s-c-s-c dihedral angles: Topics by WorldWideScience.org

Sample records for s-c-s-c dihedral angles

CACA-TOCSY with alternate 13C-12C labeling: a 13Cα direct detection experiment for mainchain resonance assignment, dihedral angle information, and amino acid type identification

International Nuclear Information System (INIS)

Takeuchi, Koh; Frueh, Dominique P.; Sun, Zhen-Yu J.; Hiller, Sebastian; Wagner, Gerhard

2010-01-01

We present a 13 C direct detection CACA-TOCSY experiment for samples with alternate 13 C- 12 C labeling. It provides inter-residue correlations between 13 C α resonances of residue i and adjacent C α s at positions i - 1 and i + 1. Furthermore, longer mixing times yield correlations to C α nuclei separated by more than one residue. The experiment also provides C α -to-sidechain correlations, some amino acid type identifications and estimates for ψ dihedral angles. The power of the experiment derives from the alternate 13 C- 12 C labeling with [1,3- 13 C] glycerol or [2- 13 C] glycerol, which allows utilizing the small scalar 3 J CC couplings that are masked by strong 1 J CC couplings in uniformly 13 C labeled samples.
CACA-TOCSY with alternate 13C-12C labeling: a 13Calpha direct detection experiment for mainchain resonance assignment, dihedral angle information, and amino acid type identification.

Science.gov (United States)

Takeuchi, Koh; Frueh, Dominique P; Sun, Zhen-Yu J; Hiller, Sebastian; Wagner, Gerhard

2010-05-01

We present a (13)C direct detection CACA-TOCSY experiment for samples with alternate (13)C-(12)C labeling. It provides inter-residue correlations between (13)C(alpha) resonances of residue i and adjacent C(alpha)s at positions i - 1 and i + 1. Furthermore, longer mixing times yield correlations to C(alpha) nuclei separated by more than one residue. The experiment also provides C(alpha)-to-sidechain correlations, some amino acid type identifications and estimates for psi dihedral angles. The power of the experiment derives from the alternate (13)C-(12)C labeling with [1,3-(13)C] glycerol or [2-(13)C] glycerol, which allows utilizing the small scalar (3)J(CC) couplings that are masked by strong (1)J(CC) couplings in uniformly (13)C labeled samples.
CACA-TOCSY with alternate {sup 13}C-{sup 12}C labeling: a {sup 13}C{sup {alpha}} direct detection experiment for mainchain resonance assignment, dihedral angle information, and amino acid type identification

Energy Technology Data Exchange (ETDEWEB)

Takeuchi, Koh [National Institute of Advanced Industrial Science and Technology (AIST), Biomedicinal Information Research Center (BIRC) (Japan); Frueh, Dominique P.; Sun, Zhen-Yu J.; Hiller, Sebastian; Wagner, Gerhard, E-mail: gerhard_wagner@hms.harvard.ed [Harvard Medical School, Department of Biological Chemistry and Molecular Pharmacology (United States)

2010-05-15

We present a {sup 13}C direct detection CACA-TOCSY experiment for samples with alternate {sup 13}C-{sup 12}C labeling. It provides inter-residue correlations between {sup 13}C{sup {alpha}} resonances of residue i and adjacent C{sup {alpha}s} at positions i - 1 and i + 1. Furthermore, longer mixing times yield correlations to C{sup {alpha}} nuclei separated by more than one residue. The experiment also provides C{sup {alpha}}-to-side chain correlations, some amino acid type identifications and estimates for {psi} dihedral angles. The power of the experiment derives from the alternate {sup 13}C-{sup 12}C labeling with [1,3-{sup 13}C] glycerol or [2-{sup 13}C] glycerol, which allows utilizing the small scalar {sup 3}J{sub CC} couplings that are masked by strong {sup 1}J{sub CC} couplings in uniformly {sup 13}C labeled samples.
(3R,6S,7aS-3-Phenyl-6-(phenylsulfanylperhydropyrrolo[1,2-c]oxazol-5-one

Directory of Open Access Journals (Sweden)

Anthony D. Woolhouse

2009-05-01

Full Text Available Molecules of the title compound [systematic name: (2R,5S,7S-2-phenyl-7-phenylsulfanyl-1-aza-3-oxabicyclo[3.3.0]octan-8-one], C18H17NO2S, form high quality crystals even though they are only packed using C—H...O(carbonyl and weak C—H...S interactions. The dihedral angle between the aromatic rings is 85.53 (5°. The fused rings adopt envelope and twist conformations.
CACA-TOCSY with alternate 13C–12C labeling: a 13Cα direct detection experiment for mainchain resonance assignment, dihedral angle information, and amino acid type identification

Science.gov (United States)

Takeuchi, Koh; Frueh, Dominique P.; Sun, Zhen-Yu J.; Hiller, Sebastian

2010-01-01

We present a 13C direct detection CACA-TOCSY experiment for samples with alternate 13C–12C labeling. It provides inter-residue correlations between 13Cα resonances of residue i and adjacent Cαs at positions i − 1 and i + 1. Furthermore, longer mixing times yield correlations to Cα nuclei separated by more than one residue. The experiment also provides Cα-to-sidechain correlations, some amino acid type identifications and estimates for ψ dihedral angles. The power of the experiment derives from the alternate 13C–12C labeling with [1,3-13C] glycerol or [2-13C] glycerol, which allows utilizing the small scalar 3JCC couplings that are masked by strong 1JCC couplings in uniformly 13C labeled samples. PMID:20383561
Textural and mechanical characterization of C-S-H gels from hydration of synthetic T1-C3S, β-C2S and their blends

International Nuclear Information System (INIS)

Goni, S.; Guerrero, A.; Puertas, F.; Hernandez, M. S.; Palacios, M.; Dolado, J. S.; Zhu, W.; Howind, T.

2011-01-01

The textural and mechanical characterization of C-S-H gels formed from the hydration of pure T1-C 3 S, β-C 2 S and their blends are studied by Nitrogen sorption and nano indentation experiments. The surface area and nano porosity of C-S-H gels formed from the hydration of β-C 2 S and the 30-70 (T1-C 3 S and β-C 2 S mixture) are higher than those from hydration of T1-C 3 S, and 70-30, with the difference decreasing with hydration age. Such changes are well supported by findings of nano indentation study, which shows the greater relative volume of C-S-H phases with lower densities in the β-C 2 S and the 30-70 pastes. With the increase in hydration age, the relative volume of C-S-H phases with higher densities increased at the expenses of those with lower density. Important quantitative correlations were found among these textural characteristics and the mean chain length, determined from 2 9Si magic-angle-spinning (MAS) NMR, of the C-S-H gels. (Author) 36 refs.
Textural and mechanical characterization of C-S-H gels from hydration of synthetic T1-C{sub 3}S, {beta}-C{sub 2}S and their blends; Caracterizacion textural y mecanica de geles C-S-H formados en la hidratacion de muestras sinteticas T1-C{sub 3}S, {beta}-C{sub 2}S y sus mezclas

Energy Technology Data Exchange (ETDEWEB)

Goni, S.; Guerrero, A.; Puertas, F.; Hernandez, M. S.; Palacios, M.; Dolado, J. S.; Zhu, W.; Howind, T.

2011-07-01

The textural and mechanical characterization of C-S-H gels formed from the hydration of pure T1-C{sub 3}S, {beta}-C{sub 2}S and their blends are studied by Nitrogen sorption and nano indentation experiments. The surface area and nano porosity of C-S-H gels formed from the hydration of {beta}-C{sub 2}S and the 30-70 (T1-C{sub 3}S and {beta}-C{sub 2}S mixture) are higher than those from hydration of T1-C{sub 3}S, and 70-30, with the difference decreasing with hydration age. Such changes are well supported by findings of nano indentation study, which shows the greater relative volume of C-S-H phases with lower densities in the {beta}-C{sub 2}S and the 30-70 pastes. With the increase in hydration age, the relative volume of C-S-H phases with higher densities increased at the expenses of those with lower density. Important quantitative correlations were found among these textural characteristics and the mean chain length, determined from {sup 2}9Si magic-angle-spinning (MAS) NMR, of the C-S-H gels. (Author) 36 refs.
Pairwise NMR experiments for the determination of protein backbone dihedral angle Φ based on cross-correlated spin relaxation

International Nuclear Information System (INIS)

Takahashi, Hideo; Shimada, Ichio

2007-01-01

Novel cross-correlated spin relaxation (CCR) experiments are described, which measure pairwise CCR rates for obtaining peptide dihedral angles Φ. The experiments utilize intra-HNCA type coherence transfer to refocus 2-bond J NCα coupling evolution and generate the N (i)-C α (i) or C'(i-1)-C α (i) multiple quantum coherences which are required for measuring the desired CCR rates. The contribution from other coherences is also discussed and an appropriate setting of the evolution delays is presented. These CCR experiments were applied to 15 N- and 13 C-labeled human ubiquitin. The relevant CCR rates showed a high degree of correlation with the Φ angles observed in the X-ray structure. By utilizing these CCR experiments in combination with those previously established for obtaining dihedral angle Ψ, we can determine high resolution structures of peptides that bind weakly to large target molecules
Teaching Molecular Symmetry of Dihedral Point Groups by Drawing Useful 2D Projections

Science.gov (United States)

Chen, Lan; Sun, Hongwei; Lai, Chengming

2015-01-01

There are two main difficulties in studying molecular symmetry of dihedral point groups. One is locating the C[subscript 2] axes perpendicular to the C[subscript n] axis, while the other is finding the s[subscript]d planes which pass through the C[subscript n] axis and bisect the angles formed by adjacent C[subscript 2] axes. In this paper, a…
Textural and mechanical characterization of C-S-H gels from hydration of synthetic T1-C3S, β-C2S and their blends

Directory of Open Access Journals (Sweden)

Dolado, J. S.

2011-06-01

Full Text Available The textural and mechanical characterization of C-S-H gels formed from the hydration of pure T1-C3S, β-C2S and their blends are studied by Nitrogen sorption and nanoindentation experiments. The surface area and nanoporosity of C-S-H gels formed from the hydration of β-C2S and the 30-70 (T1-C3S and β-C2S mixture are higher than those from hydration of T1-C3S, and 70-30, with the difference decreasing with hydration age. Such changes are well supported by findings of nanoindentation study, which shows the greater relative volume of C-S-H phases with lower densities in the β-C2S and the 30-70 pastes. With the increase in hydration age, the relative volume of C-S-H phases with higher densities increased at the expenses of those with lower density. Important quantitative correlations were found among these textural characteristics and the mean chain length, determined from 29Si magic-angle-spinning (MAS NMR, of the C-S-H gels.La caracterización textural y mecánica de geles C-S-H formados a partir de la hidratación de muestras puras de T1-C3S, ß-C2S y sus mezclas ha sido estudiada por medio de adsorción de nitrógeno y nanoindentación. El área superficial y la nano-porosidad de los geles formados durante la hidratación del ß-C2S y la mezcla 30-70 (T1-C3S- ß-C2S son mayores que los correspondientes a los geles del T1-C3S, y la mezcla 70-30; esta diferencia disminuye con el tiempo de hidratación. Estos cambios coinciden con los resultados de nanoindentación que indican un aumento de volumen relativo de las fases C-S-H con una densidad menor en el caso del ß-C2S y la mezcla 30-70. Al aumentar el tiempo de hidratación, el volumen relativo de fases C-S-H de mayor densidad aumenta a expensas de aquellas de menor densidad. Importantes correlaciones cuantitativas se establecen entre las características texturales y la longitud de cadena media del gel C-S-H, determinada mediante RMN-MAS de 29Si.
(S,S,S,S-Nebivolol hydrochloride hemihydrate

Directory of Open Access Journals (Sweden)

Yoann Rousselin

2012-12-01

Full Text Available The asymmetric unit of the title hydrated salt, C22H26F2NO4+·Cl−·0.5H2O, consists of an (S,S,S,S-nebivolol {nebivol = bis[2-(6-fluoro-3,4-dihydro-2H-1-benzopyran-2-yl-2-hydroxyethyl]ammonium} cation, a chloride anion and a half-occupancy water molecule. The dihedral angle between the mean planes of the benzene rings is 50.34 (12°. The pyran rings adopt half-chair conformations. The crystal packing features O—H...O hydrogen bonds and weak N—H...Cl, O—H...Cl, and O—H...Cl interactions, producing layers along (010.
Mass spectra for q c q ¯ c ¯, s c s ¯ c ¯, q b q ¯ ¯, s b s ¯ ¯ tetraquark states with JP C=0++ and 2++

Science.gov (United States)

Chen, Wei; Chen, Hua-Xing; Liu, Xiang; Steele, T. G.; Zhu, Shi-Lin

2017-12-01

We have studied the mass spectra of the hidden-charm/bottom q c q ¯c ¯, s c s ¯c ¯ and q b q ¯b ¯, s b s ¯b ¯ tetraquark states with JP C=0++ and 2++ in the framework of QCD sum rules. We construct ten scalar and four tensor interpolating currents in a systematic way and calculate the mass spectra for these tetraquark states. The X*(3860 ) may be either an isoscalar tetraquark state or χc 0(2 P ). If the X*(3860 ) is a tetraquark candidate, our results prefer the 0++ option over the 2++ one. The X (4160 ) may be classified as either the scalar or tensor q c q ¯c ¯ tetraquark state, while the X (3915 ) favors a 0++ q c q ¯c ¯ or s c s ¯c ¯ tetraquark assignment over the tensor one. The X (4350 ) cannot be interpreted as a s c s ¯c ¯ tetraquark with either JP C=0++ or 2++.
1-O-Acetyl-3,4,6-tri-O-benzyl-2-C-bromomethyl-2-deoxy-α-d-glucopyranose

Directory of Open Access Journals (Sweden)

Henok H. Kinfe

2013-01-01

Full Text Available In the title compound, C30H33BrO6, the pyranose ring adopts a chair conformation. Two of the O-benzyl phenyl rings lie almost perpendicular to C/C/C/O plane formed by the ring atoms not attached to these O-benzyl phenyl rings, and form dihedral angles of 85.1 (2 and 64.6 (2°, while the third O-benzyl phenyl ring is twisted so that it makes a dihedral angle 34.9 (2° to this C/C/C/O plane. This twist is ascribed to the formation of an S(8 loop stabilized by a weak intramolecular C—H...O hydrogen bond.
Predicting dihedral angle probability distributions for protein coil residues from primary sequence using neural networks

DEFF Research Database (Denmark)

Helles, Glennie; Fonseca, Rasmus

2009-01-01

residue in the input-window. The trained neural network shows a significant improvement (4-68%) in predicting the most probable bin (covering a 30°×30° area of the dihedral angle space) for all amino acids in the data set compared to first order statistics. An accuracy comparable to that of secondary...... seem to have a significant influence on the dihedral angles adopted by the individual amino acids in coil segments. In this work we attempt to predict a probability distribution of these dihedral angles based on the flanking residues. While attempts to predict dihedral angles of coil segments have been...... done previously, none have, to our knowledge, presented comparable results for the probability distribution of dihedral angles. Results: In this paper we develop an artificial neural network that uses an input-window of amino acids to predict a dihedral angle probability distribution for the middle...
$\\chi^{\\vphantom\\dagger}_{c0}(3915)$ As the Lightest $c\\bar c s \\bar s$ State

CERN Document Server

Lebed, Richard F.

2016-05-23

The state $\\chi^{\\vphantom\\dagger}_{c0}(3915)$ has recently been demoted by the Particle Data Group from its previous status as the conventional $c\\bar c$ $2 {}^3P_0$ state, largely due to the absence of expected $D\\bar D$ decays. We propose that $\\chi^{\\vphantom\\dagger}_{c0}(3915)$ is actually the lightest $c\\bar c s \\bar s$ state, and calculate the spectrum of such states using the diquark model, identifying many of the observed charmoniumlike states that lack open-charm decay modes as $c\\bar c s \\bar s$. Among other results, we argue that $Y(4140)$ is a $J^{PC} = 1^{++}$ $c\\bar c s \\bar s$ state that has been not been seen in two-photon fusion largely as a consequence of the Landau-Yang theorem.
S-C Mylonites

NARCIS (Netherlands)

Lister, G.S.; Snoke, A.W.

1984-01-01

Two types of foliations are commonly developed in mylonites and mylonitic rocks: (a) S-surfaces related to the accumulation of finite strain and (b) C-surfaces related to displacement discontinuities or zones of relatively high shear strain. There are two types of S-C mylonites. Type I S-C
Study of the $B_c^+ \\to J/\\psi D_s^+$ and $B_c^+ \\to J/\\psi D_s^{*+}$ decays with the ATLAS detector

CERN Document Server

Aad, Georges; Abdallah, Jalal; Abdinov, Ovsat; Aben, Rosemarie; Abolins, Maris; AbouZeid, Ossama; Abramowicz, Halina; Abreu, Henso; Abreu, Ricardo; Abulaiti, Yiming; Acharya, Bobby Samir; Adamczyk, Leszek; Adams, David; Adelman, Jahred; Adomeit, Stefanie; Adye, Tim; Affolder, Tony; Agatonovic-Jovin, Tatjana; Aguilar-Saavedra, Juan Antonio; Ahlen, Steven; Ahmadov, Faig; Aielli, Giulio; Akerstedt, Henrik; Åkesson, Torsten Paul Ake; Akimoto, Ginga; Akimov, Andrei; Alberghi, Gian Luigi; Albert, Justin; Albrand, Solveig; Alconada Verzini, Maria Josefina; Aleksa, Martin; Aleksandrov, Igor; Alexa, Calin; Alexander, Gideon; Alexopoulos, Theodoros; Alhroob, Muhammad; Alimonti, Gianluca; Alio, Lion; Alison, John; Alkire, Steven Patrick; Allbrooke, Benedict; Allport, Phillip; Aloisio, Alberto; Alonso, Alejandro; Alonso, Francisco; Alpigiani, Cristiano; Altheimer, Andrew David; Alvarez Gonzalez, Barbara; Άlvarez Piqueras, Damián; Alviggi, Mariagrazia; Amadio, Brian Thomas; Amako, Katsuya; Amaral Coutinho, Yara; Amelung, Christoph; Amidei, Dante; Amor Dos Santos, Susana Patricia; Amorim, Antonio; Amoroso, Simone; Amram, Nir; Amundsen, Glenn; Anastopoulos, Christos; Ancu, Lucian Stefan; Andari, Nansi; Andeen, Timothy; Anders, Christoph Falk; Anders, Gabriel; Anders, John Kenneth; Anderson, Kelby; Andreazza, Attilio; Andrei, George Victor; Angelidakis, Stylianos; Angelozzi, Ivan; Anger, Philipp; Angerami, Aaron; Anghinolfi, Francis; Anisenkov, Alexey; Anjos, Nuno; Annovi, Alberto; Antonelli, Mario; Antonov, Alexey; Antos, Jaroslav; Anulli, Fabio; Aoki, Masato; Aperio Bella, Ludovica; Arabidze, Giorgi; Arai, Yasuo; Araque, Juan Pedro; Arce, Ayana; Arduh, Francisco Anuar; Arguin, Jean-Francois; Argyropoulos, Spyridon; Arik, Metin; Armbruster, Aaron James; Arnaez, Olivier; Arnal, Vanessa; Arnold, Hannah; Arratia, Miguel; Arslan, Ozan; Artamonov, Andrei; Artoni, Giacomo; Asai, Shoji; Asbah, Nedaa; Ashkenazi, Adi; Åsman, Barbro; Asquith, Lily; Assamagan, Ketevi; Astalos, Robert; Atkinson, Markus; Atlay, Naim Bora; Auerbach, Benjamin; Augsten, Kamil; Aurousseau, Mathieu; Avolio, Giuseppe; Axen, Bradley; Ayoub, Mohamad Kassem; Azuelos, Georges; Baak, Max; Baas, Alessandra; Bacci, Cesare; Bachacou, Henri; Bachas, Konstantinos; Backes, Moritz; Backhaus, Malte; Bagiacchi, Paolo; Bagnaia, Paolo; Bai, Yu; Bain, Travis; Baines, John; Baker, Oliver Keith; Balek, Petr; Balestri, Thomas; Balli, Fabrice; Banas, Elzbieta; Banerjee, Swagato; Bannoura, Arwa A E; Bansil, Hardeep Singh; Barak, Liron; Barberio, Elisabetta Luigia; Barberis, Dario; Barbero, Marlon; Barillari, Teresa; Barisonzi, Marcello; Barklow, Timothy; Barlow, Nick; Barnes, Sarah Louise; Barnett, Bruce; Barnett, Michael; Barnovska, Zuzana; Baroncelli, Antonio; Barone, Gaetano; Barr, Alan; Barreiro, Fernando; Barreiro Guimarães da Costa, João; Bartoldus, Rainer; Barton, Adam Edward; Bartos, Pavol; Basalaev, Artem; Bassalat, Ahmed; Basye, Austin; Bates, Richard; Batista, Santiago Juan; Batley, Richard; Battaglia, Marco; Bauce, Matteo; Bauer, Florian; Bawa, Harinder Singh; Beacham, James Baker; Beattie, Michael David; Beau, Tristan; Beauchemin, Pierre-Hugues; Beccherle, Roberto; Bechtle, Philip; Beck, Hans Peter; Becker, Kathrin; Becker, Maurice; Becker, Sebastian; Beckingham, Matthew; Becot, Cyril; Beddall, Andrew; Beddall, Ayda; Bednyakov, Vadim; Bee, Christopher; Beemster, Lars; Beermann, Thomas; Begel, Michael; Behr, Janna Katharina; Belanger-Champagne, Camille; Bell, William; Bella, Gideon; Bellagamba, Lorenzo; Bellerive, Alain; Bellomo, Massimiliano; Belotskiy, Konstantin; Beltramello, Olga; Benary, Odette; Benchekroun, Driss; Bender, Michael; Bendtz, Katarina; Benekos, Nektarios; Benhammou, Yan; Benhar Noccioli, Eleonora; Benitez Garcia, Jorge-Armando; Benjamin, Douglas; Bensinger, James; Bentvelsen, Stan; Beresford, Lydia; Beretta, Matteo; Berge, David; Bergeaas Kuutmann, Elin; Berger, Nicolas; Berghaus, Frank; Beringer, Jürg; Bernard, Clare; Bernard, Nathan Rogers; Bernius, Catrin; Bernlochner, Florian Urs; Berry, Tracey; Berta, Peter; Bertella, Claudia; Bertoli, Gabriele; Bertolucci, Federico; Bertsche, Carolyn; Bertsche, David; Besana, Maria Ilaria; Besjes, Geert-Jan; Bessidskaia Bylund, Olga; Bessner, Martin Florian; Besson, Nathalie; Betancourt, Christopher; Bethke, Siegfried; Bevan, Adrian John; Bhimji, Wahid; Bianchi, Riccardo-Maria; Bianchini, Louis; Bianco, Michele; Biebel, Otmar; Bieniek, Stephen Paul; Biglietti, Michela; Bilbao De Mendizabal, Javier; Bilokon, Halina; Bindi, Marcello; Binet, Sebastien; Bingul, Ahmet; Bini, Cesare; Black, Curtis; Black, James; Black, Kevin; Blackburn, Daniel; Blair, Robert; Blanchard, Jean-Baptiste; Blanco, Jacobo Ezequiel; Blazek, Tomas; Bloch, Ingo; Blocker, Craig; Blum, Walter; Blumenschein, Ulrike; Bobbink, Gerjan; Bobrovnikov, Victor; Bocchetta, Simona Serena; Bocci, Andrea; Bock, Christopher; Boehler, Michael; Bogaerts, Joannes Andreas; Bogavac, Danijela; Bogdanchikov, Alexander; Bohm, Christian; Boisvert, Veronique; Bold, Tomasz; Boldea, Venera; Boldyrev, Alexey; Bomben, Marco; Bona, Marcella; Boonekamp, Maarten; Borisov, Anatoly; Borissov, Guennadi; Borroni, Sara; Bortfeldt, Jonathan; Bortolotto, Valerio; Bos, Kors; Boscherini, Davide; Bosman, Martine; Boudreau, Joseph; Bouffard, Julian; Bouhova-Thacker, Evelina Vassileva; Boumediene, Djamel Eddine; Bourdarios, Claire; Bousson, Nicolas; Boveia, Antonio; Boyd, James; Boyko, Igor; Bozic, Ivan; Bracinik, Juraj; Brandt, Andrew; Brandt, Gerhard; Brandt, Oleg; Bratzler, Uwe; Brau, Benjamin; Brau, James; Braun, Helmut; Brazzale, Simone Federico; Breaden Madden, William Dmitri; Brendlinger, Kurt; Brennan, Amelia Jean; Brenner, Lydia; Brenner, Richard; Bressler, Shikma; Bristow, Kieran; Bristow, Timothy Michael; Britton, Dave; Britzger, Daniel; Brochu, Frederic; Brock, Ian; Brock, Raymond; Bronner, Johanna; Brooijmans, Gustaaf; Brooks, Timothy; Brooks, William; Brosamer, Jacquelyn; Brost, Elizabeth; Brown, Jonathan; Bruckman de Renstrom, Pawel; Bruncko, Dusan; Bruneliere, Renaud; Bruni, Alessia; Bruni, Graziano; Bruschi, Marco; Bruscino, Nello; Bryngemark, Lene; Buanes, Trygve; Buat, Quentin; Buchholz, Peter; Buckley, Andrew; Buda, Stelian Ioan; Budagov, Ioulian; Buehrer, Felix; Bugge, Lars; Bugge, Magnar Kopangen; Bulekov, Oleg; Bullock, Daniel; Burckhart, Helfried; Burdin, Sergey; Burghgrave, Blake; Burke, Stephen; Burmeister, Ingo; Busato, Emmanuel; Büscher, Daniel; Büscher, Volker; Bussey, Peter; Butler, John; Butt, Aatif Imtiaz; Buttar, Craig; Butterworth, Jonathan; Butti, Pierfrancesco; Buttinger, William; Buzatu, Adrian; Buzykaev, Aleksey; Cabrera Urbán, Susana; Caforio, Davide; Cairo, Valentina; Cakir, Orhan; Calafiura, Paolo; Calandri, Alessandro; Calderini, Giovanni; Calfayan, Philippe; Caloba, Luiz; Calvet, David; Calvet, Samuel; Camacho Toro, Reina; Camarda, Stefano; Camarri, Paolo; Cameron, David; Caminada, Lea Michaela; Caminal Armadans, Roger; Campana, Simone; Campanelli, Mario; Campoverde, Angel; Canale, Vincenzo; Canepa, Anadi; Cano Bret, Marc; Cantero, Josu; Cantrill, Robert; Cao, Tingting; Capeans Garrido, Maria Del Mar; Caprini, Irinel; Caprini, Mihai; Capua, Marcella; Caputo, Regina; Cardarelli, Roberto; Cardillo, Fabio; Carli, Tancredi; Carlino, Gianpaolo; Carminati, Leonardo; Caron, Sascha; Carquin, Edson; Carrillo-Montoya, German D; Carter, Janet; Carvalho, João; Casadei, Diego; Casado, Maria Pilar; Casolino, Mirkoantonio; Castaneda-Miranda, Elizabeth; Castelli, Angelantonio; Castillo Gimenez, Victoria; Castro, Nuno Filipe; Catastini, Pierluigi; Catinaccio, Andrea; Catmore, James; Cattai, Ariella; Caudron, Julien; Cavaliere, Viviana; Cavalli, Donatella; Cavalli-Sforza, Matteo; Cavasinni, Vincenzo; Ceradini, Filippo; Cerio, Benjamin; Cerny, Karel; Santiago Cerqueira, Augusto; Cerri, Alessandro; Cerrito, Lucio; Cerutti, Fabio; Cerv, Matevz; Cervelli, Alberto; Cetin, Serkant Ali; Chafaq, Aziz; Chakraborty, Dhiman; Chalupkova, Ina; Chang, Philip; Chapleau, Bertrand; Chapman, John Derek; Charlton, Dave; Chau, Chav Chhiv; Chavez Barajas, Carlos Alberto; Cheatham, Susan; Chegwidden, Andrew; Chekanov, Sergei; Chekulaev, Sergey; Chelkov, Gueorgui; Chelstowska, Magda Anna; Chen, Chunhui; Chen, Hucheng; Chen, Karen; Chen, Liming; Chen, Shenjian; Chen, Xin; Chen, Ye; Cheng, Hok Chuen; Cheng, Yangyang; Cheplakov, Alexander; Cheremushkina, Evgenia; Cherkaoui El Moursli, Rajaa; Chernyatin, Valeriy; Cheu, Elliott; Chevalier, Laurent; Chiarella, Vitaliano; Childers, John Taylor; Chiodini, Gabriele; Chisholm, Andrew; Chislett, Rebecca Thalatta; Chitan, Adrian; Chizhov, Mihail; Choi, Kyungeon; Chouridou, Sofia; Chow, Bonnie Kar Bo; Christodoulou, Valentinos; Chromek-Burckhart, Doris; Chudoba, Jiri; Chuinard, Annabelle Julia; Chwastowski, Janusz; Chytka, Ladislav; Ciapetti, Guido; Ciftci, Abbas Kenan; Cinca, Diane; Cindro, Vladimir; Cioara, Irina Antonela; Ciocio, Alessandra; Citron, Zvi Hirsh; Ciubancan, Mihai; Clark, Allan G; Clark, Brian Lee; Clark, Philip James; Clarke, Robert; Cleland, Bill; Clement, Christophe; Coadou, Yann; Cobal, Marina; Coccaro, Andrea; Cochran, James H; Coffey, Laurel; Cogan, Joshua Godfrey; Cole, Brian; Cole, Stephen; Colijn, Auke-Pieter; Collot, Johann; Colombo, Tommaso; Compostella, Gabriele; Conde Muiño, Patricia; Coniavitis, Elias; Connell, Simon Henry; Connelly, Ian; Consonni, Sofia Maria; Consorti, Valerio; Constantinescu, Serban; Conta, Claudio; Conti, Geraldine; Conventi, Francesco; Cooke, Mark; Cooper, Ben; Cooper-Sarkar, Amanda; Cornelissen, Thijs; Corradi, Massimo; Corriveau, Francois; Corso-Radu, Alina; Cortes-Gonzalez, Arely; Cortiana, Giorgio; Costa, Giuseppe; Costa, María José; Costanzo, Davide; Côté, David; Cottin, Giovanna; Cowan, Glen; Cox, Brian; Cranmer, Kyle; Cree, Graham; Crépé-Renaudin, Sabine; Crescioli, Francesco; Cribbs, Wayne Allen; Crispin Ortuzar, Mireia; Cristinziani, Markus; Croft, Vince; Crosetti, Giovanni; Cuhadar Donszelmann, Tulay; Cummings, Jane; Curatolo, Maria; Cuthbert, Cameron; Czirr, Hendrik; Czodrowski, Patrick; D'Auria, Saverio; D'Onofrio, Monica; Da Cunha Sargedas De Sousa, Mario Jose; Da Via, Cinzia; Dabrowski, Wladyslaw; Dafinca, Alexandru; Dai, Tiesheng; Dale, Orjan; Dallaire, Frederick; Dallapiccola, Carlo; Dam, Mogens; Dandoy, Jeffrey Rogers; Dang, Nguyen Phuong; Daniells, Andrew Christopher; Danninger, Matthias; Dano Hoffmann, Maria; Dao, Valerio; Darbo, Giovanni; Darmora, Smita; Dassoulas, James; Dattagupta, Aparajita; Davey, Will; David, Claire; Davidek, Tomas; Davies, Eleanor; Davies, Merlin; Davison, Peter; Davygora, Yuriy; Dawe, Edmund; Dawson, Ian; Daya-Ishmukhametova, Rozmin; De, Kaushik; de Asmundis, Riccardo; De Castro, Stefano; De Cecco, Sandro; De Groot, Nicolo; de Jong, Paul; De la Torre, Hector; De Lorenzi, Francesco; De Nooij, Lucie; De Pedis, Daniele; De Salvo, Alessandro; De Sanctis, Umberto; De Santo, Antonella; De Vivie De Regie, Jean-Baptiste; Dearnaley, William James; Debbe, Ramiro; Debenedetti, Chiara; Dedovich, Dmitri; Deigaard, Ingrid; Del Peso, Jose; Del Prete, Tarcisio; Delgove, David; Deliot, Frederic; Delitzsch, Chris Malena; Deliyergiyev, Maksym; Dell'Acqua, Andrea; Dell'Asta, Lidia; Dell'Orso, Mauro; Della Pietra, Massimo; della Volpe, Domenico; Delmastro, Marco; Delsart, Pierre-Antoine; Deluca, Carolina; DeMarco, David; Demers, Sarah; Demichev, Mikhail; Demilly, Aurelien; Denisov, Sergey; Derendarz, Dominik; Derkaoui, Jamal Eddine; Derue, Frederic; Dervan, Paul; Desch, Klaus Kurt; Deterre, Cecile; Deviveiros, Pier-Olivier; Dewhurst, Alastair; Dhaliwal, Saminder; Di Ciaccio, Anna; Di Ciaccio, Lucia; Di Domenico, Antonio; Di Donato, Camilla; Di Girolamo, Alessandro; Di Girolamo, Beniamino; Di Mattia, Alessandro; Di Micco, Biagio; Di Nardo, Roberto; Di Simone, Andrea; Di Sipio, Riccardo; Di Valentino, David; Diaconu, Cristinel; Diamond, Miriam; Dias, Flavia; Diaz, Marco Aurelio; Diehl, Edward; Dietrich, Janet; Diglio, Sara; Dimitrievska, Aleksandra; Dingfelder, Jochen; Dita, Petre; Dita, Sanda; Dittus, Fridolin; Djama, Fares; Djobava, Tamar; Djuvsland, Julia Isabell; Barros do Vale, Maria Aline; Dobos, Daniel; Dobre, Monica; Doglioni, Caterina; Dohmae, Takeshi; Dolejsi, Jiri; Dolezal, Zdenek; Dolgoshein, Boris; Donadelli, Marisilvia; Donati, Simone; Dondero, Paolo; Donini, Julien; Dopke, Jens; Doria, Alessandra; Dova, Maria-Teresa; Doyle, Tony; Drechsler, Eric; Dris, Manolis; Dubreuil, Emmanuelle; Duchovni, Ehud; Duckeck, Guenter; Ducu, Otilia Anamaria; Duda, Dominik; Dudarev, Alexey; Duflot, Laurent; Duguid, Liam; Dührssen, Michael; Dunford, Monica; Duran Yildiz, Hatice; Düren, Michael; Durglishvili, Archil; Duschinger, Dirk; Dyndal, Mateusz; Eckardt, Christoph; Ecker, Katharina Maria; Edgar, Ryan Christopher; Edson, William; Edwards, Nicholas Charles; Ehrenfeld, Wolfgang; Eifert, Till; Eigen, Gerald; Einsweiler, Kevin; Ekelof, Tord; El Kacimi, Mohamed; Ellert, Mattias; Elles, Sabine; Ellinghaus, Frank; Elliot, Alison; Ellis, Nicolas; Elmsheuser, Johannes; Elsing, Markus; Emeliyanov, Dmitry; Enari, Yuji; Endner, Oliver Chris; Endo, Masaki; Erdmann, Johannes; Ereditato, Antonio; Ernis, Gunar; Ernst, Jesse; Ernst, Michael; Errede, Steven; Ertel, Eugen; Escalier, Marc; Esch, Hendrik; Escobar, Carlos; Esposito, Bellisario; Etienvre, Anne-Isabelle; Etzion, Erez; Evans, Hal; Ezhilov, Alexey; Fabbri, Laura; Facini, Gabriel; Fakhrutdinov, Rinat; Falciano, Speranza; Falla, Rebecca Jane; Faltova, Jana; Fang, Yaquan; Fanti, Marcello; Farbin, Amir; Farilla, Addolorata; Farooque, Trisha; Farrell, Steven; Farrington, Sinead; Farthouat, Philippe; Fassi, Farida; Fassnacht, Patrick; Fassouliotis, Dimitrios; Faucci Giannelli, Michele; Favareto, Andrea; Fayard, Louis; Federic, Pavol; Fedin, Oleg; Fedorko, Wojciech; Feigl, Simon; Feligioni, Lorenzo; Feng, Cunfeng; Feng, Eric; Feng, Haolu; Fenyuk, Alexander; Feremenga, Last; Fernandez Martinez, Patricia; Fernandez Perez, Sonia; Ferrando, James; Ferrari, Arnaud; Ferrari, Pamela; Ferrari, Roberto; Ferreira de Lima, Danilo Enoque; Ferrer, Antonio; Ferrere, Didier; Ferretti, Claudio; Ferretto Parodi, Andrea; Fiascaris, Maria; Fiedler, Frank; Filipčič, Andrej; Filipuzzi, Marco; Filthaut, Frank; Fincke-Keeler, Margret; Finelli, Kevin Daniel; Fiolhais, Miguel; Fiorini, Luca; Firan, Ana; Fischer, Adam; Fischer, Cora; Fischer, Julia; Fisher, Wade Cameron; Fitzgerald, Eric Andrew; Fleck, Ivor; Fleischmann, Philipp; Fleischmann, Sebastian; Fletcher, Gareth Thomas; Fletcher, Gregory; Fletcher, Rob Roy MacGregor; Flick, Tobias; Floderus, Anders; Flores Castillo, Luis; Flowerdew, Michael; Formica, Andrea; Forti, Alessandra; Fournier, Daniel; Fox, Harald; Fracchia, Silvia; Francavilla, Paolo; Franchini, Matteo; Francis, David; Franconi, Laura; Franklin, Melissa; Frate, Meghan; Fraternali, Marco; Freeborn, David; French, Sky; Friedrich, Felix; Froidevaux, Daniel; Frost, James; Fukunaga, Chikara; Fullana Torregrosa, Esteban; Fulsom, Bryan Gregory; Fuster, Juan; Gabaldon, Carolina; Gabizon, Ofir; Gabrielli, Alessandro; Gabrielli, Andrea; Gadatsch, Stefan; Gadomski, Szymon; Gagliardi, Guido; Gagnon, Pauline; Galea, Cristina; Galhardo, Bruno; Gallas, Elizabeth; Gallop, Bruce; Gallus, Petr; Galster, Gorm Aske Gram Krohn; Gan, KK; Gao, Jun; Gao, Yanyan; Gao, Yongsheng; Garay Walls, Francisca; Garberson, Ford; García, Carmen; García Navarro, José Enrique; Garcia-Sciveres, Maurice; Gardner, Robert; Garelli, Nicoletta; Garonne, Vincent; Gatti, Claudio; Gaudiello, Andrea; Gaudio, Gabriella; Gaur, Bakul; Gauthier, Lea; Gauzzi, Paolo; Gavrilenko, Igor; Gay, Colin; Gaycken, Goetz; Gazis, Evangelos; Ge, Peng; Gecse, Zoltan; Gee, Norman; Geerts, Daniël Alphonsus Adrianus; Geich-Gimbel, Christoph; Geisler, Manuel Patrice; Gemme, Claudia; Genest, Marie-Hélène; Gentile, Simonetta; George, Matthias; George, Simon; Gerbaudo, Davide; Gershon, Avi; Ghazlane, Hamid; Giacobbe, Benedetto; Giagu, Stefano; Giangiobbe, Vincent; Giannetti, Paola; Gibbard, Bruce; Gibson, Stephen; Gilchriese, Murdock; Gillam, Thomas; Gillberg, Dag; Gilles, Geoffrey; Gingrich, Douglas; Giokaris, Nikos; Giordani, MarioPaolo; Giorgi, Filippo Maria; Giorgi, Francesco Michelangelo; Giraud, Pierre-Francois; Giromini, Paolo; Giugni, Danilo; Giuliani, Claudia; Giulini, Maddalena; Gjelsten, Børge Kile; Gkaitatzis, Stamatios; Gkialas, Ioannis; Gkougkousis, Evangelos Leonidas; Gladilin, Leonid; Glasman, Claudia; Glatzer, Julian; Glaysher, Paul; Glazov, Alexandre; Goblirsch-Kolb, Maximilian; Goddard, Jack Robert; Godlewski, Jan; Goldfarb, Steven; Golling, Tobias; Golubkov, Dmitry; Gomes, Agostinho; Gonçalo, Ricardo; Goncalves Pinto Firmino Da Costa, Joao; Gonella, Laura; González de la Hoz, Santiago; Gonzalez Parra, Garoe; Gonzalez-Sevilla, Sergio; Goossens, Luc; Gorbounov, Petr Andreevich; Gordon, Howard; Gorelov, Igor; Gorini, Benedetto; Gorini, Edoardo; Gorišek, Andrej; Gornicki, Edward; Goshaw, Alfred; Gössling, Claus; Gostkin, Mikhail Ivanovitch; Goujdami, Driss; Goussiou, Anna; Govender, Nicolin; Gozani, Eitan; Grabas, Herve Marie Xavier; Graber, Lars; Grabowska-Bold, Iwona; Grafström, Per; Grahn, Karl-Johan; Gramling, Johanna; Gramstad, Eirik; Grancagnolo, Sergio; Grassi, Valerio; Gratchev, Vadim; Gray, Heather; Graziani, Enrico; Greenwood, Zeno Dixon; Gregersen, Kristian; Gregor, Ingrid-Maria; Grenier, Philippe; Griffiths, Justin; Grillo, Alexander; Grimm, Kathryn; Grinstein, Sebastian; Gris, Philippe Luc Yves; Grivaz, Jean-Francois; Grohs, Johannes Philipp; Grohsjean, Alexander; Gross, Eilam; Grosse-Knetter, Joern; Grossi, Giulio Cornelio; Grout, Zara Jane; Guan, Liang; Guenther, Jaroslav; Guescini, Francesco; Guest, Daniel; Gueta, Orel; Guido, Elisa; Guillemin, Thibault; Guindon, Stefan; Gul, Umar; Gumpert, Christian; Guo, Jun; Gupta, Shaun; Gustavino, Giuliano; Gutierrez, Phillip; Gutierrez Ortiz, Nicolas Gilberto; Gutschow, Christian; Guyot, Claude; Gwenlan, Claire; Gwilliam, Carl; Haas, Andy; Haber, Carl; Hadavand, Haleh Khani; Haddad, Nacim; Haefner, Petra; Hageböck, Stephan; Hajduk, Zbigniew; Hakobyan, Hrachya; Haleem, Mahsana; Haley, Joseph; Hall, David; Halladjian, Garabed; Hallewell, Gregory David; Hamacher, Klaus; Hamal, Petr; Hamano, Kenji; Hamer, Matthias; Hamilton, Andrew; Hamity, Guillermo Nicolas; Hamnett, Phillip George; Han, Liang; Hanagaki, Kazunori; Hanawa, Keita; Hance, Michael; Hanke, Paul; Hanna, Remie; Hansen, Jørgen Beck; Hansen, Jorn Dines; Hansen, Maike Christina; Hansen, Peter Henrik; Hara, Kazuhiko; Hard, Andrew; Harenberg, Torsten; Hariri, Faten; Harkusha, Siarhei; Harrington, Robert; Harrison, Paul Fraser; Hartjes, Fred; Hasegawa, Makoto; Hasegawa, Satoshi; Hasegawa, Yoji; Hasib, A; Hassani, Samira; Haug, Sigve; Hauser, Reiner; Hauswald, Lorenz; Havranek, Miroslav; Hawkes, Christopher; Hawkings, Richard John; Hawkins, Anthony David; Hayashi, Takayasu; Hayden, Daniel; Hays, Chris; Hays, Jonathan Michael; Hayward, Helen; Haywood, Stephen; Head, Simon; Heck, Tobias; Hedberg, Vincent; Heelan, Louise; Heim, Sarah; Heim, Timon; Heinemann, Beate; Heinrich, Lukas; Hejbal, Jiri; Helary, Louis; Hellman, Sten; Hellmich, Dennis; Helsens, Clement; Henderson, James; Henderson, Robert; Heng, Yang; Hengler, Christopher; Henrichs, Anna; Henriques Correia, Ana Maria; Henrot-Versille, Sophie; Herbert, Geoffrey Henry; Hernández Jiménez, Yesenia; Herrberg-Schubert, Ruth; Herten, Gregor; Hertenberger, Ralf; Hervas, Luis; Hesketh, Gavin Grant; Hessey, Nigel; Hetherly, Jeffrey Wayne; Hickling, Robert; Higón-Rodriguez, Emilio; Hill, Ewan; Hill, John; Hiller, Karl Heinz; Hillier, Stephen; Hinchliffe, Ian; Hines, Elizabeth; Hinman, Rachel Reisner; Hirose, Minoru; Hirschbuehl, Dominic; Hobbs, John; Hod, Noam; Hodgkinson, Mark; Hodgson, Paul; Hoecker, Andreas; Hoeferkamp, Martin; Hoenig, Friedrich; Hohlfeld, Marc; Hohn, David; Holmes, Tova Ray; Homann, Michael; Hong, Tae Min; Hooft van Huysduynen, Loek; Hopkins, Walter; Horii, Yasuyuki; Horton, Arthur James; Hostachy, Jean-Yves; Hou, Suen; Hoummada, Abdeslam; Howard, Jacob; Howarth, James; Hrabovsky, Miroslav; Hristova, Ivana; Hrivnac, Julius; Hryn'ova, Tetiana; Hrynevich, Aliaksei; Hsu, Catherine; Hsu, Pai-hsien Jennifer; Hsu, Shih-Chieh; Hu, Diedi; Hu, Qipeng; Hu, Xueye; Huang, Yanping; Hubacek, Zdenek; Hubaut, Fabrice; Huegging, Fabian; Huffman, Todd Brian; Hughes, Emlyn; Hughes, Gareth; Huhtinen, Mika; Hülsing, Tobias Alexander; Huseynov, Nazim; Huston, Joey; Huth, John; Iacobucci, Giuseppe; Iakovidis, Georgios; Ibragimov, Iskander; Iconomidou-Fayard, Lydia; Ideal, Emma; Idrissi, Zineb; Iengo, Paolo; Igonkina, Olga; Iizawa, Tomoya; Ikegami, Yoichi; Ikematsu, Katsumasa; Ikeno, Masahiro; Ilchenko, Iurii; Iliadis, Dimitrios; Ilic, Nikolina; Inamaru, Yuki; Ince, Tayfun; Ioannou, Pavlos; Iodice, Mauro; Iordanidou, Kalliopi; Ippolito, Valerio; Irles Quiles, Adrian; Isaksson, Charlie; Ishino, Masaya; Ishitsuka, Masaki; Ishmukhametov, Renat; Issever, Cigdem; Istin, Serhat; Iturbe Ponce, Julia Mariana; Iuppa, Roberto; Ivarsson, Jenny; Iwanski, Wieslaw; Iwasaki, Hiroyuki; Izen, Joseph; Izzo, Vincenzo; Jabbar, Samina; Jackson, Brett; Jackson, Matthew; Jackson, Paul; Jaekel, Martin; Jain, Vivek; Jakobs, Karl; Jakobsen, Sune; Jakoubek, Tomas; Jakubek, Jan; Jamin, David Olivier; Jana, Dilip; Jansen, Eric; Jansky, Roland; Janssen, Jens; Janus, Michel; Jarlskog, Göran; Javadov, Namig; Javůrek, Tomáš; Jeanty, Laura; Jejelava, Juansher; Jeng, Geng-yuan; Jennens, David; Jenni, Peter; Jentzsch, Jennifer; Jeske, Carl; Jézéquel, Stéphane; Ji, Haoshuang; Jia, Jiangyong; Jiang, Yi; Jiggins, Stephen; Jimenez Pena, Javier; Jin, Shan; Jinaru, Adam; Jinnouchi, Osamu; Joergensen, Morten Dam; Johansson, Per; Johns, Kenneth; Jon-And, Kerstin; Jones, Graham; Jones, Roger; Jones, Tim; Jongmanns, Jan; Jorge, Pedro; Joshi, Kiran Daniel; Jovicevic, Jelena; Ju, Xiangyang; Jung, Christian; Jussel, Patrick; Juste Rozas, Aurelio; Kaci, Mohammed; Kaczmarska, Anna; Kado, Marumi; Kagan, Harris; Kagan, Michael; Kahn, Sebastien Jonathan; Kajomovitz, Enrique; Kalderon, Charles William; Kama, Sami; Kamenshchikov, Andrey; Kanaya, Naoko; Kaneda, Michiru; Kaneti, Steven; Kantserov, Vadim; Kanzaki, Junichi; Kaplan, Benjamin; Kapliy, Anton; Kar, Deepak; Karakostas, Konstantinos; Karamaoun, Andrew; Karastathis, Nikolaos; Kareem, Mohammad Jawad; Karnevskiy, Mikhail; Karpov, Sergey; Karpova, Zoya; Karthik, Krishnaiyengar; Kartvelishvili, Vakhtang; Karyukhin, Andrey; Kashif, Lashkar; Kass, Richard; Kastanas, Alex; Kataoka, Yousuke; Katre, Akshay; Katzy, Judith; Kawagoe, Kiyotomo; Kawamoto, Tatsuo; Kawamura, Gen; Kazama, Shingo; Kazanin, Vassili; Kazarinov, Makhail; Keeler, Richard; Kehoe, Robert; Keller, John; Kempster, Jacob Julian; Keoshkerian, Houry; Kepka, Oldrich; Kerševan, Borut Paul; Kersten, Susanne; Keyes, Robert; Khalil-zada, Farkhad; Khandanyan, Hovhannes; Khanov, Alexander; Kharlamov, Alexey; Khoo, Teng Jian; Khovanskiy, Valery; Khramov, Evgeniy; Khubua, Jemal; Kim, Hee Yeun; Kim, Hyeon Jin; Kim, Shinhong; Kim, Young-Kee; Kimura, Naoki; Kind, Oliver Maria; King, Barry; King, Matthew; King, Samuel Burton; Kirk, Julie; Kiryunin, Andrey; Kishimoto, Tomoe; Kisielewska, Danuta; Kiss, Florian; Kiuchi, Kenji; Kivernyk, Oleh; Kladiva, Eduard; Klein, Matthew Henry; Klein, Max; Klein, Uta; Kleinknecht, Konrad; Klimek, Pawel; Klimentov, Alexei; Klingenberg, Reiner; Klinger, Joel Alexander; Klioutchnikova, Tatiana; Kluge, Eike-Erik; Kluit, Peter; Kluth, Stefan; Kneringer, Emmerich; Knoops, Edith; Knue, Andrea; Kobayashi, Aine; Kobayashi, Dai; Kobayashi, Tomio; Kobel, Michael; Kocian, Martin; Kodys, Peter; Koffas, Thomas; Koffeman, Els; Kogan, Lucy Anne; Kohlmann, Simon; Kohout, Zdenek; Kohriki, Takashi; Koi, Tatsumi; Kolanoski, Hermann; Koletsou, Iro; Komar, Aston; Komori, Yuto; Kondo, Takahiko; Kondrashova, Nataliia; Köneke, Karsten; König, Adriaan; König, Sebastian; Kono, Takanori; Konoplich, Rostislav; Konstantinidis, Nikolaos; Kopeliansky, Revital; Koperny, Stefan; Köpke, Lutz; Kopp, Anna Katharina; Korcyl, Krzysztof; Kordas, Kostantinos; Korn, Andreas; Korol, Aleksandr; Korolkov, Ilya; Korolkova, Elena; Kortner, Oliver; Kortner, Sandra; Kosek, Tomas; Kostyukhin, Vadim; Kotov, Vladislav; Kotwal, Ashutosh; Kourkoumeli-Charalampidi, Athina; Kourkoumelis, Christine; Kouskoura, Vasiliki; Koutsman, Alex; Kowalewski, Robert Victor; Kowalski, Tadeusz; Kozanecki, Witold; Kozhin, Anatoly; Kramarenko, Viktor; Kramberger, Gregor; Krasnopevtsev, Dimitriy; Krasny, Mieczyslaw Witold; Krasznahorkay, Attila; Kraus, Jana; Kravchenko, Anton; Kreiss, Sven; Kretz, Moritz; Kretzschmar, Jan; Kreutzfeldt, Kristof; Krieger, Peter; Krizka, Karol; Kroeninger, Kevin; Kroha, Hubert; Kroll, Joe; Kroseberg, Juergen; Krstic, Jelena; Kruchonak, Uladzimir; Krüger, Hans; Krumnack, Nils; Krumshteyn, Zinovii; Kruse, Amanda; Kruse, Mark; Kruskal, Michael; Kubota, Takashi; Kucuk, Hilal; Kuday, Sinan; Kuehn, Susanne; Kugel, Andreas; Kuger, Fabian; Kuhl, Andrew; Kuhl, Thorsten; Kukhtin, Victor; Kulchitsky, Yuri; Kuleshov, Sergey; Kuna, Marine; Kunigo, Takuto; Kupco, Alexander; Kurashige, Hisaya; Kurochkin, Yurii; Kurumida, Rie; Kus, Vlastimil; Kuwertz, Emma Sian; Kuze, Masahiro; Kvita, Jiri; Kwan, Tony; Kyriazopoulos, Dimitrios; La Rosa, Alessandro; La Rosa Navarro, Jose Luis; La Rotonda, Laura; Lacasta, Carlos; Lacava, Francesco; Lacey, James; Lacker, Heiko; Lacour, Didier; Lacuesta, Vicente Ramón; Ladygin, Evgueni; Lafaye, Remi; Laforge, Bertrand; Lagouri, Theodota; Lai, Stanley; Lambourne, Luke; Lammers, Sabine; Lampen, Caleb; Lampl, Walter; Lançon, Eric; Landgraf, Ulrich; Landon, Murrough; Lang, Valerie Susanne; Lange, J örn Christian; Lankford, Andrew; Lanni, Francesco; Lantzsch, Kerstin; Laplace, Sandrine; Lapoire, Cecile; Laporte, Jean-Francois; Lari, Tommaso; Lasagni Manghi, Federico; Lassnig, Mario; Laurelli, Paolo; Lavrijsen, Wim; Law, Alexander; Laycock, Paul; Lazovich, Tomo; Le Dortz, Olivier; Le Guirriec, Emmanuel; Le Menedeu, Eve; LeBlanc, Matthew Edgar; LeCompte, Thomas; Ledroit-Guillon, Fabienne Agnes Marie; Lee, Claire Alexandra; Lee, Shih-Chang; Lee, Lawrence; Lefebvre, Guillaume; Lefebvre, Michel; Legger, Federica; Leggett, Charles; Lehan, Allan; Lehmann Miotto, Giovanna; Lei, Xiaowen; Leight, William Axel; Leisos, Antonios; Leister, Andrew Gerard; Leite, Marco Aurelio Lisboa; Leitner, Rupert; Lellouch, Daniel; Lemmer, Boris; Leney, Katharine; Lenz, Tatjana; Lenzi, Bruno; Leone, Robert; Leone, Sandra; Leonidopoulos, Christos; Leontsinis, Stefanos; Leroy, Claude; Lester, Christopher; Levchenko, Mikhail; Levêque, Jessica; Levin, Daniel; Levinson, Lorne; Levy, Mark; Lewis, Adrian; Leyko, Agnieszka; Leyton, Michael; Li, Bing; Li, Haifeng; Li, Ho Ling; Li, Lei; Li, Liang; Li, Shu; Li, Yichen; Liang, Zhijun; Liao, Hongbo; Liberti, Barbara; Liblong, Aaron; Lichard, Peter; Lie, Ki; Liebal, Jessica; Liebig, Wolfgang; Limbach, Christian; Limosani, Antonio; Lin, Simon; Lin, Tai-Hua; Linde, Frank; Lindquist, Brian Edward; Linnemann, James; Lipeles, Elliot; Lipniacka, Anna; Lisovyi, Mykhailo; Liss, Tony; Lissauer, David; Lister, Alison; Litke, Alan; Liu, Bo; Liu, Dong; Liu, Hao; Liu, Jian; Liu, Jianbei; Liu, Kun; Liu, Lulu; Liu, Miaoyuan; Liu, Minghui; Liu, Yanwen; Livan, Michele; Lleres, Annick; Llorente Merino, Javier; Lloyd, Stephen; Lo Sterzo, Francesco; Lobodzinska, Ewelina; Loch, Peter; Lockman, William; Loebinger, Fred; Loevschall-Jensen, Ask Emil; Loginov, Andrey; Lohse, Thomas; Lohwasser, Kristin; Lokajicek, Milos; Long, Brian Alexander; Long, Jonathan David; Long, Robin Eamonn; Looper, Kristina Anne; Lopes, Lourenco; Lopez Mateos, David; Lopez Paredes, Brais; Lopez Paz, Ivan; Lorenz, Jeanette; Lorenzo Martinez, Narei; Losada, Marta; Loscutoff, Peter; Lösel, Philipp Jonathan; Lou, XinChou; Lounis, Abdenour; Love, Jeremy; Love, Peter; Lu, Nan; Lubatti, Henry; Luci, Claudio; Lucotte, Arnaud; Luehring, Frederick; Lukas, Wolfgang; Luminari, Lamberto; Lundberg, Olof; Lund-Jensen, Bengt; Lynn, David; Lysak, Roman; Lytken, Else; Ma, Hong; Ma, Lian Liang; Maccarrone, Giovanni; Macchiolo, Anna; Macdonald, Calum Michael; Machado Miguens, Joana; Macina, Daniela; Madaffari, Daniele; Madar, Romain; Maddocks, Harvey Jonathan; Mader, Wolfgang; Madsen, Alexander; Maeland, Steffen; Maeno, Tadashi; Maevskiy, Artem; Magradze, Erekle; Mahboubi, Kambiz; Mahlstedt, Joern; Maiani, Camilla; Maidantchik, Carmen; Maier, Andreas Alexander; Maier, Thomas; Maio, Amélia; Majewski, Stephanie; Makida, Yasuhiro; Makovec, Nikola; Malaescu, Bogdan; Malecki, Pawel; Maleev, Victor; Malek, Fairouz; Mallik, Usha; Malon, David; Malone, Caitlin; Maltezos, Stavros; Malyshev, Vladimir; Malyukov, Sergei; Mamuzic, Judita; Mancini, Giada; Mandelli, Beatrice; Mandelli, Luciano; Mandić, Igor; Mandrysch, Rocco; Maneira, José; Manfredini, Alessandro; Manhaes de Andrade Filho, Luciano; Manjarres Ramos, Joany; Mann, Alexander; Manning, Peter; Manousakis-Katsikakis, Arkadios; Mansoulie, Bruno; Mantifel, Rodger; Mantoani, Matteo; Mapelli, Livio; March, Luis; Marchiori, Giovanni; Marcisovsky, Michal; Marino, Christopher; Marjanovic, Marija; Marley, Daniel; Marroquim, Fernando; Marsden, Stephen Philip; Marshall, Zach; Marti, Lukas Fritz; Marti-Garcia, Salvador; Martin, Brian Thomas; Martin, Tim; Martin, Victoria Jane; Martin dit Latour, Bertrand; Martinez, Mario; Martin-Haugh, Stewart; Martoiu, Victor Sorin; Martyniuk, Alex; Marx, Marilyn; Marzano, Francesco; Marzin, Antoine; Masetti, Lucia; Mashimo, Tetsuro; Mashinistov, Ruslan; Masik, Jiri; Maslennikov, Alexey; Massa, Ignazio; Massa, Lorenzo; Massol, Nicolas; Mastrandrea, Paolo; Mastroberardino, Anna; Masubuchi, Tatsuya; Mättig, Peter; Mattmann, Johannes; Maurer, Julien; Maxfield, Stephen; Maximov, Dmitriy; Mazini, Rachid; Mazza, Simone Michele; Mazzaferro, Luca; Mc Goldrick, Garrin; Mc Kee, Shawn Patrick; McCarn, Allison; McCarthy, Robert; McCarthy, Tom; McCubbin, Norman; McFarlane, Kenneth; Mcfayden, Josh; Mchedlidze, Gvantsa; McMahon, Steve; McPherson, Robert; Medinnis, Michael; Meehan, Samuel; Mehlhase, Sascha; Mehta, Andrew; Meier, Karlheinz; Meineck, Christian; Meirose, Bernhard; Mellado Garcia, Bruce Rafael; Meloni, Federico; Mengarelli, Alberto; Menke, Sven; Meoni, Evelin; Mercurio, Kevin Michael; Mergelmeyer, Sebastian; Mermod, Philippe; Merola, Leonardo; Meroni, Chiara; Merritt, Frank; Messina, Andrea; Metcalfe, Jessica; Mete, Alaettin Serhan; Meyer, Carsten; Meyer, Christopher; Meyer, Jean-Pierre; Meyer, Jochen; Middleton, Robin; Miglioranzi, Silvia; Mijović, Liza; Mikenberg, Giora; Mikestikova, Marcela; Mikuž, Marko; Milesi, Marco; Milic, Adriana; Miller, David; Mills, Corrinne; Milov, Alexander; Milstead, David; Minaenko, Andrey; Minami, Yuto; Minashvili, Irakli; Mincer, Allen; Mindur, Bartosz; Mineev, Mikhail; Ming, Yao; Mir, Lluisa-Maria; Mitani, Takashi; Mitrevski, Jovan; Mitsou, Vasiliki A; Miucci, Antonio; Miyagawa, Paul; Mjörnmark, Jan-Ulf; Moa, Torbjoern; Mochizuki, Kazuya; Mohapatra, Soumya; Mohr, Wolfgang; Molander, Simon; Moles-Valls, Regina; Mönig, Klaus; Monini, Caterina; Monk, James; Monnier, Emmanuel; Montejo Berlingen, Javier; Monticelli, Fernando; Monzani, Simone; Moore, Roger; Morange, Nicolas; Moreno, Deywis; Moreno Llácer, María; Morettini, Paolo; Morgenstern, Marcus; Morii, Masahiro; Morinaga, Masahiro; Morisbak, Vanja; Moritz, Sebastian; Morley, Anthony Keith; Mornacchi, Giuseppe; Morris, John; Mortensen, Simon Stark; Morton, Alexander; Morvaj, Ljiljana; Mosidze, Maia; Moss, Josh; Motohashi, Kazuki; Mount, Richard; Mountricha, Eleni; Mouraviev, Sergei; Moyse, Edward; Muanza, Steve; Mudd, Richard; Mueller, Felix; Mueller, James; Mueller, Klemens; Mueller, Ralph Soeren Peter; Mueller, Thibaut; Muenstermann, Daniel; Mullen, Paul; Mullier, Geoffrey; Munwes, Yonathan; Murillo Quijada, Javier Alberto; Murray, Bill; Musheghyan, Haykuhi; Musto, Elisa; Myagkov, Alexey; Myska, Miroslav; Nackenhorst, Olaf; Nadal, Jordi; Nagai, Koichi; Nagai, Ryo; Nagai, Yoshikazu; Nagano, Kunihiro; Nagarkar, Advait; Nagasaka, Yasushi; Nagata, Kazuki; Nagel, Martin; Nagy, Elemer; Nairz, Armin Michael; Nakahama, Yu; Nakamura, Koji; Nakamura, Tomoaki; Nakano, Itsuo; Namasivayam, Harisankar; Naranjo Garcia, Roger Felipe; Narayan, Rohin; Naumann, Thomas; Navarro, Gabriela; Nayyar, Ruchika; Neal, Homer; Nechaeva, Polina; Neep, Thomas James; Nef, Pascal Daniel; Negri, Andrea; Negrini, Matteo; Nektarijevic, Snezana; Nellist, Clara; Nelson, Andrew; Nemecek, Stanislav; Nemethy, Peter; Nepomuceno, Andre Asevedo; Nessi, Marzio; Neubauer, Mark; Neumann, Manuel; Neves, Ricardo; Nevski, Pavel; Newman, Paul; Nguyen, Duong Hai; Nickerson, Richard; Nicolaidou, Rosy; Nicquevert, Bertrand; Nielsen, Jason; Nikiforou, Nikiforos; Nikiforov, Andriy; Nikolaenko, Vladimir; Nikolic-Audit, Irena; Nikolopoulos, Konstantinos; Nilsen, Jon Kerr; Nilsson, Paul; Ninomiya, Yoichi; Nisati, Aleandro; Nisius, Richard; Nobe, Takuya; Nomachi, Masaharu; Nomidis, Ioannis; Nooney, Tamsin; Norberg, Scarlet; Nordberg, Markus; Novgorodova, Olga; Nowak, Sebastian; Nozaki, Mitsuaki; Nozka, Libor; Ntekas, Konstantinos; Nunes Hanninger, Guilherme; Nunnemann, Thomas; Nurse, Emily; Nuti, Francesco; O'Brien, Brendan Joseph; O'grady, Fionnbarr; O'Neil, Dugan; O'Shea, Val; Oakham, Gerald; Oberlack, Horst; Obermann, Theresa; Ocariz, Jose; Ochi, Atsuhiko; Ochoa, Ines; Ochoa-Ricoux, Juan Pedro; Oda, Susumu; Odaka, Shigeru; Ogren, Harold; Oh, Alexander; Oh, Seog; Ohm, Christian; Ohman, Henrik; Oide, Hideyuki; Okamura, Wataru; Okawa, Hideki; Okumura, Yasuyuki; Okuyama, Toyonobu; Olariu, Albert; Olivares Pino, Sebastian Andres; Oliveira Damazio, Denis; Oliver Garcia, Elena; Olszewski, Andrzej; Olszowska, Jolanta; Onofre, António; Onyisi, Peter; Oram, Christopher; Oreglia, Mark; Oren, Yona; Orestano, Domizia; Orlando, Nicola; Oropeza Barrera, Cristina; Orr, Robert; Osculati, Bianca; Ospanov, Rustem; Otero y Garzon, Gustavo; Otono, Hidetoshi; Ouchrif, Mohamed; Ouellette, Eric; Ould-Saada, Farid; Ouraou, Ahmimed; Oussoren, Koen Pieter; Ouyang, Qun; Ovcharova, Ana; Owen, Mark; Owen, Rhys Edward; Ozcan, Veysi Erkcan; Ozturk, Nurcan; Pachal, Katherine; Pacheco Pages, Andres; Padilla Aranda, Cristobal; Pagáčová, Martina; Pagan Griso, Simone; Paganis, Efstathios; Pahl, Christoph; Paige, Frank; Pais, Preema; Pajchel, Katarina; Palacino, Gabriel; Palestini, Sandro; Palka, Marek; Pallin, Dominique; Palma, Alberto; Pan, Yibin; Panagiotopoulou, Evgenia; Pandini, Carlo Enrico; Panduro Vazquez, William; Pani, Priscilla; Panitkin, Sergey; Pantea, Dan; Paolozzi, Lorenzo; Papadopoulou, Theodora; Papageorgiou, Konstantinos; Paramonov, Alexander; Paredes Hernandez, Daniela; Parker, Michael Andrew; Parker, Kerry Ann; Parodi, Fabrizio; Parsons, John; Parzefall, Ulrich; Pasqualucci, Enrico; Passaggio, Stefano; Pastore, Fernanda; Pastore, Francesca; Pásztor, Gabriella; Pataraia, Sophio; Patel, Nikhul; Pater, Joleen; Pauly, Thilo; Pearce, James; Pearson, Benjamin; Pedersen, Lars Egholm; Pedersen, Maiken; Pedraza Lopez, Sebastian; Pedro, Rute; Peleganchuk, Sergey; Pelikan, Daniel; Peng, Haiping; Penning, Bjoern; Penwell, John; Perepelitsa, Dennis; Perez Codina, Estel; Pérez García-Estañ, María Teresa; Perini, Laura; Pernegger, Heinz; Perrella, Sabrina; Peschke, Richard; Peshekhonov, Vladimir; Peters, Krisztian; Peters, Yvonne; Petersen, Brian; Petersen, Troels; Petit, Elisabeth; Petridis, Andreas; Petridou, Chariclia; Petrolo, Emilio; Petrucci, Fabrizio; Pettersson, Nora Emilia; Pezoa, Raquel; Phillips, Peter William; Piacquadio, Giacinto; Pianori, Elisabetta; Picazio, Attilio; Piccaro, Elisa; Piccinini, Maurizio; Pickering, Mark Andrew; Piegaia, Ricardo; Pignotti, David; Pilcher, James; Pilkington, Andrew; Pina, João Antonio; Pinamonti, Michele; Pinfold, James; Pingel, Almut; Pinto, Belmiro; Pires, Sylvestre; Pitt, Michael; Pizio, Caterina; Plazak, Lukas; Pleier, Marc-Andre; Pleskot, Vojtech; Plotnikova, Elena; Plucinski, Pawel; Pluth, Daniel; Poettgen, Ruth; Poggioli, Luc; Pohl, David-leon; Polesello, Giacomo; Poley, Anne-luise; Policicchio, Antonio; Polifka, Richard; Polini, Alessandro; Pollard, Christopher Samuel; Polychronakos, Venetios; Pommès, Kathy; Pontecorvo, Ludovico; Pope, Bernard; Popeneciu, Gabriel Alexandru; Popovic, Dragan; Poppleton, Alan; Pospisil, Stanislav; Potamianos, Karolos; Potrap, Igor; Potter, Christina; Potter, Christopher; Poulard, Gilbert; Poveda, Joaquin; Pozdnyakov, Valery; Pralavorio, Pascal; Pranko, Aliaksandr; Prasad, Srivas; Prell, Soeren; Price, Darren; Price, Lawrence; Primavera, Margherita; Prince, Sebastien; Proissl, Manuel; Prokofiev, Kirill; Prokoshin, Fedor; Protopapadaki, Eftychia-sofia; Protopopescu, Serban; Proudfoot, James; Przybycien, Mariusz; Ptacek, Elizabeth; Puddu, Daniele; Pueschel, Elisa; Puldon, David; Purohit, Milind; Puzo, Patrick; Qian, Jianming; Qin, Gang; Qin, Yang; Quadt, Arnulf; Quarrie, David; Quayle, William; Queitsch-Maitland, Michaela; Quilty, Donnchadha; Raddum, Silje; Radeka, Veljko; Radescu, Voica; Radhakrishnan, Sooraj Krishnan; Radloff, Peter; Rados, Pere; Ragusa, Francesco; Rahal, Ghita; Rajagopalan, Srinivasan; Rammensee, Michael; Rangel-Smith, Camila; Rauscher, Felix; Rave, Stefan; Ravenscroft, Thomas; Raymond, Michel; Read, Alexander Lincoln; Readioff, Nathan Peter; Rebuzzi, Daniela; Redelbach, Andreas; Redlinger, George; Reece, Ryan; Reeves, Kendall; Rehnisch, Laura; Reisin, Hernan; Relich, Matthew; Rembser, Christoph; Ren, Huan; Renaud, Adrien; Rescigno, Marco; Resconi, Silvia; Rezanova, Olga; Reznicek, Pavel; Rezvani, Reyhaneh; Richter, Robert; Richter, Stefan; Richter-Was, Elzbieta; Ricken, Oliver; Ridel, Melissa; Rieck, Patrick; Riegel, Christian Johann; Rieger, Julia; Rijssenbeek, Michael; Rimoldi, Adele; Rinaldi, Lorenzo; Ristić, Branislav; Ritsch, Elmar; Riu, Imma; Rizatdinova, Flera; Rizvi, Eram; Robertson, Steven; Robichaud-Veronneau, Andree; Robinson, Dave; Robinson, James; Robson, Aidan; Roda, Chiara; Roe, Shaun; Røhne, Ole; Rolli, Simona; Romaniouk, Anatoli; Romano, Marino; Romano Saez, Silvestre Marino; Romero Adam, Elena; Rompotis, Nikolaos; Ronzani, Manfredi; Roos, Lydia; Ros, Eduardo; Rosati, Stefano; Rosbach, Kilian; Rose, Peyton; Rosendahl, Peter Lundgaard; Rosenthal, Oliver; Rossetti, Valerio; Rossi, Elvira; Rossi, Leonardo Paolo; Rosten, Rachel; Rotaru, Marina; Roth, Itamar; Rothberg, Joseph; Rousseau, David; Royon, Christophe; Rozanov, Alexandre; Rozen, Yoram; Ruan, Xifeng; Rubbo, Francesco; Rubinskiy, Igor; Rud, Viacheslav; Rudolph, Christian; Rudolph, Matthew Scott; Rühr, Frederik; Ruiz-Martinez, Aranzazu; Rurikova, Zuzana; Rusakovich, Nikolai; Ruschke, Alexander; Russell, Heather; Rutherfoord, John; Ruthmann, Nils; Ryabov, Yury; Rybar, Martin; Rybkin, Grigori; Ryder, Nick; Saavedra, Aldo; Sabato, Gabriele; Sacerdoti, Sabrina; Saddique, Asif; Sadrozinski, Hartmut; Sadykov, Renat; Safai Tehrani, Francesco; Saimpert, Matthias; Sakamoto, Hiroshi; Sakurai, Yuki; Salamanna, Giuseppe; Salamon, Andrea; Saleem, Muhammad; Salek, David; Sales De Bruin, Pedro Henrique; Salihagic, Denis; Salnikov, Andrei; Salt, José; Salvatore, Daniela; Salvatore, Pasquale Fabrizio; Salvucci, Antonio; Salzburger, Andreas; Sampsonidis, Dimitrios; Sanchez, Arturo; Sánchez, Javier; Sanchez Martinez, Victoria; Sandaker, Heidi; Sandbach, Ruth Laura; Sander, Heinz Georg; Sanders, Michiel; Sandhoff, Marisa; Sandoval, Carlos; Sandstroem, Rikard; Sankey, Dave; Sannino, Mario; Sansoni, Andrea; Santoni, Claudio; Santonico, Rinaldo; Santos, Helena; Santoyo Castillo, Itzebelt; Sapp, Kevin; Sapronov, Andrey; Saraiva, João; Sarrazin, Bjorn; Sasaki, Osamu; Sasaki, Yuichi; Sato, Koji; Sauvage, Gilles; Sauvan, Emmanuel; Savage, Graham; Savard, Pierre; Sawyer, Craig; Sawyer, Lee; Saxon, James; Sbarra, Carla; Sbrizzi, Antonio; Scanlon, Tim; Scannicchio, Diana; Scarcella, Mark; Scarfone, Valerio; Schaarschmidt, Jana; Schacht, Peter; Schaefer, Douglas; Schaefer, Ralph; Schaeffer, Jan; Schaepe, Steffen; Schaetzel, Sebastian; Schäfer, Uli; Schaffer, Arthur; Schaile, Dorothee; Schamberger, R Dean; Scharf, Veit; Schegelsky, Valery; Scheirich, Daniel; Schernau, Michael; Schiavi, Carlo; Schillo, Christian; Schioppa, Marco; Schlenker, Stefan; Schmidt, Evelyn; Schmieden, Kristof; Schmitt, Christian; Schmitt, Sebastian; Schmitt, Stefan; Schneider, Basil; Schnellbach, Yan Jie; Schnoor, Ulrike; Schoeffel, Laurent; Schoening, Andre; Schoenrock, Bradley Daniel; Schopf, Elisabeth; Schorlemmer, Andre Lukas; Schott, Matthias; Schouten, Doug; Schovancova, Jaroslava; Schramm, Steven; Schreyer, Manuel; Schroeder, Christian; Schuh, Natascha; Schultens, Martin Johannes; Schultz-Coulon, Hans-Christian; Schulz, Holger; Schumacher, Markus; Schumm, Bruce; Schune, Philippe; Schwanenberger, Christian; Schwartzman, Ariel; Schwarz, Thomas Andrew; Schwegler, Philipp; Schweiger, Hansdieter; Schwemling, Philippe; Schwienhorst, Reinhard; Schwindling, Jerome; Schwindt, Thomas; Sciacca, Gianfranco; Scifo, Estelle; Sciolla, Gabriella; Scuri, Fabrizio; Scutti, Federico; Searcy, Jacob; Sedov, George; Sedykh, Evgeny; Seema, Pienpen; Seidel, Sally; Seiden, Abraham; Seifert, Frank; Seixas, José; Sekhniaidze, Givi; Sekhon, Karishma; Sekula, Stephen; Seliverstov, Dmitry; Semprini-Cesari, Nicola; Serfon, Cedric; Serin, Laurent; Serkin, Leonid; Serre, Thomas; Sessa, Marco; Seuster, Rolf; Severini, Horst; Sfiligoj, Tina; Sforza, Federico; Sfyrla, Anna; Shabalina, Elizaveta; Shamim, Mansoora; Shan, Lianyou; Shang, Ruo-yu; Shank, James; Shapiro, Marjorie; Shatalov, Pavel; Shaw, Kate; Shaw, Savanna Marie; Shcherbakova, Anna; Shehu, Ciwake Yusufu; Sherwood, Peter; Shi, Liaoshan; Shimizu, Shima; Shimmin, Chase Owen; Shimojima, Makoto; Shiyakova, Mariya; Shmeleva, Alevtina; Shoaleh Saadi, Diane; Shochet, Mel; Shojaii, Seyedruhollah; Shrestha, Suyog; Shulga, Evgeny; Shupe, Michael; Shushkevich, Stanislav; Sicho, Petr; Sidiropoulou, Ourania; Sidorov, Dmitri; Sidoti, Antonio; Siegert, Frank; Sijacki, Djordje; Silva, José; Silver, Yiftah; Silverstein, Samuel; Simak, Vladislav; Simard, Olivier; Simic, Ljiljana; Simion, Stefan; Simioni, Eduard; Simmons, Brinick; Simon, Dorian; Simoniello, Rosa; Sinervo, Pekka; Sinev, Nikolai; Siragusa, Giovanni; Sisakyan, Alexei; Sivoklokov, Serguei; Sjölin, Jörgen; Sjursen, Therese; Skinner, Malcolm Bruce; Skottowe, Hugh Philip; Skubic, Patrick; Slater, Mark; Slavicek, Tomas; Slawinska, Magdalena; Sliwa, Krzysztof; Smakhtin, Vladimir; Smart, Ben; Smestad, Lillian; Smirnov, Sergei; Smirnov, Yury; Smirnova, Lidia; Smirnova, Oxana; Smith, Matthew; Smith, Russell; Smizanska, Maria; Smolek, Karel; Snesarev, Andrei; Snidero, Giacomo; Snyder, Scott; Sobie, Randall; Socher, Felix; Soffer, Abner; Soh, Dart-yin; Solans, Carlos; Solar, Michael; Solc, Jaroslav; Soldatov, Evgeny; Soldevila, Urmila; Solodkov, Alexander; Soloshenko, Alexei; Solovyanov, Oleg; Solovyev, Victor; Sommer, Philip; Song, Hong Ye; Soni, Nitesh; Sood, Alexander; Sopczak, Andre; Sopko, Bruno; Sopko, Vit; Sorin, Veronica; Sosa, David; Sosebee, Mark; Sotiropoulou, Calliope Louisa; Soualah, Rachik; Soukharev, Andrey; South, David; Sowden, Benjamin; Spagnolo, Stefania; Spalla, Margherita; Spanò, Francesco; Spearman, William Robert; Spettel, Fabian; Spighi, Roberto; Spigo, Giancarlo; Spiller, Laurence Anthony; Spousta, Martin; Spreitzer, Teresa; St Denis, Richard Dante; Staerz, Steffen; Stahlman, Jonathan; Stamen, Rainer; Stamm, Soren; Stanecka, Ewa; Stanescu, Cristian; Stanescu-Bellu, Madalina; Stanitzki, Marcel Michael; Stapnes, Steinar; Starchenko, Evgeny; Stark, Jan; Staroba, Pavel; Starovoitov, Pavel; Staszewski, Rafal; Stavina, Pavel; Steinberg, Peter; Stelzer, Bernd; Stelzer, Harald Joerg; Stelzer-Chilton, Oliver; Stenzel, Hasko; Stern, Sebastian; Stewart, Graeme; Stillings, Jan Andre; Stockton, Mark; Stoebe, Michael; Stoicea, Gabriel; Stolte, Philipp; Stonjek, Stefan; Stradling, Alden; Straessner, Arno; Stramaglia, Maria Elena; Strandberg, Jonas; Strandberg, Sara; Strandlie, Are; Strauss, Emanuel; Strauss, Michael; Strizenec, Pavol; Ströhmer, Raimund; Strom, David; Stroynowski, Ryszard; Strubig, Antonia; Stucci, Stefania Antonia; Stugu, Bjarne; Styles, Nicholas Adam; Su, Dong; Su, Jun; Subramaniam, Rajivalochan; Succurro, Antonella; Sugaya, Yorihito; Suhr, Chad; Suk, Michal; Sulin, Vladimir; Sultansoy, Saleh; Sumida, Toshi; Sun, Siyuan; Sun, Xiaohu; Sundermann, Jan Erik; Suruliz, Kerim; Susinno, Giancarlo; Sutton, Mark; Suzuki, Shota; Suzuki, Yu; Svatos, Michal; Swedish, Stephen; Swiatlowski, Maximilian; Sykora, Ivan; Sykora, Tomas; Ta, Duc; Taccini, Cecilia; Tackmann, Kerstin; Taenzer, Joe; Taffard, Anyes; Tafirout, Reda; Taiblum, Nimrod; Takai, Helio; Takashima, Ryuichi; Takeda, Hiroshi; Takeshita, Tohru; Takubo, Yosuke; Talby, Mossadek; Talyshev, Alexey; Tam, Jason; Tan, Kong Guan; Tanaka, Junichi; Tanaka, Reisaburo; Tanaka, Shuji; Tannenwald, Benjamin Bordy; Tannoury, Nancy; Tapprogge, Stefan; Tarem, Shlomit; Tarrade, Fabien; Tartarelli, Giuseppe Francesco; Tas, Petr; Tasevsky, Marek; Tashiro, Takuya; Tassi, Enrico; Tavares Delgado, Ademar; Tayalati, Yahya; Taylor, Frank; Taylor, Geoffrey; Taylor, Wendy; Teischinger, Florian Alfred; Teixeira Dias Castanheira, Matilde; Teixeira-Dias, Pedro; Temming, Kim Katrin; Ten Kate, Herman; Teng, Ping-Kun; Teoh, Jia Jian; Tepel, Fabian-Phillipp; Terada, Susumu; Terashi, Koji; Terron, Juan; Terzo, Stefano; Testa, Marianna; Teuscher, Richard; Therhaag, Jan; Theveneaux-Pelzer, Timothée; Thomas, Juergen; Thomas-Wilsker, Joshuha; Thompson, Emily; Thompson, Paul; Thompson, Ray; Thompson, Stan; Thomsen, Lotte Ansgaard; Thomson, Evelyn; Thomson, Mark; Thun, Rudolf; Tibbetts, Mark James; Ticse Torres, Royer Edson; Tikhomirov, Vladimir; Tikhonov, Yury; Timoshenko, Sergey; Tiouchichine, Elodie; Tipton, Paul; Tisserant, Sylvain; Todorov, Theodore; Todorova-Nova, Sharka; Tojo, Junji; Tokár, Stanislav; Tokushuku, Katsuo; Tollefson, Kirsten; Tolley, Emma; Tomlinson, Lee; Tomoto, Makoto; Tompkins, Lauren; Toms, Konstantin; Torrence, Eric; Torres, Heberth; Torró Pastor, Emma; Toth, Jozsef; Touchard, Francois; Tovey, Daniel; Trefzger, Thomas; Tremblet, Louis; Tricoli, Alessandro; Trigger, Isabel Marian; Trincaz-Duvoid, Sophie; Tripiana, Martin; Trischuk, William; Trocmé, Benjamin; Troncon, Clara; Trottier-McDonald, Michel; Trovatelli, Monica; True, Patrick; Truong, Loan; Trzebinski, Maciej; Trzupek, Adam; Tsarouchas, Charilaos; Tseng, Jeffrey; Tsiareshka, Pavel; Tsionou, Dimitra; Tsipolitis, Georgios; Tsirintanis, Nikolaos; Tsiskaridze, Shota; Tsiskaridze, Vakhtang; Tskhadadze, Edisher; Tsukerman, Ilya; Tsulaia, Vakhtang; Tsuno, Soshi; Tsybychev, Dmitri; Tudorache, Alexandra; Tudorache, Valentina; Tuna, Alexander Naip; Tupputi, Salvatore; Turchikhin, Semen; Turecek, Daniel; Turra, Ruggero; Turvey, Andrew John; Tuts, Michael; Tykhonov, Andrii; Tylmad, Maja; Tyndel, Mike; Ueda, Ikuo; Ueno, Ryuichi; Ughetto, Michael; Ugland, Maren; Uhlenbrock, Mathias; Ukegawa, Fumihiko; Unal, Guillaume; Undrus, Alexander; Unel, Gokhan; Ungaro, Francesca; Unno, Yoshinobu; Unverdorben, Christopher; Urban, Jozef; Urquijo, Phillip; Urrejola, Pedro; Usai, Giulio; Usanova, Anna; Vacavant, Laurent; Vacek, Vaclav; Vachon, Brigitte; Valderanis, Chrysostomos; Valencic, Nika; Valentinetti, Sara; Valero, Alberto; Valery, Loic; Valkar, Stefan; Valladolid Gallego, Eva; Vallecorsa, Sofia; Valls Ferrer, Juan Antonio; Van Den Wollenberg, Wouter; Van Der Deijl, Pieter; van der Geer, Rogier; van der Graaf, Harry; Van Der Leeuw, Robin; van Eldik, Niels; van Gemmeren, Peter; Van Nieuwkoop, Jacobus; van Vulpen, Ivo; van Woerden, Marius Cornelis; Vanadia, Marco; Vandelli, Wainer; Vanguri, Rami; Vaniachine, Alexandre; Vannucci, Francois; Vardanyan, Gagik; Vari, Riccardo; Varnes, Erich; Varol, Tulin; Varouchas, Dimitris; Vartapetian, Armen; Varvell, Kevin; Vassilakopoulos, Vassilios; Vazeille, Francois; Vazquez Schroeder, Tamara; Veatch, Jason; Veloce, Laurelle Maria; Veloso, Filipe; Velz, Thomas; Veneziano, Stefano; Ventura, Andrea; Ventura, Daniel; Venturi, Manuela; Venturi, Nicola; Venturini, Alessio; Vercesi, Valerio; Verducci, Monica; Verkerke, Wouter; Vermeulen, Jos; Vest, Anja; Vetterli, Michel; Viazlo, Oleksandr; Vichou, Irene; Vickey, Trevor; Vickey Boeriu, Oana Elena; Viehhauser, Georg; Viel, Simon; Vigne, Ralph; Villa, Mauro; Villaplana Perez, Miguel; Vilucchi, Elisabetta; Vincter, Manuella; Vinogradov, Vladimir; Vivarelli, Iacopo; Vives Vaque, Francesc; Vlachos, Sotirios; Vladoiu, Dan; Vlasak, Michal; Vogel, Marcelo; Vokac, Petr; Volpi, Guido; Volpi, Matteo; von der Schmitt, Hans; von Radziewski, Holger; von Toerne, Eckhard; Vorobel, Vit; Vorobev, Konstantin; Vos, Marcel; Voss, Rudiger; Vossebeld, Joost; Vranjes, Nenad; Vranjes Milosavljevic, Marija; Vrba, Vaclav; Vreeswijk, Marcel; Vuillermet, Raphael; Vukotic, Ilija; Vykydal, Zdenek; Wagner, Peter; Wagner, Wolfgang; Wahlberg, Hernan; Wahrmund, Sebastian; Wakabayashi, Jun; Walder, James; Walker, Rodney; Walkowiak, Wolfgang; Wang, Chao; Wang, Fuquan; Wang, Haichen; Wang, Hulin; Wang, Jike; Wang, Jin; Wang, Kuhan; Wang, Rui; Wang, Song-Ming; Wang, Tan; Wang, Xiaoxiao; Wanotayaroj, Chaowaroj; Warburton, Andreas; Ward, Patricia; Wardrope, David Robert; Warsinsky, Markus; Washbrook, Andrew; Wasicki, Christoph; Watkins, Peter; Watson, Alan; Watson, Ian; Watson, Miriam; Watts, Gordon; Watts, Stephen; Waugh, Ben; Webb, Samuel; Weber, Michele; Weber, Stefan Wolf; Webster, Jordan S; Weidberg, Anthony; Weinert, Benjamin; Weingarten, Jens; Weiser, Christian; Weits, Hartger; Wells, Phillippa; Wenaus, Torre; Wengler, Thorsten; Wenig, Siegfried; Wermes, Norbert; Werner, Matthias; Werner, Per; Wessels, Martin; Wetter, Jeffrey; Whalen, Kathleen; Wharton, Andrew Mark; White, Andrew; White, Martin; White, Ryan; White, Sebastian; Whiteson, Daniel; Wickens, Fred; Wiedenmann, Werner; Wielers, Monika; Wienemann, Peter; Wiglesworth, Craig; Wiik-Fuchs, Liv Antje Mari; Wildauer, Andreas; Wilkens, Henric George; Williams, Hugh; Williams, Sarah; Willis, Christopher; Willocq, Stephane; Wilson, Alan; Wilson, John; Wingerter-Seez, Isabelle; Winklmeier, Frank; Winter, Benedict Tobias; Wittgen, Matthias; Wittkowski, Josephine; Wollstadt, Simon Jakob; Wolter, Marcin Wladyslaw; Wolters, Helmut; Wosiek, Barbara; Wotschack, Jorg; Woudstra, Martin; Wozniak, Krzysztof; Wu, Mengqing; Wu, Miles; Wu, Sau Lan; Wu, Xin; Wu, Yusheng; Wyatt, Terry Richard; Wynne, Benjamin; Xella, Stefania; Xu, Da; Xu, Lailin; Yabsley, Bruce; Yacoob, Sahal; Yakabe, Ryota; Yamada, Miho; Yamaguchi, Yohei; Yamamoto, Akira; Yamamoto, Shimpei; Yamanaka, Takashi; Yamauchi, Katsuya; Yamazaki, Yuji; Yan, Zhen; Yang, Haijun; Yang, Hongtao; Yang, Yi; Yao, Weiming; Yasu, Yoshiji; Yatsenko, Elena; Yau Wong, Kaven Henry; Ye, Jingbo; Ye, Shuwei; Yeletskikh, Ivan; Yen, Andy L; Yildirim, Eda; Yorita, Kohei; Yoshida, Rikutaro; Yoshihara, Keisuke; Young, Charles; Young, Christopher John; Youssef, Saul; Yu, David Ren-Hwa; Yu, Jaehoon; Yu, Jiaming; Yu, Jie; Yuan, Li; Yurkewicz, Adam; Yusuff, Imran; Zabinski, Bartlomiej; Zaidan, Remi; Zaitsev, Alexander; Zalieckas, Justas; Zaman, Aungshuman; Zambito, Stefano; Zanello, Lucia; Zanzi, Daniele; Zeitnitz, Christian; Zeman, Martin; Zemla, Andrzej; Zengel, Keith; Zenin, Oleg; Ženiš, Tibor; Zerwas, Dirk; Zhang, Dongliang; Zhang, Fangzhou; Zhang, Huijun; Zhang, Jinlong; Zhang, Lei; Zhang, Ruiqi; Zhang, Xueyao; Zhang, Zhiqing; Zhao, Xiandong; Zhao, Yongke; Zhao, Zhengguo; Zhemchugov, Alexey; Zhong, Jiahang; Zhou, Bing; Zhou, Chen; Zhou, Lei; Zhou, Li; Zhou, Ning; Zhu, Cheng Guang; Zhu, Hongbo; Zhu, Junjie; Zhu, Yingchun; Zhuang, Xuai; Zhukov, Konstantin; Zibell, Andre; Zieminska, Daria; Zimine, Nikolai; Zimmermann, Christoph; Zimmermann, Stephanie; Zinonos, Zinonas; Zinser, Markus; Ziolkowski, Michael; Živković, Lidija; Zobernig, Georg; Zoccoli, Antonio; zur Nedden, Martin; Zurzolo, Giovanni; Zwalinski, Lukasz

2016-01-05

The decays $B_c^+ \\to J/\\psi D_s^+$ and $B_c^+ \\to J/\\psi D_s^{*+}$ are studied with the ATLAS detector at the LHC using a dataset corresponding to integrated luminosities of 4.9 fb$^{-1}$ and 20.6 fb$^{-1}$ of $pp$ collisions collected at centre-of-mass energies $\\sqrt{s} = 7$ TeV and 8 TeV, respectively. Signal candidates are identified through $J/\\psi\\to\\mu^+\\mu^-$ and $D_s^{(*)+}\\to\\phi\\pi^+(\\gamma/\\pi^0)$ decays. With a two-dimensional likelihood fit involving the $B_c^+$ reconstructed invariant mass and an angle between the $\\mu^+$ and $D_s^+$ candidate momenta in the muon pair rest frame, the yields of $B_c^+ \\to J/\\psi D_s^+$ and $B_c^+ \\to J/\\psi D_s^{*+}$, and the transverse polarisation fraction in $B_c^+ \\to J/\\psi D_s^{*+}$ decay are measured. The transverse polarisation fraction is determined to be $\\Gamma_{\\pm\\pm}(B_c^+ \\to J/\\psi D_s^{*+})/\\Gamma(B_c^+ \\to J/\\psi D_s^{*+}) = 0.38 \\pm 0.23 \\pm 0.07$, and the derived ratio of the branching fractions of the two modes is $\\mathcal{B}_{B_c^+ \\to J/...
Hemoglobin C, S-C, and E Diseases

Science.gov (United States)

... quickly than others, resulting in chronic anemia. Hemoglobin C disease Hemoglobin C disease occurs mostly in blacks. ... a common complication of hemoglobin C disease. Hemoglobin S-C disease Hemoglobin S-C disease occurs in people who ...
Prediction of backbone dihedral angles and protein secondary structure using support vector machines

Directory of Open Access Journals (Sweden)

Hirst Jonathan D

2009-12-01

Full Text Available Abstract Background The prediction of the secondary structure of a protein is a critical step in the prediction of its tertiary structure and, potentially, its function. Moreover, the backbone dihedral angles, highly correlated with secondary structures, provide crucial information about the local three-dimensional structure. Results We predict independently both the secondary structure and the backbone dihedral angles and combine the results in a loop to enhance each prediction reciprocally. Support vector machines, a state-of-the-art supervised classification technique, achieve secondary structure predictive accuracy of 80% on a non-redundant set of 513 proteins, significantly higher than other methods on the same dataset. The dihedral angle space is divided into a number of regions using two unsupervised clustering techniques in order to predict the region in which a new residue belongs. The performance of our method is comparable to, and in some cases more accurate than, other multi-class dihedral prediction methods. Conclusions We have created an accurate predictor of backbone dihedral angles and secondary structure. Our method, called DISSPred, is available online at http://comp.chem.nottingham.ac.uk/disspred/.
C S Sanmathi

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science. C S Sanmathi. Articles written in Bulletin of Materials Science. Volume 27 Issue 3 June 2004 pp 243-249 Polymers. Terpolymerization of 2-ethoxy ethylmethacrylate, styrene and maleic anhydride: determination of the reactivity ratios · C S Sanmathi S Prasannakumar B S ...

C S Smith

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education. C S Smith. Articles written in Resonance – Journal of Science Education. Volume 11 Issue 6 June 2006 pp 79-93 Classics. Excerpts from A Search for Structure · C S Smith · More Details Fulltext PDF ...
Predicting backbone Cα angles and dihedrals from protein sequences by stacked sparse auto-encoder deep neural network.

Science.gov (United States)

Lyons, James; Dehzangi, Abdollah; Heffernan, Rhys; Sharma, Alok; Paliwal, Kuldip; Sattar, Abdul; Zhou, Yaoqi; Yang, Yuedong

2014-10-30

Because a nearly constant distance between two neighbouring Cα atoms, local backbone structure of proteins can be represented accurately by the angle between C(αi-1)-C(αi)-C(αi+1) (θ) and a dihedral angle rotated about the C(αi)-C(αi+1) bond (τ). θ and τ angles, as the representative of structural properties of three to four amino-acid residues, offer a description of backbone conformations that is complementary to φ and ψ angles (single residue) and secondary structures (>3 residues). Here, we report the first machine-learning technique for sequence-based prediction of θ and τ angles. Predicted angles based on an independent test have a mean absolute error of 9° for θ and 34° for τ with a distribution on the θ-τ plane close to that of native values. The average root-mean-square distance of 10-residue fragment structures constructed from predicted θ and τ angles is only 1.9Å from their corresponding native structures. Predicted θ and τ angles are expected to be complementary to predicted ϕ and ψ angles and secondary structures for using in model validation and template-based as well as template-free structure prediction. The deep neural network learning technique is available as an on-line server called Structural Property prediction with Integrated DEep neuRal network (SPIDER) at http://sparks-lab.org. Copyright © 2014 Wiley Periodicals, Inc.
S C Raghavendra

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science. S C Raghavendra. Articles written in Bulletin of Materials Science. Volume 25 Issue 1 February 2002 pp 37-39 Electrical Properties. Dielectric properties of fly ash · S C Raghavendra R L Raibagkar A B Kulkarni · More Details Abstract Fulltext PDF. This paper reports the ...
[(4S,5S-2,2-Dimethyl-1,3-dioxolane-4,5-diyl]bis[N-(thiophen-2-ylmethylidenemethanamine

Directory of Open Access Journals (Sweden)

Yan Jiang

2012-02-01

Full Text Available In the title compound, C17H20N2O2S2, the five-membered heterocycle exhibits an envelope conformation and the molecular chirality and configuration are well preserved from l-tartaric acid. The dihedral angle between the two thiophene rings is 17.0 (2°. In the crystal, molecules are linked by C—H...O and C—H...S hydrogen interactions, which are effective in the stabilization of the crystal structure.
L C S Murthy

Indian Academy of Sciences (India)

Home; Journals; Bulletin of Materials Science. L C S Murthy. Articles written in Bulletin of Materials Science. Volume 27 Issue 3 June 2004 pp 295-301 Thin Films. Studies on tin oxide films prepared by electron beam evaporation and spray pyrolysis methods · K S Shamala L C S Murthy K Narasimha Rao · More Details ...
(1S,3S,4S-tert-Butyl N-[1-benzyl-3-hydroxy-5-phenyl-4-(picolinamidopentyl]carbamate

Directory of Open Access Journals (Sweden)

Jian-Feng Zheng

2008-07-01

Full Text Available The title compound, C29H35N3O4, was obtained by the reaction of (2S,4S,5S-tert-butyl N-(4-amino-1-benzyl-3-hydroxy-5-phenylpentylcarbamate and picolinic acid using oxalyl chloride as a chlorinating reagent to activate the carboxyl group. In the crystal structure there are two molecules in the asymmetric unit, which are aligned edge-to-face. In one molecule, the pyridyl ring forms a dihedral angle of 22.0 (1° with the phenyl ring of the terminal benzyl group and 14.3 (1° with the other phenyl ring; in the other molecule, the corresponding angles are 12.1 (1 and 10.6 (1°, respectively. The packing is stabilized by intermolecular hydrogen bonds and C—H...π interactions.
5-(4-Methylphenylsulfonyl-1,3-dithiolo[4,5-c]pyrrole-2-thione

Directory of Open Access Journals (Sweden)

Ning-Juan Zheng

2012-04-01

Full Text Available The asymmetric unit of the title compound, C12H9NO2S4, contains one half-molecule with the N, two S amd four C atoms lying on a mirror plane. The molecule exhibits a V-shaped conformation, with a dihedral angle of 87.00 (7° between the benzene and dithiolopyrrole rings. The methyl group was treated as rotationally disordered between two orientations in a 1:1 ratio. In the crystal, weak C—H...O hydrogen bonds link the molecules into chains in [010].
C&S Enterprise, L.L.C.

Science.gov (United States)

The EPA is providing notice of a proposed Administrative Penalty Assessment against C & S Enterprise, L.L.C. (“Respondent”), a business located at 2454 480th Ave, Deep River, IA 52222, for alleged violations of the Clean Water Act at property owned by Resp
Benzyl N-((S-2-hydroxy-1-{N′-[(E-2-methoxybenzylidene]hydrazinecarbonyl}ethylcarbamate from synchrotron data

Directory of Open Access Journals (Sweden)

Alessandra C. Pinheiro

2010-04-01

Full Text Available A U-shaped conformation is found in the title compound, C19H21N3O5, with the benzene rings lying to the same side of the molecule; the dihedral angle between them is 10.83 (16°. The dihedral angle formed between the hydrazinecarbonyl and carbamate residues is 68.42 (13°. The carbonyl groups lie approximately at right angles to each other [O—C...C—O pseudo torsion angle of 107.7 (3°], and the conformation about the C12=N3 bond [1.279 (4 Å] is E. An intramolecular Ncb—H...Ohy (cb = carbmate and hy = hydroxy hydrogen bond occurs, generating an S(6 loop. In the crystal, intermolecular Oh—H...Oca (ca = carbonyl and Nhz—H...Oca (hz = hydrazine hydrogen bonds lead to the formation of a supramolecular chain, two molecules thick, which propagates along the a axis; these are connected by C—H...Oca contacts.
Complete cDNA sequence of human complement C1s and close physical linkage of the homologous genes C1s and C1r

International Nuclear Information System (INIS)

Tosi, M.; Duponchel, C.; Meo, T.; Julier, C.

1987-01-01

Overlapping molecular clones encoding the complement subcomponent C1s were isolated from a human liver cDNA library. The nucleotide sequence reconstructed from these clones spans about 85% of the length of the liver C1s messenger RNAs, which occur in three distinct size classes around 3 kilobases in length. Comparisons with the sequence of C1r, the other enzymatic subcomponent of C1, reveal 40% amino acid identity and conservation of all the cysteine residues. Beside the serine protease domain, the following sequence motifs, previously described in C1r, were also found in C1s: (a) two repeats of the type found in the Ba fragment of complement factor B and in several other complement but also noncomplement proteins, (b) a cysteine-rich segment homologous to the repeats of epidermal growth factor precursor, and (c) a duplicated segment found only in C1r and C1s. Differences in each of these structural motifs provide significant clues for the interpretation of the functional divergence of these interacting serine protease zymogens. Hybridizations of C1r and C1s probes to restriction endonuclease fragments of genomic DNA demonstrate close physical linkage of the corresponding genes. The implications of this finding are discussed with respect to the evolution of C1r and C1s after their origin by tandem gene duplication and to the previously observed combined hereditary deficiencies of Clr and Cls
t-3-Benzyl-r-2,c-6-diphenylpiperidin-4-one oxime

Directory of Open Access Journals (Sweden)

R. Arulraj

2016-12-01

Full Text Available In the title compound, C24H24N2O [systematic name: (E-3-benzyl-2,6-diphenylpiperidin-4-one oxime], the piperidine ring adopts a slightly distorted chair conformation and the phenyl rings and the benzyl group substituents are attached equatorially. The oxime group makes a dihedral angle of 42.88 (12° with the piperidine ring. The dihedral angle between the phenyl rings is 71.96 (8°. The benzyl ring makes dihedral angles of 63.01 (8 and 59.35 (8° with the two phenyl rings. In the crystal, molecules are linked by O—H...N hydrogen bonds, forming C(7 chains along the c axis. The chains are linked by C—H...π interactions, forming slabs lying parallel to the bc plane.
V S C Manga Rao

Indian Academy of Sciences (India)

Home; Journals; Pramana – Journal of Physics. V S C Manga Rao. Articles written in Pramana – Journal of Physics. Volume 61 Issue 3 September 2003 pp 563-575 Research Articles. Phase conjugation of gap solitons: A numerical study · V S C Manga Rao S Dutta Gupta · More Details Abstract Fulltext PDF. We study the ...
Thermodynamic properties of hydrated cement phases: C-S-H, C-A-S-H and M-S-H

International Nuclear Information System (INIS)

Roosz, Cedric

2016-01-01

Concrete is one of the most widely used building materials in the world. Durability, mechanical and chemical properties have made it a material of choice in storage concepts proposed by the French National Agency for Radioactive Waste Management (Andra), including the achievement of retaining structures, cell plugs, massive supports or conditioning waste. The study of the stability of the constituent phases of cementitious materials is needed in view of the planned quantities and the durability of the structures, and must consider (i) temperature ranges suitable for cement matrices containment in contact with exothermic waste (25-80 deg. C), and (ii) a representative time scale of the lifetime of the storage. The Andra ThermoChimie project therefore aims to develop a consistent thermodynamic database, to model the chemical evolution of cement materials in the environment of radioactive waste. However, in the present state, the database offers only thermodynamic data of cementitious crystalline phases, as well as a limited data set of three different chemical compositions for nano-crystalline C-S-H. This does not allow to reproduce the degradation of cementitious materials, or model the degradation of the new formulations, such as 'Low pH' concretes. The objective is therefore to acquire a thermodynamic complementary data set on phases such as C-S-H (Calcium Silicate Hydrates) C-A-S-H (Calcium Aluminate Silicate Hydrates) and M-S-H (Magnesium Silicate Hydrates), to complete the ThermoChimie database. This study is based on experimental, analytical and digital work, in order to obtain a set of thermodynamic data (Δ f G 0 , Δ f H 0 , Cp(T), S 0 ) sufficiently representative of the chemical variability of these phases. Finally, this set of data allows the development of a thermodynamic predictive model in extended spaces of compositions and temperatures. Development of this predictive model requires (i) The acquisition of thermodynamic properties on
78 FR 42999 - City of Pickens, S.C. and City of Easley, S.C.-Acquisition Exemption-Pickens Railway Company

Science.gov (United States)

2013-07-18

....C. and City of Easley, S.C.--Acquisition Exemption--Pickens Railway Company The City of Pickens, S.C., and the City of Easley, S.C. (collectively, the Cities or Petitioners), both noncarrier political..., 16 U.S.C. 1247(d), and 49 CFR 1152.29 to permit the Cities to negotiate with Pickens Railway to...
Observation of $B^+_c \\rightarrow J/\\psi D_s^+$ and $B^+_c \\rightarrow J/\\psi D_s^{*+}$ decays

CERN Document Server

Aaij, R; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves Jr, A A; Amato, S; Amerio, S; Amhis, Y; Anderlini, L; Anderson, J; Andreassen, R; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Bachmann, S; Back, J J; Baesso, C; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bauer, Th; Bay, A; Beddow, J; Bedeschi, F; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Benayoun, M; Bencivenni, G; Benson, S; Benton, J; Berezhnoy, A; Bernet, R; Bettler, M -O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blouw, J; Blusk, S; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bowen, E; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Burducea, I; Bursche, A; Busetto, G; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Campora Perez, D; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carranza-Mejia, H; Carson, L; Carvalho Akiba, K; Casse, G; Cattaneo, M; Cauet, Ch; Charles, M; Charpentier, Ph; Chen, P; Chiapolini, N; Chrzaszcz, M; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Cogneras, E; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Coquereau, S; Corti, G; Couturier, B; Cowan, G A; Craik, D C; Cunliffe, S; Currie, R; D'Ambrosio, C; David, P; David, P N Y; Davis, A; De Bonis, I; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Silva, W; De Simone, P; Decamp, D; Deckenhoff, M; Del Buono, L; Derkach, D; Deschamps, O; Dettori, F; Di Canto, A; Dijkstra, H; Dogaru, M; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisenhardt, S; Eitschberger, U; Ekelhof, R; Eklund, L; El Rifai, I; Elsasser, Ch; Elsby, D; Falabella, A; Färber, C; Fardell, G; Farinelli, C; Farry, S; Fave, V; Ferguson, D; Fernandez Albor, V; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fiore, M; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furcas, S; Furfaro, E; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garofoli, J; Garosi, P; Garra Tico, J; Garrido, L; Gaspar, C; Gauld, R; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gordon, H; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Grünberg, O; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hall, S; Hampson, T; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; Hartmann, T; He, J; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hicks, E; Hill, D; Hoballah, M; Hombach, C; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Hussain, N; Hutchcroft, D; Hynds, D; Iakovenko, V; Idzik, M; Ilten, P; Jacobsson, R; Jaeger, A; Jans, E; Jaton, P; Jing, F; John, M; Johnson, D; Jones, C R; Jost, B; Kaballo, M; Kandybei, S; Karacson, M; Karbach, T M; Kenyon, I R; Kerzel, U; Ketel, T; Keune, A; Khanji, B; Kochebina, O; Komarov, I; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kucharczyk, M; Kudryavtsev, V; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J -P; Lefèvre, R; Leflat, A; Lefrançois, J; Leo, S; Leroy, O; Lesiak, T; Leverington, B; Li, Y; Li Gioi, L; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; Lohn, S; Longstaff, I; Lopes, J H; Lopez Asamar, E; Lopez-March, N; Lu, H; Lucchesi, D; Luisier, J; Luo, H; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Malde, S; Manca, G; Mancinelli, G; Marconi, U; Märki, R; Marks, J; Martellotti, G; Martens, A; Martin, L; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Martins Tostes, D; Massafferri, A; Matev, R; Mathe, Z; Matteuzzi, C; Maurice, E; Mazurov, A; McCarthy, J; McNab, A; McNulty, R; Meadows, B; Meier, F; Meissner, M; Merk, M; Milanes, D A; Minard, M -N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Morello, M J; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neufeld, N; Nguyen, A D; Nguyen, T D; Nguyen-Mau, C; Nicol, M; Niess, V; Niet, R; Nikitin, N; Nikodem, T; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Oyanguren, A; Pal, B K; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perego, D L; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pessina, G; Petridis, K; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pietrzyk, B; Pilař, T; Pinci, D; Playfer, S; Plo Casasus, M; Polci, F; Polok, G; Poluektov, A; Polycarpo, E; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pugatch, V; Puig Navarro, A; Punzi, G; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Rauschmayr, N; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, A; Rinnert, K; Rives Molina, V; Roa Romero, D A; Robbe, P; Rodrigues, E; Rodriguez Perez, P; Roiser, S; Romanovsky, V; Romero Vidal, A; Rouvinet, J; Ruf, T; Ruffini, F; Ruiz, H; Ruiz Valls, P; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salzmann, C; Sanmartin Sedes, B; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schindler, H; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M -H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Skwarnicki, T; Smith, N A; Smith, E; Smith, M; Sokoloff, M D; Soler, F J P; Soomro, F; Souza, D; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Swientek, S; Syropoulos, V; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teklishyn, M; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Tonelli, D; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tresch, M; Tsaregorodtsev, A; Tsopelas, P; Tuning, N; Ubeda Garcia, M; Ukleja, A; Urner, D; Uwer, U; Vagnoni, V; Valenti, G; Vazquez Gomez, R; Vazquez Regueiro, P; Vecchi, S; Velthuis, J J; Veltri, M; Veneziano, G; Vesterinen, M; Viaud, B; Vieira, D; Vilasis-Cardona, X; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voß, C; Voss, H; Waldi, R; Wallace, R; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wicht, J; Wiechczynski, J; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wishahi, J; Witek, M; Wotton, S A; Wright, S; Wu, S; Wyllie, K; Xie, Y; Xing, F; Xing, Z; Yang, Z; Young, R; Yuan, X; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhokhov, A; Zhong, L; Zvyagin, A

2013-01-01

The decays $B^+_c \\rightarrow J/\\psi D_s^+$ and $B^+_c \\rightarrow J/\\psi D_s^{*+}$ are observed for the first time using a dataset, corresponding to an integrated luminosity of 3$fb^{-1}$, collected by the LHCb experiment in proton-proton collisions at centre-of-mass energies of $\\sqrt{s}$=7 and 8 TeV. The statistical significance for both signals is in excess of 9 standard deviations. The following ratios of branching fractions are measured to be \\begin{equation*}BR( B^+_c \\rightarrow J/\\psi D_s^+)/BR( B^+_c \\rightarrow J/\\psi \\pi+ ) = 2.90 \\pm 0.57 \\pm 0.24$,\\end{equation*} \\begin{equation*}BR( B^+_c \\rightarrow J/\\psi D_s^{*+} ) / BR ( B^+_c \\rightarrow J/\\psi D_s^+ ) = 2.37 \\pm 0.56 \\pm 0.10, \\end{equation*} where the first uncertainties are statistical and the second systematic. The mass of the $B^+_c$ meson is measured to be \\begin{equation*}m_{B^+_c} = 6276.28 \\pm 1.44 (stat) \\pm 0.36(syst) MeV/c^2,\\end{equation*} using the $B^+_c \\rightarrow J/\\psi D_...
Tuning cofactor redox potentials: the 2-methoxy dihedral angle generates a redox potential difference of >160 mV between the primary (Q(A)) and secondary (Q(B)) quinones of the bacterial photosynthetic reaction center.

Science.gov (United States)

Taguchi, Alexander T; Mattis, Aidas J; O'Malley, Patrick J; Dikanov, Sergei A; Wraight, Colin A

2013-10-15

Only quinones with a 2-methoxy group can act simultaneously as the primary (QA) and secondary (QB) electron acceptors in photosynthetic reaction centers from Rhodobacter sphaeroides. (13)C hyperfine sublevel correlation measurements of the 2-methoxy in the semiquinone states, SQA and SQB, were compared with quantum mechanics calculations of the (13)C couplings as a function of the dihedral angle. X-ray structures support dihedral angle assignments corresponding to a redox potential gap (ΔEm) between QA and QB of ~180 mV. This is consistent with the failure of a ubiquinone analogue lacking the 2-methoxy to function as QB in mutant reaction centers with a ΔEm of ≈160-195 mV.
L-band brightness temperature disaggregation for use with S-band and C-band radiometer data for WCOM

Science.gov (United States)

Yao, P.; Shi, J.; Zhao, T.; Cosh, M. H.; Bindlish, R.

2017-12-01

There are two passive microwave sensors onboard the Water Cycle Observation Mission (WCOM), which includes a synthetic aperture radiometer operating at L-S-C bands and a scanning microwave radiometer operating from C- to W-bands. It provides a unique opportunity to disaggregate L-band brightness temperature (soil moisture) with S-band C-bands radiometer data. In this study, passive-only downscaling methodologies are developed and evaluated. Based on the radiative transfer modeling, it was found that the TBs (brightness temperature) between the L-band and S-band exhibit a linear relationship, and there is an exponential relationship between L-band and C-band. We carried out the downscaling results by two methods: (1) downscaling with L-S-C band passive measurements with the same incidence angle from payload IMI; (2) downscaling with L-C band passive measurements with different incidence angle from payloads IMI and PMI. The downscaling method with L-S bands with the same incident angle was first evaluated using SMEX02 data. The RMSE are 2.69 K and 1.52 K for H and V polarization respectively. The downscaling method with L-C bands is developed with different incident angles using SMEX03 data. The RMSE are 2.97 K and 2.68 K for H and V polarization respectively. These results showed that high-resolution L-band brightness temperature and soil moisture products could be generated from the future WCOM passive-only observations.
Dihedral angle control to improve the charge transport properties of conjugated polymers in organic field effect transistors

Science.gov (United States)

Dharmapurikar, Satej S.; Chithiravel, Sundaresan; Mane, Manoj V.; Deshmukh, Gunvant; Krishnamoorthy, Kothandam

2018-03-01

Diketopyrrolopyrrole (DPP) and i-Indigo (i-Ind) are two monomers that are widely explored as active materials in organic field effect transistor and solar cells. These two molecules showed impressive charge carrier mobility due to better packing that are facilitated by quadrupoles. We hypothesized that the copolymers of these monomers would also exhibit high charge carrier mobility. However, we envisioned that the dihedral angle at the connecting point between the monomers will play a crucial role in packing as well as charge transport. To understand the impact of dihedral angle on charge transport, we synthesized three copolymers, wherein the DPP was sandwiched between benzenes, thiophenes and furans. The copolymer of i-Indigo and furan comprising DPP showed a band gap of 1.4 eV with a very high dihedral angle of 179°. The polymer was found to pack better and the coherence length was found to be 112 Å. The hole carrier mobility of these polymer was found to be highest among the synthesized polymer i.e. 0.01 cm2/vs. The copolymer comprising benzene did not transport hole and electrons. The dihedral angle at the connecting point between i and Indigo and benzene DPP was 143 Å, which the packing and consequently charge transport properties.
2,6-Bis(2-hydroxyethyl-8b,8c-diphenylperhydro-2,3a,4a,6,7a,8a-hexaazacyclopenta[def]fluorene-4,8-dithione

Directory of Open Access Journals (Sweden)

Zihua Wang

2009-06-01

Full Text Available In the title molecule, C24H28N6O2S2, the dihedral angle between the aromatic ring planes is 42.2 (1°. In the crystal structure, the hydroxy groups are involved in O—H...S hydrogen bonding, which links the molecules into corrugated layers propagating parallel to the bc plane.
Rietveld refinement of the structures of 1.0 C-S-H and 1.5 C-S-H

KAUST Repository

Battocchio, Francesco

2012-11-01

Low-Q region Rietveld analyses were performed on C-S-H synchrotron XRD patterns, using the software MAUD. Two different crystal structures of tobermorite 11 Å were used as a starting model: monoclinic ordered Merlino tobermorite, and orthorhombic disordered Hamid tobermorite. Structural modifications were required to adapt the structures to the chemical composition and the different interlayer spacing of the C-S-H samples. Refinement of atomic positions was done by using special constraints called fragments that maintain interatomic distances and orientations within atomic polyhedra. Anisotropic crystallite size refinement showed that C-S-H has a nanocrystalline disordered structure with a preferred direction of elongation of the nanocrystallites in the plane of the Ca interlayer. The quality of the fit showed that the monoclinic structure gives a more adequate representation of C-S-H, whereas the disordered orthorhombic structure can be considered a more realistic model if the lack of long-range order of the silica chain along the c-direction is assumed. © 2012 Elsevier Ltd. All rights reserved.

Electric Dipole-Magnetic Dipole Polarizability and Anapole Magnetizability of Hydrogen Peroxide as Functions of the HOOH Dihedral Angle.

Science.gov (United States)

Pelloni, S; Provasi, P F; Pagola, G I; Ferraro, M B; Lazzeretti, P

2017-12-07

The trace of tensors that account for chiroptical response of the H 2 O 2 molecule is a function of the HO-OH dihedral angle. It vanishes at 0° and 180°, due to the presence of molecular symmetry planes, but also for values in the range 90-100° of this angle, in which the molecule is unquestionably chiral. Such an atypical effect is caused by counterbalancing contributions of diagonal tensor components with nearly maximal magnitude but opposite sign, determined by electron flow in open or closed helical paths, and associated with induced electric and magnetic dipole moments and anapole moments. For values of dihedral angle external to the 90-100° interval, the helical paths become smaller in size, thus reducing the amount of cancellation among diagonal components. Shrinking of helical paths determines the appearance of extremum values of tensor traces approximately at 50° and 140° dihedral angles.
(4bS,8aS-1-Isopropyl-4b,8,8-trimethyl-4b,5,6,7,8,8a,9,10-octahydrophenanthren-2-yl benzoate

Directory of Open Access Journals (Sweden)

Radouane Oubabi

2014-08-01

Full Text Available The title compound, C27H34O2, was hemisynthesized through direct benzoylation of the naturally occurring meroterpene totarol. The central fused six-membered ring has a half-chair conformation, whereas the terminal six-membered ring displays a chair conformation. The dihedral angle between the fused benzene ring and the benzoyl benzene ring is 73.05 (14°. The S,S chirality of the molecule is consistent with the synthetic pathway, and confirmed by the refinement of the Flack parameter.
S-adenosyl-L-(l-14C)-homocysteine

International Nuclear Information System (INIS)

Thomas, H.J.; Montgomery, J.A.

1987-01-01

S-Adenosyl-L-(1- 14 C)-homocysteine was prepared from commercially available L-(1- 14 C)-methionine by conversion first to S-benzyl-L-(1- 14 C)-homocysteine which upon treatment with sodium in liquid ammonia gave the disodium salt of L-(1- 14 C)-homocysteine. Reaction of this sodium salt with 5'-O-tosyladenosine gave the title compound. (author)
(2R,3aR,4S,7R,7aS,9R,10aR,11S,14R,14aS-rel-3a,4,7,7a,10a,11,14,14a-Octahydro-4,14:7,11-diepoxy-2,9-propanonaphtho[1,2-f:5,6-f′]diisoindole-1,3,8,10-tetrone (9CI: a cyclophane derived from naphtho[1,2-c:5,6-c]difuran

Directory of Open Access Journals (Sweden)

Peter W. Dibble

2008-09-01

Full Text Available The title compound, C25H18N2O6, is a naphthalenophane styled in the manner of Warrener's alicyclic cyclophanes or molecular racks wherein a trimethylene tether is perfectly staggered between the two N atoms such that the central methylene H atoms point toward the naphthalene π-system. The dihedral angle between the mean planes of the two benzene rings is 7.61 (7°.
(S-2-Oxotetrahydrofuran-3-aminium bromideCAS 15295-77-9.

Directory of Open Access Journals (Sweden)

Jace D. Sandifer

2012-08-01

Full Text Available In the title HBr salt of (S-homoserine lactone, C4H8NO2+·Br−, the five-membered ring has an envelope conformation, with the –CH2– C atom adjacent to the N-substituted C atom at the flap position. The four-atom mean plane (r.m.s. deviation = 0.005 Å of the envelope forms a dihedral angle of 32.12 (9° with the three-atom flap plane. The distorted square-pyramidal coordination about the anion involves five surrounding cations, with the square base defined by three N—H...Br hydrogen bonds [Br...N = 3.3046 (10, 3.3407 (12 and 3.3644 (13 Å] and near-contact with an H atom attached to C [Br...C = 3.739 (1 Å]. Another Br...C contact of 3.427 (1 Å defines the apex. There is also an N—H...O hydrogen bond present linking the cations.
Sb2S3:C/CdS p-n junction by laser irradiation

International Nuclear Information System (INIS)

Arato, A.; Cardenas, E.; Shaji, S.; O'Brien, J.J.; Liu, J.; Castillo, G. Alan; Das Roy, T.K.; Krishnan, B.

2009-01-01

In this paper, we report laser irradiated carbon doping of Sb 2 S 3 thin films and formation of a p-n junction photovoltaic structure using these films. A very thin carbon layer was evaporated on to chemical bath deposited Sb 2 S 3 thin films of approximately 0.5 μm in thickness. Sb 2 S 3 thin films were prepared from a solution containing SbCl 3 and Na 2 S 2 O 3 at 27 deg. C for 5 h and the films obtained were highly resistive. These C/Sb 2 S 3 thin films were irradiated by an expanded laser beam of diameter approximately 0.5 cm (5 W power, 532 nm Verdi laser), for 2 min at ambient atmosphere. Morphology and composition of these films were analyzed. These films showed p-type conductivity due to carbon diffusion (Sb 2 S 3 :C) by the thermal energy generated by the absorption of laser radiation. In addition, these thin films were incorporated in a photovoltaic structure Ag/Sb 2 S 3 :C/CdS/ITO/Glass. For this, CdS thin film of 50 nm in thickness was deposited on a commercially available ITO coated glass substrate from a chemical bath containing CdCl 2 , sodium citrate, NH 4 OH and thiourea at 70 deg. C . On the CdS film, Sb 2 S 3 /C layers were deposited. This multilayer structure was subjected to the laser irradiation, C/Sb 2 S 3 side facing the beam. The p-n junction formed by p-Sb 2 S 3 :C and n-type CdS showed V oc = 500 mV and J sc = 0.5 mA/cm 2 under illumination by a tungsten halogen lamp. This work opens up a new method to produce solar cell structures by laser assisted material processing
(R,S-2′-Amino-6′-methyl-2,5′,5′-trioxo-6′H-spiro[indoline-3,4′-pyrano[3,2-c][2,1]benzothiazine]-3′-carbonitrile dimethylformamide monosolvate

Directory of Open Access Journals (Sweden)

Svitlana V. Shishkina

2014-07-01

Full Text Available The title solvate, C20H14N4O4S·C3H7NO, comprises a stereogenic centre but the centrosymmetric space group causes the presence of the racemate in the crystal. The spiro-joined fragments are almost orthogonal, with a dihedral angle of 86.8 (2° between the mean planes of the pyrane ring and the dihydroindolone ring system. The atoms of the indolinone bicycle are coplanar, with an r.m.s. deviation of 0.005 Å. In the crystal, pairs of N—H...O hydrogen bonds link the molecules into centrosymmetric dimers which are linked to the dimethylformamide solvent molecules by further N—H...O hydrogen bonds. N—H...N hydrogen bonds link neighbouring dimers into [010] chains.
The role of C2-C7 and O-C2 angle in the development of dysphagia after cervical spine surgery.

Science.gov (United States)

Tian, Wei; Yu, Jie

2013-06-01

Dysphagia is a known complication of cervical surgery and may be prolonged or occasionally serious. A previous study showed that dysphagia after occipitocervical fusion was caused by oropharyngeal stenosis resulting from O-C2 (upper cervical lordosis) fixation in a flexed position. However, there have been few reports analyzing the association between the C2-C7 angle (middle-lower cervical lordosis) and postoperative dysphagia. The aim of this study was to analyze the relationship between cervical lordosis and the development of dysphagia after anterior and posterior cervical spine surgery (AC and PC). Three hundred fifty-four patients were reviewed in this retrospective clinical study, including 172 patients who underwent the AC procedure and 182 patients who had the PC procedure between June 2007 and May 2010. The presence and duration of postoperative dysphagia were recorded via face-to-face questioning or telephone interview performed at least 1 year after the procedure. Plain cervical radiographs before and after surgery were collected. The O-C2 angle and the C2-C7 angle were measured. Changes in the O-C2 angle and the C2-C7 angle were defined as dO-C2 angle = postoperative O-C2 angle - preoperative O-C2 angle and dC2-C7 angle = postoperative C2-C7 angle - preoperative C2-C7 angle. The association between postoperative dysphagia with dO-C2 angle and dC2-C7 angle was studied. Results showed that 12.8 % of AC and 9.4 % of PC patients reported dysphagia after cervical surgery. The dC2-C7 angle has considerable impact on postoperative dysphagia. When the dC2-C7 angle is greater than 5°, the chance of developing postoperative dysphagia is significantly greater. The dO-C2 angle, age, gender, BMI, operative time, blood loss, procedure type, revision surgery, most cephalic operative level, and number of operative levels did not significantly influence the incidence of postoperative dysphagia. No relationship was found between the dC2-C7 angle and the degree of
Composition: S.C.E

DEFF Research Database (Denmark)

2012-01-01

S.C.E. is a large collection of open compositions to be realised by improvising musicians. See more about my composition practise in the entry "Composition - General Introduction". This work is licensed under a Creative Commons "by-nc" License. You may for non-commercial purposes use and distribute...
Umesh C S Yadav

Indian Academy of Sciences (India)

Home; Journals; Journal of Biosciences. Umesh C S Yadav. Articles written in Journal of Biosciences. Volume 28 Issue 2 March 2003 pp 215-221 Articles. Regulation of glucose utilization and lipogenesis in adipose tissue of diabetic and fat fed animals: Effects of insulin and manganese · Najma Z Baquer M Sinclair S ...
Automorphic Lie algebras with dihedral symmetry

International Nuclear Information System (INIS)

Knibbeler, V; Lombardo, S; A Sanders, J

2014-01-01

The concept of automorphic Lie algebras arises in the context of reduction groups introduced in the early 1980s in the field of integrable systems. automorphic Lie algebras are obtained by imposing a discrete group symmetry on a current algebra of Krichever–Novikov type. Past work shows remarkable uniformity between algebras associated to different reduction groups. For example, if the base Lie algebra is sl 2 (C) and the poles of the automorphic Lie algebra are restricted to an exceptional orbit of the symmetry group, changing the reduction group does not affect the Lie algebra structure. In this research we fix the reduction group to be the dihedral group and vary the orbit of poles as well as the group action on the base Lie algebra. We find a uniform description of automorphic Lie algebras with dihedral symmetry, valid for poles at exceptional and generic orbits. (paper)
Crystal structure of N′-[(E-(1S,3R-(3-isopropyl-1-methyl-2-oxocyclopentylmethylidene]-4-methylbenzenesulfonohydrazide

Directory of Open Access Journals (Sweden)

David Tymann

2015-12-01

Full Text Available The title compound, C17H24N2O3S, was synthesized in order to determine the relative configuration of the corresponding β-keto aldehyde. In the U-shaped molecule, the five-membered ring approximates an envelope, with the methylene C atom adjacent to the quaternary C atom being the flap, and the methyl and isopropyl substituents lying to the same side of the ring. The dihedral angles between the four nearly coplanar atoms of the five-membered ring and the flap and the aromatic ring are 35.74 (15 and 55.72 (9°, respectively. The bond angles around the S atom are in the range from 103.26 (12 to 120.65 (14°. In the crystal, molecules are linked via N—H...O hydrogen bonds, forming a chain along the a axis.
48 CFR 15.403-4 - Requiring certified cost or pricing data (10 U.S.C. 2306a and 41 U.S.C. 254b).

Science.gov (United States)

2010-10-01

... or pricing data (10 U.S.C. 2306a and 41 U.S.C. 254b). 15.403-4 Section 15.403-4 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION CONTRACTING METHODS AND CONTRACT TYPES CONTRACTING BY NEGOTIATION Contract Pricing 15.403-4 Requiring certified cost or pricing data (10 U.S.C. 2306a and 41 U.S.C...
N-{(2S-3-Hydroxy-4-[(5-methyl-1,3,4-thiadiazol-2-ylsulfanyl]-1-phenyl-2-butyl}-4-methylbenzenesulfonamide

Directory of Open Access Journals (Sweden)

Claudia R. B. Gomes

2011-09-01

Full Text Available The thiadiazoyl and sulfonyl-benzene rings in the title compound, C20H23N3O3S3, are aligned to the same side of the molecule, forming a twisted `U' shape [dihedral angle = 77.6 (5°]. The benzyl-benzene ring is orientated in the opposite direction from the molecule but projects approximately along the same axis as the other rings [dihedral angle between benzene rings = 28.2 (5°] so that, overall, the molecule has a flattened shape. The hydroxy and amine groups are almost syn which enables the formation of intermolecular hydroxy-OH...N(thiadiazoyl and amine-H...O(sulfonyl hydrogen bonds leading to a supramolecular chain aligned along the a axis.
C&S Enterprise, L.L.C. - Clean Water Act Public Notice

Science.gov (United States)

The EPA is providing notice of a proposed Administrative Penalty Assessment against C & S Enterprise, L.L.C. (“Respondent”), a business located at 2454 480th Ave, Deep River, IA 52222, for alleged violations of the Clean Water Act at property owned by Resp
C.I.S. natural gas-1

International Nuclear Information System (INIS)

Carson, M.; Stram, B.

1993-01-01

This paper reports that in the countries that make up the Commonwealth of Independent States (C.I.S.), with their vast resources and a considerable existing production base, prospects are good for further growth of the region's exportable gas surplus. Investment fundamentals are stronger for gas than for any other energy resources in the area. But the pipeline infrastructure to move large amounts of gas will need extensive refurbishment to ensure export reliability and growth. Given the potential in terms of production and markets, significant amounts of outside investment in oil, natural gas, and NGL infrastructure will likely increase dramatically in these countries in the near future. These are some of the major conclusions of Enron Corp.'s recent investigations in the C.I.S. and other former Soviet republics
Phase Equilibria of a S- and C-Poor Lunar Core

Science.gov (United States)

Righter, K.; Pando, K.; Go, B. M.; Danielson, L. R.; Habermann, M.

2016-01-01

The composition of the lunar core can have a large impact on its thermal evolution, possible early dynamo creation, and physical state. Geochemical measurements have placed better constraints on the S and C content of the lunar mantle. In this study we have carried out phase equilibrium studies of geochemically plausible S- and C-poor lunar core compositions in the Fe-Ni-S-C system, and apply them to the early history of the Moon. We chose two bulk core compositions, with differing S and C content based on geochemical analyses of S and C trapped melts in Apollo samples, and on the partitioning of S and C between metal and silicate. This approach allowed calculation of core S and C contents - 90% Fe, 9% Ni, 0.5% C, and 0.375% S by weight; a second composition contained 1% each of S and C. Experiments were carried out from 1473K to 1973K and 1 GPa to 5 GPa, in piston cylinder and multi- anvil apparatuses. Combination of the thermal model of with our results, shows that a solid inner core (and therefore initiation of a dynamo) may have been possible in the earliest history of the Moon (approximately 4.2 Ga ago), in agreement with. Thus a volatile poor lunar core may explain the thermal and magnetic history of the Moon.
Cystatin C in Alzheimer’s disease

Directory of Open Access Journals (Sweden)

Efrat eLevy

2012-07-01

Full Text Available Changes in expression and secretion levels of cystatin C (CysC in the brain in various neurological disorders and in animal models of neurodegeneration underscore a role for CysC in these conditions. A polymorphism in the CysC gene (CST3 is linked to increased risk for Alzheimer’s disease (AD. AD pathology is characterized by deposition of oligomeric and fibrillar forms of amyloid β (Aβ in the neuropil and cerebral vessel walls, neurofibrillary tangles, and neurodegeneration. The implication of CysC in AD was initially suggested by its co-localization with Aβ in amyloid-laden vascular walls, and in senile plaque cores of amyloid in the brains of patients with AD, Down’s syndrome, hereditary cerebral hemorrhage with amyloidosis, Dutch type (HCHWA-D, and cerebral infarction. CysC also co-localizes with Aβ amyloid deposits in the brains of non-demented aged individuals. Multiple lines of research show that CysC plays protective roles in AD. In vitro studies have shown that CysC binds Aβ and inhibits Aβ oligomerization and fibril formation. In vivo results from the brains and plasma of Aβ-depositing transgenic mice confirmed the association of CysC with the soluble, non-pathological form of Aβ and the inhibition of Aβ plaques formation. The association of CysC with Aβ was also found in brain and in cerebrospinal fluid from AD patients and non-demented control individuals. Moreover, in vitro results showed that CysC protects neuronal cells from a variety of insults that may cause cell death, including cell death induced by oligomeric and fibrillar Aβ. These data suggest that the reduced levels of CysC manifested in AD contribute to increased neuronal vulnerability and impaired neuronal ability to prevent neurodegeneration. This review elaborates on the neuroprotective roles of CysC in AD and the clinical relevance of this protein as a therapeutic agent.
Genetic analysis of complement C1s deficiency associated with systemic lupus erythematosus highlights alternative splicing of normal C1s gene

DEFF Research Database (Denmark)

Amano, Mariane T; Ferriani, Virgínia P L; Florido, Marlene P C

2008-01-01

Deficiencies of complement proteins of the classical pathway are strongly associated with the development of autoimmune diseases. Deficiency of C1r has been observed to occur concomitantly with deficiency in C1s and 9 out of 15 reported cases presented systemic lupus erythematosus (SLE). Here, we...... describe a family in which all four children are deficient in C1s but only two of them developed SLE. Hemolytic activity mediated by the alternative and the lectin pathways were normal, but classical pathway activation was absent in all children's sera. C1s was undetectable, while in the parents' sera...
Observation of the decay $B^0_s \\to \\eta_c \\phi$ and evidence for $B^0_s \\to \\eta_c \\pi^+ \\pi^- $ at LHCb

CERN Multimedia

Martin, Morgan Leni

2017-01-01

A study of $B^0_s \\to \\eta_c \\phi$ and $B^0_s \\to \\eta_c \\pi^+ \\pi^-$ decays is performed using $pp$ collision data corresponding to an integrated luminosity of 3.0 fb, collected with the LHCb detector in Run 1 of the LHC. The observation of the decay $B^0_s \\to \\eta_c \\phi$ is reported, where the $\\eta_c$ meson is reconstructed in the $p\\bar p$, $K^+K^-\\pi^+\\pi^-$, $\\pi^+\\pi^-\\pi^+\\pi^-$ and $K^+K^-K^+K^-$ decay modes and the $\\phi(1020)$ in the $K^+ K^-$ decay mode. The decay $B^0_s \\to J/\\psi \\phi$ is used as a normalisation channel. Evidence is also reported for the decay $B^0_s \\to \\eta_c \\pi^+\\pi^-$, where the $\\eta_c$ meson is reconstructed in the $p\\bar p$ decay mode, using the decay $B^0_s \\to J/\\psi \\pi^+ \\pi^-$ as a normalisation channel. The measured branching fractions are \\begin{eqnarray*} {\\mathcal B (B^{0}_{s} \\to \\eta_{c} \\phi)} &=& \\left(5.01 \\pm 0.53 \\pm 0.27 \\pm 0.63 \\right) \\times 10^{-4} \\,, \

Evaporation of Cu, Sn, and S from Fe-C-Cu-Sn-S Liquid Alloys in the Temperature Range from 1513 K to 1873 K (1240 °C to 1600 °C)

Science.gov (United States)

Tafwidli, Fahmi; Choi, Moo-Eob; Yi, Sang-Ho; Kang, Youn-Bae

2018-06-01

Evaporation of Cu or Sn from liquid iron alloys containing C and S was experimentally investigated. The initial C concentration, [pct C]0, in the liquid alloy was varied from zero to C saturation, and the evaporation temperature was varied from 1513 K to 1773 K (1240 °C to 1500 °C). Along with the report by one of the present authors, the evaporation mechanism of Cu and Sn from liquid Fe-C-S alloy is proposed, after a modification from the previous mechanism. It was proposed that Cu and Sn evaporate as Cu(g) and Sn(g) and also evaporate as CuS(g) and SnS(g), which are more volatile species. Therefore, availability of S in the alloy affects the overall evaporation rate of Cu and Sn. At the same time, C in the alloy also forms volatile carbosulfides CS(g) and CS2(g), thereby competing with Cu and Sn. Moreover, C increases the activity coefficients of Cu, Sn, and S. This increases the thermodynamic driving force for the formation of CuS(g) and SnS(g). Therefore, increasing [pct C] partly accelerates the evaporation rate of Cu and Sn by increasing the activity coefficient but partly decelerates the evaporation rate by lowering the available S content. S partly accelerates the evaporation rate by increasing the available S for the sulfide gas species but partly decelerates the evaporation rate due to the surface poisoning effect. Increasing the reaction temperature increases the overall evaporation rate. All these facts were taken into account in order to develop an evaporation rate model. This model was extended from the present authors' previous one by taking into account (1) CS(g), S(g), and CS2(g) (therefore, the following species were considered as dominant evaporating species: Cu(g), CuS(g), Sn(g), SnS(g), S(g), CS(g), and CS2(g)); (2) the effect of C and temperature on the activity coefficients of Cu, Sn, and S; (3) the effect of C and temperature on the density of the liquid alloy; and (4) the effect of temperature on the S adsorption coefficient. This revised
Evaporation of Cu, Sn, and S from Fe-C-Cu-Sn-S Liquid Alloys in the Temperature Range from 1513 K to 1873 K (1240 °C to 1600 °C)

Science.gov (United States)

Tafwidli, Fahmi; Choi, Moo-Eob; Yi, Sang-Ho; Kang, Youn-Bae

2018-02-01

Evaporation of Cu or Sn from liquid iron alloys containing C and S was experimentally investigated. The initial C concentration, [pct C]0, in the liquid alloy was varied from zero to C saturation, and the evaporation temperature was varied from 1513 K to 1773 K (1240 °C to 1500 °C). Along with the report by one of the present authors, the evaporation mechanism of Cu and Sn from liquid Fe-C-S alloy is proposed, after a modification from the previous mechanism. It was proposed that Cu and Sn evaporate as Cu(g) and Sn(g) and also evaporate as CuS(g) and SnS(g), which are more volatile species. Therefore, availability of S in the alloy affects the overall evaporation rate of Cu and Sn. At the same time, C in the alloy also forms volatile carbosulfides CS(g) and CS2(g), thereby competing with Cu and Sn. Moreover, C increases the activity coefficients of Cu, Sn, and S. This increases the thermodynamic driving force for the formation of CuS(g) and SnS(g). Therefore, increasing [pct C] partly accelerates the evaporation rate of Cu and Sn by increasing the activity coefficient but partly decelerates the evaporation rate by lowering the available S content. S partly accelerates the evaporation rate by increasing the available S for the sulfide gas species but partly decelerates the evaporation rate due to the surface poisoning effect. Increasing the reaction temperature increases the overall evaporation rate. All these facts were taken into account in order to develop an evaporation rate model. This model was extended from the present authors' previous one by taking into account (1) CS(g), S(g), and CS2(g) (therefore, the following species were considered as dominant evaporating species: Cu(g), CuS(g), Sn(g), SnS(g), S(g), CS(g), and CS2(g)); (2) the effect of C and temperature on the activity coefficients of Cu, Sn, and S; (3) the effect of C and temperature on the density of the liquid alloy; and (4) the effect of temperature on the S adsorption coefficient. This revised
Calcaneal Fractures and Böhler’s Angle

Directory of Open Access Journals (Sweden)

Lindsey Spiegelman

2017-01-01

Full Text Available History of present illness: 40-year-old male presents to the emergency department after falling off a ladder. He was repairing a window when he fell, landing on the ground 12 feet below. The patient landed onto his feet bilaterally and then fell backwards onto his buttocks. On arrival, the patient had bilateral foot pain. He denied any back pain, headache, or loss of consciousness. Significant findings: The right ankle lateral radiograph shows a comminuted, non-displaced fracture of the posterior calcaneus (red arrow in addition to fracture fragments along the heel pad margin (blue arrow. The left ankle lateral radiograph shows a displaced, comminuted fracture of the mid to posterior calcaneus with extension into the subtalar joint posteriorly (purple arrow. There is subcutaneous air seen anteriorly to the tibiotalar joint space (green arrow in addition to a joint effusion. Of note, the Böhler’s angle in the left x-ray is 16 degrees which is consistent with a fracture (see red annotation showing Böhler’s angle. Discussion: Calcaneal fractures occur typically in adults who have undergone significant axial load on their feet secondary to a fall from high height.2,3 There are two broad types of calcaneal fractures: intraarticular and extraarticular.2 The intraarticular fractures are colloquially referred to as a “Lover’s Fracture” as they have been known to occur in those jumping out of a tall window to escape the wrath of a lover’s spouse.1 Calcaneal fractures are best diagnosed with a CT scan or with lateral x-ray by measuring Böhler’s angle.2,3 This is the angle formed by the intersection of two lines demonstrated on a normal lateral ankle radiograph. The first line is drawn between the superior aspect of the anterior process of the calcaneus (point A and the superior edge of the posterior articular facet (point B. The second line is drawn between the superior aspect of the posterior calcaneal tuberosity (point C and point B.2
Cross sections for 12C+12C→12C(0+2)+12C(g.s.) using breathing mode doorways

International Nuclear Information System (INIS)

Ahmed, M.U.; Beres, W.P.

1982-01-01

A previously derived projection operator method is applied to the calculation of the cross section for 12 C+ 12 C→ 12 C(0 + 2 )+ 12 C(g.s.) with a breathing mode model being used to describe the 0 + 2 (7.68 MeV) state of 12 C. The relationship to processes leading to alpha particle channels is discussed. The cross section for 12 C+ 12 C→ 12 C(3 - )+ 12 C(g.s.) is also calculated and possible correlations with inelastic scattering to the 0 + 2 and 2 + states of 12 C are discussed. The results for both 0 + 2 and 3 - inelastic scattering are in reasonable agreement with experiment
Sb{sub 2}S{sub 3}:C/CdS p-n junction by laser irradiation

Energy Technology Data Exchange (ETDEWEB)

Arato, A. [Facultad de Ingenieria Mecanica y Electrica, Universidad Autonoma de Nuevo Leon, San Nicolas de los Garza, Nuevo Leon (Mexico); Centro de Innovacion, Investigacion y Desarrollo en Ingenieria y Tecnologia-Universidad Autonoma de Nuevo Leon, Apodaca, Nuevo Leon (Mexico); Cardenas, E. [Facultad de Ingenieria Mecanica y Electrica, Universidad Autonoma de Nuevo Leon, San Nicolas de los Garza, Nuevo Leon (Mexico); Shaji, S. [Facultad de Ingenieria Mecanica y Electrica, Universidad Autonoma de Nuevo Leon, San Nicolas de los Garza, Nuevo Leon (Mexico); Centro de Innovacion, Investigacion y Desarrollo en Ingenieria y Tecnologia-Universidad Autonoma de Nuevo Leon, Apodaca, Nuevo Leon (Mexico); O' Brien, J.J.; Liu, J. [Center for Nanoscience, University of Missouri-St. Louis, One University Boulevard, St. Louis, Missouri-63121 (United States); Department of Chemistry and Biochemistry, University of Missouri-St. Louis, One University Boulevard, St. Louis, Missouri-63121 (United States); Castillo, G. Alan; Das Roy, T.K. [Facultad de Ingenieria Mecanica y Electrica, Universidad Autonoma de Nuevo Leon, San Nicolas de los Garza, Nuevo Leon (Mexico); Krishnan, B. [Facultad de Ingenieria Mecanica y Electrica, Universidad Autonoma de Nuevo Leon, San Nicolas de los Garza, Nuevo Leon (Mexico); Centro de Innovacion, Investigacion y Desarrollo en Ingenieria y Tecnologia-Universidad Autonoma de Nuevo Leon, Apodaca, Nuevo Leon (Mexico)], E-mail: bkrishnan@fime.uanl.mx

2009-02-02

In this paper, we report laser irradiated carbon doping of Sb{sub 2}S{sub 3} thin films and formation of a p-n junction photovoltaic structure using these films. A very thin carbon layer was evaporated on to chemical bath deposited Sb{sub 2}S{sub 3} thin films of approximately 0.5 {mu}m in thickness. Sb{sub 2}S{sub 3} thin films were prepared from a solution containing SbCl{sub 3} and Na{sub 2}S{sub 2}O{sub 3} at 27 deg. C for 5 h and the films obtained were highly resistive. These C/Sb{sub 2}S{sub 3} thin films were irradiated by an expanded laser beam of diameter approximately 0.5 cm (5 W power, 532 nm Verdi laser), for 2 min at ambient atmosphere. Morphology and composition of these films were analyzed. These films showed p-type conductivity due to carbon diffusion (Sb{sub 2} S{sub 3}:C) by the thermal energy generated by the absorption of laser radiation. In addition, these thin films were incorporated in a photovoltaic structure Ag/Sb{sub 2}S{sub 3}:C/CdS/ITO/Glass. For this, CdS thin film of 50 nm in thickness was deposited on a commercially available ITO coated glass substrate from a chemical bath containing CdCl{sub 2}, sodium citrate, NH{sub 4}OH and thiourea at 70 deg. C . On the CdS film, Sb{sub 2}S{sub 3}/C layers were deposited. This multilayer structure was subjected to the laser irradiation, C/Sb{sub 2}S{sub 3} side facing the beam. The p-n junction formed by p-Sb{sub 2}S{sub 3}:C and n-type CdS showed V{sub oc} = 500 mV and J{sub sc} = 0.5 mA/cm{sup 2} under illumination by a tungsten halogen lamp. This work opens up a new method to produce solar cell structures by laser assisted material processing.
Evaluation of pro-c global for identification of defects in protein c/s anticoagulant pathway

International Nuclear Information System (INIS)

Hanif, T.B.; Anwar, J.; Idrees, M.

2011-01-01

Background: Detection of protein C and S deficiency forms a major investigation in the laboratory evaluation of thrombophilia screening. It has key role in the diagnosis of protein C and S deficiency. The objective of this study is to determine the utility of ProC Global as a screening test for identifying the defects of protein C and S anticoagulant pathways. Methods: Two Hundred patients with venous thromboembolism were studied at the Department of Haematology, Armed Forces Institute of Pathology, Rawalpindi, from October 2004 to March 2006. ProC Global test (Dade Behring Diagnostics) was performed and was followed up by protein C and S assays. ProC Global is an activated partial thromboplastin time based assay in which Protac (snake venom from Aghistroden contortrix) is used for activation of the endogenous protein C of the plasma sample. The protein C activation time in the presence of the activator was set in relation to a parallel determination of PCAT/O with addition of a buffer instead of activator reagent. The ratio PCAT: PCAT/O was transformed in normalized ratio by relating them to a calibrator. Control plasma for normal range and ProC control plasma for pathological range (Dade Behring Diagnostics) were assayed in each run for quality control. Results: A total of 200 patients, 132 (66%) males and 68 (34%) females with age ranging from 1 to 68 years were studied. ProC Global was positive in 29/200 (14.5%) patients. ProC Global was found to be 86% sensitive, 94% specific and its overall efficiency turned out to be 94%. Conclusion: Pro-C Global can be used effectively as a screening test to detect abnormalities in protein C and S anticoagulant pathways. (author)
2-Phenyl-7-(4-pyridylmethylamino-1,2,4-triazolo[1,5-a][1,3,5]triazin-5(4H-oneFused heterocyclic systems with s-triazine ring. Part 17. For part 16, see Dolzhenko et al. (2011.

Directory of Open Access Journals (Sweden)

Lip Lin Koh

2011-01-01

Full Text Available In the title compound, C16H13N7O, the 1,2,4-triazolo[1,5-a][1,3,5]triazine heterocyclic system is essentially planar (r.m.s. deviation = 0.0375 Å. The attached benzene ring lies almost in the mean plane of 1,2,4-triazolo[1,5-a][1,3,5]triazine [dihedral angle = 1.36 (23°], while the pyridine ring is turned out of this plane by the aminomethyl bridge [dihedral angle = 69.22 (9°]. The amino group H atom is involved in intramolecular hydrogen bonding with a triazole N atom. In the crystal, molecules are connected via C(=ONH...N hydrogen bonds into C(11 chains parallel to [100]. The amino group H atom acts as a hydrogen-bond donor, forming an NH...O=C hydrogen bond with the carbonyl O atom, which links the molecules into C(6 chains running along [011] and [01overline{1}].
C. S. Lewis: The Romantic Rationalist

Directory of Open Access Journals (Sweden)

Vasiliu Daniela

2014-12-01

Full Text Available The paper “C. S. Lewis: The Romantic Rationalist” presents the way C. S. Lewis gives an account in his first fictional (allegorical book, The Pilgrim’s Regress, of how he discovered Christianity on the converging paths of romanticism and rationalism. The outstanding scholar and author whose intellectual and spiritual development has turned him into one of the most influential Christian writers of the twentieth century became an atheist in his teens and after a long journey through different philosophical convictions he converted to Christianity in his early thirties, a change that affected his entire work. His love of literature was essential in discovering both the rational and the imaginative appeal of Christianity, which led him into a vision of the reality of the world and of life that satisfied the longing of his heart and the hunger of his imagination.
Measurement of the $\\eta_c (1S)$ production cross-section in proton-proton collisions via the decay $\\eta_c (1S) \\rightarrow p \\bar{p}$

CERN Document Server

Aaij, Roel; Adeva, Bernardo; Adinolfi, Marco; Affolder, Anthony; Ajaltouni, Ziad; Akar, Simon; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Anderson, Jonathan; Andreassen, Rolf; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Aquines Gutierrez, Osvaldo; Archilli, Flavio; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Auriemma, Giulio; Baalouch, Marouen; Bachmann, Sebastian; Back, John; Badalov, Alexey; Baesso, Clarissa; Baldini, Wander; Barlow, Roger; Barschel, Colin; Barsuk, Sergey; Barter, William; Batozskaya, Varvara; Battista, Vincenzo; Bay, Aurelio; Beaucourt, Leo; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Belogurov, Sergey; Belous, Konstantin; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Benton, Jack; Berezhnoy, Alexander; Bernet, Roland; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bien, Alexander; Bifani, Simone; Bird, Thomas; Bizzeti, Andrea; Bjørnstad, Pål Marius; Blake, Thomas; Blanc, Frédéric; Blouw, Johan; Blusk, Steven; Bocci, Valerio; Bondar, Alexander; Bondar, Nikolay; Bonivento, Walter; Borghi, Silvia; Borgia, Alessandra; Borsato, Martino; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Brambach, Tobias; Bressieux, Joël; Brett, David; Britsch, Markward; Britton, Thomas; Brodzicka, Jolanta; Brook, Nicholas; Brown, Henry; Bursche, Albert; Busetto, Giovanni; Buytaert, Jan; Cadeddu, Sandro; Calabrese, Roberto; Calvi, Marta; Calvo Gomez, Miriam; Campana, Pierluigi; Campora Perez, Daniel; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casse, Gianluigi; Cassina, Lorenzo; Castillo Garcia, Lucia; Cattaneo, Marco; Cauet, Christophe; Cenci, Riccardo; Charles, Matthew; Charpentier, Philippe; Chefdeville, Maximilien; Chen, Shanzhen; Cheung, Shu-Faye; Chiapolini, Nicola; Chrzaszcz, Marcin; Ciba, Krzystof; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cogoni, Violetta; Cojocariu, Lucian; Collins, Paula; Comerma-Montells, Albert; Contu, Andrea; Cook, Andrew; Coombes, Matthew; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Counts, Ian; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Cruz Torres, Melissa Maria; Cunliffe, Samuel; Currie, Robert; D'Ambrosio, Carmelo; Dalseno, Jeremy; David, Pascal; David, Pieter; Davis, Adam; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Silva, Weeraddana; De Simone, Patrizia; Decamp, Daniel; Deckenhoff, Mirko; Del Buono, Luigi; Déléage, Nicolas; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Di Canto, Angelo; Dijkstra, Hans; Donleavy, Stephanie; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Dossett, David; Dovbnya, Anatoliy; Dreimanis, Karlis; Dujany, Giulio; Dupertuis, Frederic; Durante, Paolo; Dzhelyadin, Rustem; Dziurda, Agnieszka; Dzyuba, Alexey; Easo, Sajan; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; El Rifai, Ibrahim; Graverini, Elena; Elsasser, Christian; Ely, Scott; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Färber, Christian; Farinelli, Chiara; Farley, Nathanael; Farry, Stephen; Fay, Robert; Ferguson, Dianne; Fernandez Albor, Victor; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fiore, Marco; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fol, Philip; Fontana, Marianna; Fontanelli, Flavio; Forty, Roger; Francisco, Oscar; Frank, Markus; Frei, Christoph; Frosini, Maddalena; Fu, Jinlin; Furfaro, Emiliano; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; García Pardiñas, Julián; Garofoli, Justin; Garra Tico, Jordi; Garrido, Lluis; Gaspar, Clara; Gauld, Rhorry; Gavardi, Laura; Gavrilov, Gennadii; Geraci, Angelo; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianelle, Alessio; Gianì, Sebastiana; Gibson, Valerie; Giubega, Lavinia-Helena; Gligorov, Vladimir; Göbel, Carla; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gotti, Claudio; Grabalosa Gándara, Marc; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graziani, Giacomo; Grecu, Alexandru; Greening, Edward; Gregson, Sam; Griffith, Peter; Grillo, Lucia; Grünberg, Oliver; Gui, Bin; Gushchin, Evgeny; Guz, Yury; Gys, Thierry; Hadjivasiliou, Christos; Haefeli, Guido; Haen, Christophe; Haines, Susan; Hall, Samuel; Hamilton, Brian; Hampson, Thomas; Han, Xiaoxue; Hansmann-Menzemer, Stephanie; Harnew, Neville; Harnew, Samuel; Harrison, Jonathan; He, Jibo; Head, Timothy; Heijne, Veerle; Hennessy, Karol; Henrard, Pierre; Henry, Louis; Hernando Morata, Jose Angel; van Herwijnen, Eric; Heß, Miriam; Hicheur, Adlène; Hill, Donal; Hoballah, Mostafa; Hombach, Christoph; Hulsbergen, Wouter; Hunt, Philip; Hussain, Nazim; Hutchcroft, David; Hynds, Daniel; Idzik, Marek; Ilten, Philip; Jacobsson, Richard; Jaeger, Andreas; Jalocha, Pawel; Jans, Eddy; Jaton, Pierre; Jawahery, Abolhassan; Jing, Fanfan; John, Malcolm; Johnson, Daniel; Jones, Christopher; Joram, Christian; Jost, Beat; Jurik, Nathan; Kaballo, Michael; Kandybei, Sergii; Kanso, Walaa; Karacson, Matthias; Karbach, Moritz; Karodia, Sarah; Kelsey, Matthew; Kenyon, Ian; Ketel, Tjeerd; Khanji, Basem; Khurewathanakul, Chitsanu; Klaver, Suzanne; Klimaszewski, Konrad; Kochebina, Olga; Kolpin, Michael; Komarov, Ilya; Koopman, Rose; Koppenburg, Patrick; Korolev, Mikhail; Kozlinskiy, Alexandr; Kravchuk, Leonid; Kreplin, Katharina; Kreps, Michal; Krocker, Georg; Krokovny, Pavel; Kruse, Florian; Kucewicz, Wojciech; Kucharczyk, Marcin; Kudryavtsev, Vasily; Kurek, Krzysztof; Kvaratskheliya, Tengiz; La Thi, Viet Nga; Lacarrere, Daniel; Lafferty, George; Lai, Adriano; Lambert, Dean; Lambert, Robert W; Lanfranchi, Gaia; Langenbruch, Christoph; Langhans, Benedikt; Latham, Thomas; Lazzeroni, Cristina; Le Gac, Renaud; van Leerdam, Jeroen; Lees, Jean-Pierre; Lefèvre, Regis; Leflat, Alexander; Lefrançois, Jacques; Leo, Sabato; Leroy, Olivier; Lesiak, Tadeusz; Leverington, Blake; Li, Yiming; Likhomanenko, Tatiana; Liles, Myfanwy; Lindner, Rolf; Linn, Christian; Lionetto, Federica; Liu, Bo; Lohn, Stefan; Longstaff, Iain; Lopes, Jose; Lopez-March, Neus; Lowdon, Peter; Lucchesi, Donatella; Luo, Haofei; Lupato, Anna; Luppi, Eleonora; Lupton, Oliver; Machefert, Frederic; Machikhiliyan, Irina V; Maciuc, Florin; Maev, Oleg; Malde, Sneha; Malinin, Alexander; Manca, Giulia; Mancinelli, Giampiero; Mapelli, Alessandro; Maratas, Jan; Marchand, Jean François; Marconi, Umberto; Marin Benito, Carla; Marino, Pietro; Märki, Raphael; Marks, Jörg; Martellotti, Giuseppe; Martens, Aurelien; Martín Sánchez, Alexandra; Martinelli, Maurizio; Martinez Santos, Diego; Martinez Vidal, Fernando; Martins Tostes, Danielle; Massafferri, André; Matev, Rosen; Mathe, Zoltan; Matteuzzi, Clara; Mazurov, Alexander; McCann, Michael; McCarthy, James; McNab, Andrew; McNulty, Ronan; McSkelly, Ben; Meadows, Brian; Meier, Frank; Meissner, Marco; Merk, Marcel; Milanes, Diego Alejandro; Minard, Marie-Noelle; Moggi, Niccolò; Molina Rodriguez, Josue; Monteil, Stephane; Morandin, Mauro; Morawski, Piotr; Mordà, Alessandro; Morello, Michael Joseph; Moron, Jakub; Morris, Adam Benjamin; Mountain, Raymond; Muheim, Franz; Müller, Katharina; Mussini, Manuel; Muster, Bastien; Naik, Paras; Nakada, Tatsuya; Nandakumar, Raja; Nasteva, Irina; Needham, Matthew; Neri, Nicola; Neubert, Sebastian; Neufeld, Niko; Neuner, Max; Nguyen, Anh Duc; Nguyen, Thi-Dung; Nguyen-Mau, Chung; Nicol, Michelle; Niess, Valentin; Niet, Ramon; Nikitin, Nikolay; Nikodem, Thomas; Novoselov, Alexey; O'Hanlon, Daniel Patrick; Oblakowska-Mucha, Agnieszka; Obraztsov, Vladimir; Oggero, Serena; Ogilvy, Stephen; Okhrimenko, Oleksandr; Oldeman, Rudolf; Onderwater, Gerco; Orlandea, Marius; Otalora Goicochea, Juan Martin; Owen, Patrick; Oyanguren, Maria Arantza; Pal, Bilas Kanti; Palano, Antimo; Palombo, Fernando; Palutan, Matteo; Panman, Jacob; Papanestis, Antonios; Pappagallo, Marco; Pappalardo, Luciano; Parkes, Christopher; Parkinson, Christopher John; Passaleva, Giovanni; Patel, Girish; Patel, Mitesh; Patrignani, Claudia; Pazos Alvarez, Antonio; Pearce, Alex; Pellegrino, Antonio; Pepe Altarelli, Monica; Perazzini, Stefano; Perez Trigo, Eliseo; Perret, Pascal; Perrin-Terrin, Mathieu; Pescatore, Luca; Pesen, Erhan; Petridis, Konstantin; Petrolini, Alessandro; Picatoste Olloqui, Eduardo; Pietrzyk, Boleslaw; Pilař, Tomas; Pinci, Davide; Pistone, Alessandro; Playfer, Stephen; Plo Casasus, Maximo; Polci, Francesco; Poluektov, Anton; Polycarpo, Erica; Popov, Alexander; Popov, Dmitry; Popovici, Bogdan; Potterat, Cédric; Price, Eugenia; Price, Joseph David; Prisciandaro, Jessica; Pritchard, Adrian; Prouve, Claire; Pugatch, Valery; Puig Navarro, Albert; Punzi, Giovanni; Qian, Wenbin; Rachwal, Bartolomiej; Rademacker, Jonas; Rakotomiaramanana, Barinjaka; Rama, Matteo; Rangel, Murilo; Raniuk, Iurii; Rauschmayr, Nathalie; Raven, Gerhard; Redi, Federico; Reichert, Stefanie; Reid, Matthew; dos Reis, Alberto; Ricciardi, Stefania; Richards, Sophie; Rihl, Mariana; Rinnert, Kurt; Rives Molina, Vincente; Robbe, Patrick; Rodrigues, Ana Barbara; Rodrigues, Eduardo; Rodriguez Perez, Pablo; Roiser, Stefan; Romanovsky, Vladimir; Romero Vidal, Antonio; Rotondo, Marcello; Rouvinet, Julien; Ruf, Thomas; Ruiz, Hugo; Ruiz Valls, Pablo; Saborido Silva, Juan Jose; Sagidova, Naylya; Sail, Paul; Saitta, Biagio; Salustino Guimaraes, Valdir; Sanchez Mayordomo, Carlos; Sanmartin Sedes, Brais; Santacesaria, Roberta; Santamarina Rios, Cibran; Santovetti, Emanuele; Sarti, Alessio; Satriano, Celestina; Satta, Alessia; Saunders, Daniel Martin; Savrie, Mauro; Savrina, Darya; Schiller, Manuel; Schindler, Heinrich; Schlupp, Maximilian; Schmelling, Michael; Schmidt, Burkhard; Schneider, Olivier; Schopper, Andreas; Schune, Marie Helene; Schwemmer, Rainer; Sciascia, Barbara; Sciubba, Adalberto; Seco, Marcos; Semennikov, Alexander; Sepp, Indrek; Serra, Nicola; Serrano, Justine; Sestini, Lorenzo; Seyfert, Paul; Shapkin, Mikhail; Shapoval, Illya; Shcheglov, Yury; Shears, Tara; Shekhtman, Lev; Shevchenko, Vladimir; Shires, Alexander; Silva Coutinho, Rafael; Simi, Gabriele; Sirendi, Marek; Skidmore, Nicola; Skwarnicki, Tomasz; Smith, Anthony; Smith, Edmund; Smith, Eluned; Smith, Jackson; Smith, Mark; Snoek, Hella; Sokoloff, Michael; Soler, Paul; Soomro, Fatima; Souza, Daniel; Souza De Paula, Bruno; Spaan, Bernhard; Sparkes, Ailsa; Spradlin, Patrick; Sridharan, Srikanth; Stagni, Federico; Stahl, Marian; Stahl, Sascha; Steinkamp, Olaf; Stenyakin, Oleg; Stevenson, Scott; Stoica, Sabin; Stone, Sheldon; Storaci, Barbara; Stracka, Simone; Straticiuc, Mihai; Straumann, Ulrich; Stroili, Roberto; Subbiah, Vijay Kartik; Sun, Liang; Sutcliffe, William; Swientek, Krzysztof; Swientek, Stefan; Syropoulos, Vasileios; Szczekowski, Marek; Szczypka, Paul; Szilard, Daniela; Szumlak, Tomasz; T'Jampens, Stephane; Teklishyn, Maksym; Tellarini, Giulia; Teubert, Frederic; Thomas, Christopher; Thomas, Eric; van Tilburg, Jeroen; Tisserand, Vincent; Tobin, Mark; Tolk, Siim; Tomassetti, Luca; Tonelli, Diego; Topp-Joergensen, Stig; Torr, Nicholas; Tournefier, Edwige; Tourneur, Stephane; Tran, Minh Tâm; Tresch, Marco; Tsaregorodtsev, Andrei; Tsopelas, Panagiotis; Tuning, Niels; Ubeda Garcia, Mario; Ukleja, Artur; Ustyuzhanin, Andrey; Uwer, Ulrich; Vacca, Claudia; Vagnoni, Vincenzo; Valenti, Giovanni; Vallier, Alexis; Vazquez Gomez, Ricardo; Vazquez Regueiro, Pablo; Vázquez Sierra, Carlos; Vecchi, Stefania; Velthuis, Jaap; Veltri, Michele; Veneziano, Giovanni; Vesterinen, Mika; Viaud, Benoit; Vieira, Daniel; Vieites Diaz, Maria; Vilasis-Cardona, Xavier; Vollhardt, Achim; Volyanskyy, Dmytro; Voong, David; Vorobyev, Alexey; Vorobyev, Vitaly; Voß, Christian; Voss, Helge; de Vries, Jacco; Waldi, Roland; Wallace, Charlotte; Wallace, Ronan; Walsh, John; Wandernoth, Sebastian; Wang, Jianchun; Ward, David; Watson, Nigel; Websdale, David; Whitehead, Mark; Wicht, Jean; Wiedner, Dirk; Wilkinson, Guy; Williams, Matthew; Williams, Mike; Wilschut, Hans; Wilson, Fergus; Wimberley, Jack; Wishahi, Julian; Wislicki, Wojciech; Witek, Mariusz; Wormser, Guy; Wotton, Stephen; Wright, Simon; Wyllie, Kenneth; Xie, Yuehong; Xing, Zhou; Xu, Zhirui; Yang, Zhenwei; Yuan, Xuhao; Yushchenko, Oleg; Zangoli, Maria; Zavertyaev, Mikhail; Zhang, Liming; Zhang, Wen Chao; Zhang, Yanxi; Zhelezov, Alexey; Zhokhov, Anatoly; Zhong, Liang; Zvyagin, Alexander

2015-01-01

The production of the $\\eta_c (1S)$ state in proton-proton collisions is probed via its decay to the $p \\bar{p}$ final state with the LHCb detector, in the rapidity range $2.0 6.5$ GeV/c. The cross-section for prompt production of $\\eta_c (1S)$ mesons relative to the prompt $J/\\psi$ cross-section is measured, for the first time, to be $\\sigma_{\\eta_c (1S)}/\\sigma_{J/\\psi} = 1.74 \\pm 0.29 \\pm 0.28 \\pm 0.18 _{B}$ at a centre-of-mass energy $\\sqrt{s} = 7$ TeV using data corresponding to an integrated luminosity of 0.7 fb$^{-1}$, and $\\sigma_{\\eta_c (1S)}/\\sigma_{J/\\psi} = 1.60 \\pm 0.29 \\pm 0.25 \\pm 0.17 _{B}$ at $\\sqrt{s} = 8$ TeV using 2.0 fb$^{-1}$. The uncertainties quoted are, in order, statistical, systematic, and that on the ratio of branching fractions of the $\\eta_c (1S)$ and $J/\\psi$ decays to the $p \\bar{p}$ final state. In addition, the inclusive branching fraction of $b$-hadron decays into $\\eta_c (1S)$ mesons is measured, for the first time, to be $B ( b \\rightarrow \\eta_c X ) = (4.88 \\pm 0.64 \\pm ...
Synthesis and characterisation of pure C(-A)-S-H phases

International Nuclear Information System (INIS)

L'Hopital, E.; Lothenbach, B.; Le Saout, G.; Kulik, D.A.; Scrivener, K.

2015-01-01

The construction of nuclear power plants requires huge quantity of cement and the cement production generates about 8% of global man-made CO 2 emissions. One way of reducing the concrete's CO 2 contribution is to lower its CO 2 generation and energy consumption by a partial replacement of clinker with supplementary cementitious materials (SCMs). Common SCMs such as blast furnace slag or fly ash contain more silicon and aluminium than Portland cement, so that the hydrates formed are different than in Portland cements, which might affect the concrete mechanical properties. The most important phase formed during the reaction of Portland cement with water is calcium silicate hydrate, C-S-H. In the presence of SCMs, C-S-H can have different composition compared to C-S-H in Portland cements. The present work focuses on synthesis of pure C(-A)- S-H at a Ca/Si ratio equal to 1 in presence of different quantities of aluminium (Al/Si atomic ratio from 0 to 0.05) to determine the aluminium incorporation in C-S-H. The absence of any other solids and the low aluminium concentrations measured in the solution clearly showed an uptake of aluminium within the C-(A)-S-H phase. The presence of aluminium increased the interlayer distance, indicating an uptake of aluminium in the C-(A)-S-H structure. The uptake of aluminium was more pronounced at higher dissolved aluminium concentrations, consistent with the formation of a solid solution between C-S-H and C-A-S-H. The presence of aluminium led to a decrease of the calcium concentrations, while the silica and aluminium concentrations increased
Occupied and unoccupied orbitals of C{sub 60} and C{sub 70} probed with C 1s emission and absorption

Energy Technology Data Exchange (ETDEWEB)

Carlisle, J.A.; Terminello, L.J.; Hudson, E.A. [Lawrence Berkeley National Lab., CA (United States)] [and others

1997-04-01

The aim of this work is to characterize the orbital structure of the fullerenes, and to pursue its evolution from a cluster to the infinite solid. For obtaining a complete picture of the electronic structure the authors compare a variety of experimental techniques, i.e. photoemission and core level emission for occupied orbitals and inverse photoemission and core level absorption for unoccupied orbitals. Their experimental results focus on optical probes involving the C 1s core level, i.e. absorption via transitions from the C 1s level into unoccupied {pi}* and {sigma}* orbitals and emission involving transitions from occupied orbitals into a C 1s hole. Due to the simplicity of the C 1s level there exist clear selection rules. For example, only transitions to and from orbitals with p-character are dipole-allowed. These results on the p-projected density of states are compared with inverse photoemission and photoemission results, where the selection rules are less definitive. In addition, a first-principles quasiparticle calculation of the density of states is used to assign the orbital features. The spectra from C{sub 60} and C{sub 70} are still far from their infinite analog, i.e., graphite, which is also measured with the same techniques. In order to determine the effect of electron transfer onto C{sub 60}, as in superconducting alkali fullerides, the authors are studying resonant emission of C{sub 60}. An electron is placed in the lowest unoccupied molecular orbital (LUMO) by optical absorption from the C 1s level and the C 1s emission detected in the presence of this spectator electron.
Pressure-dependent {sup 13}C chemical shifts in proteins: origins and applications

Energy Technology Data Exchange (ETDEWEB)

Wilton, David J. [University of Sheffield, Department of Molecular Biology and Biotechnology (United Kingdom); Kitahara, Ryo [Ritsumeikan University, College of Pharmaceutical Sciences (Japan); Akasaka, Kazuyuki [Kinki University, Department of Biotechnological Science, School of Biology-Oriented Science and Technology (Japan); Williamson, Mike P. [University of Sheffield, Department of Molecular Biology and Biotechnology (United Kingdom)], E-mail: m.williamson@sheffield.ac.uk

2009-05-15

Pressure-dependent {sup 13}C chemical shifts have been measured for aliphatic carbons in barnase and Protein G. Up to 200 MPa (2 kbar), most shift changes are linear, demonstrating pressure-independent compressibilities. CH{sub 3}, CH{sub 2} and CH carbon shifts change on average by +0.23, -0.09 and -0.18 ppm, respectively, due to a combination of bond shortening and changes in bond angles, the latter matching one explanation for the {gamma}-gauche effect. In addition, there is a residue-specific component, arising from both local compression and conformational change. To assess the relative magnitudes of these effects, residue-specific shift changes for protein G were converted into structural restraints and used to calculate the change in structure with pressure, using a genetic algorithm to convert shift changes into dihedral angle restraints. The results demonstrate that residual {sup 13}C{alpha} shifts are dominated by dihedral angle changes and can be used to calculate structural change, whereas {sup 13}C{beta} shifts retain significant dependence on local compression, making them less useful as structural restraints.
4-(4,4-Difluoro-1,3,5,7-tetramethyl-3a-aza-4a-azonia-4-borata-s-indacen-8-ylbenzonitrile

Directory of Open Access Journals (Sweden)

Yuting Chen

2011-04-01

Full Text Available The title compound, C20H18BF2N3, contains one C9BN2 (Bodipy framework and one cyanobenzyl group. The Bodipy framework is essentially planar with a maximum deviation of 0.041 (2 Å. The introduction of two methyl groups at positions 1 and 7 of s-indacene in the Bodipy unit results in almost orthogonal configuration between the mean plane of the Bodipy unit and the cyanobenzyl group [dihedral angle = 89.78 (4°].
The influence of C{sub s}/C{sub c} correction in analytical imaging and spectroscopy in scanning and transmission electron microscopy

Energy Technology Data Exchange (ETDEWEB)

Zaluzec, Nestor J., E-mail: zaluzec@microscopy.com

2015-04-15

Aberration correction in scanning/transmission electron microscopy (S/TEM) owes much to the efforts of a small dedicated group of innovators. Leading that frontier has been Prof. Harald Rose. To date his leadership and dynamic personality has spearheaded our ability to leave behind many of the limitations imposed by spherical aberration (C{sub s}) in high resolution phase contrast imaging. Following shortly behind, has been the development of chromatic aberration correction (C{sub c}) which augments those accomplishments. In this paper we will review and summarize how the combination of C{sub s}/C{sub c} technology enhances our ability to conduct hyperspectral imaging and spectroscopy in today's and future computationally mediated experiments in both thin as well as realistic specimens in vacuo and during in-situ/environmental experiments.
Décès - French version only

CERN Document Server

2006-01-01

C'est avec une profonde tristesse que nous avons appris le décès de notre ancien collègue et ami, Jean Paul Gendras, à Roanne, le 1er février 2006, dans sa 66e année. Jean Paul avait pris sa retraite le 31 janvier 2002 après une carrière bien remplie au sein du Groupe ESS de la Division EP, où il était entré le 16 août 1971. Durant ces 30 années de présence, il s'est intéressé avec sérieux et compétence à toutes les évolutions techniques dans le domaine de l'électronique. Il était très avide de connaissances et suivait avec un grand intérêt les découvertes en physique du CERN. Toujours soucieux de faire partager sa passion, il participa activement pendant plus de vingt-cinq ans au Service des visites où il fut un guide expérimenté et très apprécié. Amoureux de la nature et sportif accompli, il partageait son temps libre entre le vélo, la course à pied, la littérature franç aise et le cinéma. C'était toujours un plaisir de l'écouter parler et jouer avec son art favori, l...
IMAGING COMET ISON C/2012 S1 IN THE INNER CORONA AT PERIHELION

Energy Technology Data Exchange (ETDEWEB)

Druckmüller, Miloslav [Faculty of Mechanical Engineering, Brno University of Technology, 616 69 Brno (Czech Republic); Habbal, Shadia Rifai [Institute for Astronomy, University of Hawaii, Honolulu 96822, Hawaii (United States); Aniol, Peter [ASTELCO Systems GmbH, D-82152 Martinsried (Germany); Ding, Adalbert [Institute of Optics and Atomic Physics, Technische Universitaet Berlin, and Institute of Technical Physics, Berlin (Germany); Morgan, Huw [Institute of Mathematics, Physics and Computer Science, Aberystwyth University, Ceredigion, Cymru SY23 3BZ (United Kingdom)

2014-04-01

Much anticipation and speculation were building around comet ISON, or C/2012 S1, discovered on 2012 September 21 by the International Scientific Optical Network telescope in Russia, and bound for the Sun on 2013 November 28, with a closest heliocentric approach distance of 2.7 R {sub ☉}. Here we present the first white light image of the comet's trail through the inner corona. The image was taken with a wide field Lyot-type coronagraph from the Mees Observatory on Haleakala at 19:12 UT, past its perihelion passage at 18:45 UT. The perfect match between the comet's trail captured in the inner corona and the trail that had persisted across the field of view of 2-6 R {sub ☉} of the Solar and Heliospheric Observatory Large Angle and Spectrometric Coronagraph Experiment/C2 coronagraph at 19:12 UT demonstrates that the comet survived its perihelion passage.
(3R,5S,7R,8R,9S,10S,12S,13R,14S-10,13-Dimethyl-17-[5-oxo-5-(prop-2-yn-1-yloxypentan-2-yl]hexadecahydro-1H-cyclopenta[a]phenanthrene-3,7,12-triyl triacetate

Directory of Open Access Journals (Sweden)

T. Kavitha

2017-03-01

Full Text Available In the title compound, C33H48O8, four terminal H atoms of cholic acid are replaced by three acetyl and one terminal alkyne group. All the acetyl residues are twisted with respect to the rings (A, B and C to which they are attached. The cyclopentane ring D adopts an envelope conformation with the methyl-substituted C atom as the flap. Rings A, B and C have chair conformations. The dihedral angle between the mean planes of rings C and D is 4.70 (11°. In the crystal, molecules are linked by C—H...O hydrogen bonds, forming a three-dimensional structure.
Observation of $S=+1$ Narrow Resonances in the System $pK^0_s$ from $p+\\rm {C_3H_8}$ Collision at 10 GeV/$c$

CERN Document Server

Aslanyan, P Zh; Rikhvitskaya, G G

2004-01-01

Experimental data from a 2 m propane bubble chamber have been analyzed to search for an exotic baryon state, the $\\Theta^+$ baryon, in the $pK^0_s$ decay mode for the reaction $p+{\\rm C_3H_8}$ at 10 GeV/$c$. The $pK^0_s$ invariant mass spectrum shows resonant structures with $M_{p K_s^0}=1540\\pm 8$, $1613\\pm10$, $1821\\pm11$ MeV/$c^2$ and $\\Gamma_{p K_s^0}= 9.2\\pm1.8$, $16.1\\pm4.1$, $28.0\\pm9.4$ MeV/$c^2$. The statistical significance of these peaks has been estimated as $5.5$, $4.8$ and $5.0$ s.d., respectively. There are also small peaks in mass regions of 1487 (3.0 s.d.), 1690 (3.6 s.d.) and 1980 (3.0 s.d.) MeV/$c^2$.
Search for the weak decays J/psi -> D-s(()*()-) e(+)nu(e) + c.c.

NARCIS (Netherlands)

Ablikim, M.; Achasov, M. N.; Ai, X. C.; Albayrak, O.; Albrecht, M.; Ambrose, D. J.; Amoroso, A.; An, F. F.; An, Q.; Bai, J. Z.; Ferroli, R. Baldini; Ban, Y.; Bennett, D. W.; Bennett, J. V.; Bertani, M.; Bettoni, D.; Bian, J. M.; Bianchi, F.; Boger, E.; Bondarenko, O.; Boyko, I.; Briere, R. A.; Cai, H.; Cai, X.; Cakir, O.; Calcaterra, A.; Cao, G. F.; Cetin, S. A.; Chang, J. F.; Chelkov, G.; Chen, G.; Chen, H. S.; Chen, H. Y.; Chen, J. C.; Chen, M. L.; Chen, S. J.; Chen, X.; Chen, X. R.; Chen, Y. B.; Cheng, H. P.; Chu, X. K.; Chu, Y. P.; Cibinetto, G.; Cronin-Hennessy, D.; Dai, H. L.; Dai, J. P.; Dedovich, D.; Deng, Z. Y.; Denig, A.; Denysenko, I.; Destefanis, M.; De Mori, F.; Ding, Y.; Dong, C.; Dong, J.; Dong, L. Y.; Dong, M. Y.; Du, S. X.; Duan, P. F.; Fan, J. Z.; Fang, J.; Fang, S. S.; Fang, X.; Fang, Y.; Fava, L.; Feldbauer, F.; Felici, G.; Feng, C. Q.; Fioravanti, E.; Fu, C. D.; Gao, Q.; Gao, Y.; Garzia, I.; Goetzen, K.; Gong, W. X.; Gradl, W.; Greco, M.; Gu, M. H.; Gu, Y. T.; Guan, Y. H.; Guo, A. Q.; Guo, L. B.; Guo, T.; Guo, Y.; Guo, Y. P.; Haddadi, Z.; Hafner, A.; Han, S; Han, Y. L.; Harris, F. A.; He, K. L.; He, Z. Y.; Held, T.; Heng, Y. K.; Hou, Z. L.; Hu, C.; Hu, H. M.; Hu, J. F.; Hu, T.; Hu, Y.; Huang, G. M.; Huang, G. S.; Huang, H. P.; Huang, J. S.; Huang, X. T.; Huang, Y.; Hussain, T.; Ji, Q.; Ji, Q. P.; Ji, X. B.; Ji, X. L.; Jiang, L. L.; Jiang, L. W.; Jiang, X. S.; Jiao, J. B.; Jiao, Z.; Jin, D. P.; Jin, S.; Johansson, T.; Julin, A.; Kalantar-Nayestanaki, N.; Kang, X. L.; Kang, X. S.; Kavatsyuk, M.; Ke, B. C.; Kliemt, R.; Kloss, B.; Kolcu, O. B.; Kopf, B.; Kornicer, M.; Kuehn, W.; Kupsc, A.; Lai, W.; Lange, J. S.; Lara, M.; Larin, P.; Li, C. H.; Li, Cheng; Li, D. M.; Li, F.; Li, G.; Li, H. B.; Li, J. C.; Li, Jin; Li, K.; Li, K.; Li, P. R.; Li, T.; Li, W. D.; Li, W. G.; Li, X. L.; Li, X. M.; Li, X. N.; Li, X. Q.; Li, Z. B.; Liang, H.; Liang, Y. F.; Liang, Y. T.; Liao, G. R.; Lin, D. X.; Liu, B. J.; Liu, C. L.; Liu, C. X.; Liu, F. H.; Liu, Fang; Liu, Feng; Liu, H. B.; Liu, H. H.; Liu, H. H.; Liu, H. M.; Liu, J.; Liu, J. P.; Liu, J. Y.; Liu, K.; Liu, K. Y.; Liu, L. D.; Liu, Q.; Liu, S. B.; Liu, X.; Liu, X. X.; Liu, Y. B.; Liu, Z. A.; Liu, Zhiqiang; Liu, Zhiqing; Loehner, H.; Lou, X. C.; Lu, H. J.; Lu, J. G.; Lu, R. Q.; Lu, Y.; Lu, Y. P.; Luo, C. L.; Luo, M. X.; Luo, T.; Luo, X. L.; Lv, M.; Lyu, X. R.; Ma, F. C.; Ma, H. L.; Ma, L. L.; Ma, Q. M.; Ma, S.; Ma, T.; Ma, X. N.; Ma, X. Y.; Maas, F. E.; Maggiora, M.; Malik, Q. A.; Mao, Y. J.; Mao, Z. P.; Marcello, S.; Messchendorp, J. G.; Min, J.; Min, T. J.; Mitchell, R. E.; Mo, X. H.; Mo, Y. J.; Moeini, H.; Morales, C. Morales; Moriya, K.; Muchnoi, N. Yu.; Muramatsu, H.; Nefedov, Y.; Nerling, F.; Nikolaev, I. B.; Ning, Z.; Nisar, S.; Niu, S. L.; Niu, X. Y.; Olsen, S. L.; Ouyang, Q.; Pacetti, S.; Patteri, P.; Pelizaeus, M.; Peng, H. P.; Peters, K.; Ping, J. L.; Ping, R. G.; Poling, R.; Pu, Y. N.; Qi, M.; Qian, S.; Qiao, C. F.; Qin, L. Q.; Qin, N.; Qin, X. S.; Qin, Y.; Qin, Z. H.; Qiu, J. F.; Rashid, K. H.; Redmer, C. F.; Ren, H. L.; Ripka, M.; Rong, G.; Ruan, X. D.; Santoro, V.; Sarantsev, A.; Savrie, M.; Schoenning, K.; Schumann, S.; Shan, W.; Shao, M.; Shen, C. P.; Shen, P. X.; Shen, X. Y.; Sheng, H. Y.; Shepherd, M. R.; Song, W. M.; Song, X. Y.; Sosio, S.; Spataro, S.; Spruck, B.; Sun, G. X.; Sun, J. F.; Sun, S. S.; Sun, Y. J.; Sun, Y. Z.; Sun, Z. J.; Sun, Z. T.; Tang, C. J.; Tang, X.; Tapan, I.; Thorndike, E. H.; Tiemens, M.; Toth, D.; Ullrich, M.; Uman, I.; Varner, G. S.; Wang, B.; Wang, B. L.; Wang, D.; Wang, D. Y.; Wang, K.; Wang, L. L.; Wang, L. S.; Wang, M.; Wang, P.; Wang, P. L.; Wang, Q. J.; Wang, S. G.; Wang, W.; Wang, X. F.; Wang, Y. D.; Wang, Y. F.; Wang, Y. Q.; Wang, Z.; Wang, Z. G.; Wang, Z. H.; Wang, Z. Y.; Wei, D. H.; Wei, J. B.; Weidenkaff, P.; Wen, S. P.; Wiedner, U.; Wolke, M.; Wu, L. H.; Wu, Z.; Xia, L. G.; Xia, Y.; Xiao, D.; Xiao, Z. J.; Xie, Y. G.; Xiu, Q. L.; Xu, G. F.; Xu, L.; Xu, Q. J.; Xu, Q. N.; Xu, X. P.; Yan, L.; Yan, W. B.; Yan, W. C.; Yan, Y. H.; Yang, H. X.; Yang, L.; Yang, Y.; Yang, Y. X.; Ye, H.; Ye, M.; Ye, M. H.; Yin, J. H.; Yu, B. X.; Yu, C. X.; Yu, H. W.; Yu, J. S.; Yuan, C. Z.; Yuan, W. L.; Yuan, Y.; Yuncu, A.; Zafar, A. A.; Zallo, A.; Zeng, Y.; Zhang, B. X.; Zhang, B. Y.; Zhang, C.; Zhang, C. C.; Zhang, D. H.; Zhang, H. H.; Zhang, H. Y.; Zhang, J. J.; Zhang, J. L.; Zhang, J. Q.; Zhang, J. W.; Zhang, J. Y.; Zhang, J. Z.; Zhang, K.; Zhang, L.; Zhang, S. H.; Zhang, X. J.; Zhang, X. Y.; Zhang, Y.; Zhang, Y. H.; Zhang, Z. H.; Zhang, Z. P.; Zhang, Z. Y.; Zhao, G.; Zhao, J. W.; Zhao, J. Y.; Zhao, J. Z.; Zhao, Lei; Zhao, Ling; Zhao, M. G.; Zhao, Q.; Zhao, Q. W.; Zhao, S. J.; Zhao, T. C.; Zhao, Y. B.; Zhao, Z. G.; Zhemchugov, A.; Zheng, B.; Zheng, J. P.; Zheng, W. J.; Zheng, Y. H.; Zhong, B.; Zhou, L.; Zhou, Li; Zhou, X.; Zhou, X. K.; Zhou, X. R.; Zhou, X. Y.; Zhu, K.; Zhu, K. J.; Zhu, S.; Zhu, X. L.; Zhu, Y. C.; Zhu, Y. S.; Zhu, Z. A.; Zhuang, J.; Zou, B. S.; Zou, J. H.

2014-01-01

Using a sample of 2.25 x 10(8) J/psi events collected with the BESIII detector at the BEPCII collider, we search for the J/psi semileptonic weak decay J/psi -> D-s(-) e(+)nu(e) +c.c. with a much higher sensitivity than previous searches. We also perform the first search for J/psi -> D-s(*-) e(+)
Search for Σc → Λcπ using Λc → Σsππ in 250 GeV π--nucleon interactions

International Nuclear Information System (INIS)

Passmore, D.A.

1995-01-01

Combined cross section times branching fraction limits are given for Σ c ++ → Λ c + π + and Σ c 0 → Λ c + π - where Λ c + → Σ s ± π ± π + . The Λ c + is reconstructed with partial information on the Σ s ; the missing Σ s momentum is established through momentum conservation imposed by a constrained fit. The data are of π - beam interactions at 250 GeV from Fermilab experiment E769

2-Benzylsulfanyl-N-(1,3-dimethylimidazolidin-2-ylideneaniline

Directory of Open Access Journals (Sweden)

Ulrich Flörke

2013-04-01

Full Text Available The molecular structure of the title compound, C18H21N3S, shows a twisted conformation with a dihedral angle of 67.45 (4° between the aromatic ring planes and an N—C—C—S torsion angle of −5.01 (13°. The imidazolidine ring and the aniline moiety make a dihedral angle of 56.03 (4° and the asscociated C—N—C angle is 125.71 (10°. The guanidine-like C=N double bond is clearly localized, with a bond length of 1.2879 (14 Å. The C—S—C angle is 102.12 (5° and the S—C(aromatic and S—C bond lengths are 1.7643 (11 and 1.8159 (12 Å.
Bite angle effects of diphosphines in C-C and C-X bond forming cross coupling reactions

NARCIS (Netherlands)

Birkholz, M.N.; Freixa, Z.; van Leeuwen, P.W.N.M.

2009-01-01

Catalytic reactions of C-C and C-X bond formation are discussed in this critical review with particular emphasis on cross coupling reactions catalyzed by palladium and wide bite angle bidentate diphosphine ligands. Especially those studies have been collected that allow comparison of the ligand bite
(3aS,7aS-5-[(S-3,3,3-Trifluoro-2-methoxy-2-phenylpropanoyl]-2,3,4,5,6,7-hexahydro-1H-pyrrolo[3,4-c]pyridin-3(2H-one monohydrate

Directory of Open Access Journals (Sweden)

Huichun Zhu

2010-01-01

Full Text Available rac-Benzyl 3-oxohexahydro-1H-pyrrolo[3,4-c]pyridine-5(6H-carboxylate was separated by chiral chromatography, and one of the enantiomers ([α]22D = +10° was hydrogenated in the presence of Pd/C in methanol, producing octahydro-3H-pyrrolo[3,4-c]pyridin-3-one. The latter was reacted with (2R-3,3,3-trifluoro-2-methoxy-2-phenylpropanoyl chloride [(R-(−-Mosher acid chloride], giving rise to the title compound, C17H19F3N2O3·H2O. The present structure established the absolute configuration of the pyrrolopiperidine fragment based on the known configuration of the (R-Mosher acid chloride. The piperidine ring has a somewhat distorted chair conformation and is cis-fused with the five-membered envelope-shaped ring; the plane of the exocyclic amide bond is approximately orthogonal to the plane of the phenyl ring, making a dihedral angle of 82.31 (3°. The water molecule acts as an acceptor to the proton of the amino group in an N—H...O interaction, and as a double proton donor in O—H...O hydrogen bonds, generating infinite bands along the a axis.
Sulfide phase in the Fe-Ti-S and Fe-C-Ti-S alloys

International Nuclear Information System (INIS)

Malinochka, Ya.N.; Balakina, N.A.; Shmelev, Yu.S.

1976-01-01

The nature of the sulfide phases in Fe-Ti-S and Fe-C-Ti-S alloys was studied. The carbide and the sulfide phase were identified the aid of X-ray spectral microanalysis. It was established that for a small content of titanium and sulfur in ternary Fe-Ti-S alloys the solidification of the γ-solution on the boundaries of dendritic branches is accompanied, along with the precipitation of a sulfide rich in iron of the (Fe, Ti) S type where a small quantity of titanium is dissolved, by the formation of a titanium-bearing sulfide eutectic γ + TiS. The amount of the sulfide eutectic increases with the contents of titanium and sulfur until a purely eutectic alloy is formed. Both carbides and sulfides may be formed in the solidification of quaternary alloys Fe-C-Ti-S
5-(2,5-Dioxooxolan-3-yl-8-methyl-3,3a,4,5-tetrahydro-1H-naphtho[1,2-c]furan-1,3-dione

Directory of Open Access Journals (Sweden)

Y. Z. Guo

2013-02-01

Full Text Available In the title compound, C17H14O6, the dihedral angle between the two anhydride rings is 76.01 (8°while the dihedral angles between the benzene and anhydride rings are 42.60 (7 and 68.94 (7°. The cyclohexene ring of the tetrahydronaphthalene unit exhibits an envelope conformation.
Effect of aluminizing on hardenability of steel (S45C)

Science.gov (United States)

Prayitno, D.; Sugiarto, R.

2018-01-01

The objective of research is to know the effect of aluminizing on hardenability of steel (S45C). The research methodologies were as follows. The Steels (S45C) were machined into the Jominy test samples. Next the samples were preheating at 700 ° C for 30 minutes and then the samples were dipped into the molten of aluminium for 3 minutes as a hot dip aluminizng method. The aluminium molten was 700 ° C. Then the samples were cooled into room temperatures. Finally the samples were into the jominy tested. The results show that the aluminizing (include the preheating process) increases the hardenability of steel (S45C).
A thermodynamic model for C-(N-)A-S-H gel: CNASH{sub s}s. Derivation and validation

Energy Technology Data Exchange (ETDEWEB)

Myers, Rupert J.; Bernal, Susan A.; Provis, John L., E-mail: j.provis@sheffield.ac.uk

2014-12-15

The main reaction product in Ca-rich alkali-activated cements and hybrid Portland cement (PC)-based materials is a calcium (alkali) aluminosilicate hydrate (C-(N-)A-S-H) gel. Thermodynamic models without explicit definitions of structurally-incorporated Al species have been used in numerous past studies to describe this gel, but offer limited ability to simulate the chemistry of blended PC materials and alkali-activated cements. Here, a thermodynamic model for C-(N-)A-S-H gel is derived and parameterised to describe solubility data for the CaO–(Na{sub 2}O,Al{sub 2}O{sub 3})–SiO{sub 2}–H{sub 2}O systems and alkali-activated slag (AAS) cements, and chemical composition data for C-A-S-H gels. Simulated C-(N-)A-S-H gel densities and molar volumes are consistent with the corresponding values reported for AAS cements, meaning that the model can be used to describe chemical shrinkage in these materials. Therefore, this model can provide insight into the chemistry of AAS cements at advanced ages, which is important for understanding the long-term durability of these materials.
C/S data processing system and its application on DECnet

International Nuclear Information System (INIS)

Jin Zhigang; Shu Yantai

1997-01-01

Because of the rapid development of PC and LAN, C/S data processing paradigm became the main stream of distributed processing. For the family of VAX which running VMS operating system, in order to implement a C/S system, the authors must solve some problems and take efforts to implement inter-process communication between VAX and PC. The authors introduce how to construct a C/S system in the VAX-PC heterogeneous environment. The authors also describe the practical method by an example of the data processing system for fusion experiment. At last, the result of performance evaluation and comparison of the centralized processing and C/S system confirmed that the latter has some advantages
Rietveld refinement of the structures of 1.0 C-S-H and 1.5 C-S-H

KAUST Repository

Battocchio, Francesco; Monteiro, Paulo J.M.; Wenk, Hans-Rudolf

2012-01-01

Low-Q region Rietveld analyses were performed on C-S-H synchrotron XRD patterns, using the software MAUD. Two different crystal structures of tobermorite 11 Å were used as a starting model: monoclinic ordered Merlino tobermorite, and orthorhombic
Antioxidant effects of betulin on porcine chondrocyte behavior in gelatin/C6S/C4S/HA modified tricopolymer scaffold

International Nuclear Information System (INIS)

Lin, Wen-Yang; Lin, Feng-Huei; Sadhasivam, S.; Savitha, S.

2010-01-01

The antioxidant effects of betulin on porcine chondrocytes cultured in gelatin/C6S/C4S/HA modified tricopolymer scaffold for a period of 4 weeks was investigated. The porous structure of the scaffold and cell attachment was observed by scanning electron microscopy (SEM). Biochemical measures of necrosis, cell proliferation, sulfated glycosaminoglycans (sGAG) content and extracellular matrix related gene expressions were quantitatively evaluated. The cell proliferation data showed good cellular viability in tricopolymer scaffold and increased optical density for total DNA demonstrated that the cells continued to proliferate inside the scaffold. The sGAG production indicated chondrogenic differentiation. Chondrocytes treated with betulin expressed transcripts encoding type II collagen, aggrecan, and decorin. To conclude, the substantiated results supported cell proliferation, production of extracellular matrix proteins and down-regulation of matrix metalloproteases and cytokine, in betulin treated scaffolds.
Antioxidant effects of betulin on porcine chondrocyte behavior in gelatin/C6S/C4S/HA modified tricopolymer scaffold

Energy Technology Data Exchange (ETDEWEB)

Lin, Wen-Yang; Lin, Feng-Huei [Institute of Biomedical Engineering, National Taiwan University, Taipei, Taiwan (China); Sadhasivam, S., E-mail: rahulsbio@yahoo.co.in [Institute of Biomedical Engineering, National Taiwan University, Taipei, Taiwan (China); Savitha, S. [Institute of Biomedical Engineering, National Taiwan University, Taipei, Taiwan (China)

2010-05-10

The antioxidant effects of betulin on porcine chondrocytes cultured in gelatin/C6S/C4S/HA modified tricopolymer scaffold for a period of 4 weeks was investigated. The porous structure of the scaffold and cell attachment was observed by scanning electron microscopy (SEM). Biochemical measures of necrosis, cell proliferation, sulfated glycosaminoglycans (sGAG) content and extracellular matrix related gene expressions were quantitatively evaluated. The cell proliferation data showed good cellular viability in tricopolymer scaffold and increased optical density for total DNA demonstrated that the cells continued to proliferate inside the scaffold. The sGAG production indicated chondrogenic differentiation. Chondrocytes treated with betulin expressed transcripts encoding type II collagen, aggrecan, and decorin. To conclude, the substantiated results supported cell proliferation, production of extracellular matrix proteins and down-regulation of matrix metalloproteases and cytokine, in betulin treated scaffolds.
(S)- and (R)-[11C]nicotine and the metabolite (R/S)-[11C]cotinine. Preparation, metabolite studies and in vivo distribution in the human brain using PET

International Nuclear Information System (INIS)

Halldin, C.; Swahn, C.-G.; Nybaeck, H.; Naagren, K.; Laangstroem, B.

1992-01-01

In order to investigate [ 11 C]nicotine binding and metabolism in the living human brain by PET, routine protocols were developed for the preparation and purification of (S)-and (R)-[ 11 C]nicotine and the metabolite (R/S)-[ 11 C]cotinine. (S)- and (R)-[ 11 C]nicotine were prepared by N-methylation with [ 11 C]methyl iodide of the appropriate secondary amine, which was liberated in situ by 2,2,6,6,-tetramethylpiperidine (TMP) from its corresponding biscamsylate-salt. (R/S)-[ 11 C]Cotinine was prepared by N-methylation of the amide precursor using tetrabutylammonium hydroxide as a phase transfer catalyst. Straight-phase semipreparative HPLC was in all purifications found to be superior to reversed-phase since the contamination by the norcompounds was eliminated. Reaction in acetonitrile for both (S)- and (R)-[ 11 C]nicotine and (R/S)-[ 11 C]cotinine with subsequent straight-phase HPLC purification resulted in 35-45% radiochemical yield with a total synthesis time of 30-35 min, a specific radioactivity of 1000-1500 Ci/mmol (37-55 GBq/μmol, EOS) and a radiochemical purity >99%. The uptake and distribution of these tracers in the human brain was studied in healthy volunteers by PET. The metabolite (R/S)-[ 11 C]cotinine did not cross the blood-brain barrier to any significant degree. (author)
Human genes for complement components C1r and C1s in a close tail-to-tail arrangement

International Nuclear Information System (INIS)

Kusumoto, H.; Hirosawa, S.; Salier, J.P.; Hagen, F.S.; Kurachi, K.

1988-01-01

Complementary DNA clones for human C1s were isolated from cDNA libraries that were prepared with poly(A) + RNAs of human liver and HepG2 cells. A clone with the largest cDNA insert of 2,664 base pairs (bp) was analyzed for its complete nucleotide sequence. It contained 202 bp of a 5' untranslated region, 45 bp of coding for a signal peptide (15 amino acid residues), 2,019 bp for complement component C1s zymogen (673 amino acid residues), 378 bp for a 3' untranslated region, a stop codon, and 17 bp of a poly(A) tail. The amino acid sequence of C1s was 40.5% identical to that of C1r, with excellent matches of tentative disulfide bond locations conserving the overall domain structure of C1r. DNA blotting and sequencing analyses of genomic DNA and of an isolated genomic DNA clone clearly showed that the human genes for C1r and C1s are closely located in a tail-to-tail arrangement at a distance of about 9.5 kilobases. Furthermore, RNA blot analyses showed that both C1r and C1s genes are primarily expressed in liver, whereas most other tissues expressed both C1r and C1s genes at much lower levels (less than 10% of that in liver). Multiple molecular sizes of specific mRNAs were observed in the RNA blot analyses for both C1r and C1s, indicating that alternative RNA processing(s), likely an alternative polyadenylylation, might take place for both genes
B{sub c} → B{sub sJ} form factors and B{sub c} decays into B{sub sJ} in covariant light-front approach

Energy Technology Data Exchange (ETDEWEB)

Shi, Yu-Ji; Zhao, Zhen-Xing [Shanghai Jiao-Tong University, INPAC, Shanghai Key Laboratory for Particle Physics and Cosmology, Department of Physics and Astronomy, Shanghai (China); Wang, Wei [Shanghai Jiao-Tong University, INPAC, Shanghai Key Laboratory for Particle Physics and Cosmology, Department of Physics and Astronomy, Shanghai (China); Chinese Academy of Sciences, State Key Laboratory of Theoretical Physics, Institute of Theoretical Physics, Beijing (China)

2016-10-15

We suggest to study the B{sub s} and its excitations B{sub sJ} in the B{sub c} decays. We calculate the B{sub c} → B{sub sJ} and B{sub c} → B{sub J} form factors within the covariant light-front quark model, where the B{sub sJ} and B{sub J} denote an s-wave or p-wave anti bs and anti bd meson, respectively. The form factors at q{sup 2} = 0 are directly computed while their q{sup 2}-distributions are obtained by extrapolation. The derived form factors are then used to study semileptonic B{sub c} → (B{sub sJ}, B{sub J}) anti lν decays, and nonleptonic B{sub c} → B{sub sJ}π. Branching fractions and polarizations are predicted in the standard model. We find that the branching fractions are sizable and might be accessible at the LHC experiment and future high-energy e{sup +}e{sup -} colliders with a high luminosity at the Z-pole. The future experimental measurements are helpful to study the nonperturbative QCD dynamics in the presence of a heavy spectator and also of great value for the study of spectroscopy. (orig.)
The clinical expression of hereditary protein C and protein S deficiency: : a relation to clinical thrombotic risk-factors and to levels of protein C and protein S

NARCIS (Netherlands)

Henkens, C. M. A.; van der Meer, J.; Hillege, J. L.; Bom, V. J. J.; Halie, M. R.; van der Schaaf, W.

We investigated 103 first-degree relatives of 13 unrelated protein C or protein S deficient patients to assess the role of additional thrombotic risk factors and of protein C and protein S levels in the clinical expression of hereditary protein C and protein S deficiency. Fifty-seven relatives were
S-25-hydroxyvitamin D and C3-epimers in pregnancy and infancy

DEFF Research Database (Denmark)

Dreier Mydtskov, Nanne; Lykkedegn, Sine; Fruekilde, Palle Back Nielsen

2017-01-01

BACKGROUND: Analysis of serum 25-hydroxyvitamin D (s-25(OH)D) may be complicated by the less active or in-active vitamin D metabolite C3-epi-25(OH)D3 (C3-epimer). We aimed to explore the relationship between s-C3-epimer and s-25(OH)D and other determinants and describe the longitudinal course of ...... correlated to s-25(OH)D, season, maternal vitamin D supplementation, maternal and infant age. The C3-epimer fraction was only of clinical importance in early infancy, where it could lead to misclassification of the vitamin D status.......BACKGROUND: Analysis of serum 25-hydroxyvitamin D (s-25(OH)D) may be complicated by the less active or in-active vitamin D metabolite C3-epi-25(OH)D3 (C3-epimer). We aimed to explore the relationship between s-C3-epimer and s-25(OH)D and other determinants and describe the longitudinal course...... correlated with s-25(OH)D (all time points, pvitamin D supplementation at some time points. The C3-epimer fraction fluctuated between adjacent time points. By cosinor analyses, a season-dependent sinusoidal pattern for s-25(OH)D and C3-epimer fraction...
(Carbonyl-1κC)bis-[2,3(η)-cyclo-penta-dien-yl][μ(3)-(S-methyl trithio-carbonato)methylidyne-1:2:3κC,S'':C:C](triphenyl-phosphine-1κP)(μ(3)-sulfido-1:2:3κS)dicobalt(II)iron(II) trifluoro-methane-sulfonate.

Science.gov (United States)

Manning, Anthony R; McAdam, C John; Palmer, Anthony J; Simpson, Jim

2008-04-10

The asymmetric unit of the title compound, [FeCo(2)(C(5)H(5))(2)(C(3)H(3)S(3))S(C(18)H(15)P)(CO)]CF(3)SO(3), consists of a triangular irondicobalt cluster cation and a trifluoro-methane-sulfonate anion. In the cation, the FeCo(2) triangle is symmetrically capped on one face by an S atom and on the other by a C atom linked to a methyl trithio-carbonate residue that bridges the Fe-C bond. Each Co atom carries a cyclo-penta-dienyl ligand while the Fe atom coordinates to one carbonyl and one triphenyl-phosphine ligand. In the crystal structure, the cation is linked to the anion by a number of weak non-classical C-H⋯O and C-H⋯F hydrogen bonds and weak S⋯O (3.317 Å) and S⋯F (3.198 Å) inter-actions. The structure is further stabilized by additional inter-molecular C-H⋯O, C-H⋯F and O⋯O (2.942 Å) contacts, together with an unusual S⋯π(Cp) inter-action (S⋯centroid distance = 3.385 Å), generating an extended network.
Observation of the decay $B_c^+ \\to \\psi(2S)\\pi^+$

CERN Document Server

INSPIRE-00258707; Abellan Beteta, C; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves Jr, A A; Amato, S; Amerio, S; Amhis, Y; Anderlini, L; Anderson, J; Andreassen, R; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Bachmann, S; Back, J J; Baesso, C; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bauer, Th; Bay, A; Beddow, J; Bedeschi, F; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Benayoun, M; Bencivenni, G; Benson, S; Benton, J; Berezhnoy, A; Bernet, R; Bettler, M -O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blouw, J; Blusk, S; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bowen, E; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Burducea, I; Bursche, A; Busetto, G; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carranza-Mejia, H; Carson, L; Carvalho Akiba, K; Casse, G; Cattaneo, M; Cauet, Ch; Charles, M; Charpentier, Ph; Chen, P; Chiapolini, N; Chrzaszcz, M; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Cogneras, E; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Coquereau, S; Corti, G; Couturier, B; Cowan, G A; Craik, D; Cunliffe, S; Currie, R; D'Ambrosio, C; David, P; David, P N Y; De Bonis, I; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Oyanguren Campos, M; De Paula, L; De Silva, W; De Simone, P; Decamp, D; Deckenhoff, M; Del Buono, L; Derkach, D; Deschamps, O; Dettori, F; Di Canto, A; Dijkstra, H; Dogaru, M; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisenhardt, S; Eitschberger, U; Ekelhof, R; Eklund, L; El Rifai, I; Elsasser, Ch; Elsby, D; Falabella, A; Färber, C; Fardell, G; Farinelli, C; Farry, S; Fave, V; Ferguson, D; Fernandez Albor, V; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furcas, S; Furfaro, E; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garofoli, J; Garosi, P; Garra Tico, J; Garrido, L; Gaspar, C; Gauld, R; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gordon, H; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Grünberg, O; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hall, S; Hampson, T; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; Hartmann, T; He, J; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hicks, E; Hill, D; Hoballah, M; Hombach, C; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Hussain, N; Hutchcroft, D; Hynds, D; Iakovenko, V; Idzik, M; Ilten, P; Jacobsson, R; Jaeger, A; Jans, E; Jaton, P; Jing, F; John, M; Johnson, D; Jones, C R; Jost, B; Kaballo, M; Kandybei, S; Karacson, M; Karbach, T M; Kenyon, I R; Kerzel, U; Ketel, T; Keune, A; Khanji, B; Kochebina, O; Komarov, I; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kucharczyk, M; Kudryavtsev, V; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J -P; Lefèvre, R; Leflat, A; Lefrançois, J; Leo, S; Leroy, O; Leverington, B; Li, Y; Li Gioi, L; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; von Loeben, J; Lohn, S; Lopes, J H; Lopez Asamar, E; Lopez-March, N; Lu, H; Lucchesi, D; Luisier, J; Luo, H; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Malde, S; Manca, G; Mancinelli, G; Marconi, U; Märki, R; Marks, J; Martellotti, G; Martens, A; Martin, L; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Martins Tostes, D; Massafferri, A; Matev, R; Mathe, Z; Matteuzzi, C; Maurice, E; Mazurov, A; McCarthy, J; McNulty, R; Mcnab, A; Meadows, B; Meier, F; Meissner, M; Merk, M; Milanes, D A; Minard, M -N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Morello, M J; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neufeld, N; Nguyen, A D; Nguyen, T D; Nguyen-Mau, C; Nicol, M; Niess, V; Niet, R; Nikitin, N; Nikodem, T; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Pal, B K; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perego, D L; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pessina, G; Petridis, K; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pietrzyk, B; Pilař, T; Pinci, D; Playfer, S; Plo Casasus, M; Polci, F; Polok, G; Poluektov, A; Polycarpo, E; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pugatch, V; Puig Navarro, A; Punzi, G; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Rauschmayr, N; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, A; Rinnert, K; Rives Molina, V; Roa Romero, D A; Robbe, P; Rodrigues, E; Rodriguez Perez, P; Roiser, S; Romanovsky, V; Romero Vidal, A; Rouvinet, J; Ruf, T; Ruffini, F; Ruiz, H; Ruiz Valls, P; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salzmann, C; Sanmartin Sedes, B; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schindler, H; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M -H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Skwarnicki, T; Smith, N A; Smith, E; Smith, M; Sokoloff, M D; Soler, F J P; Soomro, F; Souza, D; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Swientek, S; Syropoulos, V; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teklishyn, M; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Tonelli, D; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tresch, M; Tsaregorodtsev, A; Tsopelas, P; Tuning, N; Ubeda Garcia, M; Ukleja, A; Urner, D; Uwer, U; Vagnoni, V; Valenti, G; Vazquez Gomez, R; Vazquez Regueiro, P; Vecchi, S; Velthuis, J J; Veltri, M; Veneziano, G; Vesterinen, M; Viaud, B; Vieira, D; Vilasis-Cardona, X; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voß, C; Voss, H; Waldi, R; Wallace, R; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wicht, J; Wiechczynski, J; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wishahi, J; Witek, M; Wotton, S A; Wright, S; Wu, S; Wyllie, K; Xie, Y; Xing, F; Xing, Z; Yang, Z; Young, R; Yuan, X; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhokhov, A; Zhong, L; Zvyagin, A

2013-01-01

The decay $B_c^+ \\to \\psi(2S)\\pi^+$ with $\\psi(2S) \\to \\mu^+\\mu^-$ is observed with a significance of $5.2\\,\\sigma$ using $pp$ collision data corresponding to an integrated luminosity of 1.0 $fb^{-1}$ collected by the LHCb experiment. The branching fraction of $B_c^+ \\to \\psi(2S)\\pi^+$ decays relative to that of the $B_c^+ \\to J/\\psi\\pi^+$ mode is measured to be \\begin{equation*} \\frac{\\mathcal{B}(B_c^+ \\to \\psi(2S)\\pi^+)}{\\mathcal{B}(B_c^+ \\to J/\\psi\\pi^+)} = 0.250 \\pm 0.068 \\,\\text{stat} \\pm 0.014 \\,\\text{\\syst} \\pm 0.006 \\,(\\mathcal{B}). \\end{equation*} The last term is the uncertainty on the ratio $\\mathcal{B}(\\psi(2S) \\to \\mu^+\\mu^-)/\\mathcal{B}(J/\\psi \\to \\mu^+\\mu^-)$.
Observation of the decay $B_c^+ \\to B_s^0 \\pi^+$

CERN Document Server

Aaij, R; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves Jr, A A; Amato, S; Amerio, S; Amhis, Y; Anderlini, L; Anderson, J; Andreassen, R; Andrews, J E; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Baalouch, M; Bachmann, S; Back, J J; Baesso, C; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bauer, Th; Bay, A; Beddow, J; Bedeschi, F; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Bencivenni, G; Benson, S; Benton, J; Berezhnoy, A; Bernet, R; Bettler, M -O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blouw, J; Blusk, S; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bowen, E; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Bursche, A; Busetto, G; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Campora Perez, D; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carranza-Mejia, H; Carson, L; Carvalho Akiba, K; Casse, G; Cassina, L; Castillo Garcia, L; Cattaneo, M; Cauet, Ch; Cenci, R; Charles, M; Charpentier, Ph; Chen, P; Cheung, S -F; Chiapolini, N; Chrzaszcz, M; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Cogneras, E; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Coquereau, S; Corti, G; Couturier, B; Cowan, G A; Craik, D C; Cunliffe, S; Currie, R; D'Ambrosio, C; David, P; David, P N Y; Davis, A; De Bonis, I; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Silva, W; De Simone, P; Decamp, D; Deckenhoff, M; Del Buono, L; Déléage, N; Derkach, D; Deschamps, O; Dettori, F; Di Canto, A; Dijkstra, H; Dogaru, M; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Durante, P; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisenhardt, S; Eitschberger, U; Ekelhof, R; Eklund, L; El Rifai, I; Elsasser, Ch; Falabella, A; Färber, C; Farinelli, C; Farry, S; Ferguson, D; Fernandez Albor, V; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fiore, M; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furfaro, E; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garofoli, J; Garosi, P; Garra Tico, J; Garrido, L; Gaspar, C; Gauld, R; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Giubega, L; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gorbounov, P; Gordon, H; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Griffith, P; Grünberg, O; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hall, S; Hamilton, B; Hampson, T; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; Hartmann, T; He, J; Head, T; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Heß, M; Hicheur, A; Hicks, E; Hill, D; Hoballah, M; Hombach, C; Hulsbergen, W; Hunt, P; Huse, T; Hussain, N; Hutchcroft, D; Hynds, D; Iakovenko, V; Idzik, M; Ilten, P; Jacobsson, R; Jaeger, A; Jans, E; Jaton, P; Jawahery, A; Jing, F; John, M; Johnson, D; Jones, C R; Joram, C; Jost, B; Kaballo, M; Kandybei, S; Kanso, W; Karacson, M; Karbach, T M; Kenyon, I R; Ketel, T; Khanji, B; Kochebina, O; Komarov, I; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kucharczyk, M; Kudryavtsev, V; Kurek, K; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J -P; Lefèvre, R; Leflat, A; Lefrançois, J; Leo, S; Leroy, O; Lesiak, T; Leverington, B; Li, Y; Li Gioi, L; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; Lohn, S; Longstaff, I; Lopes, J H; Lopez-March, N; Lu, H; Lucchesi, D; Luisier, J; Luo, H; Lupton, O; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Malde, S; Manca, G; Mancinelli, G; Maratas, J; Marconi, U; Marino, P; Märki, R; Marks, J; Martellotti, G; Martens, A; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Martins Tostes, D; Martynov, A; Massafferri, A; Matev, R; Mathe, Z; Matteuzzi, C; Maurice, E; Mazurov, A; McCarthy, J; McNab, A; McNulty, R; McSkelly, B; Meadows, B; Meier, F; Meissner, M; Merk, M; Milanes, D A; Minard, M -N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mordà, A; Morello, M J; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neubert, S; Neufeld, N; Nguyen, A D; Nguyen, T D; Nguyen-Mau, C; Nicol, M; Niess, V; Niet, R; Nikitin, N; Nikodem, T; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Oyanguren, A; Pal, B K; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pearce, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pescatore, L; Pesen, E; Pessina, G; Petridis, K; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pietrzyk, B; Pilař, T; Pinci, D; Playfer, S; Plo Casasus, M; Polci, F; Polok, G; Poluektov, A; Polycarpo, E; Popov, A; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pritchard, A; Prouve, C; Pugatch, V; Puig Navarro, A; Punzi, G; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Rauschmayr, N; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, A; Rinnert, K; Rives Molina, V; Roa Romero, D A; Robbe, P; Roberts, D A; Rodrigues, A B; Rodrigues, E; Rodriguez Perez, P; Roiser, S; Romanovsky, V; Romero Vidal, A; Rouvinet, J; Ruf, T; Ruffini, F; Ruiz, H; Ruiz Valls, P; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salustino Guimaraes, V; Sanmartin Sedes, B; Santacesaria, R; Santamarina Rios, C; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schiller, M; Schindler, H; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M -H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Sirendi, M; Skidmore, N; Skwarnicki, T; Smith, N A; Smith, E; Smith, E; Smith, J; Smith, M; Sokoloff, M D; Soler, F J P; Soomro, F; Souza, D; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stevenson, S; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Sun, L; Sutcliffe, W; Swientek, S; Syropoulos, V; Szczekowski, M; Szczypka, P; Szilard, D; Szumlak, T; T'Jampens, S; Teklishyn, M; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Tonelli, D; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tresch, M; Tsaregorodtsev, A; Tsopelas, P; Tuning, N; Ubeda Garcia, M; Ukleja, A; Ustyuzhanin, A; Uwer, U; Vagnoni, V; Valenti, G; Vallier, A; Vazquez Gomez, R; Vazquez Regueiro, P; Vázquez Sierra, C; Vecchi, S; Velthuis, J J; Veltri, M; Veneziano, G; Vesterinen, M; Viaud, B; Vieira, D; Vilasis-Cardona, X; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voß, C; Voss, H; de Vries, J A; Waldi, R; Wallace, C; Wallace, R; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wicht, J; Wiechczynski, J; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wimberley, J; Wishahi, J; Wislicki, W; Witek, M; Wotton, S A; Wright, S; Wu, S; Wyllie, K; Xie, Y; Xing, Z; Yang, Z; Yuan, X; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhokhov, A; Zhong, L; Zvyagin, A

2013-01-01

The result of a search for the decay $B_c^+ \\to B_s^0 \\pi^+$ is presented, using the $B_s^0 \\to D_s^- \\pi^+$ and $B_s^0 \\to J/\\psi \\phi$ channels. The analysis is based on a data sample of pp collisions collected with the LHCb detector, corresponding to an integrated luminosity of 1 fb$^{-1}$ taken at a center-of-mass energy of 7 TeV, and 2 fb$^{-1}$ taken at 8 TeV. The decay $B_c^+ \\to B_s^0 \\pi^+$ is observed with significance in excess of five standard deviations independently in both decay channels. The measured product of the ratio of cross-sections and branching fraction is $\\sigma(B_c^+)/\\sigma(B_s^0) \\times \\mathcal{B}(B_c^+ \\to B_s^0 \\pi^+) = (2.37 \\pm 0.31 (\\text{stat}) \\pm 0.11 (\\text{syst}) ^{+0.17}_{-0.13} (\\tau_{B_c^+})) \\times 10^{-3}$ in the pseudorapidity range $2 < \\eta(B) < 5$, where the first uncertainty is statistical, the second is systematic and the third is due to the uncertainty on the $B_c^+$ lifetime. This is the first observation of a $B...
11 CFR 100.11 - State (2 U.S.C. 431(12)).

Science.gov (United States)

2010-01-01

... 11 Federal Elections 1 2010-01-01 2010-01-01 false State (2 U.S.C. 431(12)). 100.11 Section 100.11 Federal Elections FEDERAL ELECTION COMMISSION GENERAL SCOPE AND DEFINITIONS (2 U.S.C. 431) General Definitions § 100.11 State (2 U.S.C. 431(12)). State means each State of the United States, the District of...

Tests sérologiques dans la maladie cœliaque

Science.gov (United States)

Rashid, Mohsin; Lee, Jennie

2016-01-01

Résumé Objectif Répondre aux questions souvent posées par les généralistes et aux difficultés auxquelles ils font face lorsqu’ils prescrivent des tests sérologiques pour la maladie cœliaque et fournir des conseils pratiques pour aider à interpréter les résultats des tests. Sources de l’information Une recherche a été effectuée dans MEDLINE pour les lignes directrices sur le diagnostic et la prise en charge de la maladie cœliaque publiées en anglais entre 2000 et 2015 par des organisations professionnelles de gastro-entérologie. Message principal Pour dépister la maladie cœliaque, le dosage de l’anticorps immunoglobuline A (IgA) anti-transglutaminase tissulaire est le test de choix. Il faut mesurer le taux sérique d’IgA totale afin d’écarter un déficit sélectif en IgA et d’éviter les faux négatifs. Les patients dont le test sérologique est positif doivent être recommandés à un gastro-entérologue pour subir des biopsies de l’intestin grêle par endoscopie afin de confirmer le diagnostic. Le typage des antigènes des leucocytes humains DQ2 et DQ8 peut aider à écarter le diagnostic. Un régime sans gluten ne doit pas être entrepris avant que le diagnostic de maladie cœliaque soit confirmé. Conclusion Les tests sérologiques sont très utiles pour confirmer les soupçons d’une maladie cœliaque. Le diagnostic précoce est essentiel pour prévenir les complications liées à la maladie cœliaque.
Décès - French version only

CERN Multimedia

Affaires sociales

2004-01-01

Nous avons le regret d'annoncer le décès de Monsieur Hubert MUELLER survenu le 09.09.2004. M. Hubert MUELLER, né le 25.09.1947, travaillait à la Commission de sécurité et était au CERN depuis le 02.12.1968. Le Directeur général a envoyé un message de condoléances à sa famille de la part du personnel du CERN. Affaires sociales Département des Ressources humaines C'est avec beaucoup de tristesse que nous avons appris que notre collègue et ami Hubert Müller nous a définitivement quittés le jeudi 9 septembre. Nous perdons en lui un être apprécié dans la Commission de sécurité et partout au CERN pour sa serviabilité envers ses collègues. Ses compétences professionnelles dans les domaines électrique et mécanique prouvées depuis son entrée au CERN en 1968 ont toujours été associées à un esprit chaleureux, optimiste et serein, en dépit d'une grave maladie de longue date. ...
(4-Chloroacetanilido-κ2N,Obis[2-(pyridin-2-ylphenyl-κ2C1,N]iridium(III

Directory of Open Access Journals (Sweden)

Lijun Sun

2013-02-01

Full Text Available In the neutral mononuclear iridium(III title compound, [Ir(C8H7ClNO(C11H8N2], the IrIII atom adopts an octahedral geometry, and is coordinated by two 2-phenylpyridyl ligands and one anionic 4-chloroacetanilide ligand. The 2-phenylpyridyl ligands are arranged in a cis-C,C′ and cis-N,N′ fashion. Each 2-phenylpyridyl ligand forms a five-membered ring with the IrIII atom. The 2-phenylpyridyl planes are perpendicular to each other [dihedral angle = 89.9 (1°]. The Ir—C and Ir—N bond lengths are comparable to those reported for related iridium(III 2-phenylpyridyl complexes. The remaining two coordination sites are occupied by the amidate N and O atoms, which form a four-membered ring with the iridium atom (Ir—N—C—O. The amidate plane is nearly perpendicular to both 2-phenylpyridyl ligands [dihedral angles = 87.8 (2 and 88.3 (2°].
Crystal structure of 4-fluoro-N-[2-(4-fluoro-benzo-yl)hydra-zine-1-carbono-thio-yl]benzamide.

Science.gov (United States)

Firdausiah, Syadza; Salleh Huddin, Ameera Aqeela; Hasbullah, Siti Aishah; Yamin, Bohari M; Yusoff, Siti Fairus M

2014-09-01

In the title compound, C15H11F2N3O2S, the dihedral angle between the fluoro-benzene rings is 88.43 (10)° and that between the central semithiocarbazide grouping is 47.00 (11)°. The dihedral angle between the amide group and attached fluoro-benzene ring is 50.52 (11)°; the equivalent angle between the carbonyl-thio-amide group and its attached ring is 12.98 (10)°. The major twists in the mol-ecule occur about the C-N-N-C bonds [torsion angle = -138.7 (2)°] and the Car-Car-C-N (ar = aromatic) bonds [-132.0 (2)°]. An intra-molecular N-H⋯O hydrogen bond occurs, which generates an S(6) ring. In the crystal, the mol-ecules are linked by N-H⋯O and N-H⋯S hydrogen bonds, generating (001) sheets. Weak C-H⋯O and C-H⋯F inter-actions are also observed.
N,N,N,N′,N′,N′-Hexakis(2-hydroxyethylbutane-1,4-diaminium bis(2-sulfanylidene-1,3-dithiole-4,5-dithiolato-κ2S4,S5zincate

Directory of Open Access Journals (Sweden)

Xiulan Zhang

2013-07-01

Full Text Available In the asymmetric unit of the title compound, (C16H38N2O6[Zn(C3S52], two independent cations lie across inversion centers. In one of the cations, the three symmetry-unique O—H groups are disordered over two sets of sites with refined occupancy ratios of 0.701 (9:0.299 (9, 0.671 (8:0.329 (8 and 0.566 (7:0.434 (7. In the anion, the ZnII ion is coordinated in a distorted tetrahedral environment by four S atoms of two chelating 1,3-dithiole-2-thione-4,5-dithiolato ligands. The dihedral angle between the mean planes [maximun deviations = 0.022 (3 and 0.0656 (6 Å] of the two ligands is 87.76 (3°. An intamolecular O—H...O hydrogen bond occurs in the disordered cation. In the crystal, O—H...O and O—H...S hydrogen bonds link the components into a two-dimensional network parallel to (0-11.
The power of hard-sphere models: explaining side-chain dihedral angle distributions of Thr and Val.

Science.gov (United States)

Zhou, Alice Qinhua; O'Hern, Corey S; Regan, Lynne

2012-05-16

The energy functions used to predict protein structures typically include both molecular-mechanics and knowledge-based terms. In contrast, our approach is to develop robust physics- and geometry-based methods. Here, we investigate to what extent simple hard-sphere models can be used to predict side-chain conformations. The distributions of the side-chain dihedral angle χ(1) of Val and Thr in proteins of known structure show distinctive features: Val side chains predominantly adopt χ(1) = 180°, whereas Thr side chains typically adopt χ(1) = 60° and 300° (i.e., χ(1) = ±60° or g- and g(+) configurations). Several hypotheses have been proposed to explain these differences, including interresidue steric clashes and hydrogen-bonding interactions. In contrast, we show that the observed side-chain dihedral angle distributions for both Val and Thr can be explained using only local steric interactions in a dipeptide mimetic. Our results emphasize the power of simple physical approaches and their importance for future advances in protein engineering and design. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.
(5S,6R-6-Bromo-6-methyl-5-phenyl-3,4,5,6-tetrahydro-2H-cyclopenta[b]pyran-7-one

Directory of Open Access Journals (Sweden)

Winai Ieawsuwan

2011-10-01

Full Text Available The title compound, C15H15BrO2, was synthesized by a Brønsted acid-catalysed domino electrocyclization-halogenation reaction. The five-membered ring is essentially planar (r.m.s. deviation 0.006 Å and forms a dihedral angle of 72.7 (3° with the attached phenyl ring. The six-membered heterocycle adopts a half-chair conformation. The crystal packing is stabilized by a C—H...O contact.
CA.C.I.U.S.: Ultrasonic C imaging camera. Contribution to its study and its realization

International Nuclear Information System (INIS)

Moretti, Jean-Luc

1980-10-01

CA.C.I.U.S. is a dynamic imaging three-dimensional echographic camera. This device provides automatic C images which are frontal slices, orthogonal to the ultrasonic propagation. The detector has a cylindrical shape, its focal length of 250 mm and its size is 220 x 143 mm. The useful field is less large (170 x 143 mm) regarding the impossibility to use entirely the 73 elements electronic pattern on the edges. The emitting array is done in two parts. These two parts. The receiver is an electronically focused mono-dimensional array made of 147 elements (0,8 x 5 mm 2 ) spaced 0,7 mm apart, placed between the emitting arrays. These two arrays contain 22 strips of ten bent transducers (10 x 13,7 mm 2 ). The receiver elements are protected form the water of the tank by a loaded araldite layer of λ/4 thickness which allows a better uniformity response with the reception angle. The array elements are matched to 2.2 MHz, the basking is made of a multilayer plastic material (CELORON). This device allows a geometric focalization of the emission. The thickness of each slice C is 2 ± 0,5 cm, depending on its place in the frontal place (better in the center) and on the weighing factors adjusted at the back of the emitting array. The spatial resolution is 1.5 mm (F. W.H.M.) in the two axis orthogonal to the ultrasonic propagation. Several receivers were made. The electronic pattern was optimized by computer study, its results showed an improving of the image definition. Logarithmic amplifiers were used behind each element to allow simultaneous analysis of small echoes coming from the tissue itself and big boundary echoes. The array was placed in a tank filled with water closed by a double membrane. The visualization was obtained in a grey scale dynamic memory. Several emission reception synchronizations were studied. The slowest mode (1 image by second) gave the best signal on noise ratio. CA.C.I.U.S. demonstrates the reality of the slow dynamic C echography and the necessity
Décès - French version only

CERN Multimedia

Affaires sociales

2004-01-01

Nous avons le regret d'annoncer le décès de Madame Eveline DURIEU-THIRY survenu le 14.10.2004. Mme Eveline DURIEU-THIRY, née le 26.06.1949, a travaillé au Département AB et était au CERN depuis le 16.03.1971. Le Directeur général a envoyé un message de condoléances à sa famille de la part du personnel du CERN. Affaires sociales Département des Ressources humaines C'est avec très grande tristesse que nous avons appris que notre collègue et amie, Eveline Durieu-Thiry, nous a définitivement quittés le 14 octobre. Tout au long des quatre mois de sa terrible maladie, nous l'avons admirée pour son courage et sa combativité, et nous gardions le ferme espoir de la revoir un jour parmi nous. Nous perdons en elle une collègue appréciée de tous pour son extrême gentillesse et sa grande servi...
The phase system Fe-Ir-S at 1100, 1000 and 800 degree C

DEFF Research Database (Denmark)

Makovicky, Emil; Karup-Møller, Sven

1999-01-01

Phase relations in the dry condensed Fe-Ir-S system were determined at 1100, 1000 and 800 degrees C. Orientational runs were performed at 500 degrees C. Between 1100 and 800 degrees C, the system comprises five sulphides and an uninterrupted field of gamma(Fe, Ir). Fe1-xS dissolves 5.8 at.% Ir...... at 1100 degrees C, 3.4 at.% Ir at 1000 degrees C and 1.0 at.% Ir at 800 degrees C. The solubility of Fe in Ir2S3, IrS2 and IrSsimilar to 3 increases with decreasing temperature, reaching 2.5 at.% in the latter two sulphides at 800 degrees C. Thiospinel 'FeIr2S4' is nonstoichiometric, from Fe22.3Ir19.8S58...
Décès - French version only

CERN Document Server

2005-01-01

C'est avec une profonde tristesse que ses collègues et amis ont appris la disparition de Heiner Herr le 19 janvier, des suites d'une longue et cruelle maladie. Au début des années 80, Heiner participa à l'aventure de l'anneau de refroidissement de particules ICE au CERN. C'est à cette époque qu'il donna à une de ses inventions le nom de sa fille aînée : ELENA. Refroidir des particules n'a pas dû être particulièrement facile pour cet homme chaleureux qu'était Heiner. C'est sans doute pourquoi il a aussi largement contribué pendant les années 80 à l'utilisation de ICE dans un pays du Nord pour construire à Uppsala l'anneau Celsius. Les enseignements de ICE permirent par la suite d'obtenir de grandes quantités d'anti-protons, l'une des clés de la découverte des bosons W et Z. Par un juste retour des choses c'est dans l'expérience DELPHI, consacrée à l'étude fine de ces bosons Z et W, que Heiner allait se lancer ensuite. Son rôle dans DELPHI a été majeur et multiple. Tout d'abord, p...
(S)- and (R)-[[sup 11]C]nicotine and the metabolite (R/S)-[[sup 11]C]cotinine. Preparation, metabolite studies and in vivo distribution in the human brain using PET

Energy Technology Data Exchange (ETDEWEB)

Halldin, C.; Swahn, C.-G.; Nybaeck, H. (Karolinska Hospital, Stockholm (Sweden)); Naagren, K. (Turku Univ. (Finland). Medical Cyclotron-PET Centre/Radiochemistry Lab.); Laangstroem, B. (Uppsala Univ. (Sweden). Dept. of Organic Chemistry)

1992-11-01

In order to investigate [[sup 11]C]nicotine binding and metabolism in the living human brain by PET, routine protocols were developed for the preparation and purification of (S)-and (R)-[[sup 11]C]nicotine and the metabolite (R/S)-[[sup 11]C]cotinine. (S)- and (R)-[[sup 11]C]nicotine were prepared by N-methylation with [[sup 11]C]methyl iodide of the appropriate secondary amine, which was liberated in situ by 2,2,6,6,-tetramethylpiperidine (TMP) from its corresponding biscamsylate-salt. (R/S)-[[sup 11]C]Cotinine was prepared by N-methylation of the amide precursor using tetrabutylammonium hydroxide as a phase transfer catalyst. Straight-phase semipreparative HPLC was in all purifications found to be superior to reversed-phase since the contamination by the norcompounds was eliminated. Reaction in acetonitrile for both (S)- and (R)-[[sup 11]C]nicotine and (R/S)-[[sup 11]C]cotinine with subsequent straight-phase HPLC purification resulted in 35-45% radiochemical yield with a total synthesis time of 30-35 min, a specific radioactivity of 1000-1500 Ci/mmol (37-55 GBq/[mu]mol, EOS) and a radiochemical purity >99%. The uptake and distribution of these tracers in the human brain was studied in healthy volunteers by PET. The metabolite (R/S)-[[sup 11]C]cotinine did not cross the blood-brain barrier to any significant degree. (author).
Ethyl 2-(3,4-dimethyl-5,5-dioxo-1H,4H-benzo[e]pyrazolo[4,3-c][1,2]thiazin-1-ylacetate

Directory of Open Access Journals (Sweden)

Sana Aslam

2012-10-01

Full Text Available In the title molecule, C15H17N3O4S, the heterocyclic thiazine ring adopts a twist-boat conformation, which differs from that in related compounds, with adjacent S and C atoms displaced by 0.981 (4 and 0.413 (5 Å, respectively, on the same side of the mean plane formed by the remaining ring atoms. The mean plane of the benzene ring makes a dihedral angle of 23.43 (14° with the mean plane of the pyrazole ring. In the crystal, molecules are connected by weak C—H...O hydrogen bonds to form a three-dimensional network. The H atoms of the methyl group attached to the pyrazole ring were refined over six sites with equal occupancies.
Portlandite content and ionic transport properties of hydrated C3S pastes

International Nuclear Information System (INIS)

Henocq, P.; Samson, E.; Marchand, J.

2012-01-01

This paper presents the results of a C 3 S paste characterization study. The objective was to determine the parameters needed to model the process of degradation. The experimental study focused on determining the portlandite content and the ionic diffusion coefficients of C 3 S paste. The molar C/S ratio of C–S–H in hydrated C 3 S pastes was also investigated. The portlandite content was determined with an experimental method based on an electron microprobe analysis. This method leads to a portlandite mass content of 24.4 ± 2.3%. The diffusion coefficient of each ionic species was determined by inverse analysis of diffusion test data performed on hydrated C 3 S samples using a multiionic transport model.
Predicting beta-turns and their types using predicted backbone dihedral angles and secondary structures.

Science.gov (United States)

Kountouris, Petros; Hirst, Jonathan D

2010-07-31

Beta-turns are secondary structure elements usually classified as coil. Their prediction is important, because of their role in protein folding and their frequent occurrence in protein chains. We have developed a novel method that predicts beta-turns and their types using information from multiple sequence alignments, predicted secondary structures and, for the first time, predicted dihedral angles. Our method uses support vector machines, a supervised classification technique, and is trained and tested on three established datasets of 426, 547 and 823 protein chains. We achieve a Matthews correlation coefficient of up to 0.49, when predicting the location of beta-turns, the highest reported value to date. Moreover, the additional dihedral information improves the prediction of beta-turn types I, II, IV, VIII and "non-specific", achieving correlation coefficients up to 0.39, 0.33, 0.27, 0.14 and 0.38, respectively. Our results are more accurate than other methods. We have created an accurate predictor of beta-turns and their types. Our method, called DEBT, is available online at http://comp.chem.nottingham.ac.uk/debt/.
Synthesis of racemic, R- and S-[1-11C]-β-hydroxybutyric acid

International Nuclear Information System (INIS)

Thorell, J.-O.; Stone-Elander, S.; Karolinska Hospital and Inst., Stockholm; Koenig, W.A.; Halldin, C.; Widen, L.

1991-01-01

Racemic, R- and S-β-hydroxybutyric acid were labelled with 11 C in the carboxylic position by a two-step stereospecific synthesis starting with carrier-added [ 11 C]cyanide and R/S, R- or S-propylene oxide. Hydrolysis of the intermediate nitrile with hydrochloric acid gave racemic [1- 11 C]-β-hydroxybutyric acid and R- or S-[1- 11 C]-β-hydroxybutyric acid with an enantiomeric excess of 87-97%. The total synthesis time (including HPLC purification) was 45-50 min from end of trapping. The isolated decay-corrected radiochemical yield was 20-30% based on [ 11 C]cyanide. The radiochemical purity of the products was > 99%]. (author)
Normal mode analysis based on an elastic network model for biomolecules in the Protein Data Bank, which uses dihedral angles as independent variables.

Science.gov (United States)

Wako, Hiroshi; Endo, Shigeru

2013-06-01

We have developed a computer program, named PDBETA, that performs normal mode analysis (NMA) based on an elastic network model that uses dihedral angles as independent variables. Taking advantage of the relatively small number of degrees of freedom required to describe a molecular structure in dihedral angle space and a simple potential-energy function independent of atom types, we aimed to develop a program applicable to a full-atom system of any molecule in the Protein Data Bank (PDB). The algorithm for NMA used in PDBETA is the same as the computer program FEDER/2, developed previously. Therefore, the main challenge in developing PDBETA was to find a method that can automatically convert PDB data into molecular structure information in dihedral angle space. Here, we illustrate the performance of PDBETA with a protein-DNA complex, a protein-tRNA complex, and some non-protein small molecules, and show that the atomic fluctuations calculated by PDBETA reproduce the temperature factor data of these molecules in the PDB. A comparison was also made with elastic-network-model based NMA in a Cartesian-coordinate system. Copyright © 2013 Elsevier Ltd. All rights reserved.
Salivary Tick Cystatin OmC2 Targets Lysosomal Cathepsins S and C in Human Dendritic Cells

Czech Academy of Sciences Publication Activity Database

Zavasnik-Bergant, T.; Vidmar, R.; Sekirnik, A.; Fonovic, M.; Salát, Jiří; Grunclová, Lenka; Kopáček, Petr; Turk, B.

2017-01-01

Roč. 7, JUN 30 (2017), č. článku 288. ISSN 2235-2988 R&D Projects: GA ČR GA13-11043S Institutional support: RVO:60077344 Keywords : cystatin OmC2 * tick saliva * cathepsin S * cathepsin C * lysosomal proteases * dpp1 * dipeptidyl peptidase 1 * dendritic cells Subject RIV: EC - Immunology OBOR OECD: Immunology Impact factor: 4.300, year: 2016
C. S. Peirce’s Semiotic Answer to the Riddle of Consciousness

DEFF Research Database (Denmark)

Brier, Søren

A scientific explanation of consciousness that is not partially based on phenomenology seems logically impossible. C.S. Peirce’s pragmaticist semiotics attempts to bridge the gap between natural sciences and humanities by combining a phenomenological approach with an evolutionary and realistic...... understanding of nature and society in the development of a new transdisicplinary and evolutionary theory of meaning and logic in a semiotic theory of mind and consciousness. Though a contributor to the development of modern logic and science Peirce, through inventing a semiotics that embraced phenomenology...
(3R,4R,4aS,7aR,12bS-3-Cyclopropylmethyl-4a,9-dihydroxy-3-methyl-7-oxo-2,3,4,4a,5,6,7,7a-octahydro-1H-4,12-methanobenzofuro[3,2-e]isoquinolin-3-ium bromide

Directory of Open Access Journals (Sweden)

Xiangfeng Chen

2012-02-01

Full Text Available The title compound, C21H26NO4+·Br−, also known as R-methylnaltrexone (MNTX bromide, is a selective peripherally acting μ-opioid receptor antagonist with a oroxymorphone skeleton, synthesized by hydroxyl protection, N-methylation, deprotection and anion exchange of naltrexone. It comprises a five-ring system A/B/C/D/E. Rings C and E adopt distorted chair conformations, whereas ring D is in half-chair conformation. The C/E ring junctions are trans fused. The dihedral angle between rings D and E is 82.3 (1°, while the dihedral angles between the planes of rings C and A, and rings D and E are respectively 81.7 (1, 75.9 (1 and 12.2 (1°. In the crystal, molecules are linked by O—H...Br hydrogen bonds.

Sub-Coulomb α Transfers on C12 and the C12(α, γ)O16 S Factor

International Nuclear Information System (INIS)

Brune, C. R.; Geist, W. H.; Kavanagh, R. W.; Veal, K. D.

1999-01-01

The 12 C( α, γ) 16 O reaction is crucial for the understanding of He burning in massive stars, but the low-energy cross section is highly uncertain. To address this problem we have measured at sub-Coulomb energies total cross sections for the 12 C( 6 Li, d) 16 O and 12 C( 7 Li, t) 16 O reactions to the bound 2 + and 1 - states of 16 O . The data are analyzed to obtain the reduced α widths of these states. Together with capture and phase-shift data, these results provide for a more accurate determination of the low-energy 12C(α, γ) 16 O S factor: S E1 (0.3 MeV) =101±17 keV b and S E2 (0.3 MeV) =42 +16 -23 keV b for the E1 and E2 multipole components of the reaction. (c) 1999 The American Physical Society
Chemical alteration of calcium silicate hydrates in saline groundwater. Mechanism of sorption of Na on C-S-H and effect of NaCl on leaching of Ca from C-S-H

International Nuclear Information System (INIS)

Sugiyama, Daisuke; Fujita, Tomonari

2004-01-01

In the concept for TRU waste disposal in Japan, cement is a potential waste packaging and backfilling material and is expected to provide chemical containment. In the presence of some reactive ions in a saline groundwater, the chemical properties of cement materials should be affected. In this study, the mechanism of sorption of sodium (Na) on C-S-H and the effect of sodium chloride (NaCl) concentration on dissolution of Calcium Silicate Hydrate (C-S-H) are discussed by measuring the sorption isotherm of sodium onto C-S-H gel (Ca/Si = 0.65-1.2). Based on the experimental results, it is showed that sodium sorbs by substitution for Ca in C-S-H phases and leaching of Ca from C-S-H is enhanced in NaCl solution ( -1 mol dm -3 ). The results of sorption experiments are reasonably well modelled by the ion-exchange model assuming some calcium sites with different ion-exchange log K values. It is also suggested that the dissolution of C-S-H can be modelled reasonably well by considering the effect of ionic strength on activity coefficients of aqueous species for high Ca/Si ratio of C-S-H, and the effect of exchange of sodium with calcium of C-S-H on leaching of Ca becomes obvious for lower Ca/Si ratio of C-S-H. (author)
Accurate Analysis of Target Characteristic in Bistatic SAR Images: A Dihedral Corner Reflectors Case.

Science.gov (United States)

Ao, Dongyang; Li, Yuanhao; Hu, Cheng; Tian, Weiming

2017-12-22

The dihedral corner reflectors are the basic geometric structure of many targets and are the main contributions of radar cross section (RCS) in the synthetic aperture radar (SAR) images. In stealth technologies, the elaborate design of the dihedral corners with different opening angles is a useful approach to reduce the high RCS generated by multiple reflections. As bistatic synthetic aperture sensors have flexible geometric configurations and are sensitive to the dihedral corners with different opening angles, they specially fit for the stealth target detections. In this paper, the scattering characteristic of dihedral corner reflectors is accurately analyzed in bistatic synthetic aperture images. The variation of RCS with the changing opening angle is formulated and the method to design a proper bistatic radar for maximizing the detection capability is provided. Both the results of the theoretical analysis and the experiments show the bistatic SAR could detect the dihedral corners, under a certain bistatic angle which is related to the geometry of target structures.
Accurate Analysis of Target Characteristic in Bistatic SAR Images: A Dihedral Corner Reflectors Case

Directory of Open Access Journals (Sweden)

Dongyang Ao

2017-12-01

Full Text Available The dihedral corner reflectors are the basic geometric structure of many targets and are the main contributions of radar cross section (RCS in the synthetic aperture radar (SAR images. In stealth technologies, the elaborate design of the dihedral corners with different opening angles is a useful approach to reduce the high RCS generated by multiple reflections. As bistatic synthetic aperture sensors have flexible geometric configurations and are sensitive to the dihedral corners with different opening angles, they specially fit for the stealth target detections. In this paper, the scattering characteristic of dihedral corner reflectors is accurately analyzed in bistatic synthetic aperture images. The variation of RCS with the changing opening angle is formulated and the method to design a proper bistatic radar for maximizing the detection capability is provided. Both the results of the theoretical analysis and the experiments show the bistatic SAR could detect the dihedral corners, under a certain bistatic angle which is related to the geometry of target structures.
Accurate Analysis of Target Characteristic in Bistatic SAR Images: A Dihedral Corner Reflectors Case

Science.gov (United States)

Ao, Dongyang; Hu, Cheng; Tian, Weiming

2017-01-01

The dihedral corner reflectors are the basic geometric structure of many targets and are the main contributions of radar cross section (RCS) in the synthetic aperture radar (SAR) images. In stealth technologies, the elaborate design of the dihedral corners with different opening angles is a useful approach to reduce the high RCS generated by multiple reflections. As bistatic synthetic aperture sensors have flexible geometric configurations and are sensitive to the dihedral corners with different opening angles, they specially fit for the stealth target detections. In this paper, the scattering characteristic of dihedral corner reflectors is accurately analyzed in bistatic synthetic aperture images. The variation of RCS with the changing opening angle is formulated and the method to design a proper bistatic radar for maximizing the detection capability is provided. Both the results of the theoretical analysis and the experiments show the bistatic SAR could detect the dihedral corners, under a certain bistatic angle which is related to the geometry of target structures. PMID:29271917
39 CFR 211.1 - Disposition of former title 39, U.S.C.

Science.gov (United States)

2010-07-01

... 39 Postal Service 1 2010-07-01 2010-07-01 false Disposition of former title 39, U.S.C. 211.1... REGULATIONS § 211.1 Disposition of former title 39, U.S.C. Except as otherwise continued in effect as postal regulations, all provisions of former title 39, U.S.C., which were continued in effect as regulations of the...
In vivo positron emission tomography studies on the novel nicotinic receptor agonist [11C]MPA compared with [11C]ABT-418 and (S)(-)[11C]nicotine in Rhesus monkeys

International Nuclear Information System (INIS)

Sihver, Wiebke; Fasth, Karl-Johan; Oegren, Matthias; Lundqvist, Hans; Bergstroem, Mats; Watanabe, Yasuyoshi; Laangstroem, Bengt; Nordberg, Agneta

1999-01-01

The novel 11 C-labeled nicotinic agonist (R,S)-1-[ 11 C]methyl-2(3-pyridyl)azetidine ([ 11 C]MPA) was evaluated as a positron emission tomography (PET) ligand for in vivo characterization of nicotinic acetylcholine receptors in the brain of Rhesus monkeys in comparison with the nicotinic ligands (S)-3-methyl-5-(1-[ 11 C]methyl-2-pyrrolidinyl)isoxazol ([ 11 C]ABT-418) and (S)(-)[ 11 C]nicotine. The nicotinic receptor agonist [ 11 C]MPA demonstrated rapid uptake into the brain to a similar extent as (S)(-) [ 11 C]nicotine and [ 11 C]ABT-418. When unlabeled (S)(-)nicotine (0.02 mg/kg) was administered 5 min before the radioactive tracers, the uptake of [ 11 C]MPA was decreased by 25% in the thalamus, 19% in the temporal cortex, and 11% in the cerebellum, whereas an increase was found for the uptake of (S)(-)[ 11 C]nicotine and [ 11 C]ABT-418. This finding indicates specific binding of [ 11 C]MPA to nicotinic receptors in the brain in a simple classical displacement study. [ 11 C]MPA seems to be a more promising radiotracer than (S)(-)[ 11 C]nicotine or [ 11 C]ABT-418 for PET studies to characterize nicotinic receptors in the brain
The Re-Fe-S system at 1200, 1100, 1000 and 900 degree C

DEFF Research Database (Denmark)

Karup-Møller, Sven; Makovicky, E.

1999-01-01

Phase relations in the dry condensed phase system Fe-Re-S from 1200oC down to 900oC involve S-poor Fe-S melt with up to 0.2 at.% dissolved Re, S-rich melt with 0.3-0.4 at.% dissolved Re at 1200oC, Fe1-xS with Re contents growing from nil for troilite to 0.2 at.% for S-richer compositions, gFe wit...
HFE gene C282Y, H63D and S65C mutations frequency in the Transylvania region, Romania.

Science.gov (United States)

Trifa, Adrian P; Popp, Radu A; Militaru, Mariela S; Farcaş, Marius F; Crişan, Tania O; Gana, Ionuţ; Cucuianu, Andrei; Pop, Ioan V

2012-06-01

HFE-associated haemochromatosis is one of the most frequent autosomal recessive disorders in the Caucasian population. Although most of the cases are homozygous individuals for the C282Y mutation, another two mutations, H63D and S65C, have been reported to be associated with milder forms of the disease. This study was a first attempt to evaluate the distribution of these HFE gene mutations in the Transylvania region. Two-hundred and twenty-five healthy, unrelated volunteers originating from the Transylvania region, Romania, were screened for the HFE gene C282Y, H63D and S65C mutations, using molecular genetics assays (Polymerase Chain Reaction-Restriction Fragments Length Polymorphism). For the C282Y mutation, 7 heterozygotes (3.1%) were found, but no homozygous individual. In the case of the H63D mutation, 40 heterozygotes (17.8%) and 4 homozygotes (1.75%) for the mutant allele were evidenced. We found a compound heterozygous genotype (C282Y/H63D) in one individual (0.45%). Thus, the allele frequencies of the C282Y and H63D were 1.75% and 10.9%, respectively. Three individuals (1.3%) were found to harbour the S65C mutation in a heterozygous state, but none in a homozygous state: the allele frequency of the mutant allele was 0.75%. The distribution of the HFE gene C282Y, H63D and S65C mutations found in our group matches the tendencies observed in other European countries: a decreasing gradient from Northern to Southern Europe for the C282Y mutation; high frequency for the H63D mutation, and low frequency for the S65C mutation in most of the countries.
THE IMPLEMENTATION OF THE TABLEAU DE BORD AT S.C. TURBOMECANICA S.A.

OpenAIRE

Dragos Ionut IONESCU

2014-01-01

This paper presents the positive aspects of the usage of the tableau de bord as a management instrument, being known for having beneficial effects on the efficiency of the managers’ working processes and on the rationalization of the managerial information system. These aspects are highlighted through the creation of the tableau de bord for the general manager of S.C. Turbomecanica S.A.
On the perfectness of C^{∞,s}-diffeomorphism groups on a foliated manifold

OpenAIRE

Jacek Lech

2008-01-01

The notion of \$C^{r,s}\$ and \$C^{\\infty,s}\$-diffeomorphisms is introduced. It is shown that the identity component of the group of leaf preserving \$C^{\\infty,s}\$-diffeomorphisms with compact supports is perfect. This result is a modification of the Mather and Epstein perfectness theorem.
The Double–Double Radio Galaxy 3C293 S. A. Joshi1,∗ , S. Nandi2 ...

Indian Academy of Sciences (India)

prominent hot-spot in the north-western lobe as well as the age of the inner double structure suggests that the interruption of jet activity is <. ∼0.1 Myr. References. Beswick R.J., Peck A.B., Taylor G.B., Giovannini G. 2004, Mon. Not. R. Astron. Soc., 352, 49. Joshi S.A., Nandi S., Saikia D.J., Ishwara-Chandra C.H., Konar C.
Study of the ηc(1 1S0) state of charmonium formed in bar pp annihilations and a search for the ηc'(2 1S0)

International Nuclear Information System (INIS)

Armstrong, T.A.; Bettoni, D.; Bharadwaj, V.; Biino, C.; Blanford, G.; Borreani, G.; Broemmelsiek, D.; Buzzo, A.; Calabrese, R.; Ceccucci, A.; Cester, R.; Church, M.; Dalpiaz, P.; Dalpiaz, P.F.; Dimitroyannis, D.; Fabbri, M.; Fast, J.; Gianoli, A.; Ginsburg, C.M.; Gollwitzer, K.; Govi, G.; Hahn, A.; Hasan, M.; Hsueh, S.; Lewis, R.; Luppi, E.; Macri, M.; Majewska, A.M.; Mandelkern, M.; Marchetto, F.; Marinelli, M.; Marques, J.; Marsh, W.; Martini, M.; Masuzawa, M.; Menichetti, E.; Migliori, A.; Mussa, R.; Palestini, S.; Pallavicini, M.; Passaggio, S.; Pastrone, N.; Patrignani, C.; Peoples, J. Jr.; Petrucci, F.; Pia, M.G.; Pordes, S.; Rapidis, P.; Ray, R.; Reid, J.; Rinaudo, G.; Roccuzzo, B.; Rosen, J.; Santroni, A.; Sarmiento, M.; Savrre, M.; Schultz, J.; Seth, K.K.; Smith, A.; Smith, G.A.; Sozzi, M.; Trokenheim, S.; Weber, M.F.; Werkema, S.; Zhang, Y.; Zhao, J.; Zioulas, G.

1995-01-01

The E760 Collaboration performed an experiment in the Antiproton Accumulator at Fermilab to study the two photon decay of the η c (1 1 S 0 ) charmonium state formed in bar pp annihilations. This resulted in a new measurement of the mass M ηc =2988.3 -3.1 +3.3 MeV/c 2 and of the product B(η c → bar pp)xΓ(η c →γγ) =(8.1 -2.0 +2.9 ) eV. We performed a search for the process bar pp→η c ' (2 1 S 0 )→γγ over a limited range of center-of-mass energies. Since no signal was observed, we derived upper limits on the product of branching ratios B(η c ' → bar pp)xB(η c ' →γγ) in the center-of-mass energy range 3584≤ √s ≤3624 MeV. We observed no signal for the nonresonant process bar p+p→γ+γ and obtain upper limits
Structural defects and epitaxial rotation of C-60 and C-70(111) films on GeS(001)

DEFF Research Database (Denmark)

Bernaerts, D.; Van Tendeloo, G.; Amelinckx, S.

1996-01-01

A transmission electron microscopy study of epitaxial C60 and C70 films grown on a GeS (001) surface is presented. The relationship between the orientation of the substrate and the films and structural defects in the films, such as grain boundaries, unknown in bulk C60 and C70 crystals, are studied...
19 CFR 162.23 - Seizure under section 596(c), Tariff Act of 1930, as amended (19 U.S.C. 1595a(c)).

Science.gov (United States)

2010-04-01

... 19 Customs Duties 2 2010-04-01 2010-04-01 false Seizure under section 596(c), Tariff Act of 1930... SEIZURE Seizures § 162.23 Seizure under section 596(c), Tariff Act of 1930, as amended (19 U.S.C. 1595a(c)). (a) Mandatory seizures. The following, if introduced or attempted to be introduced into the United...
SARS-coronavirus spike S2 domain flanked by cysteine residues C822 and C833 is important for activation of membrane fusion

International Nuclear Information System (INIS)

Madu, Ikenna G.; Belouzard, Sandrine; Whittaker, Gary R.

2009-01-01

The S2 domain of the coronavirus spike (S) protein is known to be responsible for mediating membrane fusion. In addition to a well-recognized cleavage site at the S1-S2 boundary, a second proteolytic cleavage site has been identified in the severe acute respiratory syndrome coronavirus (SARS-CoV) S2 domain (R797). C-terminal to this S2 cleavage site is a conserved region flanked by cysteine residues C822 and C833. Here, we investigated the importance of this well conserved region for SARS-CoV S-mediated fusion activation. We show that the residues between C822-C833 are well conserved across all coronaviruses. Mutagenic analysis of SARS-CoV S, combined with cell-cell fusion and pseudotyped virion infectivity assays, showed a critical role for the core-conserved residues C822, D830, L831, and C833. Based on available predictive models, we propose that the conserved domain flanked by cysteines 822 and 833 forms a loop structure that interacts with components of the SARS-CoV S trimer to control the activation of membrane fusion.
Properties of superconducting S-I-N, S-I-S, and S-C-S structures with amorphous weak coupling

International Nuclear Information System (INIS)

Kozub, V.I.

1984-01-01

The properties due to the presence of two-level structure systems in superconducting tunnel junctions with amorphous insulators, as well as in point and bridge Josephson junctions with amorphous surrounds, are investigated. Equations are obtained for tunneling with participation of the two-level systems for the cases of quasistatic tunneling in an S-I-N junction (N is the normal metal) and for the case of Josephson tunneling in an S-I-S junction. It is shown that inelastic tunneling makes an additional contribution to the nonlinearity of the current-voltage characteristic of an S-I-N junction. The specific phenomena of nonexponential relaxation in this junction (in particular, tunnel-current relaxation), which have a 1/t dependence, are discussed. Low-frequency noise in S-I-S and S-C-S structures, due to transitions in the two-level system and having a 1/f dependence at not too small junction sizes are considered. In the case of the stationary Josephson effect this noise has features of critical-current fluctuations that can manifest themselves, in particular as fluctuations of the magnetic flux linked with a weakly coupled superconducting ring. Under conditions of the nonstationary Josephson effect the two-level structures lead to broadening of the Josephson-generation line. It is proposed to use the nonstationary Josephson effect to observe the echo effect in glasses
Formation and early hydration characteristics of C2.75B1.25A3$ in binary system of C2.75B1.25A3$-C2S

Directory of Open Access Journals (Sweden)

Wang, Shoude

2016-09-01

Full Text Available C2.75B1.25A3$ (2.75CaO•1.25BaO• 3Al2O3• SO3 is one of the important minerals and it govern-directly the early-strength of belite-barium calcium sulphoaluminate cement. In this paper a binary system C2.75B1.25A3$-C2S is selected to investigate the formation of C2.75B1.25A3$. In the range of 1100 °C–1200 °C, the earlier formed C2S hinders the formation of C2.75B1.25A3$. On the contrary, when the temperature is in the range of 1200 °C–1350 °C, the initially formed C2S could provide a surface for the nucleation of C2.75B1.25A3$ and cut down the potential barrier (?Gk* for the heterogeneous nucleation of C2.75B1.25A3$, which contributes to its formation. Moreover, at 1350 °C, the large amount of previously formed C2S benefits the extent of formation of C2.75B1.25A3$. The possible reason was that it could prevent sulfur evaporation. In early hydration age, AFm and AFt originating from C2.75B1.25A3$ hydration are found within 2 h and 12 h under 95% RH at 1 °C, respectively, whereas C2S is unhydrated at this moment.En el cemento de sulfoaluminato de calcio y bario, el C2.75B1.25A3$ (2.75CaO•1.25BaO• 3Al2 O3• SO3 es una de las principales fases, y regula directamente la resistencia inicial del cemento. En este trabajo, se ha seleccionado el sistema binario C2.75B1.25A3$-C2S para investigar la formación de C2.75B1.25A3$. En el rango de 1100 °C-1200 °C, el C2S formado anteriormente impide la formación de C2.75B1.25A3$, mientras que cuando la temperatura está entre 1200 °C-1350 °C, el C2S proporcionaría una superficie de nucleación de C2.75B1.25A3$ reduciendo la barrera de potencial (?Gk* para la nucleación heterogénea de C2.75B1.25A3$, lo que contribuye a su formación. Además, a 1350 °C, la gran cantidad de C2S formado beneficia la formación de C2.75B1.25A3$, ya que podía prevenir la evaporación del azufre. En las primeras etapas de la hidratación (entre 2 y 12h y 95% HR a 1 ºC se pueden encontrar AFM y AFt
NMR study of conjugation effects. 15. /sup 13/C-/sup 13/C spin-spin coupling constants in phenylalkyl ether

Energy Technology Data Exchange (ETDEWEB)

Kalabin, G.A. (Siberian Branch of the Academy of Sciences of the USSR); Krivdin, L.B.; Trofimov, B.A.

1982-07-20

In order to elucidate the /sup 13/C-/sup 13/-C SSCC (spin-spin coupling constants) segment with the electronic excitations induced by the R group, a series of phenyl alkyl ethers, PhOAlk, where Alk = Me(I), Et(II), i-Pr(III), and t-Bu(IV), were studied. This series was chosen because in studying the /sup 13/C CS in monosubstituted benzenes it was observed that the intensity of the ..pi..-electron interaction of the unshared electron pairs of oxygen with the ..pi.. system of the benzene ring was practically the same in some compounds, but increased by 30% in others. This is related to the fact that the latter is characterized by an average noncoplanar conformation, with a dihedral angle between the benzene-ring plane and the C-O-C bond of approx. 45/sup 0/, whereas some compounds have an angle < 20/sup 0/. The reason for the difference is significant steric interaction of the alkyl hydrogens with the o-position of the ring. Thus, consideration of the /sup 13/C-/sup 13/C SSCC of a series of quite similar compounds, especially when compared to the whole set of such SSCC for other monosubstituted benzenes, shows that their relationship to the structure of the substituent R is extremely complex.
Observation of the decay $\\overline{B_s^0} \\rightarrow \\chi_{c2} K^+ K^- $

CERN Document Server

Aaij, R.; LHCb Collaboration; Adinolfi, M.; Aidala, C.A.; Ajaltouni, Z.; Akar, S.; Albicocco, P.; Albrecht, J.; Alessio, F.; Alexander, M.; Albero, A. Alfonso; Ali, S.; Alkhazov, G.; Alvarez Cartelle, P.; Alves, A.A.; Amato, S.; Amerio, S.; Amhis, Y.; An, L.; Anderlini, L.; Andreassi, G.; Andreotti, M.; Andrews, J.E.; Appleby, R.B.; Archilli, F.; d'Argent, P.; Arnau Romeu, J.; Artamonov, A.; Artuso, M.; Arzymatov, K.; Aslanides, E.; Atzeni, M.; Bachmann, S.; Back, J.J.; Baker, S.; Balagura, V.; Baldini, W.; Baranov, A.; Barlow, R.J.; Barsuk, S.; Barter, W.; Baryshnikov, F.; Batozskaya, V.; Batsukh, B.; Battista, V.; Bay, A.; Beddow, J.; Bedeschi, F.; Bediaga, I.; Beiter, A.; Bel, L.J.; Beliy, N.; Bellee, V.; Belloli, N.; Belous, K.; Belyaev, I.; Ben-Haim, E.; Bencivenni, G.; Benson, S.; Beranek, S.; Berezhnoy, A.; Bernet, R.; Berninghoff, D.; Bertholet, E.; Bertolin, A.; Betancourt, C.; Betti, F.; Bettler, M.O.; van Beuzekom, M.; Bezshyiko, Ia.; Bhasin, S.; Bhom, J.; Bian, L.; Bifani, S.; Billoir, P.; Birnkraut, A.; Bizzeti, A.; Bjørn, M.; Blago, M.P.; Blake, T.; Blanc, F.; Blusk, S.; Bobulska, D.; Bocci, V.; Garcia, O. Boente; Boettcher, T.; Bondar, A.; Bondar, N.; Borghi, S.; Borisyak, M.; Borsato, M.; Bossu, F.; Boubdir, M.; Bowcock, T.J.V.; Bozzi, C.; Braun, S.; Brodski, M.; Brodzicka, J.; Brundu, D.; Buchanan, E.; Buonaura, A.; Burr, C.; Bursche, A.; Buytaert, J.; Byczynski, W.; Cadeddu, S.; Cai, H.; Calabrese, R.; Calladine, R.; Calvi, M.; Calvo Gomez, M.; Camboni, A.; Campana, P.; Perez, D.H. Campora; Capriotti, L.; Carbone, A.; Carboni, G.; Cardinale, R.; Cardini, A.; Carniti, P.; Carson, L.; Carvalho Akiba, K.; Casse, G.; Cassina, L.; Cattaneo, M.; Cavallero, G.; Cenci, R.; Chamont, D.; Chapman, M.G.; Charles, M.; Charpentier, Ph.; Chatzikonstantinidis, G.; Chefdeville, M.; Chekalina, V.; Chen, C.; Chen, S.; Chitic, S.G.; Chobanova, V.; Chrzaszcz, M.; Chubykin, A.; Ciambrone, P.; Cid Vidal, X.; Ciezarek, G.; Clarke, P.E.L.; Clemencic, M.; Cliff, H.V.; Closier, J.; Coco, V.; Coelho, J.A.B.; Cogan, J.; Cogneras, E.; Cojocariu, L.; Collins, P.; Colombo, T.; Comerma-Montells, A.; Contu, A.; Coombs, G.; Coquereau, S.; Corti, G.; Corvo, M.; Costa Sobral, C.M.; Couturier, B.; Cowan, G.A.; Craik, D.C.; Crocombe, A.; Cruz Torres, M.; Currie, R.; D'Ambrosio, C.; Da Cunha Marinho, F.; Da Silva, C.L.; Dall'Occo, E.; Dalseno, J.; Danilina, A.; Davis, A.; De Aguiar Francisco, O.; De Bruyn, K.; De Capua, S.; De Cian, M.; De Miranda, J.M.; De Paula, L.; De Serio, M.; De Simone, P.; Dean, C.T.; Decamp, D.; Del Buono, L.; Delaney, B.; Dembinski, H.P.; Demmer, M.; Dendek, A.; Derkach, D.; Deschamps, O.; Desse, F.; Dettori, F.; Dey, B.; Di Canto, A.; Di Nezza, P.; Didenko, S.; Dijkstra, H.; Dordei, F.; Dorigo, M.; Suárez, A. Dosil; Douglas, L.; Dovbnya, A.; Dreimanis, K.; Dufour, L.; Dujany, G.; Durante, P.; Durham, J.M.; Dutta, D.; Dzhelyadin, R.; Dziewiecki, M.; Dziurda, A.; Dzyuba, A.; Easo, S.; Egede, U.; Egorychev, V.; Eidelman, S.; Eisenhardt, S.; Eitschberger, U.; Ekelhof, R.; Eklund, L.; Ely, S.; Ene, A.; Escher, S.; Esen, S.; Evans, T.; Falabella, A.; Farley, N.; Farry, S.; Fazzini, D.; Federici, L.; Fernandez, G.; Fernandez Declara, P.; Fernandez Prieto, A.; Ferrari, F.; Lopes, L. Ferreira; Ferreira Rodrigues, F.; Ferro-Luzzi, M.; Filippov, S.; Fini, R.A.; Fiorini, M.; Firlej, M.; Fitzpatrick, C.; Fiutowski, T.; Fleuret, F.; Fontana, M.; Fontanelli, F.; Forty, R.; Franco Lima, V.; Frank, M.; Frei, C.; Fu, J.; Funk, W.; Färber, C.; Carvalho, M. Féo Pereira Rivello; Gabriel, E.; Gallas Torreira, A.; Galli, D.; Gallorini, S.; Gambetta, S.; Gan, Y.; Gandelman, M.; Gandini, P.; Gao, Y.; Garcia Martin, L.M.; Plana, B. Garcia; Pardiñas, J. García; Garra Tico, J.; Garrido, L.; Gascon, D.; Gaspar, C.; Gavardi, L.; Gazzoni, G.; Gerick, D.; Gersabeck, E.; Gersabeck, M.; Gershon, T.; Gerstel, D.; Ghez, Ph.; Gianì, S.; Gibson, V.; Girard, O.G.; Giubega, L.; Gizdov, K.; Gligorov, V.V.; Golubkov, D.; Golutvin, A.; Gomes, A.; Gorelov, I.V.; Gotti, C.; Govorkova, E.; Grabowski, J.P.; Graciani Diaz, R.; Granado Cardoso, L.A.; Graugés, E.; Graverini, E.; Graziani, G.; Grecu, A.; Greim, R.; Griffith, P.; Grillo, L.; Gruber, L.; Gruberg Cazon, B.R.; Grünberg, O.; Gu, C.; Gushchin, E.; Guz, Yu.; Gys, T.; Göbel, C.; Hadavizadeh, T.; Hadjivasiliou, C.; Haefeli, G.; Haen, C.; Haines, S.C.; Hainge, J.; Hamilton, B.; Han, X.; Hancock, T.H.; Hansmann-Menzemer, S.; Harnew, N.; Harnew, S.T.; Harrison, T.; Hasse, C.; Hatch, M.; He, J.; Hecker, M.; Heinicke, K.; Heister, A.; Hennessy, K.; Henry, L.; van Herwijnen, E.; Heß, M.; Hicheur, A.; Charman, R. Hidalgo; Hill, D.; Hilton, M.; Hopchev, P.H.; Hu, W.; Huang, W.; Huard, Z.C.; Hulsbergen, W.; Humair, T.; Hushchyn, M.; Hutchcroft, D.; Hynds, D.; Ibis, P.; Idzik, M.; Ilten, P.; Ivshin, K.; Jacobsson, R.; Jalocha, J.; Jans, E.; Jawahery, A.; Jiang, F.; John, M.; Johnson, D.; Jones, C.R.; Joram, C.; Jost, B.; Jurik, N.; Kandybei, S.; Karacson, M.; Kariuki, J.M.; Karodia, S.; Kazeev, N.; Kecke, M.; Keizer, F.; Kelsey, M.; Kenzie, M.; Ketel, T.; Khairullin, E.; Khanji, B.; Khurewathanakul, C.; Kim, K.E.; Kirn, T.; Klaver, S.; Klimaszewski, K.; Klimkovich, T.; Koliiev, S.; Kolpin, M.; Kopecna, R.; Koppenburg, P.; Kostiuk, I.; Kotriakhova, S.; Kozeiha, M.; Kravchuk, L.; Kreps, M.; Kress, F.; Krokovny, P.; Krupa, W.; Krzemien, W.; Kucewicz, W.; Kucharczyk, M.; Kudryavtsev, V.; Kuonen, A.K.; Kvaratskheliya, T.; Lacarrere, D.; Lafferty, G.; Lai, A.; Lancierini, D.; Lanfranchi, G.; Langenbruch, C.; Latham, T.; Lazzeroni, C.; Le Gac, R.; Leflat, A.; Lefrançois, J.; Lefèvre, R.; Lemaitre, F.; Leroy, O.; Lesiak, T.; Leverington, B.; Li, P.R.; Li, T.; Li, Z.; Liang, X.; Likhomanenko, T.; Lindner, R.; Lionetto, F.; Lisovskyi, V.; Liu, X.; Loh, D.; Loi, A.; Longstaff, I.; Lopes, J.H.; Lovell, G.H.; Lucchesi, D.; Lucio Martinez, M.; Lupato, A.; Luppi, E.; Lupton, O.; Lusiani, A.; Lyu, X.; Machefert, F.; Maciuc, F.; Macko, V.; Mackowiak, P.; Maddrell-Mander, S.; Maev, O.; Maguire, K.; Maisuzenko, D.; Majewski, M.W.; Malde, S.; Malecki, B.; Malinin, A.; Maltsev, T.; Manca, G.; Mancinelli, G.; Marangotto, D.; Maratas, J.; Marchand, J.F.; Marconi, U.; Marin Benito, C.; Marinangeli, M.; Marino, P.; Marks, J.; Marshall, P.J.; Martellotti, G.; Martin, M.; Martinelli, M.; Martinez Santos, D.; Vidal, F. Martinez; Massafferri, A.; Materok, M.; Matev, R.; Mathad, A.; Mathe, Z.; Matteuzzi, C.; Mauri, A.; Maurice, E.; Maurin, B.; Mazurov, A.; McCann, M.; McNab, A.; McNulty, R.; Mead, J.V.; Meadows, B.; Meaux, C.; Meier, F.; Meinert, N.; Melnychuk, D.; Merk, M.; Merli, A.; Michielin, E.; Milanes, D.A.; Millard, E.; Minard, M.N.; Minzoni, L.; Mitzel, D.S.; Mogini, A.; Molina Rodriguez, J.; Mombächer, T.; Monroy, I.A.; Monteil, S.; Morandin, M.; Morello, G.; Morello, M.J.; Morgunova, O.; Moron, J.; Morris, A.B.; Mountain, R.; Muheim, F.; Mulder, M.; Murphy, C.H.; Murray, D.; Mödden, A.; Müller, D.; Müller, J.; Müller, K.; Müller, V.; Naik, P.; Nakada, T.; Nandakumar, R.; Nandi, A.; Nanut, T.; Nasteva, I.; Needham, M.; Neri, N.; Neubert, S.; Neufeld, N.; Neuner, M.; Nguyen, T.D.; Nguyen-Mau, C.; Nieswand, S.; Niet, R.; Nikitin, N.; Nogay, A.; O'Hanlon, D.P.; Oblakowska-Mucha, A.; Obraztsov, V.; Ogilvy, S.; Oldeman, R.; Onderwater, C.J.G.; Ossowska, A.; Otalora Goicochea, J.M.; Owen, P.; Oyanguren, A.; Pais, P.R.; Palano, A.; Palutan, M.; Panshin, G.; Papanestis, A.; Pappagallo, M.; Pappalardo, L.L.; Parker, W.; Parkes, C.; Passaleva, G.; Pastore, A.; Patel, M.; Patrignani, C.; Pearce, A.; Pellegrino, A.; Penso, G.; Pepe Altarelli, M.; Perazzini, S.; Pereima, D.; Perret, P.; Pescatore, L.; Petridis, K.; Petrolini, A.; Petrov, A.; Petrucci, S.; Petruzzo, M.; Pietrzyk, B.; Pietrzyk, G.; Pikies, M.; Pili, M.; Pinci, D.; Pinzino, J.; Pisani, F.; Piucci, A.; Placinta, V.; Playfer, S.; Plews, J.; Plo Casasus, M.; Polci, F.; Lener, M. Poli; Poluektov, A.; Polukhina, N.; Polyakov, I.; Polycarpo, E.; Pomery, G.J.; Ponce, S.; Popov, A.; Popov, D.; Poslavskii, S.; Potterat, C.; Price, E.; Prisciandaro, J.; Prouve, C.; Pugatch, V.; Puig Navarro, A.; Pullen, H.; Punzi, G.; Qian, W.; Qin, J.; Quagliani, R.; Quintana, B.; Rachwal, B.; Rademacker, J.H.; Rama, M.; Ramos Pernas, M.; Rangel, M.S.; Ratnikov, F.; Raven, G.; Ravonel Salzgeber, M.; Reboud, M.; Redi, F.; Reichert, S.; dos Reis, A.C.; Reiss, F.; Remon Alepuz, C.; Ren, Z.; Renaudin, V.; Ricciardi, S.; Richards, S.; Rinnert, K.; Robbe, P.; Robert, A.; Rodrigues, A.B.; Rodrigues, E.; Rodriguez Lopez, J.A.; Roehrken, M.; Rogozhnikov, A.; Roiser, S.; Rollings, A.; Romanovskiy, V.; Romero Vidal, A.; Rotondo, M.; Rudolph, M.S.; Ruf, T.; Ruiz Vidal, J.; Saborido Silva, J.J.; Sagidova, N.; Saitta, B.; Salustino Guimaraes, V.; Gras, C. Sanchez; Sanchez Mayordomo, C.; Sanmartin Sedes, B.; Santacesaria, R.; Santamarina Rios, C.; Santimaria, M.; Santovetti, E.; Sarpis, G.; Sarti, A.; Satriano, C.; Satta, A.; Saur, M.; Savrina, D.; Schael, S.; Schellenberg, M.; Schiller, M.; Schindler, H.; Schmelling, M.; Schmelzer, T.; Schmidt, B.; Schneider, O.; Schopper, A.; Schreiner, H.F.; Schubiger, M.; Schune, M.H.; Schwemmer, R.; Sciascia, B.; Sciubba, A.; Semennikov, A.; Sepulveda, E.S.; Sergi, A.; Serra, N.; Serrano, J.; Sestini, L.; Seuthe, A.; Seyfert, P.; Shapkin, M.; Shcheglov, Y.; Shears, T.; Shekhtman, L.; Shevchenko, V.; Shmanin, E.; Siddi, B.G.; Silva Coutinho, R.; Silva de Oliveira, L.; Simi, G.; Simone, S.; Skidmore, N.; Skwarnicki, T.; Smeaton, J.G.; Smith, E.; Smith, I.T.; Smith, M.; Soares, M.; Soares Lavra, l.; Sokoloff, M.D.; Soler, F.J.P.; Souza De Paula, B.; Spaan, B.; Spradlin, P.; Stagni, F.; Stahl, M.; Stahl, S.; Stefko, P.; Stefkova, S.; Steinkamp, O.; Stemmle, S.; Stenyakin, O.; Stepanova, M.; Stevens, H.; Stone, S.; Storaci, B.; Stracka, S.; Stramaglia, M.E.; Straticiuc, M.; Straumann, U.; Strokov, S.; Sun, J.; Sun, L.; Swientek, K.; Syropoulos, V.; Szumlak, T.; Szymanski, M.; T'Jampens, S.; Tang, Z.; Tayduganov, A.; Tekampe, T.; Tellarini, G.; Teubert, F.; Thomas, E.; van Tilburg, J.; Tilley, M.J.; Tisserand, V.; Tolk, S.; Tomassetti, L.; Tonelli, D.; Tou, D.Y.; Aoude, R. Tourinho Jadallah; Tournefier, E.; Traill, M.; Tran, M.T.; Trisovic, A.; Tsaregorodtsev, A.; Tully, A.; Tuning, N.; Ukleja, A.; Usachov, A.; Ustyuzhanin, A.; Uwer, U.; Vacca, C.; Vagner, A.; Vagnoni, V.; Valassi, A.; Valat, S.; Valenti, G.; Vazquez Gomez, R.; Regueiro, P. Vazquez; Vecchi, S.; van Veghel, M.; Velthuis, J.J.; Veltri, M.; Veneziano, G.; Venkateswaran, A.; Verlage, T.A.; Vernet, M.; Veronika, N.V.; Vesterinen, M.; Viana Barbosa, J.V.; Vieira, D.; Vieites Diaz, M.; Viemann, H.; Vilasis-Cardona, X.; Vitkovskiy, A.; Vitti, M.; Volkov, V.; Vollhardt, A.; Voneki, B.; Vorobyev, A.; Vorobyev, V.; de Vries, J.A.; Vázquez Sierra, C.; Waldi, R.; Walsh, J.; Wang, J.; Wang, M.; Wang, Y.; Wang, Z.; Ward, D.R.; Wark, H.M.; Watson, N.K.; Websdale, D.; Weiden, A.; Weisser, C.; Whitehead, M.; Wicht, J.; Wilkinson, G.; Wilkinson, M.; Williams, I.; Williams, M.R.J.; Williams, M.; Williams, T.; Wilson, F.F.; Wimberley, J.; Winn, M.; Wishahi, J.; Wislicki, W.; Witek, M.; Wormser, G.; Wotton, S.A.; Wyllie, K.; Xiao, D.; Xie, Y.; Xu, A.; Xu, M.; Xu, Q.; Xu, Z.; Yang, Z.; Yao, Y.; Yeomans, L.E.; Yin, H.; Yu, J.; Yuan, X.; Yushchenko, O.; Zarebski, K.A.; Zavertyaev, M.; Zhang, D.; Zhang, L.; Zhang, W.C.; Zhang, Y.; Zhelezov, A.; Zheng, Y.; Zhu, X.; Zhukov, V.; Zonneveld, J.B.; Zucchelli, S.

2018-01-01

The $\\overline{B_s^0} \\rightarrow \\chi_{c2} K^+ K^- $ decay mode is observed and its branching fraction relative to the corresponding $\\chi_{c1}$ decay mode, in a $\\pm 15 \\textrm{MeV}/c^2$ window around the $\\phi$ mass, is found to be $$\\frac{\\mathcal{B}(\\overline{B_s^0} \\rightarrow \\chi_{c2} K^+ K^-) }{ \\mathcal{B}(\\overline{B_s^0} \\rightarrow \\chi_{c1} K^+K^-)} = (17.1 \\pm 3.1 \\pm 0.4 \\pm 0.9)\\%,$$ where the first uncertainty is statistical, the second systematic and the third due to the knowledge of the branching fractions of radiative $\\chi_c$ decays. The decay mode $\\overline{B_s^0} \\rightarrow \\chi_{c1} K^+ K^- $ allows the $ B_s^0$ mass to be measured as $$m(B_s^0) = 5366.83 \\pm 0.25 \\pm 0.27 \\, \\textrm{MeV}/c^2,$$ where the first uncertainty is statistical and the second systematic.

Synthesis of /sup 14/C- and /sup 35/S-labelled 2-mercaptobenzimidazoles

Energy Technology Data Exchange (ETDEWEB)

Doerge, D R

1988-09-01

/sup 14/C- and /sup 35/S-labelled 2-mercaptobenzimidazole and 1-methyl-2-mercaptobenzimidazole were synthesized from /sup 14/C-carbon disulfide, /sup 35/S-thiourea, /sup 14/C-methyl iodide and /sup 35/S-thiourea, respectively, for use in studies on the mechanism of action of antithyroid drugs. The products were purified by chromatography on silica and isolated with radiochemical purities of greater than 98%, yields of 45-77% and specific activities of 2.1-5.3 mCi/mmole.
Hydration reactions in pastes C3S+C3A+CaSO4.2aq+H20 at 25°C.I

NARCIS (Netherlands)

Corstanje, W.A.; Stein, H.N.; Stevels, J.M.

1973-01-01

A characteristic retardation of the hydration of C3A is found in pastes C3S+C3A+CaSO4.2aq+H2O of weight ratios 1:3:z:4 at certain values of z, when sulphate concentration becomes insufficient for monosulphate formation. This retardation is ascribed to precipitation of amorphous Al(OH)3, when C3A
Effect of temperature on the microstructure of calcium silicate hydrate (C-S-H)

Energy Technology Data Exchange (ETDEWEB)

Gallucci, E., E-mail: gallucci.emmanuel@ch.sika.com; Zhang, X.; Scrivener, K.L.

2013-11-15

Temperature affects the properties of concrete through its effect on the hydration of cement and its associated microstructural development. This paper focuses on the modifications to C-S-H induced by isothermal curing between 5 and 60 °C. The results show that as the temperature increases (within the range studied) the C/S ratio of C-S-H changes only slightly, with a higher degree of polymerisation of silicate chains, but there is a significant decrease in its bound water content and an increase of apparent density of 25%. This increase seems to come from a different packing of C-S-H at the nanoscale. As a consequence of these changes, the microstructure of the cement paste is much coarser and porous, which explains the lower final strengths obtained by curing at elevated temperatures. -- Highlights: •C-S-H structure studied at the atomic level •Multiple analytical techniques used •Studies conducted at temperatures above and below normal temperatures.
22 CFR 212.42 - Exemption from 5 U.S.C. 552.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Exemption from 5 U.S.C. 552. 212.42 Section 212.42 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT PUBLIC INFORMATION Exemptions From Disclosure § 212.42 Exemption from 5 U.S.C. 552. Whenever a request is made which involves access to records...
Causes de décès des patients infectés par le VIH dans le Centre tunisien

Science.gov (United States)

Chelli, Jihène; Bellazreg, Foued; Aouem, Abir; Hattab, Zouhour; Mesmia, Hèla; Lasfar, Nadia Ben; Hachfi, Wissem; Masmoudi, Tasnim; Chakroun, Mohamed; Letaief, Amel

2016-01-01

La trithérapie antirétrovirale a contribué à une baisse considérable de la mortalité liée au VIH. Les causes de décès sont dominées par les infections opportunistes dans les pays en voie de développement et par les maladies cardiovasculaires et les cancers dans les pays développés. L’objectif était de déterminer les causes et les facteurs de risque de décès des patients infectés par le VIH dans le Centre Tunisien. Une étude transversale auprès des patients infectés par le VIH âgés de plus de 15 ans suivis à Sousse et à Monastir entre 2000 et 2014. Le décès était considéré lié au VIH si la cause était un évènement classant SIDA ou s’il était la conséquence d’une infection opportuniste d’étiologie indéterminée avec des CD4 VIH si la cause n’était pas un évènement classant SIDA, et de cause inconnue si aucune information n’était disponible. Deux cents treize patients, 130 hommes (61%) et 83 femmes (39%), d’âge moyen 40±11 ans ont été inclus. Cinquante quatre patients sont décédés, avec une mortalité de 5,4/100 patients-années. La mortalité annuelle a baissé de 5,8% en 2000-2003 à 2,3% en 2012-2014. La survie était de 72% à 5 ans et de 67% à 10 ans. Les décès étaient liés au VIH dans 70,4% des cas. Les causes de décès les plus fréquentes étaient la pneumocystose pulmonaire et la cryptococcose neuroméningée dans 6 cas (11%) chacune. Les facteurs de risque de décès étaient les antécédents d’infections opportunistes, la durée de la trithérapie antirétrovirale VIH en Tunisie. PMID:28292068
75 FR 25169 - Schedule of Fees Authorized by 49 U.S.C. 30141

Science.gov (United States)

2010-05-07

... [Docket No. NHTSA 2010-0035; Notice 1] RIN 2127-AK70 Schedule of Fees Authorized by 49 U.S.C. 30141 AGENCY...: This document proposes fees for Fiscal Year 2011 and until further notice, as authorized by 49 U.S.C...-562, since recodified at 49 U.S.C. 30141-47. The reader is referred to that notice for background...
Erratum!- in paper volume 19, Supplement 1, Year 2015, pp. S109-S115, DOI:10.2298/TSCI15S1S09C

Directory of Open Access Journals (Sweden)

Editorial

2015-01-01

Full Text Available In the paper published in THERMAL SCIENCE Volume 19, Supplement 1, YEAR 2015, pp. S109-S115, DOI REFERENCE: 10.2298/TSCI15S1S09C Names and affiliations of the authors has been incorrectly written Istead of: THE DIFFUSION MODEL OF FRACTAL HEAT AND MASS TRANSFER IN FLUIDIZED BED A Local Fractional Arbitrary Euler-Lagrange Formula by Xu CHENG∗ and Xiao-Xun MA School of Chemical Engineering, Northwest University, Xi'an, Shaanxi, China Correctly has to be written: THE DIFFUSION MODEL OF FRACTAL HEAT AND MASS TRANSFER IN FLUIDIZED BED A Local Fractional Arbitrary Euler-Lagrange Formula by Xu CHENG1∗ and Lin Wang2 - 1School of Chemical Engineering, Northwest University, Xi'an, Shaanxi, China - 2Xi'an Modern Chemistry Research Institute, Xi'an, Shaanxi, China Link to the corrected article 10.2298/TSCI15S1S09C
Comparative study of electron-impact C(1s) core-excitation processes in C{sub 2} and C{sub 2}N{sub 2} molecules

Energy Technology Data Exchange (ETDEWEB)

Michelin, S.E. [Departamento de Fisica, Universidade Federal de Santa Catarina, 88040-900 Florianopolis, SC (Brazil)], E-mail: fsc1sem@fsc.ufsc.br; Mazon, K.T.; Arretche, F.; Tenfen, W.; Oliveira, H.L.; Falck, A.S.; Scopel, M.A.; Silva, L.S.S. da [Departamento de Fisica, Universidade Federal de Santa Catarina, 88040-900 Florianopolis, SC (Brazil); Fujimoto, M.M. [Departamento de Fisica, Universidade Federal do Parana, 81531-990 Curitiba, PR (Brazil); Iga, I.; Lee, M.-T. [Departamento de Quimica, Universidade Federal de Sao Carlos, 13565-905, Sao Carlos, SP (Brazil)

2009-04-15

Distorted-wave approximation (DWA) is applied to study core-orbital excitations in C{sub 2}and C{sub 2}N{sub 2} molecules by electron impact. More specifically, we report calculated integral cross sections (ICS) for the X{sup 1}{sigma}{sub g}{sup +}{yields}{sup 1,3}{pi}{sub u}(1s{sigma}{sub u}{yields}1p{pi}{sub g}) and X{sup 1}{sigma}{sub g}{sup +}{yields}{sup 1,3}{pi}{sub g}(1s{sigma}{sub g}{yields}1p{pi}{sub g}) transitions in the C{sub 2}, and X{sup 1}{sigma}{sub g}{sup +}{yields}{sup 1,3}{pi}{sub g}(2s{sigma}{sub g}{yields}2p{pi}{sub g}) and X{sup 1}{sigma}{sub g}{sup +}{yields}{sup 1,3}{pi}{sub u}(2s{sigma}{sub u}{yields}2p{pi}{sub g}) transitions in the C{sub 2}N{sub 2} molecules in the 300-800 eV incident energy range. The comparison of the calculated ICS of these targets with the corresponding data for C{sub 2}H{sub 2} presented. Comparison is also made for the theoretical RI(3:1) ratios of these targets which are calculated by dividing the ICS for triplet transitions by the corresponding results for singlet transitions. The similarities and differences of these results, particularly the presence of the shape resonances at near excitation thresholds, are discussed. The influence of the atomic (localized) and molecular (delocalized) characters of the core orbitals on the core-excitation processes is also investigated. In addition, generalized oscillator strengths for the singlet core-orbital transitions are calculated at incident energy of 1290 eV for C{sub 2} and C{sub 2}N{sub 2}. A comparison with the existing theoretical and experimental data for C{sub 2}H{sub 2} is also presented.
An estimation of applicable thermodynamic data for C-S-H gel to PHREEQC

International Nuclear Information System (INIS)

Kato, Hiroshige; Honda, Akira

2004-07-01

Cementitious materials will be used extensively in the TRU waste repository. The dissolution/precipitation of cementitious materials will affect the chemical condition of pore waster of TRU waste repository. Thus, it is important for estimation of chemical condition of pore water to apply the dissolution/precipitation of cementitious materials appropriately. A C-S-H gel (poorly crystallized calcium silicate hydrate) is a major component in cementitious materials which determined the mechanical characteristics of cementitious materials. The hydraulic condition of cementitious materials is strongly affected by the dissolution/precipitation of C-S-H gel due to the change of porosity accompanied with the dissolution/precipitation processes. Further, the chemical condition of pore water will be dominated by the dissolution/ precipitation of C-S-H gel for a long period. Therefore, an importance of the dissolution/precipitation of C-S-H gel has been recognized internationally, and several dissolution/precipitation models of C-S-H gel have been proposed. The principal scopes of the C-S-H gel models are description of an incongruent dissolution/precipitation behavior of C-S-H gel. On the other hand, PHREEQC is a compute program, which has been used generally for the geochemical calculation. PHREEQC can provide the state of chemical equilibrium of system defined by chemical equations and equilibrium constants (log K). In JNC, reference model groundwater determined by calculation using PHREEQC in HLW study will be also used in TRU waste study. In addition, PHREEQC will be used for calculation of the cement-water reaction. Therefore, applicability of the presented dissolution/precipitation models of C-S-H gel to PHREEQC was estimated. As a result of estimation of the applicability, Atkinson model and Reardon model were selected as suitable models to the PHREEQC. The chemical equations and log K values of C-S-H gel were derived from these models and tested using PHREEQC. The
Sequence of a cloned cDNA encoding human ribosomal protein S11

Energy Technology Data Exchange (ETDEWEB)

Lott, J B; Mackie, G A

1988-02-11

The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.
Safety demonstration test (SR-3/S1C-3/S2C-3/SF-2) plan using the HTTR. Contract research

International Nuclear Information System (INIS)

Nakagawa, Shigeaki; Sakaba, Nariaki; Takamatsu, Kuniyoshi; Takada, Eiji; Tochio, Daisuke; Ohwada, Hiroyuki

2005-03-01

Safety demonstration tests using the HTTR are to be conducted from the FY2002 to verify the inherent safety features and to improve the safety design and evaluation technologies for HTGRs, as well as to contribute to not only the commercial HTGRs but also the research and development for the VHTR that is one of the Generation IV reactor candidates. This paper describes the reactivity insertion test (SR-3), the coolant flow reduction test by tripping of gas circulators (S1C-3, S2C-3), and the partial flow loss of coolant test (SF-2) planned in March 2005 with their detailed test method, procedure and results of pre-test analysis. From the analytical results, it was verified that the negative reactivity feedback effect of the core brings the reactor power safely to a stable level without a reactor scram. (author)
Representations of mind: C. S. Sherrington and scientific opinion, c. 1930-1950.

Science.gov (United States)

Smith, R

2001-12-01

Recent writers in the brain sciences and the philosophy of mind contrast modern biological theories of consciousness with a mind-body dualism supposedly dominant half-a-century ago which they regard as scientifically sterile. Reference to C. S. Sherrington often signals the rejected dualism. This paper re-examines Sherrington's highly qualified position and links it to the arguments of British scientists for whom he was a figurehead in the 1930s and 1940s. I interpret the mind-body literature as ancillary to debates about cultural values. From this perspective, dualism represents a defense of a threatened conservative culture. Dismissal of scientists' supposed "dualism" does little to illuminate the tension in their thought between defense of values traditionally associated with mind and hope for an integrated mind-body science. This leads to comments on Sherrington's own concept of integration. The conclusion relates these points to the new research in the brain sciences evident by the end of the 1940s.
78 FR 46256 - Scope and Definitions (2 U.S.C. 431)

Science.gov (United States)

2013-07-31

... FEDERAL ELECTION COMMISSION 11 CFR Part 100 Scope and Definitions (2 U.S.C. 431) CFR Correction In Title 11 of the Code of Federal Regulations, revised as of January 1, 2012, on page 42, in Sec. 100.19, a heading is added to paragraph (a) to read as follows: Sec. 100.19 File, filed or filing (2 U.S.C...
Overview of $C\\!P$V parameter $\\phi_{s}$ determination

CERN Document Server

Batozskaya, Varvara

2018-01-01

The one of main goals of the LHCb experiment is the measurement of the mixing-induced $C\\!P$-violating phase $\\phi_{s}$ in the $B^{0}_{s}-\\bar{B}^{0}_{s}$ system. It has been measured exploiting the Run~I data set, using several decay channels. The most recent results obtained analyzing $B^{0}_{s}\\to J/\\psi K^{+}K^{-}$ candidates in the $K^{+}K^{-}$ mass region above the $\\phi(1020)$ resonance are presented. The measurements using the same final state with the $m(K^{+}K^{-})$ at the $\\phi(1020)$ and $B^{0}_{s}\\to J/\\psi \\pi^{+}\\pi^{-}$, as well as using the $B^{0}_{s}\\to \\psi(2S)\\phi$ decay are discussed.
Synthesis of organic substances labelled with 14C and 35S

International Nuclear Information System (INIS)

Pichat, L.

1958-01-01

After a brief history of the development of the Section des Molecules marquees of the French Atomic Energy Commission, the author gives an outline of the synthesis of the following labelled compounds: benzene 14 C-6; phenyl-p-fluorophenyl, thienyl-2 β alanines β 14 C; noradrenaline β 14 C (arterenol β 14 C), dotriacontane 14 C-16-17, aminoethane sulfinic acid (hypotaurine 35 S). (author) [fr
Representations of Nets of C*-Algebras over S 1

Science.gov (United States)

Ruzzi, Giuseppe; Vasselli, Ezio

2012-11-01

In recent times a new kind of representations has been used to describe superselection sectors of the observable net over a curved spacetime, taking into account the effects of the fundamental group of the spacetime. Using this notion of representation, we prove that any net of C*-algebras over S 1 admits faithful representations, and when the net is covariant under Diff( S 1), it admits representations covariant under any amenable subgroup of Diff( S 1).
Synthesis of (R,S)-[2,3-13C2]-1-(1'-methyl-2'-pyrrolidinyl)propan-2-one; {(R,S)-[2',3'-13C2]hygrinePound right bracePound

International Nuclear Information System (INIS)

Abraham, T.W.; Leete, Edward

1996-01-01

2-Ethoxy-1-methyl-5-pyrrolidinone (1) was reacted with ethyl [3,4- 13 C 2 ]-acetoacetate (2) in the presence of TiCl 4 to give ethyl [3,4- 13 C 2 ]-2-(1'-methyl-5'-oxo-2'-pyrrolidinyl)-3-oxobutanoate (3) in 85% yield. Decarboethoxylation of ethyl [3,4- 13 C 2 ]-2-(1'-methyl-5'-oxo-2'-pyrrolidinyl)-3-oxobutan-oate (3) was accomplished using NaCl and H 2 O in DMSO to give (R,S)-[2,3- 13 C 2 ]-1-(1'-methyl-5'-oxo-2'-pyrrolidinyl)propan-2-o ne (4) in 91% yield. Protection of the ketone as a ketal (ethylene glycol, H + ), followed by reduction of the amide to the amine using LiAlH 4 and subsequent deprotection of the ketal gave (R,S)-[2,3- 13 C 2 ]-1-(1'-methyl-2'-pyrrolidinyl)propan-2-one ((R,s)-[2', 3'- 13 C 2 ]Hygrine) (8) in 78% yield. (61% overall yield from ethyl [3,4- 13 C 2 ]acetoacetate). (Author)
Calorimetric studies on ZrC(s)

International Nuclear Information System (INIS)

Banerjee, Aparna; Venugopal, V.

1998-01-01

Enthalpy increments of ZrC(s) were determined using a Calvet micro-calorimeter in the temperature range 349.5 to 664.0 K. The enthalpy increment values were least squares analysed using the SHOMATE programme and the best fit is represented by the following polynomial equation: H o (T)-H o (298.15 K)(J/mol) = 48.44 T(K) + 0.375x10 -2 T 2 (K) + 11.67x10 5 /T(K) - 18691.97. Molar heat capacity and other thermal properties have been evaluated. (author)
2-Methyl-N-(4-methylbenzoylbenzenesulfonamide

Directory of Open Access Journals (Sweden)

B. Thimme Gowda

2010-04-01

Full Text Available The asymmetric unit of the title compound, C15H15NO3S, contains two independent molecules. The conformations of the N—C bonds in the C—SO2—NH—C(O segments have gauche torsions with respect to the SO bonds. Further, the molecules are twisted at the S atoms with torsion angles of −53.1 (2 and 61.2 (2° in the two molecules. The dihedral angles between the sulfonyl benzene rings and the —SO2—NH—C—O segments are 86.0 (1 and 87.9 (1°. Furthermore, the dihedral angles between the sulfonyl and the benzoyl benzene rings are 88.1 (1 and 83.5 (1° in the two molecules. In the crystal, molecules are linked by N—H...O(S hydrogen bonds.
Optimizing ROOT’s Performance Using C++ Modules

Science.gov (United States)

Vassilev, Vassil

2017-10-01

ROOT comes with a C++ compliant interpreter cling. Cling needs to understand the content of the libraries in order to interact with them. Exposing the full shared library descriptors to the interpreter at runtime translates into increased memory footprint. ROOT’s exploratory programming concepts allow implicit and explicit runtime shared library loading. It requires the interpreter to load the library descriptor. Re-parsing of descriptors’ content has a noticeable effect on the runtime performance. Present state-of-art lazy parsing technique brings the runtime performance to reasonable levels but proves to be fragile and can introduce correctness issues. An elegant solution is to load information from the descriptor lazily and in a non-recursive way. The LLVM community advances its C++ Modules technology providing an io-efficient, on-disk representation capable to reduce build times and peak memory usage. The feature is standardized as a C++ technical specification. C++ Modules are a flexible concept, which can be employed to match CMS and other experiments’ requirement for ROOT: to optimize both runtime memory usage and performance. Cling technically “inherits” the feature, however tweaking it to ROOT scale and beyond is a complex endeavor. The paper discusses the status of the C++ Modules in the context of ROOT, supported by few preliminary performance results. It shows a step-by-step migration plan and describes potential challenges which could appear.

(R-[(R-3-Benzyl-2-oxooxazolidin-4-yl][4-(methylsulfonylphenyl]methyl acetate

Directory of Open Access Journals (Sweden)

Feng Li

2014-05-01

Full Text Available The structure of the title compound, C20H21NO6S, is of interest with respect to its antibacterial properties. The oxazolidine ring makes dihedral angles of 79.63 (14 and 56.16 (12° with the phenyl and benzene rings, respectively, while the phenyl and benzene rings make a dihedral angle of 64.37 (13°. In the crystal, non-classical C—H...O hydrogen bonds link adjacent molecules along the c axis.
Compositional Evolution of Calcium Silicate Hydrate (C-S-H) Structures by Total X-Ray Scattering

KAUST Repository

Soyer-Uzun, Sezen; Chae, Sejung Rosie; Benmore, Chris J.; Wenk, Hans-Rudolf; Monteiro, Paulo J. M.

2011-01-01

High-energy X-ray diffraction was employed to study the structural characteristics of a set of C-S-H samples with 0.6 ≤ C/S a;circ 1.75. It has been observed that Si is tetrahedrally coordinated to O for all samples irrespective of chemical composition and the Ca-O coordination number gradually decreases from ∼7 to ∼6 with increasing C/S ratio. This suggests that the C-S-H structure evolves from a tobermorite-like structure into a jennite-like structure as a function of increasing C/S ratio as the interlayer space decreases from ∼1.3 to ∼1 nm. Evolution of these short- and medium-range order structural characteristics in the C-S-H system is associated with the alteration of the Ca-O layers and silicate depolymerization with increasing C/S. © 2011 The American Ceramic Society.
Compositional Evolution of Calcium Silicate Hydrate (C-S-H) Structures by Total X-Ray Scattering

KAUST Repository

Soyer-Uzun, Sezen

2011-12-09

High-energy X-ray diffraction was employed to study the structural characteristics of a set of C-S-H samples with 0.6 ≤ C/S a;circ 1.75. It has been observed that Si is tetrahedrally coordinated to O for all samples irrespective of chemical composition and the Ca-O coordination number gradually decreases from ∼7 to ∼6 with increasing C/S ratio. This suggests that the C-S-H structure evolves from a tobermorite-like structure into a jennite-like structure as a function of increasing C/S ratio as the interlayer space decreases from ∼1.3 to ∼1 nm. Evolution of these short- and medium-range order structural characteristics in the C-S-H system is associated with the alteration of the Ca-O layers and silicate depolymerization with increasing C/S. © 2011 The American Ceramic Society.
Thiazolidinedione-8 alters symbiotic relationship in C. albicans-S. mutans dual species biofilm

Directory of Open Access Journals (Sweden)

Mark eFeldman

2016-02-01

Full Text Available The small molecule, thiazolidinedione-8 (S-8 was shown to impair biofilm formation of various microbial pathogens, including the fungus Candida albicans and Streptococcus mutans. Previously, we have evaluated the specific molecular mode of S-8 action against C. albicans biofilm-associated pathogenicity. In this study we investigated the influence of S-8 on dual species, C. albicans-S. mutans biofilm. We show that in the presence of S-8 a reduction of the co-species biofilm formation occurred with a major effect on C. albicans. Biofilm biomass and exopolysaccharide (EPS production were significantly reduced by S-8. Moreover, the agent caused oxidative stress associated with a strong induction of reactive oxygen species (ROS and hydrogen peroxide uptake inhibition by a mixed biofilm. In addition, S-8 altered symbiotic relationship between these species by a complex mechanism. Streptococcal genes associated with quorum sensing (comDE and luxS, EPS production (gtfBCD and gbpB, as well as genes related to protection against oxidative stress (nox and sodA were markedly upregulated by S-8. In contrast, fungal genes related to hyphae formation (hwp1, adhesion (als3, hydrophobicity (csh1 and oxidative stress response (sod1, sod2 and cat1 were downregulated in the presence of S-8. In addition, ywp1 gene associated with yeast form of C. albicans was induced by S-8, which is correlated with appearance of mostly yeast cells in S-8 treated dual species biofilms. We concluded that S-8 disturbs symbiotic balance between C. albicans and S. mutans in dual species biofilm.
Hémangioblastome de l'angle ponto-cérébelleux : rapport de cas ...

African Journals Online (AJOL)

L'hémangioblastome de l'angle ponto-cérébelleux (APC) est rare. Le diagnostic différentiel peut se poser avec le schwannome vestibulaire, car ces deux entités peuvent avoir des caractéristiques identiques à l'imagerie par résonance magnétique (IRM). L'exérèse des hémangioblastomes solides peut être difficile à cause ...
Regular approach for generating van der Waals C{sub s} coefficients to arbitrary orders

Energy Technology Data Exchange (ETDEWEB)

Ovsiannikov, Vitali D [Department of Physics, Voronezh State University, 394006 Voronezh (Russian Federation); Mitroy, J [Faculty of Technology, Charles Darwin University, Darwin, NT 0909 (Australia)

2006-01-14

A completely general formalism is developed to describe the energy E{sup disp} = {sigma}{sub s}C{sub s}/R{sup s} of dispersion interaction between two atoms in spherically symmetric states. Explicit expressions are given up to the tenth order of perturbation theory for the dispersion energy E{sup disp} and dispersion coefficients C{sub s}. The method could, in principle, be used to derive the expressions for any s while including all contributing orders of perturbation theory for asymptotic interaction between two atoms. The theory is applied to the calculation of the complete series up to s = 30 for two hydrogen atoms in their ground state. A pseudo-state series expansion of the two-atom Green function gives rapid convergence of the series for radial matrix elements. The numerical values of C{sub s} are computed up to C{sub 30} to a relative accuracy of 10{sup -7} or better. The dispersion coefficients for the hydrogen-antihydrogen interaction are obtained from the H-H coefficients by simply taking the absolute magnitude of C{sub s}.
Le don après un décès d'origine cardiocirculatoire au Canada

Science.gov (United States)

Shemie, Sam D.; Baker, Andrew J.; Knoll, Greg; Wall, William; Rocker, Graeme; Howes, Daniel; Davidson, Janet; Pagliarello, Joe; Chambers-Evans, Jane; Cockfield, Sandra; Farrell, Catherine; Glannon, Walter; Gourlay, William; Grant, David; Langevin, Stéphan; Wheelock, Brian; Young, Kimberly; Dossetor, John

2006-01-01

Résumé Ces recommandations sont le fruit d'un processus multidisciplinaire national ayant duré un an et visant à déterminer si et comment l'on pourrait procéder au don d'organes après un décès d'origine cardiocirculatoire («don après le décès cardiocirculatoire», ou DDC) au Canada. Le forum national organisé en février 2005 a permis aux participants de discuter et d'élaborer des recommandations sur les principes, interventions et pratiques se rapportant au DDC. Les aspects éthiques et juridiques ont été abordés dans les discussions. À la fin du Forum, la majorité des participants ont été favorables à l'implantation de programmes de DDC au Canada. Les participants du Forum ont également convenu qu'il fallait formuler et prôner des valeurs fondamentales pour orienter l'élaboration de programmes et de protocoles basés sur le cadre médical, éthique et juridique établi lors de cette réunion. Même si la possibilité d'un don d'organes et de tissus doit faire partie intégrante des soins de fin de vie, il faut insister sur le fait que le devoir de diligence envers les patients mourants et leurs familles doit demeurer la priorité des équipes soignantes. La complexité et les répercussions profondes du décès sont reconnues et doivent être respectées, de même que les différences personnelles, ethnoculturelles et religieuses face à la mort et au don d'organes. Les décisions d'arrêter le traitement de maintien des fonctions vitales, la prise en charge des derniers moments de la vie et le diagnostic de décès selon des critères cardiocirculatoires doivent être distincts et indépendants des processus de don et transplantation. Ce rapport contient des recommandations destinées aux gestionnaires de program, aux autorités sanitaires régionales et aux instances appelés à élaborer les protocoles de DDC. Les programmes doivent être conçus en fonction des éléments suivants : direction et planification locales, éducation et
Prevalence of H63D, S65C, and C282Y hereditary hemochromatosis gene variants in Madeira Island (Portugal).

Science.gov (United States)

Spínola, Carla; Brehm, António; Spínola, Hélder

2011-01-01

Hereditary HFE Hemochromatosis is an inherited disorder of iron metabolism that results from mutations in the HFE gene. Almost all patients with hereditary hemochromatosis show a C282Y mutation in homozygosity or in compound heterozygosity with H63D. Also, the mutation S65C has been shown to be associated to a milder iron overload. Since allele and genotype frequencies of these three variants of the HFE gene vary between populations, the determination of their prevalence in Madeira Island will clarify the population susceptibility to hereditary hemochromatosis. One hundred and fifty-four samples from Madeira Island were genotyped for the three most common HFE gene mutations, H63D, C282Y, and S65C, by polymerase chain reaction followed by restriction fragment length polymorphism analysis. Results have shown a prevalence of 20.5%, 0.33%, and 1% for H63D, C282Y, and S65C, respectively. Accordingly to our estimates, both genotypes associated to hereditary hemochromatosis, C282Y homozygotes and C282/H63D compound heterozygotes, could be present in Madeira Island population in 1,648 individuals, which represents 0.65% of the total population.
Clima organizacional y satisfacción laboral de los trabajadores de la empresa E & C Contadores S.A.C., 2016

OpenAIRE

Espichán Palante, Luis

2017-01-01

En la investigación titulada “Clima organizacional y satisfacción laboral de los trabajadores de la empresa E. & C. Contadores S.A.C., 2016”, tuvo el propósito de determinar la relación entre clima organizacional y satisfacción laboral en trabajadores de una empresa de servicios contables. El tipo de investigación fue básica, el diseño no experimental, transversal y correlacional. La muestra estuvo compuesta por 80 trabajadores de la Empresa E. & C. Contadores S.A.C. La técn...
Chip formation in turning S45C medium carbon steel in cryogenic conditions

Directory of Open Access Journals (Sweden)

Jaharah A. Ghani

2017-09-01

Full Text Available This paper presents the tribology issue regarding the chip formation in machining medium carbon steel (S45C using a coated and uncoated carbide tools. The machining parameters under investigation were cutting speed, feed rate, and depth of cut under dry and cryogenic cutting condition using coated and uncoated carbide tools. The chip shape was largely depended on the combination of machining parameters, especially at high depth of cut and feed rate; the favorable chip was produced. Larger value of shear angle results in smaller shear plane area that provides benefits of lower cutting force needed to shear off the chips and lower cutting temperature being generated during the machining process.
Pair of accelerated black holes in a de Sitter background: The dS C metric

International Nuclear Information System (INIS)

Dias, Oscar J.C.; Lemos, Jose P.S.

2003-01-01

Following the work of Kinnersley and Walker for flat spacetimes, we analyzed the anti-de Sitter C metric in a previous paper. In this paper we study the de Sitter C metric (dS C metric). The C metric with a generic cosmological constant and other extra parameters was introduced by Plebanski and Demianski. When one then sets to zero some of the extra parameters, and works with a positive cosmological constant, one has the dS C metric which has been analyzed and physically interpreted by Podolsky and Griffiths. It describes a pair of accelerated black holes in the dS background with the acceleration being provided (in addition to the cosmological constant) by a strut that pushes away the two black holes or, alternatively, by a string that pulls them. We extend their analysis mainly in four directions. First, we draw the Carter-Penrose diagrams of the massless uncharged dS C metric, of the massive uncharged dS C metric and of the massive charged dS C metric. These diagrams allow us to clearly identify the presence of two dS black holes and to conclude that they cannot interact gravitationally. Second, we reexamine the embedding of the dS C metric in the 5D Minkowski spacetime and we represent the motion of the dS C metric origin in the dS 4-hyperboloid as well as the localization of the strut. Third, we comment on the physical properties of the strut that connects the two black holes. Finally, we find the range of parameters that correspond to nonextreme black holes, extreme black holes, and naked particles
75 FR 69870 - Delegation of Authority Under 18 U.S.C. 249

Science.gov (United States)

2010-11-16

... DEPARTMENT OF JUSTICE 28 CFR Part 0 [Docket No. OAG 136; A.G. Order No. 3227-2010] Delegation of Authority Under 18 U.S.C. 249 AGENCY: Department of Justice. ACTION: Final rule. SUMMARY: This rule amends....S.C. 801 does not apply. List of Subjects in 28 CFR Part 0 Authority delegations (Government...
Fullerene (C{sub 60})/CdS nanocomposite with enhanced photocatalytic activity and stability

Energy Technology Data Exchange (ETDEWEB)

Cai, Qiang [Key Laboratory of Advanced Ceramics and Machining Technology, Ministry of Education, School of Materials Science and Engineering, Tianjin University, Tianjin 300072 (China); Hu, Zhuofeng, E-mail: st04hzhf@gmail.com [Department of Chemistry, The Chinese University of Hong Kong, Shatin, New Territories, Hong Kong (China); Zhang, Qian; Li, Boyuan [Key Laboratory of Advanced Ceramics and Machining Technology, Ministry of Education, School of Materials Science and Engineering, Tianjin University, Tianjin 300072 (China); Shen, Zhurui, E-mail: shenzhurui@tju.edu.cn [Key Laboratory of Advanced Ceramics and Machining Technology, Ministry of Education, School of Materials Science and Engineering, Tianjin University, Tianjin 300072 (China)

2017-05-01

Highlights: • C{sub 60}/CdS nanocomposite has been fabricated as a novel visible-light-driven photocatalyst. • It exhibits enhanced photocatalytic activity and photostability than that of pure CdS reference. • The C{sub 60} improved the charge separation and transfer of nanocomposite due to its high electron affinity. - Abstract: Herein, the fullerene (C{sub 60})/CdS nanocomposite has been fabricated by a facile one-pot hydrothermal method. Its photocatatlytic hydrogen (H{sub 2}) evolution rate and degradation efficiency of Rhodamine B (Rh B) are evaluated under visible light irradiation (λ ≥ 420 nm). The content of C{sub 60} has been changed from 0.4 wt% to 8 wt%, and the optimal value for photocatalytic activity is determined to be 0.4 wt%. The H{sub 2} evolution rate over this optimal sample reaches 1.73 mmol h{sup −1} g{sup −1} and its apparent degradation rate of Rh B is 0.089 min{sup −1} (degradation efficiency of 97% within 40 min), which is 2.3 times and 1.5 times compared to that of pure CdS reference. Moreover, the photocorrosion of CdS in composite is effectively suppressed, and its photocatalytic activity can be well maintained after three recycles (97.8% retaining for composite vs. 84.4% retaining for CdS). Then, the enhanced photocatalytic activity and stability of C{sub 60}/CdS nanocomposite are further studied by spectroscopic and electrochemical methods. Results show that the C{sub 60} species covering on the surface of CdS can efficiently accelerate the separation and transfer of photoexcited charge carriers, which can improve its activity, and reduce the photocorrosion of CdS.
Phase equilibria in the KFeS2-Fe-S system at 300-600 °C and bartonite stability

Science.gov (United States)

Osadchii, Valentin O.; Voronin, Mikhail V.; Baranov, Alexander V.

2018-05-01

The article deals with phase relations in the KFeS2-Fe-S system studied by the dry synthesis method in the range of 300-600 °C and at a pressure of 1 bar. At the temperature below 513 ± 3 °C, pyrite coexists with rasvumite and there are pyrite-rasvumite-KFeS2 and pyrite-rasvumite-pyrrhotite equilibria established. Above 513 ± 3 °C pyrite and rasvumite react to form KFeS2 and pyrrhotite, limiting the pyrite-rasvumite association to temperatures below this in nature. The experiments also outline the compositional stability range of the copper-free analog of murunskite (K x Fe2- y S2) and suggest that mineral called bartonite is not stable in the Cl-free system, at least at atmospheric pressure and the temperature in the experiments. Chlorbartonite could be easily produced after adding KCl in the experiment. Possible parageneses in the quaternary K-Fe-S-Cl system were described based on the data obtained in this research and found in the previous studies. The factors affecting the formation of potassium-iron sulfides in nature were discussed.
Budding yeast cDNA sequencing project: S03052-01_K20 [Budding yeast cDNA sequencing project

Lifescience Database Archive (English)

Full Text Available GTCTTTGCTTCTAAA GCTTAACCATANAGTCACGGACTTAAGACTGTACGACCTGAAGGGCGCAAAAGGTGTATG CG Quality >S03052-01_K20.phd 4...C ATATACAATGTTGTCANGAGTAGCTAAACGTGCGTTTTCCTCTACANTTGCCAACCCTTA TAAAGTGACTGTCTTGGGTGCAGGCGGTGGTATTGGACAACCATT
Laccase-catalyzed C-S and C-C coupling for a one-pot synthesis of 1,4-naphthoquinone sulfides and 1,4-naphthoquinone sulfide dimers

CSIR Research Space (South Africa)

Wellington, Kevin W

2013-06-01

Full Text Available Oxidative C-S and C-C bond formation with aryl and alkyl thiols was catalyzed under mild conditions in a reaction vessel open to air at pH 4.5 in the presence of a commercial laccase (Novozym 51003 or Suberase) and a cosolvent (DMF) to afford 1...
Crystal and molecular structure of (2Z,5Z-3-(2-methoxyphenyl-2-[(2-methoxyphenylimino]-5-(4-nitrobenzylidenethiazolidin-4-one

Directory of Open Access Journals (Sweden)

Ahmed Djafri

2017-04-01

Full Text Available In the title compound, C24H19N3O5S, the thiazole ring (r.m.s. deviation = 0.012 Å displays a planar geometry and is surrounded by three fragments, two methoxyphenyl and one nitrophenyl. The thiazole ring is almost in the same plane as the nitrophenyl ring, making a dihedral angle of 20.92 (6°. The two methoxyphenyl groups are perpendicular to the thiazole ring [dihedral angles of 79.29 (6 and 71.31 (7° and make a dihedral angle of 68.59 (7°. The molecule exists in an Z,Z conformation with respect to the C=N imine bond. In the crystal, a series of C—H...N, C—H...O and C—H...S hydrogen bonds, augmented by several π–π(ring interactions, produce a three-dimensional architecture of molecules stacked along the b-axis direction. The experimentally derived structure is compered with that calculated theoretically using DFT(B3YLP methods.
Optimization of Thixoforging Parameters for C70S6 Steel Connecting Rods

Science.gov (United States)

Özkara, İsa Metin; Baydoğan, Murat

2016-11-01

A microalloyed steel, C70S6, with a solidification interval of 1390-1479 °C, was thixoforged in the semisolid state in a closed die at temperatures in the range 1400-1475 °C to form a 1/7 scaled-down model of a passenger vehicle connecting rod. Die design and an optimized thixoforging temperature eliminated the excessive flash and other problems during forging. Tension test samples from connecting rods thixoforged at the optimum temperature of 1440 °C exhibited nearly the same hardness, yield strength, and ultimate tensile strength as conventional hot forged samples but ductility decreased by about 45% due to grain boundary ferrite network formed during cooling from the thixoforging temperature. Thus, C70S6-grade steel can be thixoforged at 1440 °C to form flash-free connecting rods. This conclusion was also validated using FEA analysis.
Study on the Υ(1S)→B_cM Weak Decays

International Nuclear Information System (INIS)

Huang, Jinshu; Chang, Qin; Wang, Na; Chen, Lili; Sun, Junfeng; Yang, Yueling

2015-01-01

Motivated by the prospects of the potential Υ(1S) particle at high-luminosity heavy-flavor experiments, we studied the Υ(1S)→B_cM weak decays, where M = π, ρ, K"("∗"). The nonfactorizable contributions to hadronic matrix elements are taken into consideration with the QCDF approach. It is found that the CKM-favored Υ(1S)→B_cρ decay has branching ratio of O(10"-"1"0), which might be measured promisingly by the future experiments.
2-(4-Methylphenyl-5-[({[5-(4-methylphenyl-1,3,4-thiadiazol-2-yl]sulfanyl}methylsulfanyl]-1,3,4-thiadiazole

Directory of Open Access Journals (Sweden)

Jing-wen Yu

2012-03-01

Full Text Available In the title compound, C19H16N4S4, the molecules exhibit a butterfly conformation, where the thiadiazole and attached benzene rings in two wings are almost coplanar, with dihedral angles of 0.8 (3 and 0.9 (3°, respectively, while the two thiadiazole rings form a dihedral angle of 46.3 (3°.

Décès - French version only

CERN Multimedia

2006-01-01

Nous avons le regret d'annoncer le décès de Madame Danielle MERTINA survenu le 12 octobre 2006. Madame Danielle MERTINA, née le 27.02.1947, travaillait au Département FI et était au CERN depuis le 07.02.1966. Le Directeur général a envoyé un message de condoléances à sa famille de la part du personnel du CERN. Affaires sociales Département des Ressources humaines
First measurement of $C\\!P$ violation in $B^0_s\\!\\rightarrow J\\!/\\psi K^0_{\\text{S}}$ decays with the LHCb experiment

CERN Document Server

AUTHOR|(INSPIRE)INSPIRE-00257624

This thesis presents the first measurement of $C\\!P$ violation in decays of $B^0_s$ and $\\overline{B^0_s}$ mesons into the final state $J\\!/\\psi K^0_{\\text{S}}$, where the $C\\!P$ observables allow to constrain the contribution of penguin topologies in $B^0\\!\\rightarrow J\\!/\\psi K^0_{\\text{S}}$ decays. The measurement is performed on a dataset corresponding to an integrated luminosity of 3 $\\text{fb}^{-1}$ of proton-proton collisions, which were recorded by the LHCb experiment at centre-of-mass energies of 7 and 8 TeV. Using an unbinned maximum-likelihood fit, the $C\\!P$ observables are measured as \\begin{equation*} \\begin{alignedat}{2} A_{B^0_s\\!\\rightarrow J\\!/\\psi K^0_{\\text{S}}}^{\\Delta\\mathit{\\Gamma}} &= \\phantom{-}0.49 \\pm \\,{}^{0.77}_{0.65} &&\\text{\\,(stat)} \\pm 0.06 \\text{\\,(syst)} \\,\\text{,}\\\\ C_{B^0_s\\!\\rightarrow J\\!/\\psi K^0_{\\text{S}}} &= -0.28 \\pm 0.41 &&\\text{\\,(stat)} \\pm 0.08 \\text{\\,(syst)} \\,\\text{,}\\\\ S_{B^0_s\\!\\rightarrow J\\!/\\psi K^0_{\\text{S}}} &...
Practical synthesis of 14C S-ribosyl-L-homocysteine uniformly labelled on the sugar moiety. An enzymatic route from (U-14C) adenosine

International Nuclear Information System (INIS)

Guillerm, G.; Allart, B.

1992-01-01

[(U- 14 C) S-Ribosyl]-L-homocysteine has been prepared enzymatically from (U- 14 C) adenosine in two steps using S-adenosyl homocysteine hydrolase and bacterial S-adenosyl homocysteine nucleosidase as catalysts. (Author)
Prototype development and demonstration for response, emergency staging, communications, uniform management, and evacuation (R.E.S.C.U.M.E.) : R.E.S.C.U.M.E. prototype system architecture.

Science.gov (United States)

2014-01-01

This document provides the high-level system architecture for the Prototype Development and Demonstration of a : R.E.S.C.U.M.E. system. The requirements addressed in this document are based upon those that can be found in : previous R.E.S.C.U.M.E. re...
Crystallization and preliminary crystallographic analysis of decameric and monomeric forms of C49S mutant thioredoxin-dependent AhpC from Helicobacter pylori

International Nuclear Information System (INIS)

Supangat; Seo, Kyung Hye; Furqoni, Ahmad; Kwon, Young-Chul; Cho, Myung-Je; Rhee, Kwang-Ho; Lee, Sang Yeol; Lee, Kon Ho

2008-01-01

Decameric and monomeric forms of recombinant C49S mutant AhpC from H. pylori have been crystallized. Diffraction data were collected to 2.8 and 2.25 Å, respectively. Cys49Ser mutant Helicobacter pylori alkyl hydroperoxide reductase (C49S HpAhpC) was purified under reducing conditions in monomeric and decameric forms. The monomeric form was crystallized by the hanging-drop vapour-diffusion method. The crystals diffracted to 2.25 Å resolution and belonged to space group C2, with unit-cell parameters a = 245.8, b = 140.7, c = 189.5 Å, β = 127°, and contained 20 molecules in the asymmetric unit. A crystal of the decameric form was obtained by the microbatch crystallization method and diffracted to 2.8 Å resolution. It belonged to space group C222, with unit-cell parameters a = 257.5, b = 417.5, c = 95.6 Å. The structure of the monomeric form of C49S HpAhpC has been solved by the molecular-replacement method
Mutation of the S and 3c genes in genomes of feline coronaviruses.

Science.gov (United States)

Oguma, Keisuke; Ohno, Megumi; Yoshida, Mayuko; Sentsui, Hiroshi

2018-05-17

Feline coronavirus (FCoV) is classified into two biotypes based on its pathogenicity in cats: a feline enteric coronavirus of low pathogenicity and a highly virulent feline infectious peritonitis virus. It has been suspected that FCoV alters its biotype via mutations in the viral genome. The S and 3c genes of FCoV have been considered the candidates for viral pathogenicity conversion. In the present study, FCoVs were analyzed for the frequency and location of mutations in the S and 3c genes from faecal samples of cats in an animal shelter and the faeces, effusions, and tissues of cats that were referred to veterinary hospitals. Our results indicated that approximately 95% FCoVs in faeces did not carry mutations in the two genes. However, 80% FCoVs in effusion samples exhibited mutations in the S and 3c genes with remainder displaying a mutation in the S or 3c gene. It was also suggested that mutational analysis of the 3c gene could be useful for studying the horizontal transmission of FCoVs in multi-cat environments.
Haemoglobin C and S role in acquired immunity against Plasmodium falciparum malaria.

Directory of Open Access Journals (Sweden)

Federica Verra

2007-10-01

Full Text Available A recently proposed mechanism of protection for haemoglobin C (HbC; beta6Glu-->Lys links an abnormal display of PfEMP1, an antigen involved in malaria pathogenesis, on the surface of HbC infected erythrocytes together with the observation of reduced cytoadhesion of parasitized erythrocytes and impaired rosetting in vitro. We investigated the impact of this hypothesis on the development of acquired immunity against Plasmodium falciparum variant surface antigens (VSA encoding PfEMP1 in HbC in comparison with HbA and HbS carriers of Burkina Faso. We measured: i total IgG against a single VSA, A4U, and against a panel of VSA from severe malaria cases in human sera from urban and rural areas of Burkina Faso of different haemoglobin genotypes (CC, AC, AS, SC, SS; ii total IgG against recombinant proteins of P. falciparum asexual sporozoite, blood stage antigens, and parasite schizont extract; iii total IgG against tetanus toxoid. Results showed that the reported abnormal cell-surface display of PfEMP1 on HbC infected erythrocytes observed in vitro is not associated to lower anti- PfEMP1 response in vivo. Higher immune response against the VSA panel and malaria antigens were observed in all adaptive genotypes containing at least one allelic variant HbC or HbS in the low transmission urban area whereas no differences were detected in the high transmission rural area. In both contexts the response against tetanus toxoid was not influenced by the beta-globin genotype. These findings suggest that both HbC and HbS affect the early development of naturally acquired immunity against malaria. The enhanced immune reactivity in both HbC and HbS carriers supports the hypothesis that the protection against malaria of these adaptive genotypes might be at least partially mediated by acquired immunity against malaria.
3,5-Bis(4-meth-oxy-phen-yl)-1-phenyl-4,5-dihydro-1H-pyrazole.

Science.gov (United States)

Baktır, Zeliha; Akkurt, Mehmet; Samshuddin, S; Narayana, B; Yathirajan, H S

2011-01-12

In the title compound, C(23)H(22)N(2)O(2), the central pyrazole ring is nearly planar (r.m.s. deviation = 0.046 Å) and it makes a dihedral angle of 18.5 (2)° with the phenyl ring. The dihedral angles between the phenyl and the two meth-oxy-substituted phenyl rings are 26.2 (2) and 80.6 (2)°. The crystal structure is stabilized by C-H⋯π stacking inter-actions and weak π-π inter-actions [centriod-centroid distance = 3.891 (2) Å].
4,4′-Bipyridine–3-(thiophen-3-ylacrylic acid (1/2

Directory of Open Access Journals (Sweden)

Malaichamy Sathiyendiran

2011-10-01

Full Text Available In the title 1/2 adduct, C10H8N2·2C7H6O2S, the dihedral angle between the pyridine rings is 18.41 (11°. In the thiopheneacrylic acid molecules, the dihedral angles between the respective thiophene and acrylic acid units are 5.52 (17° and 23.92 (9°. In the crystal, the components are linked via O—H...N hydrogen-bonding interactions, forming units of two 3-thiopheneacrylic acid molecules and one 4,4′-bipyridine molecule.
Interaction of C1q and mannan-binding lectin (MBL) with C1r, C1s, MBL-associated serine proteases 1 and 2, and the MBL-associated protein MAp19

DEFF Research Database (Denmark)

Thiel, S; Petersen, Steen Vang; Vorup-Jensen, T

2000-01-01

. There is controversy as to whether MBL can utilize C1r and C1s or, inversely, whether C1q can utilize MASP-1 and 2. Serum deficient in C1r produced no complement activation in IgG-coated microwells, whereas activation was seen in mannan-coated microwells. In serum, C1r and C1s were found to be associated only with C1q...
HMB-45, S-100, NK1/C3, and MART-1 in metastatic melanoma.

Science.gov (United States)

Zubovits, Judit; Buzney, Elizabeth; Yu, Lawrence; Duncan, Lyn M

2004-02-01

The diagnosis of melanoma metastatic to lymph node remains a difficult problem given its histological diversity. We examined the staining patterns of S-100, NK1/C3, HMB-45, and MART-1 (DC10) in melanoma metastases to lymph nodes. Immunohistochemical stains were performed on tissue sections of 126 formalin-fixed lymph nodes from 126 patients with an established diagnosis of metastatic melanoma. A total of 98% of cases (123 of 126) stained positive for S-100, 93% (117 of 125) stained positive for NK1/C3, 82% (103 of 126) stained positive for MART-1, and 76% (95 of 125) stained positive for HMB-45. The distribution and intensity of staining varied among these markers. A diffuse staining pattern, defined as >50% of tumor cells stained, was observed in 83% of MART-1-positive cases but in only 56% of S-100-positive cases, 48% of NK1/C3-positive cases, and 34% of HMB-45-positive cases. A maximally intense signal was almost always observed for MART-1 (83% of positive cases) but was rarely observed for NK1/C3 (20%). S-100 and HMB-45 showed maximally intense staining in 50% and 54% of cases, respectively. S-100 and NK1/C3 stained both histiocytes and melanocytes, whereas MART-1 and HMB-45 stained only melanocytes. Seventy-eight cases (63%) stained positive for all 4 markers, 17 cases (14%) stained for all markers except HMB-45, 13 cases (10%) stained for all markers except MART-1, 6 cases (5%) stained only with S-100 and NK1/C3, 4 cases (3%) stained only with S-100 and HMB-45, and 2 cases stained for all markers except S-100. One case each stained for the following: only S-100, only S-100 and HMB-45, and all markers except NK1/C3. One case exhibited absence of staining for any of these markers. We demonstrate that lymph node metastases of melanoma are heterogeneous with regard to tumor marker expression. S-100 and NK1/C3 were the most sensitive stains for detecting metastatic melanoma; however, they both also stain other nontumor cells in lymph nodes. MART-1 did not stain
Fabrication of multilayered-sandwich MoS2/c architectures with advanced lithium storage properties

International Nuclear Information System (INIS)

Du, Jinlong; Yang, Zhanxu; Wang, Xiaorong; Qi, Chengyuan; Li, Yue; Mao, Wei; Qiao, Haiyan; Yu, ZongBao; Ren, Tieqiang; Qiao, Qingdong

2017-01-01

MoS 2 /C nanocomposite with a multilayered sandwich structure based on few-layered MoS 2 and carbon layers in an alternating sequence, was successfully synthesized through a one-step synchronized carbonization and sulfuration method. The hybrids were characterized by X-ray diffraction, High-resolution transmission electron microscopy, Atomic force microscope, Raman and X-ray photoelectron spectroscopic methods. The as-obtained MoS 2 /C nanocomposite applied as lithium-ion batteries anode materials, showed a high initial discharge and charge capacities of 1678.5 and 1386.0 mAh g −1 , respectively. High specific reversible capacity is maintained at fast C rates, e.g., 1390, 1223, 1017, 566, and 450 mAh g −1 at 0.1C, 0.6C, 3C, 10C and 20C, respectively. The good performance of the composite is mainly attributed to the unique few layered composite architectures, which can improve ion/electron transportation and prevent aggregation and restacking during the lithiation/delithiation process.
Liderazgo de una empresa familiar que influye en el clima laboral de los trabajadores de la empresa SEDEMI S.C.C

OpenAIRE

Rodríguez Valenzuela, Darwin Fausto

2015-01-01

El presente trabajo detalla el estudio del liderazgo y su influencia en el clima organizacional de los trabajadores de la empresa familiar Sedemi S.C.C., con la fin de proponer opciones de mejora, que coadyuven al directorio de la empresa, para fomentar un ambiente laboral agradable y motivador para sus empleados, y de esta manera incrementar su desempeño laboral. La investigación se realizó en la empresa SEDEMI S.C.C. La población objetivo está conformada por los empleados administrativos y ...
Safeguards evolution towards unattended c/s (containment and surveillance) systems

International Nuclear Information System (INIS)

Valentino, Lucia I.; Saavedra, Analia D.; Castro, Laura B.; Maceiras, Elena; Llacer, Carlos D.; Vicens, Hugo E.; Mairal, Maria L.; Fernandez Moreno, Sonia

2000-01-01

This paper shows the development and evolution of safeguards towards the use of different containment and surveillance (C/S) systems, which involve the possibility of working unattended. They are designed to transmit safeguards relevant data remotely. It is believed that they would increase safeguards efficiency while maintaining or even enhancing their effectiveness. At present, unattended C/S systems with or without remote transmission are in place at several installations. In addition, some other possible applications are being tested. One of these is the Remote Monitoring Systems (RMS) field trial at Embalse nuclear power plant to cover the transfers of spent fuel from the ponds to the dry storage. Some of the matters to be addressed are of general nature (i.e. applicable to any unattended/remote system) while others depend on the specific application in a nuclear installation. Among others, the following are particularly important: -) Sharing of data with the SSAC; -) Impact of a failure of the RMS on the operator, IAEA and the SSAC; -) Provision of relevant operational and accounting information; -) Review of the current safeguard approach for the selected installation; -) RMS cost-effectiveness assessment. This paper describes the status of the RMS field trial as well as the current C/S system in place at Embalse nuclear power plant. (authors)
The electromagnetic decays of B{sub c}{sup ±}(2S)

Energy Technology Data Exchange (ETDEWEB)

Wang, Tianhong; Jiang, Yue; Ju, Wan-Li; Yuan, Han; Wang, Guo-Li [Department of Physics, Harbin Institute of Technology,West Dazhi Street, Harbin, 150001 (China)

2016-03-31

We calculate the electromagnetic (EM) decay widths of the B{sub c}{sup ±}(2S) meson, which is observed recently by the ATLAS Collaboration. The main EM decay channels of this particle are 1{sup 3}S{sub 1}γ and 1Pγ, which, in literature, are estimated to have the branching ratio of about 1/10. In this work, we get the partial decay widths: Γ(2{sup 1}S{sub 0}→1{sup 3}S{sub 1}γ)=0.192 keV, Γ(2{sup 1}S{sub 0}→1P{sub 1}γ)=2.24 keV and Γ(2{sup 1}S{sub 0}→1P{sub 1}{sup ′}γ)=11.4 keV. In the calculation, the instantaneous approximated Bethe-Salpeter method is used. For the P-wave B{sub c} mesons, the wave functions are given by mixing the {sup 3}P{sub 1} and {sup 1}P{sub 1} states. Within the Mandelstam formalism, the decay amplitude is given, which includes the relativistic corrections.
Deficiencia combinada de proteínas c y s

Directory of Open Access Journals (Sweden)

Yaneth Zamora-González

Full Text Available Las trombofilias son un grupo de enfermedades que favorecen la formación de trombosis, tanto arteriales como venosas, que han sido asociadas con diferentes complicaciones durante el embarazo, como: aborto recurrente, preclampsia, crecimiento intrauterino retardado y muerte fetal intraútero, entre otras. La deficiencia congénita o adquirida de proteínas de la coagulación, como las proteínas C y S, se asocia con eventos trombóticos antes de los 30 o 40 años. La trombosis venosa profunda es considerada la manifestación clínica más frecuente, aunque también puede verse asociada con enfermedad cerebro vascular, pérdidas recurrentes de embarazos y otros estados isquémicos. En la actualidad, las enfermedades trombóticas constituyen una de las primeras causas de fallecimiento en el mundo; la morbimortalidad anual por trombosis, ya sea arterial o venosa, es de aproximadamente dos millones de personas. Presentamos un caso con antecedentes de pérdidas recurrentes de embarazos y trombosis venosa profunda en miembros inferiores con deficiencia combinada de proteínas C y S.
(4-Nitrophenylmethyl 2,3-dihydro-1H-pyrrole-1-carboxylate: crystal structure and Hirshfeld analysis

Directory of Open Access Journals (Sweden)

Julio Zukerman-Schpector

2018-03-01

Full Text Available In the title compound, C12H12N2O4, the dihydropyrrole ring is almost planar (r.m.s. deviation = 0.0049 Å and is nearly coplanar with the adjacent C2O2 residue [dihedral angle = 4.56 (9°], which links to the 4-nitrobenzene substituent [dihedral angle = 4.58 (8°]. The molecule is concave, with the outer rings lying to the same side of the central C2O2 residue and being inclined to each other [dihedral angle = 8.30 (7°]. In the crystal, supramolecular layers parallel to (10-5 are sustained by nitrobenzene-C—H...O(carbonyl and pyrrole-C—H...O(nitro interactions. The layers are connected into a three-dimensional architecture by π(pyrrole–π(nitrobenzene stacking [inter-centroid separation = 3.7414 (10 Å] and nitro-O...π(pyrrole interactions.
Potentiation of C1-esterase inhibitor by heparin and interactions with C1s protease as assessed by surface plasmon resonance.

Science.gov (United States)

Rajabi, Mohsen; Struble, Evi; Zhou, Zhaohua; Karnaukhova, Elena

2012-01-01

Human C1-esterase inhibitor (C1-INH) is a multifunctional plasma protein with a wide range of inhibitory and non-inhibitory properties, mainly recognized as a key down-regulator of the complement and contact cascades. The potentiation of C1-INH by heparin and other glycosaminoglycans (GAGs) regulates a broad spectrum of C1-INH activities in vivo both in normal and disease states. SCOPE OF RESEARCH: We have studied the potentiation of human C1-INH by heparin using Surface Plasmon Resonance (SPR), circular dichroism (CD) and a functional assay. To advance a SPR for multiple-unit interaction studies of C1-INH we have developed a novel (consecutive double capture) approach exploring different immobilization and layout. Our SPR experiments conducted in three different design versions showed marked acceleration in C1-INH interactions with complement protease C1s as a result of potentiation of C1-INH by heparin (from 5- to 11-fold increase of the association rate). Far-UV CD studies suggested that heparin binding did not alter C1-INH secondary structure. Functional assay using chromogenic substrate confirmed that heparin does not affect the amidolytic activity of C1s, but does accelerate its consumption due to C1-INH potentiation. This is the first report that directly demonstrates a significant acceleration of the C1-INH interactions with C1s due to heparin by using a consecutive double capture SPR approach. The results of this study may be useful for further C-INH therapeutic development, ultimately for the enhancement of current C1-INH replacement therapies. Published by Elsevier B.V.
Décès - French version only

CERN Multimedia

Affaires sociales

2005-01-01

Nous avons le regret d'annoncer le décès de Monsieur Bernard EIDESHEIM survenu le 17 février 2005. M. Bernard EIDESHEIM, né le 5 octobre 1963, a travaillé au Département AT-MEL-PM et était au CERN depuis le 1er juillet 2000. Le Directeur général a envoyé un message de condoléances à sa famille de la part du personnel du CERN. Affaires sociales Département des Ressources humaines
A 10-bit 200-kS/s SAR ADC IP core for a touch screen SoC

International Nuclear Information System (INIS)

Tong Xingyuan; Yang Yintang; Zhu Zhangming; Sheng Wenfang

2010-01-01

Based on a 5 MSBs (most-significant-bits)-plus-5 LSBs (least-significant-bits) C-R hybrid D/A conversion and low-offset pseudo-differential comparison approach, with capacitor array axially symmetric layout topology and resistor string low gradient mismatch placement method, an 8-channel 10-bit 200-kS/s SAR ADC (successive-approximation-register analog-to-digital converter) IP core for a touch screen SoC (system-on-chip) is implemented in a 0.18 μm 1P5M CMOS logic process. Design considerations for the touch screen SAR ADC are included. With a 1.8 V power supply, the DNL (differential non-linearity) and INL (integral non-linearity) of this converter are measured to be about 0.32 LSB and 0.81 LSB respectively. With an input frequency of 91 kHz at 200-kS/s sampling rate, the spurious-free dynamic range and effective-number-of-bits are measured to be 63.2 dB and 9.15 bits respectively, and the power is about 136 μW. This converter occupies an area of about 0.08 mm 2 . The design results show that it is very suitable for touch screen SoC applications. (semiconductor integrated circuits)

48 CFR 252.235-7001 - Indemnification under 10 U.S.C. 2354-cost reimbursement.

Science.gov (United States)

2010-10-01

....S.C. 2354-cost reimbursement. 252.235-7001 Section 252.235-7001 Federal Acquisition Regulations.... 2354—cost reimbursement. As prescribed in 235.070-3, use the following clause: Indemnification Under 10 U.S.C. 2354—Cost Reimbursement (DEC 1991) (a) This clause provides for indemnification under 10 U.S...
(1S,3R,8S,9R,10S-2,2-Dichloro-3,7,7,10-tetramethyl-9,10-epoxytricyclo[6.4.0.01,3]dodecane

Directory of Open Access Journals (Sweden)

Moha Berraho

2010-12-01

Full Text Available The title compound, C16H24Cl2O, was synthesized from β-himachalene (3,5,5,9-tetramethyl-2,4a,5,6,7,8-hexahydro-1H-benzocycloheptene, which was isolated from the essential oil of the Atlas cedar (cedrus atlantica. The molecule forms an extended sheet of two fused rings which exhibit different conformations. The six-membered ring has a half-chair conformation, while the seven-membered ring displays a chair conformation; the dihedral angle between the two rings is 38.2 (1°.
Multiple C-H Bond Activations and Ring-Opening C-S Bond Cleavage of Thiophene by Dirhenium Carbonyl Complexes.

Science.gov (United States)

Adams, Richard D; Dhull, Poonam; Tedder, Jonathan D

2018-06-14

The reaction of Re 2 (CO) 8 (μ-C 6 H 5 )(μ-H) (1) with thiophene in CH 2 Cl 2 at 40 °C yielded the new compound Re 2 (CO) 8 (μ-η 2 -SC 4 H 3 )(μ-H) (2), which contains a bridging σ-π-coordinated thienyl ligand formed by the activation of the C-H bond at the 2 position of the thiophene. Compound 2 exhibits dynamical activity on the NMR time scale involving rearrangements of the bridging thienyl ligand. The reaction of compound 2 with a second 1 equiv of 1 at 45 °C yielded the doubly metalated product [Re 2 (CO) 8 (μ-H)] 2 (μ-η 2 -2,3-μ-η 2 -4,5-C 4 H 2 S) (3), formed by the activation of the C-H bond at the 5 position of the thienyl ligand in 2. Heating 3 in a hexane solvent to reflux transformed it into the ring-opened compound Re(CO) 4 [μ-η 5 -η 2 -SCC(H)C(H)C(H)][Re(CO) 3 ][Re 2 (CO) 8 (μ-H)] (4) by the loss of one CO ligand. Compound 4 contains a doubly metalated 1-thiapentadienyl ligand formed by the cleavage of one of the C-S bonds. When heated to reflux (125 °C) in an octane solvent in the presence of H 2 O, the new compound Re(CO) 4 [η 5 -μ-η 2 -SC(H)C(H)C(H)C(H)]Re(CO) 3 (5) was obtained by cleavage of the Re 2 (CO) 8 (μ-H) group from 4 with formation of the known coproduct [Re(CO) 3 (μ 3 -OH)] 4 . All new products were characterized by single-crystal X-ray diffraction analyses.
2,6-Diphenyl-4-(2-thienyl-1,4-dihydropyridine-3,5-dicarbonitrile

Directory of Open Access Journals (Sweden)

Xiao-Tong Zhu

2009-09-01

Full Text Available The asymmetric unit of the title compound, C23H15N3S, contains two crystallographically independent molecules. The pyridine rings adopt envelope conformations. The thiophene rings are oriented at dihedral angles of 77.97 (4/53.53 (4 and 78.44 (4/57.11 (4° with respect to the phenyl rings, while the dihedral angles between the phenyl rings are 48.51 (4 and 44.49 (4°. In the crystal structure, intermolecular N—H...N hydrogen bonds link the molecules into chains along the c axis. The S, C and H atoms of one of the thiophene rings are disordered over two orientations, with occupancy ratios of 0.314 (15:0.686 (15.
(3′R-3′-Benzyl-2′,3′-dihydro-1H-spiro[indole-3,1′-naphtho[2,3-c]pyrrole]-2,4′,9′-trione

Directory of Open Access Journals (Sweden)

Garima Sharma

2012-09-01

Full Text Available In the title compound, C26H18N2O3, the maximum deviations from planarity for the tetrahydro-1H-naphtho[2,3-c]pyrrole and indoline rings systems are 0.091 (1 and 0.012 (2 Å, respectively. These ring systems make a dihedral angle of 89.95 (6° with each other and they make dihedral angles of 73.42 (8 and 71.28 (9°, respectively, with the benzene ring. In the crystal, inversion dimers linked by pairs of N—H...O hydrogen bonds generate R22(8 loops and C—H...O interactions connect the dimers into corrugated sheets lying parallel to the bc plane.
Determination of {alpha}{sub s} and m{sub c} in deep-inelastic scattering

Energy Technology Data Exchange (ETDEWEB)

Alekhin, Sergey; Bluemlein, Johannes [Deutsches Elektronen-Synchrotron (DESY), Zeuthen (Germany); Moch, Sven-Olaf [Hamburg Univ. (Germany). 2. Inst. fuer Theoretische Physik

2013-07-15

We describe the determination of the strong coupling constant {alpha}{sub s}(M{sub Z}{sup 2}) and of the charm-quark mass m{sub c}(m{sub c}) in the MS-scheme, based on the QCD analysis of the unpolarized World deep-inelastic scattering data. At NNLO the values of {alpha}{sub s}(M{sub Z}{sup 2})=0.1134{+-}0.001(exp) and m{sub c}(m{sub c})=1.24{+-}0.03(exp){sup +0.03}{sub -0.02}(scale){sup +0.00}{sub -0.07}(th) are obtained and are compared with other determinations, also clarifying discrepancies.
One-step synthesis of graphitic-C 3 N 4 /ZnS composites for enhanced supercapacitor performance

KAUST Repository

Wei, Binbin

2017-11-24

A series of graphitic-C3N4/ZnS (g-C3N4/ZnS) supercapacitor electrode materials have been prepared via a one-step calcination process of zinc acetate/thiourea with different mass ratios under nitrogen atmosphere. The optimized g-C3N4/ZnS composite shows a highest specific capacitance of 497.7 F/g at 1 A/g and good cycling stability with capacitance retention of 80.4% at 5 A/g after 1000 cycles. Moreover, g-C3N4/ZnS composites display an improved supercapacitor performance in terms of specific capacitance compared to the pure g-C3N4 and ZnS. In addition, our designed symmetric supercapacitor device based on g-C3N4/ZnS composite electrodes can exhibit an energy density of 10.4 Wh/kg at a power density of 187.3 W/kg. As a result, g-C3N4/ZnS composites are expected to be a prospective material for supercapacitors and other energy storage applications.
One-step synthesis of graphitic-C 3 N 4 /ZnS composites for enhanced supercapacitor performance

KAUST Repository

Wei, Binbin; Liang, Hanfeng; Wang, Rongrong; Zhang, Dongfang; Qi, Zhengbing; Wang, Zhoucheng

2017-01-01

A series of graphitic-C3N4/ZnS (g-C3N4/ZnS) supercapacitor electrode materials have been prepared via a one-step calcination process of zinc acetate/thiourea with different mass ratios under nitrogen atmosphere. The optimized g-C3N4/ZnS composite shows a highest specific capacitance of 497.7 F/g at 1 A/g and good cycling stability with capacitance retention of 80.4% at 5 A/g after 1000 cycles. Moreover, g-C3N4/ZnS composites display an improved supercapacitor performance in terms of specific capacitance compared to the pure g-C3N4 and ZnS. In addition, our designed symmetric supercapacitor device based on g-C3N4/ZnS composite electrodes can exhibit an energy density of 10.4 Wh/kg at a power density of 187.3 W/kg. As a result, g-C3N4/ZnS composites are expected to be a prospective material for supercapacitors and other energy storage applications.
Reducing the cost of S-65C grade beryllium for ITER first wall applications

International Nuclear Information System (INIS)

Kaczynski, D.; Sato, K.; Savchuk, V.V.; Shestakov, V.P.

2004-01-01

Beryllium is the current material of choice for plasma-facing components in ITER. The present design is for 10 mm thick beryllium tiles bonded to an actively cooled copper substrate. Brush Wellman grade S65C beryllium is preferred grade off beryllium for these tiles. S65C has the best resistance to low-cycle thermal fatigue than any other beryllium grad in the world. S65C grade beryllium has been successfully deployed in fusion reactors for more than two decades, most recently in the JET reactor. This paper will detail a supply chain to produce the most cost-effective S65C plasma facing components for ITER. This paper will also propose some future work too demonstrate the best technology for bonding beryllium to copper. (author)
N-(2,5-Dimethylphenyl-4-methylbenzenesulfonamide

Directory of Open Access Journals (Sweden)

B. Thimme Gowda

2010-01-01

Full Text Available In the crystal structure of the title compound, C15H17NO2S, the conformation of the N—C bond in the C—SO2—NH—C segment has gauche torsions with respect to the S=O bonds. The molecule is bent at the S atom with a C—SO2—NH—C torsion angle of −61.0 (2°. The dihedral angle between the two aromatic rings is 49.4 (1°. The crystal structure features inversion-related dimers linked by pairs of N—H...O hydrogen bonds.
Estrategias de desarrollo para la empresa Cal del Centro S.A.C.

OpenAIRE

Bautista Antón, Yovanni Patricia; Mendoza Rojas, Miguel Ángel

2015-01-01

Cal del Centro S.A.C. es una sociedad anónima cerrada cuyo negocio gira en torno a la actividad económica de la fabricación de cemento, cal y yeso. El objetivo del presente trabajo es evaluar la posibilidad de éxito de un proyecto de inversión en una planta de cal, a través de Cal del Centro S.A.C. –como empresa autosuficiente–, para asegurar el cien por ciento del suministro de óxido de calcio en cantidad y calidad para el procesamiento de concentrados de cobre y el tratamiento de aguas indu...
28 CFR 45.3 - Disciplinary proceedings under 18 U.S.C. 207(j).

Science.gov (United States)

2010-07-01

.... 207(j). 45.3 Section 45.3 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) EMPLOYEE RESPONSIBILITIES § 45.3 Disciplinary proceedings under 18 U.S.C. 207(j). (a) Upon a determination by the Assistant... authorized by 18 U.S.C. 207(j), or subjected to other appropriate disciplinary action under that statute. The...
Carbon fullerenes (C60s) can induce inflammatory responses in the lung of mice

International Nuclear Information System (INIS)

Park, Eun-Jung; Kim, Hero; Kim, Younghun; Yi, Jongheop; Choi, Kyunghee; Park, Kwangsik

2010-01-01

Fullerenes (C60s) occur in the environment due to natural and anthropogenic sources such as volcanic eruptions, forest fires, and the combustion of carbon-based materials. Recently, production and application of engineered C60s have also rapidly increased in diverse industrial fields and biomedicine due to C60' unique physico-chemical properties, so toxicity assessment on environmental and human health is being evaluated as a valuable work. However, data related to the toxicity of C60s have not been abundant up to now. In this study, we studied the immunotoxic mechanism and change of gene expression caused by the instillation of C60s. As a result, C60s induced an increase in sub G1 and G1 arrest in BAL cells, an increase in pro-inflammatory cytokines such as IL-1, TNF-α, and IL-6, and an increase of Th1 cytokines such as IL-12 and IFN-r in BAL fluid. In addition, IgE reached the maximum at 1 day after treatment in both BAL fluid and the blood, and decreased in a time-dependent manner. Gene expression of the MHC class II (H2-Eb1) molecule was stronger than that of the MHC class I (H2-T23), and an increase in T cell distribution was also observed during the experiment period. Furthermore, cell infiltration and expression of tissue damage related genes in lung tissue were constantly observed during the experiment period. Based on this, C60s may induce inflammatory responses in the lung of mice.
Mechanical properties of S-65C grade beryllium at elevated temperatures

Energy Technology Data Exchange (ETDEWEB)

Goods, S.H. [Sandia National Lab., Livermore, CA (United States); Dombrowski, D.E.

1998-01-01

Tensile property measurements and fractographic analysis of S-65C beryllium are reviewed. Tests were performed on specimens oriented in the longitudinal and transverse directions with respect to the direction of vacuum hot-pressing. Specimens were tested in air at RT, 100degC, 200degC, 300degC, 415degC and 500degC at an initial strain rate of 1.1 x 10{sup -4} sec{sup -1}. Ductility of the material was strongly affected by the test temperature, exhibiting a peak ductility at 300degC. The material displayed a yield point phenomenon which was most pronounced at this same temperature. Scanning electron microscopy was performed on the resulting fracture surfaces and observations are reported. (author)
S.A.C.I.: Incident Combat Support System; S.A.C.I.: Sistema de Apoio ao Combate de Incidentes

Energy Technology Data Exchange (ETDEWEB)

Macedo, Antonio R.L. [ARMTEC Tecnologia em Robotica, Fotrtaleza, CE (Brazil); Macedo, Antonio R.M. [Universidade de Fortaleza, CE (Brazil)

2004-07-01

The incidents that occur in the petrochemical industry are extremely dangerous, because of the range of temperature that it reaches and the radius of the explosion. For this reason the S.A.C.I. that is an Incident's Combat Support System was developed. The purpose of this paper is to present the complete operational capability of this machine, and also some of the construction design calculations. It is a controlled-by-distance robot that carries one water cannon that generates fog, stream or foam with a limit pressure of 125 psi. It works within 90 m from the operator, has 3 degrees of freedom and a minimum autonomy of 3 hours. Before this prototype was made, only the United Kingdom by Qinetiq and the Japan by the Tokyo Fire Department had this technology. This prototype is around 70% of the investment of the ones in the market. The tests shown in the paper were made in the training bunker of Ceara's Military Fire Corp. Headquarters and in an arena in the Gloria Marine in Rio de Janeiro. The results of this project is a national product that improves the incident's combat response time, saving the most important resource, that is the human been. (author)
C.E.E.B. and S.A.T.O. - Their Relationship.

Science.gov (United States)

Toronto Board of Education (Ontario). Research Dept.

The relationship between the Scholastic Aptitude Test of Ontario (S.A.T.O.) administered to twelfth grade students and the College Entrance Examination Board Scholastic Aptitude Test (C.E.E.B.), of which the S.A.T.O. is a modification, was studied. Data was collected through the co-operation of the schools. The S.A.T.O. data was recorded as raw…
Shear Capacity of C-Shaped and L-Shaped Angle Shear Connectors.

Directory of Open Access Journals (Sweden)

Farzad Tahmasbi

Full Text Available This paper investigates the behaviour of C-shaped and L-shaped angle shear connectors embedded in solid concrete slabs. An effective finite element model is proposed to simulate the push out tests of these shear connectors that encompass nonlinear material behaviour, large displacement and damage plasticity. The finite element models are validated against test results. Parametric studies using this nonlinear model are performed to investigate the variations in concrete strength and connector dimensions. The finite element analyses also confirm the test results that increasing the length of shear connector increases their shear strength proportionately. It is observed that the maximum stress in L-shaped angle connectors takes place in the weld attachment to the beam, whereas in the C-shaped angle connectors, it is in the attached leg. The location of maximum concrete compressive damage is rendered in each case. Finally, a new equation for prediction of the shear capacity of C-shaped angle connectors is proposed.
Shear Capacity of C-Shaped and L-Shaped Angle Shear Connectors

Science.gov (United States)

Tahmasbi, Farzad; Maleki, Shervin; Shariati, Mahdi; Ramli Sulong, N. H.; Tahir, M. M.

2016-01-01

This paper investigates the behaviour of C-shaped and L-shaped angle shear connectors embedded in solid concrete slabs. An effective finite element model is proposed to simulate the push out tests of these shear connectors that encompass nonlinear material behaviour, large displacement and damage plasticity. The finite element models are validated against test results. Parametric studies using this nonlinear model are performed to investigate the variations in concrete strength and connector dimensions. The finite element analyses also confirm the test results that increasing the length of shear connector increases their shear strength proportionately. It is observed that the maximum stress in L-shaped angle connectors takes place in the weld attachment to the beam, whereas in the C-shaped angle connectors, it is in the attached leg. The location of maximum concrete compressive damage is rendered in each case. Finally, a new equation for prediction of the shear capacity of C-shaped angle connectors is proposed. PMID:27478894
Environmental background 14C levels in Japan in 1990s

International Nuclear Information System (INIS)

Fuma, Shoichi; Inoue, Yoshikazu; Miyamoto, Kiriko; Takeda, Hiroshi; Iwakura, Tetsuo; Arai, Kiyohiko; Kashida, Yoshihiko; Ichimasa, Yusuke

2002-01-01

For assessment of radiation doses due to 14 C released from nuclear facilities, it is necessary to know the background level of environmental 14 C originated from the natural cosmic-ray production and the past atmospheric nuclear weapons tests. The authors selected grapes as an indicator of 14 C levels in the environment including atmosphere, and determined the specific activities of 14 C in ethanol extracted from wine made from grapes cultivated in several prefectures or unknown places in Japan in each year from 1990 to 2000. The specific activities of 14 C were almost uniform all over Japan in each year, though they showed the weak tendency to slightly decrease with increasing population densities in the prefecture where the wine grapes were cultivated. It is considered that this small regional variation in the specific activities of 14 C arose from Suess effect, because population densities can be regarded as an index of the amount of CO 2 emission from fossil-fuel combustion. The specific activities of 14 C gradually decreased in the 1990s. That is, they were 260 mBq/gC in 1990, and became 244 mBq/gC in 2000. This 14 C level in 2000 was still about 7% higher than the pre-bomb level. The decrease in 14 C originated from the past atmospheric nuclear weapons tests could be described by a single exponential function with a half-time of 10.3 years in 1990s. This half-time was shorter than that in the Europe, Canada and the South Pacific. This difference in the decreasing rate between Japan and other countries may be explained by a fact that the amount of CO 2 emission from fossil-fuel combustion continued to increase in Japan in this period. The specific activities of 14 C in wine ethanol determined in this study showed good agreement with those in atmospheric CO 2 predicted by a mathematical model. They were also in the same levels as the 14 C specific activities in atmospheric CO 2 , tree leaves, grass and plant food in Japan and other countries, which were
1,4-Bis{(+-(S-[1-(1-naphthylethyl]iminomethyl}benzene

Directory of Open Access Journals (Sweden)

Armando Espinosa Leija

2009-10-01

Full Text Available The title compound, C32H28N2, is a chiral bis-imine in which both imine groups display the common E configuration. The naphthyl groups present different orientations with respect to the central core, as reflected in the dihedral angles of 21.4 (2 and 78.83 (14° between the benzene and naphthyl mean planes, thus the highest possible C2 local molecular symmetry is not attained. This C1 molecular conformation allows multiple C—H...π intermolecular contacts involving all aromatic rings, while no π–π interactions are available for the stabilization of the crystal structure. The resulting packing structure is based on molecules stacked along [100].

Viscoelastic wormlike micelles formed by ionic liquid-type surfactant [C16imC8]Br towards template-assisted synthesis of CdS quantum dots.

Science.gov (United States)

Hu, Yimin; Han, Jie; Ge, Lingling; Guo, Rong

2018-01-31

In this paper, viscoelastic wormlike micelles consisting of cationic liquid-type surfactant, 1-hexadecyl-3-octyl imidazolium bromide ([C 16 imC 8 ]Br), water and different additives were utilized for the synthesis of CdS quantum dots. First, the influence of different additives, such as [Cd(NH 3 ) 6 ]Cl 2 and ethanethioamid (precursors for the synthesis of CdS quantum dots), and temperature on the viscoelasticity of the [C 16 imC 8 ]Br aqueous solution was studied by dynamic and steady rheology. Furthermore, the synthesized CdS quantum dots and their photoluminescence properties were characterized by transmission electron microscopy (TEM), UV-Vis absorption spectroscopy, X-ray diffraction (XRD) and energy-dispersive X-ray spectroscopy (EDX). In the end, the mechanism for the synthesis of CdS quantum dots in [C 16 imC 8 ]Br wormlike micelles is proposed.
Measurements of production properties of $K^{0}_{S}$ mesons and $\\Lambda$ hyperons in proton-carbon interactions at 31 GeV/c

CERN Document Server

Abgrall, N.; Ali, Y.; Anticic, T.; Antoniou, N.; Argyriades, J.; Baatar, B.; Blondel, A.; Blumer, J.; Bogomilov, M.; Bravar, A.; Brooks, W.; Brzychczyk, J.; Bunyatov, S.A.; Busygina, O.; Christakoglou, P.; Czopowicz, T.; Davis, N.; Debieux, S.; Dembinski, H.; Diakonos, F.; Di Luise, S.; Dominik, W.; Drozhzhova, T.; Dumarchez, J.; Dynowski, K.; Engel, R.; Ereditato, A.; Esposito, L.; Feofilov, G.A.; Fodor, Z.; Fulop, A.; Gazdzicki, M.; Golubeva, M.; Grebieszkow, K.; Grzeszczuk, A.; Guber, F.; Hakobyan, H.; Haesler, A.; Hasegawa, T.; Hierholzer, M.; Idczak, R.; Igolkin, S.; Ivanov, Y.; Ivashkin, A.; Jokovic, D.; Kadija, K.; Kapoyannis, A.; Katrynska, N.; Kaptur, E.; Kielczewska, D.; Kikola, D.; Kirejczyk, M.; Kisiel, J.; Kiss, T.; Kleinfelder, S.; Kobayashi, T.; Kolesnikov, V.I.; Kolev, D.; Kondratiev, V.P.; Korzenev, A.; Kowalski, S.; Krasnoperov, A.; Kuleshov, S.; Kurepin, A.; Larsen, D.; Laszlo, A.; Lyubushkin, V.V.; Mackowiak-Pawlowska, M.; Majka, Z.; Maksiak, B.; Malakhov, A.I.; Maletic, D.; Manic, D.; Marchionni, A.; Marcinek, A.; Marin, V.; Marton, K.; Mathes, H-J.; Matulewicz, T.; Matveev, V.; Melkumov, G.L.; Mrowczynski, St.; Murphy, S.; Nakadaira, T.; Nirkko, M.; Nishikawa, K.; Palczewski, T.; Palla, G.; Panagiotou, A.D.; Paul, T.; Peryt, W.; Pistillo, C.; Redij, A.; Petukhov, O.; Planeta, R.; Pluta, J.; Popov, B.A.; Posiada la, M.; Pulawski, S.; Puzovic, J.; Rauch, W.; Ravonel, M.; Renfordt, R.; Robert, A.; Rohrich, D.; Rondio, E.; Roth, M.; Rubbia, A.; Rustamov, A.; Rybczynski, M.; Sadovsky, A.; Sakashita, K.; Savic, M.; Schmidt, K.; Sekiguchi, T.; Seyboth, P.; Shibata, M.; Sipos, R.; Skrzypczak, E.; Slodkowski, M.; Staszel, P.; Stefanek, G.; Stepaniak, J.; Susa, T.; Szuba, M.; Tada, M.; Tereshchenko, V.; Tolyhi, T.; Tsenov, R.; Turko, L.; Ulrich, R.; Unger, M.; Vassiliou, M.; Veberic, D.; Vechernin, V.V.; Vesztergombi, G.; Vinogradov, L.; Wilczek, A.; Wlodarczyk, Z.; Wojtaszek, A.; Wyszynski, O.; Zambelli, L.; Zipper, W.

2014-02-28

Spectra of $K^0_S$ mesons and $\\Lambda$ hyperons were measured in p+C interactions at 31 GeV/c with the large acceptance NA61/SHINE spectrometer at the CERN SPS. The data were collected with an isotropic graphite target with a thickness of 4% of a nuclear interaction length. Interaction cross sections, charged pion spectra, and charged kaon spectra were previously measured using the same data set. Results on $K^0_S$ and $\\Lambda$ production in p+C interactions serve as reference for the understanding of the enhancement of strangeness production in nucleus-nucleus collisions. Moreover, they provide important input for the improvement of neutrino flux predictions for the T2K long baseline neutrino oscillation experiment in Japan. Inclusive production cross sections for $K^0_S$ and $\\Lambda$ are presented as a function of laboratory momentum in intervals of the laboratory polar angle covering the range from 0 up to 240 mrad. The results are compared with predictions of several hadron production models. The $K^0_...
Phase relations in the metal-rich portions of the phase system Pt-Ir-Fe-S at 1000 degrees C and 1100 degrees C

DEFF Research Database (Denmark)

Makovicky, E.; Karup-Møller, Sven

2000-01-01

Phase relations in the S-poor portions of the dry condensed Pt-Ir-Fe-S system were determined at 1000 degrees and 1100 degreesC with a particular emphasis on delineation of the solid solubility fields of the Pt-Ir-Fe alloys. At both temperatures, a broad field of gamma (Ir,Fe,Pt) alloy coexists...... with gamma-(Pt,Fe), Pt3Fe and PtFe which dissolve respectively at least 5.1, 29.3 and 24.0 at.% Ir at 1100 degreesC (2.2, 23.6 and less than or equal to 17.2 at.% Ir at 1000 degreesC). Gaps between the nearly Ir-free Pt-Fe alloys gamma (Pt,Fe), Pt3Fe s.s., PtFe s.s. and gamma (Fe,Pt) were estimated as 20......-23 at.%, 40-42 at.% and 54.2-similar to 57 at.% Fe at 1100 degreesC (18-23, 39.5-42.5 and 59-62 at.% Fe at 1000 degreesC). The first gap agrees with data from natural phases by Cabri et ni. (1996). The Fe-rich sulphide melt dissolves only traces of Pt and Ir; Fe1-xS dissolves up to 5.8 at.% Ir at 1100...
Prevalence of C282Y, H63D, and S65C mutations in hereditary HFE-hemochromatosis gene in Lithuanian population.

Science.gov (United States)

Kucinskas, Laimutis; Juzenas, Simonas; Sventoraityte, Jurgita; Cedaviciute, Ruta; Vitkauskiene, Astra; Kalibatas, Vytenis; Kondrackiene, Jurate; Kupcinskas, Limas

2012-04-01

HFE-hemochromatosis is a common autosomal recessive disease caused by HFE gene mutations and characterized as iron overload and failure of different organs. The aim of this study was to determine the prevalence of C282Y (c.845 G>A), H63D (c.187 C>G), and S65C (c.193A>T) alleles of HFE gene in the Lithuanian population. One thousand and eleven healthy blood donors of Lithuanian nationality were examined in four different ethnic Lithuanian regions to determine HFE gene alleles and genotype frequencies. The samples of DNA were analyzed for the presence of restriction fragment length polymorphism and validated by DNA sequencing. Among 1,011 blood donors tested, the frequency of C282Y, H63D, and S65C alleles were 2.6%, 15.9%, and 1.9%, respectively. One third of the tested subjects (n = 336) had at least one of the C282Y or H63D HFE gene mutations. The screening of Lithuanian blood donors has detected 13 (1.3%) subjects with a genotype C282Y/C282Y or C282Y/H63D responsible for the development of HFE-hemochromatosis. The prevalence of C282Y mutation was significantly higher among the inhabitants of Zemaitija (Somogitia) at the Baltic Sea area (5.9%) in comparison to the regions of continental part of Lithuania (2.4% in Dzukija, 2.3% in Aukstaitija, and 2% in Suvalkija, p HFE gene mutations in ethnic Lithuanians showed that the frequencies of H63D, C282Y, and S65C of HFE gene alleles are similar to the other North-Eastern Europeans, especially in the Baltic region (Estonia, Latvia), Poland, and part of Russia (Moscow region).
Λ{sub b} → π{sup -}(D{sub s}{sup -})Λ{sub c}(2595), π{sup -}(D{sub s}{sup -})Λ{sub c}(2625) decays and DN, D*N molecular components

Energy Technology Data Exchange (ETDEWEB)

Liang, Wei-Hong [Guangxi Normal University, Department of Physics, Guilin (China); Centro Mixto Universidad de Valencia-CSIC Institutos de Investigacion de Paterna, Departamento de Fisica Teorica y IFIC, Valencia (Spain); Bayar, Melahat [Kocaeli University, Department of Physics, Izmit (Turkey); Oset, Eulogio [Centro Mixto Universidad de Valencia-CSIC Institutos de Investigacion de Paterna, Departamento de Fisica Teorica y IFIC, Valencia (Spain)

2017-01-15

From the perspective that Λ{sub c}(2595) and Λ{sub c}(2625) are dynamically generated resonances from the DN, D*N interaction and coupled channels, we have evaluated the rates for Λ{sub b} → π{sup -}Λ{sub c}(2595) and Λ{sub b} → π{sup -}Λ{sub c}(2625) up to a global unknown factor that allows us to calculate the ratio of rates and compare with experiment, where good agreement is found. Similarly, we can also make predictions for the ratio of rates of the, yet unknown, decays of Λ{sub b} → D{sub s}{sup -}Λ{sub c}(2595) and Λ{sub b} → D{sub s}{sup -}Λ{sub c}(2625) and make estimates for their individual branching fractions. (orig.)
Água aquecida e radiação UV-C no controle pós-colheita de Cryptosporiopsis perennans em maçãs Heated water and UV-C radiation to postharvest control of Cryptosporiopsis perennans on apples

Directory of Open Access Journals (Sweden)

Vinícius Adão Bartnicki

2010-02-01

Full Text Available O objetivo deste trabalho foi avaliar a colonização de Cryptosporiopsis perennans na epiderme de maçãs e a eficiência da aplicação de água aquecida e radiação UV-C no controle desse patógeno. Em maçãs submetidas à inoculação de C. perennans, a colonização de lenticelas e das áreas adjacentes pelo patógeno foi avaliada por microscopia eletrônica de varredura. A sensibilidade dos conídios de C. perennans aos tratamentos foi avaliada em suspensão aquosa, às temperaturas de 28, 45, 50 e 55ºC, por 15 e 30 s, e às doses de radiação UV-C de 0,018, 0,037, 0,075, 0,150, 0,375, 0,750, 1,500 e 3,000 kJ m-2. Em maçãs submetidas à inoculação de C. perennans, foram avaliados os efeitos de 0,375, 0,750 e 1,500 kJ m-2 de radiação UV-C e da aspersão de água aquecida à 50ºC, por 15 e 30 s no controle do patógeno. O fungo produziu abundante micélio e conídios nas lenticelas e nas áreas adjacentes, na epiderme das maçãs. A água aquecida a 50ºC por 15 s e à dose de radiação de UV-C de 0,750 kJ m-2 reduzem em mais de 99% a sobrevivência de conídios. A aspersão de água aquecida a 50ºC por 15 s e à dose de radiação de UV-C de 0,375 kJ m-2, controlam C. perennans em maçãs.The objective of this work was to assess the colonization of Cryptosporiopsis perennans in the epidermis of apples and the efficiency of heated water and UV-C radiation application to control this pathogen. In apples inoculated with C. perennans, the colonization of lenticels and adjacent areas by the pathogen was observed by electronic scanning microscopy. The sensitivity of C. perennans conidia was evaluated in aqueous suspension, at temperatures of 28, 45, 50 and 55ºC for 15 and 30 s, and at UV-C radiation doses of 0.018, 0.037, 0.075, 0.150, 0.375, 0.750, 1.500 and 3.000 kJ m-2. The effects of UV-C radiation doses at 0.375, 0.750 and 1.500 kJ m-2 and heated water at 50ºC, sprayed during 15 and 30 s were evaluated for controlling C
Sinkhole investigated at B.C. Hydro`s Bennett Dam

Energy Technology Data Exchange (ETDEWEB)

Anon.

1996-07-01

The cause of a sinkhole which appeared in a roadway crossing an earth filled dam in B. C., was discussed. The hole measured 6 ft. across and 20 ft. deep, and occurred in B.C. Hydro`s W.A.C. Bennett Dam which measures 600 ft. high, 2,600 ft. wide at the base and 35 ft. wide at the crest. The cause of the sinkhole is not known, but it is believed that a weakness in the dam may have found its way to the surface via a pipe connected to a bedrock settlement gauge buried within the dam. Sonar and ground penetrating radar were used to examine the area. The hole has been filled with gravel and monitoring continues. Experts do not anticipate immediate risk of dam failure. 1 fig.
Different proportions of C/KCu7S4 hybrid structure for high-performance supercapacitors

Science.gov (United States)

Dai, Shuge; Xi, Yi; Hu, Chenguo; Yue, Xule; Cheng, Lu; Wang, Guo

2014-10-01

KCu7S4 has the channel structure and minor resistance. Its double larger channels ensure that the ions can well exchange with other's, at the same time, can shorten the ionic diffusion path and improve the ionic and electronic transport. So KCu7S4 shows good electrochemical property. The paper reports a novel and high performance supercapacitor based on hybrid carbon particles and KCu7S4 (C/KCu7S4) electrode. For the hybrid structure with different proportions of C and KCu7S4, the C/KCu7S4 (1:10) hybrid supercapacitor shows preferable electrochemical performance and large specific capacitance (469 mF cm-2) at high charge-discharge rate (2 mA), still retaining ∼95% of the capacitance over 5000 cycles by charge-discharge process at a fixed current of 10 mA. Three supercapacitor units in series can light 50 light-emitting diodes (LEDs) for 2.5 min, 10 LEDs for 4 min, one LED for 5.5 min. The much-increased capacity, rate capability, and cycling stability may be attributed to the superionic conductive KCu7S4 nanowires and C/KCu7S4 hybrid structure, which improve ionic and electronic transport, enhance the kinetics of redox reactions through the electrode system.
38 CFR 3.363 - Bar to benefits under 38 U.S.C. 1151.

Science.gov (United States)

2010-07-01

... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Bar to benefits under 38... Purposes § 3.363 Bar to benefits under 38 U.S.C. 1151. (a) Claims subject to this section. This section.... (b) Administrative award, compromises, or settlements, or judgments that bar benefits under 38 U.S.C...
N-(4-Methoxyphenyl-4-methylbenzenesulfonamide

Directory of Open Access Journals (Sweden)

Islam Ullah Khan

2011-01-01

Full Text Available In the title compound, C14H15NO3S, the dihedral angle between the aromatic rings is 59.39 (14° and the C—S—N—C torsion angle is −71.4 (2°. In the crystal, a supramolecular chain running along the b axis with a C(4 graph set is formed via N—H...O hydrogen bonds.
Understanding the anchoring effect of Graphene, BN, C2N and C3N4 monolayers for lithium-polysulfides in Li-S batteries

Science.gov (United States)

Zheng, Yanping; Li, Huanhuan; Yuan, Haiyan; Fan, Honghong; Li, Wenliang; Zhang, Jingping

2018-03-01

Recently, Li-S batteries with a high theoretical specific energy have attracted significant attention. However, their practical application is still seriously hindered by the shuttling effect of lithium polysulfides (LiPSs) in the Li-S batteries system. Introducing anchoring materials into the cathode or separator, which can strongly attract LiPSs because of advisable binding energies, has been demonstrated as an effective strategy to alleviate the shuttling effect for achieving the excellent cycling performance of Li-S batteries. In this work, the complete mechanistic understanding of the interaction between non-metallic monolayer materials (N-MMLMs, including Graphene, BN, C2N and C3N4) and LiPSs is given in detail with the aid of density functional theory. The calculation results show that N-MMLM can combine the chemical interaction and the physical entrapment of sulfur species to suppress the shuttling effect. C3N4 and C2N are predicted to trap LiPSs via stronger interfacial interaction and alleviate the interactions between LiPSs and solvents as well as the consequent dissolution. The strong anchoring effect of C3N4/C2N comes from the bonding of Li-N/C-S and charge transfer. Further charge transfer study reveals that the C3N4/C2N can serve as an electrocatalyst, which effectively accelerates the kinetics of LiPSs redox reactions.
Angela Borgia: C.F. Meyer’s 'Göttliche Komodie'

Directory of Open Access Journals (Sweden)

G. Oberprieler

1989-05-01

Full Text Available The harmonious, almost idyllic ending of C.F. Meyer’s last completed novella Angela Borgia must seem surprising in the context of his prose work as a whole. It is believed to reflect the intensified desire of the ageing and sickly poet to find a small livable ‘paradise’ in this world, based on Christian values. Man’s possible redemption and moral development are shown in the person of Giulio in strong parallel with Dante’s way to heavenly Paradise in the Divine Comedy. The fundamental difference between the two works lies, however, in the fact that the realist Meyer at the end of the 19th Century transfers Dante’s poetic vision of the hereafter not only to this world, but to a large extent to the physical sphere within man himself.
First principles prediction of the magnetic properties of Fe-X6 (X = S, C, N, O, F) doped monolayer MoS2

KAUST Repository

Feng, Nan; Mi, Wenbo; Cheng, Yingchun; Guo, Zaibing; Schwingenschlö gl, Udo; Bai, Haili

2014-01-01

Using first-principles calculations, we have investigated the electronic structure and magnetic properties of Fe-X 6 clusters (X = S, C, N, O, and F) incorporated in 4 4 monolayer MoS 2, where a Mo atom is substituted by Fe and its nearest S atoms are substituted by C, N, O, and F. Single Fe and Fe-F 6 substituions make the system display half-metallic properties, Fe-C 6 and Fe-N 6 substitutions lead to a spin gapless semiconducting behavior, and Fe-O 6 doped monolayer MoS 2 is semiconducting. Magnetic moments of 1.93, 1.45, 3.18, 2.08, and 2.21...? B are obtained for X = S, C, N, O, and F, respectively. The different electronic and magnetic characters originate from hybridization between the X and Fe/Mo atoms. Our results suggest that cluster doping can be an efficient strategy for exploring two-dimensional diluted magnetic semiconductors.
First principles prediction of the magnetic properties of Fe-X6 (X = S, C, N, O, F) doped monolayer MoS2

KAUST Repository

Feng, Nan

2014-02-05

Using first-principles calculations, we have investigated the electronic structure and magnetic properties of Fe-X 6 clusters (X = S, C, N, O, and F) incorporated in 4 4 monolayer MoS 2, where a Mo atom is substituted by Fe and its nearest S atoms are substituted by C, N, O, and F. Single Fe and Fe-F 6 substituions make the system display half-metallic properties, Fe-C 6 and Fe-N 6 substitutions lead to a spin gapless semiconducting behavior, and Fe-O 6 doped monolayer MoS 2 is semiconducting. Magnetic moments of 1.93, 1.45, 3.18, 2.08, and 2.21...? B are obtained for X = S, C, N, O, and F, respectively. The different electronic and magnetic characters originate from hybridization between the X and Fe/Mo atoms. Our results suggest that cluster doping can be an efficient strategy for exploring two-dimensional diluted magnetic semiconductors.
Temperature Effects on Tensile and Compressive Mechanical Behaviors of C-S-H Structure via Atomic Simulation

Directory of Open Access Journals (Sweden)

Hao Xin

2017-01-01

Full Text Available An atomic scale model of amorphous calcium silicate hydrate (C-S-H with Ca/Si ratio of 1.67 is constructed. Effects of temperature on mechanical properties of C-S-H structure under tensile and compressive loading in the layered direction are investigated via molecular dynamics simulations. Results from present simulations show that (1 the tensile strength and Young’s modulus of C-S-H structure significantly decrease with the increase of the temperature; (2 the water layer plays an important role in the mechanical properties of C-S-H structure; (3 the compressive strength is stronger than tensile strength, which corresponds with the characteristic of cement paste.
Effect of the hydration temperature on the microstructure of Class G cement: C-S-H composition and density

International Nuclear Information System (INIS)

Bahafid, Sara; Ghabezloo, Siavash; Duc, Myriam; Faure, Pamela; Sulem, Jean

2017-01-01

Curing temperature has a significant influence on cement paste microstructure and the properties of its principal hydrate C-S-H. In this paper, the effect of the hydration temperature in the range of 7 °C to 90 °C on the microstructure of a class G oil-well cement is studied. This is done by combining various experimental methods, including X-ray diffraction associated with the Rietveld analysis, thermo-gravimetric analysis, mercury intrusion porosimetry and porosity evaluation by drying. The experimental results show an increase of the capillary porosity and a decrease of the gel porosity by increasing the hydration temperature. This is attributed to a decrease of the C-S-H intrinsic porosity and a corresponding increase of the C-S-H density for higher curing temperatures. The experimental results are used in a simple analysis method to evaluate the density of C-S-H, as well as its C/S ratio and H/S ratio in dry and saturated conditions. The evaluated C-S-H density varies from 1.88 g/cm 3 at 7 °C to 2.10 g/cm 3 at 90 °C. The results also show a decrease of molar C/S ratio with increasing hydration temperature from 1.93 at 7 °C to 1.71 at 90 °C and of the H/S ratio from 5.1 at 7 °C to 2.66 at 90 °C.
4-{(E-[2-(4-Iodobutoxybenzylidene]amino}-1,5-dimethyl-2-phenyl-1H-pyrazol-3(2H-one

Directory of Open Access Journals (Sweden)

Hoong-Kun Fun

2010-07-01

Full Text Available The title Schiff base compound, C22H24IN3O2, adopts an E configuration about the central C=N bond. The pyrazolone ring makes a dihedral angle of 49.68 (10° with its attached phenyl ring. The phenolate plane makes dihedral angles of 16.78 (9 and 50.54 (9°, respectively, with the pyrazolone ring and the terminal phenyl ring. An intramolecular C—H...O hydrogen bond generates an S(6 ring motif. In the crystal structure, an intermolecular C—H...O hydrogen bond is also observed.
Recombinant C-terminal 311 amino acids of HapS adhesin as a vaccine candidate for nontypeable Haemophilus influenzae: A study on immunoreactivity in Balb/C mouse.

Science.gov (United States)

Tabatabaee Bafroee, Akram Sadat; Siadat, Seyed Davar; Mousavi, Seyed Fazlollah; Aghasadeghi, Mohammad Reza; Khorsand, Hashem; Nejati, Mehdi; Sadat, Seyed Mehdi; Mahdavi, Mehdi

2016-09-01

Hap, an auto-transporter protein, is an antigenically conserved adhesion protein which is present on both typeable and nontypeable Haemophilus influenzae. This protein has central role in bacterial attachment to respiratory tract epithelial cells. A 1000bp C-terminal fragment of Hap passenger domain (HapS) from nontypeable Haemophilus influenzae was cloned into a prokaryotic expression vector, pET-24a. BALB/c mice were immunized subcutaneously with purified rC-HapS. Serum IgG responses to purified rC-HapS, serum IgG subclasses were determined by ELISA and functional activity of antibodies was examined by Serum Bactericidal Assay. The output of rC-HapS was approximately 62% of the total bacterial proteins. Serum IgG responses were significantly increased in immunized group with rC-HapS mixed with Freund's adjuvant in comparison with control groups. Analysis of the serum IgG subclasses showed that the IgG1 subclass was predominant after subcutaneous immunization in BALB/c mice (IgG2a/IgG1 HapS immunized animals were strongly bactericidal against nontypeable Haemophilus influenzae. These results suggest that rC-HapS may be a potential vaccine candidate for nontypeable Haemophilus influenzae. Copyright © 2016 Elsevier Ltd. All rights reserved.
The C-Terminal O-S Acyl Shift Pathway under Acidic Condition to Propose Peptide-Thioesters

Directory of Open Access Journals (Sweden)

Bo Mi Kim

2016-11-01

Full Text Available Peptide-thioester is a pivotal intermediate for peptide ligation and N-, C-terminal cyclization. In this study, desired pathway and the side products of two C-terminal handles, hydroxyethylthiol (HET and hydroxypropylthiol (HPT are described in different conditions as well as kinetic studies. In addition, a new mechanism of C-terminal residue racemization is proposed on the basis of differentiation of products derived from the two C-terminal handles in preparing peptide thioesters through an acid-catalyzed tandem thiol switch, first by an intramolecular O-S acyl shift, and then by an intermolecular S-S exchange.
Crystal structure of 2,2′-({[2-(tritylsulfanylbenzyl]azanediyl}bis(ethane-2,1-diylbis(isoindoline-1,3-dione

Directory of Open Access Journals (Sweden)

Ulrich Flörke

2014-09-01

Full Text Available In the structure of the title compound, C46H37N3O4S, the planes of the two isoindoline units make a dihedral angle of 77.86 (3°. The dihedral angles between the benzyl plane and the isoindoline units are 79.56 (4 and 3.74 (9°. The geometry at the S atom shows a short [1.7748 (17 Å] S—Cbenzyl and a long [1.8820 (15 Å] S—Ctrityl bond and the C—S—C angle is 108.40 (7°. N—C bond lengths around the azane N atom are in the range 1.454 (2–1.463 (2 Å. he crystal packing exhibts two rather `non-classical' C—H...O hydrogen bonds that result in stacking of the molecules along the a as well as the b axis and give rise to columnar sub-structures.

Continued slide seen for C.I.S. oil production

International Nuclear Information System (INIS)

Anon.

1992-01-01

This paper reports that oil production in the Commonwealth of Independent States may dip to 7.7 million b/d next year. Robert Ebel of the Center for strategic and International Studies, Washington, D.C., made that prediction before a meeting of the National Association of Petroleum Investment Analysts. Oil and Gas Journal's latest worldwide oil production figures peg the C.I.S. volume at 8.689 million b/d last August. Ebel said a September decree will allow oil prices to move in line with the market and with costs of production. That in turn will lead to development of a deregulated domestic oil market
Measurement of the relative rate of prompt $\\chi_{c0}$, $\\chi_{c1}$ and $\\chi_{c2}$ production at $\\sqrt{s}=7$TeV

CERN Document Server

Aaij, R; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves Jr, A A; Amato, S; Amerio, S; Amhis, Y; Anderlini, L; Anderson, J; Andreassen, R; Andrews, J E; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Baalouch, M; Bachmann, S; Back, J J; Baesso, C; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bauer, Th; Bay, A; Beddow, J; Bedeschi, F; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Bencivenni, G; Benson, S; Benton, J; Berezhnoy, A; Bernet, R; Bettler, M -O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blouw, J; Blusk, S; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bowen, E; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Burducea, I; Bursche, A; Busetto, G; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Campora Perez, D; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carranza-Mejia, H; Carson, L; Carvalho Akiba, K; Casse, G; Castillo Garcia, L; Cattaneo, M; Cauet, Ch; Cenci, R; Charles, M; Charpentier, Ph; Chen, P; Chiapolini, N; Chrzaszcz, M; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Cogneras, E; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Coquereau, S; Corti, G; Couturier, B; Cowan, G A; Craik, D C; Cunliffe, S; Currie, R; D'Ambrosio, C; David, P; David, P N Y; Davis, A; De Bonis, I; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Silva, W; De Simone, P; Decamp, D; Deckenhoff, M; Del Buono, L; Déléage, N; Derkach, D; Deschamps, O; Dettori, F; Di Canto, A; Dijkstra, H; Dogaru, M; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Durante, P; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisenhardt, S; Eitschberger, U; Ekelhof, R; Eklund, L; El Rifai, I; Elsasser, Ch; Falabella, A; Färber, C; Fardell, G; Farinelli, C; Farry, S; Fave, V; Ferguson, D; Fernandez Albor, V; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fiore, M; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furcas, S; Furfaro, E; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garofoli, J; Garosi, P; Garra Tico, J; Garrido, L; Gaspar, C; Gauld, R; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Giubega, L; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gordon, H; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Griffith, P; Grünberg, O; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hall, S; Hamilton, B; Hampson, T; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; Hartmann, T; He, J; Head, T; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hicheur, A; Hicks, E; Hill, D; Hoballah, M; Hombach, C; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Hussain, N; Hutchcroft, D; Hynds, D; Iakovenko, V; Idzik, M; Ilten, P; Jacobsson, R; Jaeger, A; Jans, E; Jaton, P; Jawahery, A; Jing, F; John, M; Johnson, D; Jones, C R; Joram, C; Jost, B; Kaballo, M; Kandybei, S; Kanso, W; Karacson, M; Karbach, T M; Kenyon, I R; Ketel, T; Keune, A; Khanji, B; Kochebina, O; Komarov, I; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kucharczyk, M; Kudryavtsev, V; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J -P; Lefèvre, R; Leflat, A; Lefrançois, J; Leo, S; Leroy, O; Lesiak, T; Leverington, B; Li, Y; Li Gioi, L; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; Lohn, S; Longstaff, I; Lopes, J H; Lopez-March, N; Lu, H; Lucchesi, D; Luisier, J; Luo, H; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Malde, S; Manca, G; Mancinelli, G; Maratas, J; Marconi, U; Märki, R; Marks, J; Martellotti, G; Martens, A; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Martins Tostes, D; Massafferri, A; Matev, R; Mathe, Z; Matteuzzi, C; Maurice, E; Mazurov, A; Mc Skelly, B; McCarthy, J; McNab, A; McNulty, R; Meadows, B; Meier, F; Meissner, M; Merk, M; Milanes, D A; Minard, M -N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mordà, A; Morello, M J; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neubert, S; Neufeld, N; Nguyen, A D; Nguyen, T D; Nguyen-Mau, C; Nicol, M; Niess, V; Niet, R; Nikitin, N; Nikodem, T; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Oyanguren, A; Pal, B K; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pessina, G; Petridis, K; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pietrzyk, B; Pilař, T; Pinci, D; Playfer, S; Plo Casasus, M; Polci, F; Polok, G; Poluektov, A; Polycarpo, E; Popov, A; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pritchard, A; Prouve, C; Pugatch, V; Puig Navarro, A; Punzi, G; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Rauschmayr, N; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, A; Rinnert, K; Rives Molina, V; Roa Romero, D A; Robbe, P; Roberts, D A; Rodrigues, E; Rodriguez Perez, P; Roiser, S; Romanovsky, V; Romero Vidal, A; Rouvinet, J; Ruf, T; Ruffini, F; Ruiz, H; Ruiz Valls, P; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salustino Guimaraes, V; Salzmann, C; Sanmartin Sedes, B; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schindler, H; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M -H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Sirendi, M; Skwarnicki, T; Smith, N A; Smith, E; Smith, J; Smith, M; Sokoloff, M D; Soler, F J P; Soomro, F; Souza, D; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stevenson, S; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Sun, L; Swientek, S; Syropoulos, V; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teklishyn, M; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Tonelli, D; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tresch, M; Tsaregorodtsev, A; Tsopelas, P; Tuning, N; Ubeda Garcia, M; Ukleja, A; Urner, D; Ustyuzhanin, A; Uwer, U; Vagnoni, V; Valenti, G; Vallier, A; Van Dijk, M; Vazquez Gomez, R; Vazquez Regueiro, P; Vázquez Sierra, C; Vecchi, S; Velthuis, J J; Veltri, M; Veneziano, G; Vesterinen, M; Viaud, B; Vieira, D; Vilasis-Cardona, X; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voß, C; Voss, H; Waldi, R; Wallace, C; Wallace, R; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wicht, J; Wiechczynski, J; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wimberley, J; Wishahi, J; Witek, M; Wotton, S A; Wright, S; Wu, S; Wyllie, K; Xie, Y; Xing, Z; Yang, Z; Young, R; Yuan, X; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhokhov, A; Zhong, L; Zvyagin, A

2013-01-01

Prompt production of charmonium $\\chi_{c0}$, $\\chi_{c1}$ and $\\chi_{c2}$ mesons is studied using proton-proton collisions at the LHC at a centre-of-mass energy of $\\sqrt{s}=7$TeV. The $\\chi_{c}$ mesons are identified through their decay to $J/\\psi\\gamma$, with $J/\\psi\\rightarrow\\mu^+mu^-$ using photons that converted in the detector. A data sample, corresponding to an integrated luminosity of $1.0\\mathrm{fb}^{-1}$ collected by the LHCb detector, is used to measure the relative prompt production rate of $\\chi_{c1}$ and $\\chi_{c2}$ in the rapidity range $2.0c$. First evidence for $\\chi_{c0}$ meson production at a hadron collider is also presented.
PONDEROSA-C/S: client–server based software package for automated protein 3D structure determination

OpenAIRE

Lee, Woonghee; Stark, Jaime L.; Markley, John L.

2014-01-01

Peak-picking Of Noe Data Enabled by Restriction Of Shift Assignments-Client Server (PONDEROSA-C/S) builds on the original PONDEROSA software (Lee et al. in Bioinformatics 27:1727–1728. doi:10.1093/bioinformatics/btr200, 2011) and includes improved features for structure calculation and refinement. PONDEROSA-C/S consists of three programs: Ponderosa Server, Ponderosa Client, and Ponderosa Analyzer. PONDEROSA-C/S takes as input the protein sequence, a list of assigned chemical shifts, and nucle...
The C-terminal random coil region tunes the Ca²⁺-binding affinity of S100A4 through conformational activation.

Directory of Open Access Journals (Sweden)

Annette Duelli

Full Text Available S100A4 interacts with many binding partners upon Ca2+ activation and is strongly associated with increased metastasis formation. In order to understand the role of the C-terminal random coil for the protein function we examined how small angle X-ray scattering of the wild-type S100A4 and its C-terminal deletion mutant (residues 1-88, Δ13 changes upon Ca2+ binding. We found that the scattering intensity of wild-type S100A4 changes substantially in the 0.15-0.25 Å-1 q-range whereas a similar change is not visible in the C-terminus deleted mutant. Ensemble optimization SAXS modeling indicates that the entire C-terminus is extended when Ca2+ is bound. Pulsed field gradient NMR measurements provide further support as the hydrodynamic radius in the wild-type protein increases upon Ca2+ binding while the radius of Δ13 mutant does not change. Molecular dynamics simulations provide a rational explanation of the structural transition: the positively charged C-terminal residues associate with the negatively charged residues of the Ca2+-free EF-hands and these interactions loosen up considerably upon Ca2+-binding. As a consequence the Δ13 mutant has increased Ca2+ affinity and is constantly loaded at Ca2+ concentration ranges typically present in cells. The activation of the entire C-terminal random coil may play a role in mediating interaction with selected partner proteins of S100A4.
Anti-thrombin III, Protein C, and Protein S deficiency in acute coronary syndrome

Directory of Open Access Journals (Sweden)

Dasnan Ismail

2002-06-01

Full Text Available The final most common pathway for the majority of coronary artery disease is occlusion of a coronary vessel. Under normal conditions, antithrombin III (AT III, protein C, and protein S as an active protein C cofactor, are natural anticoagulants (hemostatic control that balances procoagulant activity (thrombin antithrombin complex balance to prevent thrombosis. If the condition becomes unbalanced, natural anticoagulants and the procoagulants can lead to thrombosis. Thirty subjects with acute coronary syndrome (ACS were studied for the incidence of antithrombin III (AT III, protein C, and protein S deficiencies, and the result were compare to the control group. Among patients with ACS, the frequency of distribution of AT-III with activity < 75% were 23,3% (7 of 30, and only 6,7% ( 2 of 30 in control subject. No one of the 30 control subject have protein C activity deficient, in ACS with activity < 70% were 13,3% (4 of 30. Fifteen out of the 30 (50% control subjects had protein S activity deficiency, while protein S deficiency activity < 70% was found 73.3.% (22 out of 30. On linear regression, the deterministic coefficient of AT-III activity deficiency to the development ACS was 13,25 %, and the deterministic coefficient of protein C activity deficient to the development of ACS was 9,06 %. The cut-off point for AT-III without protein S deficiency expected to contribute to the development of vessel disease was 45%. On discriminant analysis, protein C activity deficiency posed a risk for ACS of 4,5 greater than non deficient subjects, and AT-III activity deficiency posed a risk for ACS of 3,5 times greater than non deficient subjects. On binary logistic regression, protein S activity acted only as a reinforcing factor of AT-III activity deficiency in the development of ACS. Protein C and AT III deficiency can trigger ACS, with determinant coefficients of 9,06% and 13,25% respectively. Low levels of protein C posed a greater risk of
Décès - French version only

CERN Multimedia

2006-01-01

Nous avons le regret d'annoncer le décès de Monsieur Patrice PIERRE survenu le 26.12.2005. Monsieur Patrice PIERRE, né le 10.04.1952, travaillait au Département AB et était au CERN depuis le 01.12.1978. Le Directeur général a envoyé un message de condoléances à sa famille de la part du personnel du CERN. Affaires SocialesDépartement des Ressources Humaines. Patrice PIERRE nous a subitement quittés dans la nuit du 25 au 26 décembre 2005. Patrice, une personne discrète et calme, était très apprécié par tous ses collègues autant pour ses compétences techniques que pour sa personnalité. Il était toujours aimable, disponible, prêt à partager son expérience et savait maintenir un excellent contact avec ses collaborateurs. Patrice est arrivé au CERN comme dessinateur le 1er décembre 1978 dans le groupe responsable pour les Zones expérimentales Nord et Ouest. Il travaillait depuis lors sur les faisceaux secondaires du SPS, où il était impliqué dans les études des équipements mécan...
Scinticisternography and scintiventriculography. A study of C.S.F. dynamics

NARCIS (Netherlands)

Front, Dov

1971-01-01

The problem of C.S.F. flow and absorption has attracted many different disciplines in medicine. The normal physiology and the pathology, which declares itself mainly by hydrocephalus, have been intensively studied by neurophysiologists, neurologists and neurosurgeons. The possibility of treating
Assembly and Regulation of the Membrane Attack Complex Based on Structures of C5b6 and sC5b9

Directory of Open Access Journals (Sweden)

Michael A. Hadders

2012-03-01

Full Text Available Activation of the complement system results in formation of membrane attack complexes (MACs, pores that disrupt lipid bilayers and lyse bacteria and other pathogens. Here, we present the crystal structure of the first assembly intermediate, C5b6, together with a cryo-electron microscopy reconstruction of a soluble, regulated form of the pore, sC5b9. Cleavage of C5 to C5b results in marked conformational changes, distinct from those observed in the homologous C3-to-C3b transition. C6 captures this conformation, which is preserved in the larger sC5b9 assembly. Together with antibody labeling, these structures reveal that complement components associate through sideways alignment of the central MAC-perforin (MACPF domains, resulting in a C5b6-C7-C8β-C8α-C9 arc. Soluble regulatory proteins below the arc indicate a potential dual mechanism in protection from pore formation. These results provide a structural framework for understanding MAC pore formation and regulation, processes important for fighting infections and preventing complement-mediated tissue damage.
Electronic structure of C r2AlC as observed by angle-resolved photoemission spectroscopy

Science.gov (United States)

Ito, Takahiro; Pinek, Damir; Fujita, Taishi; Nakatake, Masashi; Ideta, Shin-ichiro; Tanaka, Kiyohisa; Ouisse, Thierry

2017-11-01

We investigate the electronic band structure and Fermi surfaces (FSs) of C r2AlC single crystals with angle-resolved photoemission spectroscopy. We evidence hole bands centered around the M points and electron bands centered around the Γ point in reciprocal space. Electron and hole bands exhibit an open, tubular structure along the c axis, confirming the quasi-two-dimensional character of this highly anisotropic, nanolamellar compound. Dependence of the photoionization cross sections on beam light polarization and orientation allows us to assess the orbital character of each observed band locally. Despite some differences, density functional theory calculations show a good agreement with experiment.
Planeamiento estratégico de la empresa ABR Lagos S.A.C.

OpenAIRE

Zuloeta Lagos, Bujarin Jaime

2016-01-01

La presente investigación tiene por finalidad desarrollar un Plan Estratégico para la empresa ABR Lagos S.A.C. para el periodo 2016-2020, con lo cual se busca consolidar su permanencia en el mercado peruano, incrementar su rentabilidad y mejorar la calidad del servicio. ABR Lagos S.A.C. es una empresa especializada en la fabricación e instalación de estructuras metálicas, la cual con casi siete años en el mercado ha mostrado un significativo crecimiento en las ventas. Para el logro del objeti...
Frequency of the hemochromatosis HFE mutations C282Y, H63D, and S65C in blood donors in the Faroe Islands

DEFF Research Database (Denmark)

Milman, Nils; á Steig, Torkil; Koefoed, Pernille

2004-01-01

on the HFE gene was assessed by genotyping using the polymerase chain reaction (PCR) technique and calculated from direct allele counting. We found no C282Y homozygous subjects; 28 (14.0%) subjects were C282Y heterozygous and four subjects were C282Y/H63D compound heterozygous (2.0%). The C282Y allele......The aim of the study was to assess the frequencies of the hereditary hemochromatosis HFE mutations C282Y, H63D, and S65C in the population in the Faroe Islands. The series comprised 200 randomly selected blood donors of Faroese heritage. The frequency of the C282Y, H63D, and S65C mutations.......6%. Screening of larger groups of the Faroese population for HFE mutations especially C282Y should be considered in order to establish the penetrance....
Registration of Images with N-fold Dihedral Blur

Czech Academy of Sciences Publication Activity Database

Pedone, M.; Flusser, Jan; Heikkila, J.

2015-01-01

Roč. 24, č. 3 (2015), s. 1036-1045 ISSN 1057-7149 R&D Projects: GA ČR GA13-29225S; GA ČR GA15-16928S Institutional support: RVO:67985556 Keywords : Image registration * blurred images * N-fold rotational symmetry * dihedral symmetry * phase correlation Subject RIV: JD - Computer Applications, Robotics Impact factor: 3.735, year: 2015 http://library.utia.cas.cz/separaty/2015/ZOI/flusser-0441247.pdf
The c equivalence principle and the correct form of writing Maxwell's equations

Energy Technology Data Exchange (ETDEWEB)

Heras, Jose A, E-mail: herasgomez@gmail.co [Universidad Autonoma Metropolitana Unidad Azcapotzalco, Av. San Pablo No. 180, Col. Reynosa, 02200, Mexico DF (Mexico)

2010-09-15

It is well known that the speed c{sub u}=1/{radical}({epsilon}{sub 0{mu}0}) is obtained in the process of defining SI units via action-at-a-distance forces, like the force between two static charges and the force between two long and parallel currents. The speed c{sub u} is then physically different from the observed speed of propagation c associated with electromagnetic waves in vacuum. However, repeated experiments have led to the numerical equality c{sub u} = c, which we have called the c equivalence principle. In this paper we point out that {nabla}xE=-[1/({epsilon}{sub 0}{mu}{sub 0}c{sup 2})]{partial_derivative}B/{partial_derivative}t is the correct form of writing Faraday's law when the c equivalence principle is not assumed. We also discuss the covariant form of Maxwell's equations without assuming the c equivalence principle.
Controlled soft-template synthesis of ultrathin C@FeS nanosheets with high-Li-storage performance.

Science.gov (United States)

Xu, Chen; Zeng, Yi; Rui, Xianhong; Xiao, Ni; Zhu, Jixin; Zhang, Wenyu; Chen, Jing; Liu, Weiling; Tan, Huiteng; Hng, Huey Hoon; Yan, Qingyu

2012-06-26

We report a facile approach to prepare carbon-coated troilite FeS (C@FeS) nanosheets via surfactant-assisted solution-based synthesis. 1-Dodecanethiol is used as both the sulfur source and the surfactant, which may form different-shaped micelles to direct the growth of nanostructures. Under appropriate growth conditions, the iron and sulfur atoms react to form thin layers of FeS while the hydrocarbon tails of 1-dodecanethiol separate the thin FeS layers, which turn to carbon after annealing in Ar. Such an approach can be extended to grow C@FeS nanospheres and nanoplates by modifying the synthesis parameters. The C@FeS nanosheets display excellent Li storage properties with high specific capacities and stable charge/discharge cyclability, especially at fast charge/discharge rates.
Crystal structures of bis[(9S,13S,14S-3-methoxy-17-methylmorphinanium] tetrachloridocobaltate and tetrachloridocuprate

Directory of Open Access Journals (Sweden)

Eric Gauchat

2017-01-01

Full Text Available (9S,13S,14S-3-Methoxy-17-methylmorphinan (dextromethorphan forms two isostructural salts with (a tetrachloridocobaltate, namely bis[(9S,13S,14S-3-methoxy-17-methylmorphinanium] tetrachloridocobaltate, (C18H26NO2[CoCl4], and (b tetrachloridocuprate, namely bis[(9S,13S,14S-3-methoxy-17-methylmorphinanium] tetrachloridocuprate, (C18H26NO2[CuCl4]. The distorted tetrahedral anions are located on twofold rotational axes. The dextromethorphan cation can be described as being composed of two ring systems, a tetrahydronaphthalene system A+B and a decahydroisoquinolinium subunit C+D, that are nearly perpendicular to one another: the angle between mean planes of the A+B and C+D moieties is 78.8 (1° for (a and 79.0 (1° for (b. Two symmetry-related cations of protonated dextromethorphan are connected to the tetrachloridocobaltate (or tetrachloridocuprate anions via strong N—H...Cl hydrogen bonds, forming neutral ion associates. These associates are packed in the (001 plane with no strong attractive bonding between them. Both compounds are attractive crystalline forms for unambiguous identification of the dextromethorphan and, presumably, of its optical isomer, levomethorphan.
Crystal structure of 2-methylamino-4-(6-methyl-4-oxo-4H-chromen-3-yl-3-nitropyrano[3,2-c]chromen-5(4H-one with an unknown solvate

Directory of Open Access Journals (Sweden)

Rajamani Raja

2015-09-01

Full Text Available In the title compound, C23H16N2O7, the mean planes of the two chromene units (r.m.s. deviations = 0.031 and 0.064 Å are almost normal to one another with a dihedral angle of 85.59 (6°. The central six-membered pyran ring has a distorted envelope conformation, with the methine C atom at the flap. There is an intramolecular N—H...O hydrogen bond, which generates an S(6 ring motif. In the crystal, molecules are linked by pairs of N—H...O hydrogen bonds, forming inversion dimers with an R22(12 ring motif. The dimers are linked by pairs of C—H...O hydrogen bonds, enclosing R22(6 ring motifs, forming zigzag chains along [001]. The chains are linked by a second pair of C—H...O hydrogen bonds, forming slabs parallel to (110. Within the slabs there are C—H...π interactions present. A region of disordered electron density was treated with the SQUEEZE procedure in PLATON [Spek (2015. Acta Cryst. C71, 9–18] following unsuccessful attempts to model it as plausible solvent molecule(s. The given chemical formula and other crystal data do not take into account the unknown solvent molecule(s.
Synthesis and evaluation of (S)-4-(3-(2'-[C-11]isopropylamino)-2-hydroxy-propoxy)-2H-benzimidazol-2-one ((S)-[C-11]CGP 12388) and (S)-4-(3-((1'-[F-18]-fluoroisopropyl)amino)-2-hydroxypropoxy)-2H-benzimidazol-2-one ((S)-[F-18]Fluoro-CGP 12388) for visualization of beta-adrenoceptors with positron emission tomography

NARCIS (Netherlands)

Elsinga, PH; vanWaarde, A; Jaeggi, KA; Schreiber, G; Heldoorn, M; Vaalburg, W

1997-01-01

The beta-adrenoceptor antagonist (S)-[C-11]CGP 12177 (4-(3-(tert-butylamino)-2-hydroxypropoxy)- 2H-benzimidazol-2[C-11]-one) is a generally accepted radioligand for cardiac and pulmonary PET studies. The synthesis of [C-11]CGP 12177 is a laborious and often troublesome procedure. Therefore, (S)-C GP
The system Cu-Rh-S at 900 degrees, 700 degrees, 540 degrees and 500 degrees C

DEFF Research Database (Denmark)

Karup-Møller, Sven; Makovicky, E.

2007-01-01

Phase relations in the dry condensed system Cu-Rh-S were determined at 900, 700, 540 and 500 degrees C. At 900 degrees C, the system contains digenite, four rhodium sulfides (Rh17S15, Rh3S4, Rh2S3 and RhS similar to 3), three ternary sulfides (CuRh2S4, CuxRhS3+x and a fibrous sulfide in the range...
Down-regulation of S100C is associated with bladder cancer progression and poor survival

DEFF Research Database (Denmark)

Memon, Ashfaque Ahmed; Sorensen, Boe Sandahl; Meldgaard, Peter

2005-01-01

cancer biopsy samples obtained from 88 patients followed for a median of 23 months (range, 1-97 months). RESULTS: We found a significantly lower mRNA expression of S100C in connective tissue invasive tumors (T1, P = 0.0030) and muscle invasive tumors [(T2-T4), P ...PURPOSE: The goal of this study was to identify proteins down-regulated during bladder cancer progression. EXPERIMENTAL DESIGN: By using comparative proteome analysis and measurement of mRNA, we found a significant down-regulation of S100C, a member of the S100 family of proteins, in T24 (grade 3......) as compared with RT4 (grade 1) bladder cancer cell lines. Moreover, quantification of the mRNA level revealed that decreased expression of the protein reflects a low level of transcription of the S100C gene. Based on this observation, we quantified the S100C mRNA expression level with real-time PCR in bladder...
The system Fe-Os-S at 1180°, 1100°and 900°C

DEFF Research Database (Denmark)

Karup-Møller, Sven; Makovicky, E.

2002-01-01

Phase relations in the condensed system Fe-Os-S were investigated by means of dry syntheses from the elements at 1180degrees, 1100degrees and 900degreesC. The Fe-rich sulfide melt dissolves only traces of Os. Fe1-xS dissolves up to 0.7 at.% Os at 1180degreesC; Os solubility decreases to 0.3 at...... partition coefficients for Os. The three-phase association alloy-FeS1-xS-OsS2 involves alloys with less than 1 at.% Fe. The solubility of Fe in OsS2 increases with decreasing temperature and increasing fugacity of sulfur, possibly making analyses of erlichmanite for trace quantities of Fe important....

The crystal structure of 2-[5-(dimethylaminonaphthalene-1-sulfonamido]phenyl 5-(dimethylaminonaphthalene-1-sulfonate

Directory of Open Access Journals (Sweden)

Kittipong Chainok

2015-10-01

Full Text Available The complete molecule of the title compound, C30H29N3O5S2, is generated by a crystallographic twofold axis: the O atom and NH group attached to the central benzene ring are statistically disordered. The dihedral angle between the naphthalene ring system and the central benzene ring is 52.99 (6°, while the pendant naphthalene ring systems subtend a dihedral angle of 68.17 (4°. An intramolecular C—H...O hydrogen bond closes an S(6 ring. In the crystal, the molecules are linked by weak C—H...O hydrogen bonds.
Measurements of the $C\\!P$-violating phase $\\phi_{s}$ at LHCb

CERN Document Server

Batozskaya, Varvara

2018-01-01

The measurement of the mixing-induced $C\\!P$-violating phase $\\phi_{s}$ in the $B^{0}_{s}-\\bar{B}^{0}_{s}$ system is one of the key goals of the LHCb experiment. It has been measured at the LHCb collaboration exploiting the Run~I data set and using several decay channels. In particular, the most recent Run~I result has been obtained analyzing $B^{0}_{s}\\to J/\\psi K^{+}K^{-}$ candidates in the mass region above the $\\phi(1020)$ resonance. Despite the large improvements in the sensitivity of $\\phi_{s}$ during the last decade, the precision is still limited by the available statistics.
Recherche sur les sous-declarations de décés, Saint Marc, Haiti, 2012

Directory of Open Access Journals (Sweden)

Stela Nazareth Meneghel

2014-11-01

Full Text Available Ce travail se réfère à une étude exploratoire menée dans la ville de Saint Marc, une commune d'environ 257,863 habitants en 2012, localisée dans le département d'Artibonite/Haïti. L'objectif est rechercher le flux d'informations concernant le système de mortalité et l'existence de non-déclarations de décès. Les décès survenus dans le mois de janvier 2013 ont fait l'objet d'une enquête dans cinq institutions de la ville de Saint Marc: l'Hôpital Saint Nicolas (HSN, la Mairie, le Bureau d'État Civil (BEC, le Cimetière et la Cathédrale. L'hôpital a été l'institution où l'on a rencontré le plus grand nombre de décès enregistrés. On a procédé au comptage des décès, à partir de la liste nominale des registres hospitaliers, en ajoutant les décè...
A thermodynamic model for C-(N-)A-S-H gel: CNASHss. Derivation and validation

International Nuclear Information System (INIS)

Myers, Rupert J.; Bernal, Susan A.; Provis, John L.

2014-01-01

The main reaction product in Ca-rich alkali-activated cements and hybrid Portland cement (PC)-based materials is a calcium (alkali) aluminosilicate hydrate (C-(N-)A-S-H) gel. Thermodynamic models without explicit definitions of structurally-incorporated Al species have been used in numerous past studies to describe this gel, but offer limited ability to simulate the chemistry of blended PC materials and alkali-activated cements. Here, a thermodynamic model for C-(N-)A-S-H gel is derived and parameterised to describe solubility data for the CaO–(Na 2 O,Al 2 O 3 )–SiO 2 –H 2 O systems and alkali-activated slag (AAS) cements, and chemical composition data for C-A-S-H gels. Simulated C-(N-)A-S-H gel densities and molar volumes are consistent with the corresponding values reported for AAS cements, meaning that the model can be used to describe chemical shrinkage in these materials. Therefore, this model can provide insight into the chemistry of AAS cements at advanced ages, which is important for understanding the long-term durability of these materials
Reduced HRAS G12V-Driven Tumorigenesis of Cell Lines Expressing KRAS C118S.

Directory of Open Access Journals (Sweden)

Lu Huang

Full Text Available In many different human cancers, one of the HRAS, NRAS, or KRAS genes in the RAS family of small GTPases acquires an oncogenic mutation that renders the encoded protein constitutively GTP-bound and thereby active, which is well established to promote tumorigenesis. In addition to oncogenic mutations, accumulating evidence suggests that the wild-type isoforms may also be activated and contribute to oncogenic RAS-driven tumorigenesis. In this regard, redox-dependent reactions with cysteine 118 (C118 have been found to promote activation of wild-type HRAS and NRAS. We sought to determine if this residue is also important for the activation of wild-type KRAS and promotion of tumorigenesis. Thus, we mutated C118 to serine (C118S in wild-type KRAS to block redox-dependent reactions at this site. We now report that this mutation reduced the level of GTP-bound KRAS and impaired RAS signaling stimulated by the growth factor EGF. With regards to tumorigenesis, we also report that oncogenic HRAS-transformed human cells in which endogenous KRAS was knocked down and replaced with KRASC118S exhibited reduced xenograft tumor growth, as did oncogenic HRAS-transformed KrasC118S/C118S murine cells in which the C118S mutation was knocked into the endogenous Kras gene. Taken together, these data suggest a role for redox-dependent activation of wild-type KRAS through C118 in oncogenic HRAS-driven tumorigenesis.
Chemical grafting of Co9S8 onto C60 for hydrogen spillover and storage.

Science.gov (United States)

Han, Lu; Qin, Wei; Zhou, Jia; Jian, Jiahuang; Lu, Songtao; Wu, Xiaohong; Fan, Guohua; Gao, Peng; Liu, Boyu

2017-04-20

Metal modified C 60 is considered to be a potential hydrogen storage medium due to its high theoretical capacity. Research interest is growing in various hybrid inorganic compounds-C 60 . While the design and synthesis of a novel hybrid inorganic compound-C 60 is difficult to attain, it has been theorized that the atomic hydrogen could transfer from the inorganic compound to the adjacent C 60 surfaces via spillover and surface diffusion. Here, as a proof of concept experiment, we graft Co 9 S 8 onto C 60 via a facile high energy ball milling process. The Raman, XPS, XRD, TEM, HTEM and EELS measurements have been conducted to evaluate the composition and structure of the pizza-like hybrid material. In addition, the electrochemical measurements and calculated results demonstrate that the chemical "bridges" (C-S bonds) between these two materials enhance the binding strength and, hence, facilitate the hydriding reaction of C 60 during the hydrogen storage process. As a result, an increased hydrogen storage capacity of 4.03 wt% is achieved, along with a favorable cycling stability of ∼80% after 50 cycles. Excluding the direct hydrogen storage contribution from Co 9 S 8 in the hybrid paper, the hydrogen storage ability of C 60 was enhanced by 5.9× through the hydriding reaction caused by the Co 9 S 8 modifier. Based on these experimental measurements and theoretical calculations, the unique chemical structure reported here could potentially inspire other C 60 -based advanced hybrids.
17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

Science.gov (United States)

2010-04-01

... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Form U5S, for annual reports filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed under...
Exploring hierarchical FeS2/C composite nanotubes arrays as advanced cathode for lithium ion batteries

Science.gov (United States)

Pan, G. X.; Cao, F.; Xia, X. H.; Zhang, Y. J.

2016-11-01

Rational construction of advanced FeS2 cathode is one of research hotspots, and of great importance for developing high-performance lithium ion batteries (LIBs). Herein we report a facile hydrolysis-sulfurization method for fabrication of FeS2/C nanotubes arrays with the help of sacrificial Co2(OH)2CO3 nanowires template and glucose carbonization. Self-supported FeS2/C nanotubes consist of interconnected nanoburrs of 5-20 nm, and show hierarchical porous structure. The FeS2/C nanotubes arrays are demonstrated with enhanced cycling life and noticeable high-rate capability with capacities ranging from 735 mAh g-1 at 0.25 C to 482 mAh g-1 at 1.5 C, superior to those FeS2 counterparts in the literature. The composite nanotubes arrays architecture plays positive roles in the electrochemical enhancement due to combined advantages of large electrode-electrolyte contact area, good strain accommodation, improved electrical conductivity, and enhanced structural stability.
Estudo das mutações C282Y, H63D e S65C do gene HFE em doentes brasileiros com sobrecarga de ferro Study of C282Y, H63D and S65C mutations in the HFE gene in Brazilian patients with iron overload

Directory of Open Access Journals (Sweden)

Rodolfo D. Cançado

2007-12-01

Full Text Available Hemocromatose é uma das doenças genéticas mais freqüentes no ser humano e uma das causas mais importantes de sobrecarga de ferro. Os objetivos deste estudo foram determinar a freqüência das mutações C282Y, H63D e S65C do gene HFE em doentes brasileiros com sobrecarga de ferro, verificar a coexistência de anemia hemolítica hereditária, hepatite C e consumo excessivo de bebida alcoólica nestes doentes e avaliar a influência destas variáveis sobre os depósitos de ferro do organismo. Saturação da transferrina, ferritina sérica e análise das mutações C282Y, H63D e S65C do gene HFE, pelo método da PCR, foram determinadas em cinqüenta doentes com sobrecarga de ferro atendidos no Hemocentro da Santa Casa de São Paulo entre janeiro de 2000 e maio de 2004. A freqüência de mutação do gene HFE nos doentes com sobrecarga de ferro foi de 76,0% (38/50. Saturação da transferrina e ferritina foram significativamente maiores nos doentes homozigotos para a mutação C282Y confirmando a correlação entre genótipo C282Y/C282Y e maior risco de sobrecarga de ferro. A coexistência de hepatite C, consumo excessivo de bebida alcoólica ou anemia hemolítica hereditária estão implicados em aumento dos estoques de ferro e constituem fator de risco adicional em pacientes com mutação do gene HFE para a condição de sobrecarga de ferro.Hemochromatosis is one of the most frequent genetic diseases in humans and one of the most important causes of iron overload. The aims of this study were to determine the frequency of C282Y, H63D and S65C mutations of the HFE gene in Brazilian patients with iron overload, to verify the coexistence of chronic hemolytic anemia, hepatitis C and excessive alcohol consumption and to evaluate the influence of these variables on body iron deposits. Transferrin saturation, serum ferritin and C282Y, H63D and S65C HFE gene mutations (by PCR method were determined in 50 patients with iron overload in the Hemocentro da
Activation of the Hg-C Bond of Methylmercury by [S2]-Donor Ligands.

Science.gov (United States)

Karri, Ramesh; Banerjee, Mainak; Chalana, Ashish; Jha, Kunal Kumar; Roy, Gouriprasanna

2017-10-16

Here we report that [S 2 ]-donor ligands Bmm OH , Bmm Me , and Bme Me bind rapidly and reversibly to the mercury centers of organomercurials, RHgX, and facilitate the cleavage of Hg-C bonds of RHgX to produce stable tetracoordinated Hg(II) complexes and R 2 Hg. Significantly, the rate of cleavage of Hg-C bonds depends critically on the X group of RHgX (X = BF 4 - , Cl - , I - ) and the [S 2 ]-donor ligands used to induce the Hg-C bonds. For instance, the initial rate of cleavage of the Hg-C bond of MeHgI induced by Bme Me is almost 2-fold higher than the initial rate obtained by Bmm OH or Bmm Me , indicating that the spacer between the two imidazole rings of [S 2 ]-donor ligands plays a significant role here in the cleavage of Hg-C bonds. Surprisingly, we noticed that the initial rate of cleavage of the Hg-C bond of MeHgI induced by Bme Me (or Bmm Me ) is almost 10-fold and 100-fold faster than the cleavage of Hg-C bonds of MeHgCl and [MeHg]BF 4 respectively, under identical reaction conditions, suggesting that the Hg-C bond of [MeHg]BF 4 is highly inert at room temperature (21 °C). We also show here that the nature of the final stable cleaved products, i.e. Hg(II) complexes, depends on the X group of RHgX and the [S 2 ]-donor ligands. For instance, the reaction of Bmm Me with MeHgCl (1:1 molar ratio) afforded the formation of the 16-membered metallacyclic dinuclear mercury compound (Bmm Me ) 2 Hg 2 Cl 4 , in which the two Cl atoms are located inside the ring, whereas due to the large size of the I atom, a similar reaction with MeHgI yielded polymeric [(Bmm Me ) 2 HgI 2 ] m ·(MeHgI) n . However, the treatment of Bmm Me with ionic [RHg]BF 4 led to the formation of the tetrathione-coordinated mononuclear mercury compound [(Bmm Me ) 2 Hg](BF 4 ) 2 , where BF 4 - serves as a counteranion.
Ionic fragmentation of a natural product, limonene (C10H16), following core [C 1s] photoionization

International Nuclear Information System (INIS)

Castilho, R.B. de; Nunez, C.V.; Coutinho, L.H.; Lago, A.F.; Bernini, R.B.; Souza, G.G.B. de

2007-01-01

Photoionization of the limonene [C 10 H 16 ] molecule was studied for the first time following C 1s ionization, using synchrotron radiation and time-of-fight mass spectrometry. As a reference for further analysis of the photon induced fragmentation of the limonene molecule, the He(I) mass spectrum was also obtained. Previously unreported singly charged species have been observed at 310 eV: H + , C + , CH + , CH 2 + , CH 3 + . A close similarity has been observed between the high photon energy mass spectrum and the standard electron impact mass spectrum of limonene, obtained at 70 eV. In particular, the base peak [C 5 H 8 + , m/q = 68], known to result from a Retro Diels-Alder reaction, remains the same in both cases. Approximate values for the mean kinetic energy were determined for all ionic species
Pentacarbonyl-1κ2C,2κ3C-[(diphenylphosphoryldiphenylphosphane-1κP]-μ-ethane-1,2-dithiolato-1:2κ4S,S′:S,S′-diiron(I(Fe—Fe

Directory of Open Access Journals (Sweden)

Xu-Feng Liu

2011-11-01

Full Text Available The dinuclear title compound, [Fe2(C2H4S2(C24H20OP2(CO5] or (μ-SCH2CH2S-μFe2(CO5[Ph2PP(OPh2], contains a butterfly-shaped Fe2S2 core in which the Fe...Fe separation is 2.5275 (6 Å. One of the Fe atoms is also coordinated to three carbonyl ligands and the other to two carbonyl ligands and one phosphane ligand [Ph2PP(OPh2]. Both Fe-atom geometries could be described as grossly distorted octahedral and the Ph2PP(OPh2 ligand lies trans to the Fe...Fe link.
Characterization and flip angle calibration of 13C surface coils for hyperpolarization studies

DEFF Research Database (Denmark)

Hansen, Rie Beck; Gutte, Henrik; Larsen, Majbrit M E

The aim of the present work is to address the challenge of optimal The aim of the present work is to address the challenge of optimal flflip angle calibration of ip angle calibration of C surface coils in C surface coils in hyperpolarization studies. To this end, we characterize the spatial pro h...
Crystal structure of 4-fluoro-N-[2-(4-fluorobenzoyl)hydrazine-1-carbonothioyl]benzamide

Science.gov (United States)

Firdausiah, Syadza; Salleh Huddin, Ameera Aqeela; Hasbullah, Siti Aishah; Yamin, Bohari M.; Yusoff, Siti Fairus M.

2014-01-01

In the title compound, C15H11F2N3O2S, the dihedral angle between the fluorobenzene rings is 88.43 (10)° and that between the central semithiocarbazide grouping is 47.00 (11)°. The dihedral angle between the amide group and attached fluorobenzene ring is 50.52 (11)°; the equivalent angle between the carbonylthioamide group and its attached ring is 12.98 (10)°. The major twists in the molecule occur about the C—N—N—C bonds [torsion angle = −138.7 (2)°] and the Car—Car—C—N (ar = aromatic) bonds [−132.0 (2)°]. An intramolecular N—H⋯O hydrogen bond occurs, which generates an S(6) ring. In the crystal, the molecules are linked by N—H⋯O and N—H⋯S hydrogen bonds, generating (001) sheets. Weak C—H⋯O and C—H⋯F interactions are also observed. PMID:25309250
Synthesis of two S-(methyl-3H)-labelled enkephalins and S-(methyl-14C) substance P

International Nuclear Information System (INIS)

Naegren, K.; Laangstroem, B.; Franzen, H.M.; Ragnarsson, U.

1988-01-01

The synthesis of 3 H-labelled Met-enkephalin and Tyr-D-Ala-Gly-Phe-Met-NH 2 (DALA) and 14 C-labelled Substance P (SP) from previously described, fully protected intermediates is reported. The labelled peptides were prepared by methylation with ( 3 H)- or ( 14 C)methyl iodide of the sulphide anions formed on deprotection of the corresponding S-benzyl-homocysteine precursors with sodium in liquid ammonia. After purification by LC, the labelled peptides were obtained in radiochemical yields in the range of 9 to 24% with a radiochemical purity higher than 97%. The specific radioactivities of the 3 H- and 14 C- labelled products, corresponding to the labelled methyl iodides used, were 80 mCi/μmol and 60 μCi/μmol, respectively. (author)
Computational Material Modeling of Hydrated Cement Paste Calcium Silicate Hydrate (C-S-H) Chemistry Structure - Influence of Magnesium Exchange on Mechanical Stiffness: C-S-H Jennite

Science.gov (United States)

2015-04-27

MODELING OF C-S-H Material chemistry level modeling following the principles and techniques commonly grouped under Computational Material Science is...Henmi, C. and Kusachi, I. Monoclinic tobermorite from fuka, bitchu-cho, Okoyama Perfecture. Japan J. Min. Petr. Econ . Geol. (1989)84:374-379. [22...31] Liu, Y. et al. First principles study of the stability and mechanical properties of MC (M=Ti, V, Zr, Nb, Hf and Ta) compounds. Journal of Alloys and Compounds. (2014) 582:500-504. 10
C3c intrathecal synthesis evaluation in patients with multiple sclerosis Evaluación de la síntesis intratecal de C3c en pacientes con esclerosis múltiple

Directory of Open Access Journals (Sweden)

Bárbara Padilla-Docal

2007-09-01

Full Text Available INTRODUCTION: Multiple sclerosis (MS is a chronic, inflammatory and progressive disease of the central nervous system in which local inflammatory injuries of the brain white matter appears, being the most outstanding feature the myeline loss (demyelination. OBJECTIVE: To determine if the complement system might be involved in the MS immunopathogeny favouring the mechanism intervening in the myelin destruction. METHOD: Samples of sera and CSF from twelve patients with a diagnosis of MS obtained at the moment of the admission to the hospital at the beginning of the break out, were collected. Levels of C3c and albumin in sera and in CSF were quantified using radial immunodiffusion plates. RESULTS: High values over 80% of intrathecal synthesis were obtained except in one of the patients. CONCLUSION: Intrathecal synthesis of C3c and its liberation to the CSF means that the activation of the complement system in any of the two ways has taken place, and that once performed its biological functions, has suffered a degradation process.INTRODUCCIÓN: La esclerosis múltiple (EM es una enfermedad crónica, inflamatoria y progresiva del sistema nervioso central que cursa con la aparición de lesiones inflamatorias focales en la sustancia blanca cerebral, en las que lo más llamativo es la pérdida de mielina (desmielinización. OBJETIVO: Conocer si el sistema de complemento puede estar involucrado en la inmunopatogenia de la EM favoreciendo los mecanismos que median la destrucción de la mielina. MÉTODO: Se colectaron muestras de suero y LCR de doce pacientes con diagnóstico de EM obtenidas en el momento del ingreso al inicio del brote. Se cuantificaron los niveles de C3c y albúmina en suero y en LCR en placas de inmunodifusión radial. RESULTADOS: Se obtuvieron altos valores que superan el 80% de síntesis intratecal, menos en uno de los pacientes. CONCLUSION: La síntesis intratecal de C3c y su liberación al LCR significa que ha sucedido la activaci
Synthesis of 1,2,4-Triazoles via Oxidative Heterocyclization: Selective C-N Bond Over C-S Bond Formation.

Science.gov (United States)

Gogoi, Anupal; Guin, Srimanta; Rajamanickam, Suresh; Rout, Saroj Kumar; Patel, Bhisma K

2015-09-18

The higher propensity of C-N over C-S bond forming ability was demonstrated, through formal C-H functionalization during the construction of 4,5-disubstituted 1,2,4-triazole-3-thiones from arylidenearylthiosemicarbazides catalyzed by Cu(II). However, steric factors imparted by the o-disubstituted substrates tend to change the reaction path giving thiodiazole as the major or an exclusive product. Upon prolonging the reaction time, the in situ generated thiones are transformed to 4,5-disubstituted 1,2,4-triazoles via a desulfurization process. Two classes of heterocycles viz. 4,5-disubstituted 1,2,4-triazole-3-thiones and 4,5-disubstituted 1,2,4-triazoles can be synthesized from arylidenearylthiosemicarbazides by simply adjusting the reaction time. Desulfurization of 1,2,4-triazole-3-thiones is assisted by thiophilic Cu to provide 1,2,4-triazoles with concomitant formation of CuS and polynuclear sulfur anions as confirmed from scanning electron microscope and energy dispersive X-ray spectroscopy measurements. A one-pot synthesis of an antimicrobial compound has been successfully achieved following this strategy.
A fast and accurate dihedral interpolation loop subdivision scheme

Science.gov (United States)

Shi, Zhuo; An, Yalei; Wang, Zhongshuai; Yu, Ke; Zhong, Si; Lan, Rushi; Luo, Xiaonan

2018-04-01

In this paper, we propose a fast and accurate dihedral interpolation Loop subdivision scheme for subdivision surfaces based on triangular meshes. In order to solve the problem of surface shrinkage, we keep the limit condition unchanged, which is important. Extraordinary vertices are handled using modified Butterfly rules. Subdivision schemes are computationally costly as the number of faces grows exponentially at higher levels of subdivision. To address this problem, our approach is to use local surface information to adaptively refine the model. This is achieved simply by changing the threshold value of the dihedral angle parameter, i.e., the angle between the normals of a triangular face and its adjacent faces. We then demonstrate the effectiveness of the proposed method for various 3D graphic triangular meshes, and extensive experimental results show that it can match or exceed the expected results at lower computational cost.
Consciousness and C. S. Peirce’s Answer to the Riddle of the Sphinx

DEFF Research Database (Denmark)

Brier, Søren

2016-01-01

on phenomenology seems logically impossible therefore the many (unsuccessful) attempts to naturalize. C.S. Peirce’s pragmaticist semiotics attempts to bridge the gap between natural sciences and humanities by combining a phenomenological approach with an evolutionary and realistic understanding of nature...... and society in the development of a semiotic theory of mind and consciousness. Though a contributor to the development of modern logic and science Peirce, through inventing a semiotics that embraced phenomenology, tried to heal the split Husserl saw. Philosophy aims primarily at the kind of knowledge...... that gives unity and system to the whole body of human, social and natural basic sciences through a critical examination of the grounds of our convictions, prejudices, and beliefs. Where Husserl wanted to heal the split he observed through his pure phenomenology, Peirce integrated his semiotics with a pure...

75 FR 49016 - County of Greenville, S.C.-Acquisition Exemption-Greenville County Economic Development Corporation

Science.gov (United States)

2010-08-12

... Greenville, S.C.--Acquisition Exemption--Greenville County Economic Development Corporation The County of... verified notice of exemption under 49 CFR 1150.31 to acquire from Greenville County Economic Development... System Act, 16 U.S.C. 1247(d). See Greenville County Economic Development Corporation--Abandonment and...
N-{4-[4-(4-Fluorophenyl-1-(2-methoxyethyl-2-methylsulfanyl-1H-imidazol-5-yl]-2-pyridyl}-2-methyl-3-phenylpropionamide

Directory of Open Access Journals (Sweden)

Stefan Laufer

2009-12-01

Full Text Available In the crystal structure of the title compound, C28H29FN4O2S, the imidazole ring makes dihedral angles of 11.85 (7, 73.33 (7 and 22.83 (8° with the 4-fluorophenyl, pyridine and phenyl rings, respectively. The 4-fluorophenyl ring makes dihedral angles of 77.91 (7 and 26.93 (8° with the pyridine and phenyl rings, respectively. The phenyl and pyridine rings are nearly perpendicular, making a dihedral angle of 86.47 (9°. The crystal packing shows an intermolecular N—H...O hydrogen-bonding interaction between the N—H and carbonyl groups of the amide functions.
Incorporation of zinc into calcium silicate hydrates, Part I: formation of C-S-H(I) with C/S=2/3 and its isochemical counterpart gyrolite

International Nuclear Information System (INIS)

Stumm, Andreas; Garbev, Krassimir; Beuchle, Guenter; Black, Leon; Stemmermann, Peter; Nueesch, Rolf

2005-01-01

We have investigated the incorporation of zinc into both nanocrystalline and crystalline calcium silicate hydrates with starting C/S ratios of 2/3 (0.66). Zinc was added replacing calcium in the starting mixtures [Zn/(Zn+Ca)=0-1/4; 0-10 wt.% Zn], and the resultant phases were characterised using X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS), differential thermal analysis-thermogravimetry (DTA-TG) and environmental scanning electron microscopy (ESEM). In both groups of samples, increasing zinc content led to gradual structural changes, until eventually a second phase was formed. Zinc was incorporated to similar limits in both sets of samples. The thermal stability of the structures increased to a certain zinc content, beyond which there was structural destabilisation. Zinc incorporation is possible up to ∼6 wt.%. Our observations strongly indicate similar zinc incorporation mechanisms in both sample series, namely incorporation of zinc into the interlayer of C-S-H(I) and the X-sheet of gyrolite for nanocrystalline and crystalline samples, respectively
Characterizing the astrophysical S factor for 12C+12C fusion with wave-packet dynamics

Science.gov (United States)

Diaz-Torres, Alexis; Wiescher, Michael

2018-05-01

A quantitative study of the astrophysically important subbarrier fusion of 12C+12C is presented. Low-energy collisions are described in the body-fixed reference frame using wave-packet dynamics within a nuclear molecular picture. A collective Hamiltonian drives the time propagation of the wave packet through the collective potential-energy landscape. The fusion imaginary potential for specific dinuclear configurations is crucial for understanding the appearance of resonances in the fusion cross section. The theoretical subbarrier fusion cross sections explain some observed resonant structures in the astrophysical S factor. These cross sections monotonically decline towards stellar energies. The structures in the data that are not explained are possibly due to cluster effects in the nuclear molecule, which need to be included in the present approach.
Studies toward the oxidative and reductive activation of C-S bonds in 2'-S-aryl-2'-thiouridine derivatives.

Science.gov (United States)

Rayala, Ramanjaneyulu; Giuglio-Tonolo, Alain; Broggi, Julie; Terme, Thierry; Vanelle, Patrice; Theard, Patricia; Médebielle, Maurice; Wnuk, Stanislaw F

2016-04-21

Studies directed toward the oxidative and reductive desulfurization of readily available 2'- S -aryl-2'-thiouridine derivatives were investigated with the prospect to functionalize the C2'-position of nucleosides. The oxidative desulfurization-difluorination strategy was successful on 2-(arylthio)alkanoate surrogates, while extension of the combination of oxidants and fluoride sources was not an efficient fluorination protocol when applied to 2'- S -aryl-2'-thiouridine derivatives, resulting mainly in C5-halogenation of the pyrimidine ring and C2'-monofluorination without desulfurization. Cyclic voltammetry of 2'-arylsulfonyl-2'-deoxyuridines and their 2'-fluorinated analogues showed that cleavage of the arylsulfone moiety could occur, although at relatively high cathodic potentials. While reductive-desulfonylation of 2'-arylsulfonyl-2'-deoxyuridines with organic electron donors (OEDs) gave predominantly base-induced furan type products, chemical (OED) and electrochemical reductive-desulfonylation of the α-fluorosulfone derivatives yielded the 2'-deoxy-2'-fluorouridine and 2',3'-didehydro-2',3'-dideoxy-2'-fluorouridine derivatives. These results provided good evidence of the generation of a C2'-anion through carbon-sulfur bond cleavage, opening new horizons for the reductive-functionalization approaches in nucleosides.
Studies toward the oxidative and reductive activation of C-S bonds in 2'-S-aryl-2'-thiouridine derivatives

Science.gov (United States)

Rayala, Ramanjaneyulu; Giuglio-Tonolo, Alain; Broggi, Julie; Terme, Thierry; Vanelle, Patrice; Theard, Patricia; Médebielle, Maurice; Wnuk, Stanislaw F.

2016-01-01

Studies directed toward the oxidative and reductive desulfurization of readily available 2'-S-aryl-2'-thiouridine derivatives were investigated with the prospect to functionalize the C2'-position of nucleosides. The oxidative desulfurization-difluorination strategy was successful on 2-(arylthio)alkanoate surrogates, while extension of the combination of oxidants and fluoride sources was not an efficient fluorination protocol when applied to 2'-S-aryl-2'-thiouridine derivatives, resulting mainly in C5-halogenation of the pyrimidine ring and C2'-monofluorination without desulfurization. Cyclic voltammetry of 2'-arylsulfonyl-2'-deoxyuridines and their 2'-fluorinated analogues showed that cleavage of the arylsulfone moiety could occur, although at relatively high cathodic potentials. While reductive-desulfonylation of 2'-arylsulfonyl-2'-deoxyuridines with organic electron donors (OEDs) gave predominantly base-induced furan type products, chemical (OED) and electrochemical reductive-desulfonylation of the α-fluorosulfone derivatives yielded the 2'-deoxy-2'-fluorouridine and 2',3'-didehydro-2',3'-dideoxy-2'-fluorouridine derivatives. These results provided good evidence of the generation of a C2'-anion through carbon-sulfur bond cleavage, opening new horizons for the reductive-functionalization approaches in nucleosides. PMID:27019535
Note on s anti s-production in anti p-nucleus reactions at 607 MeV/c incident momentum

International Nuclear Information System (INIS)

Breivik, F.O.; Haatuft, A.; Halsteinslid, A.

1990-01-01

The measured cross sections for K o s and Λ o (Σ o ) production in anti pA reactions at 607 MeV/c incident momentum, and the number of quark recombinations, give the cross section σ(s anti s) for strange particle production for target nuclei with A= 2, 4 and 20 nucleons, respectively. The result favours the relation σ(s anti s) ∝ A 1/3 . Scattering of an antiquark off a virtual s anti s-pair, or gluon Bremsstrahlung emitted by scattering of an incident antiquark passing through nuclear matter, are possible processes consistent with this relation. Models inconsistent with the relation may be wrong. 4 refs.; 2 tabs
The C-S-H gel of Portland cement mortars: Part I. The interpretation of energy-dispersive X-ray microanalyses from scanning electron microscopy, with some observations on C-S-H, AFm and AFt phase compositions

International Nuclear Information System (INIS)

Famy, C.; Brough, A.R.; Taylor, H.F.W.

2003-01-01

Scanning electron microscopy (SEM) microanalyses of the calcium-silicate-hydrate (C-S-H) gel in Portland cement pastes rarely represent single phases. Essential experimental requirements are summarised and new procedures for interpreting the data are described. These include, notably, plots of Si/Ca against other atom ratios, 3D plots to allow three such ratios to be correlated and solution of linear simultaneous equations to test and quantify hypotheses regarding the phases contributing to individual microanalyses. Application of these methods to the C-S-H gel of a 1-day-old mortar identified a phase with Al/Ca=0.67 and S/Ca=0.33, which we consider to be a highly substituted ettringite of probable composition C 6 A 2 S-bar 2 H 34 or {Ca 6 [Al(OH) 6 ] 2 ·24H 2 O}(SO 4 ) 2 [Al(OH) 4 ] 2 . If this is true for Portland cements in general, it might explain observed discrepancies between observed and calculated aluminate concentrations in the pore solution. The C-S-H gel of a similar mortar aged 600 days contained unsubstituted ettringite and an AFm phase with S/Ca=0.125
Astrophysical S factor for 13C(p,γ)14N and asymptotic normalization coefficients

International Nuclear Information System (INIS)

Mukhamedzhanov, A.M.; Azhari, A.; Gagliardi, C.A.; Sattarov, A.; Tang, X.; Trache, L.; Tribble, R.E.; Burjan, V.; Kroha, V.

2002-01-01

We reanalyze the 13 C(p,γ) 14 N radiative capture reaction within the R-matrix approach. The low-energy astrophysical S factor has important contributions from both resonant and onresonant captures. The normalization of the nonresonant component of the transition to a particular 14 N bound state is expressed in terms of the asymptotic normalization coefficient (ANC). In the analysis we use the experimental ANC's inferred from the 13 C( 14 N, 13 C) 14 N and 13 C( 3 He,d) 14 N reactions. The fits of the calculated S factors to the experimental data are sensitive to the ANC values and are used to test the extracted ANC's. We find that for transitions to all the states in 14 N, except the third excited state, the ANC's determined from the transfer reactions provide the best fit. The astrophysical factor we obtain, S(0)=7.7±1.1 keV b, is in excellent agreement with previous results
1-(4-Methylphenylsulfonyl)-5,6-dinitro-1H-indazole

Science.gov (United States)

Oulemda, Bassou; Rakib, El Mostapha; Abbassi, Najat; Saadi, Mohamed; El Ammari, Lahcen

2014-01-01

In the title compound, C14H10N4O6S, the indazole ring system is almost perpendicular to the tosyl ring, as indicated by the dihedral angle of 89.40 (9)° between their planes. The dihedral angles between the indazole system and the nitro groups are 57.0 (3) and 31.9 (3)°. In the crystal, molecules are linked by C—H⋯O interactions, forming chains running along [100]. PMID:24526962
1-(4-Methylphenylsulfonyl-5,6-dinitro-1H-indazole

Directory of Open Access Journals (Sweden)

Bassou Oulemda

2014-01-01

Full Text Available In the title compound, C14H10N4O6S, the indazole ring system is almost perpendicular to the tosyl ring, as indicated by the dihedral angle of 89.40 (9° between their planes. The dihedral angles between the indazole system and the nitro groups are 57.0 (3 and 31.9 (3°. In the crystal, molecules are linked by C—H...O interactions, forming chains running along [100].
Search for the Pentaquark via the Decay $P^0_{\\bar{c}s} \\to \\phi \\pi \\rho$

Energy Technology Data Exchange (ETDEWEB)

Beck, S.Maytal [Tel Aviv U.

1998-01-01

This work reports results of the first search for the pentaquark, which is predicted to be a doublet of states: $P^0_{\\bar{c}s} = \\mid \\bar{c}suud$ > and $P^-_{\\bar{c}s}$ = $\\mid \\bar{c}sddu>$. The color hyperfine interaction between their constituent quarks results in a maximal binding potential of 150 MeV. Calculations done using other models predict that the pentaquark is either bound or is a near-threshold resonance. A bound pentaquark would have a mass below 2.907 GeV /$c^2$ and its lifetime would be like that of other charm particles, of the order of $10^{-13}$ s. Crude estimates of the pentaquark production cross section predict values of the order of 1 % of that of the $D_s$. Observation of the pentaquark is interesting for its unusual structure and would contribute to the understanding of QCD and the concept of confinement....
cIMP synthesized by sGC as a mediator of hypoxic contraction of coronary arteries.

Science.gov (United States)

Chen, Zhengju; Zhang, Xu; Ying, Lei; Dou, Dou; Li, Yanhui; Bai, Yun; Liu, Juan; Liu, Limei; Feng, Han; Yu, Xiaoxing; Leung, Susan Wai-Sum; Vanhoutte, Paul M; Gao, Yuansheng

2014-08-01

cGMP is considered the only mediator synthesized by soluble guanylyl cyclase (sGC) in response to nitric oxide (NO). However, purified sGC can synthesize several other cyclic nucleotides, including inosine 3',5'-cyclic monophosphate (cIMP). The present study was designed to determine the role of cIMP in hypoxic contractions of isolated porcine coronary arteries. Vascular responses were examined by measuring isometric tension. Cyclic nucleotides were assayed by HPLC tandem mass spectroscopy. Rho kinase (ROCK) activity was determined by measuring the phosphorylation of myosin phosphatase target subunit 1 using Western blot analysis and an ELISA kit. The level of cIMP, but not that of cGMP, was elevated by hypoxia in arteries with, but not in those without, endothelium [except if treated with diethylenetriamine (DETA) NONOate]; the increases in cIMP were inhibited by the sGC inhibitor 1H-[1,2,4]oxadiazolo[4,3,-a]quinoxalin-1-one (ODQ). Hypoxia (Po2: 25-30 mmHg) augmented contractions of arteries with and without endothelium if treated with DETA NONOate; these hypoxic contractions were blocked by ODQ. In arteries without endothelium, hypoxic augmentation of contraction was also obtained with exogenous cIMP. In arteries with endothelium, hypoxic augmentation of contraction was further enhanced by inosine 5'-triphosphate, the precursor for cIMP. The augmentation of contraction caused by hypoxia or cIMP was accompanied by increased phosphorylation of myosin phosphatase target subunit 1 at Thr(853), which was prevented by the ROCK inhibitor Y-27632. ROCK activity in the supernatant of isolated arteries was stimulated by cIMP in a concentration-dependent fashion. These results demonstrate that cIMP synthesized by sGC is the likely mediator of hypoxic augmentation of coronary vasoconstriction, in part by activating ROCK. Copyright © 2014 the American Physiological Society.
Measurements of the Branching fractions for $B_{(s)} \\to D_{(s)}\\pi\\pi\\pi$ and $\\Lambda_b^0 \\to \\Lambda_c^+\\pi\\pi\\pi$

CERN Document Server

INSPIRE-00258707; Adeva, B.; Adinolfi, M.; Adrover, C.; Affolder, A.; Ajaltouni, Z.; Albrecht, J.; Alessio, F.; Alexander, M.; Alkhazov, G.; Alvarez Cartelle, P.; Alves, A.A.; Amato, S.; Amhis, Y.; Anderson, J.; Appleby, R.B.; Aquines Gutierrez, O.; Archilli, F.; Arrabito, L.; Artamonov, A.; Artuso, M.; Aslanides, E.; Auriemma, G.; Bachmann, S.; Back, J.J.; Bailey, D.S.; Balagura, V.; Baldini, W.; Barlow, R.J.; Barschel, C.; Barsuk, S.; Barter, W.; Bates, A.; Bauer, C.; Bauer, Th.; Bay, A.; Bediaga, I.; Belous, K.; Belyaev, I.; Ben-Haim, E.; Benayoun, M.; Bencivenni, G.; Benson, S.; Benton, J.; Bernet, R.; Bettler, M.O.; van Beuzekom, M.; Bien, A.; Bifani, S.; Bizzeti, A.; Bjornstad, P.M.; Blake, T.; Blanc, F.; Blanks, C.; Blouw, J.; Blusk, S.; Bobrov, A.; Bocci, V.; Bondar, A.; Bondar, N.; Bonivento, W.; Borghi, S.; Borgia, A.; Bowcock, T.J.V.; Bozzi, C.; Brambach, T.; van den Brand, J.; Bressieux, J.; Brett, D.; Brisbane, S.; Britsch, M.; Britton, T.; Brook, N.H.; Brown, H.; Buchler-Germann, A.; Burducea, I.; Bursche, A.; Buytaert, J.; Cadeddu, S.; Caicedo Carvajal, J.M.; Callot, O.; Calvi, M.; Calvo Gomez, M.; Camboni, A.; Campana, P.; Carbone, A.; Carboni, G.; Cardinale, R.; Cardini, A.; Carson, L.; Carvalho Akiba, K.; Casse, G.; Cattaneo, M.; Charles, M.; Charpentier, Ph.; Chiapolini, N.; Ciba, K.; Cid Vidal, X.; Ciezarek, G.; Clarke, P.E.L.; Clemencic, M.; Cliff, H.V.; Closier, J.; Coca, C.; Coco, V.; Cogan, J.; Collins, P.; Constantin, F.; Conti, G.; Contu, A.; Cook, A.; Coombes, M.; Corti, G.; Cowan, G.A.; Currie, R.; D'Almagne, B.; D'Ambrosio, C.; David, P.; De Bonis, I.; De Capua, S.; De Cian, M.; De Lorenzi, F.; De Miranda, J.M.; De Paula, L.; De Simone, P.; Decamp, D.; Deckenhoff, M.; Degaudenzi, H.; Deissenroth, M.; Del Buono, L.; Deplano, C.; Deschamps, O.; Dettori, F.; Dickens, J.; Dijkstra, H.; Diniz Batista, P.; Donleavy, S.; Dosil Suarez, A.; Dossett, D.; Dovbnya, A.; Dupertuis, F.; Dzhelyadin, R.; Eames, C.; Easo, S.; Egede, U.; Egorychev, V.; Eidelman, S.; van Eijk, D.; Eisele, F.; Eisenhardt, S.; Ekelhof, R.; Eklund, L.; Elsasser, Ch.; d'Enterria, D.G.; Esperante Pereira, D.; Esteve, L.; Falabella, A.; Fanchini, E.; Farber, C.; Fardell, G.; Farinelli, C.; Farry, S.; Fave, V.; Fernandez Albor, V.; Ferro-Luzzi, M.; Filippov, S.; Fitzpatrick, C.; Fontana, M.; Fontanelli, F.; Forty, R.; Frank, M.; Frei, C.; Frosini, M.; Furcas, S.; Gallas Torreira, A.; Galli, D.; Gandelman, M.; Gandini, P.; Gao, Y.; Garnier, J-C.; Garofoli, J.; Garra Tico, J.; Garrido, L.; Gaspar, C.; Gauvin, N.; Gersabeck, M.; Gershon, T.; Ghez, Ph.; Gibson, V.; Gligorov, V.V.; Gobel, C.; Golubkov, D.; Golutvin, A.; Gomes, A.; Gordon, H.; Grabalosa Gandara, M.; Graciani Diaz, R.; Granado Cardoso, L.A.; Grauges, E.; Graziani, G.; Grecu, A.; Gregson, S.; Gui, B.; Gushchin, E.; Guz, Yu.; Gys, T.; Haefeli, G.; Haen, C.; Haines, S.C.; Hampson, T.; Hansmann-Menzemer, S.; Harji, R.; Harnew, N.; Harrison, J.; Harrison, P.F.; He, J.; Heijne, V.; Hennessy, K.; Henrard, P.; Hernando Morata, J.A.; van Herwijnen, E.; Hicks, E.; Hofmann, W.; Holubyev, K.; Hopchev, P.; Hulsbergen, W.; Hunt, P.; Huse, T.; Huston, R.S.; Hutchcroft, D.; Hynds, D.; Iakovenko, V.; Ilten, P.; Imong, J.; Jacobsson, R.; Jaeger, A.; Jahjah Hussein, M.; Jans, E.; Jansen, F.; Jaton, P.; Jean-Marie, B.; Jing, F.; John, M.; Johnson, D.; Jones, C.R.; Jost, B.; Kandybei, S.; Karacson, M.; Karbach, T.M.; Keaveney, J.; Kerzel, U.; Ketel, T.; Keune, A.; Khanji, B.; Kim, Y.M.; Knecht, M.; Koblitz, S.; Koppenburg, P.; Kozlinskiy, A.; Kravchuk, L.; Kreplin, K.; Kreps, M.; Krocker, G.; Krokovny, P.; Kruse, F.; Kruzelecki, K.; Kucharczyk, M.; Kukulak, S.; Kumar, R.; Kvaratskheliya, T.; La Thi, V.N.; Lacarrere, D.; Lafferty, G.; Lai, A.; Lambert, D.; Lambert, R.W.; Lanciotti, E.; Lanfranchi, G.; Langenbruch, C.; Latham, T.; Le Gac, R.; van Leerdam, J.; Lees, J.P.; Lefevre, R.; Leflat, A.; Lefrancois, J.; Leroy, O.; Lesiak, T.; Li, L.; Li Gioi, L.; Lieng, M.; Liles, M.; Lindner, R.; Linn, C.; Liu, B.; Liu, G.; Lopes, J.H.; Lopez Asamar, E.; Lopez-March, N.; Luisier, J.; Machefert, F.; Machikhiliyan, I.V.; Maciuc, F.; Maev, O.; Magnin, J.; Malde, S.; Mamunur, R.M.D.; Manca, G.; Mancinelli, G.; Mangiafave, N.; Marconi, U.; Marki, R.; Marks, J.; Martellotti, G.; Martens, A.; Martin, L.; Martin Sanchez, A.; Martinez Santos, D.; Massafferri, A.; Mathe, Z.; Matteuzzi, C.; Matveev, M.; Maurice, E.; Maynard, B.; Mazurov, A.; McGregor, G.; McNulty, R.; Mclean, C.; Meissner, M.; Merk, M.; Merkel, J.; Messi, R.; Miglioranzi, S.; Milanes, D.A.; Minard, M.N.; Monteil, S.; Moran, D.; Morawski, P.; Mountain, R.; Mous, I.; Muheim, F.; Muller, K.; Muresan, R.; Muryn, B.; Musy, M.; Mylroie-Smith, J.; Naik, P.; Nakada, T.; Nandakumar, R.; Nardulli, J.; Nasteva, I.; Nedos, M.; Needham, M.; Neufeld, N.; Nguyen-Mau, C.; Nicol, M.; Nies, S.; Niess, V.; Nikitin, N.; Oblakowska-Mucha, A.; Obraztsov, V.; Oggero, S.; Ogilvy, S.; Okhrimenko, O.; Oldeman, R.; Orlandea, M.; Otalora Goicochea, J.M.; Owen, P.; Pal, B.; Palacios, J.; Palutan, M.; Panman, J.; Papanestis, A.; Pappagallo, M.; Parkes, C.; Parkinson, C.J.; Passaleva, G.; Patel, G.D.; Patel, M.; Paterson, S.K.; Patrick, G.N.; Patrignani, C.; Pavel-Nicorescu, C.; Pazos Alvarez, A.; Pellegrino, A.; Penso, G.; Pepe Altarelli, M.; Perazzini, S.; Perego, D.L.; Perez Trigo, E.; Perez-Calero Yzquierdo, A.; Perret, P.; Perrin-Terrin, M.; Pessina, G.; Petrella, A.; Petrolini, A.; Pie Valls, B.; Pietrzyk, B.; Pilar, T.; Pinci, D.; Plackett, R.; Playfer, S.; Plo Casasus, M.; Polok, G.; Poluektov, A.; Polycarpo, E.; Popov, D.; Popovici, B.; Potterat, C.; Powell, A.; du Pree, T.; Prisciandaro, J.; Pugatch, V.; Puig Navarro, A.; Qian, W.; Rademacker, J.H.; Rakotomiaramanana, B.; Rangel, M.S.; Raniuk, I.; Raven, G.; Redford, S.; Reid, M.M.; dos Reis, A.C.; Ricciardi, S.; Rinnert, K.; Roa Romero, D.A.; Robbe, P.; Rodrigues, E.; Rodrigues, F.; Rodriguez Perez, P.; Rogers, G.J.; Roiser, S.; Romanovsky, V.; Rouvinet, J.; Ruf, T.; Ruiz, H.; Sabatino, G.; Saborido Silva, J.J.; Sagidova, N.; Sail, P.; Saitta, B.; Salzmann, C.; Sannino, M.; Santacesaria, R.; Santinelli, R.; Santovetti, E.; Sapunov, M.; Sarti, A.; Satriano, C.; Satta, A.; Savrie, M.; Savrina, D.; Schaack, P.; Schiller, M.; Schleich, S.; Schmelling, M.; Schmidt, B.; Schneider, O.; Schopper, A.; Schune, M.H.; Schwemmer, R.; Sciubba, A.; Seco, M.; Semennikov, A.; Senderowska, K.; Sepp, I.; Serra, N.; Serrano, J.; Seyfert, P.; Shao, B.; Shapkin, M.; Shapoval, I.; Shatalov, P.; Shcheglov, Y.; Shears, T.; Shekhtman, L.; Shevchenko, O.; Shevchenko, V.; Shires, A.; Silva Coutinho, R.; Skottowe, H.P.; Skwarnicki, T.; Smith, A.C.; Smith, N.A.; Sobczak, K.; Soler, F.J.P.; Solomin, A.; Soomro, F.; Souza De Paula, B.; Spaan, B.; Sparkes, A.; Spradlin, P.; Stagni, F.; Stahl, S.; Steinkamp, O.; Stoica, S.; Stone, S.; Storaci, B.; Straticiuc, M.; Straumann, U.; Styles, N.; Subbiah, V.K.; Swientek, S.; Szczekowski, M.; Szczypka, P.; Szumlak, T.; T'Jampens, S.; Teodorescu, E.; Teubert, F.; Thomas, C.; Thomas, E.; van Tilburg, J.; Tisserand, V.; Tobin, M.; Topp-Joergensen, S.; Tran, M.T.; Tsaregorodtsev, A.; Tuning, N.; Ukleja, A.; Urquijo, P.; Uwer, U.; Vagnoni, V.; Valenti, G.; Vazquez Gomez, R.; Vazquez Regueiro, P.; Vecchi, S.; Velthuis, J.J.; Veltri, M.; Vervink, K.; Viaud, B.; Videau, I.; Vilasis-Cardona, X.; Visniakov, J.; Vollhardt, A.; Voong, D.; Vorobyev, A.; Voss, H.; Wacker, K.; Wandernoth, S.; Wang, J.; Ward, D.R.; Webber, A.D.; Websdale, D.; Whitehead, M.; Wiedner, D.; Wiggers, L.; Wilkinson, G.; Williams, M.P.; Williams, M.; Wilson, F.F.; Wishahi, J.; Witek, M.; Witzeling, W.; Wotton, S.A.; Wyllie, K.; Xie, Y.; Xing, F.; Yang, Z.; Young, R.; Yushchenko, O.; Zavertyaev, M.; Zhang, L.; Zhang, W.C.; Zhang, Y.; Zhelezov, A.; Zhong, L.; Zverev, E.; Zvyagin, A.

2011-01-01

Branching fractions of the decays $H_b\\to H_c\\pi^-\\pi^+\\pi^-$ relative to $H_b\\to H_c\\pi^-$ are presented, where $H_b$ ($H_c$) represents $\\overline{B^0}$ ($D^+$), $B^-$ ($D^0$), $\\overline{B_s^0}$ ($D_s^+$) and $\\Lambda_b^0$ ($\\Lambda_c^+$). The measurements are performed with the LHCb detector using 35~${\\rm pb^{-1}}$ of data collected at $\\sqrt{s}=7$~TeV. The ratios of branching fractions are measured to be \\begin{eqnarray*} {{\\cal{B}}(\\overline{B^0}\\to D^+\\pi^-\\pi^+\\pi^-)\\over{\\cal{B}}(\\overline{B^0}\\to D^+\\pi^-)} = 2.38\\pm0.11\\pm0.21 \
Solvothermal synthesis and characterisation of new one-dimensional indium and gallium sulphides: [C1N4H26]0.5[InS2] and [C1N4H26]0.5[GaS2

International Nuclear Information System (INIS)

Vaqueiro, Paz

2006-01-01

Two new main group metal sulphides, [C 1 N 4 H 26 ] 0.5 [InS 2 ] (1) and [C 1 N 4 H 26 ] 0.5 [GaS 2 ] (2) have been prepared solvothermally in the presence of 1,4-bis(3-aminopropyl)piperazine and their crystal structures determined by single-crystal X-ray diffraction. Both compounds are isostructural and crystallise in the monoclinic space group P2 1 /n (Z=4), with a=6.5628(5), b=11.2008(9), c=12.6611(9) A and β=94.410(4) o (wR=0.035) for compound (1) and a=6.1094(5), b=11.2469(9), c=12.7064(10) A and β=94.313(4) o (wR=0.021) for compound (2). The structure of [C 1 N 4 H 26 ] 0.5 [MS 2 ] (M=In,Ga) consists of one-dimensional [MS 2 ] - chains which run parallel to the crystallographic a axis and are separated by diprotonated amine molecules. These materials represent the first example of solvothermally prepared one-dimensional gallium and indium sulphides. -- Graphical abstract: [C 1 N 4 H 26 ] 0.5 [InS 2 ] and [C 1 N 4 H 26 ] 0.5 [GaS 2 ], prepared under solvothermal conditions, consist of one-dimensional [MS 2 ] - chains separated by diprotonated 1,4-bis(3-aminopropyl)piperazine molecules
Effects of Dihedral Angle on Pool Boiling Heat Transfer from Two Tubes in Vertical Alignment

Energy Technology Data Exchange (ETDEWEB)

Kang, Myeong-Gie [Andong National University, Andong (Korea, Republic of)

2014-10-15

to study the effects of the dihedral angle (α) and the heat flux of the lower tube on heat transfer enhancement of the upper tube, arranged one above the other in the same vertical plane. The combined effects of the dihedral angle and the heat flux of the lower tube on heat transfer enhancement of the upper tube were investigated. The increase in α eventually increases h{sub r} . When α changes from 2 .deg. to 18 .deg. the value of h{sub r} increases about 20.3% for q″{sub L}=10kW/m{sup 2}. The enhancement is clearly observed at the heat fluxes where the convective effect is dominant.
(13)C-metabolic flux analysis in S-adenosyl-L-methionine production by Saccharomyces cerevisiae.

Science.gov (United States)

Hayakawa, Kenshi; Kajihata, Shuichi; Matsuda, Fumio; Shimizu, Hiroshi

2015-11-01

S-Adenosyl-L-methionine (SAM) is a major biological methyl group donor, and is used as a nutritional supplement and prescription drug. Yeast is used for the industrial production of SAM owing to its high intracellular SAM concentrations. To determine the regulation mechanisms responsible for such high SAM production, (13)C-metabolic flux analysis ((13)C-MFA) was conducted to compare the flux distributions in the central metabolism between Kyokai no. 6 (high SAM-producing) and S288C (control) strains. (13)C-MFA showed that the levels of tricarboxylic acid (TCA) cycle flux in SAM-overproducing strain were considerably increased compared to those in the S228C strain. Analysis of ATP balance also showed that a larger amount of excess ATP was produced in the Kyokai 6 strain because of increased oxidative phosphorylation. These results suggest that high SAM production in Kyokai 6 strains could be attributed to enhanced ATP regeneration with high TCA cycle fluxes and respiration activity. Thus, maintaining high respiration efficiency during cultivation is important for improving SAM production. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Synergistic inhibition of the intrinsic factor X activation by protein S and C4b-binding protein

NARCIS (Netherlands)

Koppelman, S.J.

1995-01-01

The complement protein C4b-binding protein plays an important role in the regulation of the protein C anticoagulant pathway. C4b-binding protein can bind to protein S, thereby inhibiting the cofactor activity of protein S for activated protein C. In this report, we describe a new role for
Measurement of the cross-section ratio $\\sigma(\\chi_{c2})/\\sigma(\\chi_{c1})$ for prompt $\\chi_c$ production at $\\sqrt{s}=7$ TeV

CERN Document Server

INSPIRE-00258707; Abellan Beteta, C.; Adeva, B.; Adinolfi, M.; Adrover, C.; Affolder, A.; Ajaltouni, Z.; Albrecht, J.; Alessio, F.; Alexander, M.; Alkhazov, G.; Alvarez Cartelle, P.; Alves Jr, A.A.; Amato, S.; Amhis, Y.; Anderson, J.; Appleby, R.B.; Aquines Gutierrez, O.; Archilli, F.; Arrabito, L.; Artamonov, A.; Artuso, M.; Aslanides, E.; Auriemma, G.; Bachmann, S.; Back, J.J.; Bailey, D.S.; Balagura, V.; Baldini, W.; Barlow, R.J.; Barschel, C.; Barsuk, S.; Barter, W.; Bates, A.; Bauer, C.; Bauer, Th.; Bay, A.; Bediaga, I.; Belogurov, S.; Belous, K.; Belyaev, I.; Ben-Haim, E.; Benayoun, M.; Bencivenni, G.; Benson, S.; Benton, J.; Bernet, R.; Bettler, M.O.; van Beuzekom, M.; Bien, A.; Bifani, S.; Bird, T.; Bizzeti, A.; Bjornstad, P.M.; Blake, T.; Blanc, F.; Blanks, C.; Blouw, J.; Blusk, S.; Bobrov, A.; Bocci, V.; Bondar, A.; Bondar, N.; Bonivento, W.; Borghi, S.; Borgia, A.; Bowcock, T.J.V.; Bozzi, C.; Brambach, T.; van den Brand, J.; Bressieux, J.; Brett, D.; Britsch, M.; Britton, T.; Brook, N.H.; Brown, H.; Buchler-Germann, A.; Burducea, I.; Bursche, A.; Buytaert, J.; Cadeddu, S.; Callot, O.; Calvi, M.; Calvo Gomez, M.; Camboni, A.; Campana, P.; Carbone, A.; Carboni, G.; Cardinale, R.; Cardini, A.; Carson, L.; Carvalho Akiba, K.; Casse, G.; Cattaneo, M.; Cauet, Ch.; Charles, M.; Charpentier, Ph.; Chiapolini, N.; Ciba, K.; Cid Vidal, X.; Ciezarek, G.; Clarke, P.E.L.; Clemencic, M.; Cliff, H.V.; Closier, J.; Coca, C.; Coco, V.; Cogan, J.; Collins, P.; Comerma-Montells, A.; Constantin, F.; Conti, G.; Contu, A.; Cook, A.; Coombes, M.; Corti, G.; Cowan, G.A.; Currie, R.; D'Almagne, B.; D'Ambrosio, C.; David, P.; David, P.N.Y.; De Bonis, I.; De Capua, S.; De Cian, M.; De Lorenzi, F.; de Miranda, J.M.; De Paula, L.; De Simone, P.; Decamp, D.; Deckenhoff, M.; Degaudenzi, H.; Deissenroth, M.; Del Buono, L.; Deplano, C.; Derkach, D.; Deschamps, O.; Dettori, F.; Dickens, J.; Dijkstra, H.; Diniz Batista, P.; Bonal, F.Domingo; Donleavy, S.; Dordei, F.; Dosil Suarez, A.; Dossett, D.; Dovbnya, A.; Dupertuis, F.; Dzhelyadin, R.; Dziurda, A.; Easo, S.; Egede, U.; Egorychev, V.; Eidelman, S.; van Eijk, D.; Eisele, F.; Eisenhardt, S.; Ekelhof, R.; Eklund, L.; Elsasser, Ch.; Elsby, D.; Esperante Pereira, D.; Esteve, L.; Falabella, A.; Fanchini, E.; Farber, C.; Fardell, G.; Farinelli, C.; Farry, S.; Fave, V.; Fernandez Albor, V.; Ferro-Luzzi, M.; Filippov, S.; Fitzpatrick, C.; Fontana, M.; Fontanelli, F.; Forty, R.; Frank, M.; Frei, C.; Frosini, M.; Furcas, S.; Gallas Torreira, A.; Galli, D.; Gandelman, M.; Gandini, P.; Gao, Y.; Garnier, J-C.; Garofoli, J.; Garra Tico, J.; Garrido, L.; Gascon, D.; Gaspar, C.; Gauvin, N.; Gersabeck, M.; Gershon, T.; Ghez, Ph.; Gibson, V.; Gligorov, V.V.; Gobel, C.; Golubkov, D.; Golutvin, A.; Gomes, A.; Gordon, H.; Grabalosa Gandara, M.; Graciani Diaz, R.; Granado Cardoso, L.A.; Grauges, E.; Graziani, G.; Grecu, A.; Greening, E.; Gregson, S.; Gui, B.; Gushchin, E.; Guz, Yu.; Gys, T.; Haefeli, G.; Haen, C.; Haines, S.C.; Hampson, T.; Hansmann-Menzemer, S.; Harji, R.; Harnew, N.; Harrison, J.; Harrison, P.F.; He, J.; Heijne, V.; Hennessy, K.; Henrard, P.; Hernando Morata, J.A.; van Herwijnen, E.; Hicks, E.; Holubyev, K.; Hopchev, P.; Hulsbergen, W.; Hunt, P.; Huse, T.; Huston, R.S.; Hutchcroft, D.; Hynds, D.; Iakovenko, V.; Ilten, P.; Imong, J.; Jacobsson, R.; Jaeger, A.; Jahjah Hussein, M.; Jans, E.; Jansen, F.; Jaton, P.; Jean-Marie, B.; Jing, F.; John, M.; Johnson, D.; Jones, C.R.; Jost, B.; Kaballo, M.; Kandybei, S.; Karacson, M.; Karbach, T.M.; Keaveney, J.; Kenyon, I.R.; Kerzel, U.; Ketel, T.; Keune, A.; Khanji, B.; Kim, Y.M.; Knecht, M.; Koppenburg, P.; Kozlinskiy, A.; Kravchuk, L.; Kreplin, K.; Kreps, M.; Krocker, G.; Krokovny, P.; Kruse, F.; Kruzelecki, K.; Kucharczyk, M.; Kvaratskheliya, T.; La Thi, V.N.; Lacarrere, D.; Lafferty, G.; Lai, A.; Lambert, D.; Lambert, R.W.; Lanciotti, E.; Lanfranchi, G.; Langenbruch, C.; Latham, T.; Lazzeroni, C.; Le Gac, R.; van Leerdam, J.; Lees, J.P.; Lefevre, R.; Leflat, A.; Lefrancois, J.; Leroy, O.; Lesiak, T.; Li, L.; Li Gioi, L.; Lieng, M.; Liles, M.; Lindner, R.; Linn, C.; Liu, B.; Liu, G.; Lopes, J.H.; Lopez Asamar, E.; Lopez-March, N.; Lu, H.; Luisier, J.; Raighne, A.Mac; Machefert, F.; Machikhiliyan, I.V.; Maciuc, F.; Maev, O.; Magnin, J.; Malde, S.; Mamunur, R.M.D.; Manca, G.; Mancinelli, G.; Mangiafave, N.; Marconi, U.; Marki, R.; Marks, J.; Martellotti, G.; Martens, A.; Martin, L.; Martin Sanchez, A.; Martinez Santos, D.; Massafferri, A.; Mathe, Z.; Matteuzzi, C.; Matveev, M.; Maurice, E.; Maynard, B.; Mazurov, A.; McGregor, G.; McNulty, R.; Mclean, C.; Meissner, M.; Merk, M.; Merkel, J.; Messi, R.; Miglioranzi, S.; Milanes, D.A.; Minard, M.N.; Molina Rodriguez, J.; Monteil, S.; Moran, D.; Morawski, P.; Mountain, R.; Mous, I.; Muheim, F.; Muller, K.; Muresan, R.; Muryn, B.; Muster, B.; Musy, M.; Mylroie-Smith, J.; Naik, P.; Nakada, T.; Nandakumar, R.; Nasteva, I.; Nedos, M.; Needham, M.; Neufeld, N.; Nguyen-Mau, C.; Nicol, M.; Niess, V.; Nikitin, N.; Nomerotski, A.; Novoselov, A.; Oblakowska-Mucha, A.; Obraztsov, V.; Oggero, S.; Ogilvy, S.; Okhrimenko, O.; Oldeman, R.; Orlandea, M.; Otalora Goicochea, J.M.; Owen, P.; Pal, K.; Palacios, J.; Palano, A.; Palutan, M.; Panman, J.; Papanestis, A.; Pappagallo, M.; Parkes, C.; Parkinson, C.J.; Passaleva, G.; Patel, G.D.; Patel, M.; Paterson, S.K.; Patrick, G.N.; Patrignani, C.; Pavel-Nicorescu, C.; Pazos Alvarez, A.; Pellegrino, A.; Penso, G.; Pepe Altarelli, M.; Perazzini, S.; Perego, D.L.; Perez Trigo, E.; Perez-Calero Yzquierdo, A.; Perret, P.; Perrin-Terrin, M.; Pessina, G.; Petrella, A.; Petrolini, A.; Phan, A.; Picatoste Olloqui, E.; Pie Valls, B.; Pietrzyk, B.; Pilar, T.; Pinci, D.; Plackett, R.; Playfer, S.; Plo Casasus, M.; Polok, G.; Poluektov, A.; Polycarpo, E.; Popov, D.; Popovici, B.; Potterat, C.; Powell, A.; du Pree, T.; Prisciandaro, J.; Pugatch, V.; Puig Navarro, A.; Qian, W.; Rademacker, J.H.; Rakotomiaramanana, B.; Rangel, M.S.; Raniuk, I.; Raven, G.; Redford, S.; Reid, M.M.; dos Reis, A.C.; Ricciardi, S.; Rinnert, K.; Roa Romero, D.A.; Robbe, P.; Rodrigues, E.; Rodrigues, F.; Rodriguez Perez, P.; Rogers, G.J.; Roiser, S.; Romanovsky, V.; Rosello, M.; Rouvinet, J.; Ruf, T.; Ruiz, H.; Sabatino, G.; Saborido Silva, J.J.; Sagidova, N.; Sail, P.; Saitta, B.; Salzmann, C.; Sannino, M.; Santacesaria, R.; Santamarina Rios, C.; Santinelli, R.; Santovetti, E.; Sapunov, M.; Sarti, A.; Satriano, C.; Satta, A.; Savrie, M.; Savrina, D.; Schaack, P.; Schiller, M.; Schleich, S.; Schlupp, M.; Schmelling, M.; Schmidt, B.; Schneider, O.; Schopper, A.; Schune, M.H.; Schwemmer, R.; Sciascia, B.; Sciubba, A.; Seco, M.; Semennikov, A.; Senderowska, K.; Sepp, I.; Serra, N.; Serrano, J.; Seyfert, P.; Shao, B.; Shapkin, M.; Shapoval, I.; Shatalov, P.; Shcheglov, Y.; Shears, T.; Shekhtman, L.; Shevchenko, O.; Shevchenko, V.; Shires, A.; Coutinho, R.Silva; Skwarnicki, T.; Smith, A.C.; Smith, N.A.; Smith, E.; Sobczak, K.; Soler, F.J.P.; Solomin, A.; Soomro, F.; Souza De Paula, B.; Spaan, B.; Sparkes, A.; Spradlin, P.; Stagni, F.; Stahl, S.; Steinkamp, O.; Stoica, S.; Stone, S.; Storaci, B.; Straticiuc, M.; Straumann, U.; Subbiah, V.K.; Swientek, S.; Szczekowski, M.; Szczypka, P.; Szumlak, T.; T'Jampens, S.; Teodorescu, E.; Teubert, F.; Thomas, C.; Thomas, E.; van Tilburg, J.; Tisserand, V.; Tobin, M.; Topp-Joergensen, S.; Torr, N.; Tournefier, E.; Tran, M.T.; Tsaregorodtsev, A.; Tuning, N.; Garcia, M.Ubeda; Ukleja, A.; Urquijo, P.; Uwer, U.; Vagnoni, V.; Valenti, G.; Vazquez Gomez, R.; Vazquez Regueiro, P.; Vecchi, S.; Velthuis, J.J.; Veltri, M.; Viaud, B.; Videau, I.; Vilasis-Cardona, X.; Visniakov, J.; Vollhardt, A.; Volyanskyy, D.; Voong, D.; Vorobyev, A.; Voss, H.; Wandernoth, S.; Wang, J.; Ward, D.R.; Watson, N.K.; Webber, A.D.; Websdale, D.; Whitehead, M.; Wiedner, D.; Wiggers, L.; Wilkinson, G.; Williams, M.P.; Williams, M.; Wilson, F.F.; Wishahi, J.; Witek, M.; Witzeling, W.; Wotton, S.A.; Wyllie, K.; Xie, Y.; Xing, F.; Xing, Z.; Yang, Z.; Young, R.; Yushchenko, O.; Zavertyaev, M.; Zhang, F.; Zhang, L.; Zhang, W.C.; Zhang, Y.; Zhelezov, A.; Zhong, L.; Zverev, E.; Zvyagin, A.

2013-07-16

The prompt production of the charmonium $\\chi_{c1}$ and $\\chi_{c2}$ mesons has been studied in proton-proton collisions at the Large Hadron Collider at a centre-of-mass energy of $\\sqrt{s}=7$~TeV. The $\\chi_c$ mesons are identified through their decays $\\chi_c\\,\\rightarrow\\,J/\\psi\\,\\gamma$ with $J/\\psi\\,\\rightarrow\\,\\mu^+\\,\\mu^-$ using 36~$\\mathrm{pb^{-1}}$ of data collected by the LHCb detector in 2010. The ratio of the prompt production cross-sections for the two $\\chi_c$ spin states, $\\sigma(\\chi_{c2})\\,/\\,\\sigma(\\chi_{c1})$, has been determined as a function of the $J/\\psi$ transverse momentum, $p_{\\mathrm{T}}^{J/\\psi}$, in the range from 2 to 15~GeV/$c$. The results are in agreement with the next-to-leading order non-relativistic QCD model at high $p_{\\mathrm{T}}^{J/\\psi}$ and lie consistently above the pure leading-order colour singlet prediction.
MODIFIED N.R.C. VERSION OF THE U.S.G.S. SOLUTE TRANSPORT MODEL. VOLUME 2. INTERACTIVE PREPROCESSOR PROGRAM

Science.gov (United States)

The methods described in the report can be used with the modified N.R.C. version of the U.S.G.S. Solute Transport Model to predict the concentration of chemical parameters in a contaminant plume. The two volume report contains program documentation and user's manual. The program ...

Low-temperature solid-state preparation of ternary CdS/g-C_3N_4/CuS nanocomposites for enhanced visible-light photocatalytic H_2-production activity

International Nuclear Information System (INIS)

Cheng, Feiyue; Yin, Hui; Xiang, Quanjun

2017-01-01

Highlights: • CdS/g-C_3N_4/CuS composite were synthesized by low-temperature solid-state method. • CdS/g-C_3N_4/CuS show enhanced visible-light photocatalytic H_2 evolution activity. • The enhanced photocatalytic H_2 production activity is due to the heterojunction. • Heterojunction between the components promote charge separation/transfer property. - Abstract: Low-temperature solid-state method were gradually demonstrated as a high efficiency, energy saving and environmental protection strategy to fabricate composite semiconductor materials. CdS-based multiple composite photocatalytic materials have attracted increasing concern owning to the heterostructure constituents with tunable band gaps. In this study, the ternary CdS/g-C_3N_4/CuS composite photocatalysts were prepared by a facile and novel low-temperature solid-state strategy. The optimal ternary CdS/g-C_3N_4/CuS composite exhibits a high visible-light photocatalytic H_2-production rate of 57.56 μmol h"−"1 with the corresponding apparent quantum efficiency reaches 16.5% at 420 nm with Na_2S/Na_2SO_3 mixed aqueous solution as sacrificial agent. The ternary CdS/g-C_3N_4/CuS composites show the enhanced visible-light photocatalytic H_2-evolution activity comparing with the binary CdS-based composites or simplex CdS. The enhanced photocatalytic activity is ascribed to the heterojunctions and the synergistic effect of CuS and g-C_3N_4 in promotion of the charge separation and charge mobility. This work shows that the low-temperature solid-state method is efficient and environmentally benign for the preparation of CdS-based multiple composite photocatalytic materials with enhanced visible-light photocatalytic H_2-production activity.
1/2-BPS correlators as c = 1 S-matrix

International Nuclear Information System (INIS)

Jevicki, Antal; Yoneya, Tamiaki

2007-01-01

We argue from two complementary viewpoints of Holography that the 2-point correlation functions of 1/2-BPS multi-trace operators in the large-N (planar) limit are nothing but the (Wick-rotated) S-matrix elements of c = 1 matrix model. On the bulk side, we consider an Euclideanized version of the so-called bubbling geometries and show that the corresponding droplets reach the conformal boundary. Then the scattering matrix of fluctuations of the droplets gives directly the two-point correlators through the GKPW prescription. On the Yang-Mills side, we show that the two-point correlators of holomorphic and anti-holomorphic operators are essentially equivalent with the transformation functions between asymptotic in- and out-states of c = 1 matrix model. Extension to non-planar case is also discussed
Étude des interactions hadroniques à deux corps chargés, induites sur des protons par un faisceau de $\\pi^{-}, K^{-}$, et $\\overline{p}$ entre 3 et 12 GeV/c, avec un angle de diffusion dans le centre de masse voisin de 90$^{o}$

CERN Document Server

Billoir, Pierre

1983-01-01

Étude des interactions hadroniques à deux corps chargés, induites sur des protons par un faisceau de $\\pi^{-}, K^{-}$, et $\\overline{p}$ entre 3 et 12 GeV/c, avec un angle de diffusion dans le centre de masse voisin de 90$^{o}$
The S(c)ensory Immune System Theory.

Science.gov (United States)

Veiga-Fernandes, Henrique; Freitas, António A

2017-10-01

Viewpoints on the immune system have evolved across different paradigms, including the clonal selection theory, the idiotypic network, and the danger and tolerance models. Herein, we propose that in multicellular organisms, where panoplies of cells from different germ layers interact and immune cells are constantly generated, the behavior of the immune system is defined by the rules governing cell survival, systems physiology and organismic homeostasis. Initially, these rules were imprinted at the single cell-protist level, but supervened modifications in the transition to multicellular organisms. This context determined the emergence of the 'sensory immune system', which operates in a s(c)ensor mode to ensure systems physiology, organismic homeostasis, and perpetuation of its replicating molecules. Copyright © 2017 Elsevier Ltd. All rights reserved.
Os diagramas de C. S. Peirce para as dez classes de signos

Directory of Open Access Journals (Sweden)

Priscila Lena Farias

2013-12-01

Full Text Available Uma seção da Gramática Especulativa de C.S.Peirce - Dez classes de signos - recebeu, a partir de 1903, um importante tratamento diagramático. Neste artigo, são apresentados e discutidos dois diagramas desenvolvidos por Peirce para as dez classes, incluindo esboços desses modelos.
Synthesis of (R,S)-[2,3-{sup 13}C{sub 2}]-1-(1`-methyl-2`-pyrrolidinyl)propan-2-one; {l_brace}(R,S)-[2`,3`-{sup 13}C{sub 2}]hygrinePound right bracePound

Energy Technology Data Exchange (ETDEWEB)

Abraham, T.W.; Leete, Edward [Minnesota Univ., Minneapolis, MN (United States). Dept. of Chemistry

1996-05-01

2-Ethoxy-1-methyl-5-pyrrolidinone (1) was reacted with ethyl [3,4-{sup 13}C{sub 2}]-acetoacetate (2) in the presence of TiCl{sub 4} to give ethyl [3,4-{sup 13}C{sub 2}]-2-(1`-methyl-5`-oxo-2`-pyrrolidinyl)-3-oxobutanoate (3) in 85% yield. Decarboethoxylation of ethyl [3,4-{sup 13}C{sub 2}]-2-(1`-methyl-5`-oxo-2`-pyrrolidinyl)-3-oxobutan-oate (3) was accomplished using NaCl and H{sub 2}O in DMSO to give (R,S)-[2,3-{sup 13}C{sub 2}]-1-(1`-methyl-5`-oxo-2`-pyrrolidinyl)propan-2-o ne (4) in 91% yield. Protection of the ketone as a ketal (ethylene glycol, H{sup +}), followed by reduction of the amide to the amine using LiAlH{sub 4} and subsequent deprotection of the ketal gave (R,S)-[2,3-{sup 13}C{sub 2}]-1-(1`-methyl-2`-pyrrolidinyl)propan-2-one ((R,s)-[2`, 3`-{sup 13}C{sub 2}]Hygrine) (8) in 78% yield. (61% overall yield from ethyl [3,4-{sup 13}C{sub 2}]acetoacetate). (Author).
14C/C measurements support Andreev's internode method to determine lichen growth rates in Cladina stygia (Fr.) Ahti

Energy Technology Data Exchange (ETDEWEB)

Holt, E; Bench, G

2007-12-05

Growth rates and the ability to date an organism can greatly contribute to understanding its population biology and community dynamics. 1n 1954, Andreev proposed a method to date Cladina, a fruticose lichen, using total thallus length and number of internodes. No research, however, has demonstrated the reliability of this technique or compared its estimates to those derived by other means. In this study, we demonstrate the utility of {sup 14}C/C ratios to determine lichen age and growth rate in Cladina stygia (Fr.) Ahti collected from northwestern Alaska, USA. The average growth rate using {sup 14}C/C ratios was 6.5 mm {center_dot} yr{sup -1}, which was not significantly different from growth rates derived by Andreev's internode method (average = 6.2 mm {center_dot} yr{sup -1}); thus, suggesting the reliability of Andreev's simple field method for dating lichens. In addition, we found lichen growth rates appeared to differ with geographic location, yet did not seem related to ambient temperature and total precipitation.
Saturn V First Stage (S-1C) At MSFC

Science.gov (United States)

1960-01-01

This small group of unidentified officials is dwarfed by the gigantic size of the Saturn V first stage (S-1C) at the shipping area of the Manufacturing Engineering Laboratory at Marshall Space Flight Center in Huntsville, Alabama. The towering 363-foot Saturn V was a multi-stage, multi-engine launch vehicle standing taller than the Statue of Liberty. Altogether, the Saturn V engines produced as much power as 85 Hoover Dams.
Observation of the $B^0_s \\to \\eta_c \\phi$ decay with the LHCb experiment

CERN Document Server

AUTHOR|(INSPIRE)INSPIRE-00536869

The interference between $B^0_s$ meson decay amplitudes to CP final state directly or via mixing gives rise to a measurable CP-violating phase $\\phi_s$, which is predicted to be $\\phi_s^{SM} = (-0.0370\\pm0.0006)~\\mathrm{rad}$ in the Standard Model. However, such process may receive contributions from New Physics and change the value of $\\phi_s$. At present, the most precise measurement of $\\phi_s$ is given by the LHCb experiment and the world average is $\\phi_s^{\\rm{exp}} = (-0.021\\pm 0.032)~\\mathrm{rad}$, with uncertainty still dominated by the statistics. In this context, a study of $B^0_s \\to \\eta_c \\phi$ decays is performed using $pp$ collision data corresponding to an integrated luminosity of~3.0\\,fb$^{-1}$, collected with the LHCb detector during the Run~1 of the LHC. The observation of the decay $B^0_s \\to \\eta_c \\phi$ is reported, where the $\\eta_c$ meson is reconstructed in the $p\\bar{p}$, $K^+K^-\\pi^+\\pi^-$, $\\pi^+\\pi^-\\pi^+\\pi^-$ and $K^+K^-K^+K^-$ decay modes and the $\\phi(1020)$ in t...
The modified Cassie’s equation and contact angle hysteresis

KAUST Repository

Xu, Xianmin

2012-08-29

In this paper, we derive a modified Cassie\\'s equation for wetting on chemically patterned surfaces from a homogenization approach. The derivation reveals that effective contact angle is a local average of the static contact angle along the contact line which describes all possible equilibrium states including the local minimum of the free energy of the system. The usual Cassie\\'s state which corresponds to the global minimum is only a special case. We then discuss the contact angle hysteresis on chemically patterned surfaces. © 2012 Springer-Verlag.
1,5-Bis(1-phenyl-ethyl-idene)thio-carbono-hydrazide.

Science.gov (United States)

Feng, Lei; Ji, Haiwei; Wang, Renliang; Ge, Haiyan; Li, Li

2011-06-01

The title mol-ecule, C(17)H(18)N(4)S, is not planar, as indicated by the dihedral angle of 27.24 (9)° between the two benzene rings. In the crystal, inter-molecular N-H⋯S hydrogen bonds link pairs of mol-ecules into inversion dimers.
S,O-Ligand-Promoted Palladium-Catalyzed C-H Functionalization Reactions of Nondirected Arenes

NARCIS (Netherlands)

Naksomboon, K.; Valderas, C.; Gomez-Martinez, M.; Alvarez-Casao, Y.; Fernández Ibáñez, M.A.

Pd(II)-catalyzed C-H functionalization of non directed arenes has been realized using an inexpensive and easily accessible type of bidentate S,O-ligand. The catalytic system shows high efficiency in the C-H olefination reaction of electron-rich and electron-poor arenes. This methodology is
PONDEROSA-C/S: client-server based software package for automated protein 3D structure determination.

Science.gov (United States)

Lee, Woonghee; Stark, Jaime L; Markley, John L

2014-11-01

Peak-picking Of Noe Data Enabled by Restriction Of Shift Assignments-Client Server (PONDEROSA-C/S) builds on the original PONDEROSA software (Lee et al. in Bioinformatics 27:1727-1728. doi: 10.1093/bioinformatics/btr200, 2011) and includes improved features for structure calculation and refinement. PONDEROSA-C/S consists of three programs: Ponderosa Server, Ponderosa Client, and Ponderosa Analyzer. PONDEROSA-C/S takes as input the protein sequence, a list of assigned chemical shifts, and nuclear Overhauser data sets ((13)C- and/or (15)N-NOESY). The output is a set of assigned NOEs and 3D structural models for the protein. Ponderosa Analyzer supports the visualization, validation, and refinement of the results from Ponderosa Server. These tools enable semi-automated NMR-based structure determination of proteins in a rapid and robust fashion. We present examples showing the use of PONDEROSA-C/S in solving structures of four proteins: two that enable comparison with the original PONDEROSA package, and two from the Critical Assessment of automated Structure Determination by NMR (Rosato et al. in Nat Methods 6:625-626. doi: 10.1038/nmeth0909-625 , 2009) competition. The software package can be downloaded freely in binary format from http://pine.nmrfam.wisc.edu/download_packages.html. Registered users of the National Magnetic Resonance Facility at Madison can submit jobs to the PONDEROSA-C/S server at http://ponderosa.nmrfam.wisc.edu, where instructions, tutorials, and instructions can be found. Structures are normally returned within 1-2 days.
Convenient synthesis of magnetically recyclable Fe{sub 3}O{sub 4}@C@CdS photocatalysts by depositing CdS nanocrystals on carbonized ferrocene

Energy Technology Data Exchange (ETDEWEB)

Li, Dan [Institute of Physical Chemistry, Zhejiang Normal University, Jinhua, Zhejiang 321004 (China); Xie, Jianjian [Department of Materials Physics, Zhejiang Normal University, Jinhua, Zhejiang 321004 (China); Zhang, Yong; Qiao, Ru [Institute of Physical Chemistry, Zhejiang Normal University, Jinhua, Zhejiang 321004 (China); Li, Sheng [Department of Materials Physics, Zhejiang Normal University, Jinhua, Zhejiang 321004 (China); Li, Zhengquan, E-mail: zqli@zjnu.edu.cn [Institute of Physical Chemistry, Zhejiang Normal University, Jinhua, Zhejiang 321004 (China); Department of Materials Physics, Zhejiang Normal University, Jinhua, Zhejiang 321004 (China)

2015-10-15

Development of magnetic visible-light-driven photocatalysts is desirable to the practical application of photocatalyts for collection and recycling use. Here we present a facile approach to synthesize Fe{sub 3}O{sub 4}@C@CdS magnetic photocatalysts which can avoid multi-step preparation process. Through one-step solvothermal carbonization of ferrocene, the produced carbon-coated Fe{sub 3}O{sub 4} clusters can serve as both magnetic cores and deposition substrates for in situ generating crystalline CdS nanocrystals on them by rapid microwave irradiation. The prepared Fe{sub 3}O{sub 4}@C@CdS nanoparticles exhibit a uniform core–shell structure and display good photocatalytic activity and recyclability in the degradation of organic dyes. These magnetic photocatalysts may find potential application in wastewater treatment for the future environment remedy. - Highlights: • A rapid strategy is presented to obtain multifunctional core–shell nanostructures. • Magnetic visible-light-driven Fe{sub 3}O{sub 4}@C@CdS nanophotocatalysts are synthesized. • Carbonized ferrocene can provide both magnetic cores and good deposition substrate. • Photocatalytic and recyclable properties of Fe{sub 3}O{sub 4}@C@CdS nanoparticles are explored.
Thermodynamic description of the solubility of C-S-H gels in hydrated Portland cement. Literature review

International Nuclear Information System (INIS)

Soler, J.M.

2007-11-01

The objective of this study is to compile the available information published in the scientific literature regarding the solubility of C-S-H (calcium silica hydrate) gels, which are the main components of hydrated Portland cement. Modeling the thermodynamic properties of C-S-H, including its incongruent dissolution behavior, is an important requirement to understand the evolution and degradation of hydrated cement and concrete. The thermodynamic modeling of C-S-H started with the use of empirical or semi-empirical models and evolved to the application of solid solution models. Most of the experimental work has been performed at or near 25 deg C and the models are in principle applicable to temperatures near 25 deg C. One of the models provides an explicit dependence on temperature. (orig.)
On the fine spectrum of the generalized difference operator B(r,s over the sequence spaces c0 and c

Directory of Open Access Journals (Sweden)

Bilâl Altay

2005-01-01

Full Text Available We determine the fine spectrum of the generalized difference operator B(r,s defined by a band matrix over the sequence spaces c0 and c, and derive a Mercerian theorem. This generalizes our earlier work (2004 for the difference operator Δ, and includes as other special cases the right shift and the Zweier matrices.
Leaching of both calcium hydroxide and C-S-H from cement paste: Modeling the mechanical behavior

International Nuclear Information System (INIS)

Carde, C.; Torrenti, J.M.; Francois, R.

1996-01-01

This paper deals with the effect of the leaching process of cement based materials on their mechanical properties. This process induces mainly a total leaching of Ca(OH) 2 and a progressive decalcification of C-S-H which leads to a gradient of C/S ratio in the leaching zone. In a previous work, the authors venture the hypothesis that the dissolution of calcium hydroxide was the essential parameter governing both decrease in strength and increase in porosity in the case of a paste sample made with an OPC cement which leads to a 20% content of calcium. In order to quantify the effect of the decrease of C/S ratio in C-S-H, the authors have performed experiments on paste samples with the admixture of silica fume to reduce the content of calcium hydroxide and thus emphasize the effect of C/S ratio decrease of the C-S-H. The leaching process was achieved by the use of a 50% concentrate solution of ammonium nitrate. Compression tests were conducted on micro-cylinder samples (10, 12, 14, 20 and 30 mm of diameter) because of the slow kinetics of degradation due to the leaching. The deterioration of the cement paste and the mortar exposed to the action of the ammonium nitrate was indicated by a peripheral zone of less resistance. The experimental results allow the modeling of the mechanical behavior of cement pastes in relation to the ratio of degraded area over total area of the sample A d /A t . The model thus defined allows separation of the effect of calcium hydroxide leaching and C-S-H leaching, and shows the importance of the first one. The current research program tries to characterize the deterioration of the mechanical properties of the concrete surrounding radioactive wastes, due to the water flow during storage
Distinct pathogenesis and host responses during infection of C. elegans by P. aeruginosa and S. aureus.

Science.gov (United States)

Irazoqui, Javier E; Troemel, Emily R; Feinbaum, Rhonda L; Luhachack, Lyly G; Cezairliyan, Brent O; Ausubel, Frederick M

2010-07-01

The genetically tractable model host Caenorhabditis elegans provides a valuable tool to dissect host-microbe interactions in vivo. Pseudomonas aeruginosa and Staphylococcus aureus utilize virulence factors involved in human disease to infect and kill C. elegans. Despite much progress, virtually nothing is known regarding the cytopathology of infection and the proximate causes of nematode death. Using light and electron microscopy, we found that P. aeruginosa infection entails intestinal distention, accumulation of an unidentified extracellular matrix and P. aeruginosa-synthesized outer membrane vesicles in the gut lumen and on the apical surface of intestinal cells, the appearance of abnormal autophagosomes inside intestinal cells, and P. aeruginosa intracellular invasion of C. elegans. Importantly, heat-killed P. aeruginosa fails to elicit a significant host response, suggesting that the C. elegans response to P. aeruginosa is activated either by heat-labile signals or pathogen-induced damage. In contrast, S. aureus infection causes enterocyte effacement, intestinal epithelium destruction, and complete degradation of internal organs. S. aureus activates a strong transcriptional response in C. elegans intestinal epithelial cells, which aids host survival during infection and shares elements with human innate responses. The C. elegans genes induced in response to S. aureus are mostly distinct from those induced by P. aeruginosa. In contrast to P. aeruginosa, heat-killed S. aureus activates a similar response as live S. aureus, which appears to be independent of the single C. elegans Toll-Like Receptor (TLR) protein. These data suggest that the host response to S. aureus is possibly mediated by pathogen-associated molecular patterns (PAMPs). Because our data suggest that neither the P. aeruginosa nor the S. aureus-triggered response requires canonical TLR signaling, they imply the existence of unidentified mechanisms for pathogen detection in C. elegans, with
Distinct pathogenesis and host responses during infection of C. elegans by P. aeruginosa and S. aureus.

Directory of Open Access Journals (Sweden)

Javier E Irazoqui

2010-07-01

Full Text Available The genetically tractable model host Caenorhabditis elegans provides a valuable tool to dissect host-microbe interactions in vivo. Pseudomonas aeruginosa and Staphylococcus aureus utilize virulence factors involved in human disease to infect and kill C. elegans. Despite much progress, virtually nothing is known regarding the cytopathology of infection and the proximate causes of nematode death. Using light and electron microscopy, we found that P. aeruginosa infection entails intestinal distention, accumulation of an unidentified extracellular matrix and P. aeruginosa-synthesized outer membrane vesicles in the gut lumen and on the apical surface of intestinal cells, the appearance of abnormal autophagosomes inside intestinal cells, and P. aeruginosa intracellular invasion of C. elegans. Importantly, heat-killed P. aeruginosa fails to elicit a significant host response, suggesting that the C. elegans response to P. aeruginosa is activated either by heat-labile signals or pathogen-induced damage. In contrast, S. aureus infection causes enterocyte effacement, intestinal epithelium destruction, and complete degradation of internal organs. S. aureus activates a strong transcriptional response in C. elegans intestinal epithelial cells, which aids host survival during infection and shares elements with human innate responses. The C. elegans genes induced in response to S. aureus are mostly distinct from those induced by P. aeruginosa. In contrast to P. aeruginosa, heat-killed S. aureus activates a similar response as live S. aureus, which appears to be independent of the single C. elegans Toll-Like Receptor (TLR protein. These data suggest that the host response to S. aureus is possibly mediated by pathogen-associated molecular patterns (PAMPs. Because our data suggest that neither the P. aeruginosa nor the S. aureus-triggered response requires canonical TLR signaling, they imply the existence of unidentified mechanisms for pathogen detection in C
Osteoclastos: mucho más que células remodeladoras del hueso

OpenAIRE

Arboleya, L.; Castañeda, S.

2014-01-01

El osteoclasto ha sido considerado clásicamente como una célula con una función exclusivamente remodeladora del hueso, de comportamiento gregario. Sin embargo, los avances que se han ido produciendo en los últimos años han ido cambiando drásticamente este concepto y, en el momento actual, sabemos que esta célula multinucleada está sometida a una compleja regulación biológica, necesaria para ejercer un papel multifuncional de dimensiones desconocidas. Además de su participación como la única c...

C. S. Lewis, Reluctant Convert and (not so Ordinary Anglican

Directory of Open Access Journals (Sweden)

Mănăstireanu Dănuţ

2014-12-01

Full Text Available After some passing considerations on the reception of Lewis in Romania, the present paper discusses the role played by Anglicanism in the late personal commitment of C.S. Lewis to the Christian faith, after years of atheism, scepticism, and agnosticism. It argues that in fact Anglicanism contributed very little to Lewis’s (reconversion to Christianity. Furthermore, the paper agrees with the generally accepted idea that the particular calling that Lewis felt he had, that of being a Christian apologist, made him wary of being associated with the defence of any specific Christian tradition. In virtue of this special calling, Lewis also reacted quite strongly against certain aspects of Anglicanism, like, for instance, the ordination of women to priesthood, which he perceived as an obstacle to ecumenism and, implicitly, to an effective defence of the Christian faith in the public arena. In spite of all this, there is little doubt that Lewis has fully and unreservedly adopted Anglicanism as his preferred version of Christianity. From this particular stance, the life and ministry of C.S. Lewis made a huge public impact in the twentieth century and beyond. In light of the undeniable influence he had on the intellectual and religious scene in the last hundred years, one may ask not so much how Anglican was Lewis, but, rather, ‘why isn’t Anglicanism more like Lewis’.
Measurement of $\\chi_{c1}$ and $\\chi_{c2}$ production with $\\sqrt{s}=7$ TeV $pp$ collisions at ATLAS

CERN Document Server

Aad, Georges; Abbott, Brad; Abdallah, Jalal; Abdel Khalek, Samah; Abdinov, Ovsat; Aben, Rosemarie; Abi, Babak; Abolins, Maris; AbouZeid, Ossama; Abramowicz, Halina; Abreu, Henso; Abulaiti, Yiming; Acharya, Bobby Samir; Adamczyk, Leszek; Adams, David; Addy, Tetteh; Adelman, Jahred; Adomeit, Stefanie; Adye, Tim; Aefsky, Scott; Agatonovic-Jovin, Tatjana; Aguilar-Saavedra, Juan Antonio; Agustoni, Marco; Ahlen, Steven; Ahmad, Ashfaq; Ahmadov, Faig; Aielli, Giulio; {\\AA}kesson, Torsten Paul Ake; Akimoto, Ginga; Akimov, Andrei; Alam, Muhammad Aftab; Albert, Justin; Albrand, Solveig; Alconada Verzini, Maria Josefina; Aleksa, Martin; Aleksandrov, Igor; Alessandria, Franco; Alexa, Calin; Alexander, Gideon; Alexandre, Gauthier; Alexopoulos, Theodoros; Alhroob, Muhammad; Aliev, Malik; Alimonti, Gianluca; Alio, Lion; Alison, John; Allbrooke, Benedict; Allison, Lee John; Allport, Phillip; Allwood-Spiers, Sarah; Almond, John; Aloisio, Alberto; Alon, Raz; Alonso, Alejandro; Alonso, Francisco; Altheimer, Andrew David; Alvarez Gonzalez, Barbara; Alviggi, Mariagrazia; Amako, Katsuya; Amaral Coutinho, Yara; Amelung, Christoph; Ammosov, Vladimir; Amor Dos Santos, Susana Patricia; Amorim, Antonio; Amoroso, Simone; Amram, Nir; Amundsen, Glenn; Anastopoulos, Christos; Ancu, Lucian Stefan; Andari, Nansi; Andeen, Timothy; Anders, Christoph Falk; Anders, Gabriel; Anderson, Kelby; Andreazza, Attilio; Andrei, George Victor; Anduaga, Xabier; Angelidakis, Stylianos; Anger, Philipp; Angerami, Aaron; Anghinolfi, Francis; Anisenkov, Alexey; Anjos, Nuno; Annovi, Alberto; Antonaki, Ariadni; Antonelli, Mario; Antonov, Alexey; Antos, Jaroslav; Anulli, Fabio; Aoki, Masato; Aperio Bella, Ludovica; Apolle, Rudi; Arabidze, Giorgi; Aracena, Ignacio; Arai, Yasuo; Arce, Ayana; Arfaoui, Samir; Arguin, Jean-Francois; Argyropoulos, Spyridon; Arik, Engin; Arik, Metin; Armbruster, Aaron James; Arnaez, Olivier; Arnal, Vanessa; Arslan, Ozan; Artamonov, Andrei; Artoni, Giacomo; Asai, Shoji; Asbah, Nedaa; Ask, Stefan; {\\AA}sman, Barbro; Asquith, Lily; Assamagan, Ketevi; Astalos, Robert; Astbury, Alan; Atkinson, Markus; Atlay, Naim Bora; Auerbach, Benjamin; Auge, Etienne; Augsten, Kamil; Aurousseau, Mathieu; Avolio, Giuseppe; Azuelos, Georges; Azuma, Yuya; Baak, Max; Bacci, Cesare; Bach, Andre; Bachacou, Henri; Bachas, Konstantinos; Backes, Moritz; Backhaus, Malte; Backus Mayes, John; Badescu, Elisabeta; Bagiacchi, Paolo; Bagnaia, Paolo; Bai, Yu; Bailey, David; Bain, Travis; Baines, John; Baker, Oliver Keith; Baker, Sarah; Balek, Petr; Balli, Fabrice; Banas, Elzbieta; Banerjee, Swagato; Banfi, Danilo; Bangert, Andrea Michelle; Bansal, Vikas; Bansil, Hardeep Singh; Barak, Liron; Baranov, Sergei; Barber, Tom; Barberio, Elisabetta Luigia; Barberis, Dario; Barbero, Marlon; Barillari, Teresa; Barisonzi, Marcello; Barklow, Timothy; Barlow, Nick; Barnett, Bruce; Barnett, Michael; Baroncelli, Antonio; Barone, Gaetano; Barr, Alan; Barreiro, Fernando; Barreiro Guimaraes da Costa, Joao; Bartoldus, Rainer; Barton, Adam Edward; Bartos, Pavol; Bartsch, Valeria; Bassalat, Ahmed; Basye, Austin; Bates, Richard; Batkova, Lucia; Batley, Richard; Battistin, Michele; Bauer, Florian; Bawa, Harinder Singh; Beau, Tristan; Beauchemin, Pierre-Hugues; Beccherle, Roberto; Bechtle, Philip; Beck, Hans Peter; Becker, Anne Kathrin; Becker, Sebastian; Beckingham, Matthew; Beddall, Andrew; Beddall, Ayda; Bedikian, Sourpouhi; Bednyakov, Vadim; Bee, Christopher; Beemster, Lars; Beermann, Thomas; Begel, Michael; Behr, Katharina; Belanger-Champagne, Camille; Bell, Paul; Bell, William; Bella, Gideon; Bellagamba, Lorenzo; Bellerive, Alain; Bellomo, Massimiliano; Belloni, Alberto; Beloborodova, Olga; Belotskiy, Konstantin; Beltramello, Olga; Benary, Odette; Benchekroun, Driss; Bendtz, Katarina; Benekos, Nektarios; Benhammou, Yan; Benhar Noccioli, Eleonora; Benitez Garcia, Jorge-Armando; Benjamin, Douglas; Bensinger, James; Benslama, Kamal; Bentvelsen, Stan; Berge, David; Bergeaas Kuutmann, Elin; Berger, Nicolas; Berghaus, Frank; Berglund, Elina; Beringer, Jurg; Bernard, Clare; Bernat, Pauline; Bernhard, Ralf; Bernius, Catrin; Bernlochner, Florian Urs; Berry, Tracey; Berta, Peter; Bertella, Claudia; Bertolucci, Federico; Besana, Maria Ilaria; Besjes, Geert-Jan; Bessidskaia, Olga; Besson, Nathalie; Bethke, Siegfried; Bhimji, Wahid; Bianchi, Riccardo-Maria; Bianchini, Louis; Bianco, Michele; Biebel, Otmar; Bieniek, Stephen Paul; Bierwagen, Katharina; Biesiada, Jed; Biglietti, Michela; Bilbao De Mendizabal, Javier; Bilokon, Halina; Bindi, Marcello; Binet, Sebastien; Bingul, Ahmet; Bini, Cesare; Bittner, Bernhard; Black, Curtis; Black, James; Black, Kevin; Blackburn, Daniel; Blair, Robert; Blanchard, Jean-Baptiste; Blazek, Tomas; Bloch, Ingo; Blocker, Craig; Blum, Walter; Blumenschein, Ulrike; Bobbink, Gerjan; Bobrovnikov, Victor; Bocchetta, Simona Serena; Bocci, Andrea; Boddy, Christopher Richard; Boehler, Michael; Boek, Jennifer; Boek, Thorsten Tobias; Boelaert, Nele; Bogaerts, Joannes Andreas; Bogdanchikov, Alexander; Bogouch, Andrei; Bohm, Christian; Bohm, Jan; Boisvert, Veronique; Bold, Tomasz; Boldea, Venera; Boldyrev, Alexey; Bolnet, Nayanka Myriam; Bomben, Marco; Bona, Marcella; Boonekamp, Maarten; Bordoni, Stefania; Borer, Claudia; Borisov, Anatoly; Borissov, Guennadi; Borri, Marcello; Borroni, Sara; Bortfeldt, Jonathan; Bortolotto, Valerio; Bos, Kors; Boscherini, Davide; Bosman, Martine; Boterenbrood, Hendrik; Bouchami, Jihene; Boudreau, Joseph; Bouhova-Thacker, Evelina Vassileva; Boumediene, Djamel Eddine; Bourdarios, Claire; Bousson, Nicolas; Boutouil, Sara; Boveia, Antonio; Boyd, James; Boyko, Igor; Bozovic-Jelisavcic, Ivanka; Bracinik, Juraj; Branchini, Paolo; Brandt, Andrew; Brandt, Gerhard; Brandt, Oleg; Bratzler, Uwe; Brau, Benjamin; Brau, James; Braun, Helmut; Brazzale, Simone Federico; Brelier, Bertrand; Brendlinger, Kurt; Brenner, Richard; Bressler, Shikma; Bristow, Timothy Michael; Britton, Dave; Brochu, Frederic; Brock, Ian; Brock, Raymond; Broggi, Francesco; Bromberg, Carl; Bronner, Johanna; Brooijmans, Gustaaf; Brooks, Timothy; Brooks, William; Brosamer, Jacquelyn; Brost, Elizabeth; Brown, Gareth; Brown, Jonathan; Bruckman de Renstrom, Pawel; Bruncko, Dusan; Bruneliere, Renaud; Brunet, Sylvie; Bruni, Alessia; Bruni, Graziano; Bruschi, Marco; Bryngemark, Lene; Buanes, Trygve; Buat, Quentin; Bucci, Francesca; Buchholz, Peter; Buckingham, Ryan; Buckley, Andrew; Buda, Stelian Ioan; Budagov, Ioulian; Budick, Burton; Buehrer, Felix; Bugge, Lars; Bugge, Magnar Kopangen; Bulekov, Oleg; Bundock, Aaron Colin; Bunse, Moritz; Burckhart, Helfried; Burdin, Sergey; Burgess, Thomas; Burghgrave, Blake; Burke, Stephen; Burmeister, Ingo; Busato, Emmanuel; Buscher, Volker; Bussey, Peter; Buszello, Claus-Peter; Butler, Bart; Butler, John; Butt, Aatif Imtiaz; Buttar, Craig; Butterworth, Jonathan; Buttinger, William; Buzatu, Adrian; Byszewski, Marcin; Cabrera Urb\\'an, Susana; Caforio, Davide; Cakir, Orhan; Calafiura, Paolo; Calderini, Giovanni; Calfayan, Philippe; Calkins, Robert; Caloba, Luiz; Caloi, Rita; Calvet, David; Calvet, Samuel; Camacho Toro, Reina; Camarri, Paolo; Cameron, David; Caminada, Lea Michaela; Caminal Armadans, Roger; Campana, Simone; Campanelli, Mario; Canale, Vincenzo; Canelli, Florencia; Canepa, Anadi; Cantero, Josu; Cantrill, Robert; Cao, Tingting; Capeans Garrido, Maria Del Mar; Caprini, Irinel; Caprini, Mihai; Capua, Marcella; Caputo, Regina; Cardarelli, Roberto; Carli, Tancredi; Carlino, Gianpaolo; Carminati, Leonardo; Caron, Sascha; Carquin, Edson; Carrillo-Montoya, German D; Carter, Antony; Carter, Janet; Carvalho, Joao; Casadei, Diego; Casado, Maria Pilar; Caso, Carlo; Castaneda-Miranda, Elizabeth; Castelli, Angelantonio; Castillo Gimenez, Victoria; Castro, Nuno Filipe; Catastini, Pierluigi; Catinaccio, Andrea; Catmore, James; Cattai, Ariella; Cattani, Giordano; Caughron, Seth; Cavaliere, Viviana; Cavalli, Donatella; Cavalli-Sforza, Matteo; Cavasinni, Vincenzo; Ceradini, Filippo; Cerio, Benjamin; Cerny, Karel; Santiago Cerqueira, Augusto; Cerri, Alessandro; Cerrito, Lucio; Cerutti, Fabio; Cervelli, Alberto; Cetin, Serkant Ali; Chafaq, Aziz; Chakraborty, Dhiman; Chalupkova, Ina; Chan, Kevin; Chang, Philip; Chapleau, Bertrand; Chapman, John Derek; Charfeddine, Driss; Charlton, Dave; Chavda, Vikash; Chavez Barajas, Carlos Alberto; Cheatham, Susan; Chekanov, Sergei; Chekulaev, Sergey; Chelkov, Gueorgui; Chelstowska, Magda Anna; Chen, Chunhui; Chen, Hucheng; Chen, Karen; Chen, Liming; Chen, Shenjian; Chen, Xin; Chen, Yujiao; Cheng, Yangyang; Cheplakov, Alexander; Cherkaoui El Moursli, Rajaa; Chernyatin, Valeriy; Cheu, Elliott; Chevalier, Laurent; Chiarella, Vitaliano; Chiefari, Giovanni; Childers, John Taylor; Chilingarov, Alexandre; Chiodini, Gabriele; Chisholm, Andrew; Chislett, Rebecca Thalatta; Chitan, Adrian; Chizhov, Mihail; Chouridou, Sofia; Chow, Bonnie Kar Bo; Christidi, Ilektra-Athanasia; Chromek-Burckhart, Doris; Chu, Ming-Lee; Chudoba, Jiri; Ciapetti, Guido; Ciftci, Abbas Kenan; Ciftci, Rena; Cinca, Diane; Cindro, Vladimir; Ciocio, Alessandra; Cirilli, Manuela; Cirkovic, Predrag; Citron, Zvi Hirsh; Citterio, Mauro; Ciubancan, Mihai; Clark, Allan G; Clark, Philip James; Clarke, Robert; Cleland, Bill; Clemens, Jean-Claude; Clement, Benoit; Clement, Christophe; Coadou, Yann; Cobal, Marina; Coccaro, Andrea; Cochran, James H; Coelli, Simone; Coffey, Laurel; Cogan, Joshua Godfrey; Coggeshall, James; Colas, Jacques; Cole, Brian; Cole, Stephen; Colijn, Auke-Pieter; Collins-Tooth, Christopher; Collot, Johann; Colombo, Tommaso; Colon, German; Compostella, Gabriele; Conde Muino, Patricia; Coniavitis, Elias; Conidi, Maria Chiara; Connelly, Ian; Consonni, Sofia Maria; Consorti, Valerio; Constantinescu, Serban; Conta, Claudio; Conti, Geraldine; Conventi, Francesco; Cooke, Mark; Cooper, Ben; Cooper-Sarkar, Amanda; Cooper-Smith, Neil; Copic, Katherine; Cornelissen, Thijs; Corradi, Massimo; Corriveau, Francois; Corso-Radu, Alina; Cortes-Gonzalez, Arely; Cortiana, Giorgio; Costa, Giuseppe; Costa, Mar\\'ia Jos\\'e; Costanzo, Davide; C\\^ot\\'e, David; Cottin, Giovanna; Courneyea, Lorraine; Cowan, Glen; Cox, Brian; Cranmer, Kyle; Cree, Graham; Cr\\'ep\\'e-Renaudin, Sabine; Crescioli, Francesco; Crispin Ortuzar, Mireia; Cristinziani, Markus; Crosetti, Giovanni; Cuciuc, Constantin-Mihai; Cuenca Almenar, Crist\\'obal; Cuhadar Donszelmann, Tulay; Cummings, Jane; Curatolo, Maria; Cuthbert, Cameron; Czirr, Hendrik; Czodrowski, Patrick; Czyczula, Zofia; D'Auria, Saverio; D'Onofrio, Monica; D'Orazio, Alessia; Da Cunha Sargedas De Sousa, Mario Jose; Da Via, Cinzia; Dabrowski, Wladyslaw; Dafinca, Alexandru; Dai, Tiesheng; Dallaire, Frederick; Dallapiccola, Carlo; Dam, Mogens; Daniells, Andrew Christopher; Dano Hoffmann, Maria; Dao, Valerio; Darbo, Giovanni; Darlea, Georgiana Lavinia; Darmora, Smita; Dassoulas, James; Davey, Will; David, Claire; Davidek, Tomas; Davies, Eleanor; Davies, Merlin; Davignon, Olivier; Davison, Adam; Davygora, Yuriy; Dawe, Edmund; Dawson, Ian; Daya-Ishmukhametova, Rozmin; De, Kaushik; de Asmundis, Riccardo; De Castro, Stefano; De Cecco, Sandro; de Graat, Julien; De Groot, Nicolo; de Jong, Paul; De La Taille, Christophe; De la Torre, Hector; De Lorenzi, Francesco; De Nooij, Lucie; De Pedis, Daniele; De Salvo, Alessandro; De Sanctis, Umberto; De Santo, Antonella; De Vivie De Regie, Jean-Baptiste; De Zorzi, Guido; Dearnaley, William James; Debbe, Ramiro; Debenedetti, Chiara; Dechenaux, Benjamin; Dedovich, Dmitri; Degenhardt, James; Del Peso, Jose; Del Prete, Tarcisio; Delemontex, Thomas; Deliot, Frederic; Deliyergiyev, Maksym; Dell'Acqua, Andrea; Dell'Asta, Lidia; Della Pietra, Massimo; della Volpe, Domenico; Delmastro, Marco; Delsart, Pierre-Antoine; Deluca, Carolina; Demers, Sarah; Demichev, Mikhail; Demilly, Aurelien; Demirkoz, Bilge; Denisov, Sergey; Derendarz, Dominik; Derkaoui, Jamal Eddine; Derue, Frederic; Dervan, Paul; Desch, Klaus Kurt; Deviveiros, Pier-Olivier; Dewhurst, Alastair; DeWilde, Burton; Dhaliwal, Saminder; Dhullipudi, Ramasudhakar; Di Ciaccio, Anna; Di Ciaccio, Lucia; Di Domenico, Antonio; Di Donato, Camilla; Di Girolamo, Alessandro; Di Girolamo, Beniamino; Di Mattia, Alessandro; Di Micco, Biagio; Di Nardo, Roberto; Di Simone, Andrea; Di Sipio, Riccardo; Di Valentino, David; Diaz, Marco Aurelio; Diehl, Edward; Dietrich, Janet; Dietzsch, Thorsten; Diglio, Sara; Dindar Yagci, Kamile; Dingfelder, Jochen; Dionisi, Carlo; Dita, Petre; Dita, Sanda; Dittus, Fridolin; Djama, Fares; Djobava, Tamar; Barros do Vale, Maria Aline; Do Valle Wemans, Andr\\'e; Doan, Thi Kieu Oanh; Dobos, Daniel; Dobson, Ellie; Dodd, Jeremy; Doglioni, Caterina; Doherty, Tom; Dohmae, Takeshi; Dolejsi, Jiri; Dolezal, Zdenek; Dolgoshein, Boris; Donadelli, Marisilvia; Donati, Simone; Dondero, Paolo; Donini, Julien; Dopke, Jens; Doria, Alessandra; Dos Anjos, Andre; Dotti, Andrea; Dova, Maria-Teresa; Doyle, Tony; Dris, Manolis; Dubbert, Jorg; Dube, Sourabh; Dubreuil, Emmanuelle; Duchovni, Ehud; Duckeck, Guenter; Ducu, Otilia Anamaria; Duda, Dominik; Dudarev, Alexey; Dudziak, Fanny; Duflot, Laurent; Duguid, Liam; Duhrssen, Michael; Dunford, Monica; Duran Yildiz, Hatice; Duren, Michael; Dwuznik, Michal; Ebke, Johannes; Edson, William; Edwards, Clive; Edwards, Nicholas Charles; Ehrenfeld, Wolfgang; Eifert, Till; Eigen, Gerald; Einsweiler, Kevin; Eisenhandler, Eric; Ekelof, Tord; El Kacimi, Mohamed; Ellert, Mattias; Elles, Sabine; Ellinghaus, Frank; Ellis, Katherine; Ellis, Nicolas; Elmsheuser, Johannes; Elsing, Markus; Emeliyanov, Dmitry; Enari, Yuji; Endner, Oliver Chris; Endo, Masaki; Engelmann, Roderich; Erdmann, Johannes; Ereditato, Antonio; Eriksson, Daniel; Ernis, Gunar; Ernst, Jesse; Ernst, Michael; Ernwein, Jean; Errede, Deborah; Errede, Steven; Ertel, Eugen; Escalier, Marc; Esch, Hendrik; Escobar, Carlos; Espinal Curull, Xavier; Esposito, Bellisario; Etienne, Francois; Etienvre, Anne-Isabelle; Etzion, Erez; Evangelakou, Despoina; Evans, Hal; Fabbri, Laura; Facini, Gabriel; Fakhrutdinov, Rinat; Falciano, Speranza; Fang, Yaquan; Fanti, Marcello; Farbin, Amir; Farilla, Addolorata; Farooque, Trisha; Farrell, Steven; Farrington, Sinead; Farthouat, Philippe; Fassi, Farida; Fassnacht, Patrick; Fassouliotis, Dimitrios; Fatholahzadeh, Baharak; Favareto, Andrea; Fayard, Louis; Federic, Pavol; Fedin, Oleg; Fedorko, Wojciech; Fehling-Kaschek, Mirjam; Feligioni, Lorenzo; Feng, Cunfeng; Feng, Eric; Feng, Haolu; Fenyuk, Alexander; Fernando, Waruna; Ferrag, Samir; Ferrando, James; Ferrara, Valentina; Ferrari, Arnaud; Ferrari, Pamela; Ferrari, Roberto; Ferreira de Lima, Danilo Enoque; Ferrer, Antonio; Ferrere, Didier; Ferretti, Claudio; Ferretto Parodi, Andrea; Fiascaris, Maria; Fiedler, Frank; Filip\\v{c}i\\v{c}, Andrej; Filipuzzi, Marco; Filthaut, Frank; Fincke-Keeler, Margret; Finelli, Kevin Daniel; Fiolhais, Miguel; Fiorini, Luca; Firan, Ana; Fischer, Julia; Fisher, Matthew; Fitzgerald, Eric Andrew; Flechl, Martin; Fleck, Ivor; Fleischmann, Philipp; Fleischmann, Sebastian; Fletcher, Gareth Thomas; Fletcher, Gregory; Flick, Tobias; Floderus, Anders; Flores Castillo, Luis; Florez Bustos, Andres Carlos; Flowerdew, Michael; Fonseca Martin, Teresa; Formica, Andrea; Forti, Alessandra; Fortin, Dominique; Fournier, Daniel; Fox, Harald; Francavilla, Paolo; Franchini, Matteo; Franchino, Silvia; Francis, David; Franklin, Melissa; Franz, Sebastien; Fraternali, Marco; Fratina, Sasa; French, Sky; Friedrich, Conrad; Friedrich, Felix; Froidevaux, Daniel; Frost, James; Fukunaga, Chikara; Fullana Torregrosa, Esteban; Fulsom, Bryan Gregory; Fuster, Juan; Gabaldon, Carolina; Gabizon, Ofir; Gabrielli, Alessandro; Gabrielli, Andrea; Gadatsch, Stefan; Gadfort, Thomas; Gadomski, Szymon; Gagliardi, Guido; Gagnon, Pauline; Galea, Cristina; Galhardo, Bruno; Gallas, Elizabeth; Gallo, Valentina Santina; Gallop, Bruce; Gallus, Petr; Galster, Gorm Aske Gram Krohn; Gan, KK; Gandrajula, Reddy Pratap; Gao, Jun; Gao, Yongsheng; Garay Walls, Francisca; Garberson, Ford; Garc\\'ia, Carmen; Garc\\'ia Navarro, Jos\\'e Enrique; Garcia-Sciveres, Maurice; Gardner, Robert; Garelli, Nicoletta; Garonne, Vincent; Gatti, Claudio; Gaudio, Gabriella; Gaur, Bakul; Gauthier, Lea; Gauzzi, Paolo; Gavrilenko, Igor; Gay, Colin; Gaycken, Goetz; Gazis, Evangelos; Ge, Peng; Gecse, Zoltan; Gee, Norman; Geerts, Daniel Alphonsus Adrianus; Geich-Gimbel, Christoph; Gellerstedt, Karl; Gemme, Claudia; Gemmell, Alistair; Genest, Marie-H\\'el\\`ene; Gentile, Simonetta; George, Matthias; George, Simon; Gerbaudo, Davide; Gershon, Avi; Ghazlane, Hamid; Ghodbane, Nabil; Giacobbe, Benedetto; Giagu, Stefano; Giangiobbe, Vincent; Giannetti, Paola; Gianotti, Fabiola; Gibbard, Bruce; Gibson, Stephen; Gilchriese, Murdock; Gillam, Thomas; Gillberg, Dag; Gillman, Tony; Gingrich, Douglas; Giokaris, Nikos; Giordani, MarioPaolo; Giordano, Raffaele; Giorgi, Francesco Michelangelo; Giovannini, Paola; Giraud, Pierre-Francois; Giugni, Danilo; Giuliani, Claudia; Giunta, Michele; Gjelsten, B{\\o}rge Kile; Gkialas, Ioannis; Gladilin, Leonid; Glasman, Claudia; Glatzer, Julian; Glazov, Alexandre; Glonti, George; Goblirsch-Kolb, Maximilian; Goddard, Jack Robert; Godfrey, Jennifer; Godlewski, Jan; Goeringer, Christian; Goldfarb, Steven; Golling, Tobias; Golubkov, Dmitry; Gomes, Agostinho; Gomez Fajardo, Luz Stella; Gon\\c calo, Ricardo; Goncalves Pinto Firmino Da Costa, Joao; Gonella, Laura; Gonz\\'alez de la Hoz, Santiago; Gonzalez Parra, Garoe; Gonzalez Silva, Laura; Gonzalez-Sevilla, Sergio; Goodson, Jeremiah Jet; Goossens, Luc; Gorbounov, Petr Andreevich; Gordon, Howard; Gorelov, Igor; Gorfine, Grant; Gorini, Benedetto; Gorini, Edoardo; Gori\\v{s}ek, Andrej; Gornicki, Edward; Goshaw, Alfred; Gossling, Claus; Gostkin, Mikhail Ivanovitch; Gouighri, Mohamed; Goujdami, Driss; Goulette, Marc Phillippe; Goussiou, Anna; Goy, Corinne; Gozpinar, Serdar; Grabas, Herve Marie Xavier; Graber, Lars; Grabowska-Bold, Iwona; Grafstrom, Per; Grahn, Karl-Johan; Gramling, Johanna; Gramstad, Eirik; Grancagnolo, Francesco; Grancagnolo, Sergio; Grassi, Valerio; Gratchev, Vadim; Gray, Heather; Gray, Julia Ann; Graziani, Enrico; Grebenyuk, Oleg; Greenwood, Zeno Dixon; Gregersen, Kristian; Gregor, Ingrid-Maria; Grenier, Philippe; Griffiths, Justin; Grigalashvili, Nugzar; Grillo, Alexander; Grimm, Kathryn; Grinstein, Sebastian; Gris, Philippe Luc Yves; Grishkevich, Yaroslav; Grivaz, Jean-Francois; Grohs, Johannes Philipp; Grohsjean, Alexander; Gross, Eilam; Grosse-Knetter, Joern; Grossi, Giulio Cornelio; Groth-Jensen, Jacob; Grout, Zara Jane; Grybel, Kai; Guescini, Francesco; Guest, Daniel; Gueta, Orel; Guicheney, Christophe; Guido, Elisa; Guillemin, Thibault; Guindon, Stefan; Gul, Umar; Gumpert, Christian; Gunther, Jaroslav; Guo, Jun; Gupta, Shaun; Gutierrez, Phillip; Gutierrez Ortiz, Nicolas Gilberto; Gutschow, Christian; Guttman, Nir; Guyot, Claude; Gwenlan, Claire; Gwilliam, Carl; Haas, Andy; Haber, Carl; Hadavand, Haleh Khani; Haefner, Petra; Hageboeck, Stephan; Hajduk, Zbigniew; Hakobyan, Hrachya; Haleem, Mahsana; Hall, David; Halladjian, Garabed; Hamacher, Klaus; Hamal, Petr; Hamano, Kenji; Hamer, Matthias; Hamilton, Andrew; Hamilton, Samuel; Han, Liang; Hanagaki, Kazunori; Hanawa, Keita; Hance, Michael; Hanke, Paul; Hansen, John Renner; Hansen, J{\\o}rgen Beck; Hansen, Jorn Dines; Hansen, Peter Henrik; Hansson, Per; Hara, Kazuhiko; Hard, Andrew; Harenberg, Torsten; Harkusha, Siarhei; Harper, Devin; Harrington, Robert; Harris, Orin; Harrison, Paul Fraser; Hartjes, Fred; Harvey, Alex; Hasegawa, Satoshi; Hasegawa, Yoji; Hassani, Samira; Haug, Sigve; Hauschild, Michael; Hauser, Reiner; Havranek, Miroslav; Hawkes, Christopher; Hawkings, Richard John; Hawkins, Anthony David; Hayashi, Takayasu; Hayden, Daniel; Hays, Chris; Hayward, Helen; Haywood, Stephen; Head, Simon; Heck, Tobias; Hedberg, Vincent; Heelan, Louise; Heim, Sarah; Heinemann, Beate; Heisterkamp, Simon; Hejbal, Jiri; Helary, Louis; Heller, Claudio; Heller, Matthieu; Hellman, Sten; Hellmich, Dennis; Helsens, Clement; Henderson, James; Henderson, Robert; Henrichs, Anna; Henriques Correia, Ana Maria; Henrot-Versille, Sophie; Hensel, Carsten; Herbert, Geoffrey Henry; Medina Hernandez, Carlos; Hern\\'andez Jim\\'enez, Yesenia; Herrberg-Schubert, Ruth; Herten, Gregor; Hertenberger, Ralf; Hervas, Luis; Hesketh, Gavin Grant; Hessey, Nigel; Hickling, Robert; Hig\\'on-Rodriguez, Emilio; Hill, John; Hiller, Karl Heinz; Hillert, Sonja; Hillier, Stephen; Hinchliffe, Ian; Hines, Elizabeth; Hirose, Minoru; Hirschbuehl, Dominic; Hobbs, John; Hod, Noam; Hodgkinson, Mark; Hodgson, Paul; Hoecker, Andreas; Hoeferkamp, Martin; Hoffman, Julia; Hoffmann, Dirk; Hofmann, Julia Isabell; Hohlfeld, Marc; Holmes, Tova Ray; Hong, Tae Min; Hooft van Huysduynen, Loek; Hostachy, Jean-Yves; Hou, Suen; Hoummada, Abdeslam; Howard, Jacob; Howarth, James; Hrabovsky, Miroslav; Hristova, Ivana; Hrivnac, Julius; Hryn'ova, Tetiana; Hsu, Pai-hsien Jennifer; Hsu, Shih-Chieh; Hu, Diedi; Hu, Xueye; Huang, Yanping; Hubacek, Zdenek; Hubaut, Fabrice; Huegging, Fabian; Huettmann, Antje; Huffman, Todd Brian; Hughes, Emlyn; Hughes, Gareth; Huhtinen, Mika; Hulsing, Tobias Alexander; Hurwitz, Martina; Huseynov, Nazim; Huston, Joey; Huth, John; Iacobucci, Giuseppe; Iakovidis, Georgios; Ibragimov, Iskander; Iconomidou-Fayard, Lydia; Idarraga, John; Ideal, Emma; Iengo, Paolo; Igonkina, Olga; Iizawa, Tomoya; Ikegami, Yoichi; Ikematsu, Katsumasa; Ikeno, Masahiro; Iliadis, Dimitrios; Ilic, Nikolina; Inamaru, Yuki; Ince, Tayfun; Ioannou, Pavlos; Iodice, Mauro; Iordanidou, Kalliopi; Ippolito, Valerio; Irles Quiles, Adrian; Isaksson, Charlie; Ishino, Masaya; Ishitsuka, Masaki; Ishmukhametov, Renat; Issever, Cigdem; Istin, Serhat; Ivashin, Anton; Iwanski, Wieslaw; Iwasaki, Hiroyuki; Izen, Joseph; Izzo, Vincenzo; Jackson, Brett; Jackson, John; Jackson, Matthew; Jackson, Paul; Jaekel, Martin; Jain, Vivek; Jakobs, Karl; Jakobsen, Sune; Jakoubek, Tomas; Jakubek, Jan; Jamin, David Olivier; Jana, Dilip; Jansen, Eric; Jansen, Hendrik; Janssen, Jens; Janus, Michel; Jared, Richard; Jarlskog, Goran; Jeanty, Laura; Jeng, Geng-yuan; Jen-La Plante, Imai; Jennens, David; Jenni, Peter; Jentzsch, Jennifer; Jeske, Carl; J\\'ez\\'equel, St\\'ephane; Jha, Manoj Kumar; Ji, Haoshuang; Ji, Weina; Jia, Jiangyong; Jiang, Yi; Jimenez Belenguer, Marcos; Jin, Shan; Jinaru, Adam; Jinnouchi, Osamu; Joergensen, Morten Dam; Joffe, David; Johansson, Erik; Johansson, Per; Johns, Kenneth; Jon-And, Kerstin; Jones, Graham; Jones, Roger; Jones, Tim; Jorge, Pedro; Joshi, Kiran Daniel; Jovicevic, Jelena; Ju, Xiangyang; Jung, Christian; Jungst, Ralph Markus; Jussel, Patrick; Juste Rozas, Aurelio; Kaci, Mohammed; Kaczmarska, Anna; Kadlecik, Peter; Kado, Marumi; Kagan, Harris; Kagan, Michael; Kajomovitz, Enrique; Kalinin, Sergey; Kama, Sami; Kanaya, Naoko; Kaneda, Michiru; Kaneti, Steven; Kanno, Takayuki; Kantserov, Vadim; Kanzaki, Junichi; Kaplan, Benjamin; Kapliy, Anton; Kar, Deepak; Karakostas, Konstantinos; Karastathis, Nikolaos; Karnevskiy, Mikhail; Karpov, Sergey; Karthik, Krishnaiyengar; Kartvelishvili, Vakhtang; Karyukhin, Andrey; Kashif, Lashkar; Kasieczka, Gregor; Kass, Richard; Kastanas, Alex; Kataoka, Yousuke; Katre, Akshay; Katzy, Judith; Kaushik, Venkatesh; Kawagoe, Kiyotomo; Kawamoto, Tatsuo; Kawamura, Gen; Kazama, Shingo; Kazanin, Vassili; Kazarinov, Makhail; Keeler, Richard; Keener, Paul; Kehoe, Robert; Keil, Markus; Keller, John; Keoshkerian, Houry; Kepka, Oldrich; Ker\\v{s}evan, Borut Paul; Kersten, Susanne; Kessoku, Kohei; Keung, Justin; Khalil-zada, Farkhad; Khandanyan, Hovhannes; Khanov, Alexander; Kharchenko, Dmitri; Khodinov, Alexander; Khomich, Andrei; Khoo, Teng Jian; Khoriauli, Gia; Khoroshilov, Andrey; Khovanskiy, Valery; Khramov, Evgeniy; Khubua, Jemal; Kim, Hyeon Jin; Kim, Shinhong; Kimura, Naoki; Kind, Oliver; King, Barry; King, Matthew; King, Robert Steven Beaufoy; King, Samuel Burton; Kirk, Julie; Kiryunin, Andrey; Kishimoto, Tomoe; Kisielewska, Danuta; Kitamura, Takumi; Kittelmann, Thomas; Kiuchi, Kenji; Kladiva, Eduard; Klein, Max; Klein, Uta; Kleinknecht, Konrad; Klimek, Pawel; Klimentov, Alexei; Klingenberg, Reiner; Klinger, Joel Alexander; Klinkby, Esben; Klioutchnikova, Tatiana; Klok, Peter; Kluge, Eike-Erik; Kluit, Peter; Kluth, Stefan; Kneringer, Emmerich; Knoops, Edith; Knue, Andrea; Kobayashi, Tomio; Kobel, Michael; Kocian, Martin; Kodys, Peter; Koenig, Sebastian; Koevesarki, Peter; Koffas, Thomas; Koffeman, Els; Kogan, Lucy Anne; Kohlmann, Simon; Kohout, Zdenek; Kohriki, Takashi; Koi, Tatsumi; Kolanoski, Hermann; Koletsou, Iro; Koll, James; Komar, Aston; Komori, Yuto; Kondo, Takahiko; Koneke, Karsten; Konig, Adriaan; Kono, Takanori; Konoplich, Rostislav; Konstantinidis, Nikolaos; Kopeliansky, Revital; Koperny, Stefan; Kopke, Lutz; Kopp, Anna Katharina; Korcyl, Krzysztof; Kordas, Kostantinos; Korn, Andreas; Korol, Aleksandr; Korolkov, Ilya; Korolkova, Elena; Korotkov, Vladislav; Kortner, Oliver; Kortner, Sandra; Kostyukhin, Vadim; Kotov, Sergey; Kotov, Vladislav; Kotwal, Ashutosh; Kourkoumelis, Christine; Kouskoura, Vasiliki; Koutsman, Alex; Kowalewski, Robert Victor; Kowalski, Tadeusz; Kozanecki, Witold; Kozhin, Anatoly; Kral, Vlastimil; Kramarenko, Viktor; Kramberger, Gregor; Krasny, Mieczyslaw Witold; Krasznahorkay, Attila; Kraus, Jana; Kravchenko, Anton; Kreiss, Sven; Kretzschmar, Jan; Kreutzfeldt, Kristof; Krieger, Nina; Krieger, Peter; Kroeninger, Kevin; Kroha, Hubert; Kroll, Joe; Kroseberg, Juergen; Krstic, Jelena; Kruchonak, Uladzimir; Kruger, Hans; Kruker, Tobias; Krumnack, Nils; Krumshteyn, Zinovii; Kruse, Amanda; Kruse, Mark; Kruskal, Michael; Kubota, Takashi; Kuday, Sinan; Kuehn, Susanne; Kugel, Andreas; Kuhl, Thorsten; Kukhtin, Victor; Kulchitsky, Yuri; Kuleshov, Sergey; Kuna, Marine; Kunkle, Joshua; Kupco, Alexander; Kurashige, Hisaya; Kurata, Masakazu; Kurochkin, Yurii; Kurumida, Rie; Kus, Vlastimil; Kuwertz, Emma Sian; Kuze, Masahiro; Kvita, Jiri; Kwee, Regina; La Rosa, Alessandro; La Rotonda, Laura; Labarga, Luis; Lablak, Said; Lacasta, Carlos; Lacava, Francesco; Lacey, James; Lacker, Heiko; Lacour, Didier; Lacuesta, Vicente Ram\\'on; Ladygin, Evgueni; Lafaye, Remi; Laforge, Bertrand; Lagouri, Theodota; Lai, Stanley; Laier, Heiko; Laisne, Emmanuel; Lambourne, Luke; Lampen, Caleb; Lampl, Walter; Lan\\c con, Eric; Landgraf, Ulrich; Landon, Murrough; Lang, Valerie Susanne; Lange, Clemens; Lankford, Andrew; Lanni, Francesco; Lantzsch, Kerstin; Lanza, Agostino; Laplace, Sandrine; Lapoire, Cecile; Laporte, Jean-Francois; Lari, Tommaso; Larner, Aimee; Lassnig, Mario; Laurelli, Paolo; Lavorini, Vincenzo; Lavrijsen, Wim; Laycock, Paul; Le, Bao Tran; Le Dortz, Olivier; Le Guirriec, Emmanuel; Le Menedeu, Eve; LeCompte, Thomas; Ledroit-Guillon, Fabienne Agnes Marie; Lee, Claire Alexandra; Lee, Hurng-Chun; Lee, Jason; Lee, Shih-Chang; Lee, Lawrence; Lefebvre, Guillaume; Lefebvre, Michel; Legger, Federica; Leggett, Charles; Lehan, Allan; Lehmacher, Marc; Lehmann Miotto, Giovanna; Lei, Xiaowen; Leister, Andrew Gerard; Leite, Marco Aurelio Lisboa; Leitner, Rupert; Lellouch, Daniel; Lemmer, Boris; Lendermann, Victor; Leney, Katharine; Lenz, Tatjana; Lenzen, Georg; Lenzi, Bruno; Leone, Robert; Leonhardt, Kathrin; Leontsinis, Stefanos; Leroy, Claude; Lessard, Jean-Raphael; Lester, Christopher; Lester, Christopher Michael; Lev\\^eque, Jessica; Levin, Daniel; Levinson, Lorne; Lewis, Adrian; Lewis, George; Leyko, Agnieszka; Leyton, Michael; Li, Bing; Li, Bo; Li, Haifeng; Li, Ho Ling; Li, Shu; Li, Xuefei; Liang, Zhijun; Liao, Hongbo; Liberti, Barbara; Lichard, Peter; Lie, Ki; Liebal, Jessica; Liebig, Wolfgang; Limbach, Christian; Limosani, Antonio; Limper, Maaike; Lin, Simon; Linde, Frank; Lindquist, Brian Edward; Linnemann, James; Lipeles, Elliot; Lipniacka, Anna; Lisovyi, Mykhailo; Liss, Tony; Lissauer, David; Lister, Alison; Litke, Alan; Liu, Bo; Liu, Dong; Liu, Jianbei; Liu, Kun; Liu, Lulu; Liu, Miaoyuan; Liu, Minghui; Liu, Yanwen; Livan, Michele; Livermore, Sarah; Lleres, Annick; Llorente Merino, Javier; Lloyd, Stephen; Lo Sterzo, Francesco; Lobodzinska, Ewelina; Loch, Peter; Lockman, William; Loddenkoetter, Thomas; Loebinger, Fred; Loevschall-Jensen, Ask Emil; Loginov, Andrey; Loh, Chang Wei; Lohse, Thomas; Lohwasser, Kristin; Lokajicek, Milos; Lombardo, Vincenzo Paolo; Long, Jonathan; Long, Robin Eamonn; Lopes, Lourenco; Lopez Mateos, David; Lopez Paredes, Brais; Lorenz, Jeanette; Lorenzo Martinez, Narei; Losada, Marta; Loscutoff, Peter; Losty, Michael; Lou, XinChou; Lounis, Abdenour; Love, Jeremy; Love, Peter; Lowe, Andrew; Lu, Feng; Lubatti, Henry; Luci, Claudio; Lucotte, Arnaud; Ludwig, Dorthe; Ludwig, Inga; Luehring, Frederick; Lukas, Wolfgang; Luminari, Lamberto; Lund, Esben; Lundberg, Johan; Lundberg, Olof; Lund-Jensen, Bengt; Lungwitz, Matthias; Lynn, David; Lysak, Roman; Lytken, Else; Ma, Hong; Ma, Lian Liang; Maccarrone, Giovanni; Macchiolo, Anna; Ma\\v{c}ek, Bo\\v{s}tjan; Machado Miguens, Joana; Macina, Daniela; Mackeprang, Rasmus; Madar, Romain; Madaras, Ronald; Maddocks, Harvey Jonathan; Mader, Wolfgang; Madsen, Alexander; Maeno, Mayuko; Maeno, Tadashi; Magnoni, Luca; Magradze, Erekle; Mahboubi, Kambiz; Mahlstedt, Joern; Mahmoud, Sara; Mahout, Gilles; Maiani, Camilla; Maidantchik, Carmen; Maio, Am\\'elia; Majewski, Stephanie; Makida, Yasuhiro; Makovec, Nikola; Mal, Prolay; Malaescu, Bogdan; Malecki, Pawel; Maleev, Victor; Malek, Fairouz; Mallik, Usha; Malon, David; Malone, Caitlin; Maltezos, Stavros; Malyshev, Vladimir; Malyukov, Sergei; Mamuzic, Judita; Mandelli, Luciano; Mandi\\'{c}, Igor; Mandrysch, Rocco; Maneira, Jos\\'e; Manfredini, Alessandro; Manhaes de Andrade Filho, Luciano; Manjarres Ramos, Joany Andreina; Mann, Alexander; Manning, Peter; Manousakis-Katsikakis, Arkadios; Mansoulie, Bruno; Mantifel, Rodger; Mapelli, Livio; March, Luis; Marchand, Jean-Francois; Marchese, Fabrizio; Marchiori, Giovanni; Marcisovsky, Michal; Marino, Christopher; Marques, Carlos; Marroquim, Fernando; Marshall, Zach; Marti, Lukas Fritz; Marti-Garcia, Salvador; Martin, Brian; Martin, Brian Thomas; Martin, Jean-Pierre; Martin, Tim; Martin, Victoria Jane; Martin dit Latour, Bertrand; Martinez, Homero; Martinez, Mario; Martin-Haugh, Stewart; Martyniuk, Alex; Marx, Marilyn; Marzano, Francesco; Marzin, Antoine; Masetti, Lucia; Mashimo, Tetsuro; Mashinistov, Ruslan; Masik, Jiri; Maslennikov, Alexey; Massa, Ignazio; Massol, Nicolas; Mastrandrea, Paolo; Mastroberardino, Anna; Masubuchi, Tatsuya; Matsunaga, Hiroyuki; Matsushita, Takashi; Mattig, Peter; Mattig, Stefan; Mattmann, Johannes; Mattravers, Carly; Maurer, Julien; Maxfield, Stephen; Maximov, Dmitriy; Mazini, Rachid; Mazzaferro, Luca; Mazzanti, Marcello; Mc Goldrick, Garrin; Mc Kee, Shawn Patrick; McCarn, Allison; McCarthy, Robert; McCarthy, Tom; McCubbin, Norman; McFarlane, Kenneth; Mcfayden, Josh; Mchedlidze, Gvantsa; Mclaughlan, Tom; McMahon, Steve; McPherson, Robert; Meade, Andrew; Mechnich, Joerg; Mechtel, Markus; Medinnis, Mike; Meehan, Samuel; Meera-Lebbai, Razzak; Mehlhase, Sascha; Mehta, Andrew; Meier, Karlheinz; Meineck, Christian; Meirose, Bernhard; Melachrinos, Constantinos; Mellado Garcia, Bruce Rafael; Meloni, Federico; Mendoza Navas, Luis; Mengarelli, Alberto; Menke, Sven; Meoni, Evelin; Mercurio, Kevin Michael; Mergelmeyer, Sebastian; Meric, Nicolas; Mermod, Philippe; Merola, Leonardo; Meroni, Chiara; Merritt, Frank; Merritt, Hayes; Messina, Andrea; Metcalfe, Jessica; Mete, Alaettin Serhan; Meyer, Carsten; Meyer, Christopher; Meyer, Jean-Pierre; Meyer, Jochen; Meyer, Joerg; Michal, Sebastien; Middleton, Robin; Migas, Sylwia; Mijovi\\'{c}, Liza; Mikenberg, Giora; Mikestikova, Marcela; Miku\\v{z}, Marko; Miller, David; Mills, Corrinne; Milov, Alexander; Milstead, David; Milstein, Dmitry; Minaenko, Andrey; Minano Moya, Mercedes; Minashvili, Irakli; Mincer, Allen; Mindur, Bartosz; Mineev, Mikhail; Ming, Yao; Mir, Lluisa-Maria; Mirabelli, Giovanni; Mitani, Takashi; Mitrevski, Jovan; Mitsou, Vasiliki A; Mitsui, Shingo; Miyagawa, Paul; Mjornmark, Jan-Ulf; Moa, Torbjoern; Moeller, Victoria; Mohapatra, Soumya; Mohr, Wolfgang; Molander, Simon; Moles-Valls, Regina; Molfetas, Angelos; Monig, Klaus; Monini, Caterina; Monk, James; Monnier, Emmanuel; Montejo Berlingen, Javier; Monticelli, Fernando; Monzani, Simone; Moore, Roger; Mora Herrera, Clemencia; Moraes, Arthur; Morange, Nicolas; Morel, Julien; Moreno, Deywis; Moreno Ll\\'acer, Mar\\'ia; Morettini, Paolo; Morgenstern, Marcus; Morii, Masahiro; Moritz, Sebastian; Morley, Anthony Keith; Mornacchi, Giuseppe; Morris, John; Morvaj, Ljiljana; Moser, Hans-Guenther; Mosidze, Maia; Moss, Josh; Mount, Richard; Mountricha, Eleni; Mouraviev, Sergei; Moyse, Edward; Mudd, Richard; Mueller, Felix; Mueller, James; Mueller, Klemens; Mueller, Thibaut; Mueller, Timo; Muenstermann, Daniel; Munwes, Yonathan; Murillo Quijada, Javier Alberto; Murray, Bill; Mussche, Ido; Musto, Elisa; Myagkov, Alexey; Myska, Miroslav; Nackenhorst, Olaf; Nadal, Jordi; Nagai, Koichi; Nagai, Ryo; Nagai, Yoshikazu; Nagano, Kunihiro; Nagarkar, Advait; Nagasaka, Yasushi; Nagel, Martin; Nairz, Armin Michael; Nakahama, Yu; Nakamura, Koji; Nakamura, Tomoaki; Nakano, Itsuo; Namasivayam, Harisankar; Nanava, Gizo; Napier, Austin; Narayan, Rohin; Nash, Michael; Nattermann, Till; Naumann, Thomas; Navarro, Gabriela; Neal, Homer; Nechaeva, Polina; Neep, Thomas James; Negri, Andrea; Negri, Guido; Negrini, Matteo; Nektarijevic, Snezana; Nelson, Andrew; Nelson, Timothy Knight; Nemecek, Stanislav; Nemethy, Peter; Nepomuceno, Andre Asevedo; Nessi, Marzio; Neubauer, Mark; Neumann, Manuel; Neusiedl, Andrea; Neves, Ricardo; Nevski, Pavel; Newcomer, Mitchel; Newman, Paul; Nguyen, Duong Hai; Nguyen Thi Hong, Van; Nickerson, Richard; Nicolaidou, Rosy; Nicquevert, Bertrand; Nielsen, Jason; Nikiforou, Nikiforos; Nikiforov, Andriy; Nikolaenko, Vladimir; Nikolic-Audit, Irena; Nikolics, Katalin; Nikolopoulos, Konstantinos; Nilsson, Paul; Ninomiya, Yoichi; Nisati, Aleandro; Nisius, Richard; Nobe, Takuya; Nodulman, Lawrence; Nomachi, Masaharu; Nomidis, Ioannis; Norberg, Scarlet; Nordberg, Markus; Novakova, Jana; Nozaki, Mitsuaki; Nozka, Libor; Ntekas, Konstantinos; Nuncio-Quiroz, Adriana-Elizabeth; Nunes Hanninger, Guilherme; Nunnemann, Thomas; Nurse, Emily; O'Brien, Brendan Joseph; O'grady, Fionnbarr; O'Neil, Dugan; O'Shea, Val; Oakes, Louise Beth; Oakham, Gerald; Oberlack, Horst; Ocariz, Jose; Ochi, Atsuhiko; Ochoa, Ines; Oda, Susumu; Odaka, Shigeru; Ogren, Harold; Oh, Alexander; Oh, Seog; Ohm, Christian; Ohshima, Takayoshi; Okamura, Wataru; Okawa, Hideki; Okumura, Yasuyuki; Okuyama, Toyonobu; Olariu, Albert; Olchevski, Alexander; Olivares Pino, Sebastian Andres; Oliveira, Miguel Alfonso; Oliveira Damazio, Denis; Oliver Garcia, Elena; Olivito, Dominick; Olszewski, Andrzej; Olszowska, Jolanta; Onofre, Ant\\'onio; Onyisi, Peter; Oram, Christopher; Oreglia, Mark; Oren, Yona; Orestano, Domizia; Orlando, Nicola; Oropeza Barrera, Cristina; Orr, Robert; Osculati, Bianca; Ospanov, Rustem; Otero y Garzon, Gustavo; Otono, Hidetoshi; Ouchrif, Mohamed; Ouellette, Eric; Ould-Saada, Farid; Ouraou, Ahmimed; Oussoren, Koen Pieter; Ouyang, Qun; Ovcharova, Ana; Owen, Mark; Owen, Simon; Ozcan, Veysi Erkcan; Ozturk, Nurcan; Pachal, Katherine; Pacheco Pages, Andres; Padilla Aranda, Cristobal; Pagan Griso, Simone; Paganis, Efstathios; Pahl, Christoph; Paige, Frank; Pais, Preema; Pajchel, Katarina; Palacino, Gabriel; Palestini, Sandro; Pallin, Dominique; Palma, Alberto; Palmer, Jody; Pan, Yibin; Panagiotopoulou, Evgenia; Panduro Vazquez, William; Pani, Priscilla; Panikashvili, Natalia; Panitkin, Sergey; Pantea, Dan; Papadopoulou, Theodora; Papageorgiou, Konstantinos; Paramonov, Alexander; Paredes Hernandez, Daniela; Parker, Michael Andrew; Parodi, Fabrizio; Parsons, John; Parzefall, Ulrich; Pashapour, Shabnaz; Pasqualucci, Enrico; Passaggio, Stefano; Passeri, Antonio; Pastore, Fernanda; Pastore, Francesca; P\\'asztor, Gabriella; Pataraia, Sophio; Patel, Nikhul; Pater, Joleen; Patricelli, Sergio; Pauly, Thilo; Pearce, James; Pedersen, Maiken; Pedraza Lopez, Sebastian; Pedro, Rute; Peleganchuk, Sergey; Pelikan, Daniel; Peng, Haiping; Penning, Bjoern; Penwell, John; Perepelitsa, Dennis; Perez Cavalcanti, Tiago; Perez Codina, Estel; Perez Garcia-Estan, Maria Teresa; Perez Reale, Valeria; Perini, Laura; Pernegger, Heinz; Perrino, Roberto; Peschke, Richard; Peshekhonov, Vladimir; Peters, Krisztian; Peters, Yvonne; Petersen, Brian; Petersen, Jorgen; Petersen, Troels; Petit, Elisabeth; Petridis, Andreas; Petridou, Chariclia; Petrolo, Emilio; Petrucci, Fabrizio; Petteni, Michele; Pezoa, Raquel; Phillips, Peter William; Piacquadio, Giacinto; Pianori, Elisabetta; Picazio, Attilio; Piccaro, Elisa; Piccinini, Maurizio; Piec, Sebastian Marcin; Piegaia, Ricardo; Pignotti, David; Pilcher, James; Pilkington, Andrew; Pina, Joao Antonio; Pinamonti, Michele; Pinder, Alex; Pinfold, James; Pingel, Almut; Pinto, Belmiro; Pizio, Caterina; Pleier, Marc-Andre; Pleskot, Vojtech; Plotnikova, Elena; Plucinski, Pawel; Poddar, Sahill; Podlyski, Fabrice; Poettgen, Ruth; Poggioli, Luc; Pohl, David-leon; Pohl, Martin; Polesello, Giacomo; Policicchio, Antonio; Polifka, Richard; Polini, Alessandro; Pollard, Christopher Samuel; Polychronakos, Venetios; Pomeroy, Daniel; Pomm\\`es, Kathy; Pontecorvo, Ludovico; Pope, Bernard; Popeneciu, Gabriel Alexandru; Popovic, Dragan; Poppleton, Alan; Portell Bueso, Xavier; Pospelov, Guennady; Pospisil, Stanislav; Potamianos, Karolos; Potrap, Igor; Potter, Christina; Potter, Christopher; Poulard, Gilbert; Poveda, Joaquin; Pozdnyakov, Valery; Prabhu, Robindra; Pralavorio, Pascal; Pranko, Aliaksandr; Prasad, Srivas; Pravahan, Rishiraj; Prell, Soeren; Price, Darren; Price, Joe; Price, Lawrence; Prieur, Damien; Primavera, Margherita; Proissl, Manuel; Prokofiev, Kirill; Prokoshin, Fedor; Protopapadaki, Eftychia-sofia; Protopopescu, Serban; Proudfoot, James; Prudent, Xavier; Przybycien, Mariusz; Przysiezniak, Helenka; Psoroulas, Serena; Ptacek, Elizabeth; Pueschel, Elisa; Puldon, David; Purohit, Milind; Puzo, Patrick; Pylypchenko, Yuriy; Qian, Jianming; Quadt, Arnulf; Quarrie, David; Quayle, William; Quilty, Donnchadha; Radeka, Veljko; Radescu, Voica; Radhakrishnan, Sooraj Krishnan; Radloff, Peter; Ragusa, Francesco; Rahal, Ghita; Rajagopalan, Srinivasan; Rammensee, Michael; Rammes, Marcus; Randle-Conde, Aidan Sean; Rangel-Smith, Camila; Rao, Kanury; Rauscher, Felix; Rave, Tobias Christian; Ravenscroft, Thomas; Raymond, Michel; Read, Alexander Lincoln; Rebuzzi, Daniela; Redelbach, Andreas; Redlinger, George; Reece, Ryan; Reeves, Kendall; Reinsch, Andreas; Reisin, Hernan; Reisinger, Ingo; Relich, Matthew; Rembser, Christoph; Ren, Zhongliang; Renaud, Adrien; Rescigno, Marco; Resconi, Silvia; Resende, Bernardo; Reznicek, Pavel; Rezvani, Reyhaneh; Richter, Robert; Ridel, Melissa; Rieck, Patrick; Rijssenbeek, Michael; Rimoldi, Adele; Rinaldi, Lorenzo; Ritsch, Elmar; Riu, Imma; Rivoltella, Giancesare; Rizatdinova, Flera; Rizvi, Eram; Robertson, Steven; Robichaud-Veronneau, Andree; Robinson, Dave; Robinson, James; Robson, Aidan; Rocha de Lima, Jose Guilherme; Roda, Chiara; Roda Dos Santos, Denis; Rodrigues, Luis; Roe, Shaun; R{\\o}hne, Ole; Rolli, Simona; Romaniouk, Anatoli; Romano, Marino; Romeo, Gaston; Romero Adam, Elena; Rompotis, Nikolaos; Roos, Lydia; Ros, Eduardo; Rosati, Stefano; Rosbach, Kilian; Rose, Anthony; Rose, Matthew; Rosendahl, Peter Lundgaard; Rosenthal, Oliver; Rossetti, Valerio; Rossi, Elvira; Rossi, Leonardo Paolo; Rosten, Rachel; Rotaru, Marina; Roth, Itamar; Rothberg, Joseph; Rousseau, David; Royon, Christophe; Rozanov, Alexandre; Rozen, Yoram; Ruan, Xifeng; Rubbo, Francesco; Rubinskiy, Igor; Rud, Viacheslav; Rudolph, Christian; Rudolph, Matthew Scott; Ruhr, Frederik; Ruiz-Martinez, Aranzazu; Rumyantsev, Leonid; Rurikova, Zuzana; Rusakovich, Nikolai; Ruschke, Alexander; Rutherfoord, John; Ruthmann, Nils; Ruzicka, Pavel; Ryabov, Yury; Rybar, Martin; Rybkin, Grigori; Ryder, Nick; Saavedra, Aldo; Sacerdoti, Sabrina; Saddique, Asif; Sadeh, Iftach; Sadrozinski, Hartmut; Sadykov, Renat; Safai Tehrani, Francesco; Sakamoto, Hiroshi; Sakurai, Yuki; Salamanna, Giuseppe; Salamon, Andrea; Saleem, Muhammad; Salek, David; Sales De Bruin, Pedro Henrique; Salihagic, Denis; Salnikov, Andrei; Salt, Jos\\'e; Salvachua Ferrando, Bel\\'en; Salvatore, Daniela; Salvatore, Pasquale Fabrizio; Salvucci, Antonio; Salzburger, Andreas; Sampsonidis, Dimitrios; Sanchez, Arturo; S\\'anchez, Javier; Sanchez Martinez, Victoria; Sandaker, Heidi; Sander, Heinz Georg; Sanders, Michiel; Sandhoff, Marisa; Sandoval, Tanya; Sandoval, Carlos; Sandstroem, Rikard; Sankey, Dave; Sansoni, Andrea; Santoni, Claudio; Santonico, Rinaldo; Santos, Helena; Santoyo Castillo, Itzebelt; Sapp, Kevin; Sapronov, Andrey; Saraiva, Joao; Sarkisyan-Grinbaum, Edward; Sarrazin, Bjorn; Sartisohn, Georg; Sasaki, Osamu; Sasaki, Yuichi; Sasao, Noboru; Satsounkevitch, Igor; Sauvage, Gilles; Sauvan, Emmanuel; Sauvan, Jean-Baptiste; Savard, Pierre; Savinov, Vladimir; Savu, Dan Octavian; Sawyer, Craig; Sawyer, Lee; Saxon, David; Saxon, James; Sbarra, Carla; Sbrizzi, Antonio; Scanlon, Tim; Scannicchio, Diana; Scarcella, Mark; Schaarschmidt, Jana; Schacht, Peter; Schaefer, Douglas; Schaelicke, Andreas; Schaepe, Steffen; Schaetzel, Sebastian; Schafer, Uli; Schaffer, Arthur; Schaile, Dorothee; Schamberger, R. Dean; Scharf, Veit; Schegelsky, Valery; Scheirich, Daniel; Schernau, Michael; Scherzer, Max; Schiavi, Carlo; Schieck, Jochen; Schillo, Christian; Schioppa, Marco; Schlenker, Stefan; Schmidt, Evelyn; Schmieden, Kristof; Schmitt, Christian; Schmitt, Christopher; Schmitt, Sebastian; Schneider, Basil; Schnellbach, Yan Jie; Schnoor, Ulrike; Schoeffel, Laurent; Schoening, Andre; Schoenrock, Bradley Daniel; Schorlemmer, Andre Lukas; Schott, Matthias; Schouten, Doug; Schovancova, Jaroslava; Schram, Malachi; Schramm, Steven; Schreyer, Manuel; Schroeder, Christian; Schroer, Nicolai; Schuh, Natascha; Schultens, Martin Johannes; Schultz-Coulon, Hans-Christian; Schulz, Holger; Schumacher, Markus; Schumm, Bruce; Schune, Philippe; Schwartzman, Ariel; Schwegler, Philipp; Schwemling, Philippe; Schwienhorst, Reinhard; Schwindling, Jerome; Schwindt, Thomas; Schwoerer, Maud; Sciacca, Gianfranco; Scifo, Estelle; Sciolla, Gabriella; Scott, Bill; Scutti, Federico; Searcy, Jacob; Sedov, George; Sedykh, Evgeny; Seidel, Sally; Seiden, Abraham; Seifert, Frank; Seixas, Jos\\'e; Sekhniaidze, Givi; Sekula, Stephen; Selbach, Karoline Elfriede; Seliverstov, Dmitry; Sellers, Graham; Seman, Michal; Semprini-Cesari, Nicola; Serfon, Cedric; Serin, Laurent; Serkin, Leonid; Serre, Thomas; Seuster, Rolf; Severini, Horst; Sforza, Federico; Sfyrla, Anna; Shabalina, Elizaveta; Shamim, Mansoora; Shan, Lianyou; Shank, James; Shao, Qi Tao; Shapiro, Marjorie; Shatalov, Pavel; Shaw, Kate; Sherwood, Peter; Shimizu, Shima; Shimojima, Makoto; Shin, Taeksu; Shiyakova, Mariya; Shmeleva, Alevtina; Shochet, Mel; Short, Daniel; Shrestha, Suyog; Shulga, Evgeny; Shupe, Michael; Shushkevich, Stanislav; Sicho, Petr; Sidorov, Dmitri; Sidoti, Antonio; Siegert, Frank; Sijacki, Djordje; Silbert, Ohad; Silva, Jos\\'e; Silver, Yiftah; Silverstein, Daniel; Silverstein, Samuel; Simak, Vladislav; Simard, Olivier; Simic, Ljiljana; Simion, Stefan; Simioni, Eduard; Simmons, Brinick; Simoniello, Rosa; Simonyan, Margar; Sinervo, Pekka; Sinev, Nikolai; Sipica, Valentin; Siragusa, Giovanni; Sircar, Anirvan; Sisakyan, Alexei; Sivoklokov, Serguei; Sjolin, Jorgen; Sjursen, Therese; Skinnari, Louise Anastasia; Skottowe, Hugh Philip; Skovpen, Kirill; Skubic, Patrick; Slater, Mark; Slavicek, Tomas; Sliwa, Krzysztof; Smakhtin, Vladimir; Smart, Ben; Smestad, Lillian; Smirnov, Sergei; Smirnov, Yury; Smirnova, Lidia; Smirnova, Oxana; Smith, Kenway; Smizanska, Maria; Smolek, Karel; Snesarev, Andrei; Snidero, Giacomo; Snow, Joel; Snyder, Scott; Sobie, Randall; Socher, Felix; Sodomka, Jaromir; Soffer, Abner; Soh, Dart-yin; Solans, Carlos; Solar, Michael; Solc, Jaroslav; Soldatov, Evgeny; Soldevila, Urmila; Solfaroli Camillocci, Elena; Solodkov, Alexander; Solovyanov, Oleg; Solovyev, Victor; Soni, Nitesh; Sood, Alexander; Sopko, Vit; Sopko, Bruno; Sosebee, Mark; Soualah, Rachik; Soueid, Paul; Soukharev, Andrey; South, David; Spagnolo, Stefania; Span\\`o, Francesco; Spearman, William Robert; Spighi, Roberto; Spigo, Giancarlo; Spousta, Martin; Spreitzer, Teresa; Spurlock, Barry; St Denis, Richard Dante; Stahlman, Jonathan; Stamen, Rainer; Stanecka, Ewa; Stanek, Robert; Stanescu, Cristian; Stanescu-Bellu, Madalina; Stanitzki, Marcel Michael; Stapnes, Steinar; Starchenko, Evgeny; Stark, Jan; Staroba, Pavel; Starovoitov, Pavel; Staszewski, Rafal; Stavina, Pavel; Steele, Genevieve; Steinbach, Peter; Steinberg, Peter; Stekl, Ivan; Stelzer, Bernd; Stelzer, Harald Joerg; Stelzer-Chilton, Oliver; Stenzel, Hasko; Stern, Sebastian; Stewart, Graeme; Stillings, Jan Andre; Stockton, Mark; Stoebe, Michael; Stoerig, Kathrin; Stoicea, Gabriel; Stonjek, Stefan; Stradling, Alden; Straessner, Arno; Strandberg, Jonas; Strandberg, Sara; Strandlie, Are; Strauss, Emanuel; Strauss, Michael; Strizenec, Pavol; Strohmer, Raimund; Strom, David; Stroynowski, Ryszard; Stucci, Stefania Antonia; Stugu, Bjarne; Stumer, Iuliu; Stupak, John; Sturm, Philipp; Styles, Nicholas Adam; Su, Dong; Su, Jun; Subramania, Halasya Siva; Subramaniam, Rajivalochan; Succurro, Antonella; Sugaya, Yorihito; Suhr, Chad; Suk, Michal; Sulin, Vladimir; Sultansoy, Saleh; Sumida, Toshi; Sun, Xiaohu; Sundermann, Jan Erik; Suruliz, Kerim; Susinno, Giancarlo; Sutton, Mark; Suzuki, Yu; Svatos, Michal; Swedish, Stephen; Swiatlowski, Maximilian; Sykora, Ivan; Sykora, Tomas; Ta, Duc; Tackmann, Kerstin; Taenzer, Joe; Taffard, Anyes; Tafirout, Reda; Taiblum, Nimrod; Takahashi, Yuta; Takai, Helio; Takashima, Ryuichi; Takeda, Hiroshi; Takeshita, Tohru; Takubo, Yosuke; Talby, Mossadek; Talyshev, Alexey; Tam, Jason; Tamsett, Matthew; Tan, Kong Guan; Tanaka, Junichi; Tanaka, Reisaburo; Tanaka, Satoshi; Tanaka, Shuji; Tanasijczuk, Andres Jorge; Tani, Kazutoshi; Tannoury, Nancy; Tapprogge, Stefan; Tarem, Shlomit; Tarrade, Fabien; Tartarelli, Giuseppe Francesco; Tas, Petr; Tasevsky, Marek; Tashiro, Takuya; Tassi, Enrico; Tavares Delgado, Ademar; Tayalati, Yahya; Taylor, Christopher; Taylor, Frank; Taylor, Geoffrey; Taylor, Wendy; Teischinger, Florian Alfred; Teixeira Dias Castanheira, Matilde; Teixeira-Dias, Pedro; Temming, Kim Katrin; Ten Kate, Herman; Teng, Ping-Kun; Terada, Susumu; Terashi, Koji; Terron, Juan; Terzo, Stefano; Testa, Marianna; Teuscher, Richard; Therhaag, Jan; Theveneaux-Pelzer, Timoth\\'ee; Thoma, Sascha; Thomas, Juergen; Thompson, Emily; Thompson, Paul; Thompson, Peter; Thompson, Stan; Thomsen, Lotte Ansgaard; Thomson, Evelyn; Thomson, Mark; Thong, Wai Meng; Thun, Rudolf; Tian, Feng; Tibbetts, Mark James; Tic, Tom\\'{a}\\v{s}; Tikhomirov, Vladimir; Tikhonov, Yury; Timoshenko, Sergey; Tiouchichine, Elodie; Tipton, Paul; Tisserant, Sylvain; Todorov, Theodore; Todorova-Nova, Sharka; Toggerson, Brokk; Tojo, Junji; Tok\\'ar, Stanislav; Tokushuku, Katsuo; Tollefson, Kirsten; Tomlinson, Lee; Tomoto, Makoto; Tompkins, Lauren; Toms, Konstantin; Topilin, Nikolai; Torrence, Eric; Torres, Heberth; Torr\\'o Pastor, Emma; Toth, Jozsef; Touchard, Francois; Tovey, Daniel; Tran, Huong Lan; Trefzger, Thomas; Tremblet, Louis; Tricoli, Alessandro; Trigger, Isabel Marian; Trincaz-Duvoid, Sophie; Tripiana, Martin; Triplett, Nathan; Trischuk, William; Trocm\\'e, Benjamin; Troncon, Clara; Trottier-McDonald, Michel; Trovatelli, Monica; True, Patrick; Trzebinski, Maciej; Trzupek, Adam; Tsarouchas, Charilaos; Tseng, Jeffrey; Tsiareshka, Pavel; Tsionou, Dimitra; Tsipolitis, Georgios; Tsirintanis, Nikolaos; Tsiskaridze, Shota; Tsiskaridze, Vakhtang; Tskhadadze, Edisher; Tsukerman, Ilya; Tsulaia, Vakhtang; Tsung, Jieh-Wen; Tsuno, Soshi; Tsybychev, Dmitri; Tua, Alan; Tudorache, Alexandra; Tudorache, Valentina; Tuna, Alexander Naip; Tupputi, Salvatore; Turchikhin, Semen; Turecek, Daniel; Turk Cakir, Ilkay; Turra, Ruggero; Tuts, Michael; Tykhonov, Andrii; Tylmad, Maja; Tyndel, Mike; Uchida, Kirika; Ueda, Ikuo; Ueno, Ryuichi; Ughetto, Michael; Ugland, Maren; Uhlenbrock, Mathias; Ukegawa, Fumihiko; Unal, Guillaume; Undrus, Alexander; Unel, Gokhan; Ungaro, Francesca; Unno, Yoshinobu; Urbaniec, Dustin; Urquijo, Phillip; Usai, Giulio; Usanova, Anna; Vacavant, Laurent; Vacek, Vaclav; Vachon, Brigitte; Valencic, Nika; Valentinetti, Sara; Valero, Alberto; Valery, Loic; Valkar, Stefan; Valladolid Gallego, Eva; Vallecorsa, Sofia; Valls Ferrer, Juan Antonio; Van Berg, Richard; Van Der Deijl, Pieter; van der Geer, Rogier; van der Graaf, Harry; Van Der Leeuw, Robin; van der Ster, Daniel; van Eldik, Niels; van Gemmeren, Peter; Van Nieuwkoop, Jacobus; van Vulpen, Ivo; van Woerden, Marius Cornelis; Vanadia, Marco; Vandelli, Wainer; Vaniachine, Alexandre; Vankov, Peter; Vannucci, Francois; Vardanyan, Gagik; Vari, Riccardo; Varnes, Erich; Varol, Tulin; Varouchas, Dimitris; Vartapetian, Armen; Varvell, Kevin; Vassilakopoulos, Vassilios; Vazeille, Francois; Vazquez Schroeder, Tamara; Veatch, Jason; Veloso, Filipe; Veneziano, Stefano; Ventura, Andrea; Ventura, Daniel; Venturi, Manuela; Venturi, Nicola; Venturini, Alessio; Vercesi, Valerio; Verducci, Monica; Verkerke, Wouter; Vermeulen, Jos; Vest, Anja; Vetterli, Michel; Viazlo, Oleksandr; Vichou, Irene; Vickey, Trevor; Vickey Boeriu, Oana Elena; Viehhauser, Georg; Viel, Simon; Vigne, Ralph; Villa, Mauro; Villaplana Perez, Miguel; Vilucchi, Elisabetta; Vincter, Manuella; Vinogradov, Vladimir; Virzi, Joseph; Vitells, Ofer; Viti, Michele; Vivarelli, Iacopo; Vives Vaque, Francesc; Vlachos, Sotirios; Vladoiu, Dan; Vlasak, Michal; Vogel, Adrian; Vokac, Petr; Volpi, Guido; Volpi, Matteo; Volpini, Giovanni; von der Schmitt, Hans; von Radziewski, Holger; von Toerne, Eckhard; Vorobel, Vit; Vos, Marcel; Voss, Rudiger; Vossebeld, Joost; Vranjes, Nenad; Vranjes Milosavljevic, Marija; Vrba, Vaclav; Vreeswijk, Marcel; Vu Anh, Tuan; Vuillermet, Raphael; Vukotic, Ilija; Vykydal, Zdenek; Wagner, Wolfgang; Wagner, Peter; Wahrmund, Sebastian; Wakabayashi, Jun; Walch, Shannon; Walder, James; Walker, Rodney; Walkowiak, Wolfgang; Wall, Richard; Waller, Peter; Walsh, Brian; Wang, Chiho; Wang, Haichen; Wang, Hulin; Wang, Jike; Wang, Jin; Wang, Kuhan; Wang, Rui; Wang, Song-Ming; Wang, Tan; Wang, Xiaoxiao; Warburton, Andreas; Ward, Patricia; Wardrope, David Robert; Warsinsky, Markus; Washbrook, Andrew; Wasicki, Christoph; Watanabe, Ippei; Watkins, Peter; Watson, Alan; Watson, Ian; Watson, Miriam; Watts, Gordon; Watts, Stephen; Waugh, Anthony; Waugh, Ben; Webb, Samuel; Weber, Michele; Weber, Stefan Wolf; Webster, Jordan S; Weidberg, Anthony; Weigell, Philipp; Weingarten, Jens; Weiser, Christian; Weits, Hartger; Wells, Phillippa; Wenaus, Torre; Wendland, Dennis; Weng, Zhili; Wengler, Thorsten; Wenig, Siegfried; Wermes, Norbert; Werner, Matthias; Werner, Per; Wessels, Martin; Wetter, Jeffrey; Whalen, Kathleen; White, Andrew; White, Martin; White, Ryan; White, Sebastian; Whiteson, Daniel; Whittington, Denver; Wicke, Daniel; Wickens, Fred; Wiedenmann, Werner; Wielers, Monika; Wienemann, Peter; Wiglesworth, Craig; Wiik-Fuchs, Liv Antje Mari; Wijeratne, Peter Alexander; Wildauer, Andreas; Wildt, Martin Andre; Wilkens, Henric George; Will, Jonas Zacharias; Williams, Hugh; Williams, Sarah; Willis, William; Willocq, Stephane; Wilson, John; Wilson, Alan; Wingerter-Seez, Isabelle; Winkelmann, Stefan; Winklmeier, Frank; Wittgen, Matthias; Wittig, Tobias; Wittkowski, Josephine; Wollstadt, Simon Jakob; Wolter, Marcin Wladyslaw; Wolters, Helmut; Wong, Wei-Cheng; Wosiek, Barbara; Wotschack, Jorg; Woudstra, Martin; Wozniak, Krzysztof; Wraight, Kenneth; Wright, Michael; Wu, Sau Lan; Wu, Xin; Wu, Yusheng; Wulf, Evan; Wyatt, Terry Richard; Wynne, Benjamin; Xella, Stefania; Xiao, Meng; Xu, Chao; Xu, Da; Xu, Lailin; Yabsley, Bruce; Yacoob, Sahal; Yamada, Miho; Yamaguchi, Hiroshi; Yamaguchi, Yohei; Yamamoto, Akira; Yamamoto, Kyoko; Yamamoto, Shimpei; Yamamura, Taiki; Yamanaka, Takashi; Yamauchi, Katsuya; Yamazaki, Yuji; Yan, Zhen; Yang, Haijun; Yang, Hongtao; Yang, Un-Ki; Yang, Yi; Yanush, Serguei; Yao, Liwen; Yasu, Yoshiji; Yatsenko, Elena; Yau Wong, Kaven Henry; Ye, Jingbo; Ye, Shuwei; Yen, Andy L; Yildirim, Eda; Yilmaz, Metin; Yoosoofmiya, Reza; Yorita, Kohei; Yoshida, Rikutaro; Yoshihara, Keisuke; Young, Charles; Young, Christopher John; Youssef, Saul; Yu, David Ren-Hwa; Yu, Jaehoon; Yu, Jie; Yuan, Li; Yurkewicz, Adam; Zabinski, Bartlomiej; Zaidan, Remi; Zaitsev, Alexander; Zaman, Aungshuman; Zambito, Stefano; Zanello, Lucia; Zanzi, Daniele; Zaytsev, Alexander; Zeitnitz, Christian; Zeman, Martin; Zemla, Andrzej; Zengel, Keith; Zenin, Oleg; \\v{Z}eni\\v{s}, Tibor; Zerwas, Dirk; Zevi della Porta, Giovanni; Zhang, Dongliang; Zhang, Huaqiao; Zhang, Jinlong; Zhang, Lei; Zhang, Xueyao; Zhang, Zhiqing; Zhao, Zhengguo; Zhemchugov, Alexey; Zhong, Jiahang; Zhou, Bing; Zhou, Lei; Zhou, Ning; Zhu, Cheng Guang; Zhu, Hongbo; Zhu, Junjie; Zhu, Yingchun; Zhuang, Xuai; Zibell, Andre; Zieminska, Daria; Zimine, Nikolai; Zimmermann, Christoph; Zimmermann, Robert; Zimmermann, Simone; Zimmermann, Stephanie; Zinonos, Zinonas; Ziolkowski, Michael; Zitoun, Robert; Zobernig, Georg; Zoccoli, Antonio; zur Nedden, Martin; Zurzolo, Giovanni; Zutshi, Vishnu; Zwalinski, Lukasz

2014-01-01

The prompt and non-prompt production cross-sections for the $\\chi_{c1}$ and $\\chi_{c2}$ charmonium states are measured in $pp$ collisions at $\\sqrt{s}=7$ TeV with the ATLAS detector at the LHC using 4.5 fb-1 of integrated luminosity. The $\\chi_{c}$ states are reconstructed through the radiative decay $\\chi_{c}\\rightarrow J/\\psi\\,\\gamma$ (with $J/\\psi\\rightarrow\\mu^{+}\\mu^{-}$) where photons are reconstructed from $\\gamma\\rightarrow e^{+}e^{-}$ conversions. The production rate of the $\\chi_{c2}$ state relative to the $\\chi_{c1}$ state is measured for prompt and non-prompt $\\chi_{c}$ as a function of $J/\\psi$ transverse momentum. The prompt $\\chi_{c}$ cross-sections are combined with existing measurements of prompt $J/\\psi$ production to derive the fraction of prompt $J/\\psi$ produced in feed-down from $\\chi_{c}$ decays. The fractions of $\\chi_{c1}$ and $\\chi_{c2}$ produced in $b$-hadron decays are also measured. In addition to measurements of inclusive $\\chi_{c}$ production, the branching fraction ${\\cal B}(B^...
Behaviour of C-shaped angle shear connectors under monotonic and fully reversed cyclic loading: An experimental study

International Nuclear Information System (INIS)

Shariati, Mahdi; Ramli Sulong, N.H.; Suhatril, Meldi; Shariati, Ali; Arabnejad Khanouki, M.M.; Sinaei, Hamid

2012-01-01

Highlights: ► C-shaped angle connectors show 8.8–33.1% strength degradation under cyclic loading. ► Connector fracture type of failure was experienced in C-shaped angle shear connectors. ► In push-out samples, more cracking was observed in those slabs with longer angles. ► C-shaped angle connectors show good behaviour in terms of the ultimate shear capacity. ► C-shaped angle connectors did not fulfil the requirements for ductility criteria. -- Abstract: This paper presents an evaluation of the structural behaviour of C-shaped angle shear connectors in composite beams, suitable for transferring shear force in composite structures. The results of the experimental programme, including eight push-out tests, are presented and discussed. The results include resistance, strength degradation, ductility, and failure modes of C-shaped angle shear connectors, under monotonic and fully reversed cyclic loading. The results show that connector fracture type of failure was experienced in C-shaped angle connectors and after the failure, more cracking was observed in those slabs with longer angles. On top of that, by comparing the shear resistance of C-shaped angle shear connectors under monotonic and cyclic loading, these connectors showed 8.8–33.1% strength degradation, under fully reversed cyclic loading. Furthermore, it was concluded that the mentioned shear connector shows a proper behaviour, in terms of the ultimate shear capacity, but it does not satisfy the ductility criteria, imposed by the Eurocode 4, to perform a plastic distribution of the shear force between different connectors along the beam length.
Gestion des côtes marocaines : renforcement des capacités d ...

International Development Research Centre (IDRC) Digital Library (Canada)

Les répercussions de la hausse du niveau de la mer, de l'inondation des côtes et des ondes de tempête constituent un enjeu de plus en plus important en matière de politiques pour les planificateurs, les autorités locales et les intervenants de secteurs comme la côte nord-est du Maroc. Ce projet financera le renforcement ...
Monkey liver cytochrome P450 2C19 is involved in R- and S-warfarin 7-hydroxylation.

Science.gov (United States)

Hosoi, Yoshio; Uno, Yasuhiro; Murayama, Norie; Fujino, Hideki; Shukuya, Mitsunori; Iwasaki, Kazuhide; Shimizu, Makiko; Utoh, Masahiro; Yamazaki, Hiroshi

2012-12-15

Cynomolgus monkeys are widely used as primate models in preclinical studies. However, some differences are occasionally seen between monkeys and humans in the activities of cytochrome P450 enzymes. R- and S-warfarin are model substrates for stereoselective oxidation in humans. In this current research, the activities of monkey liver microsomes and 14 recombinantly expressed monkey cytochrome P450 enzymes were analyzed with respect to R- and S-warfarin 6- and 7-hydroxylation. Monkey liver microsomes efficiently mediated both R- and S-warfarin 7-hydroxylation, in contrast to human liver microsomes, which preferentially catalyzed S-warfarin 7-hydroxylation. R-Warfarin 7-hydroxylation activities in monkey liver microsomes were not inhibited by α-naphthoflavone or ketoconazole, and were roughly correlated with P450 2C19 levels and flurbiprofen 4-hydroxylation activities in microsomes from 20 monkey livers. In contrast, S-warfarin 7-hydroxylation activities were not correlated with the four marker drug oxidation activities used. Among the 14 recombinantly expressed monkey P450 enzymes tested, P450 2C19 had the highest activities for R- and S-warfarin 7-hydroxylations. Monkey P450 3A4 and 3A5 slowly mediated R- and S-warfarin 6-hydroxylations. Kinetic analysis revealed that monkey P450 2C19 had high V(max) and low K(m) values for R-warfarin 7-hydroxylation, comparable to those for monkey liver microsomes. Monkey P450 2C19 also mediated S-warfarin 7-hydroxylation with V(max) and V(max)/K(m) values comparable to those for recombinant human P450 2C9. R-warfarin could dock favorably into monkey P450 2C19 modeled. These results collectively suggest high activities for monkey liver P450 2C19 toward R- and S-warfarin 6- and 7-hydroxylation in contrast to the saturation kinetics of human P450 2C9-mediated S-warfarin 7-hydroxylation. Copyright © 2012 Elsevier Inc. All rights reserved.
Semileptonic decays of B_c meson to S-wave charmonium states in the perturbative QCD approach

International Nuclear Information System (INIS)

Rui, Zhou; Li, Hong; Wang, Guang-xin; Xiao, Ying

2016-01-01

Inspired by the recent measurement of the ratio of B_c branching fractions to J/ψπ"+ and J/ψμ"+ν_μ final states at the LHCb detector, we study the semileptonic decays of B_c meson to the S-wave ground and radially excited 2S and 3S charmonium states with the perturbative QCD approach. After evaluating the form factors for the transitions B_c → P,V, where P and V denote pseudoscalar and vector S-wave charmonia, respectively, we calculate the branching ratios for all these semileptonic decays. The theoretical uncertainty of hadronic input parameters are reduced by utilizing the light-cone wave function for the B_c meson. It is found that the predicted branching ratios range from 10"-"7 up to 10"-"2 and could be measured by the future LHCb experiment. Our prediction for the ratio of branching fractions (BR(B_c"+→J/Ψπ"+))/(BR(B_c"+→J/Ψμ"+ν_μ)) is in good agreement with the data. For B_c → Vlν_l decays, the relative contributions of the longitudinal and transverse polarization are discussed in different momentum transfer squared regions. These predictions will be tested on the ongoing and forthcoming experiments. (orig.)
study of the effect of aluminum content and c / s ratio on the physico ...

African Journals Online (AJOL)

31 déc. 2014 ... Ce travail expérimental a pour objectif de montrer que la valorisation du sable de dunes du Sahara de l'Algérie est tout à fait pertinente dans la production de béton cellulaire, et que le rapport C/S ainsi que le dosage en Aluminium possèdent une importante influence sur les propriétés de ce type de béton.
Football as a R eflection of Modern S ociety’s C onflict s and a Way of C reating S ocietal T ies in Enduring E nmity C ontext

Directory of Open Access Journals (Sweden)

Ekain Rojo - Labaien

2014-06-01

Full Text Available T his paper proposal, which emanates from a PhD research finished by the author in 2013, is attempting to present a comparative study of different realities in the world to conclude that football‟s success resides in its ability to create and recreate national belongings and that it is capable to lead to the broadening of national understanding between confronted ethnic groups or countries. That is to say, that football serves on the one hand to refl ect mimetic conflicts between countries ; however, on the other hand it serves to reconcile fragmented societies around a common sense of belonging. Which is apparently a football incongruity; actually it is a reflect ion of the inherent conflict and contrad ictions of modern societies . In fact, firstly the sport event is used in this study as a research object to c onclude its importance in order to develop inner understanding between different confronted groups in the world. Secondly, it is considered, as wel l , as a scientific tool to analyze current human organizations and the complex societal ties which are generated there . A comparativ e methodology comprising different realities allows the researcher to obtain a scientific knowledge about the scope of the football phenomenon concerning nation building and reconciling processes.
Growth and properties of the CuInS2 thin films produced by glancing angle deposition

International Nuclear Information System (INIS)

Akkari, F. Chaffar; Kanzari, M.; Rezig, B.

2008-01-01

We use the glancing angle deposition technique (GLAD) to grow CuInS 2 thin films by a vacuum thermal method onto glass substrates. During deposition, the substrate temperature was maintained at 200 deg. C. Due to shadowing effect the oblique angle deposition technique can produce nanorods tilted toward the incident deposition flux. The evaporated atoms arrive at the growing interface at a fixed angle θ measured from the substrate normal. The substrate is rotated with rotational speed ω fixed at 0.033 rev s -1 . We show that the use of this growth technique leads to an improvement in the optical properties of the films. Indeed high absorption coefficients (10 5 -3.10 5 cm -1 ) in the visible range and near-IR spectral range are reached. In the case of the absence of the substrate rotation, scanning electron microscopy pictures show that the structure of the resulting film consists of nanocolumns that are progressively inclined towards the evaporation source as the incident angle was increased. If a rapid azimuthal rotation accompanies the substrate tilt, the resulting nanostructure is composed of an array of pillars normal to the substrate. The surface morphology show an improvement without presence of secondary phases for higher incident angles (θ > 60 deg.)
3,5-Bis(4-methoxyphenyl)-1-phenyl-4,5-dihydro-1H-pyrazole

OpenAIRE

Baktır, Zeliha; Akkurt, Mehmet; Samshuddin, S.; Narayana, B.; Yathirajan, H. S.

2011-01-01

In the title compound, C23H22N2O2, the central pyrazole ring is nearly planar (r.m.s. deviation = 0.046 Å) and it makes a dihedral angle of 18.5 (2)° with the phenyl ring. The dihedral angles between the phenyl and the two methoxy-substituted phenyl rings are 26.2 (2) and 80.6 (2)°. The crystal structure is stabilized by C—H...π stacking interactions and weak π–π interactions [cen...
SEMICONDUCTOR INTEGRATED CIRCUITS A 10-bit 200-kS/s SAR ADC IP core for a touch screen SoC

Science.gov (United States)

Xingyuan, Tong; Yintang, Yang; Zhangming, Zhu; Wenfang, Sheng

2010-10-01

Based on a 5 MSBs (most-significant-bits)-plus-5 LSBs (least-significant-bits) C-R hybrid D/A conversion and low-offset pseudo-differential comparison approach, with capacitor array axially symmetric layout topology and resistor string low gradient mismatch placement method, an 8-channel 10-bit 200-kS/s SAR ADC (successive-approximation-register analog-to-digital converter) IP core for a touch screen SoC (system-on-chip) is implemented in a 0.18 μm 1P5M CMOS logic process. Design considerations for the touch screen SAR ADC are included. With a 1.8 V power supply, the DNL (differential non-linearity) and INL (integral non-linearity) of this converter are measured to be about 0.32 LSB and 0.81 LSB respectively. With an input frequency of 91 kHz at 200-kS/s sampling rate, the spurious-free dynamic range and effective-number-of-bits are measured to be 63.2 dB and 9.15 bits respectively, and the power is about 136 μW. This converter occupies an area of about 0.08 mm2. The design results show that it is very suitable for touch screen SoC applications.
Incorporation of 2(S)-methylbutanoic acid-1-14C into the structure of mevinolin

International Nuclear Information System (INIS)

Willard, A.K.; Smith, R.L.

1982-01-01

A route to mevinolin approximately equal to (1) bearing (S)-2-methylbutanoic acid -1- 14 C as the ester side chain has been developed. The structure of mevinolin approximately equal to (1) was degraded and selectively protected to provide the alcohol approximately equal to 3 in three steps. Incorporation of 14 C was accomplished by acylation of alcohol approximately equal to 3 with (R,S)-2-methylbutyryl chloride-1- 14 C. Cleavage of the silyl ether protecting group in the resulting mixture of esters approximately equal to 4 provided the two diastereoisomers approximately equal to 5 and approximately equal to 6 which were separated by reverse-phase liquid chromatography. Mevinolin - 14 C approximately equal to (5) was also converted to the ammonium salt approximately equal to 7 of the corresponding dihydroxy acid. (author)
Detection of inhibitors of Candida albicans Cdr transporters using a diS-C3(3 fluorescence

Directory of Open Access Journals (Sweden)

Joanna eSzczepaniak

2015-03-01

Full Text Available Candida albicans is a major cause of opportunistic and life-threatening, systemic fungal infections. Hence new antifungal agents, as well as new methods to treat fungal infections, are still needed. The application of inhibitors of drug-efflux pumps may increase the susceptibility of C. albicans to drugs. We developed a new fluorescence method that allows the in vivo activity evaluation of compounds inhibiting of C. albicans transporters. We show that the potentiometric dye 3,3′-dipropylthiacarbocyanine iodide diS-C3(3 is pumped out by both Cdr1 and Cdr2 transporters. The fluorescence labeling with diS-C3(3 enables a real-time observation of the activity of C. albicans Cdr1 and Cdr2 transporters. We demonstrate that enniatin A and beauvericin show different specificities toward these transporters. Enniatin A inhibits diS-C3(3 efflux by Cdr1 while beauvericin inhibits both Cdr1p and Cdr2p.
Crystal structure of 5-[bis(methylsulfonylmethyl]-1,3-dimethyl-5-(methylsulfonylpyrimidine-2,4,6(1H,3H,5H-trione

Directory of Open Access Journals (Sweden)

Eyad Mallah

2015-01-01

Full Text Available In the title compound, C10H16N2O9S3, the pyrimidine ring of the 1,3-dimethyl barbituric acid moiety has an envelope conformation with the C atom carrying the methylsulfonyl and bis(methylsulfonylmethyl substituents as the flap. The dihedral angle between mean plane of the pyrimidine ring and the S/C/S plane is 72.4 (3°. In the crystal, molecules are linked via C—H...O hydrogen bonds, forming a three-dimensional structure.
Investigation of a van der Waals complex with C 1 symmetry: the free-jet rotational spectrum of 1,2-difluoroethane-Ar

Science.gov (United States)

Melandri, Sonia; Velino, Biagio; Favero, Paolo G.; Dell'Erba, Adele; Caminati, Walther

2000-04-01

The van der Waals complex between Ar and 1,2-difluoroethane has been investigated by free-jet absorption millimeter-wave spectroscopy in the frequency range 60-78 GHz. The analysis of the spectroscopic constants derived from the rotational spectrum allowed the determination of the dimer's structure. 1,2-Difluoroethane is in the gauche conformation and the Ar atom is in a position stabilized by the interaction with one fluorine and the two carbon atoms. The distance between Ar and the center of mass (CM) of the monomer is 3.968 Å, the angle between the Ar-CM line and the C-C bond is 65° and the dihedral angle Ar-CM-C-C is 99°. From centrifugal distortion effects the dissociation energy of the complex has been estimated to be 2.1 kJ/mol.
Cr doping induced negative transverse magnetoresistance in C d3A s2 thin films

Science.gov (United States)

Liu, Yanwen; Tiwari, Rajarshi; Narayan, Awadhesh; Jin, Zhao; Yuan, Xiang; Zhang, Cheng; Chen, Feng; Li, Liang; Xia, Zhengcai; Sanvito, Stefano; Zhou, Peng; Xiu, Faxian

2018-02-01

The magnetoresistance of a material conveys various dynamic information about charge and spin carriers, inspiring both fundamental studies in physics and practical applications such as magnetic sensors, data storage, and spintronic devices. Magnetic impurities play a crucial role in the magnetoresistance as they induce exotic states of matter such as the quantum anomalous Hall effect in topological insulators and tunable ferromagnetic phases in dilute magnetic semiconductors. However, magnetically doped topological Dirac semimetals are hitherto lacking. Here, we report a systematic study of Cr-doped C d3A s2 thin films grown by molecular-beam epitaxy. With the Cr doping, C d3A s2 thin films exhibit unexpected negative transverse magnetoresistance and strong quantum oscillations, bearing a trivial Berry's phase and an enhanced effective mass. More importantly, with ionic gating the magnetoresistance of Cr-doped C d3A s2 thin films can be drastically tuned from negative to positive, demonstrating the strong correlation between electrons and the localized spins of the Cr impurities, which we interpret through the formation of magnetic polarons. Such a negative magnetoresistance under perpendicular magnetic field and its gate tunability have not been observed previously in the Dirac semimetal C d3A s2 . The Cr-induced topological phase transition and the formation of magnetic polarons in C d3A s2 provide insights into the magnetic interaction in Dirac semimetals as well as their potential applications in spintronics.
Precision Measurement of the e+e-→Λc+Λ¯c - Cross Section Near Threshold

Science.gov (United States)

Ablikim, M.; Achasov, M. N.; Ahmed, S.; Albrecht, M.; Alekseev, M.; Amoroso, A.; An, F. F.; An, Q.; Bai, J. Z.; Bai, Y.; Bakina, O.; Baldini Ferroli, R.; Ban, Y.; Begzsuren, K.; Bennett, D. W.; Bennett, J. V.; Berger, N.; Bertani, M.; Bettoni, D.; Bianchi, F.; Boger, E.; Boyko, I.; Briere, R. A.; Cai, H.; Cai, X.; Cakir, O.; Calcaterra, A.; Cao, G. F.; Cetin, S. A.; Chai, J.; Chang, J. F.; Chelkov, G.; Chen, G.; Chen, H. S.; Chen, J. C.; Chen, M. L.; Chen, P. L.; Chen, S. J.; Chen, X. R.; Chen, Y. B.; Chu, X. K.; Cibinetto, G.; Cossio, F.; Dai, H. L.; Dai, J. P.; Dbeyssi, A.; Dedovich, D.; Deng, Z. Y.; Denig, A.; Denysenko, I.; Destefanis, M.; de Mori, F.; Ding, Y.; Dong, C.; Dong, J.; Dong, L. Y.; Dong, M. Y.; Dou, Z. L.; Du, S. X.; Duan, P. F.; Fang, J.; Fang, S. S.; Fang, Y.; Farinelli, R.; Fava, L.; Fegan, S.; Feldbauer, F.; Felici, G.; Feng, C. Q.; Fioravanti, E.; Fritsch, M.; Fu, C. D.; Gao, Q.; Gao, X. L.; Gao, Y.; Gao, Y. G.; Gao, Z.; Garillon, B.; Garzia, I.; Gilman, A.; Goetzen, K.; Gong, L.; Gong, W. X.; Gradl, W.; Greco, M.; Gu, M. H.; Gu, Y. T.; Guo, A. Q.; Guo, R. P.; Guo, Y. P.; Guskov, A.; Haddadi, Z.; Han, S.; Hao, X. Q.; Harris, F. A.; He, K. L.; He, X. Q.; Heinsius, F. H.; Held, T.; Heng, Y. K.; Holtmann, T.; Hou, Z. L.; Hu, H. M.; Hu, J. F.; Hu, T.; Hu, Y.; Huang, G. S.; Huang, J. S.; Huang, X. T.; Huang, X. Z.; Huang, Z. L.; Hussain, T.; Ikegami Andersson, W.; Ji, Q.; Ji, Q. P.; Ji, X. B.; Ji, X. L.; Jiang, X. S.; Jiang, X. Y.; Jiao, J. B.; Jiao, Z.; Jin, D. P.; Jin, S.; Jin, Y.; Johansson, T.; Julin, A.; Kalantar-Nayestanaki, N.; Kang, X. S.; Kavatsyuk, M.; Ke, B. C.; Khan, T.; Khoukaz, A.; Kiese, P.; Kliemt, R.; Koch, L.; Kolcu, O. B.; Kopf, B.; Kornicer, M.; Kuemmel, M.; Kuhlmann, M.; Kupsc, A.; Kühn, W.; Lange, J. S.; Lara, M.; Larin, P.; Lavezzi, L.; Leithoff, H.; Li, C.; Li, Cheng; Li, D. M.; Li, F.; Li, F. Y.; Li, G.; Li, H. B.; Li, H. J.; Li, J. C.; Li, J. W.; Li, Jin; Li, K. J.; Li, Kang; Li, Ke; Li, Lei; Li, P. L.; Li, P. R.; Li, Q. Y.; Li, W. D.; Li, W. G.; Li, X. L.; Li, X. N.; Li, X. Q.; Li, Z. B.; Liang, H.; Liang, Y. F.; Liang, Y. T.; Liao, G. R.; Libby, J.; Lin, C. X.; Lin, D. X.; Liu, B.; Liu, B. J.; Liu, C. X.; Liu, D.; Liu, F. H.; Liu, Fang; Liu, Feng; Liu, H. B.; Liu, H. L.; Liu, H. M.; Liu, Huanhuan; Liu, Huihui; Liu, J. B.; Liu, J. Y.; Liu, K.; Liu, K. Y.; Liu, Ke; Liu, L. D.; Liu, Q.; Liu, S. B.; Liu, X.; Liu, Y. B.; Liu, Z. A.; Liu, Zhiqing; Long, Y. F.; Lou, X. C.; Lu, H. J.; Lu, J. G.; Lu, Y.; Lu, Y. P.; Luo, C. L.; Luo, M. X.; Luo, X. L.; Lusso, S.; Lyu, X. R.; Ma, F. C.; Ma, H. L.; Ma, L. L.; Ma, M. M.; Ma, Q. M.; Ma, T.; Ma, X. N.; Ma, X. Y.; Ma, Y. M.; Maas, F. E.; Maggiora, M.; Malik, Q. A.; Mao, Y. J.; Mao, Z. P.; Marcello, S.; Meng, Z. X.; Messchendorp, J. G.; Mezzadri, G.; Min, J.; Mitchell, R. E.; Mo, X. H.; Mo, Y. J.; Morales Morales, C.; Muchnoi, N. Yu.; Muramatsu, H.; Mustafa, A.; Nefedov, Y.; Nerling, F.; Nikolaev, I. B.; Ning, Z.; Nisar, S.; Niu, S. L.; Niu, X. Y.; Olsen, S. L.; Ouyang, Q.; Pacetti, S.; Pan, Y.; Papenbrock, M.; Patteri, P.; Pelizaeus, M.; Pellegrino, J.; Peng, H. P.; Peng, Z. Y.; Peters, K.; Pettersson, J.; Ping, J. L.; Ping, R. G.; Pitka, A.; Poling, R.; Prasad, V.; Qi, H. R.; Qi, M.; Qi, T. Y.; Qian, S.; Qiao, C. F.; Qin, N.; Qin, X. S.; Qin, Z. H.; Qiu, J. F.; Rashid, K. H.; Redmer, C. F.; Richter, M.; Ripka, M.; Rolo, M.; Rong, G.; Rosner, Ch.; Sarantsev, A.; Savrié, M.; Schnier, C.; Schoenning, K.; Shan, W.; Shan, X. Y.; Shao, M.; Shen, C. P.; Shen, P. X.; Shen, X. Y.; Sheng, H. Y.; Shi, X.; Song, J. J.; Song, W. M.; Song, X. Y.; Sosio, S.; Sowa, C.; Spataro, S.; Sun, G. X.; Sun, J. F.; Sun, L.; Sun, S. S.; Sun, X. H.; Sun, Y. J.; Sun, Y. K.; Sun, Y. Z.; Sun, Z. J.; Sun, Z. T.; Tan, Y. T.; Tang, C. J.; Tang, G. Y.; Tang, X.; Tapan, I.; Tiemens, M.; Tsednee, B.; Uman, I.; Varner, G. S.; Wang, B.; Wang, B. L.; Wang, D.; Wang, D. Y.; Wang, Dan; Wang, K.; Wang, L. L.; Wang, L. S.; Wang, M.; Wang, Meng; Wang, P.; Wang, P. L.; Wang, W. P.; Wang, X. F.; Wang, Y.; Wang, Y. D.; Wang, Y. F.; Wang, Y. Q.; Wang, Z.; Wang, Z. G.; Wang, Z. Y.; Wang, Zongyuan; Weber, T.; Wei, D. H.; Wei, J. H.; Weidenkaff, P.; Wen, S. P.; Wiedner, U.; Wolke, M.; Wu, L. H.; Wu, L. J.; Wu, Z.; Xia, L.; Xia, Y.; Xiao, D.; Xiao, Y. J.; Xiao, Z. J.; Xie, Y. G.; Xie, Y. H.; Xiong, X. A.; Xiu, Q. L.; Xu, G. F.; Xu, J. J.; Xu, L.; Xu, Q. J.; Xu, Q. N.; Xu, X. P.; Yan, F.; Yan, L.; Yan, W. B.; Yan, W. C.; Yan, Y. H.; Yang, H. J.; Yang, H. X.; Yang, L.; Yang, Y. H.; Yang, Y. X.; Yang, Yifan; Ye, M.; Ye, M. H.; Yin, J. H.; You, Z. Y.; Yu, B. X.; Yu, C. X.; Yu, J. S.; Yuan, C. Z.; Yuan, Y.; Yuncu, A.; Zafar, A. A.; Zeng, Y.; Zeng, Z.; Zhang, B. X.; Zhang, B. Y.; Zhang, C. C.; Zhang, D. H.; Zhang, H. H.; Zhang, H. Y.; Zhang, J.; Zhang, J. L.; Zhang, J. Q.; Zhang, J. W.; Zhang, J. Y.; Zhang, J. Z.; Zhang, K.; Zhang, L.; Zhang, S. Q.; Zhang, X. Y.; Zhang, Y.; Zhang, Y. H.; Zhang, Y. T.; Zhang, Yang; Zhang, Yao; Zhang, Yu; Zhang, Z. H.; Zhang, Z. P.; Zhang, Z. Y.; Zhao, G.; Zhao, J. W.; Zhao, J. Y.; Zhao, J. Z.; Zhao, Lei; Zhao, Ling; Zhao, M. G.; Zhao, Q.; Zhao, S. J.; Zhao, T. C.; Zhao, Y. B.; Zhao, Z. G.; Zhemchugov, A.; Zheng, B.; Zheng, J. P.; Zheng, Y. H.; Zhong, B.; Zhou, L.; Zhou, Q.; Zhou, X.; Zhou, X. K.; Zhou, X. R.; Zhou, X. Y.; Zhu, A. N.; Zhu, J.; Zhu, K.; Zhu, K. J.; Zhu, S.; Zhu, S. H.; Zhu, X. L.; Zhu, Y. C.; Zhu, Y. S.; Zhu, Z. A.; Zhuang, J.; Zou, B. S.; Zou, J. H.; Besiii Collaboration

2018-03-01

The cross section of the e+e-→Λc+Λ¯c - process is measured with unprecedented precision using data collected with the BESIII detector at √{s }=4574.5 , 4580.0, 4590.0 and 4599.5 MeV. The nonzero cross section near the Λc+Λ¯c- production threshold is cleared. At center-of-mass energies √{s }=4574.5 and 4599.5 MeV, the higher statistics data enable us to measure the Λc polar angle distributions. From these, the Λc electric over magnetic form-factor ratios (|GE/GM|) are measured for the first time. They are found to be 1.14 ±0.14 ±0.07 and 1.23 ±0.05 ±0.03 , respectively, where the first uncertainties are statistical and the second are systematic.
Bis[2-(1,3-benzothiazol-2-ylphenyl-κ2C1,N][1,3-bis(4-bromophenylpropane-1,3-dionato-κ2O,O′]iridium(III

Directory of Open Access Journals (Sweden)

Sung Kwon Kang

2013-08-01

Full Text Available The title complex, [Ir(C15H9Br2O2(C13H8NS2], lies about a crystallographic twofold rotation axis passing through the IrIII atom and the central C atom of the bis(bromophenylpropane-1,3-dionate ligand. The IrIII atom adopts a distorted octahedral geometry coordinated by two N atoms in the axial positions, and two C and two O atoms in the equatorial plane. The dihedral angle between the two thiazole ring systems in the complex is 77.45 (10°.
(4S)-4-(3,4-Dichloro?phen?yl)-1?-methyl-4?-phenyl-3,4-dihydronaphthalene-2-spiro-3?-pyrrolidine-2?-spiro-1??-acenaphthyl?ene-1,2??(2H,1??H)-dione

OpenAIRE

Murugan, R.; Gunasekaran, B.; Narayanan, S. Sriman; Manivannan, V.

2008-01-01

In the title compound, C37H27Cl2NO2, the 3,4-dichloro?phenyl ring makes a dihedral angle of 46.66?(6)? with the phenyl ring. The mol?ecular structure is stabilized by weak intra?molecular C?H?O inter?actions and the crystal structure is stabilized by weak inter?molecular C?H?O inter?actions. The C?C?C?C?C five-membered ring is planar, while the C?C?C?C?N five-membered ring adopts a half-chair conformation.
Observation of e+e-→ϕ χc 1 and ϕ χc 2 at √{s }=4.600 GeV

Science.gov (United States)

Ablikim, M.; Achasov, M. N.; Ahmed, S.; Albrecht, M.; Amoroso, A.; An, F. F.; An, Q.; Bai, J. Z.; Bai, Y.; Bakina, O.; Baldini Ferroli, R.; Ban, Y.; Bennett, D. W.; Bennett, J. V.; Berger, N.; Bertani, M.; Bettoni, D.; Bian, J. M.; Bianchi, F.; Boger, E.; Boyko, I.; Briere, R. A.; Cai, H.; Cai, X.; Cakir, O.; Calcaterra, A.; Cao, G. F.; Cetin, S. A.; Chai, J.; Chang, J. F.; Chelkov, G.; Chen, G.; Chen, H. S.; Chen, J. C.; Chen, M. L.; Chen, P. L.; Chen, S. J.; Chen, X. R.; Chen, Y. B.; Chu, X. K.; Cibinetto, G.; Dai, H. L.; Dai, J. P.; Dbeyssi, A.; Dedovich, D.; Deng, Z. Y.; Denig, A.; Denysenko, I.; Destefanis, M.; de Mori, F.; Ding, Y.; Dong, C.; Dong, J.; Dong, L. Y.; Dong, M. Y.; Dou, Z. L.; Du, S. X.; Duan, P. F.; Fang, J.; Fang, S. S.; Fang, Y.; Farinelli, R.; Fava, L.; Fegan, S.; Feldbauer, F.; Felici, G.; Feng, C. Q.; Fioravanti, E.; Fritsch, M.; Fu, C. D.; Gao, Q.; Gao, X. L.; Gao, Y.; Gao, Y. G.; Gao, Z.; Garzia, I.; Goetzen, K.; Gong, L.; Gong, W. X.; Gradl, W.; Greco, M.; Gu, M. H.; Gu, Y. T.; Guo, A. Q.; Guo, R. P.; Guo, Y. P.; Haddadi, Z.; Han, S.; Hao, X. Q.; Harris, F. A.; He, K. L.; He, X. Q.; Heinsius, F. H.; Held, T.; Heng, Y. K.; Holtmann, T.; Hou, Z. L.; Hu, H. M.; Hu, T.; Hu, Y.; Huang, G. S.; Huang, J. S.; Huang, X. T.; Huang, X. Z.; Huang, Z. L.; Hussain, T.; Ikegami Andersson, W.; Ji, Q.; Ji, Q. P.; Ji, X. B.; Ji, X. L.; Jiang, X. S.; Jiang, X. Y.; Jiao, J. B.; Jiao, Z.; Jin, D. P.; Jin, S.; Jin, Y.; Johansson, T.; Julin, A.; Kalantar-Nayestanaki, N.; Kang, X. L.; Kang, X. S.; Kavatsyuk, M.; Ke, B. C.; Khan, T.; Khoukaz, A.; Kiese, P.; Kliemt, R.; Koch, L.; Kolcu, O. B.; Kopf, B.; Kornicer, M.; Kuemmel, M.; Kuessner, M.; Kuhlmann, M.; Kupsc, A.; Kühn, W.; Lange, J. S.; Lara, M.; Larin, P.; Lavezzi, L.; Leithoff, H.; Leng, C.; Li, C.; Li, Cheng; Li, D. M.; Li, F.; Li, F. Y.; Li, G.; Li, H. B.; Li, H. J.; Li, J. C.; Li, Jin; Li, K. J.; Li, Kang; Li, Ke; Li, Lei; Li, P. L.; Li, P. R.; Li, Q. Y.; Li, W. D.; Li, W. G.; Li, X. L.; Li, X. N.; Li, X. Q.; Li, Z. B.; Liang, H.; Liang, Y. F.; Liang, Y. T.; Liao, G. R.; Lin, D. X.; Liu, B.; Liu, B. J.; Liu, C. X.; Liu, D.; Liu, F. H.; Liu, Fang; Liu, Feng; Liu, H. B.; Liu, H. M.; Liu, Huanhuan; Liu, Huihui; Liu, J. B.; Liu, J. P.; Liu, J. Y.; Liu, K.; Liu, K. Y.; Liu, Ke; Liu, L. D.; Liu, P. L.; Liu, Q.; Liu, S. B.; Liu, X.; Liu, Y. B.; Liu, Z. A.; Liu, Zhiqing; Long, Y. F.; Lou, X. C.; Lu, H. J.; Lu, J. G.; Lu, Y.; Lu, Y. P.; Luo, C. L.; Luo, M. X.; Luo, X. L.; Lyu, X. R.; Ma, F. C.; Ma, H. L.; Ma, L. L.; Ma, M. M.; Ma, Q. M.; Ma, T.; Ma, X. N.; Ma, X. Y.; Ma, Y. M.; Maas, F. E.; Maggiora, M.; Malik, Q. A.; Mao, Y. J.; Mao, Z. P.; Marcello, S.; Meng, Z. X.; Messchendorp, J. G.; Mezzadri, G.; Min, J.; Min, T. J.; Mitchell, R. E.; Mo, X. H.; Mo, Y. J.; Morales Morales, C.; Muchnoi, N. Yu.; Muramatsu, H.; Musiol, P.; Mustafa, A.; Nefedov, Y.; Nerling, F.; Nikolaev, I. B.; Ning, Z.; Nisar, S.; Niu, S. L.; Niu, X. Y.; Olsen, S. L.; Ouyang, Q.; Pacetti, S.; Pan, Y.; Papenbrock, M.; Patteri, P.; Pelizaeus, M.; Pellegrino, J.; Peng, H. P.; Peters, K.; Pettersson, J.; Ping, J. L.; Ping, R. G.; Pitka, A.; Poling, R.; Prasad, V.; Qi, H. R.; Qi, M.; Qian, S.; Qiao, C. F.; Qin, N.; Qin, X. S.; Qin, Z. H.; Qiu, J. F.; Rashid, K. H.; Redmer, C. F.; Richter, M.; Ripka, M.; Rolo, M.; Rong, G.; Rosner, Ch.; Sarantsev, A.; Savrié, M.; Schnier, C.; Schoenning, K.; Shan, W.; Shao, M.; Shen, C. P.; Shen, P. X.; Shen, X. Y.; Sheng, H. Y.; Song, J. J.; Song, W. M.; Song, X. Y.; Sosio, S.; Sowa, C.; Spataro, S.; Sun, G. X.; Sun, J. F.; Sun, L.; Sun, S. S.; Sun, X. H.; Sun, Y. J.; Sun, Y. K.; Sun, Y. Z.; Sun, Z. J.; Sun, Z. T.; Tang, C. J.; Tang, G. Y.; Tang, X.; Tapan, I.; Tiemens, M.; Tsednee, B.; Uman, I.; Varner, G. S.; Wang, B.; Wang, B. L.; Wang, D.; Wang, D. Y.; Wang, Dan; Wang, K.; Wang, L. L.; Wang, L. S.; Wang, M.; Wang, Meng; Wang, P.; Wang, P. L.; Wang, W. P.; Wang, X. F.; Wang, Y.; Wang, Y. D.; Wang, Y. F.; Wang, Y. Q.; Wang, Z.; Wang, Z. G.; Wang, Z. Y.; Wang, Zongyuan; Weber, T.; Wei, D. H.; Weidenkaff, P.; Wen, S. P.; Wiedner, U.; Wolke, M.; Wu, L. H.; Wu, L. J.; Wu, Z.; Xia, L.; Xia, Y.; Xiao, D.; Xiao, H.; Xiao, Y. J.; Xiao, Z. J.; Xie, Y. G.; Xie, Y. H.; Xiong, X. A.; Xiu, Q. L.; Xu, G. F.; Xu, J. J.; Xu, L.; Xu, Q. J.; Xu, Q. N.; Xu, X. P.; Yan, L.; Yan, W. B.; Yan, W. C.; Yan, Y. H.; Yang, H. J.; Yang, H. X.; Yang, L.; Yang, Y. H.; Yang, Y. X.; Ye, M.; Ye, M. H.; Yin, J. H.; You, Z. Y.; Yu, B. X.; Yu, C. X.; Yu, J. S.; Yuan, C. Z.; Yuan, Y.; Yuncu, A.; Zafar, A. A.; Zeng, Y.; Zeng, Z.; Zhang, B. X.; Zhang, B. Y.; Zhang, C. C.; Zhang, D. H.; Zhang, H. H.; Zhang, H. Y.; Zhang, J.; Zhang, J. L.; Zhang, J. Q.; Zhang, J. W.; Zhang, J. Y.; Zhang, J. Z.; Zhang, K.; Zhang, L.; Zhang, S. Q.; Zhang, X. Y.; Zhang, Y. H.; Zhang, Y. T.; Zhang, Yang; Zhang, Yao; Zhang, Yu; Zhang, Z. H.; Zhang, Z. P.; Zhang, Z. Y.; Zhao, G.; Zhao, J. W.; Zhao, J. Y.; Zhao, J. Z.; Zhao, Lei; Zhao, Ling; Zhao, M. G.; Zhao, Q.; Zhao, S. J.; Zhao, T. C.; Zhao, Y. B.; Zhao, Z. G.; Zhemchugov, A.; Zheng, B.; Zheng, J. P.; Zheng, W. J.; Zheng, Y. H.; Zhong, B.; Zhou, L.; Zhou, X.; Zhou, X. K.; Zhou, X. R.; Zhou, X. Y.; Zhou, Y. X.; Zhu, J.; Zhu, J.; Zhu, K.; Zhu, K. J.; Zhu, S.; Zhu, S. H.; Zhu, X. L.; Zhu, Y. C.; Zhu, Y. S.; Zhu, Z. A.; Zhuang, J.; Zou, B. S.; Zou, J. H.; Besiii Collaboration

2018-02-01

Using a data sample collected with the BESIII detector operating at the BEPCII storage ring at a center-of-mass energy of √{s }=4.600 GeV , we search for the production of e+e-→ϕ χc 0 ,1 ,2 . A search is also performed for the charmonium-like state X (4140 ) in the radiative transition e+e-→γ X (4140 ) with X (4140 ) subsequently decaying into ϕ J /ψ . The processes e+e-→ϕ χc 1 and ϕ χc 2 are observed for the first time, each with a statistical significance of more than 10 σ , and the Born cross sections are measured to be (4. 2-1.0+1.7±0.3 ) and (6. 7-1.7+3.4±0.5 ) pb , respectively, where the first uncertainties are statistical and the second systematic. No significant signals are observed for e+e-→ϕ χc 0 and e+e-→γ X (4140 ) and upper limits on the Born cross sections at 90% C.L. are provided at √{s }=4.600 GeV .

4-(4-Chlorophenyl-6-(methylsulfanylpyrimidin-2-amine

Directory of Open Access Journals (Sweden)

Qi-Hua Zhao

2009-08-01

Full Text Available In the title compound, C11H10ClN3S, the dihedral angle between the benzene and pyrimidine rings is 3.99 (4°. In the crystal, intermolecular N—H...N hydrogen bonds link the molecules into ribbons of R22(8 rings parallel to [100]. Weak C—H...S contacts connect adjacent ribbons into a two-dimensional undulating layer-like structure extending parallel to (110. The benzene and pyrimidine rings of adjacent molecules have the offset face-to-face π–π stacking interactions in a zigzag fashion along the c axis, with perpendicular ring distances of 3.463 and 3.639 Å, and a dihedral angle between the planes of 3.99< (2°. The distance between the ring centroids is 4.420 (2 Å.
11 CFR 104.20 - Reporting electioneering communications (2 U.S.C. 434(f)).

Science.gov (United States)

2010-01-01

... POLITICAL COMMITTEES AND OTHER PERSONS (2 U.S.C. 434) § 104.20 Reporting electioneering communications (2 U... 11 Federal Elections 1 2010-01-01 2010-01-01 false Reporting electioneering communications (2 U.S... electioneering communication is publicly distributed provided that the person making the electioneering...
5 CFR 2640.302 - Waivers issued pursuant to 18 U.S.C. 208(b)(3).

Science.gov (United States)

2010-01-01

... actual or potential profit or loss or cost of the matter to the company issuing the stock, the change in...) Requirements for issuing an individual waiver under 18 U.S.C. 208(b)(3). Pursuant to 18 U.S.C. 208(b)(3), an...) The type of interest that is creating the disqualification (e.g. stock, bonds, real estate, other...
46 CFR 68.5 - Requirements for citizenship under 46 U.S.C. App. 883-1.

Science.gov (United States)

2010-10-01

... territories or possessions, not less than 75 percent of the raw materials used or sold in its operations. Note... 46 Shipping 2 2010-10-01 2010-10-01 false Requirements for citizenship under 46 U.S.C. App. 883-1... Engaging in Limited Coastwise Trade § 68.5 Requirements for citizenship under 46 U.S.C. App. 883-1. A...
Smrtící pasti pro ptáky lidských sídel

Czech Academy of Sciences Publication Activity Database

Šálek, Martin; Dobrý, P.

2018-01-01

Roč. 25, č. 1 (2018), s. 24-25 ISSN 1801-7525 Institutional support: RVO:68081766 Keywords : Athene Subject RIV: EG - Zoology http://www.birdlife.cz/wp-content/uploads/2018/02/Pta%C4%8D%C3%AD-sv%C4%9Bt-Pt%C3%A1k-roku-2018. pdf
Search for $B_c \\to B_s \\pi$, $B_s \\to J/\\psi \\phi$ decay with the CDF Detector

Energy Technology Data Exchange (ETDEWEB)

Rogers, Edwin Lloyd [Univ. of Illinois, Urbana-Champaign, IL (United States)

2010-01-01

This analysis details the search for B$+\\atop{c}$ → B$0\\atop{s}$ π⁺, B$0\\atop{s}$ → J/ΨΦ decays, and the charge conjugate mode, using the CDF II detector at the Fermi National Accelerator Laboratory. The search is derived from a sample of 5.84 fb^-1 of data from p$\\bar{p}$ collisions of √s = 1.96 TeV collected via J/Ψ trigger paths.
Diseño de un sistema administrativo contable aplicable a la empresa Centro Artesanal Niño Jesús S.C.C.

OpenAIRE

Posso García, Carlos Patricio

2006-01-01

El Sistema Administrativo Contable es el pilar de toda organización para poder desarrollar adecuadamente sus actividades, estableciendo responsabilidades a los encargados de las todas las áreas, medidas de seguridad y control. Diseñar un modelo de un SISTEMA ADMINISTRATIVO-CONTABLE para la empresa CENTRO ARTESANAL NIÑO JESÚS S.C.C. permitirá contar con una oportuna, completa y exacta información de los resultados financieros de la Empresa en su conjunto; así como mejorar los procesos ad...
Why There Are Certain Parallels Between Joachim C. Fest’s Hitler-Biography and Michael Wolff’s Trump-Book

Directory of Open Access Journals (Sweden)

Christian Fuchs

2018-02-01

Full Text Available Joachim C. Fest published one of the most widely read Hitler biographies in 1973. Are there parallels of its analytical approach to Michael Wolff’s “Fire and Fury: Inside the Trump White House”?
C. S. Peirce's Complementary and Transdisciplinary Conception of Science and Religion

DEFF Research Database (Denmark)

Brier, Søren

2012-01-01

C. S. Peirce was very mathematical, logical and empirical in the foundations of his thinking and he saw no principal limits to the knowledge obtainable by science. But the transdisciplinary view he developed differs substantially from the unity science of logical positivism in that he worked...
Study of the P -Wave Charmonium State χcJ in ψ(2S) Decays

International Nuclear Information System (INIS)

Bai, J.Z.; Bian, J.G.; Chai, Z.W.; Chen, G.P.; Chen, J.C.; Chen, Y.; Chen, Y.B.; Chen, Y.Q.; Cheng, B.S.; Cui, X.Z.; Ding, H.L.; Ding, L.Y.; Dong, L.Y.; Du, Z.Z.; Feng, S.; Gao, C.S.; Gao, M.L.; Gao, S.Q.; Gu, J.H.; Gu, S.D.; Gu, W.X.; Gu, Y.F.; Guo, Y.N.; Han, S.W.; Han, Y.; He, J.; He, J.T.; Hu, G.Y.; Hu, H.M.; Hu, J.L.; Hu, Q.H.; Hu, T.; Hu, X.Q.; Huang, J.D.; Huang, Y.Z.; Jiang, C.H.; Jin, Y.; Ke, Z.J.; Lai, Y.F.; Lang, P.F.; Li, C.G.; Li, D.; Li, H.B.; Li, J.; Li, P.Q.; Li, R.B.; Li, W.; Li, W.D.; Li, W.G.; Li, X.H.; Li, X.N.; Liu, H.M.; Liu, J.; Liu, J.H.; Liu, R.G.; Liu, Y.; Lu, F.; Lu, J.G.; Lu, J.Y.; Lu, L.C.; Luo, C.H.; Ma, A.M.; Ma, E.C.; Ma, J.M.; Mao, H.S.; Mao, Z.P.; Meng, X.C.; Nie, J.; Qi, N.D.; Qi, X.R.; Qiu, J.F.; Qu, Y.H.; Que, Y.K.; Rong, G.; Shao, Y.Y.; Shen, B.W.; Shen, D.L.; Shen, H.; Shen, X.Y.; Sheng, H.Y.; Shi, H.Z.; Song, X.F.; Sun, F.; Sun, H.S.; Tang, S.Q.; Tong, G.L.; Wang, F.; Wang, L.S.; Wang, L.Z.; Wang, M.; Wang, M.; Wang, P.; Wang, P.L.; Wang, S.M.; Wang, T.J.; Wang, Y.Y.; Wei, C.L.; Wu, Y.G.; Xi, D.M.; Xia, X.M.; Xie, P.P.; Xie, Y.; Xie, Y.H.; Xiong, W.J.; Xu, C.C.; Xu, G.F.; Xue, S.T.; Yan, J.; Yan, W.G.; Yang, C.M.; Yang, C.Y.; Yang, J.; Yang, X.F.; Ye, M.H.; Yi, K.; Yu, C.S.; Yu, C.X.; Yu, Z.Q.; Yu, Z.T.; Yuan, C.Z.; Yuan, Y.; Zhang, B.Y.; Zhang, C.C.; Zhang, D.H.; Zhang, D.; Zhang, H.L.; Zhang, J.; Zhang, J.L.; Zhang, J.W.; Zhang, L.S.; Zhang, Q.J.; Zhang, S.Q.; Zhang, Y.; Zhang, Y.Y.; Zhao, D.X.; Zhao, H.W.; Zhao, J.W.; Zhao, M.; Zhao, W.R.; Zhao, Z.G.; Zheng, J.P.; Zheng, L.S.; Zheng, Z.P.; Zhou, G.P.; Zhou, H.S.; Zhou, L.; Zhu, Q.M.; Zhu, Y.C.; Zhu, Y.S.; Zhuang, B.A.; Hitlin, D.G.; Kelsey, M.H.; Oyang, J.; Panetta, J.; Porter, F.; Weaver, M.; Chen, J.; Malchow, R.; Toki, W.; Yang, W.

1998-01-01

The processes ψ(2S)→γπ + π - , γK + K - , and γpp have been studied using a sample of 3.79x10 6 ψ(2S) decays. We determine the total width of the χ c0 to be Γ tot χ c0 =14.3±2.0±3.0 MeV . We present the first measurement of the branching fraction B(χ c0 →pp)=( 15.9±4.3±5.3)x10 -5 , where the first error is statistical and the second one is systematic. Branching fractions of χ c0,2 →π + π - and K + K - are also reported. copyright 1998 The American Physical Society
Pair of accelerated black holes in an anti-de Sitter background: The AdS C metric

International Nuclear Information System (INIS)

Dias, Oscar J.C.; Lemos, Jose P.S.

2003-01-01

The anti-de Sitter C metric (AdS C metric) is characterized by a quite interesting new feature when compared with the C metric in flat or de Sitter backgrounds. Indeed, contrary to what happens in these two last exact solutions, the AdS C metric only describes a pair of accelerated black holes if the acceleration parameter satisfies A>1/l, where l is the cosmological length. The two black holes cannot interact gravitationally and their acceleration is totally provided by the pressure exerted by a strut that pushes the black holes apart. Our analysis is based on the study of the causal structure, on the description of the solution in the AdS 4-hyperboloid in a 5D Minkowski spacetime, and on the physics of the strut. We also analyze the cases A=1/l and A<1/l that represent a single accelerated black hole in the AdS background
Structural characterization of the photoswitchable fluorescent protein Dronpa-C62S

International Nuclear Information System (INIS)

Nam, Ki-Hyun; Kwon, Oh Yeun; Sugiyama, Kanako; Lee, Won-Ho; Kim, Young Kwan; Song, Hyun Kyu; Kim, Eunice Eunkyung; Park, Sam-Yong; Jeon, Hyesung; Hwang, Kwang Yeon

2007-01-01

The photoswitching behavior of green fluorescent proteins (GFPs) or GFP-like proteins is increasingly recognized as a new technique for optical marking. Recently, Ando and his colleagues developed a new green fluorescent protein Dronpa, which possesses the unique photochromic property of being photoswitchable in a non-destructive manner. To better understand this mechanism, we determined the crystal structures of a new GFP Dronpa and its mutant C62S, at 1.9 A and 1.8 A, respectively. Determination of the structures demonstrates that a unique hydrogen-bonding network and the sulfur atom of the chromophore are critical to the photoswitching property of Dronpa. Reversible photoswitching was lost in cells expressing the Dronpa-C62S upon repetitive irradiation compared to the native protein. Structural and mutational analyses reveal the chemical basis for the functional properties of photoswitchable fluorescent proteins and provide the basis for subsequent coherent engineering of this subfamily of Dronpa homolog's
[2,6-Difluoro-3-(pyridin-2-yl-κNpyridin-4-yl-κC4](pentane-2,4-dionato-κ2O,O′iridium(III

Directory of Open Access Journals (Sweden)

Kaijun Luo

2013-11-01

Full Text Available The title compound, [Ir(C10H5F2N22(C5H7O2], has a distorted octahedral coordination geometry around the IrIII atom, retaining the cis-C,C/trans-N,N chelate disposition in two 2,6-difluoro-3-(pyridin-2-yl-κNpyridin-4-yl ligands which are nearly mutually perpendicular [dihedral angle = 82.75 (15°]. The molecular structure is stabilized by weak C—H...O and C—H...F hydrogen-bond interactions. The crystal structure is stabilized by π–π stacking interactions (centroid–centroid distance = 3.951 Å.
Dissociation of activated protein C functions by elimination of protein S cofactor enhancement.

LENUS (Irish Health Repository)

Harmon, Shona

2008-11-07

Activated protein C (APC) plays a critical anticoagulant role in vivo by inactivating procoagulant factor Va and factor VIIIa and thus down-regulating thrombin generation. In addition, APC bound to the endothelial cell protein C receptor can initiate protease-activated receptor-1 (PAR-1)-mediated cytoprotective signaling. Protein S constitutes a critical cofactor for the anticoagulant function of APC but is not known to be involved in regulating APC-mediated protective PAR-1 signaling. In this study we utilized a site-directed mutagenesis strategy to characterize a putative protein S binding region within the APC Gla domain. Three single amino acid substitutions within the APC Gla domain (D35T, D36A, and A39V) were found to mildly impair protein S-dependent anticoagulant activity (<2-fold) but retained entirely normal cytoprotective activity. However, a single amino acid substitution (L38D) ablated the ability of protein S to function as a cofactor for this APC variant. Consequently, in assays of protein S-dependent factor Va proteolysis using purified proteins or in the plasma milieu, APC-L38D variant exhibited minimal residual anticoagulant activity compared with wild type APC. Despite the location of Leu-38 in the Gla domain, APC-L38D interacted normally with endothelial cell protein C receptor and retained its ability to trigger PAR-1 mediated cytoprotective signaling in a manner indistinguishable from that of wild type APC. Consequently, elimination of protein S cofactor enhancement of APC anticoagulant function represents a novel and effective strategy by which to separate the anticoagulant and cytoprotective functions of APC for potential therapeutic gain.
2-(4-Bromophenyl-5-fluoro-3-phenylsulfinyl-1-benzofuran

Directory of Open Access Journals (Sweden)

Hong Dae Choi

2010-08-01

Full Text Available In the title compound, C20H12BrFO2S, the O atom and the phenyl group of the phenylsulfinyl substituent lie on opposite sides of the plane through the benzofuran fragment; the phenyl ring is nearly perpendicular to this plane [dihedral angle = 86.98 (6°]. The 4-bromophenyl ring is rotated slightly out of the benzofuran plane, making a dihedral angle of 1.56 (8°. The crystal structure features aromatic π–π interactions between the furan and phenyl rings of neighbouring molecules [centroid–centroid distance = 3.506 (3 Å], and an intermolecular C—H...π interaction. The crystal structure also exhibits a short intermolecular S...S contact [3.2635 (8 Å].
Ettringite and C-S-H Portland cement phases for waste ion immobilization: A review

International Nuclear Information System (INIS)

Gougar, M.L.D.; Scheetz, B.E.; Roy, D.M.

1996-01-01

The formation, structure and chemistry of the ettringite and C-S-H phases of Portland cement have been reviewed as they relate to waste ion immobilization. The purpose of this review was to investigate the use of Portland cement as a host for priority metallic pollutants as identified by the Environmental Protection Agency and as a host for radioactive waste ions as identified in 40 CFR 191. Ettringite acts as host to a number of these ions in both the columnar and channel sections of the crystal structure. Substitutions have been made at the calcium, aluminum, hydroxide and sulfate sites. C-S-H also hosts a number of the waste species in both ionic and salt form. Immobilization mechanisms for C-S-H include sorption, phase mixing and substitution. The following ions have not apparently been reported as specifically immobilized by one of these phases: Ag, Am, Np, Pu, Ra, Tc, Th and Sn; however, some of these ions are immobilized by Portland cement
Magnesium Lithospermate B, an Active Extract of Salvia miltiorrhiza, Mediates sGC/cGMP/PKG Translocation in Experimental Vasospasm

Directory of Open Access Journals (Sweden)

Chih-Zen Chang

2014-01-01

Full Text Available Background. Soluble guanylyl cyclases (sGCs and Ras homolog gene family, member A (rhoA/Ras homolog gene family kinase(rho-kinase plays a role in vascular smooth muscle relaxation in subarachnoid hemorrhage (SAH. It is of interest to examine the effect of MLB on rhoA/ROCK and sGC/cGMP/PKG expression. Methods. A rodent SAH model was employed. Tissue samples were for sGCα1, sGCβ1, PKG, rhoA, ROCK (Western blot, and cGMP (ELISA measurement. Results. MLB morphologically improved convolution of the internal elastic lamina, distortion of endothelial wall, and necrosis of the smooth muscle in the SAH rats. Expressed cGMP, sGCα1, sGCβ1, and PKG in the SAH groups were reduced (P<0.01, and MLB precondition significantly induced cGMP, sGCα1, sGCβ1, and PKG. L-NAME reversed the vasodilation effect of MLB, reduced the bioexpression of PKG and cGMP (P<0.01, and tends to reduce sGCα1 level and induce rhoA, ROCK level in MLB precondition + SAH groups. Conclusion. These results demonstrate that sGC/cGMP/PKG and NO/ET pathways play pivotal roles in SAH-induced vasospasm. Through activating sGC/cGMP/PKG pathway and partially by inactivating rho-kinase in a NO-dependent mechanism, MLB shows promise to be an effective strategy for the treatment of this disease entity.
Measurement of sigma chi c2 B(chi c2-->J/psi gamma)/sigma chi c1 B(chi c1 -->J/psi gamma) in pp collisions at square root s=1.96 TeV.

Science.gov (United States)

Abulencia, A; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arguin, J-F; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Budroni, S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carillo, S; Carlsmith, D; Carosi, R; Carron, S; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciljak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Cyr, D; DaRonco, S; Datta, M; D'Auria, S; Davies, T; D'Onofrio, M; Dagenhart, D; de Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; Dell'Orso, M; Delli Paoli, F; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; DiTuro, P; Dörr, C; Donati, S; Donega, M; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Field, R; Flanagan, G; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garcia, J E; Garberson, F; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Gimmell, J L; Ginsburg, C; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, J; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Griffiths, M; Grinstein, S; Grosso-Pilcher, C; Group, R C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B-Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Holloway, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ishizawa, Y; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jensen, H; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kovalev, A; Kraan, A C; Kraus, J; Kravchenko, I; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; LeCompte, T; Lee, J; Lee, J; Lee, Y J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P; Lu, R-S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Manca, G; Margaroli, F; Marginean, R; Marino, C; Marino, C P; Martin, A; Martin, M; Martin, V; Martínez, M; Maruyama, T; Mastrandrea, P; Masubuchi, T; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyamoto, A; Moed, S; Moggi, N; Mohr, B; Moore, R; Morello, M; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Nachtman, J; Nagano, A; Naganoma, J; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nigmanov, T; Nodulman, L; Norniella, O; Nurse, E; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Oldeman, R; Orava, R; Osterberg, K; Pagliarone, C; Palencia, E; Papadimitriou, V; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Piedra, J; Pinera, L; Pitts, K; Plager, C; Pondrom, L; Portell, X; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Ranjan, N; Rappoccio, S; Reisert, B; Rekovic, V; Renton, P; Rescigno, M; Richter, S; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Ruiz, A; Russ, J; Rusu, V; Saarikko, H; Sabik, S; Safonov, A; Sakumoto, W K; Salamanna, G; Saltó, O; Saltzberg, D; Sánchez, C; Santi, L; Sarkar, S; Sartori, L; Sato, K; Savard, P; Savoy-Navarro, A; Scheidle, T; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scott, A L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Sexton-Kennedy, L; Sfyrla, A; Shapiro, M D; Shears, T; Shepard, P F; Sherman, D; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Sinervo, P; Sisakyan, A; Sjolin, J; Slaughter, A J; Slaunwhite, J; Sliwa, K; Smith, J R; Snider, F D; Snihur, R; Soderberg, M; Soha, A; Somalwar, S; Sorin, V; Spalding, J; Spinella, F; Spreitzer, T; Squillacioti, P; Stanitzki, M; Staveris-Polykalas, A; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Stuart, D; Suh, J S; Sukhanov, A; Sun, H; Suzuki, T; Taffard, A; Takashima, R; Takeuchi, Y; Takikawa, K; Tanaka, M; Tanaka, R; Tecchio, M; Teng, P K; Terashi, K; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tsuchiya, R; Tsuno, S; Turini, N; Ukegawa, F; Unverhau, T; Uozumi, S; Usynin, D; Vallecorsa, S; van Remortel, N; Varganov, A; Vataga, E; Vázquez, F; Velev, G; Veramendi, G; Veszpremi, V; Vidal, R; Vila, I; Vilar, R; Vine, T; Vollrath, I; Volobouev, I; Volpi, G; Würthwein, F; Wagner, P; Wagner, R G; Wagner, R L; Wagner, J; Wagner, W; Wallny, R; Wang, S M; Warburton, A; Waschke, S; Waters, D; Weinberger, M; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Williams, G; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Wright, T; Wu, X; Wynne, S M; Yagil, A; Yamamoto, K; Yamaoka, J; Yamashita, T; Yang, C; Yang, U K; Yang, Y C; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zhang, X; Zhou, J; Zucchelli, S

2007-06-08

We measure the ratio of cross section times branching fraction, Rp=sigma chi c2 B(chi c2-->J/psi gamma)/sigma chi c1 B(chi c1-->J/psi gamma), in 1.1 fb(-1) of pp collisions at square root s=1.96 TeV. This measurement covers the kinematic range pT(J/psi)>4.0 GeV/c, |eta(J/psi)1.0 GeV/c. For events due to prompt processes, we find Rp=0.395+/-0.016(stat)+/-0.015(syst). This result represents a significant improvement in precision over previous measurements of prompt chi c1,2 hadro production.
Low-temperature solid-state preparation of ternary CdS/g-C3N4/CuS nanocomposites for enhanced visible-light photocatalytic H2-production activity

Science.gov (United States)

Cheng, Feiyue; Yin, Hui; Xiang, Quanjun

2017-01-01

Low-temperature solid-state method were gradually demonstrated as a high efficiency, energy saving and environmental protection strategy to fabricate composite semiconductor materials. CdS-based multiple composite photocatalytic materials have attracted increasing concern owning to the heterostructure constituents with tunable band gaps. In this study, the ternary CdS/g-C3N4/CuS composite photocatalysts were prepared by a facile and novel low-temperature solid-state strategy. The optimal ternary CdS/g-C3N4/CuS composite exhibits a high visible-light photocatalytic H2-production rate of 57.56 μmol h-1 with the corresponding apparent quantum efficiency reaches 16.5% at 420 nm with Na2S/Na2SO3 mixed aqueous solution as sacrificial agent. The ternary CdS/g-C3N4/CuS composites show the enhanced visible-light photocatalytic H2-evolution activity comparing with the binary CdS-based composites or simplex CdS. The enhanced photocatalytic activity is ascribed to the heterojunctions and the synergistic effect of CuS and g-C3N4 in promotion of the charge separation and charge mobility. This work shows that the low-temperature solid-state method is efficient and environmentally benign for the preparation of CdS-based multiple composite photocatalytic materials with enhanced visible-light photocatalytic H2-production activity.
Observation of $B^0_s\\rightarrow\\chi_{c1}\\phi$ decay and study of $B^0\\rightarrow\\chi_{c1,2}K^{*0}$ decays

CERN Document Server

INSPIRE-00258707; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves Jr, A A; Amato, S; Amerio, S; Amhis, Y; Anderlini, L; Anderson, J; Andreassen, R; Andrews, J E; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Baalouch, M; Bachmann, S; Back, J J; Baesso, C; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bauer, Th; Bay, A; Beddow, J; Bedeschi, F; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Bencivenni, G; Benson, S; Benton, J; Berezhnoy, A; Bernet, R; Bettler, M -O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blouw, J; Blusk, S; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bowen, E; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Burducea, I; Bursche, A; Busetto, G; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Campora Perez, D; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carranza-Mejia, H; Carson, L; Carvalho Akiba, K; Casse, G; Castillo Garcia, L; Cattaneo, M; Cauet, Ch; Cenci, R; Charles, M; Charpentier, Ph; Chen, P; Chiapolini, N; Chrzaszcz, M; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Cogneras, E; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Coquereau, S; Corti, G; Couturier, B; Cowan, G A; Craik, D C; Cunliffe, S; Currie, R; D'Ambrosio, C; David, P; David, P N Y; Davis, A; De Bonis, I; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Silva, W; De Simone, P; Decamp, D; Deckenhoff, M; Del Buono, L; Déléage, N; Derkach, D; Deschamps, O; Dettori, F; Di Canto, A; Di Ruscio, F; Dijkstra, H; Dogaru, M; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisenhardt, S; Eitschberger, U; Ekelhof, R; Eklund, L; El Rifai, I; Elsasser, Ch; Elsby, D; Falabella, A; Färber, C; Fardell, G; Farinelli, C; Farry, S; Fave, V; Ferguson, D; Fernandez Albor, V; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fiore, M; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furcas, S; Furfaro, E; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garofoli, J; Garosi, P; Garra Tico, J; Garrido, L; Gaspar, C; Gauld, R; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Giubega, L; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gordon, H; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Griffith, P; Grünberg, O; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hall, S; Hamilton, B; Hampson, T; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; Hartmann, T; He, J; Head, T; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hicheur, A; Hicks, E; Hill, D; Hoballah, M; Holtrop, M; Hombach, C; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Hussain, N; Hutchcroft, D; Hynds, D; Iakovenko, V; Idzik, M; Ilten, P; Jacobsson, R; Jaeger, A; Jans, E; Jaton, P; Jawahery, A; Jing, F; John, M; Johnson, D; Jones, C R; Joram, C; Jost, B; Kaballo, M; Kandybei, S; Kanso, W; Karacson, M; Karbach, T M; Kenyon, I R; Ketel, T; Keune, A; Khanji, B; Kochebina, O; Komarov, I; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kucharczyk, M; Kudryavtsev, V; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J -P; Lefèvre, R; Leflat, A; Lefrançois, J; Leo, S; Leroy, O; Lesiak, T; Leverington, B; Li, Y; Li Gioi, L; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; Lohn, S; Longstaff, I; Lopes, J H; Lopez-March, N; Lu, H; Lucchesi, D; Luisier, J; Luo, H; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Malde, S; Manca, G; Mancinelli, G; Marconi, U; Märki, R; Marks, J; Martellotti, G; Martens, A; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Martins Tostes, D; Massafferri, A; Matev, R; Mathe, Z; Matteuzzi, C; Maurice, E; Mazurov, A; Mc Skelly, B; McCarthy, J; McNab, A; McNulty, R; Meadows, B; Meier, F; Meissner, M; Merk, M; Milanes, D A; Minard, M -N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mordà, A; Morello, M J; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neubert, S; Neufeld, N; Nguyen, A D; Nguyen, T D; Nguyen-Mau, C; Nicol, M; Niess, V; Niet, R; Nikitin, N; Nikodem, T; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Oyanguren, A; Pal, B K; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pessina, G; Petridis, K; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pietrzyk, B; Pilař, T; Pinci, D; Playfer, S; Plo Casasus, M; Polci, F; Polok, G; Poluektov, A; Polyakov, I; Polycarpo, E; Popov, A; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pritchard, A; Prouve, C; Pugatch, V; Puig Navarro, A; Punzi, G; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Rauschmayr, N; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, A; Rinnert, K; Rives Molina, V; Roa Romero, D A; Robbe, P; Rodrigues, E; Rodriguez Perez, P; Roiser, S; Romanovsky, V; Romero Vidal, A; Rouvinet, J; Ruf, T; Ruffini, F; Ruiz, H; Ruiz Valls, P; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salustino Guimaraes, V; Salzmann, C; Sanmartin Sedes, B; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schindler, H; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M -H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Sirendi, M; Skwarnicki, T; Smith, N A; Smith, E; Smith, J; Smith, M; Sokoloff, M D; Soler, F J P; Soomro, F; Souza, D; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Sun, L; Swientek, S; Syropoulos, V; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teklishyn, M; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Tonelli, D; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tresch, M; Tsaregorodtsev, A; Tsopelas, P; Tuning, N; Ubeda Garcia, M; Ukleja, A; Urner, D; Ustyuzhanin, A; Uwer, U; Vagnoni, V; Valenti, G; Vallier, A; Van Dijk, M; Vazquez Gomez, R; Vazquez Regueiro, P; Vázquez Sierra, C; Vecchi, S; Velthuis, J J; Veltri, M; Veneziano, G; Vesterinen, M; Viaud, B; Vieira, D; Vilasis-Cardona, X; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voß, C; Voss, H; Waldi, R; Wallace, C; Wallace, R; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wicht, J; Wiechczynski, J; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wimberley, J; Wishahi, J; Witek, M; Wotton, S A; Wright, S; Wu, S; Wyllie, K; Xie, Y; Xing, Z; Yang, Z; Young, R; Yuan, X; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhokhov, A; Zhong, L; Zvyagin, A

2013-01-01

The first observation of the decay $B^0_s\\rightarrow\\chi_{c1}\\phi$ and a study of $B^0\\rightarrow\\chi_{c1,2}K^{*0}$ decays are presented. The analysis is performed using a dataset, corresponding to an integrated luminosity of 1.0 fb$^{-1}$, collected by the LHCb experiment in pp collisions at a centre-of-mass energy of 7 TeV. The following ratios of branching fractions are measured: \\begin{equation*} \\begin{array}{lll} \\dfrac{\\cal{B}(B^0_s\\rightarrow\\chi_{c1}\\phi)}{\\cal{B}(B^0_s\\rightarrow J/\\psi\\phi)} &=& (18.9 \\pm1.8\\,(stat)\\pm1.3\\,(syst)\\pm0.8\\,(\\cal{B})) \\times 10^{-2}, \\\\ \\dfrac{\\cal{B}(B^0\\rightarrow\\chi_{c1}K^{*0})}{\\cal{B}(B^0\\rightarrow J/\\psi K^{*0})} &=& (19.8 \\pm1.1\\,(stat)\\pm1.2\\,(syst)\\pm0.9\\,(\\cal{B})) \\times 10^{-2}, \\\\ \\dfrac{\\cal{B}(B^0\\rightarrow\\chi_{c2}K^{*0})}{\\cal{B}(B^0\\rightarrow\\chi_{c 1}K^{*0})} &=& (17.1 \\pm5.0\\,(stat)\\pm1.7\\,(syst)\\pm1.1\\,(\\cal{B})) \\times 10^{-2}, \\\\ \\end{array} \\end{equation*} where the third uncertainty is due to the limited knowledge o...

Dorothy L. Sayers and C. S. Lewis: Christian Postmodernism beyond Boundaries

Science.gov (United States)

Yuasa, Kyoko

2012-01-01

Modern critics do not consider science fiction and mystery novels to be "serious reading", but Dorothy L. Sayers and C. S. Lewis questioned the boundaries between "popular" and "serious" literature. Both Christian writers critically discuss the spiritual crisis of the modern world in each fiction genre. This paper…
Report of AAPM Therapy Physics Committee Task Group 74: In-air output ratio, S{sub c}, for megavoltage photon beams

Energy Technology Data Exchange (ETDEWEB)

Zhu, Timothy C.; Ahnesjoe, Anders; Lam, Kwok Leung; Li, X. Allen; Ma, Chang-Ming Charlie; Palta, Jatinder R.; Sharpe, Michael B.; Thomadsen, Bruce; Tailor, Ramesh C. [University of Pennsylvania, Philadelphia, Pennsylvania 19104 (United States); Uppsala University, 751 85 Uppsala (Sweden) and Nucletron AB, Box 1704, 751 47 Uppsala (Sweden); University of Michigan, Ann Arbor, Michigan 48109 (United States); Medical College of Wisconsin, Milwaukee, Wisconsin 53226 (United States); Fox Chase Cancer Center, Philadelphia, Pennsylvania 19111 (United States); University of Florida, Gainesville, Florida 32610 (United States); Princess Margaret Hospital, Toronto, ON M5G 2M9 (Canada); University of Wisconsin, Madison, Wisconsin 53705 (United States); RPC, UT MD Anderson Cancer Center, Houston, Texas 77030 (United States)

2009-11-15

The concept of in-air output ratio (S{sub c}) was introduced to characterize how the incident photon fluence per monitor unit (or unit time for a Co-60 unit) varies with collimator settings. However, there has been much confusion regarding the measurement technique to be used that has prevented the accurate and consistent determination of S{sub c}. The main thrust of the report is to devise a theoretical and measurement formalism that ensures interinstitutional consistency of S{sub c}. The in-air output ratio, S{sub c}, is defined as the ratio of primary collision water kerma in free-space, K{sub p}, per monitor unit between an arbitrary collimator setting and the reference collimator setting at the same location. Miniphantoms with sufficient lateral and longitudinal thicknesses to eliminate electron contamination and maintain transient electron equilibrium are recommended for the measurement of S{sub c}. The authors present a correction formalism to extrapolate the correct S{sub c} from the measured values using high-Z miniphantom. Miniphantoms made of high-Z material are used to measure S{sub c} for small fields (e.g., IMRT or stereotactic radiosurgery). This report presents a review of the components of S{sub c}, including headscatter, source-obscuring, and monitor-backscattering effects. A review of calculation methods (Monte Carlo and empirical) used to calculate S{sub c} for arbitrary shaped fields is presented. The authors discussed the use of S{sub c} in photon dose calculation algorithms, in particular, monitor unit calculation. Finally, a summary of S{sub c} data (from RPC and other institutions) is included for QA purposes.
Measurement of the time-integrated C P asymmetry in D"0→K_S"0K_S"0 decays

International Nuclear Information System (INIS)

Aaij, R.; Adeva, B.; Adinolfi, M.; Affolder, A.

2015-01-01

The time-integrated C P asymmetry in the decay D"0→K_S"0K_S"0 is measured using 3 fb"−"1 of proton-proton collision data collected by the LHCb experiment at centre-of-mass energies of 7 and 8 TeV. The flavour of the D"0 meson is determined by use of the decay D"∗"+→D"0π"+ and its charge conjugate mode. The result is A_C _P=−0.029±0.052±0.022, where the first uncertainty is statistical and the second systematic. The result is consistent with Standard Model expectations and improves the uncertainty with respect to the only previous measurement of this quantity by more than a factor of three.
Upper limits for the circular dichroism for the C 1s and O 1s core excitation of methyl oxirane

International Nuclear Information System (INIS)

Pruemper, G; Lischke, T; Fukuzawa, H; Reinkoester, A; Ueda, K

2007-01-01

The circular dichroism (CD) in the total and partial ion yields of methyl-oxirane C 3 H 6 O was measured at the C 1s and O 1s edges. The difference of the response of the chiral molecule to circularly polarized light with opposite handedness was found to be less than 0.2% for the total ion yield and less than 0.5% for the partial ion yield. Additionally we tried to find a dipole allowed molecular orientation CD effect by analysing the fragmentation in the forward and backward direction. For this effect we found an upper limit of 1-2% for all abundant ionic fragments
POTASSIUM DETECTION AND LITHIUM DEPLETION IN COMETS C/2011 L4 (PANSTARRS) AND C/1965 S1 (IKEYA-SEKI)

Energy Technology Data Exchange (ETDEWEB)

Fulle, M.; Molaro, P. [INAF-Osservatorio Astronomico, Via Tiepolo 11, I-34143 Trieste (Italy); Buzzi, L.; Valisa, P., E-mail: fulle@oats.inaf.it [Societa Astronomica Schiaparelli, Via Beato Angelico 1, Varese (Italy)

2013-07-10

On 2013 March 21, high-resolution slit spectrographs of the comet C/2011 L4 (Panstarrs), at a heliocentric distance r = 0.46 AU, were obtained at the Osservatorio Astronomico Campo dei Fiori, Italy. Emission lines of sodium were the strongest in the spectrum as is common in comets, but potassium lines were also detected. These have rarely been observed in comets since the apparition of the brightest comet C/1965 S1 (Ikeya-Seki). Lithium was not detected and stringent upper limits of its abundance compared to other alkali were derived. We obtain the abundance ratios Na/K = 54 {+-} 14 and Na/Li {>=}810{sup 3}. In addition to Mercury's exosphere (Leblanc and Doressoundiram), we show that photoionization at the beginning of the alkali tails may increase the solar ratio Na/K = 15.5 (Asplund et al.) by a factor three, close to that required to match the observed value. In the same tail position, the Na/Li ratio increases only by a factor two, very far from the factor {>=}8 required to match an original meteoritic ratio. We apply the same model to similar alkali data (Preston) of the comet C/1965 S1 (Ikeya-Seki) and obtain consistent results. An original solar Na/K ratio fits the observed value at the beginning of the alkali tails within the slit size, whereas Li is depleted by a factor {>=}8.
Low-field anomalous magnetic phase in the kagome-lattice shandite C o3S n2S2

Science.gov (United States)

Kassem, Mohamed A.; Tabata, Yoshikazu; Waki, Takeshi; Nakamura, Hiroyuki

2017-07-01

The magnetization process of single crystals of the metallic kagome ferromagnet C o3S n2S2 was carefully measured via magnetization and ac susceptibility. Field-dependent anomalous transitions observed in low fields indicate the presence of an unconventional magnetic phase just below the Curie temperature, TC. The magnetic phase diagrams in low magnetic fields along different crystallographic directions were determined for the first time. The magnetic relaxation measurements at various frequencies covering five orders of magnitude from 0.01 to 1000 Hz indicate markedly slow spin dynamics only in the anomalous phase with characteristic relaxation times longer than 10 s.
(E-4-(2,5-Dimethoxybenzylidene-2-phenyl-1,3-oxazol-5(4H-one

Directory of Open Access Journals (Sweden)

Abdullah Mohamed Asiri

2009-08-01

Full Text Available The central azalactone ring in the title compound, C18H15NO4, is planar (r.m.s. deviation 0.05, 0.12 Å in both independent molecules comprising the asymmetric unit. The benzylidene substituent is coplanar with this ring [dihedral angle between the planes = 1.8 (1° in the first molecule and 2.8 (1° in the second], as is the phenyl substitutent [dihedral angle between rings = 4.6 (1 and 9.7 (1°, respectively].
Molecular resonances in sub-Coulomb energy region (12C-12C, 12C-24Mg, 12C-9Be systems)

International Nuclear Information System (INIS)

Takimoto, Kiyohiko; Shimomura, Susumu; Tanaka, Makoto; Murakami, Tetsuya; Fukada, Mamoru; Sakaguchi, Atsushi

1982-01-01

Molecular resonance in sub-Coulomb energy region was studied on 12 C- 12 C, 12 C- 24 Mg and 12 C- 9 Be systems. The excitation functions and the angular distributions were measured on the reactions 12 C( 12 C, 8 Besub(g,s,)) 16 Osub(g,s,), 24 Mg( 12 C, α) 32 S and 9 Be ( 12 C, 8 Besub(g,s,)) 13 Csub(g,s,). Sub-Coulomb resonances were observed in all systems and the contribution of the 12 Csub(2nd)*(0 + , 7.65 MeV) state is proposed. (author)
Effect of gamma-ray irradiation on hybridization between Chamaecyparis obtusa S. et Z. and C. pisifera S. et Z

International Nuclear Information System (INIS)

Maeta, Takehiko

1980-01-01

The effect of gamma irradiation on the interspecific hybridization between Chamaecyparis obtusa and C. pisifera was investigated, and F 1 seedlings were examined cytologically. Acute gamma irradiation and chronic gamma irradiation given throughout annual growing seasons on male flowers were effective in producing hybrids between these two species. The crossing of C. obtusa x C. pisifera was better than the reverse crossing because the pollen of C. obtusa rapidly loses its fertility, and C. pisifera blooms earlier than C. obtusa. Chronic gamma irradiation of male flowers throughout the annual growing season was slightly effective for producing the hybrids, but that of female flowers was not. Acute gamma irradiation of male flowers at the first to second telophase (300 R) was considered to be desirable for hybrid production. However, it was confirmed by cytological observation that all of the hybrids produced were triploid which had two identical genomes originated from either parent. Therefore, the unreduced male gametophytes or unreduced eggs seem to participate in the formation of the hybrids. It seems difficult to produce diploid hybrids between C. obtusa and C. pisifera. (Kaihara, S.)
Determination of the S18 astrophysical factor for 8B(p,γ)9C from the breakup of 9C at intermediate energies

International Nuclear Information System (INIS)

Trache, L.; Mukhamedzhanov, A.M.; Tribble, R.E.; Carstoiu, F.

2002-06-01

We have used existing data on the one-proton-removal cross section of 9 C at 285 MeV/u and Glauber model calculations to extract the asymptotic normalization coefficient for the wave function of the last proton in the ground state of 9 C. The calculations are done first using folded potentials starting from two different effective nucleon-nucleon interactions and second in the optical limit using three nucleon-nucleon interactions, and the results are found to be consistent, with no new parameters adjusted. We find C 2 (p 3/2 ) + C 2 (p 1/2 ) = 1.22±0.13 fm -1 . From this result we obtain the astrophysical factor for the proton radiative capture reaction 8 B(p,γ) 9 C as S 18 (0) = 46 ± 6 eV.b. The calculated energy dependence of the astrophysical S-factor for the energy region E cm = 0 - 0.8 MeV and the reaction rates for T 9 = 0 - 1 are included. (authors)
The 5C Concept and 5S Principles in Inflammatory Bowel Disease Management.

Science.gov (United States)

Hibi, Toshifumi; Panaccione, Remo; Katafuchi, Miiko; Yokoyama, Kaoru; Watanabe, Kenji; Matsui, Toshiyuki; Matsumoto, Takayuki; Travis, Simon; Suzuki, Yasuo

2017-10-27

The international Inflammatory Bowel Disease [IBD] Expert Alliance initiative [2012-2015] served as a platform to define and support areas of best practice in IBD management to help improve outcomes for all patients with IBD. During the programme, IBD specialists from around the world established by consensus two best practice charters: the 5S Principles and the 5C Concept. The 5S Principles were conceived to provide health care providers with key guidance for improving clinical practice based on best management approaches. They comprise the following categories: Stage the disease; Stratify patients; Set treatment goals; Select appropriate treatment; and Supervise therapy. Optimised management of patients with IBD based on the 5S Principles can be achieved most effectively within an optimised clinical care environment. Guidance on optimising the clinical care setting in IBD management is provided through the 5C Concept, which encompasses: Comprehensive IBD care; Collaboration; Communication; Clinical nurse specialists; and Care pathways. Together, the 5C Concept and 5S Principles provide structured recommendations on organising the clinical care setting and developing best-practice approaches in IBD management. Consideration and application of these two dimensions could help health care providers optimise their IBD centres and collaborate more effectively with their multidisciplinary team colleagues and patients, to provide improved IBD care in daily clinical practice. Ultimately, this could lead to improved outcomes for patients with IBD. Copyright © 2017 European Crohn’s and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com
The S-wave resonance contributions to the three-body decays B{sup 0}{sub (s)} → η{sub c}f{sub 0}(X) → η{sub c}π{sup +}π{sup -} in perturbative QCD approach

Energy Technology Data Exchange (ETDEWEB)

Li, Ya; Ma, Ai-Jun; Xiao, Zhen-Jun [Nanjing Normal University, Department of Physics, Institute of Theoretical Physics, Nanjing, Jiangsu (China); Wang, Wen-Fei [Shanxi University, Department of Physics, Institute of Theoretical Physics, Taiyuan, Shanxi (China)

2016-12-15

In this paper, we study the three-body decays B{sup 0}/B{sup 0}{sub s} → η{sub c}f{sub 0}(X) → η{sub c}π{sup +}π{sup -} by employing the perturbative QCD (PQCD) factorization approach. We evaluate the S-wave resonance contributions by using the two-pion distribution amplitude Φ{sub ππ}{sup S}. The Breit-Wigner formula for the f{sub 0}(500), f{sub 0}(1500), and f{sub 0}(1790) resonances and the Flatte model for the f{sub 0}(980) resonance are adopted to parameterize the time-like scalar form factors F{sub s}(ω{sup 2}). We also use the Bugg model to parameterize the f{sub 0}(500) and compare the relevant theoretical predictions from different models. We found the following results: (a) the PQCD predictions for the branching ratios are B(B{sup 0} → η{sub c}f{sub 0}(500)[π{sup +}π{sup -}]) = (1.53{sup +0.76}{sub -0.35}) x 10{sup -6} for Breit-Wigner model and B(B{sup 0} → η{sub c}f{sub 0}(500)[π{sup +}π{sup -}]) = (2.31{sup +0.96}{sub -0.48}) x 10{sup -6} for Bugg model; (b) B(B{sub s} → η{sub c}f{sub 0}(X)[π{sup +}π{sup -}]) =(5.02{sup +1.49}{sub -1.08}) x 10{sup -5} when the contributions from f{sub 0}(X) = (f{sub 0}(980), f{sub 0}(1500), f{sub 0}(1790)) are all taken into account; and (c) The considered decays could be measured at the ongoing LHCb experiment, consequently, the formalism of two-hadron distribution amplitudes could also be tested by such experiments. (orig.)
Quasi-two-body decays B→ηc(1S,2S [ρ(770,ρ(1450,ρ(1700→] ππ in the perturbative QCD approach

Directory of Open Access Journals (Sweden)

Ya Li

2017-11-01

Full Text Available In this paper, we calculated the branching ratios of the quasi-two-body decays B→ηc(1S,2S [ρ(770,ρ(1450,ρ(1700→]ππ by employing the perturbative QCD (PQCD approach. The contributions from the P-wave resonances ρ(770, ρ(1450 and ρ(1700 were taken into account. The two-pion distribution amplitude ΦππP is parameterized by the vector current time-like form factor Fπ to study the considered decay modes. We found that (a the PQCD predictions for the branching ratios of the considered quasi-two-body decays are in the order of 10−7∼10−6, while the two-body decay rates B(B→ηc(1S,2S(ρ(1450,ρ(1700 are extracted from those for the corresponding quasi-two-body decays; (b the whole pattern of the pion form factor-squared |Fπ|2 measured by the BABAR Collaboration could be understood based on our theoretical results; (c the general expectation based on the similarity between B→ηcππ and B→J/ψππ decays are confirmed: R2(ηc≈0.45 is consistent with the measured R2(J/ψ≈0.56±0.09 within errors; and (d new ratios R3(ηc(1S and R4(ηc(2S among the branching ratios of the considered decay modes are defined and could be tested by future experiments.
Small C7-T1 lordotic angle and muscle degeneration at C7 level were independent radiological characteristics of patients with cervical imbalance: a propensity score-matched analysis.

Science.gov (United States)

Tamai, Koji; Romanu, Joshua; Grisdela, Phillip; Paholpak, Permsak; Zheng, Pengfei; Nakamura, Hiroaki; Buser, Zorica; Wang, Jeffrey C

2018-01-31

Cervical sagittal vertical axis (cSVA) of ≥40 mm is recognized as the key factor of poor health-related quality of life, poor surgical outcomes, and correction loss after surgery for cervical deformity. However, little is known about the radiological characteristics of patients with cSVA≥40 mm. The purpose of this study was to identify the radiological characteristics of patients with cervical imbalance. Retrospective analysis of weight-bearing cervical magnetic resonance (MR) images. Consecutive 1,500 MR images of symptomatic patients in weight-bearing position. Cervical sagittal vertical axis, cervical alignment, cervical balance parameters (T1 slope, Co-C2 angle, C2-C7 angle, C7-T1 angle, neck tilt, and thoracic inlet angle), disc degeneration (Pfirmann and Suzuki classification), end plate degeneration (Modic change), spondylolisthesis (antero- and retrolisthesis), anteroposterior (AP) diameter of dural sac, cross-sectional area (CSA), and fat infiltration ratio of the transversospinalis muscles at C4 and C7 levels. Patients were divided into two groups: cSVA≥40 mm and cSVAimbalance (cSVA≥40 mm) and control (imbalance was 2.5% (37 patients). Those patients had a higher incidence of kyphosis, were older, and there were more male patients. In the matched imbalance group, the T1 slope was greater (p=.028), C7-T1 lordotic angle was smaller (pimbalance. Copyright © 2018 Elsevier Inc. All rights reserved.
1-[(1R,2S,4R,7S-3,3-Dichloro-4,11,11-trimethyltricyclo[5.4.0.02,4]undecan-7-yl]ethanone

Directory of Open Access Journals (Sweden)

Ahmed Benharref

2017-02-01

Full Text Available The title compound, C16H24Cl2O, crystallizes with two independent molecules in the asymmetric unit. Each molecule is built up from two fused six-membered rings, one of which is fused to a three-membered ring. The two molecules differ essentially in the orientation of two of the methyl groups. The dihedral angles between the mean planes through the two six-membered rings are 57.98 (13 and 55.29 (13°. The molecular conformation is stabilized by intramolecular C—H...Cl hydrogen bonds.
In-medium properties of pseudoscalar D{sub s} and B{sub s} mesons

Energy Technology Data Exchange (ETDEWEB)

Chhabra, Rahul; Kumar, Arvind [Dr. B R Ambedkar National Institute of Technology Jalandhar, Department of Physics, Jalandhar, Punjab (India)

2017-11-15

We calculate the shift in the masses and decay constants of D{sub s}(1968) and B{sub s}(5370) mesons in hot and dense asymmetric strange hadronic matter using QCD sum rules and chiral SU(3) model. In-medium strange quark condensates left angle anti ss right angle {sub ρB}, and gluon condensates left angle (α{sub s})/(π)G{sup a}{sub μν}G{sup aμν} right angle {sub ρB}, to be used in the QCD sum rules for pseudoscalar D{sub s} and B{sub s} mesons, are calculated using a chiral SU(3) model. As an application of our present work, we calculate the in-medium decay widths of the excited (c anti s) states D{sub s}{sup *}(2715) and D{sub s}{sup *}(2860) decaying to (D{sub s}(1968), η) mesons. The medium effects in their decay widths are incorporated through the mass modification of the D{sub s}(1968) and η mesons. The results of the present investigation may be helpful in understanding the possible outcomes of the future experiments like CBM and PANDA under the FAIR facility. (orig.)
Planeamiento estratégico para Aidisa Perú S.A.C.

OpenAIRE

Dileo Pinillos, Roberto Carlos; Diaz Amayo, Jorge Luis; Gordillo Andrade, Luis; Ubillús Galarreta, Eduardo Antonio

2016-01-01

xvii, 106 h. : il. ; 30 cm. El plan estratégico desarrollado para Aidisa Perú S.A.C. se enmarca en la industria de distribución de productos de consumo masivo, específicamente en el canal tradicional abarcando a clientes minoristas y mayoristas. Para el desarrollo del mismo se trabajó conjuntamente con un grupo de empleados de cada operación de Aidisa Perú seleccionados en base a su conocimiento de la industria y de la empresa, realizándose además una exhaustiva investigació...
Plan estratégico Limpi Max S.A.C. 2015-2019

OpenAIRE

Aniceto Prado, Fabiola Virginia; Barcelona Zakimi, Antoane Andre; Tokashiki Zakimi, Javier Elias; Yutaka Yino Oshiro, Daniel Alberto

2015-01-01

El presente plan estratégico ha sido elaborado para la empresa Limpi Max S.A.C. para el periodo comprendido entre los años 2015 a 2019, cuya actividad económica está especializada en el cristalizado de superficies y suelos calcáreos. El mercado del cristalizado se enfoca en centros comerciales, tiendas por departamento y hoteles que cuenten con las superficies mencionadas líneas arriba. El mayor problema que enfrenta Limpi Max es la reducida o nula cultura empresarial en nuestro país de reali...
Plasma cathepsin S and cystatin C levels and risk of abdominal aortic aneurysm: a randomized population-based study.

Directory of Open Access Journals (Sweden)

Bing-Jie Lv

Full Text Available BACKGROUND: Human abdominal aortic aneurysm (AAA lesions contain high levels of cathepsin S (CatS, but are deficient in its inhibitor, cystatin C. Whether plasma CatS and cystatin C levels are also altered in AAA patients remains unknown. METHODS AND RESULTS: Plasma samples were collected from 476 male AAA patients and 200 age-matched male controls to determine CatS and cystatin C levels by ELISA. Student's t test demonstrated higher plasma levels of total, active, and pro-CatS in AAA patients than in controls (P<0.001. ROC curve analysis confirmed higher plasma total, active, and pro-CatS levels in AAA patients than in controls (P<0.001. Logistic regression suggested that plasma total (odds ratio [OR] = 1.332, active (OR = 1.21, and pro-CatS (OR = 1.25 levels were independent AAA risk factors that associated positively with AAA (P<0.001. Plasma cystatin C levels associated significantly, but negatively, with AAA (OR = 0.356, P<0.001. Univariate correlation demonstrated that plasma total and active CatS levels correlated positively with body-mass index, diastolic blood pressure, and aortic diameter, but negatively with the lowest ankle-brachial index (ABI. Plasma cystatin C levels also correlated negatively with the lowest ABI. Multivariate linear regression showed that plasma total, active, and pro-CatS levels correlated positively with aortic diameter and negatively with the lowest ABI, whereas plasma cystatin C levels correlated negatively with aortic diameter and the lowest ABI, after adjusting for common AAA risk factors. CONCLUSIONS: Correlation of plasma CatS and cystatin C with aortic diameter and the lowest ABI suggest these serological parameters as biomarkers for human peripheral arterial diseases and AAA.
(2E-3-Phenylprop-2-en-1-yl thiocyanate

Directory of Open Access Journals (Sweden)

Ezzat Khan

2017-04-01

Full Text Available In the title compound, C10H9NS, the C—S—C bond angle is 99.41 (9° and the dihedral angle between the trans-alkene fragment and the benzene ring is 16.49 (19°. In the crystal, inversion dimers linked by pairs of extremely weak C—H...N interactions occur, as does a short S...N contact [3.2258 (19 Å].

Modélisation d'un choc thermique doux d'un verre S.S.C en utilisant l'approche thermomécanique

Science.gov (United States)

Malou, Z.; Hamidouche, M.; Madjoubi, M. A.; Bousbaa, C.; Bouaouadja, N.

2005-05-01

Dans ce travail, nous avons étudié l'endommagement du verre silico-sodo-calcique (trois différentes épaisseurs : 2mm, 4mm, et 8mm) par choc thermique descendant. Nous avons utilisé l'approche thermomécanique en terme de facteur d'intensité de contrainte en se basant sur un calcul numérique. Le choc thermique descendant, est la mise en contact brutal d'un échantillon, préalablement chauffé à une température Ti, avec un milieu dont la température Tf est inférieure à Ti. Le gradient thermique engendré induit des contraintes de tension dans les couches superficielles du corps. Ces contraintes peuvent conduire à la rupture du matériau. Les hypothèses prises en compte lors de la simulation sont comme suit : Le refroidissement des échantillons en verre chauffés à différentes températures, inférieures à sa température de transition, est fait par jet d'air à 20° C pendant 6 secondes. Ce temps est suffisant pour que la température des échantillons atteigne l'ambiante. Le coefficient de transfert de chaleur est de 600 W/°C.m2. Les températures chaudes ont été variées entre 100° C et 450° C. Lors des calculs, nous avons intégré, l'évolutions en fonction de la température des propriétés thermoélastiques du verre. Dans un premier temps, nous avons déterminé les températures et les contraintes transitoires dans l'échantillon à tout instant du choc thermique. Ensuite, nous avons déterminé l'évolution du facteur d'intensité de contrainte (FIC) durant le refroidissement. Enfin, les FIC calculés sont comparés à la ténacité (K1c) du matériau. Cette dernière a été mesurée en utilisant la mécanique linéaire de la rupture. Nous avons vérifié que quand le facteur FIC atteint la valeur de la ténacité dans la zone des défauts critiques, ces derniers se propagent d'une manière brutale causant ainsi la dégradation de l'échantillon. Par cette technique, nous avons directement accès à l'écart de température critique
1,4-Dimethyl-3-phenyl-3H-pyrazolo[3,4-c]isoquinolin-5(4H-one

Directory of Open Access Journals (Sweden)

Giuseppe Daidone

2008-05-01

Full Text Available The title compound, C18H15N3O, is the product of the thermal decomposition of the diazonium salt derived from 2-amino-N-methyl-N-(3-methyl-1-phenyl-1H-pyrazol-5-ylbenzamide. It is characterized by a trans orientation of the methyl groups with respect to the tricyclic ring system. The molecule has a nearly planar phenylpyrazolo[3,4-c]isoquinolin-5-one system, the largest deviation from the mean plane being 0.066 (2 Å for the O atom. The dihedral angle between the phenyl substituent and the heterotricycle is 67 (1°. The packing is stabilized by C—H...N hydrogen-bond interactions, with the formation of molecular chains along the c axis.
Capric acid secreted by S. boulardii inhibits C. albicans filamentous growth, adhesion and biofilm formation.

Directory of Open Access Journals (Sweden)

Anna Murzyn

Full Text Available Candidiasis are life-threatening systemic fungal diseases, especially of gastro intestinal track, skin and mucous membranes lining various body cavities like the nostrils, the mouth, the lips, the eyelids, the ears or the genital area. Due to increasing resistance of candidiasis to existing drugs, it is very important to look for new strategies helping the treatment of such fungal diseases. One promising strategy is the use of the probiotic microorganisms, which when administered in adequate amounts confer a health benefit. Such a probiotic microorganism is yeast Saccharomyces boulardii, a close relative of baker yeast. Saccharomyces boulardii cells and their extract affect the virulence factors of the important human fungal pathogen C. albicans, its hyphae formation, adhesion and biofilm development. Extract prepared from S. boulardii culture filtrate was fractionated and GC-MS analysis showed that the active fraction contained, apart from 2-phenylethanol, caproic, caprylic and capric acid whose presence was confirmed by ESI-MS analysis. Biological activity was tested on C. albicans using extract and pure identified compounds. Our study demonstrated that this probiotic yeast secretes into the medium active compounds reducing candidal virulence factors. The chief compound inhibiting filamentous C. albicans growth comparably to S. boulardii extract was capric acid, which is thus responsible for inhibition of hyphae formation. It also reduced candidal adhesion and biofilm formation, though three times less than the extract, which thus contains other factors suppressing C. albicans adherence. The expression profile of selected genes associated with C. albicans virulence by real-time PCR showed a reduced expression of HWP1, INO1 and CSH1 genes in C. albicans cells treated with capric acid and S. boulardii extract. Hence capric acid secreted by S. boulardii is responsible for inhibition of C. albicans filamentation and partially also adhesion and
Capric Acid Secreted by S. boulardii Inhibits C. albicans Filamentous Growth, Adhesion and Biofilm Formation

Science.gov (United States)

Murzyn, Anna; Krasowska, Anna; Stefanowicz, Piotr; Dziadkowiec, Dorota; Łukaszewicz, Marcin

2010-01-01

Candidiasis are life-threatening systemic fungal diseases, especially of gastro intestinal track, skin and mucous membranes lining various body cavities like the nostrils, the mouth, the lips, the eyelids, the ears or the genital area. Due to increasing resistance of candidiasis to existing drugs, it is very important to look for new strategies helping the treatment of such fungal diseases. One promising strategy is the use of the probiotic microorganisms, which when administered in adequate amounts confer a health benefit. Such a probiotic microorganism is yeast Saccharomyces boulardii, a close relative of baker yeast. Saccharomyces boulardii cells and their extract affect the virulence factors of the important human fungal pathogen C. albicans, its hyphae formation, adhesion and biofilm development. Extract prepared from S. boulardii culture filtrate was fractionated and GC-MS analysis showed that the active fraction contained, apart from 2-phenylethanol, caproic, caprylic and capric acid whose presence was confirmed by ESI-MS analysis. Biological activity was tested on C. albicans using extract and pure identified compounds. Our study demonstrated that this probiotic yeast secretes into the medium active compounds reducing candidal virulence factors. The chief compound inhibiting filamentous C. albicans growth comparably to S. boulardii extract was capric acid, which is thus responsible for inhibition of hyphae formation. It also reduced candidal adhesion and biofilm formation, though three times less than the extract, which thus contains other factors suppressing C. albicans adherence. The expression profile of selected genes associated with C. albicans virulence by real-time PCR showed a reduced expression of HWP1, INO1 and CSH1 genes in C. albicans cells treated with capric acid and S. boulardii extract. Hence capric acid secreted by S. boulardii is responsible for inhibition of C. albicans filamentation and partially also adhesion and biofilm formation. PMID
Comparação entre as características do sêmen humano preservado a +4ºC e -196ºC por 24 horas

Directory of Open Access Journals (Sweden)

Mattos Ana Luiza Gelpi

2003-01-01

Full Text Available OBJETIVOS: avaliar as características do sêmen humano preservado a +4ºC e a -196ºC por 24 h e determinar a técnica ideal para utilização em procedimentos específicos. MÉTODOS: amostras de sêmen de 24 voluntários foram analisadas após a coleta e divididas em duas alíquotas, uma resfriada em a +4ºC e outra congelada a -196ºC. As amostras foram mantidas em baixas temperaturas por 24 h e então em temperatura ambiente por 30 minutos (T1, capacitadas (T2 e incubadas a +37ºC por 90 minutos (T3, sendo avaliadas quanto à concentração e motilidade progressiva em T1, T2 e T3. Para análise dos resultados obtidos com as duas diferentes técnicas foi utilizado o Modelo Linear Geral e para análise dos dados obtidos com a mesma técnica, em dois diferentes momentos de observação, foi utilizado o teste de Wilcoxon (a de 5% e p0,05 quanto à concentração, motilidade e NTEM entre as técnicas nos três momentos de observação. Tampouco houve diferença entre as variáveis após capacitação e após incubação no sêmen resfriado, mas, no congelado, a concentração foi significativamente superior após capacitação. CONCLUSÕES: embora a concentração e a motilidade progressiva não tenham diferido em ambas as técnicas, sugere-se o uso do resfriamento em procedimentos específicos a curto prazo, devido à simplicidade e baixo custo. Quando o sêmen congelado for necessário, recomenda-se a utilização logo após a capacitação para evitar redução da qualidade do mesmo.
The spatial relationship between human activities and C, N, P, S in soil based on landscape geochemical interpretation.

Science.gov (United States)

Yu, Huan; He, Zheng-Wei; Kong, Bo; Weng, Zhong-Yin; Shi, Ze-Ming

2016-04-01

The development and formation of chemical elements in soil are affected not only by parent material, climate, biology, and topology factors, but also by human activities. As the main elements supporting life on earth system, the C, N, P, S cycles in soil have been altered by human activity through land-use change, agricultural intensification, and use of fossil fuels. The present study attempts to analyze whether and how a connection can be made between macroscopical control and microcosmic analysis, to estimate the impacts of human activities on C, N, P, S elements in soil, and to determine a way to describe the spatial relationship between C, N, P, S in soil and human activities, by means of landscape geochemical theories and methods. In addition, the disturbances of human activities on C, N, P, S are explored through the analysis of the spatial relationship between human disturbed landscapes and element anomalies, thereby determining the diversified rules of the effects. The study results show that the rules of different landscapes influencing C, N, P, S elements are diversified, and that the C element is closely related to city landscapes; furthermore, the elements N, P, and S are shown to be closely related to river landscapes; the relationships between mine landscapes and the elements C, N, P, S are apparent; the relationships between the elements C, N, P, S and road landscapes are quite close, which shows that road landscapes have significant effects on these elements. Therefore, the conclusion is drawn that the response mechanism analysis of human disturbance and soil chemical element aggregation is feasible, based on the landscape geochemical theories and methods. The spatial information techniques, such as remote sensing and geographic information systems, are effective for research on soil element migration.
Semisolid forming of S48C steel grade

Science.gov (United States)

Plata, Gorka; Lozares, Jokin; Azpilgain, Zigor; Hurtado, Iñaki; Loizaga, Iñigo; Idoyaga, Zuriñe

2017-10-01

Steel production and component manufacturing industries have to face the challenge of globalization, trying to overcome the economic pressure to remain competitive. Moreover, the lightweighting trend of the latter years implies an even higher challenge to maintain the steel use. Therefore, advanced manufacturing processes will be the cornerstone. In this field, Semisolid forming (SSF) has demonstrated the capability of obtaining complex geometries and saving raw material and energy. Despite it is complicated the SSF of sound components, in Mondragon Unibertsitatea it has been successfully demonstrated the capability of producing strong enough automotive components with 42CrMo4 steel grade. In this work, we demonstrate the capability of SSF S48C steel grade with great mechanical properties.
Experience with Server Self Service Center (S3C)

International Nuclear Information System (INIS)

Sucik, Juraj; Bukowiec, Sebastian

2010-01-01

CERN has a successful experience with running Server Self Service Center (S3C) for virtual server provisioning which is based on Microsoft (registered) Virtual Server 2005. With the introduction of Windows Server 2008 and its built-in hypervisor based virtualization (Hyper-V) there are new possibilities for the expansion of the current service. This paper describes the architecture of the redesigned virtual Server Self Service based on Hyper-V which provides dynamically scalable virtualized resources on demand as needed and outlines the possible implications on the future use of virtual machines at CERN.
Experience with Server Self Service Center (S3C)

CERN Multimedia

Sucik, J

2009-01-01

CERN has a successful experience with running Server Self Service Center (S3C) for virtual server provisioning which is based on Microsoft® Virtual Server 2005. With the introduction of Windows Server 2008 and its built-in hypervisor based virtualization (Hyper-V) there are new possibilities for the expansion of the current service. This paper describes the architecture of the redesigned virtual Server Self Service based on Hyper-V which provides dynamically scalable virtualized resources on demand as needed and outlines the possible implications on the future use of virtual machines at CERN.
Differentiation of DctA and DcuS function in the DctA/DcuS sensor complex of Escherichia coli: function of DctA as an activity switch and of DcuS as the C4-dicarboxylate sensor.

Science.gov (United States)

Steinmetz, Philipp Aloysius; Wörner, Sebastian; Unden, Gottfried

2014-10-01

The C4-dicarboxylate responsiveness of the sensor kinase DcuS is only provided in concert with C4-dicarboxylate transporters DctA or DcuB. The individual roles of DctA and DcuS for the function of the DctA/DcuS sensor complex were analysed. (i) Variant DctA(S380D) in the C4-dicarboxylate site of DctA conferred C4-dicarboxylate sensitivity to DcuS in the DctA/DcuS complex, but was deficient for transport and for growth on C4-dicarboxylates. Consequently transport activity of DctA is not required for its function in the sensor complex. (ii) Effectors like fumarate induced expression of DctA/DcuS-dependent reporter genes (dcuB-lacZ) and served as substrates of DctA, whereas citrate served only as an inducer of dcuB-lacZ without affecting DctA function. (iii) Induction of dcuB-lacZ by fumarate required 33-fold higher concentrations than for transport by DctA (Km = 30 μM), demonstrating the existence of different fumarate sites for both processes. (iv) In titration experiments with increasing dctA expression levels, the effect of DctA on the C4-dicarboxylate sensitivity of DcuS was concentration dependent. The data uniformly show that C4-dicarboxylate sensing by DctA/DcuS resides in DcuS, and that DctA serves as an activity switch. Shifting of DcuS from the constitutive ON to the C4-dicarboxylate responsive state, required presence of DctA but not transport by DctA. © 2014 John Wiley & Sons Ltd.
Measurement of the branching fraction ratio ${\\cal B}(B_{c}^{+} \\to \\psi(2S)\\pi^+)/{\\cal B}(B_{c}^{+} \\to J/\\psi\\pi^+)$

CERN Multimedia

An, Liupan

2016-01-01

Using the $pp$ collision data collected by LHCb at center-of-mass energies $\\sqrt{s} \\, = 7 \\, {\\rm TeV} \\,$ and $8 \\, {\\rm TeV} \\,$, corresponding to an integrated luminosity of $3 \\, \\mathrm{fb}^{-1} \\,$, the ratio of the branching fraction of the $B_{c}^{+} \\to \\psi(2S)\\pi^+$ decay relative to that of the $B_{c}^{+} \\to J/\\psi\\pi^+$ decay is measured to be ${0.268 \\pm 0.032\\mathrm{\\,(stat)} \\pm 0.007\\mathrm{\\,(syst)} \\pm 0.006\\,(\\mathrm{BF}) }$. The first uncertainty is statistical, the second is systematic, and the third is due to the uncertainties on the branching fractions of the $J/\\psi \\to \\mu^{+}\\mu^{-}$ and $\\psi(2S) \\to \\mu^{+}\\mu^{-}$ decays. To enhance the signal significance with limited $B_{c}^{+}$ statistics, the boosted decision tree selection is used to separate the signal and background effectively. The systematic uncertainties are discussed extensively. This measurement is consistent with the previous LHCb result, and the statistical uncertainty is halved.
Measurement of activity for S-adenosylmethionine decarboxylase using radioisotope 14C

International Nuclear Information System (INIS)

Ko, Kyong Cheol; Park, Sang Hyun; Kamio, Yoshiyuku

2007-01-01

Polyamines are essential for normal cell growth and have important physiological function. They are polycationic compounds that are present in all biological materials. Also, they have been implicated in a wide variety of biological reactions. Generally, putrescine and spermidine are contained high amount in prokaryote, but spermidine and spermine are in eukaryote, respectively. However, S. ruminantium cells contain the polyamins such as spermidine and spermine. Addition of an aminopropyl group to putrescine conducts to the synthesis of spermidine. Aminopropyl group is derived from the dcSAM, a decarboxylation of S-adenosylmethionine, through action of S-adenosylmethionine decarboxylase (SAMDC). We suggested that S. ruminantium has a different pathway compare with prokaryote for polyamine synthesis. Assay for SAMDC activity was used 14 C labeled substrate. Key enzyme in the biosynthesis of polyamines, SAMDC, was purified from S. ruminantium and characterized. The enzyme was purified about 1,259-fold to electrophoretic homogeneity with a specific activity of 1.89×10 -5 kat kg'- 1 of protein
Authentication of an operator-provided containment and surveillance (C and S) system

International Nuclear Information System (INIS)

Watkins, L.M.; Rundquist, D.E.

1987-01-01

Large multicomponent Operator-provided C and S systems with computer control, such as the pioneering Japanese Fast Critical Assembly Portal Monitor (FCA P/M), can efficiently meet evolving IAEA C and S requirements but they present substantial challenges to the IAEA's need to authenticate the data produced. To authenticate such systems by traditional IAEA methods would require a prohibitive expenditure of resources to ensure that each individual component is provided with credible tamper indication and that the control and interpretation of the data is appropriate. Consequently, in parallel with the FCA P/M field trial currently underway in Japan, the IAEA has initiated a programme aimed at producing resource-efficient and credible authentication of the system. Although initially focused on the P/M system, the methods under consideration are applicable to other similar Operator-provided systems
3-Ethyl-4-[(E-(4-fluorobenzylideneamino]-1H-1,2,4-triazole-5(4H-thione

Directory of Open Access Journals (Sweden)

Alphonsus D'souza

2012-05-01

Full Text Available In the title compound, C11H11FN4S, the dihedral angle between the 1,2,4-triazole ring and the benzene ring is 25.04 (12° and an intramoleuclar C—H...S interaction leads to an S(6 ring. In the crystal, inversion dimers linked by pairs of N—H...S hydrogen bonds generate R22(8 loops.
1,5-Bis(1-phenylethylidene)thiocarbonohydrazide

Science.gov (United States)

Feng, Lei; Ji, Haiwei; Wang, Renliang; Ge, Haiyan; Li, Li

2011-01-01

The title molecule, C17H18N4S, is not planar, as indicated by the dihedral angle of 27.24 (9)° between the two benzene rings. In the crystal, intermolecular N—H⋯S hydrogen bonds link pairs of molecules into inversion dimers. PMID:21754879
A requiem for AdS4×C P3 fermionic self-T duality

Science.gov (United States)

O'Colgáin, E.; Pittelli, A.

2016-11-01

Strong evidence for dual superconformal symmetry in N =6 superconformal Chern-Simons theory has fueled expectations that the AdS /CFT dual geometry AdS4×C P3 is self-dual under T duality. We revisit the problem to identify commuting bosonic and fermionic isometries in a systematic fashion and show that fermionic T duality, a symmetry originally proposed by Berkovits and Maldacena, inevitably leads to a singularity in the dilaton transformation. We show that TsT deformations commute with fermionic T duality and comment on T duality in the corresponding sigma model. Our results rule out self-duality based on fermionic T duality for AdS4×C P3 or its TsT deformations but leave the door open for new possibilities.
The interaction of protein S with the phospholipid surface is essential for the activated protein C-independent activity of protein S

NARCIS (Netherlands)

van Wijnen, M.; Stam, J. G.; van't Veer, C.; Meijers, J. C.; Reitsma, P. H.; Bertina, R. M.; Bouma, B. N.

1996-01-01

Protein S is a vitamin-K dependent glycoprotein involved in the regulation of the anticoagulant activity of activated protein C (APC). Recent data showed a direct anticoagulant role of protein S independent of APC, as demonstrated by the inhibition of prothrombinase and tenase activity both in
A Congruence Theorem for Minimal Surfaces in $S^{5}$ with Constant Contact Angle

OpenAIRE

Montes, Rodrigo Ristow; Verderesi, Jose A.

2006-01-01

We provide a congruence theorem for minimal surfaces in $S^5$ with constant contact angle using Gauss-Codazzi-Ricci equations. More precisely, we prove that Gauss-Codazzi-Ricci equations for minimal surfaces in $S^5$ with constant contact angle satisfy an equation for the Laplacian of the holomorphic angle. Also, we will give a characterization of flat minimal surfaces in $S^5$ with constant contact angle.
Semileptonic decays of B{sub c} meson to S-wave charmonium states in the perturbative QCD approach

Energy Technology Data Exchange (ETDEWEB)

Rui, Zhou; Li, Hong; Wang, Guang-xin [North China University of Science and Technology, College of Sciences, Tangshan (China); Xiao, Ying [North China University of Science and Technology, College of Information Engineering, Tangshan (China)

2016-10-15

Inspired by the recent measurement of the ratio of B{sub c} branching fractions to J/ψπ{sup +} and J/ψμ{sup +}ν{sub μ} final states at the LHCb detector, we study the semileptonic decays of B{sub c} meson to the S-wave ground and radially excited 2S and 3S charmonium states with the perturbative QCD approach. After evaluating the form factors for the transitions B{sub c} → P,V, where P and V denote pseudoscalar and vector S-wave charmonia, respectively, we calculate the branching ratios for all these semileptonic decays. The theoretical uncertainty of hadronic input parameters are reduced by utilizing the light-cone wave function for the B{sub c} meson. It is found that the predicted branching ratios range from 10{sup -7} up to 10{sup -2} and could be measured by the future LHCb experiment. Our prediction for the ratio of branching fractions (BR(B{sub c}{sup +}→J/Ψπ{sup +}))/(BR(B{sub c}{sup +}→J/Ψμ{sup +}ν{sub μ})) is in good agreement with the data. For B{sub c} → Vlν{sub l} decays, the relative contributions of the longitudinal and transverse polarization are discussed in different momentum transfer squared regions. These predictions will be tested on the ongoing and forthcoming experiments. (orig.)
11 CFR 100.2 - Election (2 U.S.C. 431(1)).

Science.gov (United States)

2010-01-01

... office as independent candidates, or without nomination by a major party (as defined in 26 U.S.C. 9002(6..., as a direct result of which candidates are nominated, in accordance with applicable State law, for... candidate: (i) The day prescribed by applicable State law as the last day to qualify for a position on the...

The Inflammation-Related Gene S100A12 Is Positively Regulated by C/EBPβ and AP-1 in Pigs

Directory of Open Access Journals (Sweden)

Xinyun Li

2014-08-01

Full Text Available S100A12 is involved in the inflammatory response and is considered an important marker for many inflammatory diseases in humans. Our previous studies indicated that the S100A12 gene was abundant in the immune tissues of pigs and was significantly upregulated during infection with Haemophilus parasuis (HPS or porcine circovirus type 2 (PCV2. In this study, the mechanism of transcriptional regulation of S100A12 was investigated in pigs. Our results showed that S100A12, CCAAT/enhancer-binding protein beta (C/EBPβ and activator protein-1 (AP-1 genes were up-regulated in PK-15 (ATCC, CCL-33 cells when treated with LPS or Poly I: C. Additionally, the promoter activity and expression level of the S100A12 gene were significantly upregulated when C/EBPβ or AP-1 were overexpressed. We utilized electromobility shift assays (EMSA to confirm that C/EBPβ and AP-1 could directly bind the S100A12 gene promoter. We also found that the transcriptional activity and expression levels of C/EBPβ and AP-1 could positively regulate each other. Furthermore, the promoter activity of the S100A12 gene was higher when C/EBPβ and AP-1 were cotransfected than when they were transfected individually. We concluded that the S100A12 gene was cooperatively and positively regulated by C/EBPβ and AP-1 in pigs. Our study offers new insight into the transcriptional regulation of the S100A12 gene.
(2S-1,1-Dichloro-2-(2-chlorophenyl-2-(4-chlorophenylethane

Directory of Open Access Journals (Sweden)

Lars Eriksson

2009-02-01

Full Text Available The title compound, C14H10Cl4, is easily crystallized while the other enantiomorph only forms an oil upon crystallization attempts. The title compound has a considerably higher density, ρ ≃ 1.562 Mg m−3 compared to the racemic substance, ρ ≃ 1.514 Mg m−3. This is supported by the fact there are two intermolecular halogen–halogen contacts in the title compound compared with only one the racemic compound. The dihedral angle between the two phenyl rings is 76.83 (5°
Geometric factors in f.c.c. and b.c.c. metal-on-metal epitaxy

International Nuclear Information System (INIS)

Bruce, L.A.; Jaeger, H.

1978-01-01

Deposits of Ni, Au and Ag formed by condensing metal vapour in U.H.V. onto (001)W, held at a temperature Tsub(s) in the range 300K< Tsub(s)<1200 K, always form epitaxial layers. However, while Au and Ag form (001) epitaxial layers of f.c.c. single crystals, (001)d parallel to (001)s with, say, [110]d parallel to [010]s, Ni and Cu occur in two orthogonal domains, each characterized by an exclusive set of fault (or twin) planes. Within a fault plane, atoms are hexagonally close-packed and, within a domain, fault planes are normal to either [1-1-0]s or [1-10]s and a close-packed direction in the planes is normal to the substrate. The lateral stacking of the fault planes may range from random at low values of Tsub(s) to that of, say, (11-1-) planes in heavily faulted and/or twinned (110) epitaxed f.c.c. material, or of basal planes in (110) epitaxed h.c.p. material at high values of Tsub(s). The results are readily explained on the basis of a growth model developed for deposits of Ni and Cu on (001) Ag. (author)
Investigation of C3 S hydration mechanism by transmission electron microscope (TEM) with integrated Super-XTM EDS system.

Science.gov (United States)

Sakalli, Y; Trettin, R

2017-07-01

Tricalciumsilicate (C 3 S, Alite) is the major component of the Portland cement clinker. Hydration of Alite is decisive in influencing the properties of the resulting material. This is due to its high content in cement. The mechanism of the hydration of C 3 S is very complicated and not yet fully understood. There are different models describing the hydration of C 3 S in various ways. In this work for a better understanding of hydration mechanism, the hydrated C 3 S was investigated by using the transmission electron microscope (TEM) and for the first time, the samples for the investigations were prepared by using of focused ion beam from sintered pellets of C 3 S. Also, an FEI Talos F200x with an integrated Super-X EDS system was used for the investigations. FEI Talos F200X combines outstanding high-resolution S/TEM and TEM imaging with energy dispersive X-ray spectroscopy signal detection, and 3D chemical characterization with compositional mapping. TEM is a very powerful tool for material science. A high energy beam of electrons passes through a very thin sample, and the interactions between the electrons and the atoms can be used to observe the structure of the material and other features in the structure. TEM can be used to study the growth of layers and their composition. TEM produces high-resolution, two-dimensional images and will be used for a wide range of educational, science and industry applications. Chemical analysis can also be performed. The purpose of these investigations was to get the information about the composition of the C-S-H phases and some details of the nanostructure of the C-S-H phases. © 2017 The Authors Journal of Microscopy © 2017 Royal Microscopical Society.
Investigation of p,π+- charged particle correlations in π-C interactions at 5 GeV/c with emission of a particle in the backward direction

International Nuclear Information System (INIS)

Budagov, Yu.A.; Bayaramov, A.A.; Dzhelepov, V.P.; Dvornik, A.M.; Efremov, A.V.; Flyagin, V.B.; Lomakin, Yu.F.; Valkar, S.; Volodko, A.G.

1976-01-01

The π-C interactions at 5 GeV/c are studied. Angle correlation between two charged particles when a particle is emitted to the backward hemisphere has been investigated. Noticeable correlation appears if the angle between the two particles is 180 deg (lab.s.). It follows from this behaviour that the backward emission of a particle is due to the hard collision mechanism
/sup 13/C, /sup 17/O, and /sup 33/S NMR spectra of alkyl phenyl sulfones C/sub 6/H/sub 5/SO/sub 2/Alk

Energy Technology Data Exchange (ETDEWEB)

Bzhezovskii, V.M.; Valeev, R.B.; Kalabin, G.A.; Aliev, I.A.

1987-06-20

The /sup 13/C, /sup 17/O, and /sup 33/S NMR spectra of alkyl phenyl sulfones C/sub 6/H/sub 5/SO/sub 2/Alk were obtained. The changes in the screening of the /sup 13/C, /sup 17/O, and /sup 33/S nuclei in these compounds are determined by the effect of the alkyl substituents, which alternates in sign and decreases along the chain of atoms in the order: CH/sub 3/, C/sub 2/H/sub 5/, iso-C/sub 3/H/sub 7/, and tert-C/sub 4/H/sub 9/. In the alkyl phenyl sulfides C/sub 6/H/sub 5/SAlk the additional effect of disruption in the p,..pi.. interaction between the sulfur atom and the benzene ring as a result of conformational changes is superimposed on the screening of the /sup 13/C/sup ortho/ nuclei. For the changes in the screening of the /sup 13/C/sup para/ nuclei in C/sub 6/H/sub 5/SAlk the steric disruption of the p,..pi.. conjugation by the alkyl substituents is determining.
The Evolution of Car Sales in S.C. Next Automobile S.A. During the Crisis

OpenAIRE

Savu Mihaela; Antonescu Eugenia; Mîndreci Georgiana

2012-01-01

The automotive industry had to withstand the effects of the economic crisis, a fact underlined by the automobile production which had a volume decrease between 2008 and 2009. The same situation occurred on the car market in Romania, with the difference that the decline began in 2009 and it has continued up to now. Regarding the car sales, the Toyota brand was negatively affected by the crisis and the number of cars sold decreased between 2009 and 2010. The same situation is specific for S.C. ...
Análisis de las polihidroxialcanoato sintasas (PhaC1 y PhaC2 en una cepa de Pseudomonas fluorescens IBUN S1602, aislada en suelos colombianos

Directory of Open Access Journals (Sweden)

Julieth Serrano Riaño

2011-07-01

Full Text Available Título en ingles: Analysis of polyhydroxyalkanoate synthases (PhaC1 and PhaC2 in a strain of Pseudomonas fluorescens IBUN S1602 isolated from Colombian soil. Resumen La cepa Pseudomonas fluorescens IBUN S1602 conforma el grupo de aislamientos provenientes de suelos colombianos de caña de azúcar, que acumula polihidrioxialcanoato (PHA, fue seleccionada como promisoria para escalamiento comercial por tener afinidad por sustratos alternativos y económicos como el glicerol, aceites usados, suero de leche, entre otros. Dada la importancia de la enzima sintasa en la síntesis de los PHAs, en el presente trabajo se realizó el análisis molecular de los genes phaC1 y phaC2 que codifican las enzimas sintasas tipo II (PhaC1 y PhaC2. Para la obtención de los amplímeros requeridos en la secuenciación, se utilizó la técnica de PCR bajo condiciones estandarizadas para iniciadores diseñados reportados en las bases de datos. Se identificaron dos fragmentos de 1680 pb y 1683 pb correspondientes a phaC1 y phaC2. El análisis comparativo de las secuencias proteicas resultantes de estos genes demuestra que la sintasa IBUN S1602 contiene la región α/β hidrolasa y 8 residuos de aminoácidos conservados, que son características de las sintasas examinadas a nivel mundial. Se analizó la estructura enzimática a nivel primario y se predijo la secundaria. Se concluyó que las sintasas de la cepa Pseudomonas fluorescens IBUN S1602 presentan alta homología con las sintasas tipo II que se reportan para Pseudomonas. Los resultados obtenidos contribuyen al entendimiento básico de la biosíntesis de PHA, la cual permitirá, en un futuro, el aumento de la calidad de PHA debida a la modulación del nivel de sintasa que se exprese en un organismo recombinante, con el fin de variar el peso molecular del biopolímero, propiedad esencial en el estudio de aplicaciones industriales. Palabras clave: polihidroxialcanoatos, PHA sintasa, bioinform
Why Y-c.c

Czech Academy of Sciences Publication Activity Database

Chodounský, David; Zapletal, Jindřich

2015-01-01

Roč. 166, č. 11 (2015), s. 1123-1149 ISSN 0168-0072 R&D Projects: GA ČR(CZ) GF15-34700L Institutional support: RVO:67985840 Keywords : c.c.c. partitions * proper forcing * forcing axiom Subject RIV: BA - General Mathematics Impact factor: 0.582, year: 2015 http://www.sciencedirect.com/science/article/pii/S0168007215000664
Measurement of the cross-section ratio {sigma}({chi}{sub c2})/{sigma}({chi}{sub c1}) for prompt {chi}{sub c} production at {radical}(s)=7 TeV

Energy Technology Data Exchange (ETDEWEB)

Aaij, R. [Nikhef National Institute for Subatomic Physics, Amsterdam (Netherlands); Abellan Beteta, C. [Universitat de Barcelona, Barcelona (Spain); Adeva, B. [Universidad de Santiago de Compostela, Santiago de Compostela (Spain); Adinolfi, M. [H.H. Wills Physics Laboratory, University of Bristol, Bristol (United Kingdom); Adrover, C. [CPPM, Aix-Marseille Universite, CNRS/IN2P3, Marseille (France); Affolder, A. [Oliver Lodge Laboratory, University of Liverpool, Liverpool (United Kingdom); Ajaltouni, Z. [Clermont Universite, Universite Blaise Pascal, CNRS/IN2P3, LPC, Clermont-Ferrand (France); Albrecht, J.; Alessio, F. [European Organization for Nuclear Research (CERN), Geneva (Switzerland); Alexander, M. [School of Physics and Astronomy, University of Glasgow, Glasgow (United Kingdom); Alkhazov, G. [Petersburg Nuclear Physics Institute (PNPI), Gatchina (Russian Federation); Alvarez Cartelle, P. [Universidad de Santiago de Compostela, Santiago de Compostela (Spain); Alves, A.A. [Sezione INFN di Roma La Sapienza, Roma (Italy); Amato, S. [Universidade Federal do Rio de Janeiro (UFRJ), Rio de Janeiro (Brazil); Amhis, Y. [Ecole Polytechnique Federale de Lausanne (EPFL), Lausanne (Switzerland); Anderson, J. [Physik-Institut, Universitaet Zuerich, Zuerich (Switzerland); Appleby, R.B. [School of Physics and Astronomy, University of Manchester, Manchester (United Kingdom); Aquines Gutierrez, O. [Max-Planck-Institut fuer Kernphysik (MPIK), Heidelberg (Germany); Archilli, F. [Laboratori Nazionali dell' INFN di Frascati, Frascati (Italy); European Organization for Nuclear Research (CERN), Geneva (Switzerland); Arrabito, L. [CC-IN2P3, CNRS/IN2P3, Lyon-Villeurbanne (France); and others

2012-08-14

The prompt production of the charmonium {chi}{sub c1} and {chi}{sub c2} mesons has been studied in proton-proton collisions at the Large Hadron Collider at a centre-of-mass energy of {radical}(s)=7 TeV. The {chi}{sub c} mesons are identified through their decays {chi}{sub c}{yields}J/{psi}{gamma} with J/{psi}{yields}{mu}{sup +}{mu}{sup -} using 36 pb{sup -1} of data collected by the LHCb detector in 2010. The ratio of the prompt production cross-sections for the two {chi}{sub c} spin states, {sigma}({chi}{sub c2})/{sigma}({chi}{sub c1}), has been determined as a function of the J/{psi} transverse momentum, p{sub T}{sup J/{psi}}, in the range from 2 to 15 GeV/c. The results are in agreement with the next-to-leading order non-relativistic QCD model at high p{sub T}{sup J/{psi}} and lie consistently above the pure leading-order colour-singlet prediction.
Dimethyl 4,4′-dihydroxy-3,3′-{[(3aRS,7aRS-2,3,3a,4,5,6,7,7a-octahydro-1H-1,3-benzimidazole-1,3-diyl]bis(methylene}dibenzoate

Directory of Open Access Journals (Sweden)

Augusto Rivera

2011-11-01

Full Text Available The title compound, C25H30N2O6, has the imidazolidine ring in an envelope conformation. There are two intramolecular O—H...N hydrogen-bond interactions with graph-set motif S(6. The cyclohexane ring adopts a slightly distorted chair conformation. One methyl carboxylate substituent forms a dihedral angle of 12.00 (5° with the plane of the benzene ring, while the other methyl carboxylate group is almost coplanar, making a dihedral angle of 2.26 (9°. In the crystal, pairs of intermolecular C—H...O hydrogen bonds form racemic dimers, corresponding to an R22(18 graph-set motif. Further weak C—H...O interactions generate a chain running along the c axis.
Observation of $\\eta_{c}(2S) \\to p \\bar p$ and search for $X(3872) \\to p \\bar p$ decays

CERN Document Server

Aaij, Roel

2017-06-10

The first observation of the decay $\\eta_{c}(2S) \\to p \\bar p$ is reported using proton-proton collision data corresponding to an integrated luminosity of $3.0\\rm \\, fb^{-1}$ recorded by the LHCb experiment at centre-of-mass energies of 7 and 8 TeV. The $\\eta_{c}(2S)$ resonance is produced in the decay $B^{+} \\to [c\\bar c] K^{+}$. The product of branching fractions normalised to that for the $J/\\psi$ intermediate state, ${\\cal R}_{\\eta_{c}(2S)}$, is measured to be \\begin{align*} {\\cal R}_{\\eta_{c}(2S)}\\equiv\\frac{{\\mathcal B}(B^{+} \\to \\eta_{c}(2S) K^{+}) \\times {\\mathcal B}(\\eta_{c}(2S) \\to p \\bar p)}{{\\mathcal B}(B^{+} \\to J/\\psi K^{+}) \\times {\\mathcal B}(J/\\psi\\to p \\bar p)} =~& (1.58 \\pm 0.33 \\pm 0.09)\\times 10^{-2}, \\end{align*} where the first uncertainty is statistical and the second systematic. No signals for the decays $B^{+} \\to X(3872) (\\to p \\bar p) K^{+}$ and $B^{+} \\to \\psi(3770) (\\to p \\bar p) K^{+}$ are seen, and the 95\\% confidence level upper limits on their relative branching ratios ar...
From Metal-Organic Framework to Li2S@C-Co-N Nanoporous Architecture: A High-Capacity Cathode for Lithium-Sulfur Batteries.

Science.gov (United States)

He, Jiarui; Chen, Yuanfu; Lv, Weiqiang; Wen, Kechun; Xu, Chen; Zhang, Wanli; Li, Yanrong; Qin, Wu; He, Weidong

2016-12-27

Owing to the high theoretical specific capacity (1166 mAh g -1 ), lithium sulfide (Li 2 S) has been considered as a promising cathode material for Li-S batteries. However, the polysulfide dissolution and low electronic conductivity of Li 2 S limit its further application in next-generation Li-S batteries. In this report, a nanoporous Li 2 S@C-Co-N cathode is synthesized by liquid infiltration-evaporation of ultrafine Li 2 S nanoparticles into graphitic carbon co-doped with cobalt and nitrogen (C-Co-N) derived from metal-organic frameworks. The obtained Li 2 S@C-Co-N architecture remarkably immobilizes Li 2 S within the cathode structure through physical and chemical molecular interactions. Owing to the synergistic interactions between C-Co-N and Li 2 S nanoparticles, the Li 2 S@C-Co-N composite delivers a reversible capacity of 1155.3 (99.1% of theoretical value) at the initial cycle and 929.6 mAh g -1 after 300 cycles, with nearly 100% Coulombic efficiency and a capacity fading of 0.06% per cycle. It exhibits excellent rate capacities of 950.6, 898.8, and 604.1 mAh g -1 at 1C, 2C, and 4C, respectively. Such a cathode structure is promising for practical applications in high-performance Li-S batteries.
Measurement of the branching fraction ratio $\\mathcal{B}(B_c^+ \\rightarrow \\psi(2S)\\pi^+)/\\mathcal{B}(B_c^+ \\rightarrow J/\\psi \\pi^+)$

CERN Document Server

Aaij, Roel; Adinolfi, Marco; Affolder, Anthony; Ajaltouni, Ziad; Akar, Simon; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderson, Jonathan; Andreassi, Guido; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Aquines Gutierrez, Osvaldo; Archilli, Flavio; d'Argent, Philippe; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Auriemma, Giulio; Baalouch, Marouen; Bachmann, Sebastian; Back, John; Badalov, Alexey; Baesso, Clarissa; Baldini, Wander; Barlow, Roger; Barschel, Colin; Barsuk, Sergey; Barter, William; Batozskaya, Varvara; Battista, Vincenzo; Bay, Aurelio; Beaucourt, Leo; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Bel, Lennaert; Bellee, Violaine; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Benton, Jack; Berezhnoy, Alexander; Bernet, Roland; Bertolin, Alessandro; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bien, Alexander; Bifani, Simone; Bird, Thomas; Birnkraut, Alex; Bizzeti, Andrea; Blake, Thomas; Blanc, Frédéric; Blouw, Johan; Blusk, Steven; Bocci, Valerio; Bondar, Alexander; Bondar, Nikolay; Bonivento, Walter; Borghi, Silvia; Borsato, Martino; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Braun, Svende; Brett, David; Britsch, Markward; Britton, Thomas; Brodzicka, Jolanta; Brook, Nicholas; Bursche, Albert; Buytaert, Jan; Cadeddu, Sandro; Calabrese, Roberto; Calvi, Marta; Calvo Gomez, Miriam; Campana, Pierluigi; Campora Perez, Daniel; Capriotti, Lorenzo; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carniti, Paolo; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casse, Gianluigi; Cassina, Lorenzo; Castillo Garcia, Lucia; Cattaneo, Marco; Cauet, Christophe; Cavallero, Giovanni; Cenci, Riccardo; Charles, Matthew; Charpentier, Philippe; Chefdeville, Maximilien; Chen, Shanzhen; Cheung, Shu-Faye; Chiapolini, Nicola; Chrzaszcz, Marcin; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cogoni, Violetta; Cojocariu, Lucian; Collazuol, Gianmaria; Collins, Paula; Comerma-Montells, Albert; Contu, Andrea; Cook, Andrew; Coombes, Matthew; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Crocombe, Andrew; Cruz Torres, Melissa Maria; Cunliffe, Samuel; Currie, Robert; D'Ambrosio, Carmelo; Dall'Occo, Elena; Dalseno, Jeremy; David, Pieter; Davis, Adam; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Simone, Patrizia; Dean, Cameron Thomas; Decamp, Daniel; Deckenhoff, Mirko; Del Buono, Luigi; Déléage, Nicolas; Demmer, Moritz; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Dey, Biplab; Di Canto, Angelo; Di Ruscio, Francesco; Dijkstra, Hans; Donleavy, Stephanie; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Dossett, David; Dovbnya, Anatoliy; Dreimanis, Karlis; Dufour, Laurent; Dujany, Giulio; Dupertuis, Frederic; Durante, Paolo; Dzhelyadin, Rustem; Dziurda, Agnieszka; Dzyuba, Alexey; Easo, Sajan; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; El Rifai, Ibrahim; Elsasser, Christian; Ely, Scott; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Färber, Christian; Farinelli, Chiara; Farley, Nathanael; Farry, Stephen; Fay, Robert; Ferguson, Dianne; Fernandez Albor, Victor; Ferrari, Fabio; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fiore, Marco; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fohl, Klaus; Fol, Philip; Fontana, Marianna; Fontanelli, Flavio; Forty, Roger; Francisco, Oscar; Frank, Markus; Frei, Christoph; Frosini, Maddalena; Fu, Jinlin; Furfaro, Emiliano; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; García Pardiñas, Julián; Garra Tico, Jordi; Garrido, Lluis; Gascon, David; Gaspar, Clara; Gauld, Rhorry; Gavardi, Laura; Gazzoni, Giulio; Geraci, Angelo; Gerick, David; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianelle, Alessio; Gianì, Sebastiana; Gibson, Valerie; Girard, Olivier Göran; Giubega, Lavinia-Helena; Gligorov, V.V.; Göbel, Carla; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gotti, Claudio; Grabalosa Gándara, Marc; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graverini, Elena; Graziani, Giacomo; Grecu, Alexandru; Greening, Edward; Gregson, Sam; Griffith, Peter; Grillo, Lucia; Grünberg, Oliver; Gui, Bin; Gushchin, Evgeny; Guz, Yury; Gys, Thierry; Hadavizadeh, Thomas; Hadjivasiliou, Christos; Haefeli, Guido; Haen, Christophe; Haines, Susan; Hall, Samuel; Hamilton, Brian; Han, Xiaoxue; Hansmann-Menzemer, Stephanie; Harnew, Neville; Harrison, Jonathan; He, Jibo; Head, Timothy; Heijne, Veerle; Hennessy, Karol; Henrard, Pierre; Henry, Louis; Hernando Morata, Jose Angel; van Herwijnen, Eric; Heß, Miriam; Hicheur, Adlène; Hill, Donal; Hoballah, Mostafa; Hombach, Christoph; Hulsbergen, Wouter; Humair, Thibaud; Hussain, Nazim; Hutchcroft, David; Hynds, Daniel; Idzik, Marek; Ilten, Philip; Jacobsson, Richard; Jaeger, Andreas; Jalocha, Pawel; Jans, Eddy; Jawahery, Abolhassan; Jing, Fanfan; John, Malcolm; Johnson, Daniel; Jones, Christopher; Joram, Christian; Jost, Beat; Jurik, Nathan; Kandybei, Sergii; Kanso, Walaa; Karacson, Matthias; Karbach, Moritz; Karodia, Sarah; Kelsey, Matthew; Kenyon, Ian; Kenzie, Matthew; Ketel, Tjeerd; Khanji, Basem; Khurewathanakul, Chitsanu; Klaver, Suzanne; Klimaszewski, Konrad; Kochebina, Olga; Kolpin, Michael; Komarov, Ilya; Koopman, Rose; Koppenburg, Patrick; Kozeiha, Mohamad; Kravchuk, Leonid; Kreplin, Katharina; Kreps, Michal; Krocker, Georg; Krokovny, Pavel; Kruse, Florian; Kucewicz, Wojciech; Kucharczyk, Marcin; Kudryavtsev, Vasily; Kuonen, Axel Kevin; Kurek, Krzysztof; Kvaratskheliya, Tengiz; Lacarrere, Daniel; Lafferty, George; Lai, Adriano; Lambert, Dean; Lanfranchi, Gaia; Langenbruch, Christoph; Langhans, Benedikt; Latham, Thomas; Lazzeroni, Cristina; Le Gac, Renaud; van Leerdam, Jeroen; Lees, Jean-Pierre; Lefèvre, Regis; Leflat, Alexander; Lefrançois, Jacques; Leroy, Olivier; Lesiak, Tadeusz; Leverington, Blake; Li, Yiming; Likhomanenko, Tatiana; Liles, Myfanwy; Lindner, Rolf; Linn, Christian; Lionetto, Federica; Liu, Bo; Liu, Xuesong; Loh, David; Lohn, Stefan; Longstaff, Iain; Lopes, Jose; Lucchesi, Donatella; Lucio Martinez, Miriam; Luo, Haofei; Lupato, Anna; Luppi, Eleonora; Lupton, Oliver; Lusardi, Nicola; Lusiani, Alberto; Machefert, Frederic; Maciuc, Florin; Maev, Oleg; Maguire, Kevin; Malde, Sneha; Malinin, Alexander; Manca, Giulia; Mancinelli, Giampiero; Manning, Peter Michael; Mapelli, Alessandro; Maratas, Jan; Marchand, Jean François; Marconi, Umberto; Marin Benito, Carla; Marino, Pietro; Märki, Raphael; Marks, Jörg; Martellotti, Giuseppe; Martin, Morgan; Martinelli, Maurizio; Martinez Santos, Diego; Martinez Vidal, Fernando; Martins Tostes, Danielle; Massafferri, André; Matev, Rosen; Mathad, Abhijit; Mathe, Zoltan; Matteuzzi, Clara; Matthieu, Kecke; Mauri, Andrea; Maurin, Brice; Mazurov, Alexander; McCann, Michael; McCarthy, James; McNab, Andrew; McNulty, Ronan; Meadows, Brian; Meier, Frank; Meissner, Marco; Melnychuk, Dmytro; Merk, Marcel; Milanes, Diego Alejandro; Minard, Marie-Noelle; Mitzel, Dominik Stefan; Molina Rodriguez, Josue; Monroy, Ignacio Alberto; Monteil, Stephane; Morandin, Mauro; Morawski, Piotr; Mordà, Alessandro; Morello, Michael Joseph; Moron, Jakub; Morris, Adam Benjamin; Mountain, Raymond; Muheim, Franz; Müller, Janine; Müller, Katharina; Müller, Vanessa; Mussini, Manuel; Muster, Bastien; Naik, Paras; Nakada, Tatsuya; Nandakumar, Raja; Nandi, Anita; Nasteva, Irina; Needham, Matthew; Neri, Nicola; Neubert, Sebastian; Neufeld, Niko; Neuner, Max; Nguyen, Anh Duc; Nguyen, Thi-Dung; Nguyen-Mau, Chung; Niess, Valentin; Niet, Ramon; Nikitin, Nikolay; Nikodem, Thomas; Ninci, Daniele; Novoselov, Alexey; O'Hanlon, Daniel Patrick; Oblakowska-Mucha, Agnieszka; Obraztsov, Vladimir; Ogilvy, Stephen; Okhrimenko, Oleksandr; Oldeman, Rudolf; Onderwater, Gerco; Osorio Rodrigues, Bruno; Otalora Goicochea, Juan Martin; Otto, Adam; Owen, Patrick; Oyanguren, Maria Aranzazu; Palano, Antimo; Palombo, Fernando; Palutan, Matteo; Panman, Jacob; Papanestis, Antonios; Pappagallo, Marco; Pappalardo, Luciano; Pappenheimer, Cheryl; Parkes, Christopher; Passaleva, Giovanni; Patel, Girish; Patel, Mitesh; Patrignani, Claudia; Pearce, Alex; Pellegrino, Antonio; Penso, Gianni; Pepe Altarelli, Monica; Perazzini, Stefano; Perret, Pascal; Pescatore, Luca; Petridis, Konstantinos; Petrolini, Alessandro; Petruzzo, Marco; Picatoste Olloqui, Eduardo; Pietrzyk, Boleslaw; Pilař, Tomas; Pinci, Davide; Pistone, Alessandro; Piucci, Alessio; Playfer, Stephen; Plo Casasus, Maximo; Poikela, Tuomas; Polci, Francesco; Poluektov, Anton; Polyakov, Ivan; Polycarpo, Erica; Popov, Alexander; Popov, Dmitry; Popovici, Bogdan; Potterat, Cédric; Price, Eugenia; Price, Joseph David; Prisciandaro, Jessica; Pritchard, Adrian; Prouve, Claire; Pugatch, Valery; Puig Navarro, Albert; Punzi, Giovanni; Qian, Wenbin; Quagliani, Renato; Rachwal, Bartolomiej; Rademacker, Jonas; Rama, Matteo; Rangel, Murilo; Raniuk, Iurii; Rauschmayr, Nathalie; Raven, Gerhard; Redi, Federico; Reichert, Stefanie; Reid, Matthew; dos Reis, Alberto; Ricciardi, Stefania; Richards, Sophie; Rihl, Mariana; Rinnert, Kurt; Rives Molina, Vincente; Robbe, Patrick; Rodrigues, Ana Barbara; Rodrigues, Eduardo; Rodriguez Lopez, Jairo Alexis; Rodriguez Perez, Pablo; Roiser, Stefan; Romanovsky, Vladimir; Romero Vidal, Antonio; Ronayne, John William; Rotondo, Marcello; Rouvinet, Julien; Ruf, Thomas; Ruiz, Hugo; Ruiz Valls, Pablo; Saborido Silva, Juan Jose; Sagidova, Naylya; Sail, Paul; Saitta, Biagio; Salustino Guimaraes, Valdir; Sanchez Mayordomo, Carlos; Sanmartin Sedes, Brais; Santacesaria, Roberta; Santamarina Rios, Cibran; Santimaria, Marco; Santovetti, Emanuele; Sarti, Alessio; Satriano, Celestina; Satta, Alessia; Saunders, Daniel Martin; Savrina, Darya; Schiller, Manuel; Schindler, Heinrich; Schlupp, Maximilian; Schmelling, Michael; Schmelzer, Timon; Schmidt, Burkhard; Schneider, Olivier; Schopper, Andreas; Schubiger, Maxime; Schune, Marie Helene; Schwemmer, Rainer; Sciascia, Barbara; Sciubba, Adalberto; Semennikov, Alexander; Serra, Nicola; Serrano, Justine; Sestini, Lorenzo; Seyfert, Paul; Shapkin, Mikhail; Shapoval, Illya; Shcheglov, Yury; Shears, Tara; Shekhtman, Lev; Shevchenko, Vladimir; Shires, Alexander; Siddi, Benedetto Gianluca; Silva Coutinho, Rafael; Simi, Gabriele; Sirendi, Marek; Skidmore, Nicola; Skillicorn, Ian; Skwarnicki, Tomasz; Smith, Edmund; Smith, Eluned; Smith, Iwan Thomas; Smith, Jackson; Smith, Mark; Snoek, Hella; Sokoloff, Michael; Soler, Paul; Soomro, Fatima; Souza, Daniel; Souza De Paula, Bruno; Spaan, Bernhard; Spradlin, Patrick; Sridharan, Srikanth; Stagni, Federico; Stahl, Marian; Stahl, Sascha; Steinkamp, Olaf; Stenyakin, Oleg; Sterpka, Christopher Francis; Stevenson, Scott; Stoica, Sabin; Stone, Sheldon; Storaci, Barbara; Stracka, Simone; Straticiuc, Mihai; Straumann, Ulrich; Sun, Liang; Sutcliffe, William; Swientek, Krzysztof; Swientek, Stefan; Syropoulos, Vasileios; Szczekowski, Marek; Szczypka, Paul; Szumlak, Tomasz; T'Jampens, Stephane; Tayduganov, Andrey; Tekampe, Tobias; Teklishyn, Maksym; Tellarini, Giulia; Teubert, Frederic; Thomas, Christopher; Thomas, Eric; van Tilburg, Jeroen; Tisserand, Vincent; Tobin, Mark; Todd, Jacob; Tolk, Siim; Tomassetti, Luca; Tonelli, Diego; Topp-Joergensen, Stig; Torr, Nicholas; Tournefier, Edwige; Tourneur, Stephane; Trabelsi, Karim; Tran, Minh Tâm; Tresch, Marco; Trisovic, Ana; Tsaregorodtsev, Andrei; Tsopelas, Panagiotis; Tuning, Niels; Ukleja, Artur; Ustyuzhanin, Andrey; Uwer, Ulrich; Vacca, Claudia; Vagnoni, Vincenzo; Valenti, Giovanni; Vallier, Alexis; Vazquez Gomez, Ricardo; Vazquez Regueiro, Pablo; Vázquez Sierra, Carlos; Vecchi, Stefania; Velthuis, Jaap; Veltri, Michele; Veneziano, Giovanni; Vesterinen, Mika; Viaud, Benoit; Vieira, Daniel; Vieites Diaz, Maria; Vilasis-Cardona, Xavier; Vollhardt, Achim; Volyanskyy, Dmytro; Voong, David; Vorobyev, Alexey; Vorobyev, Vitaly; Voß, Christian; de Vries, Jacco; Waldi, Roland; Wallace, Charlotte; Wallace, Ronan; Walsh, John; Wandernoth, Sebastian; Wang, Jianchun; Ward, David; Watson, Nigel; Websdale, David; Weiden, Andreas; Whitehead, Mark; Wilkinson, Guy; Wilkinson, Michael; Williams, Mark Richard James; Williams, Matthew; Williams, Mike; Williams, Timothy; Wilson, Fergus; Wimberley, Jack; Wishahi, Julian; Wislicki, Wojciech; Witek, Mariusz; Wormser, Guy; Wotton, Stephen; Wright, Simon; Wyllie, Kenneth; Xie, Yuehong; Xu, Zhirui; Yang, Zhenwei; Yu, Jiesheng; Yuan, Xuhao; Yushchenko, Oleg; Zangoli, Maria; Zavertyaev, Mikhail; Zhang, Liming; Zhang, Yanxi; Zhelezov, Alexey; Zhokhov, Anatoly; Zhong, Liang; Zucchelli, Stefano

2015-10-20

Using $pp$ collision data collected by LHCb at center-of-mass energies $\\sqrt{s}$ = 7 TeV and 8 TeV, corresponding to an integrated luminosity of 3 fb$^{-1}$, the ratio of the branching fraction of the $B_c^+ \\rightarrow \\psi(2S)\\pi^+$ decay relative to that of the $B_c^+ \\rightarrow J/\\psi\\pi^+$ decay is measured to be 0.268 $\\pm$ 0.032 (stat) $\\pm$ 0.007 (syst) $\\pm$ 0.006 (BF). The first uncertainty is statistical, the second is systematic, and the third is due to the uncertainties on the branching fractions of the $J/\\psi \\rightarrow \\mu^+\\mu^-$ and $\\psi(2S) \\rightarrow \\mu^+\\mu^-$ decays. This measurement is consistent with the previous LHCb result, and the statistical uncertainty is halved.
Intracranial AAV-sTRAIL combined with lanatoside C prolongs survival in an orthotopic xenograft mouse model of invasive glioblastoma.

Science.gov (United States)

Crommentuijn, Matheus H W; Maguire, Casey A; Niers, Johanna M; Vandertop, W Peter; Badr, Christian E; Würdinger, Thomas; Tannous, Bakhos A

2016-04-01

Glioblastoma (GBM) is the most common malignant brain tumor in adults. We designed an adeno-associated virus (AAV) vector for intracranial delivery of secreted, soluble tumor necrosis factor-related apoptosis-inducing ligand (sTRAIL) to GBM tumors in mice and combined it with the TRAIL-sensitizing cardiac glycoside, lanatoside C (lan C). We applied this combined therapy to two different GBM models using human U87 glioma cells and primary patient-derived GBM neural spheres in culture and in orthotopic GBM xenograft models in mice. In U87 cells, conditioned medium from AAV2-sTRAIL expressing cells combined with lan C induced 80% cell death. Similarly, lan C sensitized primary GBM spheres to sTRAIL causing over 90% cell death. In mice bearing intracranial U87 tumors treated with AAVrh.8-sTRAIL, administration of lan C caused a decrease in tumor-associated Fluc signal, while tumor size increased within days of stopping the treatment. Another round of lan C treatment re-sensitized GBM tumor to sTRAIL-induced cell death. AAVrh.8-sTRAIL treatment alone and combined with lanatoside C resulted in a significant decrease in tumor growth and longer survival of mice bearing orthotopic invasive GBM brain tumors. In summary, AAV-sTRAIL combined with lanatoside C induced cell death in U87 glioma cells and patient-derived GBM neural spheres in culture and in vivo leading to an increased in overall mice survival. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Disequilibrium dihedral angles in layered intrusions: the microstructural record of fractionation

Science.gov (United States)

Holness, Marian; Namur, Olivier; Cawthorn, Grant

2013-04-01

The dihedral angle formed at junctions between two plagioclase grains and a grain of augite is only rarely in textural equilibrium in gabbros from km-scale crustal layered intrusions. The median of a population of these disequilibrium angles, Θcpp, varies systematically within individual layered intrusions, remaining constant over large stretches of stratigraphy with significant increases or decreases associated with the addition or reduction respectively of the number of phases on the liquidus of the bulk magma. The step-wise changes in Θcpp are present in Upper Zone of the Bushveld Complex, the Megacyclic Unit I of the Sept Iles Intrusion, and the Layered Series of the Skaergaard Intrusion. The plagioclase-bearing cumulates of Rum have a bimodal distribution of Θcpp, dependent on whether the cumulus assemblage includes clinopyroxene. The presence of the step-wise changes is independent of the order of arrival of cumulus phases and of the composition of either the cumulus phases or the interstitial liquid inferred to be present in the crystal mush. Step-wise changes in the rate of change in enthalpy with temperature (ΔH) of the cooling and crystallizing magma correspond to the observed variation of Θcpp, with increases of both ΔH and Θcpp associated with the addition of another liquidus phase, and decreases of both associated with the removal of a liquidus phase. The replacement of one phase by another (e.g. olivine ⇔ orthpyroxene) has little effect on ΔH and no discernible effect on Θcpp. An increase of ΔH is manifest by an increase in the fraction of the total enthalpy budget that is the latent heat of crystallization (the fractional latent heat). It also results in an increase in the amount crystallized in each incremental temperature drop (the crystal productivity). An increased fractional latent heat and crystal productivity result in an increased rate of plagioclase growth compared to that of augite during the final stages of solidification
(E-1-(4-Aminophenyl-3-(naphthalen-2-ylprop-2-en-1-one

Directory of Open Access Journals (Sweden)

Thawanrat Kobkeatthawin

2011-05-01

Full Text Available The molecule of the title chalcone derivative, C19H15NO, exists in a trans configuration with respect to the C=C double bond. The molecule is slightly twisted with a dihedral angle of 6.12 (12° between the benzene ring and the naphthalene ring system. The prop-2-en-1-one bridge is nearly planar, with an r.m.s. deviation of 0.0194 (2, and makes dihedral angles of 8.05 (19 and 11.47 (18° with the benzene ring and the naphthalene ring system, respectively. In the crystal, molecules are linked by N—H...O hydrogen bonds into chains along the b axis. Weak N—H...π and C—H...π interactions and a short N...O contact [2.974 (4 Å] are also observed.
The uptake of Cs, Cl, I, Co, U and Pu by C-S-H, portlandite and ettringite

International Nuclear Information System (INIS)

Le Callonnec, C.; Richet, C.; Ayache, R.

2000-01-01

The aim of this work is to study the retention of Pu, Cs, Cl, U, Co and I onto the three phases of a cement paste: calcium silicate hydrates or C-S-H (Ca/Si=1.65), portlandite (Ca(OH) 2 ) and ettringite (Ca 6 Al 2 S 3 O 21 .32H 2 O). C-S-H of Ca/Si molar ratio of 1.65 and ettringite were prepared in suspension, while portlandite was provided by an industrial laboratory. The sorptive power for each ion was determined by a batch model at 20 degrees Celsius. The uptake of ions onto the phases has been obtained by introducing a very small volume of radioactive Cs, Co, Cl, I, U and Pu solution in each batch. Aliquots of solution were periodically removed for analysis. The results show that there are two kinds of ions whatever the solid phase: those which are poorly sorbed: Cs, Cl, I and Co, U and Pu which are strongly sorbed (by a factor 100 to 10000). Elsewhere, the comparison between the sorptive power of each phase reveals that C-S-H develops a significant sorption potential for pluri-valent ions (Pu, U, Co) as well as for Cl. The retention capacity of portlandite mainly towards pluri-valent cations is one or two orders of magnitude weaker than C-S-H capacity. Ettringite only plays a sorptive role relatively to Cs. However, iodine does not have a strong affinity for any solid at all. The data allow us to calculate a global sorption coefficient Kd of the cement paste for each ion. Assuming that the proportion of C-S-H, portlandite, ettringite is respectively 65%, 15% and 5% in a Portland cement, the global sorption coefficient is in good agreement with literature regarding on U, Cs, I and Cl. Cementitious materials appear to be an interesting chemical barrier that can limit the diffusion of pluri-valent cations. As C-S-H represent from 60% to 75% of the cement paste, this study leads to underline that C-S-H is mainly responsible for the retention capacity of cementitious materials specially towards U, Pu, Co, Cl although its sorption power is limited concerning
Synthesis of MoS_2/g-C_3N_4 nanosheets as 2D heterojunction photocatalysts with enhanced visible light activity

International Nuclear Information System (INIS)

Li, Juan; Liu, Enzhou; Ma, Yongning; Hu, Xiaoyun; Wan, Jun; Sun, Lin; Fan, Jun

2016-01-01

Graphical abstract: TEM image and schematic diagram of photocatalytic mechanism of 2D MoS_2/g-C_3N_4 composites. - Highlights: • g-C_3N_4 nanosheets coupled with MoS_2 nanosheets as 2D heterojunction photocatalysts were synthesized successfully. • The 2D MoS_2/g-C_3N_4 heterojunctions show higher photocatalytic activity than pure g-C_3N_4. • The photocatalytic mechanism of the 2D MoS_2/g-C_3N_4 heterojunction was described. - Abstract: g-C_3N_4 nanosheets coupled with MoS_2 nanosheets as 2D heteroconjuction were prepared via a facile impregnation and calcination method. The structure characterization clearly indicated that MoS_2 nanosheets were successfully horizontal loaded on g-C_3N_4 nanosheets. The investigation indicated that the formation of 2D heterojunction between the g-C_3N_4 nanosheets and MoS_2 nanosheets promoted the charge transfer and enhanced separation efficiency of photoinduced electron–hole pairs. Furthermore, the measurement of photocatalytic activity for the degradation of rhodamine B and methyl orange revealed that the as-prepared 2D MoS_2/g-C_3N_4 heterojunction exhibited the significantly enhanced photocatalytic activity and considerable stability under visible light irradiation. The 2D MoS_2/g-C_3N_4 heterojunction prepared with 3 wt% of MoS_2 exhibited the optimal photodegradable efficiency. The present work shows that the formation of 2D heterojunction should be a good strategy to design efficient photocatalysts.
ON THE MEASUREMENT OF THE 13C(α, n)16O S-FACTOR AT NEGATIVE ENERGIES AND ITS INFLUENCE ON THE s-PROCESS

International Nuclear Information System (INIS)

La Cognata, M.; Spitaleri, C.; Trippella, O.; Kiss, G. G.; Guardo, G. L.; Puglia, S. M. R.; Romano, S.; Spartà, R.; Rogachev, G. V.; Avila, M.; Koshchiy, E.; Kuchera, A.; Santiago, D.; Mukhamedzhanov, A. M.; Lamia, L.

2013-01-01

The 13 C(α, n) 16 O reaction is the neutron source for the main component of the s-process, responsible for the production of most of the nuclei in the mass range 90 ∼ 8 K, corresponding to an energy interval where the 13 C(α, n) 16 O reaction is effective in the range of 140-230 keV. In this regime, the astrophysical S(E)-factor is dominated by the –3 keV sub-threshold resonance due to the 6.356 MeV level in 17 O, giving rise to a steep increase in the S-factor. Its contribution is still controversial as extrapolations, e.g., through the R-matrix and indirect techniques such as the asymptotic normalization coefficient (ANC), yield inconsistent results. The discrepancy amounts to a factor of three or more precisely at astrophysical energies. To provide a more accurate S-factor at these energies, we have applied the Trojan horse method (THM) to the 13 C( 6 Li, n 16 O)d quasi-free reaction. The ANC for the 6.356 MeV level has been deduced through the THM as well as the n-partial width, allowing us to attain unprecedented accuracy for the 13 C(α, n) 16 O astrophysical factor. A larger ANC for the 6.356 MeV level is measured with respect to the ones in the literature, (C-tilde α 13 C 17O(1/2+)2 = 7.7 ± 0.3 stat -1.5 +1. |6 norm fm –1 , yet in agreement with the preliminary result given in our preceding letter, indicating an increase of the 13 C(α, n) 16 O reaction rate below about 8 × 10 7 K if compared with the recommended values. At ∼10 8 K, our reaction rate agrees with most of the results in the literature and the accuracy is greatly enhanced thanks to this innovative approach

Making a S.P.E.C.I.A.L. First Impression

Science.gov (United States)

Dovico, Adam

2016-01-01

Teachers at all levels have reported a stark decline in students' ability to interact with others face-to-face in a technology-driven world. In the world of work, communicative soft skills have surfaced as both a concern and focal point for potential employers. Schools can teach these skills using an approach called S.P.E.C.I.A.L, which focuses on…
Differential determination of 203Hg and 14C or 35S in double labelled biological samples

International Nuclear Information System (INIS)

Bem, E.M.; Bem, H.; Reimschussel, W.

1979-01-01

The differential determination of 203 Hg and 14 C or 35 S in double labelled biological samples is presented. The biological samples were mineralized with 70% HClO 4 and 30% H 2 O 2 in glass vials, MILLI-6. The γ-activity of 203 Hg was measured on a well scintillation counter. The total activity, due to 203 Hg and 14 C or 35 S, was measured by the liquid scintillation technique after addition of Aquasol into the same vials. The method of external standard channel ratio was used for standardization. Very good recoveries were obtained: 100+-0.7% for 203 Hg and 94.6-101.0% for 14 C and 35 S. This method could be used for other β, γ and β-active nuclides with similar β-spectra. (author)
First measurement of time-dependent $C\\!P$ violation in $B^0_s \\to K^+K^-$ decays

CERN Document Server

Aaij, R; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves Jr, A A; Amato, S; Amerio, S; Amhis, Y; Anderlini, L; Anderson, J; Andreassen, R; Andrews, J E; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Baalouch, M; Bachmann, S; Back, J J; Baesso, C; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bauer, Th; Bay, A; Beddow, J; Bedeschi, F; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Bencivenni, G; Benson, S; Benton, J; Berezhnoy, A; Bernet, R; Bettler, M -O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blouw, J; Blusk, S; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bowen, E; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Burducea, I; Bursche, A; Busetto, G; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Campora Perez, D; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carranza-Mejia, H; Carson, L; Carvalho Akiba, K; Casse, G; Castillo Garcia, L; Cattaneo, M; Cauet, Ch; Cenci, R; Charles, M; Charpentier, Ph; Chen, P; Chiapolini, N; Chrzaszcz, M; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Cogneras, E; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Coquereau, S; Corti, G; Couturier, B; Cowan, G A; Cowie, E; Craik, D C; Cunliffe, S; Currie, R; D'Ambrosio, C; David, P; David, P N Y; Davis, A; De Bonis, I; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Silva, W; De Simone, P; Decamp, D; Deckenhoff, M; Del Buono, L; Déléage, N; Derkach, D; Deschamps, O; Dettori, F; Di Canto, A; Dijkstra, H; Dogaru, M; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Durante, P; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisenhardt, S; Eitschberger, U; Ekelhof, R; Eklund, L; El Rifai, I; Elsasser, Ch; Falabella, A; Färber, C; Fardell, G; Farinelli, C; Farry, S; Ferguson, D; Fernandez Albor, V; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fiore, M; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furcas, S; Furfaro, E; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garofoli, J; Garosi, P; Garra Tico, J; Garrido, L; Gaspar, C; Gauld, R; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Giubega, L; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gorbounov, P; Gordon, H; Gotti, C; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Griffith, P; Grünberg, O; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hall, S; Hamilton, B; Hampson, T; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; Hartmann, T; He, J; Head, T; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hess, M; Hicheur, A; Hicks, E; Hill, D; Hoballah, M; Hombach, C; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Hussain, N; Hutchcroft, D; Hynds, D; Iakovenko, V; Idzik, M; Ilten, P; Jacobsson, R; Jaeger, A; Jans, E; Jaton, P; Jawahery, A; Jing, F; John, M; Johnson, D; Jones, C R; Joram, C; Jost, B; Kaballo, M; Kandybei, S; Kanso, W; Karacson, M; Karbach, T M; Kenyon, I R; Ketel, T; Keune, A; Khanji, B; Kochebina, O; Komarov, I; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kucharczyk, M; Kudryavtsev, V; Kurek, K; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J -P; Lefèvre, R; Leflat, A; Lefrançois, J; Leo, S; Leroy, O; Lesiak, T; Leverington, B; Li, Y; Li Gioi, L; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; Lohn, S; Longstaff, I; Lopes, J H; Lopez-March, N; Lu, H; Lucchesi, D; Luisier, J; Luo, H; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Malde, S; Manca, G; Mancinelli, G; Maratas, J; Marconi, U; Marino, P; Märki, R; Marks, J; Martellotti, G; Martens, A; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Martins Tostes, D; Martynov, A; Massafferri, A; Matev, R; Mathe, Z; Matteuzzi, C; Maurice, E; Mazurov, A; McCarthy, J; McNab, A; McNulty, R; McSkelly, B; Meadows, B; Meier, F; Meissner, M; Merk, M; Milanes, D A; Minard, M -N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mordà, A; Morello, M J; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neubert, S; Neufeld, N; Nguyen, A D; Nguyen, T D; Nguyen-Mau, C; Nicol, M; Niess, V; Niet, R; Nikitin, N; Nikodem, T; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Oyanguren, A; Pal, B K; Palano, A; Palczewski, T; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pescatore, L; Pesen, E; Petridis, K; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pietrzyk, B; Pilař, T; Pinci, D; Playfer, S; Plo Casasus, M; Polci, F; Polok, G; Poluektov, A; Polycarpo, E; Popov, A; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pritchard, A; Prouve, C; Pugatch, V; Puig Navarro, A; Punzi, G; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Rauschmayr, N; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, A; Rinnert, K; Rives Molina, V; Roa Romero, D A; Robbe, P; Roberts, D A; Rodrigues, E; Rodriguez Perez, P; Roiser, S; Romanovsky, V; Romero Vidal, A; Rouvinet, J; Ruf, T; Ruffini, F; Ruiz, H; Ruiz Valls, P; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salustino Guimaraes, V; Sanmartin Sedes, B; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schindler, H; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M -H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Sirendi, M; Skidmore, N; Skwarnicki, T; Smith, N A; Smith, E; Smith, J; Smith, M; Sokoloff, M D; Soler, F J P; Soomro, F; Souza, D; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stevenson, S; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Sun, L; Swientek, S; Syropoulos, V; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teklishyn, M; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Tonelli, D; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tresch, M; Tsaregorodtsev, A; Tsopelas, P; Tuning, N; Ubeda Garcia, M; Ukleja, A; Urner, D; Ustyuzhanin, A; Uwer, U; Vagnoni, V; Valenti, G; Vallier, A; Van Dijk, M; Vazquez Gomez, R; Vazquez Regueiro, P; Vázquez Sierra, C; Vecchi, S; Velthuis, J J; Veltri, M; Veneziano, G; Vesterinen, M; Viaud, B; Vieira, D; Vilasis-Cardona, X; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voß, C; Voss, H; Waldi, R; Wallace, C; Wallace, R; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wicht, J; Wiechczynski, J; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wimberley, J; Wishahi, J; Wislicki, W; Witek, M; Wotton, S A; Wright, S; Wu, S; Wyllie, K; Xie, Y; Xing, Z; Yang, Z; Young, R; Yuan, X; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhokhov, A; Zhong, L; Zvyagin, A

2013-01-01

Direct and mixing-induced $C\\!P$-violating asymmetries in $B^0_s \\to K^+K^-$ decays are measured for the first time using a data sample of $pp$ collisions, corresponding to an integrated luminosity of $1.0~\\mathrm{fb}^{-1}$, collected with the LHCb detector at a centre-of-mass energy of $7~\\mathrm{TeV}$. The results are $C_{KK} = 0.14 \\pm 0.11 \\pm 0.03$ and $S_{KK} = 0.30 \\pm 0.12 \\pm 0.04$, where the first uncertainties are statistical and the second systematic. The corresponding quantities are also determined for $B^0 \\to \\pi^+\\pi^-$ decays to be $C_{\\pi\\pi} = -0.38 \\pm 0.15 \\pm 0.02$ and $S_{\\pi\\pi} = -0.71 \\pm 0.13 \\pm 0.02$, in good agreement with existing measurements.
s-Processing from MHD-induced mixing and isotopic abundances in presolar SiC grains

Science.gov (United States)

Palmerini, S.; Trippella, O.; Busso, M.; Vescovi, D.; Petrelli, M.; Zucchini, A.; Frondini, F.

2018-01-01

In the past years the observational evidence that s-process elements from Sr to Pb are produced by stars ascending the so-called Asymptotic Giant Branch (or "AGB") could not be explained by self-consistent models, forcing researchers to extensive parameterizations. The crucial point is to understand how protons can be injected from the envelope into the He-rich layers, yielding the formation of 13C and then the activation of the 13C (α,n)16O reaction. Only recently, attempts to solve this problem started to consider quantitatively physically-based mixing mechanisms. Among them, MHD processes in the plasma were suggested to yield mass transport through magnetic buoyancy. In this framework, we compare results of nucleosynthesis models for Low Mass AGB Stars (M≲ 3M⊙), developed from the MHD scenario, with the record of isotopic abundance ratios of s-elements in presolar SiC grains, which were shown to offer precise constraints on the 13C reservoir. We find that n-captures driven by magnetically-induced mixing can indeed account for the SiC data quite well and that this is due to the fact that our 13C distribution fulfils the above constraints rather accurately. We suggest that similar tests should be now performed using different physical models for mixing. Such comparisons would indeed improve decisively our understanding of the formation of the neutron source.
Prevalence of H63D, S65C and C282Y hereditary hemochromatosis gene mutations in Slovenian population by an improved high-throughput genotyping assay

Directory of Open Access Journals (Sweden)

Rupreht Ruth

2007-11-01

Full Text Available Abstract Background Hereditary hemochromatosis (HH is a common genetic disease characterized by excessive iron overload that leads to multi-organ failure. Although the most prevalent genotype in HH is homozygosity for C282Y mutation of the HFE gene, two additional mutations, H63D and S65C, appear to be associated with a milder form of HH. The aim of this study was to develop a high-throughput assay for HFE mutations screening based on TaqMan technology and to determine the frequencies of HFE mutations in the Slovenian population. Methods Altogether, 1282 randomly selected blood donors from different Slovenian regions and 21 HH patients were analyzed for the presence of HFE mutations by an in-house developed real-time PCR assay based on TaqMan technology using shorter non-interfering fluorescent single nucleotide polymorphism (SNP-specific MGB probes. The assay was validated by RFLP analysis and DNA sequencing. Results The genotyping assay of the H63D, S65C and C282Y mutations in the HFE gene, based on TaqMan technology proved to be fast, reliable, with a high-throughput capability and 100% concordant with genotypes obtained by RFLP and DNA sequencing. The observed frequency of C282Y homozygotes in the group of HH patients was only 48%, others were of the heterogeneous HFE genotype. Among 1282 blood donors tested, the observed H63D, S65C and C282Y allele frequency were 12.8% (95% confidence interval (CI 11.5 – 14.2%, 1.8% (95% CI 1.4 – 2.5% and 3.6% (95% CI 3.0 – 4.5%, respectively. Approximately 33% of the tested subjects had at least one of the three HH mutations, and 1% of them were C282Y homozygotes or compound heterozygotes C282Y/H63D or C282Y/S65C, presenting an increased risk for iron overload disease. A significant variation in H63D allele frequency was observed for one of the Slovenian regions. Conclusion The improved real-time PCR assay for H63D, S65C and C282Y mutations detection is accurate, fast, cost-efficient and ready for
Fabrication of a 3D Hierarchical Sandwich Co9 S8 /α-MnS@N-C@MoS2 Nanowire Architectures as Advanced Electrode Material for High Performance Hybrid Supercapacitors.

Science.gov (United States)

Kandula, Syam; Shrestha, Khem Raj; Kim, Nam Hoon; Lee, Joong Hee

2018-05-10

Supercapacitors suffer from lack of energy density and impulse the energy density limit, so a new class of hybrid electrode materials with promising architectures is strongly desirable. Here, the rational design of a 3D hierarchical sandwich Co 9 S 8 /α-MnS@N-C@MoS 2 nanowire architecture is achieved during the hydrothermal sulphurization reaction by the conversion of binary mesoporous metal oxide core to corresponding individual metal sulphides core along with the formation of outer metal sulphide shell at the same time. Benefiting from the 3D hierarchical sandwich architecture, Co 9 S 8 /α-MnS@N-C@MoS 2 electrode exhibits enhanced electrochemical performance with high specific capacity/capacitance of 306 mA h g -1 /1938 F g -1 at 1 A g -1 , and excellent cycling stability with a specific capacity retention of 86.9% after 10 000 cycles at 10 A g -1 . Moreover, the fabricated asymmetric supercapacitor device using Co 9 S 8 /α-MnS@N-C@MoS 2 as the positive electrode and nitrogen doped graphene as the negative electrode demonstrates high energy density of 64.2 Wh kg -1 at 729.2 W kg -1 , and a promising energy density of 23.5 Wh kg -1 is still attained at a high power density of 11 300 W kg -1 . The hybrid electrode with 3D hierarchical sandwich architecture promotes enhanced energy density with excellent cyclic stability for energy storage. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Detecte el cÃ¡ncer mÃ¡s temprano (Catch Cancer Early)

Centers for Disease Control (CDC) Podcasts

2012-01-26

Los cÃ¡nceres de mama, de cuello uterino y colorrectal causan mÃ¡s de 100,000 muertes cada aÃ±o. Este podcast aborda la importancia de las pruebas de detecciÃ³n del cÃ¡ncer. Created: 1/26/2012 by MMWR. Date Released: 2/16/2012.
NMR of proteins (4Fe-4S): structural properties and intramolecular electron transfer; RMN de proteines (4Fe-4S): proprietes structurales et transfert electronique intramoleculaire

Energy Technology Data Exchange (ETDEWEB)

Huber, J G

1996-10-17

NMR started to be applied to Fe-S proteins in the seventies. Its use has recently been enlarged as the problems arising from the paramagnetic polymetallic clusters ware overcome. Applications to [4Fe-4S] are presented herein. The information derived thereof deepens the understanding of the redox properties of these proteins which play a central role in the metabolism of bacterial cells. The secondary structure elements and the overall folding of Chromatium vinosum ferredoxin (Cv Fd) in solution have been established by NMR. The unique features of this sequence have been shown to fold as an {alpha} helix at the C-terminus and as a loop between two cysteines ligand of one cluster: these two parts localize in close proximity from one another. The interaction between nuclear and electronic spins is a source of additional structural information for (4Fe-AS] proteins. The conformation of the cysteine-ligands, as revealed by the Fe-(S{sub {gamma}}-C{sub {beta}}-H{sub {beta}})Cys dihedral angles, is related to the chemical shifts of the signals associated with the protons of these residues. The longitudinal relaxation times of the protons depend on their distance to the cluster. A quantitative relationship has been established and used to show that the solution structure of the high-potential ferredoxin from Cv differs significantly from the crystal structure around Phe-48. Both parameters (chemical shifts and longitudinal relaxation times) give also insight into the electronic and magnetic properties of the [4Fe-4S] clusters. The rate of intramolecular electron transfer between the two [4FE-4S] clusters of ferredoxins has been measured by NMR. It is far slower in the case of Cv Fd than for shorter ferredoxins. The difference may be associated with changes in the magnetic and/or electronic properties of one cluster. The strong paramagnetism of the [4Fe-4S] clusters, which originally limited the applicability of NMR to proteins containing these cofactors, has been proven
First-principles analysis of MoS2/Ti2C and MoS2/Ti2CY2 (Y=F and OH) all-2D semiconductor/metal contacts

KAUST Repository

Gan, Liyong

2013-06-13

First-principles calculations are used to explore the geometry, bonding, and electronic properties of MoS2/Ti2C and MoS2/Ti2CY2 (Y = F and OH) semiconductor/metal contacts. The structure of the interfaces is determined. Strong chemical bonds formed at the MoS2/Ti2C interface result in additional states next to the Fermi level, which extend over the three atomic layers of MoS2 and induce a metallic character. The interaction in MoS2/Ti2CY2, on the other hand, is weak and not sensitive to the specific geometry, and the semiconducting nature thus is preserved. The energy level alignment implies weak and strong n-type doping of MoS2 in MoS2/Ti2CF2 and MoS2/Ti2C(OH)2, respectively. The corresponding n-type Schottky barrier heights are 0.85 and 0.26 eV. We show that the MoS2/Ti2CF2 interface is close to the Schottky limit. At the MoS2/Ti2C(OH)2 interface, we find that a strong dipole due to charge rearrangement induces the Schottky barrier. The present interfaces are well suited for application in all-two-dimensional devices.
First-principles analysis of MoS2/Ti2C and MoS2/Ti2CY2 (Y=F and OH) all-2D semiconductor/metal contacts

KAUST Repository

Gan, Liyong; Huang, Dan; Schwingenschlö gl, Udo; Zhao, Yu-Jun

2013-01-01

First-principles calculations are used to explore the geometry, bonding, and electronic properties of MoS2/Ti2C and MoS2/Ti2CY2 (Y = F and OH) semiconductor/metal contacts. The structure of the interfaces is determined. Strong chemical bonds formed at the MoS2/Ti2C interface result in additional states next to the Fermi level, which extend over the three atomic layers of MoS2 and induce a metallic character. The interaction in MoS2/Ti2CY2, on the other hand, is weak and not sensitive to the specific geometry, and the semiconducting nature thus is preserved. The energy level alignment implies weak and strong n-type doping of MoS2 in MoS2/Ti2CF2 and MoS2/Ti2C(OH)2, respectively. The corresponding n-type Schottky barrier heights are 0.85 and 0.26 eV. We show that the MoS2/Ti2CF2 interface is close to the Schottky limit. At the MoS2/Ti2C(OH)2 interface, we find that a strong dipole due to charge rearrangement induces the Schottky barrier. The present interfaces are well suited for application in all-two-dimensional devices.
DMA Controller for LEON3 SoC:s Using AMBA

OpenAIRE

Nilsson, Emelie

2013-01-01

A DMA Controller can offload a processor tremendously. A memory copy operation can be initiated by the processor and while the processor executes others tasks the memory copy can be fulfilled by the DMA Controller. An implementation of a DMA Controller for use in LEON3 SoC:s has been made during this master thesis. Problems that occurred while designing a controller of this type concerned AMBA buses, data transfers, alignment and interrupt handling. The DMA Controller supports AMBA and is att...
Measurement of $C\\!P$ asymmetries in two-body $B_{(s)}^{0}$-meson decays to charged pions and kaons arXiv

CERN Document Server

Aaij, Roel; Adinolfi, Marco; Ajaltouni, Ziad; Akar, Simon; Albicocco, Pietro; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Alfonso Albero, Alejandro; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Andreassi, Guido; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Archilli, Flavio; d'Argent, Philippe; Arnau Romeu, Joan; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Atzeni, Michele; Auriemma, Giulio; Bachmann, Sebastian; Back, John; Baker, Sophie; Balagura, Vladislav; Baldini, Wander; Baranov, Alexander; Barlow, Roger; Barsuk, Sergey; Barter, William; Baryshnikov, Fedor; Batozskaya, Varvara; Battista, Vincenzo; Bay, Aurelio; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Beiter, Andrew; Bel, Lennaert; Beliy, Nikita; Bellee, Violaine; Belloli, Nicoletta; Belous, Konstantin; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Beranek, Sarah; Berezhnoy, Alexander; Bernet, Roland; Berninghoff, Daniel; Bertholet, Emilie; Bertolin, Alessandro; Betancourt, Christopher; Betti, Federico; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bezshyiko, Iaroslava; Bifani, Simone; Billoir, Pierre; Birnkraut, Alex; Bizzeti, Andrea; Bjørn, Mikkel; Blake, Thomas; Blanc, Frederic; Blusk, Steven; Bocci, Valerio; Boente Garcia, Oscar; Boettcher, Thomas; Bondar, Alexander; Bondar, Nikolay; Borghi, Silvia; Borisyak, Maxim; Borsato, Martino; Bossu, Francesco; Boubdir, Meriem; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Braun, Svende; Brodski, Michael; Brodzicka, Jolanta; Brundu, Davide; Buchanan, Emma; Burr, Christopher; Bursche, Albert; Buytaert, Jan; Byczynski, Wiktor; Cadeddu, Sandro; Cai, Hao; Calabrese, Roberto; Calladine, Ryan; Calvi, Marta; Calvo Gomez, Miriam; Camboni, Alessandro; Campana, Pierluigi; Campora Perez, Daniel Hugo; Capriotti, Lorenzo; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carniti, Paolo; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casse, Gianluigi; Cassina, Lorenzo; Cattaneo, Marco; Cavallero, Giovanni; Cenci, Riccardo; Chamont, David; Chapman, Matthew George; Charles, Matthew; Charpentier, Philippe; Chatzikonstantinidis, Georgios; Chefdeville, Maximilien; Chen, Shanzhen; Chitic, Stefan-Gabriel; Chobanova, Veronika; Chrzaszcz, Marcin; Chubykin, Alexsei; Ciambrone, Paolo; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cogoni, Violetta; Cojocariu, Lucian; Collins, Paula; Colombo, Tommaso; Comerma-Montells, Albert; Contu, Andrea; Coombs, George; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Costa Sobral, Cayo Mar; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Crocombe, Andrew; Cruz Torres, Melissa Maria; Currie, Robert; D'Ambrosio, Carmelo; Da Cunha Marinho, Franciole; Da Silva, Cesar Luiz; Dall'Occo, Elena; Dalseno, Jeremy; Danilina, Anna; Davis, Adam; De Aguiar Francisco, Oscar; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Serio, Marilisa; De Simone, Patrizia; Dean, Cameron Thomas; Decamp, Daniel; Del Buono, Luigi; Delaney, Blaise; Dembinski, Hans Peter; Demmer, Moritz; Dendek, Adam; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Dey, Biplab; Di Canto, Angelo; Di Nezza, Pasquale; Didenko, Sergey; Dijkstra, Hans; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Douglas, Lauren; Dovbnya, Anatoliy; Dreimanis, Karlis; Dufour, Laurent; Dujany, Giulio; Durante, Paolo; Durham, John Matthew; Dutta, Deepanwita; Dzhelyadin, Rustem; Dziewiecki, Michal; Dziurda, Agnieszka; Dzyuba, Alexey; Easo, Sajan; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; Ely, Scott; Ene, Alexandru; Escher, Stephan; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Farley, Nathanael; Farry, Stephen; Fazzini, Davide; Federici, Luca; Fernandez, Gerard; Fernandez Declara, Placido; Fernandez Prieto, Antonio; Ferrari, Fabio; Ferreira Lopes, Lino; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fini, Rosa Anna; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fleuret, Frederic; Fontana, Marianna; Fontanelli, Flavio; Forty, Roger; Franco Lima, Vinicius; Frank, Markus; Frei, Christoph; Fu, Jinlin; Funk, Wolfgang; Färber, Christian; Gabriel, Emmy; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; Garcia Martin, Luis Miguel; Garcia Plana, Beatriz; García Pardiñas, Julián; Garra Tico, Jordi; Garrido, Lluis; Gascon, David; Gaspar, Clara; Gavardi, Laura; Gazzoni, Giulio; Gerick, David; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianì, Sebastiana; Gibson, Valerie; Girard, Olivier Göran; Giubega, Lavinia-Helena; Gizdov, Konstantin; Gligorov, Vladimir; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gorelov, Igor Vladimirovich; Gotti, Claudio; Govorkova, Ekaterina; Grabowski, Jascha Peter; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graverini, Elena; Graziani, Giacomo; Grecu, Alexandru; Greim, Roman; Griffith, Peter; Grillo, Lucia; Gruber, Lukas; Gruberg Cazon, Barak Raimond; Grünberg, Oliver; Gushchin, Evgeny; Guz, Yury; Gys, Thierry; Göbel, Carla; Hadavizadeh, Thomas; Hadjivasiliou, Christos; Haefeli, Guido; Haen, Christophe; Haines, Susan; Hamilton, Brian; Han, Xiaoxue; Hancock, Thomas Henry; Hansmann-Menzemer, Stephanie; Harnew, Neville; Harnew, Samuel; Hasse, Christoph; Hatch, Mark; He, Jibo; Hecker, Malte; Heinicke, Kevin; Heister, Arno; Hennessy, Karol; Henry, Louis; van Herwijnen, Eric; Heß, Miriam; Hicheur, Adlène; Hill, Donal; Hopchev, Plamen Hristov; Hu, Wenhua; Huang, Wenqian; Huard, Zachary; Hulsbergen, Wouter; Humair, Thibaud; Hushchyn, Mikhail; Hutchcroft, David; Ibis, Philipp; Idzik, Marek; Ilten, Philip; Ivshin, Kuzma; Jacobsson, Richard; Jalocha, Pawel; Jans, Eddy; Jawahery, Abolhassan; Jiang, Feng; John, Malcolm; Johnson, Daniel; Jones, Christopher; Joram, Christian; Jost, Beat; Jurik, Nathan; Kandybei, Sergii; Karacson, Matthias; Kariuki, James Mwangi; Karodia, Sarah; Kazeev, Nikita; Kecke, Matthieu; Keizer, Floris; Kelsey, Matthew; Kenzie, Matthew; Ketel, Tjeerd; Khairullin, Egor; Khanji, Basem; Khurewathanakul, Chitsanu; Kim, Kyung Eun; Kirn, Thomas; Klaver, Suzanne; Klimaszewski, Konrad; Klimkovich, Tatsiana; Koliiev, Serhii; Kolpin, Michael; Kopecna, Renata; Koppenburg, Patrick; Kotriakhova, Sofia; Kozeiha, Mohamad; Kravchuk, Leonid; Kreps, Michal; Kress, Felix Johannes; Krokovny, Pavel; Krupa, Wojciech; Krzemien, Wojciech; Kucewicz, Wojciech; Kucharczyk, Marcin; Kudryavtsev, Vasily; Kuonen, Axel Kevin; Kvaratskheliya, Tengiz; Lacarrere, Daniel; Lafferty, George; Lai, Adriano; Lanfranchi, Gaia; Langenbruch, Christoph; Latham, Thomas; Lazzeroni, Cristina; Le Gac, Renaud; Leflat, Alexander; Lefrançois, Jacques; Lefèvre, Regis; Lemaitre, Florian; Leroy, Olivier; Lesiak, Tadeusz; Leverington, Blake; Li, Pei-Rong; Li, Tenglin; Li, Zhuoming; Liang, Xixin; Likhomanenko, Tatiana; Lindner, Rolf; Lionetto, Federica; Lisovskyi, Vitalii; Liu, Xuesong; Loh, David; Loi, Angelo; Longstaff, Iain; Lopes, Jose; Lucchesi, Donatella; Lucio Martinez, Miriam; Lupato, Anna; Luppi, Eleonora; Lupton, Oliver; Lusiani, Alberto; Lyu, Xiao-Rui; Machefert, Frederic; Maciuc, Florin; Macko, Vladimir; Mackowiak, Patrick; Maddrell-Mander, Samuel; Maev, Oleg; Maguire, Kevin; Maisuzenko, Dmitrii; Majewski, Maciej Witold; Malde, Sneha; Malecki, Bartosz; Malinin, Alexander; Maltsev, Timofei; Manca, Giulia; Mancinelli, Giampiero; Marangotto, Daniele; Maratas, Jan; Marchand, Jean François; Marconi, Umberto; Marin Benito, Carla; Marinangeli, Matthieu; Marino, Pietro; Marks, Jörg; Martellotti, Giuseppe; Martin, Morgan; Martinelli, Maurizio; Martinez Santos, Diego; Martinez Vidal, Fernando; Massafferri, André; Matev, Rosen; Mathad, Abhijit; Mathe, Zoltan; Matteuzzi, Clara; Mauri, Andrea; Maurice, Emilie; Maurin, Brice; Mazurov, Alexander; McCann, Michael; McNab, Andrew; McNulty, Ronan; Mead, James Vincent; Meadows, Brian; Meaux, Cedric; Meier, Frank; Meinert, Nis; Melnychuk, Dmytro; Merk, Marcel; Merli, Andrea; Michielin, Emanuele; Milanes, Diego Alejandro; Millard, Edward James; Minard, Marie-Noelle; Minzoni, Luca; Mitzel, Dominik Stefan; Mogini, Andrea; Molina Rodriguez, Josue; Mombächer, Titus; Monroy, Igancio Alberto; Monteil, Stephane; Morandin, Mauro; Morello, Gianfranco; Morello, Michael Joseph; Morgunova, Olga; Moron, Jakub; Morris, Adam Benjamin; Mountain, Raymond; Muheim, Franz; Mulder, Mick; Müller, Dominik; Müller, Janine; Müller, Katharina; Müller, Vanessa; Naik, Paras; Nakada, Tatsuya; Nandakumar, Raja; Nandi, Anita; Nasteva, Irina; Needham, Matthew; Neri, Nicola; Neubert, Sebastian; Neufeld, Niko; Neuner, Max; Nguyen, Thi Dung; Nguyen-Mau, Chung; Nieswand, Simon; Niet, Ramon; Nikitin, Nikolay; Nogay, Alla; O'Hanlon, Daniel Patrick; Oblakowska-Mucha, Agnieszka; Obraztsov, Vladimir; Ogilvy, Stephen; Oldeman, Rudolf; Onderwater, Gerco; Ossowska, Anna; Otalora Goicochea, Juan Martin; Owen, Patrick; Oyanguren, Maria Aranzazu; Pais, Preema Rennee; Palano, Antimo; Palutan, Matteo; Panshin, Gennady; Papanestis, Antonios; Pappagallo, Marco; Pappalardo, Luciano; Parker, William; Parkes, Christopher; Passaleva, Giovanni; Pastore, Alessandra; Patel, Mitesh; Patrignani, Claudia; Pearce, Alex; Pellegrino, Antonio; Penso, Gianni; Pepe Altarelli, Monica; Perazzini, Stefano; Pereima, Dmitrii; Perret, Pascal; Pescatore, Luca; Petridis, Konstantinos; Petrolini, Alessandro; Petrov, Aleksandr; Petruzzo, Marco; Pietrzyk, Boleslaw; Pietrzyk, Guillaume; Pikies, Malgorzata; Pinci, Davide; Pisani, Flavio; Pistone, Alessandro; Piucci, Alessio; Placinta, Vlad-Mihai; Playfer, Stephen; Plo Casasus, Maximo; Polci, Francesco; Poli Lener, Marco; Poluektov, Anton; Polukhina, Natalia; Polyakov, Ivan; Polycarpo, Erica; Pomery, Gabriela Johanna; Ponce, Sebastien; Popov, Alexander; Popov, Dmitry; Poslavskii, Stanislav; Potterat, Cédric; Price, Eugenia; Prisciandaro, Jessica; Prouve, Claire; Pugatch, Valery; Puig Navarro, Albert; Pullen, Hannah Louise; Punzi, Giovanni; Qian, Wenbin; Qin, Jia-Jia; Quagliani, Renato; Quintana, Boris; Rachwal, Bartlomiej; Rademacker, Jonas; Rama, Matteo; Ramos Pernas, Miguel; Rangel, Murilo; Ratnikov, Fedor; Raven, Gerhard; Ravonel Salzgeber, Melody; Reboud, Meril; Redi, Federico; Reichert, Stefanie; dos Reis, Alberto; Remon Alepuz, Clara; Renaudin, Victor; Ricciardi, Stefania; Richards, Sophie; Rinnert, Kurt; Robbe, Patrick; Robert, Arnaud; Rodrigues, Ana Barbara; Rodrigues, Eduardo; Rodriguez Lopez, Jairo Alexis; Rogozhnikov, Alexey; Roiser, Stefan; Rollings, Alexandra Paige; Romanovskiy, Vladimir; Romero Vidal, Antonio; Rotondo, Marcello; Rudolph, Matthew Scott; Ruf, Thomas; Ruiz Vidal, Joan; Saborido Silva, Juan Jose; Sagidova, Naylya; Saitta, Biagio; Salustino Guimaraes, Valdir; Sanchez Mayordomo, Carlos; Sanmartin Sedes, Brais; Santacesaria, Roberta; Santamarina Rios, Cibran; Santimaria, Marco; Santovetti, Emanuele; Sarpis, Gediminas; Sarti, Alessio; Satriano, Celestina; Satta, Alessia; Savrina, Darya; Schael, Stefan; Schellenberg, Margarete; Schiller, Manuel; Schindler, Heinrich; Schmelling, Michael; Schmelzer, Timon; Schmidt, Burkhard; Schneider, Olivier; Schopper, Andreas; Schreiner, HF; Schubiger, Maxime; Schune, Marie Helene; Schwemmer, Rainer; Sciascia, Barbara; Sciubba, Adalberto; Semennikov, Alexander; Sepulveda, Eduardo Enrique; Sergi, Antonino; Serra, Nicola; Serrano, Justine; Sestini, Lorenzo; Seyfert, Paul; Shapkin, Mikhail; Shcheglov, Yury; Shears, Tara; Shekhtman, Lev; Shevchenko, Vladimir; Siddi, Benedetto Gianluca; Silva Coutinho, Rafael; Silva de Oliveira, Luiz Gustavo; Simi, Gabriele; Simone, Saverio; Skidmore, Nicola; Skwarnicki, Tomasz; Smith, Iwan Thomas; Smith, Mark; Soares Lavra, Lais; Sokoloff, Michael; Soler, Paul; Souza De Paula, Bruno; Spaan, Bernhard; Spradlin, Patrick; Stagni, Federico; Stahl, Marian; Stahl, Sascha; Stefko, Pavol; Stefkova, Slavomira; Steinkamp, Olaf; Stemmle, Simon; Stenyakin, Oleg; Stepanova, Margarita; Stevens, Holger; Stone, Sheldon; Storaci, Barbara; Stracka, Simone; Stramaglia, Maria Elena; Straticiuc, Mihai; Straumann, Ulrich; Strokov, Sergey; Sun, Jiayin; Sun, Liang; Swientek, Krzysztof; Syropoulos, Vasileios; Szumlak, Tomasz; Szymanski, Maciej Pawel; T'Jampens, Stephane; Tang, Zhipeng; Tayduganov, Andrey; Tekampe, Tobias; Tellarini, Giulia; Teubert, Frederic; Thomas, Eric; van Tilburg, Jeroen; Tilley, Matthew James; Tisserand, Vincent; Tobin, Mark; Tolk, Siim; Tomassetti, Luca; Tonelli, Diego; Tourinho Jadallah Aoude, Rafael; Tournefier, Edwige; Traill, Murdo; Tran, Minh Tâm; Tresch, Marco; Trisovic, Ana; Tsaregorodtsev, Andrei; Tully, Alison; Tuning, Niels; Ukleja, Artur; Usachov, Andrii; Ustyuzhanin, Andrey; Uwer, Ulrich; Vacca, Claudia; Vagner, Alexander; Vagnoni, Vincenzo; Valassi, Andrea; Valat, Sebastien; Valenti, Giovanni; Vazquez Gomez, Ricardo; Vazquez Regueiro, Pablo; Vecchi, Stefania; van Veghel, Maarten; Velthuis, Jaap; Veltri, Michele; Veneziano, Giovanni; Venkateswaran, Aravindhan; Verlage, Tobias Anton; Vernet, Maxime; Vesterinen, Mika; Viana Barbosa, Joao Vitor; Vieira, Daniel; Vieites Diaz, Maria; Viemann, Harald; Vilasis-Cardona, Xavier; Vitkovskiy, Arseniy; Vitti, Marcela; Volkov, Vladimir; Vollhardt, Achim; Voneki, Balazs; Vorobyev, Alexey; Vorobyev, Vitaly; Voß, Christian; de Vries, Jacco; Vázquez Sierra, Carlos; Waldi, Roland; Walsh, John; Wang, Jianchun; Wang, Mengzhen; Wang, Yilong; Wang, Zhenzi; Ward, David; Wark, Heather Mckenzie; Watson, Nigel; Websdale, David; Weiden, Andreas; Weisser, Constantin; Whitehead, Mark; Wicht, Jean; Wilkinson, Guy; Wilkinson, Michael; Williams, Mark Richard James; Williams, Mike; Williams, Timothy; Wilson, Fergus; Wimberley, Jack; Winn, Michael Andreas; Wishahi, Julian; Wislicki, Wojciech; Witek, Mariusz; Wormser, Guy; Wotton, Stephen; Wyllie, Kenneth; Xiao, Dong; Xie, Yuehong; Xu, Ao; Xu, Menglin; Xu, Qingnian; Xu, Zehua; Xu, Zhirui; Yang, Zhenwei; Yang, Zishuo; Yao, Yuezhe; Yin, Hang; Yu, Jiesheng; Yuan, Xuhao; Yushchenko, Oleg; Zarebski, Kristian Alexander; Zavertyaev, Mikhail; Zhang, Liming; Zhang, Yanxi; Zhelezov, Alexey; Zheng, Yangheng; Zhu, Xianglei; Zhukov, Valery; Zonneveld, Jennifer Brigitta; Zucchelli, Stefano

The time-dependent $C\\!P$ asymmetries in $B^0\\to\\pi^+\\pi^-$ and $B_s^0\\to K^+\\!K^-$ decays are measured using a data sample of $pp$ collisions corresponding to an integrated luminosity of 3.0 fb$^{-1}$, collected with the LHCb detector at centre-of-mass energies of 7 and 8 TeV. The same data sample is used to measure the time-integrated $C\\!P$ asymmetries in $B^0\\to K^+\\pi^-$ and $B_s^0\\to\\pi^+ K^-$ decays. The results are $C_{\\pi^+\\pi^-} = -0.34 \\pm 0.06 \\pm 0.01$, $S_{\\pi^+\\pi^-} = -0.63 \\pm 0.05 \\pm 0.01$, $C_{K^+\\!K^-} = 0.20 \\pm 0.06 \\pm 0.02$, $S_{K^+\\!K^-} = 0.18 \\pm 0.06 \\pm 0.02$, $C_{K^+\\!K^-}^{\\Delta\\Gamma} = -0.79 \\pm 0.07 \\pm 0.10$, $A_{C\\!P}^{B^0} = -0.084 \\pm 0.004 \\pm 0.003$, and $A_{C\\!P}^{B_s^0} = 0.213 \\pm 0.015 \\pm 0.007$, where the first uncertainties are statistical and the second systematic. Evidence for $C\\!P$ violation is found in the $B_s^0\\to K^+\\!K^-$ decay for the first time.
CPM Signals for Satellite Navigation in the S and C Bands.

Science.gov (United States)

Xue, Rui; Sun, Yanbo; Zhao, Danfeng

2015-06-05

Frequency allocations in the L band suitable for global navigation satellite system (GNSS) services are getting crowded and system providers face an ever tougher job when they try to bring in new signals and services while maintaining radio frequency compatibility. With the successive opening of the S and C bands to GNSS service, the multi-band combined navigation is predicted to become a key technology for future high-precision positioning navigation systems, and a single modulation scheme satisfying the requirements in each band is a promising solution for reducing user terminal complexity. A universal modulation scheme based on the continuous phase modulation (CPM) family suitable for the above bands' demands is proposed. Moreover, this paper has put forward two specific CPM signals for the S and C bands, respectively. Then the proposed modulation schemes, together with existing candidates, are comprehensively evaluated. Simulation results show that the proposed CPM signals can not only satisfy the constraint condition of compatibility in different bands well and reduce user terminal complexity, but also provide superior performance in terms of tracking accuracy, multi-path mitigation and anti-jamming compared to other candidate modulation schemes.
3,5-Bis(4-methoxyphenyl-1-phenyl-4,5-dihydro-1H-pyrazole

Directory of Open Access Journals (Sweden)

Zeliha Baktır

2011-02-01

Full Text Available In the title compound, C23H22N2O2, the central pyrazole ring is nearly planar (r.m.s. deviation = 0.046 Å and it makes a dihedral angle of 18.5 (2° with the phenyl ring. The dihedral angles between the phenyl and the two methoxy-substituted phenyl rings are 26.2 (2 and 80.6 (2°. The crystal structure is stabilized by C—H...π stacking interactions and weak π–π interactions [centriod–centroid distance = 3.891 (2 Å].
3,5-Bis(4-methoxyphenyl)-1-phenyl-4,5-dihydro-1H-pyrazole

Science.gov (United States)

Baktır, Zeliha; Akkurt, Mehmet; Samshuddin, S.; Narayana, B.; Yathirajan, H. S.

2011-01-01

In the title compound, C23H22N2O2, the central pyrazole ring is nearly planar (r.m.s. deviation = 0.046 Å) and it makes a dihedral angle of 18.5 (2)° with the phenyl ring. The dihedral angles between the phenyl and the two methoxy-substituted phenyl rings are 26.2 (2) and 80.6 (2)°. The crystal structure is stabilized by C—H⋯π stacking interactions and weak π–π interactions [centriod–centroid distance = 3.891 (2) Å]. PMID:21523013
2-Methyl-3-(2-methylphenyl-4-oxo-3,4-dihydroquinazolin-8-yl 4-bromobenzene-1-sulfonate

Directory of Open Access Journals (Sweden)

Edward R. T. Tiekink

2012-03-01

Full Text Available The title molecule, C22H17BrN2O4S, has a twisted U shape, the dihedral angle between the quinazolin-4-one and bromobenzene ring systems being 46.25 (8°. In order to avoid steric clashes with adjacent substituents on the quinazolin-4-one ring, the N-bound tolyl group occupies an orthogonal position [dihedral angle = 89.59 (8°]. In the crystal, molecules are connected into a three-dimensional architecture by C—H...O interactions, with the ketone O atom accepting two such bonds and a sulfonate O atom one.
Temporal HbA1c patterns amongst patients with type 2 diabetes referred for specialist care: Data from the S4S-DINGO-Diabetes Informatics Group.

Science.gov (United States)

Lam, Teresa; Hoffman, David M; Cukier, Kimberly; Darnell, David; Greenfield, Jerry R; Harrison, Natalie; Hng, Tien-Ming; Morrow, Anthony F; Cheung, N Wah

2016-06-01

To evaluate the achievement of HbA1c targets in patients with type 2 diabetes mellitus in specialist practice. This audit was undertaken by members of the S4S Diabetes Informatics Group (DINGO), a consortium of Australian endocrinologists in private practice who contribute de-identified data from their electronic medical record, Audit 4 (Software 4 Specialists, S4S, Australia & New Zealand) for audit purposes. Data from patients with type 2 diabetes was extracted. Inclusion criteria were: initial ageHbA1c>7% (53mmol/mol), with at least another HbA1c recorded in the next 2years, and a minimum of 2years follow-up. Data was analysed using a linear mixed effects model. Of the 4796 patients in the dataset with type 2 diabetes mellitus, 1379 patients fulfilled inclusion criteria. The median age at initial consultation was 57 (49-64)years. The median baseline HbA1c was 8.7 (7.8-9.8)% (72mmol/mol). There was a 1.0% reduction in HbA1c to 7.7 (7.1-8.6)% (61mmol/mol) (pHbA1c. Referral of patients with type 2 diabetes to an endocrinologist reduces HbA1c, and the effect is sustained over the medium term; however only a minority of patients reach targets. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Bethe-Salpeter wave functions of ηc(1S, 2S) and ψ(1S, 2S) states: local-potential description of the charmonium system revisited

Science.gov (United States)

Nochi, Kazuki; Kawanai, Taichi; Sasaki, Shoichi

2018-03-01

The quark potential models with an energy-independent central potential have been successful for understanding the conventional charmonium states especially below the open charm threshold. As one might consider, however, the interquark potential is in general energy-dependent, and its tendency gets stronger in higher lying states. Confirmation of whether the interquark potential is energy-independent is also important to verify the validity of the quark potential models. In this talk, we examine the energy dependence of the charmonium potential, which can be determined from the Bethe-Salpeter (BS) amplitudes of cc̅ mesons in lattice QCD.We first calculate the BS amplitudes of radially excited charmonium states, the ηc(2S) and ψ(2S) states, using the variational method and then determine both the quark kinetic mass and the charmonium potential within the HAL QCD method. Through a direct comparison of charmonium potentials determined from both the 1S and 2S states, we confirm that neither the central nor spin-spin potential shows visible energy dependence at least up to 2S state.
Hb Tianshui (HBB: C.119A > G) in Compound Heterozygosity with Hb S (HBB: C.20A > T) from Odisha, India.

Science.gov (United States)

Meher, Satyabrata; Dehury, Snehadhini; Mohanty, Pradeep Kumar; Patel, Siris; Pattanayak, Chinmayee; Bhattacharya, Subhra; Das, Kishalaya; Sarkar, Biswanath

2016-08-01

We describe here a rare β-globin gene variant, Hb Tianshui [β39(C5)Glu→Arg; HBB: c.119A > G], detected during routine screening in Odisha, India. This is the second report of Hb Tianshui and the first to describe the cation exchange high performance liquid chromatography (HPLC) and DNA studies of two cases of this variant. Both cases had coinherited Hb S (HBB: c.20A > T) but none presented with typical symptoms of sickle cell disease. One of the cases was heterozygous for a common α-thalassemia (α-thal) allele (-α(3.7)) (rightward) (NG_000006.1: g.34164_37967del3804) and marginally raised Hb F percentage, while the other Hb S/Hb Tianshui case was completely benign and healthy. An atypical Asian Indian haplotype [+ - + - +] could be assigned to the Hb Tianshui variant. Hb Tianshui seems to mimic a few other Hb variants in cation exchange HPLC. However, we report two specific patterns in the chromatograms that are characteristic to Hb Tianshui. Combining an alkaline electrophoresis result with cation exchange HPLC at screening would be preferred to detect this rare variant, especially in regions with considerable frequency of Hb E [β26(B8)Glu→Lys; HBB: c.79G > A] or Hb S.
Leber's hereditary optic neuropathy is associated with mitochondrial ND6 T14502C mutation

Energy Technology Data Exchange (ETDEWEB)

Zhao, Fuxin [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Guan, Minqiang [Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Zhou, Xiangtian [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Yuan, Meixia; Liang, Ming [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Liu, Qi [Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Liu, Yan; Zhang, Yongmei [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Yang, Li [Division of Human Genetics, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH 45229 (United States); Tong, Yi [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); The First Affiliated Hospital, Fujian Medical University, Fuzhou, Fujian 350005 (China); Wei, Qi-Ping; Sun, Yan-Hong [Department of Ophthalmology, Dongfang Hospital, Beijing University of Chinese Medicine and Pharmacology, Beijing 100078 (China); Qu, Jia, E-mail: jqu@wzmc.net [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); and others

2009-11-20

We report here the clinical, genetic, and molecular characterization of three Chinese families with Leber's hereditary optic neuropathy (LHON). There were variable severity and age of onset in visual impairment among these families. Strikingly, there were extremely low penetrances of visual impairment in these Chinese families. Sequence analysis of complete mitochondrial genomes in these pedigrees showed the homoplasmic T14502C (I58V) mutation, which localized at a highly conserved isoleucine at position 58 of ND6, and distinct sets of mtDNA polymorphisms belonging to haplogroups M10a, F1a1, and H2. The occurrence of T14502C mutation in these several genetically unrelated subjects affected by visual impairment strongly indicates that this mutation is involved in the pathogenesis of visual impairment. Here, mtDNA variants I187T in the ND1, A122V in CO1, S99A in the A6, and V254I in CO3 exhibited an evolutionary conservation, indicating a potential modifying role in the development of visual impairment associated with T14502C mutation in those families. Furthermore, nuclear modifier gene(s) or environmental factor(s) may play a role in the phenotypic manifestation of the LHON-associated T14502C mutation in these Chinese families.

Controllable growth of MoS{sub 2}/C flower-like microspheres with enhanced electrochemical performance for lithium ion batteries

Energy Technology Data Exchange (ETDEWEB)

Xiong, Q.Q., E-mail: zjxqq@hdu.edu.cn; Ji, Z.G.

2016-07-15

Tailored design/fabrication of hierarchical porous advanced electrodes is of great importance for developing high-performance power sources. Herein, we report a facile solvothermal method for fabrication of hierarchical porous MoS{sub 2}/C flower-like microspheres. Interestingly, the obtained MoS{sub 2}/C microspheres are composed of interconnected secondary thin nanoflakes and an amorphous carbon layer. As an anode material for lithium ion batteries, the resultant MoS{sub 2}/C flower-like microspheres electrode delivers a high specific capacity of 1125.9 mAh g{sup −1} and good cycle capability (916.6 mAh g{sup −1} at 200 mA g{sup −1} up to 400 cycles), as well as enhanced rate performance. The excellent electrochemical performance is attributed to the unique porous composite architecture with fast transportation of ion/electron and good strain accommodation during the lithiation/delithiation reaction. Our research may pave the way for construction of other high-performance metal sulfides electrodes for electrochemical energy storage. - Graphical abstract: We report a facile solvothermal method for fabrication of hierarchical porous MoS{sub 2}/C flower-like microspheres composed of interconnected thin nanoflakes and an amorphous carbon layer. As an anode material for LIBs, MoS{sub 2}/C flower-like microspheres electrode delivers enhanced electrochemical performance. - Highlights: • We prepared MoS{sub 2}/C flower-like microspheres via a facile solvothermal method. • The microsphere consists of interconnected nanoflake and an amorphous carbon layer. • The MoS{sub 2}/C microspheres show high capacity and good rate performance.
Interaction of calcium silicate hydrates (C-S-H), the main components of cement, with alkaline chlorides, analogy with clays

International Nuclear Information System (INIS)

Viallis-Terrisse, H.

2000-01-01

This work, belonging to a more general study on the structure and reactivity of cement, deals with the experimental and theoretical analysis of the interaction of alkaline chlorides with calcium silicate hydrates (C-S-H), the main components of cement paste. The interaction of alkaline cations with C-S-H is interfacial, involving both electrostatic and surface complexation mechanisms. The C-S-H surface is constituted of silanol sites, partially dissociated due to the high pH of the interstitial solution. The calcium ions, present in large amounts in the equilibrium solution of C-S-H, constitute potential determining ions for the C-S-H surface. The alkaline ions seem to compete with calcium for the same surface sites. The adsorption isotherms show that caesium presents a better affinity than sodium and lithium for the C-S-H surface. Moreover, solid-state NMR suggests that caesium forms with the surface sites inner-sphere complexes, whereas sodium seems to keep its hydration sphere. These results are in agreement with zeta potential measurements, which let suppose a specific adsorption of caesium ions, and an indifferent behaviour of both other alkaline ions. A model for the C-S-H surface was proposed, from the electric double layer model, and mass action laws expressing the complexation of the different ionic species with the silanol sites. The whole study relies on a structural analogy with smectites, some clays presenting well-known cationic adsorption properties. The structural similarity between both minerals is enhanced by some similarities of reactivity, though significant behaviour differences could also be noted. (author)
DNA methylation regulates expression of VEGF-C, and S-adenosylmethionine is effective for VEGF-C methylation and for inhibiting cancer growth

Energy Technology Data Exchange (ETDEWEB)

Da, M.X. [Department of Surgical Oncology, Gansu Provincial Hospital, Lanzhou (China); Zhang, Y.B. [Department of Surgery, Ningxia Medical University, Yinchuan (China); Yao, J.B. [Department of Surgical Oncology, Gansu Provincial Hospital, Lanzhou (China); Duan, Y.X. [Department of Surgery, Ningxia Medical University, Yinchuan (China)

2014-09-30

DNA hypomethylation may activate oncogene transcription, thus promoting carcinogenesis and tumor development. S-adenosylmethionine (SAM) is a methyl donor in numerous methylation reactions and acts as an inhibitor of intracellular demethylase activity, which results in hypermethylation of DNA. The main objectives of this study were to determine whether DNA hypomethylation correlated with vascular endothelial growth factor-C (VEGF-C) expression, and the effect of SAM on VEGF-C methylation and gastric cancer growth inhibition. VEGF-C expression was assayed by Western blotting and RT-qPCR in gastric cancer cells, and by immunohistochemistry in tumor xenografts. VEGF-C methylation was assayed by bisulfite DNA sequencing. The effect of SAM on cell apoptosis was assayed by flow cytometry analyses and its effect on cancer growth was assessed in nude mice. The VEGF-C promoters of MGC-803, BGC-823, and SGC-7901 gastric cancer cells, which normally express VEGF-C, were nearly unmethylated. After SAM treatment, the VEGF-C promoters in these cells were highly methylated and VEGF-C expression was downregulated. SAM also significantly inhibited tumor growth in vitro and in vivo. DNA methylation regulates expression of VEGF-C. SAM can effectively induce VEGF-C methylation, reduce the expression of VEGF-C, and inhibit tumor growth. SAM has potential as a drug therapy to silence oncogenes and block the progression of gastric cancer.
Low-temperature solid-state preparation of ternary CdS/g-C{sub 3}N{sub 4}/CuS nanocomposites for enhanced visible-light photocatalytic H{sub 2}-production activity

Energy Technology Data Exchange (ETDEWEB)

Cheng, Feiyue; Yin, Hui; Xiang, Quanjun, E-mail: xiangqj@mail.hzau.edu.cn

2017-01-01

Highlights: • CdS/g-C{sub 3}N{sub 4}/CuS composite were synthesized by low-temperature solid-state method. • CdS/g-C{sub 3}N{sub 4}/CuS show enhanced visible-light photocatalytic H{sub 2} evolution activity. • The enhanced photocatalytic H{sub 2} production activity is due to the heterojunction. • Heterojunction between the components promote charge separation/transfer property. - Abstract: Low-temperature solid-state method were gradually demonstrated as a high efficiency, energy saving and environmental protection strategy to fabricate composite semiconductor materials. CdS-based multiple composite photocatalytic materials have attracted increasing concern owning to the heterostructure constituents with tunable band gaps. In this study, the ternary CdS/g-C{sub 3}N{sub 4}/CuS composite photocatalysts were prepared by a facile and novel low-temperature solid-state strategy. The optimal ternary CdS/g-C{sub 3}N{sub 4}/CuS composite exhibits a high visible-light photocatalytic H{sub 2}-production rate of 57.56 μmol h{sup −1} with the corresponding apparent quantum efficiency reaches 16.5% at 420 nm with Na{sub 2}S/Na{sub 2}SO{sub 3} mixed aqueous solution as sacrificial agent. The ternary CdS/g-C{sub 3}N{sub 4}/CuS composites show the enhanced visible-light photocatalytic H{sub 2}-evolution activity comparing with the binary CdS-based composites or simplex CdS. The enhanced photocatalytic activity is ascribed to the heterojunctions and the synergistic effect of CuS and g-C{sub 3}N{sub 4} in promotion of the charge separation and charge mobility. This work shows that the low-temperature solid-state method is efficient and environmentally benign for the preparation of CdS-based multiple composite photocatalytic materials with enhanced visible-light photocatalytic H{sub 2}-production activity.
Leber's hereditary optic neuropathy is associated with mitochondrial ND1 T3394C mutation

Energy Technology Data Exchange (ETDEWEB)

Liang, Min [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Guan, Minqiang [Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Zhao, Fuxing; Zhou, Xiangtian [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Yuan, Meixia [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Tong, Yi [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); The First Affiliated Hospital, Fujian Medical University, Fuzhou, Fujian 350005 (China); Yang, Li [Division of Human Genetics, Cincinnati Children' s Hospital Medical Center, 3333 Burnet Avenue, Cincinnati, OH 45229 (United States); Wei, Qi-Ping; Sun, Yan-Hong [Department of Ophthalmology, Dongfang Hospital, Beijing University of Chinese Medicine and Pharmacology, Beijing 100078 (China); Lu, Fan [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Qu, Jia, E-mail: jqu@wzmc.net [School of Ophthalmology and Optometry, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); Zhejiang Provincial Key Laboratory of Medical Genetics, School of Life Sciences, Wenzhou Medical College, Wenzhou, Zhejiang 325003 (China); and others

2009-06-05

We report here the clinical, genetic and molecular characterization of four Chinese families with Leber's hereditary optic neuropathy (LHON). There were variable severity and age-of-onset in visual impairment among these families. Strikingly, there were extremely low penetrances of visual impairment in these Chinese families. Sequence analysis of complete mitochondrial genomes in these pedigrees showed the homoplasmic T3394C (Y30H) mutation, which localized at a highly conserved tyrosine at position 30 of ND1, and distinct sets of mtDNA polymorphisms belonging to haplogroups D4b and M9a. The occurrence of T3394C mutation in these several genetically unrelated subjects affected by visual impairment strongly indicates that this mutation is involved in the pathogenesis of visual impairment. However, there was the absence of functionally significant mtDNA mutations in these four Chinese pedigrees carrying the T3394C mutation. Therefore, nuclear modifier gene(s) or environmental factor(s) may play a role in the phenotypic expression of the LHON-associated T3394C mutation.
Crystal structure of 4-meth-oxy-N-(piperidine-1-carbono-thio-yl)benzamide.

Science.gov (United States)

Suhud, Khairi; Hasbullah, Siti Aishah; Ahmad, Musa; Heng, Lee Yook; Kassim, Mohammad B

2017-10-01

In the title compound, C 14 H 18 N 2 O 2 S, the piperidine ring has a chair conformation. Its mean plane is twisted with respect to the 4-meth-oxy-benzoyl ring, with a dihedral angle of 63.0 (3)°. The central N-C(=S)-N(H)-C(=O) bridge is twisted with an N-C-N-C torsion angle of 74.8 (6)°. In the crystal, mol-ecules are linked by N-H⋯O and C-H⋯O hydrogen bonds, forming chains along the c -axis direction. Adjacent chains are linked by C-H⋯π inter-actions, forming layers parallel to the ac plane. The layers are linked by offset π-π inter-actions [inter-centroid distance = 3.927 (3) Å], forming a supra-molecular three-dimensional structure.
28 CFR 2.65 - Paroling policy for prisoners serving aggregate U.S. and D.C. Code sentences.

Science.gov (United States)

2010-07-01

... policy. The Commission shall apply the guidelines at § 2.20 to the prisoner's U.S. Code crimes, and the guidelines of the District of Columbia Board of Parole to the prisoner's D.C. Code crimes. (c) Determining..., solely on the ground of punishment for the U.S. Code offenses standing alone, or on grounds that have...
Observation of non-statistical structures in the excitation function of the reaction 10B(14N,12C)12C under extreme forward angles

International Nuclear Information System (INIS)

Klauss, E.U.

1984-01-01

In the present thesis the excitation functions of the reaction 10 B( 14 N, 12 C) 12 C to the ground states, the first excited state at 4.43 MeV (Jsup(π) = 2 1 + ) of a 12 C residual nucleus, and to the double excitation of ejectile and residue nucleus to the 4.43 state are studied. The measurements were performed in an energy range 13MeV 14 N) 0 (in the c.m. system). By a fitting to elastic scattering data the optical potential for 10 B+ 14 N was determined. With this potential it was tried by means of Hauser-Feshbach calculations to calculate the cross sections of the reaction 10 B( 14 N, 12 C) 12 C. The strong 16 + resonance and indications of 18 + in the excitation function of the reaction 10 B( 14 N, 12 Csub(g.s.)) 12 Csub(g.s.) should be pronounced. An unexpected large cross section was observed in the reaction 10 B( 14 N, 12 Csub(g.s.)) 12 C(4 1 + ). This is considered as a further indication to the strong contribution of a direct process. (orig./HSI) [de
HUBBLE SPACE TELESCOPE PRE-PERIHELION ACS/WFC IMAGING POLARIMETRY OF COMET ISON (C/2012 S1) AT 3.81 AU

Energy Technology Data Exchange (ETDEWEB)

Hines, Dean C.; Mutchler, Max; Hammer, Derek [Space Telescope Science Institute, Baltimore, MD 21218 (United States); Videen, Gorden; Sitko, Michael L.; Yanamandra-Fisher, Padmavati A. [Space Science Institute, 4750 Walnut Street, Suite 205, Boulder, CO 80301 (United States); Zubko, Evgenij; Muinonen, Karri [Department of Physics, P.O. Box 64, FI-00014 University of Helsinki (Finland); Shkuratov, Yuriy; Kaydash, Vadim G. [Astronomical Institute of V. N. Karazin University, Kharkov, 61058 (Ukraine); Knight, Matthew M. [Lowell Observatory, Flagstaff, AZ 86001 (United States); Lisse, Carey M. [Applied Physics Laboratory, Johns Hopkins University, Laurel, MD 20723 (United States)

2014-01-10

We present polarization images of Comet ISON (C/2012 S1) taken with the Hubble Space Telescope (HST) on UTC 2013 May 8 (r {sub h} = 3.81 AU, Δ = 4.34 AU), when the phase angle was α ≈ 12.°16. This phase angle is approximately centered in the negative polarization branch for cometary dust. The region beyond 1000 km (∼0.32 arcsec ≈ 6 pixels) from the nucleus shows a negative polarization amplitude of p% ∼ –1.6%. Within 1000 km of the nucleus, the polarization position angle rotates to be approximately perpendicular to the scattering plane, with an amplitude p% ∼ +2.5%. Such positive polarization has been observed previously as a characteristic feature of cometary jets, and we show that Comet ISON does indeed harbor a jet-like feature. These HST observations of Comet ISON represent the first visible light, imaging polarimetry with subarcsecond spatial resolution of a Nearly Isotropic Comet beyond 3.8 AU from the Sun at a small phase angle. The observations provide an early glimpse of the properties of the cometary dust preserved in this Oort-Cloud comet.
4-Hydroxy-6-methyl-3-[3-(thiophen-2-ylacryloyl]-2H-pyran-2-one

Directory of Open Access Journals (Sweden)

Salima Thabti

2013-04-01

Full Text Available The title compound, C13H10O4S, crystallizes with two molecules in the asymmetric unit in which the rings make dihedral angles of 3.9 (1 and 6.0 (1°; this planarity is due in part to the presence of an intramolecular O—H...O hydrogen bond, which generates an S(6 ring in each molecule. Both molecules represent E isomers with respect to the central C=C bond. In the crystal, molecules are linked by C—H...O interactions into a three-dimensional network.
ORGANIZATIONAL COMMUNICATION FROM THE TOP DOWN TO S.C. ARTEGO S.A.

Directory of Open Access Journals (Sweden)

DORU CÎRNU

2016-06-01

Full Text Available Vertical communication within the organization is twofold: top down and bottom up. The communication from the top down starts from the top management and continuous vertical hierarchy downward until the execution personnel from the base. This type of organizational communication aims to inform, advise, to guide, to train and evaluate subordinates, and to provide all necessary information on the objectives and organizational policies. Often, managers are overly optimistic about the clarity and complete vertical communication. In fact, they are usually managers who frequently recorded failures in the communication of important information or adequate training of subordinates. Starting from previous research more laboriou, among which we mention the GLOBE Study of American Professor Robert House or one conducted in our country (the study Comoros team coordinated by Professor Constantin Rosca, we did a study of smaller scale (at company level the vertical communication and efficiency of communication modalities of this type of managerial act. In this regard, a research performed at S. C. ARTEGO S.A. watched and how communication is done from top to bottom line information and training of personnel. The research, based on a questionnaire, which preserves the anonymity of respondents had interesting results, we stood to attention and present them in what follows. It was surprising to find that certain legal limits for working climat, especially causes of stress are almost unknown, even if some subjects gave positive answers to questions of this nature.
4-Chloro-N-(2-chlorobenzoylbenzenesulfonamide

Directory of Open Access Journals (Sweden)

B. Thimme Gowda

2010-06-01

Full Text Available In the structure of the title compound, C13H9Cl2NO3S, the conformation of the N—H bond in the C—SO2—NH—C(O segment is anti to the C=O bond. The molecule is twisted at the S atom with a torsion angle of 65.7 (2°. The dihedral angle between the sulfonyl benzene ring and the —SO2—NH—C—O segment is 88.5 (1°, and that between the sulfonyl and the benzoyl benzene rings is 58.0 (1°. In the crystal, molecules are linked by pairs of N—H...O hydrogen bonds, forming inversion dimers.
Crystal structures of 4-meth-oxy-N-(4-methyl-phenyl)benzene-sulfonamide and N-(4-fluoro-phenyl)-4-meth-oxy-benzene-sulfonamide.

Science.gov (United States)

Rodrigues, Vinola Z; Preema, C P; Naveen, S; Lokanath, N K; Suchetan, P A

2015-11-01

Crystal structures of two N-(ar-yl)aryl-sulfonamides, namely, 4-meth-oxy-N-(4-methyl-phen-yl)benzene-sulfonamide, C14H15NO3S, (I), and N-(4-fluoro-phen-yl)-4-meth-oxy-benzene-sulfonamide, C13H12FNO3S, (II), were determined and analyzed. In (I), the benzene-sulfonamide ring is disordered over two orientations, in a 0.516 (7):0.484 (7) ratio, which are inclined to each other at 28.0 (1)°. In (I), the major component of the sulfonyl benzene ring and the aniline ring form a dihedral angle of 63.36 (19)°, while in (II), the planes of the two benzene rings form a dihedral angle of 44.26 (13)°. In the crystal structure of (I), N-H⋯O hydrogen bonds form infinite C(4) chains extended in [010], and inter-molecular C-H⋯πar-yl inter-actions link these chains into layers parallel to the ab plane. The crystal structure of (II) features N-H⋯O hydrogen bonds forming infinite one dimensional C(4) chains along [001]. Further, a pair of C-H⋯O inter-molecular inter-actions consolidate the crystal packing of (II) into a three-dimensional supra-molecular architecture.
Continuously tunable S and C+L bands ultra wideband erbium-doped fiber ring laser

International Nuclear Information System (INIS)

Wang, Q; Yu, Q X

2009-01-01

This paper presents an ultra wideband tunable silica-based erbium doped fiber ring laser (EDFRL) that can be continuously tuned in S and C+L bands from 1475 to 1619 nm. It is the first time that a fiber ring laser's tuning range reaches 144 nm using a standard silica-based C-band erbium-doped fiber as gain media. In the laser configuration two isolators are used in the fiber loop for suppressing the ASE in C-band and elevating the lasing gain in S-band. As a result the available lasing wavelength is extended toward the shorter wavelength of the gain bandwidth. The optimized erbium-doped fiber length, output coupling ratio and pumping laser power have been obtained through experimental study. This ring fiber laser has simple configuration, low threshold, flat laser spectral distribution and high signal-to-ASE-noise ratio. The laser will have many potential applications in fiber sensor wavelength interrogation, high-resolution spectroscopy and fiber optic communications
Dihedral flavor symmetries

Energy Technology Data Exchange (ETDEWEB)

Blum, Alexander Simon

2009-06-10

This thesis deals with the possibility of describing the flavor sector of the Standard Model of Particle Physics (with neutrino masses), that is the fermion masses and mixing matrices, with a discrete, non-abelian flavor symmetry. In particular, mass independent textures are considered, where one or several of the mixing angles are determined by group theory alone and are independent of the fermion masses. To this end a systematic analysis of a large class of discrete symmetries, the dihedral groups, is analyzed. Mass independent textures originating from such symmetries are described and it is shown that such structures arise naturally from the minimization of scalar potentials, where the scalars are gauge singlet flavons transforming non-trivially only under the flavor group. Two models are constructed from this input, one describing leptons, based on the group D{sub 4}, the other describing quarks and employing the symmetry D{sub 14}. In the latter model it is the quark mixing matrix element V{sub ud} - basically the Cabibbo angle - which is at leading order predicted from group theory. Finally, discrete flavor groups are discussed as subgroups of a continuous gauge symmetry and it is shown that this implies that the original gauge symmetry is broken by fairly large representations. (orig.)
Dihedral flavor symmetries

International Nuclear Information System (INIS)

Blum, Alexander Simon

2009-01-01

This thesis deals with the possibility of describing the flavor sector of the Standard Model of Particle Physics (with neutrino masses), that is the fermion masses and mixing matrices, with a discrete, non-abelian flavor symmetry. In particular, mass independent textures are considered, where one or several of the mixing angles are determined by group theory alone and are independent of the fermion masses. To this end a systematic analysis of a large class of discrete symmetries, the dihedral groups, is analyzed. Mass independent textures originating from such symmetries are described and it is shown that such structures arise naturally from the minimization of scalar potentials, where the scalars are gauge singlet flavons transforming non-trivially only under the flavor group. Two models are constructed from this input, one describing leptons, based on the group D 4 , the other describing quarks and employing the symmetry D 14 . In the latter model it is the quark mixing matrix element V ud - basically the Cabibbo angle - which is at leading order predicted from group theory. Finally, discrete flavor groups are discussed as subgroups of a continuous gauge symmetry and it is shown that this implies that the original gauge symmetry is broken by fairly large representations. (orig.)
Enhanced visible-light photocatalytic decomposition of 2,4-dichlorophenoxyacetic acid over ZnIn_2S_4/g-C_3N_4 photocatalyst

International Nuclear Information System (INIS)

Qiu, Pengxiang; Yao, Jinhua; Chen, Huan; Jiang, Fang; Xie, Xianchuan

2016-01-01

Highlights: • A novel flower-on-sheet ZnIn_2S_4/g-C_3N_4 nanocomposite was synthesized. • ZnIn_2S_4/g-C_3N_4 showed high visible light catalytic activity for 2,4-D degradation. • The photocatalytic degradation pathway of 2,4-D was investigated. - Abstract: ZnIn_2S_4/g-C_3N_4 heterojunction photocatalyst was successfully synthesized via a simple hydrothermal method and applied to visible-light photocatalytic decomposition of 2,4-dichlorophenoxyacetic acid (2,4-D) from aqueous phase. The flower-like ZnIn_2S_4 particles were dispersed on the surface of g-C_3N_4 nanosheets in the ZnIn_2S_4/g-C_3N_4 composite. The composite showed higher separation rate of electron-hole pairs as compared to ZnIn_2S_4 and g-C_3N_4. Consequently, the ZnIn_2S_4/g-C_3N_4 composite exhibited enhanced visible light photocatalytic decomposition efficiency of 2,4-D, within 20% ZnIn_2S_4/g-C_3N_4 composite owning the highest photocatalytic efficiency and initial rate. The initial rates of 2,4-D degradation on g-C_3N_4, ZnIn_2S_4, and 20% ZnIn_2S_4/g-C_3N_4 were 1.23, 0.57 and 3.69 mmol/(g_c_a_t h), respectively. The h"+ and O_2"·"− were found to be the dominant active species for 2,4-D decomposition. The photocatalytic degradation pathways of 2,4-D by ZnIn_2S_4/g-C_3N_4 under visible light irradiation were explored. The ZnIn_2S_4/g-C_3N_4 composite displayed high photostability in recycling tests, reflecting its promising potential as an effective visible light photocatalyst for 2,4-D treatment.
Crystal structures of 4-methoxy-N-(4-methylphenylbenzenesulfonamide and N-(4-fluorophenyl-4-methoxybenzenesulfonamide

Directory of Open Access Journals (Sweden)

Vinola Z. Rodrigues

2015-11-01

Full Text Available Crystal structures of two N-(arylarylsulfonamides, namely, 4-methoxy-N-(4-methylphenylbenzenesulfonamide, C14H15NO3S, (I, and N-(4-fluorophenyl-4-methoxybenzenesulfonamide, C13H12FNO3S, (II, were determined and analyzed. In (I, the benzenesulfonamide ring is disordered over two orientations, in a 0.516 (7:0.484 (7 ratio, which are inclined to each other at 28.0 (1°. In (I, the major component of the sulfonyl benzene ring and the aniline ring form a dihedral angle of 63.36 (19°, while in (II, the planes of the two benzene rings form a dihedral angle of 44.26 (13°. In the crystal structure of (I, N—H...O hydrogen bonds form infinite C(4 chains extended in [010], and intermolecular C—H...πaryl interactions link these chains into layers parallel to the ab plane. The crystal structure of (II features N—H...O hydrogen bonds forming infinite one dimensional C(4 chains along [001]. Further, a pair of C—H...O intermolecular interactions consolidate the crystal packing of (II into a three-dimensional supramolecular architecture.
Atomic and nano-scale characterization of a 50-year-old hydrated C3S paste

KAUST Repository

Geng, Guoqing; Taylor, Rae; Bae, Sungchul; Herná ndez-Cruz, Daniel; Kilcoyne, David A.; Emwas, Abdul-Hamid M.; Monteiro, Paulo J M

2015-01-01

This paper investigates the atomic and nano-scale structures of a 50-year-old hydrated alite paste. Imaged by TEM, the outer product C-S-H fibers are composed of particles that are 1.5-2 nm thick and several tens of nanometers long. 29Si NMR shows 47.9% Q1 and 52.1% Q2, with a mean SiO4 tetrahedron chain length (MCL) of 4.18, indicating a limited degree of polymerization after 50 years' hydration. A Scanning Transmission X-ray Microscopy (STXM) study was conducted on this late-age paste and a 1.5 year old hydrated C3S solution. Near Edge X-ray Absorption Fine Structure (NEXAFS) at Ca L3,2-edge indicates that Ca2 + in C-S-H is in an irregular symmetric coordination, which agrees more with the atomic structure of tobermorite than that of jennite. At Si K-edge, multi-scattering phenomenon is sensitive to the degree of polymerization, which has the potential to unveil the structure of the SiO44 - tetrahedron chain. © 2015 Elsevier Ltd. All rights reserved.
Atomic and nano-scale characterization of a 50-year-old hydrated C3S paste

KAUST Repository

Geng, Guoqing

2015-07-15

This paper investigates the atomic and nano-scale structures of a 50-year-old hydrated alite paste. Imaged by TEM, the outer product C-S-H fibers are composed of particles that are 1.5-2 nm thick and several tens of nanometers long. 29Si NMR shows 47.9% Q1 and 52.1% Q2, with a mean SiO4 tetrahedron chain length (MCL) of 4.18, indicating a limited degree of polymerization after 50 years\\' hydration. A Scanning Transmission X-ray Microscopy (STXM) study was conducted on this late-age paste and a 1.5 year old hydrated C3S solution. Near Edge X-ray Absorption Fine Structure (NEXAFS) at Ca L3,2-edge indicates that Ca2 + in C-S-H is in an irregular symmetric coordination, which agrees more with the atomic structure of tobermorite than that of jennite. At Si K-edge, multi-scattering phenomenon is sensitive to the degree of polymerization, which has the potential to unveil the structure of the SiO44 - tetrahedron chain. © 2015 Elsevier Ltd. All rights reserved.

Quantitative assessment of S. mutans and C. albicans in patients with Haas and Hyrax expanders

Directory of Open Access Journals (Sweden)

Matheus Melo Pithon

2012-06-01

Full Text Available OBJECTIVE: To assess and compare the number of Streptococcus mutans and Candida albicans colonies in patients with Haas and Hyrax appliances before and after insertion. METHODS: The sample consisted of 84 patients requiring orthodontic treatment. For all patients a midpalatal suture expansion was indicated. Patients were randomly divided into Group HA, who used the Haas appliance (n = 42 and Group HY, who used the Hyrax appliance (n = 42. Initially and thirty days after appliance insertion all patients were submitted to saliva collections. The saliva was diluted followed by seeding in Mitis Salivarius and CHROMagar media, for growth of S. mutans and C. albicans respectively. RESULTS: Results showed statistically significant difference between groups HA and HY for Streptococcus mutans and Candida albicans (p <0.05. Haas appliance promoted greater S. mutans and C. albicans proliferation when compared to Hyrax appliance. CONCLUSION: The Haas appliance favored greater proliferation of S. mutans and C. albicans when compared with the Hyrax appliance. Insertion of the appliances resulted in greater buildup of microorganisms.
Factors affecting temporal H2S emission at construction and demolition (C&D) debris landfills.

Science.gov (United States)

Xu, Qiyong; Townsend, Timothy

2014-02-01

Odor problems associated with H2S emissions often result in odor complaints from nearby residents of C&D debris landfills, especially in the early morning. As part of a field study conducted on H2S removal ability using different cover materials, daily and seasonal H2S emissions through a soil cover layer were monitored at a C&D debris landfill to investigate factors affecting H2S emissions. H2S emission rates were not a constant, but varied seasonally, with an average emission rate of 4.67×10(-6)mgm(-2)s(-1). During a the 10-month field study, as the H2S concentration increased from 140ppm to about 3500ppm underneath the cover soil in the testing cell, H2S emissions ranged from zero to a maximum emission rate of 1.24×10(-5)mgm(-2)s(-1). Continuous emission monitoring indicated that H2S emissions even changed over time throughout the day, generally increasing from morning to afternoon, and were affected by soil moisture and temperature. Laboratory experiments were also conducted to investigate the effects of H2S concentration and cover soil moisture content on H2S emissions. The results showed that increased soil moisture reduced H2S emissions by retarding H2S migration through cover soil and dissolving H2S into soil water. The field study also indicated that due to atmospheric dispersion, high H2S emissions may not cause odor problems. Copyright © 2013 Elsevier Ltd. All rights reserved.
Adsorption and dissociation of H{sub 2}S on Mo{sub 2}C(001) surface-A first-principle study

Energy Technology Data Exchange (ETDEWEB)

Fu, Dianling; Guo, Wenyue, E-mail: wyguo@upc.edu.cn; Liu, Yunjie; Chi, Yuhua

2015-10-01

Highlights: • Adsorption of reactants, intermediates involved was investigated. • The Mulliken charge and partial density of states were analyzed. • The dissociation mechanism was investigated. • The optimal pathway for the dissociation of H{sub 2}S on the Mo{sub 2}C(001) surface was given. - Abstract: The adsorption and decomposition reaction mechanisms of H{sub 2}S on Mo{sub 2}C(001) has been systematically studied using self-consistent periodic density functional theory. Results show that the molecular of H{sub 2}S is adsorbed either on the Mo top site or bridge site. Mulliken population analysis and density of states for H{sub 2}S/Mo-terminated Mo{sub 2}C(001) adsorption system are examined to confirm the adsorption mechanism of H{sub 2}S with the Mo{sub 2}C(001) surface, which can involve the donation of charge from the “s lone pair electrons” that are LUMO orbitals into the surface and the back donation of electrons from the surface into the HOMO orbital. The optimal pathway for the dissociation of H{sub 2}S on the Mo{sub 2}C(001) surface can be H{sub 2}S{sub top} → SH{sub fcc} + H{sub fcc} → S{sub fcc} + H{sub fcc} + H{sub fcc}. The first step is the rate-determining step because it has the smallest rate constant among the possible reactions pathways.
Photoionization and ionic dissociation of the C3 H3 NS molecule induced by soft X-ray near the C1s edge.

Science.gov (United States)

Lago, A F; Januário, R D; Cavasso Filho, R L; Simon, M; Dávalos, J Z

2017-10-01

Time of flight mass spectrometry, electron-ion coincidence, and ion yield spectroscopy were employed to investigate for the first time the thiazole (C 3 H 3 NS) molecule in the gas phase excited by synchrotron radiation in the soft X-ray domain. Total ion yield (TIY) and photoelectron-photoion coincidence (PEPICO) spectra were recorded as a function of the photon energy in the vicinity of the carbon K edge (C1s). The C1s resonant transitions as well as the core ionization thresholds have been determined from the profile of TIY spectrum, and the features were discussed. The corresponding partial ion yields were determined from the PEPICO spectra for the cation species produced upon the molecular photodissociation. Additional ab initio calculations have also been performed from where relevant structural and electronic configuration parameters were obtained for this molecule. Copyright © 2017 John Wiley & Sons, Ltd.
Physics Proofs of Four Millennium-Problems(MP) via CATEGORY-SEMANTICS(C-S)/F=C Aristotle SQUARE-of-OPPOSITION(SoO) DEduction-LOGIC DichotomY

Science.gov (United States)

Clay, London; Siegel, Edward Carl-Ludwig

2011-03-01

Siegel-Baez Cognitive-Category-Semantics"(C-C-S) tabular list-format matrix truth-table analytics SoO jargonial-obfuscation elimination query WHAT? yields four "pure"-maths MP "Feet of Clay!!!" proofs: (1) Siegel [AMS Natl.Mtg.(02)-Abs.973-03-126: (CCNY;64)(94;Wiles)] Fermat's: Last-Thm. = Least-Action Ppl.; (2) P=/=NP TRIVIAL simple Euclid geometry/dimensions: NO computer anything"Feet of Clay!!!"; (3) Birch-Swinnerton-Dyer conjecture; (4) Riemann-hypotheses via COMBO.: Siegel[AMS Natl.Mtg.(02)-Abs.973-60-124] digits log-law inversion to ONLY BEQS with ONLY zero-digit BEC, AND Rayleigh[1870;graph-thy."short-CUT method"[Doyle-Snell, Random-Walks & Electric-Nets,MAA(81)]-"Anderson"[(58)] critical-strip C-localization!!! SoO DichotomY ("V") IdentitY: #s:(Euler v Bernoulli) = (Sets v Multisets) = Quantum-Statistics(FD v BE) = Power-Spectra(1/f(0) v 1/f(1)) = Conic-Sections(Ellipse v Hyperbola) = Extent(Locality v Globality);Siegel[(89)] (so MIScalled) "complexity" as UTTER-SIMPLICITY(!!!) v COMPLICATEDNESS MEASURE(S) definition.
Evaluation of the BD Vacutainer Plus Urine C&S Preservative Tubes compared with nonpreservative urine samples stored at 4°C and room temperature.

Science.gov (United States)

Eisinger, Stephen W; Schwartz, Matthew; Dam, Lisa; Riedel, Stefan

2013-09-01

The stability of urine specimens submitted for culture remains a challenge for many laboratories because of delays in specimen transport. We evaluated the usefulness of BD Vacutainer Plus Urine C&S Preservative Tube in ensuring specimen stability. Clinical urine specimens collected in sterile collection cups (n = 110) were plated onto sheep blood and MacConkey agar following standard laboratory procedures guidelines. Thereafter, specimens were divided into 3 storage conditions: nonpreservative, refrigerated; nonpreservative, room temperature (RT); BD Vacutainer Plus Urine C&S Preservative Tube, RT. For each sample type, additional cultures were set up at 2, 4, 24, and 48 hours. Initially, 18 specimens had no growth, 32 showed mixed skin flora, and 60 yielded at least 1 uropathogen. Increased colony counts of uropathogens were observed for nonpreserved urine samples stored at RT; these changes were statistically significant. Minor differences between refrigerated urine samples and BD Vacutainer Plus Urine C&S Preservative Tube samples were seen but were not statistically significant. The use of preservative-containing collection tubes is desirable to ensure specimen stability when prompt processing or refrigeration is not feasible.
Open angle glaucoma as a manifestation of Waardenburg′s syndrome.

Directory of Open Access Journals (Sweden)

Gupta Viney

2000-01-01

Full Text Available Waardenburg′s syndrome is a rare, autosomal dominant disorder, with several clinical signs, each with variable penetrance. We report this case of Waardenburg′s syndrome with bilateral open-angle glaucoma with unique gonioscopic findings.
Prototype development and demonstration for response, emergency staging, communications, uniform management, and evacuation (R.E.S.C.U.M.E.) : R.E.S.C.U.M.E. prototype system design document.

Science.gov (United States)

2014-04-01

This report documents the System Design Document (SDD) for the prototype development and demonstration of the : Response, Emergency Staging, Communications, Uniform Management, and Evacuation (R.E.S.C.U.M.E.) application : bundle, with a focus on the...
(Carbonyl-1κC)bis[2,3(η5)-cyclopentadienyl][μ3-(S-methyl trithiocarbonato)methylidyne-1:2:3κ4 C,S′′:C:C](triphenylphosphine-1κP)(μ3-sulfido-1:2:3κ3 S)dicobalt(II)iron(II) trifluoromethanesulfonate

Science.gov (United States)

Manning, Anthony R.; McAdam, C. John; Palmer, Anthony J.; Simpson, Jim

2008-01-01

The asymmetric unit of the title compound, [FeCo2(C5H5)2(C3H3S3)S(C18H15P)(CO)]CF3SO3, consists of a triangular irondicobalt cluster cation and a trifluoromethanesulfonate anion. In the cation, the FeCo2 triangle is symmetrically capped on one face by an S atom and on the other by a C atom linked to a methyl trithiocarbonate residue that bridges the Fe—C bond. Each Co atom carries a cyclopentadienyl ligand while the Fe atom coordinates to one carbonyl and one triphenylphosphine ligand. In the crystal structure, the cation is linked to the anion by a number of weak non-classical C—H⋯O and C—H⋯F hydrogen bonds and weak S⋯O (3.317 Å) and S⋯F (3.198 Å) interactions. The structure is further stabilized by additional intermolecular C—H⋯O, C—H⋯F and O⋯O (2.942 Å) contacts, together with an unusual S⋯π(Cp) interaction (S⋯centroid distance = 3.385 Å), generating an extended network. PMID:21202187
Phase relations in the Cu-Te-S system at temperatures between 350 and 900 degree C

DEFF Research Database (Denmark)

Karup-Møller, Sven

1994-01-01

data and optical data on phases A and B are listed. At 350 degree C there exist two liquid fields which at 450 degree C have become one continuous field stretching from Cu45Te55 with low S content to the tellurium corner of the phase diagram and from there to the sulphur corner. With increasing S......, the Cu content of the liquid rapidly decreases to trace amonts. With increasing temperature the field extends into the ternary from the tellurium corner towards the Cu-S join. The boundary of the liquid field in the central portion of the phae diagram towards the sulphur corner does not change position...
First evidence of direct $C\\!P$ violation in charmless two-body decays of $B^0_s$ mesons

CERN Document Server

Aaij, R; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves Jr, A A; Amato, S; Amhis, Y; Anderson, J; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Arrabito, L; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Bachmann, S; Back, J J; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bates, A; Bauer, C; Bauer, Th; Bay, A; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Benayoun, M; Bencivenni, G; Benson, S; Benton, J; Bernet, R; Bettler, M -O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blanks, C; Blouw, J; Blusk, S; Bobrov, A; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Büchler-Germann, A; Burducea, I; Bursche, A; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carson, L; Carvalho Akiba, K; Casse, G; Cattaneo, M; Cauet, Ch; Charles, M; Charpentier, Ph; Chiapolini, N; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Corti, G; Couturier, B; Cowan, G A; Currie, R; D'Ambrosio, C; David, P; David, P N Y; De Bonis, I; De Bruyn, K; De Capua, S; De Cian, M; De Lorenzi, F; De Miranda, J M; De Paula, L; De Simone, P; Decamp, D; Deckenhoff, M; Degaudenzi, H; Del Buono, L; Deplano, C; Derkach, D; Deschamps, O; Dettori, F; Dickens, J; Dijkstra, H; Diniz Batista, P; Domingo Bonal, F; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Dzhelyadin, R; Dziurda, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisele, F; Eisenhardt, S; Ekelhof, R; Eklund, L; Elsasser, Ch; Elsby, D; Esperante Pereira, D; Falabella, A; Färber, C; Fardell, G; Farinelli, C; Farry, S; Fave, V; Fernandez Albor, V; Ferro-Luzzi, M; Filippov, S; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furcas, S; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garnier, J-C; Garofoli, J; Garra Tico, J; Garrido, L; Gascon, D; Gaspar, C; Gauld, R; Gauvin, N; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gordon, H; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hampson, T; Hansmann-Menzemer, S; Harji, R; Harnew, N; Harrison, J; Harrison, P F; Hartmann, T; He, J; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hicks, E; Holubyev, K; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Huston, R S; Hutchcroft, D; Hynds, D; Iakovenko, V; Ilten, P; Imong, J; Jacobsson, R; Jaeger, A; Jahjah Hussein, M; Jans, E; Jansen, F; Jaton, P; Jean-Marie, B; Jing, F; John, M; Johnson, D; Jones, C R; Jost, B; Kaballo, M; Kandybei, S; Karacson, M; Karbach, T M; Keaveney, J; Kenyon, I R; Kerzel, U; Ketel, T; Keune, A; Khanji, B; Kim, Y M; Knecht, M; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kruzelecki, K; Kucharczyk, M; Kudryavtsev, V; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J -P; Lefèvre, R; Leflat, A; Lefrançois, J; Leroy, O; Lesiak, T; Li, L; Li Gioi, L; Lieng, M; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; von Loeben, J; Lopes, J H; Lopez Asamar, E; Lopez-March, N; Lu, H; Luisier, J; Mac Raighne, A; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Magnin, J; Malde, S; Mamunur, R M D; Manca, G; Mancinelli, G; Mangiafave, N; Marconi, U; Märki, R; Marks, J; Martellotti, G; Martens, A; Martin, L; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Massafferri, A; Mathe, Z; Matteuzzi, C; Matveev, M; Maurice, E; Maynard, B; Mazurov, A; McGregor, G; McNulty, R; Meissner, M; Merk, M; Merkel, J; Miglioranzi, S; Milanes, D A; Minard, M -N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Mylroie-Smith, J; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neufeld, N; Nguyen, A D; Nguyen-Mau, C; Nicol, M; Niess, V; Nikitin, N; Nikodem, T; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Pal, B K; Palacios, J; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Paterson, S K; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perego, D L; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pessina, G; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pie Valls, B; Pietrzyk, B; Pilař, T; Pinci, D; Plackett, R; Playfer, S; Plo Casasus, M; Polok, G; Poluektov, A; Polycarpo, E; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pugatch, V; Puig Navarro, A; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, A; Rinnert, K; Roa Romero, D A; Robbe, P; Rodrigues, E; Rodrigues, F; Rodriguez Perez, P; Rogers, G J; Roiser, S; Romanovsky, V; Rosello, M; Rouvinet, J; Ruf, T; Ruiz, H; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salzmann, C; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santinelli, R; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schleich, S; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M -H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Skwarnicki, T; Smith, N A; Smith, E; Sobczak, K; Soler, F J P; Solomin, A; Soomro, F; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Swientek, S; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tsaregorodtsev, A; Tuning, N; Ubeda Garcia, M; Ukleja, A; Urquijo, P; Uwer, U; Vagnoni, V; Valenti, G; Vazquez Gomez, R; Vazquez Regueiro, P; Vecchi, S; Velthuis, J J; Veltri, M; Viaud, B; Videau, I; Vieira, D; Vilasis-Cardona, X; Visniakov, J; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voss, H; Waldi, R; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wishahi, J; Witek, M; Witzeling, W; Wotton, S A; Wyllie, K; Xie, Y; Xing, F; Xing, Z; Yang, Z; Young, R; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhong, L; Zvyagin, A

2012-01-01

Using a data sample corresponding to an integrated luminosity of 0.35 $\\mathrm{fb}^{-1}$ collected by LHCb in 2011, we report the first evidence of $C\\!P$ violation in the decays of $B^0_s$ mesons to $K^\\pm \\pi^\\mp$ pairs, $A_{C\\!P}(B^0_s \\rightarrow K \\pi)=0.27 \\pm 0.08\\,\\mathrm{(stat)} \\pm 0.02\\,\\mathrm{(syst)}$, with a significance of 3.3$\\sigma$. Furthermore, we report the first observation of $C\\!P$ violation in $B^0$ decays at a hadron collider, $A_{C\\!P}(B^0 \\rightarrow K\\pi)=-0.088 \\pm 0.011\\,\\mathrm{(stat)} \\pm 0.008\\,\\mathrm{(syst)}$, with a significance exceeding 6$\\sigma$.
Disproportionation and thermochemical sulfate reduction reactions in S-H20-Ch4 and S-D2O-CH4 systems from 200 to 340 °C at elevated pressures

Science.gov (United States)

Yuan, Shunda; Chou, I-Ming; Burruss, Robert A.

2013-01-01

Elemental sulfur, as a transient intermediate compound, by-product, or catalyst, plays significant roles in thermochemical sulfate reduction (TSR) reactions. However, the mechanisms of the reactions in S-H2O-hydrocarbons systems are not clear. To improve our understanding of reaction mechanisms, we conducted a series of experiments between 200 and 340 °C for S-H2O-CH4, S-D2O-CH4, and S-CH4-1m ZnBr2 systems in fused silica capillary capsules (FSCC). After a heating period ranging from 24 to 2160 hours (hrs), the quenched samples were analyzed by Raman spectroscopy. Combined with the in situ Raman spectra collected at high temperatures and pressures in the S-H2O and S-H2O-CH4 systems, our results showed that (1) the disproportionation of sulfur in the S-H2O-CH4 system occurred at temperatures above 200 °C and produced H2S, SO42-, and possibly trace amount of HSO4-; (2) sulfate (and bisulfate), in the presence of sulfur, can be reduced by methane between 250 and 340 °C to produce CO2 and H2S, and these TSR temperatures are much closer to those of the natural system (2O-CH4 system may take place simultaneously, with TSR being favored at higher temperatures; and (4) in the system S-D2O-CH4, both TSR and the competitive disproportionation reactions occurred simultaneously at temperatures above 300 °C, but these reactions were very slow at lower temperatures. Our observation of methane reaction at 250 °C in a laboratory time scale suggests that, in a geologic time scale, methane may be destroyed by TSR reactions at temperatures > 200 °C that can be reached by deep drilling for hydrocarbon resources.
On wave functions of mesons involving the s-, c- and b-quarks

International Nuclear Information System (INIS)

Zhitnitskij, A.R.; Zhitnitskij, I.R.; Chernyak, V.L.

1983-01-01

The wave function components of pseudoscalar and vestor mesons which are antisymmertric with respect to permutation of the quark momenta are studied. The results are as follows: elt xsub(s)-xsub(u) > sub(K) approximately equal to 0.11 for the K meson, sub(K*) approximately equal to 0.15-C.20 for the K* meson, being a mean fraction of the longitudinal momentum transferred by the s(u) quark. The following estimates are obtained: / approximately equal to 0.20-0.25; / approximately equal to 0.8x10 -2 . The asymptotics of the K 0 -meson form factor and the etasub(c) → KK* decay width are found. Properties of the wave functions of mesons which contain a light and a heavy quark (D, B, ...) are considered. For the B 0 meson approximately equal to 0.10 is found. Arguments are given supporting nonenhancement of the amplitudes of the processes involving D mesons compared to similar K-meson amplitudes. A simple way is suggested to determine the asymptotic form of various wave functions
Dicty_cDB: Contig-U16006-1 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available ne 01 Psig64s-55C regio... 50 0.22 1 ( EU648429 ) Psiguria umbrosa clone 05 Psig6...4s-55C region geno... 50 0.22 1 ( EU648428 ) Psiguria umbrosa clone 04 Psig64s-55C region geno... 50 0.22 1 ( EU648427 ) Psiguri...a umbrosa clone 03 Psig64s-55C region geno... 50 0.22 1 ( EU648426 ) Psiguria umbrosa cl...one 02 Psig64s-55C region geno... 50 0.22 1 ( EU648425 ) Psiguria umbrosa clone 0...1 Psig64s-55C region geno... 50 0.22 1 ( EU648423 ) Psiguria pedata clone 07 Psig64s-55C region genom... 50
Butane-1,4-diyl bis(pyridine-4-carboxylate

Directory of Open Access Journals (Sweden)

J. Muthukumaran

2011-07-01

Full Text Available The molecule of the title compound, C16H16N2O4, lies about an inversion centre; the butane chain adopts an extended zigzag conformation. The dihedral angle between the pyridine ring and the adjacent COO group is 3.52 (s14°.
Selective inhibition of the demethylation at C-14 in ergosterol biosynthesis by the fungicide, Denmert (S-1358)

International Nuclear Information System (INIS)

Kato, Toshiro; Kawase, Yasuo

1976-01-01

A direct evidence of the inhibitory effect in a cell-free system of S. cerevisiae was experimentally studied, and the site of action of Denmert (S-n-butyl S'-p-tert-butylbenzyl N-3-pyridyldithiocarbon-imidate) in sterol biosynthesis was examined. 14 C-labeled lanosterol and 14-desmethyl-lanosterol were biosynthetically prepared. DL-mevalonate-2- 14 C was incubated with yeast cell-free homogenates for 3 hr at 28 deg C while being shaked vigorously in atmospheric oxygen. The resultant 14 C-labeled sterol was extracted and chromatographed on a silicic acid-Hyflo Super Cel column. 4,4-dimethyl sterol thus obtained was acetylated with acetic anhydride and pyridine. The separation of lanosteryl acetate and 14-desmethyl lanosteryl acetate was accomplished on alumina thin-layer plates. After the saponification of each steryl acetate, the quantity of the sterol was assessed by gas chromatography with cholesterol as an internal standard. The incubation of the 14 C-labeled sterol was achieved under the same conditions as those for the DL-mevalonate-2- 14 C except the addition of the substrate which was dispersed in 0.1M phosphate buffer. Denmert inhibited the conversion of 14 C-labeled lanosterol to 4-desmethyl sterol, while the conversion of 14 C-labeled 14-desmethyl lanosterol to 4-desmethyl sterol was hardly affected by the fungicide. Therefore, Denmert is a potent selective inhibitor of the demethylation at the C-14 position in ergosterol biosynthesis. The fungicide, triarimol, exhibited the same effect on sterol biosynthesis as that of Denmert. (Iwakiri, K.)
meso-4,4′-Dimethoxy-2,2′-{[(3aR,7aS-2,3,3a,4,5,6,7,7a-octahydro-1H-benzimidazole-1,3-diyl]bis(methylene}diphenol

Directory of Open Access Journals (Sweden)

Augusto Rivera

2013-07-01

Full Text Available The title compound, C23H30N2O4, a di-Mannich base derived from 4-methoxyphenol and cis-1,2-diaminecyclohexane, has a perhydrobenzimidazolidine nucleus, in which the cyclohexane ring adopts a chair conformation and the heterocyclic ring has a half-chair conformation with a C—N—C—C torsion angles of −48.14 (15 and −14.57 (16°. The mean plane of the heterocycle makes dihedral angles of 86.29 (6 and 78.92 (6° with the pendant benzene rings. The molecular structure of the title compound shows the presence of two interactions between the N atoms of the imidazolidine ring and the hydroxyl groups through intramolecular O—H...N hydrogen bonds with graph-set motif S(6. The unobserved lone pairs of the N atoms are presumed to be disposed in a syn conformation, being only the second example of an exception to the typical `rabbit-ears' effect in 1,2-diamines.
4-Hydroxy-3-methoxybenzaldehyde–nicotinamide (1/1

Directory of Open Access Journals (Sweden)

Fiona N.-F. How

2011-12-01

Full Text Available In the title compound, C6H6N2O·C8H8O3, an equimolar co-crystal of nicotinamide and vanillin, the aromatic ring and the amide fragment of the nicotinamide molecule make a dihedral angle of 32.6 (2°. The vanillin molecule is almost planar, with an r.m.s. deviation for all non-H atoms of 0.0094 Å. The vaniline and nicotinamide aromatic rings are nearly coplanar, the dihedral angle between them being 3.20 (9°. In the crystal, the two components are linked through N—H...O and O—H...N hydrogen bonds into chains along the a axis. The chains are connected via C—H...O interactions, forming a three-dimensional polymeric structure.
Experiences with liquid scintillation counting of 3H, 14C and 35S from plant material

International Nuclear Information System (INIS)

Das, S.K.

1974-01-01

Relative merits of different methods in radioassay of three soft beta emitting isotopes like 3 H, 14 C and 35 S from plant material have been assessed. The methods used are: (1) combustion method (2) use of tissue solubilizing agents and (3) wet digestion method. Results show that determinations of 14 C by combustion method; 3 H by combustion and Mahin and Lofberg's method; and 35 S by wet digestion method are superior for plant material than the other methods tried. (author)
Imaging the norepinephrine transporter in humans with (S,S)-[11C]O-methyl reboxetine and PET: problems and progress

International Nuclear Information System (INIS)

Logan, Jean; Wang, Gene-jack; Telang, Frank; Fowler, Joanna S.; Alexoff, David; Zabroski, John; Jayne, Millard; Hubbard, Barbara; King, Payton; Carter, Pauline; Shea, Colleen; Xu, Youwen; Muench, Lisa; Schlyer, David; Learned-Coughlin, Susan; Cosson, Valerie; Volkow, Nora D.; Ding, Yu-shin

2007-01-01

Results from human studies with the PET radiotracer (S,S)-[ 11 C]O-methyl reboxetine ([ 11 C](S,S)-MRB), a ligand targeting the norepinephrine transporter (NET), are reported. Quantification methods were determined from test/retest studies, and sensitivity to pharmacological blockade was tested with different doses of atomoxetine (ATX), a drug that binds to the NET with high affinity (K i =2-5 nM). Methods: Twenty-four male subjects were divided into different groups for serial 90-min PET studies with [ 11 C](S,S)-MRB to assess reproducibility and the effect of blocking with different doses of ATX (25, 50 and 100 mg, po). Region-of-interest uptake data and arterial plasma input were analyzed for the distribution volume (DV). Images were normalized to a template, and average parametric images for each group were formed. Results: [ 11 C](S,S)-MRB uptake was highest in the thalamus (THL) and the midbrain (MBR) [containing the locus coeruleus (LC)] and lowest for the caudate nucleus (CDT). The CDT, a region with low NET, showed the smallest change on ATX treatment and was used as a reference region for the DV ratio (DVR). The baseline average DVR was 1.48 for both the THL and MBR with lower values for other regions [cerebellum (CB), 1.09; cingulate gyrus (CNG) 1.07]. However, more accurate information about relative densities came from the blocking studies. MBR exhibited greater blocking than THL, indicating a transporter density ∼40% greater than THL. No relationship was found between DVR change and plasma ATX level. Although the higher dose tended to induce a greater decrease than the lower dose for MBR (average decrease for 25 mg=24±7%; 100 mg=31±11%), these differences were not significant. The different blocking between MBR (average decrease=28±10%) and THL (average decrease=17±10%) given the same baseline DVR indicates that the CDT is not a good measure for non-NET binding in both regions. Threshold analysis of the difference between the average baseline DV

11 CFR 100.14 - State committee, subordinate committee, district, or local committee (2 U.S.C. 431(15)).

Science.gov (United States)

2010-01-01

... 11 Federal Elections 1 2010-01-01 2010-01-01 false State committee, subordinate committee, district, or local committee (2 U.S.C. 431(15)). 100.14 Section 100.14 Federal Elections FEDERAL ELECTION COMMISSION GENERAL SCOPE AND DEFINITIONS (2 U.S.C. 431) General Definitions § 100.14 State committee...
Characterization of the system MoS{sub 2} + C, HAADF vs Tem conventional; Cracterizacion del sistema MoS{sub 2} + C, HAADF vs TEM convencional

Energy Technology Data Exchange (ETDEWEB)

Reza, C; Cruz, G [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico); Santiago, P; Rendon, L [IFUNAM, A.P. 20-364, 04510 Mexico D.F. (Mexico)

2004-07-01

A study is presented about the synthesis and characterization of unidimensional nano systems composed of MoS{sub 2} and C with potential use as solid lubricant. The synthesis process was developed for the mold method, via thermal decomposition, which uses a film of nano porous aluminium oxide. Such systems were characterized by two analysis methods that involve Transmission Electron Microscopy, HRTEM (Conventional TEM) and HAADF (Z Contrast). The results obtained in the structural and morphological characterization were supplemented to determine the structure type obtained in the unidimensional systems. (Author)
Response of S.C.704 maize hybrid seed production to planting pattern

African Journals Online (AJOL)

In order to determine the best planting pattern for producing the S.C.704 hybrid seed of maize, a field experiment was conducted in 2007 at Safiabad Dezful Research Center via a complete block design with four treatments and replicates each. The treatments were: D1 (one row each of paternal and maternal lines), D2 (two ...
Application of high-resolution photoelectron spectroscopy: Vibrational resolved C 1s and O 1s spectra of CO adsorbed on Ni(100)

Energy Technology Data Exchange (ETDEWEB)

Foehlisch, A.; Nilsson, A.; Martensson, N. [Uppsala Univ. (Sweden)] [and others

1997-04-01

There are various effects which determine the line shape of a core-level electron spectrum. These are due to the finite life-time of the core hole, inelastic scattering of the outgoing photoelectron, electronic shake-up and shake-off processes and vibrational excitations. For free atoms and molecules the different contributions to the observed line shapes can often be well separated. For solids, surfaces and adsorbates the line shapes are in general much broader and it has in the past been assumed that no separation of the various contributions can be made. In the present report the authors will show that this is indeed not the case. Surprisingly, the vibrational fine structure of CO adsorbed on Ni(100) can be resolved in the C 1s and O 1s electron spectra. This was achieved by the combination of highly monochromatized soft X-rays from B18.0 with a high resolution Scienta 200 mm photoelectron spectrometer. X-ray photoelectron spectroscopy (XPS) with tunable excitation energy yields as a core level spectroscopy atomic and site-specific information. The presented measurements allow for a determination of internuclear distances and potential energy curves in corehole ionized adsorbed molecules. The authors analysis of the c(2x2) phase CO/Ni(100) on {open_quotes}top{close_quotes} yielded a vibrational splitting of 217 +/- 2 meV for C 1s ionization. For O 1s ionization a splitting of 173 +/- 8 meV was found.
An unsuspected autoregulatory pathway involving apocytochrome TorC and sensor TorS in Escherichia coli

OpenAIRE

Gon, Stéphanie; Jourlin-Castelli, Cécile; Théraulaz, Laurence; Méjean, Vincent

2001-01-01

Trimethylamine N-oxide (TMAO) respiration is carried out mainly by the Tor system in Escherichia coli. This system is encoded by the torCAD operon and comprises a periplasmic TMAO reductase (TorA) and a c-type cytochrome (TorC), which shuttles electrons to TorA. Expression of the tor operon is positively controlled by the TorS/TorR phosphorelay system in response to TMAO availability and negatively regulated by apocytochrome TorC. Interaction studies showed tha...
Implementation of the Continuous AutoTransfusion System (C.A.T.S) in open abdominal aortic aneurysm repair: an observational comparative cohort study.

LENUS (Irish Health Repository)

Tawfick, Wael A

2008-01-01

The use of the Continuous AutoTransfusion System (C.A.T.S; Fresenius Hemotechnology, Bad Homburg v.d.H., Germany), which conserves allogenic blood, is reported in 187 patients having abdominal aortic aneurysm repair during a 9-year period. Patients were allocated to C.A.T.S if a Haemovigilance technician was available. A mean of 685 mL of retrieved blood was reinfused in 101 patients receiving C.A.T.S; 61% required 2 U or less. All control patients required 3 U or more of allogenic blood. Allogenic transfusion in C.A.T.S patients decreased significantly (P < .0001). Mean intensive care unit stay was significantly reduced in C.A.T.S patients (P = .042). Mean postoperative hospital stay was 18 days for C.A.T.S group and 25 days in control patients (P = .014). The respective 30-day mortality was 12% versus 19% (P = .199). The C.A.T.S markedly reduced the amount of blood transfused, was associated with reduced intensive care unit and postoperative hospital stay, and was cost-effective.
Synthesis and characterization of C@CdS dots in aqueous solution and their application in labeling human gastric carcinoma cells

Energy Technology Data Exchange (ETDEWEB)

Dong, Wei, E-mail: dongwei5873@126.com [Shenyang Medical College, Department of Chemistry (China); Zhou, Siqi [Fengtian Hospital Affiliated to Shenyang Medical College, ICU (China); Dong, Yan [Shenyang Pharmaceutical University, Experiment Center of Traditional Chinese Medicine Department (China); Wang, Jingwen; Liu, Shuang; Zhu, Pengxia [Shenyang Medical College, Department of Chemistry (China)

2015-03-15

Colloidal carbon spheres coated with cadmium sulfide nanoparticle quantum dots (C@CdS dots) with the particle size smaller than 50 nm were synthesized by an aqueous approach. The effects of different reaction times, temperatures, and pH values were carefully investigated to optimize the synthesis conditions. The as-prepared C@CdS dots were linked with mouse anti-human carcinoembryonic antigen antibody and goat anti-mouse immunoglobulin (IgG) to directly and indirectly label fixed human gastric carcinoma cells, respectively. The cytotoxicity of the C@CdS dots was also tested using the human gastric carcinoma cells. No apparent cytotoxicity was observed, which suggested the potential application of the as-prepared C@CdS dots in bioimaging.
Spectral fitting for signal assignment and structural analysis of uniformly {sup 13}C-labeled solid proteins by simulated annealing based on chemical shifts and spin dynamics

Energy Technology Data Exchange (ETDEWEB)

Matsuki, Yoh; Akutsu, Hideo; Fujiwara, Toshimichi [Osaka University, Institute for Protein Research (Japan)], E-mail: tfjwr@protein.osaka-u.ac.jp

2007-08-15

We describe an approach for the signal assignment and structural analysis with a suite of two-dimensional {sup 13}C-{sup 13}C magic-angle-spinning solid-state NMR spectra of uniformly {sup 13}C-labeled peptides and proteins. We directly fit the calculated spectra to experimental ones by simulated annealing in restrained molecular dynamics program CNS as a function of atomic coordinates. The spectra are calculated from the conformation dependent chemical shift obtained with SHIFTX and the cross-peak intensities computed for recoupled dipolar interactions. This method was applied to a membrane-bound 14-residue peptide, mastoparan-X. The obtained C', C{sup {alpha}} and C{sup {beta}} chemical shifts agreed with those reported previously at the precisions of 0.2, 0.7 and 0.4 ppm, respectively. This spectral fitting program also provides backbone dihedral angles with a precision of about 50 deg. from the spectra even with resonance overlaps. The restraints on the angles were improved by applying protein database program TALOS to the obtained chemical shifts. The peptide structure provided by these restraints was consistent with the reported structure at the backbone RMSD of about 1 A.
Cudraflavone C Induces Apoptosis of A375.S2 Melanoma Cells through Mitochondrial ROS Production and MAPK Activation.

Science.gov (United States)

Lee, Chiang-Wen; Yen, Feng-Lin; Ko, Horng-Huey; Li, Shu-Yu; Chiang, Yao-Chang; Lee, Ming-Hsueh; Tsai, Ming-Horng; Hsu, Lee-Fen

2017-07-13

Melanoma is the most malignant form of skin cancer and is associated with a very poor prognosis. The aim of this study was to evaluate the apoptotic effects of cudraflavone C on A375.S2 melanoma cells and to determine the underlying mechanisms involved in apoptosis. Cell viability was determined using the MTT and real-time cytotoxicity assays. Flow cytometric evaluation of apoptosis was performed after staining the cells with Annexin V-FITC and propidium iodide. The mitochondrial membrane potential was evaluated using the JC-1 assay. Cellular ROS production was measured using the CellROX assay, while mitochondrial ROS production was evaluated using the MitoSOX assay. It was observed that cudraflavone C inhibited growth in A375.S2 melanoma cells, and promoted apoptosis via the mitochondrial pathway mediated by increased mitochondrial ROS production. In addition, cudraflavone C induced phosphorylation of MAPKs (p38, ERK, and JNK) and up-regulated the expression of apoptotic proteins (Puma, Bax, Bad, Bid, Apaf-1, cytochrome C, caspase-9, and caspase-3/7) in A375.S2 cells. Pretreatment of A375.S2 cells with MitoTEMPOL (a mitochondria-targeted antioxidant) attenuated the phosphorylation of MAPKs, expression of apoptotic proteins, and the overall progression of apoptosis. In summary, cudraflavone C induced apoptosis in A375.S2 melanoma cells by increasing mitochondrial ROS production; thus, activating p38, ERK, and JNK; and increasing the expression of apoptotic proteins. Therefore, cudraflavone C may be regarded as a potential form of treatment for malignant melanoma.
Benzyl 3-(2-methylphenyldithiocarbazate

Directory of Open Access Journals (Sweden)

Mohamed Ibrahim Mohamed Tahir

2012-05-01

Full Text Available In the title compound, C15H16N2S2, the central C2N2S2 unit is essentially planar (r.m.s. deviation = 0.047 Å and forms dihedral angles of 68.26 (4 and 65.99 (4° with the phenyl and benzene rings, respectively, indicating a twisted molecule. Supramolecular chains with a step topology and propagating along [100] feature in the crystal packing, mediated through N—H...S hydrogen bonds. The chains are consolidated into a three-dimensional architecture by C—H...π interactions.
77 FR 74472 - Application to Export Electric Energy; Energia Renovable S.C., LLC

Science.gov (United States)

2012-12-14

... DEPARTMENT OF ENERGY [OE Docket No. EA-387] Application to Export Electric Energy; Energia... application. SUMMARY: Energia Renovable S.C., LLC (Energia Renovable) has applied for authority to transmit...)). On September 11, 2012, DOE received an application from Energia Renovable for authority to transmit...
El foro romano de Termes (Hispania Citerior. Síntesis histórica, arqueológica y topográfica. S. I a. C.- s. II d. C.

Directory of Open Access Journals (Sweden)

Martínez Caballero, Santiago

2010-12-01

Full Text Available The urban development of the central public area of the Roman city of Termes (Hispania Citerior between the 1st century B.C and the 2nd century A.D. is linked to the progressive institutional transformation of the community and to its social and economic development. After the Bellum Sertorianum, the urban space previously occupied by the Celtiberian oppidum was used as a shrine related to one of the founding rites of the city, and which would become the origin of the forum. This area was refurbished during the Augustan era (31 B.C. – 14 A.D., when a temple was built that overlooked a communal area, although we are not aware of its general layout due to the progressive overlapping of structures in the zone. During the reign of Julius Claudius (14-37 A.D., a new public area was created, next to the earlier one, which was made up by an arched complex with a temple. This complex was part of a main public area, which was either a Julius Claudius Forum or just an urban sanctuary. Finally, during the Flavian era, from 75 A.D, the site of the Augustan forum would be transformed with the construction of a large scenographic and monumental agora, the Flavian Forum, a complex that would be both a forum and an Augusteum, a place for performances and a shrine for dynastic worship.La evolución urbanística del área pública central de la ciudad romana de Termes (Hispania Citerior entre el s. I a. C. y el s. II d. C. está conectada a la progresiva transformación institucional de la comunidad y a su desarrollo social y económico. Tras el Bellum Sertorianum el espacio urbano ocupado anteriormente por el oppidum celtibérico vio la creación de un santuario relacionado con un rito fundacional de la ciudad, elemento que constituirá el germen del foro. Esta área fue reformada en época augustea (31 a. C.-14 d. C., con la construcción de un templo que presidía un espacio foral, aunque desconocemos la configuración general de éste último, por la
Visible light-responded C, N and S co-doped anatase TiO{sub 2} for photocatalytic reduction of Cr(VI)

Energy Technology Data Exchange (ETDEWEB)

Lei, X.F., E-mail: leixuefei69@163.com [School of Resources and Materials, Northeastern University at Qinhuangdao, Qinhuangdao 066004 (China); Institute of Metallurgical Resource and Environmental Engineering, Northeastern University, Shenyang 110819 (China); Liaoning Key Laboratory of Metallurgical Resource Recycling Science, Shenyang 110819 (China); Liaoning Engineering and Technology Research Center of Boron Resource, Comprehensive, Utilization, Shenyang 110819 (China); Liaoning Provincial Universities Key Laboratory of Boron Resource Ecological, Utilization, Technology and Boron Materials, Shenyang 110819 (China); Xue, X.X.; Yang, H. [Institute of Metallurgical Resource and Environmental Engineering, Northeastern University, Shenyang 110819 (China); Liaoning Key Laboratory of Metallurgical Resource Recycling Science, Shenyang 110819 (China); Liaoning Engineering and Technology Research Center of Boron Resource, Comprehensive, Utilization, Shenyang 110819 (China); Liaoning Provincial Universities Key Laboratory of Boron Resource Ecological, Utilization, Technology and Boron Materials, Shenyang 110819 (China); Chen, C.; Li, X.; Pei, J.X.; Niu, M.C.; Yang, Y.T.; Gao, X.Y. [School of Resources and Materials, Northeastern University at Qinhuangdao, Qinhuangdao 066004 (China)

2015-10-15

The (C, N and S) co-doped TiO{sub 2} (TH-TiO{sub 2}) samples were synthesized by a sol-gel method calcined at 500 °C, employing butyl titanate as the titanium source and thiourea as the dopant. The structures of TH-TiO{sub 2} samples were characterized by X-ray diffraction (XRD), Transmission electron microscope (TEM), X-ray photoelectron spectroscopy (XPS), UV–vis diffuse reflectance spectra (DRS), photoluminescence (PL) spectroscopy, Thermo gravimetry and differential thermal analysis (TG-DTA), Scanning electron microscopy (SEM) and nitrogen adsorption–desorption isotherms. The photocatalytic activities were checked through the photocatalytic reduction of Cr(VI) as a model compound under visible light irradiation. The results showed that the thiourea content played an important role on the microstructure and photocatalytic activity of the samples. According to XPS results, (C, N and S) atoms were successfully co-doped into the nanostructures of TH-TiO{sub 2} samples. TH-TiO{sub 2} samples with thiourea: Ti molar ratio of 1.5 exhibits higher photocatalytic activity than that of the other samples under visible light irradiation, which can be attributed to the synergic effect of the pure anatase structure, the higher light absorption characteristics in visible regions, separation efficiency of electron–hole pairs, the specific surface area and the optimum (C, N and S) content. - Graphical abstract: (C, N and S) co-doped TiO{sub 2} samples show good photocatalytic activity for Cr (VI) reduction under visible light irradiation. - Highlights: • (C, N and S) co-doping in TH-TiO{sub 2} samples can promote the formation of the pure anatase structure. • (C, N and S) atoms were successfully co-doped into the nanostructures of TH-TiO{sub 2} samples. • The band gap energy of TH-TiO{sub 2} samples reduced after (C, N and S) co-doping. • (C, N and S) co-doped TiO{sub 2} samples were effective for the photocatalytic reduction of Cr(VI) under visible light
Características clínico patológicas del cáncer de cérvix uterino recurrente después de cirugía radical primaria.

Directory of Open Access Journals (Sweden)

Pedro Aguilar

2012-03-01

Full Text Available Objetivo: Describir las características clínico patológicas del cáncer de cérvix uterino recurrente, sitio y tiempo de recurrencia, y sobrevida después de la recurrencia de acuerdo a las variables de pronóstico en pacientes con cirugía radical primaria. Material y métodos: Estudio descriptivo, observacional y retrospectivo, tipo serie de casos, realizado en el Instituto Nacional de Enfermedades Neoplásicas de Lima Perú entre 1990 y 2005. Se incluyeron todas las pacientes con cáncer de cérvix uterino estadios IB1 y IIA a quienes se les realizó cirugía radical primaria y que tuvieron recurrencia. Las curvas de sobrevida fueron construidas con el método de Kaplan-Meier. Resultados: Se realizaron 609 histerectomías radicales tipo III, 53(8,7% tuvieron recurrencia. La edad promedio al diagnóstico de la recurrencia fue 44,5 años, el tiempo medio desde la cirugía hasta la recurrencia 18,9 meses y el sitio de recurrencia más frecuente fue a distancia (41,5% seguido por recurrencia central y pélvica. El sitio de recurrencia y los márgenes quirúrgicos tuvieron significancia estadística con respecto al tiempo de recurrencia. La terapia de salvataje más frecuente fue la radioterapia (45%. La sobrevida promedio después de la recurrencia fue 26,9 meses y la tasa de sobrevida a 5 años 9,4%. Conclusiones: El cáncer cervical recurrente es poco frecuente, afecta a mujeres jóvenes y el sitio de recurrencia más frecuente es metástasis a distancia. El tiempo de recurrencia es más corto cuando la recurrencia es central y los márgenes quirúrgicos están afectados. La sobrevida después de la recurrencia en cáncer cervical tratado con cirugía radical es baja.
Stakes of a cooperation: preliminary inquiry led with the C.L.I. and I.R.S.N

International Nuclear Information System (INIS)

Gadbois, S.; Vaillant, L.

2004-01-01

The national association of local commissions of information (A.N.C.L.I.) and the institute of radiation protection and nuclear safety (I.R.S.N.) agreed to define experimental actions for year 2004 within the framework of their protocol concerning the scientific and technical support brought by the institute to the local commissions of information (C.L.I) in this perspective, both organizations wished beforehand to realize an inquiry on the expectations of the C.L.I. and the I.R.S.N. in follow-up of release and surveillance of the nuclear installations environment. The present document reports objectives and methodology of the inquiry, results obtained notably by underlining the identified problems and the actions suggested to remedy it. (N.C.)
Determination of δ13C, δ15N, or δ34S by isotope-ratio-monitoring mass spectrometry using an elemental analyzer

Science.gov (United States)

Johnson, Craig A.; Stricker, Craig A.; Gulbransen, Cayce A.; Emmons, Matthew P.

2018-02-14

This report describes procedures used in the Geology, Geophysics, and Geochemistry Science Center of the U.S. Geological Survey in Denver, Colorado, to determine the stable-isotope ratios 13C/12C, 15N/14N, and 34S/32S in solid materials. The procedures use elemental analyzers connected directly to gas-source isotope-ratio mass spectrometers. A different elemental–analyzer–mass-spectrometer system is used for 13C/12C and 15N/14N than is used for 34S/32S to accommodate differences in reagents, catalysts, and instrument settings.
tert-Butyl 3-(8-bromo-4H,10H-1,2-oxazolo[4,3-c][1]benzoxepin-10-yl-2-methyl-1H-indole-1-carboxylate

Directory of Open Access Journals (Sweden)

Ankur Trigunait

2010-08-01

Full Text Available In the title compound, C25H23BrN2O4, the seven-membered ring adopts a twisted-boat conformation. The indole ring system is planar within 0.021 (2 Å and the ester group [–C(=O—O—C–] is almost coplanar with it [dihedral angle = 3.0 (2°]. The conformation of the ester group is influenced by intramolecular C—H...O interactions. In the crystal structure, molecules are linked into chains along the b axis by C—H...N hydrogen bonds.
A plasma coagulation assay for an activated protein C-independent anticoagulant activity of protein S

NARCIS (Netherlands)

van Wijnen, M.; van 't Veer, C.; Meijers, J. C.; Bertina, R. M.; Bouma, B. N.

1998-01-01

To study the physiological importance of the activated protein C (APC)-independent anticoagulant activity of protein S, we developed an assay specific for this activity. The ability of protein S to prolong the clotting time in an APC-independent way was expressed as the ratio of the clotting time in
C.A.S.I.S. Workshop 2003 Abstract Proceedings

International Nuclear Information System (INIS)

Azevedo, S

2003-01-01

Thirty five years ago, while in the neutron cross section group led by Robert Howerton at LLNL, the concept of reconstructing a three dimensional spatial distribution from its projections onto two dimensional planes was tackled by some of us using three now well known methods: simple back projection, Fourier projection theorem methods and iterative least squares algebraic reconstruction. The method of iterative least squares reconstruction was implemented on patient data in the early 1970s using photons from radionuclides detected by the Anger Camera. The method useful for computed tomography was modified to include the attenuation of the photons from an unknown source through an unknown attenuation distribution (a problem thought to be intractable until 1974). These methods along with a multitude of other methods developed by my small group of Ronald Huesman, Grant Gullberg, William Greenberg and Stephen Derenzo were prepared as a library with examples in FORTRAN, RECLBL. Those codes were found useful for computed tomography, geophysical problems and plasma confinement research topics in addition to their use in Nuclear Medicine. The codes were used even in the early days of magnetic resonance imaging when back projection of filtered projection data were used before the incorporation of phase encoding methods. In 1970s computed tomography of a single section of the brain required 4 minutes for single photon tomography or positron emission tomography about 30 minutes were required. Even proton and helium ion tomography were accomplished in the 1970s but with more that 2 hours of data acquisition. Thirty years later CT systems deliver 16 sections per second with 1 mm resolution and PET systems acquire 40 sections with about 4 mm resolution in 5 minutes. Computation times have reduced from 18 hours on the CDC 6600s and 7600s for gated, list mode data to less than 5 minutes in the last 30 years. Similar ratios of improvement have benefited ultrasound and magnetic
Finite size vertex correction to the strong decay of ηc and χc states and a determination of αs(mc)

International Nuclear Information System (INIS)

Ping Ronggang; Jiang Huanqing; Zou Bingsong

2002-01-01

In previous calculations of the strong decay of a charmonium, the first-order momentum dependence of the quark propagator is kept. It was found that the finite-size vertex correction to the Γ(J/ψ→3g) process is large. The authors calculate the two-gluon decay widths of η e , χ c0 and χ c2 by including the full momentum dependence of the quark propagator. Comparing to the zero-order calculation the authors find that the finite-size vertex correction factor to the two-gluon decay widths of η c is 1.32, and for the two-gluon decays of χ c0 and χ c2 , the vertex correction factors are 1.45 and 1.26, respectively. With the corrected decay widths Γ(η c →2g) authors extract the value as α s (m c ) = 0.28 +- 0.05 which agrees with that calculated from the Γ(J/ψ→3g) process with the same correction. The finite-size vertex correction to the process Γ(η c →3g) is not as large as that to the process Γ(J/ψ→3g)

Some links on this page may take you to non-federal websites. Their policies may differ from this site.