Sample records for rust-resistant western white
-
Richard A. Sniezko; Robert Danchok; Jim Hamlin; Angelia Kegley; Sally Long; James Mayo
2012-01-01
Western white pine (Pinus monticola Douglas ex D. Don) is highly susceptible to the non-native, invasive pathogen Cronartium ribicola, the causative agent of white pine blister rust. The susceptibility of western white pine to blister rust has limited its use in restoration and reforestation throughout much of western North...
-
Susan K. Hagle; Geral I. McDonald; Eugene A. Norby
1989-01-01
This report comprises a handbook for managing western white pine in northern ldaho and western Montana, under the threat of white pine blister rust. Various sections cover the history of the disease and efforts to combat it, the ecology of the white pine and Ribes, alternate host of the rust, and techniques for evaluating the rust hazard and attenuating it. The authors...
-
Blister rust control in the management of western white pine
Kenneth P. Davis; Virgil D. Moss
1940-01-01
The forest industry of the western white pine region depends on the production of white pine as a major species on about 2,670,000 acres of commercial forest land. Continued production of this species and maintenance of the forest industry at anything approaching its present level is impossible unless the white pine blister rust is controlled. Existing merchantable...
-
Jun-Jun Liu; Arezoo Zamany; Richard. Sniezko
2012-01-01
Western white pine (Pinus monticola Douglas ex D. Don) is an important forest species in North America. Forest genetics programs have been breeding for durable genetic resistance against white pine blister rust (WPBR) caused by Cronartium ribicola in the past few decades. As various genetic resistance resources are screened and...
-
White pine blister rust resistance research in Minnesota and Wisconsin
Andrew David; Paul Berrang; Carrie Pike
2012-01-01
The exotic fungus Cronartium ribicola causes the disease white pine blister rust on five-needled pines throughout North America. Although the effects of this disease are perhaps better known on pines in the western portion of the continent, the disease has also impacted regeneration and growth of eastern white pine (Pinus strobus L. ...
-
Resistance of three interspecific white pine hybrids to blister rust
R. Z. Callaham
1962-01-01
Three white pine hybrids exposed to infection by white pine blister rust (Cronartium ribicola Fischer) since 1946 have inherited the relative resistance of their parental species. The hybrids were produced from controlled pollinations in 1940 and 1941 at the Institute of Forest Genetics, Placerville, Calif. Twelve seedlings of each hybrid were...
-
Histology of white pine blister rust in needles of resistant and susceptible eastern white pine
Joel A. Jurgens; Robert A. Blanchette; Paul J. Zambino; Andrew David
2003-01-01
White pine blister rust, Cronartium ribicola, has plagued the forests of North America for almost a century. Over past decades, eastern white pine (Pinus strobus) that appear to tolerate the disease have been selected and incorporated into breeding programs. Seeds from P. strobus with putative resistance were...
-
White pine blister rust resistance in limber pine: Evidence for a major gene
A. W. Schoettle; R. A. Sniezko; A. Kegley; K. S. Burns
2014-01-01
Limber pine (Pinus flexilis) is being threatened by the lethal disease white pine blister rust caused by the non-native pathogen Cronartium ribicola. The types and frequencies of genetic resistance to the rust will likely determine the potential success of restoration or proactive measures. These first extensive inoculation trials using individual tree seed collections...
-
White pines, blister rust, and management in the Southwest
D. A. Conklin; M Fairweather; D Ryerson; B Geils; D Vogler
2009-01-01
White pines in New Mexico and Arizona are threatened by the invasive disease white pine blister rust, Cronartium ribicola. Blister rust is already causing severe damage to a large population of southwestern white pine in the Sacramento Mountains of southern New Mexico. Recent detection in northern and western New Mexico suggests that a major expansion of the...
-
Strong partial resistance to white pine blister rust in sugar pine
Bohun B. Kinloch, Jr.; Deems Burton; Dean A. Davis; Robert D. Westfall; Joan Dunlap; Detlev Vogler
2012-01-01
Quantitative resistance to white pine blister rust in 128 controlled- and open-pollinated sugar pine families was evaluated in a âdisease gardenâ, where alternate host Ribes bushes were interplanted among test progenies. Overall infection was severe (88%), but with great variation among and within families: a 30-fold range in numbers of infections...
-
Strategies for managing whitebark pine in the presence of white pine blister rust [Chapter 17
Raymond J. Hoff; Dennis E. Ferguson; Geral I. McDonald; Robert E. Keane
2001-01-01
Whitebark pine (Pinus albicaulis) is one of many North American white pine species (Pinus subgenus Strobus) susceptible to the fungal disease white pine blister rust (Cronartium ribicola). Blister rust has caused severe mortality (often reaching nearly 100 percent) in many stands of white bark pine north of 45° latitude in western North America. The rust is slowly...
-
Resistance to white pine blister rust in Pinus flexilis and P
Anna W. Schoettle; Richard A. Sniezko; Angelia Kegley; Jerry Hill; Kelly S. Burns
2010-01-01
The non-native fungus Cronartium ribicola, that causes white pine blister rust (WPBR), is impacting or threatening limber pine, Pinus flexilis, and Rocky Mountain bristlecone pine, Pinus aristata. In the Southern Rockies, where the rust invasion is still expanding, we have the opportunity to be proactive and prepare the landscape for invasion. Genetic...
-
Daniel R. Miller; Harold D. Pierce; Peter de Groot; Nicole Jeans-Williams; Robb Bennett; John H. Borden
2000-01-01
An isolated stand of western white pine, Pinus monticola Dougl. ex D. Don, on Texada Island (49°40'N, 124°10'W), British Columbia, is extremely valuable as a seed-production area for progeny resistant to white pine blister rust, Cronartium ribicola J.C. Fisch. (Cronartiaceae). During the past 5 years, cone beetles, ...
-
Contribution to Kinetics of Formation of White Rust on Galvanized Steel
International Nuclear Information System (INIS)
Han, D. J.; Pyun, Su Il; Hahn, Y. D.
1981-01-01
Kinetics of formation of white rust on galvanized steel coated with various chromating solutions was studied. White rust occurs as a mixture of zinc oxide and zinc hydroxide. White rust formation rate was measured with a salt spray test as related to Cr 3+ ion amount, ratio of Cr 3+ to Cr 6+ ion(by weight) and surface roughness of the chromate film. Incubation time of white rust formation increased as the ratio of Cr 3+ to Cr 6+ ion in the chromate film increased. White rust propagation rate decreased as the amount of Cr 3+ ion increased. Surface roughness had no detectable relationship with incubation time and white rust propagation rate. Experimental results showed that kinetics of white rust formation was as follows: chromate film consists of insoluble Cr 3+ ion and soluble Cr 6+ ion, the latter act: as a corrosion inhibitor. Leaching rate of Cr 6+ ion from the film decreases with an increase of the ratio of Cr 3+ to Cr 6+ ion in the chromate film. When Cr 6+ ion is leached from the film, a bare zine layer is exposed to air and discontinuities occur in the film where white rust formation is initiated. Further white rust formation occurs due to destruction of the chromate film by chlorine ion. It is concluded that two stages of white rust formation are present and can be ascribed to Cr 6+ ion leaching and destruction of the chromate film by chlorine ion
-
Singh, A; Knox, R E; DePauw, R M; Singh, A K; Cuthbert, R D; Campbell, H L; Shorter, S; Bhavani, S
2014-11-01
In wheat, advantageous gene-rich or pleiotropic regions for stripe, leaf, and stem rust and epistatic interactions between rust resistance loci should be accounted for in plant breeding strategies. Leaf rust (Puccinia triticina Eriks.) and stripe rust (Puccinia striiformis f. tritici Eriks) contribute to major production losses in many regions worldwide. The objectives of this research were to identify and study epistatic interactions of quantitative trait loci (QTL) for stripe and leaf rust resistance in a doubled haploid (DH) population derived from the cross of Canadian wheat cultivars, AC Cadillac and Carberry. The relationship of leaf and stripe rust resistance QTL that co-located with stem rust resistance QTL previously mapped in this population was also investigated. The Carberry/AC Cadillac population was genotyped with DArT(®) and simple sequence repeat markers. The parents and population were phenotyped for stripe rust severity and infection response in field rust nurseries in Kenya (Njoro), Canada (Swift Current), and New Zealand (Lincoln); and for leaf rust severity and infection response in field nurseries in Canada (Swift Current) and New Zealand (Lincoln). AC Cadillac was a source of stripe rust resistance QTL on chromosomes 2A, 2B, 3A, 3B, 5B, and 7B; and Carberry was a source of resistance on chromosomes 2B, 4B, and 7A. AC Cadillac contributed QTL for resistance to leaf rust on chromosome 2A and Carberry contributed QTL on chromosomes 2B and 4B. Stripe rust resistance QTL co-localized with previously reported stem rust resistance QTL on 2B, 3B, and 7B, while leaf rust resistance QTL co-localized with 4B stem rust resistance QTL. Several epistatic interactions were identified both for stripe and leaf rust resistance QTL. We have identified useful combinations of genetic loci with main and epistatic effects. Multiple disease resistance regions identified on chromosomes 2A, 2B, 3B, 4B, 5B, and 7B are prime candidates for further investigation and
-
Strategies for improving rust resistance in oats
International Nuclear Information System (INIS)
Harder, D.E.; McKenzie, R.I.H.; Martens, J.W.; Brown, P.D.
1977-01-01
During the history of breeding oats for rust resistance in Canada the known sources of resistance proved inadequate to counter the virulence potential of both stem rust (Puccinia graminis avenae) and crown rust (P. coronata avenae). A major programme to overcome the rust problem was undertaken at Winnipeg, involving four alternate approaches: (1) A search for new resistance in wild oat species, particularly Avena sterilis, has provided a wealth of good resistance to crown rust, but less to stem rust. Much of the A. sterilis-derived crown rust resistance is now being used world-wide; (2) Efforts at synthesizing new resistance by mutation breeding methods have not been successful. Of about seven million plants examined, only one showed significant new resistance, but this was associated with poor plant type; (3) Resistance with low levels of expression but which appears broadly effective has been observed against both stem and crown rusts. It appears that numbers of these low-level genes exist, and that they can be accumulated to provide increasingly effective resistance. Problems in using this type of resistance in a practical way are discussed; (4) Excellent rust resistance has been found in lower ploidy species such as A. barbata, but it was not previously possible to stabilize this resistance in hexaploid species. By using mutagenic treatments attempts have been made to translocate smaller portions of the A. barbata chromosome carrying the resistance to the hexaploid cultivar Rodney. In conclusion, mutation breeding methods at present appear to have limited application in synthesizing new rust-resistant genotypes in oats. The search for already existing genetic resistance and its synthesis into multi-genic resistant lines appears to be the most effective way at present of resolving the rust problem in oats. (author)
-
Directory of Open Access Journals (Sweden)
R.A. Sniezko
2013-12-01
Full Text Available Dorena Genetic Resource Center (DGRC has used artificial inoculation trials to evaluate progenies of thousands of Pinus monticola and P. lambertiana selections from Oregon and Washington for resistance to white pine blister rust caused by Cronartium ribicola. In addition, early results are now available for P. albicaulis and P. strobiformis. DGRC has also recently evaluated seed orchard progenies of P. strobus, as well as bulked seedlots from P. armandii and P. peuce. The majority of P. monticola, P. lambertiana, P. albicaulis, and P. strobus progenies are very susceptible to blister rust. However, resistance exists in all these species. P. strobiformis showed relatively high levels of resistance for the eight progenies tested. Resistance in P. armandii was mainly reflected in the very low percentage of cankered seedlings; for P. peuce, the high percentage of cankered seedlings alive three years after inoculation was notable. R-genes are present in some of the North American five-needle pine species, but partial resistance traits (e.g. bark reaction will play a major role in breeding activities for P. monticola and P. lambertiana and will likely be the key to developing durable resistance.
-
Buerstmayr, Maria; Matiasch, Lydia; Mascher, Fabio; Vida, Gyula; Ittu, Marianna; Robert, Olivier; Holdgate, Sarah; Flath, Kerstin; Neumayer, Anton; Buerstmayr, Hermann
2014-09-01
We detected several, most likely novel QTL for adult plant resistance to rusts. Notably three QTL improved resistance to leaf rust and stripe rust simultaneously indicating broad spectrum resistance QTL. The rusts of wheat (Puccinia spp.) are destructive fungal wheat diseases. The deployment of resistant cultivars plays a central role in integrated rust disease management. Durability of resistance would be preferred, but is difficult to analyse. The Austrian winter wheat cultivar Capo was released in the 1989 and grown on a large acreage during more than two decades and maintained a good level of quantitative leaf rust and stripe rust resistance. Two bi-parental mapping populations: Capo × Arina and Capo × Furore were tested in multiple environments for severity of leaf rust and stripe rust at the adult plant stage in replicated field experiments. Quantitative trait loci associated with leaf rust and stripe rust severity were mapped using DArT and SSR markers. Five QTL were detected in multiple environments associated with resistance to leaf rust designated as QLr.ifa-2AL, QLr.ifa-2BL, QLr.ifa-2BS, QLr.ifa-3BS, and QLr.ifa-5BL, and five for resistance to stripe rust QYr.ifa-2AL, QYr.ifa-2BL, QYr.ifa-3AS, QYr.ifa-3BS, and QYr.ifa-5A. For all QTL apart from two (QYr.ifa-3AS, QLr.ifa-5BL) Capo contributed the resistance improving allele. The leaf rust and stripe rust resistance QTL on 2AL, 2BL and 3BS mapped to the same chromosome positions, indicating either closely linked genes or pleiotropic gene action. These three multiple disease resistance QTL (QLr.ifa-2AL/QYr.ifa-2AL, QLr.ifa.2BL/QYr.ifa-2BL, QLr.ifa-3BS/QYr.ifa.3BS) potentially contribute novel resistance sources for stripe rust and leaf rust. The long-lasting resistance of Capo apparently rests upon a combination of several genes. The described germplasm, QTL and markers are applicable for simultaneous resistance improvement against leaf rust and stripe rust.
-
Screening oat populations for rust resistant mutants
International Nuclear Information System (INIS)
McKenzie, R.I.H.; Martens, J.W.; Harder, D.E.; Brown, P.D.
1976-01-01
In 1972 a two million M 2 plants were grown at Morden, Manitoba. Thirteen plants which were thought to have possible resistance to race CI0 of oat stem rust were harvested. After extensive seedling and adult plant rust tests the best of the selected plant progenies was crossed and backcrossed to Rodney 0, a stem rust susceptible oat. The resistance in this line M-72-6 was found to be controlled by a single gene. In 1973 another two million M 2 plants were examined for rust resistance at Morden and 38 were harvested. None of the M 2 plants selected in 1973 appeared to have any seedling or adult resistance when examined more thoroughly in the greenhouse and again in the field in 1974. In 1974 one million M 2 plants were examined for resistance and 73 selected. None appeared to have any resistance when tested further. The strain CI3034 which was good adult plant stem rust resistance associated with weak straw and a light green plant colour was treated with gamma radiation and EMS in 1973 and the M 2 grown in the C10 rust nursery at Morden in 1974. A considerable number of dark green plants were present in all treatments but unfortunately all were found to be stem rust susceptible. Thus it would appear to be difficult if not impossible to separate the rust resistance in CI3034 from the undesirable characters, weak straw and light green plant colour. (author)
-
Induced resistance to rust disease in lentil
International Nuclear Information System (INIS)
Paul, Amitava; Singh, D.P.
2006-01-01
Considerable yield reduction in lentil is due to rust caused by Uromyces fabae. So far the sources of resistance to rust are available in the small seeded background. There is a need to develop rust resistant/tolerant bold seeded cultivars. Mutations were induced by gamma rays (10 and 15 kR) for incorporating resistance to rust in K-75(Mallika), a high yielding bold seeded, but rust susceptible cultivar at Pantnagar which is the hot spot for this disease. Dry seeds (300) were irradiated for each treatment. In M 1 generation, individual plants from each treatment were selfed and harvested separately which constituted the M 2 generation. In M 2 individual plant progenies were scored following a rating scale of 1 (Free) to 9(highly susceptible). At 15 kR dose, 8 plants were resistant (score 3.0) and 14 plants were tolerant (score 5.0) to rust, while in control and 10 kR populations, all plants were susceptible or highly susceptible having score of 7 or 9, respectively. The M 2 plants segregated in ratio of 1 resistant: 3 susceptible. The progenies of resistant/tolerant M 2 plants were bred true in the M 3 generation suggesting that the resistance to rust is controlled by one recessive gene. (author)
-
Determination of rust resistance genes in pakistani bread wheats
International Nuclear Information System (INIS)
Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.
2014-01-01
Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)
-
4.4.5S: Genetic interactions of white pines and blister rust in western North America
Bohun B. Kinloch Jr.
1998-01-01
A century since its introduction to North America from Europe, white pine blister rust has come to be recognized as one of the catastrophic plant disease epidemics in history. It has yet to stabilize, continuing to spread and intensify. The nine native white pine hosts comprise major timber producers, important watershed protectors, keystone ecological species, and the...
-
Toor, Puneet Inder; Kaur, Satinder; Bansal, Mitaly; Yadav, Bharat; Chhuneja, Parveen
2016-12-01
A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated wheat. Inheritance and genetic mapping of stripe rust resistance gene in backcrossrecombinant inbred line (BC-RIL) population derived from the cross of a wheat-Ae. caudata introgression line (IL) T291- 2(pau16060) with wheat cv. PBW343 is reported here. Segregation of BC-RILs for stripe rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%. IL T291-2 had earlier been reported to carry introgressions on wheat chromosomes 2D, 3D, 4D, 5D, 6D and 7D. Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS enriched the target region harbouring stripe and leaf rust resistance genes. Stripe rust resistance locus, temporarily designated as YrAc, mapped at the distal most end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. LrAc mapped at a distance of 9.0 cM from the YrAc and at 2.8 cM from RGA-STS marker Ta5DS_2737450, YrAc and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance.
-
Randhawa, Mandeep; Bansal, Urmil; Lillemo, Morten; Miah, Hanif; Bariana, Harbans
2016-11-01
Wild relatives, landraces and cultivars from different geographical regions have been demonstrated as the sources of genetic variation for resistance to rust diseases. This study involved assessment of diversity for resistance to three rust diseases among a set of Nordic spring wheat cultivars. These cultivars were tested at the seedling stage against several pathotypes of three rust pathogens in the greenhouse. All stage stem rust resistance genes Sr7b, Sr8a, Sr12, Sr15, Sr17, Sr23 and Sr30, and leaf rust resistance genes Lr1, Lr3a, Lr13, Lr14a, Lr16 and Lr20 were postulated either singly or in different combinations among these cultivars. A high proportion of cultivars were identified to carry linked rust resistance genes Sr15 and Lr20. Although 51 cultivars showed variation against Puccinia striiformis f. sp. tritici (Pst) pathotypes used in this study, results were not clearly contrasting to enable postulation of stripe rust resistance genes in these genotypes. Stripe rust resistance gene Yr27 was postulated in four cultivars and Yr1 was present in cultivar Zebra. Cultivar Tjalve produced low stripe rust response against all Pst pathotypes indicating the presence either of a widely effective resistance gene or combination of genes with compensating pathogenic specificities. Several cultivars carried moderate to high level of APR to leaf rust and stripe rust. Seedling stem rust susceptible cultivar Aston exhibited moderately resistant to moderately susceptible response, whereas other cultivars belonging to this class were rated moderately susceptible or higher. Molecular markers linked with APR genes Yr48, Lr34/Yr18/Sr57, Lr68 and Sr2 detected the presence of these genes in some genotypes.
-
Shanahan, Erin; Irvine, Kathryn M.; Thoma, David P.; Wilmoth, Siri K.; Ray, Andrew; Legg, Kristin; Shovic, Henry
2016-01-01
Whitebark pine (Pinus albicaulis) forests in the western United States have been adversely affected by an exotic pathogen (Cronartium ribicola, causal agent of white pine blister rust), insect outbreaks (Dendroctonus ponderosae, mountain pine beetle), and drought. We monitored individual trees from 2004 to 2013 and characterized stand-level biophysical conditions through a mountain pine beetle epidemic in the Greater Yellowstone Ecosystem. Specifically, we investigated associations between tree-level variables (duration and location of white pine blister rust infection, presence of mountain pine beetle, tree size, and potential interactions) with observations of individual whitebark pine tree mortality. Climate summaries indicated that cumulative growing degree days in years 2006–2008 likely contributed to a regionwide outbreak of mountain pine beetle prior to the observed peak in whitebark mortality in 2009. We show that larger whitebark pine trees were preferentially attacked and killed by mountain pine beetle and resulted in a regionwide shift to smaller size class trees. In addition, we found evidence that smaller size class trees with white pine blister rust infection experienced higher mortality than larger trees. This latter finding suggests that in the coming decades white pine blister rust may become the most probable cause of whitebark pine mortality. Our findings offered no evidence of an interactive effect of mountain pine beetle and white pine blister rust infection on whitebark pine mortality in the Greater Yellowstone Ecosystem. Interestingly, the probability of mortality was lower for larger trees attacked by mountain pine beetle in stands with higher evapotranspiration. Because evapotranspiration varies with climate and topoedaphic conditions across the region, we discuss the potential to use this improved understanding of biophysical influences on mortality to identify microrefugia that might contribute to successful whitebark pine conservation
-
Aoun, Meriem; Kolmer, James A; Rouse, Matthew N; Chao, Shiaoman; Bulbula, Worku Denbel; Elias, Elias M; Acevedo, Maricelis
2017-12-01
Leaf rust, caused by Puccinia triticina, and stem rust, caused by P. graminis f. sp. tritici, are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to P. triticina race BBBQJ and stem rust resistance (Sr) genes to P. graminis f. sp. tritici race TTKSK in durum accessions. Eight leaf-rust-resistant genotypes were used to develop biparental populations. Accessions PI 192051 and PI 534304 were also resistant to P. graminis f. sp. tritici race TTKSK. The resulting progenies were phenotyped for leaf rust and stem rust response at seedling stage. The Lr and Sr genes were mapped in five populations using single-nucleotide polymorphisms and bulked segregant analysis. Five leaf-rust-resistant genotypes carried single dominant Lr genes whereas, in the remaining accessions, there was deviation from the expected segregation ratio of a single dominant Lr gene. Seven genotypes carried Lr genes different from those previously characterized in durum. The single dominant Lr genes in PI 209274, PI 244061, PI387263, and PI 313096 were mapped to chromosome arms 6BS, 2BS, 6BL, and 6BS, respectively. The Sr gene in PI 534304 mapped to 6AL and is most likely Sr13, while the Sr gene in PI 192051 could be uncharacterized in durum.
-
Incomplete resistance to coffee leaf rust (Hemileia vastatrix)
Eskes, A.B.
1983-01-01
Incomplete resistance to coffee leaf rust ( Hemileia vastatrix ) may be of value in obtaining durable resistance, which is of great importance for the perennial coffee crop. Methods were developed to assess incomplete resistance to coffee leaf rust by using illustrated scales
-
Genetic analysis of rust resistance genes in global wheat cultivars: an overview
International Nuclear Information System (INIS)
Aktar-Uz-Zaman, Md; Tuhina-Khatun, Mst; Hanafi, Mohamed Musa; Sahebi, Mahbod
2017-01-01
Rust is the most devastating fungal disease in wheat. Three rust diseases, namely, leaf or brown rust caused by Puccinia triticina Eriks, stem or black rust caused by Puccinia graminis f. sp. tritici West, and stripe or yellow rust caused by Puccinia striiformis f. Tritici Eriks, are the most economically significant and common diseases among global wheat cultivars. Growing cultivars resistant to rust is the most sustainable, cost-effective and environmentally friendly approach for controlling rust diseases. To date, more than 187 rust resistance genes (80 leaf rust, 58 stem rust and 49 stripe rust) have been derived from diverse wheat or durum wheat cultivars and the related wild species using different molecular methods. This review provides a detailed discussion of the different aspects of rust resistance genes, their primitive sources, their distribution in global wheat cultivars and the importance of durable resistant varieties for controlling rust diseases. This information will serve as a foundation for plant breeders and geneticists to develop durable rust-resistant wheat varieties through marker-assisted breeding or gene pyramiding
-
Leaf rust, caused by Puccinia triticina (Pt) and stem rust caused by Puccinia graminis f. sp. tritici (Pgt) are important diseases of durum wheat. This study determined the inheritance and genomic locations of leaf rust resistance (Lr) genes to Pt-race BBBQJ and stem rust resistance (Sr) genes to Pg...
-
R. A. Sniezko; A. Kegley; R. Danchok; J. Hamlin; J. Hill; D. Conklin
2011-01-01
Infection and mortality levels from Cronartium ribicola, the fungus causing white pine blister rust, are very high in parts of the geographic range of Pinus albicaulis (whitebark pine) and P. strobiformis (Southwestern white pine). Genetic resistance to this non-native fungus will be one of the key factors in maintaining or restoring populations of these species in...
-
Development of RAPD based markers for wheat rust resistance ...
African Journals Online (AJOL)
Rust diseases are the major cause of low yield of wheat in Pakistan. Wheat breeders all over the world as well as in Pakistan are deriving rust resistance genes from alien species like Triticum ventricosum and introducing them in common wheat (Triticum aestivum). One such example is the introgression of rust resistance ...
-
Sources of resistance to yellow rust and stem rust in wheat-alien introgressions
Rahmatov, Mahbubjon
2013-01-01
Wheat is the staple food and the main source of caloric intake in most developing countries, and thereby an important source in order to maintain food security for the growing populations in those countries. Stem rust Puccinia graminis f. sp. tritici, and yellow rust P. striiformis f. sp. tritici of wheat continues to cause severe damage locally and globally, thereby contributing to food insecurity. In this paper biology and taxonomy of stem rust and yellow rust, breeding for resistance, util...
-
Nonhost resistance to rust pathogens - a continuation of continua.
Bettgenhaeuser, Jan; Gilbert, Brian; Ayliffe, Michael; Moscou, Matthew J
2014-01-01
The rust fungi (order: Pucciniales) are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina), which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi) is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant-pathogen interactions in this intermediate state are characterized either by (1) the majority of accessions of a species being resistant to the rust or (2) the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host) to complete immunity within a species (nonhost). In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens.
-
Laboratory, greenhouse and field methods for screening rust-resistant wheat cultivars
International Nuclear Information System (INIS)
Mashaal, S.F.; Kiraly, Z.; Barabas, Z.; Barna, B.; Cereal Research Inst., Szeged, Hungary)
1977-01-01
Detached flag leaf cultures were not suitable for evaluation of stem-rust resistance in our screening programme. On the basis of yield evaluation it was possible to screen out ten stem-rust ''tolerant'' wheat lines in field experiments. Rusted and protected microplots of each line were paired within a replicate. After artificial inoculation, the protected plants were sprayed with fungicides (benomyl plus dithiocarbamate plus copper salt) at weekly intervals until maturation to keep each protected plot rust-free. The thousand-kernel weights of rusted and protected plots were compared. When the thousand-kernel weight of protected plot increased only slightly and the rust reaction type of plants was susceptible in the rusted plot, the line was screened out as putative ''tolerant''. On the basis of three-year field trial ten ''tolerant'' lines were selected. Nine out of ten lines proved to be resistant to two stem-rust races in greenhouse tests in the seedling stage, when resistance was determined on the basis of reduced spore production instead of infection types. Resistance of these seedlings related partly to the reduced number of pustules and partly to a slow rusting character of plants. It seems possible to screen resistant cultivars in the greenhouse by the method outlined in this paper, when resistance is determined on the basis of a reduced number of infection sites and/or by the slow rusting capacity. (author)
-
White pine blister rust in the interior Mountain West
Kelly Burns; Jim Blodgett; Dave Conklin; Brian Geils; Jim Hoffman; Marcus Jackson; William Jacobi; Holly Kearns; Anna Schoettle
2010-01-01
White pine blister rust is an exotic, invasive disease of white, stone, and foxtail pines (also referred to as white pines or five-needle pines) in the genus Pinus and subgenus Strobus (Price and others 1998). Cronartium ribicola, the fungus that causes WPBR, requires an alternate host - currants and gooseberries in the genus Ribes and species of Pedicularis...
-
Inheritance of resistance to orange rust in sugarcane
Orange rust, caused by Puccinia kuehnii, is an economically important disease in the Florida sugarcane industry. In this study, orange rust reactions of seedlings in progenies originating from 12 crosses between female and male parents with differing resistance to orange rust (three of each categor...
-
Current and future molecular approaches to investigate the white pine blister rust pathosystem
B. A. Richardson; A. K. M. Ekramoddoulah; J.-J. Liu; M.-S. Kim; N. B. Klopfenstein
2010-01-01
Molecular genetics is proving to be especially useful for addressing a wide variety of research and management questions on the white pine blister rust pathosystem. White pine blister rust, caused by Cronartium ribicola, is an ideal model for studying biogeography, genetics, and evolution because: (1) it involves an introduced pathogen; (2) it includes multiple primary...
-
Lan, Caixia; Zhang, Yelun; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Huerta-Espino, Julio; Lagudah, Evans S; Singh, Ravi P
2015-03-01
Two new co-located resistance loci, QLr.cim - 1AS/QYr.cim - 1AS and QLr.cim - 7BL/YrSuj , in combination with Lr46 / Yr29 and Lr67/Yr46 , and a new leaf rust resistance quantitative trait loci, conferred high resistance to rusts in adult plant stage. The tall Indian bread wheat cultivar Sujata displays high and low infection types to leaf rust and stripe rust, respectively, at the seedling stage in greenhouse tests. It was also highly resistant to both rusts at adult plant stage in field trials in Mexico. The genetic basis of this resistance was investigated in a population of 148 F5 recombinant inbred lines (RILs) derived from the cross Avocet × Sujata. The parents and RIL population were characterized in field trials for resistance to leaf rust during 2011 at El Batán, and 2012 and 2013 at Ciudad Obregón, Mexico, and for stripe rust during 2011 and 2012 at Toluca, Mexico; they were also characterized three times for stripe rust at seedling stage in the greenhouse. The RILs were genotyped with diversity arrays technology and simple sequence repeat markers. The final genetic map was constructed with 673 polymorphic markers. Inclusive composite interval mapping analysis detected two new significant co-located resistance loci, QLr.cim-1AS/QYr.cim-1AS and QLr.cim-7BL/YrSuj, on chromosomes 1AS and 7BL, respectively. The chromosomal position of QLr.cim-7BL overlapped with the seedling stripe rust resistance gene, temporarily designated as YrSuj. Two previously reported pleiotropic adult plant resistance genes, Lr46/Yr29 and Lr67/Yr46, and a new leaf rust resistance quantitative trait loci derived from Avocet were also mapped in the population. The two new co-located resistance loci are expected to contribute to breeding durable rust resistance in wheat. Closely linked molecular markers can be used to transfer all four resistance loci simultaneously to modern wheat varieties.
-
Muleta, Kebede T; Rouse, Matthew N; Rynearson, Sheri; Chen, Xianming; Buta, Bedada G; Pumphrey, Michael O
2017-08-04
The narrow genetic basis of resistance in modern wheat cultivars and the strong selection response of pathogen populations have been responsible for periodic and devastating epidemics of the wheat rust diseases. Characterizing new sources of resistance and incorporating multiple genes into elite cultivars is the most widely accepted current mechanism to achieve durable varietal performance against changes in pathogen virulence. Here, we report a high-density molecular characterization and genome-wide association study (GWAS) of stripe rust and stem rust resistance in 190 Ethiopian bread wheat lines based on phenotypic data from multi-environment field trials and seedling resistance screening experiments. A total of 24,281 single nucleotide polymorphism (SNP) markers filtered from the wheat 90 K iSelect genotyping assay was used to survey Ethiopian germplasm for population structure, genetic diversity and marker-trait associations. Upon screening for field resistance to stripe rust in the Pacific Northwest of the United States and Ethiopia over multiple growing seasons, and against multiple races of stripe rust and stem rust at seedling stage, eight accessions displayed resistance to all tested races of stem rust and field resistance to stripe rust in all environments. Our GWAS results show 15 loci were significantly associated with seedling and adult plant resistance to stripe rust at false discovery rate (FDR)-adjusted probability (P) rust in the Ethiopian wheat accessions. Many of the identified resistance loci were mapped close to previously identified rust resistance genes; however, three loci on the short arms of chromosomes 5A and 7B for stripe rust resistance and two on chromosomes 3B and 7B for stem rust resistance may be novel. Our results demonstrate that considerable genetic variation resides within the landrace accessions that can be utilized to broaden the genetic base of rust resistance in wheat breeding germplasm. The molecular markers identified in
-
Yellow Rust Resistance in Advanced Lines and Commercial ...
African Journals Online (AJOL)
The objective of this study was to characterize seedling yellow rust resistance in 21 advanced bread wheat lines and 20 cultivars from Ethiopia. Yellow rust infection types (ITs) produced on test wheat lines and cultivars from nine yellow rust races were compared with ITs produced on standard differential lines that differed ...
-
Two distinct classes of QTL determine rust resistance in sorghum.
Wang, Xuemin; Mace, Emma; Hunt, Colleen; Cruickshank, Alan; Henzell, Robert; Parkes, Heidi; Jordan, David
2014-12-31
Agriculture is facing enormous challenges to feed a growing population in the face of rapidly evolving pests and pathogens. The rusts, in particular, are a major pathogen of cereal crops with the potential to cause large reductions in yield. Improving stable disease resistance is an on-going major and challenging focus for many plant breeding programs, due to the rapidly evolving nature of the pathogen. Sorghum is a major summer cereal crop that is also a host for a rust pathogen Puccinia purpurea, which occurs in almost all sorghum growing areas of the world, causing direct and indirect yield losses in sorghum worldwide, however knowledge about its genetic control is still limited. In order to further investigate this issue, QTL and association mapping methods were implemented to study rust resistance in three bi-parental populations and an association mapping set of elite breeding lines in different environments. In total, 64 significant or highly significant QTL and 21 suggestive rust resistance QTL were identified representing 55 unique genomic regions. Comparisons across populations within the current study and with rust QTL identified previously in both sorghum and maize revealed a high degree of correspondence in QTL location. Negative phenotypic correlations were observed between rust, maturity and height, indicating a trend for both early maturing and shorter genotypes to be more susceptible to rust. The significant amount of QTL co-location across traits, in addition to the consistency in the direction of QTL allele effects, has provided evidence to support pleiotropic QTL action across rust, height, maturity and stay-green, supporting the role of carbon stress in susceptibility to rust. Classical rust resistance QTL regions that did not co-locate with height, maturity or stay-green QTL were found to be significantly enriched for the defence-related NBS-encoding gene family, in contrast to the lack of defence-related gene enrichment in multi-trait effect
-
2010-01-01
... INDUSTRIES § 23.10 Misuse of “corrosion proof,” “noncorrosive,” “corrosion resistant,” “rust proof,” “rust resistant,” etc. (a) It is unfair or deceptive to: (1) Use the terms “corrosion proof,” “noncorrosive... the product will be immune from rust and other forms of corrosion during the life expectancy of the...
-
Patrick J. Vogan; Anna W. Schoettle
2015-01-01
Limber pine (Pinus flexilis) mortality is increasing across the West as a result of the combined stresses of white pine blister rust (Cronartium ribicola; WPBR), mountain pine beetle (Dendroctonus ponderosae), and dwarf mistletoe (Arceuthobium cyanocarpum) in a changing climate. With the continued spread of WPBR, extensive mortality will continue with strong selection...
-
Nonhost resistance to rust pathogens – a continuation of continua
Directory of Open Access Journals (Sweden)
Jan eBettgenhaeuser
2014-12-01
Full Text Available The rust fungi (order: Pucciniales are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina, which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant-pathogen interactions in this intermediate state are characterized either by (1 the majority of accessions of a species being resistant to the rust or (2 the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host to complete immunity within a species (nonhost. In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens.
-
Nonhost resistance to rust pathogens – a continuation of continua
Bettgenhaeuser, Jan; Gilbert, Brian; Ayliffe, Michael; Moscou, Matthew J.
2014-01-01
The rust fungi (order: Pucciniales) are a group of widely distributed fungal plant pathogens, which can infect representatives of all vascular plant groups. Rust diseases significantly impact several crop species and considerable research focuses on understanding the basis of host specificity and nonhost resistance. Like many pathogens, rust fungi vary considerably in the number of hosts they can infect, such as wheat leaf rust (Puccinia triticina), which can only infect species in the genera Triticum and Aegilops, whereas Asian soybean rust (Phakopsora pachyrhizi) is known to infect over 95 species from over 42 genera. A greater understanding of the genetic basis determining host range has the potential to identify sources of durable resistance for agronomically important crops. Delimiting the boundary between host and nonhost has been complicated by the quantitative nature of phenotypes in the transition between these two states. Plant–pathogen interactions in this intermediate state are characterized either by (1) the majority of accessions of a species being resistant to the rust or (2) the rust only being able to partially complete key components of its life cycle. This leads to a continuum of disease phenotypes in the interaction with different plant species, observed as a range from compatibility (host) to complete immunity within a species (nonhost). In this review we will highlight how the quantitative nature of disease resistance in these intermediate interactions is caused by a continuum of defense barriers, which a pathogen needs to overcome for successfully establishing itself in the host. To illustrate continua as this underlying principle, we will discuss the advances that have been made in studying nonhost resistance towards rust pathogens, particularly cereal rust pathogens. PMID:25566270
-
Induced mutations for soybean rust resistance
International Nuclear Information System (INIS)
Smutkupt, S.; Wongpiyasatid, A.; Lamseejan, S.
1983-01-01
Soybean mutation experiments for inducing rust resistance in the cultivars G 8375, Wakashima mutant number 10, Taichung N, S.J.2, S.J.4, BM 50, BM 98, G 8377, G 8586 and G 8587 have been carried out since 1979. Six pods from each of 4438 control and 43,907 M 1 plants were randomly harvested. M 2 seeds of each cultivar of different doses were bulked (M 2 bulk). In addition, 270 good M 1 plants were selected and threshed singly (M 2 single). M 2 -bulk and M 2 -single seeds were advanced to M 3 . Both, M 3 -bulk and M 3 -single plants, together with the remaining M 2 -bulk seeds were screened for rust resistance in the rainy season of 1980 in Nong Hoi Valley (altitude about 1000 m above sea level) and at Mae Joe Station, both in Chiang Mai Province (latitude 18 deg. 31'-19 deg. N). Based on the IWGSR rating system, soybean plants with slow growth of rust were selected from both locations. The results were as follows: Six plants were selected from a total of 2802 control plants, and 115 from a total of 28,834 M 2 and M 3 plants. Further evaluation of these selections for rust resistance will be carried out in the rainy season of 1981 in Nong Hoi Valley, Chiang Mai. (author)
-
LEAF WHORL INOCULATION METHOD FOR SCREENING SUGARCANE RUST RESISTANCE
Technical Abstract: Sugarcane rust diseases, brown rust caused by Puccinia melanocephala, and orange rust caused by P. kuehnii, are agronomically important diseases in Florida. Cultivar resistance is the best means of controlling these diseases. Natural infection has been the primary means of asses...
-
Characteristics of Blister Rust Cankers on Eastern White Pine
William R. Phelps; Ray Weber
1969-01-01
The growth, development, and sporulation of white pine blister rust cankers were studied on eastern white pine in Wisconsin and Minnesota. Three district canker types were identified on the basis of physical appearance, growth rate, and sporulation. Canker growth rate and sporulation decreased as tree size or age increased, and many cankers apparently became inactive...
-
White pines, Ribes, and blister rust: integration and action
R. S. Hunt; B. W. Geils; K. E. Hummer
2010-01-01
The preceding articles in this series review the history, biology and management of white pine blister rust in North America, Europe and eastern Asia. In this integration, we connect and discuss seven recurring themes important for understanding and managing epidemics of Cronartium ribicola in the white pines (five-needle pines in subgenus Strobus). Information and...
-
Studies on stem and leaf rust resistance in wheat
International Nuclear Information System (INIS)
Knott, D.R.
1983-01-01
Stem and leaf rust resistance was successfully transferred from Agropyron to wheat by radiation-induced translocations. Mutation induction subsequently proved to be useful in separating an undesired gene for yellow pigment from the resistance. The homoeologous pairing mutant obtained by Sears was also used successfully in obtaining transfers through crossing-over between wheat and Agropyron chromosomes. Another experimental series succeeded in accumulating minor genes for rust resistance, after eliminating major genes for specific resistance. The resistance is polygenic and widely effective although not general. It is recessively inherited, and hoped to be more durable than major gene resistance used so far in the Canadian prairies. An attempt to induce mutations for leaf rust resistance in a small-scale experiment with leading Canadian wheat varieties Manitou and Neepawa using gamma rays and EMS has not been successful. (author)
-
Vatter, Thomas; Maurer, Andreas; Perovic, Dragan; Kopahnke, Doris; Pillen, Klaus; Ordon, Frank
2018-01-01
The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM) was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars.
-
Molecular dissection of white pine genetic resistance to Cronartium ribicola
Jun-Jun Liu; Richard Sniezko
2011-01-01
Pinus monticola (Dougl. ex D. Don.) maintains a complex defence system that detects white pine blister rust pathogen (Cronartium ribicola J.C.Fisch.) and activates resistance responses. A thorough understanding of how it functions at the molecular level would provide us new strategies for creating forest trees with durable disease resistance. Our research focuses on...
-
29-34 Yellow Rust Resistance in Advanced Lines and Commercial ...
African Journals Online (AJOL)
rust pathogen. The objective of this study was to characterize seedling yellow rust resistance in 21 advanced bread wheat lines and 20 cultivars from Ethiopia. Yellow rust infection types (ITs) produced on test wheat lines and cultivars from nine yellow rust races were compared with ITs produced on standard differential lines ...
-
Identification of leaf rust resistant gene Lr10 in Pakistani wheat ...
African Journals Online (AJOL)
Leaf (brown) rust is the major disease of wheat in Pakistan and other countries. The disease is more effectively controlled when several rust resistance genes are pyramided into a single line. Molecular survey was conducted to screen 25 Pakistan wheat germplasm for the presence of leaf rust resistance gene Lr10 using ...
-
Directory of Open Access Journals (Sweden)
Patricia E. Maloney
2016-04-01
Full Text Available Throughout much of the range of western white pine, Pinus monticola Dougl., timber harvesting, fire exclusion and the presence of Cronartium ribicola J. C. Fisch., the white pine blister rust (WPBR pathogen, have led to negative population and genetic consequences. To address these interactions, we examined population dynamics and genetic diversity in 10 populations of western white pine in upper montane forests of the Lake Tahoe Basin. We documented negative population trends for three of the 10 populations. These populations exhibited low estimated growth rates (λ, moderate to high incidences of WPBR and mountain pine beetle (MPB, and high levels of mortality. In contrast, seven populations appear to be stable (λ ≥ 1.0, with low to moderate disease and insect incidence, and evidence for genetic resistance to WPBR. Genetic diversity (HE for a set of 160 single nucleotide polymorphisms was in the range of 0.245–0.272 across populations, and population-specific estimates of FST ranged from 0.0062 to 0.0244. Allele frequency of the Cr2 gene, which confers complete resistance to C. ribicola in western white pine, was low, averaging 0.009 for all populations sampled. However, a low frequency of pollen receptors (i.e., susceptible maternal parents pollinated by a local resistant parent was found in nine of 10 populations. A moderate and negative relationship was found between the frequency of pollen receptors in a population and the incidence of WPBR (r2 = 0.32. In the context of an introduced pathogen, climate driven outbreaks of MPB, fire exclusion, and prolonged drought, conservation and management strategies are warranted for this species in the Lake Tahoe Basin and likely other locations in California. These strategies include gene conservation of western white pine, WPBR resistance screening, and forest restoration treatments.
-
Vatter, Thomas; Maurer, Andreas; Perovic, Dragan; Kopahnke, Doris; Pillen, Klaus
2018-01-01
The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM) was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars. PMID:29370232
-
Directory of Open Access Journals (Sweden)
Thomas Vatter
Full Text Available The biotrophic rust fungi Puccinia hordei and Puccinia striiformis are important barley pathogens with the potential to cause high yield losses through an epidemic spread. The identification of QTL conferring resistance to these pathogens is the basis for targeted breeding approaches aiming to improve stripe rust and leaf rust resistance of modern cultivars. Exploiting the allelic richness of wild barley accessions proved to be a valuable tool to broaden the genetic base of resistance of barley cultivars. In this study, SNP-based nested association mapping (NAM was performed to map stripe rust and leaf rust resistance QTL in the barley NAM population HEB-25, comprising 1,420 lines derived from BC1S3 generation. By scoring the percentage of infected leaf area, followed by calculation of the area under the disease progress curve and the average ordinate during a two-year field trial, a large variability of resistance across and within HEB-25 families was observed. NAM based on 5,715 informative SNPs resulted in the identification of twelve and eleven robust QTL for resistance against stripe rust and leaf rust, respectively. Out of these, eight QTL for stripe rust and two QTL for leaf rust are considered novel showing no overlap with previously reported resistance QTL. Overall, resistance to both pathogens in HEB-25 is most likely due to the accumulation of numerous small effect loci. In addition, the NAM results indicate that the 25 wild donor QTL alleles present in HEB-25 strongly differ in regard to their individual effect on rust resistance. In future, the NAM concept will allow to select and combine individual wild barley alleles from different HEB parents to increase rust resistance in barley. The HEB-25 results will support to unravel the genetic basis of rust resistance in barley, and to improve resistance against stripe rust and leaf rust of modern barley cultivars.
-
Legume breeding for rust resistance: Lessons to learn from the model Medicago truncatula
Rubiales, Diego; Castillejo Sánchez, M. Ángeles; Madrid, Eva; Barilli, Eleonora; Rispail, Nicolas
2011-01-01
Rusts are major biotic constraints of legumes worldwide. Breeding for rust resistance is regarded as the most cost efficient method for rust control. However, in contrast to common bean for which complete monogenic resistance exists and is efficiently used, most of the rust resistance reactions described so far in cool season food legumes are incomplete and of complex inheritance. Incomplete resistance has been described in faba bean, pea, chickpea and lentil and several of their associated Q...
-
Biology and pathology of Ribes and their implications for management of white pine blister rust
P. J. Zambino
2010-01-01
Ribes (currants and gooseberries) are telial hosts for the introduced and invasive white pine blister rust fungus, Cronartium ribicola. Knowledge of wild and introduced Ribes helps us understand the epidemiology of blister rust on its aecial hosts, white pines, and develop disease control and management strategies. Ribes differ by species in their contribution to...
-
A reassessment of the risk of rust fungi developing resistance to fungicides.
Oliver, Richard P
2014-11-01
Rust fungi are major pathogens of many annual and perennial crops. Crop protection is largely based on genetic and chemical control. Fungicide resistance is a significant issue that has affected many crop pathogens. Some pathogens have rapidly developed resistance and hence are regarded as high-risk species. Rust fungi have been classified as being low risk, in spite of sharing many relevant features with high-risk pathogens. An examination of the evidence suggests that rust fungi may be wrongly classified as low risk. Of the nine classes of fungicide to which resistance has developed, six are inactive against rusts. The three remaining classes are quinone outside inhibitors (QoIs), demethylation inhibitors (DMIs) and succinate dehydrogenase inhibitors (SDHIs). QoIs have been protected by a recently discovered intron that renders resistant mutants unviable. Low levels of resistance have developed to DMIs, but with limited field significance. Older SDHI fungicides were inactive against rusts. Some of the SDHIs introduced since 2003 are active against rusts, so it may be that insufficient time has elapsed for resistance to develop, especially as SDHIs are generally sold in mixtures with other actives. It would therefore seem prudent to increase the level of vigilance for possible cases of resistance to established and new fungicides in rusts. © 2014 Society of Chemical Industry.
-
Robert E. Keane; Anna W. Schoettle
2011-01-01
Many ecologically important, five-needle white pine forests that historically dominated the high elevation landscapes of western North America are now being heavily impacted by mountain pine beetle (Dendroctonus spp.) outbreaks, the exotic disease white pine blister rust (WPBR), and altered high elevation fire regimes. Management intervention using specially designed...
-
White pines, Ribes, and blister rust: a review and synthesis
Brian W. Geils; Kim E. Hummer; Richard S. Hunt
2010-01-01
For over a century, white pine blister rust (Cronartium ribicola) has linked white pines (Strobus) with currants and gooseberries (Ribes) in a complex and serious disease epidemic in Asia, Europe, and North America. Because of ongoing changes in climate, societal demands for forests and their amenities, and scientific advances in genetics and proteomics, our current...
-
Induced mutations for resistance to leaf rust in wheat
International Nuclear Information System (INIS)
Borojevic, K.
1983-01-01
Problems related to the induction of mutations for disease resistance were investigated under several aspects, using the wheat/leaf rust system. Previously selected mutant lines, tested in M 11 and M 13 , were found to differ with regard to infection type and disease severity from the original varieties. To verify the induced-mutation origin, these mutants were examined further using test crosses with carriers of known genes for leaf rust resistance and electrophoresis. A separate experiment to induce mutations for leaf rust resistance in the wheat varieties Sava, Aurora and Siete Cerros, using gamma rays, fast neutrons and EMS, yielded mutants with different disease reaction in the varieties Sava and Aurora at a frequency of about 1x10 - 3 per M 1 plant progenies. (author)
-
Resistance Potential of Bread Wheat Genotypes Against Yellow Rust Disease Under Egyptian Climate.
Mahmoud, Amer F; Hassan, Mohamed I; Amein, Karam A
2015-12-01
Yellow rust (stripe rust), caused by Puccinia striiformis f. sp. tritici, is one of the most destructive foliar diseases of wheat in Egypt and worldwide. In order to identify wheat genotypes resistant to yellow rust and develop molecular markers associated with the resistance, fifty F8 recombinant inbred lines (RILs) derived from a cross between resistant and susceptible bread wheat landraces were obtained. Artificial infection of Puccinia striiformis was performed under greenhouse conditions during two growing seasons and relative resistance index (RRI) was calculated. Two Egyptian bread wheat cultivars i.e. Giza-168 (resistant) and Sakha-69 (susceptible) were also evaluated. RRI values of two-year trial showed that 10 RILs responded with RRI value >6 2 rust. However, further molecular analyses would be performed to confirm markers associated with the resistance and suitable for marker-assisted selection. Resistant RILs identified in the study could be efficiently used to improve the resistance to yellow rust in wheat.
-
Millet, E; Manisterski, J; Ben-Yehuda, P; Distelfeld, A; Deek, J; Wan, A; Chen, X; Steffenson, B J
2014-06-01
Leaf rust and stripe rust are devastating wheat diseases, causing significant yield losses in many regions of the world. The use of resistant varieties is the most efficient way to protect wheat crops from these diseases. Sharon goatgrass (Aegilops sharonensis or AES), which is a diploid wild relative of wheat, exhibits a high frequency of leaf and stripe rust resistance. We used the resistant AES accession TH548 and induced homoeologous recombination by the ph1b allele to obtain resistant wheat recombinant lines carrying AES chromosome segments in the genetic background of the spring wheat cultivar Galil. The gametocidal effect from AES was overcome by using an "anti-gametocidal" wheat mutant. These recombinant lines were found resistant to highly virulent races of the leaf and stripe rust pathogens in Israel and the United States. Molecular DArT analysis of the different recombinant lines revealed different lengths of AES segments on wheat chromosome 6B, which indicates the location of both resistance genes.
-
Stem and stripe rust resistance in wheat induced by gamma rays and thermal neutrons
International Nuclear Information System (INIS)
Skorda, E.A.
1977-01-01
Attempts were made to produce rust-resistant mutants in wheat cultivars. Seeds of G-38290 and G-58383 (T. aestivum), Methoni and Ilectra (T. durum) varieties were irradiated with different doses of γ-rays (3.5, 5, 8, 11, 15 and 21 krad) and thermal neutrons (1.7, 4, 5.5, 7.5, 10.5 and 12.5x10 12 ) and the M 1 plants were grown under isolation in the field. The objective was mainly to induce stripe, leaf and stem rust resistance in G-38290, Methoni and Ilectra varieties and leaf rust resistance in G-58383. Mutations for rust resistance were detected by using the ''chimera method'' under natural and artificial field epiphytotic conditions in M 2 and successive generations. The mutants detected were tested for resistance to a broad spectrum of available races. Mutants resistant or moderately resistant to stripe and stem rusts but not to leaf rust, were selected from G-38290. From the other three varieties tested no rust-resistant mutants were detected. The frequency of resistant mutants obtained increased with increased γ-ray dose-rate, but not with increased thermal neutron doses. Some mutants proved to be resistant or moderately resistant to both rusts and others to one of them. Twenty of these mutants were evaluated for yield from M 5 to M 8 . Some of them have reached the final stage of regional yield trials and one, induced by thermal neutrons, was released this year. (author)
-
Mee-Sook Kim; Bryce A. Richardson; Geral I. McDonald; Ned B. Klopfenstein
2010-01-01
Western white pine (Pinus monticola) is an economically and ecologically important species in western North America that has declined in prominence over the past several decades, mainly due to the introduction of Cronartium ribicola (cause of white pine blister rust) and reduced opportunities for regeneration. Amplified fragment length polymorphism (AFLP) markers were...
-
Molecular mapping of a sunflower rust resistance gene from HAR6.
Bulos, Mariano; Ramos, María L; Altieri, Emiliano; Sala, Carlos A
2013-03-01
Sunflower rust, caused by Puccinia helianthi Schw., can result in significant yield losses in cultivated sunflower (Helianthus annuus L. var. macrocarpus Ckll.). HAR6 is a germplasm population resistant to most predominant rust races. The objectives of this study were to map the resistance factor present in HAR6 (R HAR6 ), and to provide and validate molecular tools for the identification of this gene for marker assisted selection purposes. Virulence reaction of seedlings for the F2 population and F2:3 families suggested that a single dominant gene confers rust resistance in HAR6-1, a selected rust resistance line from the original population. Genetic mapping with eight markers covered 97.4 cM of genetic distance on linkage group 13 of the sunflower consensus map. A co-dominant marker ZVG61 is the closest marker distal to R HAR6 at a genetic distance of 0.7 cM, while ORS581, a dominant marker linked in the coupling phase, is proximal to R HAR6 at a genetic distance of 1.5 cM. Validation of these markers was assessed by converting a susceptible line into a rust resistant isoline by means of marker assisted backcrossing. The application of these results to assist the breeding process and to design new strategies for rust control in sunflower is discussed.
-
HOW TO Identify White Pine Blister Rust and Remove Cankers
Thomas H. Nicholls; Robert L. Anderson
1977-01-01
White pine blister rust (caused by the fungus Cronartium ribicola J. C. Fisch. ex Rabenh.) was introduced into the United States about 1900 and has since spread throughout the range of white pine. The disease intensity varies throughout the range but is normally most severe where late summers (July-September) are cool (below 67? F) and damp, conditions necessary for...
-
Transfer of stripe rust resistance from Aegilops variabilis to bread ...
African Journals Online (AJOL)
In terms of area, the bread wheat producing regions of China comprise the largest area in the world that is constantly threatened by stripe rust epidemics. Consequently, it is important to exploit new adultplant resistance genes in breeding. This study reports the transfer of stripe rust resistance from Aegilops variabilis to ...
-
Patricia Maloney; Andrew Eckert; Detlev Vogler; Camille Jensen; Annette Delfino Mix; David Neale
2016-01-01
Throughout much of the range of western white pine, Pinus monticola Dougl., timber harvesting, fire exclusion and the presence of Cronartium ribicola J. C. Fisch., the white pine blister rust (WPBR) pathogen, have led to negative population and genetic consequences. To address these interactions, we examined population dynamics...
-
Studies of the genetics of inheritance of stem rust resistance in ...
African Journals Online (AJOL)
Five resistant wheat lines (KSL-2, KSL-3, KSL-5, KSL-12 and KSL-19) which were resistant in tests during 2008, 2009 and 2010 were used as parents in crosses with stem rust susceptible line CACUKE to develop genetic populations for determining the inheritance of resistance to stem rust. F3 populations were evaluated ...
-
Appraisal of wheat germplasm for adult plant resistance against stripe rust
Directory of Open Access Journals (Sweden)
Saleem Kamran
2015-12-01
Full Text Available The resurgence of wheat stripe rust is of great concern for world food security. Owing to resistance breakdown and the appearance of new virulent high-temperature adapted races of Puccinia striiformis f. sp. tritici (Pst, many high yielding commercial varieties in the country lost their yield potential. Searching for new sources of resistance is the best approach to mitigate the problem. Quantitative resistance (partial or adult plant or durable resistance is reported to be more stable than race specific resistance. In the current perusal, a repertoire of 57 promising wheat lines along with the KLcheck line Morocco, developed through hybridisation and selection of local and international lines with International Maize and Wheat Improvement Center (CIMMYT origin, were evaluated under natural field conditions at Nuclear Institute for Agriculture and Biology (NIAB during the 2012−2013 and 2013−2014 time periods. Final rust severity (FRS, the area under the rust progress curve (AURPC, the relative area under the rust progress curve (rAURPC, and the coefficient of infection (CI were unraveled to infer the level of quantitative resistance. Final rust severity was recorded when the susceptible check exhibited 100% severity. There were 21 lines which were immune (no disease, 16 which were resistant, five moderately resistant, two resistant-to-moderately resistant, one moderately resistant-to-moderately susceptible, 5 moderately susceptible-to-susceptible, one moderately susceptible, and six exhibited a susceptible response. Nevertheless, 51 lines exhibited a high level of partial resistance while the three lines, NW-5-1212-1, NW-7-30-1, and NW-7-5 all showed a moderate level of partial resistance based on FRS, while 54 lines, on the basis of AURPC and rAURPC, were identified as conferring a high level of partial resistance. Moreover, adult plant resistance was conferred by 47 wheat lines, based on CI value. It was striking that, 13 immune lines
-
Genome-Wide Association Mapping of Crown Rust Resistance in Oat Elite Germplasm.
Klos, Kathy Esvelt; Yimer, Belayneh A; Babiker, Ebrahiem M; Beattie, Aaron D; Bonman, J Michael; Carson, Martin L; Chong, James; Harrison, Stephen A; Ibrahim, Amir M H; Kolb, Frederic L; McCartney, Curt A; McMullen, Michael; Fetch, Jennifer Mitchell; Mohammadi, Mohsen; Murphy, J Paul; Tinker, Nicholas A
2017-07-01
Oat crown rust, caused by f. sp. , is a major constraint to oat ( L.) production in many parts of the world. In this first comprehensive multienvironment genome-wide association map of oat crown rust, we used 2972 single-nucleotide polymorphisms (SNPs) genotyped on 631 oat lines for association mapping of quantitative trait loci (QTL). Seedling reaction to crown rust in these lines was assessed as infection type (IT) with each of 10 crown rust isolates. Adult plant reaction was assessed in the field in a total of 10 location-years as percentage severity (SV) and as infection reaction (IR) in a 0-to-1 scale. Overall, 29 SNPs on 12 linkage groups were predictive of crown rust reaction in at least one experiment at a genome-wide level of statistical significance. The QTL identified here include those in regions previously shown to be linked with seedling resistance genes , , , , , and and also with adult-plant resistance and adaptation-related QTL. In addition, QTL on linkage groups Mrg03, Mrg08, and Mrg23 were identified in regions not previously associated with crown rust resistance. Evaluation of marker genotypes in a set of crown rust differential lines supported as the identity of . The SNPs with rare alleles associated with lower disease scores may be suitable for use in marker-assisted selection of oat lines for crown rust resistance. Copyright © 2017 Crop Science Society of America.
-
J. Dunlap
2011-01-01
White pine blister rust (caused by the non-native pathogen Cronartium ribicola) reached northern California about 80 years ago. Over the years its spread southward had been primarily recorded on sugar pine. However, observations on its occurrence had also been reported in several of the higher elevation five-needled white pine species in California. Since the late...
-
Studies on general resistance to stem rust in wheat
International Nuclear Information System (INIS)
Knott, D.R.
1977-01-01
Eight cultivars that were thought to have field resistance to stem rust were selected and crossed to produce four four-cultivar hybrids. From those crosses lines were produced that lacked seedling resistance to race 15B-1 of stem rust but had good field resistance to it. They also proved to have field resistance to many other races and it is hoped that the resistance is general. Genetic studies indicated that there is some variation in the lines, but resistance is generally inherited as a quantitative character with several largely recessive genes having small additive effects. This suggests that in an induced mutation programme, no one plant is likely to accumulate sufficient mutant genes that it will appear resistant. (author)
-
Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.
Hiebert, Colin W; Kolmer, James A; McCartney, Curt A; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N; Spielmeyer, Wolfgang
2016-01-01
Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.
-
Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael
2017-07-01
The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
-
Molecular tagging of a novel rust resistance gene R(12) in sunflower (Helianthus annuus L.).
Gong, L; Hulke, B S; Gulya, T J; Markell, S G; Qi, L L
2013-01-01
Sunflower production in North America has recently suffered economic losses in yield and seed quality from sunflower rust (Puccinia helianthi Schwein.) because of the increasing incidence and lack of resistance to new rust races. RHA 464, a newly released sunflower male fertility restorer line, is resistant to both of the most predominant and most virulent rust races identified in the Northern Great Plains of the USA. The gene conditioning rust resistance in RHA 464 originated from wild Helianthus annuus L., but has not been molecularly marked or determined to be independent from other rust loci. The objectives of this study are to identify molecular markers linked to the rust resistance gene and to investigate the allelism of this gene with the unmapped rust resistance genes present in HA-R6, HA-R8 and RHA 397. Virulence phenotypes of seedlings for the F(2) population and F(2:3) families suggested that a single dominant gene confers rust resistance in RHA 464, and this gene was designated as R(12). Bulked segregant analysis identified ten markers polymorphic between resistant and susceptible bulks. In subsequent genetic mapping, the ten markers covered 33.4 cM of genetic distance on linkage group 11 of sunflower. A co-dominant marker CRT275-11 is the closest marker distal to R(12) with a genetic distance of 1.0 cM, while ZVG53, a dominant marker linked in the repulsion phase, is proximal to R(12) with a genetic distance of 9.6 cM. The allelism test demonstrated that R(12) is not allelic to the rust resistance genes in HA-R6, HA-R8 and RHA 397, and it is also not linked to any previously mapped rust resistance genes. Discovery of the R(12) novel rust resistance locus in sunflower and associated markers will potentially support the molecular marker-assisted introgression and pyramiding of R(12) into sunflower breeding lines.
-
Mapping of stripe rust resistance gene in an Aegilops caudata ...
Indian Academy of Sciences (India)
PUNEET INDER TOOR
A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated .... infector rows and experimental material with the mixture of uredinospores of Pst ...
-
Zhang, Zhi; Song, Liqiang; Han, Haiming; Zhou, Shenghui; Zhang, Jinpeng; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui
2017-11-13
Stripe rust, caused by Puccinia striiformis f. sp. tritici ( Pst ), is one of the most destructive diseases of wheat ( Triticum aestivum L.) worldwide. Agropyron cristatum (L.) Gaertn. (2 n = 28, PPPP), one of the wild relatives of wheat, exhibits resistance to stripe rust. In this study, wheat- A . cristatum 6P disomic addition line 4844-12 also exhibited resistance to stripe rust. To identify the stripe rust resistance locus from A . cristatum 6P, ten translocation lines, five deletion lines and the BC₂F₂ and BC₃F₂ populations of two wheat- A . cristatum 6P whole-arm translocation lines were tested with a mixture of two races of Pst in two sites during 2015-2016 and 2016-2017, being genotyped with genomic in situ hybridization (GISH) and molecular markers. The result indicated that the locus conferring stripe rust resistance was located on the terminal 20% of 6P short arm's length. Twenty-nine 6P-specific sequence-tagged-site (STS) markers mapped on the resistance locus have been acquired, which will be helpful for the fine mapping of the stripe rust resistance locus. The stripe rust-resistant translocation lines were found to carry some favorable agronomic traits, which could facilitate their use in wheat improvement. Collectively, the stripe rust resistance locus from A . cristatum 6P could be a novel resistance source and the screened stripe rust-resistant materials will be valuable for wheat disease breeding.
-
Induced mutations for rust resistance in bread wheat
International Nuclear Information System (INIS)
Sawhney, R.N.
1989-01-01
Full text: Seeds of variety ''Lalbahadur'' were treated with 0.04% NMH. M 2 plants were inoculated with a mixture of pathotypes of each of the 3 Puccinia species (P. graminis, P. recondita, P. striiformis). Plants with simultaneous resistance to all 3 rusts were selected. Repeated testing in subsequent generations confirmed the resistance. The mutant lines are morphologically similar to the parent cultivar and therefore could be used as components of a multiline variety. Comparison of variety pattern against the Indian pathotypes of rusts suggests that the mutant genes are different from the ones known already in bread wheat. (author)
-
Antibiotic Treatment of Blister Rust Cankers in Eastern White Pine
William R. Phelps; Ray Weber
1970-01-01
Cycloheximide (Acti-dione) and Phytoactin antibiotics, applied as basal stem treatments, aerial spray treatments, and complete foliar drenches were not effective in controlling blister rust cankers in eastern white pine. Cycloheximide was effective in suppressing canker activity and growth if directly applied to scarified cankers.
-
Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in ‘Thatcher’ Wheat
Hiebert, Colin W.; Kolmer, James A.; McCartney, Curt A.; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N.; Spielmeyer, Wolfgang
2016-01-01
Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. ‘Thatcher’ wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in ‘Thatcher’ and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for ‘Thatcher’-derived APR in several environments and this resistance was enhanced in the presence of Lr34. PMID:27309724
-
Rahmatov, Mahbubjon
2016-01-01
Bread wheat (Triticum aestivum L., 2n = 6x = 42, AABBDD) is one of the most important food crops world-wide, but is attacked by many diseases and pests that cause significant yield losses. Globally, stem rust (Sr) (Puccinia graminis f. sp. tritici Erikss & E. Henning), stripe rust (Yr) (Puccinia striiformis Westend. f. sp. tritici Eriks) and leaf rust (Lr) (Puccinia triticina Eriks) are a great threat to wheat production. The majority of the Sr, Yr and Lr resistance genes are already defeated...
-
stem rust seedling resistance genes in ethiopian wheat cultivars
African Journals Online (AJOL)
Prof. Adipala Ekwamu
Stem rust caused by Puccinia graminis f. sp. tritici is one of the major biotic limiting factors for wheat production in Ethiopia. Host plant resistance is the best option to manage stem rust from its economic and environmental points of view. Wheat cultivars are released for production without carrying race specific tests against ...
-
First report of the white pine blister rust pathogen, Cronartium ribicola, in Arizona
M. L. Fairweather; Brian Geils
2011-01-01
White pine blister rust, caused by Cronartium ribicola J.C. Fisch., was found on southwestern white pine (Pinus flexilis James var. reflexa Engelm., synonym P. strobiformis Engelm.) near Hawley Lake, Arizona (Apache County, White Mountains, 34.024°N, 109.776°W, elevation 2,357 m) in April 2009. Although white pines in the Southwest (Arizona and New Mexico) have been...
-
Detection, breeding, and selection of durable resistance to brown rust in sugarcane
Brown rust, caused by Puccinia melanocephala, is an important disease of sugarcane in Louisiana. The adaptability of the pathogen has repeatedly resulted in resistant cultivars becoming susceptible once they are widely grown. The frequency of the brown rust resistance gene Bru1 was low in the breedi...
-
Leaf and stripe rust resistance among Ethiopian grown wheat ...
African Journals Online (AJOL)
The result indicated that 20 varieties and lines harbor resistance to the leaf rust and 26 to the stripe rust pathotypes showing infection types <2+. Twelve bread wheat varieties and lines (Et-13 A2, HAR 1407 [Tusie], HAR 1775 [Tura], HAR 1920, HAR 2192, HAR 2534, HAR 2536, HAR 2561, HAR 2563 and three durum lines ...
-
Genomic dissection of nonhost resistance to wheat stem rust in Brachypodium distachyon
Wheat stem rust caused by the fungus Puccinia graminis f.sp. tritici (Pgt) is a devastating disease that has largely been controlled for decades by the deployment of resistance genes. However, new races of this pathogen have emerged that overcome many important wheat stem rust resistance genes used ...
-
Induced mutations in beans and peas for resistance to rust
International Nuclear Information System (INIS)
Fadl, F.A.M.
1983-01-01
Gamma rays and ethyl methanesulphonate (EMS) were applied in a mutation-induction programme for rust resistance in bean and pea. Bean and pea seeds were pre-soaked 2 hours before irradiation with 9, 10 and 12 krad. For chemical mutagen treatments bean and pea seeds were pre-soaked for 8 hours and treated with 0.5 and 1.5% EMS for four hours. M 2 seeds of beans and peas were planted in 1979. Resistant M 2 plants were selected for their rust resistance and other morphological characters. M 3 seeds of selected plants were planted in 1980. In 1980 more seeds of the same varieties of beans and peas were treated with 0.1 and 0.3% EMS with the aim to produce rust-resistant mutants. Seed germination was reduced by gamma rays or EMS. Dwarf, malformed and abnormal plants were noticed. Some resistant M 2 plants selected gave high grain yields. Some were different in morphological characters. In the M 3 of selected plants various other mutant characters appeared, such as different height of plants, early and late flowering, resistance to powdery mildew in peas, altered grain yield, thickness of stem, pod shape and flower colour. (author)
-
Genome-Wide Association Mapping of Stem Rust Resistance in Hordeum vulgare subsp. spontaneum.
Sallam, Ahmad H; Tyagi, Priyanka; Brown-Guedira, Gina; Muehlbauer, Gary J; Hulse, Alex; Steffenson, Brian J
2017-10-05
Stem rust was one of the most devastating diseases of barley in North America. Through the deployment of cultivars with the resistance gene Rpg1 , losses to stem rust have been minimal over the past 70 yr. However, there exist both domestic (QCCJB) and foreign (TTKSK aka isolate Ug99) pathotypes with virulence for this important gene. To identify new sources of stem rust resistance for barley, we evaluated the Wild Barley Diversity Collection (WBDC) (314 ecogeographically diverse accessions of Hordeum vulgare subsp. spontaneum ) for seedling resistance to four pathotypes (TTKSK, QCCJB, MCCFC, and HKHJC) of the wheat stem rust pathogen ( Puccinia graminis f. sp. tritici , Pgt ) and one isolate (92-MN-90) of the rye stem rust pathogen ( P. graminis f. sp. secalis , Pgs ). Based on a coefficient of infection, the frequency of resistance in the WBDC was low ranging from 0.6% with HKHJC to 19.4% with 92-MN-90. None of the accessions was resistant to all five cultures of P. graminis A genome-wide association study (GWAS) was conducted to map stem rust resistance loci using 50,842 single-nucleotide polymorphic markers generated by genotype-by-sequencing and ordered using the new barley reference genome assembly. After proper accounting for genetic relatedness and structure among accessions, 45 quantitative trait loci were identified for resistance to P. graminis across all seven barley chromosomes. Three novel loci associated with resistance to TTKSK, QCCJB, MCCFC, and 92-MN-90 were identified on chromosomes 5H and 7H, and two novel loci associated with resistance to HKHJC were identified on chromosomes 1H and 3H. These novel alleles will enhance the diversity of resistance available for cultivated barley. Copyright © 2017 Sallam et al.
-
Dikshit, H K; Singh, Akanksha; Singh, D; Aski, M; Jain, Neelu; Hegde, V S; Basandrai, A K; Basandrai, D; Sharma, T R
2016-06-01
Lentil, as an economical source of protein, minerals and vitamins, plays important role in nutritional security of the common man. Grown mainly in West Asia, North Africa (WANA) region and South Asia, it suffers from several biotic stresses such as wilt, rust, blight and broomrape. Lentil rust caused by autoecious fungus Uromyces viciae fabae (Pers.) Schroet is a serious lentil disease in Algeria, Bangladesh, Ethiopia, India, Italy, Morocco, Pakistan and Nepal. The disease symptoms are observed during flowering and early podding stages. Rust causes severe yield losses in lentil. It can only be effectively controlled by identifying the resistant source, understanding its inheritance and breeding for host resistance. The obligate parasitic nature of pathogen makes it difficult to maintain the pathogen in culture and to apply it to screen segregating progenies under controlled growth conditions. Hence, the use of molecular markers will compliment in identification of resistant types in different breeding programs. Here, we studied the inheritance of resistance to rust in lentil using F₁, F₂ and F₂:₃ from cross PL 8 (susceptible) x L 4149 (resistant) varieties. The phenotyping of lentil population was carried out at Sirmour, India. The result of genetic analysis revealed that a single dominant gene controls rust resistance in lentil genotype L 4149. The F2 population from this cross was used to tag and map the rust resistance gene using SSR and SRAP markers. Markers such as 270 SRAP and 162 SSR were studied for polymorphism and 101 SRAP and 33 SSRs were found to be polymorphic between the parents. Two SRAP and two SSR markers differentiated the resistant and susceptible bulks. SSR marker Gllc 527 was estimated to be linked to rust resistant locus at a distance of 5.9 cM. The Gllc 527 marker can be used for marker assisted selection for rust resistance; however, additional markers closer to rust resistant locus are required. The markers linked to the rust
-
Resistance to rusts (uromyces pisi and u. viciae-fabae) in pea
Barilli, Eleonora; Sillero, Josefina C.; Prats, Elena; Rubiales, Diego
2014-01-01
Pea is the second most important food legume crop in the world. Rust is a pea disease widely distributed, particularly in regions with warm, humid weather. Pea rust can be incited by Uromyces viciae-fabae and by U. pisi. U. viciae-fabae prevails in tropical and subtropical regions such as India and China, while U. pisi prevails in temperate regions. Chemical control of rust is possible, but the use of host plant resistance is the most desired means of rust control. In this paper we revise and...
-
Antibiotics Do Not Control Blister Rust in Eastern White Pine Seedlings
William R. Phelps; Ray Weber
1968-01-01
To prevent blister rust infections in Eastern white pine seedlings, the antibiotics, cycloheximide (acti-dione) and Phytoactin, were tested in root dips, root slurries, and foliar drenches before planting and after planting the trees. None of the methods and materials tested was effective.
-
Wako, Tadayuki; Yamashita, Ken-ichiro; Tsukazaki, Hikaru; Ohara, Takayoshi; Kojima, Akio; Yaguchi, Shigenori; Shimazaki, Satoshi; Midorikawa, Naoko; Sakai, Takako; Yamauchi, Naoki; Shigyo, Masayoshi
2015-04-01
Bunching onion (Allium fistulosum L.; 2n = 16), bulb onion (Allium cepa L. Common onion group), and shallot (Allium cepa L. Aggregatum group) cultivars were inoculated with rust fungus, Puccinia allii, isolated from bunching onion. Bulb onions and shallots are highly resistant to rust, suggesting they would serve as useful resources for breeding rust resistant bunching onions. To identify the A. cepa chromosome(s) related to rust resistance, a complete set of eight A. fistulosum - shallot monosomic alien addition lines (MAALs) were inoculated with P. allii. At the seedling stage, FF+1A showed a high level of resistance in controlled-environment experiments, suggesting that the genes related to rust resistance could be located on shallot chromosome 1A. While MAAL, multi-chromosome addition line, and hypoallotriploid adult plants did not exhibit strong resistance to rust. In contrast to the high resistance of shallot, the addition line FF+1A+5A showed reproducibly high levels of rust resistance.
-
Partial resistance to stripe rust and its effect on sustainability of wheat yield
International Nuclear Information System (INIS)
Qamar, M.; Din, R.U.; Gardazi, D.A.
2014-01-01
Stripe rust (Puccinia striiformis Westend. f. sp. tritici) poses a serious threat to wheat production in cooler areas of Pakistan. The 70% area of wheat in Pakistan is prone to stripe rust disease. It can cause 10-17% yield losses if susceptible cultivars are planted under favorable conditions. Level of partial plant resistance in bread wheat and its impact on sustainable wheat production was studied at the National Agricultural Research Centre, Islamabad under natural conditions in the field. Eleven Pakistani commercial wheat cultivars/advance lines including check (Inqalab 91) were assessed for the level of partial resistance against stripe rust using Area Under the Disease Progress Curve (AUDPC), disease severity (DS) and epidemic growth rate in comparison with wheat cultivar, Inqalab 91. During 2007 cropping season, natural epidemic was developed and relative AUDPC was recorded from 0 to 100% whereas the 2008 cropping season was dry and no stripe rust appeared. Two advanced lines (NR 268 and NR 285) showed the infection type (IT) less than 7 (incompatible reaction) to the mixture of prevailing stripe rust inoculums. Very low level of DS and AUDPC were recorded in the remaining cultivars/lines indicating a high level of partial resistance to stripe rust compared to the susceptible check cultivar, Inqalab 91. Among eight cultivars/lines that showed compatible type of reaction (IT greater then equal to 7), one was resistant (relative AUDPC = 20% of Inqalab 91) and six showed very high resistance levels (relative AUDPC greater then equal to 5%). Maximum level of resistance (relative AUDPC = 0.1%) was observed in advanced line, NR 271. The wheat cultivars/lines that showed a slow disease development (low DS and AUDPC), could be considered as -1 partially resistant for stripe rust infection. The yield (2178 kg ha) of susceptible check cultivar Inqalab-91 during 2007 was reduced to 45% as -1 compared to its yield (3945 kg ha) in epidemic free year (2008). Thus the use
-
Molecular mapping and improvement of leaf rust resistance in wheat breeding lines.
Tsilo, Toi J; Kolmer, James A; Anderson, James A
2014-08-01
Leaf rust, caused by Puccinia triticina, is the most common and widespread disease of wheat (Triticum aestivum) worldwide. Deployment of host-plant resistance is one of the strategies to reduce losses due to leaf rust disease. The objective of this study was to map genes for adult-plant resistance to leaf rust in a recombinant inbred line (RIL) population originating from MN98550-5/MN99394-1. The mapping population of 139 RILs and five checks were evaluated in 2005, 2009, and 2010 in five environments. Natural infection occurred in the 2005 trials and trials in 2009 and 2010 were inoculated with leaf rust. Four quantitative trait loci (QTL) on chromosomes 2BS, 2DS, 7AL, and 7DS were detected. The QTL on 2BS explained up to 33.6% of the phenotypic variation in leaf rust response, whereas the QTL on 2DS, 7AL, and 7DS explained up to 15.7, 8.1, and 34.2%, respectively. Seedling infection type tests conducted with P. triticina races BBBD and SBDG confirmed that the QTL on 2BS and 2DS were Lr16 and Lr2a, respectively, and these genes were expressed in the seedling and field plot tests. The Lr2a gene mapped at the same location as Sr6. The QTL on 7DS was Lr34. The QTL on 7AL is a new QTL for leaf rust resistance. The joint effects of all four QTL explained 74% of the total phenotypic variation in leaf rust severity. Analysis of different combinations of QTL showed that the RILs containing all four or three of the QTL had the lowest average leaf rust severity in all five environments. Deployment of these QTL in combination or with other effective genes will lead to successful control of leaf rust.
-
Milus, Eugene A; Moon, David E; Lee, Kevin D; Mason, R Esten
2015-08-01
Stripe rust, caused by Puccinia striiformis f. sp. tritici, is an important disease of wheat in the Great Plains and southeastern United States. Growing resistant cultivars is the preferred means for managing stripe rust, but new virulence in the pathogen population overcomes some of the resistance. The objectives of this study were to characterize the stripe rust resistance in contemporary soft and hard red winter wheat cultivars, to characterize the virulence of P. striiformis f. sp. tritici isolates based on the resistances found in the cultivars, and to determine wheat breeders' perceptions on the importance and methods for achieving stripe rust resistance. Seedlings of cultivars were susceptible to recent isolates, indicating they lacked effective all-stage resistance. However, adult-plants were resistant or susceptible depending on the isolate, indicating they had race-specific adult-plant resistance. Using isolates collected from 1990 to 2013, six major virulence patterns were identified on adult plants of twelve cultivars that were selected as adult-plant differentials. Race-specific adult-plant resistance appears to be the only effective type of resistance protecting wheat from stripe rust in eastern United States. Among wheat breeders, the importance of incorporating stripe rust resistance into cultivars ranged from high to low depending on the frequency of epidemics in their region, and most sources of stripe rust resistance were either unknown or already overcome by virulence in the pathogen population. Breeders with a high priority for stripe rust resistance made most of their selections based on adult-plant reactions in the field, whereas breeders with a low priority for resistance based selections on molecular markers for major all-stage resistance genes.
-
Discovery and characterization of two new stem rust resistance genes in Aegilops sharonensis.
Yu, Guotai; Champouret, Nicolas; Steuernagel, Burkhard; Olivera, Pablo D; Simmons, Jamie; Williams, Cole; Johnson, Ryan; Moscou, Matthew J; Hernández-Pinzón, Inmaculada; Green, Phon; Sela, Hanan; Millet, Eitan; Jones, Jonathan D G; Ward, Eric R; Steffenson, Brian J; Wulff, Brande B H
2017-06-01
We identified two novel wheat stem rust resistance genes, Sr-1644-1Sh and Sr-1644-5Sh in Aegilops sharonensis that are effective against widely virulent African races of the wheat stem rust pathogen. Stem rust is one of the most important diseases of wheat in the world. When single stem rust resistance (Sr) genes are deployed in wheat, they are often rapidly overcome by the pathogen. To this end, we initiated a search for novel sources of resistance in diverse wheat relatives and identified the wild goatgrass species Aegilops sharonesis (Sharon goatgrass) as a rich reservoir of resistance to wheat stem rust. The objectives of this study were to discover and map novel Sr genes in Ae. sharonensis and to explore the possibility of identifying new Sr genes by genome-wide association study (GWAS). We developed two biparental populations between resistant and susceptible accessions of Ae. sharonensis and performed QTL and linkage analysis. In an F 6 recombinant inbred line and an F 2 population, two genes were identified that mapped to the short arm of chromosome 1S sh , designated as Sr-1644-1Sh, and the long arm of chromosome 5S sh , designated as Sr-1644-5Sh. The gene Sr-1644-1Sh confers a high level of resistance to race TTKSK (a member of the Ug99 race group), while the gene Sr-1644-5Sh conditions strong resistance to TRTTF, another widely virulent race found in Yemen. Additionally, GWAS was conducted on 125 diverse Ae. sharonensis accessions for stem rust resistance. The gene Sr-1644-1Sh was detected by GWAS, while Sr-1644-5Sh was not detected, indicating that the effectiveness of GWAS might be affected by marker density, population structure, low allele frequency and other factors.
-
Utilization of a major brown rust resistance gene in sugarcane breeding
Brown rust, caused by Puccinia melanocephala has had devastating effects on sugarcane (Saccharum spp.) breeding programs and on commercial production. The discovery of Bru1, a major gene conferring resistance to brown rust represented a substantial breakthrough and markers for the detection of Bru1 ...
-
Genetics and mapping of a new leaf rust resistance gene in Triticum ...
Indian Academy of Sciences (India)
Genetic analysis in F1, F2 and F2.3 families at the seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single incompletely dominant gene. The leaf rust resistance gene was mapped to chromosome 3BL with SSR markers Xgwm114 and Xgwm547 flanking the gene at a distance of 28.3 cM ...
-
Remapping of the stripe rust resistance gene Yr10 in common wheat.
Yuan, Cuiling; Wu, Jingzheng; Yan, Baiqiang; Hao, Qunqun; Zhang, Chaozhong; Lyu, Bo; Ni, Fei; Caplan, Allan; Wu, Jiajie; Fu, Daolin
2018-02-23
Yr10 is an important gene to control wheat stripe rust, and the search for Yr10 needs to be continued. Wheat stripe rust or yellow rust is a devastating fungal disease caused by Puccinia striiformis f. sp. tritici (Pst). Host disease resistance offers a primary source for controlling wheat stripe rust. The stripe rust resistance gene Yr10 confers the race-specific resistance to most tested Pst races in China including CYR29. Early studies proposed that Yr10 was a nucleotide-binding site, leucine-rich repeat gene archived as GenBank accession AF149112 (hereafter designated the Yr10 candidate gene or Yr10 CG ). In this study, we revealed that 15 Chinese wheat cultivars positive for Yr10 CG are susceptible to CYR29. We then expressed the Yr10 CG cDNA in the common wheat 'Bobwhite'. The Yr10 CG -cDNA positive transgenic plants were also susceptible to CYR29. Thus, it is highly unlikely that Yr10 CG corresponds to the Yr10 resistance gene. Using the Yr10 donor 'Moro' and the Pst-susceptible wheat 'Huixianhong', we generated two F 3 populations that displayed a single Mendelian segregation on the Yr10 gene, and used them to remap the Yr10 gene. Six markers were placed in the Yr10 region, with the Yr10 CG gene now mapping about 1.2-cM proximal to the Yr10 locus and the Xsdauw79 marker is completely linked to the Yr10 locus. Apparently, the Yr10 gene has not yet been identified. Fine mapping and positional cloning of Yr10 is important for gene pyramiding for stripe rust resistance in wheat.
-
Genetic characterization of stem rust resistance in a global spring wheat germplasm collection
Stem rust is considered one of the most damaging diseases of wheat. The recent emergence of the stem rust Ug99 race group poses a serious threat to world wheat production. Utilization of genetic resistance in cultivar development is the optimal way to control stem rust. Here we report association ma...
-
Lan, Caixia; Hale, Iago L; Herrera-Foessel, Sybil A; Basnet, Bhoja R; Randhawa, Mandeep S; Huerta-Espino, Julio; Dubcovsky, Jorge; Singh, Ravi P
2017-01-01
Growing resistant wheat varieties is a key method of minimizing the extent of yield losses caused by the globally important wheat leaf rust (LR) and stripe rust (YR) diseases. In this study, a population of 186 F 8 recombinant inbred lines (RILs) derived from a cross between a synthetic wheat derivative (PI610750) and an adapted common wheat line (cv. "UC1110") were phenotyped for LR and YR response at both seedling and adult plant stages over multiple seasons. Using a genetic linkage map consisting of single sequence repeats and diversity arrays technology markers, in combination with inclusive composite interval mapping analysis, we detected a new LR adult plant resistance (APR) locus, QLr.cim-2DS , contributed by UC1110. One co-located resistance locus to both rusts, QLr.cim-3DC/QYr.cim-3DC , and the known seedling resistance gene Lr26 were also mapped. QLr.cim-2DS and QLr.cim-3DC showed a marginally significant interaction for LR resistance in the adult plant stage. In addition, two previously reported YR APR loci, QYr.ucw-3BS and Yr48 , were found to exhibit stable performances in rust environments in both Mexico and the United States and showed a highly significant interaction in the field. Yr48 was also observed to confer intermediate seedling resistance against Mexican YR races, thus suggesting it should be re-classified as an all-stage resistance gene. We also identified 5 and 2 RILs that possessed all detected YR and LR resistance loci, respectively. With the closely linked molecular markers reported here, these RILs could be used as donors for multiple resistance loci to both rusts in wheat breeding programs.
-
Directory of Open Access Journals (Sweden)
Tian Ya Li
Full Text Available Stem rust is one of the most potentially harmful wheat diseases, but has been effectively controlled in China since 1970s. However, the interest in breeding wheat with durable resistance to stem rust has been renewed with the emergence of Ug99 (TTKSK virulent to the widely used resistance gene Sr31, and by which the wheat stem rust was controlled for 40 years in wheat production area worldwide. Yunnan Province, located on the Southwest border of China, is one of the main wheat growing regions, playing a pivotal role in the wheat stem rust epidemic in China. This study investigated the levels of resistance in key wheat cultivars (lines of Yunnan Province. In addition, the existence of Sr25, Sr26, Sr28, Sr31, Sr32, and Sr38 genes in 119 wheat cultivars was assessed using specific DNA markers. The results indicated that 77 (64.7% tested wheat varieties showed different levels of resistance to all the tested races of Puccinia graminis f. sp. tritici. Using molecular markers, we identified the resistance gene Sr31 in 43 samples; Sr38 in 10 samples; Sr28 in 12 samples, and one sample which was resistant against Ug99 (avirulent to Sr32. No Sr25 or Sr26 (effective against Ug99 was identified in any cultivars tested. Furthermore, 5 out of 119 cultivars tested carried both Sr31 and Sr38 and eight contained both Sr31 and Sr28. The results enable the development of appropriate strategies to breed varieties resistant to stem rust.
-
Losert, Dominik; Maurer, Hans Peter; Leiser, Willmar L; Würschum, Tobias
2017-04-01
Genome-wide association mapping of resistance against the novel, aggressive 'Warrior' race of yellow rust in triticale revealed a genetic architecture with some medium-effect QTL and a quantitative component, which in combination confer high levels of resistance on both leaves and ears. Yellow rust is an important destructive fungal disease in small grain cereals and the exotic 'Warrior' race has recently conquered Europe. The aim of this study was to investigate the genetic architecture of yellow rust resistance in hexaploid winter triticale as the basis for a successful resistance breeding. To this end, a diverse panel of 919 genotypes was evaluated for yellow rust infection on leaves and ears in multi-location field trials and genotyped by genotyping-by-sequencing as well as for known Yr resistance loci. Genome-wide association mapping identified ten quantitative trait loci (QTL) for yellow rust resistance on the leaves and seven of these also for ear resistance. The total genotypic variance explained by the QTL amounted to 44.0% for leaf and 26.0% for ear resistance. The same three medium-effect QTL were identified for both traits on chromosomes 1B, 2B, and 7B. Interestingly, plants pyramiding the resistance allele of all three medium-effect QTL were generally most resistant, but constitute less than 5% of the investigated triticale breeding material. Nevertheless, a genome-wide prediction yielded a higher predictive ability than prediction based on these three QTL. Taken together, our results show that yellow rust resistance in winter triticale is genetically complex, including both medium-effect QTL as well as a quantitative resistance component. Resistance to the novel 'Warrior' race of this fungal pathogen is consequently best achieved by recurrent selection in the field based on identified resistant lines and can potentially be assisted by genomic approaches.
-
Pawar, Sushma Kumari; Sharma, Davinder; Duhan, Joginder Singh; Saharan, Mahender Singh; Tiwari, Ratan; Sharma, Indu
2016-06-01
Stripe rust caused by Puccinia striiformis f. sp. tritici is most important and devastating disease of wheat worldwide, which affects the grain yields, quality and nutrition. To elucidate, the genetic basis of resistance, a mapping population of recombinant inbred lines was developed from a cross between resistant Cappelle-Desprez and susceptible cultivar PBW343 using single-seed descent. Variety PBW343 had been one of the most popular cultivars of North Western Plains Zone, for more than a decade, before succumbing to the stripe rust. Cappelle-Desprez, a source of durable adult plant resistance, has maintained its resistance against stripe rust for a long time in Europe. Map construction and QTL analysis were completed with 1012 polymorphic (DArT and SSR) markers. Screenings for stripe rust disease were carried out in field condition for two consecutive crop seasons (2012-2013 and 2013-2014). Susceptible parent (PBW343) achieved a significant level of disease i.e., 100 % in both the years. In present investigations, resistance in Cappelle-Desprez was found stable and response to the rust ranged from 0 to 1.5 % over the years. The estimated broad-sense heritability (h 2 ) of stripe rust rAUDPC in the mapping population was 0.82. The relative area under the disease progress curve data showed continuous distributions, indicating that trait was controlled multigenically. Genomic region identified on chromosome 2D, was located within the short arm, with flanking markers (Xgwm484-Xcfd73), explained phenotypic variation (PVE) ranged from 13.9 to 31.8 %. The genomic region identified on chromosome 5B was found with the effect of maximum contribution with flanking DArT markers (1376633|F|0-1207571|F|0), PVE ranged from 24 to 27.0 %. This can, therefore, be utilized for marker assisted selection in developing much needed stripe rust resistant lines for the northern wheat belt of India.
-
Genomic and pedigree-based prediction for leaf, stem, and stripe rust resistance in wheat.
Juliana, Philomin; Singh, Ravi P; Singh, Pawan K; Crossa, Jose; Huerta-Espino, Julio; Lan, Caixia; Bhavani, Sridhar; Rutkoski, Jessica E; Poland, Jesse A; Bergstrom, Gary C; Sorrells, Mark E
2017-07-01
Genomic prediction for seedling and adult plant resistance to wheat rusts was compared to prediction using few markers as fixed effects in a least-squares approach and pedigree-based prediction. The unceasing plant-pathogen arms race and ephemeral nature of some rust resistance genes have been challenging for wheat (Triticum aestivum L.) breeding programs and farmers. Hence, it is important to devise strategies for effective evaluation and exploitation of quantitative rust resistance. One promising approach that could accelerate gain from selection for rust resistance is 'genomic selection' which utilizes dense genome-wide markers to estimate the breeding values (BVs) for quantitative traits. Our objective was to compare three genomic prediction models including genomic best linear unbiased prediction (GBLUP), GBLUP A that was GBLUP with selected loci as fixed effects and reproducing kernel Hilbert spaces-markers (RKHS-M) with least-squares (LS) approach, RKHS-pedigree (RKHS-P), and RKHS markers and pedigree (RKHS-MP) to determine the BVs for seedling and/or adult plant resistance (APR) to leaf rust (LR), stem rust (SR), and stripe rust (YR). The 333 lines in the 45th IBWSN and the 313 lines in the 46th IBWSN were genotyped using genotyping-by-sequencing and phenotyped in replicated trials. The mean prediction accuracies ranged from 0.31-0.74 for LR seedling, 0.12-0.56 for LR APR, 0.31-0.65 for SR APR, 0.70-0.78 for YR seedling, and 0.34-0.71 for YR APR. For most datasets, the RKHS-MP model gave the highest accuracies, while LS gave the lowest. GBLUP, GBLUP A, RKHS-M, and RKHS-P models gave similar accuracies. Using genome-wide marker-based models resulted in an average of 42% increase in accuracy over LS. We conclude that GS is a promising approach for improvement of quantitative rust resistance and can be implemented in the breeding pipeline.
-
Sustracted library obtained from mutant sugarcane variety B 4362 resistant to rust
María I. Oloriz; Luis Rojas; Víctor Gil; Elio Jiménez
2002-01-01
The hypersensitive response is one of the most powerful mechanisms for which the plants resist pathogen attack. Mutations carried out previously on the variety B4362, of sugarcane, originated five mutants that express this mechanism towards the attack of rust (Puccinia melanocephala Syd.). By means of a subtractive hybridization among the cDNA obtained starting from the resistant clone inoculated with rust and a pool of cDNA of the susceptible variety (B4362) inoculated and of the resistant c...
-
Introgression of a leaf rust resistance gene from Aegilops caudata to ...
Indian Academy of Sciences (India)
tance genes (Lr) and 48 stripe rust resistance genes (Yr) have .... Leaf rust reaction of the parents, wheat – Ae. caudata introgression lines and representative F2 plants developed from the cross: .... segregation ratio, which is otherwise a serious problem with ... Financial assistance was provided by the USDA-ARS under the.
-
Prehaustorial and posthaustorial resistance to wheat leaf rust in diploid wheat
Anker, C.C.
2001-01-01
In modern wheat cultivars, resistance to wheat leaf rust, Puccinia triticina , is either based on hypersensitivity resistance or on partial resistance. Hypersensitivity resistance in wheat is monogenic, often complete and posthaustorial: it is induced after the
-
Fine Mapping of Ur-3, a Historically Important Rust Resistance Locus in Common Bean
Directory of Open Access Journals (Sweden)
Oscar P. Hurtado-Gonzales
2017-02-01
Full Text Available Bean rust, caused by Uromyces appendiculatus, is a devastating disease of common bean (Phaseolus vulgaris in the Americas and Africa. The historically important Ur-3 gene confers resistance to many races of the highly variable bean rust pathogen that overcome other rust resistance genes. Existing molecular markers tagging Ur-3 for use in marker-assisted selection produce false results. Here, we describe the fine mapping of the Ur-3 locus for the development of highly accurate markers linked to Ur-3. An F2 population from the cross Pinto 114 (susceptible × Aurora (resistant with Ur-3 was evaluated for its reaction to four different races of U. appendiculatus. A bulked segregant analysis using the SNP chip BARCBEAN6K_3 placed the approximate location of Ur-3 in the lower arm of chromosome Pv11. Specific SSR and SNP markers and haplotype analysis of 18 sequenced bean varieties positioned Ur-3 in a 46.5 kb genomic region from 46.96 to 47.01 Mb on Pv11. We discovered in this region the SS68 KASP marker that was tightly linked to Ur-3. Validation of SS68 on a panel of 130 diverse common bean cultivars containing all known rust resistance genes revealed that SS68 was highly accurate and produced no false results. The SS68 marker will be of great value in pyramiding Ur-3 with other rust resistance genes. It will also significantly reduce time and labor associated with the current phenotypic detection of Ur-3. This is the first utilization of fine mapping to discover markers linked to rust resistance in common bean.
-
Fine Mapping of Ur-3, a Historically Important Rust Resistance Locus in Common Bean.
Hurtado-Gonzales, Oscar P; Valentini, Giseli; Gilio, Thiago A S; Martins, Alexandre M; Song, Qijian; Pastor-Corrales, Marcial A
2017-02-09
Bean rust, caused by Uromyces appendiculatus , is a devastating disease of common bean ( Phaseolus vulgaris ) in the Americas and Africa. The historically important Ur-3 gene confers resistance to many races of the highly variable bean rust pathogen that overcome other rust resistance genes. Existing molecular markers tagging Ur-3 for use in marker-assisted selection produce false results. Here, we describe the fine mapping of the Ur-3 locus for the development of highly accurate markers linked to Ur-3 An F 2 population from the cross Pinto 114 (susceptible) × Aurora (resistant with Ur-3 ) was evaluated for its reaction to four different races of U. appendiculatus A bulked segregant analysis using the SNP chip BARCBEAN6K_3 placed the approximate location of Ur-3 in the lower arm of chromosome Pv11. Specific SSR and SNP markers and haplotype analysis of 18 sequenced bean varieties positioned Ur-3 in a 46.5 kb genomic region from 46.96 to 47.01 Mb on Pv11. We discovered in this region the SS68 KASP marker that was tightly linked to Ur-3 Validation of SS68 on a panel of 130 diverse common bean cultivars containing all known rust resistance genes revealed that SS68 was highly accurate and produced no false results. The SS68 marker will be of great value in pyramiding Ur-3 with other rust resistance genes. It will also significantly reduce time and labor associated with the current phenotypic detection of Ur-3 This is the first utilization of fine mapping to discover markers linked to rust resistance in common bean. Copyright © 2017 Hurtado-Gonzales et al.
-
Kolmer, J A; Bernardo, A; Bai, G; Hayden, M J; Chao, S
2018-02-01
Leaf rust caused by Puccinia triticina is an important disease of wheat in many regions worldwide. Durable or long-lasting leaf rust resistance has been difficult to achieve because populations of P. triticina are highly variable for virulence to race-specific resistance genes, and respond to selection by resistance genes in released wheat cultivars. The wheat cultivar Toropi, developed and grown in Brazil, was noted to have long-lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat background. In the first population, a single gene with major effects on chromosome 5DS that mapped 2.2 centimorgans distal to IWA6289, strongly reduced leaf rust severity in all 3 years of field plot tests. This gene for adult plant leaf rust resistance was designated as Lr78. In the second population, quantitative trait loci (QTL) with small effects on chromosomes 1BL, 3BS, and 4BS were found. These QTL expressed inconsistently over 4 years of field plot tests. The adult plant leaf rust resistance derived from Toropi involved a complex combination of QTL with large and small effects.
-
Bokore, Firdissa E; Cuthbert, Richard D; Knox, Ron E; Randhawa, Harpinder S; Hiebert, Colin W; DePauw, Ron M; Singh, Asheesh K; Singh, Arti; Sharpe, Andrew G; N'Diaye, Amidou; Pozniak, Curtis J; McCartney, Curt; Ruan, Yuefeng; Berraies, Samia; Meyer, Brad; Munro, Catherine; Hay, Andy; Ammar, Karim; Huerta-Espino, Julio; Bhavani, Sridhar
2017-12-01
Quantitative trait loci controlling stripe rust resistance were identified in adapted Canadian spring wheat cultivars providing opportunity for breeders to stack loci using marker-assisted breeding. Stripe rust or yellow rust, caused by Puccinia striiformis Westend. f. sp. tritici Erikss., is a devastating disease of common wheat (Triticum aestivum L.) in many regions of the world. The objectives of this research were to identify and map quantitative trait loci (QTL) associated with stripe rust resistance in adapted Canadian spring wheat cultivars that are effective globally, and investigate opportunities for stacking resistance. Doubled haploid (DH) populations from the crosses Vesper/Lillian, Vesper/Stettler, Carberry/Vesper, Stettler/Red Fife and Carberry/AC Cadillac were phenotyped for stripe rust severity and infection response in field nurseries in Canada (Lethbridge and Swift Current), New Zealand (Lincoln), Mexico (Toluca) and Kenya (Njoro), and genotyped with SNP markers. Six QTL for stripe rust resistance in the population of Vesper/Lillian, five in Vesper/Stettler, seven in Stettler/Red Fife, four in Carberry/Vesper and nine in Carberry/AC Cadillac were identified. Lillian contributed stripe rust resistance QTL on chromosomes 4B, 5A, 6B and 7D, AC Cadillac on 2A, 2B, 3B and 5B, Carberry on 1A, 1B, 4A, 4B, 7A and 7D, Stettler on 1A, 2A, 3D, 4A, 5B and 6A, Red Fife on 2D, 3B and 4B, and Vesper on 1B, 2B and 7A. QTL on 1A, 1B, 2A, 2B, 3B, 4A, 4B, 5B, 7A and 7D were observed in multiple parents. The populations are compelling sources of recombination of many stripe rust resistance QTL for stacking disease resistance. Gene pyramiding should be possible with little chance of linkage drag of detrimental genes as the source parents were mostly adapted cultivars widely grown in Canada.
-
Pushing the boundaries of resistance: insights from Brachypodium-rust interactions
Directory of Open Access Journals (Sweden)
Melania eFigueroa
2015-07-01
Full Text Available The implications of global population growth urge transformation of current food and bioenergy production systems to sustainability. Members of the family Poaceae are of particular importance both in food security and for their applications as biofuel substrates. For centuries, rust fungi have threatened the production of valuable crops such as wheat, barley, oat and other small grains; similarly, biofuel crops can also be susceptible to these pathogens. Emerging rust pathogenic races with increased virulence and recurrent rust epidemics around the world point out the vulnerability of monocultures. Basic research in plant immunity, especially in model plants, can make contributions to understanding plant resistance mechanisms and improve disease management strategies. The development of the grass Brachypodium distachyon as a genetically tractable model for monocots, especially temperate cereals and grasses, offers the possibility to overcome the experimental challenges presented by the genetic and genomic complexities of economically valuable crop plants. The numerous resources and tools available in Brachypodium have opened new doors to investigate the underlying molecular and genetic bases of plant-microbe interactions in grasses and evidence demonstrating the applicability and advantages of working with B. distachyon is increasing. Importantly, several interactions between B. distachyon and devastating plant pathogens, such rust fungi, have been examined in the context of non-host resistance. Here, we discuss the use of B. distachyon in these various pathosystems. Exploiting B. distachyon to understand the mechanisms underpinning disease resistance to non-adapted rust fungi may provide effective and durable approaches to fend off these pathogens. The close phylogenetic relationship among Brachypodium spp. and grasses with industrial and agronomic value support harnessing this model plant to improve cropping systems and encourage its use in
-
M.-S. Kim; N. B. Klopfenstein; Y. Ota; S. K. Lee; K.-S. Woo; S. Kaneko
2010-01-01
This article briefly reviews the history of white pine blister rust, attributed to Cronartium ribicola, and addresses current research and management issues in South Korea, Japan and other regions of eastern Asia (China, Russia and Himalaya). For each region, the distribution, damage, aecial hosts, telial hosts and management of C. ribicola and other blister rust fungi...
-
Cytogenetics and stripe rust resistance of wheat-Thinopyrum elongatum hybrid derivatives.
Li, Daiyan; Long, Dan; Li, Tinghui; Wu, Yanli; Wang, Yi; Zeng, Jian; Xu, Lili; Fan, Xing; Sha, Lina; Zhang, Haiqin; Zhou, Yonghong; Kang, Houyang
2018-01-01
Amphidiploids generated by distant hybridization are commonly used as genetic bridge to transfer desirable genes from wild wheat species into cultivated wheat. This method is typically used to enhance the resistance of wheat to biotic or abiotic stresses, and to increase crop yield and quality. Tetraploid Thinopyrum elongatum exhibits strong adaptability, resistance to stripe rust and Fusarium head blight, and tolerance to salt, drought, and cold. In the present study, we produced hybrid derivatives by crossing and backcrossing the Triticum durum-Th. elongatum partial amphidiploid ( Trititrigia 8801, 2 n = 6 × = 42, AABBEE) with wheat cultivars common to the Sichuan Basin. By means of cytogenetic and disease resistance analyses, we identified progeny harboring alien chromosomes and measured their resistance to stripe rust. Hybrid progenies possessed chromosome numbers ranging from 40 to 47 (mean = 42.72), with 40.0% possessing 42 chromosomes. Genomic in situ hybridization revealed that the number of alien chromosomes ranged from 1 to 11. Out of the 50 of analyzed lines, five represented chromosome addition (2 n = 44 = 42 W + 2E) and other five were chromosome substitution lines (2 n = 42 = 40 W + 2E). Importantly, a single chromosome derived from wheat- Th. elongatum intergenomic Robertsonian translocations chromosome was occurred in 12 lines. Compared with the wheat parental cultivars ('CN16' and 'SM482'), the majority (70%) of the derivative lines were highly resistant to strains of stripe rust pathogen known to be prevalent in China. The findings suggest that these hybrid-derivative lines with stripe rust resistance could potentially be used as germplasm sources for further wheat improvement.
-
Use of gamma radiation for inducing rust resistance in soybean
International Nuclear Information System (INIS)
Smutkupt, Sumit; Wongpiyasatid, Arunee; Lamseejan, Siranut; Naritoom, Kruik
1982-01-01
Experiments on induced mutations for rust resistance in 11 soybean cultivars were started in the rainy season of 1979. M 1 seeds were grown at Farm Suwan, Pak Chong, Nakorn Rajchasima Province. Six plods from each of 4,438 control and 43,907 M 1 plants were randomly harvested. M 2 seeds of each cultivar of different doses were bulked. In addition, 270 good M 1 plants were selected and threshed singly. M 2 -bulk and M 2 -single seeds were advanced to M 3 . Both of M 3 -bulk and M 3 -single plants together with M 2 -bulk plants derived from remnant M 2 seeds were screened for rust resistance in the rainy season of 1980. The IWGSR rust rating system was used. Based on the slow growth of rust reaction on the plant (323,333) compared with the average IWGSR rust rating notation of the rates (343) in the same row, 121 plants were selected. Among them, six were selected from a total of 2802 control plants, and 115 from a total of 28,834 M 2 and M 3 plants. Seeds of each selection harvested. Only 88 lines of M 4 and M 5 were available for further rust evaluation in the rainy season of 1981. The results were as follows: At 77 days after planting, 82 selected lines were rated 333, 323 in comparison with 87 out of 137 rows of control S.J.1, S.J.2, S.J.4 and T.K.5 were rated 343. At 86 days after planting, most of the selections reached the diseased level 343. However, six lines which were derived from G8586 were still rated 333. In addition, a plant with slow growth of rust (323) from Taichung N No. 81-1-032 was selected. The six selected lines having characteristics of slow growth of rust reaction on the plants will be further tested. The high yielding selections among 82 selected lines having low percentage of shrivelled seeds will be used for further yield evaluation in the rainy season of 1982
-
International Nuclear Information System (INIS)
Hao Long; Zhang Sixun; Dong Junhua; Ke Wei
2012-01-01
Highlights: ► The rusting evolution of a Mo–Cu-bearing fire-resistant steel in a simulated industrial atmosphere was investigated. ► The rusting evolution of the steel is related to the rust composition, structure, and electrochemical characteristics. ► Increased content of α-FeOOH and decreased γ-FeOOH and Fe 3 O 4 indicate the enhanced resistance of the rust. ► Mo and Cu are involved in the formation of molybdate and Cu(I)-bearing compounds in the rust. - Abstract: The corrosion evolution of a Mo–Cu-bearing fire-resistant steel in a simulated industrial atmosphere was investigated by corrosion weight gain, XRD, EPMA, XPS, and polarization curves. The results indicate that the corrosion kinetics is closely related to the rust composition and electrochemical properties. As the corrosion proceeds, the relative content of γ-FeOOH and Fe 3 O 4 decreases and α-FeOOH increases, and the rust layer becomes compact and adherent to steel substrate. Molybdenum and copper enrich in the inner rust layer, especially at the bottom of the corrosion nest, forming non-soluble molybdate and Cu(I)-bearing compounds responsible for enhanced corrosion resistance of the rust layer.
-
Directory of Open Access Journals (Sweden)
David Eduardo Torres
Full Text Available Puccinia horiana Hennings, the causal agent of chrysanthemum white rust, is a worldwide quarantine organism and one of the most important fungal pathogens of Chrysanthemum × morifolium cultivars, which are used for cut flowers and as potted plants in commercial production regions of the world. It was previously reported to be controlled by Lecanicillium lecanii, Cladosporium sphaerospermum, C. uredinicola and Aphanocladium album, due to their antagonistic and hyperparasitic effects. We report novel antagonist species on Puccinia horiana. Fungi isolated from rust pustules in a commercial greenhouse from Villa Guerrero, México, were identified as Cladosporium cladosporioides and Cladosporium pseudocladosporioides based upon molecular analysis and morphological characters. The antagonism of C. cladosporioides and C. pseudocladosporioides on chrysanthemum white rust was studied using light and electron microscopy in vitro at the host/parasite interface. Cladosporium cladosporioides and C. pseudocladosporioides grew towards the white rust teliospores and colonized the sporogenous cells, but no direct penetration of teliospores was observed; however, the structure and cytoplasm of teliospores were altered. The two Cladosporium spp. were able to grow on media containing laminarin, but not when chitin was used as the sole carbon source; these results suggest that they are able to produce glucanases. Results from the study indicate that both Cladosporium species had potential as biological control agents of chrysanthemum white rust.
-
Brown leaf rust in sugarcane is caused by Puccinia melanocephala (Syd. & P. Syd.), which is major cause of cultivar withdrawal. We attempted to analyze the RAPD diversity of two discrete phenotypic classes i.e. rust resistant (R) and rust susceptible (S) of six commercially available sugarcane elite...
-
Directory of Open Access Journals (Sweden)
Albert Kertho
Full Text Available Leaf rust, caused by Puccinia triticina (Pt, and stripe rust, caused by P. striiformis f. sp. tritici (Pst, are destructive foliar diseases of wheat worldwide. Breeding for disease resistance is the preferred strategy of managing both diseases. The continued emergence of new races of Pt and Pst requires a constant search for new sources of resistance. Here we report a genome-wide association analysis of 567 winter wheat (Triticum aestivum landrace accessions using the Infinium iSelect 9K wheat SNP array to identify loci associated with seedling resistance to five races of Pt (MDCL, MFPS, THBL, TDBG, and TBDJ and one race of Pst (PSTv-37 frequently found in the Northern Great Plains of the United States. Mixed linear models identified 65 and eight significant markers associated with leaf rust and stripe rust, respectively. Further, we identified 31 and three QTL associated with resistance to Pt and Pst, respectively. Eleven QTL, identified on chromosomes 3A, 4A, 5A, and 6D, are previously unknown for leaf rust resistance in T. aestivum.
-
International Nuclear Information System (INIS)
Sohail, Y.
2015-01-01
Leaf rust infected leaves of a widely growing variety Seher-06 were collected in wheat season of 2011-12. The leaf rust isolates were assessed on Thatcher derived Lr isogenic lines and a race FHPRN was identified. Seventy six wheat varieties/lines besides Lr isogenic lines were screened against this race for seedling in glass house and for adult plant resistance at Bahawalpur and Faisalabad during 2012-13. Lr1, Lr2a, Lr9, Lr19, Lr24, Lr10+27+31 (Gatcher) and Lr28 were found completely resistant at both stages against FHPRN. Molecular screening of the wheat varieties/lines indicated the presence of leaf rust resistance genes Lr9 (0%), Lr13 (43%), Lr19 (1%), Lr20 (0%), Lr24 (4%), Lr26 (23%), Lr28 (0%), Lr34 (38%), Lr37 (1%) and Lr47 (1%) in them. Field data suggested that As-02 (Lr10+26+34), Bhakar-02 (Lr13) and Shafaq-06 (Lr10+13+27) were resistant; Pasban-90 (Lr10+13+26+27), Chenab-2000 (Lr10+13+26+27+31+34), Fbd-08 (Lr10), Millat-11 (unknown) and Punjab-11 (unknown) were found moderately resistant; Blue silver (Lr13+14a), Pak-81 (Lr10+23+26+31), Bahawalpur-97 (Lr13+26) and Lasani-08 (Lr13+27+31) were susceptible while Sh-88 (unknown), Auqab-2000 (Lr10+23+26+27+31), Iqbal-2000 (Lr3+10+13+26+27+31), Bahawalpur-2000 (Lr34) and Seher-06 (Lr10+27+31) were found highly susceptible against FHPRN. Present and previous studies revealed the presence of Lr3, 10, 13, 14a, 23, 26, 27, 31 and 34 in the Pakistani wheat varieties yet lacking Lr9, 19, 24 and 28. Therefore, the latter genes and their effective combinations should be incorporated in Pakistani varieties to combat leaf rust effectively. (author)
-
Directory of Open Access Journals (Sweden)
Yi Dai
2017-05-01
Full Text Available Fusarium head blight (FHB, leaf rust, and stem rust are the most destructive fungal diseases in current world wheat production. The diploid wheatgrass, Thinopyrum elongatum (Host Dewey (2n = 2x = 14, EE is an excellent source of disease resistance genes. Two new Triticum–Secale–Thinopyrum trigeneric hybrids were derived from a cross between a hexaploid triticale (X Triticosecale Wittmack, 2n = 6x = 42, AABBRR and a hexaploid Triticum trititrigia (2n = 6x = 42, AABBEE, were produced and analyzed using genomic in situ hybridization and molecular markers. The results indicated that line RE21 contained 14 A-chromosomes, 14 B-chromosomes, three pairs of R-chromosomes (4R, 6R, and 7R, and four pairs of E-chromosomes (1E, 2E, 3E, and 5E for a total chromosome number of 2n = 42. Line RE62 contained 14 A-chromosomes, 14 B-chromosomes, six pairs of R-chromosomes, and one pair of translocation chromosomes between chromosome 5R and 5E, for a total chromosome number of 2n = 42. At the seedling and adult growth stages under greenhouse conditions, line RE21 showed high levels of resistance to FHB, leaf rust, and stem rust race Ug99, and line RE62 was highly resistant to leaf rust and stem rust race Ug99. These two lines (RE21 and RE62 display superior disease resistance characteristics and have the potential to be utilized as valuable germplasm sources for future wheat improvement.
-
Dai, Yi; Duan, Yamei; Liu, Huiping; Chi, Dawn; Cao, Wenguang; Xue, Allen; Gao, Yong; Fedak, George; Chen, Jianmin
2017-01-01
Fusarium head blight (FHB), leaf rust, and stem rust are the most destructive fungal diseases in current world wheat production. The diploid wheatgrass, Thinopyrum elongatum (Host) Dewey (2 n = 2 x = 14, EE) is an excellent source of disease resistance genes. Two new Triticum-Secale-Thinopyrum trigeneric hybrids were derived from a cross between a hexaploid triticale (X Triticosecale Wittmack, 2 n = 6 x = 42, AABBRR) and a hexaploid Triticum trititrigia (2 n = 6 x = 42, AABBEE), were produced and analyzed using genomic in situ hybridization and molecular markers. The results indicated that line RE21 contained 14 A-chromosomes, 14 B-chromosomes, three pairs of R-chromosomes (4R, 6R, and 7R), and four pairs of E-chromosomes (1E, 2E, 3E, and 5E) for a total chromosome number of 2 n = 42. Line RE62 contained 14 A-chromosomes, 14 B-chromosomes, six pairs of R-chromosomes, and one pair of translocation chromosomes between chromosome 5R and 5E, for a total chromosome number of 2 n = 42. At the seedling and adult growth stages under greenhouse conditions, line RE21 showed high levels of resistance to FHB, leaf rust, and stem rust race Ug99, and line RE62 was highly resistant to leaf rust and stem rust race Ug99. These two lines (RE21 and RE62) display superior disease resistance characteristics and have the potential to be utilized as valuable germplasm sources for future wheat improvement.
-
International Nuclear Information System (INIS)
Rahman, S.U.; Younis, M.; Iqbal, M.Z.; Nawaz, M.
2014-01-01
The most effective and environmental friendly approach for the control of wheat rust disease is the use of resistant genotypes. The present study was conducted to explore rust resistance potential of 85 elite wheat genotypes (36 varieties and 49 advanced lines) using various types of DNA markers like STS, SCAR and SSR. DNA markers linked with different genes conferring resistance to rusts (Leaf rust=Lr, Yellow rust=Yr and Stem rust=Sr) were employed in this study. A total of 18 genes, consisting of eleven Lr (lr1, lr10, lr19, lr21, lr28, lr34, lr39, lr46, lr47, lr51 and lr52), four Yr (yr5, yr18, yr26 and yr29) and three Sr genes (sr2, sr29, and sr36) were studied through linked DNA markers. Maximum number of Lr genes was found in 17 advanced lines and 9 varieties, Yr genes in 26 advanced lines and 20 wheat varieties, and Sr genes in 43 advanced lines and 27 varieties. Minimum number of Lr genes was found in advanced line D-97 and variety Kohinoor-83, Yr genes in wheat variety Bwp-97 and Sr genes in 6 advanced lines and 8 varieties. Molecular data revealed that genotypes having same origin, from a specified area showed resistance for similar type of genes. In this study, an average similarity of 84% was recorded among wheat genotypes. Out of 18 loci, 15 were found to be polymorphic. (author)
-
Jacob, Sherry R.; Srinivasan, Kalyani; Radhamani, J.; Parimalan, R.; Sivaswamy, M.; Tyagi, Sandhya; Yadav, Mamata; Kumari, Jyotisna; Deepali; Sharma, Sandeep; Bhagat, Indoo; Meeta, Madhu; Bains, N. S.; Chowdhury, A. K.; Saha, B. C.; Bhattacharya, P. M.; Kumari, Jyoti; Singh, M. C.; Gangwar, O. P.; Prasad, P.; Bharadwaj, S. C.; Gogoi, Robin; Sharma, J. B.; GM, Sandeep Kumar; Saharan, M. S.; Bag, Manas; Roy, Anirban; Prasad, T. V.; Sharma, R. K.; Dutta, M.; Sharma, Indu; Bansal, K. C.
2016-01-01
A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat–Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011–14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu), a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab), a hotspot for stripe rust and at Cooch Behar (West Bengal), a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels. PMID:27942031
-
Directory of Open Access Journals (Sweden)
Sundeep Kumar
Full Text Available A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat-Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011-14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu, a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab, a hotspot for stripe rust and at Cooch Behar (West Bengal, a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels.
-
Kumar, Sundeep; Archak, Sunil; Tyagi, R K; Kumar, Jagdish; Vk, Vikas; Jacob, Sherry R; Srinivasan, Kalyani; Radhamani, J; Parimalan, R; Sivaswamy, M; Tyagi, Sandhya; Yadav, Mamata; Kumari, Jyotisna; Deepali; Sharma, Sandeep; Bhagat, Indoo; Meeta, Madhu; Bains, N S; Chowdhury, A K; Saha, B C; Bhattacharya, P M; Kumari, Jyoti; Singh, M C; Gangwar, O P; Prasad, P; Bharadwaj, S C; Gogoi, Robin; Sharma, J B; Gm, Sandeep Kumar; Saharan, M S; Bag, Manas; Roy, Anirban; Prasad, T V; Sharma, R K; Dutta, M; Sharma, Indu; Bansal, K C
2016-01-01
A comprehensive germplasm evaluation study of wheat accessions conserved in the Indian National Genebank was conducted to identify sources of rust and spot blotch resistance. Genebank accessions comprising three species of wheat-Triticum aestivum, T. durum and T. dicoccum were screened sequentially at multiple disease hotspots, during the 2011-14 crop seasons, carrying only resistant accessions to the next step of evaluation. Wheat accessions which were found to be resistant in the field were then assayed for seedling resistance and profiled using molecular markers. In the primary evaluation, 19,460 accessions were screened at Wellington (Tamil Nadu), a hotspot for wheat rusts. We identified 4925 accessions to be resistant and these were further evaluated at Gurdaspur (Punjab), a hotspot for stripe rust and at Cooch Behar (West Bengal), a hotspot for spot blotch. The second round evaluation identified 498 accessions potentially resistant to multiple rusts and 868 accessions potentially resistant to spot blotch. Evaluation of rust resistant accessions for seedling resistance against seven virulent pathotypes of three rusts under artificial epiphytotic conditions identified 137 accessions potentially resistant to multiple rusts. Molecular analysis to identify different combinations of genetic loci imparting resistance to leaf rust, stem rust, stripe rust and spot blotch using linked molecular markers, identified 45 wheat accessions containing known resistance genes against all three rusts as well as a QTL for spot blotch resistance. The resistant germplasm accessions, particularly against stripe rust, identified in this study can be excellent potential candidates to be employed for breeding resistance into the background of high yielding wheat cultivars through conventional or molecular breeding approaches, and are expected to contribute toward food security at national and global levels.
-
Mapping genes for resistance to stripe rust in spring wheat landrace PI 480035
Stripe rust caused by Puccinia striiformis Westend. f. sp. tritici Erikks. is an economically important disease of wheat (Triticum aestivum L.). Hexaploid spring wheat landrace PI 480035 was highly resistant to stripe rust in the field in Washington during 2011 and 2012. The objective of this resear...
-
Ray J. Hoff
1986-01-01
Necrotic reactions in branch or main stems of western white pine (Pinus monticola Dougl.) caused by infection by the blister rust fungus (Cronartium ribicola J. C. Fisch. ex Rabenh.) are a major mechanism of resistance. Overall, 26 percent of the seedlings eliminated the fungus via this defense system. Heritability based upon crossing family groups averaged 33 percent...
-
Use of AFLP marker system on sugarcane somaclones to study their resistance to rust
María Ileana Oloriz; Luis Rojas; Víctor Gil; Milady Mendoza; Ariel Arencibia; Elva Rosa Carmona; Elio Jiménez
2002-01-01
AFLPs (amplified fragment length polymorphism) was carried out from genomic DNA of five rust resistant sugar cane somaclons and their susceptible donor, Saccharum officinarum var B 4362, using three combinations of primers (EcoRI/aca: MseI/acc; EcoRI/aca: MseI/atg and EcoRI/aca: MseI/agg). Six polymorphic bands were obtained, two of these only appeared in the resistant genotypes, which are probably DNA sequences, related to rust resistance locus. These fragments have been cloned to study thei...
-
Kruppa, Klaudia; Türkösi, Edina; Mayer, Marianna; Tóth, Viola; Vida, Gyula; Szakács, Éva; Molnár-Láng, Márta
2016-11-01
A Thinopyrum intermedium × Thinopyrum ponticum synthetic hybrid wheatgrass is an excellent source of leaf and stem rust resistance produced by N.V.Tsitsin. Wheat line Mv9kr1 was crossed with this hybrid (Agropyron glael) in Hungary in order to transfer its advantageous agronomic traits into wheat. As the wheat parent was susceptible to leaf rust, the transfer of resistance was easily recognizable in the progenies. Three different partial amphiploid lines with leaf rust resistance were selected from the wheat/Thinopyrum hybrid derivatives by multicolour genomic in situ hybridization. Chromosome counting on the partial amphiploids revealed 58 chromosomes (18 wheatgrass) in line 194, 56 (14 wheatgrass) in line 195 and 54 (12 wheatgrass) in line 196. The wheat chromosomes present in these lines were identified and the wheatgrass chromosomes were characterized by fluorescence in situ hybridization using the repetitive DNA probes Afa-family, pSc119.2 and pTa71. The 3D wheat chromosome was missing from the lines. Molecular marker analysis showed the presence of the Lr24 leaf rust resistance gene in lines 195 and 196. The morphological traits were evaluated in the field during two consecutive seasons in two different locations.
-
Survey the Effect of Mycorrhiza and Azospirillum of Wheat Cultivars Resistance in Yellow Rust
Directory of Open Access Journals (Sweden)
M. Jiriaie
2017-01-01
Full Text Available Introduction: Wheat is one of the major agricultural crops with respect to human nutrition. It is cultivated over a wide range of environments, because of wide adaptation to diverse environmental conditions. In Iran, 6.2 million hectares are under wheat cultivation, of which 33% is irrigated and 67% is rain-fed, the irrigated wheat growing areas (2 million hectares are located mostly in southern, central and east of Iran Production of crops is under the influence of plant genetic structure, environmental conditions and their interactions. Biotic and abiotic stresses are considered to lower production. Among the biotic stress, the fungal disease is the main factor limiting production of crop plants in hot and humid regions. Stripe rust was not a serious economic concern to the wheat industry for most of the 1990’s due to the use of resistant varieties. However, by 2003 it had developed into a significant issue, particularly as new path types evolved. Even in the dry years of 2003 and 2004, stripe rust cost growers significant income. Provide country's need for wheat as a strategic product, meanwhile, production is free from chemical fungicide is a high but achievable goal. So in order to achieve fertilizer and fungicide resources that in addition to having no adverse effects on consumers and the environment, has been economically able to provide nutrition need of crop plant, is very important. Materials and Methods: With this approach, to survey the effect of Mycorrhiza and Azospirillum in resistance to yellow rust in wheat cultivars, an experiment was conducted at the research station of the Shahid Chamran University of Ahvaz, Iran in 2012-13. The experimental design was factorial based on a randomized complete block design with three replications. The treatments include of Mycorrhiza fungi in three levels (without application of Mycorrhiza strain and using strain Glomus intraradices and Glomus mosseae, Azospirillum lipoferum bacterium in two
-
Wang, Xiao-Yan; Wen-Feng, Li; Ying-Kun, Huang; Xin, Lu; Zhi-Ming, Luo; Jiong, Yin; Hong-Li, Shan; Rong-Yue, Zhang
2013-01-01
Sugarcane brown rust disease caused by Puccinia melanocephala is one of the important fungal diseases affecting sugarcane yield around the world. Cultivar resistance is the most appropriate control method for this disease. In this study, 62 introgression lines chosen from the crossing Saccharum officinarum L. cv. Ludashi x Erianthus rockii Yunnan 95-19 were evaluated for brown rust resistance using artificial inoculation. More than 30% of the introgression lines were identified as resistant. ...
-
Lr67/Yr46 confers adult plant resistance to stem rust and powdery mildew in wheat.
Herrera-Foessel, Sybil A; Singh, Ravi P; Lillemo, Morten; Huerta-Espino, Julio; Bhavani, Sridhar; Singh, Sukhwinder; Lan, Caixia; Calvo-Salazar, Violeta; Lagudah, Evans S
2014-04-01
We demonstrate that Lr67/Yr46 has pleiotropic effect on stem rust and powdery mildew resistance and is associated with leaf tip necrosis. Genes are designated as Sr55, Pm46 and Ltn3 , respectively. Wheat (Triticum aestivum) accession RL6077, known to carry the pleiotropic slow rusting leaf and yellow rust resistance genes Lr67/Yr46 in Thatcher background, displayed significantly lower stem rust (P. graminis tritici; Pgt) and powdery mildew (Blumeria graminis tritici; Bgt) severities in Kenya and in Norway, respectively, compared to its recurrent parent Thatcher. We investigated the resistance of RL6077 to stem rust and powdery mildew using Avocet × RL6077 F6 recombinant inbred lines (RILs) derived from two photoperiod-insensitive F3 families segregating for Lr67/Yr46. Greenhouse seedling tests were conducted with Mexican Pgt race RTR. Field evaluations were conducted under artificially initiated stem rust epidemics with Pgt races RTR and TTKST (Ug99 + Sr24) at Ciudad Obregon (Mexico) and Njoro (Kenya) during 2010-2011; and under natural powdery mildew epiphytotic in Norway at Ås and Hamar during 2011 and 2012. In Mexico, a mean reduction of 41 % on stem rust severity was obtained for RILs carrying Lr67/Yr46, compared to RILs that lacked the gene, whereas in Kenya the difference was smaller (16 %) but significant. In Norway, leaf tip necrosis was associated with Lr67/Yr46 and RILs carrying Lr67/Yr46 showed a 20 % reduction in mean powdery mildew severity at both sites across the 2 years of evaluation. Our study demonstrates that Lr67/Yr46 confers partial resistance to stem rust and powdery mildew and is associated with leaf tip necrosis. The corresponding pleiotropic, or tightly linked, genes, designated as Sr55, Pm46, and Ltn3, can be utilized to provide broad-spectrum durable disease resistance in wheat.
-
A new 2DS·2RL Robertsonian translocation transfers stem rust resistance gene Sr59 into wheat.
Rahmatov, Mahbubjon; Rouse, Matthew N; Nirmala, Jayaveeramuthu; Danilova, Tatiana; Friebe, Bernd; Steffenson, Brian J; Johansson, Eva
2016-07-01
A new stem rust resistance gene Sr59 from Secale cereale was introgressed into wheat as a 2DS·2RL Robertsonian translocation. Emerging new races of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici), from Africa threaten global wheat (Triticum aestivum L.) production. To broaden the resistance spectrum of wheat to these widely virulent African races, additional resistance genes must be identified from all possible gene pools. From the screening of a collection of wheat-rye (Secale cereale L.) chromosome substitution lines developed at the Swedish University of Agricultural Sciences, we described the line 'SLU238' 2R (2D) as possessing resistance to many races of P. graminis f. sp. tritici, including the widely virulent race TTKSK (isolate synonym Ug99) from Africa. The breakage-fusion mechanism of univalent chromosomes was used to produce a new Robertsonian translocation: T2DS·2RL. Molecular marker analysis and stem rust seedling assays at multiple generations confirmed that the stem rust resistance from 'SLU238' is present on the rye chromosome arm 2RL. Line TA5094 (#101) was derived from 'SLU238' and was found to be homozygous for the T2DS·2RL translocation. The stem rust resistance gene on chromosome 2RL arm was designated as Sr59. Although introgressions of rye chromosome arms into wheat have most often been facilitated by irradiation, this study highlights the utility of the breakage-fusion mechanism for rye chromatin introgression. Sr59 provides an additional asset for wheat improvement to mitigate yield losses caused by stem rust.
-
Induced resistance and gene expression in wheat against leaf rust ...
African Journals Online (AJOL)
uvp
2013-05-15
May 15, 2013 ... 2Department of Soil, Crop and Climate Sciences, University of the Free State, P.O Box ... Key words: Wheat leaf rust, induced resistance, priming, gene ..... transformation: susceptibility of transgenic Nicotiana sylvestris plants.
-
Mapping of stripe rust resistance gene in an Aegilops caudata ...
Indian Academy of Sciences (India)
Seedling resistance is usually race-specific, but often pro- vides complete ... Genomic DNA was extracted using the CTAB method of. Saghai-Maroof ... Polymerase chain reactions (PCR) were performed in ..... The continuous supply of the rust ...
-
Yang, Xiping; Islam, Md S; Sood, Sushma; Maya, Stephanie; Hanson, Erik A; Comstock, Jack; Wang, Jianping
2018-01-01
Sugarcane ( Saccharum spp.) is an important economic crop, contributing up to 80% of table sugar used in the world and has become a promising feedstock for biofuel production. Sugarcane production has been threatened by many diseases, and fungicide applications for disease control have been opted out for sustainable agriculture. Orange rust is one of the major diseases impacting sugarcane production worldwide. Identifying quantitative trait loci (QTLs) and developing diagnostic markers are valuable for breeding programs to expedite release of superior sugarcane cultivars for disease control. In this study, an F 1 segregating population derived from a cross between two hybrid sugarcane clones, CP95-1039 and CP88-1762, was evaluated for orange rust resistance in replicated trails. Three QTLs controlling orange rust resistance in sugarcane (qORR109, qORR4 and qORR102) were identified for the first time ever, which can explain 58, 12 and 8% of the phenotypic variation, separately. We also characterized 1,574 sugarcane putative resistance ( R ) genes. These sugarcane putative R genes and simple sequence repeats in the QTL intervals were further used to develop diagnostic markers for marker-assisted selection of orange rust resistance. A PCR-based Resistance gene-derived maker, G1 was developed, which showed significant association with orange rust resistance. The putative QTLs and marker developed in this study can be effectively utilized in sugarcane breeding programs to facilitate the selection process, thus contributing to the sustainable agriculture for orange rust disease control.
-
Improvement of resistance to rust through recurrent selection in pearl millet
Energy Technology Data Exchange (ETDEWEB)
Tapsoba, H. [Univ. of Georgia, Athens, GA (United States); Wilson, J.P.; Hanna, W.W. [Univ. of Georgia Coastal Plain Experimental Station, Tifton, GA (United States)
1997-04-01
Two pearl millet [Pennisetum glaucum (L.) R.Br. = P. typhoides (Burm.) Staff & Hubb., P. americanum (L.) K. Schum.] bulk populations, Tift No. 2 and Tift No. 5, served as base populations for four cycles of recurrent selection against susceptibility to Puccinia substriata Ell. & Barth, var. indica Ramachar & Cumm. A bulk inoculum of the pathogen was used. The objectives were to evaluate the progress achieved regarding overall resistance to the pathogen in the field and resistance to different races of the pathogen, and also to evaluate changes in unselected traits. During selection, the frequency of rust resistant plants continuously increased from about 30% in each base population to more than 85% by the third cycle of selection in both populations. An average increase of about 21 and 18% per cycle was obtained in Tift No. 2 and Tift No. 5, respectively. A continuous increase of the frequency of plants resistant to some races of the pathogen was also obtained. In Tift No. 5, 80% of the plants were resistant to eight races by the third cycle of selection. The accumulation of resistance observed in the seedlings was manifested in the field, both in 1993 and 1994, by a reduction of the final rust severity from the base population to the fourth selection cycle of both populations. This improvement in resistance to the rust pathogen was accompanied by an increase in the frequency of plants resistant to Pyricularia grisea (Cooke) Sacc. only in Tift No. 2. Despite the improvement in the selected character, genetic variability for agronomic traits such as plant height, number of culms/plant, flowering date, and panicle length was successfully maintained within each population. 20 refs., 1 fig., 7 tabs.
-
Costet, L; Le Cunff, L; Royaert, S; Raboin, L-M; Hervouet, C; Toubi, L; Telismart, H; Garsmeur, O; Rousselle, Y; Pauquet, J; Nibouche, S; Glaszmann, J-C; Hoarau, J-Y; D'Hont, A
2012-09-01
Modern sugarcane cultivars (Saccharum spp., 2n = 100-130) are high polyploid, aneuploid and of interspecific origin. A major gene (Bru1) conferring resistance to brown rust, caused by the fungus Puccinia melanocephala, has been identified in cultivar R570. We analyzed 380 modern cultivars and breeding materials covering the worldwide diversity with 22 molecular markers genetically linked to Bru1 in R570 within a 8.2 cM segment. Our results revealed a strong LD in the Bru1 region and strong associations between most of the markers and rust resistance. Two PCR markers, that flank the Bru1-bearing segment, were found completely associated with one another and only in resistant clones representing efficient molecular diagnostic for Bru1. On this basis, Bru1 was inferred in 86 % of the 194 resistant sugarcane accessions, revealing that it constitutes the main source of brown rust resistance in modern cultivars. Bru1 PCR diagnostic markers should be particularly useful to identify cultivars with potentially alternative sources of resistance to diversify the basis of brown rust resistance in breeding programs.
-
Use of AFLP marker system on sugarcane somaclones to study their resistance to rust
Directory of Open Access Journals (Sweden)
María Ileana Oloriz
2002-10-01
Full Text Available AFLPs (amplified fragment length polymorphism was carried out from genomic DNA of five rust resistant sugar cane somaclons and their susceptible donor, Saccharum officinarum var B 4362, using three combinations of primers (EcoRI/aca: MseI/acc; EcoRI/aca: MseI/atg and EcoRI/aca: MseI/agg. Six polymorphic bands were obtained, two of these only appeared in the resistant genotypes, which are probably DNA sequences, related to rust resistance locus. These fragments have been cloned to study their nucleotide sequence and to investigate their roll in resistance mechanism develop by these mutants during Puccinia melanocephala infection. Key words: molecular markers, Puccinia. melanocephala, Saccharum
-
Kolmer, James A; Su, Zhenqi; Bernardo, Amy; Bai, Guihua; Chao, Shiaoman
2018-04-25
A new gene for adult plant leaf rust resistance in wheat was mapped to chromosome 3BL. This gene was designated as Lr77. 'Santa Fe' is a hard red winter cultivar that has had long-lasting resistance to the leaf rust fungus, Puccinia triticina. The objective of this study was to determine the chromosome location of the adult plant leaf rust resistance in Santa Fe wheat. A partial backcross line of 'Thatcher' (Tc) wheat with adult plant leaf rust resistance derived from Santa Fe was crossed with Thatcher to develop a Thatcher//Tc*2/Santa Fe F 6 recombinant inbred line (RIL) population. The RIL population and parental lines were evaluated for segregation of leaf rust resistance in three field plot tests and in an adult plant greenhouse test. A genetic map of the RIL population was constructed using 90,000 single-nucleotide polymorphism (SNP) markers with the Illumina Infinium iSelect 90K wheat bead array. A significant quantitative trait locus for reduction of leaf rust severity in all four tests was found on chromosome 3BL that segregated as a single adult plant resistance gene. The RILs with the allele from the resistant parent for SNP marker IWB10344 had lower leaf rust severity and a moderately resistant to moderately susceptible response compared to the susceptible RILs and Thatcher. The gene derived from Santa Fe on chromosome 3BL was designated as Lr77. Kompetitive allele-specific polymerase chain reaction assay markers linked to Lr77 on 3BL should be useful for selection of wheat germplasm with this gene.
-
New Seeds are Resistant to Wheat Stem Rust (Ug99) Multinational Programme Supported by FAO and IAEA
International Nuclear Information System (INIS)
2013-01-01
Full text: A multinational effort supported by the International Atomic Energy Agency and the U.N. Food and Agriculture Organization marked a key milestone this week when a Kenyan university debuted two new varieties of disease-resistant wheat to the nation's farmers. Over the past two days, thousands of Kenyan farmers have visited Eldoret University in western Kenya for a two-day agriculture fair highlighting the latest farming technologies. Supporting the development of the new varieties were the IAEA's Technical Cooperation Department and the Joint FAO/IAEA Programme of Nuclear Techniques in Food and Agriculture. They manage an interregional Technical Cooperation project to develop varieties of wheat that are resistant to a devastating type of fungus, causing a disease known as wheat stem rust. Wheat stem rust under control for over 30 years, but a resurgence of the disease was discovered in 1999 in Uganda that swiftly spread to neighbouring Kenya. The wheat stem rust, caused by the strain of the fungus known as Ug99, named after its place and year of origin, has since spread to Iran, Yemen and South Africa and threatens crops as far away as India as spores are carried by wind. Parasitic rusts threaten global wheat production, reducing plant growth and crop yields. The disease can destroy up to 70-100 percent of the yield of wheat crop if not prevented. 'Improving food security in developing countries through the use of nuclear techniques is an important priority of the IAEA', said IAEA Director General Yukiya Amano. 'I am pleased that we have been able to make an important contribution to fighting wheat rust'. 'Wheat rusts, particularly the Ug99 strain, are a major threat to food security because rust epidemics can result in devastating yield losses. This international project involving affected countries, plant scientists and breeders and international organizations is a major breakthrough. It clearly shows the benefits of FAO/IAEA collaboration and that
-
Corrosion-resistant amorphous alloy ribbons for electromagnetic filtration of iron rusts from water
International Nuclear Information System (INIS)
Kawashima, Asahi; Asami, Katsuhiko; Sato, Takeaki; Hashimoto, Koji
1985-01-01
An attempt was made to use corrosion-resistant amorphous Fe-9Cr-13P-7C alloy ribbons as an electromagnetic filter material for trapping various iron rusts suspended in water at 40 0 C. The ferrimagnetic Fe 3 O 4 rust was trapped with the 100 % efficiency and paramagnetic rusts such as α-Fe 2 O 3 , α-FeOOH and amorphous ferric oxyhydroxide were trapped with certain efficiencies at the magnetic field strength of 0.5-10 kOe. The regeneration of the filter by back-washing was easy. The trapping capacity of electromagnetic filter was proportional to the edge length of the filter material where the high magnetic field strength existed. Therefore, melt-spun thin and narrow amorphous alloy ribbons having the high corrosion resistance have the potential utility as electromagnetic filter material. (author)
-
Preempting the pathogen: Blister rust and proactive management of high-elevation pines
Sue Miller; Anna Schoettle; Kelly Burns; Richard Sniezko; Patty Champ
2017-01-01
White pine blister rust has been spreading through western forests since 1910, causing widespread mortality in a group that includes some of the oldest and highest-elevation pines in the United States. The disease has recently reached Colorado and is expected to travel through the southern Rockies. Although it cannot be contained, RMRS researchers and collaborators are...
-
Mapping genes for resistance to stripe rust in spring wheat landrace PI 480035.
Directory of Open Access Journals (Sweden)
Jinita Sthapit Kandel
Full Text Available Stripe rust caused by Puccinia striiformis Westend. f. sp. tritici Erikks. is an economically important disease of wheat (Triticum aestivum L.. Hexaploid spring wheat landrace PI 480035 was highly resistant to stripe rust in the field in Washington during 2011 and 2012. The objective of this research was to identify quantitative trait loci (QTL for stripe rust resistance in PI 480035. A spring wheat, "Avocet Susceptible" (AvS, was crossed with PI 480035 to develop a biparental population of 110 recombinant inbred lines (RIL. The population was evaluated in the field in 2013 and 2014 and seedling reactions were examined against three races (PSTv-14, PSTv-37, and PSTv-40 of the pathogen under controlled conditions. The population was genotyped with genotyping-by-sequencing and microsatellite markers across the whole wheat genome. A major QTL, QYr.wrsggl1-1BS was identified on chromosome 1B. The closest flanking markers were Xgwm273, Xgwm11, and Xbarc187 1.01 cM distal to QYr.wrsggl1-1BS, Xcfd59 0.59 cM proximal and XA365 3.19 cM proximal to QYr.wrsggl1-1BS. Another QTL, QYr.wrsggl1-3B, was identified on 3B, which was significant only for PSTv-40 and was not significant in the field, indicating it confers a race-specific resistance. Comparison with markers associated with previously reported Yr genes on 1B (Yr64, Yr65, and YrH52 indicated that QYr.wrsggl1-1BS is potentially a novel stripe rust resistance gene that can be incorporated into modern breeding materials, along with other all-stage and adult-plant resistance genes to develop cultivars that can provide durable resistance.
-
Pandey, Manish K; Khan, Aamir W; Singh, Vikas K; Vishwakarma, Manish K; Shasidhar, Yaduru; Kumar, Vinay; Garg, Vanika; Bhat, Ramesh S; Chitikineni, Annapurna; Janila, Pasupuleti; Guo, Baozhu; Varshney, Rajeev K
2017-08-01
Rust and late leaf spot (LLS) are the two major foliar fungal diseases in groundnut, and their co-occurrence leads to significant yield loss in addition to the deterioration of fodder quality. To identify candidate genomic regions controlling resistance to rust and LLS, whole-genome resequencing (WGRS)-based approach referred as 'QTL-seq' was deployed. A total of 231.67 Gb raw and 192.10 Gb of clean sequence data were generated through WGRS of resistant parent and the resistant and susceptible bulks for rust and LLS. Sequence analysis of bulks for rust and LLS with reference-guided resistant parent assembly identified 3136 single-nucleotide polymorphisms (SNPs) for rust and 66 SNPs for LLS with the read depth of ≥7 in the identified genomic region on pseudomolecule A03. Detailed analysis identified 30 nonsynonymous SNPs affecting 25 candidate genes for rust resistance, while 14 intronic and three synonymous SNPs affecting nine candidate genes for LLS resistance. Subsequently, allele-specific diagnostic markers were identified for three SNPs for rust resistance and one SNP for LLS resistance. Genotyping of one RIL population (TAG 24 × GPBD 4) with these four diagnostic markers revealed higher phenotypic variation for these two diseases. These results suggest usefulness of QTL-seq approach in precise and rapid identification of candidate genomic regions and development of diagnostic markers for breeding applications. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
-
Brazil, was noted to have long lasting leaf rust resistance that was effective only in adult plants. The objectives of this study were to determine the chromosome location of the leaf rust resistance genes derived from Toropi in two populations of recombinant inbred lines in a partial Thatcher wheat...
-
Sustracted library obtained from mutant sugarcane variety B 4362 resistant to rust
Directory of Open Access Journals (Sweden)
María I. Oloriz
2002-07-01
Full Text Available The hypersensitive response is one of the most powerful mechanisms for which the plants resist pathogen attack. Mutations carried out previously on the variety B4362, of sugarcane, originated five mutants that express this mechanism towards the attack of rust (Puccinia melanocephala Syd.. By means of a subtractive hybridization among the cDNA obtained starting from the resistant clone inoculated with rust and a pool of cDNA of the susceptible variety (B4362 inoculated and of the resistant clone not inoculated, it was possible to reduce the number of genes expressed during the infection with the fungus. A subtractive library was carried out where we hope that most of the genes are involved in the hypersensitive response that present these mutants towards the infection of the pathogen. Key words: Subtractive hybridization, hypersensitive response, Puccinia melanocephala Syd.
-
Targeted introgression of stem rust Ug99 resistance from wheatgrasses into pasta and bread wheat
In the past 50 years, a number of stem rust resistance (Sr) genes have been transferred from several wheat-related grasses into durum (i.e. pasta) and bread wheat through chromosome translocations and additions. To utilize these genes for controlling the Ug99 races of the stem rust pathogen, we ini...
-
Huang, Xuan; Wang, Jian; Du, Zhen; Zhang, Chen; Li, Lan; Xu, Ziqin
2013-10-01
Stripe rust is a devastating fungal disease of wheat worldwide which is primarily caused by Puccinia striiformis f. sp tritici. Transgenic wheat (Triticum aestivum L.) expressing rice class chitinase gene RC24 were developed by particle bombardment of immature embryos and tested for resistance to Puccinia striiformis f.sp tritici. under greenhouse and field conditions. Putative transformants were selected on kanamycin-containing media. Polymease chain reaction indicated that RC24 was transferred into 17 transformants obtained from bombardment of 1,684 immature embryos. Integration of RC24 was confirmed by Southern blot with a RC24-labeled probe and expression of RC24 was verified by RT-PCR. Nine transgenic T1 lines exhibited enhanced resistance to stripe rust infection with lines XN8 and BF4 showing the highest level of resistance. Southern blot hybridization confirmed the stable inheritance of RC24 in transgenic T1 plants. Resistance to stripe rust in transgenic T2 and T3 XN8 and BF4 plants was confirmed over two consecutive years in the field. Increased yield (27-36 %) was recorded for transgenic T2 and T3 XN8 and BF4 plants compared to controls. These results suggest that rice class I chitinase RC24 can be used to engineer stripe rust resistance in wheat.
-
Developing clones of Eucalyptus cloeziana resistant to rust (Puccinia psidii)
Rafael F. Alfenas; Marcelo M. Coutinho; Camila S. Freitas; Rodrigo G. Freitas; Acelino C. Alfenas
2012-01-01
Besides its high resistance to Chrysoporthe cubensis canker, Eucalyptus cloeziana F. Muell. is a highly valuable tree species for wood production. It can be used for furniture, electric poles, fence posts, and charcoal. Nevertheless, it is highly susceptible to the rust caused by Puccinia psidii, which...
-
Angelia Kegley; Richard A. Sniezko; Robert Danchok; Douglas P. Savin
2012-01-01
Whitebark pine is considered one of the most susceptible white pine species to white pine blister rust, the disease caused by the non-native pathogen Cronartium ribicola. High mortality from blister rust and other factors in much of the range in the United States and Canada have raised serious concerns about the future viability of this high-...
-
Detlev R. Vogler; Patricia E. Maloney; Tom Burt; Jacob W. Snelling
2017-01-01
In 2013, while surveying for five-needle white pine cone crops in northeastern Nevada, we observed white pine blister rust, caused by the rust pathogen Cronartium ribicola Fisch., infecting branches and stems of limber pines (Pinus flexilis James) on Pine Mountain (41.76975°N, 115.61622°W), Humboldt National Forest,...
-
Glyphosate inhibits rust diseases in glyphosate-resistant wheat and soybean
Feng, Paul C. C.; Baley, G. James; Clinton, William P.; Bunkers, Greg J.; Alibhai, Murtaza F.; Paulitz, Timothy C.; Kidwell, Kimberlee K.
2005-01-01
Glyphosate is a broad-spectrum herbicide used for the control of weeds in glyphosate-resistant crops. Glyphosate inhibits 5-enolpyruvyl shikimate 3-phosphate synthase, a key enzyme in the synthesis of aromatic amino acids in plants, fungi, and bacteria. Studies with glyphosate-resistant wheat have shown that glyphosate provided both preventive and curative activities against Puccinia striiformis f. sp. tritici and Puccinia triticina, which cause stripe and leaf rusts, respectively, in wheat. ...
-
Sources of stem rust resistance in wheat-alien introgression lines
Stem rust, caused by Puccinia graminis f. sp. tritici, is one of the most devastating diseases of wheat and the novel highly virulent race of TTKSK and its lineage are threatening wheat production worldwide. The objective of the study was to identify new sources of resistance in wheat-alien introgre...
-
Induced mutations for horizontal resistance. A model study using leaf rust resistance in wheat
International Nuclear Information System (INIS)
Chopra, V.L.; Sawhney, R.N.; Kumar, R.
1983-01-01
A mutant with seemingly non-specific resistance to leaf rust was obtained some time ago from the wheat variety Kharchia Local treated with NMH. This mutant is being studied genetically and in its disease reaction by laboratories in Australia, Canada and India in co-operation. The mutant showed a dominant inheritance of resistance in F 1 , but different segregation in F 2 and F 3 . This peculiar genetic behaviour has so far not been explained. (author)
-
The Big Rust and the Red Queen: Long-Term Perspectives on Coffee Rust Research.
McCook, Stuart; Vandermeer, John
2015-09-01
Since 2008, there has been a cluster of outbreaks of the coffee rust (Hemileia vastatrix) across the coffee-growing regions of the Americas, which have been collectively described as the Big Rust. These outbreaks have caused significant hardship to coffee producers and laborers. This essay situates the Big Rust in a broader historical context. Over the past two centuries, coffee farmers have had to deal with the "curse of the Red Queen"-the need to constantly innovate in the face of an increasing range of threats, which includes the rust. Over the 20th century, particularly after World War II, national governments and international organizations developed a network of national, regional, and international coffee research institutions. These public institutions played a vital role in helping coffee farmers manage the rust. Coffee farmers have pursued four major strategies for managing the rust: bioprospecting for resistant coffee plants, breeding resistant coffee plants, chemical control, and agroecological control. Currently, the main challenge for researchers is to develop rust control strategies that are both ecologically and economically viable for coffee farmers, in the context of a volatile, deregulated coffee industry and the emergent challenges of climate change.
-
Genetics of leaf rust resistance in the hard red winter wheat cultivars Santa Fe and Duster
Leaf rust caused by Puccinia triticina is a common and important disease of hard red winter wheat in the Great Plains of the United States. The hard red winter wheat cultivars 'Santa Fe' and 'Duster' have had effective leaf rust resistance since their release in 2003 and 2006, respectively. Both cul...
-
Localising QTLs for leaf rust resistance and agronomic traits in barley (¤Hordeum vulgare¤ L.)
DEFF Research Database (Denmark)
Kicherer, S.; Backes, G.; Walther, U.
2000-01-01
to leaf rust by means of artificial infection, heading date, plant height and Kernel weight were assessed. For leaf rust resistance, 4 QTLs were localised, that explained 96.1% of the genetic variation. One QTL on chromosome 4H confirmed a position found in another genetic background and one mapped...
-
Identification of RAPD marker associated with brown rust resistance in sugarcane
Susceptibility to brown rust caused by Puccinia melanocephala is a major reason for the withdrawal of sugarcane cultivars from production. An efficient way to control the disease is to breed cultivars with durable resistance. Our aim was to identify random amplified polymorphic DNA (RAPD) markers ...
-
Chen, Yang-Er; Cui, Jun-Mei; Su, Yan-Qiu; Yuan, Shu; Yuan, Ming; Zhang, Huai-Yu
2015-01-01
Wheat stripe rust (Puccinia striiformis f. sp. tritici, Pst), is one of the most serious diseases of wheat (Triticum aestivum L.) worldwide. To gain a better understanding of the protective mechanism against stripe rust at the adult plant stage, the differences in photosystem II and antioxidant enzymatic systems between susceptible and resistant wheat in response to stripe rust disease (P. striiformis) were investigated. We found that chlorophyll fluorescence and the activities of the antioxidant enzymes were higher in resistant wheat than in susceptible wheat after stripe rust infection. Compared with the susceptible wheat, the resistant wheat accumulated a higher level of D1 protein and a lower level of reactive oxygen species after infection. Furthermore, our results demonstrate that D1 and light-harvesting complex II (LHCII) phosphorylation are involved in the resistance to stripe rust in wheat. The CP29 protein was phosphorylated under stripe rust infection, like its phosphorylation in other monocots under environmental stresses. More extensive damages occur on the thylakoid membranes in the susceptible wheat compared with the resistant wheat. The findings provide evidence that thylakoid protein phosphorylation and antioxidant enzyme systems play important roles in plant responses and defense to biotic stress.
-
Frank M. Dugan; Michael J. Cashman; Richard C. Johnson; Meinan Wang; Chen Xianming
2014-01-01
Differential resistance to stripe rust (Puccinia striiformis) in a planting of 111 wild collections of Basin wild rye (Leymus cinereus) was noted 2011-2013. In 2011, rust severity was rated on a scale of 1-9. Much lighter infection in 2012 and 2013 was rated as the number of symptomatic leaves per plant divided by plant circumference (to adjust for plant size). Effect...
-
Effective genes for resistance to stripe rust and virulence of Puccinia ...
African Journals Online (AJOL)
The results revealed that stripe rust resistance genes Yr3, Yr5, Yr10, Yr15, Yr26, YrSP and YrCV were resistant, while Yr18 showed moderate susceptibility at all locations. Genes YrA-, Yr2, Yr6, Yr7, Yr8, Yr9, Yr17, Yr27 and gene combinations Opata (Yr27+Yr18) and Super Kauz (Yr9, Yr27, Yr18) were found susceptible.
-
Leaf rust of cultivated barley: pathology and control.
Park, Robert F; Golegaonkar, Prashant G; Derevnina, Lida; Sandhu, Karanjeet S; Karaoglu, Haydar; Elmansour, Huda M; Dracatos, Peter M; Singh, Davinder
2015-01-01
Leaf rust of barley is caused by the macrocyclic, heteroecious rust pathogen Puccinia hordei, with aecia reported from selected species of the genera Ornithogalum, Leopoldia, and Dipcadi, and uredinia and telia occurring on Hordeum vulgare, H. vulgare ssp. spontaneum, Hordeum bulbosum, and Hordeum murinum, on which distinct parasitic specialization occurs. Although Puccinia hordei is sporadic in its occurrence, it is probably the most common and widely distributed rust disease of barley. Leaf rust has increased in importance in recent decades in temperate barley-growing regions, presumably because of more intensive agricultural practices. Although total crop loss does not occur, under epidemic conditions yield reductions of up to 62% have been reported in susceptible varieties. Leaf rust is primarily controlled by the use of resistant cultivars, and, to date, 21 seedling resistance genes and two adult plant resistance (APR) genes have been identified. Virulence has been detected for most seedling resistance genes but is unknown for the APR genes Rph20 and Rph23. Other potentially new sources of APR have been reported, and additivity has been described for some of these resistances. Approaches to achieving durable resistance to leaf rust in barley are discussed.
-
Limber pine forests on the leading edge of white pine blister rust distribution in Northern Colorado
Jennifer G. Klutsch; Betsy A. Goodrich; Anna W. Schoettle
2011-01-01
The combined threats of the current mountain pine beetle (Dendroctonus ponderosae, MPB) epidemic with the imminent invasion of white pine blister rust (caused by the non-native fungus Cronartium ribicola, WPBR) in limber pine (Pinus flexilis) forests in northern Colorado threatens the limber pine's regeneration cycle and ecosystem function. Over one million...
-
Research to identify and characterize stem rust resistance genes in common wheat, Triticum aestivum, has been stimulated by the emergence of Ug99-lineage races of the wheat stem rust pathogen, Puccinia graminis f. sp. tritici (Pgt), in Eastern Africa. The Montenegrin spring wheat landrace PI 362698 ...
-
SH1 leaf rust and bacterial halo blight coffee resistances are genetically independent
Directory of Open Access Journals (Sweden)
Lucas Mateus Rivero Rodrigues
Full Text Available ABSTRACT Coffee resistance to Pseudomonas syringae pv. garcae has been associated to pleiotropic effect of SH1 allele, present in coffee plants resistant to certain races of Hemileia vastatrix, the causal agent of leaf rust, or genetic linkage between resistance alleles to both pathogens. To validate this hypothesis, 63 coffee plants in F2 generation were evaluated for resistance to 2 isolates of H. vastatrix carriers of alleles, respectively, v2, v5 (isolate I/2015 and v1; v2; v5 (isolate II/2015 with the objective to confirm presence of SH1 allele in resistant plants to isolate I/2015. The same coffee plants were evaluated for resistance to a mixture of P. syringae pv. garcae strains highly pathogenic to coffee. Results showed that, among F2 coffee allele SH1 carriers, resistant to isolate I/2015, resistant and susceptible plants to bacterial halo blight were found; the same segregation occurs between F2 homozygous for SH1 allele, susceptible to the same isolate (I/2015 of H. vastatrix. Results also indicate that there is no pleiotropic effect of gene or allele SH1 connection between genes conferring resistance to leaf rust caused by H. vastatrix and bacterial halo blight caused by P. syringae pv. garcae.
-
Lauren Fins; James Byler; Dennis Ferguson; Al Harvey; Mary Francis Mahalovich; Geral I. McDonald; Dan Miller; John Schwandt; Art Zack
2001-01-01
In 1883, when the Northern Pacific Railroad made its way through northern Idaho, western white pines dominated the moist, mid-elevation, mixed-species forests of the Inland Northwest between 2,000 and 6,000 feet. These majestic trees often lived to 350 years but could reach the ripe old ages of 400 and even 500 years. They were an integral part of the most productive...
-
Brown rust, caused by Puccinia melanocephala, is an important disease of sugarcane worldwide. Molecular markers for a major brown rust resistance gene, Bru1, were used to screen a total of 1,282 clones in the World Collection of Sugarcane and Related Grasses (WCSRG) to determine the distribution and...
-
Characterization of non-host resistance in broad bean to the wheat stripe rust pathogen
Directory of Open Access Journals (Sweden)
Cheng Yulin
2012-06-01
Full Text Available Abstract Background Non-host resistance (NHR confers plant species immunity against the majority of microbial pathogens and represents the most robust and durable form of plant resistance in nature. As one of the main genera of rust fungi with economic and biological importance, Puccinia infects almost all cereals but is unable to cause diseases on legumes. Little is known about the mechanism of this kind of effective defense in legumes to these non-host pathogens. Results In this study, the basis of NHR in broad bean (Vicia faba L. against the wheat stripe rust pathogen, Puccinia striiformis f. sp. tritici (Pst, was characterized. No visible symptoms were observed on broad bean leaves inoculated with Pst. Microscopic observations showed that successful location of stomata and haustoria formation were significantly reduced in Pst infection of broad bean. Attempted infection induced the formation of papillae, cell wall thickening, production of reactive oxygen species, callose deposition and accumulation of phenolic compounds in plant cell walls. The few Pst haustoria that did form in broad bean cells were encased in reactive oxygen and callose materials and those cells elicited cell death. Furthermore, a total of seven defense-related genes were identified and found to be up-regulated during the Pst infection. Conclusions The results indicate that NHR in broad bean against Pst results from a continuum of layered defenses, including basic incompatibility, structural and chemical strengthening of cell wall, posthaustorial hypersensitive response and induction of several defense-related genes, demonstrating the multi-layered feature of NHR. This work also provides useful information for further determination of resistance mechanisms in broad bean to rust fungi, especially the adapted important broad bean rust pathogen, Uromyces viciae-fabae, because of strong similarity and association between NHR of plants to unadapted pathogens and basal
-
Cathie Jean; Erin Shanahan; Rob Daley; Gregg DeNitto; Dan Reinhart; Chuck Schwartz
2011-01-01
There is a critical need for information on the status and trend of whitebark pine (Pinus albicaulis) in the Greater Yellowstone Ecosystem (GYE). Concerns over the combined effects of white pine blister rust (WPBR, Cronartium ribicola), mountain pine beetle (MPB, Dendroctonus ponderosae), and climate change prompted an interagency working group to design and implement...
-
Genetics and mapping of a new leaf rust resistance gene in Triticum ...
Indian Academy of Sciences (India)
AMIT KUMAR SINGH
seedling stage revealed that leaf rust resistance in Selection G12 is conditioned by a single ... closely or distantly related species of wheat (McIntosh et al. 2013 ... An effort was also made to determine the chromo- ... Materials and methods.
-
International Nuclear Information System (INIS)
Bhatti, M.A.; Burhan, M.; Shahzad, M.A.; Aslam, M.
2009-01-01
A field experiment was conducted to assess the level of resistance and susceptibility against stripe and leaf rust of wheat at Arid Zone Research 1, Institute, Bhakkar during, Rabi 2009, One hundred wheat genotypes were sown in second week of November. Each test line/variety of planted in two rows of 2 meter reach will two row of Morocco after every three entries to increase the disease pressure, fest lines/ varieties were inoculated thrice with highly susceptible Morocco and two most virulent Lr-26 and Lr-23 patho type. Out of eighty four test entries/varieties screened against le leaf rust, 5 exhibited resistant 21 moderately susceptible, 20 susceptible, 28 moderately resistant and 10 were highly susceptible. The present investigation indicated that there was no highly resistant lines/variety with zero disease severity. On the other hand, as regards stripe rust, out of thirty seven lines/varieties only two lines were susceptible to disease, Among other lines/ varieties, 12 resistant, 11 moderately resistant, 6 moderately susceptible and 2 susceptible against disease. Four (4) lines /varieties proved as highly resistant with zero disease severity.
-
Studies on /sup 32/P transport and yellow rust resistance in barley
Energy Technology Data Exchange (ETDEWEB)
Schubert, J. (Akademie der Landwirtschaftswissenschaften der DDR, Aschersleben. Inst. fuer Phytopathologie)
1982-01-01
Several cultivars of barley (Hordeum vulgare L.) differing in their resistance to yellow rust were used to study the influence of the infection with Puccinia striiformis West. (strain 24) on /sup 32/P transport in intact plants and isolated leaves. Close correlations exist between transport processes and resistance. For example, resistant plants seem to have a more intensive matter transport than susceptible ones. The importance of the rate of transport to the effectiveness of hypothetic inducers of resistance reactions and defence substances is discussed.
-
Non-Ribes alternate hosts of white pine blister rust: What this discovery means to whitebark pine
Paul J. Zambino; Bryce A. Richardson; Geral I. McDonald; Ned B. Klopfenstein; Mee-Sook. Kim
2006-01-01
From early to present-day outbreaks, white pine blister rust caused by the fungus Cronartium ribicola, in combination with mountain pine beetle outbreaks and fire exclusion has caused ecosystem-wide effects for all five-needled pines (McDonald and Hoff 2001). To be successful, efforts to restore whitebark pine will require sound management decisions that incorporate an...
-
Attempts to induce mutations for resistance of wheat to mildew, stem rust and leaf rust
International Nuclear Information System (INIS)
Kiraly, Z.; Barabas, Z.
1983-01-01
Research carried out between 1971 and 1981 is summarized. Attempts to find induced mutants with full resistance to pathotype mixtures of the three pathogens were not successful. Reasons are discussed. Studies on wheat lines tolerant to stem rust infection led to the conclusion that this disease reaction may be often accompanied by a reduced number of infection sites and a longer lag period resulting in reduced spore production. Various selection methods have been evaluated. Selecting for the multigenic 'non race specific' way is promising. (author)
-
Montilla-Bascón, Gracia; Rispail, Nicolas; Sánchez-Martín, Javier; Rubiales, Diego; Mur, Luis A J; Langdon, Tim; Howarth, Catherine J; Prats, Elena
2015-01-01
Diseases caused by crown rust (Puccinia coronata f. sp. avenae) and powdery mildew (Blumeria graminis f. sp. avenae) are among the most important constraints for the oat crop. Breeding for resistance is one of the most effective, economical, and environmentally friendly means to control these diseases. The purpose of this work was to identify elite alleles for rust and powdery mildew resistance in oat by association mapping to aid selection of resistant plants. To this aim, 177 oat accessions including white and red oat cultivars and landraces were evaluated for disease resistance and further genotyped with 31 simple sequence repeat and 15,000 Diversity Arrays Technology (DArT) markers to reveal association with disease resistance traits. After data curation, 1712 polymorphic markers were considered for association analysis. Principal component analysis and a Bayesian clustering approach were applied to infer population structure. Five different general and mixed linear models accounting for population structure and/or kinship corrections and two different statistical tests were carried out to reduce false positive. Five markers, two of them highly significant in all models tested were associated with rust resistance. No strong association between any marker and powdery mildew resistance at the seedling stage was identified. However, one DArT sequence, oPt-5014, was strongly associated with powdery mildew resistance in adult plants. Overall, the markers showing the strongest association in this study provide ideal candidates for further studies and future inclusion in strategies of marker-assisted selection.
-
Henry Amerson; C. Dana Nelson; Thomas L. Kubisiak; E.George Kuhlman; Saul Garcia
2015-01-01
Nearly two decades of research on the host-pathogen interaction in fusiform rust of loblolly pine is detailed. Results clearly indicate that pathotype-specific genes in the host interacting with pathogen avirulence cause resistance as defined by the non-gall phenotype under favorable environmental conditions for disease development. In particular, nine fusiform rust...
-
Laidò, Giovanni; Panio, Giosuè; Marone, Daniela; Russo, Maria A; Ficco, Donatella B M; Giovanniello, Valentina; Cattivelli, Luigi; Steffenson, Brian; de Vita, Pasquale; Mastrangelo, Anna M
2015-01-01
Stem rust, caused by Puccinia graminis Pers. f. sp. tritici Eriks. and E. Henn. (Pgt), is one of the most destructive diseases of wheat. Races of the pathogen in the "Ug99 lineage" are of international concern due to their virulence for widely used stem rust resistance genes and their spread throughout Africa. Disease resistant cultivars provide one of the best means for controlling stem rust. To identify quantitative trait loci (QTL) conferring resistance to African stem rust race TTKSK at the seedling stage, we evaluated an association mapping (AM) panel consisting of 230 tetraploid wheat accessions under greenhouse conditions. A high level of phenotypic variation was observed in response to race TTKSK in the AM panel, allowing for genome-wide association mapping of resistance QTL in wild, landrace, and cultivated tetraploid wheats. Thirty-five resistance QTL were identified on all chromosomes, and seventeen are of particular interest as identified by multiple associations. Many of the identified resistance loci were coincident with previously identified rust resistance genes; however, nine on chromosomes 1AL, 2AL, 4AL, 5BL, and 7BS may be novel. To validate AM results, a biparental population of 146 recombinant inbred lines was also considered, which derived from a cross between the resistant cultivar "Cirillo" and susceptible "Neodur." The stem rust resistance of Cirillo was conferred by a single gene on the distal region of chromosome arm 6AL in an interval map coincident with the resistance gene Sr13, and confirmed one of the resistance loci identified by AM. A search for candidate resistance genes was carried out in the regions where QTL were identified, and many of them corresponded to NBS-LRR genes and protein kinases with LRR domains. The results obtained in the present study are of great interest as a high level of genetic variability for resistance to race TTKSK was described in a germplasm panel comprising most of the tetraploid wheat sub-species.
-
Seifers, Dallas L.; Haber, Steve; Martin, Terry J.; McCallum, Brent D.
2014-01-01
Stable resistance to infection with Wheat streak mosaic virus (WSMV) can be evolved de novo in selfing bread wheat lines subjected to cycles of WSMV inoculation and selection of best-performing plants or tillers. To learn whether this phenomenon might be applied to evolve resistance de novo to pathogens unrelated to WSMV, we examined the responses to leaf rust of succeeding generations of the rust- and WSMV-susceptible cultivar ‘Lakin’ following WSMV inoculation and derived rust-resistant sublines. After three cycles of the iterative protocol five plants, in contrast to all others, expressed resistance to leaf and stripe rust. A subset of descendant sublines of one of these, ‘R1’, heritably and uniformly expressed the new trait of resistance to leaf rust. Such sublines, into which no genes from a known source of resistance had been introgressed, conferred resistance to progeny of crosses with susceptible parents. The F1 populations produced from crosses between, respectively, susceptible and resistant ‘Lakin’ sublines 4-3-3 and 4-12-3 were not all uniform in their response to seedling inoculation with race TDBG. In seedling tests against TDBG and MKPS races the F2s from F1 populations that were uniformly resistant had 3∶1 ratios of resistant to susceptible individuals but the F2s from susceptible F1 progenitors were uniformly susceptible. True-breeding lines derived from resistant individuals in F2 populations were resistant to natural stripe and leaf rust inoculum in the field, while the ‘Lakin’ progenitor was susceptible. The next generation of six of the ‘Lakin’-derived lines exhibited moderate to strong de novo resistance to stem rust races TPMK, QFCS and RKQQ in seedling tests while the ‘Lakin’ progenitor was susceptible. These apparently epigenetic effects in response to virus infection may help researchers fashion a new tool that expands the range of genetic resources already available in adapted germplasm. PMID:24497941
-
Mapping fusiform rust resistance genes within a complex mating design of loblolly pine
Tania Quesada; Marcio F.R. Resende Jr.; Patricio Munoz; Jill L. Wegrzyn; David B. Neale; Matias Kirst; Gary F. Peter; Salvador A. Gezan; C.Dana Nelson; John M. Davis
2014-01-01
Fusiform rust resistance can involve gene-for-gene interactions where resistance (Fr) genes in the host interact with corresponding avirulence genes in the pathogen, Cronartium quercuum f.sp. fusiforme (Cqf). Here, we identify trees with Fr genes in a loblolly pine population derived from a complex mating design challenged with two Cqf inocula (one gall and 10 gall...
-
The wheat Lr34 multipathogen resistance gene confers resistance to anthracnose and rust in sorghum.
Schnippenkoetter, Wendelin; Lo, Clive; Liu, Guoquan; Dibley, Katherine; Chan, Wai Lung; White, Jodie; Milne, Ricky; Zwart, Alexander; Kwong, Eunjung; Keller, Beat; Godwin, Ian; Krattinger, Simon G; Lagudah, Evans
2017-11-01
The ability of the wheat Lr34 multipathogen resistance gene (Lr34res) to function across a wide taxonomic boundary was investigated in transgenic Sorghum bicolor. Increased resistance to sorghum rust and anthracnose disease symptoms following infection with the biotrophic pathogen Puccinia purpurea and the hemibiotroph Colletotrichum sublineolum, respectively, occurred in transgenic plants expressing the Lr34res ABC transporter. Transgenic sorghum lines that highly expressed the wheat Lr34res gene exhibited immunity to sorghum rust compared to the low-expressing single copy Lr34res genotype that conferred partial resistance. Pathogen-induced pigmentation mediated by flavonoid phytoalexins was evident on transgenic sorghum leaves following P. purpurea infection within 24-72 h, which paralleled Lr34res gene expression. Elevated expression of flavone synthase II, flavanone 4-reductase and dihydroflavonol reductase genes which control the biosynthesis of flavonoid phytoalexins characterized the highly expressing Lr34res transgenic lines 24-h post-inoculation with P. purpurea. Metabolite analysis of mesocotyls infected with C. sublineolum showed increased levels of 3-deoxyanthocyanidin metabolites were associated with Lr34res expression, concomitant with reduced symptoms of anthracnose. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
-
Peng, Fred Y; Yang, Rong-Cai
2017-06-20
The resistance to leaf rust (Lr) caused by Puccinia triticina in wheat (Triticum aestivum L.) has been well studied over the past decades with over 70 Lr genes being mapped on different chromosomes and numerous QTLs (quantitative trait loci) being detected or mapped using DNA markers. Such resistance is often divided into race-specific and race-nonspecific resistance. The race-nonspecific resistance can be further divided into resistance to most or all races of the same pathogen and resistance to multiple pathogens. At the molecular level, these three types of resistance may cover across the whole spectrum of pathogen specificities that are controlled by genes encoding different protein families in wheat. The objective of this study is to predict and analyze genes in three such families: NBS-LRR (nucleotide-binding sites and leucine-rich repeats or NLR), START (Steroidogenic Acute Regulatory protein [STaR] related lipid-transfer) and ABC (ATP-Binding Cassette) transporter. The focus of the analysis is on the patterns of relationships between these protein-coding genes within the gene families and QTLs detected for leaf rust resistance. We predicted 526 ABC, 1117 NLR and 144 START genes in the hexaploid wheat genome through a domain analysis of wheat proteome. Of the 1809 SNPs from leaf rust resistance QTLs in seedling and adult stages of wheat, 126 SNPs were found within coding regions of these genes or their neighborhood (5 Kb upstream from transcription start site [TSS] or downstream from transcription termination site [TTS] of the genes). Forty-three of these SNPs for adult resistance and 18 SNPs for seedling resistance reside within coding or neighboring regions of the ABC genes whereas 14 SNPs for adult resistance and 29 SNPs for seedling resistance reside within coding or neighboring regions of the NLR gene. Moreover, we found 17 nonsynonymous SNPs for adult resistance and five SNPs for seedling resistance in the ABC genes, and five nonsynonymous SNPs for
-
Molecular and genetic study of wheat rusts | Le Maitre | African ...
African Journals Online (AJOL)
Puccinia triticina, Puccinia graminis and Puccinia striiformis cause leaf, stem and yellow rust, respectively. Wheat rusts can cause losses as high as 70%. The rusts ability to evolve fungicide resistance has resulted in the use of resistant cultivars as the primary method of control. Breeding resistant cultivars is a long process ...
-
Genetics of leaf rust-resistant mutant WH 147-LM-1 in hexaploid wheat variety WH 147
International Nuclear Information System (INIS)
Reddy, V.R.K.; Viswanathan, P.
1999-01-01
By applying gamma rays, EMS and their combination in hexaploid wheat variety WH 147, a total of 20 mutants (0.0226%) exhibiting complete leaf rust resistance were isolated from segregating M2 rows.When one of the rust-resistant mutants, WH 147-LM-1 was crossed with the universally susceptible, suggesting that the mutant character is controlled by one dominant gene and one recessive gene.The F2 plants derived by crossing the mutant WH 147-LM with seven near-isogenic wheat lines showed segregation for susceptibility, indicating that the mutant character was indeed generated through induced mutations
-
E. George Kuhlman; Harry R. Powers; William D. Pepper
1995-01-01
Loblolly and slash pine seedlings from the fusiform rust resistant orchards developed cooperatively by the USDA Forest Service and the Georgia Forestry Commission had significantly less rust 7 to 8 years after planting on four of five sites in the Southeastern United States than seedlings of the same species from orchard sources developed primarily for silvicultural...
-
Genetics and mapping of a new leaf rust resistance gene in Triticum ...
Indian Academy of Sciences (India)
AMIT KUMAR SINGH
Selection G12 carries a new gene for leaf rust resistance, tentatively named as LrSelG12. [Singh A. K. ..... long arm of chromosome 3B were found to be polymor- phic between ... due to the evolution of new virulent races in India (Tomar et al.
-
Liu, Weizhen; Maccaferri, Marco; Chen, Xianming; Laghetti, Gaetano; Pignone, Domenico; Pumphrey, Michael; Tuberosa, Roberto
2017-11-01
SNP-based genome scanning in worldwide domesticated emmer germplasm showed high genetic diversity, rapid linkage disequilibrium decay and 51 loci for stripe rust resistance, a large proportion of which were novel. Cultivated emmer wheat (Triticum turgidum ssp. dicoccum), one of the oldest domesticated crops in the world, is a potentially rich reservoir of variation for improvement of resistance/tolerance to biotic and abiotic stresses in wheat. Resistance to stripe rust (Puccinia striiformis f. sp. tritici) in emmer wheat has been under-investigated. Here, we employed genome-wide association (GWAS) mapping with a mixed linear model to dissect effective stripe rust resistance loci in a worldwide collection of 176 cultivated emmer wheat accessions. Adult plants were tested in six environments and seedlings were evaluated with five races from the United States and one from Italy under greenhouse conditions. Five accessions were resistant across all experiments. The panel was genotyped with the wheat 90,000 Illumina iSelect single nucleotide polymorphism (SNP) array and 5106 polymorphic SNP markers with mapped positions were obtained. A high level of genetic diversity and fast linkage disequilibrium decay were observed. In total, we identified 14 loci associated with field resistance in multiple environments. Thirty-seven loci were significantly associated with all-stage (seedling) resistance and six of them were effective against multiple races. Of the 51 total loci, 29 were mapped distantly from previously reported stripe rust resistance genes or quantitative trait loci and represent newly discovered resistance loci. Our results suggest that GWAS is an effective method for characterizing genes in cultivated emmer wheat and confirm that emmer wheat is a rich source of stripe rust resistance loci that can be used for wheat improvement.
-
The emergence and spread of new virulent races of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici; Pgt), including the TTKSK (Ug99) race group, is a serious threat to global wheat production. In this study, we mapped and characterized two stem rust resistance genes from diploid wheat ...
-
Brown rust, caused by the fungus Puccinia melanocephala, is an important disease of sugarcane posing an increasing threat to sugarcane industries worldwide. A major gene, Bru1, has been shown to contribute a significant proportion of brown rust resistance in multiple sugarcane industries. The recent...
-
Xue, Shulin; Kolmer, James A; Wang, Shuwen; Yan, Liuling
2018-04-19
Winter wheat cultivar 'Jagger' was recently found to have an alien chromosomal segment 2NS that has Lr37 , a gene conferring resistance against leaf rust caused by Puccinia triticina The objective of this study was to map and characterize the gene(s) for seedling leaf rust resistance in Jagger. The recombinant inbred line (RIL) population of Jagger × '2174' was inoculated with leaf rust pathogen THBJG and BBBDB, and evaluated for infection type (IT) response. A major quantitative trait locus (QTL) for THBJG and BBBDB was coincidently mapped to chromosome arm 2AS, and the QTL accounted for 56.6% - 66.2% of total phenotypic variation in infection type (IT) response to THBJG, and 72.1% - 86.9% to BBBDB. The causal gene for resistance to these rust races was mapped to the 2NS segment in Jagger. The 2NS segment was located in a region of approximately 27.8 Mb starting from the telomere of chromosome arm 2AS, based on the sequences of the A genome in tetraploid wheat. The Lr17a gene on chromosome arm 2AS was delimited to 3.1 Mb in the genomic region, which was orthologous to the 2NS segment. Therefore, the Lr37 gene in the 2NS segment can be pyramided with other effective resistance genes, rather than Lr17a in wheat, to improve resistance to rust diseases. Copyright © 2018, G3: Genes, Genomes, Genetics.
-
Resistance to stem rust Ug99 in six bread wheat cultivars maps to chromosome 6DS.
Lopez-Vera, Eric E; Nelson, Sarah; Singh, Ravi P; Basnet, Bhoja R; Haley, Scott D; Bhavani, Sridhar; Huerta-Espino, Julio; Xoconostle-Cazares, Beatriz G; Ruiz-Medrano, Roberto; Rouse, Matthew N; Singh, Sukhwinder
2014-01-01
Identified SSR markers ( Xcfd49 and Xbarc183 ) linked with stem rust resistance for efficient use in marker-assisted selection and stacking of resistance genes in wheat breeding programs. More than 80 % of the worldwide wheat (Triticum aestivum L.) area is currently sown with varieties susceptible to the Ug99 race group of stem rust fungus. However, wheat lines Niini, Tinkio, Coni, Pfunye, Blouk, and Ripper have demonstrated Ug99 resistance at the seedling and adult plant stages. We mapped stem rust resistance in populations derived from crosses of a susceptible parent with each of the resistant lines. The segregation of resistance in each population indicated the presence of a single gene. The resistance gene in Niini mapped to short arm of chromosome 6D and was flanked by SSR markers Xcfd49 at distances of 3.9 cM proximal and Xbarc183 8.4 cM distal, respectively. The chromosome location of this resistance was validated in three other populations: PBW343/Coni, PBW343/Tinkio, and Cacuke/Pfunye. Resistance initially postulated to be conferred by the SrTmp gene in Blouk and Ripper was also linked to Xcfd49 and Xbarc183 on 6DS, but it was mapped proximal to Xbarc183 at a similar position to previously mapped genes Sr42 and SrCad. Based on the variation in diagnostic marker alleles, it is possible that Niini and Pfunye may carry different resistance genes/alleles. Further studies are needed to determine the allelic relationships between various genes located on chromosome arm 6DS. Our results provide valuable molecular marker and genetic information for developing Ug99 resistant wheat varieties in diverse germplasm and using these markers to tag the resistance genes in wheat breeding.
-
Wheat stem rust, caused by Puccinia graminis f. sp. tritici Erikss. & E. Henn, can incur yield losses on susceptible cultivars of durum wheat, Triticum turgidum ssp. durum (Desf.) Husnot. Though several durum cultivars possess the stem rust resistance gene Sr13, additional genes in durum wheat effec...
-
Control of Fe(O,OH)6 nano-network structures of rust for high atmospheric-corrosion resistance
International Nuclear Information System (INIS)
Kimura, Masao; Kihira, Hiroshi; Ohta, Noriaki; Hashimoto, Misao; Senuma, Takehide
2005-01-01
A new-type of weathering steel containing 3.0 mass% Ni and 0.4 mass% Cu ('advanced weathering steel') exhibits good atmospheric-corrosion resistance in an atmosphere containing relatively high air-born salinity. Here, we show that the high performance was successfully achieved by controlling Fe(O,OH) 6 nano-network structures of rust formed on their surfaces. A novel technique using synchrotron radiation has been developed for the in situ observation of rust-formation during wet-dry cycles. It has been revealed that the evolution of Fe(O,OH) 6 nano-network structures of rust formed on the advanced weathering steel was more unique than those of conventional weathering steel and mild steel. At an early stage of reaction, Fe 2 NiO 4 and CuO phases precipitate, which provide sites for the nucleation of the Fe(O,OH) 6 nano-network resulting in the formation of rust composed of fine and dense-packed grains. The existence of Fe 2 NiO 4 in the nano-network changes the ion-exchanging properties of rust from anion to cation selective. Then, the rust on the advanced weathering steel 'breathes out' chloride ions from the rust/steel interface, and protects steel for more than a century by reducing the life cycle maintenance cost in an environment-friendly manner
-
Ma, G J; Song, Q J; Markell, S G; Qi, L L
2018-03-21
A novel rust resistance gene, R 15 , derived from the cultivated sunflower HA-R8 was assigned to linkage group 8 of the sunflower genome using a genotyping-by-sequencing approach. SNP markers closely linked to R 15 were identified, facilitating marker-assisted selection of resistance genes. The rust virulence gene is co-evolving with the resistance gene in sunflower, leading to the emergence of new physiologic pathotypes. This presents a continuous threat to the sunflower crop necessitating the development of resistant sunflower hybrids providing a more efficient, durable, and environmentally friendly host plant resistance. The inbred line HA-R8 carries a gene conferring resistance to all known races of the rust pathogen in North America and can be used as a broad-spectrum resistance resource. Based on phenotypic assessments of 140 F 2 individuals derived from a cross of HA 89 with HA-R8, rust resistance in the population was found to be conferred by a single dominant gene (R 15 ) originating from HA-R8. Genotypic analysis with the currently available SSR markers failed to find any association between rust resistance and any markers. Therefore, we used genotyping-by-sequencing (GBS) analysis to achieve better genomic coverage. The GBS data showed that R 15 was located at the top end of linkage group (LG) 8. Saturation with 71 previously mapped SNP markers selected within this region further showed that it was located in a resistance gene cluster on LG8, and mapped to a 1.0-cM region between three co-segregating SNP makers SFW01920, SFW00128, and SFW05824 as well as the NSA_008457 SNP marker. These closely linked markers will facilitate marker-assisted selection and breeding in sunflower.
-
Brown rust of sugarcane caused by, Puccinia melanocephala, is a serious problem in the US sugarcane industry. A major resistance gene, Bru1 was identified and methodology for detecting it was developed by French scientists at CIRAD. The majority of the research resulting in the discovery of Bru1 res...
-
Genetics and mapping of a new leaf rust resistance gene in Triticum ...
Indian Academy of Sciences (India)
A Triticum timopheevii-derived bread wheat line, Selection G12, was screened with 40 pathotypes of leaf rust pathogen, Puccinia triticina at seedling stage and with two most commonly prevalent pathotypes 77-5 and 104-2 at adult plant stage. Selection G12 showed resistance at both seedling and adult plant stages.
-
Genetics of adult plant stripe rust resistance in CSP44, a selection ...
Indian Academy of Sciences (India)
Unknown
areas of temperate zones (Johnson 1988). Yield losses can be considerable, ranging from about 40 per cent to com- plete destruction of the crop depending upon the growth stage at which the disease attacks. Using diverse genes for resistance against stripe rust disease is the most eco- nomical and environmentally safe ...
-
Identification of rust resistance genes Lr10 and Sr9a in Pakistani ...
African Journals Online (AJOL)
Identification of rust resistance genes Lr10 and Sr9a in Pakistani wheat germplasm using PCR based molecular markers. M Babar, AF Mashhadi, A Mehvish, AN Zahra, R Waheed, A Hasnain, S ur-Rahman, N Hussain, M Ali, I Khaliq, A Aziz ...
-
Bryce A. Richardson; Mee-Sook Kim; Ned B. Klopfenstein; Yuko Ota; Kwan Soo Woo; Richard C. Hamelin
2009-01-01
Presently, little is known about the worldwide genetic structure, diversity, or evolutionary relationships of the white-pineblister-rust fungus, Cronartium ribicola. A collaborative international effort is underway to determine the phylogeographic relationships among Asian, European, and North American sources of C. ribicola and...
-
Transfer of genes for stem rust resistance from Agropyron elongatum and imperial rye to durum wheat
International Nuclear Information System (INIS)
Prabhakara Rao, M.V.
1977-01-01
The Agropyron elongatum gene for stem rust resistance on chromosome 6A of Knott's Thatcher translocation line was transferred to a susceptible local durum wheat variety, Jaya, through a series of back-crosses. Plants heterozygous for the Agropyron translocation always show at least one open bivalent. Homozygotes have not been obtained, probably because of the absence of male transmission in durum background. Monotelosomic addition of the short arm of Imperial rye chromosome 3R (formerly ''G'' of Sears), which carries a gene(s) for resistance to wheat stem rust, was obtained in the local durum variety. Rust-resistant plants from parents having the added rye telocentric were irradiated with gamma rays just before meiosis, and the pollen obtained from the irradiated spikes was used to pollinate euploid plants. In addition, seeds harvested from 2n+1 resistant plants were irradiated with thermal neutrons and the resistant M 1 plants were selfed to raise M 2 families. Two durum-rye translocation lines were obtained following irradiation. DRT-1 was transmitted normally through the female gametes but showed no male transmission. As a result of this, homozygotes have not been obtained. Gametic transmission rates of DRT-2 are being tested. Alien translocations, which show normal gametic and zygotic transmissions in the hexaploid wheat, may behave differently in a tetraploid background. The results indicate that alien genetic transfers may be more difficult to obtain in durum wheat, probably owing to the reduced buffering effect of the tetraploid genome. (author)
-
Production of Basella plants resistant to rust by irradiation of seeds and vegetative tissue
International Nuclear Information System (INIS)
Makambila, C.
1997-01-01
Basella is classified in the family Chenopodiaceae or Basellaceae. Also known as African spinach, this plant is consumed in Central Africa and several other African countries. There are two types of varieties grown in Congo: i. a local variety characterized by red leaves and stalks in which the principal way of propagation is from cuttings; ii. a group of varieties which have green or purple leaves and stalks. These varieties are called Basella alba and Basella rubra. These varieties have sexual reproduction. Among the two groups of varieties, the local variety is propagated vegetatively but is resistant to rust, while varieties with green leaves or with purple leaves (B. alba and B. rubra) that are propagated from seed are susceptible to rust. Since hybrid cannot be made by conventional crossing, the following procedures have been adopted to produce plants with disease tolerance: 1. production of resistant variants by irradiation of Basella alba seeds with Cesium 137; 2. production of resistant variants by irradiation of vegetative tissues obtained by culture of meristematic cells of B alba; and 3. obtaining resistant plants through somaclonal variation. 1 tab
-
Production of Basella plants resistant to rust by irradiation of seeds and vegetative tissue
Energy Technology Data Exchange (ETDEWEB)
Makambila, C [Laboratory of Phytopathology, Faculty of Sciences, Univ. of Brazzaville, Brazzaville (Congo)
1997-12-01
Basella is classified in the family Chenopodiaceae or Basellaceae. Also known as African spinach, this plant is consumed in Central Africa and several other African countries. There are two types of varieties grown in Congo: i. a local variety characterized by red leaves and stalks in which the principal way of propagation is from cuttings; ii. a group of varieties which have green or purple leaves and stalks. These varieties are called Basella alba and Basella rubra. These varieties have sexual reproduction. Among the two groups of varieties, the local variety is propagated vegetatively but is resistant to rust, while varieties with green leaves or with purple leaves (B. alba and B. rubra) that are propagated from seed are susceptible to rust. Since hybrid cannot be made by conventional crossing, the following procedures have been adopted to produce plants with disease tolerance: 1. production of resistant variants by irradiation of Basella alba seeds with Cesium 137; 2. production of resistant variants by irradiation of vegetative tissues obtained by culture of meristematic cells of B alba; and 3. obtaining resistant plants through somaclonal variation. 1 tab.
-
Wheat Rust Information Resources - Integrated tools and data for improved decision making
DEFF Research Database (Denmark)
Hodson, David; Hansen, Jens Grønbech; Lassen, Poul
giving access to an unprecedented set of data for rust surveys, alternate hosts (barberry), rust pathotypes, trap nurseries and resistant cultivars. Standardized protocols for data collection have permitted the development of a comprehensive data management system, named the Wheat Rust Toolbox....... Integration of the CIMMYT Wheat Atlas and the Genetic Resources Information System (GRIS) databases provides a rich resource on wheat cultivars and their resistance to important rust races. Data access is facilitated via dedicated web portals such as Rust Tracker (www.rusttracker.org) and the Global Rust...
-
Stem rust, caused by Puccinia graminis Pers.:Pers. f. sp. tritici Eriks. & E. Henn.(Pgt), is a destructive disease of wheat that can be controlled by deploying effective stem rust resistance (Sr) genes. Highly virulent races of Pgt in Africa have been detected and characterized. These include race T...
-
International Nuclear Information System (INIS)
Frey, K.J.; Browning, J.A.; Simons, M.D.
1976-01-01
Attempts have been made to test the relative effectiveness of EMS treatment for inducing tolerance to crown rust among oat strains Clintland-60 of different ploidy levels. One strain of diploid and one of tetraploid oats were treated with EMS. These two strains are as susceptible to damage from crown rust as are cultivars of hexaploid oats. Multiline cultivars of oats have been shown to provide adequate protection from economic loss due to crown-rust disease in Iowa. Since 1968, eleven multiline cultivars of oats have been released from the Iowa station for use in commercial production in the midwestern USA. During the past two winter seasons, the effectiveness of multiline oat cultivars against crown-rust disease has been researched in Texas, USA, which has a ''long rust season'' of about four months, not an Iowa ''short rust season''. The protection against crown rust afforded by the multiline cultivars appeared equally good in Texas and Iowa. The seasonal productions of crown-rust spores relative to completely resistant and susceptible checks were nearly identical in both environments. Fifteen new isolines of oats have been developed for use in multiline varieties, with seed supplies sufficiently large for immediate use
-
Unveiling common responses of Medicago truncatula to appropriate and inappropriate rust species
Directory of Open Access Journals (Sweden)
Maria Carlota eVaz Patto
2014-11-01
Full Text Available Little is known about the nature of effective defense mechanisms in legumes to pathogens of remotely related plant species. Some rust species are among pathogens with broad host range causing dramatic losses in various crop plants. To understand and compare the different host and nonhost resistance responses of legume species against rusts, we characterized the reaction of the model legume Medicago truncatula to one appropriate (Uromyces striatus and two inappropriate (U. viciae-fabae and U. lupinicolus rusts. We found that similar pre and post-haustorial mechanisms of resistance appear to be operative in M. truncatula against appropriate and inappropriate rust fungus. The appropriate U. striatus germinated better on M. truncatula accessions then the inappropriate U. viciae-fabae and U. lupinicolus, but once germinated, germ tubes of the three rusts had a similar level of success in finding stomata and forming an appressoria over a stoma. However responses to different inappropriate rust species also showed some specificity, suggesting a combination of non specific and specific responses underlying this legume nonhost resistance to rust fungi. Further genetic and expression analysis studies will contribute to the development of the necessary molecular tools to use the present information on host and nonhost resistance mechanisms to breed for broad-spectrum resistance to rust in legume species.
-
Selection and evaluation of soybean lines derived from gamma irradiation for rust resistance
International Nuclear Information System (INIS)
Smutkupt, S.; Wongpiyasatid, A.; Lamseejan, S.
1983-01-01
In 1979, seeds of 11 soybean cultivars were gamma irradiated with 15 and 30 krad. Treated and control seeds of each cultivar were planted in the rainy season. In the rainy season of 1980, M 3 populations were screened for rust resistance in Nong Hoi Valley and Mae Joe Experiment Station, both in Chiang Main province. The IWGSR rust rating system was used. Based upon the slow growth of rust on soybean plants, 6 and 115 plants were selected from 2,802 control plants and from 28,824 treated plants, respectively. Selected lines were evaluated in Nong Hoi Valley in the rainy season of 1981. Sixteen selections with average good seed yield per plant and low percentage of shrivelled seeds were obtained. Among them, two lines, namely G8586/Line number 81-1-072 and S.J. 4/Line number 81-1-037 gave the higher average seed yield per plant than other lines. They are at present in a preliminary yield trial in Chiang Mai. Chiang Mai. (author)
-
Resistance of some early mutant lines of soybean to rust fungus (Phakospora pachyrhizi Syd)
International Nuclear Information System (INIS)
Ratma, Rivaie
1984-01-01
A trial for resistance to rust fungus (Phakospora pachyrhizi Syd.) was conducted on 11 early mutant lines of soybean M6 (derived from Orba variety with a dose of 0.4 kGy of Co-60) at Citayam Experimental Station, Bogor, in the wet season of 80/81. Based on IWGSR rating system, soybean mutant lines number M6/40/6 was moderately susceptible to rust fungus (Phakospora pachyrhizi Syd). While 10 other soybean mutant lines M6/40/1, M6/40/2, M6/40/3, M6/40/4, M6/40/5, M6/40/7, M6/40/8, M6/40/9, M6/40/10 and M6/40/11 were susceptible to rust fungus. Significant differences in yield were observed between the early mutant lines M6/40/6 (moderate susceptible), 10 other mutant lines (susceptible) and ringgit variety (susceptible). However, a significant lower yield was produced by those mutant lines compared with the yield of orba variety. (author)
-
Characterization of stem rust resistance gene Sr2 in Indian wheat ...
African Journals Online (AJOL)
Stem rust or black rust is one of the most important diseases of wheat worldwide. In India, central, peninsular and southern hill zones are particularly prone to stem rust where favourable environmental conditions exist. The recent emergence of wheat stem rust race Ug99 (TTKSK) and related strains threatens global wheat ...
-
Needle reactions in resistance to Cronartium ribicola: Hypersensitivity response or not?
Katarina Sweeney; Jeffrey Stone; Kathy Cook; Richard A. Sniezko; Angelia Kegley; Anna W. Schoettle
2012-01-01
White pine blister rust (WPBR) is caused by the fungal pathogen Cronartium ribicola. The pathogen is native to Eurasia and was introduced to North America early in the 20th century and is still spreading destructively throughout the range of native western white pines (Douglas ex D. Don) (McDonald and Hoff 2001). All of the North American five-needle (white) pines are...
-
Niranjana, M; Vinod; Sharma, J B; Mallick, Niharika; Tomar, S M S; Jha, S K
2017-12-01
Leaf rust (Puccinia triticina) is a major biotic stress affecting wheat yields worldwide. Host-plant resistance is the best method for controlling leaf rust. Aegilops speltoides is a good source of resistance against wheat rusts. To date, five Lr genes, Lr28, Lr35, Lr36, Lr47, and Lr51, have been transferred from Ae. speltoides to bread wheat. In Selection2427, a bread wheat introgresed line with Ae. speltoides as the donor parent, a dominant gene for leaf rust resistance was mapped to the long arm of chromosome 3B (LrS2427). None of the Lr genes introgressed from Ae. speltoides have been mapped to chromosome 3B. Since none of the designated seedling leaf rust resistance genes have been located on chromosome 3B, LrS2427 seems to be a novel gene. Selection2427 showed a unique property typical of gametocidal genes, that when crossed to other bread wheat cultivars, the F 1 showed partial pollen sterility and poor seed setting, whilst Selection2427 showed reasonable male and female fertility. Accidental co-transfer of gametocidal genes with LrS2427 may have occurred in Selection2427. Though LrS2427 did not show any segregation distortion and assorted independently of putative gametocidal gene(s), its utilization will be difficult due to the selfish behavior of gametocidal genes.
-
Qi, L L; Ma, G J; Long, Y M; Hulke, B S; Gong, L; Markell, S G
2015-03-01
The rust resistance gene R 2 was reassigned to linkage group 14 of the sunflower genome. DNA markers linked to R 2 were identified and used for marker-assisted gene pyramiding in a confection type genetic background. Due to the frequent evolution of new pathogen races, sunflower rust is a recurring threat to sunflower production worldwide. The inbred line Morden Cross 29 (MC29) carries the rust resistance gene, R 2 , conferring resistance to numerous races of rust fungus in the US, Canada, and Australia, and can be used as a broad-spectrum resistance resource. Based on phenotypic assessments and SSR marker analyses on the 117 F2 individuals derived from a cross of HA 89 with MC29 (USDA), R 2 was mapped to linkage group (LG) 14 of the sunflower, and not to the previously reported location on LG9. The closest SSR marker HT567 was located at 4.3 cM distal to R 2 . Furthermore, 36 selected SNP markers from LG14 were used to saturate the R 2 region. Two SNP markers, NSA_002316 and SFW01272, flanked R 2 at a genetic distance of 2.8 and 1.8 cM, respectively. Of the three closely linked markers, SFW00211 amplified an allele specific for the presence of R 2 in a marker validation set of 46 breeding lines, and SFW01272 was also shown to be diagnostic for R 2 . These newly developed markers, together with the previously identified markers linked to the gene R 13a , were used to screen 524 F2 individuals from a cross of a confection R 2 line and HA-R6 carrying R 13a . Eleven homozygous double-resistant F2 plants with the gene combination of R 2 and R 13a were obtained. This double-resistant line will be extremely useful in confection sunflower, where few rust R genes are available, risking evolution of new virulence phenotypes and further disease epidemics.
-
International Nuclear Information System (INIS)
Wang, Y.J.; Wang, C.Y.; Zhang, H.
2015-01-01
Synthetic hexaploid wheat is an important germplasm resource for transfer of beneficial genes from alien species to common wheat (Triticum aestivum L.). Synthetic hexaploid wheat SE5756 confers a high level of resistance against a wide range of races of Puccinia striiformis West. f. sp. tritici Eriks. et Henn.(Pst). The objectives of this study were to determine the inheritance pattern, adjacent molecular markers, and chromosomal location of the stripe rust resistance gene in SE5756 and to develop new germplasm. We constructed a segregating population of 116 F2 plants and corresponding F2:3 families from a cross between SE5756 and Xinong979 with Pst races CYR32. Genetic analysis revealed that a single dominant gene, tentatively designated as YrSE5756, was responsible for seedling stage stripe rust resistance in SE5756. A genetic map, encompassing Xwmc626, Xwmc269, Xgwm11, Xbarx137, Xwmc419, Xwmc85, Xgpw5237, Xwmc134, WE173, Xwmc631, and YrSE5756, spanned 70.1 cM on chromosome 1BS. Xwmc419 and Xwmc85 were flanking markers tightly linked to YrSE5756 at genetic distances of 2.3 and 1.8 cM. Typical adult plant responses of the SE5756, varieties of the carrier Yr10 and Yr15, Chuanmai 42 (Yr24/Yr26), Yuanfeng 175 (Yr24/Yr26) and Huixianhong resistant to mixture Pst races (CYR32, CYR33 and V26) were experimented. The results showed that YrSE5756 was likely a new resistance stripe rust gene different from Yr24/Yr26, Yr10 and Yr15. From cross and backcross populations of SE5756/Xinong 979, we developed four new wheat lines with large seeds, stripe rust resistance, and improved agronomic traits: N07178-1, N07178-2, N08256-1, and N08256-2. These new germplasm lines could serve as sources of resistance to stripe rust in wheat breeding. SE5756 has the very vital significance in the development of breeding and expand our resistance germplasm resource gene pool. (author)
-
Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace.
Babiker, E M; Gordon, T C; Chao, S; Newcomb, M; Rouse, M N; Jin, Y; Wanyera, R; Acevedo, M; Brown-Guedira, G; Williamson, S; Bonman, J M
2015-04-01
A new gene for Ug99 resistance from wheat landrace PI 374670 was detected on the long arm of chromosome 7A. Wheat landrace PI 374670 has seedling and field resistance to stem rust caused by Puccinia graminis f. sp tritici Eriks. & E. Henn (Pgt) race TTKSK. To elucidate the inheritance of resistance, 216 BC1F2 families, 192 double haploid (DH) lines, and 185 recombinant inbred lines (RILs) were developed by crossing PI 374670 and the susceptible line LMPG-6. The parents and progeny were evaluated for seedling resistance to Pgt races TTKSK, MCCFC, and TPMKC. The DH lines were tested in field stem rust nurseries in Kenya and Ethiopia. The DH lines were genotyped with the 90K wheat iSelect SNP genotyping platform. Goodness-of-fit tests indicated that a single dominant gene in PI 374670 conditioned seedling resistance to the three Pgt races. The seedling resistance locus mapped to the long arm of chromosome 7A and this result was verified in the RIL population screened with the flanking SNP markers using KASP assays. In the same region, a major QTL for field resistance was detected in a 7.7 cM interval and explained 34-54 and 29-36% of the variation in Kenya and Ethiopia, respectively. Results from tests with specific Pgt races and the csIH81 marker showed that the resistance was not due to Sr22. Thus, a new stem rust resistance gene or allele, either closely linked or allelic to Sr15, is responsible for the seedling and field resistance of PI 374670 to Ug99.
-
Gill, Upinder S; Uppalapati, Srinivasa R; Nakashima, Jin; Mysore, Kirankumar S
2015-05-08
Switchgrass rust, caused by Puccinia emaculata, is an important disease of switchgrass, a potential biofuel crop in the United States. In severe cases, switchgrass rust has the potential to significantly affect biomass yield. In an effort to identify novel sources of resistance against switchgrass rust, we explored nonhost resistance against P. emaculata by characterizing its interactions with six monocot nonhost plant species. We also studied the genetic variations for resistance among Brachypodium inbred accessions and the involvement of various defense pathways in nonhost resistance of Brachypodium. We characterized P. emaculata interactions with six monocot nonhost species and identified Brachypodium distachyon (Bd21) as a suitable nonhost model to study switchgrass rust. Interestingly, screening of Brachypodium accessions identified natural variations in resistance to switchgrass rust. Brachypodium inbred accessions Bd3-1 and Bd30-1 were identified as most and least resistant to switchgrass rust, respectively, when compared to tested accessions. Transcript profiling of defense-related genes indicated that the genes which were induced in Bd21after P. emaculata inoculation also had higher basal transcript abundance in Bd3-1 when compared to Bd30-1 and Bd21 indicating their potential involvement in nonhost resistance against switchgrass rust. In the present study, we identified Brachypodium as a suitable nonhost model to study switchgrass rust which exhibit type I nonhost resistance. Variations in resistance response were also observed among tested Brachypodium accessions. Brachypodium nonhost resistance against P. emaculata may involve various defense pathways as indicated by transcript profiling of defense related genes. Overall, this study provides a new avenue to utilize novel sources of nonhost resistance in Brachypodium against switchgrass rust.
-
Qamar, Maqsood; Niks, R.E.
2007-01-01
Isolate-specific aspect of non-hypersensitive resistance in wheat to wheat leaf rust was studied at seedling stage in the green house. Isolate-specific response of non-hypersensitive resistance was assessed from latency period (LP) and infection frequency (IF) of two single-pustule isolates of
-
K. L. Frank; B. W. Geils; L. S. Kalkstein; H. W. Thistle
2008-01-01
An invasive forest pathogen, Cronartium ribicola, white pine blister rust (WPBR), is believed to have arrived in the Sacramento Mountains of south-central New Mexico about 1970. Epidemiological and genetic evidence supports the hypothesis that introduction was the result of long-distance dispersal (LDD) by atmospheric transport from California. This...
-
Genomic Selection for Quantitative Adult Plant Stem Rust Resistance in Wheat
Directory of Open Access Journals (Sweden)
Jessica E. Rutkoski
2014-11-01
Full Text Available Quantitative adult plant resistance (APR to stem rust ( f. sp. is an important breeding target in wheat ( L. and a potential target for genomic selection (GS. To evaluate the relative importance of known APR loci in applying GS, we characterized a set of CIMMYT germplasm at important APR loci and on a genome-wide profile using genotyping-by-sequencing (GBS. Using this germplasm, we describe the genetic architecture and evaluate prediction models for APR using data from the international Ug99 stem rust screening nurseries. Prediction models incorporating markers linked to important APR loci and seedling phenotype scores as fixed effects were evaluated along with the classic prediction models: Multiple linear regression (MLR, Genomic best linear unbiased prediction (G-BLUP, Bayesian Lasso (BL, and Bayes Cπ (BCπ. We found the region to play an important role in APR in this germplasm. A model using linked markers as fixed effects in G-BLUP was more accurate than MLR with linked markers (-value = 0.12, and ordinary G-BLUP (-value = 0.15. Incorporating seedling phenotype information as fixed effects in G-BLUP did not consistently increase accuracy. Overall, levels of prediction accuracy found in this study indicate that GS can be effectively applied to improve stem rust APR in this germplasm, and if genotypes at linked markers are available, modeling these genotypes as fixed effects could lead to better predictions.
-
development of wheat germplasm for stem rust resistance in eastern ...
African Journals Online (AJOL)
ACSS
Wheat (Triticum aestivum) rust outbreak is the primary production constraint in Eastern Africa. Ethiopia, Kenya and Uganda are hot spots for the epidemic of rusts, due to higher rates of evolution of new pathogen races, especially of the virulent stem rust (Puccinia graminis) race, Ug99. The objective of this study was to ...
-
Development of wheat germplasm for stem rust resistance in eastern ...
African Journals Online (AJOL)
Wheat (Triticum aestivum) rust outbreak is the primary production constraint in Eastern Africa. Ethiopia, Kenya and Uganda are hot spots for the epidemic of rusts, due to higher rates of evolution of new pathogen races, especially of the virulent stem rust (Puccinia graminis) race, Ug99. The objective of this study was to ...
-
Discovery of a seventh Rpp soybean rust resistance locus in soybean accession PI 605823
Soybean rust, caused by the obligate biotrophic fungal pathogen Phakopsora pachyrhizi Syd. & Syd, is a disease threat to soybean production in regions of the world with mild winters. Host plant resistance to P. pachyrhizi conditioned by Rpp genes has been found in numerous soybean accessions, and at...
-
Effector proteins of rust fungi.
Petre, Benjamin; Joly, David L; Duplessis, Sébastien
2014-01-01
Rust fungi include many species that are devastating crop pathogens. To develop resistant plants, a better understanding of rust virulence factors, or effector proteins, is needed. Thus far, only six rust effector proteins have been described: AvrP123, AvrP4, AvrL567, AvrM, RTP1, and PGTAUSPE-10-1. Although some are well established model proteins used to investigate mechanisms of immune receptor activation (avirulence activities) or entry into plant cells, how they work inside host tissues to promote fungal growth remains unknown. The genome sequences of four rust fungi (two Melampsoraceae and two Pucciniaceae) have been analyzed so far. Genome-wide analyses of these species, as well as transcriptomics performed on a broader range of rust fungi, revealed hundreds of small secreted proteins considered as rust candidate secreted effector proteins (CSEPs). The rust community now needs high-throughput approaches (effectoromics) to accelerate effector discovery/characterization and to better understand how they function in planta. However, this task is challenging due to the non-amenability of rust pathosystems (obligate biotrophs infecting crop plants) to traditional molecular genetic approaches mainly due to difficulties in culturing these species in vitro. The use of heterologous approaches should be promoted in the future.
-
Kaur, Jagdeep; Fellers, John; Adholeya, Alok; Velivelli, Siva L S; El-Mounadi, Kaoutar; Nersesian, Natalya; Clemente, Thomas; Shah, Dilip
2017-02-01
Rust fungi of the order Pucciniales are destructive pathogens of wheat worldwide. Leaf rust caused by the obligate, biotrophic basidiomycete fungus Puccinia triticina (Pt) is an economically important disease capable of causing up to 50 % yield losses. Historically, resistant wheat cultivars have been used to control leaf rust, but genetic resistance is ephemeral and breaks down with the emergence of new virulent Pt races. There is a need to develop alternative measures for control of leaf rust in wheat. Development of transgenic wheat expressing an antifungal defensin offers a promising approach to complement the endogenous resistance genes within the wheat germplasm for durable resistance to Pt. To that end, two different wheat genotypes, Bobwhite and Xin Chun 9 were transformed with a chimeric gene encoding an apoplast-targeted antifungal plant defensin MtDEF4.2 from Medicago truncatula. Transgenic lines from four independent events were further characterized. Homozygous transgenic wheat lines expressing MtDEF4.2 displayed resistance to Pt race MCPSS relative to the non-transgenic controls in growth chamber bioassays. Histopathological analysis suggested the presence of both pre- and posthaustorial resistance to leaf rust in these transgenic lines. MtDEF4.2 did not, however, affect the root colonization of a beneficial arbuscular mycorrhizal fungus Rhizophagus irregularis. This study demonstrates that the expression of apoplast-targeted plant defensin MtDEF4.2 can provide substantial resistance to an economically important leaf rust disease in transgenic wheat without negatively impacting its symbiotic relationship with the beneficial mycorrhizal fungus.
-
URS Brava – a new oat cultivar with partial resistance to crown rust
Directory of Open Access Journals (Sweden)
Luiz Carlos Federizzi
2015-08-01
Full Text Available The cultivar URS Brava, obtained from a simple cross between the line ‘UFRGS 995078-2’ and the cultivar ‘URS 21’, shows high grain yield and stability, high grain quality, desirable agronomical traits and partial resistance to crown rust, caused by the fungus Puccinia coronata f. sp. avenae.
-
Sugarcane (Saccharum spp.) is an important economic crop for producing edible sugar and bioethanol. Brown rust had long been a major disease impacting sugarcane production world widely. Resistance resource and markers linked to the resistance are valuable tools for disease resistance improvement. An...
-
Bulli, Peter; Rynearson, Sheri; Chen, Xianming; Pumphrey, Michael
2017-01-01
Stripe rust, caused by Puccinia striiformis Westend. f. sp. tritici Erikss. (Pst) remains one of the most significant diseases of wheat worldwide. We investigated stripe rust resistance by genome-wide association analysis (GWAS) in 959 spring wheat accessions from the United States Department of Agriculture-Agricultural Research Service National Small Grains Collection, representing major global production environments. The panel was characterized for field resistance in multi-environment field trials and seedling resistance under greenhouse conditions. A genome-wide set of 5,619 informative SNP markers were used to examine the population structure, linkage disequilibrium and marker-trait associations in the germplasm panel. Based on model-based analysis of population structure and hierarchical Ward clustering algorithm, the accessions were clustered into two major subgroups. These subgroups were largely separated according to geographic origin and improvement status of the accessions. A significant correlation was observed between the population sub-clusters and response to stripe rust infection. We identified 11 and 7 genomic regions with significant associations with stripe rust resistance at adult plant and seedling stages, respectively, based on a false discovery rate multiple correction method. The regions harboring all, except three, of the QTL identified from the field and greenhouse studies overlap with positions of previously reported QTL. Further work should aim at validating the identified QTL using proper germplasm and populations to enhance their utility in marker assisted breeding. PMID:28591221
-
Genotyping Sugarcane for the Brown Rust Resistance Locus Bru1 Using Unlabeled Probe Melting
Brown rust, caused by the fungus Puccinia melanocephala, is a major disease of sugarcane (Saccharum spp.) in Florida, Louisiana, and other sugarcane growing regions. The Bru1 locus has been used as a durable and effective source of resistance, and markers are available to select for the trait. The...
-
Directory of Open Access Journals (Sweden)
Oswaldo Teruyo Ido
2007-09-01
Full Text Available
western" align="justify">Promising clones in the third selection phase of the sugarcane genetic breeding program in Paraná State, Brazil, were evaluated for the severity of sugarcane rust (Puccinia melanocephala incidence under natural infection. The evaluation was carried out in a sugarcane plant and a sugarcane ratoon cycles, from 1998 to 2000. The assessment of severity identified fifteen clones with rust resistance reaction in the sugarcane plant cycle. Of the 41 evaluated clones, 18.2% presented slightly resistant to susceptible reaction. The highest rust incidence was observed in the early phases of sugarcane crop development, from three to six months. Among the clones with resistance reaction to rust, five were derived from the same female parent (RB855589. This fact demonstrates the good potential of this genotype for crosses looking at clones with rust-resistance reaction.
western">KEY-WORDS: Saccharum spp.; Puccinia melanocephala; resistance; selection.
western" align="justify">Clones promissores do Programa de Melhoramento Genético da Cana-de-Açúcar no Estado do Paraná em terceira fase de seleção foram avaliados quanto à incidência e severidade da ferrugem da cana-de-açúcar (Puccinia melanocephala sob condições de infecção natural. A avaliação foi realizada nos ciclos de cana-planta e cana-soca, entre os anos 1998 e 2000. Os resultados de severidade permitiram agrupar no ciclo de cana-planta, quinze clones com reação resistente a ferrugem. Dos 41 clones avaliados, 18,2% apresentaram reação moderadamente resistente a suscetível. Observou-se a maior incidência da ferrugem nas primeiras fases de desenvolvimento da cana-de-açúcar, entre os três a seis meses. Entre os clones que apresentaram reação resistente, verificou-se que cinco foram oriundos do mesmo genitor feminino (RB855589. Isso demonstra o bom potencial
-
Rust transformation/rust compatible primers
Emeric, Dario A.; Miller, Christopher E.
1993-01-01
Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.
-
Evaluation of brown rust resistance in the Louisiana basic breeding program’s first clonal trial
Over the past decade, the Louisiana sugarcane industry has experienced increasing levels of pressure from brown rust (Puccinia melanocephala). In 2000, an epidemic spread throughout the Louisiana industry, severely affecting the state’s top yielding variety, previously resistant LCP85-384, which at ...
-
DIVERSITY OF PUCCINIA KUEHNII AND P. MELANOCEPHALA CAUSING RUST DISEASES ON BRAZILIAN SUGARCANE
Sugarcane industry in Brazil suffers yield loss due to brown rust (Puccinia melanocephala) since 1986 and orange rust (P. kuehnii) as recent as 2009. The main control measure for both diseases has been cultivar resistance. Nevertheless, recent onsets of orange rust on previously resistant cultivars ...
-
International Nuclear Information System (INIS)
Ali, M.; Ji, W.G.; Hu, Y.G; Zhong, H.; Wang, C.Y.; Baloch, G.M.
2010-01-01
Stripe rust caused by Puccinia striiformis f. sp. tritici is one of the most devastating diseases of wheat in China as well as in Pakistan. In the present studies F2 population was established by crossing N95175 resistant to stripe rust race CYR32 with two susceptible lines Huixianhong and Abbondanza to molecularly tag resistance gene existing in wheat line N95175. The segregation of phenotype was accorded with an expected 3:1 ratio in both combinations studied and fit the model of a single dominant gene controlling stripe rust resistance in N95175. Thirty five SSR primer pairs were screened on the parents and bulks and also on individuals since resistance gene to be located in chromosome 1B. The result indicated that most of resistant plants amplified same band as resistant parent while susceptible plants amplified same as susceptible parents studied and considered that markers co-segregated with resistant loci in N95175. This yellow rust resistance gene was considered to be Yr26 originally thought to be also located in chromosome arm 1BS linked to marker loci Xgwm273 and Xgwm11 with genetic distances ranging from 1.075cM to 2.74cM in both combinations studied. However, the closest loci were observed 2.67cM for Xgwm273 and 1.075cM for Xgwm11 in Huixianhong XN95175 and Abbondanza XN95175 crosses respectively. Hence, it has been concluded that the PCR-based micro satellite markers Xgwm273 and Xgwm11 located in chromosome 1B were shown to be very effective for the detection of Yr26 gene in segregating population and can be applied in future wheat breeding strategies. (author)
-
International Nuclear Information System (INIS)
Sun Yan; Yin Jing; Wang Guangjin; Zhang Hongji; Huang Jinghua; Guo Qiang; Diao Yanling; Liu Dongjun
2007-01-01
Longfu 03D51 was bred using Long 6239 immature embryo as explants through radiation mutagenesis breeding coupled with tissue culture technique. By artificial inoculation and field breeding identified Longfu 03D51 was identified with high resistance to dominant strain 21C 3 CPH, good quality and high yield. Genetic analysis suggested that stem rust was controlled by a single gene. The DNA polymorphism on Longfu 03D51 and its parents were studied by random amplified polymorphic DNA (RAPD), 3 primers out of 60 RAPD primers were found polymorphism between the Longfu 03D51 and its parent Long 6239, and 3 stable polyphymorphic bands amplified in Longfu 03D51 with the size of 380bp, 700bp, 600 bp by random primer E07, E11, E17, respectively. Genetic and RAPD analysis indicated that 3 RAPD primers E07, E11, E17 might be linked to the gene of stem rust resistance. (authors)
-
Mourad, Amira M I; Sallam, Ahmed; Belamkar, Vikas; Wegulo, Stephen; Bowden, Robert; Jin, Yue; Mahdy, Ezzat; Bakheit, Bahy; El-Wafaa, Atif A; Poland, Jesse; Baenziger, Peter S
2018-01-01
Stem rust (caused by Puccinia graminis f. sp. tritici Erikss. & E. Henn.), is a major disease in wheat ( Triticum aestivium L.). However, in recent years it occurs rarely in Nebraska due to weather and the effective selection and gene pyramiding of resistance genes. To understand the genetic basis of stem rust resistance in Nebraska winter wheat, we applied genome-wide association study (GWAS) on a set of 270 winter wheat genotypes (A-set). Genotyping was carried out using genotyping-by-sequencing and ∼35,000 high-quality SNPs were identified. The tested genotypes were evaluated for their resistance to the common stem rust race in Nebraska (QFCSC) in two replications. Marker-trait association identified 32 SNP markers, which were significantly (Bonferroni corrected P < 0.05) associated with the resistance on chromosome 2D. The chromosomal location of the significant SNPs (chromosome 2D) matched the location of Sr6 gene which was expected in these genotypes based on pedigree information. A highly significant linkage disequilibrium (LD, r 2 ) was found between the significant SNPs and the specific SSR marker for the Sr6 gene ( Xcfd43 ). This suggests the significant SNP markers are tagging Sr6 gene. Out of the 32 significant SNPs, eight SNPs were in six genes that are annotated as being linked to disease resistance in the IWGSC RefSeq v1.0. The 32 significant SNP markers were located in nine haplotype blocks. All the 32 significant SNPs were validated in a set of 60 different genotypes (V-set) using single marker analysis. SNP markers identified in this study can be used in marker-assisted selection, genomic selection, and to develop KASP (Kompetitive Allele Specific PCR) marker for the Sr6 gene. Novel SNPs for Sr6 gene, an important stem rust resistant gene, were identified and validated in this study. These SNPs can be used to improve stem rust resistance in wheat.
-
75 FR 44881 - Black Stem Rust; Additions of Rust-Resistant Varieties
2010-07-30
...;Prices of new books are listed in the first FEDERAL REGISTER issue of each #0;week. #0; #0; #0; #0;#0... direct final rule notified the public of our intention to amend the black stem rust quarantine and...
-
Flavonoid Accumulation Plays an Important Role in the Rust Resistance of Malus Plant Leaves
Directory of Open Access Journals (Sweden)
Yanfen Lu
2017-07-01
Full Text Available Cedar-apple rust (Gymnosporangium yamadai Miyabe is a fungal disease that causes substantial injury to apple trees and results in fruit with reduced size and quality and a lower commercial value. The molecular mechanisms underlying the primary and secondary metabolic effects of rust spots on the leaves of Malus apple cultivars are poorly understood. Using HPLC, we found that the contents of flavonoid compounds, especially anthocyanin and catechin, were significantly increased in rust-infected symptomatic tissue (RIT. The expression levels of structural genes and MYB transcription factors related to flavonoid biosynthesis were one- to seven-fold higher in the RIT. Among these genes, CHS, DFR, ANS, FLS and MYB10 showed more than a 10-fold increase, suggesting that these genes were expressed at significantly higher levels in the RIT. Hormone concentration assays showed that the levels of abscisic acid (ABA, ethylene (ETH, jasmonate (JA and salicylic acid (SA were higher in the RIT and were consistent with the expression levels of McNCED, McACS, McLOX and McNPR1, respectively. Our study explored the complicated crosstalk of the signal transduction pathways of ABA, ETH, JA and SA; the primary metabolism of glucose, sucrose, fructose and sorbitol; and the secondary metabolism of flavonoids involved in the rust resistance of Malus crabapple leaves.
-
76 FR 3011 - Black Stem Rust; Additions of Rust-Resistant Varieties
2011-01-19
...;Prices of new books are listed in the first FEDERAL REGISTER issue of each #0;week. #0; #0; #0; #0;#0... notified the public of our intention to amend the black stem rust quarantine and regulations by adding four...
-
IPR 107 – Dwarf arabic coffee cultivar with resistance to coffee leaf rust
Directory of Open Access Journals (Sweden)
Tumoru Sera
2013-01-01
Full Text Available ‘IPR 107’ was derived from a cross between ‘IAPAR 59’ and ‘Mundo Novo IAC 376-4’. ‘IPR 107’ is a dwarf medium sizeplant with medium precocity in ripening and with complete resistance to rust races in this time. This cultivar presents superior qualityand high yield in many coffee regions.
-
Rust diseases caused by Puccinia spp. pose a major threat to global wheat production. Puccinia triticina (Pt), an obligate basidiomycete biotroph, causes leaf rust disease which incurs yield losses of up to 50% in wheat. Historically, resistant wheat cultivars have been used to control leaf rust, bu...
-
Directory of Open Access Journals (Sweden)
Simren Brar
Full Text Available White pine blister rust is caused by the fungal pathogen Cronartium ribicola J.C. Fisch (Basidiomycota, Pucciniales. This invasive alien pathogen was introduced into North America at the beginning of the 20th century on pine seedlings imported from Europe and has caused serious economic and ecological impacts. In this study, we applied a population and landscape genetics approach to understand the patterns of introduction and colonization as well as population structure and migration of C. ribicola. We characterized 1,292 samples of C. ribicola from 66 geographic locations in North America using single nucleotide polymorphisms (SNPs and evaluated the effect of landscape features, host distribution, and colonization history on the structure of these pathogen populations. We identified eastern and western genetic populations in North America that are strongly differentiated. Genetic diversity is two to five times higher in eastern populations than in western ones, which can be explained by the repeated accidental introductions of the pathogen into northeastern North America compared with a single documented introduction into western North America. These distinct genetic populations are maintained by a barrier to gene flow that corresponds to a region where host connectivity is interrupted. Furthermore, additional cryptic spatial differentiation was identified in western populations. This differentiation corresponds to landscape features, such as mountain ranges, and also to host connectivity. We also detected genetic differentiation between the pathogen populations in natural stands and plantations, an indication that anthropogenic movement of this pathogen still takes place. These results highlight the importance of monitoring this invasive alien tree pathogen to prevent admixture of eastern and western populations where different pathogen races occur.
-
Silfhout, van C.H.
1989-01-01
In wild emmer wheat three different kinds of genes for resistance to yellow rust were found, namely genes causing overall resistance, genes causing adult-plant resistance and genes which induce resistance detectable at higher temperatures. At least eleven different and probably novel major
-
Genetic and environmental variation in rust frequency on mature mountain birch trees
Energy Technology Data Exchange (ETDEWEB)
Elamo, Pirjo; Saloniemi, Irma; Helander, M.L.; Neuvonen, Seppo [Turku Univ. (Finland). Dept. of Biology) and (Kevo Subarctic Research Inst., Turku (Finland)
2000-07-01
This study investigated genetic and environmental variation in the frequency of birch rust, the most important leaf disease of birch species, The same half-sib families of mature mountain birch trees were studied in two areas corresponding to their natural growing habitats over 3 yrs. The frequency of birch rust was examined both in the field and from detached leaves inoculated in the laboratory. The frequency of birch rust varied among the mountain birch families. However, the heritability of birch rust resistance was found to be fairly low, with the heritability of naturally occurring birch rust varying between 0.27 and 0.41. The frequency of birch rust varied highly between the two study areas and among study years. Nevertheless, the relative frequency of birch rust among tree individuals and tree families remained similar and as a result no notable genotype x environment interaction was observed. The field and in vitro results differed with respect to the ranking of birch families by birch rust resistance.
-
Characteristics of superior soybean breeding lines tolerance to rust (Phakopsora pachyrhizi Syd.
Directory of Open Access Journals (Sweden)
Alfi Inayati
2016-04-01
Full Text Available Soybean rust caused by Phakopsora pachyrhizi is one of the most important diseases which limits soybean production. The aim of this study was to evaluate the resistance of 28 superior soybean lines and their tolerance to rust. The study was conducted at a screen house and arranged in a completely randomized design (CRD; three replications. All genotypes tested were artificially inoculated with P. pachyrhizi, and a set of un-inoculated genotypes was planted as a comparison. Number of pustules was recorded weekly, and resistant criteria was rated based on the International working group on soybean rust IWGSR method. Lesion color (LC, sporulation level (SL, number of uredia (NoU, frequency of pustule which had uredia, and yield were also recorded. Among 28 genotypes tested, only one was categorized as resistant and 2 genotypes were susceptible. Resistant genotypes had few pustules, lower AUDPC values, low disease severity, and Reddish Brown lesion type. Soybean rust affected yield components, i.e. number of intact pods and yield per plant. Yield loses due to rust in this study varied from 5-89%, and the average was 51%. The set of lines from Tanggamus pedigree showed more resistant to rust but less tolerant compared to Sinabung pedigree.How to CiteInayati, A., & Yusnawan, E. (2016. Characteristics of superior soybean breeding lines tolerancet to rust (Phakopsora pachyrhizi Syd.. Biosaintifika: Journal of Biology & Biology Education, 8(1, 47-55.
-
Li, Feng; Li, Yinghui; Cao, Lirong; Liu, Peiyuan; Geng, Miaomiao; Zhang, Qiang; Qiu, Lina; Sun, Qixin; Xie, Chaojie
2018-01-01
Wheat powdery mildew, caused by Blumeria graminis f. sp. tritici , and wheat leaf rust, caused by Puccinia triticina Eriks, are two important diseases that severely threaten wheat production. Sorento, a hexaploid triticale cultivar from Poland, shows high resistance to the wheat powdery mildew isolate E09 and the leaf rust isolate PHT in Beijing, China. To introduce resistance genes into common wheat, Sorento was crossed with wheat line Xuezao, which is susceptible to both diseases, and the F 1 hybrids were then backcrossed with Xuezao as the recurrent male parent. By marker analysis, we demonstrate that the long arm of the 2R (2RL) chromosome confers resistance to both the leaf rust and powdery mildew isolates at adult-plant and seedling stages, while the long arm of 4R (4RL) confers resistance only to powdery mildew at both stages. The chromosomal composition of BC 2 F 3 plants containing 2R or 2RL and 4R or 4RL in the form of substitution and translocation were confirmed by GISH (genomic in situ hybridization) and FISH (fluorescence in situ hybridization). Monosomic and disomic substitutions of a wheat chromosome with chromosome 2R or 4R, as well as one 4RS-4DL/4DS-4RL reciprocal translocation homozigote and one 2RL-1DL translocation hemizigote, were recovered. Such germplasms are of great value in wheat improvement.
-
Unveiling common responses of Medicago truncatula to appropriate and inappropriate rust species
Vaz Patto, Maria Carlota; Rubiales, Diego
2014-01-01
Little is known about the nature of effective defense mechanisms in legumes to pathogens of remotely related plant species. Some rust species are among pathogens with broad host range causing dramatic losses in various crop plants. To understand and compare the different host and nonhost resistance (NHR) responses of legume species against rusts, we characterized the reaction of the model legume Medicago truncatula to one appropriate (Uromyces striatus) and two inappropriate (U. viciae-fabae and U. lupinicolus) rusts. We found that similar pre and post-haustorial mechanisms of resistance appear to be operative in M. truncatula against appropriate and inappropriate rust fungus. The appropriate U. striatus germinated better on M. truncatula accessions then the inappropriate U. viciae-fabae and U. lupinicolus, but once germinated, germ tubes of the three rusts had a similar level of success in finding stomata and forming an appressoria over a stoma. However, responses to different inappropriate rust species also showed some specificity, suggesting a combination of non-specific and specific responses underlying this legume NHR to rust fungi. Further genetic and expression analysis studies will contribute to the development of the necessary molecular tools to use the present information on host and NHR mechanisms to breed for broad-spectrum resistance to rust in legume species. PMID:25426128
-
Yu, Guotai; Zhang, Qijun; Friesen, Timothy L; Rouse, Matthew N; Jin, Yue; Zhong, Shaobin; Rasmussen, Jack B; Lagudah, Evans S; Xu, Steven S
2015-03-01
Mapping studies confirm that resistance to Ug99 race of stem rust pathogen in Aegilops tauschii accession Clae 25 is conditioned by Sr46 and markers linked to the gene were developed for marker-assisted selection. The race TTKSK (Ug99) of Puccinia graminis f. sp. tritici, the causal pathogen for wheat stem rust, is considered as a major threat to global wheat production. To address this threat, researchers across the world have been devoted to identifying TTKSK-resistant genes. Here, we report the identification and mapping of a stem rust resistance gene in Aegilops tauschii accession CIae 25 that confers resistance to TTKSK and the development of molecular markers for the gene. An F2 population of 710 plants from an Ae. tauschii cross CIae 25 × AL8/78 were first evaluated against race TPMKC. A set of 14 resistant and 116 susceptible F2:3 families from the F2 plants were then evaluated for their reactions to TTKSK. Based on the tests, 179 homozygous susceptible F2 plants were selected as the mapping population to identify the simple sequence repeat (SSR) and sequence tagged site (STS) markers linked to the gene by bulk segregant analysis. A dominant stem rust resistance gene was identified and mapped with 16 SSR and five new STS markers to the deletion bin 2DS5-0.47-1.00 of chromosome arm 2DS in which Sr46 was located. Molecular marker and stem rust tests on CIae 25 and two Ae. tauschii accessions carrying Sr46 confirmed that the gene in CIae 25 is Sr46. This study also demonstrated that Sr46 is temperature-sensitive being less effective at low temperatures. The marker validation indicated that two closely linked markers Xgwm210 and Xwmc111 can be used for marker-assisted selection of Sr46 in wheat breeding programs.
-
Floyd Bridgwater; Tom Kubisiak; Tom Byram; Steve Mckeand
2004-01-01
In the southeastern USA, fusiform rust resistant loblolly and slash pines may be deployed as 1) ulked seed orchard mixes. 2) half-sibling (sib) family mixtures. 3) single half-sib families. 4) full-sib cross seeds or as 6) clones of individual genotypes. These deployment types are respectively greater genetic gains from higher selection intensity. Currently, bulked...
-
Genome-wide association study of rust traits in orchardgrass using SLAF-seq technology.
Zeng, Bing; Yan, Haidong; Liu, Xinchun; Zang, Wenjing; Zhang, Ailing; Zhou, Sifan; Huang, Linkai; Liu, Jinping
2017-01-01
While orchardgrass ( Dactylis glomerata L.) is a well-known perennial forage species, rust diseases cause serious reductions in the yield and quality of orchardgrass; however, genetic mechanisms of rust resistance are not well understood in orchardgrass. In this study, a genome-wide association study (GWAS) was performed using specific-locus amplified fragment sequencing (SLAF-seq) technology in orchardgrass. A total of 2,334,889 SLAF tags were generated to produce 2,309,777 SNPs. ADMIXTURE analysis revealed unstructured subpopulations for 33 accessions, indicating that this orchardgrass population could be used for association analysis. Linkage disequilibrium (LD) analysis revealed an average r 2 of 0.4 across all SNP pairs, indicating a high extent of LD in these samples. Through GWAS, a total of 4,604 SNPs were found to be significantly ( P rust trait. The bulk analysis discovered a number of 5,211 SNPs related to rust trait. Two candidate genes, including cytochrome P450, and prolamin were implicated in disease resistance through prediction of functional genes surrounding each high-quality SNP ( P rust traits based on GWAS analysis and bulk analysis. The large number of SNPs associated with rust traits and these two candidate genes may provide the basis for further research on rust resistance mechanisms and marker-assisted selection (MAS) for rust-resistant lineages.
-
Chandra, Saket; Kazmi, Andaleeb Z; Ahmed, Zainab; Roychowdhury, Gargi; Kumari, Veena; Kumar, Manish; Mukhopadhyay, Kunal
2017-07-01
NB-ARC domain-containing resistance genes from the wheat genome were identified, characterized and localized on chromosome arms that displayed differential yet positive response during incompatible and compatible leaf rust interactions. Wheat (Triticum aestivum L.) is an important cereal crop; however, its production is affected severely by numerous diseases including rusts. An efficient, cost-effective and ecologically viable approach to control pathogens is through host resistance. In wheat, high numbers of resistance loci are present but only few have been identified and cloned. A comprehensive analysis of the NB-ARC-containing genes in complete wheat genome was accomplished in this study. Complete NB-ARC encoding genes were mined from the Ensembl Plants database to predict 604 NB-ARC containing sequences using the HMM approach. Genome-wide analysis of orthologous clusters in the NB-ARC-containing sequences of wheat and other members of the Poaceae family revealed maximum homology with Oryza sativa indica and Brachypodium distachyon. The identification of overlap between orthologous clusters enabled the elucidation of the function and evolution of resistance proteins. The distributions of the NB-ARC domain-containing sequences were found to be balanced among the three wheat sub-genomes. Wheat chromosome arms 4AL and 7BL had the most NB-ARC domain-containing contigs. The spatio-temporal expression profiling studies exemplified the positive role of these genes in resistant and susceptible wheat plants during incompatible and compatible interaction in response to the leaf rust pathogen Puccinia triticina. Two NB-ARC domain-containing sequences were modelled in silico, cloned and sequenced to analyze their fine structures. The data obtained in this study will augment isolation, characterization and application NB-ARC resistance genes in marker-assisted selection based breeding programs for improving rust resistance in wheat.
-
Proposal and reclassification of standards for resistance studies of brown rust sugarcane
Directory of Open Access Journals (Sweden)
Joaquín Montalván Delgado
2017-10-01
Full Text Available In Cuba, the methodology used for sugarcane brown rust resistance evaluation has limited patterning, which makes it difficult to adequately handle cultivars in the intermediate categories of reaction, provided that from an agro-productive point of view they are interest. Six known reaction patterns and 11 commercial cultivars were studied. The variables, length, amount and percentage of leaf area occupied by pustules were recorded, as well as the length of the major pustule. The application and interpretation of statistical methods allowed to ratify as highly resistant PR980, resistant Ja64-11 and as susceptible My5514. The cultivars SP70-1284 (moderately resistant, C88-380 (moderately susceptible and C323-68 (susceptible are included as new standards. They are reclassified to C334-64 (moderately susceptible, Ja60-5 and B4362 (highly susceptible.
-
Yang, Xiaofei; Li, Xin; Wang, Changyou; Chen, Chunhuan; Tian, Zengrong; Ji, Wanquan
2017-12-01
A common wheat - Leymus mollis (2n = 4x = 28, NsNsXmXm) double monosomic addition line, M11003-4-3-8/13/15 (2n = 44 = 42T.a + L.m2 + L.m3), with stripe rust resistance was developed (where T.a represents Triticum aestivum chromosome, L.m represents L. mollis chromosome, and L.m2/3 represents L. mollis chromosome of homoeologous groups 2 and 3). The progenies of line M11003-4-3-8/13/15 were characterized by cytological observation, specific molecular markers, fluorescence in situ hybridization (FISH), and genomic in situ hybridization (GISH). Among the progenies, there existed five different types (I, II, III, IV, and V) of chromosome constitution, the formulas of which were 2n = 44 = 42T.a + 1L.m2 + 1L.m3, 2n = 43 = 42T.a + 1L.m2, 2n = 43 = 42T.a + 1L.m3, 2n = 42 = 42T.a, and 2n = 44 = 42T.a + 2L.m2, respectively. Field disease screening showed that types I and III showed high resistance to stripe rust, while types II, IV, and V were susceptible. Leymus mollis was almost immune to stripe rust, whereas the wheat parent, cultivar 7182, was susceptible. Therefore, we concluded that the stripe rust resistance originated from L. mollis. These various lines could be further fully exploited as important disease resistance materials to enrich wheat genetic resources.
-
Influence of yellow rust infextion on 32P transport in detached barley leaves
International Nuclear Information System (INIS)
Schubert, J.
1982-01-01
Several barley cultivars (Hordeum vulgare L.) differing in their resistance to yellow rust (Puccinia striiformis West.) were tested for relationships between changes of 32 P transport in detached leaves and resistance to yellow rust disease. Investigation carried out with detached second leaves from plants infected at their first leaf revealed a matter transport in these leaves changed by the infection. Transport was also influenced by inoculation with yellow rust uredospores. In that case rust infection influenced the basipetal transport less strongly in resistent plants than in susceptible ones. Connected with the findings the influence of fungal substances on transport processes is discussed in general. (author)
-
Directory of Open Access Journals (Sweden)
Kalim Ullah
2016-06-01
Full Text Available Mixed inheritance analysis using joint segregation analysis (JSA for stripe rust (Puccinia striiformis f. sp. tritici resistance was carried out in six basic populations (P1, F1, P2, BC1, BC2 and F2 of four wheat crosses (Hashim-08 × LU-26, Farid-06 × Shafaq, Parula × Blue Silver, TD-1 × D-97603 during crop season 2009 to 2012. Genes controlling stripe rust resistance were assessed by using area under disease progress curve (AUDPC. The AUDPC was controlled by mixed two additive-dominant-epistatic major genes plus additive-dominant-epistasis of polygenes in cross Hashim-08 × LU-26 (model E, while in Farid-06 × Shafaq, it was controlled by mixed two major additive-dominant genes plus additive-dominant polygenes (model E-2. In cross Parula × Blue Silver, the AUDPC was managed by additive, dominance and epistasis of two major genes (model B-1, however, it was controlled by mixed one major gene and additive dominant polygenes in cross TD-1 × D-97603 (model D-1. Genetic variation and heritability was higher in major genes than polygene for all the crosses showing that AUDPC was mainly controlled by major genes. The genetic behavior of the AUDPC revealed that stripe rust resistance was controlled by mixed interaction of one to two major genes plus polygenes.
-
Effect of orange rust on sugarcane breeding program at canal Point
Orange rust of sugarcane (Saccharum spp. hybrids), caused by Puccinia kuehnii (W. Krüger) E.J. Butler, appeared in the Western Hemisphere ten years ago. Orange rust substantially reduces yields in susceptible sugarcane genotypes. Majority of the commercial cultivars were susceptible at the time of o...
-
Barbieri, M.; Marcel, T.C.; Niks, R.E.; Francia, E.; Pasquariello, M.; Mazzamurro, V.; Garvin, D.F.; Pecchioni, N.
2012-01-01
The potential of the model grass Brachypodium distachyon L. (Brachypodium) for studying grass–pathogen interactions is still underexploited. We aimed to identify genomic regions in Brachypodium associated with quantitative resistance to the false brome rust fungus Puccinia brachypodii. The inbred
-
'Caldwell' is a U.S. soft red winter wheat that has partial, adult plant resistance to the leaf rust pathogen Puccinia triticina. A line of 'Thatcher*2/Caldwell' with adult plant resistance derived from Caldwell was crossed with 'Thatcher' to develop a population of recombinant inbred lines (RILs). ...
-
Comparative Transcriptomics Among Four White Pine Species
Directory of Open Access Journals (Sweden)
Ethan A. G. Baker
2018-05-01
Full Text Available Conifers are the dominant plant species throughout the high latitude boreal forests as well as some lower latitude temperate forests of North America, Europe, and Asia. As such, they play an integral economic and ecological role across much of the world. This study focused on the characterization of needle transcriptomes from four ecologically important and understudied North American white pines within the Pinus subgenus Strobus. The populations of many Strobus species are challenged by native and introduced pathogens, native insects, and abiotic factors. RNA from the needles of western white pine (Pinus monticola, limber pine (Pinus flexilis, whitebark pine (Pinus albicaulis, and sugar pine (Pinus lambertiana was sampled, Illumina short read sequenced, and de novo assembled. The assembled transcripts and their subsequent structural and functional annotations were processed through custom pipelines to contend with the challenges of non-model organism transcriptome validation. Orthologous gene family analysis of over 58,000 translated transcripts, implemented through Tribe-MCL, estimated the shared and unique gene space among the four species. This revealed 2025 conserved gene families, of which 408 were aligned to estimate levels of divergence and reveal patterns of selection. Specific candidate genes previously associated with drought tolerance and white pine blister rust resistance in conifers were investigated.
-
Somatic recombination in wheat stem rust leads to virulence for Ug99-effective SR50 resistance
Race-specific resistance genes protect much of the global wheat crop from stem rust disease caused by Puccinia graminis f. sp. tritici (Pgt), but often break down due to evolution of new virulent pathogen races. To understand the molecular mechanisms of virulence evolution in Pgt we identified the p...
-
Directory of Open Access Journals (Sweden)
Jayaveeramuthu Nirmala
2017-10-01
Full Text Available Wheat stem rust, caused by Puccinia graminis f. sp. tritici Eriks. & E. Henn, can incur yield losses in susceptible cultivars of durum wheat, Triticum turgidum ssp. durum (Desf. Husnot. Although several durum cultivars possess the stem rust resistance gene Sr13, additional genes in durum wheat effective against emerging virulent races have not been described. Durum line 8155-B1 confers resistance against the P. graminis f. sp. tritici race TTKST, the variant race of the Ug99 race group with additional virulence to wheat stem rust resistance gene Sr24. However, 8155-B1 does not confer resistance to the first-described race in the Ug99 race group: TTKSK. We mapped a single gene conferring resistance in 8155-B1 against race TTKST, Sr8155B1, to chromosome arm 6AS by utilizing Rusty/8155-B1 and Rusty*2/8155-B1 populations and the 90K Infinium iSelect Custom bead chip supplemented by KASP assays. One marker, KASP_6AS_IWB10558, cosegregated with Sr8155B1 in both populations and correctly predicted Sr8155B1 presence or absence in 11 durum cultivars tested. We confirmed the presence of Sr8155B1 in cultivar Mountrail by mapping in the population Choteau/Mountrail. The marker developed in this study could be used to predict the presence of resistance to race TTKST in uncharacterized durum breeding lines, and also to combine Sr8155B1 with resistance genes effective to Ug99 such as Sr13. The map location of Sr8155B1 cannot rule out the possibility that this gene is an allele at the Sr8 locus. However, race specificity indicates that Sr8155B1 is different from the known alleles Sr8a and Sr8b.
-
Influence of yellow rust infection on /sup 32/P transport in detached barley leaves
Energy Technology Data Exchange (ETDEWEB)
Schubert, J. (Akademie der Landwirtschaftswissenschaften der DDR, Aschersleben. Inst. fuer Phytopathologie)
1982-01-01
Several barley cultivars (Hordeum vulgare L.) differing in their resistance to yellow rust (Puccinia striiformis West.) were tested for relationships between changes of /sup 32/P transport in detached leaves and resistance to yellow rust disease. Investigation carried out with detached second leaves from plants infected at their first leaf revealed a matter transport in these leaves changed by the infection. Transport was also influenced by inoculation with yellow rust uredospores. In that case rust infection influenced the basipetal transport less strongly in resistent plants than in susceptible ones. Connected with the findings the influence of fungal substances on transport processes is discussed in general.
-
Low average blister-rust infection rates may mean high control costs
Robert Marty
1965-01-01
The Northeastern Forest Experiment Station, in cooperation with Federal and State forest-pest-control agencies, undertook a survey of blister-rust infection rates in the white pine region of the East during 1962 and 1963. Those engaged in blister-rust-control activities will not be surprised at the survey's results. We found that infection rates were significantly...
-
REVIEW - Advances on molecular studies of the interaction soybean - Asian rust
Directory of Open Access Journals (Sweden)
Aguida Maria Alves Pereira Morales
2012-01-01
Full Text Available Effective management practices are essential for controlling rust outbreaks. The main control methodused is the application of fungicides, which increases substantially the cost of production and is harmful to theenvironment. Prevention is still the best way to avoid more significant losses in soybean yields. Alternatives,such as planting resistant varieties to the fungus, are also important. The use of resistant or tolerant varietiesis the most promising method for controlling Asian soybean rust. Recently, five dominant genes resistant to soybean rust were described: Rpp1, Rpp2, Rpp3, Rpp4 and Rpp5. However, little is known about the molecular interaction among soybean plant and soybean rust and on the molecular pathway triggered by pathogen recognition. Understanding the molecular mechanisms involved in defense responses is of primary importance for planning strategies to control stress and, consequently, to increase plant adaptation to limiting conditions
-
Stem rust, caused by Puccinia graminis Pers.:Pers. f.sp. tritici Eriks. and Henn., poses a serious threat to global wheat production because of the emergence of Pgt-TTKSK (Ug99). The TTKSK resistant gene Sr39 was derived from Aegilops speltoides through chromosome translocation. In this study, we ch...
-
Investigating Gene Function in Cereal Rust Fungi by Plant-Mediated Virus-Induced Gene Silencing.
Panwar, Vinay; Bakkeren, Guus
2017-01-01
Cereal rust fungi are destructive pathogens, threatening grain production worldwide. Targeted breeding for resistance utilizing host resistance genes has been effective. However, breakdown of resistance occurs frequently and continued efforts are needed to understand how these fungi overcome resistance and to expand the range of available resistance genes. Whole genome sequencing, transcriptomic and proteomic studies followed by genome-wide computational and comparative analyses have identified large repertoire of genes in rust fungi among which are candidates predicted to code for pathogenicity and virulence factors. Some of these genes represent defence triggering avirulence effectors. However, functions of most genes still needs to be assessed to understand the biology of these obligate biotrophic pathogens. Since genetic manipulations such as gene deletion and genetic transformation are not yet feasible in rust fungi, performing functional gene studies is challenging. Recently, Host-induced gene silencing (HIGS) has emerged as a useful tool to characterize gene function in rust fungi while infecting and growing in host plants. We utilized Barley stripe mosaic virus-mediated virus induced gene silencing (BSMV-VIGS) to induce HIGS of candidate rust fungal genes in the wheat host to determine their role in plant-fungal interactions. Here, we describe the methods for using BSMV-VIGS in wheat for functional genomics study in cereal rust fungi.
-
Cheng, Yulin; Yao, Juanni; Zhang, Hongchang; Huang, Lili; Kang, Zhensheng
2015-07-01
Cereal powdery mildews caused by Blumeria graminis and cereal rusts caused by Puccinia spp. are constant disease threats that limit the production of almost all important cereal crops. Rice is an intensively grown agricultural cereal that is atypical because of its immunity to all powdery mildew and rust fungi. We analyzed the nonhost interactions between rice and the wheat powdery mildew fungus B. graminis f. sp. tritici (Bgt) and the wheat leaf rust fungus Puccinia triticina (Ptr) to identify the basis of nonhost resistance (NHR) in rice against cereal powdery mildew and rust fungi at cytological and molecular levels. No visible symptoms were observed on rice leaves inoculated with Bgt or Ptr. Microscopic observations showed that both pathogens exhibited aberrant differentiation and significantly reduced penetration frequencies on rice compared to wheat. The development of Bgt and Ptr was also completely arrested at early infection stages in cases of successful penetration into rice leaves. Attempted infection of rice by Bgt and Ptr induced similar defense responses, including callose deposition, accumulation of reactive oxygen species, and hypersensitive response in rice epidermal and mesophyll cells, respectively. Furthermore, a set of defense-related genes were upregulated in rice against Bgt and Ptr infection. Rice is an excellent monocot model for genetic and molecular studies. Therefore, our results demonstrate that rice is a useful model to study the mechanisms of NHR to cereal powdery mildew and rust fungi, which provides useful information for the development of novel and durable strategies to control these important pathogens.
-
Directory of Open Access Journals (Sweden)
Eduardo Alano Vieira
2006-02-01
the use of resistant cultivars. However, for the durable resistance to be acquired, it is necessary to know the genetics of resistance to crown rust in oats. Thus, the objective of this work was to determine the type of inheritance of resistance to three Puccinia coronata f. sp. avenae Fraser & Led., isolates (collected in southern Brazil in brazilian white oat genotypes. To determine the inheritance of resistance to each one of three isolates,F2 populations were used generated through artificial crosses, between resistant (R and susceptible (S and between resistant genotypes (R. Thus, F2 populations from the following artificial crosses: i URPEL 15 (R x UFRGS 7 (S, UPF 16 (R x UFRGS 7 (S and URPEL 15 (R x UPF 16 (R, were used to determine the inheritance of resistance to isolate one (1; ii URPEL 15 (R x UFRGS 7 (S, UPF 18 (R x UFRGS 7 (S and URPEL 15 (R x UPF 18 (R, to determine the inheritance of resistance to isolate two (2; iii URPEL 15 (R x UFRGS 7 (S and URPEL 15 (R x UPF 18 (S, to determine the inheritance of resistance to isolate three (3. The obtained results indicate that the genotype URPEL 15 present dominants genes for resistance to the three oat leaf rust isolates evaluated, the cultivar UPF 16 presents a recessive gene for resistance to isolate 1 and the cultivar UPF 18 has a recessive gene of resistence to isolate 2. Also, the resistance genes presented by genotypes URPEL 15, UPF 16 and UPF 18, segregate in an independent manner.
-
Valentini, Giseli; Gonçalves-Vidigal, Maria Celeste; Hurtado-Gonzales, Oscar P; de Lima Castro, Sandra Aparecida; Cregan, Perry B; Song, Qijian; Pastor-Corrales, Marcial A
2017-08-01
Co-segregation analysis and high-throughput genotyping using SNP, SSR, and KASP markers demonstrated genetic linkage between Ur-14 and Co-3 4 /Phg-3 loci conferring resistance to the rust, anthracnose and angular leaf spot diseases of common bean. Rust, anthracnose, and angular leaf spot are major diseases of common bean in the Americas and Africa. The cultivar Ouro Negro has the Ur-14 gene that confers broad spectrum resistance to rust and the gene cluster Co-3 4 /Phg-3 containing two tightly linked genes conferring resistance to anthracnose and angular leaf spot, respectively. We used co-segregation analysis and high-throughput genotyping of 179 F 2:3 families from the Rudá (susceptible) × Ouro Negro (resistant) cross-phenotyped separately with races of the rust and anthracnose pathogens. The results confirmed that Ur-14 and Co-3 4 /Phg-3 cluster in Ouro Negro conferred resistance to rust and anthracnose, respectively, and that Ur-14 and the Co-3 4 /Phg-3 cluster were closely linked. Genotyping the F 2:3 families, first with 5398 SNPs on the Illumina BeadChip BARCBEAN6K_3 and with 15 SSR, and eight KASP markers, specifically designed for the candidate region containing Ur-14 and Co-3 4 /Phg-3, permitted the creation of a high-resolution genetic linkage map which revealed that Ur-14 was positioned at 2.2 cM from Co-3 4 /Phg-3 on the short arm of chromosome Pv04 of the common bean genome. Five flanking SSR markers were tightly linked at 0.1 and 0.2 cM from Ur-14, and two flanking KASP markers were tightly linked at 0.1 and 0.3 cM from Co-3 4 /Phg-3. Many other SSR, SNP, and KASP markers were also linked to these genes. These markers will be useful for the development of common bean cultivars combining the important Ur-14 and Co-3 4 /Phg-3 genes conferring resistance to three of the most destructive diseases of common bean.
-
Stem rust of wheat caused by the fungal pathogen Puccinia graminis f. sp. tritici historically caused major yield losses of wheat worldwide. To understand the genetic basis of stem rust resistance in conventional North American spring wheat, genome-wide association analysis (GWAS) was conducted on a...
-
Feng, Junyan; Wang, Meinan; See, Deven R; Chao, Shiaoman; Zheng, Youliang; Chen, Xianming
2018-06-01
Stripe rust, caused by Puccinia striiformis f. sp. tritici, is an important disease of wheat worldwide. Exploring new resistance genes is essential for breeding resistant wheat cultivars. PI 182103, a spring wheat landrace originally from Pakistan, has shown a high level of resistance to stripe rust in fields for many years, but genes for resistance to stripe rust in the variety have not been studied. To map the resistance gene(s) in PI 182103, 185 recombinant inbred lines (RILs) were developed from a cross with Avocet Susceptible (AvS). The RIL population was genotyped with simple sequence repeat (SSR) and single nucleotide polymorphism markers and tested with races PST-100 and PST-114 at the seedling stage under controlled greenhouse conditions and at the adult-plant stage in fields at Pullman and Mt. Vernon, Washington under natural infection by the stripe rust pathogen in 2011, 2012, and 2013. A total of five quantitative trait loci (QTL) were detected. QyrPI182103.wgp-2AS and QyrPI182103.wgp-3AL were detected at the seedling stage, QyrPI182103.wgp-4DL was detected only in Mt. Vernon field tests, and QyrPI182103.wgp-5BS was detected in both seedling and field tests. QyrPI182103.wgp-7BL was identified as a high-temperature adult-plant resistance gene and detected in all field tests. Interactions among the QTL were mostly additive, but some negative interactions were detected. The 7BL QTL was mapped in chromosomal bin 7BL 0.40 to 0.45 and identified as a new gene, permanently designated as Yr79. SSR markers Xbarc72 and Xwmc335 flanking the Yr79 locus were highly polymorphic in various wheat genotypes, indicating that the molecular markers are useful for incorporating the new gene for potentially durable stripe rust resistance into new wheat cultivars.
-
Sugarcane is susceptible to infection by two rust pathogens, Puccinia melanocephala and P. kuehnii, causing brown and orange rust, respectively. Orange rust of sugarcane was first reported in the Western hemisphere in Florida in July 2007. The pathogen was found to be distributed widely throughout t...
-
Directory of Open Access Journals (Sweden)
Gustavo Hiroshi Sera
2010-01-01
Full Text Available As cultivares de café IPR 99 ("Sarchimor" e IPR 107 ('IAPAR 59' x 'Mundo Novo IAC 376-4' eram no passado resistentes à ferrugem (Hemileia vastatrix. Os objetivos deste estudo foram: a Identificar progênies dessas duas cultivares com resistência à ferrugem; b Identificar progênies com resistência incompleta; c Verificar a eficiência dos cruzamentos testes na seleção dessas cultivares. A avaliação da resistência em campo foi realizada em cafeeiros adultos expostos à população local de raças presentes no IAPAR. Foram avaliados 23 cruzamentos testes com progênies F3 de 'IPR 107' e 5 com progênies F4 de 'IPR 99'. Além disso, foram avaliadas 11 progênies F4 de 'IPR 107' e 5 progênies F5 de 'IPR 99', provenientes de autofecundação. Várias progênies das cultivares IPR 99 e 107 apresentaram alta freqüência de plantas com resistência completa e são portadoras de mais genes de resistência não quebrados pelas raças de ferrugem. Progênies das cultivares IPR 99 e IPR 107 com a resistência quebrada apresentaram resistência incompleta à população local de raças. Cruzamentos testes foram eficientes na seleção de progênies de café com mais genes de resistência não quebrados.All plants of the coffee cultivars IPR 99 ("Sarchimor" and IPR 107 ('IAPAR 59' x 'Mundo Novo IAC 376-4' were resistant to rust (Hemileia vastatrix in the past. Currently, susceptible plants were observed in the two cultivars due to the breakdown of resistance by new rust races. The aims of this study were: a to identify coffee (Coffea arabica L. progenies of the two cultivars with resistance to rust; b to identify progenies with incomplete resistance; c to investigate the efficiency of test-crosses for selection from these cultivars. Evaluation for field resistance was carried out in adult plants subjected to natural infection by the local leaf rust population at IAPAR. Twenty-three test-crosses with F3 progenies of 'IPR 107' and five with F4
-
BRS Ártico - Common bean cultivar with exportstandard white grain
Directory of Open Access Journals (Sweden)
Helton Santos Pereira
2016-07-01
Full Text Available BRS Ártico is a common bean cultivar with white grains with international standard size (62 g per 100 seeds, appropriate for cultivation in the Central region of Brazil and the state of Paraná. The cycle is semi-early, the yield potential 2677 kg ha-1 and BRS Ártico has moderate resistance to rust and curtobacterium wilt.
-
Marker-assisted pyramiding of Thinopyrumderived leaf rust ...
Indian Academy of Sciences (India)
2017-03-20
Mar 20, 2017 ... resistance genes Lr19 and Lr24 using marker assisted foreground .... is linked with stem rust resistance gene Sr24(McIntosh et al. 1976). .... Received 29 July 2016, in final revised form 3 March 2017; accepted 16 March 2017.
-
Stem rust is a serious disease of wheat that has caused historical epidemics, but it has not been a threat in recent decades in North America due to the eradication of the alternate host and deployment of resistant cultivars. However, the recent emergence of Ug99 (or race TTKS) poses a threat to glo...
-
Bulos, Mariano; Vergani, Pablo Nicolas; Altieri, Emiliano
2014-09-01
Rust resistance in the sunflower line P386 is controlled by Pu 6 , a gene which was reported to segregate independently from other rust resistant genes, such as R 4 . The objectives of this work were to map Pu 6 , to provide and validate molecular tools for its identification, and to determine the linkage relationship of Pu 6 and R 4 . Genetic mapping of Pu 6 with six markers covered 24.8 cM of genetic distance on the lower end of linkage Group 13 of the sunflower consensus map. The marker most closely linked to Pu 6 was ORS316 at 2.5 cM in the distal position. ORS316 presented five alleles when was assayed with a representative set of resistant and susceptible lines. Allelism test between Pu 6 and R 4 indicated that both genes are linked at a genetic distance of 6.25 cM. This is the first confirmation based on an allelism test that at least two members of the R adv /R 4 /R 11 / R 13a /R 13b /Pu 6 cluster of genes are at different loci. A fine elucidation of the architecture of this complex locus will allow designing and constructing completely new genomic regions combining genes from different resistant sources and the elimination of the linkage drag around each resistant gene.
-
Anonymous,
1986-01-01
This brief guide for identifying rust diseases of smaill grain cereals contains color photos depicting the growth stages of small grain cereal crops and provides instructions for recording rust severity and field response for stripe rust (Puccinia striiformis), stem rust (P. graminis), and leaf rust
-
Pushing the boundaries of resistance: insights from Brachypodium-rust interactions
Figueroa, Melania; Castell-Miller, Claudia V.; Li, Feng; Hulbert, Scot H.; Bradeen, James M.
2015-01-01
The implications of global population growth urge transformation of current food and bioenergy production systems to sustainability. Members of the family Poaceae are of particular importance both in food security and for their applications as biofuel substrates. For centuries, rust fungi have threatened the production of valuable crops such as wheat, barley, oat, and other small grains; similarly, biofuel crops can also be susceptible to these pathogens. Emerging rust pathogenic races with i...
-
The Puccinia graminis f. sp. tritici (Pgt) Ug99 race group is virulent to most stem rust resistance genes currently deployed in wheat and poses a serious threat to global wheat production. The durum wheat (Triticum turgidum ssp. durum) gene Sr13 confers resistance to Ug99 in addition to virulent rac...
-
Anonymous
1986-01-01
This brief guide for identifying rust diseases of smaill grain cereals contains color photos depicting the growth stages of small grain cereal crops and provides instructions for recording rust severity and field response for stripe rust (Puccinia striiformis), stem rust (P. graminis), and leaf rust (P. recondita).
-
Directory of Open Access Journals (Sweden)
Joaquín Montalván Delgado
2016-01-01
Full Text Available The sugarcane brown rust disease is caused by fungus Puccinia melanocephala Sydow & P. Sydow and it is one of the more importance diseases. The environment where the sugarcane is cultivated is constituted by numerous factors and its combination contributes to the formation of different development and production conditions, what influences in the varietal disease resistance. With the objective of to characterize and to define the resistance tests location to the brown rust disease were carried out experiments in 6 location of the country. Eleven varieties and six patterns were studied. The climatic variables were analyzed during the period in each location and they were carried out evaluations in different ages of the plant and number of the leaves. The quantity of pustules, long of the most frequent pustules, size of the biggest pustules and area per - centage occupied by pustules were evaluated. The data were analyzed statistically. Differential behavior of the locations and the importance of the relative humidity and the temperatures in the manifestation of the disease symptoms were proven. All the locations were important although similarity exists between Matanzas and Villa Clara and between Camagüey and Holguín. Mayabeque and Santiago de Cuba didn’t present similarity with any other one. These 6 locations can be used for the resistance tests and to define the progenitors’ Santiago de Cuba, Holguín, Villa Clara and Mayabeque
-
Bariana, H. S.; Brown, G. N.; Ahmed, N. U.; Khatkar, S.; Conner, R. L.; Wellings, C. R.; Haley, S.; Sharp, P. J.; Laroche, A.
2002-02-01
Stripe rust resistance was identified in Triticum vavilovii( T. vaviloviiAus22498)-derived Russian wheat aphid (RWA)-resistant germplasm. Inheritance studies indicated monogenic control of resistance. The resistance gene was tentatively designated as Yrvav and was located on chromosome 1B by monosomic analysis. A close association (1.5+/-0.9% recombination) of Yrvav with a T. vavilovii-derived gliadin allele ( Gli-B1vav) placed it in chromosome arm 1BS. Yrvavwas allelic with Yr10. Tests with Yr10 avirulent and virulent pathotypes showed that Yrvav and Yr10 possess identical pathogenic specificity. Yrvav and Yr10 showed close genetic associations with alternate alleles at the Xpsp3000(microsatellite marker), Gli-B1 and Rg1 loci. Based on these observations Yrvav was named as Yr10vav. The close association between Xpsp3000 and Gli-B1 was also confirmed. The Yr10vav-linked Xpsp3000 allele (285 bp) was not present in 65 Australian cultivars, whereas seven Australian wheats lacking Yr10 carried the same Xpsp3000 allele (260 bp) as Yr10carrying wheat cultivar Moro. Xpsp3000 and/or Gli-B1 could be used in marker-assisted selection for pyramiding Yr10vavor Yr10 with other stripe rust resistance genes. Yr10vav was inherited independently of the T. vavilovii-derived RWA resistance.
-
Directory of Open Access Journals (Sweden)
Larissa de Oliveira Fassio
2016-01-01
Full Text Available Considering the importance of the chemical compounds in Arabica coffee beans in the definition of the drink sensory quality and authentication of coffee regions, the aim of this study was to evaluate, from principal component analysis—PCA—if there is a relation between the caffeine, trigonelline, and chlorogenic acid (5-CQA content and the sensory attributes of the drink, and in this context, enabling the differentiation of cultivars in two coffee-producing regions of Brazil. We evaluated seven rust-resistant Coffea arabica cultivars, and two rust-susceptible cultivars in two cultivation environments: Lavras, in the southern region of Minas Gerais state, and Patrocinio in the Cerrado region of Minas Gerais. The flavor and acidity were determinant for differentiation of the cultivars and their interaction with the evaluated environments. Cultivars Araponga MG1, Catigua MG2, and Catigua MG1 are the most suitable for the production of specialty coffee in the state of Minas Gerais. A poor correlation was found between caffeine, trigonelline, 5-CQA contents, and fragrance, flavor, acidity, body, and final score attributes. However, these compounds enabled the differentiation of the environments. The PCA indicated superiority in the sensory quality of cultivars resistant to rust, compared to the control, Bourbon Amarelo, and Topázio MG1190.
-
A new highly effective resistance to oat crown rust (Puccinia coronata f. sp. avenae) was identified in the diploid oat Avena strigosa PI 258731 and introgressed into hexaploid cultivated oat. Young plants with this resistance show moderate susceptibility, whereas older plant tissues and adult plant...
-
Naruoka, Y; Garland-Campbell, K A; Carter, A H
2015-06-01
Potential novel and known QTL for race-specific all-stage and adult plant resistance to stripe rust were identified by genome-wide association mapping in the US PNW winter wheat accessions. Stripe rust (Puccinia striiformis F. sp. tritici; also known as yellow rust) is a globally devastating disease of wheat (Triticum aestivum L.) and a major threat to wheat production in the US Pacific Northwest (PNW), therefore both adult plant and all-stage resistance have been introduced into the winter wheat breeding programs in the PNW. The goal of this study was to identify quantitative trait loci (QTL) and molecular markers for these resistances through genome-wide association (GWAS) mapping in winter wheat accessions adapted to the PNW. Stripe rust response for adult plants was evaluated in naturally occurring epidemics in a total of nine environments in Washington State, USA. Seedling response was evaluated with three races under artificial inoculation in the greenhouse. The panel was genotyped with the 9K Illumina Wheat single nucleotide polymorphism (SNP) array and additional markers linked to previously reported genes and QTL for stripe rust resistance. The population was grouped into three sub-populations. Markers linked to Yr17 and previously reported QTL for stripe rust resistance were identified on chromosomes 1B, 2A, and 2B. Potentially novel QTL associated with race-specific seedling response were identified on chromosomes 1B and 1D. Potentially novel QTL associated with adult plant response were located on chromosomes 2A, 2B, 3B, 4A, and 4B. Stripe rust was reduced when multiple alleles for resistance were present. The resistant allele frequencies were different among sub-populations in the panel. This information provides breeders with germplasm and closely linked markers for stripe rust resistance to facilitate the transfer of multiple loci for durable stripe rust resistance into wheat breeding lines and cultivars.
-
Directory of Open Access Journals (Sweden)
Duli Zhao
2015-07-01
Full Text Available Sugarcane (Saccharum spp. brown rust (caused by Puccinia melanocephala Syd. & P. Syd. was first reported in the United States in 1978 and is still one of the great challenges for sugarcane production. A better understanding of sugarcane genotypic variation in response to brown rust will help optimize breeding and selection strategies for disease resistance. Brown rust ratings were scaled from non-infection (0 to severe infection (4 with intervals of 0.5 and routinely recorded for genotypes in the first clonal selection stage of the Canal Point sugarcane breeding program in Florida. Data were collected from 14,272 and 12,661 genotypes and replicated check cultivars in 2012 and 2013, respectively. Mean rust rating, % infection, and severity in each family and progeny of female parent were determined, and their coefficients of variation (CV within and among families (females were estimated. Considerable variation exists in rust ratings among families or females. The families and female parents with high susceptibility or resistance to brown rust were identified and ranked. The findings of this study can help scientists to evaluate sugarcane crosses and parents for brown rust disease, to use desirable parents for crossing, and to improve genetic resistance to brown rust in breeding programs.
-
International Nuclear Information System (INIS)
Ahmad, S.; Afzal, M.; Noorka, I.R.; Iqbal, Z.; Akhtar, N.; Iiftikhar, Y.; Kamran, M.
2010-01-01
Thirty six genotypes were screened against yellow rust to check their level of susceptibility or resistance. Among 36 genotypes screened against yellow rust, 18 were susceptible, 6 were moderately susceptible to susceptible, 7 were moderately resistant to moderately susceptible and 5 genotypes remained resistant. Yield losses were predicted in wheat on the basis of varying level of yellow rust severities. It was observed that susceptible genotypes showed higher yield losses as compared to resistant genotypes. Maximum severity of 90% of yellow rust resulted in 54% to 55% calculated and predicted losses, respectively. While 40, 50, 60 and 70% disease severity of yellow rust caused 35-34%, 38-37%, 42-40% and 46-47% calculated and predicted losses, respectively. However, the decline in losses was observed as the genotypes changed their reaction from susceptible to moderate susceptible. Similarly, losses were diminished as the varieties/lines showed moderate resistant reaction from moderate susceptible. Minimum temperature and relative humidity remained positively correlated while the maximum temperature showed negative correlation with stripe rust severity. With the increase of minimum temperature and relative humidity a rise up in stripe rust infection was seen while as the maximum temperature increased stripe rust infection decreased on different genotypes. It may be concluded from the study that environmental factors played major role in the spread of the disease which result in yield losses. (author)
-
Aoun, Meriem; Breiland, Matthew; Kathryn Turner, M; Loladze, Alexander; Chao, Shiaoman; Xu, Steven S; Ammar, Karim; Anderson, James A; Kolmer, James A; Acevedo, Maricelis
2016-11-01
Leaf rust (caused by Erikss. []) is increasingly impacting durum wheat ( L. var. ) production with the recent appearance of races with virulence to widely grown cultivars in many durum producing areas worldwide. A highly virulent race on durum wheat was recently detected in Kansas. This race may spread to the northern Great Plains, where most of the US durum wheat is produced. The objective of this study was to identify sources of resistance to several races from the United States and Mexico at seedling stage in the greenhouse and at adult stage in field experiments. Genome-wide association study (GWAS) was used to identify single-nucleotide polymorphism (SNP) markers associated with leaf rust response in a worldwide durum wheat collection of 496 accessions. Thirteen accessions were resistant across all experiments. Association mapping revealed 88 significant SNPs associated with leaf rust response. Of these, 33 SNPs were located on chromosomes 2A and 2B, and 55 SNPs were distributed across all other chromosomes except for 1B and 7B. Twenty markers were associated with leaf rust response at seedling stage, while 68 markers were associated with leaf rust response at adult plant stage. The current study identified a total of 14 previously uncharacterized loci associated with leaf rust response in durum wheat. The discovery of these loci through association mapping (AM) is a significant step in identifying useful sources of resistance that can be used to broaden the relatively narrow leaf rust resistance spectrum in durum wheat germplasm. Copyright © 2016 Crop Science Society of America.
-
White blister rusts and downy mildews from bajaur agency fata, with some new records from pakistan
International Nuclear Information System (INIS)
Haq, M.A.; Shahzad, S.
2015-01-01
In a species diversity study of Oomycyctes of Bajaur Agency FATA, Pakistan, infection of white blister rusts and downy mildews recorded on three cultivated and four wild plants. Capsella bursa-pastoris showed mixed infection of Albugo candida and Hyaloperonospora parasitica (syn: Peronospora parasitica). Similarly, A. candida and H. brassicae (syn: P. brassicae) parasitized Brassica campestris. Wilsoniana portulacae (syn: Albugo portulacae) and W. occidentalis com. nov. (syn: Albugo occidentalis) recovered from Portulaca oleracea and Spinacia oleracea, respectively. Bremia taraxaci, B. sonchicola and B. saussureae recorded on Taraxicum officinale, Sonchus sp., and Saussurea sp., respectively. All these obligate parasites are new records from Bajaur Agency, while H. parasitica, W. occidentalis, B. taraxaci, and B. saussureae on the mentioned hosts are new records from Pakistan. (author)
-
Wheat Rust Toolbox Related to New Initiatives on Yellow Rust
DEFF Research Database (Denmark)
Hansen, Jens Grønbech; Lassen, Poul
://www.fao.org/agriculture/crops/rust/stem/rust-report/en/). The Wheat rust toolbox is one of several International research platforms hosted by Aarhus University, and it uses the same ICT framework and databases as EuroWheat (www.eurowheat.org) and EuroBlight (www.EuroBlight.net). The Wheat Rust Toolbox will also serve the Global Rust Reference Centre (GRRC) as well...... – 2009), and as soon as possible this will be expanded to cover all global yellow rust data available via the GRRC. The presentation will focus on experiences from the previous work on global databases and web based information systems, as well as propose ideas how the toolbox can be helpful regarding...
-
Lin, F; Chen, X M
2007-05-01
Stripe rust, caused by Puccinia striiformis f. sp. tritici, is one of the most widespread and destructive wheat diseases worldwide. Growing resistant cultivars is the preferred control of the disease. The spring wheat cultivar 'Alpowa' has both race-specific, all-stage resistance and non-race-specific, high-temperature adult-plant (HTAP) resistances to stripe rust. To identify genes for the stripe rust resistances, Alpowa was crossed with 'Avocet Susceptible' (AVS). Seedlings of the parents, and F(1), F(2) and F(3) progeny were tested with races PST-1 and PST-21 of P. striiformis f. sp. tritici under controlled greenhouse conditions. Alpowa has a single partially dominant gene, designated as YrAlp, conferring all-stage resistance. Resistance gene analog polymorphism (RGAP) and simple sequence repeat (SSR) techniques were used to identify molecular markers linked to YrAlp. A linkage group of five RGAP markers and two SSR markers was constructed for YrAlp using 136 F(3) lines. Amplification of a set of nulli-tetrasomic Chinese Spring lines with RGAP markers Xwgp47 and Xwgp48 and the two SSR markers indicated that YrAlp is located on the short arm of chromosome 1B. To map quantitative trait loci (QTLs) for the non-race-specific HTAP resistance, the parents and 136 F(3) lines were tested at two sites near Pullman and one site near Mount Vernon, Washington, under naturally infected conditions. A major HTAP QTL was consistently detected across environments and was located on chromosome 7BL. Because of its chromosomal location and the non-race-specific nature of the HTAP resistance, this gene is different from previously described genes for adult-plant resistance, and is therefore designated Yr39. The gene contributed to 64.2% of the total variation of relative area under disease progress curve (AUDPC) data and 59.1% of the total variation of infection type data recorded at the heading-flowering stages. Two RGAP markers, Xwgp36 and Xwgp45 with the highest R (2) values
-
Multi-location wheat stripe rust QTL analysis: genetic background and epistatic interactions.
Vazquez, M Dolores; Zemetra, Robert; Peterson, C James; Chen, Xianming M; Heesacker, Adam; Mundt, Christopher C
2015-07-01
Epistasis and genetic background were important influences on expression of stripe rust resistance in two wheat RIL populations, one with resistance conditioned by two major genes and the other conditioned by several minor QTL. Stripe rust is a foliar disease of wheat (Triticum aestivum L.) caused by the air-borne fungus Puccinia striiformis f. sp. tritici and is present in most regions around the world where commercial wheat is grown. Breeding for durable resistance to stripe rust continues to be a priority, but also is a challenge due to the complexity of interactions among resistance genes and to the wide diversity and continuous evolution of the pathogen races. The goal of this study was to detect chromosomal regions for resistance to stripe rust in two winter wheat populations, 'Tubbs'/'NSA-98-0995' (T/N) and 'Einstein'/'Tubbs' (E/T), evaluated across seven environments and mapped with diversity array technology and simple sequence repeat markers covering polymorphic regions of ≈1480 and 1117 cM, respectively. Analysis of variance for phenotypic data revealed significant (P located in chromosomes 2AS and 6AL, with epistatic interaction between them, were responsible for the main phenotypic response. For the T/N population, eight QTL were identified, with those in chromosomes 2AL and 2BL accounting for the largest percentage of the phenotypic variance.
-
Qi, L L; Seiler, G J; Vick, B A; Gulya, T J
2012-09-01
Sunflower oil is one of the major sources of edible oil. As the second largest hybrid crop in the world, hybrid sunflowers are developed by using the PET1 cytoplasmic male sterility system that contributes to a 20 % yield advantage over the open-pollinated varieties. However, sunflower production in North America has recently been threatened by the evolution of new virulent pathotypes of sunflower rust caused by the fungus Puccinia helianthi Schwein. Rf ANN-1742, an 'HA 89' backcross restorer line derived from wild annual sunflower (Helianthus annuus L.), was identified as resistant to the newly emerged rust races. The aim of this study was to elucidate the inheritance of rust resistance and male fertility restoration and identify the chromosome location of the underlying genes in Rf ANN-1742. Chi-squared analysis of the segregation of rust response and male fertility in F(2) and F(3) populations revealed that both traits are controlled by single dominant genes, and that the rust resistance gene is closely linked to the restorer gene in the coupling phase. The two genes were designated as R ( 11 ) and Rf5, respectively. A set of 723 mapped SSR markers of sunflower was used to screen the polymorphism between HA 89 and the resistant plant. Bulked segregant analysis subsequently located R ( 11 ) on linkage group (LG) 13 of sunflower. Based on the SSR analyses of 192 F(2) individuals, R ( 11 ) and Rf5 both mapped to the lower end of LG13 at a genetic distance of 1.6 cM, and shared a common marker, ORS728, which was mapped 1.3 cM proximal to Rf5 and 0.3 cM distal to R ( 11 ) (Rf5/ORS728/R ( 11 )). Two additional SSRs were linked to Rf5 and R ( 11 ): ORS995 was 4.5 cM distal to Rf5 and ORS45 was 1.0 cM proximal to R ( 11 ). The advantage of such an introduced alien segment harboring two genes is its large phenotypic effect and simple inheritance, thereby facilitating their rapid deployment in sunflower breeding programs. Suppressed recombination was observed in LGs 2, 9
-
Blister rust in North America: What we have not learned in the past 100 years
Eugene P. Van Arsdel; Brian W. Geils
2011-01-01
Introduction of Cronartium ribicola (white pine blister rust) greatly motivated development of tree disease control and research in America. Although foresters and pathologists have learned much in the past 100 years, more remains to learn. The most important lesson is that fear of blister rust has reduced pine regeneration more than the disease itself. Based on six...
-
Detection of wheat stem rust race RRTTF in Ecuador in 2016
Wheat stem rust is a devastating disease that has incited numerous severe epidemics resulting in extreme yield losses over the past century. Stem rust infection in plots of wheat line UC11075, known to carry the Sr38 resistance gene, was severe in February 2016 in a nursery at the Instituto Nacional...
-
Stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst), is one of the most damaging diseases of wheat worldwide. It is essential to identify new genes for effective resistance against the disease. Durum wheat PI 480148, originally from Ethiopia, was resistant in all seedling tests with s...
-
Bryant, Ruth R M; McGrann, Graham R D; Mitchell, Alice R; Schoonbeek, Henk-Jan; Boyd, Lesley A; Uauy, Cristobal; Dorling, Steve; Ridout, Christopher J
2014-01-08
Rust diseases are of major importance in wheat production worldwide. With the constant evolution of new rust strains and their adaptation to higher temperatures, consistent and durable disease resistance is a key challenge. Environmental conditions affect resistance gene performance, but the basis for this is poorly understood. Here we show that a change in day temperature affects wheat resistance to Puccinia striiformis f. sp tritici (Pst), the causal agent of yellow (or stripe) rust. Using adult plants of near-isogenic lines UC1041 +/- Yr36, there was no significant difference between Pst percentage uredia coverage in plants grown at day temperatures of 18°C or 25°C in adult UC1041 + Yr36 plants. However, when plants were transferred to the lower day temperature at the time of Pst inoculation, infection increased up to two fold. Interestingly, this response was independent of Yr36, which has previously been reported as a temperature-responsive resistance gene as Pst development in adult UC1041 -Yr36 plants was similarly affected by the plants experiencing a temperature reduction. In addition, UC1041 -Yr36 plants grown at the lower temperature then transferred to the higher temperature were effectively resistant and a temperature change in either direction was shown to affect Pst development up to 8 days prior to inoculation. Results for seedlings were similar, but more variable compared to adult plants. Enhanced resistance to Pst was observed in seedlings of UC1041 and the cultivar Shamrock when transferred to the higher temperature. Resistance was not affected in seedlings of cultivar Solstice by a temperature change in either direction. Yr36 is effective at 18°C, refining the lower range of temperature at which resistance against Pst is conferred compared to previous studies. Results reveal previously uncharacterised defence temperature sensitivity in the UC1041 background which is caused by a change in temperature and independently of Yr36. This novel
-
Singh, Ravi P; Hodson, David P; Jin, Yue; Lagudah, Evans S; Ayliffe, Michael A; Bhavani, Sridhar; Rouse, Matthew N; Pretorius, Zacharias A; Szabo, Les J; Huerta-Espino, Julio; Basnet, Bhoja R; Lan, Caixia; Hovmøller, Mogens S
2015-07-01
Race Ug99 (TTKSK) of Puccinia graminis f. sp. tritici, detected in Uganda in 1998, has been recognized as a serious threat to food security because it possesses combined virulence to a large number of resistance genes found in current widely grown wheat (Triticum aestivum) varieties and germplasm, leading to its potential for rapid spread and evolution. Since its initial detection, variants of the Ug99 lineage of stem rust have been discovered in Eastern and Southern African countries, Yemen, Iran, and Egypt. To date, eight races belonging to the Ug99 lineage are known. Increased pathogen monitoring activities have led to the identification of other races in Africa and Asia with additional virulence to commercially important resistance genes. This has led to localized but severe stem rust epidemics becoming common once again in East Africa due to the breakdown of race-specific resistance gene SrTmp, which was deployed recently in the 'Digalu' and 'Robin' varieties in Ethiopia and Kenya, respectively. Enhanced research in the last decade under the umbrella of the Borlaug Global Rust Initiative has identified various race-specific resistance genes that can be utilized, preferably in combinations, to develop resistant varieties. Research and development of improved wheat germplasm with complex adult plant resistance (APR) based on multiple slow-rusting genes has also progressed. Once only the Sr2 gene was known to confer slow rusting APR; now, four more genes-Sr55, Sr56, Sr57, and Sr58-have been characterized and additional quantitative trait loci identified. Cloning of some rust resistance genes opens new perspectives on rust control in the future through the development of multiple resistance gene cassettes. However, at present, disease-surveillance-based chemical control, large-scale deployment of new varieties with multiple race-specific genes or adequate levels of APR, and reducing the cultivation of susceptible varieties in rust hot-spot areas remains the best
-
Reaction of Rust on Some Bread Wheat Varieties in Çukurova Region
AY, Hasan
2013-01-01
This study was conducted with 126 varieties of wheat between 2009-2010 years in Adana. There has not been artificially inoculated yellow, leaf and stem rusts. Races of rust in natural were evaluated in both years. Between 2009-2010 this study was conducted in Adana, with 126 varieties of bread wheat. In both years, only the natural environment leaf rust races inoculated for assessments reactions of bread wheat. According to results, 49 bread wheat varieties were found resistant, 6 bread wheat...
-
2011-03-15
... Requirements for Addition of Rust-Resistant Varieties AGENCY: Animal and Plant Health Inspection Service, USDA... Rust-Resistant Varieties. OMB Number: 0579-0186. Type of Request: Extension of approval of an... products to prevent the introduction of plant pests into the United States or their dissemination within...
-
Induced multiple disease resistance in wheat
International Nuclear Information System (INIS)
Borojevic, K.; Worland, A.J.
1990-01-01
Full text: The existence of genes suppressing resistance to leaf rust, stem rust and yellow rust in hexaploid wheat has been suggested. If such genes are deleted or inactivated, a more resistant variety may be obtained. In mutant lines of the wheat variety San Pastore, selected after treatment with 20,000 rad of gamma-rays, resistance to leaf rust, yellow rust, stem rust, and to some extent to Erysiphe graminis was determined. The mutants responded to infection by producing necrotic flecks in the presence of high level of disease inoculum. Similar flecks develop under stress condition. It is likely that the mother variety San Pastore carries genes for resistance which are masked by suppressor genes. Irradiation inactivates suppressors so that resistance genes which were previously masked are expressed. The first results of monosomic analysis indicate that chromosomes of groups 4 and 5 or possibly 7 may be critical for expression of resistance in the mutant lines. (author)
-
Protecting steel from rusting by rust. The mechanism of rust formation and its control
International Nuclear Information System (INIS)
Kimura, Masao
2008-01-01
Weathering steel, when exposed outdoors for a few years, forms a protective layer resulting in reduction of the corrosion rate. The state of rusts is fundamental for understanding its mechanisms, but the structure and its relationship with the mechanism have not been understood. In this study, a new crystallographic approach was applied to reveal nano-structure of rusts with using of X-ray synchrotron radiation. It has been shown that additional elements alter the corrosion process in its early stage, resulting in formation of protective rusts. (author)
-
International Nuclear Information System (INIS)
Riaz, F.; Rizvi, Z.H.; Arshad, K.
2008-01-01
The present work evaluates the anti corrosive properties of a tannin based rust converter applied on the pre rusted steel coupons as compared with the grit blasted bare metal and pre rusted steel coupons. The mechanism and the corrosion control behaviour of the rust converter are characterized and monitored using EIS technique. The result suggested that when the tannin based rust converter applied on the pre rusted/corroded coupon, the protection properties of the mild steel coupon clearly improved because of the more compact conversion layer being formed on the coupon. It is inferred that the rust converter can be applied on the pre rusted samples as an alternative technique to the surface preparation for protection purpose. (author)
-
Qi, L L; Pumphrey, M O; Friebe, Bernd; Zhang, P; Qian, C; Bowden, R L; Rouse, M N; Jin, Y; Gill, B S
2011-06-01
Stem rust (Puccinia graminis f. sp. tritici Eriks. & E. Henn.) (the causal agent of wheat stem rust) race Ug99 (also designated TTKSK) and its derivatives have defeated several important stem rust resistance genes widely used in wheat (Triticum aestivum L.) production, rendering much of the worldwide wheat acreage susceptible. In order to identify new resistance sources, a large collection of wheat relatives and genetic stocks maintained at the Wheat Genetic and Genomic Resources Center was screened. The results revealed that most accessions of the diploid relative Dasypyrum villosum (L.) Candargy were highly resistant. The screening of a set of wheat-D. villosum chromosome addition lines revealed that the wheat-D. villosum disomic addition line DA6V#3 was moderately resistant to race Ug99. The objective of the present study was to produce and characterize compensating wheat-D. villosum whole arm Robertsonian translocations (RobTs) involving chromosomes 6D of wheat and 6V#3 of D. villosum through the mechanism of centric breakage-fusion. Seven 6V#3-specific EST-STS markers were developed for screening F(2) progeny derived from plants double-monosomic for chromosomes 6D and 6V#3. Surprisingly, although 6D was the target chromosome, all recovered RobTs involved chromosome 6A implying a novel mechanism for the origin of RobTs. Homozygous translocations (T6AS·6V#3L and T6AL·6V#3S) with good plant vigor and full fertility were selected from F(3) families. A stem rust resistance gene was mapped to the long arm 6V#3L in T6AS·6V#3L and was designated as Sr52. Sr52 is temperature-sensitive and is most effective at 16°C, partially effective at 24°C, and ineffective at 28°C. The T6AS·6V#3L stock is a new source of resistance to Ug99, is cytogenetically stable, and may be useful in wheat improvement.
-
Characterization of the rust formed on weathering steel exposed to Qinghai salt lake atmosphere
International Nuclear Information System (INIS)
Li, Q.X.; Wang, Z.Y.; Han, W.; Han, E.H.
2008-01-01
The product formed on weathering steel exposed to salt lake atmosphere for 12 months was investigated by X-ray diffraction (XRD), infrared transmission spectroscopy (IRS), scanning electron microscopy (SEM), electron probe micro analyzer (EPMA) and electrochemical techniques. The rust was mainly composed of β-FeOOH, Fe 8 (O,OH) 16 Cl 1.3 and a little γ-FeOOH. Amorphous δ-FeOOH was only on skyward surface. The rust layer suppressed anodic reaction and facilitated the cathodic reaction. The very small value of rust resistance R r in this work indicated that the rust had poor protective ability. Cl element was rich in the whole rust layer and played an important role in accelerating the corrosion of weathering steel in salt lake atmosphere
-
Stability of rust resistance and yield potential of some icarda bread wheat lines in Pakistan
International Nuclear Information System (INIS)
Shah, S.J.A.; Khan, A.J.; Azam, F.; Mirza, J.I.; Atiq-ur-Rehman
2003-01-01
Thirty bread wheat lines resistant to Yellow rust (Yr) were selected after careful screening from two ICARDA nurseries during 1998 - 1999, Rabi season at Nuclear Institute for Food and Agriculture (NIFA), Tarnab, Peshawar under severe disease pressure. In the following crop cycle, these selections were again field evaluated for stability and effectiveness of Yr resistance at multilocations while their yield potential was ascertained at Tarnab in two different trials with Tatara as commercial check. Results revealed that uniformity was found in the potential behavior of 23 lines (77%) in both the cropping seasons against Yr. This included some high yielding (up to 7067 kg/ ha) and low yielding lines (up to 4333 kg / ha) when compared with the check (6089 kg / ha). Yield potential of some high yielding lines with stable Yr resistance should be further evaluated over sites and seasons for wide adaptability, under national uniform testing in order to select and deploy future varieties to combat Yr for acquiring food security in Pakistan.(author)
-
Directory of Open Access Journals (Sweden)
Deepmala Sehgal
2016-11-01
Full Text Available Wheat landraces in Turkey are an important genetic resource for wheat improvement. An exhaustive five-year (2009-2014 effort made by the International Winter Wheat Improvement Programme (IWWIP a cooperative program between the Ministry of Food, Agriculture and Livestock of Turkey, the International Center for Maize and Wheat Improvement (CIMMYT and the International Center for Agricultural Research in the Dry Areas (ICARDA, led to the collection and documentation of around 2,000 landrace populations from 55 provinces throughout Turkey. This study reports the genetic characterization of a subset of bread wheat landraces collected in 2010 from 11 diverse provinces using genotyping-by-sequencing (GBS technology. The potential of this collection to identify loci determining grain yield and stripe rust resistance via genome-wide association (GWA analysis was explored. A high genetic diversity (diversity index = 0.260 and a moderate population structure based on highly inherited spike traits was revealed in the panel. The linkage disequilibrium decayed at 10 cM across the whole genome and was slower as compared to other landrace collections. In addition to previously reported QTL, GWA analysis also identified new candidate genomic regions for stripe rust resistance, grain yield and spike productivity components. New candidate genomic regions reflect the potential of this landrace collection to further increase genetic diversity in elite germplasm.
-
Chen, Shisheng; Guo, Yan; Briggs, Jordan; Dubach, Felix; Chao, Shiaoman; Zhang, Wenjun; Rouse, Matthew N; Dubcovsky, Jorge
2018-03-01
The new stem rust resistance gene Sr60 was fine-mapped to the distal region of chromosome arm 5A m S, and the TTKSK-effective gene SrTm5 could be a new allele of Sr22. The emergence and spread of new virulent races of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici; Pgt), including the Ug99 race group, is a serious threat to global wheat production. In this study, we mapped and characterized two stem rust resistance genes from diploid wheat Triticum monococcum accession PI 306540. We mapped SrTm5, a previously postulated gene effective to Ug99, on chromosome arm 7A m L, completely linked to Sr22. SrTm5 displayed a different race specificity compared to Sr22 indicating that they are distinct. Sequencing of the Sr22 homolog in PI 306540 revealed a novel haplotype. Characterization of the segregating populations with Pgt race QFCSC revealed an additional resistance gene on chromosome arm 5A m S that was assigned the official name Sr60. This gene was also effective against races QTHJC and SCCSC but not against TTKSK (a Ug99 group race). Using two large mapping populations (4046 gametes), we mapped Sr60 within a 0.44 cM interval flanked by sequenced-based markers GH724575 and CJ942731. These two markers delimit a 54.6-kb region in Brachypodium distachyon chromosome 4 and a 430-kb region in the Chinese Spring reference genome. Both regions include a leucine-rich repeat protein kinase (LRRK123.1) that represents a potential candidate gene. Three CC-NBS-LRR genes were found in the colinear Brachypodium region but not in the wheat genome. We are currently developing a Bacterial Artificial Chromosome library of PI 306540 to determine which of these candidate genes are present in the T. monococcum genome and to complete the cloning of Sr60.
-
Stem rust (caused by Puccinia graminis f. sp. tritici Erikss. & E. Henn.), is a major disease in wheat (Triticum aestivium L.). However, in recent years it occurs rarely in Nebraska due to weather and the effective selection and gene pyramiding of resistance genes. To understand the genetic basis of...
-
Protein modeling of yellow rust disease in wheat
International Nuclear Information System (INIS)
Aziz, S.E.; Bano, R.; Zayed, M.E.; Elshikh, M.S.; Khan, M.H.; Chaudhry, Z.
2017-01-01
Wheat production in Pakistan is affected by yellow rust disease caused by a fungus Puccinia striiformis. There is a need to broaden the genetic basis of wheat by identifying new resistance genes. The present study was aimed to identify an alternate resistance gene for yellow rust disease in wheat caused by Puccinia striiformis. Genome sequence was compared with databases and similar gene was identified for disease resistance in rye plant. Structural analysis of RGA1 gene (resistance gene in wheat) was carried out using different bioinformatics tools and an alternative gene having same structure was identified on the basis of structural and sequence homology. Rye plant is the proposed plant for the alternate new resistance gene. The result of pairwise alignment of RGA1 gene in wheat and gene of rye plant is 94.2% with accession DQ494535 .The secondary structures of both the genes was compared and found similar to each other. These comparisons between the wheat resistance gene and gene from rye plant depict structural similarities between the two genes. Results of RGA1 gene's structural analysis in wheat is as follow: Helices: 59, Extended sheets: 30, Turns: 12, Coils: 13 and for alternate resistance genes in Rye is as follow: Helices: 52, Extended sheets: 30, Turns: 14, Coils: 17. As structures are similar, the alternate identified gene could be used for resistance in wheat. (author)
-
Breeding wheat for disease resistance in Kenya
International Nuclear Information System (INIS)
Njau, P.N.; Kinyua, M.G.; Karanja, L.; Maling'a, J.
2001-01-01
Yellow rust caused by Puccinia striformis and stem rust caused by Puccinia graminis tritici are most destructive diseases in Kenya. In wheat improvement, development of varieties of wheat with resistance to these diseases has been among the foremost contributions in wheat breeding. In breeding programs each disease is considered as a separate problem. Attention has been given to varieties resistant to stem rust, yellow rust and leaf rust among other diseases. In the year 2001 program stem rust and yellow rust were recorded in all the sites where NPT was performed. Breeding for resistance for the two diseases is approached through the Introductions and Hybridisation. The Doubled Haploid Technique is used to quicken the time of homozygous lines production. The introduction and the homozygous lines are then evaluated for yield and disease resistance in the field under preliminary yield trials and the National Performance Trials (NPT) in 2001, 18 lines and 2 check varieties were included in the NPT. The results show that there were some differences in reaction to the three diseases where lines R946, K7972-1 and R899 had the lowest score of the diseases in all sites. In the commercial variety trial the results show that all the varietieshave become susceptible to stem rust and so the need to develop new cultivars which will be resistance to the rusts. Yombi a newly developed variety showed a substantially high level resistance. (author)
-
An overview of sugarcane brown rust in Cuba
Directory of Open Access Journals (Sweden)
María La O
Full Text Available ABSTRACT: Multiple pathogens affect sugarcane, among them Puccinia melanocephala, the causal agent of brown rust. This disease was first reported in Cuba in 1979 when it was responsible for a severe attack on the main sugarcane variety B4362. The aims of the present study were to give an overview of sugarcane brown rust in Cuba and show the current disease situation in the country. A retrospective analysis regard to sugarcane cultivar composition resistant to brown rust in Cuba was carried out. In addition 154 genotypes, including the most used progenitors in the breeding program and commercial varieties were evaluated under natural infection conditions. The identity of P. melanocephala was verified by Polymerase Chain Reaction (PCR and by sequencing the ITS1 region. After the introduction of P. melanocephala into Cuba, the susceptible variety, B4362, was replaced by Ja60-5 which remained resistant until 1998. Since 2002, a varietal policy supported by a governmental resolution establishing that any single cultivar cannot occupy more than 20 % of the production area for each production company, local area and province, has been applied. Out of the genotypes evaluated, 49 showed resistance to the disease and 35 intermediate behavior, while 39 were susceptible and 31, highly susceptible. P. melanocephala was detected by PCR in all symptomatic samples and its identify confirmed by sequencing the ITS1 region. The adopted measurement together with permanent phytosanitary monitoring and commercial release of resistant or intermediate cultivars succeeded in avoiding any new epidemic. Inoculum pressure was reduced, even on susceptible and highly susceptible varieties since, by resolution, they cannot occupy more than 10 % of the planted area.
-
Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...
Indian Academy of Sciences (India)
Mona Singh
2017-12-08
Dec 8, 2017 ... Abstract. This study was undertaken to pyramid two effective leaf rust resistance genes (Lr19 and Lr24) derived from ... genes such as Lr9, Lr19, Lr26 and Lr28 became ineffective ..... Disease management recommendations.
-
Stem rust seedling resistance genes in Ethiopian wheat cultivars ...
African Journals Online (AJOL)
Thirty durum wheat (19 commercial cultivars and 11 breeding lines) and 30 bread wheat (20 commercial cultivars and 10 breeding lines) were tested for gene postulation. Stem rust infection types produced on wheat cultivars and breeding lines by ten Pgt races was compared with infection types produced on 40 near ...
-
Creation of variation in Basella for rust resistance through mutagenesis
Energy Technology Data Exchange (ETDEWEB)
Makambila, C [Phytopathology Lab., Faculty of Sciences, Brazzaville (Congo)
1997-07-01
African spinach, basella is grown as a leafy vegetable in Central Africa. Basella cultivars belong to the species Basella alba and B. rubra which are seed propagated and are likely Asiatic in origin. Basella alba seeds were irradiated with doses of 50, 100, 200, 300 and 500 Gy to create variation for rust resistance which is caused by the fungus, Uromyces basellae Sidow. The effects of irradiation were investigated on seed germination, plant mortality and height. Seed germination varied from 97% for those irradiated with 50 Gy to 39% with 500 Gy, and LD{sub 50} for seed germination was between 300 to 400 Gy. Doses between 50 and 150 Gy did not cause any mortality of plants obtained from irradiated seeds; however, doses between 200 to 500 Gy caused high mortality among such plants. Irradiation with 150 Gy inhibited plant growth by 48% in relation to the growth of control plants. Based on the results, radiation doses above 150 and up to 400 Gy were used for the production of desired variation. (author). 11 refs, 9 figs.
-
Creation of variation in Basella for rust resistance through mutagenesis
International Nuclear Information System (INIS)
Makambila, C.
1997-01-01
African spinach, basella is grown as a leafy vegetable in Central Africa. Basella cultivars belong to the species Basella alba and B. rubra which are seed propagated and are likely Asiatic in origin. Basella alba seeds were irradiated with doses of 50, 100, 200, 300 and 500 Gy to create variation for rust resistance which is caused by the fungus, Uromyces basellae Sidow. The effects of irradiation were investigated on seed germination, plant mortality and height. Seed germination varied from 97% for those irradiated with 50 Gy to 39% with 500 Gy, and LD 50 for seed germination was between 300 to 400 Gy. Doses between 50 and 150 Gy did not cause any mortality of plants obtained from irradiated seeds; however, doses between 200 to 500 Gy caused high mortality among such plants. Irradiation with 150 Gy inhibited plant growth by 48% in relation to the growth of control plants. Based on the results, radiation doses above 150 and up to 400 Gy were used for the production of desired variation. (author). 11 refs, 9 figs
-
D. R. Vogler; B. W. Geils; K. Coats
2017-01-01
Cronartium ribicola Fisch. has not been found infecting any of the five-needle white pines (Pinus subgenus Strobus) in Utah, despite being established on both white pine and Ribes hosts in the other 10 western states, defined as those west of the 102° meridian.
-
Sources of stem rust resistance in Ethiopian tetraploid wheat ...
African Journals Online (AJOL)
Stem or black rust of wheat caused by the fungus Puccinia graminis f. sp. tritici Ericks and Henn (Pgt) is an important disease on wheat worldwide. Pgt is an obligate biotroph, heteroceous in its life cycle and heterothallic in mating type. Seedlings of 41 emmer (Triticum dicoccum), 56 durum (T. durum) wheat accessions were ...
-
Study of Rust Effect on the Corrosion Behavior of Reinforcement Steel Using Impedance Spectroscopy
Bensabra, Hakim; Azzouz, Noureddine
2013-12-01
Most studies on corrosion of steel reinforcement in concrete are conducted on steel samples with polished surface (free of all oxides) in order to reproduce the same experimental conditions. However, before embedding in concrete, the steel bars are often covered with natural oxides (rust), which are formed during exposure to the atmosphere. The presence of this rust may affect the electrochemical behavior of steel rebar in concrete. In order to understand the effect of rust on the corrosion behavior of reinforcement steel, potentiodynamic and electrochemical impedance spectroscopy (EIS) tests were carried out in a simulated concrete pore solution using steel samples with two different surface conditions: polished and rusted samples. The obtained results have shown that the presence of rust on the steel bar has a negative effect on its corrosion behavior, with or without the presence of chlorides. This detrimental effect can be explained by the fact that the rust provokes a decrease of the electrolyte resistance at the metal-concrete interface and reduces the repassivating ability. In addition, the rust layer acts as a barrier against the hydroxyl ion diffusion, which prevents the realkalinization phenomenon.
-
International Nuclear Information System (INIS)
1988-01-01
In alfalfa after gamma irradiation with 50,100, and 150 krads, 38 rust resistant plants have been selected throughout a screening programme. During four months, cuttings were obtained from these plants individually. Results revealed that 20 plants were remar-kably surpassed the origin in the total fresh weight and in the average weight of each cutting. In broad bean, following gamma irradiation and EMS in two cuitivars for induction of wilt resistance. Seeds of these plants were sown in artificially infested soil . During the growing season, all susceptible plants were removed and at epidemic form of wilt disease
-
Mutation breeding for disease resistance in wheat and field beans in Egypt
International Nuclear Information System (INIS)
Abdel-Hak, T.M.
1983-01-01
Seeds of three varieties of hexaploid wheat and of one variety of tetraploid wheat were treated with gamma rays in order to obtain mutants with improved resistance to stem rust, leaf rust and stripe rust. Mutants with resistance to prevailing races of rusts were selected; however, the race spectrum shifted and made the mutants useless for the time being. Induction of mutations for resistance to chocolate spot and rusts was attempted in Vicia faba. No resistant mutant was found but some mutants with lower levels of infection were. (author)
-
Litrenta, Jody; Tornetta, Paul; Mehta, Samir; Jones, Clifford; OʼToole, Robert V; Bhandari, Mohit; Kottmeier, Stephen; Ostrum, Robert; Egol, Kenneth; Ricci, William; Schemitsch, Emil; Horwitz, Daniel
2015-11-01
To determine the reliability of the Radiographic Union Scale for Tibia (RUST) score and a new modified RUST score in quantifying healing and to define a value for radiographic union in a large series of metadiaphyseal fractures treated with plates or intramedullary nails. Healing was evaluated using 2 methods: (1) evaluation of interrater agreement in a series of radiographs and (2) analysis of prospectively gathered data from 2 previous large multicenter trials to define thresholds for radiographic union. Part 1: 12 orthopedic trauma surgeons evaluated a series of radiographs of 27 distal femur fractures treated with either plate or retrograde nail fixation at various stages of healing in random order using a modified RUST score. For each radiographic set, the reviewer indicated if the fracture was radiographically healed. Part 2: The radiographic results of 2 multicenter randomized trials comparing plate versus nail fixation of 81 distal femur and 46 proximal tibia fractures were reviewed. Orthopaedic surgeons at 24 trauma centers scored radiographs at 3, 6, and 12 months postoperatively using the modified RUST score above. Additionally, investigators indicated if the fracture was healed or not healed. The intraclass correlation coefficient (ICC) with 95% confidence intervals was determined for each cortex, the standard and modified RUST score, and the assignment of union for part 1 data. The RUST and modified RUST that defined "union" were determined for both parts of the study. ICC: The modified RUST score demonstrated slightly higher ICCs than the standard RUST (0.68 vs. 0.63). Nails had substantial agreement, whereas plates had moderate agreement using both modified and standard RUST (0.74 and 0.67 vs. 0.59 and 0.53). The average standard and modified RUST at union among all fractures was 8.5 and 11.4. Nails had higher standard and modified RUST scores than plates at union. The ICC for union was 0.53 (nails: 0.58; plates: 0.51), which indicates moderate
-
Directory of Open Access Journals (Sweden)
Wanli Du
Full Text Available The aim of this study was to characterize a Triticum aestivum-Psathyrostachys huashanica Keng (2n = 2x = 14, NsNs disomic addition line 2-1-6-3. Individual line 2-1-6-3 plants were analyzed using cytological, genomic in situ hybridization (GISH, EST-SSR, and EST-STS techniques. The alien addition line 2-1-6-3 was shown to have two P. huashanica chromosomes, with a meiotic configuration of 2n = 44 = 22 II. We tested 55 EST-SSR and 336 EST-STS primer pairs that mapped onto seven different wheat chromosomes using DNA from parents and the P. huashanica addition line. One EST-SSR and nine EST-STS primer pairs indicated that the additional chromosome of P. huashanica belonged to homoeologous group 7, the diagnostic fragments of five EST-STS markers (BE404955, BE591127, BE637663, BF482781 and CD452422 were cloned, sequenced and compared. The results showed that the amplified polymorphic bands of P. huashanica and disomic addition line 2-1-6-3 shared 100% sequence identity, which was designated as the 7Ns disomic addition line. Disomic addition line 2-1-6-3 was evaluated to test the leaf rust resistance of adult stages in the field. We found that one pair of the 7Ns genome chromosomes carried new leaf rust resistance gene(s. Moreover, wheat line 2-1-6-3 had a superior numbers of florets and grains per spike, which were associated with the introgression of the paired P. huashanica chromosomes. These high levels of disease resistance and stable, excellent agronomic traits suggest that this line could be utilized as a novel donor in wheat breeding programs.
-
Loope, Lloyd
2010-01-01
The neotropical rust fungus Puccinia psidii(P. psidii) was originally described from the host common guava in its native Brazil but has been found since on hosts throughout the myrtle family (Myrtaceae), including a dramatic host jump to nonnative Eucalyptus plantations. Most rust fungi are able to live only on a very narrow range of host species. P. psidii is unusual both for having a broad host range and for the intensity of its damage to susceptible young growth. This rust first got a foothold in the United States in Florida more than three decades ago. The U.S. Department of Agriculture (USDA) has since considered it a nonactionable, nonreportable pest. Hawaii and Florida are the only two states with native species in the myrtle family. Over a period of 30 years, this rust has done little damage to any of the scattered native Myrtaceae in Florida, although the host range of the rust has gradually grown to about 30 mostly nonnative species in the family, apparently because of increasing genetic variety of the rust by repeated introductions. However, Florida’s native Myrtaceae are among the roughly 1,100 neotropical species that are largely resistant to P. psidii. The 3,000 species of non-neotropical Myrtaceae of the Pacific, Australia, Asia, and Africa are expected to prove much more vulnerable to P. psidii. Little is known about the genetics or genetic strains of P. psidii, although existing literature shows that there are numerous strains that have differential ability to infect suites of host plants.
-
Marker-assisted pyramiding of Thinopyrum-derived leaf rust ...
Indian Academy of Sciences (India)
Annual Meetings · Mid Year Meetings · Discussion Meetings · Public Lectures · Lecture Workshops · Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 96; Issue 6. Marker-assisted pyramiding of Thinopyrum-derived leaf rust resistance genes Lr19 and Lr24 in bread wheat variety ...
-
Studies of the genetics of inheritance of stem rust resistance in ...
African Journals Online (AJOL)
User
2013-05-22
May 22, 2013 ... increased production of wheat could help to ensure food and nutritional ... also characterized by genes with additive effects and non hypersensitive .... to create an artificial stem rust epidemic in the field (Hickey et al.,. 2012 ...
-
The diet of whiting Merlangius merlangus in the western Baltic Sea
DEFF Research Database (Denmark)
Ross, Stine Dalmann; Gislason, Henrik; Andersen, Niels Gerner
2016-01-01
The diet of whiting Merlangius merlangus in the western Baltic Sea was investigated and compared to the diet in the southern North Sea. Clupeids were important prey in both areas, but especially in the western Baltic Sea where they constituted up to 90% of the diet of larger individuals. Gobies......, brown shrimps and polychaetes were the main prey of juveniles in the western Baltic Sea, while a wider range of species were consumed in the North Sea. The shift to piscivory occurred at smaller sizes in the western Baltic Sea and the fish prey consumed was proportionately larger than in the southern...
-
SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD
Directory of Open Access Journals (Sweden)
Mehmet AYBEKE
2015-12-01
Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.
-
Quantitative variables associated to the resistance to sugarcane brown rust disease
Directory of Open Access Journals (Sweden)
Joaquin Montalvan Delgado
2017-01-01
Full Text Available With the purpose to analyze the behavior of a group of sugarcane cultivars in the presence of brown rust (Puccinia melanocephala Sydow and P. Sydow in the area of the Territorial Sugarcane Research Station Oriental Center Camagüey, it was carried out an experiment with 11 sugarcane cultivars (C1051-73, C132-81, C266-70, C323-68, C86-12, C86-503, C86- 56, C88-380, C90-530, Co997, SP70-1284 and six patterns of well-known reaction PR980 (I grade, Ja64-11 (II grade, C334-64 (III grade, My5514 y Ja60-5 (IV grade y B4362 (V grade. The evaluations were made at the plant and ratoon shoot at the ages of three, four, five, six and nine months in the leaves +1, +3 y +5. The evaluated parameters were: length and the number of pustules, size of the biggest pustule, and the occupied area by pustules. It was made an analysis of variance and Tukey’s test to find the differences between the cultivars. The statistical packet SPSS such as the main additive and multiplicative interactions (AMMI Models were used. There are differences in every analyzed factors (cultivar, leaf and evaluation moment and in the analyzed variables (TPM and occupied area by pustule. The resistance patterns kept the expected behavior and the biggest cultivars percentage behaved like resistant.
-
Directory of Open Access Journals (Sweden)
Eleonora Barilli
2018-02-01
Full Text Available Pisum fulvum, a wild relative of pea is an important source of allelic diversity to improve the genetic resistance of cultivated species against fungal diseases of economic importance like the pea rust caused by Uromyces pisi. To unravel the genetic control underlying resistance to this fungal disease, a recombinant inbred line (RIL population was generated from a cross between two P. fulvum accessions, IFPI3260 and IFPI3251, and genotyped using Diversity Arrays Technology. A total of 9,569 high-quality DArT-Seq and 8,514 SNPs markers were generated. Finally, a total of 12,058 markers were assembled into seven linkage groups, equivalent to the number of haploid chromosomes of P. fulvum and P. sativum. The newly constructed integrated genetic linkage map of P. fulvum covered an accumulated distance of 1,877.45 cM, an average density of 1.19 markers cM−1 and an average distance between adjacent markers of 1.85 cM. The composite interval mapping revealed three QTLs distributed over two linkage groups that were associated with the percentage of rust disease severity (DS%. QTLs UpDSII and UpDSIV were located in the LGs II and IV respectively and were consistently identified both in adult plants over 3 years at the field (Córdoba, Spain and in seedling plants under controlled conditions. Whenever they were detected, their contribution to the total phenotypic variance varied between 19.8 and 29.2. A third QTL (UpDSIV.2 was also located in the LGIVand was environmentally specific as was only detected for DS % in seedlings under controlled conditions. It accounted more than 14% of the phenotypic variation studied. Taking together the data obtained in the study, it could be concluded that the expression of resistance to fungal diseases in P. fulvum originates from the resistant parent IFPI3260.
-
International Nuclear Information System (INIS)
Konishi, Hiroyuki; Mizuki, Jun'ichiro; Yamashita, Masato; Uchida, Hitoshi
2005-01-01
Chloride in atmosphere considerably reduces the corrosion resistance of conventional weathering steel containing a small amount of Cr. Ni is an effective anticorrosive element for improving the corrosion resistance of steel in a Cl-rich environment. In order to clarify the structure of the protective rust layer of weathering steel, Cl and Fe K-edge X-ray absorption near edge structure (XANES) spectra of atmospheric corrosion products (rust) formed on Fe, Fe-Ni and Fe-Cr alloys exposed to Cl-rich atmosphere were measured. The Fe K-XANES measurements enable the characterization of mixture of iron oxides such as rust. The chemical composition of the rust was determined by performing pattern fitting of the measured spectra. All the rust is composed mainly of goethite, akaganeite, lepidocrocite and magnetite. Among these iron oxides, akaganeite in particular is the major component in the rust. Additionally, the amount of akaganeite in the rust of Fe-Ni alloy is much greater than that in rust of Fe-Cr alloy. Akaganeite is generally considered to facilitate the corrosion of steel, but our results indicate that akaganeite in the rust of Fe-Ni alloy is quantitatively different from that in rust of Fe-Cr alloy and does not facilitate the corrosion of steel. The shoulder peak observed in Cl K-XANES spectra reveals that the rust contains a chloride other than akaganeite. The energy of the shoulder peak does not correspond to that of any well-known chlorides. In the measured spectra, there is no proof that Cl, by combining with the alloying element, inhibits the alloying element from acting in corrosion resistance. The shoulder peak appears only when the content of the alloying element is lower than a certain value. This suggests that the generation of the unidentified chloride is related to the corrosion rate of steel. (author)
-
Flavan-3-ols Are an Effective Chemical Defense against Rust Infection.
Ullah, Chhana; Unsicker, Sybille B; Fellenberg, Christin; Constabel, C Peter; Schmidt, Axel; Gershenzon, Jonathan; Hammerbacher, Almuth
2017-12-01
Phenolic secondary metabolites are often thought to protect plants against attack by microbes, but their role in defense against pathogen infection in woody plants has not been investigated comprehensively. We studied the biosynthesis, occurrence, and antifungal activity of flavan-3-ols in black poplar ( Populus nigra ), which include both monomers, such as catechin, and oligomers, known as proanthocyanidins (PAs). We identified and biochemically characterized three leucoanthocyanidin reductases and two anthocyanidin reductases from P. nigra involved in catalyzing the last steps of flavan-3-ol biosynthesis, leading to the formation of catechin [2,3-trans-(+)-flavan-3-ol] and epicatechin [2,3-cis-(-)-flavan-3-ol], respectively. Poplar trees that were inoculated with the biotrophic rust fungus ( Melampsora larici-populina ) accumulated higher amounts of catechin and PAs than uninfected trees. The de novo-synthesized catechin and PAs in the rust-infected poplar leaves accumulated significantly at the site of fungal infection in the lower epidermis. In planta concentrations of these compounds strongly inhibited rust spore germination and reduced hyphal growth. Poplar genotypes with constitutively higher levels of catechin and PAs as well as hybrid aspen ( Populus tremula × Populus alba ) overexpressing the MYB134 transcription factor were more resistant to rust infection. Silencing PnMYB134 , on the other hand, decreased flavan-3-ol biosynthesis and increased susceptibility to rust infection. Taken together, our data indicate that catechin and PAs are effective antifungal defenses in poplar against foliar rust infection. © 2017 American Society of Plant Biologists. All Rights Reserved.
-
Kumar, Dhananjay; Dutta, Summi; Singh, Dharmendra; Prabhu, Kumble Vinod; Kumar, Manish; Mukhopadhyay, Kunal
2017-01-01
Deep sequencing identified 497 conserved and 559 novel miRNAs in wheat, while degradome analysis revealed 701 targets genes. QRT-PCR demonstrated differential expression of miRNAs during stages of leaf rust progression. Bread wheat (Triticum aestivum L.) is an important cereal food crop feeding 30 % of the world population. Major threat to wheat production is the rust epidemics. This study was targeted towards identification and functional characterizations of micro(mi)RNAs and their target genes in wheat in response to leaf rust ingression. High-throughput sequencing was used for transcriptome-wide identification of miRNAs and their expression profiling in retort to leaf rust using mock and pathogen-inoculated resistant and susceptible near-isogenic wheat plants. A total of 1056 mature miRNAs were identified, of which 497 miRNAs were conserved and 559 miRNAs were novel. The pathogen-inoculated resistant plants manifested more miRNAs compared with the pathogen infected susceptible plants. The miRNA counts increased in susceptible isoline due to leaf rust, conversely, the counts decreased in the resistant isoline in response to pathogenesis illustrating precise spatial tuning of miRNAs during compatible and incompatible interaction. Stem-loop quantitative real-time PCR was used to profile 10 highly differentially expressed miRNAs obtained from high-throughput sequencing data. The spatio-temporal profiling validated the differential expression of miRNAs between the isolines as well as in retort to pathogen infection. Degradome analysis provided 701 predicted target genes associated with defense response, signal transduction, development, metabolism, and transcriptional regulation. The obtained results indicate that wheat isolines employ diverse arrays of miRNAs that modulate their target genes during compatible and incompatible interaction. Our findings contribute to increase knowledge on roles of microRNA in wheat-leaf rust interactions and could help in rust
-
Moessbauer spectra of white micas from the Central Western Carpathians Mountains
International Nuclear Information System (INIS)
Sitek, J; Toth, I; Sulak, M; Putis, M
2010-01-01
Potassium white micas from the rocks included into Cretaceous deformation zones (ca. 100-70 Ma in age) of the Central Western Carpathians were investigated by Moessbauer spectroscopy. White micas formed during a polystage evolution and changing P-T conditions of their crystallization in crustal-scale shear zones. We found criteria for distinguishing generations of celadonite-poor (muscovitic) and celadonite-rich (phengitic) white micas using Moessbauer spectroscopy. This method revealed contrasting spectra characterized by typical quadrupole doublets corresponding to Fe 2+ Fe 3+ contents in white micas. They are in the range of 2.9-3.0 mm/s for phengite, and 2.6-2.7 mm/s for muscovite. Moessbauer spectra reflect well the chemical changes in white mica aggregates, especially of those close to the end-member muscovite and (alumino-)celadonite compositions.
-
Moessbauer spectra of white micas from the Central Western Carpathians Mountains
Energy Technology Data Exchange (ETDEWEB)
Sitek, J; Toth, I [Department of Nuclear Physics and Technology, Faculty of Electrical Engineering and Information Technology, Slovak University of Technology, Ilkovicova 3, Bratislava (Slovakia); Sulak, M; Putis, M, E-mail: jozef.sitek@stuba.s [Department of of Mineralogy and Petrology, Faculty of Natural Sciences, Comenius University Bratislava, Mlynska dolina G, 842 15 Bratislava (Slovakia)
2010-03-01
Potassium white micas from the rocks included into Cretaceous deformation zones (ca. 100-70 Ma in age) of the Central Western Carpathians were investigated by Moessbauer spectroscopy. White micas formed during a polystage evolution and changing P-T conditions of their crystallization in crustal-scale shear zones. We found criteria for distinguishing generations of celadonite-poor (muscovitic) and celadonite-rich (phengitic) white micas using Moessbauer spectroscopy. This method revealed contrasting spectra characterized by typical quadrupole doublets corresponding to Fe{sup 2+} Fe{sup 3+} contents in white micas. They are in the range of 2.9-3.0 mm/s for phengite, and 2.6-2.7 mm/s for muscovite. Moessbauer spectra reflect well the chemical changes in white mica aggregates, especially of those close to the end-member muscovite and (alumino-)celadonite compositions.
-
Identifying and utilizing resistance to Puccinia striiformis in wheat
International Nuclear Information System (INIS)
Line, R.F.; Allan, R.E.; Konzak, C.F.
1976-01-01
Resistance to Puccinia striiformis in wheat cultivars, breeding lines, and induced mutants, was studied on plants exposed to natural rust inoculum at field sites and on plants inoculated with specific races and grown under controlled temperatures. Based on infection types and disease intensity at various stages of plant growth throughout the duration of rust establishment, the following resistance-types (R-types) were identified: R-type 1, plants resistant or susceptible at all stages of growth and at both low and high temperatures throughout duration of rust establishment; R-type 2, plants initially resistant in the seedling stage but eventually become susceptible, plants resistant at later stages in the field; R-type 3, variable resistance in the seedling stage, high resistance in later growth stages; R-type 4, plants resistant in the eedling stage, but susceptible in late stages of growth; R-type 5, plants susceptible, but the pathogen is slow to sporulate and consequently, rust increases slower in the field; R-type 6, plants susceptible at low temperatures and resistant at high temperatures at all stages of growth; R-type 7, plants very susceptible at both low and high temperatures in the seedling stage and at low temperatures in later stages; when temperatures are high, plants become more resistant in later stages; R-type 8, plants susceptible at all stages, when rust intensity is low and when not under stress, but become more resistant when intensity is high or under moderate stress in the field. Combinations of the above types were also observed. Techniques for identifying resistance to stripe rust, race specificity of the resistance-types, relationship of plant growth habit and head characteristics to disease intensity, historical significance of various types of resistance in the United States, and methods of using the resistance-types are also discussed. (author)
-
Vaz Patto, M.C.; Rubiales, D.; Martin, A.; Hernandez, P.; Lindhout, W.H.; Niks, R.E.; Stam, P.
2003-01-01
In cereals, rust fungi are among the most harmful pathogens. Breeders usually rely on short-lived hypersensitivity resistance. As an alternative, "avoidance" may be a more durable defence mechanism to protect plants to rust fungi. In Hordeum chilense avoidance is based on extensive wax covering of
-
Increasing the resistance of common bean to white mold through recurrent selection
Directory of Open Access Journals (Sweden)
Monik Evelin Leite
2016-02-01
Full Text Available ABSTRACT White mold, caused by Sclerotinea sclerotiorum (Lib. de Bary is one of the most important diseases of the common bean (Phaseolus vulgaris L. worldwide. Physiological resistance and traits related to disease avoidance such as architecture contribute to field resistance. The aim of this study was to verify the efficiency of recurrent selection in physiological resistance to white mold, “Carioca” grain type and upright habit in common bean. Thirteen common bean lines with partial resistance to white mold were intercrossed by means of a circulant diallel table, and seven recurrent selection cycles were obtained. Of these cycles, progenies of the S0:1, S0:2 and S0:3 generations of cycles III, IV, V and VI were evaluated. The best (8 to 10 progenies of the seven cycles were also evaluated, in two experiments, one in the greenhouse and one in the field. Lattice and/or randomized block experimental designs were used. The traits evaluated were: resistance to white mold by the straw test method, growth habit and grain type. The most resistant progenies were selected based on the average score of resistance to white mold. Subsequently, they were evaluated with regard to grain type and growth habit. Recurrent selection allowed for genetic progress of about 11 % per year for white mold resistance and about 15 % per year for the plant architecture. There was no gain among cycles for grain type. Progeny selection and recurrent selection were efficient for obtaining progenies with a high level of resistance to white mold with “Carioca” grain type and upright habit.
-
International Nuclear Information System (INIS)
Starosvetsky, J.; Kamari, R.; Farber, Y.; Bilanović, D.; Armon, R.
2016-01-01
Highlights: • The present study demonstrated the high reductive capacity of both strains: the collection S. oneidensis and the wild strain Geobacter spp. (soil isolate). • The experimental strains were successful in Fe 3+ reduction for both states: soluble and crystalline (originally prepared from rust). • Rust dissolution can be improved by: addition of AFC at low concentration (0.2 g/l), increasing bacterial initial inoculum and rust reactive surface. • Both experimental IRB strains were able to completely remove previously formed rust on carbon steel coupons. • Additional results (not showed) revealed that culture S. oneidensis and the environmental isolate Geobacter spp., apparently have a different mechanism of iron reduction that requires further study. - Abstract: Iron reducing bacteria (IRB), to be used in rust dissolution and removal, have been isolated and enriched from different environmental sources. Comparative measurements revealed that a soil isolate (Geobacter sulfurreducens sp.) had the highest reductive activity equivalent to Shewanella oneidensis (strain CIP 106686, pure culture). Both reductive microorganisms can use Fe 3+ ions as electron acceptors from soluble as well as from crystalline sources. In nutrient medium containing soluble Fe 3+ , the highest reductive activity obtained for G. sulfurreducens sp. and S. oneidensis was 93 and 97% respectively. Successful removal of rust from carbon steel coupons has been achieved with both experimental bacteria.
-
Directory of Open Access Journals (Sweden)
Peipei Zhang
2017-05-01
Full Text Available Wheat leaf rust is an important disease worldwide. Growing resistant cultivars is an effective means to control the disease. In the present study, 244 recombinant inbred lines from Zhou 8425B/Chinese Spring cross were phenotyped for leaf rust severities during the 2011–2012, 2012–2013, 2013–2014, and 2014–2015 cropping seasons at Baoding, Hebei province, and 2012–2013 and 2013–2014 cropping seasons in Zhoukou, Henan province. The population was genotyped using the high-density Illumina iSelect 90K SNP assay and SSR markers. Inclusive composite interval mapping identified eight QTL, designated as QLr.hebau-2AL, QLr.hebau-2BS, QLr.hebau-3A, QLr.hebau-3BS, QLr.hebau-4AL, QLr.hebau-4B, QLr.hebau-5BL, and QLr.hebau-7DS, respectively. QLr.hebau-2BS, QLr.hebau-3A, QLr.hebau-3BS, and QLr.hebau-5BL were derived from Zhou 8425B, whereas the other four were from Chinese Spring. Three stable QTL on chromosomes 2BS, 4B and 7DS explained 7.5–10.6%, 5.5–24.4%, and 11.2–20.9% of the phenotypic variance, respectively. QLr.hebau-2BS in Zhou 8425B might be the same as LrZH22 in Zhoumai 22; QLr.hebau-4B might be the residual resistance of Lr12, and QLr.hebau-7DS is Lr34. QLr.hebau-2AL, QLr.hebau-3BS, QLr.hebau-4AL, and QLr.hebau-5BL are likely to be novel QTL for leaf rust. These QTL and their closely linked SNP and SSR markers can be used for fine mapping, candidate gene discovery, and marker-assisted selection in wheat breeding.
-
Flavan-3-ols Are an Effective Chemical Defense against Rust Infection1[OPEN
Unsicker, Sybille B.; Fellenberg, Christin; Schmidt, Axel
2017-01-01
Phenolic secondary metabolites are often thought to protect plants against attack by microbes, but their role in defense against pathogen infection in woody plants has not been investigated comprehensively. We studied the biosynthesis, occurrence, and antifungal activity of flavan-3-ols in black poplar (Populus nigra), which include both monomers, such as catechin, and oligomers, known as proanthocyanidins (PAs). We identified and biochemically characterized three leucoanthocyanidin reductases and two anthocyanidin reductases from P. nigra involved in catalyzing the last steps of flavan-3-ol biosynthesis, leading to the formation of catechin [2,3-trans-(+)-flavan-3-ol] and epicatechin [2,3-cis-(−)-flavan-3-ol], respectively. Poplar trees that were inoculated with the biotrophic rust fungus (Melampsora larici-populina) accumulated higher amounts of catechin and PAs than uninfected trees. The de novo-synthesized catechin and PAs in the rust-infected poplar leaves accumulated significantly at the site of fungal infection in the lower epidermis. In planta concentrations of these compounds strongly inhibited rust spore germination and reduced hyphal growth. Poplar genotypes with constitutively higher levels of catechin and PAs as well as hybrid aspen (Populus tremula × Populus alba) overexpressing the MYB134 transcription factor were more resistant to rust infection. Silencing PnMYB134, on the other hand, decreased flavan-3-ol biosynthesis and increased susceptibility to rust infection. Taken together, our data indicate that catechin and PAs are effective antifungal defenses in poplar against foliar rust infection. PMID:29070515
-
Characterization of stem rust resistance gene Sr2 in Indian wheat ...
African Journals Online (AJOL)
SONY
2013-05-01
May 1, 2013 ... accelerating wheat production in the last forty years and ensured food security of the Nation. In the present investigation, Sr2 specific molecular markers were used to assess their efficacy for assessing the deployment of Sr2 gene in Indian wheat cultivars of highly productive north-west plains and stem rust ...
-
Henrietta Myburg; Alison M. Morse; Henry V. Amerson; Thomas L. Kubisiak; Dudley Huber; Jason A. Osborne; Saul A. Garcia; C. Dana Nelson; John M. Davis; Sarah F. Covert; Leonel M. van Zyle
2006-01-01
Cronartium quercuum f.sp. fusiforme is the pathogen that incites fusiform rust disease of southern pine species. To date, a number of host resistance genes have been mapped. Although genomic mapping studies have provided valuable information on the genetic basis of disease interactions in this pine-rust pathosystem, the interaction...
-
Structure of titanium-doped goethite rust
International Nuclear Information System (INIS)
Nakayama, Takenori; Ishikawa, Tatsuo; Konno, Toyohiko J.
2005-01-01
To investigate the influence of titanium addition on the formation and structure of goethite (α-FeOOH) rust which is one of main corrosion products of weathering steel, the artificially synthesized α-FeOOH rusts were prepared by hydrolysis of aqueous solutions of Fe(III) containing Ti(IV) at different atomic ratios (Ti/Fe) in the range 0-0.1. The obtained rusts particles were observed by TEM. Characterization by XRD, N 2 absorption, Moessbauer spectroscopy was also done. TEM observation revealed that the α-FeOOH rust particle size increased with the increase of Ti/Fe, and that Ti-enriched poorly crystalline particles were formed around the rust particles. XRD confirmed that the crystallite size increased with the increase of Ti/Fe, while the XRD peaks decreased in intensity. Specific surface area obtained by N 2 absorption increased with the increase of Ti/Fe. It is deduced from the obtained results that the addition of Ti(IV) increases the crystallite size of α-FeOOH, and produces double domain particles consisting of the particle core and a porous poorly crystalline shell. It is thought that such unique rust structure produced by titanium addition contributes to the protective properties of rust layer of the weathering steel
-
Daniel R. Miller
2007-01-01
I report on the attraction of the white pine cone beetle, Canophthorus coniperda (Schwarz) (Coleoptera: Scolytidae), to traps baited with the host monoterpene limonene in western North Carolina. Both (+)- and (-)-limonene attracted male and female cone beetles to Japenese beetle traps in an eastern white pine, Pinus strobus L. seed...
-
The revolt of the Rust Belt: place and politics in the age of anger.
McQuarrie, Michael
2017-11-01
This paper argues that the election of Donald Trump is the product of a confluence of historical factors rather than the distinctive appeal of the victor himself. By paying particular attention to the geography of unusual voting behaviour the analytical question comes into view: why did so much uncharacteristic voting occur in the Rust Belt states of the upper Midwest? It is impossible to answer this question adequately using conventional categorical attributes. The usual hypotheses of 'economic anxiety' and white revanchism are unable to account for sudden shifts in the voting behaviour of both white and black voters in post-industrial territories. Instead, it is necessary to turn to the history of the region and the institutional apparatus that connected voters there to the federal government and the Democratic Party. From this perspective we can see that the active dismantling of the Fordist social order set the region on a divergent path from the rest of the country. But this path had no political outlet due to the reorientation of the Democratic Party around a new class and geographic base. Due to this, the party pursued policies that would magnify the region's difficulties rather than alleviate its circumstances. Moreover, the elaborate institutional ties that connected the region's voters to the Democratic Party and the federal government meant that the political implications of regional decline would be muted. However, as these institutions frayed, Rust Belt voters were made available to candidates that challenged the policy consensus that had done so much damage to the region. The election was decided by a Rust Belt revolt that unified black and white working-class voters against Hillary Clinton and the Democratic Party. © London School of Economics and Political Science 2017.
-
DEFF Research Database (Denmark)
Milus, Eugene A; Kristensen, Kristian; Hovmøller, Mogens S
2009-01-01
Stripe rust (yellow rust) of wheat, caused by Puccinia striiformis f. sp. tritici, has become more severe in eastern United States, Australia, and elsewhere since 2000. Recent research has shown that this coincided with a global spread of two closely related strains that were similar based on vir...... that wheat rust fungi can adapt to warmer temperatures and cause severe disease in previously unfavorable environments......Stripe rust (yellow rust) of wheat, caused by Puccinia striiformis f. sp. tritici, has become more severe in eastern United States, Australia, and elsewhere since 2000. Recent research has shown that this coincided with a global spread of two closely related strains that were similar based...... regimes for latent period, lesion length, lesion width, lesion area, and spore production on adult plants of a susceptible wheat cultivar with no known genes for resistance to stripe rust. "New" isolates (since 2000) were significantly more aggressive than "old" isolates (before 2000) for all variables...
-
Threats, status & management options for bristlecone pines and limber pines in Southern Rockies
A. W. Schoettle; K. S. Burns; F. Freeman; R. A. Sniezko
2006-01-01
High-elevation white pines define the most remote alpine-forest ecotones in western North America yet they are not beyond the reach of a lethal non-native pathogen. The pathogen (Cronartium ribicola), a native to Asia, causes the disease white pine blister rust (WPBR) and was introduced into western Canada in 1910. Whitebark (Pinus albicaulis) and...
-
International Nuclear Information System (INIS)
Khan, M.A.; Haider, M.M.; Hussain, M.; Ahmad, S.
2007-01-01
Wheat genotypes were screened against leaf rust to evaluate slow rusting response. Among one hundred and sixty varieties/lines, 86 showed response to leaf rust while all other remained immune or showed no response. The slow rusting, wheat varieties/ lines displayed 20-40% severity level and these were Maxi-Pak65, Blue silver, Pothohar, Punjab81, Faisalabd-83, Shalimar-88, Kohnoor-83, Pasban-90, Inqilab-91, Uqab-99-94105, Punjab-76, Parwaz-94, HD2169, HD2179, HD2204, HD2285, Lr27+31, LrB, LR17, Lr14A, Lr15 and Yr1-E-1 while the fast rusting varieties/lines that showed severity level up to 90% were WL-711, Morocco, PAK-1, Punjab-85 and Chakwal-86 SA42, SA75, Lr1, Lr2A, Lr2B. Lr23, Lr3KA, Lr3g, Lr10, Lr18, Lr21, Lr24, Yr2-E35 and 95153 respectively. Slow rusting genotypes exhibited low AUDPC (200-400) values while fast rusters displayed high AUDPC (400-1500) values. Leaf rust severity displayed significant correlation with maximum and minimum temperatures, rainfall and sunshine radiation. It was observed that with an increase of these environmental conditions a significant increase in disease severity was recorded
-
Alan E. Harvey; James W. Byler; Geral I. McDonald; Leon F. Neuenschwander; Jonalea R. Tonn
2008-01-01
The effective loss of western white pine (Pinus monticola Dougl.) in the white pine ecosystem has far-reaching effects on the sustainability of local forests and both regional and global forestry issues. Continuing trends in management of this forest type has the potential to put western white pine, as well as the ecosystem it once dominated, at very...
-
Mössbauer spectra of white micas from the Central Western Carpathians Mountains
Sitek, J.; Sulák, M.; Putiš, M.; Tóth, I.
2010-03-01
Potassium white micas from the rocks included into Cretaceous deformation zones (ca. 100-70 Ma in age) of the Central Western Carpathians were investigated by Mössbauer spectroscopy. White micas formed during a polystage evolution and changing P-T conditions of their crystallization in crustal-scale shear zones. We found criteria for distinguishing generations of celadonite-poor (muscovitic) and celadonite-rich (phengitic) white micas using Mössbauer spectroscopy. This method revealed contrasting spectra characterized by typical quadrupole doublets corresponding to Fe2+ Fe3+ contents in white micas. They are in the range of 2.9-3.0 mm/s for phengite, and 2.6-2.7 mm/s for muscovite. Mössbauer spectra reflect well the chemical changes in white mica aggregates, especially of those close to the end-member muscovite and (alumino-)celadonite compositions.
-
Magnetic property based characterization of rust on weathering steels
International Nuclear Information System (INIS)
Mizoguchi, T.; Ishii, Y.; Okada, T.; Kimura, M.; Kihira, H.
2005-01-01
The characterization of rusts on weathering steels is important in understanding the origin of their corrosion resistance. Rust consists of several phases, e.g. α-, β- and γ-FeOOH, which are anti-ferromagnetic with different Neel temperatures. Rust on so-called advanced weathering steel containing 3 wt.% Ni [H. Kihira, A. Usami, K. Tanabe, M. Ito, G. Shigesato, Y. Tomita, T. Kusunoki, T. Tsuzuki, S. Ito, T. Murata, in: Proc. Symp. on Corrosion and Corrosion Control in Saltwater Environments, Honolulu, 1999, The Electrochemical Soc., pp. 127-136] contains in addition a ferrimagnetic spinel phase [M. Kimura, H. Kihira, Y. Ishii, T. Mizoguchi, in: Proc. 13th Asian-Pacific Corrosion Control Conference, Osaka, 2003; M. Kimura, H. Kihira, N. Ohta, M. Hashimoto, T. Senuma, Corros. Sci., this volume; M. Kimura, N. Ohta, H. Kihira, Mater. Trans. JIM, in press]. The nanostructure of real rust cannot be elucidated satisfactorily only with conventional analytical methods such as X-ray diffraction, because of the complex mixture of phases with fine and imperfect crystallites. Because of the short range of the super-exchange coupling between Fe ions in a solid, the magnetic properties can give information on local configurations even in the absence of perfect crystalline coherence. Therefore, the magnetic properties of rust samples were investigated in detail using a Superconducting Quantum Interference Device (SQUID) magnetometer and Moessbauer spectroscopy. SQUID magnetometry is effective to determine the quantity of the ferrimagnetic phase. The temperature dependence of the Moessbauer spectrum gives information about not only the fractions of the phases but also the distribution of grain volume, V, in each phase according to the super-paramagnetic relaxation effect. This approach has been applied to rust of conventional [T. Okada, Y. Ishii, T. Mizoguchi, I. Tamura, Y. Kobayashi, Y. Takagi, S. Suzuki, H. Kihira, M. Ito, A. Usami, K. Tanabe, K. Masuda, Jpn. J. Appl. Phys. 39
-
Induced mutations for disease resistance in wheat and field beans
International Nuclear Information System (INIS)
Abdel-Hak, T.M.; Kamel, A.H.
1976-01-01
Wheat disease in Egypt is reviewed and results of mutation breeding by γ irradiation for disease resistance in wheat and field beans are described. Wheat mutants of the variety Giza 155 resistant to leaf rust, Giza 156 resistant to both leaf and yellow rusts, and Tosson with a reasonable level of combined resistance to the three rusts in addition to mutants of the tetraploid variety Dakar 52 with a good level of stem and yellow rust resistance are required. Their seeds were subjected to 10, 15 and 20 krad. Of 3000-3700 M 2 plants from each variety and dosage, 22 plants from both Giza 155 and Giza 156, although susceptible, showed a lower level of disease development. In 1975, M 3 families of these selected plants and 6000 plants from bulked material were grown from each variety and dosage at two locations. Simultaneously, an additional population consisting of 3000 mutagen-treated seeds was grown to have a reasonable chance of detecting mutants; 2 heads from each plant were harvested. These will be grown next season (1976) to make a population of 25,000-30,000 M 2 plants and screened to composite cultures of specific rusts. Vicia faba seeds of field bean varieties Giza 1, Giza 2 and Rebaya 40, equally susceptible to rust and chocolate spot, were subjected to 3, 5 and 7 krad of 60 Co gamma radiation and 800 M 1 plants were grown in 1972 per variety and dose. Up to this later growing season (M 3 ) no resistance was detected in M 3 plank
-
Deployment of deer-resistant western redcedar (Thuja plicata)
John Russell
2008-01-01
Protecting planted western redcedar (Thuja plicata) seedlings from deer browse in the Pacific Northwest and British Columbia is estimated to cost up to CAN$ 25 million annually. Recent studies linking deer browse and needle monoterpenes has resulted in the initiation of a breeding program for deer-resistant western redcedar at Cowichan Lake Research...
-
Directory of Open Access Journals (Sweden)
Diane G O Saunders
Full Text Available Rust fungi are obligate biotrophic pathogens that cause considerable damage on crop plants. Puccinia graminis f. sp. tritici, the causal agent of wheat stem rust, and Melampsora larici-populina, the poplar leaf rust pathogen, have strong deleterious impacts on wheat and poplar wood production, respectively. Filamentous pathogens such as rust fungi secrete molecules called disease effectors that act as modulators of host cell physiology and can suppress or trigger host immunity. Current knowledge on effectors from other filamentous plant pathogens can be exploited for the characterisation of effectors in the genome of recently sequenced rust fungi. We designed a comprehensive in silico analysis pipeline to identify the putative effector repertoire from the genome of two plant pathogenic rust fungi. The pipeline is based on the observation that known effector proteins from filamentous pathogens have at least one of the following properties: (i contain a secretion signal, (ii are encoded by in planta induced genes, (iii have similarity to haustorial proteins, (iv are small and cysteine rich, (v contain a known effector motif or a nuclear localization signal, (vi are encoded by genes with long intergenic regions, (vii contain internal repeats, and (viii do not contain PFAM domains, except those associated with pathogenicity. We used Markov clustering and hierarchical clustering to classify protein families of rust pathogens and rank them according to their likelihood of being effectors. Using this approach, we identified eight families of candidate effectors that we consider of high value for functional characterization. This study revealed a diverse set of candidate effectors, including families of haustorial expressed secreted proteins and small cysteine-rich proteins. This comprehensive classification of candidate effectors from these devastating rust pathogens is an initial step towards probing plant germplasm for novel resistance components.
-
Induced mutants in beans and peas resistant to rust
International Nuclear Information System (INIS)
Fadl, F.A.M.
1983-01-01
Beans (Phaseolus vulgaris) and peas (Pisum sativum) are important leguminous vegetable crops in Egypt. The area planted with beans is about 40,000 acres and peas 22,000 acres. These crops suffer from several diseases, particularly rusts, (Uromyces phaseoli/Uromyces pisi), which are mainly spread in northern Egypt. In our mutation induction programme we used 60 Co gamma rays and ethyl methane sulphonate (EMS). Bean and pea seeds were soaked in water for two hours before exposure to 8, 10 and 12 krad. For chemical treatments, bean and pea seeds were soaked in water for eight hours and then treated with 0.5 and 1.5% EMS for four hours. The M 1 was cultivated in 1978
-
Reaction of some soybean mutant lines to natural rust fungus caused by (phakopsora pachyrhizi syd)
International Nuclear Information System (INIS)
Ratma, R.
1988-01-01
Reaction of some soybean mutant lines to natural rust fungus caused by (phakopsora pachyhizi syd). Eleven soybean mutant lines of orba variety derived from gamma fungus disease in the wet season 1985/86 at the experimental station of Citayam, Bogor. Based on IWGSR rating system, soybean mutant lines No 18/PsJ was moderately resistant to rust fungus disease. The other mutant lines, 14/PsJ, 15/PsJ, 20/PsJ, 102/PsJ, 106/PsJ, 111/PsJ, 118/PsJ, 119/PsJ and 220/PsJ were susceptible. (author). 4 figs.; 8 refs
-
Silvicultural approaches for management of eastern white pine to minimize impacts of damaging agents
M.E. Ostry; G. Laflamme; S.A. Katovich
2010-01-01
Since the arrival to North America of Cronartium ribicola, management of eastern white pine has been driven by the need to avoid the actual or, in many areas, the perceived damage caused by white pine blister rust. Although white pine has lost much of its former dominance, it remains a valuable species for biotic diversity, aesthetics, wildlife...
-
Loope, Lloyd; La Rosa, Anne Marie
2010-01-01
In April 2005, the rust fungus Puccinia psidii (most widely known as guava rust or eucalyptus rust) was found in Hawai'i. This was the first time this rust had been found outside the Neotropics (broadly-defined, including subtropical Florida, where the rust first established in the 1970s). First detected on a nursery-grown 'ohi'a plant, it became known as ''ohi'a rust'in Hawai'i. The rust spread rapidly and by August 2005 had been found throughout the main Hawaiian Islands. The rust probably reached Hawai'i via the live plant trade or via the foliage trade. In Hawai'i, the rust has infected three native plant species and at least eight non-native species. Effects have been substantial on the endangered endemic plant Eugenia koolauensis and the introduced rose apple, Syzygium jambos. Billions of yellow, asexual urediniospores are produced on rose apple, but a complete life cycle (involving sexual reproduction) has not yet been observed. The rust is autoecious (no alternate host known) on Myrtaceae. The strain introduced into Hawai'i is found sparingly on 'ohi'a (Metrosideros polymorpha), the dominant tree of Hawai'i's forests, with sporadic damage detected to date. The introduction of a rust strain that causes widespread damage to 'ohi'a would be catastrophic for Hawai'i's native biodiversity. Most imports of material potentially contaminated with rust are shipped to Hawai'i from Florida and California (from which P. psidii was reported in late 2005 by Mellano, 2006). Florida is known to have multiple strains. The identity of the strain or strains in California is unclear, but one of them is known to infect myrtle, Myrtus communis, a species commonly imported into Hawai'i. It is important to ecosystem conservation and commercial forestry that additional rust strains or genotypes be prevented from establishing in Hawai'i. The purpose of this analysis of risk is to evaluate the need for an interim rule by the Hawai'i Department of Agriculture to regulate plant
-
Historic Rust College: Fulfilling a Mission.
Hoffman, Carl
1989-01-01
Describes Rust College, a Mississippi college dedicated to educating Blacks from economically and educationally impoverished backgrounds. Discusses the college's financial management, recent fund-raising efforts, building program, and academic programs. Examines the role of the predominantly Black college and Rust's mission to help students…
-
International Nuclear Information System (INIS)
Ventura Gonzalez, Morella Fuchs; Castroni, Sonia; Diaz, Ezequiel
1997-01-01
With the purpose to generate sugar cane variability in vitro, in order the obtain genotypes resistant to the mosaic viruses and to the rusts (Puccinia melanocephala), callus coming from cultivars susceptible to the mosaic viruses (B 6749, B 7987 and PR 62258) and to the rusts (B 4362 and PR 641791) were irradiated with different gamma radiation dose. The IVIC cobalt source was used, being applied two, four, eight and twelve krads. The effect of irradiation on the percentage of regeneration of plants for each dose and variety was evaluated. The regenerated plants were taken to shelter, where they were inoculated with the mosaic viruses B (SCMB-B). The asymptomatic subclons were transplanted to field in August of 1992, to evaluate the presence of symptoms of mosaic and rusts. A high proportion of the plants didn't show symptoms of illnesses, being obtained 2,35% of sick plants coming from cultivar B 6749 and 0,72 from cultivar PR 62258. This low incidence of infection remained stable up to the following year of evaluation. The genetic variation was studied through isoenzymatics pattern, peroxidase specifically. This analysis allowed to detect variation in the number and intensity of the bands among the subclons and in the original variety. 229 subclons were selected from cultivar B 6749 and they were incorporated to the program of cultivation improvement. Among them 60 subclons, with good agronomic and productivity characteristics, were chosen and continue being evaluated to be incorporated to the regional essays, last phase of the selection process [es
-
Directory of Open Access Journals (Sweden)
Lucimara Junko Koga
2008-10-01
Full Text Available O objetivo deste trabalho foi detalhar os ciclos de infecção da Phakopsora pachyrhizi Syd. & P. Syd. em genótipos de soja, para o estabelecimento de grupos de genótipos mais promissores para o uso como fontes de resistência à ferrugem. Os componentes do ciclo de infecção foram quantificados em 48 genótipos. Foram avaliados: tipo de lesão, intensidade de esporulação, severidade, número de lesões e de urédias e produtividade de urediniósporos. Pela análise de agrupamentos, formaram-se quatro grupos: A - desenvolveu a maior quantidade de doença; B - desenvolveu a menor quantidade de doença; C - baixa resistência inicial e D - alta resistência inicial. Os genótipos dos grupos B, C e D apresentaram lesões RB ("redish-brown" e variaram quanto à resistência inicial, resistência tardia, intensidade de esporulação, estabilidade da resposta qualitativa, produtividade de urediniósporos e número de dias para atingir 50% da severidade máxima. Entre as variáveis analisadas, as que apresentaram importância prática foram as avaliações das respostas qualitativas e as de severidade. Esta última reflete os efeitos combinados de resistência sobre todos os componentes da infecção e apresentam importância prática na diferenciação de genótipos, quanto à resistência à doença. Os genótipos dos grupos B, C e D manifestaram resistência qualitativa e quantitativa, em diferentes graus, e promissores para serem utilizados como fontes de genes de resistência à ferrugem-asiática-da-soja.The objective of this study was to detail the infection cycles of Phakopsora pachyrhizi Syd. & P. Syd. in soybean genotypes, in order to establish a group of the most promising genotypes for use as sources of resistance to Asian soybean rust. The infection cycle components were quantified in 48 genotypes. The assessments consisted of: type of lesion, intensity of sporulation, severity, number of lesions and uredinias, and productivity of
-
Panwar, Vinay; Jordan, Mark; McCallum, Brent; Bakkeren, Guus
2018-05-01
Leaf rust, caused by the pathogenic fungus Puccinia triticina (Pt), is one of the most serious biotic threats to sustainable wheat production worldwide. This obligate biotrophic pathogen is prevalent worldwide and is known for rapid adaptive evolution to overcome resistant wheat varieties. Novel disease control approaches are therefore required to minimize the yield losses caused by Pt. Having shown previously the potential of host-delivered RNA interference (HD-RNAi) in functional screening of Pt genes involved in pathogenesis, we here evaluated the use of this technology in transgenic wheat plants as a method to achieve protection against wheat leaf rust (WLR) infection. Stable expression of hairpin RNAi constructs with sequence homology to Pt MAP-kinase (PtMAPK1) or a cyclophilin (PtCYC1) encoding gene in susceptible wheat plants showed efficient silencing of the corresponding genes in the interacting fungus resulting in disease resistance throughout the T 2 generation. Inhibition of Pt proliferation in transgenic lines by in planta-induced RNAi was associated with significant reduction in target fungal transcript abundance and reduced fungal biomass accumulation in highly resistant plants. Disease protection was correlated with the presence of siRNA molecules specific to targeted fungal genes in the transgenic lines harbouring the complementary HD-RNAi construct. This work demonstrates that generating transgenic wheat plants expressing RNAi-inducing transgenes to silence essential genes in rust fungi can provide effective disease resistance, thus opening an alternative way for developing rust-resistant crops. © 2017 Her Majesty the Queen in Right of Canada. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
-
Directory of Open Access Journals (Sweden)
Albano Silva da Conceição
2005-01-01
porte baixo portando o gene SH3 de resistência ao agente da ferrugem.The present work evaluated 36 arabic coffee (Coffea arabica L. F3 progenies, originated from crosses among cultivars Catuaí Vermelho IAC 46 and Catuaí Vermelho IAC 81 and access IAC 1110 (BA-10. This last cultivar came from India and exhibits SH2 and SH3 rust resistance genes. The experiment was installed in 1988 at the Experimental Center of the Agronomic Institute (IAC/APTA, in Campinas, using random blocks design with six repetitions and two plants per plot. Field evaluations included yield (average of seven annual harvests, vegetative vigor, resistance to leaf rust, plant size, color of young leaves and complete fruit maturation period. Based on these evaluations, plants exhibiting high yield, good vegetative vigor, low height, and resistance to the leaf rust agent Hemileia vastatrix were selected. Fruit yield of selected plants was calculated and seeds were characterized according to type (flat, peaberry and elephant, outturn and grain size. A total of 11 optimal F3 progenies were identified as rust resistant. By further classifications, 39 plants out from these progenies were selected, along with 15 plants from other 25 evaluated progenies. Laboratory analyses lead to a final selection of 18 coffee trees, all exhibiting leaf rust resistance, high yield and low height. Also, F4 progenies of selected plants had been evaluated regarding height and leaf rust resistance, at seedling stage, in greenhouse conditions. Eighteen plants were selected for further analysis and move forward from F3 to F4 generation in the coffee breeding program developed by IAC.
-
Directory of Open Access Journals (Sweden)
Alexandre Sandri Capucho
2009-03-01
Full Text Available O objetivo deste trabalho foi caracterizar a herança da resistência do Híbrido de Timor UFV 443-03 à ferrugem-do-cafeeiro (Hemileia vastatrix. Para isso, a raça II e o patótipo 001 de ferrugem foram inoculados em 246 plantas da população F2, 115 plantas do retrocruzamento suscetível (RC S e 87 plantas do retrocruzamento resistente (RC R, originadas do cruzamento entre o genótipo suscetível cv. Catuaí Amarelo IAC 64 e a fonte de resistência Híbrido de Timor UFV 443-03. Para ambos os inóculos, a cv. Catuaí Amarelo IAC 64 foi suscetível, enquanto o Híbrido de Timor UFV 443-03, a planta representante da geração F1 e as plantas do RC R foram resistentes. As plantas F2, quando inoculadas com a raça II, apresentaram dois padrões de segregação significativos: 15:1 e 61:3. A herança da resistência foi confirmada pela inoculação das plantas do RC S, que segregaram na proporção de 3:1, padrão esperado para herança condicionada por dois genes. A hipótese de segregação 7:1 para três genes foi rejeitada. Resultados semelhantes foram obtidos para o patótipo 001. Dois genes dominantes e independentes conferem a resistência genética do Híbrido de Timor UFV 443-03 à raça II e ao patótipo 001 de H. vastatrix.The aim of this work was to characterize the resistance inheritance of the Timor Hybrid UFV 443-03 to coffee leaf rust (Hemileia vastatrix. For this, the race II and pathotype 001 of coffee leaf rust were inoculated in 246 F2 plants, 115 susceptible backcrossing (BCS plants, and 87 resistant backcrossing (BC R plants, derived from the crossing between the susceptible genotype 'Catuaí Amarelo' IAC 64 and the resistance source Timor Hybrid UFV 443-03. For both inoculums, the 'Catuaí Amarelo' IAC 64 was susceptible, while the Timor Hybrid, the plant representing F1 generation, and the BC R plants were resistant. The F2 plants inoculated with race II presented two significant segregation ratios: 15:1 and 61:3. The
-
Tuberculosis drug resistance in the Western Cape | Weyer | South ...
African Journals Online (AJOL)
Objectives: Drug resistance is a serious problem in the treatment of tuberculosis and a threat to successful tuberculosis control programmes. Local health workers have expressed concern that the increasing tuberculosis epidemic in the Western Cape is partly attributable to drug resistance. The aim of this study was to ...
-
Field-Evolved Resistance to Bt Maize by Western Corn Rootworm
Gassmann, Aaron J.; Petzold-Maxwell, Jennifer L.; Keweshan, Ryan S.; Dunbar, Mike W.
2011-01-01
Background Crops engineered to produce insecticidal toxins derived from the bacterium Bacillus thuringiensis (Bt) are planted on millions of hectares annually, reducing the use of conventional insecticides and suppressing pests. However, the evolution of resistance could cut short these benefits. A primary pest targeted by Bt maize in the United States is the western corn rootworm Diabrotica virgifera virgifera (Coleoptera: Chrysomelidae). Methodology/Principal Findings We report that fields identified by farmers as having severe rootworm feeding injury to Bt maize contained populations of western corn rootworm that displayed significantly higher survival on Cry3Bb1 maize in laboratory bioassays than did western corn rootworm from fields not associated with such feeding injury. In all cases, fields experiencing severe rootworm feeding contained Cry3Bb1 maize. Interviews with farmers indicated that Cry3Bb1 maize had been grown in those fields for at least three consecutive years. There was a significant positive correlation between the number of years Cry3Bb1 maize had been grown in a field and the survival of rootworm populations on Cry3Bb1 maize in bioassays. However, there was no significant correlation among populations for survival on Cry34/35Ab1 maize and Cry3Bb1 maize, suggesting a lack of cross resistance between these Bt toxins. Conclusions/Significance This is the first report of field-evolved resistance to a Bt toxin by the western corn rootworm and by any species of Coleoptera. Insufficient planting of refuges and non-recessive inheritance of resistance may have contributed to resistance. These results suggest that improvements in resistance management and a more integrated approach to the use of Bt crops may be necessary. PMID:21829470
-
Species interactions in the western Baltic Sea: With focus on the ecological role of whiting
DEFF Research Database (Denmark)
Ross, Stine Dalmann
, which potentially prey on and compete for food with whiting. Here, the growth dynamics and feeding ecology of whiting in the western Baltic Sea is investigated and discussed in an ecosystem context. Furthermore, the diet of the harbour porpoise is examined and the interactions between whiting, cod......, implementation of the models in strategic management advice for commercially important fish stocks and protected marine mammals is not common practice. This is due to the lack of sufficient information about species interactions including knowledge about the diet, food intake and growth dynamics. This thesis...
-
Directory of Open Access Journals (Sweden)
Melania eFigueroa
2016-02-01
Full Text Available The recent resurgence of wheat stem rust caused by new virulent races of Puccinia graminis f. sp. tritici (Pgt poses a threat to food security. These concerns have catalyzed an extensive global effort towards controlling this disease. Substantial research and breeding programs target the identification and introduction of new stem rust resistance (Sr genes in cultivars for genetic protection against the disease. Such resistance genes typically encode immune receptor proteins that recognize specific components of the pathogen, known as avirulence (Avr proteins. A significant drawback to deploying cultivars with single Sr genes is that they are often overcome by evolution of the pathogen to escape recognition through alterations in Avr genes. Thus, a key element in achieving durable rust control is the deployment of multiple effective Sr genes in combination, either through conventional breeding or transgenic approaches, to minimize the risk of resistance breakdown. In this situation, evolution of pathogen virulence would require simultaneous changes in multiple Avr genes in order to bypass recognition. However, choosing the optimal Sr gene combinations to deploy is a challenge that requires detailed knowledge of the pathogen Avr genes with which they interact and the virulence phenotypes of Pgt existing in nature. Identifying specific Avr genes from Pgt will provide screening tools to enhance pathogen virulence monitoring, assess heterozygosity and propensity for mutation in pathogen populations, and confirm individual Sr gene functions in crop varieties carrying multiple effective resistance genes. Towards this goal, much progress has been made in assembling a high quality reference genome sequence for Pgt, as well as a Pan-genome encompassing variation between multiple field isolates with diverse virulence spectra. In turn this has allowed prediction of Pgt effector gene candidates based on known features of Avr genes in other plant pathogens
-
Figueroa, Melania; Upadhyaya, Narayana M; Sperschneider, Jana; Park, Robert F; Szabo, Les J; Steffenson, Brian; Ellis, Jeff G; Dodds, Peter N
2016-01-01
The recent resurgence of wheat stem rust caused by new virulent races of Puccinia graminis f. sp. tritici (Pgt) poses a threat to food security. These concerns have catalyzed an extensive global effort toward controlling this disease. Substantial research and breeding programs target the identification and introduction of new stem rust resistance (Sr) genes in cultivars for genetic protection against the disease. Such resistance genes typically encode immune receptor proteins that recognize specific components of the pathogen, known as avirulence (Avr) proteins. A significant drawback to deploying cultivars with single Sr genes is that they are often overcome by evolution of the pathogen to escape recognition through alterations in Avr genes. Thus, a key element in achieving durable rust control is the deployment of multiple effective Sr genes in combination, either through conventional breeding or transgenic approaches, to minimize the risk of resistance breakdown. In this situation, evolution of pathogen virulence would require changes in multiple Avr genes in order to bypass recognition. However, choosing the optimal Sr gene combinations to deploy is a challenge that requires detailed knowledge of the pathogen Avr genes with which they interact and the virulence phenotypes of Pgt existing in nature. Identifying specific Avr genes from Pgt will provide screening tools to enhance pathogen virulence monitoring, assess heterozygosity and propensity for mutation in pathogen populations, and confirm individual Sr gene functions in crop varieties carrying multiple effective resistance genes. Toward this goal, much progress has been made in assembling a high quality reference genome sequence for Pgt, as well as a Pan-genome encompassing variation between multiple field isolates with diverse virulence spectra. In turn this has allowed prediction of Pgt effector gene candidates based on known features of Avr genes in other plant pathogens, including the related flax rust
-
2004-01-01
The rust color of the Martian landscape is apparent in this low-resolution thumbnail image taken by the panoramic camera on the Mars Exploration Rover Spirit. This image is part of a larger image currently stored onboard the rover in its memory.
-
Directory of Open Access Journals (Sweden)
Lijun Yang
Full Text Available Deployment of cultivars with genetic resistance is an effective approach to control the diseases of powdery mildew (PM and yellow rust (YR. Chinese wheat cultivar XK0106 exhibits high levels of resistance to both diseases, while cultivar E07901 has partial, adult plant resistance (APR. The aim of this study was to map resistance loci derived from the two cultivars and analyze their effects against PM and YR in a range of environments. A doubled haploid population (388 lines was used to develop a framework map consisting of 117 SSR markers, while a much higher density map using the 90K Illumina iSelect SNP array was produced with a subset of 80 randomly selected lines. Seedling resistance was characterized against a range of PM and YR isolates, while field scores in multiple environments were used to characterize APR. Composite interval mapping (CIM of seedling PM scores identified two QTLs (QPm.haas-6A and QPm.haas-2A, the former being located at the Pm21 locus. These QTLs were also significant in field scores, as were Qpm.haas-3A and QPm.haas-5A. QYr.haas-1B-1 and QYr.haas-2A were identified in field scores of YR and were located at the Yr24/26 and Yr17 chromosomal regions respectively. A second 1B QTL, QYr.haas-1B-2 was also identified. QPm.haas-2A and QYr.haas-1B-2 are likely to be new QTLs that have not been previously identified. Effects of the QTLs were further investigated in multiple environments through the testing of selected lines predicted to contain various QTL combinations. Significant additive interactions between the PM QTLs highlighted the ability to pyramid these loci to provide higher level of resistance. Interactions between the YR QTLs gave insights into the pathogen populations in the different locations as well as showing genetic interactions between these loci.
-
Directory of Open Access Journals (Sweden)
Mario Guilherme Roberto Donalísio
1985-01-01
Full Text Available Foram estudadas no Centro Experimental de Campinas, entre 1973 e 1976, 450 progênies do clone Samby e 295 do clone Valinhos, ambos da espécie Mentha arvensis L. var. piperascens Malinvaud, que apresentavam alguma resistência à ferrugem causada pelo fungo Puccinia menthae Pers., bom desenvolvimento vegetativo e óleo essencial com alto teor em mentol. As progênies foram obtidas de polinização livre. As plantas que apresentavam pulegona foram eliminadas por seleção olfativa, e as restantes, inoculadas com uredosporos de P. menthae Pers. e, posteriormente, classificadas em três notas de resistência à doença. Em pleno florescimento, as plantas foram destiladas em corrente de vapor, e o óleo essencial obtido analisado em cromatógrafo de gás para avaliação quantitativa de seus componentes principais: mentol, mentona e pulegona. Destacaram-se oito progênies do clone Valinhos e catorze do Samby, respectivamente, mentol entre 75,85-85,18% e 77,12-83,74%, e pulegona entre 0,48-1,36% e 0,94-2,05% pela resistência à ferrugem. Três progênies do clone Valinhos e duas do Samby apresentaram baixos teores do mentol: 56,65, 56,94 e 60,11, e 54,26 e 64,93% respectivamente, semelhantes aos verificados nos óleos desmentolados de M. arvensis L.Seedlings froco two clones of M. arvensis L var. piperascens Malinvaud were selected by olfative test to eliminate the plants with high pulegone content in the essencial oil; the selected plants were inoculated with spore suspension of Puccinia menthae Pers., and classified in three classes of susceptibility. The blooming plants were distilled and the obtained samples of essential oil were analysed by gas chromatography to verify its menthol, menthone and pulegone contents. The data showed that the studied material presents high variability to rust resistance and menthol content in its essencial oil. Eight progenies from Valinhos clone presented high rust resistance, 75.80% to 85.18% menthol and 0.48 to
-
WHITE BLISTER SPECIES (Albuginaceae ON WEEDS
Directory of Open Access Journals (Sweden)
Karolina Vrandečić
2011-06-01
Full Text Available The obligate fungi inside the family Albuginaceae are widespread world wide and cause white rust or white blister disease. Mycopopulation of weeds has been researched within the project „The role of weeds in epidemiology of row-crop diseases“. The aim of this research was to identify white blister species occurring on weeds in Eastern Croatia. Weed plants with disease symptoms characteristic for white blister species have been collected since 2001 on location Slavonia and Baranja country. Determination of white blister species was based on morphological characters of pathogen and the host. Wilsoniana bliti was determined on Amaranthus retroflexus and Amaranthus hybridus leaves. Capsella bursa pastoris is a host for Albugo candida. Ambrosia artemisiifolia is a host for Pustula sp. and Cirsium arvense was found to be host for Pustula spinulosa. Wilsoniana portulaceae was determined on Portulaca oleracea.
-
Directory of Open Access Journals (Sweden)
Thaiza Galhardo Silva Morceli
2008-11-01
Full Text Available O objetivo deste trabalho foi identificar novos marcadores microssatélites, ligados ao gene Rpp5 de resistência à ferrugem-da-soja, e validar os marcadores previamente mapeados, para que possam ser utilizados em programas de seleção assistida por marcadores moleculares (SAM. Para tanto, uma população F2 com 100 indivíduos, derivada do cruzamento entre a PI 200526 e a cultivar Coodetec 208, suscetível à ferrugem, foi artificialmente infectada e avaliada quanto à sua reação de resistência à ferrugem. Marcadores microssatélites foram testados nos genitores e em dois "bulks" contrastantes, para a identificação de marcadores ligados. Dois novos marcadores, potencialmente associados à resistência, foram testados em plantas individuais, e se constatou que eles estão ligados ao gene Rpp5 e estão presentes no grupo de ligação N da soja. A eficiência de seleção foi determinada em relação a todos os marcadores ligados ao gene Rpp5, e a combinação entre os marcadores Sat_275+Sat_280 foi de 100%.The main objective of this work was to identify new microsatellite markers, linked to the Rpp5 resistance gene to Asian soybean rust, and to validate previously mapped markers for use in marker-assisted selection (MAS programs. To this end, a F2 population with 100 individuals, derived from crossing between PI 200526 and cultivar Coodetec 208, susceptible to rust, was artificially infected and evaluated for its reaction of resistance to rust. Microsatellite markers were tested on parents and in the two contrasting bulks to identifying linked markers. Two new markers, potentially associated with resistance, were tested in individual plants, and they were found to be linked to gene Rpp5 and to be present in the N linkage group of soybean. The selection efficiencies were determined for all markers linked to gene Rpp5, and the combination of the markers Sat_275+Sat_280 was 100%.
-
Yan, Xueming; Huang, Xiang; Ren, Jun; Zou, Zhengzhi; Yang, Shujin; Ouyang, Jing; Zeng, Weihong; Yang, Bin; Xiao, Shijun; Huang, Lusheng
2009-08-01
Diarrhoea in newborn and weaned piglets is mainly caused by enterotoxigenic Escherichia coli (ETEC) with fimbriae F4. To investigate the prevalence of resistance to three fimbrial strains, F4ab, F4ac and F4ad, among Chinese indigenous pigs and Western commercial pigs introduced into China, we determined the ETEC F4 adhesion phenotypes in 292 pure-bred piglets from three Western commercial breeds and 12 Chinese indigenous breeds, and a total of 1093 adult pigs in a White DurocxErhualian intercross, by an in vitro microscopic adhesion assay. All the Tibet and Lantang pigs and a majority of the Erhualian and Rongchang pigs were resistant (nonadherent) to ETEC F4 whereas all the Laiwu pigs and most of the Jiangquhai and Tongcheng pigs were susceptible (adhesive) to at least one of the F4 strains. Yushan Black pigs were uniformly resistant to F4ab, and Jinhua pigs were predominantly resistant to F4ac. Susceptible and resistant animals were observed in the other breeds, indicating that diarrhoea caused by ETEC F4 could be prevalent in these breeds. This study confirmed the existence of eight previously reported F4 adhesion patterns, and supported the assumption that the three F4 receptors are encoded by distinct loci. Expression of the weakly adherent phenotype was observed in six pure-bred piglets and 90 adult F(2)/F(3) animals, and the inheritance of this phenotype and its correlation with susceptibility to disease are still not known.
-
International Nuclear Information System (INIS)
Yamashita, M.; Konishi, H.; Kozakura, T.; Mizuki, J.; Uchida, H.
2005-01-01
Atmospheric corrosion of steel proceeds under thin electrolyte film formed by rain and dew condensation followed by wet and dry cycles. It is said that rust layer formed on steel as a result of atmospheric corrosion strongly affects the corrosion behavior of steel. The effect of environmental corrosiveness on the formation process and structure of the rust layer is, however, not clear to date. In this study, in situ observation of the rusting process of a carbon steel covered with a thin film of Na 2 SO 4 or NaCl solution was performed under a wet/dry repeating condition by X-ray diffraction spectroscopy with white X-rays obtained from synchrotron radiation. The present in situ experiments successfully detected initial process of the rust formation. In the early cycles, the rust constituents were not well crystallized yet, but the presence of Fe(OH) 2 and Fe(OH) 3 was confirmed. In the subsequent cycles, two different solutions resulted in difference in preferential phase of the rust constituents. α-FeOOH was preferentially formed in the case of the Na 2 SO 4 solution film, whereas β-FeOOH appeared only under the NaCl solution film
-
Jonathan D. Coop; Anna W. Schoettle
2009-01-01
Rocky Mountain bristlecone pine (Pinus aristata) and limber pine (Pinus flexilis) are important highelevation pines of the southern Rockies that are forecast to decline due to the recent spread of white pine blister rust (Cronartium ribicola) into this region. Proactive management strategies to promote the evolution of rust resistance and maintain ecosystem function...
-
Swindells, Steve; Burcikova, Mila
2013-01-01
Articulated as a practice of design-couture, conceptualized as a project that seeks a sense \\ud of social engagement through research, design and making of everyday ‘common couture’, \\ud Rusted puts craft action in a very close relation with daily (political) or practical life. Rusted \\ud designs collage pre-used fabric and clothing (found, bought or gifted) with new cloth, thus \\ud using items of fabric and clothing from different times, countries and with variety of social \\ud histories. Th...
-
Balbaert, Ivo
2015-01-01
This book is intended for software developers interested in systems level and application programming, and are looking for a quick entry into using Rust and understanding the core features of the framework. It is assumed that you have a basic understanding of Java, C#, Ruby, Python or JavaScript.
-
Directory of Open Access Journals (Sweden)
Christina Dudienas
2013-03-01
localities of São Paulo State, correlated to yield. A total of 50 simple and triple hybrids (HST and 22 double hybrids and varieties of maize (HDV in use by farmers were evaluated in 2005/2006 for their reaction to southern rust in six locations in western and north-central regions of São Paulo State. In the experiments with HST, the most resistant cultivars with the highest yields were: 30F80, 30F90, 30K73, AG 7000, DAS 2B710, DKB 191, DKB 466 and Impacto. Among HDV, the most resistant ones presenting the highest yields were: 30S40 and AG 2040. Yield losses due to the severity of southern rust, assessed in the stage of pastry grain, ranged from 3.5%, for cultivars with approximately 2.5% of leaf area affected by the disease, to 20.3% for cultivars with 39% of the leaf area affected, compared to cultivars of higher resistance to the disease (1.4% affected leaf area.
-
Nuclear and allied approaches in improvement of wheat for disease and pest resistance
Energy Technology Data Exchange (ETDEWEB)
Sawhney, R N
1987-09-01
The paper attempts to review information on the role of physical and chemical mutagens used directly and indirectly in the improvement of wheat for disease and pest resistance. The illustrations relate to transfer of many useful genes for resistance to rusts and pest from alien sources to Triticum aestivum. Popular wheats have been rectified for resistance to rusts mostly without any negative effects on yield potential. The mutation approach has also been successful in the development of multilines. Multiline constituting mutant components conferring simultaneous resistance to more than one rust pathogen has an additional value. The use of induced mutagenesis in breaking linkage between the genes conferring resistance and other genes for undesirable characters has been described. New disease resistant mutant variations with additional changes of positive effect have been obtained for practical utilization with widening the genetic base of future breeding programmes. (author). 56 refs.
-
Molecular and genetic study of wheat rusts | Le Maitre | African ...
African Journals Online (AJOL)
Microsatellite markers were used to differentiate P. triticina and P. striiformis pathotypes. Amplified fragment length polymorphisms (AFLP) were used to differentiate stem rust P. graminis pathotypes. Phylogenetic trees were created for leaf and stem rust pathotypes. Field isolates of leaf, stem and yellow rust were collected ...
-
Leaf rust, caused by Puccinia triticina Eriks., is one of the most widespread diseases of wheat worldwide and breeding for resistance is one of the most effective methods of control. Lr16 is a wheat leaf rust resistance gene that provides resistance at both the seedling and adult stages. Simple s...
-
Painting rusted steel: The role of aluminum phosphosilicate
International Nuclear Information System (INIS)
Roselli, S.N.; Amo, B. del; Carbonari, R.O.; Di Sarli, A.R.; Romagnoli, R.
2013-01-01
Highlights: •Aluminum phosphosilicate is an acid pigment which could act as mild phosphating agent. •Aluminum phosphosilicate can phosphatize iron oxides on rusted surfaces. •Aluminum phosphosilicate is compatible with acid binders. •Aluminum phosphosilicate could replace chromate in complete painting schemes. •Aluminum phosphosilicate primers improve paints adhesion on rusted surfaces. -- Abstract: Surface preparation is a key factor for the adequate performance of a paint system. The aim of this investigation is to employ a wash-primer to accomplish the chemical conversion of rusted surface when current cleaning operations are difficult to carry out. The active component of the wash-primer was aluminum phosphosilicate whose electrochemical behavior and the composition of the generated protective layer, both, were studied by electrochemical techniques and scanning electron microscopy (SEM), respectively. Primed rusted steel panels were coated with an alkyd system to perform accelerated tests in the salt spray chamber and electrochemical impedance measurements (EIS). These tests were conducted in parallel with a chromate wash primer and the same alkyd system. Results showed that the wash-primer containing aluminum phosphosilicate could be used satisfactorily to paint rusted steel exhibiting a similar performance to the chromate primer
-
Relationship between sugarcane rust severity and soil properties in louisiana.
Johnson, Richard M; Grisham, Michael P; Richard, Edward P
2007-06-01
ABSTRACT The extent of spatial and temporal variability of sugarcane rust (Puccinia melanocephala) infestation was related to variation in soil properties in five commercial fields of sugarcane (interspecific hybrids of Saccharum spp., cv. LCP 85-384) in southern Louisiana. Sugarcane fields were grid-soil sampled at several intensities and rust ratings were collected at each point over 6 to 7 weeks. Soil properties exhibited significant variability (coefficients of variation = 9 to 70.1%) and were spatially correlated in 39 of 40 cases with a range of spatial correlation varying from 39 to 201 m. Rust ratings were spatially correlated in 32 of 33 cases, with a range varying from 29 to 241 m. Rust ratings were correlated with several soil properties, most notably soil phosphorus (r = 0.40 to 0.81) and soil sulfur (r = 0.36 to 0.68). Multiple linear regression analysis resulted in coefficients of determination that ranged from 0.22 to 0.73, and discriminant analysis further improved the overall predictive ability of rust models. Finally, contour plots of soil properties and rust levels clearly suggested a link between these two parameters. These combined data suggest that sugarcane growers that apply fertilizer in excess of plant requirements will increase the incidence and severity of rust infestations in their fields.
-
Host jumps shaped the diversity of extant rust fungi (Pucciniales).
McTaggart, Alistair R; Shivas, Roger G; van der Nest, Magriet A; Roux, Jolanda; Wingfield, Brenda D; Wingfield, Michael J
2016-02-01
The aim of this study was to determine the evolutionary time line for rust fungi and date key speciation events using a molecular clock. Evidence is provided that supports a contemporary view for a recent origin of rust fungi, with a common ancestor on a flowering plant. Divergence times for > 20 genera of rust fungi were studied with Bayesian evolutionary analyses. A relaxed molecular clock was applied to ribosomal and mitochondrial genes, calibrated against estimated divergence times for the hosts of rust fungi, such as Acacia (Fabaceae), angiosperms and the cupressophytes. Results showed that rust fungi shared a most recent common ancestor with a mean age between 113 and 115 million yr. This dates rust fungi to the Cretaceous period, which is much younger than previous estimations. Host jumps, whether taxonomically large or between host genera in the same family, most probably shaped the diversity of rust genera. Likewise, species diversified by host shifts (through coevolution) or via subsequent host jumps. This is in contrast to strict coevolution with their hosts. Puccinia psidii was recovered in Sphaerophragmiaceae, a family distinct from Raveneliaceae, which were regarded as confamilial in previous studies. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
-
Carbohydrates, Dietary Fiber, and Resistant Starch in White Vegetables: Links to Health Outcomes12
Slavin, Joanne L.
2013-01-01
Vegetables are universally promoted as healthy. Dietary Guidelines for Americans 2010 recommend that you make half of your plate fruits and vegetables. Vegetables are diverse plants that vary greatly in energy content and nutrients. Vegetables supply carbohydrates, dietary fiber, and resistant starch in the diet, all of which have been linked to positive health outcomes. Fiber lowers the incidence of cardiovascular disease and obesity. In this paper, the important role of white vegetables in the human diet is described, with a focus on the dietary fiber and resistant starch content of white vegetables. Misguided efforts to reduce consumption of white vegetables will lower intakes of dietary fiber and resistant starch, nutrients already in short supply in our diets. PMID:23674804
-
Dutta, Summi; Kumar, Dhananjay; Jha, Shailendra; Prabhu, Kumble Vinod; Kumar, Manish; Mukhopadhyay, Kunal
2017-11-01
A novel leaf rust responsive ta-siRNA-producing locus was identified in wheat showing similarity to 28S rRNA and generated four differentially expressing ta-siRNAs by phasing which targeted stress responsive genes. Trans-acting-small interfering RNAs (Ta-siRNAs) are plant specific molecules generally involved in development and are also stress responsive. Ta-siRNAs identified in wheat till date are all responsive to abiotic stress only. Wheat cultivation is severely affected by rusts and leaf rust particularly affects grain filling. This study reports a novel ta-siRNA producing locus (TAS) in wheat which is a segment of 28S ribosomal RNA but shows differential expression during leaf rust infestation. Four small RNA libraries prepared from wheat Near Isogenic Lines were treated with leaf rust pathogen and compared with untreated controls. A TAS with the ability to generate four ta-siRNAs by phasing events was identified along with the microRNA TamiR16 as the phase initiator. The targets of the ta-siRNAs included α-gliadin, leucine rich repeat, trans-membrane proteins, glutathione-S-transferase, and fatty acid desaturase among others, which are either stress responsive genes or are essential for normal growth and development of plants. Expression of the TAS, its generated ta-siRNAs, and their target genes were profiled at five different time points after pathogen inoculation of susceptible and resistant wheat isolines and compared with mock-inoculated controls. Comparative analysis of expression unveiled differential and reciprocal relationship as well as discrete patterns between susceptible and resistant isolines. The expression profiles of the target genes of the identified ta-siRNAs advocate more towards effector triggered susceptibility favouring pathogenesis. The study helps in discerning the functions of wheat genes regulated by ta-siRNAs in response to leaf rust.
-
Frequency of comandra blister rust infection episodes on lodgepole pine
William R. Jacobi; Brian W. Geils; Jane E. Taylor
2002-01-01
Comandra blister rust is a damaging canker disease of lodgepole pine in the Central Rocky Mountains. Our knowledge of previous blister rust outbreaks and the effects of weather and climate on rust epidemiology has not been sufficient to explain the frequency and severity of disease outbreaks. Thus, we sought to describe the seasonal and annual frequency and duration of...
-
Ruan, Liu; Wang, Rui; Liu, Qi; Ma, Zhanhong; Li, Xiaolong; Cheng, Pei; Wang, Haiguang
2016-01-01
It is important to implement detection and assessment of plant diseases based on remotely sensed data for disease monitoring and control. Hyperspectral data of healthy leaves, leaves in incubation period and leaves in diseased period of wheat stripe rust and wheat leaf rust were collected under in-field conditions using a black-paper-based measuring method developed in this study. After data preprocessing, the models to identify the diseases were built using distinguished partial least squares (DPLS) and support vector machine (SVM), and the disease severity inversion models of stripe rust and the disease severity inversion models of leaf rust were built using quantitative partial least squares (QPLS) and support vector regression (SVR). All the models were validated by using leave-one-out cross validation and external validation. The diseases could be discriminated using both distinguished partial least squares and support vector machine with the accuracies of more than 99%. For each wheat rust, disease severity levels were accurately retrieved using both the optimal QPLS models and the optimal SVR models with the coefficients of determination (R2) of more than 0.90 and the root mean square errors (RMSE) of less than 0.15. The results demonstrated that identification and severity evaluation of stripe rust and leaf rust at the leaf level could be implemented based on the hyperspectral data acquired using the developed method. A scientific basis was provided for implementing disease monitoring by using aerial and space remote sensing technologies. PMID:27128464
-
Wang, Hui; Qin, Feng; Ruan, Liu; Wang, Rui; Liu, Qi; Ma, Zhanhong; Li, Xiaolong; Cheng, Pei; Wang, Haiguang
2016-01-01
It is important to implement detection and assessment of plant diseases based on remotely sensed data for disease monitoring and control. Hyperspectral data of healthy leaves, leaves in incubation period and leaves in diseased period of wheat stripe rust and wheat leaf rust were collected under in-field conditions using a black-paper-based measuring method developed in this study. After data preprocessing, the models to identify the diseases were built using distinguished partial least squares (DPLS) and support vector machine (SVM), and the disease severity inversion models of stripe rust and the disease severity inversion models of leaf rust were built using quantitative partial least squares (QPLS) and support vector regression (SVR). All the models were validated by using leave-one-out cross validation and external validation. The diseases could be discriminated using both distinguished partial least squares and support vector machine with the accuracies of more than 99%. For each wheat rust, disease severity levels were accurately retrieved using both the optimal QPLS models and the optimal SVR models with the coefficients of determination (R2) of more than 0.90 and the root mean square errors (RMSE) of less than 0.15. The results demonstrated that identification and severity evaluation of stripe rust and leaf rust at the leaf level could be implemented based on the hyperspectral data acquired using the developed method. A scientific basis was provided for implementing disease monitoring by using aerial and space remote sensing technologies.
-
Wheat rusts in the United States in 2016
In 2016, wheat stripe rust caused by Puccinia striiformis f. sp. graminis was widespread throughout the United States. Cool temperatures and abundant rainfall in the southern Great Plains allowed stripe rust to become widely established and spread throughout the Great Plains and eastern United State...
-
Incorporation of Monovalent Cations in Sulfate Green Rust
DEFF Research Database (Denmark)
Christiansen, B. C.; Dideriksen, K.; Katz, A.
2014-01-01
Green rust is a naturally occurring layered mixed-valent ferrous-ferric hydroxide, which can react with a range of redox-active compounds. Sulfate-bearing green rust is generally thought to have interlayers composed of sulfate and water. Here, we provide evidence that the interlayers also contain...... with water showed that Na+ and K+ were structurally fixed in the interlayer, whereas Rb+ and Cs+ could be removed, resulting in a decrease in the basal layer spacing. The incorporation of cations in the interlayer opens up new possibilities for the use of sulfate green rust for exchange reactions with both...
-
Rust fungi on some poaceous weeds of wheat crops in Pakistan
NAJAM-UL-SEHAR AFSHAN*; ABDUL REHMAN NIAZI
2013-01-01
The article enlists common poaceous weeds found in wheat crop sand their specific parasitic rust fungi. In this study, four (04) plant taxa of Poaceae infected with rust fungi are collected from different wheat crops grown in different areas of Pakistan. The rust fungi are isolated, characterized and identified. All these host plants are known weeds of wheat crop in Pakistan. This work would help to identify and enlist the potential rust fungi on weeds of wheat crop that could be utilized to ...
-
Xia, Chongjing; Wang, Meinan; Cornejo, Omar E; Jiwan, Derick A; See, Deven R; Chen, Xianming
2017-01-01
Stripe (yellow) rust, caused by Puccinia striiformis f. sp. tritici ( Pst ), is one of the most destructive diseases of wheat worldwide. Planting resistant cultivars is an effective way to control this disease, but race-specific resistance can be overcome quickly due to the rapid evolving Pst population. Studying the pathogenicity mechanisms is critical for understanding how Pst virulence changes and how to develop wheat cultivars with durable resistance to stripe rust. We re-sequenced 7 Pst isolates and included additional 7 previously sequenced isolates to represent balanced virulence/avirulence profiles for several avirulence loci in seretome analyses. We observed an uneven distribution of heterozygosity among the isolates. Secretome comparison of Pst with other rust fungi identified a large portion of species-specific secreted proteins, suggesting that they may have specific roles when interacting with the wheat host. Thirty-two effectors of Pst were identified from its secretome. We identified candidates for Avr genes corresponding to six Yr genes by correlating polymorphisms for effector genes to the virulence/avirulence profiles of the 14 Pst isolates. The putative AvYr76 was present in the avirulent isolates, but absent in the virulent isolates, suggesting that deleting the coding region of the candidate avirulence gene has produced races virulent to resistance gene Yr76 . We conclude that incorporating avirulence/virulence phenotypes into correlation analysis with variations in genomic structure and secretome, particularly presence/absence polymorphisms of effectors, is an efficient way to identify candidate Avr genes in Pst . The candidate effector genes provide a rich resource for further studies to determine the evolutionary history of Pst populations and the co-evolutionary arms race between Pst and wheat. The Avr candidates identified in this study will lead to cloning avirulence genes in Pst , which will enable us to understand molecular mechanisms
-
Moessbauer Characterization of Rust Obtained in an Accelerated Corrosion Test
International Nuclear Information System (INIS)
Garcia, K. E.; Morales, A. L.; Arroyave, C. E.; Barrero, C. A.; Cook, D. C.
2003-01-01
We have performed drying-humectation cyclical processes (CEBELCOR) on eight A36 low carbon steel coupons in NaCl solutions containing 1x10 -2 M and 1x10 -1 M concentrations. The main purpose of these experiments is to contribute to the understanding of the conditions for akaganeite formation. Additionally, and with the idea to perform a complete characterization of the rust, this work also considers the formation of other iron oxide phases. The corrosion products were characterized by Moessbauer spectroscopy and X-ray diffraction techniques. Gravimetric analysis demonstrates that the coupons presented high corrosion rates. Magnetite/maghemite was common in the rust stuck to the steel surface, whereas akaganeite was present only in traces. In the rust collected from the solutions, i.e., the rust that goes away from the metal surface easily, a magnetite/maghemite was not present and akaganeite showed up in larger quantities. These results support the idea that high concentrations of Cl - ions are required for the akaganeite formation. We concluded that akaganeite is not easily bonded to the rust layer; this may lead to the formation of a less protective rust layer and to higher corrosion rates.
-
Directory of Open Access Journals (Sweden)
Eduardo Alano Vieira
2006-04-01
Full Text Available Os objetivos deste trabalho foram: determinar o padrão de resistência/suscetibilidade de 20 genótipos de aveia a 40 isolados de Puccinia coronata f. sp. avenae, coletados em três municípios do Rio Grande do Sul; o padrão de virulência/avirulência desses isolados contra os genótipos de aveia; e indicar genitores para a geração de populações com elevada resistência à ferrugem-da-folha. Os padrões de resistência de Puccinia coronata f. sp. avenae e o de virulência/avirulência dos isolados foram determinados pela avaliação da reação desencadeada pela aspersão dos isolados deste fungo em plântulas de genótipos de aveia. A seleção de genitores foi baseada no índice de complementação de cultivares, proposto neste trabalho. Os genótipos que expressaram resistência ao maior número de isolados foram FAPA6, URS20, UPFA20, CFT1 e FAPA5, ao passo que os genótipos UFRGS15, UPF15, UPF18, UPF19 e UPF16 evidenciaram suscetibilidade ao maior número de isolados. Os cruzamentos mais indicados entre os genótipos estudados são: FAPA6 x Albasul, URS22 x FAPA6, CFT1 x URPEL15 e CFT1 x UFRGS19.The objectives of this work were: to determine the resistance/susceptibility pattern of 20 elite oat genotypes to 40 isolates of Puccinia coronata f. sp. avenae; to determine the pattern of virulence/avirulence of isolates collected in three counties of Rio Grande do Sul to the oat genotypes studied; and to indicate potential parents for the generation of populations with high crown rust resistance. The resistance pattern of oat genotypes and the virulence/avirulence of the fungi were determined by the analysis of the reaction incited by the inoculation of Puccinia coronata f. sp. avenae isolates into seedlings of oat genotypes. The selection of genitors was based on the cultivar complementation index proposed in this work. Genotypes expressing resistance to the larger number of isolates were FAPA6, URS20, UPFA20, CFT1 and FAPA5, while UFRGS15
-
Creation and validation of a simulator for corneal rust ring removal.
Mednick, Zale; Tabanfar, Reza; Alexander, Ashley; Simpson, Sarah; Baxter, Stephanie
2017-10-01
To create and validate a simulation model for corneal rust ring removal. Rust rings were created on cadaveric eyes with the use of small particles of metal. The eyes were mounted on suction plates at slit lamps and the trainees practiced rust ring removal. An inexperienced cohort of medical students and first year ophthalmology residents (n=11), and an experienced cohort of senior residents and faculty (n=11) removed the rust rings from the eyes with the use of a burr. Rust ring removal was evaluated based on removal time, percentage of rust removed and incidence of corneal perforation. A survey was administered to participants to determine face validity. Time for rust ring removal was longer in the inexperienced group at 187±93 seconds (range of 66-408 seconds), compared to the experienced group at 117±54 seconds (range of 55-240 seconds) (p=0.046). Removal speed was similar between groups, at 4847±4355 pixels/minute and 7206±5181 pixels/minute in the inexperienced and experienced groups, respectively (p=0.26). Removal percentage values were similar between groups, at 61±15% and 69±18% (p=0.38). There were no corneal perforations. 100% (22/22) of survey respondents believed the simulator would be a valuable practice tool, and 89% (17/19) felt the simulation was a valid representation of the clinical correlate. The corneal rust ring simulator presented here is a valid training tool that could be used by early trainees to gain greater comfort level before attempting rust ring removal on a live patient. Copyright © 2017 Canadian Ophthalmological Society. Published by Elsevier Inc. All rights reserved.
-
First Detection of Bat White-Nose Syndrome in Western North America.
Lorch, Jeffrey M; Palmer, Jonathan M; Lindner, Daniel L; Ballmann, Anne E; George, Kyle G; Griffin, Kathryn; Knowles, Susan; Huckabee, John R; Haman, Katherine H; Anderson, Christopher D; Becker, Penny A; Buchanan, Joseph B; Foster, Jeffrey T; Blehert, David S
2016-01-01
White-nose syndrome (WNS) is an emerging fungal disease of bats caused by Pseudogymnoascus destructans. Since it was first detected near Albany, NY, in 2006, the fungus has spread across eastern North America, killing unprecedented numbers of hibernating bats. The devastating impacts of WNS on Nearctic bat species are attributed to the likely introduction of P. destructans from Eurasia to naive host populations in eastern North America. Since 2006, the disease has spread in a gradual wavelike pattern consistent with introduction of the pathogen at a single location. Here, we describe the first detection of P. destructans in western North America in a little brown bat (Myotis lucifugus) from near Seattle, WA, far from the previously recognized geographic distribution of the fungus. Whole-genome sequencing and phylogenetic analyses indicated that the isolate of P. destructans from Washington grouped with other isolates of a presumed clonal lineage from the eastern United States. Thus, the occurrence of P. destructans in Washington does not likely represent a novel introduction of the fungus from Eurasia, and the lack of intensive surveillance in the western United States makes it difficult to interpret whether the occurrence of P. destructans in the Pacific Northwest is disjunct from that in eastern North America. Although there is uncertainty surrounding the impacts of WNS in the Pacific Northwest, the presence of the pathogen in western North America could have major consequences for bat conservation. IMPORTANCE White-nose syndrome (WNS) represents one of the most consequential wildlife diseases of modern times. Since it was first documented in New York in 2006, the disease has killed millions of bats and threatens several formerly abundant species with extirpation or extinction. The spread of WNS in eastern North America has been relatively gradual, inducing optimism that disease mitigation strategies could be established in time to conserve bats susceptible
-
International Nuclear Information System (INIS)
Konishi, Hiroyuki; Mizuki, Jun'ichiro; Yamashita, Masato; Uchida, Hitoshi
2004-01-01
Cl K-edge XANES measurements of atmospheric corrosion products (rust) formed on Fe, Fe-Ni and Fe-Cr alloys in chloride pollution have been performed using synchrotron radiation in order to clarify roles of anticorrosive alloying elements and of Cl in the corrosion resistance of weathering steel. The spectra of binary alloys show a shoulder structure near the absorption edge. The intensity of the shoulder peak depends on the kind and amount of the alloying element, whereas the energy position is invariant. This indicates that Cl is not combined directly with alloying elements in the rust. (author)
-
African Journals Online (AJOL)
Owner
Om te trek is om jou kortstondig in 'n liminale staat te bevind. Nóg by jou vertrekpunt, nóg by jou uiteindelike bestemming, sonder die geborgenheid wat hierdie twee vaste plekke kwansuis bied. In 'n hele aantal opsigte is Trek van Winnie Rust 'n beskrywing van verskil- lende liminale state. Dit is egter nie 'n reisverhaal met ...
-
Correlation between RUST assessments of fracture healing to structural and biomechanical properties.
Cooke, Margaret E; Hussein, Amira I; Lybrand, Kyle E; Wulff, Alexander; Simmons, Erin; Choi, Jeffrey H; Litrenta, Jody; Ricci, William M; Nascone, Jason W; O'Toole, Robert V; Morgan, Elise F; Gerstenfeld, Louis C; Tornetta, Paul
2018-03-01
Radiographic Union Score for Tibia (RUST) and modified RUST (mRUST) are radiographic tools for quantitatively evaluating fracture healing using a cortical scoring system. This tool has high intra-class correlation coefficients (ICCs); however, little evidence has evaluated the scores against the physical properties of bone healing. Closed, stabilized fractures were made in the femora of C3H/HeJ male mice (8-12 week-old) of two dietary groups: A control and a phosphate restricted diet group. Micro-computed tomography (µCT) and torsion testing were carried out at post-operative days (POD) 14, 21, 35, and 42 (n = 10-16) per group time-point. Anteroposterior and lateral radiographic views were constructed from the µCT scans and scored by five raters. The raters also indicated if the fracture were healed. ICCs were 0.71 (mRUST) and 0.63 (RUST). Both RUST scores were positively correlated with callus bone mineral density (BMD) (r = 0.85 and 0.80, p RUST scores positively correlated with callus strength (r = 0.35 and 0.26, p RUST ≥10 and had excellent relationship to structural and biomechanical metrics. Effect of delayed healing due to phosphate dietary restrictions was found at later time points with all mechanical properties (p RUST scores (p > 0.318). Clinical relevance of this study is both RUST scores showed high correlation to physical properties of healing and generally distinguished healed vs. non-healed fractures. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 36:945-953, 2018. © 2017 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.
-
Duplications and losses in gene families of rust pathogens highlight putative effectors.
Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M
2014-01-01
Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.
-
Directory of Open Access Journals (Sweden)
Aliny Simony Ribeiro
2009-11-01
Full Text Available The objective of this work was to identify the best selection strategies for the more promising parental combinations to obtain lines with good resistance to soybean Asian rust (Phakopsora pachyrhizi. Two experiments were carried out in the field during the 2006/2007 and 2007/2008 growing seasons, to determine the percentage of infected leaf area of individual plants of five parents and their segregant F2 and F3 populations. The data obtained indicates that additive genetic variance predominates in the control of soybean resistance to Asian rust, and that the year and time of assessment do not significantly influence the estimates of the genetic parameters obtained. The narrow-sense heritability (h²r ranged from 23.12 to 55.83%, and indicates the possibility of successful selection of resistant individuals in the early generations of the breeding program. All the procedures used to select the most promising populations to generate superior inbred lines for resistance to P. pachyrhizi presented similar results and identified the BR01-18437 x BRS 232 population as the best for inbred line selection.O objetivo deste estudo foi identificar as estratégias mais eficientes para selecionar as combinações parentais mais promissoras e obter linhas com bom grau de resistência à ferrugem-asiática da soja (Phakopsora pachyrhizi. Dois experimentos foram realizados em campo nos anos agrícolas 2006/2007 e 2007/2008, para avaliar a percentagem da área foliar infectada em plantas individuais de cinco parentais e das suas populações segregantes F2 e F3. Os dados obtidos indicam que a variância genética aditiva predomina no controle da resistência da soja à ferrugem-asiática e que os anos e as épocas de avaliação não influenciaram significativamente as estimativas dos parâmetros genéticos obtidos. A herdabilidade no sentido restrito (h²r variou de 23,12 a 55,83%, o que indica a possibilidade de sucesso com a seleção de indiv
-
A rapid method for extracting eriophyoid mites was adapted from previous studies to provide growers and IPM consultants with a practical, efficient, and reliable tool to monitor for rust mites in vineyards. The rinse in bag (RIB) method allows quick extraction of mites from collected plant parts (sh...
-
International Nuclear Information System (INIS)
Nabulsi, I.; Al-Safadi, B.; Mir ali, N.; Arabi, M.I.E.
2002-01-01
Random amplified polymorphic DNA (RAPD) analysis was used to evaluate genetic diversity among eight garlic mutants resistant to white rot disease (Sclerotium cepivorum) and two controls. Twelve of 13 synthetic random primers were found to identify polymorphism in amplification products. Mutants characterised with moderate resistance to white rot were closely related to the control using cluster and correlation analyses. On the other hand, highly resistant mutants were quite distant from the control with low correlation coefficients. The banding patterns produced by primer OPB-15 (GGAAGGGTGTT) with highly resistant mutants may be used as genetic markers for early selection of resistant plants. (author)
-
Constance I. Millar; Bohun B. Kinloch; Robert D. Westfall
1992-01-01
Genetic diversity in sugar plne will be severely reduced by the blister rust pandemic predicted within the next 50 to 75 years. We model effects of the epidemic on genetic diversity at the stand and landscape levels for both natural and artificial regeneration. In natural stands, because natural frequencies of the dominant gene (R) for resistance are low, the most...
-
Aecidium kalanchoe sp. nov., a new rust on Kalanchoe blossfeldiana (Crassulaceae).
Hernádez, José R; Aime, M Catherine; Newbry, Brad
2004-07-01
A rust fungus found on cultivars of Kalanchoe blossfeldiana (Crassulaceae) is described as a new species, Aecidium kalanchoe sp. nov., and compared to the other described rusts on members of the Crassulaceae. Only one other rust is known to parasitize Kalanchoe spp. A DNA sequence of A. kalanchoe suggests that the teleomorph is related to Puccinia.
-
Kinetics of structural rust transformation in environments containing chloride and SO2
International Nuclear Information System (INIS)
Rendon, J. L.; Valencia, A.
2003-01-01
The behaviour of the rusts produced on low carbon steel exposed in industrial atmospheres, at different distances from the sea, was studied by simulating the wetting-drying cycle in a CEBELCOR type apparatus. Coupons electrode potential was monitored and rust layer was analyzed by gravimetric techniques, optical microscopy and Moessbauer spectroscopy. A particular chloride/sulfur ratio in the atmosphere was found, for which there is a particular behaviour in rust formation. For this ratio, corrosion rates were much less than expected. it is postulated a kinetic mechanism for rust layer formation as the origin of this special behavior. An electrode potential similar to that in a weathering steel was observed, this is reflected in the low corrosion rate obtained. The proposed kinetic mechanism for rust formation under these exposure conditions enables new research lines on layer formation and the development of protective rust for industrial marine atmospheres. (Author) 8 refs
-
Duplications and losses in gene families of rust pathogens highlight putative effectors
Directory of Open Access Journals (Sweden)
Amanda L. Pendleton
2014-06-01
Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.
-
David W. Johnson
1986-01-01
Commandra blister rust is a disease of hard pines that is caused by a fungus growing in the inner bark. The fungus (Cronartium commandrae Pk.) has a complex life cycle. It infects hard pines but needs an alternate host, an unrelated plant, to spread from one pine to another.
-
Weather and Climate Indicators for Coffee Rust Disease
Georgiou, S.; Imbach, P. A.; Avelino, J.; Anzueto, F.; del Carmen Calderón, G.
2014-12-01
Coffee rust is a disease that has significant impacts on the livelihoods of those who are dependent on the Central American coffee sector. Our investigation has focussed on the weather and climate indicators that favoured the high incidence of coffee rust disease in Central America in 2012 by assessing daily temperature and precipitation data available from 81 weather stations in the INSIVUMEH and ANACAFE networks located in Guatemala. The temperature data were interpolated to determine the corresponding daily data at 1250 farms located across Guatemala, between 400 and 1800 m elevation. Additionally, CHIRPS five day (pentad) data has been used to assess the anomalies between the 2012 and the climatological average precipitation data at farm locations. The weather conditions in 2012 displayed considerable variations from the climatological data. In general the minimum daily temperatures were higher than the corresponding climatology while the maximum temperatures were lower. As a result, the daily diurnal temperature range was generally lower than the corresponding climatological range, leading to an increased number of days where the temperatures fell within the optimal range for either influencing the susceptibility of the coffee plants to coffee rust development during the dry season, or for the development of lesions on the coffee leaves during the wet season. The coffee rust latency period was probably shortened as a result, and farms at high altitudes were impacted due to these increases in minimum temperature. Factors taken into consideration in developing indicators for coffee rust development include: the diurnal temperature range, altitude, the environmental lapse rate and the phenology. We will present the results of our study and discuss the potential for each of the derived weather and climatological indicators to be used within risk assessments and to eventually be considered for use within an early warning system for coffee rust disease.
-
Oviposition Behaviors in Relation to Rotation Resistance in the Western Corn Rootworm
Knolhoff, L.M.; Glas, J.J.; Spencer, J.L.; Berenbaum, M.R.
2010-01-01
Across a large area of the midwestern United States Corn Belt, the western corn rootworm beetle (Diabrotica virgifera virgifera LeConte, Coleoptera: Chrysomelidae) exhibits behavioral resistance to annual crop rotation. Resistant females exhibit increased locomotor activity and frequently lay eggs
-
Coprecipitation of Arsenate and Arsenite with Green Rust Minerals
The objectives of this experiment were to evaluate the extent and nature of arsenic co-precipitation with green rusts and to examine the influence of arsenic incorporation on the mineralogy of formed solid phases. Stoichiometric green rusts were obtained by coprecipitation of fe...
-
Directory of Open Access Journals (Sweden)
M. SERENIUS
2008-12-01
Full Text Available Disease infection in relation to sowing time of winter rye (Secale cereale was studied in southern Finland in order to compare overwintering capacity of modern rye varieties and to give recommendations for rye cultivation. This was done by using three sowing times and four rye varieties in field trials conducted at three locations in 19992001. The early sown rye (beginning of August was severely affected by diseases caused by Puccinia recondita and Microdochium nivale, whereas postponing sowing for two weeks after the recommended sowing time resulted in considerably less infection. The infection levels of diseases differed among rye varieties. Finnish rye varieties Anna and Bor 7068 were more resistant to snow mould and more winter hardy than the Polish variety Amilo, or the German hybrid varieties Picasso and Esprit. However, Amilo was the most resistant to leaf rust. In the first year snow mould appeared to be the primary cause of winter damage, but in the second year the winter damage was positively correlated with leaf rust. No significant correlation between frit fly infestation and winter damage or disease incidence of snow mould or leaf rust was established. The late sowing of rye (in the beginning of September is recommended in Finland, particularly with hybrid varieties, to minimize the need for chemical plant protection in autumn.;
-
Glyphosate Control of Orange and Brown Rusts in Glyphosate-Sensitive Sugarcane Cultivars
Technical Abstract: Brown and orange rust diseases cause substantial yield reductions on sugarcane (Saccharum spp.) in Florida and other regions where sugarcane is grown. Brown rust caused by Puccinia melanocephala Syd. & P. Syd has been present in Florida since 1978 and orange rust caused by Pucci...
-
Steve McKeand; Saul Garcia; Josh Steiger; Jim Grissom; Ross Whetten; Fikret. Isik
2012-01-01
The elite breeding populations of loblolly pine (Pinus taeda L.) in the North Carolina State University Cooperative Tree Improvement Program are intensively managed for short-term genetic gain. Fusiform rust disease, caused by the fungus Cronartium quercuum f. sp. fusiforme, is the most economically...
-
The genome sequence and effector complement of the flax rust pathogen Melampsora lini
Directory of Open Access Journals (Sweden)
Adnane eNemri
2014-03-01
Full Text Available Rust fungi cause serious yield reductions on crops, including wheat, barley, soybean, coffee, and represent real threats to global food security. Of these fungi, the flax rust pathogen Melampsora lini has been developed extensively over the past 80 years as a model to understand the molecular mechanisms that underpin pathogenesis. During infection, M. lini secretes virulence effectors to promote disease. The number of these effectors, their function and their degree of conservation across rust fungal species is unknown. To assess this, we sequenced and assembled de novo the genome of M. lini isolate CH5 into 21,130 scaffolds spanning 189 Mbp (scaffold N50 of 31 kbp. Global analysis of the DNA sequence revealed that repetitive elements, primarily retrotransposons, make up at least 45% of the genome. Using ab initio predictions, transcriptome data and homology searches, we identified 16,271 putative protein-coding genes. An analysis pipeline was then implemented to predict the effector complement of M. lini and compare it to that of the poplar rust, wheat stem rust and wheat stripe rust pathogens to identify conserved and species-specific effector candidates. Previous knowledge of four cloned M. lini avirulence effector proteins and two basidiomycete effectors was used to optimise parameters of the effector prediction pipeline. Markov clustering based on sequence similarity was performed to group effector candidates from all four rust pathogens. Clusters containing at least one member from M. lini were further analysed and prioritized based on features including expression in isolated haustoria and infected leaf tissue and conservation across rust species. Herein, we describe 200 of 940 clusters that ranked highest on our priority list, representing 725 flax rust candidate effectors. Our findings on this important model rust species provide insight into how effectors of rust fungi are conserved across species and how they may act to promote
-
The genome sequence and effector complement of the flax rust pathogen Melampsora lini.
Nemri, Adnane; Saunders, Diane G O; Anderson, Claire; Upadhyaya, Narayana M; Win, Joe; Lawrence, Gregory J; Jones, David A; Kamoun, Sophien; Ellis, Jeffrey G; Dodds, Peter N
2014-01-01
Rust fungi cause serious yield reductions on crops, including wheat, barley, soybean, coffee, and represent real threats to global food security. Of these fungi, the flax rust pathogen Melampsora lini has been developed most extensively over the past 80 years as a model to understand the molecular mechanisms that underpin pathogenesis. During infection, M. lini secretes virulence effectors to promote disease. The number of these effectors, their function and their degree of conservation across rust fungal species is unknown. To assess this, we sequenced and assembled de novo the genome of M. lini isolate CH5 into 21,130 scaffolds spanning 189 Mbp (scaffold N50 of 31 kbp). Global analysis of the DNA sequence revealed that repetitive elements, primarily retrotransposons, make up at least 45% of the genome. Using ab initio predictions, transcriptome data and homology searches, we identified 16,271 putative protein-coding genes. An analysis pipeline was then implemented to predict the effector complement of M. lini and compare it to that of the poplar rust, wheat stem rust and wheat stripe rust pathogens to identify conserved and species-specific effector candidates. Previous knowledge of four cloned M. lini avirulence effector proteins and two basidiomycete effectors was used to optimize parameters of the effector prediction pipeline. Markov clustering based on sequence similarity was performed to group effector candidates from all four rust pathogens. Clusters containing at least one member from M. lini were further analyzed and prioritized based on features including expression in isolated haustoria and infected leaf tissue and conservation across rust species. Herein, we describe 200 of 940 clusters that ranked highest on our priority list, representing 725 flax rust candidate effectors. Our findings on this important model rust species provide insight into how effectors of rust fungi are conserved across species and how they may act to promote infection on their
-
Rust Inhibitor And Fungicide For Cooling Systems
Adams, James F.; Greer, D. Clay
1988-01-01
Mixture of benzotriazole, benzoic acid, and fungicide prevents growth of rust and fungus. Water-based cooling mixture made from readily available materials prevents formation of metallic oxides and growth of fungi in metallic pipes. Coolant remains clear and does not develop thick sludge tending to collect in low points in cooling systems with many commercial rust inhibitors. Coolant compatible with iron, copper, aluminum, and stainless steel. Cannot be used with cadmium or cadmium-plated pipes.
-
Insecticide resistance in the western flower thrips, Frankliniella occidentalis
DEFF Research Database (Denmark)
Jensen, Sten Erik
of acetylcholinesterase, the target site enzyme for methiocarb. The results from bioassays with synergists included indicated involvement of cytochrome P450- monooxygenases and esterases in methiocarb resistance in the most resistant populations. Selection with methiocarb on one of the populations to increase the level......The western flower thrips, Frankliniella occidentalis (Pergande) is a serious pest on a wide range of crops throughout the world. In Denmark F. occidentalis is a pest in greenhouses. F. occidentalis is difficult to control with insecticides because of its thigmokinetic behaviour and resistance...... to insecticides. Since F. occidentulis spread to become a worldwide pest in 1980’es, resistance to a number of different insecticides has been shown in many populations of F. occidentalis. This flower thrips has the potential of fast development of resistance owing to the short generation time, high fecundity...
-
Cattle or sheep reduce fawning habitat available to Columbian white-tailed deer in western Oregon
Winston P. Smith; Bruce E. Coblentz
2010-01-01
We studied responses of Columbian white-tailed deer (Odocoileus virginianus leucurus) to cattle and sheep in western Oregon because of viability concerns. We used radio-telemetry, observations from horseback, and searches with a trained dog to determine fawning habitat, dam home ranges, and habitat use by fawns. Dams shifted their center of...
-
Experimental mutation of disease resistance in wheat
International Nuclear Information System (INIS)
Hanisova, A.; Hanis, M.; Knytl, V.; Cerny, J.
1980-01-01
In 1968 to 1974, 19 cultivars and lines of wheat were treated with mutagens (i.e., with X rays, gamma radiation, neutrons, EMS). ALtogether 140 lines were obtained showing better resistance and/or tolerance to black stem rust, yellow rust, stem rust of wheat, powdery mildew of cereals, and root-rot of wheat. The frequency of the induced mutations was sufficiently high, i.e., 0.0012 to 0.078 mutants per 100 plants of M 2 . The major part of mutant lines showed a lower agronomical value due to negative pleiotropy of mutant genes and a changed genetic background of mutants. Some mutant lines can be used as the starting material in hybridization programmes. (author)
-
Essential Oils for Alternative Teak Rust Control
Directory of Open Access Journals (Sweden)
Pedro Raymundo Argüelles Osorio
2018-03-01
Full Text Available ABSTRACT The objectives of this study were to evaluate the effect of lemon grass, citronella grass, Mexican-tea and noni essential oils on urediniospore germination of Olivea neotectonae , the agent responsible for rust in Teak (Tectona grandis L.f.; to evaluate the phytotoxic effect of these essential oils on teak seedlings; and to evaluate the use of essential oils to control rust in teak plants when preventively and curatively applied. We found that the noni and lemon grass essential oils inhibited 100% of urediniospore germination. On the other hand, the essential oils from noni and lemon grass caused phytotoxicity when applied to seedlings at concentrations of 2000 and 1500 μL L-1, respectively. The major constituents found in lemon grass essential oil were Geranial and Neral, while Octanoic Acid was found in noni oil. Lower values in the area below the rust progress curve were observed with the preventive application of lemon grass and noni essential oils.
-
Genetic Markers for Western Corn Rootworm Resistance to Bt Toxin
Flagel, Lex E.; Swarup, Shilpa; Chen, Mao; Bauer, Christopher; Wanjugi, Humphrey; Carroll, Matthew; Hill, Patrick; Tuscan, Meghan; Bansal, Raman; Flannagan, Ronald; Clark, Thomas L.; Michel, Andrew P.; Head, Graham P.; Goldman, Barry S.
2015-01-01
Western corn rootworm (WCR) is a major maize (Zea mays L.) pest leading to annual economic losses of more than 1 billion dollars in the United States. Transgenic maize expressing insecticidal toxins derived from the bacterium Bacillus thuringiensis (Bt) are widely used for the management of WCR. However, cultivation of Bt-expressing maize places intense selection pressure on pest populations to evolve resistance. Instances of resistance to Bt toxins have been reported in WCR. Developing genet...
-
Barberry rust survey – developing tools for diagnosis, analysis and data management
DEFF Research Database (Denmark)
Justesen, Annemarie Fejer; Hansen, Jens Grønbech; Hovmøller, Mogens Støvring
Barberry (Berberis spp.) may serve as alternate host of several Puccinia species including Puccinia graminis and P. striiformis causing stem and yellow rust on cereals and grasses, respectively. In order to study the importance of barberry in the epidemiology of Puccinia species in the CWANA regi...... a rust survey was initiated. The aim was to 1) develop a surveillance protocol 2) develop molecular diagnostic tools for identifying Puccinia spp. from aecial samples, and 3) develop a data management and display system of results as part of the Wheat Rust ToolBox (http....... Due to variable quality of aecial samples DNA extraction was not successful for 40% of the samples. Sequences of EF1α, β-tubulin or ITS were analysed and compared to reference sequences of rust fungi infecting cereals and grasses. The analysis supported the presence of P. graminis s.l., P....... arrhenatheri and P. striiformoides on barberry species. Survey and DNA sample maps with species designation were displayed in the Wheat Rust ToolBox. The future aim is to integrate barberry rust survey data based on molecular diagnostics and infection assays from research groups world-wide in order to gain...
-
Interacting genes in the pine-fusiform rust forest pathosystem
H.V. Amerson; T.L. Kubisiak; S.A. Garcia; G.C. Kuhlman; C.D. Nelson; S.E. McKeand; T.J. Mullin; B. Li
2005-01-01
Fusiform rust (FR) disease of pines, caused by Cronartium quercuum f.sp. fusiforme (Cqf), is the most destructive disease in pine plantations of the southern U. S. The NCSU fusiform rust program, in conjunction with the USDA-Forest Service in Saucier, MS and Athens, GA, has research underway to elucidate some of the genetic interactions in this...
-
Identification of Green Rust in Groundwater
DEFF Research Database (Denmark)
Christiansen, Bo C.; Balic Zunic, Tonci; Dideriksen, Knud
2009-01-01
to air. In this paper, we present a sampling method for capturing green rust so it is not oxidized. We then we used the method to identify the compound in a groundwater sample taken below the water table from fractures in granite. X-ray diffraction patterns were weak, but clearly identical to those......Green rust, a family of Fe(II),Fe(III) layered double hydroxides, is believed to be present in environments close to the Fe(II)/Fe(III) transition zone. Attempts to identify members of this family in nature have proven difficult because the material is oxidized after only a few minutes exposure...
-
Structure and Charge Hopping Dynamics in Green Rust
International Nuclear Information System (INIS)
Wander, Matthew C.; Rosso, Kevin M.; Schoonen, Martin A.
2007-01-01
Green rust is a family of mixed-valent iron phases formed by a number of abiotic and biotic processes under alkaline suboxic conditions. Due to its high Fe2+ content, green rust is a potentially important phase for pollution remediation by serving as a powerful electron donor for reductive transformation. However, mechanisms of oxidation of this material are poorly understood. An essential component of the green rust structure is a mixed-valent brucite-like Fe(OH)2 sheet comprised of a two dimensional network of edge-sharing iron octahedra. Room temperature Mossbauer spectra show a characteristic signature for intermediate valence on the iron atoms in this sheet, indicative of a Fe2+-Fe3+ valence interchange reaction faster than approximately 107s-1. Using Fe(OH)2 as structural analogue for reduced green rust, we performed Hartree-Fock calculations on periodic slab models and cluster representations to determine the structure and hopping mobility of Fe3+ hole polarons in this material, providing a first principles assessment of the Fe2+-Fe3+ valence interchange reaction rate. The calculations show that among three possible symmetry unique iron-to-iron hops within a sheet, a hop to next-nearest neighbors at an intermediate distance of 5.6Angstroms is the fastest. The predicted rate is on the order of 1012 s-1 consistent the Mossbauer-based constraint. All other possibilities, including hopping across interlayer spaces, are predicted to be slower than 107s-1. Collectively, the findings suggest the possibility of hole self-diffusion along sheets as a mechanism for regeneration of lattice Fe2+ sites, consistent with previous experimental observations of edge-inward progressive oxidation of green rust.
-
Accelerating resistance breeding in wheat by integrating marker ...
African Journals Online (AJOL)
Genetic resistance is the simplest and most cost-effective way to guard against disease in plants. The pyramiding of resistance genes is a useful practice in bringing about durable resistance. This study aimed to develop a series of doubled haploid (DH) wheat lines containing combinations of wild species genes for rust ...
-
Warming drives a front of white spruce establishment near western treeline, Alaska.
Miller, Amy E; Wilson, Tammy L; Sherriff, Rosemary L; Walton, James
2017-12-01
Regional warming has led to increased productivity near the boreal forest margin in Alaska. To date, the effects of warming on seedling recruitment have received little attention, in spite of forecasted forest expansion. Here, we used stand structure and environmental data from 95 white spruce (Picea glauca) plots sampled across a longitudinal gradient in southwest Alaska to explore factors influencing spruce establishment and recruitment near western treeline. We used total counts of live seedlings, saplings, and trees, representing five life stages, to evaluate whether geospatial, climate, and measured plot covariates predicted abundance, using current abundance distributions as a surrogate for climate conditions in the past. We used generalized linear models to test the null hypothesis that conditions favorable for recruitment were similar along the environmental gradient represented by longitude, by exploring relationships between per-plot counts of each life stage and the covariates hypothesized to affect abundance. We also examined the relationship between growing degree days (GDD) and seedling establishment over a period of three decades using tree-ring chronologies obtained from cores taken at a subset of our sites (n = 30). Our results indicated that seedling, sapling, and tree abundance were positively correlated with temperature across the study area. The response to longitude was mixed, with earlier life stages (seedlings, saplings) most abundant at the western end of the gradient, and later life stages (trees) most abundant to the east. The differential relationship between longitude and life-stage abundance suggests a moving front of white spruce establishment through time, driven by changes in environmental conditions near the species' western range limit. Likewise, we found a positive relationship between periods of seedling establishment and GDD, suggesting that longer summers and/or greater heat accumulation might enhance establishment
-
International Nuclear Information System (INIS)
Koch, E.; Ebrahim-Nesbat, F.; Hoppe, H.H.
1983-01-01
Where soybeans are cultivated in the tropics, soybean rust may cause heavy crop losses. Resistance found so far was only of local and temporary value. More substantial breeding efforts are needed, but these may require a better understanding of the pathogen's biology and evolutionary capacity, the infection process and the host-pathogen relationships. The report deals with the infection process and the development of the fungus in a susceptible host variety. (author)
-
Wheat stem rust (Puccinia graminis f. sp. tritici Eriks. and E. Henn.) is one of the most destructive diseases world-wide. Races belonging to Ug99 (or TTKSK) continue to cause crop losses in East Africa and threaten global wheat production. Developing and deploying wheat varieties with multiple race...
-
Wheat production is threatened by the disease stem rust, which is caused by the biotrophic fungal pathogen Puccinia graminis Pers.:Pers. f. sp. tritici (Pgt). Among all known Pgt races, TTKSK (Ug99) and TRTTF are significant threats to North American wheat production due to their virulence against f...
-
Yun, Yeo Hong; Ahn, Geum Ran; Yoon, Seong Kwon; Kim, Hoo Hyun; Son, Seung Yeol; Kim, Seong Hwan
2016-12-01
During the growing season of 2015, leaf specimens with yellow rust spots were collected from Salix koreensis Andersson, known as Korean willow, in riverine areas in Cheonan, Korea. The fungus on S. koreensis was identified as the rust species, Melampsora yezoensis , based on the morphology of urediniospores observed by light and scanning electron microscopy, and the molecular properties of the internal transcribed spacer rDNA region. Pathogenicity tests confirmed that the urediniospores are the causal agent of the rust symptoms on the leaves and young stems of S. koreensis . Here, we report a new rust disease of S. koreensis caused by the rust fungus, M. yezoensis , a previously unrecorded rust pathogen in Korea.
-
Genotyping of rifampin-resistant Mycobacterium tuberculosis isolates from Western Turkey
International Nuclear Information System (INIS)
Cavasoglu, Cengiz; Bilgic, Altinay; Durmaz, Riza; Gunal, Selami
2004-01-01
Although the rate of multiple drug resistance is high there is no published data on the transmission rate of drug-resistant strains of Mycobacterium tuberculosis in the Aegean region of Western Turkey that are based on molecular methods. IS6110 and pTBN12 restriction fragment lengthpolymorphism (RFLP) methods were used for typing Mycobacterium tuberculosis isolated from 26 sputum samples from 26 patients. 19 of rifampin-resistant isolates (73.1%) contained 6 to 11 copies of 156110. Eighteen different IS6110 DNA fingerprint patterns were observed in the 26 rifampin resistant isolates. 23 of the 26 rifampin-resistant isolates were also resistant to isoniazid. When evaluated together, both methods yielded 21 (80.9%) different banding patterns and the level of clustering was 34.6%. The average number per pattern was 1.23 (26/21). IS6110 fingerprinting suggests that the rifampin-resistant isolates obtained from the Aegean region had a relatively high clustering rate and were clonally related. These findings showed that the rifampin-resistant isolates are actively transmitted between patients. Urgent measures should be taken to prevent the spread of these resistant strains. (author)
-
Bulked fusiform rust inocula and Fr gene interactions in loblolly pine
Fikret Isik; Henry Amerson; Saul Garcia; Ross Whetten; Steve. McKeand
2012-01-01
Fusiform rust disease in loblolly (Pinus taeda L.) and slash (Pinus elliottii Engelm. var elliottii) pine plantations in the southern United States causes multi-million dollar annual losses. The disease is endemic to the region. The fusiform rust fungus (Cronartium quercuum sp.
-
Vitamin D Supplementation Does Not Impact Insulin Resistance in Black and White Children.
Ferira, Ashley J; Laing, Emma M; Hausman, Dorothy B; Hall, Daniel B; McCabe, George P; Martin, Berdine R; Hill Gallant, Kathleen M; Warden, Stuart J; Weaver, Connie M; Peacock, Munro; Lewis, Richard D
2016-04-01
Vitamin D supplementation trials with diabetes-related outcomes have been conducted almost exclusively in adults and provide equivocal findings. The objective of this study was to determine the dose-response of vitamin D supplementation on fasting glucose, insulin, and a surrogate measure of insulin resistance in white and black children aged 9–13 years, who participated in the Georgia, Purdue, and Indiana University (or GAPI) trial: a 12-week multisite, randomized, triple-masked, dose-response, placebo-controlled vitamin D trial. Black and white children in the early stages of puberty (N = 323, 50% male, 51% black) were equally randomized to receive vitamin D3 (0, 400, 1000, 2000, or 4000 IU/day) for 12 weeks. Fasting serum 25-hydroxyvitamin D (25(OH)D), glucose and insulin were assessed at baseline and weeks 6 and 12. Homeostasis model assessment of insulin resistance was used as a surrogate measure of insulin resistance. Statistical analyses were conducted as intent-to-treat using a mixed effects model. Baseline serum 25(OH)D was inversely associated with insulin (r = −0.140, P = 0.017) and homeostasis model assessment of insulin resistance (r = −0.146, P = 0.012) after adjusting for race, sex, age, pubertal maturation, fat mass, and body mass index. Glucose, insulin, and insulin resistance increased (F > 5.79, P insulin resistance, vitamin D supplementation had no impact on fasting glucose, insulin, or a surrogate measure of insulin resistance over 12 weeks in apparently healthy children.
-
Solidification structure and abrasion resistance of high chromium white irons
Doğan, Ö. N.; Hawk, J. A.; Laird, G.
1997-06-01
Superior abrasive wear resistance, combined with relatively low production costs, makes high Cr white cast irons (WCIs) particularly attractive for applications in the grinding, milling, and pumping apparatus used to process hard materials. Hypoeutectic, eutectic, and hypereutectic cast iron compositions, containing either 15 or 26 wt pct chromium, were studied with respect to the macrostructural transitions of the castings, solidification paths, and resulting microstructures when poured with varying superheats. Completely equiaxed macrostructures were produced in thick section castings with slightly hypereutectic compositions. High-stress abrasive wear tests were then performed on the various alloys to examine the influence of both macrostructure and microstructure on wear resistance. Results indicated that the alloys with a primarily austenitic matrix had a higher abrasion resistance than similar alloys with a pearlitic/bainitic matrix. Improvement in abrasion resistance was partially attributed to the ability of the austenite to transform to martensite at the wear surface during the abrasion process.
-
Mutation breeding for disease resistance in wheat and field beans
International Nuclear Information System (INIS)
Abdel-Hak, T.M.; Kamel, A.H.
1977-01-01
Wheat and broad-bean diseases cause considerable losses under Egyptian conditions; therefore, an attempt was made to induce useful mutations in both crops resistant to diseases which may be of direct or indirect use in breeding programmes. The methodology of artificial inoculation, evaluation, selection, radiation levels used are reported, in addition to the economic importance of the varieties used. This work passed through two phases, the first started in the 1972/73 crop season with a small population, while the second in 1974/75 with a larger one to have a better chance of detecting resistant mutants. In the first phase, a total of 3563M 1 wheat plants was grown in addition to approximately 3600-44,000M 2 and 77,646M 3 plants. Twenty-two M 2 plants were selected as showing lower level of leaf rust development, but further tests showed these plants are not true mutants since they rusted at the same level of their parent varieties. Out of the M 3 plants none showed good resistance. In the second phase, 36,000, 277,080 and 289,492 plants of M 1 , M 2 and M 3 , respectively, were grown and 73M 2 plants were selected as showing complete resistance to leaf and stem rusts. In field beans out of the first phase, a total of 5760, 37,200 and 33,240M 1 , M 2 and M 3 plants, respectively, was grown and none showed a good level of disease resistance although some were less diseased. These were further tested and proved not true mutants for reduced disease development. In the second phase, 8747, 203,520 and 90,285 plants of M 1 , M 2 and M 3 , respectively, were grown and 27M 2 plants were selected as showing a lower level of chocolate spot and rust development. The paper also discusses the use of single versus composite cultures in mutation breeding for disease resistance. (author)
-
"Cowan," Whiteness, Resistance to "Brown," and the Persistence of the Past
Donnor, Jamel K.
2018-01-01
In this paper, I examine the use of litigation as a strategic tool of resistance for thwarting school desegregation. Utilizing "Cowan v. Bolivar County Board of Education" as a case study, I argue that, despite losing the constitutional right to racially segregate public schools according to an explicit white supremacist doctrine, whites…
-
Pratiwi, V. N.
2018-03-01
Rice is a staple food and regarded as a useful carbohydrate source. In general rice is high in glycaemic index (GI) and low colonic fermentation. People are aware of the alterations in blood glucose levels or glycaemic index after consuming rice. Resistant starch (RS) and amylose content play an important role in controlling GI. GI and RS content have been established as important indicators of starch digestibility. The aim of this study was to determine the precooked process with hydrothermal (boiling at 80°C, 10 minutes) and cooling process with low temperature (4°C, 1 h) to increase potential content of RS and decrease of glycaemic index of white rice. There were two stages of this research, 1) preparation of white rice with precooked process; 2) analysis of precooked white rice characteristics (resistant starch, amylose content, and estimated glycaemic index). The result of analysis on precooked white rice showed an increased RS content (1.11%) and white rice (0.99%), but the difference was not statistically significant. The amylose content increased significantly after precooked process in white rice (24.70%) compared with white rice (20.89%). Estimated glycaemic index (EGI) decreased after precooked proses (65.63%) but not significant as compared to white rice (66.47%). From the present study it was concluded that precooked process had no significant impact on increasing RS and decreasing EGI of white rice. This may be due to the relatively short cooling time (1hour) in 4°C.
-
Wheat stem rust in South Africa: Current status and future research ...
African Journals Online (AJOL)
. In South Africa, stem rust caused by Puccinia graminis Pers. f. sp. tritici. Eriks. & E. Henn. (Pgt) is an important disease of wheat. Records of stem rust occurrence in South Africa date back to the late 1720's, when it was first discovered in the ...
-
James, Timothy Y; Marino, John A; Perfecto, Ivette; Vandermeer, John
2016-01-15
The interaction of crop pests with their natural enemies is a fundament to their control. Natural enemies of fungal pathogens of crops are poorly known relative to those of insect pests, despite the diversity of fungal pathogens and their economic importance. Currently, many regions across Latin America are experiencing unprecedented epidemics of coffee rust (Hemileia vastatrix). Identification of natural enemies of coffee rust could aid in developing management strategies or in pinpointing species that could be used for biocontrol. In the present study, we characterized fungal communities associated with coffee rust lesions by single-molecule DNA sequencing of fungal rRNA gene bar codes from leaf discs (≈28 mm(2)) containing rust lesions and control discs with no rust lesions. The leaf disc communities were hyperdiverse in terms of fungi, with up to 69 operational taxonomic units (putative species) per control disc, and the diversity was only slightly reduced in rust-infected discs, with up to 63 putative species. However, geography had a greater influence on the fungal community than whether the disc was infected by coffee rust. Through comparisons between control and rust-infected leaf discs, as well as taxonomic criteria, we identified 15 putative mycoparasitic fungi. These fungi are concentrated in the fungal family Cordycipitaceae and the order Tremellales. These data emphasize the complexity of diverse fungi of unknown ecological function within a leaf that might influence plant disease epidemics or lead to the development of species for biocontrol of fungal disease. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
-
Directory of Open Access Journals (Sweden)
Omar Vergara-Diaz
2015-06-01
Full Text Available The biotrophic fungus Puccinia striiformis f. sp. tritici is the causal agent of the yellow rust in wheat. Between the years 2010–2013 a new strain of this pathogen (Warrior/Ambition, against which the present cultivated wheat varieties have no resistance, appeared and spread rapidly. It threatens cereal production in most of Europe. The search for sources of resistance to this strain is proposed as the most efficient and safe solution to ensure high grain production. This will be helped by the development of high performance and low cost techniques for field phenotyping. In this study we analyzed vegetation indices in the Red, Green, Blue (RGB images of crop canopies under field conditions. We evaluated their accuracy in predicting grain yield and assessing disease severity in comparison to other field measurements including the Normalized Difference Vegetation Index (NDVI, leaf chlorophyll content, stomatal conductance, and canopy temperature. We also discuss yield components and agronomic parameters in relation to grain yield and disease severity. RGB-based indices proved to be accurate predictors of grain yield and grain yield losses associated with yellow rust (R2 = 0.581 and R2 = 0.536, respectively, far surpassing the predictive ability of NDVI (R2 = 0.118 and R2 = 0.128, respectively. In comparison to potential yield, we found the presence of disease to be correlated with reductions in the number of grains per spike, grains per square meter, kernel weight and harvest index. Grain yield losses in the presence of yellow rust were also greater in later heading varieties. The combination of RGB-based indices and days to heading together explained 70.9% of the variability in grain yield and 62.7% of the yield losses.
-
First detection of bat white-nose syndrome in western North America
Lorch, Jeffrey M.; Palmer, Jonathan M.; Lindner, Daniel L.; Ballmann, Anne; George, Kyle; Griffin, Kathryn M.; Knowles, Susan N.; Huckabee, John R.; Haman, Katherine H.; Anderson, Christopher D.; Becker, Penny A.; Buchanan, Joseph B.; Foster, Jeffrey T.; Blehert, David
2016-01-01
White-nose syndrome (WNS) is an emerging fungal disease of bats caused by Pseudogymnoascus destructans. Since it was first detected near Albany, NY, in 2006, the fungus has spread across eastern North America, killing unprecedented numbers of hibernating bats. The devastating impacts of WNS on Nearctic bat species are attributed to the likely introduction of P. destructans from Eurasia to naive host populations in eastern North America. Since 2006, the disease has spread in a gradual wavelike pattern consistent with introduction of the pathogen at a single location. Here, we describe the first detection of P. destructans in western North America in a little brown bat (Myotis lucifugus) from near Seattle, WA, far from the previously recognized geographic distribution of the fungus. Whole-genome sequencing and phylogenetic analyses indicated that the isolate of P. destructans from Washington grouped with other isolates of a presumed clonal lineage from the eastern United States. Thus, the occurrence of P. destructans in Washington does not likely represent a novel introduction of the fungus from Eurasia, and the lack of intensive surveillance in the western United States makes it difficult to interpret whether the occurrence of P. destructans in the Pacific Northwest is disjunct from that in eastern North America. Although there is uncertainty surrounding the impacts of WNS in the Pacific Northwest, the presence of the pathogen in western North America could have major consequences for bat conservation.
-
Gortari, Fermín; Guiamet, Juan José; Graciano, Corina
2018-01-23
Rust produced by Melampsora sp. is considered one of the most relevant diseases in poplar plantations. Growth reduction in poplar plantations takes place because rust, like other pathogens, alters leaf physiology. There is not a complete evaluation of several of the physiological traits that can be affected by rust at leaf level. Therefore, the aim of this work was to evaluate, in an integrative way and in the same pathosystem, which physiological processes are affected when Populus deltoides Bartr. ex Marsh. leaves are infected by rust (Melampsora medusae Thümen). Leaves of two clones with different susceptibility to rust were analyzed. Field and pot experiments were performed, and several physiological traits were measured in healthy and infected leaves. We conclude that rust affects leaf mesophyll integrity, and so water movement in the leaf in liquid phase is affected. As a consequence, gas exchange is reduced, affecting both carbon fixation and transpiration. However, there is an increase in respiration rate, probably due to plant and fungal respiration. The increase in respiration rate is important in the reduction of net photosynthetic rate, but also some damage in the photosynthetic apparatus limits leaf capacity to fix carbon. The decrease in chlorophyll content would start later and seems not to explain the reduction in net photosynthetic rate. Both clones, although they have different susceptibility to rust, are affected in the same physiological mechanisms. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
-
New Spectral Index for Detecting Wheat Yellow Rust Using Sentinel-2 Multispectral Imagery
Directory of Open Access Journals (Sweden)
Qiong Zheng
2018-03-01
Full Text Available Yellow rust is one of the most destructive diseases for winter wheat and has led to a significant decrease in winter wheat quality and yield. Identifying and monitoring yellow rust is of great importance for guiding agricultural production over large areas. Compared with traditional crop disease discrimination methods, remote sensing technology has proven to be a useful tool for accomplishing such a task at large scale. This study explores the potential of the Sentinel-2 Multispectral Instrument (MSI, a newly launched satellite with refined spatial resolution and three red-edge bands, for discriminating between yellow rust infection severities (i.e., healthy, slight, and severe in winter wheat. The corresponding simulative multispectral bands for the Sentinel-2 sensor were calculated by the sensor’s relative spectral response (RSR function based on the in situ hyperspectral data acquired at the canopy level. Three Sentinel-2 spectral bands, including B4 (Red, B5 (Re1, and B7 (Re3, were found to be sensitive bands using the random forest (RF method. A new multispectral index, the Red Edge Disease Stress Index (REDSI, which consists of these sensitive bands, was proposed to detect yellow rust infection at different severity levels. The overall identification accuracy for REDSI was 84.1% and the kappa coefficient was 0.76. Moreover, REDSI performed better than other commonly used disease spectral indexes for yellow rust discrimination at the canopy scale. The optimal threshold method was adopted for mapping yellow rust infection at regional scales based on realistic Sentinel-2 multispectral image data to further assess REDSI’s ability for yellow rust detection. The overall accuracy was 85.2% and kappa coefficient was 0.67, which was found through validation against a set of field survey data. This study suggests that the Sentinel-2 MSI has the potential for yellow rust discrimination, and the newly proposed REDSI has great robustness and
-
New Spectral Index for Detecting Wheat Yellow Rust Using Sentinel-2 Multispectral Imagery.
Zheng, Qiong; Huang, Wenjiang; Cui, Ximin; Shi, Yue; Liu, Linyi
2018-03-15
Yellow rust is one of the most destructive diseases for winter wheat and has led to a significant decrease in winter wheat quality and yield. Identifying and monitoring yellow rust is of great importance for guiding agricultural production over large areas. Compared with traditional crop disease discrimination methods, remote sensing technology has proven to be a useful tool for accomplishing such a task at large scale. This study explores the potential of the Sentinel-2 Multispectral Instrument (MSI), a newly launched satellite with refined spatial resolution and three red-edge bands, for discriminating between yellow rust infection severities (i.e., healthy, slight, and severe) in winter wheat. The corresponding simulative multispectral bands for the Sentinel-2 sensor were calculated by the sensor's relative spectral response (RSR) function based on the in situ hyperspectral data acquired at the canopy level. Three Sentinel-2 spectral bands, including B4 (Red), B5 (Re1), and B7 (Re3), were found to be sensitive bands using the random forest (RF) method. A new multispectral index, the Red Edge Disease Stress Index (REDSI), which consists of these sensitive bands, was proposed to detect yellow rust infection at different severity levels. The overall identification accuracy for REDSI was 84.1% and the kappa coefficient was 0.76. Moreover, REDSI performed better than other commonly used disease spectral indexes for yellow rust discrimination at the canopy scale. The optimal threshold method was adopted for mapping yellow rust infection at regional scales based on realistic Sentinel-2 multispectral image data to further assess REDSI's ability for yellow rust detection. The overall accuracy was 85.2% and kappa coefficient was 0.67, which was found through validation against a set of field survey data. This study suggests that the Sentinel-2 MSI has the potential for yellow rust discrimination, and the newly proposed REDSI has great robustness and generalized ability
-
Guedes, J A C; Esteves, J V; Morais, M R; Zorn, T M; Furuya, D T
2017-11-26
The discovery of osteocalcin, a protein synthetized by osteoblasts, as a hormone that has positive effects on insulin resistance, contributed to support the concept of bone as an endocrine organ. However, very little is known about the molecular pathways involved in osteocalcin improved-insulin resistance. The present study aimed to investigate the mechanisms of action of osteocalcin on insulin resistance and inflammation in obese mice and 3T3-L1 adipocytes. Lean control, saline-treated obese and uncarboxylated osteocalcin (uOC)-treated obese mice were subjected to insulin tolerance test in vivo. Blood was collect for biochemical/metabolic profile analysis; and, skeletal muscle, white adipose tissue (WAT) and bone were collected for protein (Western blotting) and mRNA (RT-qPCR) analysis. uOC effects on insulin resistance and inflammation were also investigated in 3T3-L1 adipocytes challenged with tumor necrosis factor. Osteocalcin treatment improved in vivo insulin resistance in obese mice. In WAT, osteocalcin had positive effects such as (1) WAT weight reduction; (2) upregulation of glucose transporter (GLUT) 4 protein and its mRNA (Slc2a4); (3) improved insulin-induced AKT phosphorylation; (4) downregulation of several genes involved in inflammation and inflammassome transcriptional machinery, and (5) reduction of the density of macrophage in crown-like structures (histomorphometrical analysis). Notably, in 3T3-L1 adipocytes, osteocalcin restored Slc2a4/GLUT4 content and reduced the expression of inflammatory genes after TNF-a challenge; moreover, osteocalcin treatment increased AKT phosphorylation induced by insulin. Finally, it was observed that in bone, osteocalcin improves insulin resistance by increasing insulin-induced AKT phosphorylation and reducing the expression of genes involved in bone insulin resistance, resulting in increased secretion of uncarboxylated osteocalcin in circulation. We provided some mechanisms of action for osteocalcin in the
-
Niu, Zhixia; Klindworth, Daryl L; Friesen, Timothy L; Chao, Shiaoman; Jin, Yue; Cai, Xiwen; Xu, Steven S
2011-04-01
Chromosome engineering is a useful strategy for transfer of alien genes from wild relatives into modern crops. However, this strategy has not been extensively used for alien gene introgression in most crops due to low efficiency of conventional cytogenetic techniques. Here, we report an improved scheme of chromosome engineering for efficient elimination of a large amount of goatgrass (Aegilops speltoides) chromatin surrounding Sr39, a gene that provides resistance to multiple stem rust races, including Ug99 (TTKSK) in wheat. The wheat ph1b mutation, which promotes meiotic pairing between homoeologous chromosomes, was employed to induce recombination between wheat chromosome 2B and goatgrass 2S chromatin using a backcross scheme favorable for inducing and detecting the homoeologous recombinants with small goatgrass chromosome segments. Forty recombinants with Sr39 with reduced surrounding goatgrass chromatin were quickly identified from 1048 backcross progenies through disease screening and molecular marker analysis. Four of the recombinants carrying Sr39 with a minimal amount of goatgrass chromatin (2.87-9.15% of the translocated chromosomes) were verified using genomic in situ hybridization. Approximately 97% of the goatgrass chromatin was eliminated in one of the recombinants, in which a tiny goatgrass chromosome segment containing Sr39 was retained in the wheat genome. Localization of the goatgrass chromatin in the recombinants led to rapid development of three molecular markers tightly linked to Sr39. The new wheat lines and markers provide useful resources for the ongoing global effort to combat Ug99. This study has demonstrated great potential of chromosome engineering in genome manipulation for plant improvement.
-
Mechanical properties of the rust layer induced by impressed current method in reinforced mortar
International Nuclear Information System (INIS)
Care, S.; Nguyen, Q.T.; L'Hostis, V.; Berthaud, Y.
2008-01-01
This paper describes the mechanical effects of rust layer formed in reinforced mortar through accelerated tests of corrosion. The morphological and physico-chemical properties (composition, structures) of the corrosion system were characterized at different stages by using optical microscope and scanning electron microscope coupled with energy dispersive spectroscopy. The corrosion pattern was mainly characterized by a rust layer confined at the interface between the steel and the mortar. Expansion coefficient of rust products was determined from the rust thickness and the Faraday's law. Furthermore, in order to understand the mechanical effects of corrosion on the damage of mortar, displacement field measurements were obtained by using digital image correlation. An analytical model (hollow cylinder subjected to inner and outer pressures) was used with a set of experimental data to deduce the time of cracking and the order of magnitude of the mechanical properties of the rust layer
-
Climate change impacts on coffee rust disease
Alfonsi, W. M. V.; Koga-Vicente, A.; Pinto, H. S.; Alfonsi, E. L., Sr.; Coltri, P. P.; Zullo, J., Jr.; Patricio, F. R.; Avila, A. M. H. D.; Gonçalves, R. R. D. V.
2016-12-01
Changes in climate conditions and in extreme weather events may affect the food security due to impacts in agricultural production. Despite several researches have been assessed the impacts of extremes in yield crops in climate change scenarios, there is the need to consider the effects in pests and diseases which increase losses in the sector. Coffee Arabica is an important commodity in world and plays a key role in Brazilian agricultural exports. Although the coffee crop has a world highlight, its yield is affected by several factors abiotic or biotic. The weather as well pests and diseases directly influence the development and coffee crop yield. These problems may cause serious damage with significant economic impacts. The coffee rust, caused by the fungus Hemileia vastarix,is among the diseases of greatest impact for the crop. The disease emerged in Brazil in the 70s and is widely spread in all producing regions of coffee in Brazil, and in the world. Regions with favorable weather conditions for the pathogen may exhibit losses ranging from 30% to 50% of the total grain production. The evaluation of extreme weather events of coffee rust disease in futures scenarios was carried out using the climatic data from CMIP5 models, data field of coffee rust disease incidence and, incubation period simulation data for Brazilian municipalities. Two Regional Climate Models were selected, Eta-HadGEM2-ES and Eta-MIROC5, and the Representative Concentration Pathways 8.5 w/m2 was adopted. The outcomes pointed out that in these scenarios the period of incubation tends to decrease affecting the coffee rust disease incidence, which tends to increase. Nevertheless, the changing in average trends tends to benefit the reproduction of the pathogen. Once the temperature threshold for the disease reaches the adverse conditions it may be unfavorable for the incidence.
-
Directory of Open Access Journals (Sweden)
Diana F. Tomback
2016-01-01
Full Text Available Whitebark pine (Pinus albicaulis has the largest and most northerly distribution of any white pine (Subgenus Strobus in North America, encompassing 18° latitude and 21° longitude in western mountains. Within this broad range, however, whitebark pine occurs within a narrow elevational zone, including upper subalpine and treeline forests, and functions generally as an important keystone and foundation species. In the Rocky Mountains, whitebark pine facilitates the development of krummholz conifer communities in the alpine-treeline ecotone (ATE, and thus potentially provides capacity for critical ecosystem services such as snow retention and soil stabilization. The invasive, exotic pathogen Cronartium ribicola, which causes white pine blister rust, now occurs nearly rangewide in whitebark pine communities, to their northern limits. Here, we synthesize data from 10 studies to document geographic variation in structure, conifer species, and understory plants in whitebark pine treeline communities, and examine the potential role of these communities in snow retention and regulating downstream flows. Whitebark pine mortality is predicted to alter treeline community composition, structure, and function. Whitebark pine losses in the ATE may also alter response to climate warming. Efforts to restore whitebark pine have thus far been limited to subalpine communities, particularly through planting seedlings with potential blister rust resistance. We discuss whether restoration strategies might be appropriate for treeline communities.
-
MICROCOSM STUDY OF DEGRADATION OF CHLORINATED SOLVENTS ON SYNTHETIC GREEN RUST MINERALS
Green rust minerals contain ferrous ion in their structure that can potentially serve as a chemical reductant for degradation of chlorinated solvents. Green rusts are found in zerovalent iron based permeable reactive barriers and in certain soil and sediments. Some previous labor...
-
Continuous White Noise to Reduce Resistance Going to Sleep and Night Wakings in Toddlers
Forquer, LeAnne M.; Johnson, C. Merle
2005-01-01
White noise generators were turned on at 75 dB at bedtime and kept on all night to treat resistance going to sleep and night wakings in one-year-old toddlers. In a multiple baseline design four sets of parents recorded duration of resistance going to sleep, number of night wakings, completed surveys of their child's feeding and sleeping patterns…
-
Effects of rust in the crack face on crack detection based on Sonic-IR method
International Nuclear Information System (INIS)
Harai, Y.; Izumi, Y.; Tanabe, H.; Takamatsu, T.; Sakagami, T.
2015-01-01
Sonic-IR, which is based on the thermographic detection of the temperature rise due to frictional heating at the defect faces under ultrasonic excitation, has an advantage in the detection of closed and small defects. However, this method has a lot of nuclear factors relating to heat generation. In this study, effects of rust in the crack faces on the crack detection based on the sonic-IR method is experimentally investigated by using crack specimens. The heat generation by ultrasonic excitation was observed regularly during rust accelerated test using original device. The distribution of temperature change around the crack was changed with the progress of rust. This change in heat generation, it believed to be due to change in the contact state of the crack surface due to rust. As a result, it was found that heat generation by ultrasonic excitation is affected by rust in the crack faces. And it was also found that crack detection can be conducted by sonic-IR even if rust was generated in the crack faces. (author)
-
International Nuclear Information System (INIS)
Saito, M.; Suzuki, S.; Kimura, M.; Suzuki, T.; Kihira, H.; Waseda, Y.
2005-01-01
Quantitative X-ray structural analysis coupled with anomalous X-ray scattering has been used for characterizing the atomic-scale structure of rust formed on steel surfaces. Samples were prepared from rust layers formed on the surfaces of two commercial steels. X-ray scattered intensity profiles of the two samples showed that the rusts consisted mainly of two types of ferric oxyhydroxide, α-FeOOH and γ-FeOOH. The amounts of these rust components and the realistic atomic arrangements in the components were estimated by fitting both the ordinary and the environmental interference functions with a model structure calculated using the reverse Monte Carlo simulation technique. The two rust components were found to be the network structure formed by FeO 6 octahedral units, the network structure itself deviating from the ideal case. The present results also suggest that the structural analysis method using anomalous X-ray scattering and the reverse Monte Carlo technique is very successful in determining the atomic-scale structure of rusts formed on the steel surfaces
-
Directory of Open Access Journals (Sweden)
Louise Morin
Full Text Available The exotic rust fungus Puccinia psidii sensu lato was first detected in Australia in April 2010. This study aimed to determine the host-range potential of this accession of the rust by testing its pathogenicity on plants of 122 taxa, representative of the 15 tribes of the subfamily Myrtoideae in the family Myrtaceae. Each taxon was tested in two separate trials (unless indicated otherwise that comprised up to five replicates per taxon and six replicates of a positive control (Syzygium jambos. No visible symptoms were observed on the following four taxa in either trial: Eucalyptus grandis×camaldulensis, E. moluccana, Lophostemon confertus and Sannantha angusta. Only small chlorotic or necrotic flecks without any uredinia (rust fruiting bodies were observed on inoculated leaves of seven other taxa (Acca sellowiana, Corymbia calophylla 'Rosea', Lophostemon suaveolens, Psidium cattleyanum, P. guajava 'Hawaiian' and 'Indian', Syzygium unipunctatum. Fully-developed uredinia were observed on all replicates across both trials of 28 taxa from 8 tribes belonging to the following 17 genera: Agonis, Austromyrtus, Beaufortia, Callistemon, Calothamnus, Chamelaucium, Darwinia, Eucalyptus, Gossia, Kunzea, Leptospermum, Melaleuca, Metrosideros, Syzygium, Thryptomene, Tristania, Verticordia. In contrast, the remaining 83 taxa inoculated, including the majority of Corymbia and Eucalyptus species, developed a broad range of symptoms, often across the full spectrum, from fully-developed uredinia to no visible symptoms. These results were encouraging as they indicate that some levels of genetic resistance to the rust possibly exist in these taxa. Overall, our results indicated no apparent association between the presence or absence of disease symptoms and the phylogenetic relatedness of taxa. It is most likely that the majority of the thousands of Myrtaceae species found in Australia have the potential to become infected to some degree by the rust, although this
-
Morin, Louise; Aveyard, Ruth; Lidbetter, Jonathan R.; Wilson, Peter G.
2012-01-01
The exotic rust fungus Puccinia psidii sensu lato was first detected in Australia in April 2010. This study aimed to determine the host-range potential of this accession of the rust by testing its pathogenicity on plants of 122 taxa, representative of the 15 tribes of the subfamily Myrtoideae in the family Myrtaceae. Each taxon was tested in two separate trials (unless indicated otherwise) that comprised up to five replicates per taxon and six replicates of a positive control (Syzygium jambos). No visible symptoms were observed on the following four taxa in either trial: Eucalyptus grandis×camaldulensis, E. moluccana, Lophostemon confertus and Sannantha angusta. Only small chlorotic or necrotic flecks without any uredinia (rust fruiting bodies) were observed on inoculated leaves of seven other taxa (Acca sellowiana, Corymbia calophylla ‘Rosea’, Lophostemon suaveolens, Psidium cattleyanum, P. guajava ‘Hawaiian’ and ‘Indian’, Syzygium unipunctatum). Fully-developed uredinia were observed on all replicates across both trials of 28 taxa from 8 tribes belonging to the following 17 genera: Agonis, Austromyrtus, Beaufortia, Callistemon, Calothamnus, Chamelaucium, Darwinia, Eucalyptus, Gossia, Kunzea, Leptospermum, Melaleuca, Metrosideros, Syzygium, Thryptomene, Tristania, Verticordia. In contrast, the remaining 83 taxa inoculated, including the majority of Corymbia and Eucalyptus species, developed a broad range of symptoms, often across the full spectrum, from fully-developed uredinia to no visible symptoms. These results were encouraging as they indicate that some levels of genetic resistance to the rust possibly exist in these taxa. Overall, our results indicated no apparent association between the presence or absence of disease symptoms and the phylogenetic relatedness of taxa. It is most likely that the majority of the thousands of Myrtaceae species found in Australia have the potential to become infected to some degree by the rust, although this wide
-
Polly C. Buotte; Jeffrey A. Hicke; Haiganoush K. Preisler; John T. Abatzoglou; Kenneth F. Raffa; Jesse A. Logan
2016-01-01
Extensive mortality of whitebark pine, beginning in the early to mid-2000s, occurred in the Greater Yellowstone Ecosystem (GYE) of the western USA, primarily from mountain pine beetle but also from other threats such as white pine blister rust. The climatic drivers of this recent mortality and the potential for future whitebark pine mortality from mountain pine beetle...
-
Rust fungi are obligate biotrophic pathogens causing considerable damage on crop plants. P. graminis f. sp. tritici, the causal agent of wheat stem rust, and M. larici-populina, the poplar rust pathogen, have strong deleterious impact on wheat and poplar wood production, respectively. The recently r...
-
Determining yield loss caused by brown rust in production fields of sugarcane
Infections of Puccinia melanocephala, the causal agent of brown rust, appear on Louisiana sugarcane in the spring. Disease expression is usually limited to 2 to 3 months until temperatures exceed those favorable for spore production. The affected sugarcane is harvested 4 to 6 months after rust sympt...
-
Robert O. Curtis; Nancy M. Diaz; Gary W. Clendenen
1990-01-01
Height growth and site index curves were constructed from stem analyses of mature western white pine (Pinus monticola Dougl. ex D. Don) growing in high-elevation forests of the Cascade Range in the Mount Hood and Gifford Pinchot National Forests of Oregon and Washington, respectively. Alternate systems using reference ages for site index of 50 and...
-
Ona-Nguema, G.; Guerbois, D.; Morin, G.; Zhang, Y.; Noel, V.; Brest, J.
2013-12-01
The occurrence of high nitrite concentrations as a result of anthropogenic activities is an important water quality concern as it is highly toxic to human and fauna, and it is used as a nitrogen source for the assimilation process. The toxicity of nitrite is related to its transformation into carcinogenic N-nitroso compounds, which are suspected to be responsible for some gastric cancers, and to its ability to convert the hemoglobin to methaemoglobin what is then unable to fix oxygen and to transport it to the tissues, involving hypoxia and the blue-baby syndrome [1]. To reduce the adverse effect of nitrite on human health and on macroalgal blooms, any process enhancing the transformation of nitrite ions to nitrogen gas is of interest for the remediation of natural environments. To achieve this purpose the use of processes involving Fe(II)-containing minerals could be considered as one of the best options. Green-rusts are mixed Fe(II-III) layered double hydroxides commonly found in anoxic zones of natural environments such as sediments and hydromorphic soils. In such anoxic environments, green rust minerals play an important role in the biogeochemical redox cycling of iron and nitrogen, and can affect the speciation and mobility of many organic and inorganic contaminants. The present study investigates the reduction of nitrite by two synthetic and two biogenic green rusts. On the one hand, Fe(II-III) hydroxychloride and Fe(II-III) hydroxycarbonate green rusts were used as synthetic interlayer forms of GR, which are referred to as ';syn-GR(CO3)' and ';syn-GR(Cl)', respectively. On the other hand, the study was performed with biogenic Fe(II-III) hydroxycarbonate green rusts obtained from the bioreduction of two ferric precursors, either Fe(III)-oxyhydroxycarbonate or lepidocrocite; these biogenic green rusts are referred to as ';bio-GR(CO3)F' and ';bio-GR(CO3)L', respectively. For synthetic green rusts, results showed that the oxidation of both syn-GR(CO3) and syn
-
Control Of Rust Disease In Irradiated Vicia Faba By Using Safe Alternative Methods
International Nuclear Information System (INIS)
Ahmed, B.M.; Helal, I.M.; Mohamed, G.A.
2013-01-01
Infection of Vicia faba with Uromyces viciae-fabae causes significant decrease in growth and total nitrogen content and increase in the phenolic compounds. The study was carried out to investigate the effects of chemicals used as drench application in soil (e.g. saccharin), biotic agents (e.g. Bacillus subtilis) and artificial essential oils (e.g. rosemary) in irradiated (0, 5, 10, 15 Gy) broad bean Vicia faba on the rust fungus Uromyces viciae-fabae. Bacillus subtilis was inoculated to beans at the third leaf then saccharin (5 mM/l) was used as drench application in the soil and the essential oil was used for foliar application at concentrations 0, 500, 1000 and 1500 ppm. All treatments gave positive results to control the disease but differ in the mechanism of action. The control of the disease with saccharin application may be due to the formation of antimicrobial components (wyrone acid) by plant tissues and increase with increasing the concentration of saccharin. In case of using the essential oil, the affect on the microbe was directly observed within 28 h because the oil affect the permeability of cell membrane of the pathogen but in case of Bacillus, it acts as biological control agent induced resistance of plant by affecting the activity of antioxidant enzymes; peroxidase and chitinase. Saccharin and spore suspension induce systemic protection to rust infection after 72 and 96 hours. The disease index and the phenolic compounds were determined because they play important role in the systemic protection of rust disease 96 h after application. The results showed that the phytoalexin wyerone acid was formed in case of biotic agent (Bacillus subtilis) and the chemical (saccharin) but did not form in case of essential oil (rosemary)
-
Lapp, M S; Malinek, J; Coffey, M
1996-04-01
We developed a protocol for the production of shoots from bud explants from 1- to 7-year-old trees of western white pine (Pinus monticola Dougl.). The best explant was a 2-mm-thick cross-sectional slice of the early winter bud. Genotype of the donor tree was a significant factor affecting shoot production, but more than 80% of the genotypes tested produced shoots. Of the media tested, bud slices from 1- to 3-year-old trees grew best in Litvay's medium containing N(6)-benzyladenine in the range of 1 to 30 micro M, whereas bud slices from older trees grew best in Gupta and Durzan's DCR medium with zeatin riboside. Up to 400 shoots more than 3 mm in height were obtained from 100 bud-slice explants taken from 7-year-old western white pine trees.
-
Long-term changes in fusiform rust incidence in the southeastern United States
KaDonna C. Randolph; Ellis B. Cowling; Dale A. Starkey
2015-01-01
Fusiform rust is the most devastating disease of slash pine (Pinus elliottii) and loblolly pine (Pinus taeda) in the southeastern United States. Since the 1970s, the USDA Forest Service Forest Inventory and Analysis (FIA) Program has assessed fusiform rust incidence on its network of ground plots in 13 states across the...
-
Guo, Xiang; Wang, Ming Tian; Zhang, Guo Zhi
2017-12-01
The winter reproductive areas of Puccinia striiformis var. striiformis in Sichuan Basin are often the places mostly affected by wheat stripe rust. With data on the meteorological condition and stripe rust situation at typical stations in the winter reproductive area in Sichuan Basin from 1999 to 2016, this paper classified the meteorological conditions inducing wheat stripe rust into 5 grades, based on the incidence area ratio of the disease. The meteorological factors which were biologically related to wheat stripe rust were determined through multiple analytical methods, and a meteorological grade model for forecasting wheat stripe rust was created. The result showed that wheat stripe rust in Sichuan Basin was significantly correlated with many meteorological factors, such as the ave-rage (maximum and minimum) temperature, precipitation and its anomaly percentage, relative humidity and its anomaly percentage, average wind speed and sunshine duration. Among these, the average temperature and the anomaly percentage of relative humidity were the determining factors. According to a historical retrospective test, the accuracy of the forecast based on the model was 64% for samples in the county-level test, and 89% for samples in the municipal-level test. In a meteorological grade forecast of wheat stripe rust in the winter reproductive areas in Sichuan Basin in 2017, the prediction was accurate for 62.8% of the samples, with 27.9% error by one grade and only 9.3% error by two or more grades. As a result, the model could deliver satisfactory forecast results, and predicate future wheat stripe rust from a meteorological point of view.
-
Directory of Open Access Journals (Sweden)
Xiaofei Yang
Full Text Available Leymus mollis (2n = 4x = 28, NsNsXmXm possesses novel and important genes for resistance against multi-fungal diseases. The development of new wheat-L. mollis introgression lines is of great significance for wheat disease resistance breeding. M11003-3-1-15-8, a novel disomic substitution line of common wheat cv. 7182 -L. mollis, developed and selected from the BC1F5 progeny between wheat cv. 7182 and octoploid Tritileymus M47 (2n = 8x = 56, AABBDDNsNs, was characterized by morphological and cytogenetic identification, analysis of functional molecular markers, genomic in situ hybridization (GISH, sequential fluorescence in situ hybridization (FISH-genomic in situ hybridization (GISH and disease resistance evaluation. Cytological observations suggested that M11003-3-1-15-8 contained 42 chromosomes and formed 21 bivalents at meiotic metaphase I. The GISH investigations showed that line contained 40 wheat chromosomes and a pair of L. mollis chromosomes. EST-STS multiple loci markers and PLUG (PCR-based Landmark Unique Gene markers confirmed that the introduced L. mollis chromosomes belonged to homoeologous group 7, it was designated as Lm#7Ns. While nulli-tetrasomic and sequential FISH-GISH analysis using the oligonucleotide Oligo-pSc119.2 and Oligo-pTa535 as probes revealed that the wheat 7D chromosomes were absent in M11003-3-1-15-8. Therefore, it was deduced that M11003-3-1-15-8 was a wheat-L. mollis Lm#7Ns (7D disomic substitution line. Field disease resistance demonstrated that the introduced L. mollis chromosomes Lm#7Ns were responsible for the stripe rust resistance at the adult stage. Moreover, M11003-3-1-15-8 had a superior numbers of florets. The novel disomic substitution line M11003-3-1-15-8, could be exploited as an important genetic material in wheat resistance breeding programs and genetic resources.
-
Fusiform Rust of Southern Pines
W. R. Phelps; F. L. Czabator
1978-01-01
Fusiform rust, caused by the fungus Cronartium fusiforme Hedg. & Hunt ex Cumm., is distributed in the Southern United States from Maryland to Florida and west to Texas and southern Arkansas. Infections by the fungus, which develops at or near the point of infection, result in tapered, spindle-shaped swells, called galls, on branches and stems of pines. (see photo...
-
Majka, Maciej; Kwiatek, Michał T; Majka, Joanna; Wiśniewska, Halina
2017-01-01
Aegilops tauschii (2n = 2x = 14) is a diploid wild species which is reported as a donor of the D-genome of cultivated bread wheat. The main goal of this study was to examine the differences and similarities in chromosomes organization among accessions of Ae. tauschii with geographically diversed origin, which is believed as a potential source of genes, especially determining resistance to fungal diseases (i.e., leaf rust and powdery mildew) for breeding of cereals. We established and compared the fluorescence in situ hybridization patterns of 21 accessions of Ae. tauschii using various repetitive sequences mainly from the BAC library of wheat cultivar Chinese Spring. Results obtained for Ae. tauschii chromosomes revealed many similarities between analyzed accessions, however, some hybridization patterns were specific for accessions, which become from cognate regions of the World. The most noticeable differences were observed for accessions from China which were characterized by presence of distinct signals of pTa-535 in the interstitial region of chromosome 3D, less intensity of pTa-86 signals in chromosome 2D, as well as lack of additional signals of pTa-86 in chromosomes 1D, 5D, or 6D. Ae. tauschii of Chinese origin appeared homogeneous and separate from landraces that originated in western Asia. Ae. tauschii chromosomes showed similar hybridization patterns to wheat D-genome chromosomes, but some differences were also observed among both species. What is more, we identified reciprocal translocation between short arm of chromosome 1D and long arm of chromosome 7D in accession with Iranian origin. High polymorphism between analyzed accessions and extensive allelic variation were revealed using molecular markers associated with resistance genes. Majority of the markers localized in chromosomes 1D and 2D showed the diversity of banding patterns between accessions. Obtained results imply, that there is a moderate or high level of polymorphism in the genome of Ae
-
Effect of fungicide on the development of wheat stem rust and yield ...
African Journals Online (AJOL)
Stem rust caused by Puccinia graminis f.sp tritici Erik. & E. Henn. is a highly destructive disease of wheat (Triticum aestivum L.). The effects of fungicide application on stem rust (Puccinia graminis tritici) epidemics and yield of three bread wheat varieties varying in reaction to the disease were studied in two major wheat ...
-
Genetic markers for western corn rootworm resistance to Bt toxin.
Flagel, Lex E; Swarup, Shilpa; Chen, Mao; Bauer, Christopher; Wanjugi, Humphrey; Carroll, Matthew; Hill, Patrick; Tuscan, Meghan; Bansal, Raman; Flannagan, Ronald; Clark, Thomas L; Michel, Andrew P; Head, Graham P; Goldman, Barry S
2015-01-07
Western corn rootworm (WCR) is a major maize (Zea mays L.) pest leading to annual economic losses of more than 1 billion dollars in the United States. Transgenic maize expressing insecticidal toxins derived from the bacterium Bacillus thuringiensis (Bt) are widely used for the management of WCR. However, cultivation of Bt-expressing maize places intense selection pressure on pest populations to evolve resistance. Instances of resistance to Bt toxins have been reported in WCR. Developing genetic markers for resistance will help in characterizing the extent of existing issues, predicting where future field failures may occur, improving insect resistance management strategies, and in designing and sustainably implementing forthcoming WCR control products. Here, we discover and validate genetic markers in WCR that are associated with resistance to the Cry3Bb1 Bt toxin. A field-derived WCR population known to be resistant to the Cry3Bb1 Bt toxin was used to generate a genetic map and to identify a genomic region associated with Cry3Bb1 resistance. Our results indicate that resistance is inherited in a nearly recessive manner and associated with a single autosomal linkage group. Markers tightly linked with resistance were validated using WCR populations collected from Cry3Bb1 maize fields showing significant WCR damage from across the US Corn Belt. Two markers were found to be correlated with both diet (R2 = 0.14) and plant (R2 = 0.23) bioassays for resistance. These results will assist in assessing resistance risk for different WCR populations, and can be used to improve insect resistance management strategies. Copyright © 2015 Flagel et al.
-
In situ hybridization for the detection of rust fungi in paraffin embedded plant tissue sections.
Ellison, Mitchell A; McMahon, Michael B; Bonde, Morris R; Palmer, Cristi L; Luster, Douglas G
2016-01-01
Rust fungi are obligate pathogens with multiple life stages often including different spore types and multiple plant hosts. While individual rust pathogens are often associated with specific plants, a wide range of plant species are infected with rust fungi. To study the interactions between these important pathogenic fungi and their host plants, one must be able to differentiate fungal tissue from plant tissue. This can be accomplished using the In situ hybridization (ISH) protocol described here. To validate reproducibility using the ISH protocol, samples of Chrysanthemum × morifolium infected with Puccinia horiana, Gladiolus × hortulanus infected with Uromyces transversalis and Glycine max infected with Phakopsora pachyrhizi were tested alongside uninfected leaf tissue samples. The results of these tests show that this technique clearly distinguishes between rust pathogens and their respective host plant tissues. This ISH protocol is applicable to rust fungi and potentially other plant pathogenic fungi as well. It has been shown here that this protocol can be applied to pathogens from different genera of rust fungi with no background staining of plant tissue. We encourage the use of this protocol for the study of plant pathogenic fungi in paraffin embedded sections of host plant tissue.
-
Natural regeneration of whitebark pine: Factors affecting seedling density
S. Goeking; D. Izlar
2014-01-01
Whitebark pine (Pinus albicaulis) is an ecologically important species in high-altitude areas of the western United States and Canada due to the habitat and food source it provides for Clarkâs nutcrackers, red squirrels, grizzly bears, and other animals. Whitebark pine stands have recently experienced high mortality due to wildfire, white pine blister rust, and a...
-
Lawrence, Gregory J.; Dodds, Peter N.; Ellis, Jeffrey G.
2009-01-01
Rust fungi cause devastating diseases on many important food crops, with a damaging stem rust epidemic currently affecting wheat production in Africa and the Middle East. These parasitic fungi propagate exclusively on plants, precluding the use of many biotechnological tools available for other culturable fungi. In particular the lack of a stable transformation system has been an impediment to the genetic manipulation required for molecular analysis of rust pathogenicity. We have developed an...
-
Negotiating the Geopolitics of Student Resistance in Global Feminisms Classrooms
Ergun, Emek
2013-01-01
This article discusses the geo-political operations of student resistance in global feminisms classrooms, a topic that is largely ignored in the feminist pedagogies literature, where a generic understanding of the feminist teacher as a white, American and/or Western, and upper-class PhD seems to dominate. Given that the number of minority faculty…
-
Abnormal germling development by brown rust and powdery mildew on cer barley mutants
Rubiales, D.; Ramirez, M.C.; Carver, T.L.W.; Niks, R.E.
2001-01-01
The barley leaf rust fungus forms appressoria over host leaf stomata and penetrates via the stomatal pore. High levels of avoidance to leaf rust fungi have been described in some wild accessions of Hordeum species where a prominent wax layer on the stomata inhibits triggering of fungal appressorium
-
Chemical reduction of rust on 2 1/4 Cr-1 Mo steel surface in sodium
International Nuclear Information System (INIS)
Yokota, N.; Shimoyashiki, S.
1986-01-01
Low-alloy Fe-2 1/4 Cr-1 Mo ferritic steel has been favored for the tube material of steam generators in fast breeder reactors (FBRs). However, this material rusts easily due to moisture condensation on its surface when left in air. Therefore, measures to prevent tube materials from rusting have been taken during manufacturing of the steam generators. When rust is present on tube surfaces, its oxygen and iron dissolve into liquid sodium. When the concentration of these impurities in the sodium increases rapidly, the cold traps can become choked locally and lose their removal ability. This work has been done, therefore, to clarify reduction processes of rust in sodium and to select optimum operating temperatures of steam generators in the initial operation
-
Molecular and genetic study of wheat rusts
African Journals Online (AJOL)
Nicholas Le Maitre
Phylogenetic trees were created for leaf and stem rust pathotypes. Field isolates of ... Key words: Prevalence, microsatellite, amplified fragment length polymorphisms (AFLP), phylogeny, Puccinia. INTRODUCTION. Puccinia triticina Eriks ..... Genetic distances and reconstruction phylogenetic trees from microsatellite DNA.
-
Environment-Friendly Control of Pear Scab and Rust Using Lime Sulfur
Directory of Open Access Journals (Sweden)
Ju Hoon Cha
2018-03-01
Full Text Available Pear scab and rust are the major diseases causing severe epidemics in organic cultivation of pear trees. Incidences of pear scab and rust were compared in organically managed plots and conventionally managed plots to obtain optimum application schedule of environment-friendly control agents in organically managed plots. Organically cultural practice with 10 time-applications of lime sulfur and Bordeaux mixture showed higher than 40% of control efficacies of pear scab and rust compared to conventionally cultural practice. Organically cultural practice with 8 time-applications of lime sulfur considering weather condition showed higher than 30% of control efficacies of pear scab compared to conventionally cultural practice. The results suggest that proper application of environment-friendly control agents such as lime sulfur considering weather condition will enable effective control of the major diseases for organic cultivation of pear.
-
Rust formed on cannons of XVIII century under two environment conditions
International Nuclear Information System (INIS)
Cindra Fonseca, M.P.; Bastos, I.N.; Caytuero, A.; Baggio Saitovitch, E.M.
2007-01-01
The corrosion products of two ancient cannons exposed to atmospheric corrosion were analysed by X-ray powder diffraction, transmission Moessbauer spectroscopy and scanning electron microscopy (SEM). After almost three centuries exposed in marine environment one of them was moved to a rural region and was maintained in this environment for approximately 30 years. The inland region has an altitude of 1000 m above sea level and consequently low aggressiveness. The studied rusts were obtained from external and internal surfaces of the cannon barrels. This investigation, using three different techniques, was done to check if the relatively short time (ca. 30 years) in rural area was sufficient to change the characteristics of the thick rust formed during long time exposure (ca. 300 years) in marine atmosphere. The time-environment effects change the physical nature of rust, mainly observed by Moessbauer spectroscopy results
-
Zoete rust : Een muzikale soap-detective
Maas, P.
1989-01-01
De komedie' Zoete Rust' werd geschreven in opdracht van Theater de Tobbe in Voorburg . Naast de circa 120 professionele voorstellingen die elk seizoen in dit theater plaats vinden, organiseert De Tobbe een maal per laar een eigen theaterproduktie, die wordt gespeeld door het Tobbe-toneel, een ad-hoc
-
Sarah Hines; Ned Klopfenstein; Bryce Richardson; Marcus Warwell; Mee-Sook Kim
2013-01-01
Western white pine (Pinus monticola) is a species that used to dominate the forests of the Interior Northwest prior to the expansion of the Northern Pacific Railroad in the late 19th century. Its foundational role contributed to a landscape that was resilient, fire-adapted, and provided abundant suitable habitat for terrestrial and aquatic species. However, substantial...
-
Green rusts synthesis by coprecipitation of Fe II-Fe III ions and mass-balance diagram
Ruby, Christian; Aïssa, Rabha; Géhin, Antoine; Cortot, Jérôme; Abdelmoula, Mustapha; Génin, Jean-Marie
2006-06-01
A basic solution is progressively added to various mixed Fe II-Fe III solutions. The nature and the relative quantities of the compounds that form can be visualised in a mass-balance diagram. The formation of hydroxysulphate green rust {GR( SO42-)} is preceded by the precipitation of a sulphated ferric basic salt that transforms in a badly ordered ferric oxyhydroxide. Then octahedrally coordinated Fe II species and SO42- anions are adsorbed on the FeOOH surface and GR( SO42-) is formed at the solid/solution interface. By using the same method of preparation, other types of green rust were synthesised, e.g. hydroxycarbonate green rust {GR( CO32-)}. Like other layered double hydroxides, green rusts obey the general chemical formula [ṡ[ṡmHO]x+ with x⩽1/3. Al-substituted hydroxysulphate green rust consists of small hexagonal crystals with a lateral size ˜50 nm, which is significantly smaller than the size of the GR( SO42-) crystals (˜500 nm). To cite this article: C. Ruby et al., C. R. Geoscience 338 (2006).
-
Strategies to be used in the struggle between resistance and virulence genes
International Nuclear Information System (INIS)
Zitelli, G.; Vallega, V.
1977-01-01
The cultivation of wheat varieties resistant to diseases such as stem and leaf rusts, mildew and septoria plays an important role in modern agriculture. However, the problem of how to keep varieties resistant for a long period has not yet been solved. Whatever type of resistance (specific, non-specific, tolerance etc.) the breeder chooses to use in his breeding work, the resistance stability will depend very much on the strategy used. There are many different approaches: (i) To introduce single specific factors into the cultivated varieties; (ii) To introduce the maximum number of factors in the same variety; (iii) To create multiline varieties; (iv) To cultivate different varieties carrying different resistant factors. Such a ''mosaic'' artificially creates, as in the case of multiline varieties, conditions similar to those which we find in wild populations. The use of multiline varieties and of ''mosaic'' varieties stresses the need for finding a greater number of different genes for resistance. At present we know that a large number of genes for resistance to rusts and to mildew is available in bread and durum wheats and in related species. (author)
-
International Nuclear Information System (INIS)
Yamashita, Masato; Uchida, Hitoshi; Konishi, Hiroyuki; Mizuki, Jun'ichiro
2004-01-01
The X-ray absorption fine structure (XAFS) spectrum of pure goethite around the Fe K absorption edge and that of the protective rust layer formed on weathering steel exposed for 17 years in an atmospheric environment around the Cr K edge, have been examined using synchrotron radiation X-rays. It was found that the rust layer on the weathering steel mainly consisted of Cr-goethite. By examining the fine structure at the Cr K edge and the Fe K edge, we concluded that Cr 3+ in the rust layer is coordinated with O 2- and is positioned in the double chains of vacant sites in the network of FeO 3 (OH) 3 octahedra in the goethite crystal. This Cr 3+ site indicates that the protective effect of the rust layer is due to the dense aggregation of fine crystals of Cr-goethite with cation selectivity. (author)
-
Influence of lactate ions on the formation of rust
International Nuclear Information System (INIS)
Sabot, R.; Jeannin, M.; Gadouleau, M.; Guo, Q.; Sicre, E.; Refait, Ph.
2007-01-01
The formation of rust can be simulated by oxidation of aqueous suspensions of Fe(OH) 2 obtained by mixing solutions of NaOH and a Fe(II) salt. The aim of this study was to investigate the influence of organic species associated with microbially influenced corrosion. The lactate anion, often used as a carbon and electrons source for the development of microorganisms, was chosen as an example. Then, in the first part of the study, Fe(OH) 2 was precipitated using iron(II) lactate and NaOH. Its oxidation process involved two stages, as usually observed. The first stage led to a Fe(II-III) intermediate compound, the lactate green rust, GR(C 3 H 5 O 3 - ). This compound has never been reported yet. Its existence demonstrates that the GR structure is able to incorporate a very wide range of anions, whatever the size and geometry. The second stage corresponded to the oxidation of GR(C 3 H 5 O 3 - ). It led to ferrihydrite, the most poorly ordered form of iron(III) oxides and oxyhydroxides. In the second part of the study, the formation of rust in seawater was simulated by oxidation of Fe(OH) 2 in an aqueous media containing both Cl - and SO 4 2- anions. The first stage led to the sulphate green rust, GR(SO 4 2- ), the second stage to lepidocrocite γ-FeOOH. Small amounts of iron(II) lactate were added to the reactants. Lactate ions did not modify the first stage but drastically perturbed the second stage, as ferrihydrite was obtained instead of γ-FeOOH
-
Jafary, H.; Szabo, L.J.; Niks, R.E.
2006-01-01
We developed an evolutionary relevant model system, barley-Puccini rust fungi, to study the inheritance and specificity of plant factors that determine to what extent innate nonhost immunity can be suppressed. A mapping population was developed from a cross between an experimental barley line
-
DEFF Research Database (Denmark)
Liu, Changhai
Stripe rust caused by Puccinia striiformis f. sp. tritici (Pst), is one of the most important fungal diseases on wheat worldwide and a serious threat to wheat production. Understanding the plant-microbe interaction mechanism is the basic step to assist future plant breeding aiming at increasing...... factor. By using the yeast two-hybrid system, the adenosine kinase (ADK) was identified as a host target of PEC6. Virus-induced gene silencing (VIGS) of ADK enhanced wheat susceptibility to stripe rust indicates that ADK is a positive regulator in plant defense. Based on EtHAn-mediated effector delivery......, seventy-two wheat landraces were screened to search for the presence of potential resistance (R) genes. Three landraces showed strong hypersensitive response (HR) when PEC6 was expressed in the cells, suggesting the presence of certain R gene(s) recognizing PEC6. However, these landraces did not show...
-
Séré, Mathieu G; Tortosa, Pablo; Chabanet, Pascale; Turquet, Jean; Quod, Jean-Pascal; Schleyer, Michael H
2013-01-01
The scleractinian coral Porites lutea, an important reef-building coral on western Indian Ocean reefs (WIO), is affected by a newly-reported white syndrome (WS) the Porites white patch syndrome (PWPS). Histopathology and culture-independent molecular techniques were used to characterise the microbial communities associated with this emerging disease. Microscopy showed extensive tissue fragmentation generally associated with ovoid basophilic bodies resembling bacterial aggregates. Results of 16S rRNA sequence analysis revealed a high variability between bacterial communities associated with PWPS-infected and healthy tissues in P. lutea, a pattern previously reported in other coral diseases such as black band disease (BBD), white band disease (WBD) and white plague diseases (WPD). Furthermore, substantial variations in bacterial communities were observed at the different sampling locations, suggesting that there is no strong bacterial association in Porites lutea on WIO reefs. Several sequences affiliated with potential pathogens belonging to the Vibrionaceae and Rhodobacteraceae were identified, mainly in PWPS-infected coral tissues. Among them, only two ribotypes affiliated to Shimia marina (NR043300.1) and Vibrio hepatarius (NR025575.1) were consistently found in diseased tissues from the three geographically distant sampling localities. The role of these bacterial species in PWPS needs to be tested experimentally.
-
The Ouro Negro common bean cultivar contains the Co-34/Phg-3 gene cluster that confers resistance to the anthracnose (ANT) and angular leaf spot (ALS) pathogens. These genes are tightly linked on chromosome 4. Ouro Negro also has the Ur-14 rust resistance gene, reportedly in the vicinity of Co- 34; ...
-
The formation of green rust induced by tropical river biofilm components
International Nuclear Information System (INIS)
Jorand, F.; Zegeye, A.; Ghanbaja, J.; Abdelmoula, M.
2011-01-01
In the Sinnamary Estuary (French Guiana), a dense red biofilm grows on flooded surfaces. In order to characterize the iron oxides in this biofilm and to establish the nature of secondary minerals formed after anaerobic incubation, we conducted solid analysis and performed batch incubations. Elemental analysis indicated a major amount of iron as inorganic compartment along with organic matter. Solid analysis showed the presence of two ferric oxides ferrihydrite and lepidocrocite. Bacteria were abundant and represented more than 10 11 cells g -1 of dry weight among which iron reducers were revealed. Optical and electronic microscopy analysis revealed than the bacteria were in close vicinity of the iron oxides. After anaerobic incubations with exogenous electron donors, the biofilm's ferric material was reduced into green rust, a Fe II -Fe III layered double hydroxide. This green rust remained stable for several years. From this study and previous reports, we suggest that ferruginous biofilms should be considered as a favorable location for GR biomineralization when redox conditions and electron donors availability are gathered. - Research highlights: → Characterization of ferruginous biofilm components by solid analysis methods. → Lepidocrocite and ferrihydrite were the main iron oxides. → Anaerobic incubation of biofilm with electron donors produced green rust. → Biofilm components promote the formation of the green rust. → Ferruginous biofilm could contribute to the natural mercury attenuation.