WorldWideScience

Sample records for rod myopathy nrm

  1. Myopathies

    Science.gov (United States)

    ... find appropri- ate therapists, and to locate and purchase important assistive devices. And today, people with disabilities ... in inheritable myopathies • Anesthesia: People with myopathies can experience a range of adverse reactions to certain anesthetic ...

  2. Myopathy

    Science.gov (United States)

    ... alternating episodes of twitching and stiffness; and stiff-man syndrome: characterized by episodes of rigidity and reflex spasms common muscle cramps and stiffness, and tetany: characterized by prolonged spasms of the arms and legs × Definition The myopathies are neuromuscular disorders in which the ...

  3. Desmin myopathy with severe cardiomyopathy in a Uruguayan family due to a codon deletion in a new location within the desmin 1A rod domain.

    Science.gov (United States)

    Vernengo, Luis; Chourbagi, Oussama; Panuncio, Ana; Lilienbaum, Alain; Batonnet-Pichon, Sabrina; Bruston, Francine; Rodrigues-Lima, Fernando; Mesa, Rosario; Pizzarossa, Carlos; Demay, Laurence; Richard, Pascale; Vicart, Patrick; Rodriguez, Maria-Mirta

    2010-03-01

    Desmin myopathy is a heterogeneous neuromuscular disorder characterized by skeletal myopathy and cardiomyopathy, inherited mostly in an autosomal dominant pattern. We report a five generation Uruguayan family with severe cardiomyopathy and skeletal myopathy. Its most striking features are: atrial dilation, arrhythmia, conduction block and sudden death due to conduction impairment. Affected skeletal muscle shows alteration of mitochondria with paracrystallin inclusions and granulofilamentous material scattered in the muscle fibres. This family carries an unusual deletion p.E114del within the 1A rod domain of desmin. Transfected cells expressing the mutated desmin show punctuated and speckled cytoplasmic aggregates. The mutation causes a local conformational change in heptads a/d residues and charge positions. These findings lead to the hypothesis that coiled-coil interactions may be impaired, resulting in severe alterations in the desmin network. This is the first time that a mutation affecting this domain in the desmin molecule is described in a desminopathy. Copyright 2010. Published by Elsevier B.V.

  4. Sagging Eye Syndrome or Nemaline Rod Myopathy? Divergence Insufficiency with Levator Dehiscence as an Overlapping Symptom between Two Diagnoses

    Directory of Open Access Journals (Sweden)

    Stephanie S. L. Cheung

    2017-01-01

    Full Text Available A 78-year-old woman complained of gradual, painless onset of horizontal binocular diplopia associated with progressive axial weakness. Physical examination revealed esotropia that was greater at distance than at near vision, bilateral levator dehiscence, and normal abducting saccadic speeds. Given the age of the patient and compatible clinical findings, the diagnosis of Sagging Eye Syndrome (SES was made. However, further work-up with a muscle biopsy suggested Sporadic Late-Onset Nemaline Myopathy (SLONM as the cause of her progressive muscle weakness. Although rare, external ophthalmoplegia has been described in the literature as a presenting symptom in SLONM. To elucidate the pathological mechanism for the patient’s diplopia, an MRI of the orbits was performed, which revealed findings consistent with SES. This case aims to highlight the importance of integrating clinical findings during the diagnostic process and serves as a reminder that diplopia can be a common symptom for an uncommon diagnosis.

  5. DISTAL MYOPATHIES

    Science.gov (United States)

    Dimachkie, Mazen M.; Barohn, Richard J.

    2014-01-01

    Over a century ago, Gowers described two young patients in whom distal muscles weakness involved the hand, foot, sternocleidomastoid, and facial muscles in the other case the shoulder and distal leg musculature. Soon after, , similar distal myopathy cases were reported whereby the absence of sensory symptoms and of pathologic changes in the peripheral nerves and spinal cord at postmortem examination allowed differentiation from Charcot-Marie-Tooth disease. In 1951, Welander described autosomal dominant (AD) distal arm myopathy in a large Scandanavian cohort. Since then the number of well-characterized distal myopathies has continued to grow such that the distal myopathies have formed a clinically and genetically heterogeneous group of disorders. Affected kindred commonly manifest weakness that is limited to foot and toe muscles even in advanced stages of the disease, with variable mild proximal leg, distal arm, neck and laryngeal muscle involvement in selected individuals. An interesting consequence of the molecular characterization of the distal myopathies has been the recognition that mutation in a single gene can lead to more than one clinical disorder. For example, Myoshi myopathy (MM) and limb girdle muscular dystrophy (LGMD) type 2B are allelic disorders due to defects in the gene that encodes dysferlin. The six well described distal myopathy syndromes are shown in Table 1. Table 2 lists advances in our understanding of the myofibrillar myopathy group and Table 3 includes more recently delineated and less common distal myopathies. In the same manner, the first section of this review pertains to the more traditional six distal myopathies followed by discussion of the myofibrillar myopathies. In the third section, we review other clinically and genetically distinctive distal myopathy syndromes usually based upon single or smaller family cohorts. The fourth section considers other neuromuscular disorders that are important to recognize as they display prominent

  6. Axial myopathy

    DEFF Research Database (Denmark)

    Witting, Nanna; Andersen, Linda K; Vissing, John

    2016-01-01

    Classically, myopathies are categorized according to limb or cranial nerve muscle affection, but with the growing use of magnetic resonance imaging it has become evident that many well-known myopathies have significant involvement of the axial musculature. New disease entities with selective axial...

  7. Metabolic Myopathies.

    Science.gov (United States)

    Tarnopolsky, Mark A

    2016-12-01

    Metabolic myopathies are genetic disorders that impair intermediary metabolism in skeletal muscle. Impairments in glycolysis/glycogenolysis (glycogen-storage disease), fatty acid transport and oxidation (fatty acid oxidation defects), and the mitochondrial respiratory chain (mitochondrial myopathies) represent the majority of known defects. The purpose of this review is to develop a diagnostic and treatment algorithm for the metabolic myopathies. The metabolic myopathies can present in the neonatal and infant period as part of more systemic involvement with hypotonia, hypoglycemia, and encephalopathy; however, most cases present in childhood or in adulthood with exercise intolerance (often with rhabdomyolysis) and weakness. The glycogen-storage diseases present during brief bouts of high-intensity exercise, whereas fatty acid oxidation defects and mitochondrial myopathies present during a long-duration/low-intensity endurance-type activity or during fasting or another metabolically stressful event (eg, surgery, fever). The clinical examination is often normal between acute events, and evaluation involves exercise testing, blood testing (creatine kinase, acylcarnitine profile, lactate, amino acids), urine organic acids (ketones, dicarboxylic acids, 3-methylglutaconic acid), muscle biopsy (histology, ultrastructure, enzyme testing), MRI/spectroscopy, and targeted or untargeted genetic testing. Accurate and early identification of metabolic myopathies can lead to therapeutic interventions with lifestyle and nutritional modification, cofactor treatment, and rapid treatment of rhabdomyolysis.

  8. Mitochondrial myopathies.

    Science.gov (United States)

    DiMauro, Salvatore

    2006-11-01

    Our understanding of mitochondrial diseases (defined restrictively as defects of the mitochondrial respiratory chain) is expanding rapidly. In this review, I will give the latest information on disorders affecting predominantly or exclusively skeletal muscle. The most recently described mitochondrial myopathies are due to defects in nuclear DNA, including coenzyme Q10 deficiency and mutations in genes controlling mitochondrial DNA abundance and structure, such as POLG, TK2, and MPV17. Barth syndrome, an X-linked recessive mitochondrial myopathy/cardiopathy, is associated with decreased amount and altered structure of cardiolipin, the main phospholipid of the inner mitochondrial membrane, but a secondary impairment of respiratory chain function is plausible. The role of mutations in protein-coding genes of mitochondrial DNA in causing isolated myopathies has been confirmed. Mutations in tRNA genes of mitochondrial DNA can also cause predominantly myopathic syndromes and--contrary to conventional wisdom--these mutations can be homoplasmic. Defects in the mitochondrial respiratory chain impair energy production and almost invariably involve skeletal muscle, causing exercise intolerance, cramps, recurrent myoglobinuria, or fixed weakness, which often affects extraocular muscles and results in droopy eyelids (ptosis) and progressive external ophthalmoplegia.

  9. [Metabolic myopathies].

    Science.gov (United States)

    Papazian, Óscar; Rivas-Chacón, Rafael

    2013-09-06

    To review the metabolic myopathies manifested only by crisis of myalgias, cramps and rigidity of the muscles with decreased voluntary contractions and normal inter crisis neurologic examination in children and adolescents. These metabolic myopathies are autosomic recessive inherited enzymatic deficiencies of the carbohydrates and lipids metabolisms. The end result is a reduction of intra muscle adenosine triphosphate, mainly through mitochondrial oxidative phosphorylation, with decrease of available energy for muscle contraction. The one secondary to carbohydrates intra muscle metabolism disorders are triggered by high intensity brief (fatty acids metabolism disorders are triggered by low intensity prolonged (> 10 min) exercises. The conditions in the first group in order of decreasing frequency are the deficiencies of myophosforilase (GSD V), muscle phosphofructokinase (GSD VII), phosphoglycerate mutase 1 (GSD X) and beta enolase (GSD XIII). The conditions in the second group in order of decreasing frequency are the deficiencies of carnitine palmitoyl transferase II and very long chain acyl CoA dehydrogenase. The differential characteristics of patients in each group and within each group will allow to make the initial presumptive clinical diagnosis in the majority and then to order only the necessary tests to achieve the final diagnosis. Treatment during the crisis includes hydration, glucose and alkalinization of urine if myoglobin in blood and urine are elevated. Prevention includes avoiding exercise which may induce the crisis and fasting. The prognosis is good with the exception of rare cases of acute renal failure due to hipermyoglobinemia because of severe rabdomyolisis.

  10. Molecular and Genetic Studies of Congenital Myopathies

    Science.gov (United States)

    2018-03-21

    Central Core Disease; Centronuclear Myopathy; Congenital Fiber Type Disproportion; Multiminicore Disease; Myotubular Myopathy; Nemaline Myopathy; Rigid Spine Muscular Dystrophy; Undefined Congenital Myopathy

  11. Myopathy in acute hypothyroidism

    OpenAIRE

    Ma, JTC; Yu, YL; Kung, AWC

    1987-01-01

    Hypothyroid myopathy has so far been reported in long standing cases of hypothyroidism. We describe two adult patients with myopathy associated with acute transient hypothyroidism. Both presented with severe muscle aches and cramps, stiffness and spasms. Muscle enzymes were markedly elevated and electromyography in one patient showed myopathic features. Histological changes were absent in muscle biopsy, probably because of the short duration of metabolic disturbance. The myopathy subsided pro...

  12. Myopathy in acute hypothyroidism.

    OpenAIRE

    Kung, A. W.; Ma, J. T.; Yu, Y. L.; Wang, C. C.; Woo, E. K.; Lam, K. S.; Huang, C. Y.; Yeung, R. T.

    1987-01-01

    Hypothyroid myopathy has so far been reported in long standing cases of hypothyroidism. We describe two adult patients with myopathy associated with acute transient hypothyroidism. Both presented with severe muscle aches and cramps, stiffness and spasms. Muscle enzymes were markedly elevated and electromyography in one patient showed myopathic features. Histological changes were absent in muscle biopsy, probably because of the short duration of metabolic disturbance. The myopathy subsided pro...

  13. Genetics Home Reference: Miyoshi myopathy

    Science.gov (United States)

    ... links) Centers for Disease Control and Prevention: Muscular Dystrophy Cincinnati Children's Hospital: Molkentin Lab: Mechanisms of Duchenne and Miyoshi Myopathy Disease InfoSearch: Miyoshi myopathy Jain ...

  14. Mutation update and genotype-phenotype correlations of novel and previously described mutations in TPM2 and TPM3 causing congenital myopathies

    NARCIS (Netherlands)

    Marttila, Minttu; Lehtokari, Vilma-Lotta; Marston, Steven; Nyman, Tuula A.; Barnerias, Christine; Beggs, Alan H.; Bertini, Enrico; Ceyhan-Birsoy, Ozge; Cintas, Pascal; Gerard, Marion; Gilbert-Dussardier, Brigitte; Hogue, Jacob S.; Longman, Cheryl; Eymard, Bruno; Frydman, Moshe; Kang, Peter B.; Klinge, Lars; Kolski, Hanna; Lochmüller, Hans; Magy, Laurent; Manel, Véronique; Mayer, Michèle; Mercuri, Eugenio; North, Kathryn N.; Peudenier-Robert, Sylviane; Pihko, Helena; Probst, Frank J.; Reisin, Ricardo; Stewart, Willie; Taratuto, Ana Lia; de Visser, Marianne; Wilichowski, Ekkehard; Winer, John; Nowak, Kristen; Laing, Nigel G.; Winder, Tom L.; Monnier, Nicole; Clarke, Nigel F.; Pelin, Katarina; Grönholm, Mikaela; Wallgren-Pettersson, Carina

    2014-01-01

    Mutations affecting skeletal muscle isoforms of the tropomyosin genes may cause nemaline myopathy, cap myopathy, core-rod myopathy, congenital fiber-type disproportion, distal arthrogryposes, and Escobar syndrome. We correlate the clinical picture of these diseases with novel (19) and previously

  15. [Descending ocular myopathy].

    Science.gov (United States)

    de Freitas, M R; Nascimento, O J

    1975-06-01

    The case of a 23 years old female patient, with primary involvement of the extraocular and faringeal muscles without familiar history is reported. Electromyographic and muscular biopsy studies proved the myogenic nature of the process. A clinical comparison between the ocular myopathy and the descending ocular myopathy is made, the authors thinking that both of them would be variants of the same muscle disease.

  16. Mitochondrial disorders in congenital myopathies

    Directory of Open Access Journals (Sweden)

    D. A. Kharlamov

    2014-01-01

    Full Text Available The literature review gives data on the role of mitochondrial disorders in the pathogenesis of congenital myopathies: congenital muscular dystrophies and congenital structural myopathies. It describes changes in congenital muscular dystrophies with type VI collagen, in myodystrophy with giant mitochondria, in congenital central core myopathies, myotubular myopathy, etc. Clinical and experimental findings are presented. Approaches to therapy for energy disorders in congenital myopathies are depicted.

  17. Climatic influence in NRM and 10 Be-derived geomagnetic paleointensity data

    NARCIS (Netherlands)

    1999-01-01

    One can determine geomagnetic paleointensities from natural remanent magnetizations (NRM) and by inverting production rates of cosmogenic isotopes such as 10 Be and 14 C. Recently, two independently derived 200-kyr stacks [Y. Guyodo, J.-P. Valet, Relative variations in geomagnetic intensity from

  18. STATINS AND MYOPATHY: MOLECULAR MECHANISMS

    Directory of Open Access Journals (Sweden)

    O. M. Drapkina

    2012-01-01

    Full Text Available The safety of statin therapy is considered. In particular the reasons of a complication such as myopathy are discussed in detail. The molecular mechanisms of statin myopathy , as well as its risk factors are presented. The role of coenzyme Q10 in the myopathy development and coenzyme Q10 application for the prevention of this complication are considered. 

  19. The Impact of Varying Statutory Arrangements on Spatial Data Sharing and Access in Regional NRM Bodies

    Science.gov (United States)

    Paudyal, D. R.; McDougall, K.; Apan, A.

    2014-12-01

    Spatial information plays an important role in many social, environmental and economic decisions and increasingly acknowledged as a national resource essential for wider societal and environmental benefits. Natural Resource Management is one area where spatial information can be used for improved planning and decision making processes. In Australia, state government organisations are the custodians of spatial information necessary for natural resource management and regional NRM bodies are responsible to regional delivery of NRM activities. The access and sharing of spatial information between government agencies and regional NRM bodies is therefore as an important issue for improving natural resource management outcomes. The aim of this paper is to evaluate the current status of spatial information access, sharing and use with varying statutory arrangements and its impacts on spatial data infrastructure (SDI) development in catchment management sector in Australia. Further, it critically examined whether any trends and significant variations exist due to different institutional arrangements (statutory versus non-statutory) or not. A survey method was used to collect primary data from 56 regional natural resource management (NRM) bodies responsible for catchment management in Australia. Descriptive statistics method was used to show the similarities and differences between statutory and non-statutory arrangements. The key factors which influence sharing and access to spatial information are also explored. The results show the current statutory and administrative arrangements and regional focus for natural resource management is reasonable from a spatial information management perspective and provides an opportunity for building SDI at the catchment scale. However, effective institutional arrangements should align catchment SDI development activities with sub-national and national SDI development activities to address catchment management issues. We found minor

  20. Genuine myotubular myopathy

    International Nuclear Information System (INIS)

    Edstroem, L.; Wroblewski, R.; Mair, W.G.

    1982-01-01

    Two patients, a father and his 14-year-old son, were suffering from a facioperoneal syndrome, and muscle biopsy findings were consistent with a myotubular myopathy. The father exhibited central nuclei in most muscle fibers, but his son had typical changes exclusively in hypotrophic type I fibers. The cytochemical and ultrastructural analysis revealed a spectrum of pathological changes typical of myotubular myopathy. Energy-dispersive electron probe x-ray microanalysis was performed on 6- to 12-microns thick freeze-dried cryosections visualized in the scanning or scanning transmission mode of electron microscopy. We found a high intracellular sodium and chlorine concentration and a low potassium concentration in comparison with control muscles. These changes pointed in the direction similar to results from human fetal muscle. The changes in the intracellular elemental composition may indicate a membrane pump dysfunction, which might be caused by a partial arrest in muscle fiber maturation

  1. Cerebrovascular Accidents In Myopathies

    Directory of Open Access Journals (Sweden)

    Farzad Fatehi

    2017-02-01

    Full Text Available Several types of stroke in myopathies are described: ischemic, metabolic, or cryptogenic. Ischemic stroke may be categorized as cardioembolic, angiopathic, hemodynamic, or thrombophilic. Cardiac involvement in the form of atrial fibrillation/flutter, dilated cardiomyopathy, or non-compaction Cardioembolic could ensue in stroke. Angiopathic stroke occurs provided that there is atherosclerosis or mitochondrial disorders. Thrombophilic stroke may happen in polymyositis or dermatomyositis along with anti-phospholipid syndrome. Metabolic stroke usually manifests as stroke-like episode and is a distinct feature of various mitochondrial disorders, principally MELAS syndrome. The clinical manifestations are as a result of a vasogenic edema, demonstrating as hyperintensity on T2, DWI, and apparent diffusion coefficient mapping. Differentiation between ischemic and metabolic stroke is essential in terms of diagnosis, therapy, and prognosis. In conclusion, ischemic stroke attributable to cardioembolism, arteriopathy, or thrombophilia are occasional events in myopathies, but metabolic stroke is a frequent feature of mitochondrial disorders.

  2. Muscle regeneration in mitochondrial myopathies

    DEFF Research Database (Denmark)

    Krag, T O; Hauerslev, S; Jeppesen, T D

    2013-01-01

    Mitochondrial myopathies cover a diverse group of disorders in which ragged red and COX-negative fibers are common findings on muscle morphology. In contrast, muscle degeneration and regeneration, typically found in muscular dystrophies, are not considered characteristic features of mitochondrial...... myopathies. We investigated regeneration in muscle biopsies from 61 genetically well-defined patients affected by mitochondrial myopathy. Our results show that the perturbed energy metabolism in mitochondrial myopathies causes ongoing muscle regeneration in a majority of patients, and some were even affected...

  3. Spectrum of metabolic myopathies.

    Science.gov (United States)

    Angelini, Corrado

    2015-04-01

    Metabolic myopathies are disorders of utilization of carbohydrates or fat in muscles. The acute nature of energy failure is manifested either by a metabolic crisis with weakness, sometimes associated with respiratory failure, or by myoglobinuria. A typical disorder where permanent weakness occurs is glycogenosis type II (GSDII or Pompe disease) both in infantile and late-onset forms, where respiratory insufficiency is manifested by a large number of cases. In GSDII the pathogenetic mechanism is still poorly understood, and has to be attributed more to structural muscle alterations, possibly in correlation to macro-autophagy, rather than to energetic failure. This review is focused on recent advances about GSDII and its treatment, and the most recent notions about the management and treatment of other metabolic myopathies will be briefly reviewed, including glycogenosis type V (McArdle disease), glycogenosis type III (debrancher enzyme deficiency or Cori disease), CPT-II deficiency, and ETF-dehydrogenase deficiency (also known as riboflavin-responsive multiple acyl-CoA dehydrogenase deficiency or RR-MADD). The discovery of the genetic defect in ETF dehydrogenase confirms the etiology of this syndrome. Other metabolic myopathies with massive lipid storage and weakness are carnitine deficiency, neutral lipid storage-myopathy (NLSD-M), besides RR-MADD. Enzyme replacement therapy is presented with critical consideration and for each of the lipid storage disorders, representative cases and their response to therapy is included. This article is part of a Special Issue entitled: Neuromuscular Diseases: Pathology and Molecular Pathogenesis. Copyright © 2014. Published by Elsevier B.V.

  4. The stability test of natural remanent magnetization (NRM) vulcanic rock of merapi mountain in central Java

    International Nuclear Information System (INIS)

    Husna; Rauf, Nurlela; Bijaksana, Satria

    2002-01-01

    An assessment has been done on magnetic properties of the rock from the area around the top of Merapi Mountain. The research conducted In form of stability test of Natural Remanent Magnetization (NRM), Which 16 specimens that used in that test were taken from Pasar Bubar, Kali Gendol and Kali Gendong Alternating Field Demagnetization Methods applied on measurement of intensity and direction of NRM and demagnetization process. The result shown that the rock from Pasar Bubar had mean intensity of 2255486 mA/meter with a range of declination 32.80 -650 and inclination -37.40 -3.90, Kali Gendol had mean intensity of 2469.387 mA/meter with range of declination of 356.10-110 and inclination of -490 --0.10, and Kali Gendong had mean Intensity of 4139.062 mA/meter with range of declination of 62.10 -12540 and inclination of -0.80 -3520. The stability test is determined from intensity curve, stereo net Plot. Zijderveld diagram and Maximum Angular Deviation (MAD) According the result, the specimen from kali gendol were the most stable and qualifield for further used on paleomagnetic study

  5. Inherited myopathies and muscular dystrophies

    NARCIS (Netherlands)

    Cardamone, Michael; Darras, Basil T.; Ryan, Monique M.

    The inherited myopathies and muscular dystrophies are a diverse group of muscle diseases presenting with common complaints and physical signs: weakness, motor delay, and respiratory and bulbar dysfunction. The myopathies are caused by genetic defects in the contractile apparatus of muscle, and

  6. Stepwise approach to myopathy in systemic disease.

    Science.gov (United States)

    Chawla, Jasvinder

    2011-01-01

    Muscle diseases can constitute a large variety of both acquired and hereditary disorders. Myopathies in systemic disease results from several different disease processes including endocrine, inflammatory, paraneoplastic, infectious, drug- and toxin-induced, critical illness myopathy, metabolic, and myopathies with other systemic disorders. Patients with systemic myopathies often present acutely or sub acutely. On the other hand, familial myopathies or dystrophies generally present in a chronic fashion with exceptions of metabolic myopathies where symptoms on occasion can be precipitated acutely. Most of the inflammatory myopathies can have a chance association with malignant lesions; the incidence appears to be specifically increased only in patients with dermatomyositis. In dealing with myopathies associated with systemic illnesses, the focus will be on the acquired causes. Management is beyond the scope of this chapter. Prognosis is based upon the underlying cause and, most of the time, carries a good prognosis. In order to approach a patient with suspected myopathy from systemic disease, a stepwise approach is utilized.

  7. Exercise training in metabolic myopathies

    DEFF Research Database (Denmark)

    Vissing, J

    2016-01-01

    metabolic adaptations, such as increased dependence on glycogen use and a reduced capacity for fatty acid oxidation, which is detrimental in GSDs. Training has not been studied systematically in any FAODs and in just a few GSDs. However, studies on single bouts of exercise in most metabolic myopathies show......Metabolic myopathies encompass muscle glycogenoses (GSD) and disorders of muscle fat oxidation (FAOD). FAODs and GSDs can be divided into two main clinical phenotypes; those with static symptoms related to fixed muscle weakness and atrophy, and those with dynamic, exercise-related symptoms...... that are brought about by a deficient supply of ATP. Together with mitochondrial myopathies, metabolic myopathies are unique among muscle diseases, as the limitation in exercise performance is not solely caused by structural damage of muscle, but also or exclusively related to energy deficiency. ATP consumption...

  8. Genetics Home Reference: nemaline myopathy

    Science.gov (United States)

    ... deformities, abnormal curvature of the spine ( scoliosis ), and joint deformities (contractures). Most people with nemaline myopathy are ... Centre for Rare Diseases Washington University, St. Louis: Neuromuscular Disease Center Patient Support and Advocacy Resources (3 ...

  9. Control rod

    International Nuclear Information System (INIS)

    Kawakami, Kazuo; Shimoshige, Takanori; Nishimura, Akira

    1979-01-01

    Purpose: A control rod has been developed, which provided a plurality of through-holes in the vicinity of the sheath fitting position, in order to flatten burn-up, of fuel rods in positions confronting a control rod. Thereby to facilitate the manufacture of the control rods and prevent fuel rod failures. Constitution: A plurality of through-holes are formed in the vicinity of the sheath fitting position of a central support rod to which a sheath for the control rod is fitted. These through-holes are arranged in the axial direction of the central support rod. Accordingly, burn-up of fuel rods confronting the control rods can be reduced by through-holes and fuel rod failures can be prevented. (Yoshino, Y.)

  10. Endocrine myopathy: Case-based review

    Directory of Open Access Journals (Sweden)

    Babul Reddy Hanmayyagari

    2016-01-01

    Full Text Available Endocrine myopathy means muscle weakness in the presence of an abnormal endocrine state. Most of the endocrine disorders are associated with myopathy and it is usually reversible with correction of the underlying disturbance, though, there is an increasing knowledge of the metabolic effects of hormones, endocrine myopathy is a less recognized and often overlooked entity in clinical practice. Here, we describe this association in three of our patients, then, we discuss systematically about endocrine myopathy.

  11. Resveratrol and Myopathy

    Science.gov (United States)

    Bastin, Jean; Djouadi, Fatima

    2016-01-01

    Resveratrol is a natural polyphenolic compound produced by plants under various stress conditions. Resveratrol has been reported to exhibit antioxidant, anti-inflammatory, and anti-proliferative properties in mammalian cells and animal models, and might therefore exert pleiotropic beneficial effects in different pathophysiological states. More recently, resveratrol has also been shown to potentially target many mitochondrial metabolic pathways, including fatty acid β-oxidation or oxidative phosphorylation, leading to the up-regulation of the energy metabolism via signaling pathways involving PGC-1α, SIRT1, and/or AMP-kinase, which are not yet fully delineated. Some of resveratrol beneficial effects likely arise from its cellular effects in the skeletal muscle, which, surprisingly, has been given relatively little attention, compared to other target tissues. Here, we review the potential for resveratrol to ameliorate or correct mitochondrial metabolic deficiencies responsible for myopathies, due to inherited fatty acid β-oxidation or to respiratory chain defects, for which no treatment exists to date. We also review recent data supporting therapeutic effects of resveratrol in the Duchenne Muscular Dystrophy, a fatal genetic disease affecting the production of muscle dystrophin, associated to a variety of mitochondrial dysfunctions, which likely contribute to disease pathogenesis. PMID:27136581

  12. Lipid storage myopathies.

    Science.gov (United States)

    Bruno, Claudio; Dimauro, Salvatore

    2008-10-01

    The aim of this review is to provide an update on disorders of lipid metabolism affecting skeletal muscle exclusively or predominantly and to summarize recent clinical, genetic, and therapeutic studies in this field. Over the past 5 years, new clinical phenotypes and genetic loci have been described, unusual pathogenic mechanisms have been elucidated, and novel pharmacological approaches have been developed. At least one genetic defect responsible for the myopathic form of CoQ10 deficiency has been identified, causing a disorder that is allelic with the late-onset riboflavine-responsive form of multiple acyl-coenzyme A dehydrogenation deficiency. Novel mechanisms involved in the lipolytic breakdown of cellular lipid depots have been described and have led to the identification of genes and mutations responsible for multisystemic neutral lipid storage disorders, characterized by accumulation of triglyceride in multiple tissues, including muscle. Defects in lipid metabolism can affect either the mitochondrial transport and oxidation of exogenous fatty acid or the catabolism of endogenous triglycerides. These disorders impair energy production and almost invariably involve skeletal muscle, causing progressive myopathy with muscle weakness, or recurrent acute episodes of rhabdomyolysis triggered by exercise, fasting, or infections. Clinical and genetic characterization of these disorders has important implications both for accurate diagnostic approach and for development of therapeutic strategies.

  13. Phenotypes, genotypes, and prevalence of congenital myopathies older than 5 years in Denmark

    DEFF Research Database (Denmark)

    Witting, Nanna; Werlauff, Ulla; Duno, Morten

    2017-01-01

    .3% NEB mutations. Less than 5% had mutations in ACTA1, TPM2/3, MTM1, TTN, SEPN1, or SC4NA. A genetic cause was established in 83% with specific histology (cores/rods/centronuclear myopathy) vs 29% with unspecific histology. The detailed clinical examination found gene-dependent discrepancies...... in the pattern of muscle affection and walking ability. Although walking ability was delayed in patients with ACTA1, TPM2/3, and RYR1 mutations, it was within normal limits in patients with NEB and DNM2 mutations. CONCLUSIONS: We found that overall, genetic and histologic prevalence of congenital myopathy...

  14. Amyloid myopathy: a diagnostic challenge

    Directory of Open Access Journals (Sweden)

    Heli Tuomaala

    2009-08-01

    Full Text Available Amyloid myopathy (AM is a rare manifestation of primary systemic amyloidosis (AL. Like inflammatory myopathies, it presents with proximal muscle weakness and an increased creatine kinase level. We describe a case of AL with severe, rapidly progressive myopathy as the initial symptom. The clinical manifestation and muscle biopsy were suggestive of inclusion body myositis. AM was not suspected until amyloidosis was seen in the gastric mucosal biopsy. The muscle biopsy was then re-examined more specifically, and Congo red staining eventually showed vascular and interstitial amyloid accumulation, which led to a diagnosis of AM. The present case illustrates the fact that the clinical picture of AM can mimic that of inclusion body myositis.

  15. Idiopathic Inflammatory Myopathies: An update

    Directory of Open Access Journals (Sweden)

    Bulent KURT

    2016-06-01

    Full Text Available Idiopathic inflammatory myopathies (IIM are a heterogeneous group of disease with complex clinical features. It has been sub-classified as: (1 Dermatomyositis, (2 Polymyositis, and (3 Inclusion body myositis (IBM. Nowadays, there are some studies in literature suggest necrotizing autoimmune myopathy and immune-mediated necrotizing myopathy should also be added to this group of disease. There is a debate in the diagnosis of IIMs and up until now, about 12 criteria systems have been proposed. Some of the criteria systems have been used widely such as Griggs et al.'s proposal for IBM. Clinical findings, autoantibodies, enzymes, electrophysiological, and muscle biopsy findings are diagnostic tools. Because of diseases' complexity, none of the findings are diagnostic alone. In this study, we discussed the diagnostic criteria of IMMs and described detailed morphological features. [J Interdiscipl Histopathol 2016; 4(2.000: 41-45

  16. Control rods

    International Nuclear Information System (INIS)

    Maruyama, Hiromi.

    1984-01-01

    Purpose: To realize effective utilization, cost reduction and weight reduction in neutron absorbing materials. Constitution: Residual amount of neutron absorbing material is averaged between the top end region and other regions of a control rod upon reaching to the control rod working life, by using a single kind of neutron absorbing material and increasing the amount of the neutron absorber material at the top end region of the control rod as compared with that in the other regions. Further, in a case of a control rod having control rod blades such as in a cross-like control rod, the amount of the neutron absorbing material is decreased in the middle portion than in the both end portions of the control rod blade along the transversal direction of the rod, so that the residual amount of the neutron absorbing material is balanced between the central region and both end regions upon reaching the working life of the control rod. (Yoshihara, H.)

  17. Control rod

    International Nuclear Information System (INIS)

    Igarashi, Takao; Sugawara, Satoshi; Yoshimoto, Yuichiro; Saito, Shozo; Fukumoto, Takashi.

    1987-01-01

    Purpose: To reduce the weight and thereby obtain satisfactory operationability of control rods by combining absorbing nuclear chain type neutron absorbers and conventional type neutron absorbers in the axial direction of blades. Constitution: Neutron absorber rods and long life type neutron absorber rods are disposed in a tie rod and a sheath. The neutron absorber rod comprises a poison tube made of stainless steels and packed with B 4 C powder. The long life type neutron absorber rod is prepared by packing B-10 enriched boron carbide powder into a hafnium metal rod, hafnium pipe, europium and stainless made poison tube. Since the long life type absorber rod uses HF as the absorbing nuclear chain type neutron absorber, it absorbs neutrons to form new neutron absorbers to increase the nuclear life. (Yoshino, Y.)

  18. A Patient With Pyruvate Carboxylase Deficiency and Nemaline Rods on Muscle Biopsy

    DEFF Research Database (Denmark)

    Unal, Ozlem; Orhan, Diclehan; Ostergaard, Elsebet

    2013-01-01

    Nemaline rods are the pathologic hallmark of nemaline myopathy, but they have also been described as a secondary phenomenon in a variety of other disorders. Nemaline rods have not been reported in pyruvate carboxylase deficiency before. Here we present a patient with pyruvate carboxylase deficiency...

  19. Novel autosomal dominant TNNT1 mutation causing nemaline myopathy.

    Science.gov (United States)

    Konersman, Chamindra G; Freyermuth, Fernande; Winder, Thomas L; Lawlor, Michael W; Lagier-Tourenne, Clotilde; Patel, Shailendra B

    2017-11-01

    Nemaline myopathy (NEM) is one of the three major forms of congenital myopathy and is characterized by diffuse muscle weakness, hypotonia, respiratory insufficiency, and the presence of nemaline rod structures on muscle biopsy. Mutations in troponin T1 (TNNT1) is 1 of 10 genes known to cause NEM. To date, only homozygous nonsense mutations or compound heterozygous truncating or internal deletion mutations in TNNT1 gene have been identified in NEM. This extended family is of historical importance as some members were reported in the 1960s as initial evidence that NEM is a hereditary disorder. Proband and extended family underwent Sanger sequencing for TNNT1. We performed RT-PCR and immunoblot on muscle to assess TNNT1 RNA expression and protein levels in proband and father. We report a novel heterozygous missense mutation of TNNT1 c.311A>T (p.E104V) that segregated in an autosomal dominant fashion in a large family residing in the United States. Extensive sequencing of the other known genes for NEM failed to identify any other mutant alleles. Muscle biopsies revealed a characteristic pattern of nemaline rods and severe myofiber hypotrophy that was almost entirely restricted to the type 1 fiber population. This novel mutation alters a residue that is highly conserved among vertebrates. This report highlights not only a family with autosomal dominant inheritance of NEM, but that this novel mutation likely acts via a dominant negative mechanism. © 2017 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  20. Why do NRM regional planning processes and tools have limited effect? Presenting the perspective of the end user

    Directory of Open Access Journals (Sweden)

    Dana Reiter

    2017-01-01

    Full Text Available Natural resource managers are required to prepare a plan for managing the natural resources in their regions. Environmental decision support systems (EDSS have been developed to assist managers and stakeholders make decisions about complex natural resource problems. Research has shown that these EDSS are valuable and used internationally. However, sustainability science literature reports that too often these natural resource management (NRM plans are not consulted upon completion, and the EDSS are no longer used. To gain insight into why the EDSS are no longer used after the research and development phase of the NRM planning project, we have asked the stakeholders, as end users of the EDSS tool themselves, to share their perceptions of, and experience with development of the tool and then, the tool itself. This paper reports on the perspectives of the end users of an EDSS used in a South Australian NRM planning project from 2011 to 2013. The findings were mixed in that they show that the majority (90% of respondents felt the EDSS had overall value, yet it was virtually abandoned after the completion of the planning project. Further, just over half of respondents reported that they thought that the EDSS should have been used on a regular basis after the pilot project ended. We conclude that genuine capacity development, aided by the EDSS, took place during the project. However, the lack of use of the EDSS after the pilot project finished was the result of failures both with researcher follow up and especially with the lack of commitment from government agencies who support and influence the array of end users. Unless agencies commit to the changed practices identified by end users that would support ongoing use of EDSS it is inevitable that the legacy value of EDSS development will remain limited.

  1. Immune-mediated statin myopathy.

    Science.gov (United States)

    Loganathan, Priyadarshini; Oddis, Chester V; Aggarwal, Rohit

    2016-01-01

    Statin-induced necrotizing autoimmune myopathy (SINAM) is associated with a unique clinical 5 phenotype of severe proximal muscle weakness during or after exposure to statins in patients with high creatine kinase (CK) levels. Electromyography (EMG) and muscle biopsy reveal features of a necrotizing myopathy and the anti-HMGCR autoantibody is frequently detected. Treatment requires a combination of statin discontinuation as well as immunomodulatory or immunosuppressive therapy. HLA typing (HLADRB1*1101) is strongly associated with anti-10 HMGCR autoantibody positivity in statin-exposed patients. It is well documented that statin triggers autoimmune disease in those with a genetic susceptibility. With the commercial availability of an accurate ELISA test, the natural history of the disease and its phenotypic features are becoming increasingly understood.

  2. Localized scleroderma and regional inflammatory myopathy.

    Science.gov (United States)

    Zivković, Saša A; Freiberg, William; Lacomis, David; Domsic, Robyn T; Medsger, Thomas A

    2014-05-01

    Inflammatory myopathy is rare in localized scleroderma. We report 2 new cases of regional inflammatory myopathy associated with localized scleroderma and review 10 reported cases of localized scleroderma associated with an inflammatory myopathy with regional muscle involvement, more often in the upper extremities. Serum creatine kinase was mildly elevated or normal. Histopathology often showed perimysial inflammation and plasma cell infiltration. These cases demonstrate that inflammatory myopathy should be considered in patients with localized scleroderma and regional muscle weakness, pain or atrophy. Muscle biopsy can confirm the diagnosis of myositis, which if identified, will require anti-inflammatory and/or immunosuppressive therapy. Published by Elsevier B.V.

  3. Replacement rod

    International Nuclear Information System (INIS)

    Hatfield, S.C.

    1989-01-01

    This patent describes in an elongated replacement rod for use with fuel assemblies of the type having two end fittings connected by guide tubes with a plurality of rod and guide tube cell defining spacer grids containing rod support features and mixing vanes. The grids secured to the guide tubes in register between the end fittings at spaced intervals. The fuel rod comprising: an asymmetrically beveled tip; a shank portion having a straight centerline; and a permanently diverging portion between the tip and the shank portion

  4. Water rod

    International Nuclear Information System (INIS)

    Kashiwai, Shin-ichi; Yokomizo, Osamu; Orii, Akihito.

    1992-01-01

    In a reactor core of a BWR type reactor, the area of a flow channel in a lower portion of a downcoming pipe for downwardly releasing steams present at the top portion in a water rod is increased. Further, a third coolant flow channel (an inner water rod) is disposed in an uprising having an exit opened near the inlet of the water rod and an inlet opened at the outside near the top portion of the water and having an increase flow channel area in the upper portion. The downcoming pipe in the water rod is filled with steams, and the void ratio is increased by so much as the flow channel area of the downcoming pipe is increased. Since the pressure difference between the inlet and the exit of the inner water rod is greater than the pressure difference between the inlet and the exit of the water rod, most of water flown into the inner water rod is discharged out of the exit in the form of water as it is. Since the area of the flow channel is increased in the portion of the inner water rod, void efficiency in the upper portion of the reactor core is decreased by so much. Since the void ratio is thus increased in the lower portion and the void efficiency is decreased in the upper portion of the reactor core, axial void distribution can be flattened. (N.H.)

  5. Evidence-based treatment of metabolic myopathy

    Directory of Open Access Journals (Sweden)

    Yan LIN

    2014-05-01

    Full Text Available Objective To evaluate the current treatments and possible adverse reactions of metabolic myopathy, and to develop the best solution for evidence-based treatment.  Methods Taking metabolic myopathy, mitochondrial myopathy, lipid storage myopathy, glycogen storage diseases, endocrine myopathy, drug toxicity myopathy and treatment as search terms, retrieve in databases such as PubMed, Cochrane Library, ClinicalKey database, National Science and Technology Library (NSTL, in order to collect the relevant literature database including clinical guidelines, systematic reviews (SR, randomized controlled trials (RCT, controlled clinical trials, retrospective case analysis and case study. Jadad Scale was used to evaluate the quality of literature.  Results Twenty-eight related articles were selected, including 6 clinical guidelines, 5 systematic reviews, 10 randomized controlled trials and 7 clinical controlled trials. According to Jadad Scale, 23 articles were evaluated as high-quality literature (≥ 4, and the remaining 5 were evaluated as low-quality literature (< 4. Treatment principles of these clinical trials, efficacy of different therapies and drug safety evaluation suggest that: 1 Acid α-glycosidase (GAA enzyme replacement therapy (ERT is the main treatment for glycogen storage diseases, with taking a high-protein diet, exercising before taking a small amount of fructose orally and reducing the patient's physical activity gradually. 2 Carnitine supplementation is used in the treatment of lipid storage myopathy, with carbohydrate and low fat diet provided before exercise or sports. 3 Patients with mitochondrial myopathy can take coenzyme Q10, vitamin B, vitamin K, vitamin C, etc. Proper aerobic exercise combined with strength training is safe, and it can also enhance the exercise tolerance of patients effectively. 4 The first choice to treat the endocrine myopathy is treating primary affection. 5 Myopathies due to drugs and toxins should

  6. A diagnostic algorithm for metabolic myopathies.

    Science.gov (United States)

    Berardo, Andres; DiMauro, Salvatore; Hirano, Michio

    2010-03-01

    Metabolic myopathies comprise a clinically and etiologically diverse group of disorders caused by defects in cellular energy metabolism, including the breakdown of carbohydrates and fatty acids to generate adenosine triphosphate, predominantly through mitochondrial oxidative phosphorylation. Accordingly, the three main categories of metabolic myopathies are glycogen storage diseases, fatty acid oxidation defects, and mitochondrial disorders due to respiratory chain impairment. The wide clinical spectrum of metabolic myopathies ranges from severe infantile-onset multisystemic diseases to adult-onset isolated myopathies with exertional cramps. Diagnosing these diverse disorders often is challenging because clinical features such as recurrent myoglobinuria and exercise intolerance are common to all three types of metabolic myopathy. Nevertheless, distinct clinical manifestations are important to recognize as they can guide diagnostic testing and lead to the correct diagnosis. This article briefly reviews general clinical aspects of metabolic myopathies and highlights approaches to diagnosing the relatively more frequent subtypes (Fig. 1). Fig. 1 Clinical algorithm for patients with exercise intolerance in whom a metabolic myopathy is suspected. CK-creatine kinase; COX-cytochrome c oxidase; CPT-carnitine palmitoyl transferase; cyt b-cytochrome b; mtDNA-mitochondrial DNA; nDNA-nuclear DNA; PFK-phosphofructokinase; PGAM-phosphoglycerate mutase; PGK-phosphoglycerate kinase; PPL-myophosphorylase; RRF-ragged red fibers; TFP-trifunctional protein deficiency; VLCAD-very long-chain acyl-coenzyme A dehydrogenase.

  7. Control rod

    International Nuclear Information System (INIS)

    Igarashi, Takao; Yoshimoto, Yuichiro; Sugawara, Satoshi; Fukumoto, Takashi; Endo, Zen-ichiro; Saito, Shozo; Shinpo, Katsutoshi; Nishimura, Akira; Ozawa, Michihiro

    1988-01-01

    Purpose: To provide a sufficient shutdown margin upon reactor shutdown, prevent sheath deformation without decreasing neutron absorbents and prevent impact shocks exerted to structural materials. Constitution: The control rod of the present invention comprises a neutron absorption region, a sheath deformation means attached to the side wall and means for restricting and supporting axial movement of the neutron absorbent rod. Then, the amount of absorptive nuclei chained absorbents in the lower region is reduced than that in the upper region. In this way, effective neutron absorbing performance can be obtained relative to the neutron importance distribution during reactor shutdown. In addition, since the operationability is improved by reducing the weight of the control rod and the absorptive nuclei chained neutron abosrbers are used, mechanical nuclear life of the control rod can be increased. Thus, it is possible to prevent the outward deformation of the sheath, as well as prevent collision between the neutron absorber rod and the structural material on the side of inserting the control rod generated upon reactor scram by a simple structure. (Kamimura, M.)

  8. Autosomal dominant distal myopathy due to a novel ACTA1 mutation.

    Science.gov (United States)

    Liewluck, Teerin; Sorenson, Eric J; Walkiewicz, Magdalena A; Rumilla, Kandelaria M; Milone, Margherita

    2017-08-01

    Mutations in skeletal muscle α-actin 1-encoding gene (ACTA1) cause autosomal dominant or recessive myopathies with marked clinical and pathological heterogeneity. Patients typically develop generalized or limb-girdle pattern of weakness, but recently a family with scapuloperoneal myopathy was reported. We describe a father and 2 children with childhood-to-juvenile onset distal myopathy, carrying a novel dominant ACTA1 variant, c.757G>C (p.Gly253Arg). Father had delayed motor development and developed significant proximal weakness later in life; he was initially misdiagnosed as having spinal muscular atrophy based on electromyographic findings. His children had predominant anterior distal leg and finger extensor involvement. Nemaline rods were abundant on the daughter's biopsy, absent on the father's initial biopsy, and extremely rare on the father's subsequent biopsy a decade later. The father's second biopsy also showed myofibrillar pathology and rare fibers with actin filament aggregates. The present family expands the spectrum of actinopathy to include a distal myopathy. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Actin Nemaline Myopathy Mouse Reproduces Disease, Suggests Other Actin Disease Phenotypes and Provides Cautionary Note on Muscle Transgene Expression

    Science.gov (United States)

    Ravenscroft, Gianina; Jackaman, Connie; Sewry, Caroline A.; McNamara, Elyshia; Squire, Sarah E.; Potter, Allyson C.; Papadimitriou, John; Griffiths, Lisa M.; Bakker, Anthony J.; Davies, Kay E.; Laing, Nigel G.; Nowak, Kristen J.

    2011-01-01

    Mutations in the skeletal muscle α-actin gene (ACTA1) cause congenital myopathies including nemaline myopathy, actin aggregate myopathy and rod-core disease. The majority of patients with ACTA1 mutations have severe hypotonia and do not survive beyond the age of one. A transgenic mouse model was generated expressing an autosomal dominant mutant (D286G) of ACTA1 (identified in a severe nemaline myopathy patient) fused with EGFP. Nemaline bodies were observed in multiple skeletal muscles, with serial sections showing these correlated to aggregates of the mutant skeletal muscle α-actin-EGFP. Isolated extensor digitorum longus and soleus muscles were significantly weaker than wild-type (WT) muscle at 4 weeks of age, coinciding with the peak in structural lesions. These 4 week-old mice were ∼30% less active on voluntary running wheels than WT mice. The α-actin-EGFP protein clearly demonstrated that the transgene was expressed equally in all myosin heavy chain (MHC) fibre types during the early postnatal period, but subsequently became largely confined to MHCIIB fibres. Ringbinden fibres, internal nuclei and myofibrillar myopathy pathologies, not typical features in nemaline myopathy or patients with ACTA1 mutations, were frequently observed. Ringbinden were found in fast fibre predominant muscles of adult mice and were exclusively MHCIIB-positive fibres. Thus, this mouse model presents a reliable model for the investigation of the pathobiology of nemaline body formation and muscle weakness and for evaluation of potential therapeutic interventions. The occurrence of core-like regions, internal nuclei and ringbinden will allow analysis of the mechanisms underlying these lesions. The occurrence of ringbinden and features of myofibrillar myopathy in this mouse model of ACTA1 disease suggests that patients with these pathologies and no genetic explanation should be screened for ACTA1 mutations. PMID:22174871

  10. Genetics Home Reference: idiopathic inflammatory myopathy

    Science.gov (United States)

    ... stumble while walking and find it difficult to grasp items. As in dermatomyositis and polymyositis, swallowing can ... and development? More about Mutations and Health Inheritance Pattern Most cases of idiopathic inflammatory myopathy are sporadic, ...

  11. Adult-onset nemaline myopathy in a dog presenting with persistent atrial standstill and primary hypothyroidism.

    Science.gov (United States)

    Nakamura, R K; Russell, N J; Shelton, G D

    2012-06-01

    A nine-year-old neutered female mixed breed dog presented for evaluation following a five-day history of lethargy, inappetence, weakness, abdominal distension and generalised muscle atrophy. Persistent vatrial standstill with a junctional rhythm was identified on electrocardiogram. Echocardiogram identified moderate dilation of all cardiac chambers and mild thickening of the mitral and tricuspid valves. Serology was negative for Neospora caninum and Toxoplasma gondii. Permanent pacemaker implantation was performed in addition to endomyocardial and skeletal muscle biopsies. Cryosections from the biceps femoris muscle showed numerous nemaline rod bodies while endomyocardial biopsies were possibly consistent with end-stage myocarditis. Rod bodies have rarely been reported in the veterinary literature. To the authors' knowledge, this is the first report of adult-onset nemaline rod myopathy and hypothyroidism with concurrent cardiac disease in a dog. © 2012 British Small Animal Veterinary Association.

  12. CONTROL ROD

    Science.gov (United States)

    Walker, D.E.; Matras, S.

    1963-04-30

    This patent shows a method of making a fuel or control rod for a nuclear reactor. Fuel or control material is placed within a tube and plugs of porous metal wool are inserted at both ends. The metal wool is then compacted and the tube compressed around it as by swaging, thereby making the plugs liquid- impervious but gas-pervious. (AEC)

  13. Fuel rods

    International Nuclear Information System (INIS)

    Hattori, Shinji; Kajiwara, Koichi.

    1980-01-01

    Purpose: To ensure the safety for the fuel rod failures by adapting plenum springs to function when small forces such as during transportation of fuel rods is exerted and not to function the resilient force when a relatively great force is exerted. Constitution: Between an upper end plug and a plenum spring in a fuel rod, is disposed an insertion member to the lower portion of which is mounted a pin. This pin is kept upright and causes the plenum spring to function resiliently to the pellets against the loads due to accelerations and mechanical vibrations exerted during transportation of the fuel rods. While on the other hand, if a compression force of a relatively high level is exerted to the plenum spring during reactor operation, the pin of the insertion member is buckled and the insertion member is inserted to the inside of the plenum spring, whereby the pellets are allowed to expand freely and the failures in the fuel elements can be prevented. (Moriyama, K.)

  14. Rodding Surgery

    Science.gov (United States)

    ... Physical activity prior to surgery,  Length of the operation; anesthesia issues,  Reason for the choice of rod,  Time in the hospital,  Length of recovery time at home,  Pain management including control of muscle spasms,  The rehabilitation plan. ...

  15. Control rods

    International Nuclear Information System (INIS)

    Koga, Isao; Masuoka, Ryuzo.

    1979-01-01

    Purpose: To prevent fuel element failures during power conditioning by removing liquid absorbents in poison tubes of control rods in a fast power up step and extracting control rods to slightly increase power in a medium power up step. Constitution: A plurality of poison tubes are disposed in a coaxial or plate-like arrangement and divided into a region capable of compensating the reactivity from the initial state at low temperature to 40% power operation and a region capable of compensating the reactivity in the power up above 40% power operation. Soluble poisons are used as absorbers in the poison tubes corresponding to above 40% power operation and they are adapted to be removed independently from the driving of control rods. The poison tubes filled with the soluble absorbers are responsible for the changes in the reactivity from the initial state at low temperature to the medium power region and the reactivity control is conducted by the elimination of liquid absorbers from the poison tubes. In the succeeding slight power up region above the medium power, power up is proceeding by extracting the control rods having remaining poison tubes filled with solid or liquid absorbers. (Seki, T.)

  16. Control rod

    International Nuclear Information System (INIS)

    Takeda, Toshikazu; Inoue, Kotaro.

    1979-01-01

    Purpose: To flatten the power distribution in the reactor core without impairing neutron economy by disposing pins containing elements of lower atomic number in the central region of a shroud and loading pins containing depleted uranium in the periphery region thereof. Constitution: The shroud has a layer of pins containing depleted uranium in the peripheral region and a layer of pins containing elements of lower atomic number such as beryllium in the central region. Heat removal from those pins containing depleted uranium and elements of lower atomic number (neutron moderator) is effected by sodium flow outside of the cladding material. The control rod operation is conducted by inserting or extracting the central portion (pins containing elements of lower atomic number such as beryllium) inside of the stainless pipe. Upon extraction of the control rod, the moderator in the central region is removed whereby high speed neutrons are no more deccelerated and the absorption rate to the depleted uranium is decreased. This can flatten the power distribution in the reactore core with the disposition of a plurality of control rods at a better neutron economy as compared with the use of neutron absorber such as boron. (Seki, T.)

  17. Control rod

    International Nuclear Information System (INIS)

    Fukumoto, Takashi; Hirakawa, Hiromasa; Kawashima, Norio; Goto, Yasuyuki.

    1994-01-01

    Neutron absorbers are contained in a tubular member comprising, integrally a tubular portion and four corners disposed at the outer circumference of the tubular portion at every 90deg, to provide a neutron absorbing tube. A plurality of neutron absorbing tubes are arranged in parallel in the lateral direction, and adjacent corners are joined, into a blade to constitute a control rod. Such a control rod has a great structural strength, simple in the structure and relatively light in weight and can contain a great amount of neutron absorbers. Upon formation of the control rod by arranging the blades in a cross-like shape, at least a portion thereof is constituted with short neutron absorbing tubes shorter than the entire length of the blade, and gaps are formed at positions in adjacent in the axial direction. With such a constitution, there is no worry that a wing end of the blade collides against or be abraded with a fuel channel box or a fuel support. Even if fuel channels are vibrated upon scram of the reactor, such as occurrence of earthquakes, it can be inserted to the reactor easily. (N.H.)

  18. Understanding mitochondrial myopathies: a review

    Directory of Open Access Journals (Sweden)

    Abhimanyu S. Ahuja

    2018-05-01

    Full Text Available Mitochondria are small, energy-producing structures vital to the energy needs of the body. Genetic mutations cause mitochondria to fail to produce the energy needed by cells and organs which can cause severe disease and death. These genetic mutations are likely to be in the mitochondrial DNA (mtDNA, or possibly in the nuclear DNA (nDNA. The goal of this review is to assess the current understanding of mitochondrial diseases. This review focuses on the pathology, causes, risk factors, symptoms, prevalence data, symptomatic treatments, and new research aimed at possible preventions and/or treatments of mitochondrial diseases. Mitochondrial myopathies are mitochondrial diseases that cause prominent muscular symptoms such as muscle weakness and usually present with a multitude of symptoms and can affect virtually all organ systems. There is no cure for these diseases as of today. Treatment is generally supportive and emphasizes symptom management. Mitochondrial diseases occur infrequently and hence research funding levels tend to be low in comparison with more common diseases. On the positive side, quite a few genetic defects responsible for mitochondrial diseases have been identified, which are in turn being used to investigate potential treatments. Speech therapy, physical therapy, and respiratory therapy have been used in mitochondrial diseases with variable results. These therapies are not curative and at best help with maintaining a patient’s current abilities to move and function.

  19. An integrated diagnosis strategy for congenital myopathies.

    Directory of Open Access Journals (Sweden)

    Johann Böhm

    Full Text Available Congenital myopathies are severe muscle disorders affecting adults as well as children in all populations. The diagnosis of congenital myopathies is constrained by strong clinical and genetic heterogeneity. Moreover, the majority of patients present with unspecific histological features, precluding purposive molecular diagnosis and demonstrating the need for an alternative and more efficient diagnostic approach. We used exome sequencing complemented by histological and ultrastructural analysis of muscle biopsies to identify the causative mutations in eight patients with clinically different skeletal muscle pathologies, ranging from a fatal neonatal myopathy to a mild and slowly progressive myopathy with adult onset. We identified RYR1 (ryanodine receptor mutations in six patients and NEB (nebulin mutations in two patients. We found novel missense and nonsense mutations, unraveled small insertions/deletions and confirmed their impact on splicing and mRNA/protein stability. Histological and ultrastructural findings of the muscle biopsies of the patients validated the exome sequencing results. We provide the evidence that an integrated strategy combining exome sequencing with clinical and histopathological investigations overcomes the limitations of the individual approaches to allow a fast and efficient diagnosis, accelerating the patient's access to a better healthcare and disease management. This is of particular interest for the diagnosis of congenital myopathies, which involve very large genes like RYR1 and NEB as well as genetic and phenotypic heterogeneity.

  20. Systemic calciphylaxis presenting as a painful, proximal myopathy.

    OpenAIRE

    Edelstein, C. L.; Wickham, M. K.; Kirby, P. A.

    1992-01-01

    A renal transplant patient who presented with a painful, proximal myopathy due to systemic calciphylaxis is described. The myopathy preceded the characteristic skin and soft tissue necrosis. Systemic calciphylaxis should be considered in a dialysis or a renal transplant patient presenting with a painful proximal myopathy even in the absence of necrotic skin lesions.

  1. Adult-onset nemaline myopathy presenting as respiratory failure.

    LENUS (Irish Health Repository)

    Kelly, Emer

    2008-11-01

    Nemaline myopathy is a rare congenital myopathy that generally presents in childhood. We report a case of a 44-year-old man who presented with severe hypoxic hypercapnic respiratory failure as the initial manifestation of nemaline myopathy. After starting noninvasive ventilation, his pulmonary function test results improved substantially, and over the 4 years since diagnosis his respiratory function remained stable. There are few reported cases of respiratory failure in patients with adult-onset nemaline myopathy, and the insidious onset in this case is even more unusual. This case highlights the varied presenting features of adult-onset nemaline myopathy and that noninvasive ventilation improves respiratory function.

  2. Sucker rods

    Energy Technology Data Exchange (ETDEWEB)

    Rylov, B M; Kostur, I N; Shcheigiy, B I; Sukhanov, V S

    1983-01-01

    As an addendum to A.s. USSR patent No 769087, this particular sucker rod utilizes a differential piston spring that has been attached outside the body of the auxiliary pump. The pump cylinder is attached to the intake line of the main pump. The lower part of the auxiliary pump is equipped with vertical slits, while the differential piston is equipped with a perforated pusher and support under the spring; it can also be shifted as necessary with respect to the vertical slits.

  3. Myopathies of endocrine disorders: A prospective clinical and biochemical study

    Directory of Open Access Journals (Sweden)

    Vikas Sharma

    2014-01-01

    Full Text Available Introduction: Major categories of endocrine myopathy include those associated with: Adrenal dysfunction (as in Cushing′s disease or steroid myopathy; thyroid dysfunction (as in myxedema coma or thyrotoxic myopathy; vitamin D deficiency; parathyroid dysfunction; and pituitary dysfunction. Steroid myopathy is the most common endocrine myopathy. Objective: To study the etiology, varied presentations, and outcome after therapy of patients with endocrine myopathies. Materials and Methods: Myopathy was evaluated by the standard clinical procedures: Detailed clinical history, manual muscle strength testing, and creatine phosphokinase (CPK. Endocrine disorders were diagnosed as per clinical features and biochemical parameters. The treatment was given to patients as per underlying endocrine disease. Myopathy was assessed before and after treatment. Results: Out of the 37 patients who were diagnosed with endocrine myopathies, thyroid dysfunction was the most common cause (17 cases, followed by vitamin D deficiency in nine, adrenal dysfunction in six, parathyroid dysfunction in three, and pituitary dysfunction in two. Some patients had atypical presentation (repeated falls in one, tongue fasciculations in one, neck weakness in five, one with ptosis and facial weakness, asymmetrical onset in one, and calf hypertrophy in one. The serum creatine kinase (CK concentration did not correlate with muscle weakness. Following the treatment regimen which was specific for a given myopathy, 26 patients recovered fully. Conclusion: We found varied clinical presentations of endocrine myopathies. All the patients with neuromuscular complaints should be investigated for endocrine causes because significant number of them recovers fully with specific treatment.

  4. Fuel rods

    International Nuclear Information System (INIS)

    Adachi, Hajime; Ueda, Makoto

    1985-01-01

    Purpose: To provide a structure capable of measuring, in a non-destructive manner, the releasing amount of nuclear gaseous fission products from spent fuels easily and at a high accuracy. Constitution: In order to confirm the integrity and the design feasibility of a nuclear fuel rod, it is important to accurately determine the amount of gaseous nuclear fission products released from nuclear pellets. In a structure where a plurality of fuel pellets are charged in a fuel cladding tube and retained by an inconel spring, a hollow and no-sealed type spacer tube made of zirconium or the alloy thereof, for example, not containing iron, cobalt, nickel or manganese is formed between the spring and the upper end plug. In the fuel rod of such a structure, by disposing a gamma ray collimator and a gamma ray detector on the extension of the spacer pipe, the gamma rays from the gaseous nuclear fission products accumulated in the spacer pipe can be detected while avoiding the interference with the induction radioactivity from inconel. (Kamimura, M.)

  5. Acute steroid myopathy: a highly overlooked entity.

    Science.gov (United States)

    Haran, Michal; Schattner, Ami; Kozak, Natasha; Mate, Andras; Berrebi, Alain; Shvidel, Lev

    2018-02-15

    Myopathy in patients being treated with corticosteroids is known primarily among chronically-treated patients or in critically ill and mechanically-ventilated patients receiving corticosteroids, often in high doses. To highlight the entity of acute, early-onset corticosteroid-treatment-associated myopathy and its characteristics. Reporting our experience with four patients and reviewing all published reports of myopathy developing ≤14 days of initiating corticosteroid-treatment. Acute corticosteroid myopathy (ASM) exists, though the syndrome appears to be rare. It is characterized by unpredictability and heterogeneity, sometimes developing within 1-3 days, after a single dose, which may not be high and administered by varied routes. Proximal limb muscle weakness is the most common form, but distal limb, bulbar and respiratory muscles may be involved. Steroid cessation often leads to improvement/resolution, but irreversibility may occur. A high index of suspicion for the possibility of ASM is necessary, to ensure drug discontinuation and recovery. This is particularly true since the entity is not widely recognized and its symptoms are often erroneously interpreted as due to the patient's underlying disease.

  6. Fuel rods

    International Nuclear Information System (INIS)

    Fukushima, Kimichika.

    1984-01-01

    Purpose: To reduce the size of the reactor core upper mechanisms and the reactor container, as well as decrease the nuclear power plant construction costs in reactors using liquid metals as the coolants. Constitution: Isotope capturing devices comprising a plurality of pipes are disposed to the gas plenum portion of a nuclear fuel rod main body at the most downstream end in the flowing direction of the coolants. Each of the capturing devices is made of nickel, nickel alloys, stainless steel applied with nickel plating on the surface, nickel alloys applied with nickel plating on the surface or the like. Thus, radioactive nuclides incorporated in the coolants are surely captured by the capturing devices disposed at the most downstream end of the nuclear fuel main body as the coolants flow along the nuclear fuel main body. Accordingly, since discharging of radioactive nuclides to the intermediate fuel exchange system can be prevented, the maintenance or reparing work for the system can be facilitated. (Moriyama, K.)

  7. Control rods

    International Nuclear Information System (INIS)

    Hirukawa, Koji.

    1979-01-01

    Purpose: To ensure the fuel safety by constituting a control rod with a plurality of poison bodies suspended in a cross-like section and shorter length poison bodies made movable and engageable in the gap between each of the above poison bodies thereby maintaining the function of the shorter length poison constant. Constitution: Cross-like supports are secured to the upper and lower parts of a driving shaft journaled in a sheath and poison bodies composed of neutron absorber poisons of a large thermal neutron absorption cross section and neutron absorber poison tubes for containing them are suspended from the supports. A movable cross-like support is mounted slidably at its base to the lower part of the driving shaft and poison bodies shorter than the above poison bodies and composed of neutron absorber poisons having a greater absorption cross section at the neutron energy region higher than thermal neutron region and neutron poison tubes for containing them are suspended to the movable support at the position capable of engaging in the gap between each of the poison bodies. (Kawakami, Y.)

  8. Centronuclear myopathy in a Border collie dog.

    Science.gov (United States)

    Eminaga, S; Cherubini, G B; Shelton, G D

    2012-10-01

    A two-year old, male entire Border collie was presented with a one-year history of exercise-induced collapsing on the pelvic limbs. Physical examination revealed generalised muscle atrophy. Neurological examination supported a generalised neuromuscular disorder. Electromyography revealed spontaneous electrical activity in almost all muscles. Unfixed and formaldehyde-fixed biopsy samples were collected from the triceps brachii, longissimus and vastus lateralis muscles. Histopathological, histochemical and ultrastructural examinations of biopsy specimens were consistent with either centronuclear or myotubular myopathy. The dog clinically improved with supportive treatment with L-carnitine, co-enzyme Q10 and vitamin B compound. To the authors' knowledge, this is the first report of centronuclear/myotubular myopathy in a Border collie. © 2012 British Small Animal Veterinary Association.

  9. Aerobic Training in Patients with Congenital Myopathy

    DEFF Research Database (Denmark)

    Hedermann, Gitte; Vissing, Christoffer Rasmus; Jensen, Karen

    2016-01-01

    INTRODUCTION: Congenital myopathies (CM) often affect contractile proteins of the sarcomere, which could render patients susceptible to exercise-induced muscle damage. We investigated if exercise is safe and beneficial in patients with CM. METHODS: Patients exercised on a stationary bike for 30......: The Regional Committee on Health Research Ethics of the Capital Region of Denmark H-2-2013-066 and ClinicalTrials.gov H2-2013-066....

  10. Bethlem myopathy: An autosomal dominant myopathy with flexion contractures, keloids, and follicular hyperkeratosis.

    Science.gov (United States)

    Saroja, Aralikatte Onkarappa; Naik, Karkal Ravishankar; Nalini, Atcharayam; Gayathri, Narayanappa

    2013-10-01

    Bethlem myopathy and Ullrich congenital muscular dystrophy form a spectrum of collagenopathies caused by genetic mutations encoding for any of the three subunits of collagen VI. Bethlem phenotype is relatively benign and is characterized by proximal dominant myopathy, keloids, contractures, distal hyperextensibility, and follicular hyperkeratosis. Three patients from a single family were diagnosed to have Bethlem myopathy based on European Neuromuscular Centre Bethlem Consortium criteria. Affected father and his both sons had slowly progressive proximal dominant weakness and recurrent falls from the first decade. Both children aged 18 and 20 years were ambulant at presentation. All had flexion contractures, keloids, and follicular hyperkeratosis without muscle hypertrophy. Creatinine kinase was mildly elevated and electromyography revealed myopathic features. Muscle imaging revealed severe involvement of glutei and vasti with "central shadow" in rectus femoris. Muscle biopsy in the father showed dystrophic changes with normal immmunostaining for collagen VI, sarcoglycans, and dysferlin.

  11. Bethlem myopathy: An autosomal dominant myopathy with flexion contractures, keloids, and follicular hyperkeratosis

    Directory of Open Access Journals (Sweden)

    Aralikatte Onkarappa Saroja

    2013-01-01

    Full Text Available Bethlem myopathy and Ullrich congenital muscular dystrophy form a spectrum of collagenopathies caused by genetic mutations encoding for any of the three subunits of collagen VI. Bethlem phenotype is relatively benign and is characterized by proximal dominant myopathy, keloids, contractures, distal hyperextensibility, and follicular hyperkeratosis. Three patients from a single family were diagnosed to have Bethlem myopathy based on European Neuromuscular Centre Bethlem Consortium criteria. Affected father and his both sons had slowly progressive proximal dominant weakness and recurrent falls from the first decade. Both children aged 18 and 20 years were ambulant at presentation. All had flexion contractures, keloids, and follicular hyperkeratosis without muscle hypertrophy. Creatinine kinase was mildly elevated and electromyography revealed myopathic features. Muscle imaging revealed severe involvement of glutei and vasti with "central shadow" in rectus femoris. Muscle biopsy in the father showed dystrophic changes with normal immmunostaining for collagen VI, sarcoglycans, and dysferlin.

  12. Control rod drives

    International Nuclear Information System (INIS)

    Nakamura, Akira.

    1984-01-01

    Purpose: To enable to monitor the coupling state between a control rod and a control rod drive. Constitution: After the completion of a control rod withdrawal, a coolant pressure is applied to a control rod drive being adjusted so as to raise only the control rod drive and, in a case where the coupling between the control rod drive and the control rod is detached, the former is elevated till it contacts the control rod and then stopped. The actual stopping position is detected by an actual position detection circuit and compared with a predetermined position stored in a predetermined position detection circuit. If both of the positions are not aligned with each other, it is judged by a judging circuit that the control rod and the control rod drives are not combined. (Sekiya, K.)

  13. The expanding phenotype of mitochondrial myopathy.

    Science.gov (United States)

    DiMauro, Salvatore; Gurgel-Giannetti, Juliana

    2005-10-01

    Our understanding of mitochondrial diseases (defined restrictively as defects in the mitochondrial respiratory chain) continues to progress apace. In this review we provide an update of information regarding disorders that predominantly or exclusively affect skeletal muscle. Most recently described mitochondrial myopathies are due to defects in nuclear DNA, including coenzyme Q10 deficiency, and mutations in genes that control mitochondrial DNA (mtDNA) abundance and structure such as POLG and TK2. Barth syndrome, an X-linked recessive mitochondrial myopathy/cardiopathy, is associated with altered lipid composition of the inner mitochondrial membrane, but a putative secondary impairment of the respiratory chain remains to be documented. Concerning the 'other genome', the role played by mutations in protein encoding genes of mtDNA in causing isolated myopathies has been confirmed. It has also been confirmed that mutations in tRNA genes of mtDNA can cause predominantly myopathic syndromes and - contrary to conventional wisdom - these mutations can be homoplasmic. Defects in the mitochondrial respiratory chain impair energy production and almost invariably involve skeletal muscle, causing exercise intolerance, myalgia, cramps, or fixed weakness, which often affects extraocular muscles and results in droopy eyelids (ptosis) and progressive external ophthalmoplegia.

  14. Control rod assembly

    International Nuclear Information System (INIS)

    Takahashi, Akio.

    1982-01-01

    Purpose: To enable reliable insertion and drops of control rods, as well as insure a sufficient flow rate of coolants flowing through the control rods for attaining satisfactory cooling thereof to enable relexation of thermal stress resulted to rectifying mechanisms or the likes. Constitution: To the outer circumference of a control rod contained vertically movably within a control rod guide tube, resistive members are retractably provided in such a way as to project to close the gap between outer circumference of the control rod and the inner surface of the control rod guide tube upon engagement of a gripper of control rod drives, and retract upon release of the engagement of the gripper. Thus, since the resistive members project to provide a greater resistance to the coolants flowing between them and the control rod guide tube in the normal operation where the gripper is engaged to drive the control rod by the control rod drives, a major part of the coolant flowing into the control rod guide tube flows into the control rod. This enables to cool the control rod effectively and make the temperature distribution uniform for the coolant flowing from the upper end of the control rod guide tube to thereby attain the relaxation of the thermal stress resulted in the rectifying mechanisms or the likes. (Moriyama, K.)

  15. Control rod displacement

    International Nuclear Information System (INIS)

    Nakazato, S.

    1987-01-01

    This patent describes a nuclear reactor including a core, cylindrical control rods, a single support means supporting the control rods from their upper ends in spaced apart positions and movable for displacing the control rods in their longitudinal direction between a first end position in which the control rods are fully inserted into the core and a second end position in which the control rods are retracted from the core, and guide means contacting discrete regions of the outer surface of each control rod at least when the control rods are in the vicinity of the second end position. The control rods are supported by the support means for longitudinal movement without rotation into and out of the core relative to the guide means to thereby cause the outer surface of the control rods to experience wear as a result of sliding contact with the guide means. The support means are so arranged with respect to the core and the guide means that it is incapable of rotation relative to the guide means. The improvement comprises displacement means being operatively coupled to a respective one of the control rods for periodically rotating the control rod in a single angular direction through an angle selected to change the locations on the outer surfaces of the control rods at which the control rods are contacted by the guide means during subsequent longitudinal movement of the control rods

  16. Hereditary myopathies with early respiratory insufficiency in adults.

    Science.gov (United States)

    Naddaf, Elie; Milone, Margherita

    2017-11-01

    Hereditary myopathies with early respiratory insufficiency as a predominant feature of the clinical phenotype are uncommon and underestimated in adults. We reviewed the clinical and laboratory data of patients with hereditary myopathies who demonstrated early respiratory insufficiency before the need for ambulatory assistance. Only patients with disease-causing mutations or a specific histopathological diagnosis were included. Patients with cardiomyopathy were excluded. We identified 22 patients; half had isolated respiratory symptoms at onset. The diagnosis of the myopathy was often delayed, resulting in delayed ventilatory support. The most common myopathies were adult-onset Pompe disease, myofibrillar myopathy, multi-minicore disease, and myotonic dystrophy type 1. Single cases of laminopathy, MELAS (mitochondrial encephalomyopathy with lactic acidosis and strokelike events), centronuclear myopathy, and cytoplasmic body myopathy were identified. We highlighted the most common hereditary myopathies associated with early respiratory insufficiency as the predominant clinical feature, and underscored the importance of a timely diagnosis for patient care. Muscle Nerve 56: 881-886, 2017. © 2017 Wiley Periodicals, Inc.

  17. Meeting the challenges in the diagnosis of inflammatory myopathies ...

    African Journals Online (AJOL)

    Conditions that mimic IM include other causes of myopathy such as endocrine disorders, adverse effects of medication, metabolic myopathies and muscle dystrophies. Atypical features suggesting an alternative diagnosis are acute onset, severe pain, assymmetrical involvement, distal weakness and wasting. Appropriate ...

  18. Hypothyroid myopathy. A clinical and pathologaical study.

    Science.gov (United States)

    McKeran, R O; Slavin, G; Ward, P; Paul, E; Mair, W G

    1980-09-01

    Ten patients with varying degrees of hypothroid myopathy were studied clinically and by serial percutaneous needle muscle biopsies before and during treatment with L-thyroxine. The biochemical evidence of hypothyroidism was related to the severity of the myopathic and signs before treatment. The severity of myopathic symptoms before and during treatment correlated with the biochemical evidence of hypothyrodism, a type II fibre atrophy and increased central nuclear counts. Likewise, the clinical evidence of a myopathy before and during treatment was correlated with both a type II fibre atrophy and loss and increased central nuclear counts but was not related to the biochemical parameters of hypothyroidism, except the level of thyroid stimulating hormone. In the muscle, before and during treatment, of the two most severely affected patients, intracellular glycogen inclusions were seen in scattered muscle fibres. On light microscopy and on electronmicroscopy, numerous mitochondria were seen responding to L-thyroxine with accumulations of subsarcolemmal honey-combing. Vesicular abnormalities, an electron dense matrix or occasional crystalline deposits were seen in muscle mitochondria from less severely azffected patients. Severely myopathic muscle contained excessive glycogen, membrane bound glycogen and excess lipid in a mainly perinuclear distribution. Occasional myelin and membranous bodies were seen and satellite cells during the recovery phase. A group of patients with hypothyroid myopathy who are likely to have a delayed recovery of full muscle strength on L-thyroxine may be recognised by the presence of severe proximal muscle weakness and characteristic changes on histochemical and electronmicroscopic examination of muscle. The spectrum of histochemical and electronmicroscopic abnormalities of muscle revealed with increasing degree of hypothyrodism, suggests that a generally reversible acquired glycogen storage and mictochondrial disorder is an important feature

  19. Control rod drive mechanism

    International Nuclear Information System (INIS)

    Nakamura, Akira.

    1981-01-01

    Purpose: To ensure the scram operation of a control rod by the reliable detection for the position of control rods. Constitution: A permanent magnet is provided to the lower portion of a connecting rod in engagement with a control rod and a tube having a plurality of lead switches arranged axially therein in a predetermined pitch is disposed outside of the control rod drives. When the control rod moves upwardly in the scram operation, the lead switches are closed successively upon passage of the permanent magnet to operate the electrical circuit provided by way of each of the lead switches. Thus, the position for the control rod during the scram can reliably be determined and the scram characteristic of the control rod can be recognized. (Furukawa, Y.)

  20. [Cardiac myopathy due to overt hypothyroidism].

    Science.gov (United States)

    Harbeck, B; Berndt, M J; Lehnert, H

    2014-03-01

    A 51-year-old man presented with progressive tiredness, proximal muscle weakness, hair loss and weight gain for months. The patient showed mild pretibial myxedema and dry skin. Laboratory findings revealed strongly elevated cardiac enzymes as well as marked hypothyroidism. The electrocardiogram, echocardiography, abdominal sonography and chest X-ray were unremarkable. Thyroid ultrasound demonstrated features of Hashimoto thyroiditis. The findings supported the diagnosis of an overt hypothyroidism with myxedema and rhabdomyolysis. After starting levothyroxine and volume substitution laboratory parameters and clinical condition slowly normalized. Severe overt hypothyroidism may rarely present primarily as myopathy with myositis and cardiac involvement. © Georg Thieme Verlag KG Stuttgart · New York.

  1. Treatment Opportunities in Patients With Metabolic Myopathies

    DEFF Research Database (Denmark)

    Ørngreen, Mette Cathrine; Vissing, John

    2017-01-01

    the development of new therapeutic options. Enzyme replacement therapy with rGAA has revolutionized treatment of early onset Pompe disease. Supplements of riboflavin, carnitine, and sucrose show promise in patients with respectively riboflavin-responsive multiple acyl-CoA dehydrogenase deficiency, primary...... carnitine deficiency, and McArdle disease. Treatment with citric acid cycle intermediates supply by triheptanoin seems promising in patients with glucogenoses, and studies are ongoing in patients with McArdle disease. Summary Treatment of metabolic myopathies primarily relies on avoiding precipitating...

  2. Bethlem myopathy is not allelic to limb-girdle muscular dystrophy type 1A

    Energy Technology Data Exchange (ETDEWEB)

    Speer, M.C.; Yamaoka, L.H.; Stajich, J.; Lewis, K. [and others

    1995-08-28

    The Bethlem myopathy, an autosomal-dominant myopathy, shows a distribution of proximal muscle weakness similar to that observed in dominant limb-girdle muscular dystrophy (LGMD). Yet the Bethlem myopathy differs from most limb-girdle dystrophies in two important regards. First, the Bethlem myopathy presents with joint contractures most commonly observed at the elbows, ankles, and neck. Secondly, disease onset in the Bethlem myopathy is in early childhood, while most dominant LGMDs present with adult onset. 6 refs., 1 fig.

  3. Control rod drive

    International Nuclear Information System (INIS)

    Hawke, B.C.

    1986-01-01

    A reactor core, one or more control rods, and a control rod drive are described for selectively inserting and withdrawing the one or more control rods into and from the reactor core, which consists of: a support structure secured beneath the reactor core; control rod positioning means supported by the support structure for movably supporting the control rod for movement between a lower position wherein the control rod is located substantially beneath the reactor core and an upper position wherein at least an upper portion of the control rod extends into the reactor core; transmission means; primary drive means connected with the control rod positioning means by the transmission means for positioning the control rod under normal operating conditions; emergency drive means for moving the control rod from the lower position to the upper position under emergency conditions, the emergency drive means including a weight movable between an upper and a lower position, means for movably supporting the weight, and means for transmitting gravitational force exerted on the weight to the control rod positioning means to move the control rod upwardly when the weight is pulled downwardly by gravity; the transmission means connecting the control rod positioning means with the emergency drive means so that the primary drive means effects movement of the weight and the control rod in opposite directions under normal conditions, thus providing counterbalancing to reduce the force required for upward movement of the control rod under normal conditions; and restraint means for restraining the fall of the weight under normal operating conditions and disengaging the primary drive means to release the weight under emergency conditions

  4. [Biologic therapy in idiopathic inflammatory myopathy].

    Science.gov (United States)

    Selva-O'Callaghan, Albert; Ramos Casals, Manel; Grau Junyent, Josep M

    2014-09-15

    The aim of this article is to study the evidence-based knowledge related to the use of biological therapies in patients diagnosed with idiopathic inflammatory myopathy (dermatomyositis, polymyositis and inclusion body myositis). In this review the leading published studies related to the use of biological therapy in patients with myositis are analysed; mainly those with high methodological standards, that means randomized and controlled studies. Methodological drawbacks due to the rarity and heterogeneity of these complex diseases are also addressed. Up to now is not possible to ascertain the biologics as a recommended therapy in patients with myositis, at least based in the current evidence-based knowledge, although it can not be neglected as a therapeutic option in some clinical situations, taking into account the scarce of effective treatments in those patients, especially in refractory myositis. Future studies probably will help to better define the role of biological therapies in patients with idiopathic inflammatory myopathy. Copyright © 2013 Elsevier España, S.L.U. All rights reserved.

  5. Flaccid quadriplegia due to thyrotoxic myopathy.

    Science.gov (United States)

    Couillard, Philippe; Wijdicks, Eelco F M

    2014-04-01

    Acute flaccid paralysis is an important clinical problem in neurological critical care. After implementing life-supporting measures, it is imperative to identify the correct diagnosis to provide timely appropriate care. Thyrotoxicosis is a recognized cause of myopathy, but rarely of quadriplegia. Here, we report a case of hyperthyroidism with severe weakness. Case report and video demonstration of clinical examination. We describe a case of a 59-year-old woman with Grave's disease who presented to the hospital with progressive shortness of breath secondary to atrial fibrillation with rapid ventricular response. Following contrast administration, she had a pulseless electrical activity arrest from which she recovered without cognitive sequelae, but with flaccid quadriplegia, facial diplegia, and hypophonia. CK was mildly elevated and electrolytes were essentially normal. Nerve conduction studies and electromyography demonstrated features supporting an acute myopathy without evidence of neuromuscular junction conduction abnormality. Normalization of thyroid hormones resulted in slow, but steady improvement over months after which she regained ambulation. Acute flaccid quadriplegia can result from thyrotoxicosis. With normalization of thyroid function, recovery can be expected.

  6. Fuel rod leak detector

    International Nuclear Information System (INIS)

    Womack, R.E.

    1978-01-01

    A typical embodiment of the invention detects leaking fuel rods by means of a radiation detector that measures the concentration of xenon-133 ( 133 Xe) within each individual rod. A collimated detector that provides signals related to the energy of incident radiation is aligned with one of the ends of a fuel rod. A statistically significant sample of the gamma radiation (γ-rays) that characterize 133 Xe is accumulated through the detector. The data so accumulated indicates the presence of a concentration of 133 Xe appropriate to a sound fuel rod, or a significantly different concentration that reflects a leaking fuel rod

  7. Two novel MYH7 proline substitutions cause Laing Distal Myopathy-like phenotypes with variable expressivity and neck extensor contracture.

    Science.gov (United States)

    Feinstein-Linial, Miora; Buvoli, Massimo; Buvoli, Ada; Sadeh, Menachem; Dabby, Ron; Straussberg, Rachel; Shelef, Ilan; Dayan, Daniel; Leinwand, Leslie Anne; Birk, Ohad S

    2016-08-12

    Human skeletal muscles express three major myosin heavy chain (MyHC) isoforms: MyHCIIx (MYH1) in fast type 2B muscle fibers, MyHCIIa (MYH2) in fast type 2A fibers and MyHCI/β-cardiac MyHC (MYH7) in slow type I skeletal fibers and cardiac ventricles. In line with its expression pattern, MYH7 mutations have been reported in association with hypertrophic or dilated cardiomyopathy, skeletal myopathies or a combination of both. We analyzed the clinical and molecular phenotype of two unrelated families of Jewish Moroccan ancestry that presented with apparently autosomal dominant inheritance of progressive Laing-like distal myopathy with non-specific myopathic changes, but uncommon marked contractures and wasting of the neck extensors. Clinical phenotyping, whole exome sequencing and restriction analysis, generation of mutants followed by cell culture transfection and imaging. Using whole exome sequencing we identified in both families two novel heterozygous proline substitutions located in exon 31 of MYH7 within its rod domain: c.4309G>C (p.Ala1437Pro) and c.4301G>C (p.Arg1434Pro). Here we show that the phenotype caused by these mutations includes marked cervical muscle contracture, and report that the severity of the phenotype varies significantly, to the extent of non-penetrance in one of the families. Finally, we provide evidence that both proline substitutions impair myosin self-assembly in non-muscle cells transfected with β-myosin constructs carrying the mutations, but do not prevent incorporation of the mutant molecules into the sarcomere. This study expands our clinical and molecular knowledge of MYH7 rod mutations causing skeletal myopathies, and underscores the importance of discussing disease penetrance during genetic counseling.

  8. Fission reactor control rod

    International Nuclear Information System (INIS)

    Irie, Tomoo.

    1991-01-01

    The present invention concerns a control rod in a PWR type reactor. A control rod has an inner cladding tube and an outer cladding tube disposed coaxially, and a water draining hole is formed at the inside of the inner cladding tube. Neutron absorbers are filled in an annular gap between the outer cladding tube and the inner cladding tube. The water draining hole opens at the lower end thereof to the top end of the control rod and at the upper end thereof to the side of the upper end plug of the control rod. If the control rod is dropped to a control rod guide thimble for reactor scram, coolants from the control rod guide thimble are flown from the lower end of the water draining hole and discharged from the upper end passing through the water draining hole. In this way, water from the control rod guide thimble is removed easily when the control rod is dropped. Further, the discharging amount of water itself is reduced by the provision of the water draining hole. Accordingly, sufficient control rod dropping speed can be attained. (I.N.)

  9. Atypical presentation of GNE myopathy with asymmetric hand weakness

    Science.gov (United States)

    de Dios, John Karl L.; Shrader, Joseph A.; Joe, Galen O.; McClean, Jeffrey C.; Williams, Kayla; Evers, Robert; Malicdan, May Christine V.; Ciccone, Carla; Mankodi, Ami; Huizing, Marjan; McKew, John C.; Bluemke, David A.; Gahl, William A.; Carrillo-Carrasco, Nuria

    2014-01-01

    GNE myopathy is a rare autosomal recessive muscle disease caused by mutations in GNE, the gene encoding the rate-limiting enzyme in sialic acid biosynthesis. GNE myopathy usually manifests in early adulthood with distal myopathy that progresses slowly and symmetrically, first involving distal muscles of the lower extremities, followed by proximal muscles with relative sparing of the quadriceps. Upper extremities are typically affected later in the disease. We report a patient with GNE myopathy who presented with asymmetric hand weakness. He had considerably decreased left grip strength, atrophy of the left anterior forearm and fibro-fatty tissue replacement of left forearm flexor muscles on T1-weighted magnetic resonance imaging. The patient was an endoscopist and thus the asymmetric hand involvement may be associated with left hand overuse in daily repetitive pinching and gripping movements, highlighting the possible impact of environmental factors on the progression of genetic muscle conditions. PMID:25182749

  10. Genetics Home Reference: early-onset myopathy with fatal cardiomyopathy

    Science.gov (United States)

    ... in childhood, people with EOMFC may also develop joint deformities called contractures that restrict the movement of ... Home Edition for Patients and Caregivers: Dilated Cardiomyopathy Neuromuscular Disease Center, Washington University Orphanet: Early-onset myopathy ...

  11. Statin Induced Myopathy a Patient with Multiple Systemic Diseases

    Directory of Open Access Journals (Sweden)

    Özgül Uçar

    2011-04-01

    Full Text Available Hydroxymethylglutaryl-coenzyme A reductase inhibitors (statins are the most successful class of drugs for the treatment of hypercholesterolaemia and dyslipidaemia. However, the popular profile of statins in terms of efficacy has been maligned by theiradverse effects. Statin induced myopathy, which can be seen at any time during the course of therapy, is a clinically important cause of statin intolerance and discontinuation. When a patient with multiple systemic diseases who use numerous medications represent with myalgia and muscle cramps, statin induced myopathy may not be remembered at first. We present a patient with multiple systemic diseases, alcohol and morphine abuse in whom myopathy developed. After exclusion of other etiologies, we concluded that myopathy was related to statin therapy.

  12. Safety rod driving device

    International Nuclear Information System (INIS)

    Murakami, Kiyonobu; Kurosaki, Akira.

    1988-01-01

    Purpose: To rapidly insert safety rods for a criticality experiment device into a reactor core container to stop the criticality reaction thereby prevent reactivity accidents. Constitution: A cylinder device having a safety rod as a cylinder rod attached with a piston at one end is constituted. The piston is elevated by pressurized air and attracted and fixed by an electromagnet which is a stationary device disposed at the upper portion of the cylinder. If the current supply to the electromagnet is disconnected, the safety rod constituting the cylinder rod is fallen together with the piston to the lower portion of the cylinder. Since the cylinder rod driving device has neither electrical motor nor driving screw as in the conventional device, necessary space can be reduced and the weight is decreased. In addition, since the inside of the nuclear reactor can easily be shielded completely from the external atmosphere, leakage of radioactive materials can be prevented. (Horiuchi, T.)

  13. Congenital myopathy is caused by mutation of HACD1

    OpenAIRE

    Muhammad, Emad; Reish, Orit; Ohno, Yusuke; Scheetz, Todd; DeLuca, Adam; Searby, Charles; Regev, Miriam; Benyamini, Lilach; Fellig, Yakov; Kihara, Akio; Sheffield, Val C.; Parvari, Ruti

    2013-01-01

    Congenital myopathies are heterogeneous inherited diseases of muscle characterized by a range of distinctive histologic abnormalities. We have studied a consanguineous family with congenital myopathy. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous non-sense mutation in 3-hydroxyacyl-CoA dehydratase 1 (HACD1) in affected individuals. The mutation results in non-sense mediated decay of the HACD1 mRNA to 31% of control levels in patient muscle and completely abro...

  14. Skeletal muscle repair in a mouse model of nemaline myopathy

    OpenAIRE

    Sanoudou, Despina; Corbett, Mark A.; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T.; Vlahovich, Nicole; Hardeman, Edna C.; Beggs, Alan H.

    2006-01-01

    Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five d...

  15. Aerobic Training in Patients with Congenital Myopathy.

    Directory of Open Access Journals (Sweden)

    Gitte Hedermann

    Full Text Available Congenital myopathies (CM often affect contractile proteins of the sarcomere, which could render patients susceptible to exercise-induced muscle damage. We investigated if exercise is safe and beneficial in patients with CM.Patients exercised on a stationary bike for 30 minutes, three times weekly, for 10 weeks at 70% of their maximal oxygen uptake (VO2max. Creatine kinase (CK was monitored as a marker of muscle damage. VO2max, functional tests, and questionnaires evaluated efficacy.Sixteen patients with CM were included in a controlled study. VO2max increased by 14% (range, 6-25%; 95% CI 7-20; p < 0.001 in the seven patients who completed training, and tended to decrease in a non-intervention group (n = 7; change -3.5%; range, -11-3%, p = 0.083. CK levels were normal and remained stable during training. Baseline Fatigue Severity Scale scores were high, 4.9 (SE 1.9, and tended to decrease (to 4.4 (SE 1.7; p = 0.08 with training. Nine patients dropped out of the training program. Fatigue was the major single reason.Ten weeks of endurance training is safe and improves fitness in patients with congenital myopathies. The training did not cause sarcomeric injury, even though sarcomeric function is affected by the genetic abnormalities in most patients with CM. Severe fatigue, which characterizes patients with CM, is a limiting factor for initiating training in CM, but tends to improve in those who train.The Regional Committee on Health Research Ethics of the Capital Region of Denmark H-2-2013-066 and ClinicalTrials.gov H2-2013-066.

  16. Association between statin-associated myopathy and skeletal muscle damage.

    Science.gov (United States)

    Mohaupt, Markus G; Karas, Richard H; Babiychuk, Eduard B; Sanchez-Freire, Verónica; Monastyrskaya, Katia; Iyer, Lakshmanan; Hoppeler, Hans; Breil, Fabio; Draeger, Annette

    2009-07-07

    Many patients taking statins often complain of muscle pain and weakness. The extent to which muscle pain reflects muscle injury is unknown. We obtained biopsy samples from the vastus lateralis muscle of 83 patients. Of the 44 patients with clinically diagnosed statin-associated myopathy, 29 were currently taking a statin, and 15 had discontinued statin therapy before the biopsy (minimal duration of discontinuation 3 weeks). We also included 19 patients who were taking statins and had no myopathy, and 20 patients who had never taken statins and had no myopathy. We classified the muscles as injured if 2% or more of the muscle fibres in a biopsy sample showed damage. Using reverse transcriptase polymerase chain reaction, we evaluated the expression levels of candidate genes potentially related to myocyte injury. Muscle injury was observed in 25 (of 44) patients with myopathy and in 1 patient without myopathy. Only 1 patient with structural injury had a circulating level of creatine phosphokinase that was elevated more than 1950 U/L (10x the upper limit of normal). Expression of ryanodine receptor 3 was significantly upregulated in patients with biopsy evidence of structural damage (1.7, standard error of the mean 0.3). Persistent myopathy in patients taking statins reflects structural muscle damage. A lack of elevated levels of circulating creatine phosphokinase does not rule out structural muscle injury. Upregulation of the expression of ryanodine receptor 3 is suggestive of an intracellular calcium leak.

  17. Status of rod consolidation

    International Nuclear Information System (INIS)

    Bailey, W.J.

    1985-04-01

    Two of the factors that need to be taken into account with rod consolidation are (1) the effects on rods from their removal from the fuel assembly and (2) the effects on rods as a result of the consolidation process. Potential components of both factors are described in the report. Discussed under (1) are scratches on the fuel rod surfaces, rod breakage, crud, extended burnup, and possible cladding embrittlement due to hydrogen injection at BWRs. Discussed under (2) are the increased water temperature (less than 10 0 C) because of closer packing of the rods, formation of crevices between rods in the close-packed mode, contact with dissimilar metals, and the potential for rapid heating of fuel rods following the loss of water from a spent fuel storage pool. Another factor that plays an important role in rod consolidation is the cost of disposal of the nonfuel-bearing components of the fuel assembly. Also, the dose rate from the components - especially Inconel spacer grids - can affect the handling procedures. Several licensing issues that exist are described. A list of recommendations is provided. 98 refs., 5 figs., 5 tabs

  18. Control rod shutdown system

    International Nuclear Information System (INIS)

    Miyamoto, Yoshiyuki; Higashigawa, Yuichi.

    1996-01-01

    The present invention provides a control rod terminating system in a BWR type nuclear power plant, which stops an induction electric motor as rapidly as possible to terminate the control rods. Namely, the control rod stopping system controls reactor power by inserting/withdrawing control rods into a reactor by driving them by the induction electric motor. The system is provided with a control device for controlling the control rods and a control device for controlling the braking device. The control device outputs a braking operation signal for actuating the braking device during operation of the control rods to stop the operation of the control rods. Further, the braking device has at least two kinds of breaks, namely, a first and a second brakes. The two kinds of brakes are actuated by receiving the brake operation signals at different timings. The brake device is used also for keeping the control rods after the stopping. Even if a stopping torque of each of the breaks is small, different two kinds of brakes are operated at different timings thereby capable of obtaining a large stopping torque as a total. (I.S.)

  19. Control rod drives

    International Nuclear Information System (INIS)

    Futatsugi, Masao.

    1980-01-01

    Purpose: To secure the reactor operation safety by the provision of a fluid pressure detecting section for control rod driving fluid and a control rod interlock at the midway of the flow pass for supplying driving fluid to the control rod drives. Constitution: Between a driving line and a direction control valve are provided a pressure detecting portion, an alarm generating device, and a control rod inhibition interlock. The driving fluid from a driving fluid source is discharged by way of a pump and a manual valve into the reactor in which the control rods and reactor fuels are contained. In addition, when the direction control valve is switched and the control rods are inserted and extracted by the control rod drives, the pressure in the driving line is always detected by the pressure detection section, whereby if abnormal pressure is resulted, the alarm generating device is actuated to warn the abnormality and the control rod inhibition interlock is actuated to lock the direction control valve thereby secure the safety operation of the reactor. (Seki, T.)

  20. Why Rods and Cocci

    Indian Academy of Sciences (India)

    Bacteria exhibit a wide variety of shapes but the commonly studied species of bacteria are generally either spherical in shape which are called cocci (singular coccus) or have a cylindrical shape and are called rods or bacilli (singular bacillus). In reality rods and cocci are the ends of a continuum. Sonle of the cocci are.

  1. Control rod drives

    International Nuclear Information System (INIS)

    Oonuki, Koji.

    1981-01-01

    Purpose: To increase the driving speed of control rods at rapid insertion with an elongate control rod and an extension pipe while ensuring sufficient buffering performance in a short buffering distance, by providing a plurality of buffers to an extension pipe between a control rod drive source and a control rod in LMFBR type reactor. Constitution: First, second and third buffers are respectively provided to an acceleration piston, an extension pipe and a control rod respectively and the insertion positions for each of the buffers are displaced orderly from above to below. Upon disconnection of energizing current for an electromagnet, the acceleration piston, the extension pipe and the control rod are rapidly inserted in one body. The first, second and third buffers are respectively actuated at each of their falling strokes upon rapid insertion respectively, and the acceleration piston, the extension pipe and the control rod receive the deceleration effect in the order correspondingly. Although the compression force is applied to the control rod only near the stroke end, it does not cause deformation. (Kawakami, Y.)

  2. Failed fuel rod detector

    Energy Technology Data Exchange (ETDEWEB)

    Uchida, Katsuya; Matsuda, Yasuhiko

    1984-05-02

    The purpose of the project is to enable failed fuel rod detection simply with no requirement for dismantling the fuel assembly. A gamma-ray detection section is arranged so as to attend on the optional fuel rods in the fuel assembly. The fuel assembly is adapted such that a gamma-ray shielding plate is detachably inserted into optional gaps of the fuel rods or, alternatively, the fuel assembly can detachably be inserted to the gamma-ray shielding plate. In this way, amount of gaseous fission products accumulated in all of the plenum portions in the fuel rods as the object of the measurement can be determined without dismantling the fuel assembly. Accordingly, by comparing the amounts of the gaseous fission products, the failed fuel rod can be detected.

  3. Genetics Home Reference: hereditary fibrosing poikiloderma with tendon contractures, myopathy, and pulmonary fibrosis

    Science.gov (United States)

    ... Hereditary fibrosing poikiloderma with tendon contractures, myopathy, and pulmonary fibrosis Printable PDF Open All Close All Enable Javascript ... Fibrosing Poikiloderma with Tendon Contractures, Myopathy, and Pulmonary ... Lung, and Blood Institute (NHLBI): Pulmonary Function Tests National ...

  4. Acute liver failure after recommended doses of acetaminophen in patients with myopathies

    NARCIS (Netherlands)

    I. Ceelie (Ilse); L.P. James (Laura); V.M.G.J. Gijsen (Violette); R.A.A. Mathôt (Ron); S. Ito (Shinya); C.D. Tesselaar (Coranne); D. Tibboel (Dick); G. Koren (Gideon); S.N. de Wildt (Saskia)

    2011-01-01

    textabstractObjective: To determine the likelihood that recommended doses of acetaminophen are associated with acute liver failure in patients with myopathies. Design: Retrospective analysis. Setting: Level III pediatric intensive care unit. Patients: Two pediatric patients with myopathies and acute

  5. Acute liver failure after recommended doses of acetaminophen in patients with myopathies

    NARCIS (Netherlands)

    Ceelie, Ilse; James, Laura P.; Gijsen, Violette; Mathot, Ron A. A.; Ito, Shinya; Tesselaar, Coranne D.; Tibboel, Dick; Koren, Gideon; de Wildt, Saskia N.

    2011-01-01

    To determine the likelihood that recommended doses of acetaminophen are associated with acute liver failure in patients with myopathies. Retrospective analysis. Level III pediatric intensive care unit. Two pediatric patients with myopathies and acute liver failure. CLINICAL INVESTIGATIONS: We

  6. Genetics Home Reference: myopathy with deficiency of iron-sulfur cluster assembly enzyme

    Science.gov (United States)

    ... Myopathy with deficiency of iron-sulfur cluster assembly enzyme Printable PDF Open All Close All Enable Javascript ... Myopathy with deficiency of iron-sulfur cluster assembly enzyme is an inherited disorder that primarily affects muscles ...

  7. Genetics Home Reference: inclusion body myopathy with early-onset Paget disease and frontotemporal dementia

    Science.gov (United States)

    ... Share: Email Facebook Twitter Home Health Conditions IBMPFD Inclusion body myopathy with early-onset Paget disease and ... Javascript to view the expand/collapse boxes. Description Inclusion body myopathy with early-onset Paget disease and ...

  8. Control rod drives

    International Nuclear Information System (INIS)

    Hayakawa, Hiroyasu.

    1979-01-01

    Purpose: To enable rapid control in a simple circuit by providing a motor control device having an electric capacity capable of simultaneously driving all of the control rods rapidly only in the inserting direction as well as a motor controlling device capable of fine control for the insertion and extraction at usual operation. Constitution: The control rod drives comprise a first motor control device capable of finely controlling the control rods both in inserting and extracting directions, a second motor control device capable of rapidly driving the control rods only in the inserting direction, and a first motor switching circuit and a second motor switching circuit switched by switches. Upon issue of a rapid insertion instruction for the control rods, the second motor switching circuit is closed by the switch and the second motor control circuit and driving motors are connected. Thus, each of the control rod driving motors is driven at a high speed in the inserting direction to rapidly insert all of the control rods. (Yoshino, Y.)

  9. Multiple fuel rod gripper

    International Nuclear Information System (INIS)

    Shields, E.P.

    1987-01-01

    An apparatus is described for gripping an array of rods comprising: (a) gripping members grippingly engageable with the rods, each of which has a hollow portion terminating in an open end for receiving the end of one of the rods; (b) a closing means for causing the hollow portion of each of the gripping members to apply substantially the same gripping force onto the end of its respective rod, including (i) a locking plate having a plurality of tapered holes registrable with the array of rods, wherein the exterior of each of the gripping members is tapered and nested within one of the tapered holes, (ii) a withdrawing means having a hydraulic plunger operatively connected to each of the gripping members for applying a substantially identical withdrawing force on each of the gripping members, whereby the hollow portion of each of the gripping members applies substantially the same gripping force on its respective rod, and (c) means for detecting whether each of the gripping members has grippingly engaged its respective rod

  10. BAG3 myofibrillar myopathy presenting with cardiomyopathy.

    Science.gov (United States)

    Konersman, Chamindra G; Bordini, Brett J; Scharer, Gunter; Lawlor, Michael W; Zangwill, Steven; Southern, James F; Amos, Louella; Geddes, Gabrielle C; Kliegman, Robert; Collins, Michael P

    2015-05-01

    Myofibrillar myopathies (MFMs) are a heterogeneous group of neuromuscular disorders distinguished by the pathological hallmark of myofibrillar dissolution. Most patients present in adulthood, but mutations in several genes including BCL2-associated athanogene 3 (BAG3) cause predominantly childhood-onset disease. BAG3-related MFM is particularly severe, featuring weakness, cardiomyopathy, neuropathy, and early lethality. While prior cases reported either neuromuscular weakness or concurrent weakness and cardiomyopathy at onset, we describe the first case in which cardiomyopathy and cardiac transplantation (age eight) preceded neuromuscular weakness by several years (age 12). The phenotype comprised distal weakness and severe sensorimotor neuropathy. Nerve biopsy was primarily axonal with secondary demyelinating/remyelinating changes without "giant axons." Muscle biopsy showed extensive neuropathic changes that made myopathic changes difficult to interpret. Similar to previous cases, a p.Pro209Leu mutation in exon 3 of BAG3 was found. This case underlines the importance of evaluating for MFMs in patients with combined neuromuscular weakness and cardiomyopathy. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Myofibrillar myopathies: State of the art, present and future challenges.

    Science.gov (United States)

    Béhin, A; Salort-Campana, E; Wahbi, K; Richard, P; Carlier, R-Y; Carlier, P; Laforêt, P; Stojkovic, T; Maisonobe, T; Verschueren, A; Franques, J; Attarian, S; Maues de Paula, A; Figarella-Branger, D; Bécane, H-M; Nelson, I; Duboc, D; Bonne, G; Vicart, P; Udd, B; Romero, N; Pouget, J; Eymard, B

    2015-10-01

    Myofibrillar myopathies (MFM) have been described in the mid-1990s as a group of diseases sharing common histological features, including an abnormal accumulation of intrasarcoplasmic proteins, the presence of vacuoles and a disorganization of the intermyofibrillar network beginning at the Z-disk. The boundaries of this concept are still uncertain, and whereas six genes (DES, CRYAB, LDB3/ZASP, MYOT, FLNC and BAG3) are now classically considered as responsible for MFM, other entities such as FHL1 myopathy or Hereditary Myopathy with Early Respiratory Failure linked to mutations of titin can now as well be included in this group. The diagnosis of MFM is not always easy; as histological lesions can be focal, and muscle biopsy may be disappointing; this has led to a growing importance of muscle imaging, and the selectivity of muscle involvement has now been described in several disorders. Due to the rarity of these myopathies, if some clinical patterns (such as distal myopathy associated with cardiomyopathy due to desmin mutations) are now well known, surprises remain possible and should lead to systematic testing of the known genes in case of a typical histological presentation. In this paper, we aim at reviewing the data acquired on the six main genes listed above as well as presenting the experience from two French reference centres, Paris and Marseilles. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  12. Mitochondrial myopathy presenting as fibromyalgia: a case report

    Directory of Open Access Journals (Sweden)

    Abdullah Mishal

    2012-02-01

    Full Text Available Abstract Introduction To the best of our knowledge, we describe for the first time the case of a woman who met the diagnostic criteria for fibromyalgia, did not respond to therapy for that disorder, and was subsequently diagnosed by biochemical and genetic studies with a mitochondrial myopathy. Treatment of the mitochondrial myopathy resulted in resolution of symptoms. This case demonstrates that mitochondrial myopathy may present in an adult with a symptom complex consistent with fibromyalgia. Case presentation Our patient was a 41-year-old Caucasian woman with symptoms of fatigue, exercise intolerance, headache, and multiple trigger points. Treatment for fibromyalgia with a wide spectrum of medications including non-steroidal anti-inflammatory drugs, antidepressants, gabapentin and pregabalin had no impact on her symptoms. A six-minute walk study demonstrated an elevated lactic acid level (5 mmol/L; normal Conclusions This case demonstrates that adults diagnosed with fibromyalgia may have their symptom complex related to an adult onset mitochondrial myopathy. This is an important finding since treatment of mitochondrial myopathy resulted in resolution of symptoms.

  13. Autosomal dominant distal myopathy: Linkage to chromosome 14

    Energy Technology Data Exchange (ETDEWEB)

    Laing, N.G.; Laing, B.A.; Wilton, S.D.; Dorosz, S.; Mastaglia, F.L.; Kakulas, B.A. [Australian Neuromuscular Research Institute, Perth (Australia); Robbins, P.; Meredith, C.; Honeyman, K.; Kozman, H.

    1995-02-01

    We have studied a family segregating a form of autosomal dominant distal myopathy (MIM 160500) and containing nine living affected individuals. The myopathy in this family is closest in clinical phenotype to that first described by Gowers in 1902. A search for linkage was conducted using microsatellite, VNTR, and RFLP markers. In total, 92 markers on all 22 autosomes were run. Positive linkage was obtained with 14 of 15 markers tested on chromosome 14, with little indication of linkage elsewhere in the genome. Maximum two-point LOD scores of 2.60 at recombination fraction .00 were obtained for the markers MYH7 and D14S64 - the family structure precludes a two-point LOD score {ge} 3. Recombinations with D14S72 and D14S49 indicate that this distal myopathy locus, MPD1, should lie between these markers. A multipoint analysis assuming 100% penetrance and using the markers D14S72, D14S50, MYH7, D14S64, D14S54, and D14S49 gave a LOD score of exactly 3 at MYH7. Analysis at a penetrance of 80% gave a LOD score of 2.8 at this marker. This probable localization of a gene for distal myopathy, MPD1, on chromosome 14 should allow other investigators studying distal myopathy families to test this region for linkage in other types of the disease, to confirm linkage or to demonstrate the likely genetic heterogeneity. 24 refs., 3 figs., 1 tab.

  14. Prevalence and phenotypes of congenital myopathy due to α-actin 1 gene mutations

    DEFF Research Database (Denmark)

    Witting, Nanna; Werlauff, Ulla; Duno, Morten

    2016-01-01

    airway pressure. Limb flexor/extensor muscles and upper and lower extremities were affected equally. Pronounced neck flexor weakness was noted. CONCLUSIONS: Congenital myopathy caused by ACTA1 mutations is fatal in infancy in most cases. This study shows that the prevalence of α-actin myopathy in older...... patients with congenital myopathy is not negligible and that phenotypes can be quite mild....

  15. Is Vitamin D Deficiency a Confounder in Alcoholic Skeletal Muscle Myopathy?

    NARCIS (Netherlands)

    Wijnia, J.W.; Wielders, J.P.M.; Lips, P.T.A.M.; van der Wiel, A.; Mulder, C.L.; Nieuwenhuis, K.G.A.

    2013-01-01

    Background: Excessive intake of alcohol is often associated with low or subnormal levels of vitamin D even in the absence of active liver disease. As vitamin D deficiency is a well-recognized cause of myopathy, alcoholic myopathy might be related to vitamin D deficiency. Chronic alcoholic myopathy

  16. Fuel rod technology

    International Nuclear Information System (INIS)

    Bezold, H.; Romeiser, H.J.

    1979-07-01

    By extensive mechanization and automation of the fuel rod production, also at increasing production numbers, an efficient production shall be secured, simultaneously corresponding to the high quality standard of the fuel rods. The works done up to now concentrated on the lay out of a rough concept for a mechanized production course. Detail-studies were made for the problems of fuel rod humidity, filling and resistance welding. Further promotion of this project and thus further report will be stopped, since the main point of these works is the production technique. (orig.) [de

  17. Control rod testing apparatus

    International Nuclear Information System (INIS)

    Gaunt, R.R.; Ashman, C.M.

    1987-01-01

    A control rod testing apparatus is described comprising: a first guide means having a vertical cylindrical opening for grossly guiding a control rod; a second guide means having a vertical cylindrical opening for grossly guiding a control rod. The first and second guide means are supported at axially spaced locations with the openings coaxial; and a substantially cylindrical subassembly having a vertical cylindrical opening therethrough. The subassembly is trapped coaxial with and between the first and second guide means, and the subassembly radially floats with respect to the first and second guide means

  18. Burnable poison rod

    International Nuclear Information System (INIS)

    Natsume, Tomohiro.

    1988-01-01

    Purpose: To decrease the effect of water elimination and the effect of burn-up residue boron, thereby reduce the effect of burnable poison rods as the neutron poisons at the final stage of reactor core lifetime. Constitution: In a burnable poison rod according to the present invention, a hollow burnable poison material is filled in an external fuel can, an inner fuel can mounted with a carbon rod is inserted to the hollow portion of the burnable poison material and helium gases are charged in the outer fuel can. In such a burnable poison rod, the reactivity worths after the burning are reduced to one-half as compared with the conventional case. Accordingly, since the effect of the burnable poison as the neutron poisons is reduced at the final stage of the reactor core of lifetime, the excess reactivity of the reactor core is increased. (Horiuchi, T.)

  19. A Rare Manifestation of Hypothyroid Myopathy: Hoffmann's Syndrome

    Directory of Open Access Journals (Sweden)

    Kang Won Lee

    2015-12-01

    Full Text Available Hypothyroid myopathy is observed frequently and the resolution of the clinical manifestations of myopathy following thyroid hormone replacement is well known. However, a specific subtype of hypothyroid myopathy, Hoffmann's syndrome, characterized by increased muscular mass (pseudohypertrophy, proximal muscle weakness, muscle stiffness and cramps, is rarely reported. Herein, we describe a 34-year-old male who presented with proximal muscle weakness and non-pitting edema of the lower extremities. He initially visited the neurology department where he was suspected of having polymyositis. Additional laboratory evaluation revealed profound autoimmune hypothyroidism and elevated muscle enzymes including creatine kinase. The patient was started on levothyroxine treatment and, subsequently, clinical symptoms and biochemical parameters resolved with the treatment. The present case highlights that hypothyroidism should be considered in the differential diagnosis of musculoskeletal symptoms even in the absence of overt manifestations of hypothyroidism. To our knowledge, this is the first case reported in Korea.

  20. A Case Report of Inflammatory Myopathy and Sideroblastic Anemia

    Directory of Open Access Journals (Sweden)

    F Binesh

    2007-01-01

    Full Text Available Mitochondrial myopathy, lactic acidosis, and siderobastic anemia (MLA SA syndrome is one of the newly reported mitochondrial diseases, seven cases of which have been reported. We report a child with inflammatory myopathy, sideroblastic anemia and lactic acidosis .The patient is a 8.5 year old boy with normal cognitive function suffering from chronic progressive weakness in lower extremities, inability to walk since four months and pallor. In paraclinical evaluation, sideroblastic anemia, mild lactic acidosis and elevated muscle enzymes were seen. Inflammatory myopathy (myositis in muscle biopsy was detected as well .The patient was administered oral prednisolone, folic acid, B6 and underwent regular physiotherapy. He ambulated after four months and resumed education and schooling.

  1. Refractory Hyperlactatemia with Organ Insufficiency in Lipid Storage Myopathy.

    Science.gov (United States)

    Xu, Yuanda; Zhou, Li; Liang, Weibo; He, Weiqun; Liu, Xiaoqing; Liang, Xiuling; Zhong, Nanshan; Li, Yimin

    2015-08-01

    Lipid storage myopathy is a metabolic disorder characterized by abnormal lipid accumulation in muscle fibers and progressive muscle weakness. Here, we report the case of a 17-year-old woman with progressive muscle weakness, refractory hyperlactatemia, and multiple organ insufficiency. Severe pneumonia was the initial diagnosis. After anti-infective treatment, fluid resuscitation, and mechanical ventilation, the patient's symptoms improved but hyperlactatemia and muscle weakness persisted. She was empirically treated with carnitine. Biochemical tests, electromyography, and muscle biopsy confirmed lipid storage myopathy. After 7 weeks of treatment, the patient resumed normal daily life. An empirical treatment with carnitine may be beneficial for patients before an accurate diagnosis of lipid storage myopathy is made.

  2. Control rod driving mechanism

    International Nuclear Information System (INIS)

    Ooshima, Yoshio.

    1983-01-01

    Purpose: To perform reliable scram operation, even if abnormality should occur in a system instructing scram operation in FBR type reactors. Constitution: An aluminum alloy member to be melt at a predetermined temperature (about 600sup(o)C) is disposed to a connection part between a control rod and a driving mechanism, whereby the control rod is detached from the driving mechanism and gravitationally fallen to the reactor core. (Ikeda, J.)

  3. Control rod drives

    International Nuclear Information System (INIS)

    Hayakawa, Hiroyasu; Kawamura, Atsuo.

    1979-01-01

    Purpose: To reduce pellet-clad mechanical interactions, as well as improve the fuel safety. Constitution: In the rod drive of a bwr type reactor, an electric motor operated upon intermittent input such as of pulse signals is connected to a control rod. A resolver for converting the rotational angle of the motor to electric signals is connected to the rotational shaft of the motor and the phase difference between the output signal from the resolver and a reference signal is adapted to detect by a comparator. Based on the detection result, the controller is actuated to control a motor for control rod drive so that fine control for the movement of the control rod is made possible. This can reduce the moving distance of the control rod, decrease the thermal stress applied to the control rod and decrease the pellet clad mechanical interaction failures due to thermal expansion between the cladding tube and the pellets caused by abrupt changes in the generated power. (Furukawa, Y.)

  4. Control rod drive

    International Nuclear Information System (INIS)

    Okutani, Tetsuro.

    1988-01-01

    Purpose: To provide a simple and economical control rod drive using a control circuit requiring no pulse circuit. Constitution: Control rods in a BWR type reactor are driven by hydraulic pressure and inserted or withdrawn in the direction of applying the hydraulic pressure. The direction of the hydraulic pressure is controlled by a direction control valve. Since the driving for the control rod is extremely important in view of the operation, a self diagnosis function is disposed for rapid inspection of possible abnormality. In the present invention, two driving contacts are disposed each by one between the both ends of a solenoid valve of the direction control valve for driving the control rod and the driving power source, and diagnosis is conducted by alternately operating them. Therefore, since it is only necessary that the control circuit issues a driving instruction only to one of the two driving contacts, the pulse circuit is no more required. Further, since the control rod driving is conducted upon alignment of the two driving instructions, the reliability of the control rod drive can be improved. (Horiuchi, T.)

  5. Method of inserting fuel rod

    International Nuclear Information System (INIS)

    Kamimoto, Shuji; Imoo, Makoto; Tsuchida, Kenji.

    1991-01-01

    The present invention concerns a method of inserting a fuel rod upon automatic assembling, automatic dismantling and reassembling of a fuel assembly in a light water moderated reactor, as well as a device and components used therefor. That is, a fuel rod is inserted reliably to an aimed point of insertion by surrounding the periphery of the fuel rod to be inserted with guide rods, and thereby suppressing the movement of the fuel rod during insertion. Alternatively, a fuel rod is inserted reliably to a point of insertion by inserting guide rods at the periphery of the point of insertion for the fuel rod to be inserted thereby surrounding the point of insertion with the guide rods or fuel rods. By utilizing fuel rods already present in the fuel assembly as the guide rods described above, the fuel rod can be inserted reliably to the point of insertion with no additional devices. Dummy fuel rods are previously inserted in a fuel assembly which are then utilized as the above-mentioned guide rods to accurately insert the fuel rod to the point of insertion. (I.S.)

  6. Hoffmann's disease: MR imaging of hypothyroid myopathy

    International Nuclear Information System (INIS)

    Chung, Jeewon; Ahn, Kyung-Sik; Kang, Chang Ho; Hong, Suk-Joo; Kim, Beak Hyun

    2015-01-01

    Hoffmann's syndrome is a hypothyroid myopathy presenting as muscle stiffness and hypertrophy. It is a rare complication of hypothyroidism. MRI features of this syndrome have seldom been described in the literature. We present a case of Hoffmann's syndrome in a 34-year-old man who underwent lower extremity contrast-enhanced MRI. MRI can demonstrate the hypertrophic configuration, T2 hyperintensity, and enhancement of the involved muscles in Hoffmann's syndrome. Along with clinical, laboratory, and electromyography findings, MRI may be helpful in distinguishing between inflammatory myopathy, myonecrosis, subacute muscle denervation, and infectious myositis. (orig.)

  7. Hoffmann's disease: MR imaging of hypothyroid myopathy

    Energy Technology Data Exchange (ETDEWEB)

    Chung, Jeewon; Ahn, Kyung-Sik; Kang, Chang Ho [Korea University Anam Hospital, Korea University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Hong, Suk-Joo [Korea University Guro Hospital, Korea University College of Medicine, Department of Radiology, Seoul (Korea, Republic of); Kim, Beak Hyun [Korea University Ansan Hospital, Korea University College of Medicine, Department of Radiology, Gyeonggi-do (Korea, Republic of)

    2015-11-15

    Hoffmann's syndrome is a hypothyroid myopathy presenting as muscle stiffness and hypertrophy. It is a rare complication of hypothyroidism. MRI features of this syndrome have seldom been described in the literature. We present a case of Hoffmann's syndrome in a 34-year-old man who underwent lower extremity contrast-enhanced MRI. MRI can demonstrate the hypertrophic configuration, T2 hyperintensity, and enhancement of the involved muscles in Hoffmann's syndrome. Along with clinical, laboratory, and electromyography findings, MRI may be helpful in distinguishing between inflammatory myopathy, myonecrosis, subacute muscle denervation, and infectious myositis. (orig.)

  8. Glucocorticoid-induced myopathy in the intensive care unit

    DEFF Research Database (Denmark)

    Eddelien, Heidi Shil; Hoffmeyer, Henrik Westy; Lund, Eva Charlotte Løbner

    2015-01-01

    Glucocorticoids (GC) are used for intensive care unit (ICU) patients on several indications. We present a patient who was admitted to the ICU due to severe respiratory failure caused by bronchospasm requiring mechanical ventilation and treated with methylprednisolone 240 mg/day in addition...... to antibiotics and bronchiolytics. When the sedation was lifted on day 10, the patient was awake but quadriplegic. Blood samples revealed elevated muscle enzymes, electromyography showed myopathy, and a muscle biopsy was performed. Glucocorticoid-induced myopathy was suspected, GC treatment was tapered...

  9. Mitochondrial Myopathy: A Rare Cause of Early-Onset Vocal Fold Atrophy

    Science.gov (United States)

    Kelly, Elizabeth A.; Bock, Jonathan M.; Peltier, Amanda C.; Oh, Shin J.; Garrett, C. Gaelyn

    2014-01-01

    Objectives We present the second published case of laryngeal involvement in mitochondrial myopathy. Methods A patient with laryngeal involvement of mitochondrial myopathy is presented, together with a literature review. Results A 41-year-old man presented with progressive breathy dysphonia. His brother had mitochondrial myopathy. Biopsy of the biceps muscle demonstrated cytochrome C oxidase–negative ragged blue fibers confirming mitochondrial myopathy. Videostroboscopy showed marked vocal fold atrophy, but subsequent injection laryngoplasty did not significantly improve the patient’s voice, despite improved postoperative glottic closure. Conclusions Mitochondrial myopathy should be considered in the differential diagnosis of severe early-onset vocal fold atrophy. PMID:23577570

  10. Control rod velocity limiter

    International Nuclear Information System (INIS)

    Cearley, J.E.; Carruth, J.C.; Dixon, R.C.; Spencer, S.S.; Zuloaga, J.A. Jr.

    1986-01-01

    This patent describes a velocity control arrangement for a reciprocable, vertically oriented control rod for use in a nuclear reactor in a fluid medium, the control rod including a drive hub secured to and extending from one end therefrom. The control device comprises: a toroidally shaped control member spaced from and coaxially positioned around the hub and secured thereto by a plurality of spaced radial webs thereby providing an annular passage for fluid intermediate the hub and the toroidal member spaced therefrom in coaxial position. The side of the control member toward the control rod has a smooth generally conical surface. The side of the control member away from the control rod is formed with a concave surface constituting a single annular groove. The device also comprises inner and outer annular vanes radially spaced from one another and spaced from the side of the control member away from the control rod and positioned coaxially around and spaced from the hub and secured thereto by spaced radial webs thereby providing an annular passage for fluid intermediate the hub and the vanes. The vanes are angled toward the control member, the outer edge of the inner vane being closer to the control member and the inner edge of the outer vane being closer to the control member. When the control rod moves in the fluid in the direction toward the drive hub the vanes direct a flow of fluid turbulence which provides greater resistance to movement of the control rod in the direction toward the drive hub than in the other direction

  11. DNAJB6 myopathies: Focused review on an emerging and expanding group of myopathies

    Directory of Open Access Journals (Sweden)

    Alessandra Ruggieri

    2016-09-01

    Full Text Available Mutations in the DNAJB6 gene have been associated with the autosomal dominant limb girdle muscular dystrophy type 1D (LGMD1D, a disorder characterized by abnormal protein aggregates and rimmed vacuoles in muscle fibers. DNAJB6 is a ubiquitously expressed Hsp40 co-chaperone characterized by a J domain that specifies Hsp70 functions in the cellular environment. DNAJB6 is also a potent inhibitor of expanded polyglutamine (polyQ aggregation preventing aggregate toxicity in cells. In DNAJB6-mutated patients this anti-aggregation property is significantly reduced, albeit not completely lost. To elucidate the pathogenetic mechanisms underlying the DNAJB6-related myopathy, animal models have been created showing that, indeed, conditional muscular expression of a DNAJB6 mutant in the mouse causes a LGMD1D myofibrillary muscle tissue phenotype. Both mutations and phenotypes reported until recently were rather homogeneous, being exclusively missense mutations of a few amino acids of the protein G/F domain, and with a phenotype characterized by adult-onset slowly progressive muscular dystrophy predominantly affecting proximal muscles. Lately, several novel mutations and new phenotypes of DNAJB6 have been described. These mutations once more affect the G/F domain of DNAJB6 with missense changes and a splice site mutation; and the phenotypes include childhood onset and distal involvement of muscles, or childhood-onset LGMD1D with loss of ambulation in early adulthood and respiratory involvement. Thus, the spectrum of DNAJB6-related phenotypes is widening. Although our knowledge about the role of DNAJB6 in the pathogenesis of muscle diseases has made great progression, several questions remain unsolved, including why a ubiquitous protein affects only, or predominantly, skeletal muscle; why only the G/F domain is involved; and what is the possible role of the DNAJB6a isoform. Clarification of these issues will provide clues to implement possible therapeutic

  12. Control rod housing alignment

    International Nuclear Information System (INIS)

    Dixon, R.C.; Deaver, G.A.; Punches, J.R.; Singleton, G.E.; Erbes, J.G.; Offer, H.P.

    1990-01-01

    This patent describes a process for measuring the vertical alignment between a hole in a core plate and the top of a corresponding control rod drive housing within a boiling water reactor. It comprises: providing an alignment apparatus. The alignment apparatus including a lower end for fitting to the top of the control rod drive housing; an upper end for fitting to the aperture in the core plate, and a leveling means attached to the alignment apparatus to read out the difference in angularity with respect to gravity, and alignment pin registering means for registering to the alignment pin on the core plate; lowering the alignment device on a depending support through a lattice position in the top guide through the hole in the core plate down into registered contact with the top of the control rod drive housing; registering the upper end to the sides of the hole in the core plate; registering the alignment pin registering means to an alignment pin on the core plate to impart to the alignment device the required angularity; and reading out the angle of the control rod drive housing with respect to the hole in the core plate through the leveling devices whereby the angularity of the top of the control rod drive housing with respect to the hole in the core plate can be determined

  13. Genetics Home Reference: CAV3-related distal myopathy

    Science.gov (United States)

    ... gene causes a peculiar form of distal myopathy. Neurology. 2002 Jan 22;58(2):323-5. Erratum in: Neurology 2002 Mar 12;58(5):839. Itoyoma Y [ ... 3 cause four distinct autosomal dominant muscle diseases. Neurology. 2004 Feb 24;62(4):538-43. Review. ...

  14. Congenital myopathy is caused by mutation of HACD1.

    Science.gov (United States)

    Muhammad, Emad; Reish, Orit; Ohno, Yusuke; Scheetz, Todd; Deluca, Adam; Searby, Charles; Regev, Miriam; Benyamini, Lilach; Fellig, Yakov; Kihara, Akio; Sheffield, Val C; Parvari, Ruti

    2013-12-20

    Congenital myopathies are heterogeneous inherited diseases of muscle characterized by a range of distinctive histologic abnormalities. We have studied a consanguineous family with congenital myopathy. Genome-wide linkage analysis and whole-exome sequencing identified a homozygous non-sense mutation in 3-hydroxyacyl-CoA dehydratase 1 (HACD1) in affected individuals. The mutation results in non-sense mediated decay of the HACD1 mRNA to 31% of control levels in patient muscle and completely abrogates the enzymatic activity of dehydration of 3-hydroxyacyl-CoA, the third step in the elongation of very long-chain fatty acids (VLCFAs). We describe clinical findings correlated with a deleterious mutation in a gene not previously known to be associated with congenital myopathy in humans. We suggest that the mutation in the HACD1 gene causes a reduction in the synthesis of VLCFAs, which are components of membrane lipids and participants in physiological processes, leading to congenital myopathy. These data indicate that HACD1 is necessary for muscle function.

  15. Eosinophilic fasciitis in a child mimicking a myopathy.

    NARCIS (Netherlands)

    Pillen, S.; Engelen, B.G.M. van; Hoogen, F.H.J. van den; Fiselier, T.J.W.; Vossen, P. van der; Drost, G.

    2006-01-01

    A 14-year-old boy was suspected of having a myopathy with joint contractures. He presented with progressive painless joint contractures of his right wrist and fingers, and reduced muscle strength of his right arm, without obvious skin changes. Laboratory investigation showed a normal CK,

  16. GNE Myopathy in Turkish Sisters with a Novel Homozygous Mutation

    Science.gov (United States)

    Diniz, Gulden; Secil, Yaprak; Ceylaner, Serdar; Tokucoglu, Figen; Türe, Sabiha; Celebisoy, Mehmet; İncesu, Tülay Kurt; Akhan, Galip

    2016-01-01

    Background. Hereditary inclusion body myopathy is caused by biallelic defects in the GNE gene located on chromosome 9p13. It generally affects adults older than 20 years of age. Methods and Results. In this study, we present two Turkish sisters with progressive myopathy and describe a novel mutation in the GNE gene. Both sisters had slightly higher levels of creatine kinase (CK) and muscle weakness. The older sister presented at 38 years of age with an inability to climb steps, weakness, and a steppage gait. Her younger sister was 36 years old and had similar symptoms. The first symptoms of the disorder were seen when the sisters were 30 and 34 years old, respectively. The muscle biopsy showed primary myopathic features and presence of rimmed vacuoles. DNA analysis demonstrated the presence of previously unknown homozygous mutations [c.2152 G>A (p.A718T)] in the GNE genes. Conclusion. Based on our literature survey, we believe that ours is the first confirmed case of primary GNE myopathy with a novel missense mutation in Turkey. These patients illustrate that the muscle biopsy is still an important method for the differential diagnosis of vacuolar myopathies in that the detection of inclusions is required for the definitive diagnosis. PMID:27298745

  17. Clinical, serologic, and immunogenetic features of familial idiopathic inflammatory myopathy

    NARCIS (Netherlands)

    Rider, L. G.; Gurley, R. C.; Pandey, J. P.; Garcia de la Torre, I.; Kalovidouris, A. E.; O'Hanlon, T. P.; Love, L. A.; Hennekam, R. C.; Baumbach, L. L.; Neville, H. E.; Garcia, C. A.; Klingman, J.; Gibbs, M.; Weisman, M. H.; Targoff, I. N.; Miller, F. W.

    1998-01-01

    OBJECTIVE: To describe the clinical, serologic, and immunogenetic features of familial idiopathic inflammatory myopathy (IIM) and to compare these with the features of sporadic IIM. METHODS: Clinical signs and symptoms, autoantibodies, HLA-DRB1 and DQA1 alleles, and GM/KM phenotypes were compared

  18. Severe polysaccharide storage myopathy in Belgian and Percheron draught horses.

    Science.gov (United States)

    Valentine, B A; Credille, K M; Lavoie, J P; Fatone, S; Guard, C; Cummings, J F; Cooper, B J

    1997-05-01

    A severe myopathy leading to death or euthanasia was identified in 4 Belgian and 4 Percheron draught horses age 2-21 years. Clinical signs ranged from overt weakness and muscle atrophy in 2 horses age 2 and 3 years, to recumbency with inability to rise in 6 horses age 4-21 years. In 5 horses there was mild to severe increases in muscle enzyme levels. Clinical diagnoses included equine motor neuron disease (2 horses), post anaesthetic myopathy (2 horses), exertional myopathy (2 horses), myopathy due to unknown (one horse), and equine protozoal myelitis (one horse). Characteristic histopathology of muscle from affected horses was the presence of excessive complex polysaccharide and/or glycogen, revealed by periodic acid-Schiff staining in all cases and by electron microscopy in one case. Evaluation of frozen section histochemistry performed on 2 cases indicated that affected fibres were Type 2 glycolytic fibres. Subsarcolemmal and intracytoplasmic vacuoles were most prominent in 3 horses age 2-4 years, and excessive glycogen, with little or no complex polysaccharide, was the primary compound stored in affected muscle in these young horses. Myopathic changes, including fibre size variation, fibre hypertrophy, internal nuclei, and interstitial fat infiltration, were most prominent in 5 horses age 6-21 years, and the accumulation of complex polysaccharide appeared to increase with age. Mild to moderate segmental myofibre necrosis was present in all cases.

  19. Control rod drives

    International Nuclear Information System (INIS)

    Asano, Hiromitsu.

    1979-01-01

    Purpose: To drive control rods at an optimum safety speed corresponding to the reactor core output. Constitution: The reactor power is detected by a neutron detector and the output signal is applied to a process computer. The process computer issues a signal representing the reactor core output, which is converted through a function generator into a signal representing the safety speed of control rods. The converted signal is further supplied to a V/F converter and converted into a pulse signal. The pulse signal is inputted to a step motor driving circuit, which actuates a step motor to operate the control rods always at a safety speed corresponding to the reactor core power. (Furukawa, Y.)

  20. Hydraulically centered control rod

    International Nuclear Information System (INIS)

    Horlacher, W.R.; Sampson, W.T.; Schukei, G.E.

    1981-01-01

    A control rod suspended to reciprocate in a guide tube of a nuclear fuel assembly has a hydraulic bearing formed at its lower tip. The bearing includes a plurality of discrete pockets on its outer surface into which a flow of liquid is continuously provided. In one embodiment the flow is induced by the pressure head in a downward facing chamber at the end of the bearing. In another embodiment the flow originates outside the guide tube. In both embodiments the flow into the pockets produces pressure differences across the bearing which counteract forces tending to drive the rod against the guide tube wall. Thus contact of the rod against the guide tube is avoided

  1. Control rod control device

    International Nuclear Information System (INIS)

    Seiji, Takehiko; Obara, Kohei; Yanagihashi, Kazumi

    1998-01-01

    The present invention provides a device suitable for switching of electric motors for driving each of control rods in a nuclear reactor. Namely, in a control rod controlling device, a plurality of previously allotted electric motors connected in parallel as groups, and electric motors of any selected group are driven. In this case, a voltage of not driving predetermined selected electric motors is at first applied. In this state an electric current supplied to the circuit of predetermined electric motors is detected. Whether integration or failure of a power source and the circuit of the predetermined electric motors are normal or not is judged by the detected electric current supplied. After they are judged normal, the electric motors are driven by a regular voltage. With such procedures, whether the selected circuit is normal or not can be accurately confirmed previously. Since the electric motors are not driven just at the selected time, the control rods are not operated erroneously. (I.S.)

  2. Sucker rod motor

    Energy Technology Data Exchange (ETDEWEB)

    Radzalov, N N; Radzhabov, N A

    1983-01-01

    The motor consists of rollers mounted on the wellmouth and connected by a flexible rink. Reciprocating mechanism is in the form of a horizontal non-mobile single-side operation cylinder, inside which a plunger and rod are mounted. The working housing of the hydrocylinder is connected to a gas-hydr aulic batter, and when running is connected via plunger to the high pressure source; running in reverse it is connected with a safety valve and automatic control unit. The unit is equipped with a reducer and a mechanical transformer consisting of screw and nut, and which is shutoff with a single-side lining. The plunger rod consists of an auger-like unit. The high pressure source is provided by the injection line of the sucker rod that has been equipped with a reverse valve.

  3. Burnable poison rod

    International Nuclear Information System (INIS)

    Natsume, Tomohiro.

    1988-01-01

    Purpose: To increase the reactor core lifetime by decreasing the effect of neutron absorption of burnable poison rods by using material with less neutron absorbing effect. Constitution: Stainless steels used so far as the coating material for burnable poison rods have relatively great absorption in the thermal neutral region and are not preferred in view of the neutron economy. Burnable poison rods having fuel can made of zirconium alloy shows absorption the thermal neutron region lower by one digit than that of stainless steels but they shows absorption in the resonance region and the cost is higher. In view of the above, the fuel can of the burnable poison material is made of aluminum or aluminu alloy. This can reduce the neutron absorbing effect by stainless steel fuel can and effectively utilize neutrons that have been wastefully absorbed and consumed in stainless steels. (Takahashi, M.)

  4. REV-ERB and ROR: therapeutic targets for treating myopathies

    Science.gov (United States)

    Welch, Ryan D.; Flaveny, Colin A.

    2017-08-01

    Muscle is primarily known for its mechanical roles in locomotion, maintenance of posture, and regulation of cardiac and respiratory function. There are numerous medical conditions that adversely affect muscle, myopathies that disrupt muscle development, regeneration and protein turnover to detrimental effect. Skeletal muscle is also a vital secretory organ that regulates thermogenesis, inflammatory signaling and directs context specific global metabolic changes in energy substrate preference on a daily basis. Myopathies differ in the causative factors that drive them but share common features including severe reduction in quality of life and significantly increased mortality all due irrefutably to the loss of muscle mass. Thus far clinically viable approaches for preserving muscle proteins and stimulating new muscle growth without unwanted side effects or limited efficacy has been elusive. Over the last few decades, evidence has emerged through in vitro and in vivo studies that suggest the nuclear receptors REV-ERB and ROR might modulate pathways involved in myogenesis and mitochondrial biogenesis. Hinting that REV-ERB and ROR might be targeted to treat myopathies. However there is still a need for substantial investigation into the roles of these nuclear receptors in in vivo rodent models of degenerative muscle diseases and acute injury. Although exciting, REV-ERB and ROR have somewhat confounding roles in muscle physiology and therefore more studies utilizing in vivo models of skeletal muscle myopathies are needed. In this review we highlight the molecular forces driving some of the major degenerative muscular diseases and showcase two promising molecular targets that may have the potential to treat myopathies: ROR and REV-ERB.

  5. Flow in rod bundles

    International Nuclear Information System (INIS)

    Hazi, G.; Mayer, G.

    2005-01-01

    For power upgrading VVER-440 reactors we need to know exactly how the temperature measured by the thermocouples is related to the average outlet temperature of the fuel assemblies. Accordingly, detailed knowledge on mixing process in the rod bundles and in the fuel assembly head have great importance. Here we study the hydrodynamics of rod bundles based on the results of direct numerical and large eddy simulation of flows in subchannels. It is shown that secondary flow and flow pulsation phenomena can be observed using both methodologies. Some consequences of these observations are briefly discussed. (author)

  6. Device for coupling a control rod and control rod drive

    International Nuclear Information System (INIS)

    Nishioka, Kazuya.

    1975-01-01

    Object: To obtain simple and reliable coupling between a control rod and control rod drive by equipping the lower end of the control rod with an extension provided with lateral protuberances and forming the upper end of an index tube with a recess provided with lateral holes. Structure: The tapering central extension of the control rod is inserted into the recess by lowering the control rod, and then it is further inserted by causing frictional movement of the inclined surfaces of lateral protuberances in frictional contact with guide surfaces. When the lateral protuberances are brought into contact with a stepped portion, the control rod is rotated to fit the lateral protuberances into the lateral holes. In this way, the control rod is coupled to the index tube of the control rod drive. (Yoshino, Y.)

  7. Control rod drives

    International Nuclear Information System (INIS)

    Ikakura, Hiroaki.

    1986-01-01

    Purpose: To enable to direct disconnection of control rods upon abnormal temperature rise in the reactor thereby improve the reliability for the disconnecting operation in control rod drives for FBR type reactors upon emergency. Constitution: A diaphragm is disposed to the upper opening of a sealing vessel inserted to the hollow portion of an electromagnet and a rod is secured to the central position of the upper surface. A spring contacts are attached by way of an insulator to the inner surface at the lower portion of an extension pipe and connected with cables for supplying electric power sources respectively to a magnet. If the temperature in the reactor abnormally rises, liquid metals in the sealing vessel are expanded tending to extend the bellows downwardly. However, since they are attracted by the electromagnet, the thermal expansion of the liquid metals exert on the diaphragm prior to the bellows. Thus, the switch between the spring contacts is made open to attain the deenergized state to thereby disconnect the control rod and shutdown the neclear reactor. (Horiuchi, T.)

  8. Control rod drive mechanism

    International Nuclear Information System (INIS)

    Mizuno, Katsuyuki.

    1976-01-01

    Object: To restrict the reduction in performance due to stress corrosion cracks by making use of condensate produced in a turbine steam condenser. Structure: Water produced in a turbine steam condenser is forced into a condensed water desalting unit by low pressure condensate pump. The condensate is purified and then forced by a high pressure condensate pump into a feedwater heater for heating before it is returned to the reactor by a feedwater pump. Part of the condensate issuing from the condensate desalting unit is branched from the remaining portion at a point upstream the pump and is withdrawn into a control rod drive water pump after passing through a motordriven bypass valve, an orifice and a condenser water level control valve, is pressurized in the control rod drive water desalting unit and supplied to a control rod drive water pressure system. The control rod is vertically moved by the valve operation of the water pressure system. Since water of high oxygen concentration does not enter during normal operation, it is possible to prevent the stress cracking of the stainless steel apparatus. (Nakamura, S.)

  9. Trunnion Rod Microcrack Detection

    Science.gov (United States)

    2013-08-01

    Richard W. Haskins, Joseph A. Padula , and John E. Hite BACKGROUND: Post-tensioned rods are used to anchor spillway gates and transfer the forces...email: James.A.Evans@usace.army.mil). This technical note should be cited as follows: Evans, J. A., Haskins, R. W., Padula , J. A., and Hite, J. E. 2013

  10. Morphoelastic rods. Part I: A single growing elastic rod

    KAUST Repository

    Moulton, D.E.

    2013-02-01

    A theory for the dynamics and statics of growing elastic rods is presented. First, a single growing rod is considered and the formalism of three-dimensional multiplicative decomposition of morphoelasticity is used to describe the bulk growth of Kirchhoff elastic rods. Possible constitutive laws for growth are discussed and analysed. Second, a rod constrained or glued to a rigid substrate is considered, with the mismatch between the attachment site and the growing rod inducing stress. This stress can eventually lead to instability, bifurcation, and buckling. © 2012 Elsevier Ltd. All rights reserved.

  11. Control rod cluster with removable rods for nuclear fuel assembly

    International Nuclear Information System (INIS)

    Denizou, J.P.

    1989-01-01

    For each removable control rod, the open end section of the sleeve has a certain length of reduced diameter with openings in its wall. The top end of the rod is joined to an extension tube that surrounds the shaft over part of its lenght. This extension tube fits over the reduced part of the sleeve when the shaft is screwed into the bore of the sleeve. Rotation of the rod in the sleeve is prevented by deforming the extension tube locally in the openings of the end part of the sleeve. The rod is dismantled by exerting a torque on it using a gripping area near the end of the rod [fr

  12. Morphoelastic rods. Part I: A single growing elastic rod

    KAUST Repository

    Moulton, D.E.; Lessinnes, T.; Goriely, A.

    2013-01-01

    A theory for the dynamics and statics of growing elastic rods is presented. First, a single growing rod is considered and the formalism of three-dimensional multiplicative decomposition of morphoelasticity is used to describe the bulk growth of Kirchhoff elastic rods. Possible constitutive laws for growth are discussed and analysed. Second, a rod constrained or glued to a rigid substrate is considered, with the mismatch between the attachment site and the growing rod inducing stress. This stress can eventually lead to instability, bifurcation, and buckling. © 2012 Elsevier Ltd. All rights reserved.

  13. REACTOR CONTROL ROD OPERATING SYSTEM

    Science.gov (United States)

    Miller, G.

    1961-12-12

    A nuclear reactor control rod mechanism is designed which mechanically moves the control rods into and out of the core under normal conditions but rapidly forces the control rods into the core by catapultic action in the event of an emergency. (AEC)

  14. Control rod drive shaft latch

    International Nuclear Information System (INIS)

    Thorp, A.G. II.

    1976-01-01

    A latch mechanism is operated by differential pressure on a piston to engage the drive shaft for a control rod in a nuclear reactor, thereby preventing the control rod from being ejected from the reactor in case of failure of the control rod drive mechanism housing which is subjected to the internal pressure in the reactor vessel. 6 claims, 4 drawing figures

  15. Control rod calibration including the rod coupling effect

    International Nuclear Information System (INIS)

    Szilard, R.; Nelson, G.W.

    1984-01-01

    In a reactor containing more than one control rod, which includes all reactors licensed in the United States, there will be a 'coupling' or 'shadowing' of control rod flux at the location of a control rod as a result of the flux depression caused by another control rod. It was decided to investigate this phenomenon further, and eventually to put calibration table data or formulae in a small computer in the control room, so once could insert the positions of the three control rods and receive the excess reactivity without referring to separate tables. For this to be accomplished, a 'three control- rod reactivity function' would be used which would include the flux coupling between the rods. The function is design and measured data was fitted into it to determine the calibration constants. The input data for fitting the trial functions consisted of 254 data points, each consisting of the position of the reg, shim, and transient rods, and the total excess reactivity. (About 200 of these points were 'critical balance points', that is the rod positions for which reactor was critical, and the remainder were determined by positive period measurements.) Although this may be unrealistic from a physical viewpoint, the function derived gave a very accurate recalculation of the input data, and thus would faithfully give the excess reactivity for any possible combination of the locations of the three control rods. The next step, incorporation of the three-rod function into the minicomputer, will be pursued in the summer and fall of 1984

  16. The effect of coenzyme Q10 in statin myopathy.

    Science.gov (United States)

    Zlatohlavek, Lukas; Vrablik, Michal; Grauova, Barbora; Motykova, Eva; Ceska, Richard

    2012-01-01

    Statins significantly reduce CV morbidity and mortality. Unfortunately, one of the side effects of statins is myopathy, for which statins cannot be administered in sufficient doses or administered at all. The aim of this study was to demonstrate the effect of coenzyme Q10 in patients with statin myopathy. Twenty eight patients aged 60.6±10.7 years were monitored (18 women and 10 men) and treated with different types and doses of statin. Muscle weakness and pain was monitored using a scale of one to ten, on which patients expressed the degree of their inconvenience. Examination of muscle problems was performed prior to administration of CQ10 and after 3 and 6 months of dosing. Statistical analysis was performed using Friedman test, Annova and Students t-test. Pain decreased on average by 53.8% (pmuscle weakness by 44.4% (pmuscle pain and sensitivity statistically significantly decreased.

  17. Myopathy in Childhood Muscle-Specific Kinase Myasthenia Gravis.

    Science.gov (United States)

    Kirzinger, Lukas; Khomenko, Andrei; Schulte-Mattler, Wilhelm; Backhaus, Roland; Platen, Sabine; Schalke, Berthold

    2016-12-01

    Adult and pediatric patients suffering from MuSK (muscle-specific kinase) -antibody positive myasthenia gravis exhibit similar features to individuals with acetylcholine receptor (AChR) antibodies, but they differ in several characteristics such as a predominant bulbar, respiratory and neck weakness, a generally worse disease severity and a tendency to develop muscle atrophy. Muscle atrophy is a rare phenomenon that is usually restricted to the facial muscles. We describe a girl with MuSK-antibody positive myasthenia gravis who developed a myopathy with severe generalized muscular weakness, muscle atrophy, and myopathic changes on electromyography. This is the first published example of a generalized myopathic syndrome in myasthenia gravis. We review the relevant literature and discuss the hypothesis of a mitochondrial myopathy as a pathogenic mechanism in MuSK-antibody positive myasthenia gravis. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Miopatia ocular descendente Descending ocular myopathy: a case report

    Directory of Open Access Journals (Sweden)

    Marcos R. G. de Freitas

    1975-06-01

    Full Text Available Os autores apresentam caso de paciente jovem, do sexo feminino, com afecção muscular primária ocular e faríngea sem caráter familial. Foram feitos estudos eletromiográficos e histopatológicos musculares que confirmam o caráter miogênico do processo. É feita comparação entre a miopatia ocular e a miopatia ocular descendente, acreditando os autores que seriam variantesThe case of a 23 years old female patient, with primary involvement of the extraocular and faringeal muscles without familiar history is reported. Electromyographic and muscular biopsy studies proved the myogenic nature of the process. A clinical comparison between the ocular myopathy and the descending ocular myopathy is made, the authors thinking that both of them would be variants of the same muscle disease.

  19. Sarcoidosis Presenting as Löfgren’s Syndrome with Myopathy

    Directory of Open Access Journals (Sweden)

    Şenol Kobak

    2013-01-01

    Full Text Available A 34-year-old female patient, who had proximal muscle weakness for 8 months, presented with erythema nodosum lesions on the pretibial region in addition to pain, swelling, and movement restriction in both ankles for the last one month. Thoracic CT demonstrated hilar and mediastinal lymphadenopathy. She underwent mediastinoscopic lymph node biopsy; biopsy result was consistent with noncaseating granuloma. Serum angiotensin converting enzyme level and muscle enzymes have been elevated. Muscular MRI and EMG findings were consistent with myositis. Muscle biopsy was done, and myopathy was found. The patient was diagnosed with sarcoidosis, Löfgren's syndrome, and sarcoid myopathy. The patient displayed remarkable clinical and radiological regression after 6-month corticosteroid and MTX therapy.

  20. Fuel rod fixing system

    International Nuclear Information System (INIS)

    Christiansen, D.W.

    1982-01-01

    This is a reusable system for fixing a nuclear reactor fuel rod to a support. An interlock cap is fixed to the fuel rod and an interlock strip is fixed to the support. The interlock cap has two opposed fingers, which are shaped so that a base is formed with a body part. The interlock strip has an extension, which is shaped so that this is rigidly fixed to the body part of the base. The fingers of the interlock cap are elastic in bending. To fix it, the interlock cap is pushed longitudinally on to the interlock strip, which causes the extension to bend the fingers open in order to engage with the body part of the base. To remove it, the procedure is reversed. (orig.) [de

  1. Control rod drive mechanism

    International Nuclear Information System (INIS)

    Futatsugi, Masao; Goto, Mikihiko.

    1976-01-01

    Purpose: To provide a control rod drive mechanism using water as an operating source, which prevents a phenomenon for forming two-layers of water in the neighbourhood of a return nozzle in a reactor to limit formation of excessive thermal stress to improve a safety. Constitution: In the control rod drive mechanism of the present invention, a heating device is installed in the neighbourhood of a pressure container for a reactor. This heating device is provided to heat return water in the reactor to a level equal to the temperature of reactor water thereby preventing a phenomenon for forming two-layers of water in the reactor. This limits formation of thermal stress in the return nozzle in the reactor. Accordingly, it is possible to minimize damages in the return nozzle portion and yet a possibility of failure in reactor water. (Kawakami, Y.)

  2. Fuel rod attachment system

    International Nuclear Information System (INIS)

    Christiansen, D.W.

    1982-01-01

    A reusable system for removably attaching a nuclear reactor fuel rod to a support member. A locking cap is secured to the fuel rod and a locking strip is fastened to the support member or vice versa. The locking cap has two opposing fingers and shaped to form a socket having a body portion. The locking strip has an extension shaped to rigidly attach to the socket's body portion. The locking cap's fingers are resiliently deflectable. For attachment, the locking cap is longitudinally pushed onto the locking strip causing the extension to temporarily deflect open the fingers to engage the socket's body portion. For removal, the process is reversed. In an alternative embodiment, the cap is rigid and the strip is transversely resiliently compressible. (author)

  3. Control rod drives

    International Nuclear Information System (INIS)

    Yamanaka, Toshikatsu.

    1979-01-01

    Purpose: To protect bellows against failures due to negative pressure to prevent the loss of pressure balance caused by the expansion of the bellows upon scram. Constitution: An expansion pipe connected to the control rod drive is driven along a guide pipe to insert a control rod into the reactor core. Expansible bellows are provided at the step between the expansion pipe and the guide pipe. Further, a plurality of bore holes or slits are formed on the side wall of the guide pipe corresponding to the expansion portion of the bellows. In such an arrangement, when the expansion pipe falls rapidly and the bellows are expanded upon scram, the volume between each of the pipes of the bellows and the guide pipe is increased to produce a negative pressure, but the effect of the negative pressure on the bellows can be eliminated by the flowing-in of coolants corresponding to that pressure through the bore holes or the slits. (Furukawa, Y.)

  4. Analysis of lipid profile in lipid storage myopathy.

    Science.gov (United States)

    Aguennouz, M'hammed; Beccaria, Marco; Purcaro, Giorgia; Oteri, Marianna; Micalizzi, Giuseppe; Musumesci, Olimpia; Ciranni, Annmaria; Di Giorgio, Rosa Maria; Toscano, Antonio; Dugo, Paola; Mondello, Luigi

    2016-09-01

    Lipid dysmetabolism disease is a condition in which lipids are stored abnormally in organs and tissues throughout the body, causing muscle weakness (myopathy). Usually, the diagnosis of this disease and its characterization goes through dosage of Acyl CoA in plasma accompanied with evidence of droplets of intra-fibrils lipids in the patient muscle biopsy. However, to understand the pathophysiological mechanisms of lipid storage diseases, it is useful to identify the nature of lipids deposited in muscle fiber. In this work fatty acids and triglycerides profile of lipid accumulated in the muscle of people suffering from myopathies syndromes was characterized. In particular, the analyses were carried out on the muscle biopsy of people afflicted by lipid storage myopathy, such as multiple acyl-coenzyme A dehydrogenase deficiency, and neutral lipid storage disease with myopathy, and by the intramitochondrial lipid storage dysfunctions, such as deficiencies of carnitine palmitoyltransferase II enzyme. A single step extraction and derivatization procedure was applied to analyze fatty acids from muscle tissues by gas chromatography with a flame ionization detector and with an electronic impact mass spectrometer. Triglycerides, extracted by using n-hexane, were analyzed by high performance liquid chromatography coupled to mass spectrometer equipped with an atmospheric pressure chemical ionization interface. The most representative fatty acids in all samples were: C16:0 in the 13-24% range, C18:1n9 in the 20-52% range, and C18:2n6 in the 10-25% range. These fatty acids were part of the most representative triglycerides in all samples. The data obtained was statistically elaborated performing a principal component analysis. A satisfactory discrimination was obtained among the different diseases. Using component 1 vs component 3 a 43.3% of total variance was explained. Such results suggest the important role that lipid profile characterization can have in supporting a correct

  5. Quantitative nailfold video capillaroscopy in patients with idiopathic inflammatory myopathy

    OpenAIRE

    Mercer, Louise K.; Moore, Tonia L.; Chinoy, Hector; Murray, Andrea K.; Vail, Andy; Cooper, Robert G.; Herrick, Ariane L.

    2010-01-01

    Objectives. To quantify nailfold capillary density and dimensions in patients with idiopathic inflammatory myopathy (IIM) and compare them with those in healthy controls; to look for associations with microvascular disease in IIM; and to determine whether nailfold capillary density and dimensions change over time. Methods. Nailfold video microscopy (×300 magnification) was performed on 24 patients with IIM and 35 healthy controls. Capillary density and dimensions (total width and apical width...

  6. Cardiac involvement in adult and juvenile idiopathic inflammatory myopathies

    DEFF Research Database (Denmark)

    Schwartz, TThomas W; Diederichsen, L. P.; Lundberg, Ingrid E.

    2016-01-01

    Idiopathic inflammatory myopathies (IIM) include the main subgroups polymyositis (PM), dermatomyositis (DM), inclusion body myositis (IBM) and juvenile DM ( JDM). The mentioned subgroups are characterised by inflammation of skeletal muscles leading to muscle weakness and other organs can also...... that statins might worsen muscle symptoms mimicking myositis relapse. On the basis of recent studies, we recommend a low threshold for cardiac workup and follow-up in patients with IIM. © 2016 Published by the BMJ Publishing Group Limited....

  7. Diagnosis and treatment of the idiopathic inflammatory myopathies

    OpenAIRE

    Gazeley, David J.; Cronin, Mary E.

    2011-01-01

    The idiopathic inflammatory myopathies (IIMs) are rare disorders with the unifying feature of proximal muscle weakness. These diseases include polymyositis(PM), dermatomyositis (DM) and inclusion body myositis (IBM) as the most common. The diagnosis is based on the finding of weakness on exam, elevated muscles enzymes, characteristic histopathology of muscle biopsies, electromyography abnormalities and rash in DM. Myositis-specific antibodies have been helpful in defining subsets of patients ...

  8. Association between statin-associated myopathy and skeletal muscle damage.

    OpenAIRE

    Mohaupt Markus G; Karas Richard H; Babiychuk Eduard B; Sanchez-Freire Verónica; Monastyrskaya Katia; Iyer Lakshmanan; Hoppeler Hans; Breil Fabio; Draeger Annette

    2009-01-01

    BACKGROUND Many patients taking statins often complain of muscle pain and weakness. The extent to which muscle pain reflects muscle injury is unknown. METHODS We obtained biopsy samples from the vastus lateralis muscle of 83 patients. Of the 44 patients with clinically diagnosed statin associated myopathy 29 were currently taking a statin and 15 had discontinued statin therapy before the biopsy (minimal duration of discontinuation 3 weeks). We also included 19 patients who were taking stat...

  9. Schistosomiasis and nutritional myopathy in a Brazilian tapir (Tapirus terrestris).

    Science.gov (United States)

    Yamini, B; Schillhorn van Veen, T W

    1988-10-01

    Gross lesions suggestive of severe hepatoenteropathy and myopathy were noted in a 4.5-yr-old Brazilian tapir (Tapirus terrestris) from a zoo in Michigan (USA). The major microscopic lesions were granulomatous hepatitis and hemorrhagic enteritis associated with non-operculated eggs compatible with those of the Schistosomatidae (Digenea). Skeletal muscle and tongue contained foci of severe acute myodegeneration and necrosis. The hepatic vitamin E value of 1.3 ppm dry weight was considered critically low.

  10. Search for Pompe disease among patients with undetermined myopathies.

    Science.gov (United States)

    Lindberg, C; Anderson, B; Engvall, M; Hult, M; Oldfors, A

    2015-07-20

    Pompe disease is a rare treatable glycogen storage disease with in adults - a limb-girdle muscle weakness. Muscle biopsy may fail to show the typical vacuolar myopathy. We asked if we had un-diagnosed patients with Pompe disease in western Sweden. We searched the muscle biopsy registry during the time period 1986 until 2006 including 3665 biopsies and included patients at our Neuromuscular Center with unspecified myopathy or limb-girdle muscular dystrophy. The dry blood spot test was used to identify patients with Pompe disease. A total of 82 patients (46 from the biopsy register and 36 from our center) were seen and dry blood spot test was obtained. No patient with Pompe disease was found. The dry blood spot test was low in three cases (11, 16, and 18% of normal) but a second blood sample showed a normal result based on GAA enzyme activity in lymphocytes in all three patients. In one patient with low normal result of the analysis in lymphocytes a genetic test showed no pathogenic mutations. Further investigation gave a definite diagnose of another myopathy in 12 patients. The prevalence of Pompe disease in western Sweden (3 in 1.27 million or 0.24 per 100.000 inhabitants) is lower than in the Netherlands and New York. Re-evaluation of patients with myopathies but without definite diagnosis is rewarding since 12 of 82 patients in our study had a definite molecular diagnosis after workup. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Nuclear fuel rod loading apparatus

    International Nuclear Information System (INIS)

    King, H.B.; Macivergan, R.; Mckenzie, G.W.

    1980-01-01

    An apparatus incorporating a microprocessor control is provided for automatically loading nuclear fuel pellets into fuel rods commonly used in nuclear reactor cores. The apparatus comprises a split ''v'' trough for assembling segments of fuel pellets in rows and a shuttle to receive the fuel pellets from the split ''v'' trough when the two sides of the split ''v'' trough are opened. The pellets are weighed while in the shuttle, and the shuttle then moves the pellets into alignment with a fuel rod. A guide bushing is provided to assist the transfer of the pellets into the fuel rod. A rod carousel which holds a plurality of fuel rods presents the proper rod to the guide bushing at the appropriate stage in the loading sequence. The bushing advances to engage the fuel rod, and the shuttle advances to engage the guide bushing. The pellets are then loaded into the fuel rod by a motor operated push rod. The guide bushing includes a photocell utilized in conjunction with the push rod to measure the length of the row of fuel pellets inserted in the fuel rod

  12. Control rod withdrawal monitoring device

    International Nuclear Information System (INIS)

    Ebisuya, Mitsuo.

    1984-01-01

    Purpose: To prevent the power ramp even if a plurality of control rods are subjected to withdrawal operation at a time, by reducing the reactivity applied to the reactor. Constitution: The control rod withdrawal monitoring device is adapted to monitor and control the withdrawal of the control rods depending on the reactor power and the monitoring region thereof is divided into a control rod group monitoring region a transition region and a control group monitoring not interfere region. In a case if the distance between a plurality of control rods for which the withdrawal positions are selected is less than a limiting value, the coordinate for the control rods, distance between the control rods and that the control rod distance is shorter are displayed on a display panel, and the withdrawal for the control rods are blocked. Accordingly, even if a plurality of control rods are subjected successively to the withdrawal operation contrary to the control rod withdrawal sequence upon high power operation of the reactor, the power ramp can be prevented. (Kawakami, Y.)

  13. Rod drive and latching mechanism

    International Nuclear Information System (INIS)

    Veronesi, L.; Sherwood, D.G.

    1982-01-01

    Hydraulic drive and latching mechanisms for driving reactivity control mechanisms in nuclear reactors are described. Preferably, the pressurized reactor coolant is utilized to raise the drive rod into contact with and to pivot the latching mechanism so as to allow the drive rod to pass the latching mechanism. The pressure in the housing may then be equalized which allows the drive rod to move downwardly into contact with the latching mechanism but to hold the shaft in a raised position with respect to the reactor core. Once again, the reactor coolant pressure may be utilized to raise the drive rod and thus pivot the latching mechanism so that the drive rod passes above the latching mechanism. Again, the mechanism pressure can be equalized which allows the drive rod to fall and pass by the latching mechanism so that the drive rod approaches the reactor core. (author)

  14. Morphologic imaging in muscular dystrophies and inflammatory myopathies

    International Nuclear Information System (INIS)

    Degardin, Adrian; Lacour, Arnaud; Vermersch, Patrick; Morillon, David; Cotten, Anne; Stojkovic, Tanya

    2010-01-01

    To determine if magnetic resonance imaging (MR imaging) is useful in the diagnostic workup of muscular dystrophies and idiopathic inflammatory myopathies for describing the topography of muscle involvement. MR imaging was performed in 31 patients: 8 with dystrophic myotony types 1 (n = 4) or 2 (n = 4); 11 with limb-girdle muscular dystrophy, including dysferlinopathy, calpainopathy, sarcoglycanopathy, and dystrophy associated with fukutin-related protein mutation; 3 with Becker muscular dystrophy; and 9 with idiopathic inflammatory myopathies, including polymyositis, dermatomyositis, and sporadic inclusion body myositis. Analysis of T1 images enabled us to describe the most affected muscles and the muscles usually spared for each muscular disease. In particular, examination of pelvis, thigh, and leg muscles demonstrated significant differences between the muscular diseases. On STIR images, hyperintensities were present in 62% of our patients with muscular dystrophies. A specific pattern of muscular involvement was established for each muscular disease. Hyperintensities observed on STIR images precede fatty degeneration and are not specific for inflammatory myopathies. (orig.)

  15. Morphologic imaging in muscular dystrophies and inflammatory myopathies

    Energy Technology Data Exchange (ETDEWEB)

    Degardin, Adrian; Lacour, Arnaud; Vermersch, Patrick [CHU de Lille, Clinique neurologique, Lille (France); Morillon, David; Cotten, Anne [CHRU de Lille, Service de Radiologie Osteoarticulaire, Hopital Roger Salengro, Lille (France); Stojkovic, Tanya [G-H Pitie-Salpetriere, Institut de Myologie, Paris (France)

    2010-12-15

    To determine if magnetic resonance imaging (MR imaging) is useful in the diagnostic workup of muscular dystrophies and idiopathic inflammatory myopathies for describing the topography of muscle involvement. MR imaging was performed in 31 patients: 8 with dystrophic myotony types 1 (n = 4) or 2 (n = 4); 11 with limb-girdle muscular dystrophy, including dysferlinopathy, calpainopathy, sarcoglycanopathy, and dystrophy associated with fukutin-related protein mutation; 3 with Becker muscular dystrophy; and 9 with idiopathic inflammatory myopathies, including polymyositis, dermatomyositis, and sporadic inclusion body myositis. Analysis of T1 images enabled us to describe the most affected muscles and the muscles usually spared for each muscular disease. In particular, examination of pelvis, thigh, and leg muscles demonstrated significant differences between the muscular diseases. On STIR images, hyperintensities were present in 62% of our patients with muscular dystrophies. A specific pattern of muscular involvement was established for each muscular disease. Hyperintensities observed on STIR images precede fatty degeneration and are not specific for inflammatory myopathies. (orig.)

  16. Zidovudine-induced myopathy: A study in Indian patients.

    Science.gov (United States)

    Sagar, Amitabh; Mohanty, Ambika P; Bahal, Ashish

    2010-07-01

    Literature is replete with studies on zidovudine-induced myopathy after prolonged use (use beyond 270 days on an average). However, all these studies have been done on patients of Caucasian, American and African ethnic origin. No such study has been carried out in Indian patients to our knowledge. To determine the correlation of zidovudine usage with serum creatine phosphokinase (CK) levels, clinical muscular weakness and muscle histology in Indian patients, we studied 147 physically active, Human Immunodeficiency Virus infected men on prolonged zidovudine-based antiretroviral therapy (ART). Cross-sectional study on hospital follow-up patients of HIV infection. All cases on ART who reported to our canter during a period of 18 months were evaluated for symptoms (muscle fatigue, myalgia), objective muscle strength (testing clinically) and serum CK levels, and a select group was evaluated by muscle biopsy. These patients were on zidovudine for 1 to 7 years. None of the patients studied had significant symptoms or objective muscle weakness and only a small fraction (10.8% of cases) had marginally raised serum CK levels. All muscle biopsies were normal on light microscopy. Zidovudine myopathy may be a constraint for use of the drug in the western population; however, it is a well-tolerated drug as regards myopathy in our study on Indian patients.

  17. Cone rod dystrophies

    Science.gov (United States)

    Hamel, Christian P

    2007-01-01

    Cone rod dystrophies (CRDs) (prevalence 1/40,000) are inherited retinal dystrophies that belong to the group of pigmentary retinopathies. CRDs are characterized by retinal pigment deposits visible on fundus examination, predominantly localized to the macular region. In contrast to typical retinitis pigmentosa (RP), also called the rod cone dystrophies (RCDs) resulting from the primary loss in rod photoreceptors and later followed by the secondary loss in cone photoreceptors, CRDs reflect the opposite sequence of events. CRD is characterized by primary cone involvement, or, sometimes, by concomitant loss of both cones and rods that explains the predominant symptoms of CRDs: decreased visual acuity, color vision defects, photoaversion and decreased sensitivity in the central visual field, later followed by progressive loss in peripheral vision and night blindness. The clinical course of CRDs is generally more severe and rapid than that of RCDs, leading to earlier legal blindness and disability. At end stage, however, CRDs do not differ from RCDs. CRDs are most frequently non syndromic, but they may also be part of several syndromes, such as Bardet Biedl syndrome and Spinocerebellar Ataxia Type 7 (SCA7). Non syndromic CRDs are genetically heterogeneous (ten cloned genes and three loci have been identified so far). The four major causative genes involved in the pathogenesis of CRDs are ABCA4 (which causes Stargardt disease and also 30 to 60% of autosomal recessive CRDs), CRX and GUCY2D (which are responsible for many reported cases of autosomal dominant CRDs), and RPGR (which causes about 2/3 of X-linked RP and also an undetermined percentage of X-linked CRDs). It is likely that highly deleterious mutations in genes that otherwise cause RP or macular dystrophy may also lead to CRDs. The diagnosis of CRDs is based on clinical history, fundus examination and electroretinogram. Molecular diagnosis can be made for some genes, genetic counseling is always advised. Currently

  18. Cone rod dystrophies

    Directory of Open Access Journals (Sweden)

    Hamel Christian P

    2007-02-01

    Full Text Available Abstract Cone rod dystrophies (CRDs (prevalence 1/40,000 are inherited retinal dystrophies that belong to the group of pigmentary retinopathies. CRDs are characterized by retinal pigment deposits visible on fundus examination, predominantly localized to the macular region. In contrast to typical retinitis pigmentosa (RP, also called the rod cone dystrophies (RCDs resulting from the primary loss in rod photoreceptors and later followed by the secondary loss in cone photoreceptors, CRDs reflect the opposite sequence of events. CRD is characterized by primary cone involvement, or, sometimes, by concomitant loss of both cones and rods that explains the predominant symptoms of CRDs: decreased visual acuity, color vision defects, photoaversion and decreased sensitivity in the central visual field, later followed by progressive loss in peripheral vision and night blindness. The clinical course of CRDs is generally more severe and rapid than that of RCDs, leading to earlier legal blindness and disability. At end stage, however, CRDs do not differ from RCDs. CRDs are most frequently non syndromic, but they may also be part of several syndromes, such as Bardet Biedl syndrome and Spinocerebellar Ataxia Type 7 (SCA7. Non syndromic CRDs are genetically heterogeneous (ten cloned genes and three loci have been identified so far. The four major causative genes involved in the pathogenesis of CRDs are ABCA4 (which causes Stargardt disease and also 30 to 60% of autosomal recessive CRDs, CRX and GUCY2D (which are responsible for many reported cases of autosomal dominant CRDs, and RPGR (which causes about 2/3 of X-linked RP and also an undetermined percentage of X-linked CRDs. It is likely that highly deleterious mutations in genes that otherwise cause RP or macular dystrophy may also lead to CRDs. The diagnosis of CRDs is based on clinical history, fundus examination and electroretinogram. Molecular diagnosis can be made for some genes, genetic counseling is

  19. Nuclear reactor fuel rod

    International Nuclear Information System (INIS)

    Busch, H.; Mindnich, F.R.

    1973-01-01

    The fuel rod consists of a can with at least one end cap and a plenum spring between this cap and the fuel. To prevent the hazard that a eutectic mixture is formed during welding of the end cap, a thermal insulation is added between the end cap and plenum spring. It consists of a comical extension of the end cap with a terminal disc against which the spring is supported. The end cap, the extension, and the disc may be formed by one or several pieces. If the disc is separated from the other parts it may be manufactured from chrome steel or VA steel. (DG) [de

  20. CT and the diagnosis of myopathies. Preliminary findings in 42 cases

    Energy Technology Data Exchange (ETDEWEB)

    Calgo, M; Crisi, G; Martinelli, C; Colombo, A; Schoenhuber, R; Gibertoni, M

    1986-01-01

    A total of 42 patients with myopathies underwent CT scans in order to study the relationship between CT images and clinical findings. CT is a valuable diagnostic aid to distinguish primary from neurogenic myopathies, to facilitate directed biopsy and finally to classify the disease according to the degree and extent of the muscular lesion. (orig.).

  1. Myopathy and hepatic lipidosis in weaned lambs due to vitamin E deficiency.

    Science.gov (United States)

    Menzies, Paula; Langs, Lisa; Boermans, Herman; Martin, John; McNally, John

    2004-03-01

    A sheep flock experienced losses in weaned lambs from myopathy and hepatic lipidosis. Investigation revealed painful ambulation, illthrift, and unexpected death in lambs with normal selenium levels, deficient vitamin E levels, and elevated muscle and liver enzyme levels. Vitamin E deficiency should be considered when investigating myopathy and illthrift in lambs.

  2. Myopathy and hepatic lipidosis in weaned lambs due to vitamin E deficiency

    OpenAIRE

    Menzies, Paula; Langs, Lisa; Boermans, Herman; Martin, John; McNally, John

    2004-01-01

    A sheep flock experienced losses in weaned lambs from myopathy and hepatic lipidosis. Investigation revealed painful ambulation, illthrift, and unexpected death in lambs with normal selenium levels, deficient vitamin E levels, and elevated muscle and liver enzyme levels. Vitamin E deficiency should be considered when investigating myopathy and illthrift in lambs.

  3. Fuel rod pellet loading head

    International Nuclear Information System (INIS)

    Howell, T.E.

    1975-01-01

    An assembly for loading nuclear fuel pellets into a fuel rod comprising a loading head for feeding pellets into the open end of the rod is described. The pellets rest in a perforated substantially V-shaped seat through which air may be drawn for removal of chips and dust. The rod is held in place in an adjustable notched locator which permits alignment with the pellets

  4. Control-rod driving mechanism

    International Nuclear Information System (INIS)

    Jodoi, Takashi.

    1976-01-01

    Purpose: To prevent falling of control rods due to malfunction. Constitution: The device of the present invention has a scram function in particular, and uses principally a fluid pressure as a scram accelerating means. The control rod is held by upper and lower holding devices, which are connected by a connecting mechanism. This connecting mechanism is designed to be detachable only at the lower limit of driving stroke of the control rod so that there occurs no erroneous scram resulting from careless disconnection of the connecting mechanism. Further, scramming operation due to own weight of the scram operating portion such as control rod driving shaft may be effected to increase freedom. (Kamimura, M.)

  5. Integrated control rod monitoring device

    International Nuclear Information System (INIS)

    Saito, Katsuhiro

    1997-01-01

    The present invention provides a device in which an entire control rod driving time measuring device and a control rod position support device in a reactor building and a central control chamber are integrated systematically to save hardwares such as a signal input/output device and signal cables between boards. Namely, (1) functions of the entire control rod driving time measuring device for monitoring control rods which control the reactor power and a control rod position indication device are integrated into one identical system. Then, the entire devices can be made compact by the integration of the functions. (2) The functions of the entire control rod driving time measuring device and the control rod position indication device are integrated in a central operation board and a board in the site. Then, the place for the installation of them can be used in common in any of the cases. (3) The functions of the entire control rod driving time measuring device and the control rod position indication device are integrated to one identical system to save hardware to be used. Then, signal input/output devices and drift branching panel boards in the site and the central operation board can be saved, and cables for connecting both of the boards is no more necessary. (I.S.)

  6. Reconstitutable control rod spider assembly

    International Nuclear Information System (INIS)

    Shallenberger, J.M.; Ferian, S.J.

    1990-01-01

    A reconstitutable control rod/spider assembly includes a hollow connecting finger of the spider having a pair of opposing flat segments formed on the interior thereof and engaging a pair of opposing flat sectors formed on the exterior of a stem extending form the upper end of control rod. The stem also has an externally-threaded portion engaging a nut and a pilot aligning portion for the nut. The nut has a radially flexible and expandable thread-defining element captured in its bore. The segments and sectors allow the rod to be removed and reattached after turning through 180 0 to allow more even wear on the rod. (author)

  7. Nuclear fuel rods

    International Nuclear Information System (INIS)

    Wada, Toyoji.

    1979-01-01

    Purpose: To remove failures caused from combination of fuel-cladding interactions, hydrogen absorptions, stress corrosions or the likes by setting the quantity ratio of uranium or uranium and plutonium relative to oxygen to a specific range in fuel pellets and forming a specific size of a through hole at the center of the pellets. Constitution: In a fuel rods of a structure wherein fuel pellets prepared by compacting and sintering uranium dioxide, or oxide mixture consisting of oxides of plutonium and uranium are sealed with a zirconium metal can, the ratio of uranium or uranium and plutonium to oxygen is specified as 1 : 2.01 - 1 : 2.05 in the can and a passing hole of a size in the range of 15 - 30% of the outer diameter of the fuel pellet is formed at the center of the pellet. This increases the oxygen partial pressure in the fuel rod, oxidizes and forms a protection layer on the inner surface of the can to control the hydrogen absorption and stress corrosion. Locallized stress due to fuel cladding interaction (PCMI) can also be moderated. (Horiuchi, T.)

  8. Study of cognitive sphere in children and adolescents with congenital myopathy (theoretical review

    Directory of Open Access Journals (Sweden)

    V. A. Erokhina

    2013-08-01

    Full Text Available This paper presents an analysis of current approaches to the study of states of higher mental functions in children and adolescents suffering from various forms of hereditary myopathies. The aim of this work is to study the theoretical rationale and the possibility of specific disorders of mental function in children and adolescents with congenital myopathies. To achieve this objective during the study it was necessary to solve the following problems: give a description of the various groups and forms of congenital myopathies, their clinical characteristics; justify the possibility of considering the hereditary myopathies as a factor in the formation of changes in visual-spatial activities and thinking; evaluate the possibility to use complex neuropsychological psycho-diagnostic techniques for investigating the state of the higher mental functions of children with congenital myopathies. The possibility of neuropsychological correction for this category of patients is discussed also.

  9. Fuel rod simulator effects in flooding experiments single rod tests

    International Nuclear Information System (INIS)

    Nishida, M.

    1984-09-01

    The influence of a gas filled gap between cladding and pellet on the quenching behavior of a PWR fuel rod during the reflood phase of a LOCA has been investigated. Flooding experiments were conducted with a short length electrically heated single fuel rod simulator surrounded by glass housing. The gap of 0.05 mm width between the Zircaloy cladding and the internal Al 2 O 3 pellets of the rod was filled either wit helium or with argon to vary the radial heat resistance across the gap. This report presents some typical data and an evaluation of the reflood behavior of the fuel rod simulator used. The results show that the quench front propagates faster for increasing heat resistance in the gap between cladding and heat source of the rod. (orig.) [de

  10. Muscle structural changes in mitochondrial myopathy relate to genotype

    DEFF Research Database (Denmark)

    Olsen, David B.; Langkilde, Annika Reynberg; Ørngreen, Mette C.

    2003-01-01

    It is well known that morphological changes at the cellular level occur in muscle of patients with mitochondrial myopathy (MM), but changes in muscle structure with fat infiltration and gross variation of muscle fiber size with giant fibers, normally encountered in the muscular dystrophies, have...... typically not been associated with mitochondrial disease. We investigated gross and microscopic muscle morphology in thigh muscles by muscle biopsy and MRI in 16 patients with MM, and compared findings with those obtained in muscular dystrophy patients and healthy subjects. Changes of muscle architecture...

  11. Digital control rod blocking monitor

    International Nuclear Information System (INIS)

    Funayama, Yoshio.

    1996-01-01

    The present invention system is used for monitoring of a power region of a reactor, and used for monitoring of simultaneous withdrawal of a plurality of control rods without increasing the size or complicating the system. Namely, the system processes signals from a neutron flux detectors at the periphery of control rods controlled for withdrawal. As a result of the processing, the digital monitoring system generates an alarm when the reactor power at the periphery of the control rods fluctuates exceeding an allowable range. In the system, a control rod information forming means prepares frame data comprising front data, positions of the control rods to be withdrawn, frame numbers and completion data. A serial data transmitting means transmits the frame data successively as repeating frame data rows. A control rod information receiving means takes up the frame data of each of control rods to be withdrawn from the transmitted frame data rows. Since the system of the present invention can monitor the withdrawal of a plurality of control rods simultaneously without increasing the size or complicating the system, cost can be saved and the maintenance can be improved. (I.S.)

  12. Cuisenaire Rods Go to College.

    Science.gov (United States)

    Chinn, Phyllis; And Others

    1992-01-01

    Presents examples of questions and answers arising from a hands-on and exploratory approach to discrete mathematics using cuisenaire rods. Combinatorial questions about trains formed of cuisenaire rods provide the setting for discovering numerical patterns by experimentation and organizing the results using induction and successive differences.…

  13. Control rod experiments in Racine

    International Nuclear Information System (INIS)

    Stanculescu, A.; Humbert, G.

    1981-09-01

    A survey of the control-rod experiments planned within the joint CEA/CNEN-DeBeNe critical experiment RACINE is given. The applicability to both heterogeneous and homogeneous large power LMFBR-cores is discussed. Finally, the most significant results of the provisional design calculations performed on behalf of the RACINE control-rod programme are presented

  14. Control rod drives

    International Nuclear Information System (INIS)

    Furumitsu, Yutaka.

    1981-01-01

    Purpose: To improve the reliability of a device for driving an LMFBR type reactor control rod by providing a buffer unit having a stationary electromagnetic coil and a movable electromagnetic coil in the device to thereby avord impact stress at scram time and to simplify the structure of the buffer unit. Constitution: A non-contact type buffer unit is constructed with a stationary electromagnetic coil, a cable for the stationary coil, a movable electromagnetic coil, a spring cable for the movable coil, and a backup coil spring or the like. Force produced at scram time is delivered without impact by the attracting or repelling force between the stationary coil and the movable coil of the buffer unit. Accordingly, since the buffer unit is of a non-contact type, there is no mechanical impact and thus no large impact stress, and as it has simple configuration, the reliability is improved and the maintenance can be conducted more easily. (Yoshihara, H.)

  15. [Insight into the training of patients with idiopathic inflammatory myopathy].

    Science.gov (United States)

    Váncsa, Andrea

    2016-09-01

    Using current recommended treatment, a majority of patients with idiopathic inflammatory myopathy develop muscle impairment and poor health. Beneficial effects of exercise have been reported on muscle performance, aerobic capacity and health in chronic polymyositis and dermatomyositis, as well as in active disease and inclusion body myositis to some extent. Importantly, randomized controlled trials indicate that improved health and decreased clinical disease activity could be mediated through increased aerobic capacity. Recently, reports seeking pathomechanisms of the underlying effects of exercise on skeletal muscle indicate increased aerobic capacity (i.e. increased mitochondrial capacity and capillary density, reduced lactate levels), activation of genes of aerobic phenotype and muscle growth programs and down regulation of genes related to inflammation. Exercise contributes to both systemic and within-muscle adaptations demonstrating that it is fundamental for improving muscle performance and health in patients with idiopathic inflammatory myopathy. There is a need for randomized controlled trials to study the effects of exercise in patients with active disease and inclusion body myositis. Orv. Hetil., 2016, 157(39), 1557-1562.

  16. Statin-associated myopathy: from genetic predisposition to clinical management.

    Science.gov (United States)

    Vrablik, M; Zlatohlavek, L; Stulc, T; Adamkova, V; Prusikova, M; Schwarzova, L; Hubacek, J A; Ceska, R

    2014-01-01

    Statin-associated myopathy (SAM) represents a broad spectrum of disorders from insignificant myalgia to fatal rhabdomyolysis. Its frequency ranges from 1-5 % in clinical trials to 15-20 % in everyday clinical practice. To a large extent, these variations can be explained by the definition used. Thus, we propose a scoring system to classify statin-induced myopathy according to clinical and biochemical criteria as 1) possible, 2) probable or 3) definite. The etiology of this disorder remains poorly understood. Most probably, an underlying genetic cause is necessary for overt SAM to develop. Variants in a few gene groups that encode proteins involved in: i) statin metabolism and distribution (e.g. membrane transporters and enzymes; OATP1B1, ABCA1, MRP, CYP3A4), ii) coenzyme Q10 production (e.g. COQ10A and B), iii) energy metabolism of muscle tissue (e.g. PYGM, GAA, CPT2) and several others have been proposed as candidates which can predispose to SAM. Pharmacological properties of individual statin molecules (e.g. lipophilicity, excretion pathways) and patients´ characteristics influence the likelihood of SAM development. This review summarizes current data as well as our own results.

  17. Skeletal muscle repair in a mouse model of nemaline myopathy.

    Science.gov (United States)

    Sanoudou, Despina; Corbett, Mark A; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T; Vlahovich, Nicole; Hardeman, Edna C; Beggs, Alan H

    2006-09-01

    Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five different skeletal muscles from affected mice, which are representative of muscles with differing fiber-type compositions, different physiological specializations and variable degrees of pathology. Although these same muscles in non-affected mice showed marked variation in patterns of gene expression, with diaphragm being the most dissimilar, the presence of the mutant protein in nemaline muscles resulted in a more similar pattern of gene expression among the muscles. This result suggests a common process or mechanism operating in nemaline muscles independent of the variable degrees of pathology. Transcriptional and protein expression data indicate the presence of a repair process and possibly delayed maturation in nemaline muscles. Markers indicative of satellite cell number, activated satellite cells and immature fibers including M-Cadherin, MyoD, desmin, Pax7 and Myf6 were elevated by western-blot analysis or immunohistochemistry. Evidence suggesting elevated focal repair was observed in nemaline muscle in electron micrographs. This analysis reveals that NM is characterized by a novel repair feature operating in multiple different muscles.

  18. Statin-associated immune-mediated myopathy: biology and clinical implications.

    Science.gov (United States)

    Christopher-Stine, Lisa; Basharat, Pari

    2017-04-01

    In the last 6 years, our understanding of statin-associated myopathy expanded to include not only a toxic myopathy with limited and reversible side-effects but also an autoimmune variety in which statins likely induce an autoimmune myopathy that is both associated with a specific autoantibody and responsive to immunosuppression and immune modulation. This review widens the reader's understanding of statin myopathy to include an autoimmune process. Statin-associated immune-mediated myopathy provides an example of an environmental trigger (statins) directly implicated in an autoimmune disease associated with a genetic predisposition as well as potential risk factors including concomitant diseases and specific statins. Given a median exposure to statins of 38 months, providers should be aware that anti-3-hydroxy-3-methyl-glutaryl-coenzyme A reductase (HMGCR) myopathy may occur even after several years of statin exposure. It is important for the reader to understand the clinical presentation of statin-associated immune-mediated myopathy and the difference in its clinical presentation to that of statins as direct myotoxins. Prompt recognition of such an entity allows the clinician to immediately stop the offending agent if it has not already been discontinued as well as to recognize that statin rechallenge is not a likely option, and that prompt treatment with immunosuppression and/or immunomodulation is usually of enormous benefit to the patient in restoring muscle strength and physical function. VIDEO ABSTRACT.

  19. Myopathy With SQSTM1 and TIA1 Variants: Clinical and Pathological Features

    Directory of Open Access Journals (Sweden)

    Zhiyv Niu

    2018-03-01

    Full Text Available ObjectiveThe aim of this study is to identify the molecular defect of three unrelated individuals with late-onset predominant distal myopathy; to describe the spectrum of phenotype resulting from the contributing role of two variants in genes located on two different chromosomes; and to highlight the underappreciated complex forms of genetic myopathies.Patients and methodsClinical and laboratory data of three unrelated probands with predominantly distal weakness manifesting in the sixth-seventh decade of life, and available affected and unaffected family members were reviewed. Next-generation sequencing panel, whole exome sequencing, and targeted analyses of family members were performed to elucidate the genetic etiology of the myopathy.ResultsGenetic analyses detected two contributing variants located on different chromosomes in three unrelated probands: a heterozygous pathogenic mutation in SQSTM1 (c.1175C>T, p.Pro392Leu and a heterozygous variant in TIA1 (c.1070A>G, p.Asn357Ser. The affected fraternal twin of one proband also carries both variants, while the unaffected family members harbor one or none. Two unrelated probands (family 1, II.3, and family 3, II.1 have a distal myopathy with rimmed vacuoles that manifested with index extensor weakness; the other proband (family 2, I.1 has myofibrillar myopathy manifesting with hypercapnic respiratory insufficiency and distal weakness.ConclusionThe findings indicate that all the affected individuals have a myopathy associated with both variants in SQSTM1 and TIA1, respectively, suggesting that the two variants determine the phenotype and likely functionally interact. We speculate that the TIA1 variant is a modifier of the SQSTM1 mutation. We identify the combination of SQSTM1 and TIA1 variants as a novel genetic defect associated with myofibrillar myopathy and suggest to consider sequencing both genes in the molecular investigation of myopathy with rimmed vacuoles and myofibrillar myopathy

  20. Myopathy With SQSTM1 and TIA1 Variants: Clinical and Pathological Features.

    Science.gov (United States)

    Niu, Zhiyv; Pontifex, Carly Sabine; Berini, Sarah; Hamilton, Leslie E; Naddaf, Elie; Wieben, Eric; Aleff, Ross A; Martens, Kristina; Gruber, Angela; Engel, Andrew G; Pfeffer, Gerald; Milone, Margherita

    2018-01-01

    The aim of this study is to identify the molecular defect of three unrelated individuals with late-onset predominant distal myopathy; to describe the spectrum of phenotype resulting from the contributing role of two variants in genes located on two different chromosomes; and to highlight the underappreciated complex forms of genetic myopathies. Clinical and laboratory data of three unrelated probands with predominantly distal weakness manifesting in the sixth-seventh decade of life, and available affected and unaffected family members were reviewed. Next-generation sequencing panel, whole exome sequencing, and targeted analyses of family members were performed to elucidate the genetic etiology of the myopathy. Genetic analyses detected two contributing variants located on different chromosomes in three unrelated probands: a heterozygous pathogenic mutation in SQSTM1 (c.1175C>T, p.Pro392Leu) and a heterozygous variant in TIA1 (c.1070A>G, p.Asn357Ser). The affected fraternal twin of one proband also carries both variants, while the unaffected family members harbor one or none. Two unrelated probands (family 1, II.3, and family 3, II.1) have a distal myopathy with rimmed vacuoles that manifested with index extensor weakness; the other proband (family 2, I.1) has myofibrillar myopathy manifesting with hypercapnic respiratory insufficiency and distal weakness. The findings indicate that all the affected individuals have a myopathy associated with both variants in SQSTM1 and TIA1 , respectively, suggesting that the two variants determine the phenotype and likely functionally interact. We speculate that the TIA1 variant is a modifier of the SQSTM1 mutation. We identify the combination of SQSTM1 and TIA1 variants as a novel genetic defect associated with myofibrillar myopathy and suggest to consider sequencing both genes in the molecular investigation of myopathy with rimmed vacuoles and myofibrillar myopathy although additional studies are needed to investigate the

  1. Control rod position detection device

    International Nuclear Information System (INIS)

    Akita, Haruo; Ogiwara, Sakae.

    1996-01-01

    The device of the present invention is used in a back-up shut down system of an LMFBR type reactor which is easy for maintenance, has high reliability and can recognize the position of control rods accurately. Namely, a permanent magnet is disposed to a control rod extension tube connected to the lower portion of the control rod. The detector guide tube is disposed in the vicinity of the control rod extension tube. A detector having a detection coil is inserted into a detector tube. With such constitution, the control rod can be detected at one position using the following method. (1) the movement of the magnetic field of the permanent magnet is detected by the detection coil. (2) a plurality of grooves are formed on the control rod extension tube, and the movement of the grooves is detected. In addition, the detection coil is inserted into the detector guide tube, and the signals from the detection coil are inputted to a signal processing circuit disposed at the outside of the reactor vessel using an MI cable to enable the maintenance of the detector. Further, if the detector comprises a detection coil and an excitation coil, the position of a dropped control rod can be recognized at a plurality of points. (I.S.)

  2. Control rod position control device

    International Nuclear Information System (INIS)

    Ubukata, Shinji.

    1997-01-01

    The present invention provides a control rod position control device which stores data such as of position signals and driving control rod instruction before and after occurrence of abnormality in control for the control rod position for controlling reactor power and utilized the data effectively for investigating the cause of abnormality. Namely, a plurality of individual control devices have an operation mismatching detection circuit for outputting signals when difference is caused between a driving instruction given to the control rod position control device and the control rod driving means and signals from a detection means for detecting an actual moving amount. A general control device collectively controls the individual control devices. In addition, there is also disposed a position storing circuit for storing position signals at least before and after the occurrence of the control rod operation mismatching. With such procedures, the cause of the abnormality can be determined based on the position signals before and after the occurrence of control rod mismatching operation stored in the position storing circuit. Accordingly, the abnormality cause can be determined to conduct restoration in an early stage. (I.S.)

  3. Status of rod consolidation, 1988

    International Nuclear Information System (INIS)

    Bailey, W.J.

    1989-01-01

    It is estimated that the spent fuel storage pools at some domestic light-water reactors will run out of space before 2003, the year that the US Department of Energy currently predicts it will have a repository available. Of the methods being studied to alleviate the problem, rod consolidation is one of the leading candidates for achieving more efficient use of existing space in spent fuel storage pools. Rod consolidation involves mechanically removing all the fuel rods from the fuel assembly hardware (i.e., the structural components) and placing the fuel rods in a close-packed array in a canister without space grids. A typical goal of rod consolidation systems is to insert the fuel rods from two fuel assemblies into a canister that has the same exterior dimensions as one standard fuel assembly (i.e., to achieve a consolidation or compaction ratio of 2:1) and to compact the nonfuel-bearing structural components from those two fuel assemblies by a factor of 10 to 20. This report provides an overview of the current status of rod consolidation in the United States and a small amount of information on related activities in other countries. 85 refs., 36 figs., 5 tabs

  4. Inspecting method for fuel rods

    International Nuclear Information System (INIS)

    Watanabe, Masaaki; Kogure, Sumio.

    1976-01-01

    Purpose: To precisely detect the response of flaw in clad tube and submerged fuel pellets from a relationship between the surface of fuel rod and internal signal. Constitution: Ultrasonic reflected waves from the surface of fuel rods and the interior are detected and either one of fuel rod or ultrasonic flaw detecting contact is rotated to thereby precisely detect the response of the flaw of clad tube and submerged fuel pellets from a relationship between said surface and the interior. It will be noted that the ultrasonic flaw detecting contact used is of the line-focus type, the incident angle of ultrasonic wave from the ultrasonic flaw detecting contact relative to the fuel rod is the angle of skew, that is, the ultrasonic flaw detecting contact is not perpendicular to a center axis of the fuel rod but is slightly displace. That is, the use of the aforesaid contact may facilitate discrimination between the surface flaw of the fuel rod and the response of submergence, and in addition, the employment of the aforesaid incident angle makes it hard to receive reflected waves from the surface of the fuel rod which is great in terms of energy to facilitate discrimination of waves responsive to submergence. (Kawakami, Y.)

  5. Fibrous Myopathy as a Complication of Repeated Intramuscular Injections for Chronic Headache

    Directory of Open Access Journals (Sweden)

    R Burnham

    2006-01-01

    Full Text Available Two cases of fibrous myopathy associated with repeated, long-term intramuscular injections for treatment of chronic temporomandibular joint pain and chronic headache, respectively, are described. Both patients developed severe, function-limiting contractures in upper and lower extremity muscles used as injection sites. In one of the cases, the contractures were painful. Electrophysiological testing, magnetic resonance imaging and muscle biopsy results were all consistent with myopathy and replacement of skeletal muscle with noncontractile fibrous tissue. These cases are presented to increase awareness of fibrous myopathy and to promote surveillance for this serious potential complication of long-term intramuscular injections in chronic headache and other pain patients.

  6. Spacers for fuel rod clusters

    International Nuclear Information System (INIS)

    Jabsen, F.S.

    1978-01-01

    The proposition deals with the fixing of nuclear fuel element rods in a grid which consists of a number of crossed Zy-plates which form cells. The rectangular cells have projections which serve as spacers for the fuel rods. According to the invention there are additional butt straps which can be moved in such a way that insertion and extraction of the fuel rods can be done without obstruction and they can be spring-loaded hold in their final position. (UWI) [de

  7. Nuclear reactor control rod

    International Nuclear Information System (INIS)

    Cearley, J.E.; Izzo, K.R.

    1987-01-01

    This patent describes a vertically oriented bottom entry control rod from a nuclear reactor: a frame including an elongated central spine of cruciform cross section connected between an upper support member and a lower support member both of cruciform shape having four laterally extending arms. The arms are in alignment with the arms of the lower support member and each aligned upper and lower support members has a sheath extending between; absorber plates of neutron absorber material, different from the material of the frame, one of the absorber plates is positioned within a sheath beneath each of the arms; attachment means suspends the absorber plates from the arms of the upper support member within a sheath; elongated absorber members positioned within a sheath between each of the suspended absorber plates and an arm of the lower support member; and joint means between the upper ends of the absorber members and the lower ends of the suspended absorber plates for minimizing gaps; the sheath means encloses the suspended absorber plates and the absorber members extending between aligned arms of the upper and lower support members and secured

  8. Control rod drive

    International Nuclear Information System (INIS)

    Kojima, Akira.

    1989-01-01

    In the control rod drive for a BWR type reactor, etc., according to this invention, the lower limit flow rate is set so as to keep the restriction for stability upon spectral shift operation. The setting condition for keeping the restriction is the lowest pump speed and the lower limit for the automatic control of the flow rate, which are considered to be important in view of the stablility from the actual power state. In view of the above, it is possible to keep the reactor core stably even in a case where such a transient phenomenon occurs that the recycling flow rate has to be run back to the lowest pump speed during spectral shift opeeration or in a case where the load demand is reduced and the flow rate is decreased by an automatic mode as in night operation. Accordingly, in the case of conducting the spectral shift operation according to this invention, the operation region capable of keeping the reactor core state stably during operation can be extended. (I.S.)

  9. Control rod drive

    International Nuclear Information System (INIS)

    Watando, Kosaku; Tanaka, Yuzo; Mizumura, Yasuhiro; Hosono, Kazuya.

    1975-01-01

    Object: To provide a simple and compact construction of an apparatus for driving a drive shaft inside with a magnetic force from the outside of the primary system water side. Structure: The weight of a plunger provided with an attraction plate is supported by a plunger lift spring means so as to provide a buffer action at the time of momentary movement while also permitting the load on lift coil to be constituted solely by the load on the drive shaft. In addition, by arranging the attraction plate and lift coil so that they face each other with a small gap there-between, it is made possible to reduce the size and permit efficient utilization of the attracting force. Because of the small size, cooling can be simply carried out. Further, since there is no mechanical penetration portion, there is no possibility of leakage of the primary system water. Furthermore, concentration of load on a latch pin is prevented by arranging so that with a structure the load of the control rod to be directly beared through the scrum latch. (Kamimura, M.)

  10. The myositis autoantibody phenotypes of the juvenile idiopathic inflammatory myopathies.

    Science.gov (United States)

    Rider, Lisa G; Shah, Mona; Mamyrova, Gulnara; Huber, Adam M; Rice, Madeline Murguia; Targoff, Ira N; Miller, Frederick W

    2013-07-01

    The juvenile idiopathic inflammatory myopathies (JIIM) are systemic autoimmune diseases characterized by skeletal muscle weakness, characteristic rashes, and other systemic features. In follow-up to our study defining the major clinical subgroup phenotypes of JIIM, we compared demographics, clinical features, laboratory measures, and outcomes among myositis-specific autoantibody (MSA) subgroups, as well as with published data on adult idiopathic inflammatory myopathy patients enrolled in a separate natural history study. In the present study, of 430 patients enrolled in a nationwide registry study who had serum tested for myositis autoantibodies, 374 had either a single specific MSA (n = 253) or no identified MSA (n = 121) and were the subject of the present report. Following univariate analysis, we used random forest classification and exact logistic regression modeling to compare autoantibody subgroups. Anti-p155/140 autoantibodies were the most frequent subgroup, present in 32% of patients with juvenile dermatomyositis (JDM) or overlap myositis with JDM, followed by anti-MJ autoantibodies, which were seen in 20% of JIIM patients, primarily in JDM. Other MSAs, including anti-synthetase, anti-signal recognition particle (SRP), and anti-Mi-2, were present in only 10% of JIIM patients. Features that characterized the anti-p155/140 autoantibody subgroup included Gottron papules, malar rash, "shawl-sign" rash, photosensitivity, cuticular overgrowth, lowest creatine kinase (CK) levels, and a predominantly chronic illness course. The features that differed for patients with anti-MJ antibodies included muscle cramps, dysphonia, intermediate CK levels, a high frequency of hospitalization, and a monocyclic disease course. Patients with anti-synthetase antibodies had higher frequencies of interstitial lung disease, arthralgia, and "mechanic's hands," and had an older age at diagnosis. The anti-SRP group, which had exclusively juvenile polymyositis, was characterized by high

  11. Means for driving control rod

    International Nuclear Information System (INIS)

    Sato, Haruo; Sasaki, Masayoshi.

    1974-01-01

    Object: To enable wire rope to be readily removed from guide pulleys for the inspection or replacement of control rods. Structure: A pair of guide pulleys disposed to oppose each other are provided on their periphery with respective notches which are arranged in a staggered fashion. In this way, the rope is made to be removed from the notches for inspection of the control rod or for other purposes. (Kamimura, M.)

  12. Segmented fuel and moderator rod

    International Nuclear Information System (INIS)

    Doshi, P.K.

    1987-01-01

    This patent describes a continuous segmented fuel and moderator rod for use with a water cooled and moderated nuclear fuel assembly. The rod comprises: a lower fuel region containing a column of nuclear fuel; a moderator region, disposed axially above the fuel region. The moderator region has means for admitting and passing the water moderator therethrough for moderating an upper portion of the nuclear fuel assembly. The moderator region is separated from the fuel region by a water tight separator

  13. Oculopharyngeal Weakness, Hypophrenia, Deafness, and Impaired Vision: A Novel Autosomal Dominant Myopathy with Rimmed Vacuoles

    Directory of Open Access Journals (Sweden)

    Ting Chen

    2016-01-01

    Conclusions: We reported a novel autosomal dominant myopathy with rimmed vacuoles characterized by dysarthria, dysphagia, external ophthalmoplegia, limb weakness, hypophrenia, deafness, and impaired vision, but the causative gene has not been found and needs further study.

  14. Nuclear actin aggregation is a hallmark of anti-synthetase syndrome-induced dysimmune myopathy

    NARCIS (Netherlands)

    Stenzel, Werner; Preuße, Corinna; Allenbach, Yves; Pehl, Debora; Junckerstorff, Reimar; Heppner, Frank L.; Nolte, Kay; Aronica, Eleonora; Kana, Veronika; Rushing, Elisabeth; Schneider, Udo; Claeys, Kristl G.; Benveniste, Olivier; Weis, Joachim; Goebel, Hans H.

    2015-01-01

    To analyze antisynthetase syndrome-associated myositis by modern myopathologic methods and to define its place in the spectrum of idiopathic inflammatory myopathies (IIMs). Skeletal muscle biopsies from antisynthetase syndrome-associated myositis and other IIMs from different institutions worldwide

  15. Fulminant lipid storage myopathy due to multiple acyl-coenzyme a dehydrogenase deficiency.

    Science.gov (United States)

    Whitaker, Charles H; Felice, Kevin J; Silvers, David; Wu, Qian

    2015-08-01

    The lipid storage myopathies, primary carnitine deficiency, neutral lipid storage disease, and multiple acyl coenzyme A dehydrogenase deficiency (MADD), are progressive disorders that cause permanent weakness. These disorders of fatty acid metabolism and intracellular triglyceride degradation cause marked fat deposition and damage to muscle cells. We describe a rapidly progressive myopathy in a previously healthy 33-year-old woman. Over 4 months, she developed a proximal and axial myopathy associated with diffuse myalgia and dysphagia, ultimately leading to respiratory failure and death. Muscle biopsy showed massive accumulation of lipid. Plasma acylcarnitine and urine organic acid analysis was consistent with MADD. This was confirmed by molecular genetic testing, which revealed 2 pathogenic mutations in the ETFDH gene. This report illustrates a late-onset case of MADD and reviews the differential diagnosis and evaluation of patients with proximal myopathy and excessive accumulation of lipid on muscle biopsy. © 2014 Wiley Periodicals, Inc.

  16. Diagnostic value of MHC class I staining in idiopathic inflammatory myopathies.

    NARCIS (Netherlands)

    Pas, J. van der; Hengstman, G.J.D.; Laak, H.J. ter; Borm, G.F.; Engelen, B.G.M. van

    2004-01-01

    BACKGROUND: Identification of mononuclear cellular infiltrates in skeletal muscle tissue is the histological cornerstone of the diagnosis of idiopathic inflammatory myopathy (IIM). However, these infiltrates are not always present. OBJECTIVE: To determine whether MHC class I antigen expression on

  17. Fabrication of internally instrumented reactor fuel rods

    International Nuclear Information System (INIS)

    Schmutz, J.D.; Meservey, R.H.

    1975-01-01

    Procedures are outlined for fabricating internally instrumented reactor fuel rods while maintaining the original quality assurance level of the rods. Instrumented fuel rods described contain fuel centerline thermocouples, ultrasonic thermometers, and pressure tubes for internal rod gas pressure measurements. Descriptions of the thermocouples and ultrasonic thermometers are also contained

  18. Organophosphate-induced intermediate syndrome: aetiology and relationships with myopathy.

    Science.gov (United States)

    Karalliedde, Lakshman; Baker, David; Marrs, Timothy C

    2006-01-01

    -15 days and even up to 21 days. Weaning from ventilatory care is best carried out in stages, with provision of continuous positive airway pressure prior to complete weaning. Continuous and close monitoring of respiratory function (arterial oxygen saturation, partial pressure of oxygen in arterial blood, partial pressure of carbon dioxide in arterial blood) and acid-base status are an absolute necessity. Prophylactic antibiotics are usually not required unless there has been evidence of aspiration of material into the lungs. Close monitoring of fluid and electrolyte balance is mandatory in view of the profuse offensive diarrhoea that most patients develop. Maintenance of nutrition, physiotherapy, prevention of bed sores and other routine measures to minimise discomfort during ventilatory care are necessary. Recovery from the intermediate syndrome is normally complete and without any sequelae. The usefulness of oximes during the IMS remains uncertain. In animal experiments, very early administration of oximes has prevented the occurrence of myopathy. There are reports from developed countries where administration of oximes at recommended doses and within 2 hours of ingestion of OP insecticide did not prevent the onset of the IMS. Controlled randomised clinical studies are necessary to evaluate the efficacy of oximes in combating the IMS. Electrophysiological studies following OP poisoning have revealed three characteristic phenomena: (i) repetitive firing following a single stimulus; (ii) gradual reduction in twitch height or compound muscle action potential followed by an increase with repetitive stimulation (the 'decrement-increment response'); and (iii) continued reduction in twitch height or compound muscle action potential with repetitive simulation ('decrementing response'). Of these, the decrementing response is the most frequent finding during the IMS, whilst repetitive firing is observed during the acute cholinergic syndrome. The distribution of the weakness in

  19. Acylcarnitines profile best predicts survival in horses with atypical myopathy.

    Directory of Open Access Journals (Sweden)

    François Boemer

    Full Text Available Equine atypical myopathy (AM is caused by hypoglycin A intoxication and is characterized by a high fatality rate. Predictive estimation of survival in AM horses is necessary to prevent unnecessary suffering of animals that are unlikely to survive and to focus supportive therapy on horses with a possible favourable prognosis of survival. We hypothesized that outcome may be predicted early in the course of disease based on the assumption that the acylcarnitine profile reflects the derangement of muscle energetics. We developed a statistical model to prognosticate the risk of death of diseased animals and found that estimation of outcome may be drawn from three acylcarnitines (C2, C10:2 and C18 -carnitines with a high sensitivity and specificity. The calculation of the prognosis of survival makes it possible to distinguish the horses that will survive from those that will die despite severe signs of acute rhabdomyolysis in both groups.

  20. Acylcarnitines profile best predicts survival in horses with atypical myopathy

    Science.gov (United States)

    Detilleux, Johann; Cello, Christophe; Amory, Hélène; Marcillaud-Pitel, Christel; Richard, Eric; van Galen, Gaby; van Loon, Gunther; Lefère, Laurence; Votion, Dominique-Marie

    2017-01-01

    Equine atypical myopathy (AM) is caused by hypoglycin A intoxication and is characterized by a high fatality rate. Predictive estimation of survival in AM horses is necessary to prevent unnecessary suffering of animals that are unlikely to survive and to focus supportive therapy on horses with a possible favourable prognosis of survival. We hypothesized that outcome may be predicted early in the course of disease based on the assumption that the acylcarnitine profile reflects the derangement of muscle energetics. We developed a statistical model to prognosticate the risk of death of diseased animals and found that estimation of outcome may be drawn from three acylcarnitines (C2, C10:2 and C18 -carnitines) with a high sensitivity and specificity. The calculation of the prognosis of survival makes it possible to distinguish the horses that will survive from those that will die despite severe signs of acute rhabdomyolysis in both groups. PMID:28846683

  1. Restrictive extraocular myopathy: A presenting feature of acromegaly

    Directory of Open Access Journals (Sweden)

    Steven Heireman

    2011-01-01

    Full Text Available A 45-year-old man presented with binocular diplopia in primary gaze for 1 year. Orthoptic evaluation showed 10-prism diopter right eye hypotropia and 6-prism diopter right eye esotropia. The elevation and abduction of the right eye were mechanically restricted. This was associated with systemic features suggestive of acromegaly. Magnetic resonance imaging (MRI of the brain demonstrated a pituitary macroadenoma. An elevated serum insulin-like growth factor I level and the failure of growth hormone suppression after an oral glucose load biochemically confirmed the diagnosis of acromegaly. Computed tomography (CT of the orbit demonstrated bilateral symmetrical enlargement of the medial rectus and inferior rectus muscle bellies. All tests regarding Graves-Basedow disease were negative. Although rare, diplopia due to a restrictive extraocular myopathy could be the presenting symptom of acromegaly.

  2. A case of congenital myopathy masquerading as paroxysmal dyskinesia

    Directory of Open Access Journals (Sweden)

    Harsh Patel

    2014-01-01

    Full Text Available Gastroesophageal reflux (GER disease is a significant comorbidity of neuromuscular disorders. It may present as paroxysmal dyskinesia, an entity known as Sandifer syndrome. A 6-week-old neonate presented with very frequent paroxysms of generalized stiffening and opisthotonic posture since day 22 of life. These were initially diagnosed as seizures and he was started on multiple antiepileptics which did not show any response. After a normal video electroencephalogram (VEEG was documented, possibility of dyskinesia was kept. However, when he did not respond to symptomatic therapy, Sandifer syndrome was thought of and GER scan was done, which revealed severe GER. After his symptoms got reduced to some extent, a detailed clinical examination revealed abnormal facies with flaccid quadriparesis. Muscle biopsy confirmed the diagnosis of a specific congenital myopathy. On antireflux measures, those episodic paroxysms reduced to some extent. Partial response to therapy in GER should prompt search for an underlying secondary etiology.

  3. The BWR Hybrid 4 control rod

    International Nuclear Information System (INIS)

    Gross, H.; Fuchs, H.P.; Lippert, H.J.; Dambietz, W.

    1988-01-01

    The service life of BWR control rods designed in the past has been unsatisfactory. The main reason was irradiation assisted stress corrosion cracking of B 4 C rods caused by external swelling of the B 4 C powder. By this reason KWU developed an improved BWR control rod (Hybrid 4 control rod) with extended service life and increased control rod worth. It also allows the procedure for replacing and rearranging fuel assemblies to be considerably simplified. A complete set of Hydbrid 4 control rods is expected to last throughout the service life of a plant (assumption: ca. 40 years) if an appropriate control rod reshuffling management program is used. (orig.)

  4. The genetic basis of pectoralis major myopathies in modern broiler chicken lines

    OpenAIRE

    Bailey, Richard A.; Watson, Kellie A.; Bilgili, S. F.; Avendano, Santiago

    2015-01-01

    This is the first report providing estimates of the genetic basis of breast muscle myopathies (BMM) and their relationship with growth and yield in broiler chickens. In addition, this paper addresses the hypothesis that genetic selection for increase breast yield has contributed to the onset of BMM. Data were analyzed from ongoing recording of BMM within the Aviagen breeding program. This study focused on three BMM: deep pectoral myopathy (DPM; binary trait), white striping (WS; 4 categories)...

  5. Hereditary vacuolar internal anal sphincter myopathy causing proctalgia fugax and constipation: a new case contribution.

    Science.gov (United States)

    de la Portilla, Fernando; Borrero, Juan José; Rafel, Enrique

    2005-03-01

    Hereditary anal sphincter myopathy is rare. We present a family with one affected member with proctalgia fugax, constipation and internal anal sphincter hypertrophy. Ultrastructural findings show vacuolization of smooth muscle cells without the characteristic polyglucosan inclusion. Further relief of symptoms was obtained using an oral calcium antagonist. Based on clinical presentation, endosonography and morphological findings, we consider our case is a histological variant of the vacuolar myopathy originally described.

  6. Statin induced myopathy presenting as mechanical musculoskeletal pain observed in two chiropractic patients

    OpenAIRE

    Rodine, Robert J; Tibbles, Anthony C; Kim, Peter SY; Alikhan, Neetan

    2010-01-01

    Lipid lowering drugs, such as statins, are commonly used to treat approximately 10 million Canadians affected by hypercholesterolemia. The most commonly experienced side-effect of statin medication is muscle pain. Statin induced myopathy consists of a spectrum of myopathic disorders ranging from mild myalgia to fatal rhabdomyolysis. The following is a presentation of 2 cases of statin induced myopathy in patients presenting in a chiropractic setting. In addition, discussion will surround the ...

  7. Dietary intervention rescues myopathy associated with neurofibromatosis type 1.

    Science.gov (United States)

    Summers, Matthew A; Rupasinghe, Thusitha; Vasiljevski, Emily R; Evesson, Frances J; Mikulec, Kathy; Peacock, Lauren; Quinlan, Kate GR; Cooper, Sandra T; Roessner, Ute; Stevenson, David A; Little, David G; Schindeler, Aaron

    2018-02-15

    Neurofibromatosis type 1 (NF1) is an autosomal dominant genetic disorder with complex symptomology. In addition to a predisposition to tumors, children with NF1 can present with reduced muscle mass, global muscle weakness, and impaired motor skills, which can have a significant impact on quality of life. Genetic mouse models have shown a lipid storage disease phenotype may underlie muscle weakness in NF1. Herein we confirm that biopsy specimens from six individuals with NF1 similarly manifest features of a lipid storage myopathy, with marked accumulation of intramyocellular lipid, fibrosis, and mononuclear cell infiltrates. Intramyocellular lipid was also correlated with reductions in neurofibromin protein expression by western analysis. An RNASeq profile of Nf1null muscle from a muscle-specific Nf1 knockout mouse (Nf1MyoD-/-) revealed alterations in genes associated with glucose regulation and cell signaling. Comparison by lipid mass spectrometry demonstrated that Nf1null muscle specimens were enriched for long chain fatty acid (LCFA) containing neutral lipids, such as cholesterol esters and triacylglycerides, suggesting fundamentally impaired LCFA metabolism. The subsequent generation of a limb-specific Nf1 knockout mouse (Nf1Prx1-/-) recapitulated all observed features of human NF1 myopathy, including lipid storage, fibrosis, and muscle weakness. Collectively, these insights led to the evaluation of a dietary intervention of reduced LCFAs, and enrichment of medium-chain fatty acids (MCFAs) with L-carnitine. Following 8-weeks of dietary treatment, Nf1Prx1-/- mice showed a 45% increase in maximal grip strength, and a 71% reduction in intramyocellular lipid staining compared with littermates fed standard chow. These data link NF1 deficiency to fundamental shifts in muscle metabolism, and provide strong proof of principal that a dietary intervention can ameliorate symptoms. © The Author(s) 2017. Published by Oxford University Press. All rights reserved. For

  8. White striping and woody breast myopathies in the modern poultry industry: a review.

    Science.gov (United States)

    Kuttappan, V A; Hargis, B M; Owens, C M

    2016-11-01

    Myopathies are gaining the attention of poultry meat producers globally. White Striping (WS) is a condition characterized by the occurrence of white striations parallel to muscle fibers on breast, thigh, and tender muscles of broilers, while Woody Breast (WB) imparts tougher consistency to raw breast fillets. Histologically, both conditions have been characterized with myodegeneration and necrosis, fibrosis, lipidosis, and regenerative changes. The occurrence of these modern myopathies has been associated with increased growth rate in birds. The severity of the myopathies can adversely affect consumer acceptance of raw cut up parts and/or quality of further processed poultry meat products, resulting in huge economic loss to the industry. Even though gross and/or histologic characteristics of modern myopathies are similar to some of the known conditions, such as hereditary muscular dystrophy, nutritional myopathy, toxic myopathies, and marbling, WS and WB could have a different etiology. As a result, there is a need for future studies to identify markers for WS and WB in live birds and genetic, nutritional, and/or management strategies to alleviate the condition. © 2016 Poultry Science Association Inc.

  9. Whole-body muscle MRI to detect myopathies in non-extrapyramidal bent spine syndrome

    International Nuclear Information System (INIS)

    Ohana, Mickael; Durand, Marie-Christine; Marty, Catherine; Lazareth, Jean-Philippe; Maisonobe, Thierry; Mompoint, Dominique; Carlier, Robert-Yves

    2014-01-01

    Bent spine syndrome (BSS), defined as an abnormal forward flexion of the trunk resolving in supine position, is usually related to parkinsonism, but can also be encountered in myopathies. This study evaluates whole-body muscle MRI (WB-mMRI) as a tool for detecting underlying myopathy in non-extrapyramidal BSS. Forty-three patients (90 % women; 53-86 years old) with a non-extrapyramidal BSS were prospectively included. All underwent a 1.5-T WB-mMRI and a nerve conduction study. Muscle biopsy was performed if a myopathy could not be eliminated based on clinical examination and all tests. Systematic MRI interpretation focused on peripheral and axial muscle injury; spinal posture and incidental findings were also reported. WB-mMRI was completed for all patients, with 13 muscle biopsies ultimately needed and myopathy revealed as the final etiological diagnosis in five cases (12 %). All biopsy-proven myopathies were detected by the WB-mMRI. Relevant incidental MRI findings were made in seven patients. This study supports WB-mMRI as a sensitive and feasible tool for detecting myopathy in BSS patients. Associated with electroneuromyography, it can better indicate when a muscle biopsy is needed and guide it when required. Rigorous radiological interpretation is mandatory, so as not to miss incidental findings of clinical consequence. (orig.)

  10. Whole-body muscle MRI to detect myopathies in non-extrapyramidal bent spine syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Ohana, Mickael [Nouvel Hopital Civil - Hopitaux Universitaires de Strasbourg, Service de Radiologie B, Strasbourg (France); Durand, Marie-Christine [AP-HP - Hopital Raymond Poincare, Service de Neurologie, Garches (France); Marty, Catherine; Lazareth, Jean-Philippe [AP-HP - Hopital Raymond Poincare, Service de Rhumatologie, Garches (France); Maisonobe, Thierry [APH-HP - Hopital de la Pitie-Salpetriere, Service de Neuropathologie, Paris (France); Mompoint, Dominique; Carlier, Robert-Yves [AP-HP - Hopital Raymond Poincare, Service de Radiologie, Garches (France)

    2014-08-15

    Bent spine syndrome (BSS), defined as an abnormal forward flexion of the trunk resolving in supine position, is usually related to parkinsonism, but can also be encountered in myopathies. This study evaluates whole-body muscle MRI (WB-mMRI) as a tool for detecting underlying myopathy in non-extrapyramidal BSS. Forty-three patients (90 % women; 53-86 years old) with a non-extrapyramidal BSS were prospectively included. All underwent a 1.5-T WB-mMRI and a nerve conduction study. Muscle biopsy was performed if a myopathy could not be eliminated based on clinical examination and all tests. Systematic MRI interpretation focused on peripheral and axial muscle injury; spinal posture and incidental findings were also reported. WB-mMRI was completed for all patients, with 13 muscle biopsies ultimately needed and myopathy revealed as the final etiological diagnosis in five cases (12 %). All biopsy-proven myopathies were detected by the WB-mMRI. Relevant incidental MRI findings were made in seven patients. This study supports WB-mMRI as a sensitive and feasible tool for detecting myopathy in BSS patients. Associated with electroneuromyography, it can better indicate when a muscle biopsy is needed and guide it when required. Rigorous radiological interpretation is mandatory, so as not to miss incidental findings of clinical consequence. (orig.)

  11. Mutation Spectrum of GNE Myopathy in the Indian Sub-Continent.

    Science.gov (United States)

    Bhattacharya, Sudha; Khadilkar, Satish V; Nalini, Atchayaram; Ganapathy, Aparna; Mannan, Ashraf U; Majumder, Partha P; Bhattacharya, Alok

    GNE myopathy is an adult onset recessive genetic disorder that affects distal muscles sparing the quadriceps. GNE gene mutations have been identified in GNE myopathy patients all over the world. Homozygosity is a common feature in GNE myopathy patients worldwide. The major objective of this study was to investigate the mutation spectrum of GNE myopathy in India in relation to the population diversity in the country. We have collated GNE mutation data of Indian GNE myopathy patients from published literature and from recently identified patients. We also used data of people of Indian subcontinent from 1000 genomes database, South Asian Genome database and Strand Life Science database to determine frequency of GNE mutations in the general population. A total of 67 GNE myopathy patients were studied, of whom 21% were homozygous for GNE variants, while the rest were compound heterozygous. Thirty-five different mutations in the GNE gene were recorded, of which 5 have not been reported earlier. The most frequent mutation was p.Val727Met (65%) found mainly in the heterozygous form. Another mutation, p.Ile618Thr was also common (16%) but was found mainly in patients from Rajasthan, while p.Val727Met was more widely distributed. The latter was also seen at a high frequency in general population of Indian subcontinent in all the databases. It was also present in Thailand but was absent in general population elsewhere in the world. p.Val727Met is likely to be a founder mutation of Indian subcontinent.

  12. NEUTRONIC REACTOR CONTROL ROD DRIVE APPARATUS

    Science.gov (United States)

    Oakes, L.C.; Walker, C.S.

    1959-12-15

    ABS>A suspension mechanism between a vertically movable nuclear reactor control rod and a rod extension, which also provides information for the operator or an automatic control signal, is described. A spring connects the rod extension to a drive shift. The extension of the spring indicates whether (1) the rod is at rest on the reactor, (2) the rod and extension are suspended, or (3) the extension alone is suspended, the spring controlling a 3-position electrical switch.

  13. Radioactive lightning rods waste treatment

    International Nuclear Information System (INIS)

    Vicente, Roberto; Dellamano, Jose C.; Hiromoto, Goro

    2008-01-01

    Full text: In this paper, we present alternative processes that could be adopted for the management of radioactive waste that arises from the replacement of lightning rods with attached Americium-241 sources. Lightning protectors, with Americium-241 sources attached to the air terminals, were manufactured in Brazil until 1989, when the regulatory authority overthrew the license for fabrication, commerce, and installation of radioactive lightning rods. It is estimated that, during the license period, about 75,000 such devices were set up in public, commercial and industrial buildings, including houses and schools. However, the policy of CNEN in regard to the replacement of the installed radioactive rods, has been to leave the decision to municipal governments under local building regulations, requiring only that the replaced rods be sent immediately to one of its research institutes to be treated as radioactive waste. As a consequence, the program of replacement proceeds in a low pace and until now only about twenty thousand rods have reached the waste treatment facilities The process of management that was adopted is based primarily on the assumption that the Am-241 sources will be disposed of as radioactive sealed sources, probably in a deep borehole repository. The process can be described broadly by the following steps: a) Receive and put the lightning rods in initial storage; b) Disassemble the rods and pull out the sources; c) Decontaminate and release the metal parts to metal recycling; d) Store the sources in intermediate storage; e) Package the sources in final disposal packages; and f) Send the sources for final disposal. Up to now, the disassembled devices gave rise to about 90,000 sources which are kept in storage while the design of the final disposal package is in progress. (author)

  14. Simulation of leaking fuel rods

    International Nuclear Information System (INIS)

    Hozer, Z.

    2006-01-01

    The behaviour of failed fuel rods includes several complex phenomena. The cladding failure initiates the release of fission product from the fuel and in case of large defect even urania grains can be released into the coolant. In steady state conditions an equilibrium - diffusion type - release is expected. During transients the release is driven by a convective type leaching mechanism. There are very few experimental data on leaking WWER fuel rods. For this reason the activity measurements at the nuclear power plants provide very important information. The evaluation of measured data can help in the estimation of failed fuel rod characteristics and the prediction of transient release dynamics in power plant transients. The paper deals with the simulation of leaking fuel rods under steady state and transient conditions and describes the following new results: 1) A new algorithm has been developed for the simulation of leaking fuel rods under steady state conditions and the specific parameters of the model for the Paks NPP has been determined; 2) The steady state model has been applied to calculation of leaking fuel characteristics using iodine and noble gas activity measurement data; 3) A new computational method has been developed for the simulation of leaking fuel rods under transient conditions and the specific parameters for the Paks NPP has been determined; 4) The transient model has been applied to the simulation of shutdown process at the Paks NPP and for the prediction of the time and magnitude of 123 I activity peak; 5) Using Paks NPP data a conservative value has been determined for the upper limit of the 123 I release from failed fuel rods during transients

  15. The Third ATLAS ROD Workshop

    CERN Multimedia

    Poggioli, L.

    A new-style Workshop After two successful ATLAS ROD Workshops dedicated to the ROD hardware and held at the Geneva University in 1998 and in 2000, a new style Workshop took place at LAPP in Annecy on November 14-15, 2002. This time the Workshop was fully dedicated to the ROD-TDAQ integration and software in view of the near future integration activities of the final RODs for the detector assembly and commissioning. More precisely, the aim of this workshop was to get from the sub-detectors the parameters needed for T-DAQ, as well as status and plans from ROD builders. On the other hand, what was decided and assumed had to be stated (like EB decisions and URDs), and also support plans. The Workshop gathered about 70 participants from all ATLAS sub-detectors and the T-DAQ community. The quite dense agenda allowed nevertheless for many lively discussions, and for a dinner in the old town of Annecy. The Sessions The Workshop was organized in five main sessions: Assumptions and recommendations Sub-de...

  16. Measuring device for control rod driving time

    International Nuclear Information System (INIS)

    Tanaka, Kazuhiko; Hanabusa, Masatoshi.

    1993-01-01

    The present invention concerns a measuring device for control driving time having a function capable of measuring a selected control rod driving time and measuring an entire control rod driving time simultaneously. A calculation means and a store means for the selected rod control rod driving time, and a calculation means and a store means for the entire control rod driving time are disposed individually. Each of them measures the driving time and stores the data independent of each other based on a selected control rod insert ion signal and an entire control rod insertion signal. Even if insertion of selected and entire control rods overlaps, each of the control rod driving times can be measured reliably to provide an advantageous effect capable of more accurately conducting safety evaluation for the nuclear reactor based on the result of the measurement. (N.H.)

  17. Control rod drive for vertical movement

    International Nuclear Information System (INIS)

    Suskov, I.I.; Gorjunov, V.S.; Zajcev, B.I.; Derevjankin, N.E.; Petrov, V.A.; Istomin, S.D.; Kovalencik, D.I.; Archipov, E.A.; Serebrjakov, V.I.; Kacalin, V.S.

    1982-01-01

    The control of the rod repositioning gear unit and the control unit of the profile grab of the control rod drive for the alkali metal-cooled fast breeder reactor is achieved by an electromotor being arranged outside the hermetic drive casing. The guide tube is directly repositioned by the rod repositioning gear unit. Coupling control of the drive with the control rod is done in the lower operative position of the control rod and that because of the interaction of the tie rod arranged on the spring-mounted control rod with the induction transmitter for the lower position of the control rod. In the transfer position the rod is fixed within the guide tube. (orig.)

  18. Maximum/minimum asymmetric rod detection

    International Nuclear Information System (INIS)

    Huston, J.T.

    1990-01-01

    This patent describes a system for determining the relative position of each control rod within a control rod group in a nuclear reactor. The control rod group having at least three control rods therein. It comprises: means for producing a signal representative of a position of each control rod within the control rod group in the nuclear reactor; means for establishing a signal representative of the highest position of a control rod in the control rod group in the nuclear reactor; means for establishing a signal representative of the lowest position of a control rod in the control rod group in the nuclear reactor; means for determining a difference between the signal representative of the position of the highest control rod and the signal representative of the position of the lowest control rod; means for establishing a predetermined limit for the difference between the signal representative of the position of the highest control rod and the signal representative of the position of the lowest control rod; and means for comparing the difference between the signals with the predetermined limit. The comparing means producing an output signal when the difference between the signals exceeds the predetermined limit

  19. Refabricated and instrumented fuel rods

    International Nuclear Information System (INIS)

    Silberstein, K.

    2005-01-01

    Nuclear Fuel for power reactors capabilities evaluation is strongly based on the intimate knowledge of its behaviour under irradiation. This knowledge can be acquired from refabricated and instrumented fuel rods irradiated at different levels in commercial reactors. This paper presents the development and qualification of a new technique called RECTO related to a double-instrumented rod re-fabrication process developed by CEA/LECA hot laboratory facility at CADARACHE. The technique development includes manufacturing of the properly dimensioned cavity in the fuel pellet stack to house the thermocouple and the use of a newly designed pressure transducer. An analytic irradiation of such a double-instrumented fuel rod will be performed in OSIRIS test reactor starting October 2004. (Author)

  20. Prototypical Rod Consolidation Demonstration Project

    International Nuclear Information System (INIS)

    1993-05-01

    The objective of Phase 3 of the Prototypical Rod consolidation Demonstration Project (PRCDP) was to procure, fabricate, assemble, and test the Prototypical Rod consolidation System as described in the NUS Phase 2 Final Design Report. This effort required providing the materials, components, and fabricated parts which makes up all of the system equipment. In addition, it included the assembly, installation, and setup of this equipment at the Cold Test Facility. During the Phase 3 effort the system was tested on a component, subsystem, and system level. This volume 1, discusses the PRCDP Phase 3 Test Program that was conducted by the HALLIBURTON NUS Environmental Corporation under contract AC07-86ID12651 with the United States Department of Energy. This document, Volume 1, Book 2 discusses the following topics: Fuel Rod Extraction System Test Results and Analysis Reports and Clamping Table Test Results and Analysis Reports

  1. Prototypical Rod Consolidation Demonstration Project

    International Nuclear Information System (INIS)

    1993-05-01

    The objective of Phase III of the Prototypical Rod Consolidation Demonstration Project (PRCDP) was to procure, fabricate, assemble, and test the Prototypical Rod Consolidation System as described in the NUS Phase II Final Design Report. This effort required providing the materials, components, and fabricated parts which makes up all of the system equipment. In addition, it included the assembly, installation, and setup of this equipment at the Cold Test Facility. During the Phase III effort the system was tested on a component, subsystem, and system level. Volume IV provides the Operating and Maintenance Manual for the Prototypical Rod Consolidation System that was installed at the Cold Test Facility. This document, Book 1 of Volume IV, discusses: Process overview functional descriptions; Control system descriptions; Support system descriptions; Maintenance system descriptions; and Process equipment descriptions

  2. Reactor control rod supporting structure

    International Nuclear Information System (INIS)

    Akimoto, Tokuzo; Miyata, Hiroshi.

    1984-01-01

    Purpose: To enable stable reactor core control even in extremely great vertical earthquakes, as well as under normal operation conditions in FBR type reactors. Constitution: Since a mechanism for converting the rotational movement of a control rod into vertical movement is placed at the upper portion of the reactor core at high temperature, the mechanism should cause fusion or like other danger after the elapse of a long period of time. In view of the above, the conversion mechanism is disposed to the lower portion of the reactor core at a lower temperature region. Further, the connection between the control rod and the control rod drive can be separated upon great vertical earthquakes. (Seki, T.)

  3. Advanced gray rod control assembly

    Science.gov (United States)

    Drudy, Keith J; Carlson, William R; Conner, Michael E; Goldenfield, Mark; Hone, Michael J; Long, Jr., Carroll J; Parkinson, Jerod; Pomirleanu, Radu O

    2013-09-17

    An advanced gray rod control assembly (GRCA) for a nuclear reactor. The GRCA provides controlled insertion of gray rod assemblies into the reactor, thereby controlling the rate of power produced by the reactor and providing reactivity control at full power. Each gray rod assembly includes an elongated tubular member, a primary neutron-absorber disposed within the tubular member said neutron-absorber comprising an absorber material, preferably tungsten, having a 2200 m/s neutron absorption microscopic capture cross-section of from 10 to 30 barns. An internal support tube can be positioned between the primary absorber and the tubular member as a secondary absorber to enhance neutron absorption, absorber depletion, assembly weight, and assembly heat transfer characteristics.

  4. Lifting device for drilling rods

    Energy Technology Data Exchange (ETDEWEB)

    Radzivilovich, L L; Laptev, A G; Lipkovich, V A

    1982-01-01

    A lifter is proposed for drilling rods including a spacer stand with rotating bracket, boom with by-pass rollers, spacing and lifting hydrocylinders with rods and flexible tie mechanism. In order to improve labor productivity by improving maneuverability and to increase the maintenance zone, the lifter is equipped with a hydrocylinder of advance and a cross piece which is installed with the possibility of forward and rotational movement on the stand, and in which by means of the hydrocylinder of advance a boom is attached. Within the indicated boom there is a branch of the flexible tie mechanism with end attached with the possibility of regulation over the length on a rotating bracket, while the rod of the lifting hydrocylinder is connected to the cross piece.

  5. Prototypical Rod Consolidation Demonstration Project

    International Nuclear Information System (INIS)

    1993-05-01

    The objective of Phase III of the Prototypical Rod Consolidation Demonstration Project (PRCDP) was to procure, fabricate, assemble, and test the Prototypical Rod Consolidation System as described in the NUS Phase II Final Design Report. This effort required providing the materials, components, and fabricated parts which makes up all of the system equipment. In addition, it included the assembly, installation, and setup of this equipment at the Cold Test Facility. During the Phase III effort the system was tested on a component, subsystem, and system level. Volume IV provides the Operating and Maintenance Manual for the Prototypical Rod Consolidation System that was installed at the Cold Test Facility. This document, Book 4 of Volume IV, discusses: Off-normal operating and recovery procedures; Emergency response procedures; Troubleshooting procedures; and Preventive maintenance procedures

  6. Cadmium safety rod thermal tests

    International Nuclear Information System (INIS)

    Thomas, J.K.; Iyer, N.C.; Peacock, H.B.

    1992-01-01

    Thermal testing of cadmium safety rods was conducted as part of a program to define the response of Savannah River Site (SRS) production reactor core components to a hypothetical LOCA leading to a drained reactor tank. The safety rods are present in the reactor core only during shutdown and are not used as a control mechanism during operation; thus, their response to the conditions predicted for the LOCA is only of interest to the extent that it could impact the progression of the accident. This document provides a description of this testing

  7. Control rod housing alignment apparatus

    International Nuclear Information System (INIS)

    Dixon, R.C.; Deaver, G.A.; Punches, J.R.; Singleton, G.E.; Erbes, J.G.; Offer, H.P.

    1991-01-01

    This paper discusses an alignment device for precisely locating the position of the top of a control rod drive housing from an overlying and corresponding hole and alignment pin in a core plate within a boiling water nuclear reactor. It includes a shaft, the shaft having a length sufficient to extend from the vicinity of the top of the control rod drive housing up to and through the hole in the core plate; means for registering the top of the shaft to the hole in the core plate, the registering means including means for registering with an alignment pin in the core plate adjacent the hole

  8. Control rod guide tube assemblies

    International Nuclear Information System (INIS)

    Jabsen, F.S.

    1979-01-01

    A nuclear fuel assembly including sleeves telescoped over end portions of control rod guide tubes which bear against internal shoulders of the sleeves. Upper ends of the sleeves protrude beyond a control rod guide tube spider and are locked in place by means of a resilient cellular lattice or lock that is seated in mating grooves in the outer surfaces of the sleeves. A grapple is provided for disengaging the entire lock structure spider and associated washers, springs and a grill from the end of the fuel assembly in order to enable these components to be removed and subsequently replaced on the fuel assembly after inspection and repair. (UK)

  9. Diagnostic criteria for idiopathic inflammatory myopathies. Problems of their optimization

    Directory of Open Access Journals (Sweden)

    O. A. Antelava

    2014-01-01

    Full Text Available The paper deals with the problems of optimizing the diagnostic criteria for idiopathic inflammatory myopathies (IIM, a group of heterogeneous rare autoimmune diseases characterized by inflammatory lesion in the skeletal muscles. The representatives of this group are traditionally considered to be polymyositis (PM, dermatomyositis (DM, and inclusion-body myositis. The authors detail the history of classification criteria for IIM from those proposed by T.A. Medsger et al. (1970 relying on its clinical picture, laboratory data and instrumental findings, as well as the criteria (including the first introduced exclusion ones elaborated by A. Bohan and J.B. Peter in 1975, which remain fundamental in both clinical practice and researches. The basis for the clinical and serological criteria proposed by Y. Troyanov et al. (2005 for IIM is the identification of myositis-overlap syndromes. The classificational (subtype identification and therapeutic value of the criteria based on clinical and serological characteristics was supported by the Hungarian investigators A. Vancsa et al. (2010 who investigated the relationship between the clinical and therapeutic characteristics of IIM and positivity for myositis-specific and myositis-associated antibodies. The criteria developed by M.C. Dalakas (1991, 2003 are based on the specific immunopathological features of a histological pattern, which allow the differentiation of DM, PM, and inclusion-body myositis from other myopathic syndromes. The 2004 European Neuromuscular Center (ENMC criteria first identify necrotizing autoimmune myopathy and nonspecific myositis as individual subtypes. The serological classification of IIM, which is based onthe assessment of autoantibodies that play an important role in the pathogenesis of the disease, is of indubitable interest. There is an obvious need for the correct and timely diagnosis of both IIM as a whole and its subtypes in particular, which is complicated by

  10. Flow resistance in rod assemblies

    International Nuclear Information System (INIS)

    Korsun, A.S.; Sokolova, M.S.

    2000-01-01

    The general form of relation between the resistance force and the velocity vector, resistance tensor structure and possible types of anisotropy in the flow thorough such structures as rod or tube assemblies are under discussion. Some questions of experimental determination of volumetric resistance force tensor are also under consideration. (author)

  11. Nuclear fuel rod loading apparatus

    International Nuclear Information System (INIS)

    King, H.B.

    1981-01-01

    A nuclear fuel loading apparatus, incorporating a microprocessor control unit, is described which automatically loads nuclear fuel pellets into dual fuel rods with a minimum of manual involvement and in a manner and sequence to ensure quality control and accuracy. (U.K.)

  12. Control rod driving hydraulic device

    International Nuclear Information System (INIS)

    Sugano, Hiroshi.

    1993-01-01

    In a control rod driving hydraulic device for an improved BWR type reactor, a bypass pipeline is disposed being branched from a scram pipeline, and a control orifice and a throttle valve are interposed to the bypass pipeline for restricting pressure. Upon occurrence of scram, about 1/2 of water quantity flowing from an accumulator of a hydraulic control unit to the lower surface of a piston of control rod drives by way of a scram pipeline is controlled by the restricting orifice and the throttle valve, by which the water is discharged to a pump suction pipeline or other pipelines by way of the bypass pipeline. With such procedures, a function capable of simultaneously conducting scram for two control rod drives can be attained by one hydraulic control unit. Further, an excessive peak pressure generated by a water hammer phenomenon in the scram pipeline or the control rod drives upon occurrence of scram can be reduced. Deformation and failure due to the excessive peak pressure can be prevented, as well as vibrations and degradation of performance of relevant portions can be prevented. (N.H.)

  13. Inspection system for Zircaloy clad fuel rods

    International Nuclear Information System (INIS)

    Yancey, M.E.; Porter, E.H.; Hansen, H.R.

    1975-10-01

    A description is presented of the design, development, and performance of a remote scanning system for nondestructive examination of fuel rods. Characteristics that are examined include microcracking of fuel rod cladding, fuel-cladding interaction, cladding thickness, fuel rod diameter variation, and fuel rod bowing. Microcracking of both the inner and outer fuel rod surfaces and variations in wall thickness are detected by using a pulsed eddy current technique developed by Argonne National Laboratory (ANL). Fuel rod diameter variation and fuel rod bowing are detected by using two linear variable differential transformers (LVDTs) and a signal conditioning system. The system's mechanical features include variable scanning speeds, a precision indexing system, and a servomechanism to maintain proper probe alignment. Initial results indicate that the system is a very useful mechanism for characterizing irradiated fuel rods

  14. Control rods in LMFBRs: a physics assessment

    International Nuclear Information System (INIS)

    McFarlane, H.F.; Collins, P.J.

    1982-08-01

    This physics assessment is based on roughly 300 control rod worth measurements in ZPPR from 1972 to 1981. All ZPPR assemblies simulated mixed-oxide LMFBRs, representing sizes of 350, 700, and 900 MWe. Control rod worth measurements included single rods, various combinations of rods, and Ta and Eu rods. Additional measurements studied variations in B 4 C enrichment, rod interaction effects, variations in rod geometry, neutron streaming in sodium-filled channels, and axial worth profiles. Analyses were done with design-equivalent methods, using ENDF/B Version IV data. Some computations for the sensitivities to approximations in the methods have been included. Comparisons of these analyses with the experiments have allowed the status of control rod physics in the US to be clearly defined

  15. Duke Power Company's control rod wear program

    International Nuclear Information System (INIS)

    Culp, D.C.; Kitlan, M.S. Jr.

    1990-01-01

    Recent examinations performed at several foreign and domestic pressurized water reactors have identified significant control rod cladding wear, leading to the conclusion that previously believed control rod lifetimes are not attainable. To monitor control rod performance and reduce safety concerns associated with wear, Duke Power Company has developed a comprehensive control rod wear program for Ag-In-Cd and boron carbide (B 4 C) rods at the McGuire and Catawba nuclear stations. Duke Power currently uses the Westinghouse 17 x 17 Ag-In-Cd control rod design at McGuire Unit 1 and the Westinghouse 17 x 17 hybrid B 4 C control rod design with a Ag-In-Cd tip at McGuire Unit 2 and Catawba Units 1 and 2. The designs are similar, with the exception of the absorber material and clad thickness. There are 53 control rods per unit

  16. Quantitative nailfold video capillaroscopy in patients with idiopathic inflammatory myopathy.

    Science.gov (United States)

    Mercer, Louise K; Moore, Tonia L; Chinoy, Hector; Murray, Andrea K; Vail, Andy; Cooper, Robert G; Herrick, Ariane L

    2010-09-01

    To quantify nailfold capillary density and dimensions in patients with idiopathic inflammatory myopathy (IIM) and compare them with those in healthy controls; to look for associations with microvascular disease in IIM; and to determine whether nailfold capillary density and dimensions change over time. Nailfold video microscopy (x300 magnification) was performed on 24 patients with IIM and 35 healthy controls. Capillary density and dimensions (total width and apical width) were quantified. Patients were clinically assessed and disease activity recorded using the Myositis Disease Activity Assessment Tool. Disease severity and physical function were assessed using the myositis damage index and Stanford HAQ, respectively. Findings were analysed using linear and logistic regression, adjusted for age and sex. In a subgroup of 16 patients with IIM and 27 controls, the process was repeated 6-12 months later and the results were analysed using Student's t-test. Capillary density was lower and dimensions were higher in patients with IIM compared with healthy controls (P nailfold capillaroscopy, suggesting that nailfold capillaroscopy may be useful as an outcome measure of microvascular disease in studies of IIM.

  17. Muscle sonography in six patients with hereditary inclusion body myopathy

    International Nuclear Information System (INIS)

    Adler, Ronald S.; Garolfalo, Giovanna; Paget, Stephen; Kagen, Lawrence

    2008-01-01

    To evaluate the morphological changes of muscle with sonography in six patients affected by hereditary inclusion body myopathy (HIBM). We studied a group of six Persian Jews diagnosed with HIBM. All were homozygous for the GNE mutation M712T. Ultrasonographic examinations of the quadriceps femoris and hamstring muscle groups were performed. A follow-up ultrasound examination was performed, after an interval of 3 years, in four of these patients. Muscles were assessed subjectively as to echogenicity, determined by gray-scale assessment, and loss of normal muscle morphology. Power Doppler sonography (PDS) was used to assess vascularity. A sonographic finding of central atrophy and peripheral sparing resulting in a target-like appearance was noted in the hamstring compartment of all six patients. The quadriceps compartment also showed involvement of the rectus femoris of all patients, which, in some cases, was the only muscle involved in the quadriceps. Vascularity was markedly reduced in the affected areas, with blood flow demonstrated in the peripherally spared areas. The severity of atrophy increased with disease duration. In this case series, we describe a new sonographic finding as well as document progression of HIBM disease, which has generally been described as quadriceps sparing. The myopathic target lesion, as well as isolated rectus femoris atrophy, may provide a useful adjunct to disease diagnosis. (orig.)

  18. Myopathy in CRPS-I: disuse or neurogenic?

    Science.gov (United States)

    Hulsman, Natalie M; Geertzen, Jan H B; Dijkstra, Pieter U; van den Dungen, Jan J A M; den Dunnen, Wilfred F A

    2009-08-01

    The diagnosis Complex Regional Pain Syndrome type I (CRPS-I) is based on clinical symptoms, including motor symptoms. Histological changes in muscle tissue may be present in the chronic phase of CRPS-I. Aim of this study was to analyze skeletal muscle tissue from amputated limbs of patients with CRPS-I, in order to gain more insight in factors that may play a role in changes in muscles in CRPS-I. These changes may be helpful in clarifying the pathophysiology of CRPS-I. Fourteen patients with therapy resistant and longstanding CRPS-I, underwent an amputation of the affected limb. In all patients histological analysis showed extensive changes in muscle tissue, such as fatty degeneration, fibre atrophy and nuclear clumping, which was not related to duration of CRPS-I prior to amputation. In all muscles affected, both type 1 and type 2 fibre atrophy was found, without selective type 2 fibre atrophy. In four patients, type grouping was observed, indicating a sequence of denervation and reinnervation of muscle tissue. In two patients even large group atrophy was present, suggesting new denervation after reinnervation. Comparison between subgroups in arms and legs showed no difference in the number of changes in muscle tissue. Intrinsic and extrinsic muscles were affected equally. Our findings show that in the chronic phase of CRPS-I extensive changes can be seen in muscle tissue, not related to duration of CRPS-I symptoms. Signs of neurogenic myopathy were present in five patients.

  19. OCULAR ASPECTS OF HYPERTHYROIDISM WITH SPECIAL REFERENCE TO OCULAR MYOPATHY

    Directory of Open Access Journals (Sweden)

    Mallika O. U

    2017-04-01

    Full Text Available BACKGROUND Hyperthyroidism can result in ocular manifestations even before systemic signs and symptoms develop. It is seen more in females and severe forms are more common in males. Early detection of ocular involvement can prevent vision threatening complications and troublesome discomforts affecting quality of vision. This clinical study highlights the importance of detailed ocular examination in hyperthyroidism. MATERIALS AND METHODS Fifty consecutive patients with ocular signs of hyperthyroidism were evaluated and followed up for an average period of 1 year. Detailed ocular examination included exophthalmometric measurements, ocular movements and Worth four-dot test. T3, T4, TSH, CT scan and antimicrosomal antibodies and antithyroglobulin antibodies were done along with routine investigations. Study Design- Prospective cohort study. RESULTS Statistical analysis did not reveal any correlation between the level of serum T3 and severity of ocular findings. Majority of the cases were euthyroid with moderate ocular myopathy having multiple muscle involvement. Inferior rectus was affected most. CONCLUSION The ocular signs of hyperthyroidism in the present study seem to be mild. The severe eye changes like corneal involvement and optic nerve changes were less common.

  20. [Statin associated myopathy in clinical practice. Results of DAMA study].

    Science.gov (United States)

    Millán, Jesús; Pedro-Botet, Juan; Climent, Elisenda; Millán, Joaquín; Rius, Joan

    Muscle symptoms, with or without elevation of creatin kinase are one of the main adverse effects of statin therapy, a fact that sometimes limits their use. The aim of this study was to evaluate the clinical characteristics of patients treated with statins who have complained muscle symptoms and to identify possible predictive factors. A cross-sectional one-visit, non-interventional, national multicenter study including patients of both sexes over 18 years of age referred for past or present muscle symptoms associated with statin therapy was conducted. 3,845 patients were recruited from a one-day record from 2,001 physicians. Myalgia was present in 78.2% of patients included in the study, myositis in 19.3%, and rhabdomyolysis in 2.5%. Patients reported muscle pain in 77.5% of statin-treated individuals, general weakness 42.7%, and cramps 28.1%. Kidney failure, intense physical exercise, alcohol consumption (>30g/d in men and 20g/d in women) and abdominal obesity were the clinical situations associated with statin myopathy. Myalgia followed by myositis are the most frequent statin-related side effects. It should be recommended control environmental factors such as intense exercise and alcohol intake as well as abdominal obesity and renal function of the patient treated with statins. Copyright © 2016 Sociedad Española de Arteriosclerosis. Publicado por Elsevier España, S.L.U. All rights reserved.

  1. Differential effect of the rs4149056 variant in SLCO1B1 on myopathy associated with simvastatin and atorvastatin

    NARCIS (Netherlands)

    Brunham, L. R.; Lansberg, P. J.; Zhang, L.; Miao, F.; Carter, C.; Hovingh, G. K.; Visscher, H.; Jukema, J. W.; Stalenhoef, A. F.; Ross, C. J. D.; Carleton, B. C.; Kastelein, J. J. P.; Hayden, M. R.

    2012-01-01

    Statins reduce cardiovascular morbidity and mortality in appropriately selected patients. However, statin-associated myopathy is a significant risk associated with these agents. Recently, variation in the SLCO1B1 gene was reported to predict simvastatin-associated myopathy. The aim of this study was

  2. Process and apparatus for controlling control rods

    International Nuclear Information System (INIS)

    Gebelin, B.; Couture, R.

    1987-01-01

    This process and apparatus is characterized by 2 methods, for examination of cluster of nuclear control rods. Foucault current analyzer which examines fraction by fraction all the control rods. This examination is made by rotation of the cluster. Doubtful rods are then analysed by ultrasonic probe [fr

  3. Fuel followed control rod installation at AFRRI

    International Nuclear Information System (INIS)

    Moore, Mark; Owens, Chris; Forsbacka, Matt

    1992-01-01

    Fuel Followed Control Rods (FFCRs) were installed at the Armed Forces Radiobiology Research Institute's 1 MW TRIGA Reactor. The procedures for obtaining, shipping, and installing the FFCRs is described. As part of the FFCR installation, the transient rod drive was relocated. Core performance due to the addition of the fuel followed control rods is discussed. (author)

  4. Solitary waves on nonlinear elastic rods. II

    DEFF Research Database (Denmark)

    Sørensen, Mads Peter; Christiansen, Peter Leth; Lomdahl, P. S.

    1987-01-01

    In continuation of an earlier study of propagation of solitary waves on nonlinear elastic rods, numerical investigations of blowup, reflection, and fission at continuous and discontinuous variation of the cross section for the rod and reflection at the end of the rod are presented. The results ar...... are compared with predictions of conservation theorems for energy and momentum....

  5. ELECTRIC FIELD MEASUREMENT IN ROD-DISCONTINUED ...

    African Journals Online (AJOL)

    2014-06-30

    Jun 30, 2014 ... the electrogeometrical model using a laboratory experimental rod-plane air gap arrangement with a lightning conductor (Franklin rod or horizontal conductor). The stepped leader could be represented by the rod electrode under a negative lightning impulse voltage having a level leading to breakdown with ...

  6. Testing device for control rod drives

    International Nuclear Information System (INIS)

    Hayakawa, Toshifumi.

    1992-01-01

    A testing device for control rod drives comprises a logic measuring means for measuring an output signal from a control rod drive logic generation circuit, a control means for judging the operation state of a control rod and a man machine interface means for outputting the result of the judgement. A driving instruction outputted from the control rod operation device is always monitored by the control means, and if the operation instruction is stopped, a testing signal is outputted to the control rod control device to simulate a control rod operation. In this case, the output signal of the control rod drive logic generation circuit is held in a control rod drive memory means and intaken into a logic analysis means for measurement and an abnormality is judged by the control means. The stopping of the control rod drive instruction is monitored and the operation abnormality of the control rod is judged, to mitigate the burden of an operator. Further, the operation of the control rod drive logic generation circuit can be confirmed even during a nuclear plant operation by holding the control rod drive instruction thereby enabling to improve maintenance efficiency. (N.H.)

  7. 21 CFR 876.4270 - Colostomy rod.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Colostomy rod. 876.4270 Section 876.4270 Food and... GASTROENTEROLOGY-UROLOGY DEVICES Surgical Devices § 876.4270 Colostomy rod. (a) Identification. A colostomy rod is a device used during the loop colostomy procedure. A loop of colon is surgically brought out through...

  8. Spider and burnable poison rod combinations

    International Nuclear Information System (INIS)

    Edwards, G.T.; Schluderberg, D.C.

    1980-01-01

    An improved design of burnable poison rods and associated spiders used in fuel assemblies of pressurized water power reactor cores, is described. The rods are joined to the spider arms in a manner which is proof against the reactor core environment and yet allows the removal of the rods from the spider simply, swiftly and delicately. (U.K.)

  9. Self-Assembly of Rod-Coil Block Copolymers

    National Research Council Canada - National Science Library

    Jenekhe, S

    1999-01-01

    ... the self-assembly of new rod-coil diblock, rod- coil-rod triblock, and coil-rod-coil triblock copolymers from solution and the resulting discrete and periodic mesostmctares with sizes in the 100...

  10. Technological quality, mineral profile, and sensory attributes of broiler chicken breasts affected by White Striping and Wooden Breast myopathies.

    Science.gov (United States)

    Tasoniero, G; Cullere, M; Cecchinato, M; Puolanne, E; Dalle Zotte, A

    2016-11-01

    The aim of the research was to study the impact of white striping and wooden breast myopathies on the technological quality, mineral, and sensory profile of poultry meat. With this purpose, a total of 138 breasts were selected for a control group with normal breasts (N), a group of breasts characterised by white striping (WS) myopathy, and a group of breasts having both white striping and wooden breast myopathies (WSWB). Data revealed that the simultaneous presence of the two myopathies, with respect to the WS lesion individually considered, had a further detrimental effect on pH (6.04 vs. 5.96; P white striping and wooden breast myopathies. © 2016 Poultry Science Association Inc.

  11. Lipid storage myopathy with clinical markers of Marfan syndrome: A rare association

    Directory of Open Access Journals (Sweden)

    Subasree Ramakrishnan

    2012-01-01

    Full Text Available Disorders of lipid metabolism can cause variable clinical presentations, often involving skeletal muscle, alone or together with other tissues. A 19-year-old boy presented with a 2-year history of muscle pain, cramps, exercise intolerance and progressive weakness of proximal lower limbs. Examination revealed skeletal markers of Marfan syndrome in the form of increased arm span compared with height, Kyphoscoliois, moderate pectus excavatum, high arched palate and wrist sign. He also had mild neck flexor weakness and proximal lower limb weakness with areflexia. Pathologic findings revealed lipid-laden fine vacuoles in the muscle fibers. Possibility of carnitine deficiency myopathy was considered and the patient was started on carnitine and Co Q. The patient made remarkable clinical improvement over the next 2 months. This case is reported for rarity of the association of clinical markers of Marfan syndrome and lipid storage myopathy and sparse literature on lipid storage myopathy in the Indian context.

  12. Muscle imaging in patients with tubular aggregate myopathy caused by mutations in STIM1

    DEFF Research Database (Denmark)

    Tasca, Giorgio; D'Amico, Adele; Monforte, Mauro

    2015-01-01

    Tubular aggregate myopathy is a genetically heterogeneous disease characterized by tubular aggregates as the hallmark on muscle biopsy. Mutations in STIM1 have recently been identified as one genetic cause in a number of tubular aggregate myopathy cases. To characterize the pattern of muscle...... involvement in this disease, upper and lower girdles and lower limbs were imaged in five patients with mutations in STIM1, and the scans were compared with two patients with tubular aggregate myopathy not caused by mutations in STIM1. A common pattern of involvement was found in STIM1-mutated patients...... of thigh and posterior leg with sparing of gracilis, tibialis anterior and, to a lesser extent, short head of biceps femoris. Mutations in STIM1 are associated with a homogeneous involvement on imaging despite variable clinical features. Muscle imaging can be useful in identifying STIM1-mutated patients...

  13. A novel mutation in PNPLA2 leading to neutral lipid storage disease with myopathy.

    Science.gov (United States)

    Ash, Daniel B; Papadimitriou, Dimitra; Hays, Arthur P; Dimauro, Salvatore; Hirano, Michio

    2012-09-01

    Mutations in PNPLA2, a gene encoding adipose triglyceride lipase, lead to neutral lipid storage disease with myopathy. To report the clinical and molecular features of a case of neutral lipid storage disease with myopathy resulting from a novel mutation in PNPLA2. Case report. University hospital. A 65-year-old man with progressive muscle weakness and high serum creatine kinase levels. Direct sequencing of the PNPLA2 gene. Identification of a novel homozygous mutation in the patient's PNPLA2 gene confirmed the suspected diagnosis of neutral lipid storage disease with myopathy. Screening of the PNPLA2 gene should be considered for patients presenting with high levels of creatine kinase, progressive muscle weakness, and systemic lipid accumulation. The presence of Jordans anomaly can be a strong diagnostic clue.

  14. Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone: A case report.

    Science.gov (United States)

    Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu

    2017-07-01

    Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Relative hypothyroidism-induced myopathy. Antithyroid drug (ATD) dosage was reduced without levothyroxine replacement. The muscular symptoms were recovered with CK level returned to normal after adoption of the euthyroid status. Differentiation of relative hypothyroidism from other causes of myopathy, especially with the effect of ATD, is important for clinical practice, although difficult in many cases.

  15. Role of Autophagy in Glycogen Breakdown and Its Relevance to Chloroquine Myopathy

    Science.gov (United States)

    Zirin, Jonathan; Nieuwenhuis, Joppe; Perrimon, Norbert

    2013-01-01

    Several myopathies are associated with defects in autophagic and lysosomal degradation of glycogen, but it remains unclear how glycogen is targeted to the lysosome and what significance this process has for muscle cells. We have established a Drosophila melanogaster model to study glycogen autophagy in skeletal muscles, using chloroquine (CQ) to simulate a vacuolar myopathy that is completely dependent on the core autophagy genes. We show that autophagy is required for the most efficient degradation of glycogen in response to starvation. Furthermore, we show that CQ-induced myopathy can be improved by reduction of either autophagy or glycogen synthesis, the latter possibly due to a direct role of Glycogen Synthase in regulating autophagy through its interaction with Atg8. PMID:24265594

  16. Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone

    Science.gov (United States)

    Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu

    2017-01-01

    Abstract Rationale: Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. Patient concerns: We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Diagnoses: Relative hypothyroidism-induced myopathy. Interventions: Antithyroid drug (ATD) dosage was reduced without levothyroxine replacement. Outcomes: The muscular symptoms were recovered with CK level returned to normal after adoption of the euthyroid status. Lessons: Differentiation of relative hypothyroidism from other causes of myopathy, especially with the effect of ATD, is important for clinical practice, although difficult in many cases. PMID:28746208

  17. Identification of methylenecyclopropyl acetic acid in serum of European horses with atypical myopathy.

    Science.gov (United States)

    Votion, D-M; van Galen, G; Sweetman, L; Boemer, F; de Tullio, P; Dopagne, C; Lefère, L; Mouithys-Mickalad, A; Patarin, F; Rouxhet, S; van Loon, G; Serteyn, D; Sponseller, B T; Valberg, S J

    2014-03-01

    It is hypothesised that European atypical myopathy (AM) has a similar basis as seasonal pasture myopathy in North America, which is now known to be caused by ingestion of hypoglycin A contained in seeds from the tree Acer negundo. Serum from horses with seasonal pasture myopathy contained the conjugated toxic metabolite of hypoglycin A, methylenecyclopropyl acetic acid (MCPA). Retrospective study on archived samples. 1) To determine whether MCPA-carnitine was present in serum of European horses confirmed to have AM; 2) to determine whether Acer negundo or related Acer species were present on AM pastures in Europe. Concentrations of MCPA-carnitine were analysed in banked serum samples of 17 AM horses from Europe and 3 diseased controls (tetanus, neoplasia and exertional rhabdomyolysis) using tandem mass spectrometry. Atypical myopathy was diagnosed by characteristic serum acylcarnitine profiles. Pastures of 12 AM farms were visited by experienced botanists and plant species were documented. Methylenecyclopropyl acetic acid-carnitine at high concentrations (20.39 ± 17.24 nmol/l; range 0.95-57.63 nmol/l; reference: <0.01 nmol/l) was identified in serum of AM but not disease controls (0.00 ± 0.00 nmol/l). Acer pseudoplatanus but not Acer negundo was present on all AM farms. Atypical myopathy in Europe, like seasonal pasture myopathy in North America, is highly associated with the toxic metabolite of hypoglycin A, MCPA-carnitine. This finding coupled with the presence of a tree of which seeds are known to also contain hypoglycin A indicates that ingestion of Acer pseudoplatanus is the probable cause of AM. This finding has major implications for the prevention of AM. © 2013 EVJ Ltd.

  18. Snubber assembly for a control rod drive

    International Nuclear Information System (INIS)

    Matthews, J.C.

    1978-01-01

    A snubber cartridge assembly is mounted to the nozzle of a control rod drive mechanism to insure that the snubber assembly will be located within the liquid filled section of a nuclear reactor vessel whenever the control rod drive is assembled thereto. The snubber assembly includes a piston mounted proximate to the control rod connecting end of the control rod drive leadscrew to allow the piston to travel within the liquid filled snubber cartridge and controllably exhaust liquid therefrom during a ''scram'' condition. The snubber cartridge provides three separate areas of increasing resistance to piston travel to insure a speedy but safe ''scram'' of the control rod into the reactor

  19. Individual nuclear fuel rod weighing system

    International Nuclear Information System (INIS)

    Fogg, J. L.; Howell, C. A.; Smith, J. H.; Vining, G. E.

    1985-01-01

    An individual nuclear fuel rod weighing system for rods carried on a tray which moves along a materials handling conveyor. At a first tray position on the conveyor, a lifting device raises the rods off the tray and places them on an overhead ramp. A loading mechanism conveys the rods singly from the overhead ramp onto an overhead scale for individual weighing. When the tray is at a second position on the conveyor, a transfer apparatus transports each weighed rod from the scale back onto the tray

  20. Individual nuclear fuel rod weighing system

    International Nuclear Information System (INIS)

    Fogg, J.L.; Smith, J.H.; Vining, G.E.; Howell, C.A.

    1985-01-01

    An individual nuclear fuel rod weighing system for rods carried on a tray which moves along a materials handling conveyor is discussed. At a first tray position on the conveyor, a lifting device raises the rods off the tray and places them on an overhead ramp. A loading mechanism conveys the rods singly from the overhead ramp onto an overhead scale for individual weighing. When the tray is at a second position on the conveyor, a transfer apparatus transports each weighed rod from the scale back onto the tray

  1. Automated nuclear fuel rod pattern loading system

    International Nuclear Information System (INIS)

    Lambert, D.V.; Nyland, T.W.; Byers, J.W.; Haley, D.E. Jr.; Cioffi, J.V.

    1990-01-01

    This patent describes an apparatus for loading fuel rods in a desired pattern. It comprises: a carousel having a plurality of movable gondolas for stocking thereon fuel rods of known enrichments; an elongated magazine defining a matrix of elongated slots being open at their forward ends for receiving fuel rods; a workstation defining a fuel rod feed path; and a holder and indexing mechanism for movably supporting the magazine and being actuatable for moving the magazine along X-Y axes to successively align one at a time selected ones of the slots with the feed path for loading in the magazine the successive fuel rods in a desired enrichment pattern

  2. ELECTROMAGNETIC APPARATUS FOR MOVING A ROD

    Science.gov (United States)

    Young, J.N.

    1958-04-22

    An electromagnetic apparatus for moving a rod-like member in small steps in either direction is described. The invention has particular application in the reactor field where the reactor control rods must be moved only a small distance and where the use of mechanical couplings is impractical due to the high- pressure seals required. A neutron-absorbing rod is mounted in a housing with gripping uaits that engage the rod, and coils for magnetizing the gripping units to make them grip, shift, and release the rod are located outside the housing.

  3. Snubber assembly for a control rod drive

    International Nuclear Information System (INIS)

    1976-01-01

    A snubber cartridge assembly is described which is mounted to the nozzle of a control rod drive mechanism to insure that it will be located within the liquid filled section of a nuclear reactor vessel whenever the control rod drive is assembled thereto. The snubber assembly includes a piston-mounted proximate to the control rod connecting end of the control rod drive leadscrew to allow the piston to travel within the liquid filled snubber cartridge and controllable exhaust the liquid during a 'scram' condition. The snubber cartridge provides three separate areas of increasing resistance to piston travel to insure a speedy but safe 'scram' of the control rod into the reactor

  4. Rod cluster having improved vane configuration

    International Nuclear Information System (INIS)

    Shockling, L.A.; Francis, T.A.

    1989-01-01

    This patent describes a pressurized water reactor vessel, the vessel defining a predetermined axial direction of the flow of coolant therewithin and having plural spider assemblies supporting, for vertical movement within the vessel, respective clusters of rods in spaced, parallel axial relationship, parallel to the predetermined axial direction of coolant flow, and a rod guide for each spider assembly and respective cluster of rods. The rod guide having horizontally oriented support plates therewithin, each plate having an interior opening for accommodating axial movement therethrough of the spider assembly and respective cluster of rods. The opening defining plural radially extending channels and corresponding parallel interior wall surfaces of the support plate

  5. Prototypical Rod Consolidation Demonstration Project

    International Nuclear Information System (INIS)

    1993-05-01

    The objective of Phase 3 of the Prototypical Rod consolidation Demonstration Project (PRCDP) was to procure, fabricate, assemble, and test the Prototypical Rod consolidation System as described in the NUS Phase 2 Final Design Report. This effort required providing the materials, components, and fabricated parts which makes up all of the system equipment. In addition, it included the assembly, installation, and setup of this equipment at the Cold Test Facility. During the Phase 3 effort the system was tested on a component, subsystem, and system level. This volume 1, discusses the PRCDP Phase 3 Test Program that was conducted by the HALLIBURTON NUS Environmental Corporation under contract AC07-86ID12651 with the United States Department of Energy. This document, Volume 1, Book 1 discusses the following topics: the background of the project; test program description; summary of tests and test results; problem evaluation; functional requirements confirmation; recommendations; and completed test documentation for tests performed in Phase 3

  6. Prototypical Rod Consolidation Demonstration Project

    International Nuclear Information System (INIS)

    1993-05-01

    The objective of Phase 3 of the Prototypical Rod consolidation Demonstration Project (PRCDP) was to procure, fabricate, assemble, and test the Prototypical Rod consolidation System as described in the NUS Phase 2 Final Design Report. This effort required providing the materials, components, and fabricated parts which makes up all of the system equipment. In addition, it included the assembly, installation, and setup of this equipment at the Cold Test Facility. During the Phase 3 effort the system was tested on a component, subsystem, and system level. This volume 1, discusses the PRCDP Phase 3 Test Program that was conducted by the HALLIBURTON NUS Environmental Corporation under contract AC07-86ID12651 with the United States Department of Energy. This document, Volume 1, Book 9 discusses the following topics: Integrated System Normal Operations Test Results and Analysis Report; Integrated System Off-Normal Operations Test Results and Analysis Report; and Integrated System Maintenance Operations Test Results and Analysis Report

  7. Prototypical Rod Consolidation Demonstration Project

    International Nuclear Information System (INIS)

    1993-05-01

    The objective of Phase 3 of the Prototypical Rod consolidation Demonstration Project (PRCDP) was to procure, fabricate, assemble, and test the Prototypical Rod consolidation System as described in the NUS Phase 2 Final Design Report. This effort required providing the materials, components, and fabricated parts which makes up all of the system equipment. In addition, it included the assembly, installation, and setup of this equipment at the Cold Test Facility. During the Phase 3 effort the system was tested on a component, subsystem, and system level. This volume 1, discusses the PRCDP Phase 3 Test Program that was conducted by the HALLIBURTON NUS Environmental Corporation under contract AC07-86ID12651 with the United States Department of Energy. This document, Volume 1, Book 8 discusses Control System SOT Tests Results and Analysis Report. This is a continuation of Book 7

  8. Prototypical Rod Construction Demonstration Project

    International Nuclear Information System (INIS)

    1993-05-01

    The objective of Phase 3 of the Prototypical Rod consolidation Demonstration Project (PRCDP) was to procure, fabricate, assemble, and test the Prototypical Rod consolidation System as described in the NUS Phase 2 Final Design Report. This effort required providing the materials, components, and fabricated parts which makes up all of the system equipment. In addition, it included the assembly, installation, and setup of this equipment at the Cold Test Facility. During the Phase 3 effort the system was tested on a component, subsystem, and system level. This volume 1, discusses the PRCDP Phase 3 Test Program that was conducted by the HALLIBURTON NUS Environmental Corporation under contract AC07-86ID12651 with the United States Department of Energy. This document, Volume 1, Book 3 discusses the following topics: Downender Test Results and Analysis Report; NFBC Canister Upender Test Results and Analysis Report; Fuel Assembly Handling Fixture Test Results and Analysis Report; and Fuel Canister Upender Test Results and Analysis Report

  9. Lipid myopathy associated with renal tubular acidosis and spastic diplegia in two brothers.

    Science.gov (United States)

    Tung, Y C; Tsau, Y K; Chu, L W; Young, C; Shen, Y Z

    2001-07-01

    Lipid myopathy is a group of disorders involving mitochondrial fatty acid oxidation. We describe two brothers, 3 years 8 months old and 2 years 9 months old, respectively, with progressive spastic diplegia, developmental delay, failure to thrive, and chronic metabolic acidosis who had lipid myopathy and renal tubular acidosis. Brain magnetic resonance imaging revealed demyelinating changes in the periventricular white matter, which was compatible with spastic diplegia. These symptoms may be related to errors in fatty acid metabolism. Cerebral palsy had been misdiagnosed in both of these patients at another hospital. Therefore, for patients with late-onset and progressive spastic diplegia, detailed investigations for underlying diseases are warranted.

  10. A study of acute muscle dysfunction with particular reference to dengue myopathy

    Directory of Open Access Journals (Sweden)

    Rajesh Verma

    2017-01-01

    Full Text Available Background: Acute myopathy is a common cause of acute motor quadriparesis which has various etiologies with different courses of illness and prognosis depending on the cause. Understanding this diversity helps us in proper approach toward diagnosis, predicting the prognosis, and possible complications and in improving the treatments that are being provided. This study was planned to study the clinical, electrophysiological, and etiological profile of patients presenting with acute myopathy. We also studied how dengue-related acute myopathy differs from other causes and also difference between myopathy due to myositis and hypokalemia in cases of dengue. Materials and Methods: This was a prospective, observational study involving all clinically suspected cases of acute myopathy of not more than 4 weeks duration with raised serum creatine kinase (CK level. They were subjected to detailed clinical evaluation along with hematological, biochemical, microbiological, and electrophysiological studies and followed-up for outcome at 1 and 3 months. Muscle biopsy and histopathological examination were done in selected patients after taking informed consent. Statistical analysis was performed by appropriate methods using SPSS version 16.0 (Chicago, IL, USA. Results: We evaluated thirty patients of acute myopathy with raised CK level. Seventeen patients had fever, 11 had myalgia, and 5 had skin lesions. All presented with symmetric weakness, 17 (56.7% patients having predominantly proximal weakness, neck or truncal weakness in 6 (20%, hyporeflexia in 12 (40%, with mean Medical Research Council (MRC sum score of 46.67 ± 6.0. Eight (mean modified Barthel index [MBI] at presentation - 15 ± 3.7 patients had poor functional status according to MBI and 15 according to modified Rankin scale (MRS (mean MRS score - 2.5 ± 1.2. Etiology was dengue viral infection in 14 patients; hypokalemia due to various causes other than dengue in 8; pyomyositis in 3

  11. Collagen XII myopathy with rectus femoris atrophy and collagen XII retention in fibroblasts

    DEFF Research Database (Denmark)

    Witting, Nanna; Krag, Thomas; Werlauff, Ulla

    2018-01-01

    INTRODUCTION: Mutation in the collagen XII gene (COL12A1) was recently reported to induce Bethlem myopathy. We describe a family affected by collagen XII-related myopathy in 3 generations. METHODS: Systematic interview, clinical examination, skin biopsies, and MRI of muscle were used. RESULTS...... affection and abnormal collagen XII retention in fibroblasts. MRI disclosed a selective wasting of the rectus femoris muscle. DISCUSSION: COL12A1 mutations should be considered in patients with a mild Bethlem phenotype who present with selective wasting of the rectus femoris, absence of the outside......-in phenomenon on MRI, and abnormal collagen XII retention in fibroblasts. Muscle Nerve, 2018....

  12. Treatment of critical illness polyneuropathy and/or myopathy - a systematic review

    DEFF Research Database (Denmark)

    Ydemann, Mogens; Eddelien, Heidi Shil; Lauritsen, Anne Øberg

    2012-01-01

    The objective was to search the literature with a view to providing a general description of critical illness myopathy/polyneuropathy (CIM/CIP), including its genesis and prevention. Furthermore, it was our aim to determine whether new treatments have occurred in the past five years.......The objective was to search the literature with a view to providing a general description of critical illness myopathy/polyneuropathy (CIM/CIP), including its genesis and prevention. Furthermore, it was our aim to determine whether new treatments have occurred in the past five years....

  13. Autophagy, inflammation and innate immunity in inflammatory myopathies.

    Directory of Open Access Journals (Sweden)

    Cristina Cappelletti

    Full Text Available Autophagy has a large range of physiological functions and its dysregulation contributes to several human disorders, including autoinflammatory/autoimmune diseases such as inflammatory myopathies (IIMs. In order to better understand the pathogenetic mechanisms of these muscular disorders, we sought to define the role of autophagic processes and their relation with the innate immune system in the three main subtypes of IIM, specifically sporadic inclusion body myositis (sIBM, polymyositis (PM, dermatomyositis (DM and juvenile dermatomyositis (JDM. We found that although the mRNA transcript levels of the autophagy-related genes BECN1, ATG5 and FBXO32 were similar in IIM and controls, autophagy activation in all IIM subgroups was suggested by immunoblotting results and confirmed by immunofluorescence. TLR4 and TLR3, two potent inducers of autophagy, were highly increased in IIM, with TLR4 transcripts significantly more expressed in PM and DM than in JDM, sIBM and controls, and TLR3 transcripts highly up-regulated in all IIM subgroups compared to controls. Co-localization between autophagic marker, LC3, and TLR4 and TLR3 was observed not only in sIBM but also in PM, DM and JDM muscle tissues. Furthermore, a highly association with the autophagic processes was observed in all IIM subgroups also for some TLR4 ligands, endogenous and bacterial HSP60, other than the high-mobility group box 1 (HMGB1. These findings indicate that autophagic processes are active not only in sIBM but also in PM, DM and JDM, probably in response to an exogenous or endogenous 'danger signal'. However, autophagic activation and regulation, and also interaction with the innate immune system, differ in each type of IIM. Better understanding of these differences may lead to new therapies for the different IIM types.

  14. Monitoring device for withdrawing control rods

    International Nuclear Information System (INIS)

    Higashigawa, Yuichi.

    1985-01-01

    Purpose: To improve the sensitivity and the responsivity to an equivalent extent to those in the case where local power range monitors are densely arranged near each of the control rods, with no actual but pseudo increase of the number of local power range monitors. Constitution: The monitor arrangement is patterned by utilizing the symmetricity of the reactor core and stored in a monitor designating device. The symmetricity of control rods to be selected and withdrawn by an operator is judged by a control rod symmetry monitoring device, while the symmetricity of the withdrawn control rods is judged by a control rod withdrawal state monitoring device. Then, only when both of the devices judge the symmetricity, the control rods are subjected to gang driving by the control rod drive mechanisms. In this way, monitoring at a high sensitivity and responsivity is enabled with no increase for the number of monitors. (Yoshino, Y.)

  15. Rope wind-up type control rod

    International Nuclear Information System (INIS)

    Tsuji, Teruaki; Watanabe, Shigeru.

    1979-01-01

    Purpose: To hold a control rod at a certain position even if the sealed cover of the rod drive mechanism should fail. Constitution: A plurality of friction plates, engaging wheels and a threaded shaft are provided to the wind-up drum for winding up a rope which moves the control rod up and down. While the control rod is adapted to drop by its own weight upon insertion, it is adapted to stop at a predetermined position exactly with no shocks by gradually increasing braking force by the sliding friction caused from the friction plates or the like. A ratch mechanism is provided to the upper portion of the control rod so that the top of the ratch piece may automatically engage the guide passage wall of the control rod upon uncontrolled running of the control rod to prevent further uncontrolled running thereof. (Ikeda, J.)

  16. Hollow rods for the oil producing industry

    Energy Technology Data Exchange (ETDEWEB)

    Khalimova, L M; Elyasheva, M A

    1970-01-01

    Hollow sucker rods have several advantages over conventional ones. The hollow rods actuate the well pump and at the same time conduct produced fluids to surface. When paraffin deposition occurs, it can be minimized by injecting steam, hot oil or hot water into the hollow rod. Other chemicals, such as demulsifiers, scale inhibitors, corrosion inhibitors, etc., can also be placed in the well through the hollow rods. This reduces cost of preventive treatments, reduces number of workovers, increases oil production, and reduces cost of oil. Because the internal area of the rod is small, the passing liquids have a high velocity and thereby carry sand and dirt out of the well. This reduces pump wear between the piston and the plunger. Specifications of hollow rods, their operating characteristics, and results obtained with such rods under various circumstances are described.

  17. Control-rod scram device

    International Nuclear Information System (INIS)

    Matsui, Yoshiro; Saito, Koji.

    1986-01-01

    Purpose: To eliminate the requirement for the nitrogen gas system in a scram device and enable safety and reliable shutdown of a water-cooled reactor power plant. Constitution: A piston and a spring are contained within a hydraulic vessel, and the piston is driven by the energy stored in the spring so as to supply hydraulic water to control mechanisms. During usual reactor operation, a scram valve is closed and a high water pressure of about 130 kg/cm 2 is applied to the water filled in the vessel through a check valve. Upon occurrence of abnormal conditions and generation of scram signals, the scram valve is opened to supply the water filled in the vessel through the scram valve to the control rod drive mechanisms. When the water pressure in the vessel is decreased, since the piston is urged upwardly by the energy stored in the spring, the water filled in the vessel is intermitently supplied to the control rod drive mechanisms. Thus, control rods can be inserted into the nuclear reactor to shutdown the same. (Horiuchi, T.)

  18. Prototypical Rod Consolidation Demonstration Project

    International Nuclear Information System (INIS)

    1993-05-01

    The objective of Phase 3 of the Prototypical Rod consolidation Demonstration Project (PRCDP) was to procure, fabricate, assemble, and test the Prototypical Rod consolidation System as described in the NUS Phase 2 Final Design Report. This effort required providing the materials, components, and fabricated parts which makes up all of the system equipment. In addition, it included the assembly, installation, and setup of this equipment at the Cold Test Facility. During the Phase 3 effort the system was tested on a component, subsystem, and system level. This volume 1, discusses the PRCDP Phase 3 Test Program that was conducted by the HALLIBURTON NUS Environmental Corporation under contract AC07-86ID12651 with the United States Department of Energy. This document, Volume 1, Book 4 discusses the following topics: Rod Compaction/Loading System Test Results and Analysis Report; Waste Collection System Test Results and Analysis Report; Waste Container Transfer Fixture Test Results and Analysis Report; Staging and Cutting Table Test Results and Analysis Report; and Upper Cutting System Test Results and Analysis Report

  19. Automated nuclear fuel rod pattern loading system

    International Nuclear Information System (INIS)

    Lambert, D.V.; Nylund, T.W.; Byers, J.W.; Haley, D.E. Jr.; Cioffi, J.V.

    1991-01-01

    This patent describes a method for loading fuel rods in a desired pattern. It comprises providing a supply of fuel rods of known enrichments; providing a magazine defining a matrix of elongated slots open at their forward ends for receiving fuel rods; defining a fuel rod feed path; receiving successively one at a time along the feed path fuel rods selected from the supply thereof; verifying successively one at a time along the feed path the identity of the selected fuel rods, the verifying including blocking passage of each selected fuel rod along the feed path until the identity of each selected fuel rod is confirmed as correct; feeding to the magazine successively one at a time along the feed path the selective and verified fuel rods; and supporting and moving the magazine along X-Y axes to successively align one at a time selected ones of the slots with the feed path for loading in the magazine the successive fuel rods in a desired enrichment pattern

  20. Vibrational characteristics and wear of fuel rods

    International Nuclear Information System (INIS)

    Schmugar, K.L.

    1977-01-01

    Fuel rod wear, due to vibration, is a continuing concern in the design of liquid-cooled reactors. In my report, the methodology and models that are used to predict fuel rod vibrational response and vibratory wear, in a light water reactor environment, are discussed. This methodology is being followed at present in the design of Westinghouse Nuclear Fuel. Fuel rod vibrations are expressed as the normal bending modes, and sources of rod vibration are examined with special emphasis on flow-induced mechanisms in the stable flow region. In a typical Westinghouse PWR fuel assembly design, each fuel rod is supported at multiple locations along the rod axis by a square-shaped 'grid cell'. For a fuel rod /grid support system, the development of small oscillatory motions, due to fluid flow at the rod/grid interface, results in material wear. A theoretical wear mode is developed using the Archard Theory of Adhesive Wear as the basis. Without question certainty, fretting wear becomes a serious problem if it progresses to the stage where the fuel cladding is penetrated and fuel is exposed to the coolant. Westinghouse fuel is designed to minimize fretting wear by limiting the relative motion between the fuel rod and its supports. The wear producing motion between the fuel rod and its supports occurs when the vibration amplitude exceeds the slippage threshold amplitude

  1. Absence of anti-HMG-CoA reductase autoantibodies in severe self-limited statin-related myopathy.

    Science.gov (United States)

    Floyd, James S; Brody, Jennifer A; Tiniakou, Eleni; Psaty, Bruce M; Mammen, Andrew

    2016-06-01

    Patients with self-limited statin-related myopathy improve spontaneously when statins are stopped. In contrast, patients with statin-associated autoimmune myopathy have autoantibodies recognizing 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase (HMGCR) and usually require immunosuppressive therapy to control their disease. On initial presentation, it can sometimes be difficult to distinguish between these 2 diseases, as both present with muscle pain, weakness, and elevated serum creatine kinase (CK) levels. The goal of this study was to determine whether patients with severe self-limited statin-related myopathy also make anti-HMGCR autoantibodies. We screened 101 subjects with severe self-limited cerivastatin-related myopathy for anti-HMGCR autoantibodies. No patient with severe self-limited cerivastatin-related myopathy had anti-HMGCR autoantibodies. Anti-HMGCR autoantibody testing can be used to help differentiate whether a patient has self-limited myopathy due to cerivastatin or autoimmune statin-associated myopathy; these findings may apply to other statins as well. Muscle Nerve 54: 142-144, 2016. © 2016 Wiley Periodicals, Inc.

  2. The heart in Becker muscular dystrophy, facioscapulohumeral dystrophy, and Bethlem myopathy

    NARCIS (Netherlands)

    de Visser, M.; de Voogt, W. G.; la Rivière, G. V.

    1992-01-01

    We report a study, assessing involvement of the heart in 33 familial cases of Becker muscular dystrophy (BMD), 31 familiar cases of facioscapulohumeral (FSH) dystrophy, and 27 familial cases of Bethlem myopathy. In the patients with BMD, correlations of myocardial involvement with age and extent of

  3. Management of cases suffering from atypical myopathy: interpretations of descriptive, epidemiological and pathophysiological findings

    DEFF Research Database (Denmark)

    van Galen Verwilghen, Gaby; Votion, D.-M.

    2013-01-01

    Atypical myopathy is highly fatal, but about a quarter of affected horses survive. This highlights the need for provision of supportive treatment for these cases. This review is a practical guideline for equine practitioners and includes suggestions for close monitoring of involved organ systems ...

  4. Acquired multiple Acyl-CoA dehydrogenase deficiency in 10 horses with atypical myopathy

    NARCIS (Netherlands)

    Westermann, C. M.; Dorland, L.; Votion, D. M.; de Sain-van der Velden, M. G. M.; Wijnberg, I. D.; Wanders, R. J. A.; Spliet, W. G. M.; Testerink, N.; Berger, R.; Ruiter, J. P. N.; van der Kolk, J. H.

    2008-01-01

    The aim of the current study was to assess lipid metabolism in horses with atypical myopathy. Urine samples from 10 cases were subjected to analysis of organic acids, glycine conjugates, and acylcarnitines revealing increased mean excretion of lactic acid, ethylmalonic acid, 2-methylsuccinic acid,

  5. [External progressive ophthalmoplegia secondary to mitochondrial myopathy. Report of a case and review of the literature].

    Science.gov (United States)

    Calderón-Garcidueñas, A L; Pérez-Loria, O; Alberto-Sagástegui, J; Farías-García, R

    2000-01-01

    Progressive limitation of occular motility, accompanied by ptosis but usually without diplopia, occurs in many pathologic states, including mitochondrial diseases. A case with chronic progressive external ophthalmoplegia with onset during childhood, associated with proximal myopathy and dysphasia is presented. The muscle biopsy showed a myopathic pattern and abnormal subsarcolemmal mitochondrial deposits. Muscle biopsy for important in the correct diagnosis of this entity.

  6. Congenital myotonic myopathy in the miniature schnauzer: an autosomal recessive trait.

    Science.gov (United States)

    Vite, C H; Melniczek, J; Patterson, D; Giger, U

    1999-01-01

    Myotonia is a clinical sign characterized by a delay in skeletal muscle relaxation following electrical or mechanical stimulation. A series of related miniature schnauzer dogs with congenital myotonic myopathy were studied. A composite pedigree of six affected litters and the results of a planned breeding between two affected animals are consistent with an autosomal recessive mode of inheritance.

  7. Suspected myofibrillar myopathy in Arabian horses with a history of exertional rhabdomyolysis.

    Science.gov (United States)

    Valberg, S J; McKenzie, E C; Eyrich, L V; Shivers, J; Barnes, N E; Finno, C J

    2016-09-01

    Although exertional rhabdomyolysis (ER) is common in Arabian horses, there are no dedicated studies describing histopathological characteristics of muscle from Arabian horses with ER. To prospectively identify distinctive histopathological features of muscle from Arabian endurance horses with a history of ER (pro-ER) and to retrospectively determine their prevalence in archived samples from Arabian horses with exertional myopathies (retro-ER). Prospective and retrospective histopathological description. Middle gluteal muscle biopsies obtained from Arabian controls (n = 14), pro-ER (n = 13) as well as archived retro-ER (n = 25) muscle samples previously classified with type 2 polysaccharide storage myopathy (15/25), recurrent exertional rhabdomyolysis (7/25) and no pathology (3/25) were scored for histopathology and immunohistochemical staining of cytoskeletal proteins. Glutaraldehyde-fixed samples (2 pro-ER, one control) were processed for electron microscopy. Pro-ER and retro-ER groups were compared with controls using Mann-Whitney U and Fisher's exact tests. Centrally located myonuclei in mature myofibres were found in significantly more (Prhabdomyolysis, ectopic accumulation of cytoskeletal proteins and Z-disc degeneration bear a strong resemblance to a myofibrillar myopathy. While many of these horses were previously diagnosed with type 2 polysaccharide storage myopathy, pools of glycogen forming within disrupted myofibrils appeared to give the false appearance of a glycogen storage disorder. © 2015 EVJ Ltd.

  8. Atypical myopathy in Denmark confirmed with the aTRAQ assay

    DEFF Research Database (Denmark)

    Høffer, Sofie Esbjørn; Votion, Dominique-Marie; Anderberg, Marie

    2016-01-01

    Atypical myopathy is a severe form of rhabdomyolysis that occurs in grazing horses. Over the past decades, the disease has been emerging in Europe. The disease is widespread in Europe and has been suspected in Denmark since 2000, yet no cases have been confirmed. The objective of this study...

  9. Evaluating the Atrial Myopathy Underlying Atrial Fibrillation: Identifying the Arrhythmogenic and Thrombogenic Substrate

    Science.gov (United States)

    Goldberger, Jeffrey J.; Arora, Rishi; Green, David; Greenland, Philip; Lee, Daniel C.; Lloyd-Jones, Donald M.; Markl, Michael; Ng, Jason; Shah, Sanjiv J.

    2015-01-01

    Atrial disease or myopathy forms the substrate for atrial fibrillation (AF) and underlies the potential for atrial thrombus formation and subsequent stroke. Current diagnostic approaches in patients with AF focus on identifying clinical predictors with evaluation of left atrial size by echocardiography serving as the sole measure specifically evaluating the atrium. Although the atrial substrate underlying AF is likely developing for years prior to the onset of AF, there is no current evaluation to identify the pre-clinical atrial myopathy. Atrial fibrosis is one component of the atrial substrate that has garnered recent attention based on newer MRI techniques that have been applied to visualize atrial fibrosis in humans with prognostic implications regarding success of treatment. Advanced ECG signal processing, echocardiographic techniques, and MRI imaging of fibrosis and flow provide up-to-date approaches to evaluate the atrial myopathy underlying AF. While thromboembolic risk is currently defined by clinical scores, their predictive value is mediocre. Evaluation of stasis via imaging and biomarkers associated with thrombogenesis may provide enhanced approaches to assess risk for stroke in patients with AF. Better delineation of the atrial myopathy that serves as the substrate for AF and thromboembolic complications might improve treatment outcomes. Furthermore, better delineation of the pathophysiologic mechanisms underlying the development of the atrial substrate for AF, particularly in its earlier stages, could help identify blood and imaging biomarkers that could be useful to assess risk for developing new onset AF and suggest specific pathways that could be targeted for prevention. PMID:26216085

  10. Effects of ubiquinone (coenzyme Q10) on myopathy in statin users.

    NARCIS (Netherlands)

    Schaars, C.F.; Stalenhoef, A.F.H.

    2008-01-01

    PURPOSE OF REVIEW: Statins are associated with muscle complaints, including myositis. The mechanism through which statin use causes muscle toxicity is unknown. One of the theories is that statin therapy reduces coenzyme Q10 levels in muscle mitochondria, which leads to muscle injury and myopathy.

  11. Whole-body MRI in adult inflammatory myopathies: Do we need imaging of the trunk?

    International Nuclear Information System (INIS)

    Filli, Lukas; Manoliu, Andrei; Andreisek, Gustav; Guggenberger, Roman; Maurer, Britta

    2015-01-01

    To evaluate whether imaging of the trunk could be omitted in patients with inflammatory myopathies without losing diagnostic accuracy using a restricted whole-body magnetic resonance imaging (rWB-MRI) protocol. After approval by the institutional review board, this study was performed in 63 patients (male/female, 13/50; median age, 52 years; range, 20-81 years) with new-onset myopathic symptoms (group 1, n = 41) or previously diagnosed inflammatory myopathy (group 2, n = 22). After performing whole-body MRI (WB-MRI) at 3.0 Tesla, myositis and fatty atrophy were evaluated in different muscles by two independent radiologists. The intra-class correlation coefficient (ICC) was calculated to evaluate inter-observer reliability. Acquisition time was 56:01 minutes for WB-MRI and 37:37 minutes (32.8 % shorter) for rWB-MRI. In group 1, 14 patients were diagnosed with inflammatory myopathy based on muscle biopsy. rWB-MRI and WB-MRI showed equal sensitivity (42.9 %) and specificity (100 %) for myositis, and showed equal sensitivity (71.4 %) and similar specificity (63.0 % and 48.1 %, respectively) for fatty atrophy. No myositis was found in the body trunk in any patient. Inter-observer reliability was between substantial and perfect (ICC, 0.77-1.00). rWB-MRI showed diagnostic accuracy similar to WB-MRI for inflammatory myopathy at markedly reduced overall acquisition time. (orig.)

  12. Whole-body MRI in adult inflammatory myopathies: Do we need imaging of the trunk?

    Energy Technology Data Exchange (ETDEWEB)

    Filli, Lukas; Manoliu, Andrei; Andreisek, Gustav; Guggenberger, Roman [University Hospital Zurich, University of Zurich, Institute of Diagnostic and Interventional Radiology, Zurich (Switzerland); Maurer, Britta [University Hospital Zurich, University of Zurich, Division of Rheumatology, Zurich (Switzerland)

    2015-12-15

    To evaluate whether imaging of the trunk could be omitted in patients with inflammatory myopathies without losing diagnostic accuracy using a restricted whole-body magnetic resonance imaging (rWB-MRI) protocol. After approval by the institutional review board, this study was performed in 63 patients (male/female, 13/50; median age, 52 years; range, 20-81 years) with new-onset myopathic symptoms (group 1, n = 41) or previously diagnosed inflammatory myopathy (group 2, n = 22). After performing whole-body MRI (WB-MRI) at 3.0 Tesla, myositis and fatty atrophy were evaluated in different muscles by two independent radiologists. The intra-class correlation coefficient (ICC) was calculated to evaluate inter-observer reliability. Acquisition time was 56:01 minutes for WB-MRI and 37:37 minutes (32.8 % shorter) for rWB-MRI. In group 1, 14 patients were diagnosed with inflammatory myopathy based on muscle biopsy. rWB-MRI and WB-MRI showed equal sensitivity (42.9 %) and specificity (100 %) for myositis, and showed equal sensitivity (71.4 %) and similar specificity (63.0 % and 48.1 %, respectively) for fatty atrophy. No myositis was found in the body trunk in any patient. Inter-observer reliability was between substantial and perfect (ICC, 0.77-1.00). rWB-MRI showed diagnostic accuracy similar to WB-MRI for inflammatory myopathy at markedly reduced overall acquisition time. (orig.)

  13. RYR1-related myopathies: a wide spectrum of phenotypes throughout life

    NARCIS (Netherlands)

    Snoeck, M.; Engelen, B.G.M. van; Kusters, B.; Lammens, M.M.; Meijer, R.; Molenaar, J.P.F.; Raaphorst, J.; Verschuuren-Bemelmans, C.C.; Straathof, C.S.; Sie, L.T.L.; Coo, I.F.M. de; Pol, W.L. van der; Visser, M de; Scheffer, H.; Treves, S.; Jungbluth, H.; Voermans, N.C.; Kamsteeg, E.J.

    2015-01-01

    BACKGROUND AND PURPOSE: Although several recent studies have implicated RYR1 mutations as a common cause of various myopathies and the malignant hyperthermia susceptibility (MHS) trait, many of these studies have been limited to certain age groups, confined geographical regions or specific

  14. Management of cases suffering from atypical myopathy: interpretations of descriptive, epidemiological and pathophysiological findings

    DEFF Research Database (Denmark)

    van Galen Verwilghen, Gaby; Votion, D.-M.

    2013-01-01

    Atypical myopathy is highly fatal, but about a quarter of affected horses survive. This highlights the need for provision of supportive treatment for these patients. This review is a practical guideline for equine practitioners and includes suggestions for close monitoring of involved organ systems...

  15. Leiomodin-3-deficient mice display nemaline myopathy with fast-myofiber atrophy

    Directory of Open Access Journals (Sweden)

    Lei Tian

    2015-06-01

    Full Text Available Nemaline myopathy (NM is one of the most common forms of congenital myopathy, and affects either fast myofibers, slow myofibers, or both. However, an animal model for congenital myopathy with fast-myofiber-specific atrophy is not available. Furthermore, mutations in the leiomodin-3 (LMOD3 gene have recently been identified in a group of individuals with NM. However, it is not clear how loss of LMOD3 leads to NM. Here, we report a mouse mutant in which the piggyBac (PB transposon is inserted into the Lmod3 gene and disrupts its expression. Lmod3PB/PB mice show severe muscle weakness and postnatal growth retardation. Electron microscopy and immunofluorescence studies of the mutant skeletal muscles revealed the presence of nemaline bodies, a hallmark of NM, and disorganized sarcomeric structures. Interestingly, Lmod3 deficiency caused muscle atrophy specific to the fast fibers. Together, our results show that Lmod3 is required in the fast fibers for sarcomere integrity, and this study offers the first NM mouse model with muscle atrophy that is specific to fast fibers. This model could be a valuable resource for interrogating myopathy pathogenesis and developing therapeutics for NM as well as other pathophysiological conditions with preferential atrophy of fast fibers, including cancer cachexia and sarcopenia.

  16. Hypoglycin A in maple trees in the Netherlands and the risk of equine atypical myopathy

    NARCIS (Netherlands)

    Westermann, C.M.; van Leeuwen, Robbert; Mol, Hans

    2016-01-01

    The Acer (maple) genus of trees comprises over 120 species worldwide. Some of these contain the plant-toxin hypoglycin-A which has been proven to be a cause of the highly fatal condition called atypical myopathy (AM) in horses and ponies. In an earlier study of maple-tree samples (leaves and seeds)

  17. Fatigue in patients with spinal muscular atrophy type II and congenital myopathies

    DEFF Research Database (Denmark)

    Werlauff, Ulla; Højberg, A; Firla-Holme, R

    2014-01-01

    PURPOSE: The aim of this study was to evaluate whether the fatigue severity scale (FSS) is an appropriate instrument to assess fatigue in patients with spinal muscular atrophy type II (SMA II) and congenital myopathies (CM). METHODS: FSS and visual analog scale (VAS) were administered to 33 SMA II...

  18. Triacylglycerol infusion improves exercise endurance in patients with mitochondrial myopathy due to complex I deficiency

    NARCIS (Netherlands)

    Roef, MJ; de Meer, K; Reijngoud, DJ; Straver, HWHC; de Barse, M; Kalhan, SC; Berger, R

    Background: A high-fat diet has been recommended for the treatment of patients with mitochondrial myopathy due to complex I (NADH dehydrogenase) deficiency (CID). Objective: This study evaluated the effects of intravenous infusion of isoenergetic amounts of triacylglycerol or glucose on substrate

  19. Ileocolonic transfer of solid chyme in small intestinal neuropathies and myopathies

    Energy Technology Data Exchange (ETDEWEB)

    Greydanus, M.P.; Camilleri, M.; Colemont, L.J.; Phillips, S.F.; Brown, M.L.; Thomforde, G.M. (Mayo Clinic and Foundation, Rochester, MN (USA))

    1990-07-01

    The aims of this study were to assess gastric emptying, small bowel transit and colonic filling in patients with motility disorders, with particular attention to the patterns of colonic filling. Gastrointestinal transit was assessed using a previously validated radiolabeled mixed meal. Fourteen patients with clinical and manometric features of chronic intestinal pseudoobstruction classified as intestinal neuropathy and 6 as intestinal myopathy, were studied. The results were compared with those from 10 healthy controls studied similarly. Gastric emptying and small bowel transit of solids were significantly slower in both groups of patients than in healthy controls (P less than 0.05). In health, the ileocolonic transit of solid chyme was characterized by intermittent bolus transfers. The mean size of boluses transferred to the colon (expressed as a percentage of ingested radiolabel) was significantly less (P less than 0.05) in patients with intestinal myopathy (10% +/- 4% (SEM)) than in healthy controls (25% +/- 4%) or in patients with intestinal neuropathy (25% +/- 4%). The intervals between bolus transfer of solids (plateaus in the colonic filling curve) were longer (P less than 0.05) in myopathies (212 +/- 89 minutes) than in health (45 +/- 7 minutes) or neuropathies (53 +/- 11 minutes). Thus, gastric emptying and small bowel transit were delayed in small bowel neuropathies and myopathies. Bolus filling of the colon was less frequent and less effective in patients with myopathic intestinal pseudoobstruction, whereas bolus transfer was preserved in patients with neuropathic intestinal pseudoobstruction.

  20. The Impact of Exercise on Statin-Associated Skeletal Muscle Myopathy

    Science.gov (United States)

    Chung, Hae R.; Vakil, Mayand; Munroe, Michael; Parikh, Alay; Meador, Benjamin M.; Wu, Pei T.; Jeong, Jin H.; Woods, Jeffrey A.; Wilund, Kenneth R.; Boppart, Marni D.

    2016-01-01

    HMG-CoA reductase inhibitors (statins) are the most effective pharmacological means of reducing cardiovascular disease risk. The most common side effect of statin use is skeletal muscle myopathy, which may be exacerbated by exercise. Hypercholesterolemia and training status are factors that are rarely considered in the progression of myopathy. The purpose of this study was to determine the extent to which acute and chronic exercise can influence statin-induced myopathy in hypercholesterolemic (ApoE-/-) mice. Mice either received daily injections of saline or simvastatin (20 mg/kg) while: 1) remaining sedentary (Sed), 2) engaging in daily exercise for two weeks (novel, Nov), or 3) engaging in daily exercise for two weeks after a brief period of training (accustomed, Acct) (2x3 design, n = 60). Cholesterol, activity, strength, and indices of myofiber damage and atrophy were assessed. Running wheel activity declined in both exercise groups receiving statins (statin x time interaction, pstatin treatment (statin main effect, pstatin x exercise interaction, pstatin treatment. Exercise (Acct and Nov) increased atrogin-1 mRNA in combination with statin treatment, yet enhanced fiber damage or atrophy was not observed. The results from this study suggest that exercise (Nov, Acct) does not exacerbate statin-induced myopathy in ApoE-/- mice, yet statin treatment reduces activity in a manner that prevents muscle from mounting a beneficial adaptive response to training. PMID:27936249

  1. Evaluation of ubiquinone concentration and mitochondrial function relative to cerivastatin-induced skeletal myopathy in rats

    International Nuclear Information System (INIS)

    Schaefer, William H.; Lawrence, Jeffery W.; Loughlin, Amy F.; Stoffregen, Dana A.; Mixson, Lori A.; Dean, Dennis C.; Raab, Conrad E.; Yu, Nathan X.; Lankas, George R.; Frederick, Clay B.

    2004-01-01

    As a class, hydroxymethylglutaryl-coenzyme A (HMG-CoA) reductase inhibitors can potentially cause skeletal myopathy. One statin, cerivastatin, has recently been withdrawn from the market due to an unacceptably high incidence of rhabdomyolysis. The mechanism underlying statin-induced myopathy is unknown. This paper sought to investigate the relationship among statin-induced myopathy, mitochondrial function, and muscle ubiquinone levels. Rats were administered cerivastatin at 0.1, 0.5, and 1.0 (mg/kg)/day or dose vehicle (controls) by oral gavage for 15 days. Samples of type I-predominant skeletal muscle (soleus) and type II-predominant skeletal muscle [quadriceps and extensor digitorum longus (EDL)], and blood were collected on study days 5, 10, and 15 for morphological evaluation, clinical chemistry, mitochondrial function tests, and analysis of ubiquinone levels. No histological changes were observed in any of the animals on study days 5 or 10, but on study day 15, mid- and high-dose animals had necrosis and inflammation in type II skeletal muscle. Elevated creatine kinase (CK) levels in blood (a clinical marker of myopathy) correlated with the histopathological diagnosis of myopathy. Ultrastructural characterization of skeletal muscle revealed disruption of the sarcomere and altered mitochondria only in myofibers with degeneration, while adjacent myofibers were unaffected and had normal mitochondria. Thus, mitochondrial effects appeared not to precede myofiber degeneration. Mean coenzyme Q9 (CoQ9) levels in all dose groups were slightly decreased relative to controls in type II skeletal muscle, although the difference was not significantly different in most cases. Mitochondrial function in skeletal muscle was not affected by the changes in ubiquinone levels. The ubiquinone levels in high-dose-treated animals exhibiting myopathy were not significantly different from low-dose animals with no observable toxic effects. Furthermore, ubiquinone levels did not correlate

  2. Statin-Associated Autoimmune Myopathy: A Systematic Review of 100 Cases.

    Science.gov (United States)

    Nazir, Salik; Lohani, Saroj; Tachamo, Niranjan; Poudel, Dilliram; Donato, Anthony

    2017-04-01

    Statins are a group of drugs that reduce the levels of triglycerides and cholesterol in blood by inhibiting HMG-CoA reductase, an enzyme involved in rate limiting step in cholesterol synthesis. About 2-20% patients on statins develop toxic myopathies, which usually resolve on discontinuation of statin. More recently, an immune-mediated necrotizing myopathy has been found to be associated with statin use which in most cases requires treatment with immunosuppressants. To perform a systematic review on published case reports and case series of statin-associated autoimmune myopathy. A comprehensive search of PUBMED, EMBASE, Cochrane library and ClinicalTrials.gov databases was performed for relevant articles from inception until March 19, 2016 to identify cases of statin-associated necrotizing myopathy and characterize their symptoms, evaluation and response to treatment. A total of 16 articles describing 100 patients with statin-associated autoimmune myopathy were identified. The mean age of presentation was 64.72 years, and 54.44% were males. The main presenting clinical feature was proximal muscle weakness, which was symmetric in 83.33% of patients. The mean creatine kinase (CK) was 6853 IU/l. Anti-HMG-CoA reductase antibody was positive in all cases tested (n = 57/57, 100%). In patients with no anti-HMG-CoA antibody results, diagnosis was established by findings of necrotizing myopathy on biopsy. Among the 83 cases where muscle biopsy information was available, 81.48% had necrosis, while 18.51% had combination of necrosis and inflammation. Most (83.82%) patients received two or more immunosuppressants to induce remission. Ninety-one percent had resolution of symptoms after treatment. Statin-associated necrotizing myopathy is a symmetric proximal muscle weakness associated with extreme elevations of CK. It is common in males and can occur after months of statin use. It is associated with necrosis on muscle biopsy and the presence of anti-HMG-CoA reductase antibodies

  3. Control rod for a reactor

    International Nuclear Information System (INIS)

    Natori, Hisahide.

    1975-01-01

    Object: To change arrangement and density of each layer of neutron absorber in the control rod and to render rotation by each layer possible, whereby the neutron absorber may be rotated to readily flatten power distribution. Structure: Neutron absorbers such as boron and carbide are filled into stainless steel pipes, which are peripherally arranged in a multi-layer fashion. Arrangement and density of the neutron absorber by each layer are changed and rotation by each layer is made possible, whereby surface area of the absorber or the like is changed to flatten power distribution. (Furukawa, Y.)

  4. Accident-tolerant control rod

    International Nuclear Information System (INIS)

    Ohta, Hirokazu; Sawabe, Takashi; Ogata, Takanari

    2013-01-01

    Boron carbide (B 4 C) and hafnium (Hf) metal are used for the neutron absorber materials of control rods in BWRs, and silver-indium-cadmium (Ag-In-Cd) alloy is used in PWRs. These materials are clad with stainless steel. The eutectic point of B 4 C and iron (Fe) is about 1150 deg. C and the melting point of Ag-In-Cd alloy is about 800 deg. C, which are lower than the temperature of zircaloy - steam reaction increases rapidly (∼1200 deg. C). Accordingly, it is possible that the control rods melt and collapse before the reactor core is significantly damaged in the case of severe accidents. Since the neutron absorber would be separated from the fuels, there is a risk of re-criticality, when pure water or seawater is injected for emergency cooling. In order to ensure sub-criticality and extend options of emergency cooling in the course of severe accidents, a concept of accident-tolerant control rod (ACT) has been derived. ACT utilises a new absorber material having the following properties: - higher neutron absorption than current control rod; - higher melting or eutectic temperature than 1200 deg. C where rapid zircaloy oxidation occurs; - high miscibility with molten fuel materials. The candidate of a new absorber material for ATC includes gadolinia (Gd 2 O 3 ), samaria (Sm 2 O 3 ), europia (Eu 2 O 3 ), dysprosia (Dy 2 O 3 ), hafnia (HfO 2 ). The melting point of these materials and the liquefaction temperature with Fe are higher than the rapid zircaloy oxidation temperature. ACT will not collapse before the core melt-down. After the core melt-down, the absorber material will be mixed with molten fuel material. The current absorber materials, such as B 4 C, Hf and Ag-In-Cd, are charged at the tip of ATC in which the neutron flux is high, and a new absorber material is charged in the low-flux region. This design could minimise the degradation of a new absorber material by the neutron absorption and the influence of ATC deployment on reactor control procedure. As a

  5. Development of a control rod drive

    International Nuclear Information System (INIS)

    1991-01-01

    In the period under review, the computer codes required for transients calculation have been completed, as well as the programs for modelling and testing the hot-gas temperature control by means of combined core rod and reflector rod operation. The specification of requirements to be fulfilled by the rod drive computer and the neutron flux measuring system has been done relying essentially on the data obtained by the transients calculations performed and the resulting informations on operating conditions. The work for optimization of the core rod drive with regard to rod driving speeds and the 'three-point switch' with hysteresis for controlled, automatic core rod operation has been concentrating on the case of specified, normal operation of the reactor. (orig./DG) [de

  6. Evidence for marsh mallow (Malva parviflora) toxicosis causing myocardial disease and myopathy in four horses.

    Science.gov (United States)

    Bauquier, J; Stent, A; Gibney, J; Jerrett, I; White, J; Tennent-Brown, B; Pearce, A; Pitt, J

    2017-05-01

    Investigation of toxicosis caused by Malva parviflora was required after 4 horses from the same farm developed severe muscle fasciculations, tachycardia, sweating and periods of recumbency leading to death or euthanasia after ingesting the plant. To describe historical, clinical, clinicopathological and pathological findings of 4 horses with suspected M. parviflora toxicosis. The role of cyclopropene fatty acids (found in M. parviflora) and mechanism for toxicosis are proposed. Case series. Historical, physical examination, clinicopathological and pathological findings are reported. Due to similarities with atypical myopathy or seasonal pasture myopathy acyl carnitine profiles were performed on sera from 2 cases and equine controls. Presence of cyclopropene fatty acids was also examined in sera of 2 cases. M. parviflora had been heavily grazed by the horses with little other feed available. Horse 1 deteriorated rapidly and was subjected to euthanasia. Horse 2 was referred to hospital where severe myocardial disease and generalised myopathy was determined; this horse was subjected to euthanasia 36 h after admission. Horse 3 died rapidly and Horse 4 was subjected to euthanasia at onset of clinical signs. Post-mortem examinations performed on 3 horses revealed acute, multifocal cardiac and skeletal myonecrosis. Myocyte glycogen accumulation was absent when examined in Horse 2. Acyl carnitine profiles revealed increased C14-C18 acyl carnitine concentrations in cases relative to controls. Cyclopropene fatty acids were detected in sera of cases but not controls. These findings suggest aetiology different to that of atypical myopathy or seasonal pasture myopathy. We hypothesise that cyclopropene fatty acids in M. parviflora interfere with fatty acid β-oxidation in horses in negative energy balance, causing the clinical signs and abnormal acyl carnitine profiles. These equine cases suggest a pathophysiological course that closely mimics the human genetic condition very

  7. ColVI myopathies: where do we stand, where do we go?

    Directory of Open Access Journals (Sweden)

    Allamand Valérie

    2011-09-01

    Full Text Available Abstract Collagen VI myopathies, caused by mutations in the genes encoding collagen type VI (ColVI, represent a clinical continuum with Ullrich congenital muscular dystrophy (UCMD and Bethlem myopathy (BM at each end of the spectrum, and less well-defined intermediate phenotypes in between. ColVI myopathies also share common features with other disorders associated with prominent muscle contractures, making differential diagnosis difficult. This group of disorders, under-recognized for a long time, has aroused much interest over the past decade, with important advances made in understanding its molecular pathogenesis. Indeed, numerous mutations have now been reported in the COL6A1, COL6A2 and COL6A3 genes, a large proportion of which are de novo and exert dominant-negative effects. Genotype-phenotype correlations have also started to emerge, which reflect the various pathogenic mechanisms at play in these disorders: dominant de novo exon splicing that enables the synthesis and secretion of mutant tetramers and homozygous nonsense mutations that lead to premature termination of translation and complete loss of function are associated with early-onset, severe phenotypes. In this review, we present the current state of diagnosis and research in the field of ColVI myopathies. The past decade has provided significant advances, with the identification of altered cellular functions in animal models of ColVI myopathies and in patient samples. In particular, mitochondrial dysfunction and a defect in the autophagic clearance system of skeletal muscle have recently been reported, thereby opening potential therapeutic avenues.

  8. Cardiovascular magnetic resonance imaging (CMR) reveals characteristic pattern of myocardial damage in patients with mitochondrial myopathy.

    Science.gov (United States)

    Yilmaz, Ali; Gdynia, Hans-Jürgen; Ponfick, Matthias; Rösch, Sabine; Lindner, Alfred; Ludolph, Albert C; Sechtem, Udo

    2012-04-01

    Mitochondrial myopathy comprises various clinical subforms of neuromuscular disorders that are characterised by impaired mitochondrial energy metabolism due to dysfunction of the mitochondrial respiratory chain. No comprehensive and targeted cardiovascular magnetic resonance (CMR) studies have been performed so far in patients with mitochondrial disorders. The present study aimed at characterising cardiac disease manifestations in patients with mitochondrial myopathy and elucidating the in vivo cardiac damage pattern of patients with different subforms of mitochondrial disease by CMR studies. In a prospective study, 37 patients with mitochondrial myopathy underwent comprehensive neurological and cardiac evaluations including physical examination, resting ECG and CMR. The CMR studies comprised cine-CMR, T2-weighted "edema" imaging and T1-weighted late-gadolinium-enhancement (LGE) imaging. Various patterns and degrees of skeletal myopathy were present in the participants of this study, whereas clinical symptoms such as chest pain symptoms (in eight (22%) patients) and various degrees of dyspnea (in 16 (43%) patients) were less frequent. Pathological ECG findings were documented in eight (22%) patients. T2-weighted "edema" imaging was positive in one (3%) patient with MELAS (mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes) only. LGE imaging demonstrated the presence of non-ischemic LGE in 12 (32%) patients: 10 out of 24 (42%) patients with CPEO (chronic progressive external ophthalmoplegia) or KSS (Kearns-Sayre syndrome) and 2 of 3 (67%) patients with MELAS were LGE positive. All 10 LGE-positive patients with CPEO or KSS demonstrated a potentially typical pattern of diffuse intramural LGE in the left-ventricular (LV) inferolateral segments. Cardiac involvement is a frequent finding in patients with mitochondrial myopathy. A potentially characteristic pattern of diffuse intramural LGE in the LV inferolateral segments was identified in

  9. Elucidation of the mechanism of atorvastatin-induced myopathy in a rat model.

    Science.gov (United States)

    El-Ganainy, Samar O; El-Mallah, Ahmed; Abdallah, Dina; Khattab, Mahmoud M; Mohy El-Din, Mahmoud M; El-Khatib, Aiman S

    2016-06-01

    Myopathy is among the well documented and the most disturbing adverse effects of statins. The underlying mechanism is still unknown. Mitochondrial dysfunction related to coenzyme Q10 decline is one of the proposed theories. The present study aimed to investigate the mechanism of atorvastatin-induced myopathy in rats. In addition, the mechanism of the coenzyme Q10 protection was investigated with special focus of mitochondrial alterations. Sprague-Dawely rats were treated orally either with atorvastatin (100mg/kg) or atorvastatin and coenzyme Q10 (100mg/kg). Myopathy was assessed by measuring serum creatine kinase (CK) and myoglobin levels together with examination of necrosis in type IIB fiber muscles. Mitochondrial dysfunction was evaluated by measuring muscle lactate/pyruvate ratio, ATP level, pAkt as well as mitochondrial ultrastructure examination. Atorvastatin treatment resulted in a rise in both CK (2X) and myoglobin (6X) level with graded degrees of muscle necrosis. Biochemical determinations showed prominent increase in lactate/pyruvate ratio and a decline in both ATP (>80%) and pAkt (>50%) levels. Ultrastructure examination showed mitochondrial swelling with disrupted organelle membrane. Co-treatment with coenzyme Q10 induced reduction in muscle necrosis as well as in CK and myoglobin levels. In addition, coenzyme Q10 improved all mitochondrial dysfunction parameters including mitochondrial swelling and disruption. These results presented a model for atorvastatin-induced myopathy in rats and proved that mitochondrial dysfunction is the main contributor in statin-myopathy pathophysiology. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  10. Expandable device for a nuclear fuel rod

    International Nuclear Information System (INIS)

    Gesinski, L.T.

    1978-01-01

    A nuclear fuel rod and a device for use within the rod cladding to maintain the axial position of the fuel pellets stacked one atop another within the cladding are described. The device is initially of a smaller external cross-section than the fuel rod cladding internal cross-section so as to accommodate loading into the rod at preselected locations. During power operation the device responds to a rise in temperature, so as to permanently maintain its position and restrain any axial motion of the fuel pellets

  11. Control rod selecting and driving device

    International Nuclear Information System (INIS)

    Isobe, Hideo.

    1981-01-01

    Purpose: To simultaneously drive a predetermined number of control rods in a predetermined mode by the control of addresses for predetermined number of control rods and read or write of driving codified data to and from the memory by way of a memory controller. Constitution: The system comprises a control rod information selection device for selecting predetermined control rods from a plurality of control rods disposed in a reactor and outputting information for driving them in a predetermined mode, a control rod information output device for codifying the information outputted from the above device and outputting the addresses to the predetermined control rods and driving mode coded data, and a driving device for driving said predetermined control rods in a predetermined mode in accordance with the codified data outputted from the above device, said control rod infromation output device comprising a memory device capable of storing a predetermined number of the codified data and a memory control device for storing the predetermined number of data into the above memory device at a predetermined timing while successively outputting the thus stored predetermined number of data at a predetermined timing. (Seki, T.)

  12. Nuclear fuel rod end plug weld inspection

    International Nuclear Information System (INIS)

    Parker, M. A.; Patrick, S. S.; Rice, G. F.

    1985-01-01

    Apparatus and method for testing TIG (tungsten inert gas) welds of end plugs on a sealed nuclear reactor fuel rod. An X-ray fluorescent spectrograph testing unit detects tungsten inclusion weld defects in the top end plug's seal weld. Separate ultrasonic weld inspection system testing units test the top end plug's seal and girth welds and test the bottom end plug's girth weld for penetration, porosity and wall thinning defects. The nuclear fuel rod is automatically moved into and out from each testing unit and is automatically transported between the testing units by rod handling devices. A controller supervises the operation of the testing units and the rod handling devices

  13. Temperature actuated automatic safety rod release

    Science.gov (United States)

    Hutter, E.; Pardini, J.A.; Walker, D.E.

    1984-03-13

    A temperature-actuated apparatus is disclosed for releasably supporting a safety rod in a nuclear reactor, comprising a safety rod upper adapter having a retention means, a drive shaft which houses the upper adapter, and a bimetallic means supported within the drive shaft and having at least one ledge which engages a retention means of the safety rod upper adapter. A pre-determined increase in temperature causes the bimetallic means to deform so that the ledge disengages from the retention means, whereby the bimetallic means releases the safety rod into the core of the reactor.

  14. Absorber rod drive for nuclear reactors

    International Nuclear Information System (INIS)

    Acher, H.

    1985-01-01

    The invention concerns a further addition to the invention of DE 33 42 830 A1. The free contact of the hollow piston with the nut due to hydraulic pressure is replaced by a hydraulic or spring attachment. The pressure system required to produce the hydraulic pressure is therefore omitted, and the electrical power required for driving the pump or the mass flow is also omitted. The absorber rod slotted along its longitudinal axis is replaced by an absorber rod, in the longitudinal axis of which a hollow piston is connected together with the absorber rod. This makes the absorber rod more stable, and assembly is simplified. (orig./HP) [de

  15. Acoustic loading effects on oscillating rod bundles

    International Nuclear Information System (INIS)

    Lin, W.H.

    1980-01-01

    An analytical study of the interaction between an infinite acoustic medium and a cluster of circular rods is described. The acoustic field due to oscillating rods and the acoustic loading on the rods are first solved in a closed form. The acoustic loading is then used as a forcing function for rod responses, and the acousto-elastic couplings are solved simultaneously. Numerical examples are presented for several cases to illustrate the effects of various system parameters on the acoustic reaction force coefficients. The effect of the acoustic loading on the coupled eigenfrequencies are discussed

  16. Growth and Morphology of Rod Eutectics

    Energy Technology Data Exchange (ETDEWEB)

    Jing Teng; Shan Liu; R. Trivedi

    2008-03-17

    The formation of rod eutectic microstructure is investigated systematically in a succinonitrile-camphor alloy of eutectic composition by using the directional solidification technique. A new rod eutectic configuration is observed in which the rods form with elliptical cylindrical shape. Two different orientations of the ellipse are observed that differ by a 90{sup o} rotation such that the major and the minor axes are interchanged. Critical experiments in thin samples, where a single layer of rods forms, show that the spacing and orientation of the elliptic rods are governed by the growth rate and the sample thickness. In thicker samples, multi layers of rods form with circular cross-section and the scaling law between the spacing and velocity predicted by the Jackson and Hunt model is validated. A theoretical model is developed for a two-dimensional array of elliptical rods that are arranged in a hexagonal or a square array, and the results are shown to be consistent with the experimental observations. The model of elliptic rods is also shown to reduce to that for the circular rod eutectic when the lengths of the two axes are equal, and to the lamellar eutectic model when one of the axes is much larger than the other one.

  17. Nuclear reactor fuel rod attachment system

    International Nuclear Information System (INIS)

    Christiansen, D.W.

    1983-01-01

    The invention involves a technique to quickly, inexpensively and rigidly attach a nuclear reactor fuel rod to a support member. The invention also allows for the repeated non-destructive removal and replacement of the fuel rod. The proposed fuel rod and support member attachment and removal system consists of a locking cap fastened to the fuel rod and a locking strip fastened to the support member or vice versa. The locking cap has two or more opposing fingers shaped to form a socket. The fingers spring back when moved apart and released. The locking strip has an extension shaped to rigidly attach to the socket's body portion

  18. Dry rod consolidation technology development

    International Nuclear Information System (INIS)

    Rasmussen, T.L.; Schoonen, D.H.; Fisher, M.W.

    1986-01-01

    The Department of Energy's (DOE) Office of Civilian Radioactive Waste Management (OCRWM) is funding a Program to consolidate commercial spent fuel for testing in dry storage casks and to develop technology that will be fed into other OCRWM Programs, e.g., Prototypical Consolidation Demonstration Program. The Program is being conducted at the Idaho National Engineering Laboratory (INEL) by the Operating Contractor, EGandG Idaho, Inc. Hardware and software have been designed and fabricated for installation in a hot cell adjacent to the Test Area North (TAN) Hot Shop Facility. This equipment will be used to perform dry consolidation of commercial spent fuel from the Virginia Power (VP) Cooperative Agreement Spent Fuel Storage Cask (SPSC) Demonstration Program and assemblies that had previously been stored at the Engine Maintenance and Disassembly (EMAD) facility in Nevada. Consolidation will be accomplished by individual, horizontal rod pulling. A computerized semi-automatic control system with operator involvement will be utilized to conduct consolidation operations. Special features have been incorporated in the design to allow crud collection and measurement of rod pulling forces. During consolidation operations, data will be taken to characterize this technology. Still photo, video tape, and other documentation will be generated to make developed information available to interested parties. Cold checkout of the hardware and software will complete in September of 1986. Following installation in the hot cell, consolidation operations will begin in January 1987. Resulting consolidated fuel will be utilized in the VP Cooperative Agreement SFSC Program

  19. Attracting electromagnet for control rod

    International Nuclear Information System (INIS)

    Kato, Kazuo; Sasaki, Kotaro.

    1989-01-01

    Non-magnetic material plates with inherent resistivity of greater than 20 μΩ-cm and thickness of less than 3 mm are used for the end plates of attracting electromagnets for closed type control rods. By using such control rod attracting electromagnets, the scram releasing time can be shortened than usual. Since the armature attracting side of the electromagnet has to be sealed by a non-magnetic plate, a bronze plate of about 5 mm thickness has been used so far. Accordingly, non-magnetic plate is inserted to the electromagnet attracting face to increase air source length for improving to shorten the scram releasing time. This method, however, worsens the attracting property on one hand to require a great magnetomotive force. For overcoming these drawbacks, in the present invention, the material for tightly closing end plates in an electromagnet is changed from bronze plate to non-magnetic stainless steel SUS 303 or non-magnetic Monel metal and, in addition, the plate thickness is reduced to less than 5 mm thereby maintaining the attracting property and shortening the scram releasing time. (K.M.)

  20. Prototypical Rod Consolidation Demonstration Project

    International Nuclear Information System (INIS)

    1993-05-01

    The objective of Phase 3 of the Prototypical Rod consolidation Demonstration Project (PRCDP) was to procure, fabricate, assemble, and test the Prototypical Rod consolidation System as described in the NUS Phase 2 Final Design Report. This effort required providing the materials, components, and fabricated parts which makes up all of the system equipment. In addition, it included the assembly, installation, and setup of this equipment at the Cold Test Facility. During the Phase 3 effort the system was tested on a component, subsystem, and system level. This volume 1, discusses the PRCDP Phase 3 Test Program that was conducted by the HALLIBURTON NUS Environmental Corporation under contract AC07-86ID12651 with the United States Department of Energy. This document, Volume 1, Book 5 discusses the following topics: Lower Cutting System Test Results and Analysis Report; NFBC Loading System Test Results and Analysis Report; Robotic Bridge Transporter Test Results and Analysis Report; RM-10A Remotec Manipulator Test Results and Analysis Report; and Manipulator Transporter Test Results and Analysis Report

  1. Seismic scrammability of HTTR control rods

    International Nuclear Information System (INIS)

    Nishiguchi, I.; Iyoku, T.; Ito, N.; Watanabe, Y.; Araki, T.; Katagiri, S.

    1990-01-01

    Scrammability tests on HTTR (High-Temperature Engineering Test Reactor) control rods under seismic conditions have been carried out and seismic conditions influences on scram time as well as functional integrity were examined. A control rod drive located in a stand-pipe at the top of a reactor vessel, raises and lowers a pair of control rods by suspension cables. Each flexible control rod consists of 10 neutron absorber sections held together by a metal spine passing through the center. It falls into a hole in graphite blocks due to gravity at scram. In the tests, a full scale control rod drive and a pair of control rods were employed with a column of graphite blocks in which holes for rods were formed. Blocks misalignment and contact with the hole surface during earthquakes were considered as major causes of disturbance in scram time. Therefore, the following parameters were set up in the tests: excitation direction, combination or horizontal and vertical excitation, acceleration, frequency and block to block gaps. Main results obtained from tests are as follow. 1) Every scram time obtained under the design conditions was within 6 seconds. On the contrary, the scram times were 5.2 seconds when there were no vibration. Therefore, it was concluded that the seismic effects on scram time were not significant. 2) Scram time became longer with increase in both acceleration and horizontal excitation frequency, and control rods fell very smoothly without any jerkiness. This suggests that collision between control rods and hole surface is the main disturbing factor of falling motion. 3) Mechanical and functional integrity of control rod drive mechanism, control rods and graphite blocks was confirmed after 140 seismic scrammability tests. (author). 10 figs, 1 tab

  2. Muscle-fiber conduction velocity and electromyography as diagnostic tools in patients with suspected inflammatory myopathy: a prospective study.

    NARCIS (Netherlands)

    Blijham, P.J.; Hengstman, G.J.D.; Laak, H.J. ter; Engelen, B.G.M. van; Zwarts, M.J.

    2004-01-01

    Combinations of different techniques can increase the diagnostic yield from neurophysiological examination of muscle. In 25 patients with suspected inflammatory myopathy, we prospectively performed needle electromyography (EMG) and measured muscle-fiber conduction velocity (MFCV) in a single muscle,

  3. Opposed-phase MR imaging of lipid storage myopathy in a case of Chanarin-Dorfman disease

    International Nuclear Information System (INIS)

    Gaeta, Michele; Celona, Antonio; Racchiusa, Sergio; Mazziotti, Silvio; Minutoli, Fabio; Toscano, Antonio; Musumeci, Olimpia

    2008-01-01

    Chanarin-Dorfman disease (CDD) is a rare genetic disorder characterized by ichthyosis, myopathy, central nervous system disturbances, and intracellular lipid storage in muscle fibers, hepatocytes, and granulocytes. We describe skeletal muscle magnetic resonance imaging findings in a case of CDD, outlining the potential role of GE T1-weighted opposed-phase sequence (chemical shift imaging) in the evaluation of lipid storage myopathies. (orig.)

  4. Opposed-phase MR imaging of lipid storage myopathy in a case of Chanarin-Dorfman disease

    Energy Technology Data Exchange (ETDEWEB)

    Gaeta, Michele; Celona, Antonio; Racchiusa, Sergio; Mazziotti, Silvio [University of Messina, Department of Radiological Sciences, Messina (Italy); Minutoli, Fabio [University of Messina, Department of Radiological Sciences, Messina (Italy); A.O.U. ' ' Policlinico G. Martino' ' , Dipartimento di Scienze Radiologiche, Messina (Italy); Toscano, Antonio; Musumeci, Olimpia [University of Messina, Department of Neurosciences, Psychiatry and Anaesthesiology, Messina (Italy)

    2008-11-15

    Chanarin-Dorfman disease (CDD) is a rare genetic disorder characterized by ichthyosis, myopathy, central nervous system disturbances, and intracellular lipid storage in muscle fibers, hepatocytes, and granulocytes. We describe skeletal muscle magnetic resonance imaging findings in a case of CDD, outlining the potential role of GE T1-weighted opposed-phase sequence (chemical shift imaging) in the evaluation of lipid storage myopathies. (orig.)

  5. Acute quadriplegia caused by necrotizing myopathy in a renal transplant recipient with severe pneumonia: acute onset and complete recovery.

    Science.gov (United States)

    Tu, Guo-Wei; Song, Jie-Qiong; Ting, Simon Kang Seng; Ju, Min-Jie; He, Hong-Yu; Dong, Ji-Hong; Luo, Zhe

    2015-02-03

    Critical illness polyneuropathy and myopathy are multifaceted complications that follow severe illnesses involving the sensorimotor axons and proximal skeletal muscles. These syndromes have rarely been reported among renal transplant recipients. In this paper, we report a case of acute quadriplegia caused by necrotizing myopathy in a renal transplant recipient with severe pneumonia. The muscle strength in the patient's extremities improved gradually after four weeks of comprehensive treatment, and his daily life activities were normal a year after being discharged.

  6. Self-contact for rods on cylinders

    NARCIS (Netherlands)

    Heijden, van der G.H.M.; Peletier, M.A.; Planqué, R.

    2006-01-01

    We study self-contact phenomena in elastic rods that are constrained to lie on a cylinder. By choosing a particular set of variables to describe the rod centerline the variational setting is made particularly simple: the strain energy is a second-order functional of a single scalar variable, and the

  7. Self-contact for rods on cylinders

    NARCIS (Netherlands)

    G.H.M. van der Heijden; M.A. Peletier (Mark); R. Planqué (Robert)

    2004-01-01

    textabstractWe study self-contact phenomena in elastic rods that are constrained to lie on a cylinder. By choosing a particular set of variables to describe the rod centerline the variational setting is made particularly simple: the strain energy is a second-order functional of a single scalar

  8. Self-contact for rods on cylinders

    NARCIS (Netherlands)

    Heijden, van der G.H.M.; Peletier, M.A.; Planqué, R.

    2004-01-01

    We study self-contact phenomena in elastic rods that are constrained to lie on a cylinder. By choosing a particular set of variables to describe the rod centerline the variational setting is made particularly simple: the strain energy is a second-order functional of a single scalar variable, and the

  9. Tipping Time of a Quantum Rod

    Science.gov (United States)

    Parrikar, Onkar

    2010-01-01

    The behaviour of a quantum rod, pivoted at its lower end on an impenetrable floor and restricted to moving in the vertical plane under the gravitational potential, is studied analytically under the approximation that the rod is initially localized to a "small-enough" neighbourhood around the point of classical unstable equilibrium. It is shown…

  10. Pressurized water reactor fuel rod design methodology

    International Nuclear Information System (INIS)

    Silva, A.T.; Esteves, A.M.

    1988-08-01

    The fuel performance program FRAPCON-1 and the structural finite element program SAP-IV are applied in a pressurized water reactor fuel rod design methodology. The applied calculation procedure allows to dimension the fuel rod components and characterize its internal pressure. (author) [pt

  11. Spider and burnable poison rod combinations

    International Nuclear Information System (INIS)

    Walton, L.A.

    1980-01-01

    A description is given of an improved design of burnable poison rods and their associated spiders used in the fuel assemblies of pressurized water power reactor cores which allows the rods to be installed and removed more quickly, simply and gently than in previously described systems. (U.K.)

  12. Method of inspecting control rod drive mechanism

    International Nuclear Information System (INIS)

    Sato, Tomomi; Tatemichi, Shin-ichiro; Hasegawa, Hidenobu.

    1988-01-01

    Purpose: To conduct inspection for control rod drives and fuel handling operations in parallel without taking out the entire fuel, while maintaining the reactor in a subcritical state. Method: Control rod drives are inspected through the release of connection between control rods and control rod drives, detachment and dismantling of control rod drives, etc. In this case, structural materials having neutron absorbing power equal to or greater than the control rods are inserted into the gap after taking out fuels. Since the structural materials have neutron absorbing portion, subcriticality is maintained by the neutron absorbing effect. Accordingly, there is no requirement for taking out all of the fuels, thereby enabling to check the control rod drives and conduct handling for the fuels in parallel. As a result, the number of days required for the inspection can be shortened and it is possible to improve the working efficiency for the decomposition, inspection, etc. of the control rod drives and, thus, improve the operation efficiency of the nuclear power plant thereby attaining the predetermined purpose. (Kawakami, Y.)

  13. Control rod guide tube assembly

    International Nuclear Information System (INIS)

    Jabsen, F.S.

    1982-01-01

    An improved fuel assembly is described as consisting of a sleeve that engages one end of a control rod guide tube essentially fixing the guide tube to one of the fuel assembly end structures. The end of the sleeve protrudes above the surface of the end fitting. The outer surface of the sleeve has a peripheral groove that engages the resilient sides of a cellular grid or lattice shaped lock. This lock fixes the sleeve in position between the various elements that comprise the end fitting, thereby eliminating a profusion of costly and potentially troublesome nuts, threaded studs and the like that are frequently employed in the fuel assemblies that are presently in use

  14. Thermal behavior simulation of a nuclear fuel rod through an eletrically heated rod

    International Nuclear Information System (INIS)

    Lima, R. de C.F. de.

    1984-01-01

    In thermalhydraulic loops the nuclear industry often uses electrically heated rods to simulate power transients, which occur in nuclear fuel rods. The development and design of a electrically heated rod, by supplying the dimensions and materials which should be used in order to yeld the same temperature and heat flux at the surfaces of the nuclear rod and the electrically heated rod are presented. To a given nuclear transient this equality was obtained by fitting the linear power through the lumped parameters technique. (Author) [pt

  15. Nuclear reactor with scrammable part length rod

    International Nuclear Information System (INIS)

    Bevilacqua, F.

    1979-01-01

    A new part length rod is provided. It may be used to control xenon induced power oscillations but to contribute to shutdown reactivity when a rapid shutdown of the reactor is required. The part length rod consists of a control rod with three regions. The lower control region is a longer weaker active portion separated from an upper stronger shorter poison section by an intermediate section which is a relative non-absorber of neutrons. The combination of the longer weaker control section with the upper high worth poison section permits the part length rod of this to be scrammed into the core when a reactor shutdown is required but also permits the control rod to be used as a tool to control power distribution in both the axial and radial directions during normal operation

  16. Control rod for HTGR type reactor

    International Nuclear Information System (INIS)

    Mogi, Haruyoshi; Saito, Yuji; Fukamichi, Kenjiro.

    1990-01-01

    Upon dropping control rod elements into the reactor core, impact shocks are applied to wire ropes or spines to possibly deteriorate the integrity of the control rods. In view of the above in the present invention, shock absorbers such as springs or bellows are disposed between a wire rope and a spine in a HTGR type reactor control rod comprising a plurality of control rod elements connected axially by means of a spine that penetrates the central portion thereof, and is suspended at the upper end thereof by a wire rope. Impact shocks of about 5 kg are applied to the wire rope and the spine and, since they can be reduced by the shock absorbers, the control rod integrity can be maintained and the reactor safety can be improved. (T.M.)

  17. Detection device for control rod interference

    International Nuclear Information System (INIS)

    Saito, Noboru.

    1984-01-01

    Purpose: To enable to detect the mechanical interference or friction between a control rod and a channel box automatically, simply and rapidly. Constitution: A signal from a gate circuit and a signal from a comparison mechanism are inputted into an AND circuit if a control rod has not been displaced by a predetermined distance within a prescribed time Δt after the output of an insertion or withdrawal signal for the control rod, by which a control-rod-interference signal is outputted from the AND circuit. Accordingly, the interference between the control rod and the channel box can be detected automatically, easily and rapidly. Furthermore, by properly adjusting the prescribed time Δt set by the gate circuit, the degree of the interference can also be detected, whereby the safety and the reliability of the reactor can be improved significantly. (Horiuchi, T.)

  18. RODMOD: a code for control rod positioning

    International Nuclear Information System (INIS)

    Vondy, D.R.; Fowler, T.B.

    1978-11-01

    The report documents a computer code which has been implemented to position control rods according to a prescribed schedule during the calculation of a reactor history. Control rods may be represented explicitly with or without internal black absorber conditions in selected energy groups, or fractional insertion may be done, or both, in a problem. There is provision for control rod follower, movement of materials through a series of zones in a closed loop, and shutdown rod insertion and subsequent removal to allow the reactor history calculation to be continued. This code is incorporated in the system containing the VENTURE diffusion theory neutronics and the BURNER exposure codes for routine use. The implemented automated procedures cause the prescribed control rod insertion schedule to be applied without the access of additional user input data during the calculation of a reactor operating history

  19. Vortex Noise from Rotating Cylindrical Rods

    Science.gov (United States)

    Stowell, E Z; Deming, A F

    1935-01-01

    A series of round rods of the some diameter were rotated individually about the mid-point of each rod. Vortices are shed from the rods when in motion, giving rise to the emission of sound. With the rotating system placed in the open air, the distribution of sound in space, the acoustical power output, and the spectral distribution have been studied. The frequency of emission of vortices from any point on the rod is given by the formula von Karman. From the spectrum estimates are made of the distribution of acoustical power along the rod, the amount of air concerned in sound production, the "equivalent size" of the vortices, and the acoustical energy content for each vortex.

  20. Microcomputer system for controlling fuel rod length

    International Nuclear Information System (INIS)

    Meyer, E.R.; Bouldin, D.W.; Bolfing, B.J.

    1979-01-01

    A system is being developed at the Oak Ridge National Laboratory (ORNL) to automatically measure and control the length of fuel rods for use in a high temperature gas-cooled reactor (HTGR). The system utilizes an LSI-11 microcomputer for monitoring fuel rod length and for adjusting the primary factor affecting length. Preliminary results indicate that the automated system can maintain fuel rod length within the specified limits of 1.940 +- 0.040 in. This system provides quality control documentation and eliminates the dependence of the current fuel rod molding process on manual length control. In addition, the microcomputer system is compatible with planned efforts to extend control to fuel rod fissile and fertile material contents

  1. Fabrication Of Control Rod System Of The RSG-GAS

    International Nuclear Information System (INIS)

    Sudirdjo, Hari; Setyono; Prasetya, Hendra

    2001-01-01

    Eight units of control rod mechanical system of RSG-GAS has been fabricated. The control rod mechanical system of RSG-GAS consist of guide tube and lifting rod. Complete construction of the control rod mechanical system of RSG-GAS are guide tube, lifting rod, absorber, and absorber casing. The eight units of the control rod mechanical system of RSG-GAS has been fabricated according to the mechanical engineering design

  2. Role of Exercise Therapy in Prevention of Decline in Aging Muscle Function: Glucocorticoid Myopathy and Unloading

    Directory of Open Access Journals (Sweden)

    Teet Seene

    2012-01-01

    Full Text Available Changes in skeletal muscle quantity and quality lead to disability in the aging population. Physiological changes in aging skeletal muscle are associated with a decline in mass, strength, and inability to maintain balance. Glucocorticoids, which are in wide exploitation in various clinical scenarios, lead to the loss of the myofibrillar apparatus, changes in the extracellular matrix, and a decrease in muscle strength and motor activity, particularly in the elderly. Exercise therapy has shown to be a useful tool for the prevention of different diseases, including glucocorticoid myopathy and muscle unloading in the elderly. The purpose of the paper is to discuss the possibilities of using exercise therapy in the prevention of glucocorticoid caused myopathy and unloading in the elderly and to describe relationships between the muscle contractile apparatus and the extracellular matrix in different types of aging muscles.

  3. Free radicals in alcoholic myopathy: indices of damage and preventive studies.

    Science.gov (United States)

    Preedy, Victor R; Adachi, Junko; Asano, Migiwa; Koll, Michael; Mantle, David; Niemela, Onni; Parkkila, Seppo; Paice, Alistair G; Peters, Timothy; Rajendram, Rajkumar; Seitz, Helmut; Ueno, Yasuhiro; Worrall, Simon

    2002-04-15

    Chronic alcoholic myopathy affects up to two-thirds of all alcohol misusers and is characterized by selective atrophy of Type II (glycolytic, fast-twitch, anaerobic) fibers. In contrast, the Type I fibers (oxidative, slow-twitch, aerobic) are relatively protected. Alcohol increases the concentration of cholesterol hydroperoxides and malondialdehyde-protein adducts, though protein-carbonyl concentration levels do not appear to be overtly increased and may actually decrease in some studies. In alcoholics, plasma concentrations of alpha-tocopherol may be reduced in myopathic patients. However, alpha-tocopherol supplementation has failed to prevent either the loss of skeletal muscle protein or the reductions in protein synthesis in alcohol-dosed animals. The evidence for increased oxidative stress in alcohol-exposed skeletal muscle is thus inconsistent. Further work into the role of ROS in alcoholic myopathy is clearly warranted.

  4. Fatal hepatic hemorrhage by peliosis hepatis in X-linked myotubular myopathy: a case report.

    Science.gov (United States)

    Motoki, T; Fukuda, M; Nakano, T; Matsukage, S; Fukui, A; Akiyoshi, S; Hayashi, Y K; Ishii, E; Nishino, I

    2013-11-01

    We report a 5-year-old boy with X-linked myotubular myopathy complicated by peliosis hepatis. At birth, he was affected with marked generalized muscle hypotonia and weakness, which required permanent ventilatory support, and was bedridden for life. He died of acute fatal hepatic hemorrhage after using a mechanical in-exsufflator. Peliosis hepatis, defined as multiple, variable-sized, cystic blood-filled spaces through the liver parenchyma, was confirmed by autopsy. To avoid fatal hepatic hemorrhage by peliosis hepatis, routine hepatic function tests and abdominal imaging tests should be performed for patients with X-linked myotubular myopathy, especially at the time of using artificial respiration. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Neutral lipid-storage disease with myopathy and extended phenotype with novel PNPLA2 mutation.

    Science.gov (United States)

    Massa, Roberto; Pozzessere, Simone; Rastelli, Emanuele; Serra, Laura; Terracciano, Chiara; Gibellini, Manuela; Bozzali, Marco; Arca, Marcello

    2016-04-01

    Neutral lipid-storage disease with myopathy is caused by mutations in PNPLA2, which produce skeletal and cardiac myopathy. We report a man with multiorgan neutral lipid storage and unusual multisystem clinical involvement, including cognitive impairment. Quantitative brain MRI with voxel-based morphometry and extended neuropsychological assessment were performed. In parallel, the coding sequences and intron/exon boundaries of the PNPLA2 gene were screened by direct sequencing. Neuropsychological assessment revealed global cognitive impairment, and brain MRI showed reduced gray matter volume in the temporal lobes. Molecular characterization revealed a novel homozygous mutation in exon 5 of PNPLA2 (c.714C>A), resulting in a premature stop codon (p.Cys238*). Some PNPLA2 mutations, such as the one described here, may present with an extended phenotype, including brain involvement. In these cases, complete neuropsychological testing, combined with quantitative brain MRI, may help to characterize and quantify cognitive impairment. © 2016 Wiley Periodicals, Inc.

  6. Homozygous LIPE Mutation in Siblings with Multiple Symmetric Lipomatosis, Partial Lipodystrophy, and Myopathy

    OpenAIRE

    Zolotov, Sagit; Xing, Chao; Mahamid, Riad; Shalata, Adel; Sheikh-Ahmad, Mohammed; Garg, Abhimanyu

    2016-01-01

    Despite considerable progress in identifying causal genes for lipodystrophy syndromes, the molecular basis of some peculiar adipose tissue disorders remains obscure. In an Israeli–Arab pedigree with a novel autosomal recessive, multiple symmetric lipomatosis (MSL), partial lipodystrophy and myopathy, we conducted exome sequencing of two affected siblings to identify the disease-causingmutation. The 41-year-old female proband and her 36-year-old brother reported marked accumulation of subcutan...

  7. Cardiac abnormalities assessed by non-invasive techniques in patients with newly diagnosed idiopathic inflammatory myopathies

    DEFF Research Database (Denmark)

    Diederichsen, Louise Pyndt; Simonsen, Jane Angel; Diederichsen, Axel Cosmus Pyndt

    2015-01-01

    inflammatory myopathies (IIM) by means of non-invasive techniques. METHODS: Fourteen patients with IIM (8 polymyositis, 4 dermatomyositis, 2 cancer-associated dermatomyositis) and 14 gender- and age- matched healthy control subjects were investigated. Participant assessments included a cardiac questionnaire...... in 8 (57%) of the patients compared to none of the controls (pgroup (p=0.01). Two patients had systolic dysfunction, and one diastolic dysfunction...

  8. Case Report: Elevated CPK, an indicator of idiopathic inflammatory myopathy? [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Hina N. Khan

    2016-02-01

    Full Text Available Polymyositis is a rare disease with incidence rates at about 1 per 100,000 people annually. In this case report we will review a case of proximal muscle weakness with an elevated creatine phosphokinase that was initially misdiagnosed twice as rhabdomyolysis. Therefore, emphasizing that idiopathic inflammatory myopathy is a potential cause of myasthenia that must be considered in the differential. The case will also describe the current treatment and treatment response in polymyositis.

  9. Toxic myopathy in a dog associated with the presence of monensin in dry food.

    Science.gov (United States)

    Wilson, J S

    1980-01-01

    This report describes a case of toxic myopathy in a two year old sheltie dog with clinical signs of profound weakness, myoglobinuria, and muscle enzyme elevations. The clinical signs were likely related to the accidental inclusion of monensin sodium in the dog's food. This food was prepared by a small feed milling company that also prepares cattle and chicken rations. A change of dog food resulted in remission of the clinical signs.

  10. Toxic Myopathy in a Dog Associated with the Presence of Monensin in Dry Food

    OpenAIRE

    Wilson, J. S.

    1980-01-01

    This report describes a case of toxic myopathy in a two year old sheltie dog with clinical signs of profound weakness, myoglobinuria, and muscle enzyme elevations. The clinical signs were likely related to the accidental inclusion of monensin sodium in the dog's food. This food was prepared by a small feed milling company that also prepares cattle and chicken rations. A change of dog food resulted in remission of the clinical signs.

  11. Whole-body MRI for full assessment and characterization of diffuse inflammatory myopathy

    Directory of Open Access Journals (Sweden)

    Saleh Saleh Elessawy

    2016-09-01

    Full Text Available Background Conventional magnetic resonance imaging (MRI is a highly valuable tool for full assessment of the extent of bilateral symmetrical diffuse inflammatory myopathy, owing to its high sensitivity in the detection of edema which correlates with, and sometimes precedes, clinical findings. Purpose To evaluate the use of whole-body (WB-MRI in characterization and full assessment of the extent and distribution of diffuse inflammatory myopathy. Material and Methods A prospective study on 15 patients presenting with clinical evidence of inflammatory myopathy. It included 4 boys/men and 11 girls/women (age range, 6–44 years; mean age, 25.5 years. 1.5 T WB-MRI was performed and the distribution and extent of disease severity was assessed according to muscle edema on STIR images. Results Four cases of dermatomyositis showed lower limb disease predilection with edema in gluteal, thigh, and calf muscles. The same finding was seen in one case with recurrent polymyositis and three cases with overlap myositis with systemic lupus erythematosus (SLE. Bilateral upper and lower limb myositis was demonstrated in three cases of polymyositis and one case of overlap myositis with scleroderma. Bilateral edema involving all scanned muscle groups was detected in three cases of polymyositis with paraneoplastic syndrome, SLE, and severe active dermatomyositis (including the neck muscles. Conclusion WB-MRI is the diagnostic modality of choice for cases of inflammatory myopathy. It accurately detects the most severely affected muscles candidate for biopsy and provides a reliable baseline study for follow-up of disease progression as well as response to treatment.

  12. Apparent diffusion coefficient (ADC) does not correlate with different serological parameters in myositis and myopathy.

    Science.gov (United States)

    Meyer, Hans-Jonas; Ziemann, Oliver; Kornhuber, Malte; Emmer, Alexander; Quäschling, Ulf; Schob, Stefan; Surov, Alexey

    2018-06-01

    Background Magnetic resonance imaging (MRI) is widely used in several muscle disorders. Diffusion-weighted imaging (DWI) is an imaging modality, which can reflect microstructural tissue composition. The apparent diffusion coefficient (ADC) is used to quantify the random motion of water molecules in tissue. Purpose To investigate ADC values in patients with myositis and non-inflammatory myopathy and to analyze possible associations between ADC and laboratory parameters in these patients. Material and Methods Overall, 17 patients with several myositis entities, eight patients with non-inflammatory myopathies, and nine patients without muscle disorder as a control group were included in the study (mean age = 55.3 ± 14.3 years). The diagnosis was confirmed by histopathology in every case. DWI was obtained in a 1.5-T scanner using two b-values: 0 and 1000 s/mm 2 . In all patients, the blood sample was acquired within three days to the MRI. The following serological parameters were estimated: C-reactive protein, lactate dehydrogenase, alanine aminotransferase, aspartate aminotransferase, creatine kinase, and myoglobine. Results The estimated mean ADC value for the myositis group was 1.89 ± 0.37 × 10 -3  mm 2 /s and for the non-inflammatory myopathy group was 1.79 ± 0.33 × 10 -3  mm 2 /s, respectively. The mean ADC values (1.15 ± 0.37 × 10 -3  mm 2 /s) were significantly higher to unaffected muscles (vs. myositis P = 0.0002 and vs. myopathy P = 0.0021). There were no significant correlations between serological parameters and ADC values. Conclusion Affected muscles showed statistically significantly higher ADC values than normal muscles. No linear correlations between ADC and serological parameters were identified.

  13. Nuclear actin aggregation is a hallmark of anti-synthetase syndrome-induced dysimmune myopathy

    OpenAIRE

    Stenzel, W; Preusse, C; Allenbach, Y; Pehl, D; Junckerstorff, R; Heppner, F L; Nolte, K; Aronica, E; Kana, V; Rushing, E; Schneider, U; Claeys, K G; Benveniste, O; Weis, J; Goebel, H H

    2015-01-01

    Objective: To analyze antisynthetase syndrome–associated myositis by modern myopathologic methods and to define its place in the spectrum of idiopathic inflammatory myopathies (IIMs). Methods: Skeletal muscle biopsies from antisynthetase syndrome–associated myositis and other IIMs from different institutions worldwide were analyzed by histopathology, quantitative PCR, and electron microscopy. Results: Myonuclear actin filament inclusions were identified as a unique morphologic hallmark of a...

  14. Mutation-specific effects on thin filament length in thin filament myopathy.

    Science.gov (United States)

    Winter, Josine M de; Joureau, Barbara; Lee, Eun-Jeong; Kiss, Balázs; Yuen, Michaela; Gupta, Vandana A; Pappas, Christopher T; Gregorio, Carol C; Stienen, Ger J M; Edvardson, Simon; Wallgren-Pettersson, Carina; Lehtokari, Vilma-Lotta; Pelin, Katarina; Malfatti, Edoardo; Romero, Norma B; Engelen, Baziel G van; Voermans, Nicol C; Donkervoort, Sandra; Bönnemann, C G; Clarke, Nigel F; Beggs, Alan H; Granzier, Henk; Ottenheijm, Coen A C

    2016-06-01

    Thin filament myopathies are among the most common nondystrophic congenital muscular disorders, and are caused by mutations in genes encoding proteins that are associated with the skeletal muscle thin filament. Mechanisms underlying muscle weakness are poorly understood, but might involve the length of the thin filament, an important determinant of force generation. We investigated the sarcomere length-dependence of force, a functional assay that provides insights into the contractile strength of muscle fibers as well as the length of the thin filaments, in muscle fibers from 51 patients with thin filament myopathy caused by mutations in NEB, ACTA1, TPM2, TPM3, TNNT1, KBTBD13, KLHL40, and KLHL41. Lower force generation was observed in muscle fibers from patients of all genotypes. In a subset of patients who harbor mutations in NEB and ACTA1, the lower force was associated with downward shifted force-sarcomere length relations, indicative of shorter thin filaments. Confocal microscopy confirmed shorter thin filaments in muscle fibers of these patients. A conditional Neb knockout mouse model, which recapitulates thin filament myopathy, revealed a compensatory mechanism; the lower force generation that was associated with shorter thin filaments was compensated for by increasing the number of sarcomeres in series. This allowed muscle fibers to operate at a shorter sarcomere length and maintain optimal thin-thick filament overlap. These findings might provide a novel direction for the development of therapeutic strategies for thin filament myopathy patients with shortened thin filament lengths. Ann Neurol 2016;79:959-969. © 2016 American Neurological Association.

  15. Unfolded protein response and activated degradative pathways regulation in GNE myopathy.

    Directory of Open Access Journals (Sweden)

    Honghao Li

    Full Text Available Although intracellular beta amyloid (Aβ accumulation is known as an early upstream event in the degenerative course of UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE myopathy, the process by which Aβdeposits initiate various degradative pathways, and their relationship have not been fully clarified. We studied the possible secondary responses after amyloid beta precursor protein (AβPP deposition including unfolded protein response (UPR, ubiquitin proteasome system (UPS activation and its correlation with autophagy system. Eight GNE myopathy patients and five individuals with normal muscle morphology were included in this study. We performed immunofluorescence and immunoblotting to investigate the expression of AβPP, phosphorylated tau (p-tau and endoplasmic reticulum molecular chaperones. Proteasome activities were measured by cleavage of fluorogenic substrates. The expression of proteasome subunits and linkers between proteasomal and autophagy systems were also evaluated by immunoblotting and relative quantitative real-time RT-PCR. Four molecular chaperones, glucose-regulated protein 94 (GRP94, glucose-regulated protein 78 (GRP78, calreticulin and calnexin and valosin containing protein (VCP were highly expressed in GNE myopathy. 20S proteasome subunits, three main proteasome proteolytic activities, and the factors linking UPS and autophagy system were also increased. Our study suggests that AβPP deposition results in endoplasmic reticulum stress (ERS and highly expressed VCP deliver unfolded proteins from endoplasmic reticulum to proteosomal system which is activated in endoplasmic reticulum associated degradation (ERAD in GNE myopathy. Excessive ubiquitinated unfolded proteins are exported by proteins that connect UPS and autophagy to autophagy system, which is activated as an alternative pathway for degradation.

  16. Computed tomography and angiography in MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes)

    International Nuclear Information System (INIS)

    Hasuo, K.; Tamura, S.; Yasumori, K.; Uchino, A.; Masuda, K.; Goda, S.; Ishimoto, S.; Kamikaseda, K.; Wakuta, Y.; Kishi, M.

    1987-01-01

    Among mitochondrial encephalomyopathies, MELAS (mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes, Pavlakis et al., 1983) is recognized as a distinct syndrome characterized by generalized convulsions and recurrrent stroke-like episodes. The neuroradiological findings of three patients with MELAS are reported here. Retrospective review shows that MELAS should be included in the differential diagnosis of infarct-like lesions of the cerebrum. (orig.)

  17. Myopathy in hyperthyroidism as a consequence of rapid reduction of thyroid hormone

    OpenAIRE

    Li, Qianrui; Liu, Yuping; Zhang, Qianying; Tian, Haoming; Li, Jianwei; Li, Sheyu

    2017-01-01

    Abstract Rationale: Myalgia and elevated creatine kinase (CK) are occasionally observed during the treatment of hyperthyroid patients. Relative hypothyroidism resulted from rapid thyroid hormone reduction had been promoted as a plausible cause of these myopathic changes, however rarely reported. Patient concerns: We hereby presented a 20-year-old female with Grave's disease, who developed myopathy and elevated CK during rapid correction of thyroid hormone. Diagnoses: Relative hypothyroidism-i...

  18. Estimation of irradiated control rod worth

    International Nuclear Information System (INIS)

    Varvayanni, M.; Catsaros, N.; Antonopoulos-Domis, M.

    2009-01-01

    When depleted control rods are planned to be used in new core configurations, their worth has to be accurately predicted in order to deduce key design and safety parameters such as the available shutdown margin. In this work a methodology is suggested for the derivation of the distributed absorbing capacity of a depleted rod, useful in the case that the level of detail that is known about the irradiation history of the control rod does not allow an accurate calculation of the absorber's burnup. The suggested methodology is based on measurements of the rod's worth carried out in the former core configuration and on corresponding calculations based on the original (before first irradiation) absorber concentration. The methodology is formulated for the general case of the multi-group theory; it is successfully tested for the one-group approximation, for a depleted control rod of the Greek Research Reactor, containing five neutron absorbers. The computations reproduce satisfactorily the irradiated rod worth measurements, practically eliminating the discrepancy of the total rod worth, compared to the computations based on the nominal absorber densities.

  19. Nondestructive assay of HTGR fuel rods

    International Nuclear Information System (INIS)

    Menlove, H.O.

    1974-01-01

    Performance characteristics of three different radioactive source NDA systems are compared for the assay of HTGR fuel rods and stacks of rods. These systems include the fast neutron Sb-Be assay system, the 252 Cf ''Shuffler,'' and the thermal neutron PAPAS assay system. Studies have been made to determinethe perturbation on the measurements from particle size, kernel Th/U ratio, thorium content, and hydrogen content. In addition to the total 235 U determination, the pellet-to-pellet or rod-to-rod uniformity of HTGR fuel rod stacks has been measured by counting the delayed gamma rays with a NaI through-hole in the PAPAS system. These measurements showed that rod substitutions can be detected easily in a fuel stack, and that detailed information is available on the loading variations in a uniform stack. Using a 1.0 mg 252 Cf source, assay rates of 2 to 4 rods/s are possible, thus facilitating measurement of 100 percent of a plant's throughput. (U.S.)

  20. Control Rod Malfunction at the NRAD Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Thomas L. Maddock

    2010-05-01

    The neutron Radiography Reactor (NRAD) is a training, research, and isotope (TRIGA) reactor located at the INL. The reactor is normally shut down by the insertion of three control rods that drop into the core when power is removed from electromagnets. During a routine shutdown, indicator lights on the console showed that one of the control rods was not inserted. It was initially thought that the indicator lights were in error because of a limit switch that was out of adjustment. Through further testing, it was determined that the control rod did not drop when the scram switch was initially pressed. The control rod anomaly led to a six month shutdown of the reactor and an in depth investigation of the reactor protective system. The investigation looked into: scram switch operation, console modifications, and control rod drive mechanisms. A number of latent issues were discovered and corrected during the investigation. The cause of the control rod malfunction was found to be a buildup of corrosion in the control rod drive mechanism. The investigation resulted in modifications to equipment, changes to both operation and maintenance procedures, and additional training. No reoccurrences of the problem have been observed since corrective actions were implemented.

  1. French LMFBR's control rods experience and development

    International Nuclear Information System (INIS)

    Arnaud, G.; Guigon, A.; Verset, L.

    1983-06-01

    Since the last ten years, the French program has been, first of all, directed to the setting up, and then the development of, at once, the Phenix control rods, and next, the Super-Phenix ones. The vented pin design, with porous plug and sodium bonding, which allows the choices of large diameters, has been taken, since the Rapsodie experience was decisive. The absorber material is sintered, 10 B enriched, boron carbide. The can is made of 316 type stainless steel, stabilised, or not, with titanium. The experience gained in Phenix up to now is important, and deals with about six loads of control rods. Results confirm the validity of the design of the absorber pins. Some difficulties has been encountered for the guiding devices, due to the swelling of the steel. They have required design and material improvements. Such difficulties are discarded by a new design of the bearing, for the Super-Phenix control rods. The other parts of these rods, from the Primary Shut-Down System, are strictly derived from Phenix. The design of the rods from the Secondary Shut-Down System is rather different, but it's not the case for the design of the absorber pins: in many a way, they are derived from Phenix pins and from Rapsodie control rods. Both types of rods irradiation tests are in progress in Phenix [fr

  2. High-yield production of hydrophobins RodA and RodB from Aspergillus fumigatus in Pichia pastoris

    DEFF Research Database (Denmark)

    Pedersen, Mona Højgaard; Borodina, Irina; Moresco, Jacob Lange

    2011-01-01

    A as well as rRodB were able to convert a glass surface from hydrophilic to hydrophobic similar to native RodA, but only rRodB was able to decrease the hydrophobicity of a Teflon-like surface to the same extent as native RodA, while rRodA showed this ability to a lesser extent. Recombinant RodA and native...

  3. Radiological features of Paget disease of bone associated with VCP myopathy

    Energy Technology Data Exchange (ETDEWEB)

    Farpour, Farzin [University of California, Department of Radiology, VA Long Beach Health Care, Irvine, CA (United States); Queens Hospital Center, Mount Sinai School of Medicine, New York, NY (United States); Tehranzadeh, Jamshid [University of California, Department of Radiology, VA Long Beach Health Care, Irvine, CA (United States); Donkervoort, Sandra; Vanjara, Pari [University of California, Division of Genetics and Metabolism, Department of Pediatrics, Irvine, CA (United States); Smith, Charles [University of Kentucky, Department of Neurology and Sanders-Brown Center on Aging, Lexington, KY (United States); Martin, Barbara [University of Kentucky, Lexington, KY (United States); Osann, Kathryn [University of California, Department of Medicine, Division of Hematology/Oncology, Irvine, CA (United States); Kimonis, Virginia E. [University of California, Division of Genetics and Metabolism, Department of Pediatrics, Irvine, CA (United States); UC Irvine Medical Center, Division of Genetics and Metabolism, Orange, CA (United States)

    2012-03-15

    Mutations in the Valosin-containing protein (VCP) gene cause a unique disorder characterized by classic Paget disease of bone (PDB), inclusion body myopathy, and frontotemporal dementia (IBMPFD). Our objective was to analyze the radiographic features of PDB associated with VCP mutations since there is a dearth of literature on the PDB component of VCP disease. Radiographic bone surveys were examined in 23 individuals with VCP mutation and compared with their unaffected relatives. Laboratory testing relevant for VCP disease was performed in all individuals. Of the 17 affected individuals with clinical manifestations of VCP disease, 16 of whom had myopathy, radiographic analysis revealed classic PDB in 11 individuals (65%). The mean age of diagnosis for myopathy was 43.8 years and for PDB was 38.1 years of age. Radiological evidence of PDB was seen in one individual (16%) amongst six clinically asymptomatic VCP mutation carriers. Alkaline phosphatase was a useful marker for diagnosing PDB in VCP disease. Radiographic findings of classic PDB are seen in 52% of individuals carrying VCP mutations at a significantly younger age than conventional PDB. Screening for PDB is warranted in at-risk individuals because of the benefit of early treatment with the new powerful bisphosphonates that hold the potential for prevention of disease. (orig.)

  4. Insulin resistance and increased muscle cytokine levels in patients with mitochondrial myopathy.

    Science.gov (United States)

    Rue, Nana; Vissing, John; Galbo, Henrik

    2014-10-01

    Mitochondrial dysfunction has been proposed to cause insulin resistance and that might stimulate cytokine production. The objective of the study was to elucidate the association between mitochondrial myopathy, insulin sensitivity, and cytokine levels in muscle. This was an experimental, controlled study in outpatients. Eight overnight-fasted patients (P) with various inherited mitochondrial myopathies and eight healthy subjects (C) matched for sex, age, weight, height, and physical activity participated in the study. The intervention included a 120-minute hyperinsulinemic, euglycemic clamp. Another morning, microdialysis of both vastus lateralis muscles for 4 hours, including one-legged, knee extension exercise for 30 minutes, was performed. Glucose infusion rate during 90-120 minutes of insulin infusion was measured. Cytokine concentrations in dialysate were also measured. Muscle strength, percentage fat mass, and creatine kinase in plasma did not differ between groups. The maximal oxygen uptake was 21 ± 3 (SE) (P) and 36 ± 3(C) mL/kg·min (2P fatty acids and glycerol at 120 minutes were higher in P vs C (2P myopathies, insulin sensitivity of muscle, adipose tissue, and pancreatic A cells is reduced, supporting that mitochondrial function influences insulin action. Furthermore, a local, low-grade inflammation of potential clinical importance exists in the muscle of these patients.

  5. Rapid diagnosis of hypoglycin A intoxication in atypical myopathy of horses.

    Science.gov (United States)

    Sander, Johannes; Cavalleri, Jessika-M V; Terhardt, Michael; Bochnia, Mandy; Zeyner, Annette; Zuraw, Aleksandra; Sander, Stefanie; Peter, Michael; Janzen, Nils

    2016-03-01

    Hypoglycin A (2-amino-3-(2-methylidenecyclopropyl)propanoic acid) is the plant toxin shown to cause atypical myopathy in horses. It is converted in vivo to methylenecyclopropyl acetic acid, which is transformed to a coenzyme A ester that subsequently blocks beta oxidation of fatty acids. Methylenecyclopropyl acetic acid is also conjugated with carnitine and glycine. Acute atypical myopathy may be diagnosed by quantifying the conjugates of methylenecyclopropyl acetic acid plus a selection of acyl conjugates in urine and serum. We describe a new mass spectrometric method for sample volumes of acid in urine, the coefficients of variation for intraday quantification were 2.9% and 3.0%, respectively. The respective values for interday were 9.3% and 8.0%. Methylenecyclopropyl acetyl carnitine was detected as high as 1.18 µmol/L in serum (median: 0.46 µmol/L) and 1.98 mmol/mol creatinine in urine (median: 0.79 mmol/mol creatinine) of diseased horses, while the glycine derivative accumulated up to 1.97 mmol/mol creatinine in urine but was undetectable in most serum samples. In serum samples from horses with atypical myopathy, the intraday coefficients of variation for C4-C8 carnitines and glycines were ≤4.5%. Measured concentrations exceeded those in healthy horses by ~10 to 1,400 times. © 2015 The Author(s).

  6. The genetic basis of pectoralis major myopathies in modern broiler chicken lines.

    Science.gov (United States)

    Bailey, Richard A; Watson, Kellie A; Bilgili, S F; Avendano, Santiago

    2015-12-01

    This is the first report providing estimates of the genetic basis of breast muscle myopathies (BMM) and their relationship with growth and yield in broiler chickens. In addition, this paper addresses the hypothesis that genetic selection for increase breast yield has contributed to the onset of BMM. Data were analyzed from ongoing recording of BMM within the Aviagen breeding program. This study focused on three BMM: deep pectoral myopathy (DPM; binary trait), white striping (WS; 4 categories) and wooden breast (WB; 3 categories). Data from two purebred commercial broiler lines (A and B) were utilized providing greater than 40,000 meat quality records per line. The difference in selection history between these two lines has resulted in contrasting breast yield (BY): 29% for Line A and 21% for Line B. Data were analyzed to estimate genetic parameters using a multivariate animal model including six traits: body weight (BW), processing body weight (PW), BY, DPM, WB, and WS, in addition to the appropriate fixed effects and permanent environmental effect of the dam. Results indicate similar patterns of heritability and genetic correlations for the two lines. Heritabilities (h2) of BW, PW and BY ranged from 0.271-0.418; for DPM and WB h2white striping of breast muscle and more than 90% of the variance of the incidence of wooden breast and deep pectoral myopathy in broiler chickens. © The Author 2015. Published by Oxford University Press on behalf of Poultry Science Association.

  7. [Rhabdomyolysis - may it be a metabolic myopathy? Case report and diagnostic algorithm].

    Science.gov (United States)

    Sebők, Ágnes; Pál, Endre; Molnár, Gergő Attila; Wittmann, István; Berenténé Bene, Judit; Melegh, Béla; Komoly, Sámuel; Hidvégi, Tibor; Balogh, Lídia; Szabó, Attila; Zsidegh, Petra

    2017-11-01

    We report the case of a 46-year-old female patient with recurrent rhabdomyolysis. In the background of her metabolic myopathy an inherited metabolic disorder of the fatty acid oxidation, very long-chain acyl-coenzyme A-dehydrogenase deficiency was diagnosed. The diagnosis was based on abnormal acyl-carnitine- and urine organic-acid profile in addition to low residual enzyme activity, and was confirmed by genetic testing. After introduction of dietotherapy metabolic crisis necessitating hospital admission has not occurred neither have fixed myopathic changes developed. We present here the differential diagnosis of rhabdomyolysis and exertional muscle complaints, with the metabolic myopathies in focus. The main features of fatty acid oxidation disorders are highlighted, acute and chronic managements of very long-chain acyl-coenzyme A-dehydrogenase deficiency are discussed. Metabolic myopathies respond well to treatment, so good quality of life can be achieved. However, especially in fatty acid oxidation disorders, a metabolic crisis may develop quickly and can be fatal, albeit rarely. Some of these disorders can be identified by newborn screening, but occasionally the symptoms may manifest only in adulthood. With the presentation of this case we would like to point out that in the differential diagnosis of recurrent rhabdomyolysis inherited metabolic disorders should be considered regardless of the patient's age. Orv Hetil. 2017; 158(46): 1873-1882.

  8. Exertional Myopathy in a Juvenile Green Sea Turtle (Chelonia mydas Entangled in a Large Mesh Gillnet

    Directory of Open Access Journals (Sweden)

    Brianne E. Phillips

    2015-01-01

    Full Text Available A juvenile female green sea turtle (Chelonia mydas was found entangled in a large mesh gillnet in Pamlico Sound, NC, and was weak upon presentation for treatment. Blood gas analysis revealed severe metabolic acidosis and hyperlactatemia. Plasma biochemistry analysis showed elevated aspartate aminotransferase and creatine kinase, marked hypercalcemia, hyperphosphatemia, and hyperkalemia. Death occurred within 24 hours of presentation despite treatment with intravenous and subcutaneous fluids and sodium bicarbonate. Necropsy revealed multifocal to diffuse pallor of the superficial and deep pectoral muscles. Mild, multifocal, and acute myofiber necrosis was identified by histopathological examination. While histological changes in the examined muscle were modest, the acid-base, mineral, and electrolyte abnormalities were sufficiently severe to contribute to this animal’s mortality. Exertional myopathy in reptiles has not been well characterized. Sea turtle mortality resulting from forced submergence has been attributed to blood gas derangements and seawater aspiration; however, exertional myopathy may also be an important contributing factor. If possible, sea turtles subjected to incidental capture and entanglement that exhibit weakness or dull mentation should be clinically evaluated prior to release to minimize the risk of delayed mortality. Treatment with appropriate fluid therapy and supportive care may mitigate the effects of exertional myopathy in some cases.

  9. Genetic factors affecting statin concentrations and subsequent myopathy: a HuGENet systematic review

    Science.gov (United States)

    Canestaro, William J.; Austin, Melissa A.; Thummel, Kenneth E.

    2015-01-01

    Statins, 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase inhibitors, have proven efficacy in both lowering low-density-lipoprotein levels and preventing major coronary events, making them one of the most commonly prescribed drugs in the United States. Statins exhibit a class-wide side effect of muscle toxicity and weakness, which has led regulators to impose both dosage limitations and a recall. This review focuses on the best-characterized genetic factors associated with increased statin muscle concentrations, including the genes encoding cytochrome P450 enzymes (CYP2D6, CYP3A4, and CYP3A5), a mitochondrial enzyme (GATM), an influx transporter (SLCO1B1), and efflux transporters (ABCB1 and ABCG2). A systematic literature review was conducted to identify relevant research evaluating the significance of genetic variants predictive of altered statin concentrations and subsequent statin-related myopathy. Studies eligible for inclusion must have incorporated genotype information and must have associated it with some measure of myopathy, either creatine kinase levels or self-reported muscle aches and pains. After an initial review, focus was placed on seven genes that were adequately characterized to provide a substantive review: CYP2D6, CYP3A4, CYP3A5, GATM, SLCO1B1, ABCB1, and ABCG2. All statins were included in this review. Among the genetic factors evaluated, statin-related myopathy appears to be most strongly associated with variants in SLCO1B1. PMID:24810685

  10. Tc-99m ECD brain SPECT in MELAS syndrome and mitochondrial myopathy: comparison with MR findings

    International Nuclear Information System (INIS)

    Park, Sang Joon; Ryu, Young Hoon; Jeon, Tae Joo; Kim, Jai Keun; Nam, Ji Eun; Yoon, Pyeong Ho; Yoon, Choon Sik; Lee, Jong Doo

    1998-01-01

    We evaluated brain perfusion SPECT findings of MELAS syndrome and mitochondrial myopathy in correlation with MR imaging in search of specific imaging features. Subjects were five patients (four females and one male; age range, 1 to 25 year) who presented with repeated stroke like episodes, seizures or developmental delay or asymptomatic but had elevated lactic acid in CSF and serum. Conventional non-contrast MR imaging and Tc-99m-ethyl cysteinate dimer (ECD) brain perfusion SPECT were performed and imaging features were analyzed. MRI demonstrated increased T2 signal intensities in the affected areas of gray and white matters mainly in the parietal (4/5) and occipital lobes (4/5) and in the basal ganglia (1/5), which were not restricted to a specific vascular territory. SPECT demonstrated decreased perfusion in the corresponding regions of MRI lesions. In addition, there were perfusion defects in parietal (1 patient), temporal (2), and frontal (1) lobes and basal ganglia (1) and thalami (2). In a patient with mitochondrial myopathy who had normal MRI, decreased perfusion was noted in left parietal area and bilateral thalami. Tc-99m ECD SPECT imaging in patients with MELAS syndrome and mitochondrial myopathy showed hypoperfusion of parieto-occipital cortex, basal ganglia, thalamus and temporal cortex, which were not restricted to a specific vascular territory. There were no specific imaging features on SPECT. The significance of abnormal perfusion on SPECT without corresponding MR abnormalities needs to be evaluated further in larger number of patients

  11. [Value of MRI in the treatment of Grave's disease orbital myopathy].

    Science.gov (United States)

    Oğuz, V; Yolar, M; Yetik, H; Cakirer, D; Uysal, O; Pazarli, H

    2001-10-01

    In order to evaluate the predictability of the results in the treatment of myopathy in cases with the clinical signs of muscle involvement, 177 extraocular muscles of 27 cases whose oedematous status was detected by MRI and who were given antiinflammatory treatment according to the data of this method, were studied. The nature of involvement was detected in respect with the signal intensity and thickness of each rectus muscle prior to the treatment and at the end of the sixth month following a three months' application of combined treatment of steroids and irradiation of 2000 rads. When the initial and final results were compared, the signal intensities of four involved recti showed significant decrease at the end of the treatment, as they were evaluated separately or together. Besides the thicknesses of these groups of involved recti which were evaluated separately showed significant decrease. The evaluation of the signal intensities by MRI is a way that enables noninvasive detection of the edema and prediction of the anti-inflammatory treatment's results of dysthyroid myopathy. Therefore a systematic follow up by MRI is recommended for the treatment choice in dysthyroid myopathy.

  12. Control rod housing alignment and repair apparatus

    International Nuclear Information System (INIS)

    Dixon, R.C.; Deaver, G.A.; Punches, J.R.; Singleton, G.E.; Erbes, J.G.; Offer, H.P.

    1991-01-01

    This patent describes a welding a repair device for precisely locating and welding the position of the top of a control rod drive housing attached from a stub tube from a corresponding aperture and alignment pin in a core plate within a boiling water nuclear reactor, the welding and repair device. It comprises: a shaft, the shaft extending from the vicinity of the top of the control rod drive housing up to and through the aperture in the core plate; means for registering to the aperture and the alignment pin on the core plate; a fixture attached to the bottom end of the shaft for mating to the top of the control rod drive housing in precise mating relationship; the fixture attached to the bottom end of the shaft whereby the fixture, when mated to the control rod drove housing and the registering means when registered to the alignment pin and aperture on the core plate imparts to the shaft, and angularity between the top of the control rod drive housing and the hole in the core plate; a hollow cylinder, the cylinder mounted for depending and sealed support with respect to the shaft above, about and below the control rod drive housing top; the cylinder depending down below the control rod drive housing to an elevation below the top of the sub tube; a rotating welding apparatus with a welding head for dispensing weldment mounted for rotation with respect to the shaft; the welding head disposed at the juncture between the side of the control rod drive housing and the stub tube; and means for flooding the cylinder with gas whereby the cylinder may be lowered. flooded in a gas environment and effect a weld between the top of the stub tube and the control rod drive housing

  13. Control rod housing alignment and repair method

    International Nuclear Information System (INIS)

    Dixon, R.C.; Deaver, G.A.; Punches, J.R.; Singleton, G.E.; Erbes, J.G.; Offer, H.P.

    1992-01-01

    This patent describes a method for underwater welding of a control rod drive housing inserted through a stub tube to maintain requisite alignment and elevation of the top of the control rod drive housing to an overlying and corresponding aperture in a core plate as measured by an alignment device which determines the relative elevation and angularity with respect to the aperture. It comprises providing a welding cylinder dependent from the alignment device such that the elevation of the top of the welding cylinder is in a fixed relationship to the alignment device and is gas-proof; pressurizing the welding cylinder with inert welding gas sufficient to maintain the interior of the welding cylinder dry; lowering the welding cylinder through the aperture in the core plate by depending the cylinder with respect to the alignment device, the lowering including lowering through and adjusting the elevation relationship of the welding cylinder to the alignment device such that when the alignment device is in position to measure the elevation and angularity of the new control rod drive housing, the lower distal end of the welding cylinder extends below the upper periphery of the stub where welding is to occur; inserting a new control rod drive housing through the stub tube and positioning the control rod drive housing to a predetermined relationship to the anticipated final position of the control rod drive housing; providing welding implements transversely rotatably mounted interior of the welding cylinder relative to the alignment device such that the welding implements may be accurately positioned for dispensing weldment around the periphery of the top of the stub tube and at the side of the control rod drive housing; measuring the elevation and angularity of the control rod drive housing; and dispensing weldment along the top of the stub tube and at the side of the control rod drive housing

  14. Apparatus for handling control rod drives

    International Nuclear Information System (INIS)

    Akimoto, A.; Watanabe, M.; Yoshida, T.; Sugaya, Z.; Saito, T.; Ishii, Y.

    1979-01-01

    An apparatus for handling control rod drives (CRD's) attached by detachable fixing means to housings mounted in a reactor pressure vessel and each coupled to one of control rods inserted in the reactor pressure vessel is described. The apparatus for handling the CRD's comprise cylindrical housing means, uncoupling means mounted in the housing means for uncoupling each of the control rods from the respective CRD, means mounted on the housing means for effecting attaching and detaching of the fixing means, means for supporting the housing means, and means for moving the support means longitudinally of the CRD

  15. Depletion calculations of adjuster rods in Darlington

    Energy Technology Data Exchange (ETDEWEB)

    Arsenault, B.; Tsang, K., E-mail: benoit.arsenault@amecfw.com, E-mail: kwok.tsang@amecfw.com [AMEC Foster Wheeler, Toronto, ON (Canada)

    2015-07-01

    This paper describes the simulation methodology and reactivity worth calculated for aged adjuster rods in the Darlington core. ORIGEN-S IST was applied to simulate the isotope transmutation process of the stainless steel and titanium adjusters. The compositions were used in DRAGON-IST to calculate the change in incremental properties of aged adjusters. Pre-simulations of the reactivity worth of the stainless steel and titanium adjusters in Darlington were performed using RFSP-IST and the results showed that the titanium adjuster rods exhibit faster reactivity-worth drop than that of stainless steel rods. (author)

  16. LOFT fuel rod pressure measurement

    International Nuclear Information System (INIS)

    Billeter, T.R.

    1979-01-01

    Pressure sensors selected for measuring fuel rod pressure within the LOFT reactor exhibited stable, repeatable operating characteristics during calibrations at temperatures up to 800 0 F and pressures to 2500 psig. All sensors have a nominal sensitivity of .5 millivolts per psi, decreasing monotonically with temperature. Output signal increases linearly with increasing pressure up to 2000 psig. For imposed slow and rapid temperature variations and for pressure applied during these tests, the sensor indicates a pressure at variance with the actual value by up to 15% of reading. However, the imposed temperature rates of change often exceeded the value of -10 0 F/sec. specified for LOFT. The series of tests in an autoclave permit creation of an environment most closely resembling sensor operating conditions within LOFT. For multiple blowdowns and for longtime durations the sensor continued to provide pressure-related output signals. For temperature rates up to -87 0 F/sec, the indicated pressure measurement error remained less than 13% of reading. Adverse effects caused by heating the 1/16 inch O.D. signal cable to 800 0 F contributed only insignificantly to the noted pressure measurement error

  17. Dry rod consolidation technology development

    International Nuclear Information System (INIS)

    Rasmussen, T.L.; Schoonen, D.H.; Feldman, E.M.; Fisher, M.W.

    1987-01-01

    The Department of Energy's (DOE) Office of Civilian Radioactive Waste Management (OCRWM) is funding a program to consolidate commercial spent fuel for testing in dry storage casks and to develop technology that will be fed into other OCRWM programs, e.g., Prototypical Consolidation Demonstration Program (PCDP). The program is being conducted at the Idaho National Engineering Laboratory (INEL) by the INEL Operating Contractor EG and G Idaho, Inc. Hardware and software have been designed and fabricated for installation in a hot cell adjacent to the Test Area North (TAN) Hot Shop Facility. This equipment is used to perform dry consolidation of commercial spent fuel from the Virginia Power (VP) Cooperative Agreement Spent Fuel Storage Cask (SFSC) Demonstration Program and assemblies that had previously been stored at the Engine Maintenance and Disassembly (EMAD) facility in Nevada. Consolidation is accomplished by individual, horizontal rod pulling. A computerized semiautomatic control system with operator involvement is utilized to conduct consolidation operations. During consolidation operations, data is taken to characterize this technology. Still photo, video tape, and other documentation will be generated to make developed information available to interested parties. Cold checkout of the hardware and software was completed in September of 1986. Following installation in the hot cell, consolidation operations begins in May 1987. Resulting consolidated fuel will be utilized in the VP Cooperative Agreement SFSC Program

  18. Water rod and fuel assembly

    International Nuclear Information System (INIS)

    Tsutsumi, Shinro; Tada, Nobuo; Nakajima, Junjiro; Aizawa, Yasuhiro.

    1995-01-01

    A water rod disposed in a fuel assembly comprises a larger diameter tube constituting an upwarding flow channel for coolants flown from the lower portion of a reactor core, and a smaller diameter tube connected fixedly to the larger diameter tube at the periphery of the upper end thereof and constituting a downwarding flow channel for coolants upwardly flown in the larger diameter tube. The larger diameter tube is formed by subjecting a base tube made of a zirconium alloy to PILGER mil fabrication and annealing in α region repeatingly for several times, then subjecting it to α + β treatment for once. The smaller diameter tube is formed by subjecting a base tube made of a zirconium alloy to PILGER mil fabrication and annealing in α region repeatingly for several times, then subjecting it to β treatment for once. With such procedures, the amount of irradiation growth of the tube in the axial direction is made greater in the larger diameter tube than that in the smaller diameter tube. Accordingly, since the smaller diameter tube is never bent by pressing, mechanical integrity of the fuel assembly is never lost. (I.N.)

  19. Taylor impact of glass rods

    International Nuclear Information System (INIS)

    Willmott, G.R.; Radford, D.D.

    2005-01-01

    The deformation and fracture behavior of soda-lime and borosilicate glass rods was examined during classic and symmetric Taylor impact experiments for impact pressures to 4 and 10 GPa, respectively. High-speed photography and piezoresistive gauges were used to measure the failure front velocities in both glasses, and for impact pressures below ∼2 GPa the failure front velocity increases rapidly with increasing pressure. As the pressure was increased above ∼3 GPa, the failure front velocities asymptotically approached maximum values between the longitudinal and shear wave velocities of each material; at ∼4 GPa, the average failure front velocities were 4.7±0.5 and 4.6±0.5 mm μs -1 for the soda-lime and borosilicate specimens, respectively. The observed mechanism of failure in these experiments involved continuous pressure-dependent nucleation and growth of microcracks behind the incident wave. As the impact pressure was increased, there was a decrease in the time to failure. The density of cracks within the failed region was material dependent, with the more open-structured borosilicate glass showing a larger fracture density

  20. Control rod drive hydraulic device

    International Nuclear Information System (INIS)

    Takekawa, Toru.

    1994-01-01

    The device of the present invention can reliably prevent a possible erroneous withdrawal of control rod driving mechanism when the pressure of a coolant line is increased by isolation operation of hydraulic control units upon periodical inspection for a BWR type reactor. That is, a coolant line is connected to the downstream of a hydraulic supply device. The coolant line is connected to a hydraulic control unit. A coolant hydraulic detection device and a pressure setting device are disposed to the coolant line. A closing signal line and a returning signal line are disposed, which connect the hydraulic supply device and a flow rate control valve for the hydraulic setting device. In the device of the present invention, even if pressure of supplied coolants is elevated due to isolation of hydraulic control units, the elevation of the hydraulic pressure can be prevented. Accordingly, reliability upon periodical reactor inspection can be improved. Further, the facility is simplified and the installation to an existent facility is easy. (I.S.)

  1. Control rod for a nuclear reactor

    International Nuclear Information System (INIS)

    Roman, W.G.; Sutton, H.G. Jr.

    1976-01-01

    A control rod assembly for a nuclear reactor is disclosed having a remotely disengageable coupling between the control rod and the control rod drive shaft. The coupling is actuated by first lowering then raising the drive shaft. The described motion causes axial repositioning of a pin in a grooved rotatable cylinder, each being attached to different parts of the drive shaft which are axially movable relative to each other. In one embodiment, the relative axial motion of the parts of the drive shaft is used either to couple or to uncouple the connection by forcing resilent members attached to the drive shaft into or out of shouldered engagement, respectively, with an indentation formed in the control rod

  2. Control rod position detector for nuclear reactor

    International Nuclear Information System (INIS)

    Kudo, Mitsuru; Fujiwara, Hiroshi.

    1981-01-01

    Purpose: To improve the reliability of a control rod position detector by detecting a reactive code with a combination of control rod position change signals produced from vertical and horizontal axis decoders, generation an error signal and thus simultaneously detecting the operation of more than two lead switches. Constitution: Horizontal and vertical axis position signals responsive to changes in the control rod position are applied from lead switches connected in a predetermined matrix connection corresponding to the notches of the positions of respective position detecting probes, the reactive output from the decoder is detected by a reactive code detecting circuit, which in turn generates a fault signal, and the control rod position code converted in a notch number generating circuit is converted to a predetermined value indicating invalidity. Accordingly, a fault caused by the simultaneous operation of a plurality of failed lead switches can be effectively detected. (Yoshino, Y.)

  3. Control rod for a nuclear reactor

    Science.gov (United States)

    Roman, Walter G.; Sutton, Jr., Harry G.

    1979-01-01

    A control rod assembly for a nuclear reactor is disclosed having a remotely disengageable coupling between the control rod and the control rod drive shaft. The coupling is actuated by first lowering then raising the drive shaft. The described motion causes axial repositioning of a pin in a grooved rotatable cylinder, each being attached to different parts of the drive shaft which are axially movable relative to each other. In one embodiment, the relative axial motion of the parts of the drive shaft is used either to couple or to uncouple the connection by forcing resilient members attached to the drive shaft into or out of shouldered engagement, respectively, with an indentation formed in the control rod.

  4. Rod bundle burnout data and correlation comparisons

    International Nuclear Information System (INIS)

    Yoder, G.L.; Morris, D.G.; Mullins, C.B.

    1985-01-01

    Rod bundle burnout data from 30 steady-state and 3 transient tests were obtained from experiments performed in the Thermal Hydraulic Test Facility at the Oak Ridge National Laboratory. The tests covered a parameter range relevant to intact core reactor accidents ranging from large break to small break loss-ofcoolant conditions. Instrumentation within the 64-rod test section indicated that burnout occurred over an axial range within the bundle. The distance from the point where the first dry rod was detected to the point where all rods were dry was up to 60 cm in some of the tests. The burnout data should prove useful in developing new correlations for use in reactor thermalhydraulic codes. Evaluation of several existing critical heat flux correlations using the data show that three correlations, the Barnett, Bowring, and Katto correlations, perform similarly and correlate the data better than the Biasi correlation

  5. Genetics Home Reference: cone-rod dystrophy

    Science.gov (United States)

    ... common cause of autosomal recessive cone-rod dystrophy , accounting for 30 to 60 percent of cases. At ... dystrophy play essential roles in the structure and function of specialized light receptor cells (photoreceptors) in the ...

  6. Stabilizing device for control rod tip

    International Nuclear Information System (INIS)

    Verdone, G.F.

    1982-01-01

    A control rod has a spring device on its lower end for eliminating oscillatory contact of the rod against its adjacent guide tube wall. The base of the device is connected to the lower tip of the rod. A plurality of elongated extensions are cantilevered downward from the base. Each extension has a shoulder for contacting the guide tube, and the plurality of shoulders as a group has a transverse dimension that is preset to be larger than the inner diameter of the guide tube such that an interference fit is obtained when the control rod is inserted in the tube. The elongated extensions form an open-ended, substantially hollow member through which most of the liquid coolant flows, and the spaces between adjacent extensions allow the flow to bypass the shoulders without experiencing a significant pressure drop

  7. Control rod drive of nuclear reactor

    International Nuclear Information System (INIS)

    Zhuchkov, I.I.; Gorjunov, V.S.; Zaitsev, B.I.

    1980-01-01

    This invention relates to nuclear reactors and, more particularly, to a drive of a control rod of a nuclear reactor and allows power control, excess reactivity compensation, and emergency shut-down of a reactor. (author)

  8. Control rod for a nuclear reactor

    International Nuclear Information System (INIS)

    Roman, W.G.; Sutton, H.G. Jr.

    1979-01-01

    A control rod assembly for a nuclear reactor is disclosed having a remotely disengageable coupling between the control rod and the control rod drive shaft. The coupling is actuated by first lowering then raising the drive shaft. The described motion causes axial repositioning of a pin in a grooved rotatable cylinder, each being attached to different parts of the drive shaft which are axially movable relative to each other. In one embodiment, the relative axial motion of the parts of the drive shaft is used either to couple or to uncouple the connection by forcing resilient members attached to the drive shaft into or out of shouldered engagement, respectively, with an indentation formed in the control rod

  9. Intrasacral rod fixation for pediatric lumbopelvic fusion.

    Science.gov (United States)

    Ilharreborde, Brice; Mazda, Keyvan

    2014-07-01

    This paper reports the authors' 19 years experience with pediatric intrasacral rod fixation. After insertion of two cannulated screws in S1 with and an original template guiding them into the anterior third of the endplate, two short fusion rods were inserted into the sacrum according to Jackson's technique distally to S3. In neuromuscular scoliosis, pelvic obliquity was reduced by connecting the proximal and distal constructs, distraction or compression, and in situ rod bending. In children with high-grade spondylolisthesis, lumbosacral kyphosis was reduced by rotation of the sacrum and in situ bending. There were no direct neurological or vascular injuries. The main complication was infection (7%). No pseudarthrosis or significant loss of correction at the lumbosacral junction was observed during follow-up. Intrasacral rod fixation appears to be safe and reliable for lumbopelvic fusion in pediatric patients.

  10. Cutting system for burnable poison rod

    International Nuclear Information System (INIS)

    Shiina, Atsushi; Toyama, Norihide; Koshino, Yasuo; Fujii, Toshio

    1989-01-01

    Burnable poison rods attached to spent fuels are contained in a containing box and transported to a receiving pool. The burnable poison rod-containing box is provisionally situated by the operation to a handling device to a provisional setting rack in a cutting pool and attached to a cutting guide of a cutting device upon cutting. The burnable poison rod is cut only in a cutting pool water and tritium generated upon cutting is dissolved into the cutting pool water. Diffusion of tritium is thus restricted. Further, the cutting pool is isolated by a partition device from the receiving pool during cutting of the burnable poison rod. Accordingly, water in which tritium is dissolved is inhibited from moving to the receiving pool and prevail of tritium contamination can be avoided. (T.M.)

  11. Detection device for control rod scram

    International Nuclear Information System (INIS)

    Ishiyama, Satoshi.

    1989-01-01

    The device of the present invention comprises a control rod dropping separately from a control rod driving mechanism main body, a following tube falling separately accompanying therewith and a guide tube for guiding the dropping of the control rod and the following tube. Further, rare earth permanent magnets are embedded with the pole being axially oriented in the following tube and bobbins each mounted with an inner flange made of high magnetic permeability material are disposed to the guide tube. Coils are wound in the bobbin. In this control rod scram detection device, since magnetic fluxes can effectively be supplied to the coils, it is possible to obtain stable and highly reliable scram detection signals. Further, since the coils and the bobbins can be manufactured separately from the guide tube, their assemblies can be tested independently from the guide tube. (K.M.)

  12. Freely suspended rod fall dampener, especially for control rod of liquid-cooled nuclear reactor

    International Nuclear Information System (INIS)

    Becvar, J.; Saroch, V.

    1977-01-01

    A shock absorber is described whose advantage is that the space required for the movement of the shock absorber in the operating travel of the system suspension rod-control rod bundle may be reduced. The design allows the automatic disconnection of the system and the removal of the suspension rod from the reactor without dismantling. The braking force reaction is transmitted to the structure above the core. The system fall energy is absorbed on the side of the suspension rod which has a bigger mass. (J.B.)

  13. Control rod for FBR type reactor

    International Nuclear Information System (INIS)

    Nakai, Koichi.

    1993-01-01

    In a control rod for an LMFBR type reactor, a thermal resistor is disposed between a temperature sensitive cylinder and a cam unit support rod. A thermal expansion difference due to the temperature difference is caused between the temperature sensitive cylinder and the cam unit support rod only upon abrupt temperature change of coolants. A control rod shaft extending mechanism of downwardly depressing an absorbent portion by amplifying the thermal expansion difference by an extension link mechanism and the cam unit is provided. The thermal resistor comprises inconel 625 or like other steel of small heat conductivity. If a certain abnormality should cause to the reactor system to elevate the coolant temperature in the reactor elevates abruptly and the reactor shutdown system does not actuate, since the control rod extension shaft extends to urge the absorbent and lower the reactor core reactivity, so that leading to serious accident can be prevented surely. Further, the control rod extension shaft does not extend upon moderate temperature elevation in the usual startup and causes no unnecessary reactivity change. (N.H.)

  14. Control rod supporting device in reactor

    International Nuclear Information System (INIS)

    Seki, Osamu; Itooka, Satoshi; Harada, Kiyoshi; Jodoi, Takashi.

    1990-01-01

    Since coolants flowing from a reactor core hit against a control rod and a control rod connection pipe, a considerable amount of bending moment for separating an attracting surface between an electromagnet and an armature is formed. Then, a plurality of grooves are formed on a heat sensitive material to dispose a heat collecting fin, and each of upper and lower contact portions of a control rod supporting portion in which the flanged portion of T-like cross section does not slip out is made into a partial spheric surface and a portion between the electromagnet and the attracted member are engaged by the unevenness. With such a constitution, even if a bending moment is applied, the control rod only swings and the bending moment is not transmitted to the attracted member. Further, since the temperature of the heat sensitive material can be rapidly made closer to the peripheral temperature by using the heat collecting fin, the timing for separation is made accurate. Further, since the engaging portion is brought into contact at the spheric surface, the load distribution on the control rod is made uniform, and the positional relationship is made accurate, to support the control rod reliably and the separation depends only on the temperature of the coolants. (N.H.)

  15. Control rod excess withdrawal prevention device

    International Nuclear Information System (INIS)

    Takayama, Yoshihito.

    1992-01-01

    Excess withdrawal of a control rod of a BWR type reactor is prevented. That is, the device comprises (1) a speed detector for detecting the driving speed of a control rod, (2) a judging circuit for outputting an abnormal signal if the driving speed is greater than a predetermined level and (3) a direction control valve compulsory closing circuit for controlling the driving direction of inserting and withdrawing a control rod based on an abnormal signal. With such a constitution, when the with drawing speed of a control rod is greater than a predetermined level, it is detected by the speed detector and the judging circuit. Then, all of the direction control valve are closed by way of the direction control valve compulsory closing circuit. As a result, the operation of the control rod is stopped compulsorily and the withdrawing speed of the control rod can be lowered to a speed corresponding to that upon gravitational withdrawal. Accordingly, excess withdrawal can be prevented. (I.S)

  16. Method for compacting spent nuclear reactor fuel rods

    International Nuclear Information System (INIS)

    Wachter, W.J.

    1988-01-01

    In a nuclear reactor system which requires periodic physical manipulation of spent fuel rods, the method of compacting fuel rods from a fuel rod assembly is described. The method consists of: (1) removing the top end from the fuel rod assembly; (2) passing each of multiple fuel rod pulling elements in sequence through a fuel rod container and thence through respective consolidating passages in a fuel rod directing chamber; (3) engaging one of the pulling elements to the top end of each of the fuel rods; (4) drawing each of the pulling elements axially to draw the respective engaged fuel rods in one axial direction through the respective the passages in the chamber to thereby consolidate the fuel rods into a compacted configuration of a cross-sectional area smaller than the cross-sectional area occupied thereby within the fuel rod assembly; and (5) drawing all of the engaged fuel rods concurrently and substantially parallel to one another in the one axial direction into the fuel rod container while maintaining the compacted configuration whereby the fuel rods are aligned within the container in a fuel rod density of the the fuel rod assembly

  17. International symposium on fuel rod simulators: development and application

    Energy Technology Data Exchange (ETDEWEB)

    McCulloch, R.W. (comp.)

    1981-05-01

    Separate abstracts are included for each of the papers presented concerning fuel rod simulator operation and performance; simulator design and evaluation; clad heated fuel rod simulators and fuel rod simulators for cladding investigations; fuel rod simulator components and inspection; and simulator analytical modeling. Ten papers have previously been input to the Energy Data Base.

  18. Diagnosis of myocardial involvement in patients with systemic myopathies with 15-(p-[I-123]iodophenyl) pentadecanoic acid (IPPA) SPECT

    Energy Technology Data Exchange (ETDEWEB)

    Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St. [Bonn Univ. (Germany); Knapp, F.F. [Oak Ridge National Lab., TN (United States)

    1992-03-01

    Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-[I-123]iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of {beta}-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques.

  19. Diagnosis of myocardial involvement in patients with systemic myopathies with 15-(p-(I-123)iodophenyl) pentadecanoic acid (IPPA) SPECT

    Energy Technology Data Exchange (ETDEWEB)

    Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St. (Bonn Univ. (Germany)); Knapp, F.F. (Oak Ridge National Lab., TN (United States))

    1992-01-01

    Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-(I-123)iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of {beta}-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques.

  20. Diagnosis of myocardial involvement in patients with systemic myopathies with 15-(p-[I-123]iodophenyl) pentadecanoic acid (IPPA) SPECT

    International Nuclear Information System (INIS)

    Kropp, J.; Briele, B.; Smekal, A.V.; Hotze, A.L.; Biersack, H.J.; Koehler, U.; Zierz, St.; Knapp, F.F.

    1992-01-01

    Involvement of the myocardium in non-infectious myopathies presents in most cases as systolic dysfunction or a disturbed cardiac rhythm. We are interested in exploring how often cardiac involvement can be evaluated with various diagnostic techniques in patients with proven myopathy. We investigated 41 patients with myopathies of various etiology, including mitochondrial and congenital myopathies, Curshmann-Steinert disease, muscular dystrophy, and others. Myopathy was proven by muscular biopsy usually from the bicep. Fatty acid imaging was performed with 15-(p-[I-123]iodophenyl)pentadecanoic acid (IP-PA) and sequential SPECT-scintigraphy with a 180 deg. rotation starting at the 45 deg. RAO position. 190 MBq were injected at the maximal stage of a submaximal exercise. Filtered backprojection and reorientation of the slices were achieved by standard techniques. The quantitative comparison of the oblique slices (bulls-eye technique) of the SPECT-studies revealed turnover-rates as a qualitative measure of β-oxidation. Serum levels of lactate (L), pyruvate (P), glucose (G) and triglycerides (TG) were measured at rest and stress. Ventricular function was investigated by radionuclide ventriculography (MUGA) at rest and under stress with Tc-99m labeled red blood cells. In addition, ECG, 24 hour-ECG, and echocardiography were also performed with standard techniques

  1. Statin myopathy: the fly in the ointment for the prevention of cardiovascular disease in the 21st century?

    Science.gov (United States)

    Keen, Helen I; Krishnarajah, Janakan; Bates, Timothy R; Watts, Gerald F

    2014-09-01

    Cardiovascular disease (CVD) remains the leading cause of death in industrialized nations. Despite clear evidence of CVD risk reduction with HMG-CoA reductase inhibitors (statins), the side effects of these medications, particularly myopathy, limit their effectiveness. Studies into the mechanisms, aetiology and management of statin myopathy are limited by lack of an internationally agreed clinical definition and tools for assessing outcomes. Currently there is a paucity of evidence to guide the management of patients affected by statin myopathy; with the exception of dose reduction, there is little evidence that other strategies can improve statin tolerance, and even less evidence to suggest these alternate dosing strategies reduce cardiovascular risk. This review will cover current definitions, clinical presentations, risk factors, pathogenesis and management. PubMed was searched (English language, to 2014) for key articles pertaining to statin myopathy. This review then briefly describes our experience of managing this condition in a tertiary lipid disorders clinic, in the setting of limited guiding evidence. Knowledge gaps in the field of statin myopathy are identified and future research directions are suggested. We urge the need for international attention to address this important, but largely neglected clinical problem, that if unresolved will remain an impediment to the effective prevention and treatment of CVD.

  2. Regulatory perspective on incomplete control rod insertions

    International Nuclear Information System (INIS)

    Chatterton, M.

    1997-01-01

    The incomplete control rod insertions experienced at South Texas Unit 1 and Wolf Creek are of safety concern to the NRC staff because they represent potential precursors to loss of shutdown margin. Even before it was determined if these events were caused by the control rods or by the fuel there was an apparent correlation of the problem with high burnup fuel. It was determined that there was also a correlation between high burnup and high drag forces as well as with rod drop time histories and lack of rod recoil. The NRC staff initial actions were aimed at getting a perspective on the magnitude of the problem as far as the number of plants and the amount of fuel that could be involved, as well as the safety significance in terms of shutdown margin. As tests have been performed and data has been analyzed the focus has shifted more toward understanding the problem and the ways to eliminate it. At this time the staff's understanding of the phenomena is that it was a combination of factors including burnup, power history and temperature. The problem appears to be very sensitive to these factors, the interaction of which is not clearly understood. The model developed by Westinghouse provides a possible explanation but there is not sufficient data to establish confidence levels and sensitivity studies involving the key parameters have not been done. While several fixes to the problem have been discussed, no definitive fixes have been proposed. Without complete understanding of the phenomena, or fixes that clearly eliminate the problem the safety concern remains. The safety significance depends on the amount of shutdown margin lost due to incomplete insertion of the control rods. Were the control rods to stick high in the core, the reactor could not be shutdown by the control rods and other means such as emergency boration would be required

  3. Skeletal muscle-specific HMG-CoA reductase knockout mice exhibit rhabdomyolysis: A model for statin-induced myopathy.

    Science.gov (United States)

    Osaki, Yoshinori; Nakagawa, Yoshimi; Miyahara, Shoko; Iwasaki, Hitoshi; Ishii, Akiko; Matsuzaka, Takashi; Kobayashi, Kazuto; Yatoh, Shigeru; Takahashi, Akimitsu; Yahagi, Naoya; Suzuki, Hiroaki; Sone, Hirohito; Ohashi, Ken; Ishibashi, Shun; Yamada, Nobuhiro; Shimano, Hitoshi

    2015-10-23

    HMG-CoA reductase (HMGCR) catalyzes the conversion of HMG-CoA to mevalonic acid (MVA); this is the rate-limiting enzyme of the mevalonate pathway that synthesizes cholesterol. Statins, HMGCR inhibitors, are widely used as cholesterol-reducing drugs. However, statin-induced myopathy is the most adverse side effect of statins. To eludicate the mechanisms underlying statin the myotoxicity and HMGCR function in the skeletal muscle, we developed the skeletal muscle-specific HMGCR knockout mice. Knockout mice exhibited postnatal myopathy with elevated serum creatine kinase levels and necrosis. Myopathy in knockout mice was completely rescued by the oral administration of MVA. These results suggest that skeletal muscle toxicity caused by statins is dependent on the deficiencies of HMGCR enzyme activity and downstream metabolites of the mevalonate pathway in skeletal muscles rather than the liver or other organs. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. RODDRP - A FORTRAN program for use in control rod calibration by the rod drop method

    International Nuclear Information System (INIS)

    Wilson, W.E.

    1972-01-01

    The different methods to measure reactivity which are applicable to control rod calibration are discussed. They include: 1) the positive period method, 2) the rod drop method, 3) the source-jerk method, 4) the rod oscillation method, and 5) the pulsed neutron method. The instrument setup used at WSU for rod drop measurements is presented. To speed up the analysis of power fall-off trace, a FORTRAN IV program called RODDRP was written to simultaneously solve the in-hour equation and relative neutron flux. The procedure for calculating the worth of the rod that produced the power trace is given. The reactivity for each time relative flux point is obtained. Conclusions about the status of the equipment are made

  5. Evaluation of inflammatory biomarkers associated with oxidative stress and histological assessment of magnetic therapy on experimental myopathy in rats.

    Science.gov (United States)

    Vignola, María Belén; Dávila, Soledad; Cremonezzi, David; Simes, Juan C; Palma, José A; Campana, Vilma R

    2012-12-01

    The effect of pulsed electromagnetic field (PEMF) therapy, also called magnetic therapy, upon inflammatory biomarkers associated with oxidative stress plasma fibrinogen, nitric oxide (NO), L-citrulline, carbonyl groups, and superoxide dismutase (SOD) was evaluated through histological assessment, in rats with experimental myopathy. The groups studied were: (A) control (intact rats that received PEMF sham exposures); (B) rats with myopathy and sacrificed 24 h later; (C) rats with myopathy; (D) rats with myopathy and treated with PEMF; and (E) intact rats treated with PEMF. Groups A, C, D, and E were sacrificed 8 days later. Myopathy was induced by injecting 50 μl of 1% carrageenan λ (type IV) once sub-plantar. Treatment was carried out with PEMF emitting equipment with two flat solenoid disks for 8 consecutive days in groups D and E, at 20 mT and 50 Hz for 30 min/day/rat. The biomarkers were determined by spectrophotometry. The muscles (5/8) were stained with Hematoxylin-Eosin and examined by optic microscopy. Quantitative variables were statistically analyzed by the Fisher test, and categorical applying Pearson's Chi Squared test at p < 0.05 for all cases. In Groups B and C, the biomarkers were significantly increased compared to A, D, and E groups: fibrinogen (p < 0.001); NO, L-citrulline and carbonyl groups (p < 0.05); SOD (p < 0.01) as well as the percentage of area with inflammatory infiltration (p < 0.001). PEMF caused decreased levels of fibrinogen, L-citrulline, NO, SOD, and carbonyl groups and significant muscle recovery in rats with experimental myopathies.

  6. Subclinical myopathy in patients with colorectal cancer: clinical-pathological characterization and search for tissue markers

    Directory of Open Access Journals (Sweden)

    Massimo Vecchiato

    2012-03-01

    Full Text Available Skeletal muscle in patients with cancer undergoes many morphological changes due to immuno-inflammatory factors of tumor origin or treatment.T he latest event of these changes is cancer cachexia. Aim of the study is to identify myopathic features in skeletal muscle biopsies from weight stable patients with colorectal cancer and without cachexia or asthenia / weakness, that could possibly provide new diagnostic and prognostic cancer biomarkers. Morphometric analyses and immunohistochemical studies were performed on intraoperative muscle biopsies from patients with colorectal cancer and from weight stable patients undergoing surgery for benign non-inflammatory conditions. A rectus abdominis biopsy was taken in all patients and controls.A correlation between histopathologic findings and clinical characteristics, circulating inflammatory biomarkers and markers of muscle necrosis,surgery data and cancer phenotype were investigated.. Forty four patients (21male/23 female and 17 controls (6 male/11 female (p=NS were studied. In cancer patients’biopsies we observed asubclinical myopathy characterized by an abnormal distribution of myonuclei, which are localized inside the myofiber rather than at the periphery, and by the presence of regenerating muscle fibers. The percentage of myofibers with internalized nuclei is significantly higher in patients (median= 9%, IQR= 3.7-18.8 than in controls (median= 2.7%, IQR= 1.7-3.2 ( p=0.0002. In patients we observed an inverse correlation between the number of centronucleated fibers and the presence of node metastasis (N+(ρ=-0.64 (p=0.002. Patients affected with colorectal cancer display early sign of a myopathy, characterized by centronucleated and regenerating myofibers. This myopathy appears to be associated with an early stage of neoplasia and it could be an adaptive response of muscle to cancer. We hope a future application of these findings as a possible early diagnostic and prognostic biomarker of

  7. Acquired multiple Acyl-CoA dehydrogenase deficiency in 10 horses with atypical myopathy.

    Science.gov (United States)

    Westermann, C M; Dorland, L; Votion, D M; de Sain-van der Velden, M G M; Wijnberg, I D; Wanders, R J A; Spliet, W G M; Testerink, N; Berger, R; Ruiter, J P N; van der Kolk, J H

    2008-05-01

    The aim of the current study was to assess lipid metabolism in horses with atypical myopathy. Urine samples from 10 cases were subjected to analysis of organic acids, glycine conjugates, and acylcarnitines revealing increased mean excretion of lactic acid, ethylmalonic acid, 2-methylsuccinic acid, butyrylglycine, (iso)valerylglycine, hexanoylglycine, free carnitine, C2-, C3-, C4-, C5-, C6-, C8-, C8:1-, C10:1-, and C10:2-carnitine as compared with 15 control horses (12 healthy and three with acute myopathy due to other causes). Analysis of plasma revealed similar results for these predominantly short-chain acylcarnitines. Furthermore, measurement of dehydrogenase activities in lateral vastus muscle from one horse with atypical myopathy indeed showed deficiencies of short-chain acyl-CoA dehydrogenase (0.66 as compared with 2.27 and 2.48 in two controls), medium-chain acyl-CoA dehydrogenase (0.36 as compared with 4.31 and 4.82 in two controls) and isovaleryl-CoA dehydrogenase (0.74 as compared with 1.43 and 1.61 nmol min(-1) mg(-1) in two controls). A deficiency of several mitochondrial dehydrogenases that utilize flavin adenine dinucleotide as cofactor including the acyl-CoA dehydrogenases of fatty acid beta-oxidation, and enzymes that degrade the CoA-esters of glutaric acid, isovaleric acid, 2-methylbutyric acid, isobutyric acid, and sarcosine was suspected in 10 out of 10 cases as the possible etiology for a highly fatal and prevalent toxic equine muscle disease similar to the combined metabolic derangements seen in human multiple acyl-CoA dehydrogenase deficiency also known as glutaric acidemia type II.

  8. Autism in the Son of a Woman with Mitochondrial Myopathy and Dysautonomia: A Case Report.

    Science.gov (United States)

    Brown, Bradley D; Rais, Theodore

    2015-01-01

    The relationship between autism spectrum disorders and mitochondrial dysfunction, including mitochondrial myopathies and other mitochondrial diseases, is an area of ongoing research. All autism spectrum disorders are known to be heritable, via genetic and/or epigenetic mechanisms, but specific modes of inheritance are not well characterized. Nevertheless, autism spectrum disorders have been linked to many specific genes associated with mitochondrial function, especially to genes involved in mitochondrial tRNA and the electron transport chain, both particularly vulnerable to point mutations, and clinical research also supports a relationship between the two pathologies. Although only a small minority of patients with autism have a mitochondrial disease, many patients with mitochondrial myopathies have autism spectrum disorder symptoms, and these symptoms may be the presenting symptoms, which presents a diagnostic challenge for clinicians. The authors report the case of a 15-year-old boy with a history of autism spectrum disorder and neurocardiogenic syncope, admitted to the inpatient unit for self-injury, whose young mother, age 35, was discovered to suffer from mitochondrial myopathy, dysautonomia, neurocardiogenic syncope, Ehler-Danlos syndrome, and other uncommon multisystem pathologies likely related to mitochondrial dysfunction. This case illustrates the need for a high index of suspicion for mitochondrial disease in patients with autism, as they have two orders of magnitude greater risk for such diseases than the general population. The literature shows that mitochondrial disease is underdiagnosed in autism spectrum disorder patients and should not be viewed as a "zebra" (i.e., an obscure diagnosis that is made when a more common explanation is more likely).

  9. Craniopharyngioma presenting with severe hyponatremia, hyponatremia-induced myopathy, and panhypopituitarism: a case report.

    Science.gov (United States)

    Dilrukshi, M D S A; Sandakumari, G V N; Abeysundara, P K; Chang, T

    2017-02-05

    Craniopharyngiomas are rare intracranial tumors commonly presenting with neurological symptoms. Reports of severe hyponatremia as a presenting manifestation of a craniopharyngioma and hyponatremia-induced myopathy are rare. We report the case of a patient with craniopharyngioma presenting with severe hyponatremia, panhypopituitarism, and hyponatremia-induced myopathy. A 52-year-old Sri Lankan man presented with anorexia, nausea, fatigue, generalized muscle weakness, and cramps for 1 week. The onset of his illness had been preceded by vomiting and diarrhea for 1 day which he attributed to food poisoning. On examination, he had an apathetic disposition with a generalized "sallow complexion." He was not dehydrated. Apart from reduced muscle power (4/5) and hyporeflexia, the neurological examination was normal. His serum sodium was 102 mmol/l; potassium 4.1 mmol/l; chloride 63 mmol/l; plasma osmolality 272 mosm/KgH 2 O; urine osmolality 642 mosm/KgH 2 O; and urine sodium 79 mmol/l. His creatine phosphokinase was 12,400 U/l, lactate dehydrogenase 628 U/l, aspartate aminotransferase 360 U/l, and alanine aminotransferase 64 U/l. His hormone profile revealed panhypopituitarism. An electromyogram showed nonspecific abnormalities while a muscle biopsy did not show any pathology. Magnetic resonance imaging of his brain demonstrated a well-defined craniopharyngioma with suprasellar extension. His pituitary gland was compressed and the pituitary stalk was displaced by the tumor. He had marked improvement in muscle power and rapid reduction of serum creatine phosphokinase levels paralleling the correction of severe hyponatremia, even before the initiation of hormone replacement. This case illustrates the rare presentation of severe hyponatremia and hyponatremia-induced myopathy in patients with craniopharyngioma, awareness of which would facilitate early appropriate investigations and treatment.

  10. BAG3-related myopathy, polyneuropathy and cardiomyopathy with long QT syndrome.

    Science.gov (United States)

    Kostera-Pruszczyk, Anna; Suszek, Małgorzata; Płoski, Rafał; Franaszczyk, Maria; Potulska-Chromik, Anna; Pruszczyk, Piotr; Sadurska, Elżbieta; Karolczak, Justyna; Kamińska, Anna M; Rędowicz, Maria Jolanta

    2015-12-01

    BAG3 belongs to BAG family of molecular chaperone regulators interacting with HSP70 and anti-apoptotic protein Bcl-2. It is ubiquitously expressed with strong expression in skeletal and cardiac muscle, and is involved in a panoply of cellular processes. Mutations in BAG3 and aberrations in its expression cause fulminant myopathies, presenting with progressive limb and axial muscle weakness, and respiratory insufficiency and neuropathy. Herein, we report a sporadic case of a 15-years old girl with symptoms of myopathy, demyelinating polyneuropathy and asymptomatic long QT syndrome. Genetic testing demonstrated heterozygous mutation Pro209Leu (c.626C > T) in exon 3 of BAG3 gene causing severe myopathy and neuropathy, often associated with restrictive cardiomyopathy. We did not find a mutation in any known LQT syndrome genes. Analysis of muscle biopsy revealed profound disintegration of Z-discs with extensive accumulation of granular debris and large inclusions within fibers. We demonstrated profound alterations in BAG3 distribution as the protein localized to long filamentous structures present across the fibers that were positively stained not only for α-actinin but also for desmin and filamin indicating that those disintegrated Z-disc regions contained also other sarcomeric proteins. The mutation caused a decrease in the content of BAG3 and HSP70, and also of α-actinin desmin, filamin and fast myosin heavy chain, confirming its severe effect on the muscle fiber morphology and thus function. We provide further evidence that BAG3 is associated with Z-disc maintenance, and the Pro209Leu mutation may occur worldwide. We also provide a summary of cases associated with this mutation reported so far.

  11. Equine atypical myopathy caused by hypoglycin A intoxication associated with ingestion of sycamore maple tree seeds.

    Science.gov (United States)

    Żuraw, A; Dietert, K; Kühnel, S; Sander, J; Klopfleisch, R

    2016-07-01

    Evidence suggest there is a link between equine atypical myopathy (EAM) and ingestion of sycamore maple tree seeds. To further evaluate the hypothesis that the ingestion of hypoglycin A (HGA) containing sycamore maple tree seeds causes acquired multiple acyl-CoA dehydrogenase deficiency and might be associated with the clinical and pathological signs of EAM. Case report. Necropsy and histopathology, using hematoxylin and eosin and Sudan III stains, were performed on a 2.5-year-old mare that died following the development of clinical signs of progressive muscle stiffness and recumbency. Prior to death, the animal ingested sycamore maple tree seeds (Acer pseudoplatanus). Detection of metabolites in blood and urine obtained post mortem was performed by rapid ultra-performance liquid chromatography-tandem mass spectrometry. Data from this case were compared with 3 geldings with no clinical history of myopathy. Macroscopic examination revealed fragments of maple tree seeds in the stomach and severe myopathy of several muscle groups including Mm. intercostales, deltoidei and trapezii. Histologically, the affected muscles showed severe, acute rhabdomyolysis with extensive accumulation of finely dispersed fat droplets in the cytoplasm of degenerated skeletal muscle cells not present in controls. Urine and serum concentrations of several acyl carnitines and acyl glycines were increased, and both contained metabolites of HGA, a toxic amino acid present in sycamore maple tree seeds. The study supports the hypothesis that ingestion of HGA-containing maple tree seeds may cause EAM due to acquired multiple acyl-CoA dehydrogenase deficiency. © 2015 EVJ Ltd.

  12. Toxic myopathies: muscle biopsy features Miopatia tóxica: biópsia muscular

    Directory of Open Access Journals (Sweden)

    Rosana Herminia Scola

    2007-03-01

    Full Text Available Several drugs and toxic substances can cause muscular abnormalities and are frequent causes of acquired myopathies. We present a series of 32 patients, predominance of young adult patients, diagnosed with toxic myopathy. The most common substances inducing myopathy were corticosteroids (56.2% followed by the propoxyphene, neuroleptics, zidovudine and drug-induced hypokalemia. The investigation showed normal serum creatine kinase levels in 65.4%, myopathic pattern of the needle electromyography in 40% and the more frequent histological diagnosis of the muscle biopsy was type 2 fiber atrophy (59.3%. Clinical features, etiology, course of the disease, serum levels of muscular enzymes, electromyographic features and, especially, muscle biopsy features are discussed.Diversos medicamentos e substâncias tóxicas podem causar alterações musculares e são causas freqüentes de miopatia adquirida. Apresentamos uma série de 32 pacientes, predomínio de pacientes adulto jovens, com miopatia tóxica. As substâncias mais relacionadas com a miopatia foram os corticosteróides (56,2% seguidos pelo propoxifeno, neurolépticos, zidovudina e drogas indutoras de hipocalemia. A investigação mostrou níveis normais de creatino quinase sérica em 65,4%, eletromiografia de agulha com padrão miopático em 40% e o mais freqüente diagnóstico histológico da biópsia muscular foi atrofia de fibras do tipo 2 (59,3%. As manifestações clínicas, etiologia, tempo de evolução, nível sérico das enzimas musculares, alterações da eletroneuromiografia e, especialmente, da biópsia muscular são discutidos.

  13. Gelation And Mechanical Response of Patchy Rods

    Science.gov (United States)

    Kazem, Navid; Majidi, Carmel; Maloney, Craig

    We perform Brownian Dynamics simulations to study the gelation of suspensions of attractive, rod-like particles. We show that details of the particle-particle interactions can dramatically affect the dynamics of gelation and the structure and mechanics of the networks that form. If the attraction between the rods is perfectly smooth along their length, they will collapse into compact bundles. If the attraction is sufficiently corrugated or patchy, over time, a rigid space spanning network forms. We study the structure and mechanical properties of the networks that form as a function of the fraction of the surface that is allowed to bind. Surprisingly, the structural and mechanical properties are non-monotonic in the surface coverage. At low coverage, there are not a sufficient number of cross-linking sites to form networks. At high coverage, rods bundle and form disconnected clusters. At intermediate coverage, robust networks form. The elastic modulus and yield stress are both non-monotonic in the surface coverage. The stiffest and strongest networks show an essentially homogeneous deformation under strain with rods re-orienting along the extensional axis. Weaker, clumpy networks at high surface coverage exhibit relatively little re-orienting with strong non-affine deformation. These results suggest design strategies for tailoring surface interactions between rods to yield rigid networks with optimal properties. National Science Foundation and the Air Force Office of Scientific Research.

  14. Control rod drives for HTGR type reactor

    International Nuclear Information System (INIS)

    Nishiguchi, Isoharu; Katagiri, Shigeo.

    1991-01-01

    The device of the present invention has a feature of having stable braking characteristics upon scram operation of control rods. That is, control rod drives are moved upon and down by a dram which rotates the control rod suspended from to a wire rope, and the dram is disconnected from the driving mechanism by a crutch mechanism upon scram, to rapidly insert the control rod in the reactor by its own weight. An electric generator is used as a braking mechanism for controlling the scram speed of the control rod. A plurality of resistors disposed outside of the reactor coolants boundary are connected in parallel between input/output terminals of the electric generator. With such a constitution, braking characteristics are determined by the intensity of the permanent magnet, number of the coil windings and values of the resistors constituting the power generator. Accordingly, the braking characteristics are less changed relative to the working circumstantial conditions, the history of use and the state of mounting. As a result, stable braking characteristics can always be obtained. Further, braking characteristics can easily be controlled by varying the resistance value. (I.S.)

  15. Control rod driving hydraulic pressure device

    International Nuclear Information System (INIS)

    Ishida, Kazuo.

    1990-01-01

    Discharged water after actuating control rod drives in a BWR type reactor is once discharged to a discharging header, then returned to a master control unit and, subsequently, discharged to a reactor by way of a cooling water header. The radioactive level in the discharging header and the master control unit is increased by the reactor water to increase the operator's exposure. In view of the above, a riser is disposed for connecting a hydraulic pressure control unit incorporating a directional control valve and the cooling water head. When a certain control rod is inserted, the pressurized driving water is supplied through a hydraulic pressure control unit to the control rod drives. The discharged water from the control rod drives is entered by way of the hydraulic pressure control unit into the cooling water header and then returned to the reactor by way of other hydraulic pressure control unit and the control rod drives. Thus, the reactor water is no more recycled to the master control unit to reduce the radioactive exposure. (N.H.)

  16. Management of radioactive disused lightning rods

    Energy Technology Data Exchange (ETDEWEB)

    Santos, Paulo de Oliveira; Silva, Fabio, E-mail: pos@cdtn.br, E-mail: silvaf@cdtn.br [Centro de Desenvolvimento da Energia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)

    2013-07-01

    The manufacture of radioactive lightning rod was allowed from 1970 to 1989. This authorization was based on state-of-the art science of that time that verified that radioactive lightning rods had efficiency superior to the conventional lightning rods, denominated Franklin. However, the experience showed that their efficiency was not superior enough to justify the use of radioactive sources. Consequently, in 1989, the National Commission or Nuclear Energy - CNEN, issued the Resolution 04/89 from 04-19-1989, that forbidden the importation of {sup 241}Am tapes, assembling and commercialization of radioactive lightning-rods. The institutes of CNEN are responsible for receiving these lightning-rods and sending to the users procedures for removing and dispatch to the institutes. Therewith, these devices are kept away from the human being and environment. The Nuclear technology Development Center - CDTN and Institute for Energy and Nuclear Research - IPEN of CNEN, has built laboratories appropriate for dismantling such devices and store the {sup 241}Am tapes safely. Nowadays are being researched methodologies to evaluate the contamination levels of the frame for possible recycling and become better the management of these devices. (author)

  17. Gray rod for a nuclear reactor

    International Nuclear Information System (INIS)

    Francis, T.A.; Cerni, Samuel.

    1986-01-01

    The invention relates to an improved gray rod for insertion in a nuclear fuel assembly having an array of fuel rods. The gray rod includes a thin-walled cladding tube a first longitudinal section of which is positioned within, and a second longitudinal section of which is positioned essentially without, the array of fuel rods when the gray rod is inserted in the fuel assembly. The first longitudinal section defines a pellet-receiving space having detained therein a stack of annular pellets with an outer diameter sufficient to lend radial support to the wall of the first longitudinal tube section. The second longitudinal section defines a hollow space devoid of pellets and having means to resist radial collapse under external pressure. This means may be a partially compressed spiral spring which serves the dual purpose of retaining the stack of pellets in the pellet-receiving space and of lending radial support to the wall of the second longitudinal tube section or it may be holes through the wall to allow pressure equalisation. The cladding tube is composed of stainless-steel material having a low neutron-capture cross-section, and the annular pellets preferably being composed of Zircaloy or Zirconia material. (author)

  18. Broadband Vibration Attenuation Using Hybrid Periodic Rods

    Directory of Open Access Journals (Sweden)

    S. Asiri

    2008-12-01

    Full Text Available This paper presents both theoretically and experimentally a new kind of a broadband vibration isolator. It is a table-like system formed by four parallel hybrid periodic rods connected between two plates. The rods consist of an assembly of periodic cells, each cell being composed of a short rod and piezoelectric inserts. By actively controlling the piezoelectric elements, it is shown that the periodic rods can efficiently attenuate the propagation of vibration from the upper plate to the lower one within critical frequency bands and consequently minimize the effects of transmission of undesirable vibration and sound radiation. In such a system, longitudinal waves can propagate from the vibration source in the upper plate to the lower one along the rods only within specific frequency bands called the "Pass Bands" and wave propagation is efficiently attenuated within other frequency bands called the "Stop Bands". The spectral width of these bands can be tuned according to the nature of the external excitation. The theory governing the operation of this class of vibration isolator is presented and their tunable filtering characteristics are demonstrated experimentally as functions of their design parameters. This concept can be employed in many applications to control the wave propagation and the force transmission of longitudinal vibrations both in the spectral and spatial domains in an attempt to stop/attenuate the propagation of undesirable disturbances.

  19. Method of driving control rod in reactor

    International Nuclear Information System (INIS)

    Osa, Hirotaka.

    1986-01-01

    Purpose: To improve security and safety of the reactor by reducing reactor output automatically and quickly when circulation of cooling water is stopped. Constitution: When the circulating pump is under operation, fluid pressure in the discharge pipe is transferred to the fluid room of fluid pressure cylinder via the control rod drive pipe and lift up the piston, and then the control rod is drawn out of the reactor core. When the circulating pump is lowered in its functions, discharge pipe fluid pressure decreases, fluid pressure in the fluid room decreases, and with less force of piston movement, the control rod gets lowered by its own weight. At this time, the blocked state of the opening by the piston is released, fluid flows into the room. Lowering of pressure and the control rod is promoted by transferring out fluid below the piston in the fluid room to the upper part of the piston via a small gap when the control rod falls by gravity. (Horiuchi, T.)

  20. Control rod drives for FBR type reactor

    International Nuclear Information System (INIS)

    Ikakura, Hiroaki.

    1990-01-01

    The control rod drives for an FBR type reactor of the present invention eliminate obstacles deposited on attracting surfaces between an electromagnet and an armature which connect control rods to recover their retaining power. That is, a sealed chamber capable of controlling its inner pressure by an operation from the outside of a reactor is disposed in an extension pipe, and a nozzle connected to the sealed chamber and facing at the lower end thereof to the attracting surface is disposed. Liquid sodium sucked by evacuating the sealed chamber is jetted out from the nozzle by pressurizing the chamber to simultaneously eliminate obstacles deposited to the attracting surfaces of the electromagnet and the control rod. Alternatively, a nozzle protruding from and retracting to the lower surface of the electromagnet is disposed opposing to each of the attracting surfaces of the electromagnet and the control rod. Similar effect can also be obtained if gases are jetted out in this state. As a result, control rod drives of high reliability for a FBR type reactor can be obtained. (I.S.)

  1. Radiological characterization of spent control rod assemblies

    International Nuclear Information System (INIS)

    Lepel, E.A.; Robertson, D.E.; Thomas, C.W.; Pratt, S.L.; Haggard, D.L.

    1995-10-01

    This document represents the final report of an ongoing study to provide radiological characterizations, classifications, and assessments in support of the decommissioning of nuclear power stations. This report describes the results of non-destructive and laboratory radionuclide measurements, as well as waste classification assessments, of BWR and PWR spent control rod assemblies. The radionuclide inventories of these spent control rods were determined by three separate methodologies, including (1) direct assay techniques, (2) calculational techniques, and (3) by sampling and laboratory radiochemical analyses. For the BWR control rod blade (CRB) and PWR burnable poison rod assembly (BPRA), 60 Co and 63 Ni, present in the stainless steel cladding, were the most abundant neutron activation products. The most abundant radionuclide in the PWR rod cluster control assembly (RCCA) was 108m Ag (130 yr halflife) produced in the Ag-In-Cd alloy used as the neutron poison. This radionuclide will be the dominant contributor to the gamma dose rate for many hundreds of years. The results of the direct assay methods agree very well (±10%) with the sampling/radiochemical measurements. The results of the calculational methods agreed fairly well with the empirical measurements for the BPRA, but often varied by a factor of 5 to 10 for the CRB and the RCCA assemblies. If concentration averaging and encapsulation, as allowed by 10CFR61.55, is performed, then each of the entire control assemblies would be classified as Class C low-level radioactive waste

  2. Clad buffer rod sensors for liquid metals

    International Nuclear Information System (INIS)

    Jen, C.-K.; Ihara, I.

    1999-01-01

    Clad buffer rods, consisting of a core and a cladding, have been developed for ultrasonic monitoring of liquid metal processing. The cores of these rods are made of low ultrasonic-loss materials and the claddings are fabricated by thermal spray techniques. The clad geometry ensures proper ultrasonic guidance. The lengths of these rods ranges from tens of centimeters to 1m. On-line ultrasonic level measurements in liquid metals such as magnesium at 700 deg C and aluminum at 960 deg C are presented to demonstrate their operation at high temperature and their high ultrasonic performance. A spherical concave lens is machined at the rod end for improving the spatial resolution. High quality ultrasonic images have been obtained in the liquid zinc at 600 deg C. High spatial resolution is needed for the detection of inclusions in liquid metals during processing. We also show that the elastic properties such as density, longitudinal and shear wave velocities of liquid metals can be measured using a transducer which generates and receives both longitudinal and shear waves and is mounted at the end of a clad buffer rod. (author)

  3. Overview of Japanese control rods development program

    International Nuclear Information System (INIS)

    Koyama, M.

    1984-01-01

    The Japanese control rods development program was established based on the fast breeder reactor program. Therefore, PNC's efforts have been made mainly for the development of analysis, design and fabrication technologies for ''JOYO'' and ''MONJU'' control rods. Laboratory studies were performed to obtain the information for absorber materials. The design and fabrication of the sealed and vented type control rod pins were completed, and water loop tests and in-sodium tests were carried out. Irradiation behavior of enriched B 4 C pellets with low and high density in DFR was examined. Japan's experimental fast reactor, JOYO, has been operated at the rated power of 50MWt and 75MWt since April 1977 when the MK-I core (breeder core) attained initial criticality. Post irradiation examinations on control rod, removed from the reactor, were carried out and their performance behavior were evaluated. In the MK-II core, a control rods monitoring program has been in investigation. Absorber Materials Irradiation Rigs (AMIR) are scheduled to be loaded and irradiated in the JOYO MK-II core from 1984. (author)

  4. Protective guide structure for reactor control rod

    International Nuclear Information System (INIS)

    Ban, Minoru; Umeda, Kenji; Kubo, Noboru; Ito, Tomohiro.

    1996-01-01

    The present invention provides an improved protective guide structure for control rods, which does not cause swirling of coolants and resonance even though a slit is formed on a protective tube which surrounds a control rod element in a PWR type reactor. Namely, a reactor control rod is constituted with elongated control elements collectively bundled in the form of a cluster. The protective guide structure protectively guides the collected constituent at the upper portion of a reactor container. The protective structure comprises a plurality of protective tubes each having a C-shaped cross section disposed in parallel for receiving control rod elements individually in which the corners of the opening of the cross section of the protective tube are chamfered to an appropriate configuration. With such a constitution, even if coolant flows in a circumferential direction along the protective tubes surrounding the control rod elements, no shearing stream is caused to the coolants flow since the corners of the cross sectional opening (slit) of the tube are chamfered. Accordingly, occurrence of swirlings can be suppressed. (I.S.)

  5. Management of radioactive disused lightning rods

    International Nuclear Information System (INIS)

    Santos, Paulo de Oliveira; Silva, Fabio

    2013-01-01

    The manufacture of radioactive lightning rod was allowed from 1970 to 1989. This authorization was based on state-of-the art science of that time that verified that radioactive lightning rods had efficiency superior to the conventional lightning rods, denominated Franklin. However, the experience showed that their efficiency was not superior enough to justify the use of radioactive sources. Consequently, in 1989, the National Commission or Nuclear Energy - CNEN, issued the Resolution 04/89 from 04-19-1989, that forbidden the importation of 241 Am tapes, assembling and commercialization of radioactive lightning-rods. The institutes of CNEN are responsible for receiving these lightning-rods and sending to the users procedures for removing and dispatch to the institutes. Therewith, these devices are kept away from the human being and environment. The Nuclear technology Development Center - CDTN and Institute for Energy and Nuclear Research - IPEN of CNEN, has built laboratories appropriate for dismantling such devices and store the 241 Am tapes safely. Nowadays are being researched methodologies to evaluate the contamination levels of the frame for possible recycling and become better the management of these devices. (author)

  6. A Case of Myopathy, Encephalopathy, Lactic Acidosis and Stroke-Like Episodes (MELAS) Syndrome with Intracardiac Thrombus [corrected].

    Science.gov (United States)

    Joo, Jung-Chul; Seol, Myung Do; Yoon, Jin Won; Lee, Young Soo; Kim, Dong-Keun; Choi, Yong Hoon; Ahn, Hyo Seong; Cho, Wook Hyun

    2013-03-01

    Myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS) is a multisystem clinical syndrome manifested by mitochondrial myopathy, encephalopathy, lactic acidosis and recurrent stroke-like episodes. A 27-year-old female with MELAS syndrome presented with cerebral infarction. Echocardiography revealed a thrombus attached to the apex of the hypertrophied left ventricle, with decreased systolic function. The embolism of the intracardiac thrombus might have been the cause of stroke. There should be more consideration given to the increased possibility of intracardiac thrombus formation when a MELAS patient with cardiac involvement is encountered.

  7. X linked neonatal centronuclear/myotubular myopathy: evidence for linkage to Xq28 DNA marker loci.

    OpenAIRE

    Thomas, N S; Williams, H; Cole, G; Roberts, K; Clarke, A; Liechti-Gallati, S; Braga, S; Gerber, A; Meier, C; Moser, H

    1990-01-01

    We have studied the inheritance of several polymorphic Xq27/28 DNA marker loci in two three generation families with the X linked neonatal lethal form of centronuclear/myotubular myopathy (XL MTM). We found complete linkage of XLMTM to all four informative Xq28 markers analysed, with GCP/RCP (Z = 3.876, theta = 0.00), with DXS15 (Z = 3.737, theta = 0.00), with DXS52 (Z = 2.709, theta = 0.00), and with F8C (Z = 1.020, theta = 0.00). In the absence of any observable recombination, we are unable...

  8. Serum and tissue markers of myopathy in patients with colorectal cancer

    Directory of Open Access Journals (Sweden)

    Nicoletta Adami

    2012-09-01

    Full Text Available Skeletal muscles in patients with cancer undergo many changes due to immuno-inflammatory factors of tumor origin, or to chemotherapy and irradiation. Aim of the present study is to identify serological biomarkers and early myopathic features in skeletal muscle biopsies from weight stable patients bearing colorectal cancer at the onset of disease. Morphometric analyses by histochemistry and immunohistochemistry were performed on intraoperative muscle biopsies from patients with early colorectal cancer and from weight stable patients undergoing surgery for benign non-inflammatory conditions. Serological analyses for testing markers of inflammation (C Reactive Protein, CRP, muscle enzymes, (Creatin Kinase, CK, soluble isoforms of adhesion molecules (Neural Cell Adhesion Molecule, NCAM, and a marker of protein turnover (prealbumin, a typical indicator of caloric and protein malnutrition were also performed. Fifty oncologic patients (28 male/22 female and 25 non oncologic patients (18 male/7 female (p=N.S. were studied. In muscles from cancer patients we observed a subclinical myopathy characterized by an abnormal distribution of myonuclei. The percentage of myofibers with internalized nuclei was significantly higher in oncologic (median= 13.1%, IQR= 6.0-20.3 than in non oncologic patients (median= 3%, IQR= 2.5-6.1 (p<0.0001. The frequency of these internally nucleated myofibers is even higher in a subgroup of oncologic patients taking myotoxic drugs. In cancer patients, we observed an inverse correlation between the number of internally nucleated fibers and the presence of node metastasis (N+ (ρ=-0.30 (p=0.03. Moreover, in patients with colorectal cancer, low serum levels of preoperative prealbumin (median= 167,7 mg/L, normal range 200-400 mg/L, were detected. The link between the observed early myopathy and long-term cachexia is supported also by the altered expression of sarcolemma associated proteins, in particular laminin and dystrophin

  9. Miopatia por corpos esferóides: relato de caso Spheroid body myopathy: case report

    Directory of Open Access Journals (Sweden)

    Rosana Hermínia Scola

    2005-06-01

    Full Text Available A miopatia por corpos esferóides é doença rara, classificada no grupo das miopatias congênitas relacionadas aos distúrbios da desmina; apresenta, em geral, origem autossômica dominante e com início dos sintomas na fase adulta. Relatamos o caso de menina de sete anos, com diparesia facial, hipotrofia e hipotonia muscular generalizadas, arreflexia profunda generalizada, força muscular proximal nos membros superiores e inferiores e distal dos membros superiores grau 3 e distal nos membros inferiores grau 1. A eletromiografia de agulha evidenciou recrutamento aumentado e potenciais de unidade motora de curta duração e baixa amplitude, caracterizando um padrão miopático. A biópsia muscular revelou padrão misto para miopatia e desinervação e presença de corpos esferóides intracitoplasmáticos compatíveis com a miopatia por corpos esferóides. No presente caso, a paciente apresentou precocemente o início dos sintomas e não há relatos de casos semelhantes na família.Spheroid body myopathy is a rare illness classified in the group of the congenital myopathies as a desmin-related neuromuscular disorder, presenting dominant autosomical origin with the beginning of the symptoms in the adult phase. We report on a seven years old girl with facial paresia, generalized muscular hypotrophy and hypotony, generalized deep areflexia, proximal upper and lower limbs muscular strengh and distal upper limbs grade 3 and distal lower limbs grade 1. Needle electromyography evidenced increased conscription and potentials of motor unit of short duration and low amplitude, characterizing a myopathic standard. The muscle biopsy disclosed mixed standard to myopathy, denervation and inclusion bodies that are consistent to spheroid body myopathy. In this case, the patient presented, in advance, early beginning of the symptoms and there are no similar cases in the family.

  10. Severe insulin-resistant diabetes mellitus in patients with congenital muscle fiber type disproportion myopathy

    DEFF Research Database (Denmark)

    Vestergaard, H; Klein, H H; Hansen, T

    1995-01-01

    Congenital muscle fiber type disproportion myopathy (CFTDM) is a chronic, nonprogressive muscle disorder characterized by universal muscle hypotrophy and growth retardation. Histomorphometric examination of muscle shows a preponderance of smaller than normal type 1 fibers and overall fiber size....... Insulin receptor function and glycogen synthase (GS) activity and expression were examined in biopsies of vastus lateralis muscle. Despite a 45-90-fold increase in both fasting and postprandial serum insulin levels, both CFTDM patients had diabetes mellitus. Clamp studies revealed that the oldest boy had...

  11. Method and apparatus for inspection of nuclear fuel rods

    International Nuclear Information System (INIS)

    Wachter, W.J.

    1977-01-01

    A method and apparatus are provided for the inspection of nuclear fuel rods to detect defects or failures in such rods. Assemblies of fuel rods are immersed in water and means are provided for causing a change in the relative pressures in the water and within the fuel rod such that fluid is expelled from the rod through any defects that may exist. Means are also provided for thereafter vibrating the rods to cause additional internal fluid or other material that may be trapped in the rod to be expelled. Sensors are provided for detecting the emission of bubbles of fluid or other material from the rod and for locating the position of the defective rod in the assembly. 5 figures

  12. Rod consolidation at the West Valley Demonstration Project

    International Nuclear Information System (INIS)

    Bailey, W.J.

    1986-12-01

    A rod consolidation demonstration with irradiated pressurized water reactor fuel was recently conducted by personnel from Nuclear Assurance Corporation and West Valley Nuclear Services Company at the West Valley Demonstration Project in West Valley, New York. The rod consolidation demonstration involved pulling all of the fuel rods from six fuel Assemblies. In general, the rod pulling proceeded smoothly. The highest compaction ratio attained was 1:8:1. Among the total of 1074 fuel rods were some known degraded rods (they had collapsed cladding, a result of in-reactor fuel densification), but no rods were broken or dropped during the demonstration. One aim was to gather information on the effect of rod consolidation operations on the integrity of the fuel rods during subsequent handling and storage. Another goal was to collect information on the condition and handling of intact, damaged, and failed fuel that has been in storage for an extended period. 9 refs., 8 figs., 1 tab

  13. Method and apparatus for compacting spent nuclear reactor fuel rods

    International Nuclear Information System (INIS)

    Wachter, W.J.

    1988-01-01

    In a nuclear reactor system requiring periodic physical manipulation of spent fuel rods, the method of compacting fuel rods from a fuel rod assembly is described comprising the steps of: (1) removing the top end from pulling members having electrodes of weld elements in leading ends thereof in sequence through a fuel rod container and thence through respective consolidating passages in a fuel-rod directing chamber; (3) welding the weld elements of the pulling members to the top end of respective fuel rods corresponding to the respective pulling members; (4) drawing each of the pulling members axially to draw the respective engaged fuel rods in one axial direction through the respective passages in the chamber to thereby consolidate the fuel rods into a compacted configuration of a cross-sectional area smaller than the cross-sectional area occupied thereby within the fuel rod assembly; and (5) drawing all of the engaged fuel rods concurrently and substantially parallel to one another to the one axial direction into the fuel rod container while maintaining the compacting configuration in a fuel rod density which is greater than that of the fuel rod density of the fuel rod assembly

  14. The turbulent flow in rod bundles

    International Nuclear Information System (INIS)

    Moeller, S.V.

    1989-01-01

    Experimental studies have shown that the axial and azimuthal turbulence intensities in the gap regions of rod bundles increase strongly with decreasing rod spacing; the fluctuating velocities in the axial and azimuthal directions have a quasi-periodic behaviour. To determine the origin of this phenomenon, an its characteristics as a function of the geometry and the Reynolds number, an experimental investigation was performed on the turbulent in several rod bundles with different aspect ratios (P/D, W/D). Hot-wires and microsphones were used for the measurements of velocity and wall pressure fluctuations. The data were evaluated to obtain spectra as well as auto and cross correlations. Based on the results, a phenomenological model is presented to explain this phenomenon. By means of the model, the mass exchange between neighbouring subchannels is explained [pt

  15. A nuclear reactor with buffered control rods

    International Nuclear Information System (INIS)

    Bevilacqua, F.

    1974-01-01

    The control rods for, e.g., water-cooled reactors are fastened as units on common crossbars in vertical downward direction. The fastening on the crossbar is achieved by means of cross-shaped parts, e.g., in the shape of a double 'H'. A cylinder connected with a drive rod in normal operation is joined to each of the crossbars. In an emergency shut-down, this connection is interrupted and the control rod unit drops into the core through the action of gravity. Its fall is slowed down by a cushion or shock absorbing unit. For this purpose a piston is provided mounted on the supporting plate below the cylinder and guided within it. In the cylinder, the coolant is contained as damping medium. An upper opening in the cylinder serves as a ventilation hole. The movement of the piston is limited by a stopping part within the cylinder and slowed down by a spiral spring. (DG) [de

  16. Performance analysis of LMFBR control rods

    International Nuclear Information System (INIS)

    Pitner, A.L.; Birney, K.R.

    1975-01-01

    Control rods in the FFTF and LMFBR's will consist of pin bundles of stainless steel-clad boron carbide pellets. In the FFTF reference design, sixty-one pins of 0.474-inch diameter each containing a 36-inch stack of 0.362-inch diameter boron carbide pellets comprise a control rod. Reactivity control is provided by the 10 B (n,α) 7 Li reaction in the boron carbide. This reaction is accompanied by an energy release of 2.8 MeV, and heating from this reaction typically approaches 100 watts/cm 3 for natural boron carbide pellets in an LMFBR flux. Performance analysis of LMFBR control rods must include an assessment of the thermal performance of control pins. In addition, irradiation performance with regard to helium release, pellet swelling, and reactivity worth depletion as a function of service time must be evaluated

  17. LOFT advanced fuel rod instrumentation development

    International Nuclear Information System (INIS)

    Billeter, T.R.; Brown, R.L.; Chan, A.I.Y.; Day, C.K.; Meyers, S.C.; Sheen, E.M.; Stringer, J.L.

    1978-01-01

    Advanced fuel rod instrumentation for the Loss of Fluid Test (LOFT) reactor is being developed by the Hanford Engineering Development Laboratory for the Nuclear Regulatory Commission. This effort calls for development of sensors to measure fuel rod axial motion, fuel centerline temperature (to 2200 0 C), fuel rod plenum gas pressure (to 2500 psig), and plenum gas temperature (to 1500 0 F). A parallel test and evaluation of several modified commercial sensors was undertaken and will result in commercial availability of the final qualified sensors. Necessary test facilities were prepared for the development and evaluation effort. Tests to date indicate a three coil Linear Variable Differential Transformer (LVDT), operated from temperature compensating signal source and processing electronics, will meet the desired requirements

  18. Elliptical cross section fuel rod study II

    International Nuclear Information System (INIS)

    Taboada, H.; Marajofsky, A.

    1996-01-01

    In this paper it is continued the behavior analysis and comparison between cylindrical fuel rods of circular and elliptical cross sections. Taking into account the accepted models in the literature, the fission gas swelling and release were studied. An analytical comparison between both kinds of rod reveals a sensible gas release reduction in the elliptical case, a 50% swelling reduction due to intragranular bubble coalescence mechanism and an important swelling increase due to migration bubble mechanism. From the safety operation point of view, for the same linear power, an elliptical cross section rod is favored by lower central temperatures, lower gas release rates, greater gas store in ceramic matrix and lower stored energy rates. (author). 6 refs., 8 figs., 1 tab

  19. Flame spread along thermally thick horizontal rods

    Science.gov (United States)

    Higuera, F. J.

    2002-06-01

    An analysis is carried out of the spread of a flame along a horizontal solid fuel rod, for which a weak aiding natural convection flow is established in the underside of the rod by the action of the axial gradient of the pressure variation that gravity generates in the warm gas surrounding the flame. The spread rate is determined in the limit of infinitely fast kinetics, taking into account the effect of radiative losses from the solid surface. The effect of a small inclination of the rod is discussed, pointing out a continuous transition between upward and downward flame spread. Flame spread along flat-bottomed solid cylinders, for which the gradient of the hydrostatically generated pressure drives the flow both along and across the direction of flame propagation, is also analysed.

  20. Digital, electromagnetic rod position indicator with compensation

    International Nuclear Information System (INIS)

    Feilchenfeld, M.M.; Geis, C.G.

    1985-01-01

    A digital rod position indicator having discrete coils L 0 , L 1 , L 2 ..... spaced along the travel path of an elongate magnetically permeable member stores in digital form compensation signals for automatically adjusting the location relative to the coils at which a digital output signal representative of the position of the end of the elongate member transitions from one code to the next. The appropriate compensation signal is addressed using the digital output signal and a correction factor which takes into account the direction of movement including reversals. Reference is made to the positioning of the control rods in a pressurized water reactor. (author)

  1. Environmental report for rod storage. Volume V

    International Nuclear Information System (INIS)

    Danese, F.L.

    1981-09-01

    Volume V of this report examines the environmental impact of the rod consolidation program. The postulated, nonsite-specific, differential impacts are primarily additional occupational exposures due to the rod storage operations. Other potential radiological and nonradiological impacts that are identified and addressed are negligible. There are no increases in population exposures except those associated with transportation of spent fuel and waste material. The increased utilization of existing spent fuel storage space could result in a decrease in the nonrecoverable material resources lost to new permanent spent fuel storage

  2. Oligo(naphthylene–ethynylene) Molecular Rods

    DEFF Research Database (Denmark)

    Cramer, Jacob Roland; Ning, Yanxiao; Shen, Cai

    2013-01-01

    of palladium-catalyzed Sonogashira reactions between naphthyl halides and acetylenes. The triazene functionality was used as a protected iodine precursor to allow linear extension of the molecular rods during the synthe-ses. The carboxylic acid groups in the target molecules were protected as esters during......Molecular rods designed for surface chirality studies have been synthesized in high yields. The molecules are composed of oligo(naphthylene–ethynylene) skeletons and functionalized at their two termini with carboxylic acids and hydrophobic groups. The molecular skeletons were constructed by means...

  3. Quivers For Special Fuel Rods-Disposal Of Special Fuel Rods In CASTOR V Casks

    International Nuclear Information System (INIS)

    Bannani, Amin; Cebula, Wojciech; Buchmuller, Olga; Huggenberg, Roland; Helmut Kuhl

    2015-01-01

    While GNS casks of the CASTOR family are a suitable means to transfer fuel assemblies (FA) from the NPP to an interim dry storage site, Germanys phase-out of nuclear energy has triggered the demand for an additional solution to dispose of special fuel rods (SFR), normally remaining in the fuel pond until the final shutdown of the NPP. SFR are fuel rods that had to be removed from fuel assemblies mainly due to their special condition, e. g. damages in the cladding of the fuel rods which may have occurred during reactor operations. SFR are usually stored in the spent fuel pond after they are removed from the FA. The quiver for special fuel rods features a robust yet simple design, with a high mechanical stability, a reliable leak-tightness and large safety margins for future requirements on safety analysis. The quiver for special fuel rods can be easily adapted to a large variety of different damaged fuel rods and tailored to the specific need of the customer. The quiver for special fuel rods is adaptable e.g. in length and diameter for use in other types of transport and storage casks and is applicable in other countries as well. The overall concept presented here is a first of its kind solution for the disposal of SFRs via Castor V-casks. This provides an important precondition in achieving the status 'free from nuclear fuel' of the shut down German NPPs

  4. Quivers For Special Fuel Rods-Disposal Of Special Fuel Rods In CASTOR V Casks

    Energy Technology Data Exchange (ETDEWEB)

    Bannani, Amin; Cebula, Wojciech; Buchmuller, Olga; Huggenberg, Roland [GNS, Essen (Germany); Helmut Kuhl [WTI, Julich (Germany)

    2015-05-15

    While GNS casks of the CASTOR family are a suitable means to transfer fuel assemblies (FA) from the NPP to an interim dry storage site, Germanys phase-out of nuclear energy has triggered the demand for an additional solution to dispose of special fuel rods (SFR), normally remaining in the fuel pond until the final shutdown of the NPP. SFR are fuel rods that had to be removed from fuel assemblies mainly due to their special condition, e. g. damages in the cladding of the fuel rods which may have occurred during reactor operations. SFR are usually stored in the spent fuel pond after they are removed from the FA. The quiver for special fuel rods features a robust yet simple design, with a high mechanical stability, a reliable leak-tightness and large safety margins for future requirements on safety analysis. The quiver for special fuel rods can be easily adapted to a large variety of different damaged fuel rods and tailored to the specific need of the customer. The quiver for special fuel rods is adaptable e.g. in length and diameter for use in other types of transport and storage casks and is applicable in other countries as well. The overall concept presented here is a first of its kind solution for the disposal of SFRs via Castor V-casks. This provides an important precondition in achieving the status 'free from nuclear fuel' of the shut down German NPPs.

  5. Effects of different rod spacers (helical types) on coolant crossmixing

    International Nuclear Information System (INIS)

    Zhukov, A.V.; Sviridenko, E.Ya.; Matyukhin, N.M.; Rymkevich, K.S.; Ushakov, P.A.

    1981-11-01

    The results of investigations (electromagnetic measuring method) on coolant cross mixing in rod clusters with spiral wire spacers with different winding directions, with alternating unfinned and finned rods (case 'fin to rod'), as well as in rod clusters with much space between the rods, (case 'fin to fin') are reported. The local fluid dynamics parameters (distribution of the transversal and longitudinal velocity component) that define the physical processes of the coolant exchange in the rod clusters with helical spacers are explained. The investigation results for different helical spacer types are compared with each other. (orig.) [de

  6. Processing of poison rods with a view to disposal

    International Nuclear Information System (INIS)

    Bichet, R.; Charamathieu, A.; Lasseur, C.; Golicheff, I.; Pouteaux, M.

    1979-01-01

    In the core of the French 900 and 1300 MW reactors, a certain number of rods have to be processed as wastes, particularly the burnable poison rods used during reactor start-up (900 MW: 68 rods; 1300 MW: 96 rods). Several solutions are possible: cutting and conditionning in reactor pool; transfer of the poison rods to a cutting and conditionning facility; transfer of the poison rods and fuel assemblies to a storage area where they are cutted and stored. Each of these solutions are studied, the advantages and disadvantages being presented

  7. Development of cutting device for irradiated fuel rod

    International Nuclear Information System (INIS)

    Lee, E. P.; Jun, Y. B.; Hong, K. P.; Min, D. K.; Lee, H. K.; Su, H. S.; Kim, K. S.; Kwon, H. M.; Joo, Y. S.; Yoo, K. S.; Joo, J. S.; Kim, E. K.

    2004-01-01

    Post Irradiation Examination(PIE) on irradiated fuel rods is essential for the evaluation of integrity and irradiation performance of fuel rods of commercial reactor fuel. For PIE, fuel rods should be cut very precisely. The cutting positions selected from NDT data are very important for further destructive examination and analysis. A fuel rod cutting device was developed witch can cut fuel rods longitudinal very precisely and can also cut the fuels into the same length rod cuts repeatedly. It is also easy to remove the fuel cutting powder after cutting works and it can extend the life time of cutting device and lower the contamination level of hot cell

  8. Nemaline myopathy: clinical, histochemical and immunohistochemical features Miopatia nemalínica: achados clínicos, histoquímicos e imuno-histoquímicos

    Directory of Open Access Journals (Sweden)

    Nazah Cherif Mohamad Youssef

    2009-09-01

    Full Text Available Nemaline myopathy (NM is a congenital disease that leads to hypotonia and feeding difficulties in neonates. Some cases have a more benign course, with skeletal abnormalities later in life. We analyzed a series of eight patients with NM obtained from a retrospective analysis of 4300 muscle biopsies. Patients were classified as having the typical form in five cases, intermediate form in two cases and severe form in one case. Histochemical analysis showed mixed rods distribution in all cases and predominance of type I fibers in five cases. Immunohistochemical analysis showed abnormal nebulin expression in all patients (four heterogeneous and four absent, homogeneous desmin expression in four cases, strongly positive in three and absent in one, fast myosin expression in a mosaic pattern in six cases and absent in two cases. There was no specific relation between these protein expression patterns and the clinical forms of NM.Miopatia nemalínica (NM é uma doença congênita que leva a hipotonia e dificuldade de sugar em neonatos. Alguns casos possuem uma evolução benigna, com deformidades ósseas tardias. Nós analisamos uma série de oito pacientes com NM obtidos da análise retrospectiva de 4300 biópsias musculares. Os pacientes foram classificados como forma típica em cinco casos, forma intermediária em dois casos e forma severa em um caso. Análise histoquímica mostrou distribuição mista dos rods em todos os casos e predominância de fibras tipo I em cinco casos. Análise imuno-histoquímica mostrou expressão anormal da nebulina em todos os pacientes (quatro heterogênea e quatro ausente, expressão homogenea da desmina em quatro casos, fortemente positiva em tres e ausente em um, expressão da miosina (rápida com padrão em mosaico em seis casos e ausente em dois casos. Não há relação específica entre a expressão destas proteínas e as formas clínicas da NM.

  9. Ejected control rod and rods drop measurements during Mochovce startup physical tests

    International Nuclear Information System (INIS)

    Minarcin, Miroslav; Elko, Marek

    1998-01-01

    Paper deals with measurements of asymmetric reactivity insertion into the reactor core that were carried out during physical startup tests of Mochovce Unit 1 in June 1998. Control rods worth measurements with one and two rods s tucked in upper limit and worth measurement of one control rod from group 6 'ejected' from the reactor core are discussed. During the experiments neutron flux was measured by four ionisation chambers (three of them were placed symmetrically around the reactor core). Results of measurements and influence of asymmetric reactivity influence on ionisation chambers response are presented in the paper. (Authors)

  10. The Effect of the Wooden Breast Myopathy on Sarcomere Structure and Organization.

    Science.gov (United States)

    Velleman, Sandra G; Clark, Daniel L; Tonniges, Jeffrey R

    2018-03-01

    The wooden breast (WB) has been classically identified by the phenotypic presence of a wood-like pectoralis major (p. major) muscle. The WB-affected p. major muscle is characterized by necrotic muscle fibers and the replacement of muscle with connective tissue, water, and fat. The objective of the current study was to determine the effect of the WB myopathy on sarcomere organization by transmission electron microscopy. Sarcomere structure and organization were examined in two broiler lines with a high incidence of WB (Lines A and B) and another broiler line without WB (Line C). Affected muscle had an increase in smaller myofibers with diameters of 20 μm or less. Sarcomere organization decreased with fiber diameter in both Lines A and B. The structure and organization of sarcomeres in Line C were similar to WB-unaffected muscle in Lines A and B. Taken together, these data demonstrate that the WB myopathy detrimentally affects sarcomere organization in a broiler line-specific manner. Disorganization of sarcomere structure will affect the function of the p. major muscle as well as meat quality.

  11. A Nonsense Variant in the ACADVL Gene in German Hunting Terriers with Exercise Induced Metabolic Myopathy

    Directory of Open Access Journals (Sweden)

    Vincent Lepori

    2018-05-01

    Full Text Available Several enzymes are involved in fatty acid oxidation, which is a key process in mitochondrial energy production. Inherited defects affecting any step of fatty acid oxidation can result in clinical disease. We present here an extended family of German Hunting Terriers with 10 dogs affected by clinical signs of exercise induced weakness, muscle pain, and suspected rhabdomyolysis. The combination of clinical signs, muscle histopathology and acylcarnitine analysis with an elevated tetradecenoylcarnitine (C14:1 peak suggested a possible diagnosis of acyl-CoA dehydrogenase very long chain deficiency (ACADVLD. Whole genome sequence analysis of one affected dog and 191 controls revealed a nonsense variant in the ACADVL gene encoding acyl-CoA dehydrogenase very long chain, c.1728C>A or p.(Tyr576*. The variant showed perfect association with the phenotype in the 10 affected and more than 500 control dogs of various breeds. Pathogenic variants in the ACADVL gene have been reported in humans with similar myopathic phenotypes. We therefore considered the detected variant to be the most likely candidate causative variant for the observed exercise induced myopathy. To our knowledge, this is the first description of this disease in dogs, which we propose to name exercise induced metabolic myopathy (EIMM, and the identification of the first canine pathogenic ACADVL variant. Our findings provide a large animal model for a known human disease and will enable genetic testing to avoid the unintentional breeding of affected offspring.

  12. Homozygous LIPE mutation in siblings with multiple symmetric lipomatosis, partial lipodystrophy, and myopathy.

    Science.gov (United States)

    Zolotov, Sagit; Xing, Chao; Mahamid, Riad; Shalata, Adel; Sheikh-Ahmad, Mohammed; Garg, Abhimanyu

    2017-01-01

    Despite considerable progress in identifying causal genes for lipodystrophy syndromes, the molecular basis of some peculiar adipose tissue disorders remains obscure. In an Israeli-Arab pedigree with a novel autosomal recessive, multiple symmetric lipomatosis (MSL), partial lipodystrophy and myopathy, we conducted exome sequencing of two affected siblings to identify the disease-causing mutation. The 41-year-old female proband and her 36-year-old brother reported marked accumulation of subcutaneous fat in the face, neck, axillae, and trunk but loss of subcutaneous fat from the lower extremities and progressive distal symmetric myopathy during adulthood. They had increased serum creatine kinase levels, hypertriglyceridemia and low levels of high-density lipoprotein cholesterol. Exome sequencing identified a novel homozygous NC_000019.9:g.42906092C>A variant on chromosome 19, leading to a NM_005357.3:c.3103G>T nucleotide change in coding DNA and corresponding p.(Glu1035*) protein change in hormone sensitive lipase (LIPE) gene as the disease-causing variant. Sanger sequencing further confirmed the segregation of the mutation in the family. Hormone sensitive lipase is the predominant regulator of lipolysis from adipocytes, releasing free fatty acids from stored triglycerides. The homozygous null LIPE mutation could result in marked inhibition of lipolysis from some adipose tissue depots and thus may induce an extremely rare phenotype of MSL and partial lipodystrophy in adulthood associated with complications of insulin resistance, such as diabetes, hypertriglyceridemia and hepatic steatosis. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  13. Inflammatory myopathies in childhood: correlation between nailfold capillaroscopy findings and clinical and laboratory data.

    Science.gov (United States)

    Nascif, Ana K S; Terreri, Maria T R A; Len, Cláudio A; Andrade, Luis E C; Hilário, Maria O E

    2006-01-01

    Nailfold capillaroscopy is an important tool for the diagnosis and follow-up of patients with rheumatic diseases, in particular dermatomyositis and scleroderma. A relationship has been observed in adults between improved capillaroscopic findings and reduced disease activity. Our aim was to correlate disease activity (clinical and laboratory data) and nailfold capillaroscopy findings in 18 patients with inflammatory myopathies. This prospective study included 13 juvenile dermatomyositis patients (Bohan and Peter criteria) (mean age of 8.8 years) and five patients with overlap syndrome (mean age of 15.7 years). We evaluated disease activity (skin abnormalities and muscle weakness, muscle enzymes and acute phase reactants) and its correlation with nailfold capillaroscopy findings (dilatation of isolated loops, dropout of surrounding vessels and giant capillary loops). We used a microscope with special light and magnification of 10 to 16X. Eighteen patients underwent a total of 26 capillaroscopic examinations, seven of them on two or more occasions (13 were performed during the active disease phase and 13 during remission). Twelve of the 13 examinations performed during the active phase exhibited scleroderma pattern and 8 of the 13 examinations performed during remission were normal. Therefore, in 20 of the 26 examinations clinical and laboratory data and nailfold capillaroscopy findings correlated (p = 0.01). Nailfold capillaroscopy is a non-invasive examination that offers satisfactory correlation with disease activity and could be a useful tool for the diagnosis and follow-up of inflammatory myopathies.

  14. Hypothyroid myopathy: A peculiar clinical presentation of thyroid failure. Review of the literature.

    Science.gov (United States)

    Sindoni, Alessandro; Rodolico, Carmelo; Pappalardo, Maria Angela; Portaro, Simona; Benvenga, Salvatore

    2016-12-01

    Abnormalities in thyroid function are common endocrine disorders that affect 5-10 % of the general population, with hypothyroidism occurring more frequently than hyperthyroidism. Clinical symptoms and signs are often nonspecific, particularly in hypothyroidism. Muscular symptoms (stiffness, myalgias, cramps, easy fatigability) are mentioned by the majority of patients with frank hypothyroidism. Often underestimated is the fact that muscle symptoms may represent the predominant or the only clinical manifestation of hypothyroidism, raising the issue of a differential diagnosis with other causes of myopathy, which sometimes can be difficult. Elevated serum creatine kinase, which not necessarily correlates with the severity of the myopathic symptoms, is certainly suggestive of muscle impairment, though it does not explain the cause. Rare muscular manifestations, associated with hypothyroidism, are rhabdomyolysis, acute compartment syndrome, Hoffman's syndrome and Kocher-Debré-Sémélaigne syndrome. Though the pathogenesis of hypothyroid myopathy is not entirely known, proposed mechanisms include altered glycogenolytic and oxidative metabolism, altered expression of contractile proteins, and neuro-mediated damage. Correlation studies of haplotype, muscle gene expression and protein characterization, could help understanding the pathophysiological mechanisms of this myopathic presentation of hypothyroidism.

  15. MYOPATHY AS A SIDE EFFECT OF STATIN THERAPY: MECHANISMS OF DEVELOPMENT AND PROSPECTS FOR TREATMENT

    Directory of Open Access Journals (Sweden)

    O. M. Drapkina

    2015-01-01

    Full Text Available Statins are lipid-lowering drugs with proven efficacy that reduce cardiovascular risk and are well tolerated by most patients. Myopathy as a side effect of statin therapy is one of the most common reasons for their withdrawal. Its severity can range from asymptomatic increase of serum CPK to life-threatening rhabdomyolysis. Therefore it is necessary to remember about the possibility of its occurrence.The exact molecular mechanisms of muscle damage by statins are still unknown. Various hypotheses are suggested in this respect: fatty acid oxidation disorders, mitochondrial dysfunction, increased protein degradation in myocytes due to changes in atrogin-1 and ubiquitin activity, activation of autoimmune processes, intracellular depletion of essential metabolites, destabilization of cell membranes, impaired expression of genes involved in apoptosis and protein degradation. The theory that the reduction of intramuscular CoQ10 level is the cause of myopathy prevails. Additional intake of CoQ10 seems promising, but is not evidence-based.

  16. Anaesthetic management of a paediatric patient with congenital fibre type disproportion myopathy.

    Science.gov (United States)

    Buisán, F; de la Varga, O; Flores, M; Sánchez-Ruano, J

    2018-04-23

    Congenital fibre type disproportion (CFTD) is a rare type of myopathy that is characterised by muscle weakness and hypotonia during childhood. Clinical features include motor delay, feeding difficulties, limb weakness, joint contractures, and scoliosis. A report is presented of the anaesthetic management of a 3-year-old girl with CFTD myopathy associated with a mutation of the TPM3 gene, scheduled for adenotonsillectomy because of obstructive sleep apnoea hypopnoea syndrome (OSAHS). The main concerns were the possible susceptibility to malignant hyperthermia, the risk of anaesthesia-induced rhabdomyolysis, a greater sensitivity to non-depolarising muscle relaxants, and the presence of OSAHS. Total intravenous anaesthesia with propofol and the use of rocuronium/sugammadex appear to be safe options. Given the high risk of respiratory compromise and other complications, patients should be closely monitored in the post-operative period. Copyright © 2018 Sociedad Española de Anestesiología, Reanimación y Terapéutica del Dolor. Publicado por Elsevier España, S.L.U. All rights reserved.

  17. A Nonsense Variant in the ACADVL Gene in German Hunting Terriers with Exercise Induced Metabolic Myopathy.

    Science.gov (United States)

    Lepori, Vincent; Mühlhause, Franziska; Sewell, Adrian C; Jagannathan, Vidhya; Janzen, Nils; Rosati, Marco; Alves de Sousa, Filipe Miguel Maximiano; Tschopp, Aurélie; Schüpbach, Gertraud; Matiasek, Kaspar; Tipold, Andrea; Leeb, Tosso; Kornberg, Marion

    2018-05-04

    Several enzymes are involved in fatty acid oxidation, which is a key process in mitochondrial energy production. Inherited defects affecting any step of fatty acid oxidation can result in clinical disease. We present here an extended family of German Hunting Terriers with 10 dogs affected by clinical signs of exercise induced weakness, muscle pain, and suspected rhabdomyolysis. The combination of clinical signs, muscle histopathology and acylcarnitine analysis with an elevated tetradecenoylcarnitine (C14:1) peak suggested a possible diagnosis of acyl-CoA dehydrogenase very long chain deficiency (ACADVLD). Whole genome sequence analysis of one affected dog and 191 controls revealed a nonsense variant in the ACADVL gene encoding acyl-CoA dehydrogenase very long chain, c.1728C>A or p.(Tyr576*). The variant showed perfect association with the phenotype in the 10 affected and more than 500 control dogs of various breeds. Pathogenic variants in the ACADVL gene have been reported in humans with similar myopathic phenotypes. We therefore considered the detected variant to be the most likely candidate causative variant for the observed exercise induced myopathy. To our knowledge, this is the first description of this disease in dogs, which we propose to name exercise induced metabolic myopathy (EIMM), and the identification of the first canine pathogenic ACADVL variant. Our findings provide a large animal model for a known human disease and will enable genetic testing to avoid the unintentional breeding of affected offspring. Copyright © 2018 Lepori et al.

  18. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  19. Uremic myopathy: Is oxidative stress implicated in muscle dysfunction in uremia?

    Directory of Open Access Journals (Sweden)

    Antonia eKaltsatou

    2015-03-01

    Full Text Available Renal failure is accompanied by progressive muscle weakness and premature fatigue, in part linked to hypokinesis and in part to uremic toxicity. These changes are associated with various detrimental biochemical and morphological alterations. All of these pathological parameters are collectively termed ureamic myopathy. Various interventions while helpful can’t fully remedy the pathological phenotype. Complex mechanisms that stimulate muscle dysfunction in uremia have been proposed, and oxidative stress could be implicated. Skeletal muscles continuously produce reactive oxygen species (ROS and reactive nitrogen species (RNS at rest and more so during contraction. The aim of this mini review is to provide an update on recent advances in our understanding of how ROS and RNS generation might contribute to muscle dysfunction in uremia. Thus a systematic review was conducted searching PubMed and Scopus by using the Cochrane and PRISMA guidelines. While few studies met our criteria their findings are discussed making reference to other available literature data. Oxidative stress can direct muscle cells into a catabolic state and chronic exposure to it leads to wasting. Moreover, redox disturbances can significantly affect force production per se. We conclude that oxidative stress can be in part responsible for some aspects of uremic myopathy. Further research is needed to discern clear mechanisms and to help efforts to counteract muscle weakness and exercise intolerance in uremic patients.

  20. Elevated risk of venous thromboembolic events in patients with inflammatory myopathies

    Directory of Open Access Journals (Sweden)

    Nowak M

    2016-06-01

    Full Text Available Michał Nowak, Katarzyna Królak-Nowak, Aleksandra Sobolewska-Włodarczyk, Jakub Fichna, Marcin Włodarczyk Department of Biochemistry, Faculty of Medicine, Medical University of Lodz, Lodz, Poland Abstract: Venous thromboembolism (VTE is a multifactorial disease manifesting as either deep vein thrombosis or pulmonary embolism. Its prevalence makes VTE a significant issue for both the individual – as a negative factor influencing the quality of life and prognosis – and the society due to economic burden. VTE is the third most common vascular disorder in Western countries, after myocardial infarction and stroke, making it a major cause of in-hospital mortality, responsible for 5%–10% of hospital deaths. Despite many studies conducted, only 50%–60% provoking factors have been identified, while the remaining 40%–50% have been classified as idiopathic or unprovoked. Chronic inflammatory disorders, with their underlying prothrombotic state, reveal an increased risk of VTE (six to eight times compared with the general population. Among the inflammatory disorders, we can identify inflammatory myopathies – a group of rare, chronic diseases featuring weakness and inflammation of muscles with periods of exacerbation and remission; their main classes are polymyositis and dermatomyositis. The objective of this review is to emphasize the need of VTE prophylaxis in individuals with inflammatory myopathies in order to reduce morbidity and mortality rates among those patients and improve their quality of life and prognosis. Keywords: deep vein thrombosis, pulmonary embolism, inflammation, polymyositis, dermatomyositis, prothrombotic state

  1. Hereditary internal anal sphincter myopathy causing proctalgia fugax and constipation. A newly identified condition.

    Science.gov (United States)

    Kamm, M A; Hoyle, C H; Burleigh, D E; Law, P J; Swash, M; Martin, J E; Nicholls, R J; Northover, J M

    1991-03-01

    A newly identified myopathy of the internal anal sphincter is described. In the affected family, at least one member from each of five generations had severe proctalgia fugax; onset was usually in the third to fifth decades of life. Three members of the family have been studied in detail. Each had severe pain intermittently during the day and hourly during the night. Constipation was an associated symptom, in particular difficulty with rectal evacuation. Clinically the internal anal sphincter was thickened and of decreased compliance. The maximum anal canal pressure was usually increased with marked ultraslow wave activity. Anal endosonography confirmed a grossly thickened internal anal sphincter. Two patients were treated by internal anal sphincter strip myectomy; one showed marked improvement and one was relieved of the constipation but had only slight improvement of the pain. The hypertrophied muscle in two of the patients showed unique myopathic changes, consisting of vacuolar changes with periodic acid-Schiff-positive polyglycosan bodies in the smooth muscle fibers and increased endomysial fibrosis. In vitro organ-bath studies showed insensitivity of the muscle to noradrenaline, isoprenaline, carbachol, dimethylpiperazinium, and electrical-field stimulation. Immunohistochemical studies for substance P, calcitonin gene-related peptide, galanin, neuropeptide Y, and vasoactive intestinal peptide showed staining in a similar distribution to that in control tissue. A specific autosomal-dominant inherited myopathy of the internal anal sphincter that causes anal pain and constipation has been identified and characterized.

  2. MYOPATHY AS A SIDE EFFECT OF STATIN THERAPY: MECHANISMS OF DEVELOPMENT AND PROSPECTS FOR TREATMENT

    Directory of Open Access Journals (Sweden)

    O. M. Drapkina

    2015-09-01

    Full Text Available Statins are lipid-lowering drugs with proven efficacy that reduce cardiovascular risk and are well tolerated by most patients. Myopathy as a side effect of statin therapy is one of the most common reasons for their withdrawal. Its severity can range from asymptomatic increase of serum CPK to life-threatening rhabdomyolysis. Therefore it is necessary to remember about the possibility of its occurrence.The exact molecular mechanisms of muscle damage by statins are still unknown. Various hypotheses are suggested in this respect: fatty acid oxidation disorders, mitochondrial dysfunction, increased protein degradation in myocytes due to changes in atrogin-1 and ubiquitin activity, activation of autoimmune processes, intracellular depletion of essential metabolites, destabilization of cell membranes, impaired expression of genes involved in apoptosis and protein degradation. The theory that the reduction of intramuscular CoQ10 level is the cause of myopathy prevails. Additional intake of CoQ10 seems promising, but is not evidence-based.

  3. Idiopathic Inflammatory Myopathies; Association with Overlap Myositis and Syndromes: Classification, Clinical Characteristics, and Associated Autoantibodies

    Directory of Open Access Journals (Sweden)

    Pari Basharat

    2016-07-01

    Full Text Available Idiopathic inflammatory myopathies (IIM are traditionally identified as a group of disorders that target skeletal muscle due to autoimmune dysfunction. The IIM can be divided into subtypes based on certain clinical characteristics, and several classification schemes have been proposed. The predominant diagnostic criteria for IIM is the Bohan and Peter criteria, which subdivides IIM into primary polymyositis (PM, primary dermatomyositis (DM, myositis with another connective tissue disease, and myositis associated with cancer. However, this measure has been criticised for several reasons including lack of specific criteria to help distinguish between muscle biopsy findings of PM, DM, and immune-mediated necrotising myopathy, as well as the lack of identification of cases of overlap myositis (OM. Because of this issue, other classification criteria for IIM have been proposed, which include utilising myositis-associated antibodies and myositis-specific antibodies, as well as overlap features such as Raynaud’s phenomenon, polyarthritis, oesophageal abnormalities, interstitial lung disease, small bowel abnormalities such as hypomotility and malabsorption, and renal crises, amongst others. Indeed, the identification of autoantibodies associated with certain clinical phenotypes of myositis, in particular connective tissue disease-myositis overlap, has further helped divide IIM into distinct clinical subsets, which include OM and overlap syndromes (OS. This paper reviews the concepts of OM and OS as they pertain to IIM, including definitions in the literature, clinical characteristics, and overlap autoantibodies.

  4. Gene expression profiling in equine polysaccharide storage myopathy revealed inflammation, glycogenesis inhibition, hypoxia and mitochondrial dysfunctions

    Directory of Open Access Journals (Sweden)

    Benech Philippe

    2009-08-01

    Full Text Available Abstract Background Several cases of myopathies have been observed in the horse Norman Cob breed. Muscle histology examinations revealed that some families suffer from a polysaccharide storage myopathy (PSSM. It is assumed that a gene expression signature related to PSSM should be observed at the transcriptional level because the glycogen storage disease could also be linked to other dysfunctions in gene regulation. Thus, the functional genomic approach could be conducted in order to provide new knowledge about the metabolic disorders related to PSSM. We propose exploring the PSSM muscle fiber metabolic disorders by measuring gene expression in relationship with the histological phenotype. Results Genotypying analysis of GYS1 mutation revealed 2 homozygous (AA and 5 heterozygous (GA PSSM horses. In the PSSM muscles, histological data revealed PAS positive amylase resistant abnormal polysaccharides, inflammation, necrosis, and lipomatosis and active regeneration of fibers. Ultrastructural evaluation revealed a decrease of mitochondrial number and structural disorders. Extensive accumulation of an abnormal polysaccharide displaced and partially replaced mitochondria and myofibrils. The severity of the disease was higher in the two homozygous PSSM horses. Gene expression analysis revealed 129 genes significantly modulated (p Conclusion The main disorders observed in PSSM muscles could be related to mitochondrial dysfunctions, glycogenesis inhibition and the chronic hypoxia of the PSSM muscles.

  5. Nutritional status evaluation in patients affected by bethlem myopathy and ullrich congenital muscular dystrophy.

    Science.gov (United States)

    Toni, Silvia; Morandi, Riccardo; Busacchi, Marcello; Tardini, Lucia; Merlini, Luciano; Battistini, Nino Carlo; Pellegrini, Massimo

    2014-01-01

    Collagen VI mutations lead to disabling myopathies like Bethlem myopathy (BM) and Ullrich congenital muscular dystrophy (UCMD). We have investigated the nutritional and metabolic status of one UCMD and seven BM patients (five female, three male, mean age 31 ± 9 years) in order to find a potential metabolic target for nutritional intervention. For this study, we used standard anthropometric tools, such as BMI evaluation and body circumference measurements. All results were compared to dual-energy X-ray absorptiometry (DXA), considered the "gold standard" method. Energy intake of each patient was evaluated through longitudinal methods (7-day food diary) while resting energy expenditure (REE) was predicted using specific equations and measured by indirect calorimetry. Clinical evaluation included general and nutritional blood and urine laboratory analyses and quantitative muscle strength measurement by hand-held dynamometry. BM and UCMD patients showed an altered body composition, characterized by low free fat mass (FFM) and high fat mass (FM), allowing us to classify them as sarcopenic, and all but one as sarcopenic-obese. Another main result was the negative correlation between REE/FFM ratio (basal energy expenditure per kilograms of fat-free mass) and the severity of the disease, as defined by the muscle megascore (correlation coefficient -0.955, P-value nutritional intervention in these patients.

  6. Treatment options for mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome.

    Science.gov (United States)

    Santa, Kristin M

    2010-11-01

    Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome is a rare neurodegenerative disease caused by the decreased ability of cells to produce sufficient energy in the form of adenosine 5'-triphosphate. Although it is one of the most common maternally inherited mitochondrial disorders, its exact incidence is unknown. Caused most frequently by an A-to-G point mutation at the 3243 position in the mitochondrial DNA, MELAS syndrome has a broad range of clinical manifestations and a highly variable course. The classic neurologic characteristics include encephalopathy, seizures, and stroke-like episodes. In addition to its neurologic manifestations, MELAS syndrome exhibits multisystem effects including cardiac conduction defects, diabetes mellitus, short stature, myopathy, and gastrointestinal disturbances. Unfortunately, no consensus guidelines outlining standard drug regimens exist for this syndrome. Many of the accepted therapies used in treating MELAS syndrome have been identified through a small number of clinical trials or isolated case reports. Currently, the drugs most often used include antioxidants and various vitamins aimed at minimizing the demands on the mitochondria and supporting and maximizing their function. Some of the most frequently prescribed agents include coenzyme Q(10), l-arginine, B vitamins, and levocarnitine. Although articles describing MELAS syndrome are available, few specifically target education for clinical pharmacists. This article will provide pharmacists with a practical resource to enhance their understanding of MELAS syndrome in order to provide safe and effective pharmaceutical care.

  7. Effects of aerobic training on exercise-related oxidative stress in mitochondrial myopathies.

    Science.gov (United States)

    Siciliano, Gabriele; Simoncini, Costanza; Lo Gerfo, Annalisa; Orsucci, Daniele; Ricci, Giulia; Mancuso, Michelangelo

    2012-12-01

    In mitochondrial myopathies with respiratory chain deficiency impairment of energy cell production may lead to in excess reactive oxygen species generation with consequent oxidative stress and cell damage. Aerobic training has been showed to increase muscle performance in patients with mitochondrial myopathies. Aim of this study has been to evaluate, in 7 patients (6 F e 1M, mean age 44.9 ± 12.1 years) affected by mitochondrial disease, concomitantly to lactate exercise curve, the occurrence of oxidative stress, as indicated by circulating levels of lipoperoxides, in rest condition and as effect of exercise, and also, to verify if an aerobic training program is able to modify, in these patients, ox-redox balance efficiency. At rest and before training blood level of lipoperoxides was 382.4 ± 37.8 AU, compared to controls (318.7 ± 63.8; Pstress degree according to the adopted scale. During incremental exercise blood level of lipoperoxides did not increase, but maintained significantly higher compared to controls. After an aerobic training of 10 weeks the blood level of lipoperoxides decreased by 13.7% at rest (Pexercise test (P=0.06). These data indicate that, in mitochondrial patients, oxidative stress occurs and that an aerobic training is useful in partially reverting this condition. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Muscle spindles exhibit core lesions and extensive degeneration of intrafusal fibers in the Ryr1I4895T/wt mouse model of core myopathy

    International Nuclear Information System (INIS)

    Zvaritch, Elena; MacLennan, David H.

    2015-01-01

    Muscle spindles from the hind limb muscles of adult Ryr1 I4895T/wt (IT/+) mice exhibit severe structural abnormalities. Up to 85% of the spindles are separated from skeletal muscle fascicles by a thick layer of connective tissue. Many intrafusal fibers exhibit degeneration, with Z-line streaming, compaction and collapse of myofibrillar bundles, mitochondrial clumping, nuclear shrinkage and pyknosis. The lesions resemble cores observed in the extrafusal myofibers of this animal model and of core myopathy patients. Spindle abnormalities precede those in extrafusal fibers, indicating that they are a primary pathological feature in this murine Ryr1-related core myopathy. Muscle spindle involvement, if confirmed for human core myopathy patients, would provide an explanation for an array of devastating clinical features characteristic of these diseases and provide novel insights into the pathology of RYR1-related myopathies. - Highlights: • Muscle spindles exhibit structural abnormalities in a mouse model of core myopathy. • Myofibrillar collapse and mitochondrial clumping is observed in intrafusal fibers. • Myofibrillar degeneration follows a pattern similar to core formation in extrafusal myofibers. • Muscle spindle abnormalities are a part of the pathological phenotype in the mouse model of core myopathy. • Direct involvement of muscle spindles in the pathology of human RYR1-related myopathies is proposed

  9. Mechanical properties of bioresorbable self-reinforced posterior cervical rods.

    Science.gov (United States)

    Savage, Katherine; Sardar, Zeeshan M; Pohjonen, Timo; Sidhu, Gursukhman S; Eachus, Benjamin D; Vaccaro, Alexander

    2014-04-01

    A biomechanical study. To test the mechanical and physical properties of self-reinforced copolymer bioresorbable posterior cervical rods and compare their mechanical properties to commonly used Irene titanium alloy rods. Bioresorbable instrumentation is becoming increasingly common in surgical spine procedures. Compared with metallic implants, bioresorbable implants are gradually reabsorbed as the bone heals, transferring the load from the instrumentation to bone, eliminating the need for hardware removal. In addition, bioresorbable implants produce less stress shielding due to a more physiological modulus of elasticity. Three types of rods were used: (1) 5.5 mm copolymer rods and (2) 3.5 mm and (3) 5.5 mm titanium alloy rods. Four tests were used on each rod: (1) 3-point bending test, (2) 4-point bending test, (3) shear test, and (4) differential scanning calorimeter test. The outcomes were recorded: Young modulus (E), stiffness, maximum load, deflection at maximum load, load at 1.0% strain of the rod's outer surface, and maximum bending stress. The Young modulus (E) for the copolymer rods (mean range, 6.4-6.8 GPa) was significantly lower than the 3.5 mm titanium rods (106 GPa) and the 5.5 mm titanium rods (95 GPa). The stiffness of the copolymer rods (mean range, 16.6-21.4 N/mm) was also significantly lower than the 3.5 mm titanium alloy rods (43.6 N/mm) and the 5.5 mm titanium alloy rods (239.6 N/mm). The mean maximum shear load of the copolymer rods was 2735 N and they had significantly lower mean maximum loads than the titanium rods. Copolymer rods have adequate shear resistance, but less load resistance and stiffness compared with titanium rods. Their stiffness is closer to that of bone, causing less stress shielding and better gradual dynamic loading. Their use in semirigid posterior stabilization of the cervical spine may be considered.

  10. Modeling and simulation performance of sucker rod beam pump

    Energy Technology Data Exchange (ETDEWEB)

    Aditsania, Annisa, E-mail: annisaaditsania@gmail.com [Department of Computational Sciences, Institut Teknologi Bandung (Indonesia); Rahmawati, Silvy Dewi, E-mail: silvyarahmawati@gmail.com; Sukarno, Pudjo, E-mail: psukarno@gmail.com [Department of Petroleum Engineering, Institut Teknologi Bandung (Indonesia); Soewono, Edy, E-mail: esoewono@math.itb.ac.id [Department of Mathematics, Institut Teknologi Bandung (Indonesia)

    2015-09-30

    Artificial lift is a mechanism to lift hydrocarbon, generally petroleum, from a well to surface. This is used in the case that the natural pressure from the reservoir has significantly decreased. Sucker rod beam pumping is a method of artificial lift. Sucker rod beam pump is modeled in this research as a function of geometry of the surface part, the size of sucker rod string, and fluid properties. Besides its length, sucker rod string also classified into tapered and un-tapered. At the beginning of this research, for easy modeling, the sucker rod string was assumed as un-tapered. The assumption proved non-realistic to use. Therefore, the tapered sucker rod string modeling needs building. The numerical solution of this sucker rod beam pump model is computed using finite difference method. The numerical result shows that the peak of polished rod load for sucker rod beam pump unit C-456-D-256-120, for non-tapered sucker rod string is 38504.2 lb, while for tapered rod string is 25723.3 lb. For that reason, to avoid the sucker rod string breaks due to the overload, the use of tapered sucker rod beam string is suggested in this research.

  11. Modeling and simulation performance of sucker rod beam pump

    International Nuclear Information System (INIS)

    Aditsania, Annisa; Rahmawati, Silvy Dewi; Sukarno, Pudjo; Soewono, Edy

    2015-01-01

    Artificial lift is a mechanism to lift hydrocarbon, generally petroleum, from a well to surface. This is used in the case that the natural pressure from the reservoir has significantly decreased. Sucker rod beam pumping is a method of artificial lift. Sucker rod beam pump is modeled in this research as a function of geometry of the surface part, the size of sucker rod string, and fluid properties. Besides its length, sucker rod string also classified into tapered and un-tapered. At the beginning of this research, for easy modeling, the sucker rod string was assumed as un-tapered. The assumption proved non-realistic to use. Therefore, the tapered sucker rod string modeling needs building. The numerical solution of this sucker rod beam pump model is computed using finite difference method. The numerical result shows that the peak of polished rod load for sucker rod beam pump unit C-456-D-256-120, for non-tapered sucker rod string is 38504.2 lb, while for tapered rod string is 25723.3 lb. For that reason, to avoid the sucker rod string breaks due to the overload, the use of tapered sucker rod beam string is suggested in this research

  12. RodPilotR - The Innovative and Cost-Effective Digital Control Rod Drive Control System for PWRs

    International Nuclear Information System (INIS)

    Baron, Clemens

    2008-01-01

    With RodPilot, AREVA NP offers an innovative and cost-effective system for controlling control rods in Pressurized Water Reactors. RodPilot controls the three operating coils of the control rod drive mechanism (lift, moveable gripper and stationary gripper coil). The rods are inserted into or withdrawn from the core as required by the Reactor Control System. The system combines modern components, state-of-the-art logic and a proven electronic control rod drive control principle to provide enhanced reliability and lower maintenance costs. (author)

  13. RodPilot{sup R} - The Innovative and Cost-Effective Digital Control Rod Drive Control System for PWRs

    Energy Technology Data Exchange (ETDEWEB)

    Baron, Clemens [AREVA NP GmbH, NLEE-G, Postfach 1199, 91001 Erlangen (Germany)

    2008-07-01

    With RodPilot, AREVA NP offers an innovative and cost-effective system for controlling control rods in Pressurized Water Reactors. RodPilot controls the three operating coils of the control rod drive mechanism (lift, moveable gripper and stationary gripper coil). The rods are inserted into or withdrawn from the core as required by the Reactor Control System. The system combines modern components, state-of-the-art logic and a proven electronic control rod drive control principle to provide enhanced reliability and lower maintenance costs. (author)

  14. Connectedness percolation of hard deformed rods

    NARCIS (Netherlands)

    Drwenski, Tara; Dussi, Simone; Dijkstra, Marjolein; van Roij, Rene; van der Schoot, Paul

    2017-01-01

    Nanofiller particles, such as carbon nanotubes or metal wires, are used in functional polymer composites to make them conduct electricity. They are often not perfectly straight cylinders but may be tortuous or exhibit kinks. Therefore we investigate the effect of shape deformations of the rod-like

  15. Piston rod seal for a Stirling engine

    Science.gov (United States)

    Shapiro, Wilbur

    1984-01-01

    In a piston rod seal for a Stirling engine, a hydrostatic bearing and differential pressure regulating valve are utilized to provide for a low pressure differential across a rubbing seal between the hydrogen and oil so as to reduce wear on the seal.

  16. Automatic operation device for control rods

    International Nuclear Information System (INIS)

    Sekimizu, Koichi

    1984-01-01

    Purpose: To enable automatic operation of control rods based on the reactor operation planning, and particularly, to decrease the operator's load upon start up and shutdown of the reactor. Constitution: Operation plannings, demand for the automatic operation, break point setting value, power and reactor core flow rate change, demand for operation interrupt, demand for restart, demand for forecasting and the like are inputted to an input device, and an overall judging device performs a long-term forecast as far as the break point by a long-term forecasting device based on the operation plannings. The automatic reactor operation or the like is carried out based on the long-term forecasting and the short time forecasting is performed by the change in the reactor core status due to the control rod operation sequence based on the control rod pattern and the operation planning. Then, it is judged if the operation for the intended control rod is possible or not based on the result of the short time forecasting. (Aizawa, K.)

  17. Temperature actuated automatic safety rod release

    International Nuclear Information System (INIS)

    Hutter, E.; Pardini, J.A.; Walker, D.E.

    1987-01-01

    This patent describes a nuclear reactor having a core, a safety rod for downward insertion into and upward withdrawal from the core, a drive shaft for supporting and operating the safety rod, and drive means connected to the drive shaft for operating the shaft. An apparatus is described for releasably supporting the safety rod, the apparatus comprising an upper adapter adapted to be affixed to the upper end of the safety rod, the upper adapter having a retention means, a lower portion on the drive shaft and having a hollow interior for housing the upper adapter, a bimetallic means supported within the hollow interior of the lower portion and having at least one ledge which engages the retention means to support the upper adapter, the bimetallic means being a substantially cylindrical bimetallic member for receiving the upper adapter in a generally coaxial relation, the substantially cylindrical bimetallic member comprising an inner layer and an outer layer, and the inner layer having a greater coefficient of thermal expansion than the outer layer

  18. Confinement stabilises single crystal vaterite rods.

    OpenAIRE

    Schenk, AS; Albarracin, EJ; Kim, YY; Ihli, J; Meldrum, FC

    2014-01-01

    Single-crystals of vaterite, the least-stable anhydrous polymorph of CaCO3, are rare in biogenic and synthetic systems. We here describe the synthesis of high aspect ratio single crystal vaterite rods under additive-free conditions by precipitating CaCO3 within the cylindrical pores of track-etch membranes.

  19. CNEN resolution phohibits radioactive lightning rods

    International Nuclear Information System (INIS)

    1989-01-01

    After 15 years of irrestricted use in Brazil, the radioactive lightning rods were phohibited by Brazilian CNEN since the publication of a new law (Resolution number 4 of april 19,1989) published on may 9, 1989. All the existing ones will be removed at the time of their programed maintenance. (A.C.A.S.) [pt

  20. On contact numbers in random rod packings

    NARCIS (Netherlands)

    Wouterse, A.; Luding, Stefan; Philipse, A.P.

    2009-01-01

    Random packings of non-spherical granular particles are simulated by combining mechanical contraction and molecular dynamics, to determine contact numbers as a function of density. Particle shapes are varied from spheres to thin rods. The observed contact numbers (and packing densities) agree well