneto-structural transition observed in the as-cast powder. The pressed and sintered powder also do not present the first-order transition. Furthermore, the compacting pressure shifts the second-order magnetic transition to lower temperatures. The behavior of cell parameters as a function of the compacting pressure indicates that T C is directly affected by parameter c change.

iWork '09 pocket genius

CERN Document Server

Hart-Davis, Guy

2010-01-01

If you want to get the very most out of the suite of iWork '09 applications, put this savvy Portable Genius guide to work. Want to create professional-quality documents? Make your spreadsheets powerful and unique? Deliver a persuasive presentation in person, on paper, or via the Internet? You'll find cool and useful Genius tips, full-color screenshots, and pages of easy-to-access shortcuts and tools that will save you loads of time and let you enjoy the iWork '09 applications to the max.

Variability Of KD Values In Cementitious Materials And Sediments

International Nuclear Information System (INIS)

Almond, P.; Kaplan, D.; Shine, E.

2012-01-01

values and solubility values differ from the sandy sediments. The K d value range and distribution currently used in the PA are estimated to range between 0.25*K d and 1.75*K d , where the minimum and maximum values of the ranges reflect the 95% confidence level for the mean K d value (Kaplan 2010). The objective of the research with cementitious materials was to measure the range and distribution of a monovalent (Cs) and I - (anion), divalent (Sr), and trivalent (Eu) ions for a variety of laboratory-prepared saltstone surrogate samples to establish a K d range other than that which is presently used in the PA. It has been observed in laboratory samples that cure temperature profiles can affect properties such as heat of hydration, permeability, porosity, compressive strength, and set time (Harbour et al. 2009). The intent was to identify a range and distribution that could be used by stochastic modelers for the PA. Furthermore, the intent was to replace the arbitrarily selected distributions based on geological sandy sediments and to base it on actual cementitious materials. The scope of this study did not include understanding saltstone sorption mechanisms responsible for increasing or decreasing sorption. Similar to the work with cementitious materials, the purpose of the Pu sediment K d dataset was not to attempt to understand through statistics how to better understand Pu sorption to sediments or to lower Pu K d variance. The sediment Pu K d data is included in this study because it is a key risk driver for the PAs on the SRS, and there is presently no direct studies of Pu variability in SRS soils. Instead the distribution of Pu sediment K d values was assumed to be similar to other cations, as presented by Kaplan (2010).

Chemical, physical and profile oceanographic data collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-09 to 2010-09-15 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069126)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard the RYAN CHOUEST in the Gulf of Mexico from 2010-09-09 to 2010-09-15 in response to the...

Chemical, physical and profile oceanographic data collected aboard NOAA Ship Pisces in the Gulf of Mexico from 2010-09-09 to 2010-09-17 in response to the Deepwater Horizon Oil Spill event (NODC Accession 0069113)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical, physical and profile oceanographic data were collected aboard NOAA Ship Pisces in the Gulf of Mexico from 2010-09-09 to 2010-09-17 in response to the...

Comparison of leach results from field and laboratory prepared samples

International Nuclear Information System (INIS)

Oblath, S.B.; Langton, C.A.

1985-01-01

The leach behavior of saltstone prepared in the laboratory agrees well with that from samples mixed in the field using the Littleford mixer. Leach rates of nitrates and cesium from the current reference formulation saltstone were compared. The laboratory samples were prepared using simulated salt solution; those in the field used Tank 50 decontaminated supernate. For both nitrate and cesium, the field and laboratory samples showed nearly identical leach rates for the first 30 to 50 days. For the remaining period of the test, the field samples showed higher leach rates with the maximum difference being less than a factor of three. Ruthenium and antimony were present in the Tank 50 supernate in known amounts. Antimony-125 was observed in the leachate and a fractional leach rate was calculated to be at least a factor of ten less than that of 137 Cs. No 106 Ru was observed in the leachate, and the release rate was not calculated. However, based on the detection limits for the analysis, the ruthenium leach rate must also be at least a factor of ten less than cesium. These data are the first measurements of the leach rates of Ru and Sb from saltstone. The nitrate leach rates for these samples were 5 x 10 -5 grams of nitrate per square cm per day after 100 days for the laboratory samples and after 200 days for the field samples. These values are consistent with the previously measured leach rates for reference formulation saltstone. The relative standard deviation in the leach rate is about 15% for the field samples, which all were produced from one batch of saltstone, and about 35% for the laboratory samples, which came from different batches. These are the first recorded estimates of the error in leach rates for saltstone

Degradation of cementitious materials associated with salstone disposal units

Energy Technology Data Exchange (ETDEWEB)

Flach, G. P. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Smith, F. G. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2014-09-01

The Saltstone facilities at the DOE Savannah River Site (SRS) stabilize and dispose of low-level radioactive salt solution originating from liquid waste storage tanks at the site. The Saltstone Production Facility (SPF) receives treated salt solution and mixes the aqueous waste with dry cement, blast furnace slag, and fly ash to form a grout slurry which is mechanically pumped into concrete disposal cells that compose the Saltstone Disposal Facility (SDF). The solidified grout is termed “saltstone”. Cementitious materials play a prominent role in the design and long-term performance of the SDF. The saltstone grout exhibits low permeability and diffusivity, and thus represents a physical barrier to waste release. The waste form is also reducing, which creates a chemical barrier to waste release for certain key radionuclides, notably Tc-99. Similarly, the concrete shell of a saltstone disposal unit (SDU) represents an additional physical and chemical barrier to radionuclide release to the environment. Together the waste form and the SDU compose a robust containment structure at the time of facility closure. However, the physical and chemical state of cementitious materials will evolve over time through a variety of phenomena, leading to degraded barrier performance over Performance Assessment (PA) timescales of thousands to tens of thousands of years. Previous studies of cementitious material degradation in the context of low-level waste disposal have identified sulfate attack, carbonation influenced steel corrosion, and decalcification (primary constituent leaching) as the primary chemical degradation phenomena of most relevance to SRS exposure conditions. In this study, degradation time scales for each of these three degradation phenomena are estimated for saltstone and concrete associated with each SDU type under conservative, nominal, and best estimate assumptions.

Effect of sintering temperature on structural and electrical properties of gadolinium doped ceria (Ce_0.9Gd_0.1O_1.95)

DEFF Research Database (Denmark)

Jadhav, L. D.; Pawar, S. H.; Chourashiya, M. G.

2007-01-01

Gadolinium doped ceria oxide is one of the promising materials as an electrolyte for IT-SOFCs. Ce0.9Gd0.1O1.95 (GDC10) powder was prepared by solid state reaction and sintered at 1473 K, 1573 K, 1673 K and 1773 K All samples were studied using X-ray diffraction, scanning electron micrograph and d...

Results for the First, Second, and Third Quarter Calendar Year 2015 Tank 50H WAC slurry samples chemical and radionuclide contaminants

Energy Technology Data Exchange (ETDEWEB)

Crawford, C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2016-02-18

This report details the chemical and radionuclide contaminant results for the characterization of the Calendar Year (CY) 2015 First, Second, and Third Quarter sampling of Tank 50H for the Saltstone Waste Acceptance Criteria (WAC) in effect at that time. Information from this characterization will be used by Defense Waste Processing Facility (DWPF) & Saltstone Facility Engineering (D&S-FE) to support the transfer of low-level aqueous waste from Tank 50H to the Salt Feed Tank in the Saltstone Facility in Z-Area, where the waste will be immobilized. This information is also used to update the Tank 50H Waste Characterization System. Previous memoranda documenting the WAC analyses results have been issued for these three samples.

Electroresistance and magnetoresistance in La0.9Ba0.1MnO3 thin films

International Nuclear Information System (INIS)

Hu, F.X.; Gao, J.; Wang, Z.H.

2006-01-01

The electroresistance and magnetoresistance effects have been investigated in La 0.9 Ba 0.1 MnO 3 epitaxial thin films. Tensile strain caused by substrate mismatch makes the Curie temperature T C of the film at ∼300 K. The influence of an applied dc-current on the resistance in the absence of a magnetic field was studied. Significant change of the peak resistance at different currents was found. The reduction of the peak resistance reaches ∼27% with an electric current density up to 1.3 x 10 5 A cm -2 . We also studied colossal magnetoresistance (CMR) effect in the films. Applying a magnetic field of 2 T could lead to a magnetoresistance as large as 42%. The reduction of resistance caused by a current density ∼1.3 x 10 5 A cm -2 was found to be equivalent to the CMR effect caused by 1.5 T near T C . The phenomenon that the resistance in CMR manganites could be easily controlled by the electric current should be of high interest for both fundamental research and practical applications

Synthesis, Sintering, and Electrical Properties of BaCe0.9−xZrxY0.1O3−δ

DEFF Research Database (Denmark)

Ricote, S.; Caboche, G.; Estournes, C.

2008-01-01

BaCe0.9-xZrxY0.1O3-delta powders were synthesized by a solid-state reaction. Different contents of cerium and zirconium were studied. Pellets were sintered using either conventional sintering in air at 1700 degrees C or the Spark Plasma Sintering (SPS) technique. The density of the samples sintered...

Alteraciones morfológicas en pulmón por la influenza A H1N1/v09 en autopsias, Colombia, 2009

Directory of Open Access Journals (Sweden)

Jorge Rivera

2011-03-01

Conclusión. El porcentaje bajo de infección bacteriana concomitante observado en los casos de influenza A H1N1/ v09 en este estudio, es una característica sobresaliente que sugiere que el resultado fatal de la infección, probablemente no esté asociado a una enfermedad bacteriana secundaria, como se ha sugerido en reportes previos. Es probable que las lesiones observadas se puedan atribuir al daño tisular en la respuesta inflamatoria celular y humoral asociada a la infiltración por células poliformonucleares y macrófagos en el intersticio y la luz alveolares, como también por la lesión viral.

One-step synthesis and scale-dependent luminescence properties of 1D Zn0.9Cd0.1S nanostructures prepared by PVD

International Nuclear Information System (INIS)

Jin, Changqing; Zhu, Kexin; Jian, Zengyun; Wei, Yongxing; Ge, Chenghai; Peterson, George

2017-01-01

1D Zn 0.9 Cd 0.1 S nanostructures were successfully synthesized via one-step physical vapor deposition. The separation of ultraviolet (UV) emission peaks in the cathodoluminescence (CL) curves, taken in combination with x-ray diffraction (XRD) patterns, proves the coexistence of wurtzite and zincblende phases. The diversity of morphology in nanostuctures originates from Au catalyst splitting during the growth process. The similar photoluminescence spectrums at different positions prove that the composition and defect types were homogeneous, and that defect distribution and density have very small fluctuation at the micron scale. In contrast, the CL curves taken from different locations showed that the defect types and distribution were not uniform on the nanoscale level. (paper)

NCBI nr-aa BLAST: CBRC-PTRO-09-0020 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-PTRO-09-0020 ref|NP_000671.2| alpha-1A-adrenergic receptor isoform 1 [Homo sap...iens] sp|P35348|ADA1A_HUMAN Alpha-1A adrenergic receptor (Alpha 1A-adrenoceptor) (Alpha 1A-adrenoreceptor) (Alpha-1C adrenergic... receptor) (Alpha adrenergic receptor 1c) gb|AAB60353.1| adrenergic alpha-1c receptor pro...tein dbj|BAC05926.1| seven transmembrane helix receptor [Homo sapiens] gb|AAQ91331.1| adrenergic

Factors controlling the microstructure of Ce0.9Gd0.1O2-δ films in pulsed laser deposition process

DEFF Research Database (Denmark)

Rodrigo, Katarzyna Agnieszka; Heiroth, S.; Döbeli, M.

2010-01-01

Films of Ce0.9Gd0.1O2-delta (CGO10) are prepared at a range of conditions by pulsed laser deposition (PLD) on a single crystal Si (100) and MgO (100), and on a polycrystalline Pt/MgO (100) substrate. The relationship between the film microstructure, crystallography, chemical composition and PLD p...

Leachability of Arsenic and Heavy Metals from Mine Tailings of Abandoned Metal Mines

Science.gov (United States)

Lim, Mihee; Han, Gi-Chun; Ahn, Ji-Whan; You, Kwang-Suk; Kim, Hyung-Seok

2009-01-01

Mine tailings from an abandoned metal mine in Korea contained high concentrations of arsenic (As) and heavy metals [e.g., As: 67,336, Fe: 137,180, Cu: 764, Pb: 3,572, and Zn: 12,420 (mg/kg)]. US EPA method 6010 was an effective method for analyzing total arsenic and heavy metals concentrations. Arsenic in the mine tailings showed a high residual fraction of 89% by a sequential extraction. In Toxicity Characteristic Leaching Procedure (TCLP) and Korean Standard Leaching Test (KSLT), leaching concentrations of arsenic and heavy metals were very low [e.g., As (mg/L): 0.4 for TCLP and 0.2 for KSLT; cf. As criteria (mg/L): 5.0 for TCLP and 1.5 for KSLT]. PMID:20049231

Microhardness and fracture toughness of Ce0.9Gd0.1O1.95 for manufacturing solid oxide electrolytes

International Nuclear Information System (INIS)

Mangalaraja, R.V.; Ananthakumar, S.; Uma, Kasimayan; Jimenez, Romel M.; Lopez, Marta; Camurri, Carlos P.

2009-01-01

Synthesis of nanocrystalline gadolinium doped ceria (Ce 0.9 Gd 0.1 O 1.95 ) was attempted by nitrate-fuel combustion technique involving different organic fuels namely urea, citric acid, glycine and poly ethylene glycol. As-combusted ceria precursors were calcined at 700 deg. C for 2 h for obtaining fully dense, nanocrystalline ceria powders. Cylindrical ceria discs were fabricated by uni-axial pressing and sintered intentionally at low temperature of 1200 deg. C for 2 h for assessing the sintering characteristics of the nano powders as well as the mechanical performance of the sintered ceria body. The study confirms that the nano powders could be sintered to 98% theoretical sintered density at 1200 deg. C with a grain size of 400 nm to 1 μm. The sintered samples exhibited the Vickers microhardness of 8.82 ± 0.2 GPa and the fracture toughness of 1.75 ± 0.3 MPa m 1/2 at a load 20 N for glycine and citric acid fuels derived ceria, respectively. A comparison between the fuels was made with respect to the sintering and mechanical properties of doped ceria. Citric acid and glycine fuels resulted in sintered ceria with high hardness where as the urea and polyethylene fuels derived nano ceria resulted in high fracture toughness.

40 CFR 61.09 - Notification of startup.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Notification of startup. 61.09 Section...) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS General Provisions § 61.09 Notification of startup. (a) The owner or operator of each stationary source which has an initial startup after the effective...

Densification and grain growth kinetics of Ce_0.9Gd_0.1O_1.95 in tape cast layers: The influence of porosity

DEFF Research Database (Denmark)

Ni, De Wei; Esposito, Vincenzo; Foghmoes, Søren Preben Vagn

2014-01-01

process at the initial sintering stage at T constitutive laws indicate......The sintering behavior of Ce0.9Gd0.1O1.95(CGO) tape cast layers with different porosity was investigated by an extensive characterization of densification, microstructural evolution, and applying the constitutive laws of sintering. The densification of CGO tapes associates with grain coarsening...

Chemical and physical oceanographic profile data collected from CTD casts aboard the Arctic in the Gulf of Mexico from 2010-09-09 to 2010-09-14 in response to the Deepwater Horizon oil spill event (NODC Accession 0068955)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the Arctic in the Gulf of Mexico from 2010-09-09 to 2010-09-14 in response to the Deepwater...

Exon: CBRC-MMUS-09-0206 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MMUS-09-0206 gttcaataccaccaccaccaccaccaccaccaccaccaccactaccaccaccaccaccaccaccaccaccactaccaccaccaccacca...ccaccaccaccaccaccactaccaccaccaccaccaccaccaccaccatcaccactaccaccaccaccaccaccaccaccaccaccaccaccaccaccagggagaacaagcattcaa ...

La2/3Sr1/3MnO3-La0.1Bi0.9MnO3 heterostructures for spin filtering

Science.gov (United States)

Gajek, M.; Bibes, M.; Varela, M.; Fontcuberta, J.; Herranz, G.; Fusil, S.; Bouzehouane, K.; Barthélémy, A.; Fert, A.

2006-04-01

We have grown heterostructures associating half-metallic La2/3Sr1/3MnO3 (LSMO) bottom electrodes and ferromagnetic La0.1Bi0.9MnO3 (LBMO) tunnel barriers. The layers in the heterostructures have good structural properties and top LBMO films (4 nm thick) have a very low roughness when deposited onto LSMO/SrTiO3(1.6 nm) templates. The LBMO films show an insulating behavior and a ferromagnetic character that are both preserved down to very low thicknesses. They are thus suitable for being used as tunnel barriers. Spin-dependent transport measurements performed on tunnel junctions defined from LSMO/SrTiO3/LBMO/Au samples show a magnetoresistance of up to ~90% at low temperature and bias. This evidences a spin-filtering effect by the LBMO layer, with a spin-filtering efficiency of ~35%.

Synthesis and characterization hollow spherical La0.7Sr0.2Ca0.1Co0.9Fe0.1O3–δ (LSCCT for cathode of solid oxide fuel cell (SOFC

Directory of Open Access Journals (Sweden)

H. H. Yu

2016-10-01

Full Text Available Hollow spheres structures of La0.7Sr0.2Ca0.1Co0.9Fe0.1O3–δ (LSCCT have been synthesized via hydrothermal method using carbon spheres as template. The structure and electrical conductivity of obtained samples are characterized by X-ray diffraction (XRD, scanning electron microscope (SEM, transmission electron microscope (TEM and direct current (DC four-probe method respectively. The results show that hollow spheres structures of LSCCT with the mean particle size of 0,9 - 1,2 μm is single perovskite. The electrical conductivity of the samples is higher than 100 S/cm from 600 to 800 ℃ and can meet the demand of the electrical properties for the cathode materials.

76 FR 60871 - In the Matter of Certain Toner Cartridges and Components Thereof; Notice of Commission Final...

Science.gov (United States)

2011-09-30

...-Toner''); Alpha Image Tech of South El Monte, California (``Alpha Image''); ACM Technologies, Inc. of Corona, California (``ACM''); Virtual Imaging Products Inc. of North York, Ontario; Acecom Inc.--San... Image, Copy Tech, LTT, C&R, ACM, Ink Master, Direct Billing, Ink Tech, QCI, IJSS, Acecom, Ninestar Tech...

Chemical and physical oceanographic profile data collected from CTD casts aboard the HOS Davis in the Gulf of Mexico from 2010-09-09 to 2010-09-27 in response to the Deepwater Horizon oil spill event (NODC Accession 0069071)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Chemical and physical oceanographic profile data were collected aboard the HOS Davis in the Gulf of Mexico from 2010-09-09 to 2010-09-27 in response to the Deepwater...

A polyvalent influenza A DNA vaccine induces heterologous immunity and protects pigs against pandemic A(H1N1)pdm09 virus infection

DEFF Research Database (Denmark)

Bragstad, Karoline; Vinner, Lasse; Hansen, Mette Sif

2013-01-01

seasonal and emerging influenza viruses. We have developed an alternative influenza vaccine based on DNA expressing selected influenza proteins of pandemic and seasonal origin. In the current study, we investigated the protection of a polyvalent influenza DNA vaccine approach in pigs. We immunised pigs...... intradermally with a combination of influenza DNA vaccine components based on the pandemic 1918 H1N1 (M and NP genes), pandemic 2009 H1N1pdm09 (HA and NA genes) and seasonal 2005 H3N2 genes (HA and NA genes) and investigated the protection against infection with virus both homologous and heterologous to the DNA...... of this DNA vaccine to limit virus shedding may have an impact on virus spread among pigs which could possibly extend to humans as well, thereby diminishing the risk for epidemics and pandemics to evolve....

Thermal equation of state of (Mg 0.9Fe 0.1) 2SiO 4 olivine

Science.gov (United States)

Liu, Wei; Li, Baosheng

2006-08-01

In situ synchrotron X-ray diffraction measurements have been carried out on San Carlos olivine (Mg 0.9Fe 0.1) 2SiO 4 up to 8 GPa and 1073 K. Data analysis using the high-temperature Birch-Murnaghan (HTBM) equation of state (EoS) yields the temperature derivative of the bulk modulus (∂ KT/∂ T) P = -0.019 ± 0.002 GPa K -1. The thermal pressure (TH) approach gives αKT = 4.08 ± 0.10 × 10 -3 GPa K -1, from which (∂ KT/∂ T) P = -0.019 ± 0.001 GPa K -1 is derived. Fitting the present data to the Mie-Grüneisen-Debye (MGD) formalism, the Grüneisen parameter at ambient conditions γ0 is constrained to be 1.14 ± 0.02 with fixed volume dependence q = 1. Combining the present data with previous results on iron-bearing olivine and fitting to MGD EoS, we obtain γ0 = 1.11 ± 0.01 and q = 0.54 ± 0.36. In this study the thermoelastic parameters obtained from various approaches are in good agreement with one another and previous results.

Synthesis dependent characteristics of Sr1−xMnxTiO3 (x=0.03, 0.05, 0.07 and 0.09)

International Nuclear Information System (INIS)

Preethi Meher, K.R.S.; Bogicevic, Christine; Janolin, Pierre-Eymeric; Varma, K.B.R.

2012-01-01

Sr 1−x Mn x TiO 3 (where x=0.03, 0.05, 0.07 and 0.09) was synthesized via different routes that include solid-state, oxalate precipitation and freeze drying. In oxalate precipitation technique, compositions corresponding to 3 and 5 mol% doping of Mn were monophasic whereas the higher compositions revealed the presence of the secondary phases such as MnO, Mn 3 O 4 etc., as confirmed by high resolution X-ray diffraction (XRD) studies. The decomposition behavior of the precursors prepared using oxalate precipitation method corresponding to the above mentioned compositions was studied. Nanopowders of compositions pertaining to 5 to 9 mol% of Mn doping were obtained using freeze–drying technique. The average crystallite size of these nanopowders was found to be in the 35 to 65 nm range. The microstructural studies carried out on the sintered ceramics, fabricated using powders synthesized by different routes established the fine grained nature ( 1−x Mn x TiO 3 (x=0.03 and 0.05) obtained by oxalate precipitation technique along with that of the nanopowders for x=0.05, 0.07 and 0.09 obtained by freeze drying method, microstructural characterization and synthesis dependent dielectric behavior. Highlights: ► Monophasic samples obtained for compositions Sr 1−x Mn x TiO 3 with x=0.03 and 0.05. ► Nanopowders of Sr 1−x Mn x TiO 3 with x=0.05, 0.07 and 0.09 were synthesized by freeze–drying method. ► Phase purity of samples synthesized using freeze drying method were studied at different sintering temperatures. ► Analysis of Raman spectra for samples prepared by both oxalate precipitation and freeze–drying. ► Microstructure dependent dielectric characteristics have been illustrated.

Electrochemical characterization of Pr2CuO4–Ce0.9Gd0.1O1.95 composite cathodes for solid oxide fuel cells

International Nuclear Information System (INIS)

Kolchina, L.M.; Lyskov, N.V.; Petukhov, D.I.; Mazo, G.N.

2014-01-01

Highlights: • PCO–GDC composites are studied as a cathode for SOFCs. • The rate-determined step of the overall electrode process vs. temperature was defined. • PCO–GDC33 composite gave the lowest area surface resistance of 0.41 Ω cm 2 at 700 °C. • PCO–GDC33 is preferred to use as a cathode material for IT-SOFCs. - Abstract: Pr 2 CuO 4 –Ce 0.9 Gd 0.1 O 1.95 (PCO–GDC) composites screen printed on Ce 0.9 Gd 0.1 O 1.95 (GDC) electrolyte were considered as a cathode material for intermediate temperature solid oxide fuel cells (IT-SOFCs). Phase composition, microstructure and electrochemical properties were investigated by X-ray powder diffraction (XRD), scanning electron microscopy and AC impedance spectroscopy, respectively. The oxygen reduction on porous PCO–GDC electrode applied on CGO electrolyte was studied in a symmetrical cell configuration by AC impedance spectroscopy at OCV conditions at 670–730 °C and p O 2 =10 -2 -0.21atm. The charge transfer process and the dissociation of adsorbed molecular oxygen were found to be rate-determining steps of the oxygen reduction reaction. Results reveal that both GDC addition and electrode morphology have strong influence on area specific resistance (ASR) of the electrode/electrolyte interface. The lowest ASR value of 0.41 Ω cm 2 was achieved for the composition containing 33 wt.% GDC at 700 °S in air. The data obtained allow to consider the PCO–GDC33 composite as a promising cathode material for IT-SOFCs

Antigenic and genomic characterization of human influenza A and B viruses circulating in Argentina after the introduction of influenza A(H1N1)pdm09.

Science.gov (United States)

Russo, Mara L; Pontoriero, Andrea V; Benedetti, Estefania; Czech, Andrea; Avaro, Martin; Periolo, Natalia; Campos, Ana M; Savy, Vilma L; Baumeister, Elsa G

2014-12-01

This study was conducted as part of the Argentinean Influenza and other Respiratory Viruses Surveillance Network, in the context of the Global Influenza Surveillance carried out by the World Health Organization (WHO). The objective was to study the activity and the antigenic and genomic characteristics of circulating viruses for three consecutive seasons (2010, 2011 and 2012) in order to investigate the emergence of influenza viral variants. During the study period, influenza virus circulation was detected from January to December. Influenza A and B, and all current subtypes of human influenza viruses, were present each year. Throughout the 2010 post-pandemic season, influenza A(H1N1)pdm09, unexpectedly, almost disappeared. The haemagglutinin (HA) of the A(H1N1)pdm09 viruses studied were segregated in a different genetic group to those identified during the 2009 pandemic, although they were still antigenically closely related to the vaccine strain A/California/07/2009. Influenza A(H3N2) viruses were the predominant strains circulating during the 2011 season, accounting for nearly 76 % of influenza viruses identified. That year, all HA sequences of the A(H3N2) viruses tested fell into the A/Victoria/208/2009 genetic clade, but remained antigenically related to A/Perth/16/2009 (reference vaccine recommended for this three-year period). A(H3N2) viruses isolated in 2012 were antigenically closely related to A/Victoria/361/2011, recommended by the WHO as the H3 component for the 2013 Southern Hemisphere formulation. B viruses belonging to the B/Victoria lineage circulated in 2010. A mixed circulation of viral variants of both B/Victoria and B/Yamagata lineages was detected in 2012, with the former being predominant. A(H1N1)pdm09 viruses remained antigenically closely related to the vaccine virus A/California/7/2009; A(H3N2) viruses continually evolved into new antigenic clusters and both B lineages, B/Victoria/2/87-like and B/Yamagata/16/88-like viruses, were observed

Effects of the fabrication process on the grain-boundary resistance in BaZr_0.9Y0.1O3-δ

DEFF Research Database (Denmark)

Ricote, Sandrine; Bonanos, Nikolaos; Manerbino, A.

2014-01-01

This paper reports on the effect of the fabrication process on the conductivity of BZY10 (BaZr0.9Y0.1O3-δ). The dense specimens were prepared by four methods: (1) solid-state reactive sintering (SSRS), (2) conventional sintering using powder prepared by solid-state reaction and NiO as sintering a...

Induction of protective immunity against H1N1 influenza A(H1N1)pdm09 with spray-dried and electron-beam sterilised vaccines in non-human primates.

Science.gov (United States)

Scherließ, Regina; Ajmera, Ankur; Dennis, Mike; Carroll, Miles W; Altrichter, Jens; Silman, Nigel J; Scholz, Martin; Kemter, Kristina; Marriott, Anthony C

2014-04-17

Currently, the need for cooled storage and the impossibility of terminal sterilisation are major drawbacks in vaccine manufacturing and distribution. To overcome current restrictions a preclinical safety and efficacy study was conducted to evaluate new influenza A vaccine formulations regarding thermal resistance, resistance against irradiation-mediated damage and storage stability. We evaluated the efficacy of novel antigen stabilizing and protecting solutions (SPS) to protect influenza A(H1N1)pdm09 split virus antigen under experimental conditions in vitro and in vivo. Original or SPS re-buffered vaccine (Pandemrix) was spray-dried and terminally sterilised by irradiation with 25 kGy (e-beam). Antigen integrity was monitored by SDS-PAGE, dynamic light scattering, size exclusion chromatography and functional haemagglutination assays. In vitro screening experiments revealed a number of highly stable compositions containing glycyrrhizinic acid (GA) and/or chitosan. The most stable composition was selected for storage tests and in vivo assessment of seroconversion in non-human primates (Macaca fascicularis) using a prime-boost strategy. Redispersed formulations with original adjuvant were administered intramuscularly. Storage data revealed high stability of protected vaccines at 4°C and 25°C, 60% relative humidity, for at least three months. Animals receiving original Pandemrix exhibited expected levels of seroconversion after 21 days (prime) and 48 days (boost) as assessed by haemagglutination inhibition and microneutralisation assays. Animals vaccinated with spray-dried and irradiated Pandemrix failed to exhibit seroconversion after 21 days whereas spray-dried and irradiated, SPS-protected vaccines elicited similar seroconversion levels to those vaccinated with original Pandemrix. Boost immunisation with SPS-protected vaccine resulted in a strong increase in seroconversion but had only minor effects in animals treated with non SPS-protected vaccine. In conclusion

Synthesis and characterization of Gd_0.1Ce_0.9O_1.95 thin films by spray pyrolysis technique

DEFF Research Database (Denmark)

Chourashiya, M. G.; Pawar, S. H.; Jadhav, L. D.

2008-01-01

The Gd doped ceria (CGO) in thin layers is of great interest for low temperature operation. In the present investigation, we report on the use of spray pyrolysis technique for the synthesis of CGO thin films. The process parameters were optimized for synthesizing Gd0.1Ce0.9O1.95 films. Films were...... characterized by XRD, EDS, SEM, and AFM and are observed to be phase pure and dense with surface roughness of the order of ∼5 nm. The d.c. conductivity was also measured and is observed to be ∼0.5 S/cm at 623 K....

Residual mercury content and leaching of mercury and silver from used amalgam capsules.

Science.gov (United States)

Stone, M E; Pederson, E D; Cohen, M E; Ragain, J C; Karaway, R S; Auxer, R A; Saluta, A R

2002-06-01

The objective of this investigation was to carry out residual mercury (Hg) determinations and toxicity characteristic leaching procedure (TCLP) analysis of used amalgam capsules. For residual Hg analysis, 25 capsules (20 capsules for one brand) from each of 10 different brands of amalgam were analyzed. Total residual Hg levels per capsule were determined using United States Environmental Protection Agency (USEPA) Method 7471. For TCLP analysis, 25 amalgam capsules for each of 10 brands were extracted using a modification of USEPA Method 1311. Hg analysis of the TCLP extracts was done with USEPA Method 7470A. Analysis of silver (Ag) concentrations in the TCLP extract was done with USEPA Method 6010B. Analysis of the residual Hg data resulted in the segregation of brands into three groups: Dispersalloy capsules, Group A, retained the most Hg (1.225 mg/capsule). These capsules were the only ones to include a pestle. Group B capsules, Valliant PhD, Optaloy II, Megalloy and Valliant Snap Set, retained the next highest amount of Hg (0.534-0.770 mg/capsule), and were characterized by a groove in the inside of the capsule. Group C, Tytin regular set double-spill, Tytin FC, Contour, Sybraloy regular set, and Tytin regular set single-spill retained the least amount of Hg (0.125-0.266 mg/capsule). TCLP analysis of the triturated capsules showed Sybraloy and Contour leached Hg at greater than the 0.2 mg/l Resource Conservation and Recovery Act (RCRA) limit. This study demonstrated that residual mercury may be related to capsule design features and that TCLP extracts from these capsules could, in some brands, exceed RCRA Hg limits, making their disposal problematic. At current RCRA limits, the leaching of Ag is not a problem.

NCBI nr-aa BLAST: CBRC-MMUS-09-0191 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MMUS-09-0191 ref|NP_000854.1| 5-hydroxytryptamine (serotonin) receptor 1B [Hom...o sapiens] ref|NP_001009102.1| 5-hydroxytryptamine (serotonin) receptor 1B [Pan troglodytes] sp|P28222|5HT1B...HT-1B) (Serotonin receptor 1B) (5-HT1B) gb|AAA58675.1| serotonin 1Db receptor gb|AAA36029.1| serotonin recep...tor gb|AAA36030.1| 5-hyroxytryptamine 1D receptor dbj|BAA01763.1| serotonin 1B receptor [Homo sapiens] gb|AAA60316.1| serotonin... 1D receptor emb|CAB51537.1| 5-hydroxytryptamine (serotonin) r

NCBI nr-aa BLAST: CBRC-MMUS-09-0013 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MMUS-09-0013 ref|NP_005950.1| melatonin receptor 1B [Homo sapiens] sp|P49286|M...TR1B_HUMAN Melatonin receptor type 1B (Mel-1B-R) (Mel1b melatonin receptor) gb|AAC50612.1| Mel1b-melatonin r...eceptor dbj|BAA92315.1| melatonin 1b receptor [Homo sapiens] gb|AAS00461.1| melatonin receptor 1B [Homo sapi...ens] gb|AAH69163.1| Melatonin receptor 1B [Homo sapiens] gb|EAW66891.1| melatonin receptor 1B [Homo sapiens] NP_005950.1 1e-164 80% ...

Signal Immune Reactions of Macrophages Differentiated from THP-1 Monocytes to Infection with Pandemic H1N1PDM09 Virus and H5N2 and H9N2 Avian Influenza A Virus.

Science.gov (United States)

Sokolova, T M; Poloskov, V V; Shuvalov, A N; Rudneva, I A; Timofeeva, T A

2018-03-01

In culture of THP-1 cells differentiated into macrophages with PMA (THP-PMA macrophages) infected with influenza viruses of subtypes H1, H5 and H9, we measured the expression of TLR7 and RIG1 receptor genes, sensors of viral RNA and ribonucleoprotein, and the levels of production of inflammatory cytokines IL-1β, TNFα, IL-10, and IFNα. The sensitivity and inflammatory response of THP-PMA macrophages to pandemic influenza A virus H1N1pdm09 and avian influenza H5N2 and H9N2 viruses correlate with the intracellular level of their viral RNA and activation of the RIG1 gene. Abortive infection is accompanied by intensive macrophage secretion of TNFα, IL-1β, and toxic factors inducing cell death. Activity of endosomal TLR7 receptor gene changed insignificantly in 24 h after infection and significantly decreased in 48 and 72 h under the action of H5N2 and H9N2, which correlated with manifestation of the cytopathogenic effect of these viruses. H5N2 and H9N2 avian viruses in THP-PMA macrophages are strong activators of the expression of the gene of the cytoplasmic RIG1 receptor 24 and 48 h after infection, and the pandemic virus H1N1pdm09 is a weak stimulator of RIG1 gene. Avian influenza H5N2 and H9N2 viruses are released by rapid induction of the inflammatory response in macrophages. At the late stages of infection, we observed a minor increase in IL-10 secretion in macrophages and, probably, the polarization of a part of the population in type M2. The studied influenza A viruses are weak inductors of IFN in THP-PMA macrophages. In the culture medium of THP-PMA macrophages infected with H9N2 and H5N2 viruses, MTT test revealed high levels of toxic factors causing the death of Caco-2 cells. In contrast to avian viruses, pandemic virus H1N1pdm09 did not induce production of toxic factors.

NCBI nr-aa BLAST: CBRC-GACU-09-0018 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-GACU-09-0018 ref|NP_000669.1| alpha-1D-adrenergic receptor [Homo sapiens] sp|P...25100|ADA1D_HUMAN Alpha-1D adrenergic receptor (Alpha 1D-adrenoceptor) (Alpha 1D-adrenoreceptor) (Alpha-1A adrenergic... receptor) (Alpha adrenergic receptor 1a) gb|AAB60351.1| adrenergic alpha-1a receptor protein gb|AAB59487.1| alpha 1a/d adre...nergic receptor dbj|BAA06222.1| alpha1A/D adrenergic rec...eptor [Homo sapiens] emb|CAH70478.1| adrenergic, alpha-1D-, receptor [Homo sapiens] emb|CAC00601.2| adrenergic

Cephradine as corrosion inhibitor for copper in 0.9% NaCl solution

Science.gov (United States)

Tasić, Žaklina Z.; Petrović Mihajlović, Marija B.; Radovanović, Milan B.; Simonović, Ana T.; Antonijević, Milan M.

2018-05-01

The effect of (6R,7R)-7-[[(2R)-2-amino-2-cyclohexa-1,4-dien-1-ylacetyl]amino]-3-methyl-8-oxo-5-thia-1-azobicyclo[4.2.0]oct-2-ene-2-carboxylic acid (cephradine) on corrosion behavior of copper in 0.9% NaCl solution was investigated. The electrochemical methods including the open circuit potential measurements, potentiodynamic polarization and electrochemical impedance spectroscopy measurements, scanning electron microscopy with energy dispersive X-ray spectroscopy and quantum chemical calculations were used for this investigation. According to the results obtained by potentiodynamic polarization, cephradine acts as mixed type inhibitor. Also, the results obtained by electrochemical impedance spectroscopy indicate that cephradine provides good copper protection in 0.9% NaCl solution. The inhibition efficiency of cephradine increases with increasing its concentration. The scanning electron microscopy with energy dispersive X-ray spectroscopy confirms that a protective layer is formed on the copper surface due to the adsorption of cephradine on the active sites on the copper surface. Adsorption of cephradine in 0.9% NaCl solution follows the Langmuir adsorption isotherm. Quantum chemical calculations are in agreement with results obtained by electrochemical measurements.

Book of short papers : International symposium on convective heat and mass transfer in sustainable energy Conv - 09. Volume 1

International Nuclear Information System (INIS)

2009-01-01

This book contains the short papers from the International Symposium on Convective heat and Mass Transfer in sustainable Energy ( Conv-09), organized on behalf of the International Centre for Heat and Mass Transfer, it was held on April 26- 1st May, In Hammamet, Tunisia. The objective of this conference is to bring together researchers in a forum to exchange innovative ideas, methods and results, and visions of the future related to the general theme of convective heat and mass transfer

Ac conductivity and relaxation mechanism in Ba{sub 0.9}Sr{sub 0.1}TiO{sub 3}

Energy Technology Data Exchange (ETDEWEB)

Singh, A K; Barik, Subrat K [Department of Physics and Meteorology, Indian Institute of Technology, Kharagpur 721 302 (India); Choudhary, R N.P. , [Department of Physics and Meteorology, Indian Institute of Technology, Kharagpur 721 302 (India); Mahapatra, P K [Department of Physics, Vidyasagar University, Midnapore 721 102 (India)

2009-06-24

The ac conductivity and relaxation mechanism in Ba{sub 0.9}Sr{sub 0.1}TiO{sub 3} ceramics have been investigated systematically. A high-temperature solid-state reaction technique was used to synthesize the compound. The formation of the compound was checked by an X-ray diffraction (XRD) technique. The dielectric permittivity and the loss tangent of the sample were measured in a frequency range from 1 kHz to 1 MHz at different temperatures (30-500 deg. C). A study on dielectric properties reveals the electrical relaxation phenomenon occurs in the material. The activation energy was calculated from the temperature variation of dc conductivity. Studies of frequency and temperature dependence of ac conductivity of the compound suggest that conduction process in the material is thermally activated.

The n-Cu0.9Ag0.1In3Se5 chalcopyrite, electronic as well as ionic conductor

International Nuclear Information System (INIS)

Diaz, R

2008-01-01

A resistance increase with time of the n-Cu 0.9 Ag 0.1 In 3 Se 5 chalcopyrite has been observed. This new effect is analysed in terms of a hypothesis of ion migration and Schottky barrier formation. These results might explain why different solar cell efficiencies are obtained for the chalcopyrites, CuInSe 2 and CuIn x Ga 1-x Se 2 , when an In-rich film is deposited on top of the chalcopyrite. In these solar cells, ion migration can exist and a new effect appears similar to the one observed in our compound. The ions, probably the cations, are moved by the electrical field towards the cathode. A gradient of mobile ions appears across the sample and the positive charge is accumulated near this electrode such that it varies the metal-semiconductor interface. This interface is a Schottky barrier where the contact potential is a function of time due to the arrival of ions. The electrical measurements have been carried out on a solid state device, graphite/n-Cu 0.9 Ag 0.1 In 3 Se 5 /graphite. The current intensity and the potential drop across the sample have been measured with time when a constant electrical potential is applied for 600 s at dark or under ultraviolet illumination and at room temperature. A comparative study in similar electrical conditions is done; the current intensity difference and the potential drop across the difference (under ultraviolet illumination minus at dark) are not constant and both measurements increase with time

Equilibrium leaching of toxic elements from cement stabilized soil.

Science.gov (United States)

Voglar, Grega E; Leštan, Domen

2013-02-15

The toxicity characteristics leaching procedure (TCLP) is commonly used to assess the efficiency of solidification/stabilization (S/S) of pollutants in wastes, despite recent objections to this method. In this study, formulations of 7, 10, 15 and 20% (w/w) of calcium aluminate cement (CAC) and sulfate resistant Portland cement (SRC) were used for S/S of soil from brownfield contaminated with 43,149, 10,115, 7631, 6130, 90, 82 mg kg(-1) of Zn, Pb, Cu, As, Cd and Ni, respectively. CAC produced S/S soil monoliths of higher mechanical strength (up to 7.65 N mm(-2)). Mass-transfer analysis indicated surface wash-off as a mechanism of toxic elements release, and equilibrium leaching as a crucial parameter of S/S efficiency assessment. In the expected range of field soil pH after S/S (pH 7-9), the TCLP gave markedly different results than the multi-point pH equilibrium leaching method (using nine targeted pH values): up to 2953-, 94-, 483-, 1.3-, 27- and 1.5-times more Zn, Pb, Cu, As, Cd and Ni, respectively, was determined in the TCLP leachate. S/S with CAC reduced leachability of toxic elements more effectively than SRC. Our results indicate that, under given field conditions, the TCLP significantly underrates the efficiency of S/S of contaminated soil with cementitious binders. Copyright © 2012 Elsevier B.V. All rights reserved.

Molecular diagnosis of microbial copathogens with influenza A(H1N1pdm09 in Oaxaca, Mexico

Directory of Open Access Journals (Sweden)

Ramírez-Palacios LR

2018-04-01

Full Text Available Luis Román Ramírez-Palacios,1 Diana Reséndez-Pérez,2 Maria Cristina Rodríguez-Padilla,2 Santiago Saavedra-Alonso,2 Olga Real-Najarro,3 Nadia A Fernández-Santos,4 Mario A Rodriguez Perez4 1Laboratorio Estatal de Salud Pública de Oaxaca, Oaxaca, 2Departamento de Inmunología y Virología, Facultad de Ciencias Biológicas, Universidad Autónoma de Nuevo León, San Nicolás de los Garza, Mexico; 3Consejería de Educación, Madrid, Spain; 4Instituto Politécnico Nacional (IPN, Centro de Biotecnología Genómica, Reynosa, Mexico Background: Multiple factors have been associated with the severity of infection by influenza A(H1N1pdm09. These include H1N1 cases with proven coinfections showing clinical association with bacterial contagions. Purpose: The objective was to identify H1N1 and copathogens in the Oaxaca (Mexico population. A cross-sectional survey was conducted from 2009 to 2012. A total of 88 study patients with confirmed H1N1 by quantitative RT-PCR were recruited. Methods: Total nucleic acid from clinical samples of study patients was analyzed using a TessArray RPM-Flu microarray assay to identify other respiratory pathogens. Results: High prevalence of copathogens (77.3%; 68 patients harbored one to three pathogens, predominantly from Streptococcus, Haemophilus, Neisseria, and Pseudomonas, were detected. Three patients (3.4% had four or five respiratory copathogens, whereas others (19.3% had no copathogens. Copathogenic occurrence with Staphylococcus aureus was 5.7%, Coxsackie virus 2.3%, Moraxella catarrhalis 1.1%, Klebsiella pneumoniae 1.1%, and parainfluenza virus 3 1.1%. The number of patients with copathogens was four times higher to those with H1N1 alone (80.68% and 19.32%, respectively. Four individuals (4.5%; two males, one female, and one infant who died due to H1N1 were observed to have harbored such copathogens as Streptococcus, Staphylococcus, Haemophilus, and Neisseria. Conclusion: In summary, copathogens were found in a

Hospitalized cases of influenza A(H1N1pdm09 in the French territories of the Americas, July 2009-March 2010 Casos hospitalizados de gripe A(H1N1pdm09 en los territorios franceses de las Américas entre julio de 2009 y marzo de 2010

Directory of Open Access Journals (Sweden)

Marie Barrau

2012-08-01

Full Text Available OBJECTIVE: To describe the methodology used for implementing a surveillance system specifically for influenza A(H1N1pdm09 in the French West Indies and French Guiana during an outbreak of this new virus in 2009-2010, and to report its main results. METHODS: This was an observational descriptive study of confirmed and probable cases of influenza A(H1N1pdm09 hospitalized for at least 24 hours in 23 July 2009-3 March 2010. Reverse transcription polymerase chain reaction was performed on nasopharyngeal swab samples according to the Centers for Disease Control and Prevention protocol. A probable case was defined as fever > 38ºC or aches or asthenia with respiratory symptoms (cough or dyspnea. All confirmed and probable hospitalized cases were reported, along with patient's age, sex, clinical condition at admission, place and length of hospitalization, antiviral treatment, underlying conditions, complications, and clinical evolution. A case was classified as severe if respiratory assistance or intensive care was required or if death resulted. RESULTS: A total of 331 confirmed and 16 probable cases were hospitalized, with a hospitalization rate ranging from 4.3 per 1 000 clinical cases in Saint Martin to 10.3 in French Guiana. Of these, 36 were severe, and subsequently, 10 were fatal. The median length of stay was 4 days for non-severe cases and 9 days for severe (P OBJETIVO: Describir la metodología usada para implementar un sistema de vigilancia específico para la gripe A(H1N1pdm09 en las Indias Occidentales Francesas y la Guayana Francesa durante un brote ocasionado por este virus nuevo ocurrido en 20092010 y presentar sus principales resultados. MÉTODOS: Se llevó a cabo un estudio de observación descriptivo de los casos confirmados y probables de gripe por A(H1N1pdm09 hospitalizados durante al menos 24 horas entre el 23 de julio de 2009 y el 3 de marzo de 2010. De conformidad con el protocolo de los Centros para el Control y la Prevención de

Evidence for a vortex-glass transition in superconducting Ba(Fe0.9Co0.1)2As2.

Science.gov (United States)

Prando, G; Giraud, R; Aswartham, S; Vakaliuk, O; Abdel-Hafiez, M; Hess, C; Wurmehl, S; Wolter, A U B; Büchner, B

2013-12-18

Measurements of magneto-resistivity and magnetic susceptibility were performed on single crystals of superconducting Ba(Fe0.9Co0.1)2As2 close to the conditions of optimal doping. The high quality of the investigated samples allows us to reveal dynamic scaling behaviour associated with a vortex-glass phase transition in the limit of a weak degree of quenched disorder. Accordingly, the dissipative component of the ac susceptibility is reproduced well within the framework of Havriliak-Negami relaxation, assuming a critical power-law divergence for the characteristic correlation time τ of the vortex dynamics. Remarkably, the random disorder introduced by the Fe1-xCox chemical substitution is found to act on the vortices as a much weaker quenched disorder than previously reported for cuprate superconductors such as Y1-xPrxBa2Cu3O7-δ.

Detección de virus influenza A, B y subtipos A (H1N1 pdm09, A (H3N2 por múltiple RT-PCR en muestras clínicas

Directory of Open Access Journals (Sweden)

Pool Marcos

Full Text Available Objetivos. Estandarizar la técnica de reacción en cadena de la polimerasa en tiempo real (RT-PCR múltiple para la detección de virus influenza A, B y tipificación de subtipos A (H1N1 pdm09, A (H3N2 en muestras clínicas. Materiales y métodos. Se analizaron 300 muestras de hisopado nasofaríngeo. Esta metodología fue estandarizada en dos pasos: la primera reacción detectó el gen de la matriz del virus de influenza A, gen de la nucleoproteína del virus influenza B y el gen GAPDH de las células huésped. La segunda reacción detectó el gen de la hemaglutinina de los subtipos A (H1N1 pandémico (pdm09 y A (H3N2. Resultados. Se identificaron 109 muestras positivas a influenza A y B, de las cuales 72 fueron positivas a influenza A (36 positivas a influenza A (H1N1 pdm09 y 36 positivos a influenza A (H3N2 y 37 muestras positivas a influenza B. 191 fueron negativas a ambos virus mediante RT-PCR en tiempo real multiplex. Se encontró una sensibilidad y especificidad del 100% al analizar los resultados de ambas reacciones. El límite de detección viral fue del rango de 7 a 9 copias/µL por virus. Los resultados no mostraron ninguna reacción cruzada con otros virus tales como adenovirus, virus sincitial respiratorio, parainfluenza (1,2 y 3, metapneumovirus, subtipos A (H1N1 estacional, A (H5N2 y VIH. Conclusiones. La RT-PCR múltiple demostró ser una prueba muy sensible y específica para la detección de virus influenza A, B y subtipos A (H1N1, H3N2 y su uso puede ser conveniente en brotes estacionales.

Characterization of the influenza A H5N1 viruses of the 2008-09 outbreaks in India reveals a third introduction and possible endemicity.

Directory of Open Access Journals (Sweden)

Alok K Chakrabarti

Full Text Available Widespread infection of highly pathogenic avian influenza A H5N1 was reported from backyard and commercial poultry in West Bengal (WB, an eastern state of India in early 2008. Infection gradually spread to Tripura, Assam and Sikkim, the northeastern states, with 70 outbreaks reported between January 2008 and May 2009. Whole genome sequence analysis of three isolates from WB, one isolate from Tripura along with the analysis of hemagglutinin (HA and neuraminidase (NA genes of 17 other isolates was performed during this study. In the HA gene phylogenetic tree, all the 2008-09 Indian isolates belonged to EMA3 sublineage of clade 2.2. The closest phylogenetic relationship was found to be with the 2007-09 isolates from Bangladesh and not with the earlier 2006 and 2007 Indian isolates implying a third introduction into the country. The receptor-binding pocket of HA1 of two isolates from WB showed S221P mutation, one of the markers predicted to be associated with human receptor specificity. Two substitutions E119A (2 isolates of WB and N294S (2 other isolates of WB known to confer resistance to NA inhibitors were observed in the active site of neuraminidase. Several additional mutations were observed within the 2008-09 Indian isolates indicating genetic diversification. Overall, the study is indicative of a possible endemicity in the eastern and northeastern parts of the country, demanding active surveillance specifically in view of the critical mutations that have been observed in the influenza A H5N1 viruses.

46 CFR 42.09-5 - All vessels-division into types.

Science.gov (United States)

2010-10-01

... 46 Shipping 2 2010-10-01 2010-10-01 false All vessels-division into types. 42.09-5 Section 42.09-5... BY SEA Load Line Assignments and Surveys-General Requirements § 42.09-5 All vessels—division into types. (a) For the purposes of this part, each vessel to which this part applies is either a Type “A” or...

Crystal structures and electronic properties of UTixNb3-xO10 (x=0,1/3,1) and of the intercalation compound Li0.9UTiNb2O10

International Nuclear Information System (INIS)

Dickens, P.G.; Flynn, G.J.; Patat, S.; Stuttart, G.P.

1997-01-01

Complete crystal structures of the related phases UTi x Nb 3-x O 10 (x=0,1/3,1) and of the intercalation compound Li 0.9 UTiNb 2 O 10 have been determined by Rietveld analysis of room-temperature powder neutron diffraction data. The new structural data combined with magnetic susceptibility measurements made in the range 5 y 1 U V 1+y-x U VI x-y Ti IV x Nb V 3-x O 10 (y≤ x ≤1) with U V (f 1 ) being the only paramagnetic species present. (Author)

ENVIRONMENTAL TECHNOLOGY VERIFICATION REPORT, REMOVAL OF ARSENIC IN DRINKING WATER: PHASE 1-ADI PILOT TEST UNIT NO. 2002-09 WITH MEDIA G2®

Science.gov (United States)

Integrity verification testing of the ADI International Inc. Pilot Test Unit No. 2002-09 with MEDIA G2® arsenic adsorption media filter system was conducted at the Hilltown Township Water and Sewer Authority (HTWSA) Well Station No. 1 in Sellersville, Pennsylvania from October 8...

Annual report 2008-09

International Nuclear Information System (INIS)

2009-01-01

The Pakistan Atomic Energy Commission (PAEC) annual report for the year 2008-09 has been compiled. The salient features of the activities of various Centers, Power Plants and different project have been explained. The activities are described under the topics as: highlights of various projects, nuclear power, engineering, physical sciences, biological sciences, nuclear materials, safety, human resource development, PAEC health services projects and publications. (A.B).

Effect of A-site deficiency in LaMn_0_._9Co_0_._1O_3 perovskites on their catalytic performance for soot combustion

International Nuclear Information System (INIS)

Dinamarca, Robinson; Garcia, Ximena; Jimenez, Romel; Fierro, J.L.G.; Pecchi, Gina

2016-01-01

Highlights: • A-site defective perovskites increases the oxidation state of the B-cation. • Not always non-stoichiometric perovskites exhibit higher catalytic activity in soot combustion. • The highly symmetric cubic crystalline structure diminishes the redox properties of perovskites. - Abstract: The influence of lanthanum stoichiometry in Ag-doped (La_1_-_xAg_xMn_0_._9Co_0_._1O_3) and A-site deficient (La_1_-_xMn_0_._9Co_0_._1O_3_-_δ) perovskites with x equal to 10, 20 and 30 at.% has been investigated in catalysts for soot combustion. The catalysts were prepared by the amorphous citrate method and characterized by XRD, nitrogen adsorption, XPS, O_2-TPD and TPR. The formation of a rhombohedral excess-oxygen perovskite for Ag-doped and a cubic perovskite structure for an A-site deficient series is confirmed. The efficient catalytic performance of the larger Ag-doped perovskite structure is attributed to the rhombohedral crystalline structure, Ag_2O segregated phases and the redox pair Mn"4"+/Mn"3"+. A poor catalytic activity for soot combustion was observed with A-site deficient perovskites, despite the increase in the redox pair Mn"4"+/Mn"3"+, which is attributed to the cubic crystalline structure.

Safety and persistence of the humoral and cellular immune responses induced by 2 doses of an AS03-adjuvanted A(H1N1)pdm09 pandemic influenza vaccine administered to infants, children and adolescents: Two open, uncontrolled studies.

Science.gov (United States)

Garcia-Sicilia, José; Arístegui, Javier; Omeñaca, Félix; Carmona, Alfonso; Tejedor, Juan C; Merino, José M; García-Corbeira, Pilar; Walravens, Karl; Bambure, Vinod; Moris, Philippe; Caplanusi, Adrian; Gillard, Paul; Dieussaert, Ilse

2015-01-01

In children, 2 AS03-adjuvanted A(H1N1)pdm09 vaccine doses given 21 days apart were previously shown to induce a high humoral immune response and to have an acceptable safety profile up to 42 days following the first vaccination. Here, we analyzed the persistence data from 2 open-label studies, which assessed the safety, and humoral and cell-mediated immune responses induced by 2 doses of this vaccine. The first study was a phase II, randomized trial conducted in 104 children aged 6-35 months vaccinated with the A(H1N1)pdm09 vaccine containing 1.9 µg haemagglutinin antigen (HA) and AS03B (5.93 mg tocopherol) and the second study, a phase III, non-randomized trial conducted in 210 children and adolescents aged 3-17 years vaccinated with the A(H1N1)pdm09 vaccine containing 3.75 µg HA and AS03A (11.86 mg tocopherol). Approximately one year after the first dose, all children with available data were seropositive for haemagglutinin inhibition and neutralising antibody titres, but a decline in geometric mean antibody titres was noted. The vaccine induced a cell-mediated immune response in terms of antigen-specific CD4(+) T-cells, which persisted up to one year post-vaccination. The vaccine did not raise any safety concern, though these trials were not designed to detect rare events. In conclusion, 2 doses of the AS03-adjuvanted A(H1N1)pdm09 vaccine at 2 different dosages had a clinically acceptable safety profile, and induced high and persistent humoral and cell-mediated immune responses in children aged 6-35 months and 3-17 years. These studies have been registered at www.clinicaltrials.gov NCT00971321 and NCT00964158.

Optical and vibrational spectroscopy of Ba0.85Ca0.15Zr0.1Ti0.9O3 modified lithium borate glass ceramics

Science.gov (United States)

Viswanath, Pamarti; Prashanth, Sadhu Sai Pavan; Molli, Muralikrishna; Wicram, Jaschin Prem; Sai Muthukumar, V.

2018-04-01

Glass ceramics are excellent replacement for single crystalline materials which are expensive and difficult to fabricate. In this context, we have attempted to fabricate glass nanocomposites comprising of Lithium Borate glass matrix embedded with lead free ferroelectric Ba0.85Ca0.15Zr0.1Ti0.9O3 (BCZT). Both of these functional materials are known to exhibit excellent ferroelectric behavior and are currently explored for various device applications. We have prepared these novel glass nanocomposite using melt-quenching techniquein various chemical composition involving different molar ratio. x(Ba0.85Ca0.15Zr0.1Ti0.9O3)-(1-x)(Li2O.2B2O3) where (x=0.1,0.2,0.3,0.4). The as-quenched samples exhibited amorphous nature as revealed by X-ray Diffraction studies. With the increase in BCZT content we have observed significant alteration in optical bandgap and Urbach energy. The tailoring of optical properties by tuning the structure was probed by Raman vibrational spectroscopy which confirmed the dominant role played by BCZT as a network modifier in these borate glasses. Concomitantly, these glass nanocomposites were found to be excellent UV absorbers.

Effect of MCM09, an active site-directed inhibitor of factor Xa, on B16-BL6 melanoma lung colonies in mice.

Science.gov (United States)

Rossi, C; Hess, S; Eckl, R W; di Lena, A; Bruno, A; Thomas, O; Poggi, A

2006-03-01

Treatment with anticoagulant drugs has shown potential inhibitory effect on tumor invasion, although the relationship with clotting inhibition was not clear. The aim of our study was to evaluate the potential antitumor activity of MCM09, a newly developed, active site-directed, small molecule inhibitor of factor Xa (FXa) [WO0216312], and to relate the findings to anticlotting potency. MCM09 (0.1-10 mg kg(-1)) or heparin (H; 10 mg kg(-1)) was injected intravenously (i.v.), with 5 x 10(4) B16-BL6 melanoma cells, in C57BL/6 mice. Mice were killed after 18 days, to count lung colonies. Ex vivo anticoagulant activity was measured by activated partial thromboplastin time (APTT) on mouse plasma. MCM09, a selective inhibitor of FXa (IC-50 = 2.4 nm against human FXa), inhibited in a dose-dependent manner B16-BL6 melanoma lung colonies in mice. Mean lung metastasis number was 20.9 +/- 4.8 in controls (n = 10), 1.2 +/- 0.4 in mice treated with H, 10 mg kg(-1) i.v. (P < 0.01), 0.9 +/- 0.3, 9.2 +/- 2.2 and 15.5 +/- 2.6 in mice treated with MCM09, at 10 (P < 0.01), 1 (P < 0.05) and 0.1 mg kg(-1) i.v. (ns), respectively. MCM09 (10 mg kg(-1) i.v.) significantly prolonged APTT (57.1 +/- 10.2 s) 30 min after i.v. injection when compared with controls (25.3 +/- 1.6 s; P < 0.05). Lung colonies were 74.2-72.6% reduced by MCM09 (10 mg kg(-1)) given 60 or 120 min before cells, but not by MCM09 given 60 min thereafter, suggesting a direct cell interaction as a mechanism underlying antitumor activity.

iMovie '09 & iDVD pocket genius

CERN Document Server

Hart-Davis, Guy

2010-01-01

If you want to get the very most out of iMovie '09 or iDVD, put this savvy Portable Genius to work. Want to quickly turn raw footage into a polished movie? Crop, rotate, or delete clips? Add background music or sound effects? Customize your iDVD themes? You'll find cool and useful Genius tips, insider secrets, full-color screenshots, and pages of easy-to-access shortcuts and tools that will save you loads of time and let you enjoy iMovie '09 and iDVD to the max.

Mechanical properties of the Mg-14Ti-1Al-0.9Mn (%Wt) synthesized by physical vapour

International Nuclear Information System (INIS)

Garces, G.; Cristina, M. C.; Torralba, M.; Adeva, P.

2001-01-01

The mechanical properties of the alloy Mg-14% Ti-1% Al-0.9 Mn obtained by PVD techniques have been evaluated up to 300 degree centigree. The alloy presents a columnar grain microstructure, typical of the zone 2 of the structure zone model of MD, where surface diffusion takes place. The alloy tested in compression at room temperature presented a high yield stress, 360 MPa. This resistance to the plastic deformation is principally due to a solid solution hardening and small grain size. The yield stress decrease with the compression temperature. However, the alloy showed low fracture resistance, especially at room temperature. The presence of pores at the grain boundaries, results in the crack formation, running fast along the grain boundary. (Author) 13 refs

Enhanced reducibility and electronic conductivity of Nb or W doped Ce0.9Gd0.1O1.95 - δ

DEFF Research Database (Denmark)

Chatzichristodoulou, Christodoulos; Ricote, Sandrine; Foghmoes, Søren Preben Vagn

2015-01-01

The transport and thermomechanical properties of acceptor (Gd) and donor (Nb or W) co-doped ceria were investigated. The solubility limit of Nb in Ce0.9Gd0.1O2 - δ (CGO10) exceeds 4 at.%, whereas that of W is approximately 2 at.%. Both the thermal and stoichiometric expansion coefficients...... are decreased relative to that of CGO10. Charge compensation of the donor dopants takes place primarily by annihilation of oxide ion vacancies, and a sharp decrease in ionic mobility is observed upon Nb or W doping of CGO10. On the other hand, the n-type electronic conductivity, associated with the reduction...... of Ce4+, increases upon doping with Nb or W, due to enhanced reducibility of cerium. This is beneficial for applications where electronic conductivity is also required, like oxygen permeation membranes. Modeling shows that 4 at.% Nb or W doped CGO10 will deliver higher oxygen fluxes than CGO10, due...

Pan-STARRS1 DISCOVERY OF TWO ULTRALUMINOUS SUPERNOVAE AT z Almost-Equal-To 0.9

Energy Technology Data Exchange (ETDEWEB)

Chomiuk, L. [National Radio Astronomy Observatory, P.O. Box O, Socorro, NM 87801 (United States); Chornock, R.; Soderberg, A. M.; Berger, E.; Foley, R. J.; Kirshner, R. P.; Czekala, I. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Chevalier, R. A. [Department of Astronomy, University of Virginia, P.O. Box 400325, Charlottesville, VA 22904-4325 (United States); Huber, M. E.; Gezari, S.; Riess, A.; Rodney, S. A. [Department of Physics and Astronomy, Johns Hopkins University, 3400 North Charles Street, Baltimore, MD 21218 (United States); Narayan, G.; Stubbs, C. W. [Department of Physics, Harvard University, Cambridge, MA 02138 (United States); Rest, A. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Smartt, S. J. [Astrophysics Research Centre, School of Mathematics and Physics, Queen' s University Belfast, Belfast BT7 1NN (United Kingdom); Tonry, J. L.; Burgett, W. S.; Chambers, K. C. [Institute for Astronomy, University of Hawaii at Manoa, Honolulu, HI 96822 (United States); Wood-Vasey, W. M., E-mail: lchomiuk@cfa.harvard.edu [Department of Physics and Astronomy, University of Pittsburgh, 3941 O' Hara Street, Pittsburgh, PA 15260 (United States); and others

2011-12-20

We present the discovery of two ultraluminous supernovae (SNe) at z Almost-Equal-To 0.9 with the Pan-STARRS1 Medium Deep Survey. These SNe, PS1-10ky and PS1-10awh, are among the most luminous SNe ever discovered, comparable to the unusual transients SN 2005ap and SCP 06F6. Like SN 2005ap and SCP 06F6, they show characteristic high luminosities (M{sub bol} Almost-Equal-To -22.5 mag), blue spectra with a few broad absorption lines, and no evidence for H or He. We have constructed a full multi-color light curve sensitive to the peak of the spectral energy distribution in the rest-frame ultraviolet, and we have obtained time series spectroscopy for these SNe. Given the similarities between the SNe, we combine their light curves to estimate a total radiated energy over the course of explosion of (0.9-1.4) Multiplication-Sign 10{sup 51} erg. We find photospheric velocities of 12,000-19,000 km s{sup -1} with no evidence for deceleration measured across {approx}3 rest-frame weeks around light curve peak, consistent with the expansion of an optically thick massive shell of material. We show that, consistent with findings for other ultraluminous SNe in this class, radioactive decay is not sufficient to power PS1-10ky, and we discuss two plausible origins for these events: the initial spin-down of a newborn magnetar in a core-collapse SN, or SN shock breakout from the dense circumstellar wind surrounding a Wolf-Rayet star.

Bistand til risikovurdering (evt. ændringer af tidligere risikovurdering). Zea mays (MON863; MON863x810). Supplerende materiale til ansøgningen. Modtaget 07-09-2004, deadline 19-09-2004, svar 17-09-2004

DEFF Research Database (Denmark)

Kjellsson, Gøsta; Strandberg, Morten Tune

2012-01-01

"DMU har modtaget og vurderet de supplerende oplysninger (mail fra Skov- og Naturstyrelsen d. 07-09-2004) til ansøgningen om tilladelse til markedsføring af genetisk modificeret majs C/DE/02/09 (MON863 og MON863 x MON810). Vi har gennemgået oplysningerne i det tilsendte materiale for at se om de ...

Results for the first quarter calendar year 2017 tank 50H salt solution sample

Energy Technology Data Exchange (ETDEWEB)

Crawford, C. L. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

2017-04-12

In this memorandum, the chemical and radionuclide contaminant results from the First Quarter Calendar Year 2017 (CY17) sample of Tank 50H salt solution are presented in tabulated form. The First Quarter CY17 Tank 50H samples [a 200 mL sample obtained 6” below the surface (HTF-50-17-7) and a 1 L sample obtained 66” from the tank bottom (HTF-50-17-8)] were obtained on January 15, 2017 and received at Savannah River National Laboratory (SRNL) on January 16, 2017. Prior to obtaining the samples from Tank 50H, a single pump was run at least 4.4 hours and the samples were pulled immediately after pump shut down. All volatile organic analysis (VOA) and semi-volatile organic analysis (SVOA) were performed on the surface sample and all other analyses were performed on the variable depth sample. The information from this characterization will be used by Savannah River Remediation (SRR) for the transfer of aqueous waste from Tank 50H to the Saltstone Production Facility, where the waste will be treated and disposed of in the Saltstone Disposal Facility. This memorandum compares results, where applicable, to Saltstone Waste Acceptance Criteria (WAC) limits and targets. The chemical and radionuclide contaminant results from the characterization of the First Quarter CY17 sampling of Tank 50H were requested by SRR personnel and details of the testing are presented in the SRNL Task Technical and Quality Assurance Plan (TTQAP). This memorandum is part of Deliverable 2 from SRR request. Data pertaining to the regulatory limits for Resource Conservation and Recovery Act (RCRA) metals will be documented at a later time per the TTQAP for the Tank 50H saltstone task.

Synthesis and characterization of structural, morphological and photosensor properties of Cu0.1Zn0.9S thin film prepared by a facile chemical method

Science.gov (United States)

Gubari, Ghamdan M. M.; Ibrahim Mohammed S., M.; Huse, Nanasaheb P.; Dive, Avinash S.; Sharma, Ramphal

2018-05-01

The Cu0.1Zn0.9S thin film was grown by facile chemical bath deposition (CBD) method on glass substrates at 60°C. The structural, morphological, photosensor properties of the as-grown thin film has been investigated. The structural and phase confirmation of the as-grown thin film was carried out by X-ray diffraction (XRD) technique and Raman spectroscopy. The FE-SEM images showed that the thin films are well covered with material on an entire glass substrate. From the optical absorption spectrum, the direct band gap energy for the Cu0.1Zn0.9S thin film was found to be ˜3.16 eV at room temperature. The electrical properties were measured at room temperature in the voltage range ±2.5 V, showed a drastic enhancement in current under light illumination with the highest photosensitivity of ˜72 % for 260 W.

Hong Kong domestic health spending: financial years 1989/90 to 2008/09.

Science.gov (United States)

Tin, K Y K; Tsoi, P K O; Lee, Y H; Tsui, E L H; Lam, D W S; Chui, A W M; Lo, S V

2012-08-01

This report presents the latest estimates of Hong Kong domestic health spending for financial years 1989/90 to 2008/09, cross-stratified and categorised by financing source, provider and function. Total expenditure on health (TEH) was HK$84,391 million in financial year 2008/09, which represents an increase of HK$5030 million or 6.3% over the preceding year. Amid the financial tsunami in late 2008, TEH grew faster relative to gross domestic product (GDP) leading to a marked increase as a percentage of GDP from 4.8% in 2007/08 to 5.1% in 2008/09. During the period 1989/90 to 2008/09, TEH per capita (at constant 2009 prices) grew at an average annual rate of 4.9%, which was faster than that of per capita GDP by 2.0 percentage points. 6.4% when compared with 2007/08, reaching HK$41 257 million and HK$43 134 million, respectively. Consequently, public and private shares of total health expenditure remained the same in the 2 years at 48.9% and 51.1%, respectively. Regarding private spending, the most important source of health financing was out-of-pocket payments by households (35.4% of TEH), followed by employer-provided group medical benefits (7.5%) and private insurance (6.4%). During the period, a growing number of households (mostly in middle to high-income groups) subscribed to pre-payment plans for financing health care. As such, private insurance has taken on an increasingly important role for financing private spending. Of the HK$84 391 million total health expenditure in 2008/09, current expenditure comprised HK$81 186 million (96.2%), whereas HK$3206 million (3.8%) was for capital expenses (ie investment in medical facilities). Analysed by health care function, services for curative care accounted for the largest share of total health spending (66.1%), which was made up of ambulatory services (32.8%), in-patient curative care (28.8%), day patient hospital services (3.9%) and home care (0.5%). Notwithstanding the small share of total spending for day patient

Reduction of hexavalent chromium by Pannonibacter phragmitetus LSSE-09 stimulated with external electron donors under alkaline conditions

International Nuclear Information System (INIS)

Xu Lin; Luo Mingfang; Li Wangliang; Wei Xuetuan; Xie Keng; Liu Lijun; Jiang Chengying; Liu Huizhou

2011-01-01

Research highlights: → Growing cells have high Cr (VI) resistant and reducing ability aerobically. → Resting cells show strong anaerobic-reduction potential. → Acetate can highly stimulate both aerobic and anaerobic reduction process. - Abstract: A novel Cr (VI) resistant bacterial strain LSSE-09, identified as Pannonibacter phragmitetus, was isolated from industrial sludge. It has strong aerobic and anaerobic Cr (VI)-reduction potential under alkaline conditions. At 37 o C and pH 9.0, growing cells of strain LSSE-09 could completely reduce 100 and 1000 mg L -1 Cr (VI)-Cr (III) within 9 and 24 h, respectively under aerobic condition. Resting cells showed higher anaerobic reduction potential with the rate of 1.46 mg g -1 (dryweight) min -1 , comparing with their aerobic reduction rate, 0.21 mg g -1 min -1 . External electron donors, such as lactate, acetate, formate, pyruvate, citrate and glucose could highly increase the reduction rate, especially for aerobic reduction. The presence of 3000 mg L -1 acetate enhanced anaerobic and aerobic Cr (VI)-reduction rates up to 9.47 mg g -1 min -1 and 4.42 mg g -1 min -1 , respectively, which were 5 and 20 times faster than those without it. Strain LSSE-09 retained high activities over six batch cycles and NO 3 - and SO 4 2- had slightly negative effects on Cr (VI)-reduction rates. The results suggest that strain LSSE-09 has potential application for Cr (VI) detoxification in alkaline wastewater.

Strain-based HLA association analysis identified HLA-DRB1*09:01 associated with modern strain tuberculosis.

Science.gov (United States)

Toyo-Oka, L; Mahasirimongkol, S; Yanai, H; Mushiroda, T; Wattanapokayakit, S; Wichukchinda, N; Yamada, N; Smittipat, N; Juthayothin, T; Palittapongarnpim, P; Nedsuwan, S; Kantipong, P; Takahashi, A; Kubo, M; Sawanpanyalert, P; Tokunaga, K

2017-09-01

Tuberculosis (TB) occurs as a result of complex interactions between the host immune system and pathogen virulence factors. Human leukocyte antigen (HLA) class II molecules play an important role in the host immune system. However, no study has assessed the association between HLA class II genes and susceptibility to TB caused by specific strains. This study investigated the possible association of HLA class II genes with TB caused by modern and ancient Mycobacterium tuberculosis (MTB). The study included 682 patients with TB and 836 control subjects who were typed for HLA-DRB1 and HLA-DQB1 alleles. MTB strains were classified using a large sequence polymorphism typing method. Association analysis was performed using common HLA alleles and haplotypes in different MTB strains. HLA association analysis of patients infected with modern MTB strains showed significant association for HLA-DRB1*09:01 (odds ratio [OR] = 1.82; P-value = 9.88 × 10 -4 ) and HLA-DQB1*03:03 alleles (OR = 1.76; P-value = 1.31 × 10 -3 ) with susceptibility to TB. Haplotype analysis confirmed that these alleles were in strong linkage disequilibrium and did not exert an interactive effect. Thus, the results of this study showed an association between HLA class II genes and susceptibility to TB caused by modern MTB strains, suggesting the importance of strain-specific analysis to determine susceptibility genes associated with TB. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Effect of synthesis conditions on the nanopowder properties of Ce{sub 0.9}Zr{sub 0.1}O{sub 2}

Energy Technology Data Exchange (ETDEWEB)

Zimicz, M.G.; Fabregas, I.O.; Lamas, D.G. [CINSO (Centro de Investigaciones en Solidos) CONICET-CITEFA J.B. de La Salle 4397, 1603 Villa Martelli, Pcia. de Buenos Aires (Argentina); Larrondo, S.A., E-mail: susana@di.fcen.uba.ar [Laboratorio de Procesos Cataliticos, Departamento de Ingenieria Quimica, Facultad de Ingenieria, Universidad de Buenos Aires, Pabellon de Industrias, Ciudad Universitaria, 1428 Buenos Aires (Argentina)

2011-06-15

Graphical abstract: . The synthesis of nanocrystalline Ce{sub 0.9}Zr{sub 0.1}O{sub 2} powders via the gel-combustion method, using different fuels, and following either stoichiometric or non-stoichiometric pH-controlled routes is investigated. Research highlights: {yields} All samples exhibited the fluorite-type crystal structure, nanometric average crystallite size and negligible carbon content. {yields} Synthesis conditions strongly affect the average crystallite size, the degree of agglomeration, the specific surface area and the pore volume. {yields} Our results indicate that, by controlling the synthesis conditions it is possible to obtain solids with custom-made morphological properties. -- Abstract: In this work, the synthesis of nanocrystalline Ce{sub 0.9}Zr{sub 0.1}O{sub 2} powders via the gel-combustion method, using different fuels, and following either stoichiometric or non-stoichiometric pH-controlled routes is investigated. The objective is to evaluate the effect of synthesis conditions on the textural and morphological properties, and the crystal structure of the synthesized materials. The solids were characterized by nitrogen physisorption, Scanning Electron Microscopy (SEM), X-ray powder diffraction (XPD), and Carbon-Hydrogen-Nitrogen Elemental Analysis (CHN). All the powders exhibited nanometric crystallite size, fluorite-type structure and negligible carbon content. Synthesis conditions strongly affect the average crystallite size, the degree of agglomeration, the specific surface area and the pore volume. Our results indicate that, by controlling the synthesis conditions it is possible to obtain solids with custom-made morphological properties.

Defense waste salt disposal at the Savannah River Plant

International Nuclear Information System (INIS)

Langton, C.A.; Dukes, M.D.

1984-01-01

A cement-based waste form, saltstone, has been designed for disposal of Savannah River Plant low-level radioactive salt waste. The disposal process includes emplacing the saltstone in engineered trenches above the water table but below grade at SRP. Design of the waste form and disposal system limits the concentration of salts and radionuclides in the groundwater so that EPA drinking water standards will not be exceeded at the perimeter of the disposal site. 10 references, 4 figures, 3 tables

Structure and dielectric properties of (Ba{sub 0.7}Sr{sub 0.3}){sub 1-x}Na{sub x}(Ti{sub 0.9}Sn{sub 0.1}){sub 1-x}Nb{sub x}O{sub 3} ceramics

Energy Technology Data Exchange (ETDEWEB)

Ghoudi, Hanen; Khirouni, Kamel [Universite de Gabes, Laboratoire de Physique des Materiaux et des Nanomateriaux Appliquee a l' Environnement (La Phy MNE), Faculte des Sciences de Gabes, Gabes (Tunisia); Chkoundali, Souad [Universite de Sfax, Laboratoire des Materiaux Multifonctionnels et Applications (LaMMA), Faculte des Sciences de Sfax (FSS), Sfax (Tunisia); Aydi, Abdelhedi [Universite de Gabes, Laboratoire de Physique des Materiaux et des Nanomateriaux Appliquee a l' Environnement (La Phy MNE), Faculte des Sciences de Gabes, Gabes (Tunisia); Universite de Sfax, Laboratoire des Materiaux Multifonctionnels et Applications (LaMMA), Faculte des Sciences de Sfax (FSS), Sfax (Tunisia)

2017-11-15

(Ba{sub 0.7}Sr{sub 0.3}){sub 1-x}Na{sub x}(Ti{sub 0.9}Sn{sub 0.1}){sub 1-x}Nb{sub x}O{sub 3} ceramics with compositions x = 0.6, 0.7, 0.8 and 0.9 were synthesized using the solid-state reaction method. These ceramics were examined by X-ray diffraction and dielectric measurements over a broad temperature and frequency ranges. X-ray diffraction patterns revealed a single-perovskite phase crystallized in a cubic structure, for x < 0.8, and in tetragonal, for x ≥ 0.8, with Pm3m and P4mm spaces groups, respectively. Two types of behaviors, classical ferroelectric or relaxor, were observed depending on the x composition. It is noted that temperatures T{sub C} (the Curie temperature) or T{sub m} (the temperature of maximum permittivity) rise when x increases and the relaxor character grows more significantly when x composition decreases. To analyze the dielectric relaxation degree of relaxor, various models were considered. It was proven that an exponential function could well describe the temperature dependence of the static dielectric constant and relaxation time. (orig.)

NCBI nr-aa BLAST: CBRC-MDOM-09-0050 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MDOM-09-0050 ref|NP_689554.2| progestin and adipoQ receptor family member IV [...Homo sapiens] sp|Q8N4S7|PAQR4_HUMAN RecName: Full=Progestin and adipoQ receptor family member 4; AltName: Full=Progesti...n and adipoQ receptor family member IV gb|AAH33703.1| Progestin and adipoQ receptor family member... IV [Homo sapiens] gb|AAR08370.1| progestin and adipoQ receptor family member IV ...[Homo sapiens] gb|EAW85441.1| progestin and adipoQ receptor family member IV, isoform CRA_a [Homo sapiens] gb|EAW85443.1| progesti

INTERNATIONAL PROGRAM: SUMMARY REPORT ON THE PROPERTIES OF CEMENTITIOUS WASTE FORMS

International Nuclear Information System (INIS)

Harbour, J

2007-01-01

This report provides a summary of the results on the properties of cementitious waste forms obtained as part of the International Program. In particular, this report focuses on the results of Task 4 of the Program that was initially entitled ''Improved Retention of Key Contaminants of Concern in Low Temperature Immobilized Waste Forms''. Task 4 was a joint program between Khlopin Radium Institute and the Savannah River National Laboratory. The task evolved during this period into a study of cementitious waste forms with an expanded scope that included heat of hydration and fate and transport modeling. This report provides the results for Task 4 of the International Program as of the end of FY06 at which time funding for Task 4 was discontinued due to the needs of higher priority tasks within the International Program. Consequently, some of the subtasks were only partially completed, but it was considered important to capture the results up to this point in time. Therefore, this report serves as the closeout report for Task 4. The degree of immobilization of Tc-99 within the Saltstone waste form was measured through monolithic and crushed grout leaching tests. An effective diffusion coefficient of 4.8 x 10 -12 (Leach Index of 11.4) was measured using the ANSI/ANS-16.1 protocol which is comparable with values obtained for tank closure grouts using a dilute salt solution. The leaching results show that, in the presence of concentrated salt solutions such as those that will be processed at the Saltstone Production Facility, blast furnace slag can effectively reduce pertechnetate to the immobile +4 oxidation state. Leaching tests were also initiated to determine the degree of immobilization of selenium in the Saltstone waste form. Results were obtained for the upper bound of projected selenium concentration (∼5 x 10 -3 M) in the salt solution that will be treated at Saltstone. The ANSI/ANS 16.1 leaching tests provided a value for the effective diffusivity of ∼5 x 10

Effects of Er3+ and Pr3+ Substitution on Structural, Dielectric, Ferroelectric and Photoluminescence Properties of the BaTi0.9Zr0.1O3 Ceramic

Science.gov (United States)

Zouari, I.; Sassi, Z.; Seveyrat, L.; Perrin, V.; Zghal, S.; Abdelmoula, N.; Lebrun, L.; Khemakhem, H.

2017-07-01

BaTi0.9Zr0.1O3 (BZT), Ba1- x Ln2 x/3□ x/3Ti0.9Zr0.1O3 (with x = 0.5% mol and Ln = Er3+) (BZT-Er) and Ba1- x Ln2 x/3□ x/3Ti0.9Zr0.1O3 (with x = 0.5% mol and Ln = Pr3+) (BZT-Pr) were prepared via the conventional solid-state reaction method. X-ray diffraction showed that all these ceramics were in the single perovskite phase at room temperature (RT). The temperature dependence of dielectric behavior was investigated in the temperature range 25-225°C and exhibited a classical ferroelectric behavior. A slight decrease of the Curie temperature ( T C) with Pr3+ and Er3+ substitution was observed in addition to an increase in the maximum dielectric permittivity ( \\varepsilon_{r {max} }^' }} ) of about 40% for the BZT-Er. At RT, the ferroelectric and piezoelectric coefficients were decreased for BZT-Pr, but were maintained for BZT-Er with a piezoelectric coefficient ( d 33) of 185 pC/N, a planar electromechanical coupling factor of 30%, and a remanent polarization of 11.6 μC/cm2. The Raman bands as a function of temperature confirmed the paraelectric-ferroelectric phase transition of all those ceramics. The photoluminescence spectra showed that strong red (615 nm and 645 nm) and bright green (523 nm and 545 nm) emission bands were obtained, under excitation by laser at 488 nm at RT, for BZT-Pr and BZT-Er, respectively. These multifunctional materials showed a significant technological promise in coupling device applications.

Impact of concomitant Y and Mn substitution on properties of La{sub 1-z}Y{sub z}Fe{sub 1-y}Mn{sub y}AsO{sub 0.9}F{sub 0.1}

Energy Technology Data Exchange (ETDEWEB)

Kappenberger, Rhea; Hammerath, Franziska; Wurmehl, Sabine; Buechner, Bernd [Leibniz Institute for Solid State and Materials Research Dresden, IFW Dresden (Germany); Institut fuer Festkoerperphysik, TU Dresden, Dresden (Germany); Asfaw Afrassa, Mesfin [Leibniz Institute for Solid State and Materials Research Dresden, IFW Dresden (Germany); Addis Ababa University, College of Natural Science, Addis Ababa (Ethiopia); Rousse, Pierre; Hess, Christian; Prando, Giacomo; Moroni, Matteo; Wolter, Anja U.B. [Leibniz Institute for Solid State and Materials Research Dresden, IFW Dresden (Germany); Sanna, Samuele; Carretta, Pietro [Dipartimento di Fisica e Unita di CNISM, Pavia (Italy); Lamura, Gianrico [Universita di Genova (Italy); CNR-SPIN, Genova (Italy); Kamusella, Sirko; Klauss, Hans-Henning [Institut fuer Festkoerperphysik, TU Dresden, Dresden (Germany)

2016-07-01

The substitution of constituents is frequently used as a local probe to check the microscopic properties of an unconventional superconductor in response to such an ''impurity''. In this talk, we present several structural parameters and the superconducting critical temperatures in response to different substitution levels of Mn and Y in La{sub 1-z}Y{sub z}Fe{sub 1-y}Mn{sub y}AsO{sub 0.9}F{sub 0.1}. We will discuss our findings in the light of chemical pressure inflicted by Y, which has a significantly smaller ionic radius than La, and strong electron localization caused by small amounts of paramagnetic Mn impurities.

Oxygen transport properties of tubular Ce0.9Gd0.1O1.95-La0.6Sr0.4FeO3−d composite asymmetric oxygen permeation membranes supported on magnesium oxide

DEFF Research Database (Denmark)

Ovtar, Simona; Gurauskis, Jonas; Bjørnetun Haugen, Astri

2017-01-01

The oxygen permeation through dense Ce0.9Gd0.1O1.95-La0.6Sr0.4FeO3−d  dual-phase composite asymmetric membranes supported on a porous MgO tube was studied. The membranes were prepared by thermoplastic extrusion, dip coating, co-sintering and infiltration of a catalyst. Oxygen permeation measureme...

46 CFR 42.09-35 - Additional survey requirements for wood-hull vessels.

Science.gov (United States)

2010-10-01

... 46 Shipping 2 2010-10-01 2010-10-01 false Additional survey requirements for wood-hull vessels. 42.09-35 Section 42.09-35 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) LOAD LINES... Additional survey requirements for wood-hull vessels. (a) In addition to the requirements in § 42.09-25, the...

Impact of influenza in the post-pandemic phase: Clinical features in hospitalized patients with influenza A (H1N1) pdm09 and H3N2 viruses, during 2013 in Santa Fe, Argentina.

Science.gov (United States)

Kusznierz, Gabriela; Carolina, Cudós; Manuel, Rudi Juan; Sergio, Lejona; Lucila, Ortellao; Julio, Befani; Mirta, Villani; Pedro, Morana; Graciana, Morera; Andrea, Uboldi; Elsa, Zerbini

2017-07-01

It is important to characterize the clinical and epidemiological pattern of the influenza A (H1N1) pdm09 virus and compare it with influenza A (H3N2) virus, as surveyed in just a few studies, in order to contribute to the implementation and strengthening of influenza control and prevention strategies. The aims in this study were to describe influenza clinical and epidemiological characteristics in hospitalized patients, caused by influenza A (H1N1)pdm09 and influenza A (H3N2) viruses during 2013, in Santa Fe, Argentina. A retrospective study was conducted over 2013 among hospitalized patients with laboratory-confirmed influenza diagnosis. In contrast to patients with influenza A (H3N2) (20.5%), a higher proportion of hospitalizations associated with influenza H1N1pdm were reported among adults aged 35-65 years (42.8%). Of all patients, 73.6% had an underlying medical condition. Hospitalized patients with H1N1pdm were subject to 2.6 (95%CI, 1.0-6.8) times higher risk of severity, than those hospitalized with influenza A (H3N2). This results demonstrate the impact in the post-pandemic era of H1N1pdm virus, with increased risk of severe disease, in relation to H3N2 virus, both viruses co-circulating during 2013. © 2017 Wiley Periodicals, Inc.

Impedance spectroscopy studies on lead free (Ba0.85Ca0.15(Ti0.9Zr0.1O3 ceramics

Directory of Open Access Journals (Sweden)

Ahcène Chaouchi

2012-12-01

Full Text Available The AC complex impedance spectroscopy technique has been used to obtain the electrical parameters of polycrystalline sample of (Ba0.85Ca0.15(Ti0.9Zr0.1O3 in a wide frequency range at different temperatures. This sample was prepared by a high temperature solid-state reaction technique and single phase formation was confirmed by X-ray diffraction technique. This study was carried out by the means of simultaneous analysis of impedance, modulus, and electrical conductivity. The Cole-Cole (Nyquist plots suggest that the grains and grain boundaries are responsible in the conduction mechanism of the material at high temperature. The ColeCole (Nyquist plot studies revealed the presence of grain and grain boundary effect at 485 °C. On the other hand, it showed only the presence of grain boundary component of the resistivity at 535 °C. Complex impedance analysis indicated the presence of non-Debye type dielectric relaxation. The bulk resistance of the material decreases with rise in temperature similar to a semiconductor, and the Cole-Cole (Nyquist plot showed the negative temperature coefficient of resistance (NTCR character of (Ba0.85Ca0.15(Ti0.9Zr0.1O3. The value of activation energy is found to be 0.7433 eV, which suggests that the conduction may be the result of defect and charge carriers present in the materials.

Synthesis, characterization, and photoactivity of InTaO4 and In0.9Ni0.1TaO4 thin films prepared by electron evaporation

International Nuclear Information System (INIS)

Rico, V. J.; Frutos, F.; Yubero, F.; Espinos, J. P.; Gonzales-Elipe, A. R.

2010-01-01

InTaO 4 and In 0.9 Ni 0.1 TaO 4 thin films have been prepared by electron evaporation of successive layers of the single oxide components and posterior annealing at T>800 deg. C. The annealed thin films presented the monoclinic crystallographic structure typical of these mixed oxides. The electrical and optical behaviors of the films, assessed by C-V measurements, surface conductivity as a function of temperature, and UV-vis absorption spectroscopy, indicate that these oxides are wide band gap semiconductors with a variable dielectric constant depending on the annealing conditions. By reflection electron energy loss spectroscopy some electronic states have been found in the gap at an energy that is compatible with the activation energy deduced from the conductivity versus 1/T plots for these oxides. The photoactivity of these materials has been assessed by looking to the evolution of the wetting contact angle as a function of the irradiation time. All the films became superhydrophilic when irradiated with UV light, while the In 0.9 Ni 0.1 TaO 4 thin films also presented a small partial decrease in wetting angle when irradiated with visible photons.

Effect of InSb/In0.9Al0.1Sb superlattice buffer layer on the structural and electronic properties of InSb films

Science.gov (United States)

Zhao, Xiaomeng; Zhang, Yang; Guan, Min; Cui, Lijie; Wang, Baoqiang; Zhu, Zhanping; Zeng, Yiping

2017-07-01

The effect of InSb/In0.9Al0.1Sb buffer layers on InSb thin films grown on GaAs (0 0 1) substrate by molecular beam epitaxy (MBE) is investigated. The crystal quality and the surface morphology of InSb are characterized by XRD and AFM. The carrier transport property is researched through variable temperature hall test. The sharp interface between InSb/In0.9Al0.1Sb is demonstrated important for the high quality InSb thin film. We try different superlattice buffer layers by changing ratios, 2-0.5, thickness, 300-450 nm, and periods, 20-50. According to the function of the dislocation density to the absolute temperature below 150 K with different periods of SL buffers, we can find that the number of periods of superlattice is a major factor to decrease the density of threading dislocations. With the 50 periods SL buffer layer, the electron mobility of InSb at the room temperature and liquid nitrogen cooling temperature is ∼63,000 and ∼4600 cm2/V s, respectively. We deduce that the interface in the SL structure works as a filter layer to prevent the dislocation propagating to the upper InSb thin films.

The Constitutional Review Chamber of the Republic of Estonia : no. of the case 3-4-1-2-09 : date of decision 9 June 2009

Index Scriptorium Estoniae

2009-01-01

Kohtulahendi 3-4-1-2-09 (Tallinna Linnavolikogu taotlus tunnistada kehtetuks kohaliku omavalitsuse volikogu valimise seaduse § 7 lg 2 p 5 ja § 8 lg 4 ; või § 7 lg 2 p 5 ja § 9 lg 4 ; või § 7 lg 2 p 5, § 8 lg 4 ja § 9 lg 2.) tekst inglise keeles

Water vapour solubility and conductivity study of the proton conductor BaCe(0.9 − x)ZrxY0.1O(3 − δ)

DEFF Research Database (Denmark)

Ricote, Sandrine; Bonanos, Nikolaos; Caboche, G:

2009-01-01

The perovskite BaCe(0.9 − x)ZrxY0.1O(3 − δ) has been prepared by solid state reaction at 1400 °C and conventional sintering at 1700 °C. Water uptake experiments performed between 400 and 600 °C, at a water vapour pressure of 0.02 atm, provide data on the concentration of protons incorporated in t...

Ionic/Electronic Conductivity, Thermal/Chemical Expansion and Oxygen Permeation in Pr and Gd Co-Doped Ceria PrxGd0.1Ce0.9-xO1.95-δ

DEFF Research Database (Denmark)

Cheng, Shiyang; Chatzichristodoulou, Christodoulos; Søgaard, Martin

2017-01-01

Pr. A series of compositions of PrxGd0.1Ce0.9-xO1.95-δ (x = 0, 0.02, 0.05, 0.08, 0.15, 0.25, 0.3 and 0.4) was prepared by solid state reaction. X-ray powder diffraction (XPD) indicates that Pr is completely dissolved in the fluorite structure up to 40 at.%. Pronounced nonlinear thermal expansion...... behavior was observed as a function of temperature, due to the simultaneous contributions of both thermal and chemical expansion. The electronic and ionic conductivities were measured as a function of temperature and oxygen partial pressure. Within the range from 10 to 15 at.% Pr, a drastic drop...

Effect of Chlorine Substitution on Sulfide Reactivity with OH Radicals

Science.gov (United States)

2008-09-01

Single point energy: MP2/6-311+G(3df,2p) (LRG) • Zero Point Energy from a vibrational frequency analysis: MP2/6-31++G** ( ZPE ) • Extrapolated energy...E(QCI) + E(LARG) – E(SML) + ZPE • Characterize the TS • Use a three-point fit methodology – fit a harmonic potential to three CCSD single point

Leping kinnisvaraarendaja ja kinnisasja omandaja vahel : kas müügileping või segatüüpi leping? Kommentaar Riigikohtu otsusele tsiviilasjas 3-2-1-98-09 / Karin Sein

Index Scriptorium Estoniae

Sein, Karin, 1974-

2010-01-01

Riigikohtu lahendist 3-2-1-98-09: A & M Invest OÜ kassatsioonkaebus Tallinna Ringkonnakohtu 30.03.2009. a otsusele A & M Invest OÜ hagis K. Radiku ja M. Radiku vastu hüvitise 1 950 946,70 krooni väljamõistmiseks

Isomers of (Ca0.1La0.9)(Ba1.65La0.35)Cu3Oy Superconductor Having Different Tc

International Nuclear Information System (INIS)

Knizhnik, A.; Reisner, G.M.; Men, A.; Eckstein, Y.

1998-01-01

(Ca 0.1 La 0.9 )(Ba 1.65 La 0.35 )Cu 3 O y is a YBCO like superconductor but tetragonal for any y, i.e. without ordered chains. Its T c vs y plot has no intermediate plateau and is a nearly straight line in the under doped region. Different oxygen contents were obtained by oxygenation at various temperatures under 1 atm O 2 followed by quench in liquid nitrogen. This type of oxygenation leads to samples where the oxygen content corresponds to the thermodynamic equilibrium with the gas phase because the form of attaining the oxygenation temperature (Tom higher or lower temperature) and time (over 10h) of oxygenation do not change y and Tc. Changing of the firing temperature (we used the usual carbonate-oxide preparation which included 3 firings in powder, pelletization, sintering and oxygenation) changes Tc at the same y. The increase of the firing temperature by 40 deg C increases T c by 7-10K while y remains unchanged. Increases of the temperature of sintering virtually do not change T c which shows that low and high Tc compounds are formed during the first stages of preparation and that there is no thermodynamic equilibrium between them. The low Tc compounds cannot be transformed into high Tc ones by raising the temperature

Facilities Performance Indicators Report, 2008-09

Science.gov (United States)

Hills, Christina, Ed.

2010-01-01

This paper features another expanded Web-based Facilities Performance Indicators Report (FPI). The purpose of APPA's Facilities Performance Indicators is to provide a representative set of statistics about facilities in educational institutions. The 2008-09 iteration of the Web-based Facilities Performance Indicators Survey was posted and…

Immobilization of lead in shooting range soils by means of cement, quicklime, and phosphate amendments.

Science.gov (United States)

Cao, Xinde; Dermatas, Dimitris; Xu, Xuanfeng; Shen, Gang

2008-03-01

Lead (Pb) contamination at shooting range sites is increasingly under environmental concern. Controlling Pb leachability from shooting range soil media is an important step to minimize Pb exposure to the surrounding environment. This study investigated stabilization of Pb in shooting range soils treated with cement, quicklime, and phosphate. Two soils were used and collected from two shooting ranges, referred to as SR1 and SR2. The treatment additives were applied to the soils at rates from 2.5% to 10% (w/w). The effectiveness of each treatment was evaluated by Pb (w/w). The effectiveness of each treatment was evaluated by Pb leachability, measured by the Toxicity Characteristic Leaching Procedure (TCLP). The possible mechanisms for Pb immobilization were elucidated using X-ray powder diffraction (XRPD). Cement and quicklime treatments were effective in immobilizing Pb in SR1 soil, with reduction of Pb concentration in TCLP leachate (TCLP-Pb) to be below the U.S. EPA non-hazardous regulatory limit of 5 mg L(-1) at application rates of > or =5% and 28-d incubation. By contrast, cement and quicklime amendments were less effective for Pb stabilization in SR2 soil because the TCLP-Pb levels in the treated soil were still higher than the limit of 5 mg L(-1) at all application rates, although they were significantly reduced in comparison with the untreated soil. Phosphate application was most effective in reducing Pb leach ing in both soils. Even at an application rate as low as 5% and 1-d incubation, phosphate could reduce TCLP-Pb to be below the limit of 5 mg L(-1) in both soils. Immobilization of Pb in the SR1 soil amended with cement and quicklime was attributed to the formation of pozzolanic minerals (e.g., calcium silicate hydrate C-S-H and ettringite) that could encapsulate soil Pb. The pozzolanic reaction was limited in the SR2 soil upon the application of cement and quicklime. Reduction of the TCLP-Pb might result from complexation of Pb on the surface of the

Structural and conductivity study of the proton conductor BaCe(0.9−x)ZrxY0.1O(3−δ) at intermediate temperatures

DEFF Research Database (Denmark)

Ricote, Sandrine; Bonanos, Nikolaos; Marco de Lucas, M.C.

2009-01-01

The perovskite BaCe(0.9−x)ZrxY0.1O(3−δ) is prepared by solid-state reaction at 1400 °C and sintering at 1700 °C. It is characterised using X-ray diffraction, Raman spectroscopy and electrical measurements. A distortion from the cubic structure at room temperature is noticeable in the Raman spectr...

Stability of methadone hydrochloride in 0.9% sodium chloride injection in single-dose plastic containers.

Science.gov (United States)

Denson, D D; Crews, J C; Grummich, K W; Stirm, E J; Sue, C A

1991-03-01

The stability of methadone hydrochloride in 0.9% sodium chloride injection in flexible polyvinyl chloride containers was studied. Commercially available methadone hydrochloride 20 mg/mL and 25-mL single-dose bags of 0.9% sodium chloride injection were used. Six samples each were prepared at methadone hydrochloride concentrations of 1, 2, and 5 mg/mL. The solutions were stored at room temperature and were not protected from light. Immediately after preparation and after two, three, and four weeks of storage, each of the 18 samples was divided into three aliquots, each of which was analyzed in duplicate for methadone hydrochloride concentration by gas chromatography. There was less than 10% change in methadone hydrochloride concentration in any sample throughout the four-week study period. Methadone hydrochloride at concentrations of 1, 2, and 5 mg/mL prepared in commercially available flexible polyvinyl chloride containers of 0.9% sodium chloride injection and stored at room temperature without deliberate protection from light is stable for at least four weeks.

Dynamic mass exchange in doubly degenerate binaries. I - 0.9 and 1.2 solar mass stars

International Nuclear Information System (INIS)

Benz, W.; Cameron, A.G.W.; Press, W.H.; Bowers, R.L.

1990-01-01

The dynamic mass exchange process in doubly degenerate binaries was investigated using a three-dimensional numerical simulation of the evolution of a doubly degenerate binary system in which the primary is a 1.2-solar-mass white dwarf and the Roche lobe filling secondary is a 0.9-solar-mass dwarf. The results show that, in a little more than two orbital periods, the secondary is completely destroyed and transformed into a thick disk orbiting about the primary. Since only a very small fraction of the mass (0.0063 solar mass) escapes the system, the evolution of the binary results in the formation of a massive object. This object is composed of three parts, the initial white dwarf primary, a very hot pressure-supported spherical envelope, and a rotationally supported outer disk. The evolution of the system can be understood in terms of a simple analytical model where it is shown that the angular momentum carried by the mass during the transfer and stored in the disk determines the evolution of the system. 34 refs

Simple top-down preparation of magnetic Bi_0.9Gd_0.1Fe_1−xTi_xO₃ nanoparticles by ultrasonication of multiferroic bulk material

DEFF Research Database (Denmark)

Basith, M. A.; Ngo, Duc-The; Quader, A.

2014-01-01

We present a simple technique to synthesize ultrafine nanoparticles directly from bulk multiferroic perovskitepowder. The starting materials, which were ceramic pellets of the nominal compositions Bi0.9Gd0.1-Fe1−xTixO3 (x = 0.00–0.20), were prepared initially by a solid state reaction technique, ...

Effects of electric-field-induced piezoelectric strain on the electronic transport properties of La0.9Ce0.1MnO3 thin films

International Nuclear Information System (INIS)

Zheng, R.K.; Dong, S.N.; Wu, Y.Q.; Zhu, Q.X.; Wang, Y.; Chan, H.L.W.; Li, X.M.; Luo, H.S.; Li, X.G.

2012-01-01

The authors constructed multiferroic structures by growing La 0.9 Ce 0.1 MnO 3 (LCEMO) thin films on piezoelectric 0.68Pb(Mg 1/3 Nb 2/3 )O 3 –0.32PbTiO 3 (PMN-PT) single-crystal substrates. Due to the efficient elastic coupling at the interface, the electric-field-induced piezoelectric strain in PMN-PT substrates is effectively transferred to LCEMO films and thus, leads to a decrease in the resistance and an increase in the magnetoresistance of the films. Particularly, it was found that the resistance-strain coefficient [(ΔR/R) film /(Δε zz ) film ] of the LCEMO film was considerably enhanced by the application of magnetic fields, demonstrating strong coupling between the lattice and the spin degrees of freedom. (ΔR/R) film /(Δε zz ) film at 122 K was enhanced by ∼ 28.8% by a magnetic field of 1.2 T. An analysis of the overall results demonstrates that the phase separation is crucial to understand strain-mediated modulation of electronic transport properties of manganite film/PMN-PT multiferroic structures. - Highlights: ► La 0.9 Ce 0.1 Mn O3 films were epitaxially grown on piezoelectric single crystals. ► Piezoelectric strain influences the electronic transport properties of films. ► Magnetic field enhances the piezoelectric strain effect. ► Phase separation is crucial to understand the piezoelectric strain effect.

Assessment of heavy metal mobility in mine tailings in the province of Huelva; Evaluacion de la movilidad de metales pesados en residuos mineros de flotacion de mineria metalica en la provincia de Huelva

Energy Technology Data Exchange (ETDEWEB)

Arranz Gonzalez, J. C.; Cala Rivero, V.

2011-07-01

Metallurgic mine wastes often contain high concentrations of potentially toxic elements, the mobility of which may pose an environmental hazard for water and surrounding ecosystems. We have examined the mobility of Ag, As, Cu, Pb and Zn from composite surface samples (0-20 cm) of different pyritic tailings impoundments in the province of Huelva (Spain). These samples were also subject to physical chemical and mineralogical (XRD) characterization. The total metal content of the tailings ranged between 1.89-11.2 ppm for Ag, 72-610 ppm for As, 245-1194 ppm for Cu, 220-11933 for Pb and 41-706 for Zn, all proving to be highly acidic. The mobility of these elements was assessed by using a seven-step sequential extraction procedure and applying the toxicity characteristic leaching procedure (TCLP). We investigated the applicability of TCLP to the tailings by comparing the results with those of the first steps of the sequential extraction procedure. It was found that the pH values remained buffered (close to 4.97) upon adding the TCLP extraction reagent and that the pH values differed significantly from those of the aqueous extracts. This could result in an underestimation of mobile forms compared with those dissolved in water. We may also conclude that due to the presence of specific minerals or to the preference of some elements for acetate ions the results of any assessment of metal mobility in pyritic tailings using the TCLP test may be questionable. (Author) 42 refs.

Enhanced conductivity in pulsed laser deposited Ce0.9Gd0.1O2−δ/SrTiO3 heterostructures

DEFF Research Database (Denmark)

Kant, K. Mohan; Esposito, Vincenzo; Pryds, Nini

2010-01-01

Significant enhancement in the electrical conductivity of Ce0.9Gd0.1O2−δ (CGO) thin films (250 and 500 nm) deposited on MgO(001) substrate is observed by introducing ∼ 50 nm thin SrTiO3 buffer layer film. Introduction of the buffer layer is found to form epitaxial films, leading to minimal grain...... boundary network that results in a free conduction path with near-zero blocking effects perpendicular to current flow. The in-plane conductivity measurements confirm increase in conductivity with increase in compressive strain on CGO films. © 2010 American Institute of Physics...

Vitreoscilla hemoglobin promotes Salecan production by Agrobacterium sp. ZX09.

Science.gov (United States)

Chen, Yun-mei; Xu, Hai-yang; Wang, Yang; Zhang, Jian-fa; Wang, Shi-ming

2014-11-01

Salecan is a novel exopolysaccharide produced by the strain Agrobacterium sp. ZX09, and it is composed of only glucose monomers. The unique chemical composition and excellent physicochemical properties make Salecan a promising material for applications in coagulation, lubrication, protection against acute liver injury, and alleviating constipation. In this study, we cloned the Vitreoscilla hemoglobin gene into a broad-host-range plasmid pCM158. Without antibiotic selection, there was negligible loss of the plasmid in the host Agrobacterium sp. ZX09 after one passage of cultivation. The expression of Vitreoscilla hemoglobin was demonstrated by carbon monoxide (CO) difference spectrum. The engineered strain Agrobacterium sp. ZX09 increased Salecan yield by 30%. The other physiological changes included its elevated respiration rate and cellular invertase activity.

Optical rectification in a strained GaAs{sub 0.9}P{sub 0.1}/GaAs{sub 0.6}P{sub 0.4} quantum dot: Simultaneous effects of electric and magnetic fields

Energy Technology Data Exchange (ETDEWEB)

Vinolin, Ada [Dept. of Physics, Madurai Kamaraj University College, Alagarkoil Road, Madurai-625002 (India); Peter, A. John, E-mail: a.john.peter@gmail.com [Dept. of Physics, Government Arts College, Melur-625106, Tamilnadu (India)

2014-04-24

Simultaneous effects of electric field and magnetic field on exciton binding energy as a function of dot radius in a cylindrical GaAs{sub 0.9}P{sub 0.1}/GaAs{sub 0.6}P{sub 0.4} strained quantum dot are investigated. The strain contribution includes the strong built-in electric field induced by the spontaneous and piezoelectric polarizations. Numerical calculations are performed using variational procedure within the single band effective mass approximation. Optical rectification in the GaAs{sub 0.9}P{sub 0.1}/GaAs{sub 0.6}P{sub 0.4} quantum dot is computed in the presence of electric and magnetic fields.

First International Diagnosis Competition - DXC'09

Science.gov (United States)

Kurtoglu, tolga; Narasimhan, Sriram; Poll, Scott; Garcia, David; Kuhn, Lukas; deKleer, Johan; vanGemund, Arjan; Feldman, Alexander

2009-01-01

A framework to compare and evaluate diagnosis algorithms (DAs) has been created jointly by NASA Ames Research Center and PARC. In this paper, we present the first concrete implementation of this framework as a competition called DXC 09. The goal of this competition was to evaluate and compare DAs in a common platform and to determine a winner based on diagnosis results. 12 DAs (model-based and otherwise) competed in this first year of the competition in 3 tracks that included industrial and synthetic systems. Specifically, the participants provided algorithms that communicated with the run-time architecture to receive scenario data and return diagnostic results. These algorithms were run on extended scenario data sets (different from sample set) to compute a set of pre-defined metrics. A ranking scheme based on weighted metrics was used to declare winners. This paper presents the systems used in DXC 09, description of faults and data sets, a listing of participating DAs, the metrics and results computed from running the DAs, and a superficial analysis of the results.

Influenza sentinel surveillance network: a public health-primary care collaborative action to assess influenza A(H1N1)pmd09 in Catalonia, Spain.

Science.gov (United States)

Torner, Nuria; Baricot, Maretva; Martínez, Ana; Toledo, Diana; Godoy, Pere; Dominguez, Ángela

2013-03-01

The aim of this study was to evaluate the outcome of a collaborative action between Public Health services and Primary Care in the context of a case-control study on effectiveness of pharmaceutical and non-pharmaceutical measures to prevent hospitalization in a pandemic situation. To carry out this research the collaborative action of the primary care physicians members of the Influenza surveillance network was needed, they had to recall clinical information from influenza A(H1N1)pmd09 confirmed outpatient cases and negative outpatient controls matching their corresponding hospitalized confirmed case.   A survey questionnaire to assess involvement of Influenza Sentinel Surveillance Primary care physicians' Network of Catalonia (PIDIRAC) regarding the outpatient case and control outreach during the pandemic influenza season was performed. A total of 71,1% of completed surveys were received. Perception of pandemic activity was considered to be similar to seasonal influenza activity in 43.8% or higher but not unbearable in 37.5% of the replies. There was no nuisance reported from patients regarding neither the questions nor the surveyor. Collaborative research between Public Health services and Primary Care physicians enhances Public Health actions and research.

Barcelona - Talent Latent 09 / Ahto Sooaru

Index Scriptorium Estoniae

Sooaru, Ahto

2010-01-01

Fotonäitusest "Talent Latent 09" Barcelonas Arts Santa Monica kunstikeskuses. Loetletud näitusel eksponeeritud fotode autorid. Pikemalt Rafael Milach'i (sünd. 1978), Lucia Ganieva, Javier Marquerie Thomas'i (sünd. 1986), Amaury da Cunha (sünd. 1976) töödest. Lühidalt ka teistest näitustest Arts Santa Monica kunstikeskuses

Disposal of decontaminated salts at the Savannah River Plant by solidification and burial

International Nuclear Information System (INIS)

Dukes, M.D.; Wolf, H.C.; Langton, C.A.

1983-01-01

The current plan for disposal of waste salt at the Savannah River Plant (SRP) is to immobilize the decontaminated salt solution by mixing with cement and SRP soil, and bury the resulting grout (saltstone) in a landfill. The grout which contains 37.8 wt % salt solution, 22.8 wt % Portland I-P cement, and 39.2 wt % SRP soil, was specially formulated to have a low permeability ( -10 cm/sec). This material will be mixed and placed in trenches. After setting, the saltstone will be covered with a clay cap, and an overburden of compacted native soil will be replaced. 6 references

Magnetic and Moessbauer study of Mg{sub 0.9}Mn{sub 0.1}Cr{sub x}Fe{sub 2-x}O{sub 4} ferrites

Energy Technology Data Exchange (ETDEWEB)

Elzain, M., E-mail: elzain@squ.edu.om; Widatallah, H.; Gismelseed, A.; Bouziane, K.; Yousif, A.; Al Rawas, A.; Al-Omari, I.; Sellai, A. [Sultan Qaboos University, Department of Physics, College of Science (Oman)

2006-02-15

The ferrites Mg{sub 0.9}Mn{sub 0.1}Cr{sub x}Fe{sub 2-x}O{sub 4} (0x0.9) were prepared using the conventional double sintering method. The XRD showed that the samples maintain a single spinel cubic phase. The Moessbauer measurements were carried out at room and liquid nitrogen temperatures. From the area ratios of the A and B sites, it was found that the Fe cation population of the A and B sites decreases in proportion to Cr concentration. The contact hyperfine fields at the A and B sites were found to decrease with increasing Cr contents. This was found to be in approximate agreement with the results of magnetization measurement. The distributions of Mg and Mn cations versus Cr concentration were also determined using the Moessbauer and magnetization results. The Curie temperatures were determined and found to agree with the reported values. As the Cr contents increases the relative magnetization, was found to increase at low temperatures and decreases at higher temperatures.

Influence of porosity on densification and grain growth kinetics of Ce_0.9Gd_0.1O_1.95 tape

DEFF Research Database (Denmark)

Ni, De Wei; Esposito, Vincenzo; Foghmoes, Søren Preben Vagn

porous layer allowing gas flow is necessary in catalytic and in gas purification devices. During the sintering with shrinkage, the total solid volume is maintained to be a constant value but the shape and size of each particle change with the formation of grain boundaries. This change in solid particles...... is accompanied by the change of shape, size and fraction of pores in a given volume. Therefore, porosity can be treated as an extra phase during sintering study. In this work, we presented the densification and grain growth behaviour of Ce0.9Gd0.1O1.95 tape cast layers with different percentage of porosity....... The emphasis was put on the effect of porosity on densification and grain growth kinetics. Derived from the sintering constitutive laws, the densification and grain growth kinetics were experimentally characterized and analyzed. Furthermore, the activation energies for viscous flow were determined from master...

Multifold polar states in Zn-doped Sr0.9Ba0.1TiO3 ceramics

Science.gov (United States)

Guo, Yan-Yan; Guo, Yun-Jun; Wei, Tong; Liu, Jun-Ming

2015-12-01

We investigate the effect of Zn doping on the dielectricity and ferroelectricity of a series of polycrystalline Sr0.9-xZnxBa0.1TiO3 (0.0% ≤ x ≤ 5.0%) ceramics. It is surprisingly observed that the Zn doping will produce the multifold polar states, i.e., the Zn-doped ceramic will convert a reduced polar state into an enhanced polar state, and eventually into a stabilized polar state with increasing the doping level x. It is revealed that in the background of quantum fluctuations, the competition between the Zn-doping-induced lattice contraction and the Ba-doping-induced lattice expansion is responsible for both the reduced polar state and the enhanced polar state coming into being. Also, the addition of the antiferrodistortive effect, which is the antipolar interaction originating from the opposite tilted-TiO6 octahedra rotation, represents the core physics behind the stabilized polar state. Project supported by the National Natural Science Foundation of China (Grant Nos. 11304158, 51431006, 51102277, and 11104118), the Scientific Research Foundation of Nanjing University of Posts and Telecommunications, China (Grant No. NY213020), and the Qing Lan Project of Jiangsu Province, China.

Effect of A-site deficiency in LaMn{sub 0.9}Co{sub 0.1}O{sub 3} perovskites on their catalytic performance for soot combustion

Energy Technology Data Exchange (ETDEWEB)

Dinamarca, Robinson [Department of Physical Chemistry, Faculty of Chemical Sciences, University of Concepción, Concepción (Chile); Garcia, Ximena; Jimenez, Romel [Department of Chemical Engineering, Faculty of Engineering, University of Concepción, Concepción (Chile); Fierro, J.L.G. [Instituto de Catálisis y Petroleoquímica, CSIC, Cantoblanco, 28049 Madrid (Spain); Pecchi, Gina, E-mail: gpecchi@udec.cl [Department of Physical Chemistry, Faculty of Chemical Sciences, University of Concepción, Concepción (Chile)

2016-09-15

Highlights: • A-site defective perovskites increases the oxidation state of the B-cation. • Not always non-stoichiometric perovskites exhibit higher catalytic activity in soot combustion. • The highly symmetric cubic crystalline structure diminishes the redox properties of perovskites. - Abstract: The influence of lanthanum stoichiometry in Ag-doped (La{sub 1-x}Ag{sub x}Mn{sub 0.9}Co{sub 0.1}O{sub 3}) and A-site deficient (La{sub 1-x}Mn{sub 0.9}Co{sub 0.1}O{sub 3-δ}) perovskites with x equal to 10, 20 and 30 at.% has been investigated in catalysts for soot combustion. The catalysts were prepared by the amorphous citrate method and characterized by XRD, nitrogen adsorption, XPS, O{sub 2}-TPD and TPR. The formation of a rhombohedral excess-oxygen perovskite for Ag-doped and a cubic perovskite structure for an A-site deficient series is confirmed. The efficient catalytic performance of the larger Ag-doped perovskite structure is attributed to the rhombohedral crystalline structure, Ag{sub 2}O segregated phases and the redox pair Mn{sup 4+}/Mn{sup 3+}. A poor catalytic activity for soot combustion was observed with A-site deficient perovskites, despite the increase in the redox pair Mn{sup 4+}/Mn{sup 3+}, which is attributed to the cubic crystalline structure.

Üldohtlik viis, kahe või enama isiku tapmine ja omakasu motiiv kui mõrva tunnused. Riigikohtu kriminaalkolleegiumi otsus asjas 3-1-1-36-09 / Elina Elkind

Index Scriptorium Estoniae

Elkind, Elina, 1982-

2009-01-01

Riigikohtu lahendist 3-1-1-36-09: Nikolai Galkovski kaitsja vandeadvokaat Anatoli Jaroslavski, Andrei Grišini kaitsja vandeadvokaat Leonid Olovjanišnikovi, Aleksandr Semjonovi kaitsja vandeadvokaat Oleg Nišajevi ja Dmitri Štšerbakovi kaitsja vandeadvokaat Toomas Alpi kassatsioonid Tallinna Ringkonnakohtu 24. novembri 2008. a kohtuotsuse peale kriminaalasjas Andrei Grišini süüdistuses KarS § 114 p-de 2, 3 ja 5 ja § 22 lg-te 2 ja 3, Dmitri Štšerbakovi süüdistuses KarS § 114 p-de 2, 3 ja 5, Aleksandr Semjonovi süüdistuses KarS § 114 p-de 2, 3 ja 5 ning Nikolai Galkovski süüdistuses KarS § 257, § 114 p-de 2, 3 ja 5 ja § 22 lg 3 järgi

Oxygen Exchange and Transport in (La0.6Sr0.4)0.98FeO3-d – Ce0.9Gd0.1O1.95 Dual-Phase Composites

DEFF Research Database (Denmark)

Ovtar, Simona; Søgaard, Martin; Norrman, Kion

2018-01-01

The chemical diffusion coefficient and the effective surface exchange coefficient (kex) of dual-phase (La0.6Sr0.4)0.98FeO3-d (LSF) − Ce0.9Gd0.1O1.95 (CGO) composites containing between 30 and 70 vol.% of CGO were determined by electrical conductivity relaxation (ECR) at high oxygen partial...... pressures (10−3 .../s for a 70 vol.% of CGO in the composite at 750°C for a pO2 change from 0.2 to 1.0 atm. The experiments demonstrate that the kex is enhanced due to a synergistic effect between the two phases, and suggest a direct involvement of CGO phase in the oxygen surface exchange reaction. Possible mechanisms...

Study of the Polarization Behavior of Ce_0.9Gd_0.1O_2-δ Single Crystals below 350°C to Room Temperature

DEFF Research Database (Denmark)

Neuhaus, K.; Bernemann, M.; Hansen, Karin Vels

2016-01-01

was investigated by mapping the introduced defect gradient and its decay with time using Kelvin probe force microscopy. The generated surface potential gradients were found to have a diameter of up to 1 μm, which is explained by the local ionization of defect associates by the applied high electric field......Single crystalline ceria samples with the composition Ce0.9Gd0.1O2-δ were pre-polarized with ±5 V for up to 300 s using a Pt coated AFM tip as working electrode. The direct contact zone had a diameter of potential of the samples....... Measurements were performed at room temperature and 50°C. The polarization behavior of the Ce0.9Gd0.1O2-δ single crystals was compared to cyclovoltammetry and polarization-relaxation experiments at T ≤ 350°C and in dry air or nitrogen which were performed using a specially suited AFM (Controlled Atmosphere...

Observation of an hexatic vortex glass in flux lattices of the high-Tc superconductor Bi2.1Sr1.9Ca0.9Cu2O8+δ

International Nuclear Information System (INIS)

Bishop, D.J.; Gammel, P.L.; Murray, C.A.; Mitzi, D.B.; Kapitulnik, A.

1991-01-01

We report observation of hexatic order in Abrikosov flus lattices in very clean crystals of the high-Tc superconductor Bi 2.1 Sr 1.9 Ca 0.9 Cu 2 O 8+δ (BSCCO). Our experiments consist of in situ magnetic decoration of the flux lattice at 4.2 K. Analysis of the decoration images shows that the positional order decays exponentially with a correlation length of a few lattice constants while the orientational order persists for hundreds of lattice constants and decays algebraically with an exponent η 6 =0.6±0.01. Our results confirm recent theoretical speculation that the positional order should be far more sensitive to disorder than the orientational order and that the low-temperature ordered phase of the flux lines in these systems might be an hexatic glass. (orig.)

Observation of an hexatic vortex glass in flux lattices of the high Tc superconductor Bi2.1Sr1.9Ca0.9Cu2O8+δ

International Nuclear Information System (INIS)

Bishop, D.J.; Gammel, P.L.; Murray, C.A.; Mitzi, D.B.; Kapitulnik, A.

1990-01-01

We report observation of hexatic order in Abrikosov flux lattices in very clean crystals of the high T c superconductor Bi 2.1 Sr 1.9 Ca 0.9 Cu 2 O 8+δ (BSCCO). Our experiments consist of in situ magnetic decoration of the flux lattice at 4.2 K. Analysis of the decoration images shows that the positional order decays exponentially with a correlation length of a few lattice constants while the orientational order persists for hundreds of lattice constants and decays algebraically with an exponent η 6 =0.06±0.01. Our results confirm recent theoretical speculation that the positional order should be far more sensitive to disorder than the orientational order and that the low temperature ordered phase of the flux lines in these systems might be an hexatic glass

Observation of a hexatic vortex glass in flux lattices of the high-Tc superconductor Bi2.1Sr1.9Ca0.9Cu2O8+δ

International Nuclear Information System (INIS)

Murray, C.A.; Gammel, P.L.; Bishop, D.J.; Mitzi, D.B.; Kapitulnik, A.

1990-01-01

We report observation of hexatic order in Abrikosov flux lattices in very clean crystals of the high-T c superconductor Bi 2.1 Sr 1.9 Ca 0.9 Cu 2 O 8+δ . Our experiments consist of in situ magnetic decoration of the flux lattice at 4.2 K. Analysis of the decoration images shows that the positional order decays exponentially with a correlation length of a few lattice constants while the orientational order persists for hundreds of lattice constants and decays algebraically with an exponent η 6 =0.06±0.01. Our results confirm recent theoretical speculation that the positional order should be far more sensitive to disorder than the orientational order and that the low-temperature ordered phase of the flux lines in these systems might be a hexatic glass

Observation of a hexatic vortex glass in flux lattices of the High-Tc superconductor Bi(2.1)Sr(1.9)Ca(0.9)Cu2O(8 + delta)

Science.gov (United States)

Murray, C. A.; Gammel, P. L.; Bishop, D. J.; Mitzi, D. B.; Kapitulnik, A.

1990-05-01

Hexatic order is observed in Abrikosov flux lattices in very clean crystals of the high-Tc superconductor Bi(2.1)Sr(1.9)Ca(0.9)Cu2O(8 + delta) by in situ magnetic decoration of the flux lattice at 4.2 K. Analysis of the decoration images shows that the positional order decays exponentially with a correlation length of a few lattice constants, while the orientational order persists for hundreds of lattice constants and decays algebraically with an exponent eta6 = 0.06 + or - 0.01. These results confirm recent theoretical speculation that the positional order should be far more sensitive to disorder than the orientational order, and that the low-temperature ordered phase of the flux lines in these systems might be a hexatic glass.

Observation of an hexatic vortex glass in flux lattices of the high- Tc superconductor Bi 2.1Sr 1.9Ca 0.9Cu 2O 8+δ

Science.gov (United States)

Bishop, D. J.; Gammel, P. L.; Murray, C. A.; Mitzi, D. B.; Kapitulnik, A.

1991-02-01

We report observation of hexatic order in Abrikosov flux lattices in very clean crystals of the high- Tc superconductor Bi 2.1Sr 1.9Ca 0.9Cu 2O 8+δ (BSCCO). Our experiments consist of in situ magnetic decoration of the flux lattice at 4.2 K. Analysis of the decoration images shows that the positional order decays exponentially with a correlation length of a few lattice constants while the orientational order persists for hundreds of lattice constants and decays algebraically with an exponent η 6 = 0.6 ± 0.01. Our results confirm recent theoretical speculation that the positional order should be far more sensitive to disorder than the orientational order and that the low-temperature ordered phase of the flux lines in these systems might be an hexatic glass.

Observation of an hexatic vortex glass in flux lattices of the high Tc superconductor Bi2.1Sr1.9Ca0.9Cu2O8+δ

Science.gov (United States)

Bishop, D. J.; Gammel, P. L.; Murray, C. A.; Mitzi, D. B.; Kapitulnik, A.

1990-10-01

We report observation of hexatic order in Abrikosov flux lattices in very clean crystals of the high Tc superconductor Bi2.1Sr1.9Ca0.9Cu2O8+δ (BSCCO). Our experiments consist of in situ magnetic decoration of the flux lattice at 4.2 K. Analysis of the decoration images shows that the positional order decays exponentially with a correlation length of a few lattice constants while the orientational order persists for hundreds of lattice constants and decays algebraically with an exponent η6=0.06±0.01. Our results confirm recent theoretical speculation that the positional order should be far more sensitive to disorder than the orientational order and that the low temperature ordered phase of the flux lines in these systems might be an hexatic glass.

Characterization of the perovskite La0,9Sr0,1Ga0,2O2,85 prepared by cation complexation

International Nuclear Information System (INIS)

Reis, S.L.; Grosso, R.L.; Muccillo, E.N.S.

2012-01-01

Strontium and magnesium doped lanthanum gallate exhibits perovskite-type structure and high ionic conductivity. Other features of this ceramic material are large electrolytic regime and negligible electronic conductivity. These characteristics are responsible for the potential use of this solid electrolyte in solid oxide fuel cells operating at intermediate temperatures (~∼500-700 deg C). In this work, the composition La 0.9 Sr 0.1 Ga 0.8 Mg 0.2 O 2.85 was prepared by the cation complexation technique aiming to obtain powder and sintered specimens with good chemical and structural homogeneities. X-ray diffraction results evidence that single phase was obtained, within the limitations of the technique, in samples sintered at 1350 deg C/4 h, with relative density above 92%. (author)

Pretreatment of Tc-Containing Waste and Its Effect on Tc-99 Leaching From Grouts

International Nuclear Information System (INIS)

Aloy, Albert; Kovarskaya, Elena N.; Harbour, John R.; Langton, Christine A.; Holtzscheiter, E. William

2007-01-01

A salt solution (doped with Tc-99), that simulates the salt waste stream to be processed at the Saltstone Production Facility, was immobilized in grout waste forms with and without (1) ground granulated blast furnace slag and (2) pretreatment with iron salts. The degree of immobilization of Tc-99 was measured through monolithic and crushed grout leaching tests. Although Fe (+2) was shown to be effective in reducing Tc-99 to the +4 state, the strong reducing nature of the blast furnace slag present in the grout formulation dominated the reduction of Tc-99 in the cured grouts. An effective diffusion coefficient of 4.75 x 10 -12 (Leach Index of 11.4) was measured using the ANSI/ANS-16.1 protocol. The leaching results show that, even in the presence of a concentrated salt solution, blast furnace slag can effectively reduce pertechnetate to the immobile +4 oxidation state. The measured diffusivity was introduced into a flow and transport model (PORFLOW) to calculate the release of Tc-99 from a Saltstone Vault as a function of hydraulic conductivity of the matrix. (authors)

Regulation of gene expression in Streptococcus pneumoniae by response regulator 09 is strain dependent

NARCIS (Netherlands)

W.T. Hendriksen (Wouter); N. Silva (Nuno); H.J. Bootsma (Hester); C.E. Blue (Clare); G.K. Paterson (Gavin); A.R. Kerr (Alison); A.S. de Jong (Arjan); O.P. Kuipers (Oscar); P.W.M. Hermans (Peter); T.J. Mitchell

2007-01-01

textabstractRecent murine studies have demonstrated that the role of response regulator 09 (RR09) of Streptococcus pneumoniae in virulence is different in different strains. In the present study, we used a murine pneumonia model of infection to assess the virulence of a TIGR4 rr09 mutant, and we

Regulation of gene expression in Streptococcus pneumoniae by response regulator 09 is strain dependent

NARCIS (Netherlands)

Hendriksen, Wouter T.; Silva, Nuno; Bootsma, Hester J.; Blue, Clare E.; Paterson, Gavin K.; Kerr, Alison R.; de Jong, Anne; Kuipers, Oscar P.; Hermans, Peter W. M.; Mitchell, Tim J.

Recent murine studies have demonstrated that the role of response regulator 09 (RR09) of Streptococcus pneumoniae in virulence is different in different strains. In the present study, we used a murine pneumonia model of infection to assess the virulence of a TIGR4 rr09 mutant, and we found that

Perovskite SrCo0.9 Nb0.1 O3-δ as an Anion-Intercalated Electrode Material for Supercapacitors with Ultrahigh Volumetric Energy Density.

Science.gov (United States)

Zhu, Liang; Liu, Yu; Su, Chao; Zhou, Wei; Liu, Meilin; Shao, Zongping

2016-08-08

We have synthesized and characterized perovskite-type SrCo0.9 Nb0.1 O3-δ (SCN) as a novel anion-intercalated electrode material for supercapacitors in an aqueous KOH electrolyte, demonstrating a very high volumetric capacitance of about 2034.6 F cm(-3) (and gravimetric capacitance of ca. 773.6 F g(-1) ) at a current density of 0.5 A g(-1) while maintaining excellent cycling stability with a capacity retention of 95.7 % after 3000 cycles. When coupled with an activated carbon (AC) electrode, the SCN/AC asymmetric supercapacitor delivered a specific energy density as high as 37.6 Wh kg(-1) with robust long-term stability. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Reproductive number and serial interval of the first wave of influenza A(H1N1pdm09 virus in South Africa.

Directory of Open Access Journals (Sweden)

Brett N Archer

Full Text Available Describing transmissibility parameters of past pandemics from diverse geographic sites remains critical to planning responses to future outbreaks. We characterize the transmissibility of influenza A(H1N1pdm09 (hereafter pH1N1 in South Africa during 2009 by estimating the serial interval (SI, the initial effective reproductive number (initial R(t and the temporal variation of R(t.We make use of data from a central registry of all pH1N1 laboratory-confirmed cases detected throughout South Africa. Whenever date of symptom onset is missing, we estimate it from the date of specimen collection using a multiple imputation approach repeated 100 times for each missing value. We apply a likelihood-based method (method 1 for simultaneous estimation of initial R(t and the SI; estimate initial R(t from SI distributions established from prior field studies (method 2; and the Wallinga and Teunis method (method 3 to model the temporal variation of R(t.12,360 confirmed pH1N1 cases were reported in the central registry. During the period of exponential growth of the epidemic (June 21 to August 3, 2009, we simultaneously estimate a mean R(t of 1.47 (95% CI: 1.30-1.72 and mean SI of 2.78 days (95% CI: 1.80-3.75 (method 1. Field studies found a mean SI of 2.3 days between primary cases and laboratory-confirmed secondary cases, and 2.7 days when considering both suspected and confirmed secondary cases. Incorporating the SI estimate from field studies using laboratory-confirmed cases, we found an initial R(t of 1.43 (95% CI: 1.38-1.49 (method 2. The mean R(t peaked at 2.91 (95% CI: 0.85-2.91 on June 21, as the epidemic commenced, and R(t>1 was sustained until August 22 (method 3.Transmissibility characteristics of pH1N1 in South Africa are similar to estimates reported by countries outside of Africa. Estimations using the likelihood-based method are in agreement with field findings.

Bacillus velezensis CC09: A Potential 'Vaccine' for Controlling Wheat Diseases.

Science.gov (United States)

Kang, Xingxing; Zhang, Wanling; Cai, Xunchao; Zhu, Tong; Xue, Yarong; Liu, Changhong

2018-04-11

Biocontrol bacteria that can act like a "vaccine", stimulating plant resistance to pathogenic diseases, are still not fully elucidated. In this study, an endophytic bacterium, Bacillus velezensis CC09, labeled with green fluorescent protein, was tested for its colonization, migration, and expression of genes encoding iturin A synthetase within wheat tissues and organs as well as for protective effects against wheat take-all and spot blotch diseases. The results showed that strain CC09 not only formed biofilm on the root surface but was also widely distributed in almost every tissue, including the epidermis, cortex, and xylem vessels, and even migrated to stems and leaves, resulting in 66.67% disease-control efficacy (DCE) of take-all and 21.64% DCE of spot blotch. Moreover, the gene cluster encoding iturin A synthase under the control of the p itu promoter is expressed in B. velezensis CC09 in wheat tissues, which indicates that iturin A might contribute to the in-vivo antifungal activity and leads to the disease control. All these data suggested that strain CC09 can act like a 'vaccine' in the control of wheat diseases, with a single treatment inoculated on roots through multiple mechanisms.

Aespoe Hard Rock Laboratory. BIPS logging in borehole KAS09

Energy Technology Data Exchange (ETDEWEB)

Gustafsson, Jaana; Gustafsson, Christer (Malaa Geoscience AB (Sweden))

2010-01-15

This report includes the data gained in BIPS logging performed at the Aespoe Hard Rock Laboratory. The logging operation presented here includes BIPS logging in the core drilled borehole KAS09. The objective for the BIPS logging was to observe the condition of KAS09 in order to restore the borehole in the hydrogeological monitoring programme.All measurements were conducted by Malaa Geoscience AB on October 9th 2009. The objective of the BIPS logging is to achieve information of the borehole including occurrence of rock types as well as determination of fracture distribution and orientation. This report describes the equipment used as well as the measurement procedures and data gained. For the BIPS survey, the result is presented as images. The basic conditions of the BIPS logging for geological mapping and orientation of structures are satisfying for borehole KAS09, although induced affects from the drilling on the borehole walls limit the visibility

Aespoe Hard Rock Laboratory. BIPS logging in borehole KAS09

International Nuclear Information System (INIS)

Gustafsson, Jaana; Gustafsson, Christer

2010-01-01

This report includes the data gained in BIPS logging performed at the Aespoe Hard Rock Laboratory. The logging operation presented here includes BIPS logging in the core drilled borehole KAS09. The objective for the BIPS logging was to observe the condition of KAS09 in order to restore the borehole in the hydrogeological monitoring programme.All measurements were conducted by Malaa Geoscience AB on October 9th 2009. The objective of the BIPS logging is to achieve information of the borehole including occurrence of rock types as well as determination of fracture distribution and orientation. This report describes the equipment used as well as the measurement procedures and data gained. For the BIPS survey, the result is presented as images. The basic conditions of the BIPS logging for geological mapping and orientation of structures are satisfying for borehole KAS09, although induced affects from the drilling on the borehole walls limit the visibility

The European I-MOVE Multicentre 2013-2014 Case-Control Study. Homogeneous moderate influenza vaccine effectiveness against A(H1N1)pdm09 and heterogenous results by country against A(H3N2).

LENUS (Irish Health Repository)

Valenciano, Marta

2015-06-04

In the first five I-MOVE (Influenza Monitoring Vaccine Effectiveness in Europe) influenza seasons vaccine effectiveness (VE) results were relatively homogenous among participating study sites. In 2013-2014, we undertook a multicentre case-control study based on sentinel practitioner surveillance networks in six European Union (EU) countries to measure 2013-2014 influenza VE against medically-attended influenza-like illness (ILI) laboratory-confirmed as influenza. Influenza A(H3N2) and A(H1N1)pdm09 viruses co-circulated during the season.

In-situ stabilization of the Geiger (C and M Oil) Superfund Site

International Nuclear Information System (INIS)

Andromalos, K.B.; Ameel, M.E.

1994-01-01

The Geiger (C and M Oil) Superfund Site is the first US Army Corps of Engineers managed soil remediation project which utilized the in-situ stabilization/solidification technique to remediate the soil. This project involved the remediation of approximately 23,000 cubic yards of contaminated soil. Contaminants of concern included chromium, lead, PCB'S, toluene, benzene, and other organic compounds. Clean-up criteria for the stabilized material was equal to the National Primary Drinking Water Regulations, when tested using the TCLP leachate extraction method. Chromium, lead, and toluene were the main contaminants of concern, with TCLP clean-up goals of 150, 15 and 1,000 parts per billion (ppb), respectively. This National Priorities List (NPL) site is located near Charleston, SC and was an abandoned old waste oil facility that utilized unlined shallow trenches for the storage of waste oil. This paper summarizes the initial testing programs and the final production work at the site. Extensive testing was performed throughout all phases of the project. This testing was performed for the purpose of mix optimization, quality assurance, and verification testing. Specific parameters tested included: TCLP testing of organics, metals and PCBs, permeability testing, and unconfirmed compression strength

Influence of Cd-content on structural and optical dispersion characteristics of nanocrystalline Zn1−xCdxS (0 ⩽ x ⩽ 0.9) films

International Nuclear Information System (INIS)

Farag, A.A.M.; Abdel Rafea, M.; Roushdy, N.; El-Shazly, O.; El-Wahidy, E.F.

2015-01-01

Highlights: • Highly uniform and good adhesion of nanocrystalline Zn 1−x Cd x S films were synthesized. • Small magnitude of optical electronegativity was calculated. • Third-order nonlinear optical susceptibility and molar polarizability were considered. - Abstract: Low cost dip coating technique was successfully used to deposit highly uniform and good adhesive nanocrystalline Zn 1−x Cd x S (0 ⩽ x ⩽ 0.9) thin films. The surface morphology and crystalline structural characteristics of Zn 1−x Cd x S were achieved by using atomic force microscopy (AFM) and transmission electron microscopy (TEM), respectively. Transmission spectra show red shifting of absorption edge as the Cd content increased. The optical constants were accurately determined by using reflectance and transmittance spectra. The effect of Cd-content on refractive index, extinction index and other optical dispersion parameters were also investigated. The dispersion of the refractive index was discussed in terms of single oscillator model. In addition, the ratio of free carrier concentration to its effective mass was estimated. The calculated value of oscillator energy E o obeys the empirical relation (E o ≈ 2 E g ), obtained from single oscillator model. Small magnitude of optical electronegativity (χ ∗ ) for Zn 1−x Cd x S (0 ⩽ x ⩽ 0.9) thin films and relatively high refractive index can be attributed to covalent nature, in agreement with β value, obtained from dispersion energy analysis. Moreover, molar polarizability and third-order nonlinear optical susceptibility were also considered

Leachability characteristics of beryllium in redmud waste and its stabilization in cement

International Nuclear Information System (INIS)

Saradhi, I.V.; Mahadevan, T.N.; Krishnamoorthy, T.M.

1999-01-01

More than 70% of the beryl ore processed by the Beryllium Metal Plant at the BARC Vashi Complex ends up as redmud waste. The presence of significant quantities (0.4 to 0.8%) of beryllium in the redmud qualifies it as hazardous requiring safe handling, storage and disposal. The waste also contains 0.09% of water soluble fluoride. The various standard protocol of procedures were employed to estimate the leachability of beryllium from redmud for both short term and long term periods. Nearly 50% of beryllium present in redmud is leachable in water. We have tried the stabilization of redmud using portland cement. The proportion of redmud to cement was in the ratio of 1:1, 1:2 and 1:4. The blocks were cast, cured and used in the leachability experiments using standard protocols as above. The results of the TCLP test gave the levels of beryllium well below the standard limits in the TCLP extract of cement stabilized waste indicating the suitability of stabilization of redmud with cement whereas that of raw waste (redmud) are much higher than the prescribed limits. The total leach percent of beryllium in 1:2 block is 0.05% over period of 164 days whereas 1:1 and 1:4 gave a leach percent of 0.26 and 0.15% respectively. The DLT results indicate, diffusion controlled release of beryllium from the cement stabilized redmud blocks. The effective diffusion coefficient of beryllium obtained from the modelling study is 10 orders of magnitude less than the molecular diffusion coefficient of beryllium indicating the effectiveness of cement stabilization. From the detailed experiments performed, it is felt that 1:2 proportion of redmud and cement will be the best suited option for stabilization of redmud waste. The 1:1 proportion of redmud to cement mixture which could not be cast into compact cement blocks also exhibited very low leachability characteristics similar to 1:2 and 1:4 and can be be favourably considered for stabilization in case of space constraints at storage sites. The

Annual North Dakota Elevator Marketing Report, 2008-09

Science.gov (United States)

2009-12-01

The Annual North Dakota Elevator Marketing Report for 2008-09 was prepared by Kimberly Vachal and Laurel Benson, : Upper Great Plains Transportation Institute. The authors gratefully acknowledge the assistance of the North Dakota : Grain Dealers Asso...

Stability of polymyxin B sulfate diluted in 0.9% sodium chloride injection and stored at 4 or 25 degrees C.

Science.gov (United States)

He, Jie; Figueroa, Deborah A; Lim, Tze-Peng; Chow, Diana S; Tam, Vincent H

2010-07-15

The stability of polymyxin B sulfate in infusion bags containing 0.9% sodium chloride injection stored at 4 and 25 degrees C was studied. Seven manufacturing batches of polymyxin B from different sources were tested. The products were reconstituted in sterile water for injection, diluted in infusion bags containing 0.9% sodium chloride injection, and stored at room temperature (25 degrees C) or under refrigeration (4 degrees C). Samples were withdrawn at the same time on days 0, 1, 2, 3, 5, and 7. A modified microbiological assay was used to determine the concentrations, as indicated by zones of inhibition, of polymyxin B. Bordetella bronchiseptica served as the reference organism. Stability was defined as retention of >90% of the initial concentration. The decomposition kinetics of polymyxin B in 0.9% sodium chloride injection were evaluated by plotting the polymyxin B concentration remaining versus time. On average, the samples retained over 90% of their initial concentration for up to two days at both storage temperatures. All samples retained over 90% of their initial concentration at 24 hours. The decomposition kinetics of polymyxin B in infusion bags containing 0.9% sodium chloride injection exhibited pseudo-first-order kinetics, with rate constants of 0.024-0.075 day(-1) at 25 degrees C and 0.022-0.043 day(-1) at 4 degrees C (p > 0.05). Polymyxin B was stable for at least one day when stored at 4 or 25 degrees C in infusion bags containing 0.9% sodium chloride injection. Stability did not differ significantly between the two storage temperatures.

Profile of yttrium segregation in BaCe0,9Y0,1O3-δ as function of sintering temperature

International Nuclear Information System (INIS)

Hosken, C.M.; Souza, D.P.F. de

2010-01-01

Researches on solid oxide fuel cells indicate barium cerate perovskite as a very attractive material for using as electrolyte due to its high protonic conductivity. The objective of this work is investigate the yttrium segregation during sintering of BaCe 0,9 Y 0,1 O 3-δ doped with Zn O as a sintering aid. The powders were prepared by citrate process. Powders were isostatic pressed into pellets and sintered in air at 1200, 1275, 1325 and 1400 deg C. The samples were characterized by scanning electron microscopy, X-ray diffraction and impedance spectroscopy. Secondary phase containing Yttrium and Cerium was detected as sintering temperature increased. Increase of the lattice parameter and activation energy for electrical conductivity were also detected on samples sintered at 1400 deg C. (author)

iWork '09 The Missing Manual

CERN Document Server

Clark, Josh

2009-01-01

With iWork '09: The Missing Manual, you'll quickly learn everything you need to know about Apple's incredible productivity programs, including the Pages word-processor, the Numbers spreadsheet, and the Keynote presentation program that Al Gore and Steve Jobs made famous. This book gives you crystal-clear and jargon-free explanations of iWork's capabilities, advantages, and limitations to help you produce stunning documents and cinema-quality digital presentations in no time.

Biochemical and Pharmacological Characterizations of ESI-09 Based EPAC Inhibitors: Defining the ESI-09 “Therapeutic Window”

OpenAIRE

Yingmin Zhu; Haijun Chen; Stephen Boulton; Fang Mei; Na Ye; Giuseppe Melacini; Jia Zhou; Xiaodong Cheng

2015-01-01

The cAMP signaling cascade is one of the most frequently targeted pathways for the development of pharmaceutics. A plethora of recent genetic and pharmacological studies suggest that exchange proteins directly activated by cAMP (EPACs) are implicated in multiple pathologies. Selective EPAC inhibitors have been recently developed. One specific inhibitor, ESI-09, has been shown to block EPAC activity and functions, as well as to recapitulate genetic phenotypes of EPAC knockout mice when applied...

Spatio-temporal Change Patterns of Tropical Forests from 2000 to 2014 Using MOD09A1 Dataset

Science.gov (United States)

Qin, Y.; Xiao, X.; Dong, J.

2016-12-01

Large-scale deforestation and forest degradation in the tropical region have resulted in extensive carbon emissions and biodiversity loss. However, restricted by the availability of good-quality observations, large uncertainty exists in mapping the spatial distribution of forests and their spatio-temporal changes. In this study, we proposed a pixel- and phenology-based algorithm to identify and map annual tropical forests from 2000 to 2014, using the 8-day, 500-m MOD09A1 (v005) product, under the support of Google cloud computing (Google Earth Engine). A temporal filter was applied to reduce the random noises and to identify the spatio-temporal changes of forests. We then built up a confusion matrix and assessed the accuracy of the annual forest maps based on the ground reference interpreted from high spatial resolution images in Google Earth. The resultant forest maps showed the consistent forest/non-forest, forest loss, and forest gain in the pan-tropical zone during 2000 - 2014. The proposed algorithm showed the potential for tropical forest mapping and the resultant forest maps are important for the estimation of carbon emission and biodiversity loss.

17 CFR 8.09 - Review of investigation report.

Science.gov (United States)

2010-04-01

... PROCEDURES FOR DISCIPLINARY, SUMMARY, AND MEMBERSHIP DENIAL ACTIONS Disciplinary Procedure § 8.09 Review of investigation report. The disciplinary committee shall promptly review each investigation report. In the event the disciplinary committee determines that additional investigation or evidence is needed, it shall...

Morphological and structural characterization of the Zn0,9Mn0,1O powder synthesized by combustion reaction and Pechini

International Nuclear Information System (INIS)

Ribeiro, M.A.; Torquato, R.; Simoes, A.N.; Costa, A.C.F.M.; Gama, L.; Kiminami, R.H.G.A.

2009-01-01

Zinc oxide, due to the piezoelectric and electro-optical characteristics, is used in application such as, chemical sensor, varistor, transparent conductive thin film and DMS. The aim of this work is to evaluate and compare structural and morphological characteristics of nanometric powders of Zn 0,9 Mn 0,1 O prepared by chemical synthesis of combustion reaction and Pechini method. The powders were characterized by XRD, SEM and BET. The XRD data shown to both studied method the presence of ZnO phase with hexagonal structure and without second phase. The powder prepared by combustion reaction presented 9% of reduction in crystallinity and 42% of increase in surface area in comparison with the powder prepared by Pechini method. The morphological analysis of the powder showed that both method produce powders with soft agglomerates constituted by nano size particles. (author)

Preparation of a Novel Ce0.9La0.1O2/Gd2Zr2O7 Buffer Layer Stack on NiW Alloy Substrates by the MOD Route

DEFF Research Database (Denmark)

Yue, Zhao; Grivel, Jean-Claude; Abrahamsen, Asger Bech

2011-01-01

An optimized buffer layer architecture prepared by a metal organic deposition method on biaxially textured metallic substrate is proposed and developed successfully. The major achievement of this work is to choose a ${\\rm Ce}_{0.9}{\\rm La}_{0.1}{\\rm O}_{2}$ layer as cap layer that possesses an ex...

Impedance and modulus spectroscopy characterization of Tb modified Bi{sub 0.8}A{sub 0.1}Pb{sub 0.1}Fe{sub 0.9}Ti{sub 0.1}O{sub 3} ceramics

Energy Technology Data Exchange (ETDEWEB)

Thakur, Shweta; Rai, Radheshyam, E-mail: rshyam1273@gmail.com [School of Physics, Shoolini University, Himachal Pradesh (India); Bdikin, Igor [Centre for Mechanical Technology and Automation (TEMA), University of Aveiro (Portugal); Valente, Manuel Almeida [Departamento de Fisica, Universidade de Aveiro (Portugal)

2016-01-15

In this paper we present the impedance spectroscopy of ternary solid solutions of BiFeO{sub 3} , TbFeO{sub 3} and PbTiO{sub 3} , prepared by solid-state reaction method. The preliminary structural studies were carried out by X-ray diffraction technique, showing the formation of polycrystalline sample with ABO{sub 3} type of perovskite structure with hexagonal symmetry for Bi{sub 0.8}Tb{sub 0.1}Pb{sub 0.1}Fe{sub 0.9}Ti{sub 0.1}O{sub 3} system at room temperature. Dielectric and impedance study of this ceramic has been characterized in the temperature range 175 - 325 deg C and frequency range 100 Hz - 1 MHz. The maximum ferroelectric transition temperature (T{sub c} ) of this system was in the range 210 - 225 deg C with the dielectric constant having maximum value ∼ 2480 at 1 kHz. The complex impedance graph exhibited one impedance semicircle arc at all reported temperatures, which indicates that the impedance response is a Cole-Cole type relaxation. Single semicircle indicate that the grain effect of the bulk in ceramic. The bulk resistance of the material decreases with increasing temperature showing negative temperature showing a typical semiconducting property, i.e. negative temperature coefficient of resistance (NTCR) behavior. (author)

Registration of ‘CP 09-1822’ Sugarcane

Science.gov (United States)

‘CP 09-1822’ (Reg. No. __; PI 686942 sugarcane (a complex hybrid of Saccharum spp.) was released in June 2016 for commercial cultivation on sand (mineral) soils in Florida. This cultivar was developed through a collaborative sugarcane cultivar development program of the USDA-ARS, the University of F...

Development of an accelerated leaching method for incineration bottom ash correlated to toxicity characteristic leaching protocol.

Science.gov (United States)

Lin, Shengxuan; Zhou, Xuedong; Ge, Liya; Ng, Sum Huan; Zhou, Xiaodong; Chang, Victor Wei-Chung

2016-10-01

Heavy metals and some metalloids are the most significant inorganic contaminants specified in toxicity characteristic leaching procedure (TCLP) in determining the safety of landfills or further utilization. As a consequence, a great deal of efforts had been made on the development of miniaturized analytical devices, such as Microchip Electrophoresis (ME) and μTAS for on-site testing of heavy metals and metalloids to prevent spreading of those pollutants or decrease the reutilization period of waste materials such as incineration bottom ash. However, the bottleneck lied in the long and tedious conventional TCLP that requires 18 h of leaching. Without accelerating the TCLP process, the on-site testing of the waste material leachates was impossible. In this study, therefore, a new accelerated leaching method (ALM) combining ultrasonic assisted leaching with tumbling was developed to reduce the total leaching time from 18 h to 30 min. After leaching, the concentrations of heavy metals and metalloids were determined with ICP-MS or ICP-optical emission spectroscopy. No statistical significance between ALM and TCLP was observed for most heavy metals (i.e., cobalt, manganese, mercury, molybdenum, nickel, silver, strontium, and tin) and metalloids (i.e., arsenic and selenium). For the heavy metals with statistical significance, correlation factors derived between ALM and TCLP were 0.56, 0.20, 0.037, and 0.019 for barium, cadmium, chromium, and lead, respectively. Combined with appropriate analytical techniques (e.g., ME), the ALM can be applied to rapidly prepare the incineration bottom ash samples as well as other environmental samples for on-site determination of heavy metals and metalloids. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Impact of natural and calcined starfish (Asterina pectinifera) on the stabilization of Pb, Zn and As in contaminated agricultural soil.

Science.gov (United States)

Lim, Jung Eun; Sung, Jwa Kyung; Sarkar, Binoy; Wang, Hailong; Hashimoto, Yohey; Tsang, Daniel C W; Ok, Yong Sik

2017-04-01

Metal stabilization using soil amendments is an extensively applied, economically viable and environmentally friendly remediation technique. The stabilization of Pb, Zn and As in contaminated soils was evaluated using natural starfish (NSF) and calcined starfish (CSF) wastes at different application rates (0, 2.5, 5.0 and 10.0 wt%). An incubation study was conducted over 14 months, and the efficiency of stabilization for Pb, Zn and As in soil was evaluated by the toxicity characteristic leaching procedure (TCLP) test. The TCLP-extractable Pb was reduced by 76.3-100 and 91.2-100 % in soil treated with NSF and CSF, respectively. The TCLP-extractable Zn was also reduced by 89.8-100 and 93.2-100 % in soil treated with NSF and CSF, respectively. These reductions could be associated with the increased metal adsorption and the formation of insoluble metal precipitates due to increased soil pH following application of the amendments. However, the TCLP-extractable As was increased in the soil treated with NSF, possibly due to the competitive adsorption of phosphorous. In contrast, the TCLP-extractable As in the 10 % CSF treatment was not detectable because insoluble Ca-As compounds might be formed at high pH values. Thermodynamic modeling by visual MINTEQ predicted the formation of ettringite (Ca 6 Al 2 (SO 4 ) 3 (OH) 12 ·26H 2 O) and portlandite (Ca(OH) 2 ) in the 10 % CSF-treated soil, while SEM-EDS analysis confirmed the needle-like structure of ettringite in which Pb was incorporated and stabilized in the 10 % CSF treatment.

Pressure effect on the transport properties of superconducting Li0.9MobO17bronze

International Nuclear Information System (INIS)

Filippini, C.E.; Boujida, M.; Marcus, J.; Schlenker, C.; Beille, J.

1989-01-01

The electrical resistivity of Li 0.9 Mo 6 O 17 single crystal has been studied between 1.5 K and 300 K under hydrostatic pressures up to 20 k bar. A large increase of the superconducting transition temperature, from 1.7 K to 2.5 K, is associated to a sharp decease of the temperature T m of the electronic, probably CDW instability

Morphological and structural characterization of the Zn{sub 0,9}Mn{sub 0,1}O powder synthesized by combustion reaction and Pechini; Caracterizacao estrutural e morfologica de pos de Zn{sub 0,9}Mn{sub 0,1}O sintetizados por reacao de combustao e metodo Pechini

Energy Technology Data Exchange (ETDEWEB)

Ribeiro, M A; Torquato, R; Simoes, A N; Costa, A C.F.M.; Gama, L [Universidade Federal de Campina Grande (DEMA/UFCG), PB (Brazil). Dept. de Engenharia dos Materiais; Kiminami, R H.G.A. [Universidade Federal de Sao Carlos (DEMA/UFSCar), SP (Brazil). Dept. de Engenharia de Materiais

2009-07-01

Zinc oxide, due to the piezoelectric and electro-optical characteristics, is used in application such as, chemical sensor, varistor, transparent conductive thin film and DMS. The aim of this work is to evaluate and compare structural and morphological characteristics of nanometric powders of Zn{sub 0,9}Mn{sub 0,1}O prepared by chemical synthesis of combustion reaction and Pechini method. The powders were characterized by XRD, SEM and BET. The XRD data shown to both studied method the presence of ZnO phase with hexagonal structure and without second phase. The powder prepared by combustion reaction presented 9% of reduction in crystallinity and 42% of increase in surface area in comparison with the powder prepared by Pechini method. The morphological analysis of the powder showed that both method produce powders with soft agglomerates constituted by nano size particles. (author)