Identification of a maize chlorotic dwarf virus silencing suppressor protein

Science.gov (United States)

Maize chlorotic dwarf virus (MCDV), a member of the genus Waikavirus, family Secoviridae, has a 11784 nt (+)ssRNA genome that encodes a 389 kDa proteolytically processed polyprotein. We show that an N-terminal 78kDa polyprotein (R78) has silencing suppressor activity, that it is cleaved by the viral...

The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

Directory of Open Access Journals (Sweden)

Adrian Valli

Full Text Available RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

BIOLOGICAL FUNCTION OF TOMBUSVIRUS-ENCODED SUPPRESSOR OF RNA SILENCING IN PLANTS

Directory of Open Access Journals (Sweden)

Omarov R.T.

2012-08-01

Full Text Available RNA interference (RNAi plays multiple biological roles in eukaryotic organisms to regulate gene expression. RNAi also operates as a conserved adaptive molecular immune mechanism against invading viruses. The antiviral RNAi pathway is initiated with the generation of virus-derived short-interfering RNAs (siRNAs that are used for subsequent sequence-specific recognition and degradation of the cognate viral RNA molecules. As an efficient counter-defensive strategy, most plant viruses evolved the ability to encode specific proteins capable of interfering with RNAi, and this process is commonly known as RNA silencing suppression. Virus-encoded suppressors of RNAi (VSRs operate at different steps in the RNAi pathway and display distinct biochemical properties that enable these proteins to efficiently interfere with the host-defense system. Tombusvirus-encoded P19 is an important pathogenicity factor, required for symptom development and elicitation of a hypersensitive response in a host-dependent manner. Protein plays a crucial role of TBSV P19 in protecting viral RNA during systemic infection on Nicotiana benthamiana. The X-ray crystallographic studies conducted by two independent groups revealed the existence of a P19-siRNA complex; a conformation whereby caliper tryptophan residues on two subunits of P19 dimers measure and bind 21-nt siRNA duplexes. These structural studies provided the first details on the possible molecular mechanism of any viral suppressor to block RNAi. The association between P19 and siRNAs was also shown to occur in infected plants These and related studies revealed that in general the ability of P19 to efficiently sequester siRNAs influences symptom severity, however this is not a strict correlation in all hosts.The current working model is that during TBSV infection of plants, P19 appropriates abundantly circulating Tombusvirus-derived siRNAs thereby rendering these unavailable to program RISC, to prevent degradation of

Cowpea mosaic virus RNA-1 acts as an amplicon whose effects can be counteracted by a RNA-2-encoded suppressor of silencing

International Nuclear Information System (INIS)

Liu Li; Grainger, Jef; Canizares, M. Carmen; Angell, Susan M.; Lomonossoff, George P.

2004-01-01

Lines of Nicotiana benthamiana transgenic for full-length copies of both Cowpea mosaic virus (CPMV) genomic RNAs, either singly or together, have been produced. Plants transgenic for both RNAs developed symptoms characteristic of a CPMV infection. When plants transgenic for RNA-1 were agro-inoculated with RNA-2, no infection developed and the plants were also resistant to challenge with CPMV. By contrast, plants transgenic for RNA-2 became infected when agro-inoculated with RNA-1 and were fully susceptible to CPMV infection. The resistance of RNA-1 transgenic plants was shown to be related to the ability of RNA-1 to self-replicate and act as an amplicon. The ability of transgenically expressed RNA-2 to counteract the amplicon effect suggested that it encodes a suppressor of posttranscriptional gene silencing (PTGS). By examining the ability of portions of RNA-2 to reverse PTGS in N. benthamiana, we have identified the small (S) coat protein as the CPMV RNA-2-encoded suppressor of PTGS

The Polerovirus silencing suppressor P0 targets ARGONAUTE proteins for degradation.

Science.gov (United States)

Baumberger, Nicolas; Tsai, Ching-Hsui; Lie, Miranda; Havecker, Ericka; Baulcombe, David C

2007-09-18

Plant and animal viruses encode suppressor proteins of an adaptive immunity mechanism in which viral double-stranded RNA is processed into 21-25 nt short interfering (si)RNAs. The siRNAs guide ARGONAUTE (AGO) proteins so that they target viral RNA. Most viral suppressors bind long dsRNA or siRNAs and thereby prevent production of siRNA or binding of siRNA to AGO. The one exception is the 2b suppressor of Cucumoviruses that binds to and inhibits AGO1. Here we describe a novel suppressor mechanism in which a Polerovirus-encoded F box protein (P0) targets the PAZ motif and its adjacent upstream sequence in AGO1 and mediates its degradation. F box proteins are components of E3 ubiquitin ligase complexes that add polyubiquitin tracts on selected lysine residues and thereby mark a protein for proteasome-mediated degradation. With P0, however, the targeted degradation of AGO is insensitive to inhibition of the proteasome, indicating that the proteasome is not involved. We also show that P0 does not block a mobile signal of silencing, indicating that the signal molecule does not have AGO protein components. The ability of P0 to block silencing without affecting signal movement may contribute to the phloem restriction of viruses in the Polerovirus group.

F-box-like domain in the polerovirus protein P0 is required for silencing suppressor function

Science.gov (United States)

Pazhouhandeh, Maghsoud; Dieterle, Monika; Marrocco, Katia; Lechner, Esther; Berry, Bassam; Brault, Véronique; Hemmer, Odile; Kretsch, Thomas; Richards, Kenneth E.; Genschik, Pascal; Ziegler-Graff, Véronique

2006-01-01

Plants employ small RNA-mediated posttranscriptional gene silencing as a virus defense mechanism. In response, plant viruses encode proteins that can suppress RNA silencing, but the mode of action of most such proteins is poorly understood. Here, we show that the silencing suppressor protein P0 of two Arabidopsis-infecting poleroviruses interacts by means of a conserved minimal F-box motif with Arabidopsis thaliana orthologs of S-phase kinase-related protein 1 (SKP1), a component of the SCF family of ubiquitin E3 ligases. Point mutations in the F-box-like motif abolished the P0–SKP1 ortholog interaction, diminished virus pathogenicity, and inhibited the silencing suppressor activity of P0. Knockdown of expression of a SKP1 ortholog in Nicotiana benthamiana rendered the plants resistant to polerovirus infection. Together, the results support a model in which P0 acts as an F-box protein that targets an essential component of the host posttranscriptional gene silencing machinery. PMID:16446454

The bifunctional abiotic stress signalling regulator and endogenous RNA silencing suppressor FIERY1 is required for lateral root formation

KAUST Repository

Chen, Hao

2010-09-28

The Arabidopsis FIERY1 (FRY1) locus was originally identified as a negative regulator of stress-responsive gene expression and later shown to be required for suppression of RNA silencing. In this study we discovered that the FRY1 locus also regulates lateral root formation. Compared with the wild type, fry1 mutant seedlings generated significantly fewer lateral roots under normal growth conditions and also exhibited a dramatically reduced sensitivity to auxin in inducing lateral root initiation. Using transgenic plants that overexpress a yeast homolog of FRY1 that possesses only the 3\\', 5\\'-bisphosphate nucleotidase activity but not the inositol 1-phosphatase activity, we demonstrated that the lateral root phenotypes in fry1 result from loss of the nucleotidase activity. Furthermore, a T-DNA insertion mutant of another RNA silencing suppressor, XRN4 (but not XRN2 or XRN3), which is an exoribonuclease that is inhibited by the substrate of the FRY1 3\\', 5\\'-bisphosphate nucleotidase, exhibits similar lateral root defects. Although fry1 and xrn4 exhibited reduced sensitivity to ethylene, our experiments demonstrated that restoration of ethylene sensitivity in the fry1 mutant is not sufficient to rescue the lateral root phenotypes of fry1. Our results indicate that RNA silencing modulated by FRY1 and XRN4 plays an important role in shaping root architecture. © 2010 Blackwell Publishing Ltd.

Mild and severe cereal yellow dwarf viruses differ in silencing suppressor efficiency of the P0 protein.

Science.gov (United States)

Almasi, Reza; Miller, W Allen; Ziegler-Graff, Véronique

2015-10-02

Viral pathogenicity has often been correlated to the expression of the viral encoded-RNA silencing suppressor protein (SSP). The silencing suppressor activity of the P0 protein encoded by cereal yellow dwarf virus-RPV (CYDV-RPV) and -RPS (CYDV-RPS), two poleroviruses differing in their symptomatology was investigated. CYDV-RPV displays milder symptoms in oat and wheat whereas CYDV-RPS is responsible for more severe disease. We showed that both P0 proteins (P0(CY-RPV) and P0(CY-RPS)) were able to suppress local RNA silencing induced by either sense or inverted repeat transgenes in an Agrobacterium tumefaciens-mediated expression assay in Nicotiana benthamiana. P0(CY-RPS) displayed slightly higher activity. Systemic spread of the silencing signal was not impaired. Analysis of short-interfering RNA (siRNA) abundance revealed that accumulation of primary siRNA was not affected, but secondary siRNA levels were reduced by both CYDV P0 proteins, suggesting that they act downstream of siRNA production. Correlated with this finding we showed that both P0 proteins partially destabilized ARGONAUTE1. Finally both P0(CY-RPV) and P0(CY-RPS) interacted in yeast cells with ASK2, a component of an E3-ubiquitin ligase, with distinct affinities. Copyright © 2015 Elsevier B.V. All rights reserved.

Heterologous RNA-silencing suppressors from both plant- and animal-infecting viruses support plum pox virus infection.

Science.gov (United States)

Maliogka, Varvara I; Calvo, María; Carbonell, Alberto; García, Juan Antonio; Valli, Adrian

2012-07-01

HCPro, the RNA-silencing suppressor (RSS) of viruses belonging to the genus Potyvirus in the family Potyviridae, is a multifunctional protein presumably involved in all essential steps of the viral infection cycle. Recent studies have shown that plum pox potyvirus (PPV) HCPro can be replaced successfully by cucumber vein yellowing ipomovirus P1b, a sequence-unrelated RSS from a virus of the same family. In order to gain insight into the requirement of a particular RSS to establish a successful potyviral infection, we tested the ability of different heterologous RSSs from both plant- and animal-infecting viruses to substitute for HCPro. Making use of engineered PPV chimeras, we show that PPV HCPro can be replaced functionally by some, but not all, unrelated RSSs, including the NS1 protein of the mammal-infecting influenza A virus. Interestingly, the capacity of a particular RSS to replace HCPro does not correlate strictly with its RNA silencing-suppression strength. Altogether, our results suggest that not all suppression strategies are equally suitable for efficient escape of PPV from the RNA-silencing machinery. The approach followed here, based on using PPV chimeras in which an under-consideration RSS substitutes for HCPro, could further help to study the function of diverse RSSs in a 'highly sensitive' RNA-silencing context, such as that taking place in plant cells during the process of a viral infection.

Increased RNA-induced silencing complex (RISC) activity contributes to hepatocellular carcinoma.

Science.gov (United States)

Yoo, Byoung Kwon; Santhekadur, Prasanna K; Gredler, Rachel; Chen, Dong; Emdad, Luni; Bhutia, Sujit; Pannell, Lewis; Fisher, Paul B; Sarkar, Devanand

2011-05-01

There is virtually no effective treatment for advanced hepatocellular carcinoma (HCC) and novel targets need to be identified to develop effective treatment. We recently documented that the oncogene Astrocyte elevated gene-1 (AEG-1) plays a seminal role in hepatocarcinogenesis. Employing yeast two-hybrid assay and coimmunoprecipitation followed by mass spectrometry, we identified staphylococcal nuclease domain containing 1 (SND1), a nuclease in the RNA-induced silencing complex (RISC) facilitating RNAi-mediated gene silencing, as an AEG-1 interacting protein. Coimmunoprecipitation and colocalization studies confirmed that AEG-1 is also a component of RISC and both AEG-1 and SND1 are required for optimum RISC activity facilitating small interfering RNA (siRNA) and micro RNA (miRNA)-mediated silencing of luciferase reporter gene. In 109 human HCC samples SND1 was overexpressed in ≈74% cases compared to normal liver. Correspondingly, significantly higher RISC activity was observed in human HCC cells compared to immortal normal hepatocytes. Increased RISC activity, conferred by AEG-1 or SND1, resulted in increased degradation of tumor suppressor messenger RNAs (mRNAs) that are target of oncomiRs. Inhibition of enzymatic activity of SND1 significantly inhibited proliferation of human HCC cells. As a corollary, stable overexpression of SND1 augmented and siRNA-mediated inhibition of SND1 abrogated growth of human HCC cells in vitro and in vivo, thus revealing a potential role of SND1 in hepatocarcinogenesis. We unravel a novel mechanism that overexpression of AEG-1 and SND1 leading to increased RISC activity might contribute to hepatocarcinogenesis. Targeted inhibition of SND1 enzymatic activity might be developed as an effective therapy for HCC. Copyright © 2011 American Association for the Study of Liver Diseases.

Characterization of the RNA silencing suppression activity of the Ebola virus VP35 protein in plants and mammalian cells.

Science.gov (United States)

Zhu, Yali; Cherukuri, Nil Celebi; Jackel, Jamie N; Wu, Zetang; Crary, Monica; Buckley, Kenneth J; Bisaro, David M; Parris, Deborah S

2012-03-01

Ebola virus (EBOV) causes a lethal hemorrhagic fever for which there is no approved effective treatment or prevention strategy. EBOV VP35 is a virulence factor that blocks innate antiviral host responses, including the induction of and response to alpha/beta interferon. VP35 is also an RNA silencing suppressor (RSS). By inhibiting microRNA-directed silencing, mammalian virus RSSs have the capacity to alter the cellular environment to benefit replication. A reporter gene containing specific microRNA target sequences was used to demonstrate that prior expression of wild-type VP35 was able to block establishment of microRNA silencing in mammalian cells. In addition, wild-type VP35 C-terminal domain (CTD) protein fusions were shown to bind small interfering RNA (siRNA). Analysis of mutant proteins demonstrated that reporter activity in RSS assays did not correlate with their ability to antagonize double-stranded RNA (dsRNA)-activated protein kinase R (PKR) or bind siRNA. The results suggest that enhanced reporter activity in the presence of VP35 is a composite of nonspecific translational enhancement and silencing suppression. Moreover, most of the specific RSS activity in mammalian cells is RNA binding independent, consistent with VP35's proposed role in sequestering one or more silencing complex proteins. To examine RSS activity in a system without interferon, VP35 was tested in well-characterized plant silencing suppression assays. VP35 was shown to possess potent plant RSS activity, and the activities of mutant proteins correlated strongly, but not exclusively, with RNA binding ability. The results suggest the importance of VP35-protein interactions in blocking silencing in a system (mammalian) that cannot amplify dsRNA.

Phytophthora suppressor of RNA silencing 2 is a conserved RxLR effector that promotes infection in soybean and Arabidopsis thaliana.

Science.gov (United States)

Xiong, Qin; Ye, Wenwu; Choi, Duseok; Wong, James; Qiao, Yongli; Tao, Kai; Wang, Yuanchao; Ma, Wenbo

2014-12-01

The genus Phytophthora consists of notorious and emerging pathogens of economically important crops. Each Phytophthora genome encodes several hundreds of cytoplasmic effectors, which are believed to manipulate plant immune response inside the host cells. However, the majority of Phytophthora effectors remain functionally uncharacterized. We recently discovered two effectors from the soybean stem and root rot pathogen Phytophthora sojae with the activity to suppress RNA silencing in plants. These effectors are designated Phytophthora suppressor of RNA silencing (PSRs). Here, we report that the P. sojae PSR2 (PsPSR2) belongs to a conserved and widespread effector family in Phytophthora. A PsPSR2-like effector produced by P. infestans (PiPSR2) can also suppress RNA silencing in plants and promote Phytophthora infection, suggesting that the PSR2 family effectors have conserved functions in plant hosts. Using Agrobacterium rhizogenes-mediated hairy roots induction, we demonstrated that the expression of PsPSR2 rendered hypersusceptibility of soybean to P. sojae. Enhanced susceptibility was also observed in PsPSR2-expressing Arabidopsis thaliana plants during Phytophthora but not bacterial infection. These experiments provide strong evidence that PSR2 is a conserved Phytophthora effector family that performs important virulence functions specifically during Phytophthora infection of various plant hosts.

AGO/RISC-mediated antiviral RNA silencing in a plant in vitro system.

Science.gov (United States)

Schuck, Jana; Gursinsky, Torsten; Pantaleo, Vitantonio; Burgyán, Jozsef; Behrens, Sven-Erik

2013-05-01

AGO/RISC-mediated antiviral RNA silencing, an important component of the plant's immune response against RNA virus infections, was recapitulated in vitro. Cytoplasmic extracts of tobacco protoplasts were applied that supported Tombusvirus RNA replication, as well as the formation of RNA-induced silencing complexes (RISC) that could be functionally reconstituted with various plant ARGONAUTE (AGO) proteins. For example, when RISC containing AGO1, 2, 3 or 5 were programmed with exogenous siRNAs that specifically targeted the viral RNA, endonucleolytic cleavages occurred and viral replication was inhibited. Antiviral RNA silencing was disabled by the viral silencing suppressor p19 when this was present early during RISC formation. Notably, with replicating viral RNA, only (+)RNA molecules were accessible to RISC, whereas (-)RNA replication intermediates were not. The vulnerability of viral RNAs to RISC activity also depended on the RNA structure of the target sequence. This was most evident when we characterized viral siRNAs (vsiRNAs) that were particularly effective in silencing with AGO1- or AGO2/RISC. These vsiRNAs targeted similar sites, suggesting that accessible parts of the viral (+)RNA may be collectively attacked by different AGO/RISC. The in vitro system was, hence, established as a valuable tool to define and characterize individual molecular determinants of antiviral RNA silencing.

Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins

Directory of Open Access Journals (Sweden)

Marcio Hedil

2016-07-01

Full Text Available The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins.

Science.gov (United States)

Hedil, Marcio; Kormelink, Richard

2016-07-23

The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

Biochemical and single-molecule analyses of the RNA silencing suppressing activity of CrPV-1A.

Science.gov (United States)

Watanabe, Mariko; Iwakawa, Hiro-Oki; Tadakuma, Hisashi; Tomari, Yukihide

2017-10-13

Viruses often encode viral silencing suppressors (VSSs) to counteract the hosts' RNA silencing activity. The cricket paralysis virus 1A protein (CrPV-1A) is a unique VSS that binds to a specific Argonaute protein (Ago)-the core of the RNA-induced silencing complex (RISC)-in insects to suppress its target cleavage reaction. However, the precise molecular mechanism of CrPV-1A action remains unclear. Here we utilized biochemical and single-molecule imaging approaches to analyze the effect of CrPV-1A during target recognition and cleavage by Drosophila Ago2-RISC. Our results suggest that CrPV-1A obstructs the initial target searching by Ago2-RISC via base pairing in the seed region. The combination of biochemistry and single-molecule imaging may help to pave the way for mechanistic understanding of VSSs with diverse functions. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Diverging affinity of tospovirus RNA silencing suppressor proteins, NSs, for various RNA duplex molecules.

Science.gov (United States)

Schnettler, Esther; Hemmes, Hans; Huismann, Rik; Goldbach, Rob; Prins, Marcel; Kormelink, Richard

2010-11-01

The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs proteins analyzed exhibited affinity to small double-stranded RNA molecules, i.e., small interfering RNAs (siRNAs) and micro-RNA (miRNA)/miRNA* duplexes. Interestingly, the NSs proteins from tomato spotted wilt virus (TSWV), impatiens necrotic spot virus (INSV), and groundnut ringspot virus (GRSV) also showed affinity to long double-stranded RNA (dsRNA), whereas tomato yellow ring virus (TYRV) NSs did not. The TSWV NSs protein was shown to be capable of inhibiting Dicer-mediated cleavage of long dsRNA in vitro. In addition, it suppressed the accumulation of green fluorescent protein (GFP)-specific siRNAs during coinfiltration with an inverted-repeat-GFP RNA construct in Nicotiana benthamiana. In vivo interference of TSWV NSs in the miRNA pathway was shown by suppression of an enhanced GFP (eGFP) miRNA sensor construct. The ability to stabilize miRNA/miRNA* by different tospovirus NSs proteins in vivo was demonstrated by increased accumulation and detection of both miRNA171c and miRNA171c* in tospovirus-infected N. benthamiana. All together, these data suggest that tospoviruses interfere in the RNA silencing pathway by sequestering siRNA and miRNA/miRNA* molecules before they are uploaded into their respective RNA-induced silencing complexes. The observed affinity to long dsRNA for only a subset of the tospoviruses studied is discussed in light of evolutional divergence and their ancestral relation to the animal-infecting members of the Bunyaviridae.

Identification and characterization of two RNA silencing suppressors encoded by ophioviruses

NARCIS (Netherlands)

Robles Luna, Gabriel; Reyes, Carina A.; Peña, Eduardo J.; Ocolotobiche, Eliana; Baeza, Cecilia; Borniego, Maria Belén; Kormelink, Richard; García, María Laura

2017-01-01

Citrus psorosis virus and Mirafiori lettuce big-vein virus are two members of the genus Ophiovirus, family Ophioviridae. So far, how these viruses can interfere in the antiviral RNA silencing pathway is not known. In this study, using a local GFP silencing assay on Nicotiana benthamiana, the

Soilborne wheat mosaic virus (SBWMV 19K protein belongs to a class of cysteine rich proteins that suppress RNA silencing

Directory of Open Access Journals (Sweden)

Howard Amanda

2005-03-01

Full Text Available Abstract Amino acid sequence analyses indicate that the Soilborne wheat mosaic virus (SBWMV 19K protein is a cysteine-rich protein (CRP and shares sequence homology with CRPs derived from furo-, hordei-, peclu- and tobraviruses. Since the hordei- and pecluvirus CRPs were shown to be pathogenesis factors and/or suppressors of RNA silencing, experiments were conducted to determine if the SBWMV 19K CRP has similar activities. The SBWMV 19K CRP was introduced into the Potato virus X (PVX viral vector and inoculated to tobacco plants. The SBWMV 19K CRP aggravated PVX-induced symptoms and restored green fluorescent protein (GFP expression to GFP silenced tissues. These observations indicate that the SBWMV 19K CRP is a pathogenicity determinant and a suppressor of RNA silencing.

Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple turnover.

Science.gov (United States)

Rawlings, Renata A; Krishnan, Vishalakshi; Walter, Nils G

2011-04-29

RNA interference is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response to viruses and retrotransposons. During viral infection, the RNase-III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs) 21-24 nucleotides in length and helps load them into the RNA-induced silencing complex (RISC) to guide the cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressors (RSS) that tightly, and presumably quantitatively, bind siRNAs to thwart RNA-interference-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus, as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding [(1.69 ± 0.07) × 10(8) M(-)(1) s(-1)] and marked dissociation (k(off)=0.062 ± 0.002 s(-1)). We also observe that p19 efficiently competes with recombinant Dicer and inhibits the formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. Copyright © 2011 Elsevier Ltd. All rights reserved.

Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple-turnover

Science.gov (United States)

Rawlings, Renata A.; Krishnan, Vishalakshi; Walter, Nils G.

2011-01-01

RNA interference (RNAi) is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response against viruses and retrotransposons. During viral infection, the RNase III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs), 21–24 nucleotides in length, and helps load them into the RNA-induced silencing complex (RISC) to guide cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressor (RSS) proteins that tightly, and presumably quantitatively, bind siRNAs to thwart RNAi-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus (CIRV), as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding ((1.69 ± 0.07)×108 M−1s−1) and marked dissociation (koff = 0.062 ± 0.002 s−1). We also observe that p19 efficiently competes with recombinant Dicer and inhibits formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple-turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. PMID:21354178

Amino acid sequence motifs essential for P0-mediated suppression of RNA silencing in an isolate of potato leafroll virus from Inner Mongolia.

Science.gov (United States)

Zhuo, Tao; Li, Yuan-Yuan; Xiang, Hai-Ying; Wu, Zhan-Yu; Wang, Xian-Bin; Wang, Ying; Zhang, Yong-Liang; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2014-06-01

Polerovirus P0 suppressors of host gene silencing contain a consensus F-box-like motif with Leu/Pro (L/P) requirements for suppressor activity. The Inner Mongolian Potato leafroll virus (PLRV) P0 protein (P0(PL-IM)) has an unusual F-box-like motif that contains a Trp/Gly (W/G) sequence and an additional GW/WG-like motif (G139/W140/G141) that is lacking in other P0 proteins. We used Agrobacterium infiltration-mediated RNA silencing assays to establish that P0(PL-IM) has a strong suppressor activity. Mutagenesis experiments demonstrated that the P0(PL-IM) F-box-like motif encompasses amino acids 76-LPRHLHYECLEWGLLCG THP-95, and that the suppressor activity is abolished by L76A, W87A, or G88A substitution. The suppressor activity is also weakened substantially by mutations within the G139/W140/G141 region and is eliminated by a mutation (F220R) in a C-terminal conserved sequence of P0(PL-IM). As has been observed with other P0 proteins, P0(PL-IM) suppression is correlated with reduced accumulation of the host AGO1-silencing complex protein. However, P0(PL-IM) fails to bind SKP1, which functions in a proteasome pathway that may be involved in AGO1 degradation. These results suggest that P0(PL-IM) may suppress RNA silencing by using an alternative pathway to target AGO1 for degradation. Our results help improve our understanding of the molecular mechanisms involved in PLRV infection.

Grape seed proanthocyanidins reactivate silenced tumor suppressor genes in human skin cancer cells by targeting epigenetic regulators

International Nuclear Information System (INIS)

Vaid, Mudit; Prasad, Ram; Singh, Tripti; Jones, Virginia; Katiyar, Santosh K.

2012-01-01

Grape seed proanthocyanidins (GSPs) have been shown to have anti-skin carcinogenic effects in in vitro and in vivo models. However, the precise epigenetic molecular mechanisms remain unexplored. This study was designed to investigate whether GSPs reactivate silenced tumor suppressor genes following epigenetic modifications in skin cancer cells. For this purpose, A431 and SCC13 human squamous cell carcinoma cell lines were used as in vitro models. The effects of GSPs on DNA methylation, histone modifications and tumor suppressor gene expressions were studied in these cell lines using enzyme activity assays, western blotting, dot-blot analysis and real-time polymerase chain reaction (RT-PCR). We found that treatment of A431 and SCC13 cells with GSPs decreased the levels of: (i) global DNA methylation, (ii) 5-methylcytosine, (iii) DNA methyltransferase (DNMT) activity and (iv) messenger RNA (mRNA) and protein levels of DNMT1, DNMT3a and DNMT3b in these cells. Similar effects were noted when these cancer cells were treated identically with 5-aza-2′-deoxycytidine, an inhibitor of DNA methylation. GSPs decreased histone deacetylase activity, increased levels of acetylated lysines 9 and 14 on histone H3 (H3-Lys 9 and 14) and acetylated lysines 5, 12 and 16 on histone H4, and reduced the levels of methylated H3-Lys 9. Further, GSP treatment resulted in re-expression of the mRNA and proteins of silenced tumor suppressor genes, RASSF1A, p16 INK4a and Cip1/p21. Together, this study provides a new insight into the epigenetic mechanisms of GSPs and may have significant implications for epigenetic therapy in the treatment/prevention of skin cancers in humans. -- Highlights: ►Epigenetic modulations have been shown to have a role in cancer risk. ►Proanthocyanidins decrease the levels of DNA methylation and histone deacetylation. ►Proanthocyanidins inhibit histone deacetylase activity in skin cancer cells. ►Proanthocyanidins reactivate tumor suppressor genes in skin

Salicylic acid-mediated and RNA-silencing defense mechanisms cooperate in the restriction of systemic spread of plum pox virus in tobacco.

Science.gov (United States)

Alamillo, Josefa M; Saénz, Pilar; García, Juan Antonio

2006-10-01

Plum pox virus (PPV) is able to replicate in inoculated leaves of Nicotiana tabacum, but is defective in systemic movement in this host. However, PPV produces a systemic infection in transgenic tobacco expressing the silencing suppressor P1/HC-Pro from tobacco etch virus (TEV). In this work we show that PPV is able to move to upper non-inoculated leaves of tobacco plants expressing bacterial salicylate hydroxylase (NahG) that degrades salicylic acid (SA). Replication and accumulation of PPV is higher in the locally infected leaves of plants deficient in SA or expressing TEV P1/HC-Pro silencing suppressor. Accumulation of viral derived small RNAs was reduced in the NahG transgenic plants, suggesting that SA might act as an enhancer of the RNA-silencing antiviral defense in tobacco. Besides, expression of SA-mediated defense transcripts, such as those of pathogenesis-related (PR) proteins PR-1 and PR-2 or alternative oxidase-1, as well as that of the putative RNA-dependent RNA polymerase NtRDR1, is induced in response to PPV infection, and the expression patterns of these defense transcripts are altered in the TEV P1/HC-Pro transgenic plants. Long-distance movement of PPV is highly enhanced in NahG x P1/HC-Pro double-transgenic plants and systemic symptoms in these plants reveal that the expression of an RNA-silencing suppressor and the lack of SA produce additive but distinct effects. Our results suggest that SA might act as an enhancer of the RNA-silencing antiviral defense in tobacco, and that silencing suppressors, such as P1/HC-Pro, also alter the SA-mediated defense. Both an RNA-silencing and an SA-mediated defense mechanism could act together to limit PPV infection.

The P0 protein encoded by cotton leafroll dwarf virus (CLRDV) inhibits local but not systemic RNA silencing.

Science.gov (United States)

Delfosse, Verónica C; Agrofoglio, Yamila C; Casse, María F; Kresic, Iván Bonacic; Hopp, H Esteban; Ziegler-Graff, Véronique; Distéfano, Ana J

2014-02-13

Plants employ RNA silencing as a natural defense mechanism against viruses. As a counter-defense, viruses encode silencing suppressor proteins (SSPs) that suppress RNA silencing. Most, but not all, the P0 proteins encoded by poleroviruses have been identified as SSP. In this study, we demonstrated that cotton leafroll dwarf virus (CLRDV, genus Polerovirus) P0 protein suppressed local silencing that was induced by sense or inverted repeat transgenes in Agrobacterium co-infiltration assay in Nicotiana benthamiana plants. A CLRDV full-length infectious cDNA clone that is able to infect N. benthamiana through Agrobacterium-mediated inoculation also inhibited local silencing in co-infiltration assays, suggesting that the P0 protein exhibits similar RNA silencing suppression activity when expressed from the full-length viral genome. On the other hand, the P0 protein did not efficiently inhibit the spread of systemic silencing signals. Moreover, Northern blotting indicated that the P0 protein inhibits the generation of secondary but not primary small interfering RNAs. The study of CLRDV P0 suppression activity may contribute to understanding the molecular mechanisms involved in the induction of cotton blue disease by CLRDV infection. Copyright © 2013 Elsevier B.V. All rights reserved.

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing.

Science.gov (United States)

Hedil, Marcio; Sterken, Mark G; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silencing has only been studied to a limited extent. Here, the NSs proteins of TSWV, groundnut ringspot virus (GRSV) and tomato yellow ring virus (TYRV), representatives for three distinct tospovirus species, have been studied on their ability and strength to suppress local and systemic silencing. A system has been developed to quantify suppression of GFP silencing in Nicotiana benthamiana 16C lines, to allow a comparison of relative RNA silencing suppressor strength. It is shown that NSs of all three tospoviruses are suppressors of local and systemic silencing. Unexpectedly, suppression of systemic RNA silencing by NSsTYRV was just as strong as those by NSsTSWV and NSsGRSV, even though NSsTYRV was expressed in lower amounts. Using the system established, a set of selected NSsTSWV gene constructs mutated in predicted RNA binding domains, as well as NSs from TSWV isolates 160 and 171 (resistance breakers of the Tsw resistance gene), were analyzed for their ability to suppress systemic GFP silencing. The results indicate another mode of RNA silencing suppression by NSs that acts further downstream the biogenesis of siRNAs and their sequestration. The findings are discussed in light of the affinity of NSs for small and long dsRNA, and recent mutant screen of NSsTSWV to map domains required for RSS activity and triggering of Tsw-governed resistance.

The Polerovirus F box protein P0 targets ARGONAUTE1 to suppress RNA silencing.

Science.gov (United States)

Bortolamiol, Diane; Pazhouhandeh, Maghsoud; Marrocco, Katia; Genschik, Pascal; Ziegler-Graff, Véronique

2007-09-18

Plants employ post-transcriptional gene silencing (PTGS) as an antiviral defense response. In this mechanism, viral-derived small RNAs are incorporated into the RNA-induced silencing complex (RISC) to guide degradation of the corresponding viral RNAs. ARGONAUTE1 (AGO1) is a key component of RISC: it carries the RNA slicer activity. As a counter-defense, viruses have evolved various proteins that suppress PTGS. Recently, we showed that the Polerovirus P0 protein carries an F box motif required to form an SCF-like complex, which is also essential for P0's silencing suppressor function. Here, we investigate the molecular mechanism by which P0 impairs PTGS. First we show that P0's expression does not affect the biogenesis of primary siRNAs in an inverted repeat-PTGS assay, but it does affect their activity. Moreover, P0's expression in transformed Arabidopsis plants leads to various developmental abnormalities reminiscent of mutants affected in miRNA pathways, which is accompanied by enhanced levels of several miRNA-target transcripts, suggesting that P0 acts at the level of RISC. Interestingly, ectopic expression of P0 triggered AGO1 protein decay in planta. Finally, we provide evidence that P0 physically interacts with AGO1. Based on these results, we propose that P0 hijacks the host SCF machinery to modulate gene silencing by destabilizing AGO1.

Diverging affinity of tospovirus RNA silencing suppressor proteins, NSs, for various RNA duplex molecules

NARCIS (Netherlands)

Schnettler, E.; Hemmes, J.C.; Huisman, R.; Goldbach, R.W.; Prins, M.W.; Kormelink, R.J.M.

2010-01-01

The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs

Genetic variability and evolutionary implications of RNA silencing suppressor genes in RNA1 of sweet potato chlorotic stunt virus isolates infecting sweetpotato and related wild species.

Directory of Open Access Journals (Sweden)

Arthur K Tugume

sweetpotato. A second virus encoding an RNase3-like RNA silencing suppressor was detected. Overall, results provided many novel and important insights into evolutionary biology of SPCSV.

The Ebola virus VP35 protein is a suppressor of RNA silencing

NARCIS (Netherlands)

Haasnoot, J.; Vries, de W.; Geutjes, E.J.; Prins, M.W.; Haan, de P.; Berkhout, B.

2007-01-01

RNA silencing or interference (RNAi) is a gene regulation mechanism in eukaryotes that controls cell differentiation and developmental processes via expression of microRNAs. RNAi also serves as an innate antiviral defence response in plants, nematodes, and insects. This antiviral response is

Gene silencing activity of siRNA polyplexes based on thiolated N,N,N-trimethylated chitosan.

Science.gov (United States)

Varkouhi, Amir K; Verheul, Rolf J; Schiffelers, Raymond M; Lammers, Twan; Storm, Gert; Hennink, Wim E

2010-12-15

N,N,N-Trimethylated chitosan (TMC) is a biodegradable polymer emerging as a promising nonviral vector for nucleic acid and protein delivery. In the present study, we investigated whether the introduction of thiol groups in TMC enhances the extracellular stability of the complexes based on this polymer and promotes the intracellular release of siRNA. The gene silencing activity and the cellular cytotoxicity of polyplexes based on thiolated TMC were compared with those based on the nonthiolated counterpart and the regularly used lipidic transfection agent Lipofectamine. Incubation of H1299 human lung cancer cells expressing firefly luciferase with siRNA/thiolated TMC polyplexes resulted in 60-80% gene silencing activity, whereas complexes based on nonthiolated TMC showed less silencing (40%). The silencing activity of the complexes based on Lipofectamine 2000 was about 60-70%. Importantly, the TMC-SH polyplexes retained their silencing activity in the presence of hyaluronic acid, while nonthiolated TMC polyplexes hardly showed any silencing activity, demonstrating their stability against competing anionic macromolecules. Under the experimental conditions tested, the cytotoxicity of the thiolated and nonthiolated siRNA complexes was lower than those based on Lipofectamine. Given the good extracellular stability and good silencing activity, it is concluded that polyplexes based on TMC-SH are attractive systems for further in vivo evaluations.

Two Novel Motifs of Watermelon Silver Mottle Virus NSs Protein Are Responsible for RNA Silencing Suppression and Pathogenicity.

Science.gov (United States)

Huang, Chung-Hao; Hsiao, Weng-Rong; Huang, Ching-Wen; Chen, Kuan-Chun; Lin, Shih-Shun; Chen, Tsung-Chi; Raja, Joseph A J; Wu, Hui-Wen; Yeh, Shyi-Dong

2015-01-01

The NSs protein of Watermelon silver mottle virus (WSMoV) is the RNA silencing suppressor and pathogenicity determinant. In this study, serial deletion and point-mutation mutagenesis of conserved regions (CR) of NSs protein were performed, and the silencing suppression function was analyzed through agroinfiltration in Nicotiana benthamiana plants. We found two amino acid (aa) residues, H113 and Y398, are novel functional residues for RNA silencing suppression. Our further analyses demonstrated that H113 at the common epitope (CE) ((109)KFTMHNQ(117)), which is highly conserved in Asia type tospoviruses, and the benzene ring of Y398 at the C-terminal β-sheet motif ((397)IYFL(400)) affect NSs mRNA stability and protein stability, respectively, and are thus critical for NSs RNA silencing suppression. Additionally, protein expression of other six deleted (ΔCR1-ΔCR6) and five point-mutated (Y15A, Y27A, G180A, R181A and R212A) mutants were hampered and their silencing suppression ability was abolished. The accumulation of the mutant mRNAs and proteins, except Y398A, could be rescued or enhanced by co-infiltration with potyviral suppressor HC-Pro. When assayed with the attenuated Zucchini yellow mosaic virus vector in squash plants, the recombinants carrying individual seven point-mutated NSs proteins displayed symptoms much milder than the recombinant carrying the wild type NSs protein, suggesting that these aa residues also affect viral pathogenicity by suppressing the host silencing mechanism.

Mimic Phosphorylation of a βC1 Protein Encoded by TYLCCNB Impairs Its Functions as a Viral Suppressor of RNA Silencing and a Symptom Determinant.

Science.gov (United States)

Zhong, Xueting; Wang, Zhan Qi; Xiao, Ruyuan; Cao, Linge; Wang, Yaqin; Xie, Yan; Zhou, Xueping

2017-08-15

Phosphorylation of the βC1 protein encoded by the betasatellite of tomato yellow leaf curl China virus (TYLCCNB-βC1) by SNF1-related protein kinase 1 (SnRK1) plays a critical role in defense of host plants against geminivirus infection in Nicotiana benthamiana However, how phosphorylation of TYLCCNB-βC1 impacts its pathogenic functions during viral infection remains elusive. In this study, we identified two additional tyrosine residues in TYLCCNB-βC1 that are phosphorylated by SnRK1. The effects of TYLCCNB-βC1 phosphorylation on its functions as a viral suppressor of RNA silencing (VSR) and a symptom determinant were investigated via phosphorylation mimic mutants in N. benthamiana plants. Mutations that mimic phosphorylation of TYLCCNB-βC1 at tyrosine 5 and tyrosine 110 attenuated disease symptoms during viral infection. The phosphorylation mimics weakened the ability of TYLCCNB-βC1 to reverse transcriptional gene silencing and to suppress posttranscriptional gene silencing and abolished its interaction with N. benthamiana ASYMMETRIC LEAVES 1 in N. benthamiana leaves. The mimic phosphorylation of TYLCCNB-βC1 had no impact on its protein stability, subcellular localization, or self-association. Our data establish an inhibitory effect of phosphorylation of TYLCCNB-βC1 on its pathogenic functions as a VSR and a symptom determinant and provide a mechanistic explanation of how SnRK1 functions as a host defense factor. IMPORTANCE Tomato yellow leaf curl China virus (TYLCCNV), which causes a severe yellow leaf curl disease in China, is a monopartite geminivirus associated with the betasatellite (TYLCCNB). TYLCCNB encodes a single pathogenicity protein, βC1 (TYLCCNB-βC1), which functions as both a viral suppressor of RNA silencing (VSR) and a symptom determinant. Here, we show that mimicking phosphorylation of TYLCCNB-βC1 weakens its ability to reverse transcriptional gene silencing, to suppress posttranscriptional gene silencing, and to interact with N

Genome-Wide DNA Methylation Indicates Silencing of Tumor Suppressor Genes in Uterine Leiomyoma

Science.gov (United States)

Navarro, Antonia; Yin, Ping; Monsivais, Diana; Lin, Simon M.; Du, Pan; Wei, Jian-Jun; Bulun, Serdar E.

2012-01-01

Background Uterine leiomyomas, or fibroids, represent the most common benign tumor of the female reproductive tract. Fibroids become symptomatic in 30% of all women and up to 70% of African American women of reproductive age. Epigenetic dysregulation of individual genes has been demonstrated in leiomyoma cells; however, the in vivo genome-wide distribution of such epigenetic abnormalities remains unknown. Principal Findings We characterized and compared genome-wide DNA methylation and mRNA expression profiles in uterine leiomyoma and matched adjacent normal myometrial tissues from 18 African American women. We found 55 genes with differential promoter methylation and concominant differences in mRNA expression in uterine leiomyoma versus normal myometrium. Eighty percent of the identified genes showed an inverse relationship between DNA methylation status and mRNA expression in uterine leiomyoma tissues, and the majority of genes (62%) displayed hypermethylation associated with gene silencing. We selected three genes, the known tumor suppressors KLF11, DLEC1, and KRT19 and verified promoter hypermethylation, mRNA repression and protein expression using bisulfite sequencing, real-time PCR and western blot. Incubation of primary leiomyoma smooth muscle cells with a DNA methyltransferase inhibitor restored KLF11, DLEC1 and KRT19 mRNA levels. Conclusions These results suggest a possible functional role of promoter DNA methylation-mediated gene silencing in the pathogenesis of uterine leiomyoma in African American women. PMID:22428009

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

NARCIS (Netherlands)

Hedil, M.; Sterken, M.G.; Ronde, de D.; Lohuis, D.; Kormelink, R.

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS.

Epigenetic silencing of miRNA-9 is associated with HES1 oncogenic activity and poor prognosis of medulloblastoma.

Science.gov (United States)

Fiaschetti, G; Abela, L; Nonoguchi, N; Dubuc, A M; Remke, M; Boro, A; Grunder, E; Siler, U; Ohgaki, H; Taylor, M D; Baumgartner, M; Shalaby, T; Grotzer, M A

2014-02-04

microRNA-9 is a key regulator of neuronal development aberrantly expressed in brain malignancies, including medulloblastoma. The mechanisms by which microRNA-9 contributes to medulloblastoma pathogenesis remain unclear, and factors that regulate this process have not been delineated. Expression and methylation status of microRNA-9 in medulloblastoma cell lines and primary samples were analysed. The association of microRNA-9 expression with medulloblastoma patients' clinical outcome was assessed, and the impact of microRNA-9 restoration was functionally validated in medulloblastoma cells. microRNA-9 expression is repressed in a large subset of MB samples compared with normal fetal cerebellum. Low microRNA-9 expression correlates significantly with the diagnosis of unfavourable histopathological variants and with poor clinical outcome. microRNA-9 silencing occurs via cancer-specific CpG island hypermethylation. HES1 was identified as a direct target of microRNA-9 in medulloblastoma, and restoration of microRNA-9 was shown to trigger cell cycle arrest, to inhibit clonal growth and to promote medulloblastoma cell differentiation. microRNA-9 is a methylation-silenced tumour suppressor that could be a potential candidate predictive marker for poor prognosis of medulloblastoma. Loss of microRNA-9 may confer a proliferative advantage to tumour cells, and it could possibly contribute to disease pathogenesis. Thus, re-expression of microRNA-9 may constitute a novel epigenetic regulation strategy against medulloblastoma.

Epigenetic silencing of miRNA-9 is associated with HES1 oncogenic activity and poor prognosis of medulloblastoma

Science.gov (United States)

Fiaschetti, G; Abela, L; Nonoguchi, N; Dubuc, A M; Remke, M; Boro, A; Grunder, E; Siler, U; Ohgaki, H; Taylor, M D; Baumgartner, M; Shalaby, T; Grotzer, M A

2014-01-01

Background: microRNA-9 is a key regulator of neuronal development aberrantly expressed in brain malignancies, including medulloblastoma. The mechanisms by which microRNA-9 contributes to medulloblastoma pathogenesis remain unclear, and factors that regulate this process have not been delineated. Methods: Expression and methylation status of microRNA-9 in medulloblastoma cell lines and primary samples were analysed. The association of microRNA-9 expression with medulloblastoma patients' clinical outcome was assessed, and the impact of microRNA-9 restoration was functionally validated in medulloblastoma cells. Results: microRNA-9 expression is repressed in a large subset of MB samples compared with normal fetal cerebellum. Low microRNA-9 expression correlates significantly with the diagnosis of unfavourable histopathological variants and with poor clinical outcome. microRNA-9 silencing occurs via cancer-specific CpG island hypermethylation. HES1 was identified as a direct target of microRNA-9 in medulloblastoma, and restoration of microRNA-9 was shown to trigger cell cycle arrest, to inhibit clonal growth and to promote medulloblastoma cell differentiation. Conclusions: microRNA-9 is a methylation-silenced tumour suppressor that could be a potential candidate predictive marker for poor prognosis of medulloblastoma. Loss of microRNA-9 may confer a proliferative advantage to tumour cells, and it could possibly contribute to disease pathogenesis. Thus, re-expression of microRNA-9 may constitute a novel epigenetic regulation strategy against medulloblastoma. PMID:24346283

Antiviral RNA silencing viral counter defense in plants

NARCIS (Netherlands)

Bucher, E.C.

2006-01-01

The research described in this thesis centres around the mechanism of RNA silencing in relation to virus-host interaction, an area of increasing importance. It shows how this recently disclosed mechanism can be used to produce virus-resistant plants. Based on the activity of the RNA silencing

Drosophila PAF1 Modulates PIWI/piRNA Silencing Capacity.

Science.gov (United States)

Clark, Josef P; Rahman, Reazur; Yang, Nachen; Yang, Linda H; Lau, Nelson C

2017-09-11

To test the directness of factors in initiating PIWI-directed gene silencing, we employed a Piwi-interacting RNA (piRNA)-targeted reporter assay in Drosophila ovary somatic sheet (OSS) cells [1]. This assay confirmed direct silencing roles for piRNA biogenesis factors and PIWI-associated factors [2-12] but suggested that chromatin-modifying proteins may act downstream of the initial silencing event. Our data also revealed that RNA-polymerase-II-associated proteins like PAF1 and RTF1 antagonize PIWI-directed silencing. PAF1 knockdown enhances PIWI silencing of reporters when piRNAs target the transcript region proximal to the promoter. Loss of PAF1 suppresses endogenous transposable element (TE) transcript maturation, whereas a subset of gene transcripts and long-non-coding RNAs adjacent to TE insertions are affected by PAF1 knockdown in a similar fashion to piRNA-targeted reporters. Additionally, transcription activation at specific TEs and TE-adjacent loci during PIWI knockdown is suppressed when PIWI and PAF1 levels are both reduced. Our study suggests a mechanistic conservation between fission yeast PAF1 repressing AGO1/small interfering RNA (siRNA)-directed silencing [13, 14] and Drosophila PAF1 opposing PIWI/piRNA-directed silencing. Copyright © 2017 Elsevier Ltd. All rights reserved.

Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

Directory of Open Access Journals (Sweden)

Michelle S Lewis

2007-08-01

Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

DICER-LIKE2 plays a primary role in transitive silencing of transgenes in Arabidopsis.

Directory of Open Access Journals (Sweden)

Sizolwenkosi Mlotshwa

2008-03-01

Full Text Available Dicer-like (DCL enzymes play a pivotal role in RNA silencing in plants, processing the long double-stranded RNA (dsRNA that triggers silencing into the primary short interfering RNAs (siRNAs that mediate it. The siRNA population can be augmented and silencing amplified via transitivity, an RNA-dependent RNA polymerase (RDR-dependent pathway that uses the target RNA as substrate to generate secondary siRNAs. Here we report that Arabidopsis DCL2-but not DCL4-is required for transitivity in cell-autonomous, post-transcriptional silencing of transgenes. An insertion mutation in DCL2 blocked sense transgene-induced silencing and eliminated accumulation of the associated RDR-dependent siRNAs. In hairpin transgene-induced silencing, the dcl2 mutation likewise eliminated accumulation of secondary siRNAs and blocked transitive silencing, but did not block silencing mediated by primary siRNAs. Strikingly, in all cases, the dcl2 mutation eliminated accumulation of all secondary siRNAs, including those generated by other DCL enzymes. In contrast, mutations in DCL4 promoted a dramatic shift to transitive silencing in the case of the hairpin transgene and enhanced silencing induced by the sense transgene. Suppression of hairpin and sense transgene silencing by the P1/HC-Pro and P38 viral suppressors was associated with elimination of secondary siRNA accumulation, but the suppressors did not block processing of the stem of the hairpin transcript into primary siRNAs. Thus, these viral suppressors resemble the dcl2 mutation in their effects on siRNA biogenesis. We conclude that DCL2 plays an essential, as opposed to redundant, role in transitive silencing of transgenes and may play a more important role in silencing of viruses than currently thought.

Polerovirus protein P0 prevents the assembly of small RNA-containing RISC complexes and leads to degradation of ARGONAUTE1.

Science.gov (United States)

Csorba, Tibor; Lózsa, Rita; Hutvágner, György; Burgyán, József

2010-05-01

RNA silencing plays an important role in plants in defence against viruses. To overcome this defence, plant viruses encode suppressors of RNA silencing. The most common mode of silencing suppression is sequestration of double-stranded RNAs involved in the antiviral silencing pathways. Viral suppressors can also overcome silencing responses through protein-protein interaction. The poleroviral P0 silencing suppressor protein targets ARGONAUTE (AGO) proteins for degradation. AGO proteins are the core component of the RNA-induced silencing complex (RISC). We found that P0 does not interfere with the slicer activity of pre-programmed siRNA/miRNA containing AGO1, but prevents de novo formation of siRNA/miRNA containing AGO1. We show that the AGO1 protein is part of a high-molecular-weight complex, suggesting the existence of a multi-protein RISC in plants. We propose that P0 prevents RISC assembly by interacting with one of its protein components, thus inhibiting formation of siRNA/miRNA-RISC, and ultimately leading to AGO1 degradation. Our findings also suggest that siRNAs enhance the stability of co-expressed AGO1 in both the presence and absence of P0.

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

OpenAIRE

Hedil, Marcio; Sterken, Mark G.; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silen...

Thermodynamic control of small RNA-mediated gene silencing

Directory of Open Access Journals (Sweden)

Kumiko eUi-Tei

2012-06-01

Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.

Long Non-coding RNA, PANDA, Contributes to the Stabilization of p53 Tumor Suppressor Protein.

Science.gov (United States)

Kotake, Yojiro; Kitagawa, Kyoko; Ohhata, Tatsuya; Sakai, Satoshi; Uchida, Chiharu; Niida, Hiroyuki; Naemura, Madoka; Kitagawa, Masatoshi

2016-04-01

P21-associated noncoding RNA DNA damage-activated (PANDA) is induced in response to DNA damage and represses apoptosis by inhibiting the function of nuclear transcription factor Y subunit alpha (NF-YA) transcription factor. Herein, we report that PANDA affects regulation of p53 tumor-suppressor protein. U2OS cells were transfected with PANDA siRNAs. At 72 h post-transfection, cells were subjected to immunoblotting and quantitative reverse transcription-polymerase chain reaction. Depletion of PANDA was associated with decreased levels of p53 protein, but not p53 mRNA. The stability of p53 protein was markedly reduced by PANDA silencing. Degradation of p53 protein by silencing PANDA was prevented by treatment of MG132, a proteasome inhibitor. Moreover, depletion of PANDA prevented accumulation of p53 protein, as a result of DNA damage, induced by the genotoxic agent etoposide. These results suggest that PANDA stabilizes p53 protein in response to DNA damage, and provide new insight into the regulatory mechanisms of p53. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Telomeric trans-silencing: an epigenetic repression combining RNA silencing and heterochromatin formation.

Directory of Open Access Journals (Sweden)

Thibaut Josse

2007-09-01

Full Text Available The study of P-element repression in Drosophila melanogaster led to the discovery of the telomeric Trans-Silencing Effect (TSE, a repression mechanism by which a transposon or a transgene inserted in subtelomeric heterochromatin (Telomeric Associated Sequence or TAS has the capacity to repress in trans in the female germline, a homologous transposon, or transgene located in euchromatin. TSE shows variegation among egg chambers in ovaries when silencing is incomplete. Here, we report that TSE displays an epigenetic transmission through meiosis, which involves an extrachromosomal maternally transmitted factor. We show that this silencing is highly sensitive to mutations affecting both heterochromatin formation (Su(var205 encoding Heterochromatin Protein 1 and Su(var3-7 and the repeat-associated small interfering RNA (or rasiRNA silencing pathway (aubergine, homeless, armitage, and piwi. In contrast, TSE is not sensitive to mutations affecting r2d2, which is involved in the small interfering RNA (or siRNA silencing pathway, nor is it sensitive to a mutation in loquacious, which is involved in the micro RNA (or miRNA silencing pathway. These results, taken together with the recent discovery of TAS homologous small RNAs associated to PIWI proteins, support the proposition that TSE involves a repeat-associated small interfering RNA pathway linked to heterochromatin formation, which was co-opted by the P element to establish repression of its own transposition after its recent invasion of the D. melanogaster genome. Therefore, the study of TSE provides insight into the genetic properties of a germline-specific small RNA silencing pathway.

HC-Pro silencing suppressor significantly alters the gene expression profile in tobacco leaves and flowers

Directory of Open Access Journals (Sweden)

Lehto Kirsi

2011-04-01

Full Text Available Abstract Background RNA silencing is used in plants as a major defence mechanism against invasive nucleic acids, such as viruses. Accordingly, plant viruses have evolved to produce counter defensive RNA-silencing suppressors (RSSs. These factors interfere in various ways with the RNA silencing machinery in cells, and thereby disturb the microRNA (miRNA mediated endogene regulation and induce developmental and morphological changes in plants. In this study we have explored these effects using previously characterized transgenic tobacco plants which constitutively express (under CaMV 35S promoter the helper component-proteinase (HC-Pro derived from a potyviral genome. The transcript levels of leaves and flowers of these plants were analysed using microarray techniques (Tobacco 4 × 44 k, Agilent. Results Over expression of HC-Pro RSS induced clear phenotypic changes both in growth rate and in leaf and flower morphology of the tobacco plants. The expression of 748 and 332 genes was significantly changed in the leaves and flowers, respectively, in the HC-Pro expressing transgenic plants. Interestingly, these transcriptome alterations in the HC-Pro expressing tobacco plants were similar as those previously detected in plants infected with ssRNA-viruses. Particularly, many defense-related and hormone-responsive genes (e.g. ethylene responsive transcription factor 1, ERF1 were differentially regulated in these plants. Also the expression of several stress-related genes, and genes related to cell wall modifications, protein processing, transcriptional regulation and photosynthesis were strongly altered. Moreover, genes regulating circadian cycle and flowering time were significantly altered, which may have induced a late flowering phenotype in HC-Pro expressing plants. The results also suggest that photosynthetic oxygen evolution, sugar metabolism and energy levels were significantly changed in these transgenic plants. Transcript levels of S

Analysis of Tomato spotted wilt virus NSs protein indicates the importance of the N-terminal for avirulence and RNA silencing suppression

NARCIS (Netherlands)

Ronde, de D.; Pasquier, A.; Ying, S.; Butterbach, P.B.E.; Lohuis, D.; Kormelink, R.J.M.

2014-01-01

Recently, Tomato spotted wilt virus (TSWV) nonstructural protein NSs has been identified unambiguously as an avirulence (Avr) determinant for Tomato spotted wilt (Tsw)-based resistance. The observation that NSs from two natural resistance-breaking isolates had lost RNA silencing suppressor (RSS)

Effective gene silencing activity of prodrug-type 2'-O-methyldithiomethyl siRNA compared with non-prodrug-type 2'-O-methyl siRNA.

Science.gov (United States)

Hayashi, Junsuke; Nishigaki, Misa; Ochi, Yosuke; Wada, Shun-Ichi; Wada, Fumito; Nakagawa, Osamu; Obika, Satoshi; Harada-Shiba, Mariko; Urata, Hidehito

2018-07-01

Small interfering RNAs (siRNAs) are an active agent to induce gene silencing and they have been studied for becoming a biological and therapeutic tool. Various 2'-O-modified RNAs have been extensively studied to improve the nuclease resistance. However, the 2'-O-modified siRNA activities were often decreased by modification, since the bulky 2'-O-modifications inhibit to form a RNA-induced silencing complex (RISC). We developed novel prodrug-type 2'-O-methyldithiomethyl (MDTM) siRNA, which is converted into natural siRNA in an intracellular reducing environment. Prodrug-type 2'-O-MDTM siRNAs modified at the 5'-end side including 5'-end nucleotide and the seed region of the antisense strand exhibited much stronger gene silencing effect than non-prodrug-type 2'-O-methyl (2'-O-Me) siRNAs. Furthermore, the resistances for nuclease digestion of siRNAs were actually enhanced by 2'-O-MDTM modifications. Our results indicate that 2'-O-MDTM modifications improve the stability of siRNA in serum and they are able to be introduced at any positions of siRNA. Copyright © 2018 Elsevier Ltd. All rights reserved.

Strategies underlying RNA silencing suppression by negative strand RNA viruses

NARCIS (Netherlands)

Hemmes, J.C.

2007-01-01

The research described in this thesis focused on the strategies of negative strand RNA viruses to counteract antiviral RNA silencing. In plants and insects, RNA silencing has been shown to act as a sequence specific antiviral defence mechanism that is characterised by the processing of double

Tospovirus : induction and suppression of RNA silencing

NARCIS (Netherlands)

Hedil, Marcio

2016-01-01

While infecting their hosts, viruses must deal with host immunity. In plants the antiviral RNA silencing pathway is an important part of plant innate immunity. Tospoviruses are segmented negative-stranded RNA viruses of plants. To counteract the antiviral RNA silencing response in plants,

The interaction between endogenous 30S ribosomal subunit protein S11 and Cucumber mosaic virus LS2b protein affects viral replication, infection and gene silencing suppressor activity.

Directory of Open Access Journals (Sweden)

Ruilin Wang

Full Text Available Cucumber mosaic virus (CMV is a model virus for plant-virus protein interaction and mechanism research because of its wide distribution, high-level of replication and simple genome structure. The 2b protein is a multifunctional protein encoded by CMV that suppresses RNA silencing-based antiviral defense and contributes to CMV virulence in host plants. In this report, 12 host proteins were identified as CMV LS2b binding partners using the yeast two-hybrid screen system from the Arabidopsis thaliana cDNA library. Among the host proteins, 30S ribosomal subunit protein S11 (RPS11 was selected for further studies. The interaction between LS2b and full-length RPS11 was confirmed using the yeast two-hybrid system. Bimolecular fluorescence complementation (BIFC assays observed by confocal laser microscopy and Glutathione S-transferase (GST pull-down assays were used to verify the interaction between endogenous NbRPS11 and viral CMVLS2b both in vivo and in vitro. TRV-based gene silencing vector was used to knockdown NbRPS11 transcription, and immunoblot analysis revealed a decline in infectious viral RNA replication and a decrease in CMV infection in RPS11 down-regulated Nicotiana benthamiana plants. Thus, the knockdown of RPS11 likely inhibited CMV replication and accumulation. The gene silencing suppressor activity of CMV2b protein was reduced by the RPS11 knockdown. This study demonstrated that the function of viral LS2b protein was remarkably affected by the interaction with host RPS11 protein.

Ring structure amino acids affect the suppressor activity of melon aphid-borne yellows virus P0 protein.

Science.gov (United States)

Han, Yan-Hong; Xiang, Hai-Ying; Wang, Qian; Li, Yuan-Yuan; Wu, Wen-Qi; Han, Cheng-Gui; Li, Da-Wei; Yu, Jia-Lin

2010-10-10

Melon aphid-borne yellows virus (MABYV) is a newly identified polerovirus occurring in China. Here, we demonstrate that the MABYV encoded P0 (P0(MA)) protein is a strong suppressor of post-transcriptional gene silencing (PTGS) with activity comparable to tobacco etch virus (TEV) HC-Pro. In addition we have shown that the LP F-box motif present at the N-terminus of P0(MA) is required for suppressor activity. Detailed mutational analyses on P0(MA) revealed that changing the conserved Trp 212 with non-ring structured amino acids altered silencing suppressor functions. Ala substitutions at positions 12 and 211 for Phe had no effect on P0 suppression-activity, whereas Arg and Glu substitutions had greatly decreased suppressor activity. Furthermore, substitutions targeting Phe at position 30 also resulted in reduced P0 suppression-activity. Altogether, these results suggest that ring structured Trp/Phe residues in P0 have important roles in suppressor activity. Copyright © 2010 Elsevier Inc. All rights reserved.

The Cucumber vein yellowing virus silencing suppressor P1b can functionally replace HCPro in Plum pox virus infection in a host-specific manner.

Science.gov (United States)

Carbonell, Alberto; Dujovny, Gabriela; García, Juan Antonio; Valli, Adrian

2012-02-01

Plant viruses of the genera Potyvirus and Ipomovirus (Potyviridae family) use unrelated RNA silencing suppressors (RSS) to counteract antiviral RNA silencing responses. HCPro is the RSS of Potyvirus spp., and its activity is enhanced by the upstream P1 protein. Distinctively, the ipomovirus Cucumber vein yellowing virus (CVYV) lacks HCPro but contains two P1 copies in tandem (P1aP1b), the second of which functions as RSS. Using chimeras based on the potyvirus Plum pox virus (PPV), we found that P1b can functionally replace HCPro in potyviral infections of Nicotiana plants. Interestingly, P1a, the CVYV protein homologous to potyviral P1, disrupted the silencing suppression activity of P1b and reduced the infection efficiency of PPV in Nicotiana benthamiana. Testing the influence of RSS in host specificity, we found that a P1b-expressing chimera poorly infected PPV's natural host, Prunus persica. Conversely, P1b conferred on PPV chimeras the ability to replicate locally in cucumber, CVYV's natural host. The deleterious effect of P1a on PPV infection is host dependent, because the P1aP1b-expressing PPV chimera accumulated in cucumber to higher levels than PPV expressing P1b alone. These results demonstrate that a potyvirus can use different RSS, and that particular RSS and upstream P1-like proteins contribute to defining the virus host range.

Conifers have a unique small RNA silencing signature

OpenAIRE

Dolgosheina, Elena V.; Morin, Ryan D.; Aksay, Gozde; Sahinalp, S. Cenk; Magrini, Vincent; Mardis, Elaine R.; Mattsson, Jim; Unrau, Peter J.

2008-01-01

Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an u...

Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

Science.gov (United States)

Travella, Silvia; Keller, Beat

Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

Regulation of the activity of the promoter of RNA-induced silencing, C3PO.

Science.gov (United States)

Sahu, Shriya; Williams, Leo; Perez, Alberto; Philip, Finly; Caso, Giuseppe; Zurawsky, Walter; Scarlata, Suzanne

2017-09-01

RNA-induced silencing is a process which allows cells to regulate the synthesis of specific proteins. RNA silencing is promoted by the protein C3PO (component 3 of RISC). We have previously found that phospholipase Cβ, which increases intracellular calcium levels in response to specific G protein signals, inhibits C3PO activity towards certain genes. Understanding the parameters that control C3PO activity and which genes are impacted by G protein activation would help predict which genes are more vulnerable to downregulation. Here, using a library of 10 18 oligonucleotides, we show that C3PO binds oligonucleotides with structural specificity but little sequence specificity. Alternately, C3PO hydrolyzes oligonucleotides with a rate that is sensitive to substrate stability. Importantly, we find that oligonucleotides with higher Tm values are inhibited by bound PLCβ. This finding is supported by microarray analysis in cells over-expressing PLCβ1. Taken together, this study allows predictions of the genes whose post-transcriptional regulation is responsive to the G protein/phospholipase Cβ/calcium signaling pathway. © 2017 The Protein Society.

The dynamics and efficacy of antiviral RNA silencing: A model study

Directory of Open Access Journals (Sweden)

Hogeweg Paulien

2008-03-01

Full Text Available Abstract Background Mathematical modeling is important to provide insight in the complicated pathway of RNA silencing. RNA silencing is an RNA based mechanism that is widely used by eukaryotes to fight viruses, and to control gene expression. Results We here present the first mathematical model that combines viral growth with RNA silencing. The model involves a plus-strand RNA virus that replicates through a double-strand RNA intermediate. The model of the RNA silencing pathway consists of cleavage of viral RNA into siRNA by Dicer, target cleavage of viral RNA via the RISC complex, and a secondary response. We found that, depending on the strength of the silencing response, different viral growth patterns can occur. Silencing can decrease viral growth, cause oscillations, or clear the virus completely. Our model can explain various observed phenomena, even when they seem contradictory at first: the diverse responses to the removal of RNA dependent RNA polymerase; different viral growth curves; and the great diversity in observed siRNA ratios. Conclusion The model presented here is an important step in the understanding of the natural functioning of RNA silencing in viral infections.

RNAi suppressors encoded by pathogenic human viruses

NARCIS (Netherlands)

de Vries, Walter; Berkhout, Ben

2008-01-01

RNA silencing or RNAi interference (RNAi) serves as an innate antiviral mechanism in plants, fungi and animals. Human viruses, like plant viruses, encode suppressor proteins or RNAs that block or modulate the RNAi pathway. This review summarizes the mechanisms by which pathogenic human viruses

Plant RNA Regulatory Network and RNA Granules in Virus Infection

Directory of Open Access Journals (Sweden)

Kristiina Mäkinen

2017-12-01

Full Text Available Regulation of post-transcriptional gene expression on mRNA level in eukaryotic cells includes translocation, translation, translational repression, storage, mRNA decay, RNA silencing, and nonsense-mediated decay. These processes are associated with various RNA-binding proteins and cytoplasmic ribonucleoprotein complexes many of which are conserved across eukaryotes. Microscopically visible aggregations formed by ribonucleoprotein complexes are termed RNA granules. Stress granules where the translationally inactive mRNAs are stored and processing bodies where mRNA decay may occur present the most studied RNA granule types. Diverse RNP-granules are increasingly being assigned important roles in viral infections. Although the majority of the molecular level studies on the role of RNA granules in viral translation and replication have been conducted in mammalian systems, some studies link also plant virus infection to RNA granules. An increasing body of evidence indicates that plant viruses require components of stress granules and processing bodies for their replication and translation, but how extensively the cellular mRNA regulatory network is utilized by plant viruses has remained largely enigmatic. Antiviral RNA silencing, which is an important regulator of viral RNA stability and expression in plants, is commonly counteracted by viral suppressors of RNA silencing. Some of the RNA silencing suppressors localize to cellular RNA granules and have been proposed to carry out their suppression functions there. Moreover, plant nucleotide-binding leucine-rich repeat protein-mediated virus resistance has been linked to enhanced processing body formation and translational repression of viral RNA. Many interesting questions relate to how the pathways of antiviral RNA silencing leading to viral RNA degradation and/or repression of translation, suppression of RNA silencing and viral RNA translation converge in plants and how different RNA granules and

Plant RNA Regulatory Network and RNA Granules in Virus Infection.

Science.gov (United States)

Mäkinen, Kristiina; Lõhmus, Andres; Pollari, Maija

2017-01-01

Regulation of post-transcriptional gene expression on mRNA level in eukaryotic cells includes translocation, translation, translational repression, storage, mRNA decay, RNA silencing, and nonsense-mediated decay. These processes are associated with various RNA-binding proteins and cytoplasmic ribonucleoprotein complexes many of which are conserved across eukaryotes. Microscopically visible aggregations formed by ribonucleoprotein complexes are termed RNA granules. Stress granules where the translationally inactive mRNAs are stored and processing bodies where mRNA decay may occur present the most studied RNA granule types. Diverse RNP-granules are increasingly being assigned important roles in viral infections. Although the majority of the molecular level studies on the role of RNA granules in viral translation and replication have been conducted in mammalian systems, some studies link also plant virus infection to RNA granules. An increasing body of evidence indicates that plant viruses require components of stress granules and processing bodies for their replication and translation, but how extensively the cellular mRNA regulatory network is utilized by plant viruses has remained largely enigmatic. Antiviral RNA silencing, which is an important regulator of viral RNA stability and expression in plants, is commonly counteracted by viral suppressors of RNA silencing. Some of the RNA silencing suppressors localize to cellular RNA granules and have been proposed to carry out their suppression functions there. Moreover, plant nucleotide-binding leucine-rich repeat protein-mediated virus resistance has been linked to enhanced processing body formation and translational repression of viral RNA. Many interesting questions relate to how the pathways of antiviral RNA silencing leading to viral RNA degradation and/or repression of translation, suppression of RNA silencing and viral RNA translation converge in plants and how different RNA granules and their individual

Suppressors of RNA silencing encoded by tomato leaf curl

Indian Academy of Sciences (India)

Whitefly-transmitted begomoviruses infecting tomato crop code for five different proteins, ORF AC4, ORF AC2 and ORF AV2 in DNA-A component, ORF BV1 in DNA-B ... In the present study suppressor function of ORF C1 of three betasatellites Tomato leaf curl Bangalore betasatellite ToLCBB-[IN:Hess:08], Cotton leaf curl ...

RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops.

Science.gov (United States)

Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo

2016-12-01

Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.

An Algorithm for Generating Small RNAs Capable of Epigenetically Modulating Transcriptional Gene Silencing and Activation in Human Cells

Directory of Open Access Journals (Sweden)

Amanda Ackley

2013-01-01

Full Text Available Small noncoding antisense RNAs (sasRNAs guide epigenetic silencing complexes to target loci in human cells and modulate gene transcription. When these targeted loci are situated within a promoter, long-term, stable epigenetic silencing of transcription can occur. Recent studies suggest that there exists an endogenous form of such epigenetic regulation in human cells involving long noncoding RNAs. In this article, we present and validate an algorithm for the generation of highly effective sasRNAs that can mimic the endogenous noncoding RNAs involved in the epigenetic regulation of gene expression. We validate this algorithm by targeting several oncogenes including AKT-1, c-MYC, K-RAS, and H-RAS. We also target a long antisense RNA that mediates the epigenetic repression of the tumor suppressor gene DUSP6, silenced in pancreatic cancer. An algorithm that can efficiently design small noncoding RNAs for the epigenetic transcriptional silencing or activation of specific genes has potential therapeutic and experimental applications.

The RNA silencing pathway: the bits and pieces that matter.

Directory of Open Access Journals (Sweden)

2005-07-01

Full Text Available Cellular pathways are generally proposed on the basis of available experimental knowledge. The proposed pathways, however, may be inadequate to describe the phenomena they are supposed to explain. For instance, by means of concise mathematical models we are able to reveal shortcomings in the current description of the pathway of RNA silencing. The silencing pathway operates by cleaving siRNAs from dsRNA. siRNAs can associate with RISC, leading to the degradation of the target mRNA. We propose and analyze a few small extensions to the pathway: a siRNA degrading RNase, primed amplification of aberrant RNA pieces, and cooperation between aberrant RNA to trigger amplification. These extensions allow for a consistent explanation for various types of silencing phenomena, such as virus induced silencing, transgene and transposon induced silencing, and avoidance of self-reactivity, as well as for differences found between species groups.

LncRNA GAS5 Represses Osteosarcoma Cells Growth and Metastasis via Sponging MiR-203a

Directory of Open Access Journals (Sweden)

Yang Wang

2018-01-01

Full Text Available Background/Aims: LncRNA GAS5, a growth suppressor, has been reported to exert anti-tumor actions in various cancers, whereas the exact mechanism underling the anti-tumor action is still unclear. This study was aimed to investigate the effect of lncRNA GAS5 on osteosarcoma and tried to decode the underling mechanisms. Methods: Expressions of lncRNA GAS5 in MG-63 cells were silenced by shRNA transfection, while were overexpressed by vector transfection. Cell viability, migration, invasion and apoptosis were respectively assessed by MTT, Transwell assay and flow cytometry. Regulations between lncRNA GAS5 and miR-203a, as well as between miR-203a and TIMP2 were detected by qPCR, western blot and dual luciferase activity assay. Results: LncRNA GAS5 was down-regulated in MG-63 and OS-732 cells compared to hFOB1.19 cells. Silence of lncRNA GAS5 significantly promoted MG-63 cells viability, migration and invasion, and up-regulated Cyclin D1, Cyclin B1, CDK1 and CDK4 expressions. miR-203a was negatively regulated by lncRNA GAS5. The promoting activities of lncRNA GAS5 silence on MG-63 cells growth and metastasis were reversed by miR-203a suppression. TIMP2 was a target of miR-203a and the anti-growth and anti-metastasis actions of miR-203a suppression were reversed by TIMP2 silence. Further, lncRNA GAS5 silence, miR-203a overexpression, and TIMP2 silence could activate PI3K/AKT/GSK3β signaling while block NF-κB signaling. Conclusion: LncRNA GAS5 might be a tumor suppressor in osteosarcoma via sponging miR-203a, sequestering miR-203a away from TIMP2.

Platinum Interference with siRNA Non-seed Regions Fine-Tunes Silencing Capacity

DEFF Research Database (Denmark)

Hedman, Hanna K; Kirpekar, Finn; Elmroth, Sofi K C

2011-01-01

expression, and the other one focused on the function of endogenous miRNAs. In both cases, the active molecule consists of a ∼20-nucleotide-long RNA duplex. In the siRNA case, improved systemic stability is of central interest for its further development toward clinical applications. With respect to mi......RNA processing and function, understanding its influence on mRNA targeting and the silencing ability of individual miRNAs, e.g., under pathological conditions, remains a scientific challenge. In the present study, a model system is presented where the influence of the two clinically used anticancer drugs......, cisplatin and oxaliplatin, on siRNA's silencing capacity has been evaluated. More specifically, siRNAs targeting the 3' UTR region of Wnt-5a mRNA (NM_003352) were constructed, and the biologically active antisense RNA strand was pre-platinated. Platinum adducts were detected and characterized...

High-level HIV-1 Nef transient expression in Nicotiana benthamiana using the P19 gene silencing suppressor protein of Artichoke Mottled Crinckle Virus

Directory of Open Access Journals (Sweden)

Bianco Linda

2009-11-01

Full Text Available Abstract Background In recent years, different HIV antigens have been successfully expressed in plants by either stable transformation or transient expression systems. Among HIV proteins, Nef is considered a promising target for the formulation of a multi-component vaccine due to its implication in the first steps of viral infection. Attempts to express Nef as a single protein product (not fused to a stabilizing protein in transgenic plants resulted in disappointingly low yields (about 0.5% of total soluble protein. In this work we describe a transient expression system based on co-agroinfiltration of plant virus gene silencing suppressor proteins in Nicotiana benthamiana, followed by a two-step affinity purification protocol of plant-derived Nef. Results The effect of three gene silencing viral suppressor proteins (P25 of Potato Virus X, P19 of either Artichoke Mottled Crinckle virus and Tomato Bushy Stunt virus on Nef transient expression yield was evaluated. The P19 protein of Artichoke Mottled Crinckle virus (AMCV-P19 gave the highest expression yield in vacuum co-agroinfiltration experiments reaching 1.3% of total soluble protein, a level almost three times higher than that previously reported in stable transgenic plants. The high yield observed in the co-agroinfiltrated plants was correlated to a remarkable decrease of Nef-specific small interfering RNAs (siRNAs indicating an effective modulation of RNA silencing mechanisms by AMCV-P19. Interestingly, we also showed that expression levels in top leaves of vacuum co-agroinfiltrated plants were noticeably reduced compared to bottom leaves. Moreover, purification of Nef from agroinfiltrated tissue was achieved by a two-step immobilized metal ion affinity chromatography protocol with yields of 250 ng/g of fresh tissue. Conclusion We demonstrated that expression level of HIV-1 Nef in plant can be improved using a transient expression system enhanced by the AMCV-P19 gene silencing suppressor

Demonstration of helicase activity in the nonstructural protein, NSs, of the negative-sense RNA virus, groundnut bud necrosis virus.

Science.gov (United States)

Bhushan, Lokesh; Abraham, Ambily; Choudhury, Nirupam Roy; Rana, Vipin Singh; Mukherjee, Sunil Kumar; Savithri, Handanahal Subbarao

2015-04-01

The nonstructural protein NSs, encoded by the S RNA of groundnut bud necrosis virus (GBNV) (genus Tospovirus, family Bunyaviridae) has earlier been shown to possess nucleic-acid-stimulated NTPase and 5' α phosphatase activity. ATP hydrolysis is an essential function of a true helicase. Therefore, NSs was tested for DNA helicase activity. The results demonstrated that GBNV NSs possesses bidirectional DNA helicase activity. An alanine mutation in the Walker A motif (K189A rNSs) decreased DNA helicase activity substantially, whereas a mutation in the Walker B motif resulted in a marginal decrease in this activity. The parallel loss of the helicase and ATPase activity in the K189A mutant confirms that NSs acts as a non-canonical DNA helicase. Furthermore, both the wild-type and K189A NSs could function as RNA silencing suppressors, demonstrating that the suppressor activity of NSs is independent of its helicase or ATPase activity. This is the first report of a true helicase from a negative-sense RNA virus.

Anti-viral RNA silencing: do we look like plants ?

Directory of Open Access Journals (Sweden)

Lecellier Charles-Henri

2006-01-01

Full Text Available Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to be similarly conserved from plants to insects, even in worms, RNA silencing does influence the replication of mammalian viruses but in a particular mode: micro(miRNAs, endogenous small RNAs naturally implicated in translational control, rather than virus-derived small interfering (siRNAs like in other organisms, are involved. In fact, these recent studies even suggest that RNA silencing may be beneficial for viral replication. Accordingly, several large DNA mammalian viruses have been shown to encode their own miRNAs. Here, we summarize the seminal studies that have implicated RNA silencing in viral infection and compare the different eukaryotic responses.

Stability of RNA silencing-based traits after virus infection

DEFF Research Database (Denmark)

Jørgensen, Bodil; Albrechtsen, Merete

2007-01-01

with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...

Phylogenetic Studies of the Three RNA Silencing Suppressor Genes of South American CTV Isolates Reveal the Circulation of a Novel Genetic Lineage

Directory of Open Access Journals (Sweden)

María José Benítez-Galeano

2015-07-01

Full Text Available Citrus Tristeza Virus (CTV is the most economically important virus of citrus worldwide. Genetic diversity and population structure of CTV isolates from all citrus growing areas from Uruguay were analyzed by RT-PCR and cloning of the three RNA silencing suppressor genes (p25, p20 and p23. Bayesian phylogenetic analysis revealed the circulation of three known genotypes (VT, T3, T36 in the country, and the presence of a new genetic lineage composed by isolates from around the world, mainly from South America. Nucleotide and amino acid identity values for this new genetic lineage were both higher than 97% for the three analyzed regions. Due to incongruent phylogenetic relationships, recombination analysis was performed using Genetic Algorithms for Recombination Detection (GARD and SimPlot software. Recombination events between previously described CTV isolates were detected. High intra-sample variation was found, confirming the co-existence of different genotypes into the same plant. This is the first report describing: (1 the genetic diversity of Uruguayan CTV isolates circulating in the country and (2 the circulation of a novel CTV genetic lineage, highly present in the South American region. This information may provide assistance to develop an effective cross-protection program.

A Medicago truncatula rdr6 allele impairs transgene silencing and endogenous phased siRNA production but not development.

Science.gov (United States)

Bustos-Sanmamed, Pilar; Hudik, Elodie; Laffont, Carole; Reynes, Christelle; Sallet, Erika; Wen, Jiangqi; Mysore, Kirankumar S; Camproux, Anne-Claude; Hartmann, Caroline; Gouzy, Jérome; Frugier, Florian; Crespi, Martin; Lelandais-Brière, Christine

2014-12-01

RNA-dependent RNA polymerase 6 (RDR6) and suppressor of gene silencing 3 (SGS3) act together in post-transcriptional transgene silencing mediated by small interfering RNAs (siRNAs) and in biogenesis of various endogenous siRNAs including the tasiARFs, known regulators of auxin responses and plant development. Legumes, the third major crop family worldwide, has been widely improved through transgenic approaches. Here, we isolated rdr6 and sgs3 mutants in the model legume Medicago truncatula. Two sgs3 and one rdr6 alleles led to strong developmental defects and impaired biogenesis of tasiARFs. In contrast, the rdr6.1 homozygous plants produced sufficient amounts of tasiARFs to ensure proper development. High throughput sequencing of small RNAs from this specific mutant identified 354 potential MtRDR6 substrates, for which siRNA production was significantly reduced in the mutant. Among them, we found a large variety of novel phased loci corresponding to protein-encoding genes or transposable elements. Interestingly, measurement of GFP expression revealed that post-transcriptional transgene silencing was reduced in rdr6.1 roots. Hence, this novel mis-sense mutation, affecting a highly conserved amino acid residue in plant RDR6s, may be an interesting tool both to analyse endogenous pha-siRNA functions and to improve transgene expression, at least in legume species. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Impact of target mRNA structure on siRNA silencing efficiency: A large-scale study.

Science.gov (United States)

Gredell, Joseph A; Berger, Angela K; Walton, S Patrick

2008-07-01

The selection of active siRNAs is generally based on identifying siRNAs with certain sequence and structural properties. However, the efficiency of RNA interference has also been shown to depend on the structure of the target mRNA, primarily through studies using exogenous transcripts with well-defined secondary structures in the vicinity of the target sequence. While these studies provide a means for examining the impact of target sequence and structure independently, the predicted secondary structures for these transcripts are often not reflective of structures that form in full-length, native mRNAs where interactions can occur between relatively remote segments of the mRNAs. Here, using a combination of experimental results and analysis of a large dataset, we demonstrate that the accessibility of certain local target structures on the mRNA is an important determinant in the gene silencing ability of siRNAs. siRNAs targeting the enhanced green fluorescent protein were chosen using a minimal siRNA selection algorithm followed by classification based on the predicted minimum free energy structures of the target transcripts. Transfection into HeLa and HepG2 cells revealed that siRNAs targeting regions of the mRNA predicted to have unpaired 5'- and 3'-ends resulted in greater gene silencing than regions predicted to have other types of secondary structure. These results were confirmed by analysis of gene silencing data from previously published siRNAs, which showed that mRNA target regions unpaired at either the 5'-end or 3'-end were silenced, on average, approximately 10% more strongly than target regions unpaired in the center or primarily paired throughout. We found this effect to be independent of the structure of the siRNA guide strand. Taken together, these results suggest minimal requirements for nucleation of hybridization between the siRNA guide strand and mRNA and that both mRNA and guide strand structure should be considered when choosing candidate si

Reexamining the P-Element Invasion of Drosophila melanogaster Through the Lens of piRNA Silencing

Science.gov (United States)

Kelleher, Erin S.

2016-01-01

Transposable elements (TEs) are both important drivers of genome evolution and genetic parasites with potentially dramatic consequences for host fitness. The recent explosion of research on regulatory RNAs reveals that small RNA-mediated silencing is a conserved genetic mechanism through which hosts repress TE activity. The invasion of the Drosophila melanogaster genome by P elements, which happened on a historical timescale, represents an incomparable opportunity to understand how small RNA-mediated silencing of TEs evolves. Repression of P-element transposition emerged almost concurrently with its invasion. Recent studies suggest that this repression is implemented in part, and perhaps predominantly, by the Piwi-interacting RNA (piRNA) pathway, a small RNA-mediated silencing pathway that regulates TE activity in many metazoan germlines. In this review, I consider the P-element invasion from both a molecular and evolutionary genetic perspective, reconciling classic studies of P-element regulation with the new mechanistic framework provided by the piRNA pathway. I further explore the utility of the P-element invasion as an exemplar of the evolution of piRNA-mediated silencing. In light of the highly-conserved role for piRNAs in regulating TEs, discoveries from this system have taxonomically broad implications for the evolution of repression. PMID:27516614

MicroRNA-103 Promotes Colorectal Cancer by Targeting Tumor Suppressor DICER and PTEN

Directory of Open Access Journals (Sweden)

Li Geng

2014-05-01

Full Text Available MicroRNAs (miRNAs are a class of small, noncoding RNAs that act as key regulators in various physiological and pathological processes. However, the regulatory mechanisms for miRNAs in colorectal cancer remain largely unknown. Here, we found that miR-103 is up-regulated in colorectal cancer and its overexpression is closely associated with tumor proliferation and migration. In addition, repressing the expression of miR-103 apparently inhibits colorectal cancer cell proliferation and migration in vitro and HCT-116 xenograft tumor growth in vivo. Subsequent software analysis and dual-luciferase reporter assay identified two tumor suppressor genes DICER and PTEN as direct targets of miR-103, and up-regulation of DICER and PTEN obtained similar results to that occurred in the silencing of miR-103. In addition, restoration of DICER and PTEN can inhibit miR-103-induced colorectal cancer cell proliferation and migration. Our data collectively demonstrate that miR-103 is an oncogene miRNA that promotes colorectal cancer proliferation and migration through down-regulation of the tumor suppressor genes DICER and PTEN. Thus, miR-103 may represent a new potential diagnostic and therapeutic target for colorectal cancer treatment.

Strategies for Improving siRNA-Induced Gene Silencing Efficiency.

Science.gov (United States)

Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad

2017-12-01

Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.

Small RNA-Mediated Epigenetic Myostatin Silencing

Directory of Open Access Journals (Sweden)

Thomas C Roberts

2012-01-01

Full Text Available Myostatin (Mstn is a secreted growth factor that negatively regulates muscle mass and is therefore a potential pharmacological target for the treatment of muscle wasting disorders such as Duchenne muscular dystrophy. Here we describe a novel Mstn blockade approach in which small interfering RNAs (siRNAs complementary to a promoter-associated transcript induce transcriptional gene silencing (TGS in two differentiated mouse muscle cell lines. Silencing is sensitive to treatment with the histone deacetylase inhibitor trichostatin A, and the silent state chromatin mark H3K9me2 is enriched at the Mstn promoter following siRNA transfection, suggesting epigenetic remodeling underlies the silencing effect. These observations suggest that long-term epigenetic silencing may be feasible for Mstn and that TGS is a promising novel therapeutic strategy for the treatment of muscle wasting disorders.

Effective Anti-miRNA Oligonucleotides Show High Releasing Rate of MicroRNA from RNA-Induced Silencing Complex.

Science.gov (United States)

Ariyoshi, Jumpei; Matsuyama, Yohei; Kobori, Akio; Murakami, Akira; Sugiyama, Hiroshi; Yamayoshi, Asako

2017-10-01

MicroRNAs (miRNAs) regulate gene expression by forming RNA-induced silencing complexes (RISCs) and have been considered as promising therapeutic targets. MiRNA is an essential component of RISC for the modulation of gene expression. Therefore, the release of miRNA from RISC is considered as an effective method for the inhibition of miRNA functions. In our previous study, we reported that anti-miRNA oligonucleotides (AMOs), which are composed of the 2'-O-methyl (2'-OMe) RNA, could induce the release of miRNA from RISC. However, the mechanisms underlying the miRNA-releasing effects of chemically modified AMOs, which are conventionally used as anti-cancer drugs, are still unclear. In this study, we investigated the relationship between the miRNA releasing rate from RISC and the inhibitory effect on RISC activity (IC 50 ) using conventional chemically modified AMOs. We demonstrated that the miRNA-releasing effects of AMOs are directly proportional to the IC 50 values, and AMOs, which have an ability to promote the release of miRNA from RISC, can effectively inhibit RISC activity in living cells.

An RNA-seq transcriptome analysis of histone modifiers and RNA silencing genes in soybean during floral initiation process.

Directory of Open Access Journals (Sweden)

Lim Chee Liew

Full Text Available Epigenetics has been recognised to play vital roles in many plant developmental processes, including floral initiation through the epigenetic regulation of gene expression. The histone modifying proteins that mediate these modifications involve the SET domain-containing histone methyltransferases, JmjC domain-containing demethylase, acetylases and deacetylases. In addition, RNA interference (RNAi-associated genes are also involved in epigenetic regulation via RNA-directed DNA methylation and post-transcriptional gene silencing. Soybean, a major crop legume, requires a short day to induce flowering. How histone modifications regulate the plant response to external cues that initiate flowering is still largely unknown. Here, we used RNA-seq to address the dynamics of transcripts that are potentially involved in the epigenetic programming and RNAi mediated gene silencing during the floral initiation of soybean. Soybean is a paleopolyploid that has been subjected to at least two rounds of whole genome duplication events. We report that the expanded genomic repertoire of histone modifiers and RNA silencing genes in soybean includes 14 histone acetyltransferases, 24 histone deacetylases, 47 histone methyltransferases, 15 protein arginine methyltransferases, 24 JmjC domain-containing demethylases and 47 RNAi-associated genes. To investigate the role of these histone modifiers and RNA silencing genes during floral initiation, we compared the transcriptional dynamics of the leaf and shoot apical meristem at different time points after a short-day treatment. Our data reveal that the extensive activation of genes that are usually involved in the epigenetic programming and RNAi gene silencing in the soybean shoot apical meristem are reprogrammed for floral development following an exposure to inductive conditions.

Human microRNA oncogenes and tumor suppressors show significantly different biological patterns: from functions to targets.

Directory of Open Access Journals (Sweden)

Dong Wang

Full Text Available MicroRNAs (miRNAs are small noncoding RNAs which play essential roles in many important biological processes. Therefore, their dysfunction is associated with a variety of human diseases, including cancer. Increasing evidence shows that miRNAs can act as oncogenes or tumor suppressors, and although there is great interest in research into these cancer-associated miRNAs, little is known about them. In this study, we performed a comprehensive analysis of putative human miRNA oncogenes and tumor suppressors. We found that miRNA oncogenes and tumor suppressors clearly show different patterns in function, evolutionary rate, expression, chromosome distribution, molecule size, free energy, transcription factors, and targets. For example, miRNA oncogenes are located mainly in the amplified regions in human cancers, whereas miRNA tumor suppressors are located mainly in the deleted regions. miRNA oncogenes tend to cleave target mRNAs more frequently than miRNA tumor suppressors. These results indicate that these two types of cancer-associated miRNAs play different roles in cancer formation and development. Moreover, the patterns identified here can discriminate novel miRNA oncogenes and tumor suppressors with a high degree of accuracy. This study represents the first large-scale bioinformatic analysis of human miRNA oncogenes and tumor suppressors. Our findings provide help for not only understanding of miRNAs in cancer but also for the specific identification of novel miRNAs as miRNA oncogenes and tumor suppressors. In addition, the data presented in this study will be valuable for the study of both miRNAs and cancer.

E-cadherin is transcriptionally activated via suppression of ZEB1 transcriptional repressor by small RNA-mediated gene silencing.

Directory of Open Access Journals (Sweden)

Minami Mazda

Full Text Available RNA activation has been reported to be induced by small interfering RNAs (siRNAs that act on the promoters of several genes containing E-cadherin. In this study, we present an alternative mechanism of E-cadherin activation in human PC-3 cells by siRNAs previously reported to possess perfect-complementary sequences to E-cadherin promoter. We found that activation of E-cadherin can be also induced via suppression of ZEB1, which is a transcriptional repressor of E-cadherin, by seed-dependent silencing mechanism of these siRNAs. The functional seed-complementary sites of the siRNAs were found in the coding region in addition to the 3' untranslated region of ZEB1 mRNA. Promoter analyses indicated that E-boxes, which are ZEB1-binding sites, in the upstream promoter region are indispensable for E-cadherin transcription by the siRNAs. Thus, the results caution against ignoring siRNA seed-dependent silencing effects in genome-wide transcriptional regulation. In addition, members of miR-302/372/373/520 family, which have the same seed sequences with one of the siRNAs containing perfect-complementarity to E-cadherin promoter, are also found to activate E-cadherin transcription. Thus, E-cadherin could be upregulated by the suppression of ZEB1 transcriptional repressor by miRNAs in vivo.

Interplays between soil-borne plant viruses and RNA silencing-mediated antiviral defense in roots

Directory of Open Access Journals (Sweden)

Ida Bagus Andika

2016-09-01

Full Text Available Although the majority of plant viruses are transmitted by arthropod vectors and invade the host plants through the aerial parts, there is a considerable number of plant viruses that infect roots via soil-inhabiting vectors such as plasmodiophorids, chytrids, and nematodes. These soil-borne viruses belong to diverse families, and many of them cause serious diseases in major crop plants. Thus, roots are important organs for the life cycle of many viruses. Compared to shoots, roots have a distinct metabolism and particular physiological characteristics due to the differences in development, cell composition, gene expression patterns, and surrounding environmental conditions. RNA silencing is an important innate defense mechanism to combat virus infection in plants, but the specific information on the activities and molecular mechanism of RNA silencing-mediated viral defense in root tissue is still limited. In this review, we summarize and discuss the current knowledge regarding RNA silencing aspects of the interactions between soil-borne viruses and host plants. Overall, research evidence suggests that soil-borne viruses have evolved to adapt to the distinct mechanism of antiviral RNA silencing in roots.

RNA silencing is required for Arabidopsis defence against Verticillium wilt disease

NARCIS (Netherlands)

Ellendorff, U.; Fradin, E.F.; Jonge, de R.; Thomma, B.P.H.J.

2009-01-01

RNA silencing is a conserved mechanism in eukaryotes that plays an important role in various biological processes including regulation of gene expression. RNA silencing also plays a role in genome stability and protects plants against invading nucleic acids such as transgenes and viruses. Recently,

MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts

Science.gov (United States)

Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng

2014-01-01

Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645

MicroRNA-mediated myostatin silencing in caprine fetal fibroblasts.

Directory of Open Access Journals (Sweden)

Bushuai Zhong

Full Text Available Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi mediated by microRNAs (miRNAs is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN response genes, such as interferon beta (IFN-β and 2'-5'-oligoadenylate synthetase 2 (OAS2, were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats.

Pathways of cellular internalisation of liposomes delivered siRNA and effects on siRNA engagement with target mRNA and silencing in cancer cells.

Science.gov (United States)

Alshehri, Abdullah; Grabowska, Anna; Stolnik, Snow

2018-02-28

Design of an efficient delivery system is a generally recognised bottleneck in translation of siRNA technology into clinic. Despite research efforts, cellular processes that determine efficiency of siRNA silencing achieved by different delivery formulations remain unclear. Here, we investigated the mechanism(s) of cellular internalisation of a model siRNA-loaded liposome system in a correlation to the engagement of delivered siRNA with its target and consequent silencing by adopting siRNA molecular beacon technology. Probing of cellular internalisation pathways by a panel of pharmacological inhibitors indicated that clathrin-mediated (dynamin-dependent) endocytosis, macropinocytosis (dynamine independent), and cell membrane cholesterol dependent process(es) (clathrin and caveolea-independent) all play a role in the siRNA-liposomes internalization. The inhibition of either of these entry routes was, in general, mirrored by a reduction in the level of siRNA engagement with its target mRNA, as well as in a reduction of the target gene silencing. A dramatic increase in siRNA engagement with its target RNA was observed on disruption of endosomal membrane (by chloroquine), accompanied with an increased silencing. The work thus illustrates that employing molecular beacon siRNA technology one can start to assess the target RNA engagement - a stage between initial cellular internalization and final gene silencing of siRNA delivery systems.

An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing.

Science.gov (United States)

Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria; Dagnæs-Hansen, Frederik; Wengel, Jesper; Malle, Birgitte Mølholm; Kragh-Hansen, Ulrich; Cameron, Jason; Bukrinski, Jens Thostrup; Howard, Kenneth A

2016-06-28

Major challenges for the clinical translation of small interfering RNA (siRNA) include overcoming the poor plasma half-life, site-specific delivery and modulation of gene silencing. In this work, we exploit the intrinsic transport properties of human serum albumin to tune the blood circulatory half-life, hepatic accumulation and gene silencing; based on the number of siRNA cholesteryl modifications. We demonstrate by a gel shift assay a strong and specific affinity of recombinant human serum albumin (rHSA) towards cholesteryl-modified siRNA (Kd>1×10(-7)M) dependent on number of modifications. The rHSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies using multiple cholesteryl modifications. A structural-activity-based screen of in vitro EGFP-silencing was used to select optimal siRNA designs containing cholesteryl modifications within the sense strand that were used for in vivo studies. We demonstrate plasma half-life extension in NMRI mice from t1/2 12min (naked) to t1/2 45min (single cholesteryl) and t1/2 71min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing of 28% (rHSA/siRNA) compared to 4% (naked siRNA) 6days post-injection. This work presents a novel albumin-mediated cholesteryl design-based strategy for tuning pharmacokinetics and systemic gene silencing. Copyright © 2016 Elsevier B.V. All rights reserved.

A Novel Type of Non-coding RNA, nc886, Implicated in Tumor Sensing and Suppression

Directory of Open Access Journals (Sweden)

Yong Sun Lee

2015-06-01

Full Text Available nc886 (=vtRNA2-1, pre-miR-886, or CBL3 is a newly identified non-coding RNA (ncRNA that represses the activity of protein kinase R (PKR. nc886 is transcribed by RNA polymerase III (Pol III and is intriguingly the first case of a Pol III gene whose expression is silenced by CpG DNA hypermethylation in several types of cancer. PKR is a sensor protein that recognizes evading viruses and induces apoptosis to eliminate infected cells. Like viral infection, nc886 silencing activates PKR and induces apoptosis. Thus, the significance of the nc886:PKR pathway in cancer is to sense and eliminate pre-malignant cells, which is analogous to PKR's role in cellular innate immunity. Beyond this tumor sensing role, nc886 plays a putative tumor suppressor role as supported by experimental evidence. Collectively, nc886 provides a novel example how epigenetic silencing of a ncRNA contributes to tumorigenesis by controlling the activity of its protein ligand.

Hydroxychloroquine-conjugated gold nanoparticles for improved siRNA activity.

Science.gov (United States)

Perche, F; Yi, Y; Hespel, L; Mi, P; Dirisala, A; Cabral, H; Miyata, K; Kataoka, K

2016-06-01

Current technology of siRNA delivery relies on pharmaceutical dosage forms to route maximal doses of siRNA to the tumor. However, this rationale does not address intracellular bottlenecks governing silencing activity. Here, we tested the impact of hydroxychloroquine conjugation on the intracellular fate and silencing activity of siRNA conjugated PEGylated gold nanoparticles. Addition of hydroxychloroquine improved endosomal escape and increased siRNA guide strand distribution to the RNA induced silencing complex (RISC), both crucial obstacles to the potency of siRNA. This modification significantly improved gene downregulation in cellulo. Altogether, our data suggest the benefit of this modification for the design of improved siRNA delivery systems. Copyright © 2016 Elsevier Ltd. All rights reserved.

Conifers have a unique small RNA silencing signature.

Science.gov (United States)

Dolgosheina, Elena V; Morin, Ryan D; Aksay, Gozde; Sahinalp, S Cenk; Magrini, Vincent; Mardis, Elaine R; Mattsson, Jim; Unrau, Peter J

2008-08-01

Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an unexpected phylogenetic difference in the size distribution of small RNAs among the vascular plants. By extracting total RNA from freshly growing shoot tissue, we conducted a survey of small RNAs in 24 vascular plant species. We find that conifers, which radiated from the other seed-bearing plants approximately 260 million years ago, fail to produce significant amounts of 24-nucleotide (nt) RNAs that are known to guide DNA methylation and heterochromatin formation in angiosperms. Instead, they synthesize a diverse population of small RNAs that are exactly 21-nt long. This finding was confirmed by high-throughput sequencing of the small RNA sequences from a conifer, Pinus contorta. A conifer EST search revealed the presence of a novel Dicer-like (DCL) family, which may be responsible for the observed change in small RNA expression. No evidence for DCL3, an enzyme that matures 24-nt RNAs in angiosperms, was found. We hypothesize that the diverse class of 21-nt RNAs found in conifers may help to maintain organization of their unusually large genomes.

An intronic microRNA silences genes that are functionally antagonistic to its host gene.

Science.gov (United States)

Barik, Sailen

2008-09-01

MicroRNAs (miRNAs) are short noncoding RNAs that down-regulate gene expression by silencing specific target mRNAs. While many miRNAs are transcribed from their own genes, nearly half map within introns of 'host' genes, the significance of which remains unclear. We report that transcriptional activation of apoptosis-associated tyrosine kinase (AATK), essential for neuronal differentiation, also generates miR-338 from an AATK gene intron that silences a family of mRNAs whose protein products are negative regulators of neuronal differentiation. We conclude that an intronic miRNA, transcribed together with the host gene mRNA, may serve the interest of its host gene by silencing a cohort of genes that are functionally antagonistic to the host gene itself.

A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

Science.gov (United States)

Pompey, Justine M; Foda, Bardees; Singh, Upinder

2015-01-01

Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

Directory of Open Access Journals (Sweden)

Justine M Pompey

Full Text Available Dicer enzymes process double-stranded RNA (dsRNA into small RNAs that target gene silencing through the RNA interference (RNAi pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

An SGS3-like protein functions in RNA-directed DNA methylation and transcriptional gene silencing in Arabidopsis

KAUST Repository

Zheng, Zhimin

2010-01-06

RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.

Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

Directory of Open Access Journals (Sweden)

Jiangyu Wu

2013-01-01

Full Text Available RNA interference (RNAi was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc. of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system.

Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

Science.gov (United States)

Huang, Weizhe; He, Ziying

2013-01-01

RNA interference (RNAi) was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA) are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc.) of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system. PMID:24288498

Targeted transfection increases siRNA uptake and gene silencing of primary endothelial cells in vitro--a quantitative study.

Science.gov (United States)

Asgeirsdóttir, Sigridur A; Talman, Eduard G; de Graaf, Inge A; Kamps, Jan A A M; Satchell, Simon C; Mathieson, Peter W; Ruiters, Marcel H J; Molema, Grietje

2010-01-25

Applications of small-interfering RNA (siRNA) call for specific and efficient delivery of siRNA into particular cell types. We developed a novel, non-viral targeting system to deliver siRNA specifically into inflammation-activated endothelial cells. This was achieved by conjugating the cationic amphiphilic lipid SAINT to antibodies recognizing the inflammatory cell adhesion molecule E-selectin. These anti-E-selectin-SAINT lipoplexes (SAINTarg) maintained antigen recognition capacity of the parental antibody in vitro, and ex vivo in human kidney tissue slices subjected to inflammatory conditions. Regular SAINT mediated transfection resulted in efficient gene silencing in human microvascular endothelial cells (HMEC-1) and conditionally immortalized glomerular endothelial cells (ciGEnC). However, primary human umbilical vein endothelial cells (HUVEC) transfected poorly, a phenomenon that we could quantitatively correlate with a cell-type specific capacity to facilitate siRNA uptake. Importantly, SAINTarg increased siRNA uptake and transfection specificity for activated endothelial cells. Transfection with SAINTarg delivered significantly more siRNA into activated HUVEC, compared to transfection with non-targeted SAINT. The enhanced uptake of siRNA was corroborated by improved silencing of both gene- and protein expression of VE-cadherin in activated HUVEC, indicating that SAINTarg delivered functionally active siRNA into endothelial cells. The obtained results demonstrate a successful design of a small nucleotide carrier system with improved and specific siRNA delivery into otherwise difficult-to-transfect primary endothelial cells, which in addition reduced considerably the amount of siRNA needed for gene silencing. Copyright 2009 Elsevier B.V. All rights reserved.

Capturing microRNA targets using an RNA-induced silencing complex (RISC)-trap approach.

Science.gov (United States)

Cambronne, Xiaolu A; Shen, Rongkun; Auer, Paul L; Goodman, Richard H

2012-12-11

Identifying targets is critical for understanding the biological effects of microRNA (miRNA) expression. The challenge lies in characterizing the cohort of targets for a specific miRNA, especially when targets are being actively down-regulated in miRNA- RNA-induced silencing complex (RISC)-messengerRNA (mRNA) complexes. We have developed a robust and versatile strategy called RISCtrap to stabilize and purify targets from this transient interaction. Its utility was demonstrated by determining specific high-confidence target datasets for miR-124, miR-132, and miR-181 that contained known and previously unknown transcripts. Two previously unknown miR-132 targets identified with RISCtrap, adaptor protein CT10 regulator of kinase 1 (CRK1) and tight junction-associated protein 1 (TJAP1), were shown to be endogenously regulated by miR-132 in adult mouse forebrain. The datasets, moreover, differed in the number of targets and in the types and frequency of microRNA recognition element (MRE) motifs, thus revealing a previously underappreciated level of specificity in the target sets regulated by individual miRNAs.

Analysis of Tomato spotted wilt virus NSs protein indicates the importance of the N-terminal domain for avirulence and RNA silencing suppression.

Science.gov (United States)

de Ronde, Dryas; Pasquier, Adrien; Ying, Su; Butterbach, Patrick; Lohuis, Dick; Kormelink, Richard

2014-02-01

Recently, Tomato spotted wilt virus (TSWV) nonstructural protein NSs has been identified unambiguously as an avirulence (Avr) determinant for Tomato spotted wilt (Tsw)-based resistance. The observation that NSs from two natural resistance-breaking isolates had lost RNA silencing suppressor (RSS) activity and Avr suggested a link between the two functions. To test this, a large set of NSs mutants was generated by alanine substitutions in NSs from resistance-inducing wild-type strains (NSs(RI) ), amino acid reversions in NSs from resistance-breaking strains (NSs(RB)), domain deletions and swapping. Testing these mutants for their ability to suppress green fluorescent protein (GFP) silencing and to trigger a Tsw-mediated hypersensitive response (HR) revealed that the two functions can be separated. Changes in the N-terminal domain were found to be detrimental for both activities and indicated the importance of this domain, additionally supported by domain swapping between NSs(RI) and NSs(RB). Swapping domains between the closely related Tospovirus Groundnut ringspot virus (GRSV) NSs and TSWV NSs(RI) showed that Avr functionality could not simply be transferred between species. Although deletion of the C-terminal domain rendered NSs completely dysfunctional, only a few single-amino-acid mutations in the C-terminus affected both functions. Mutation of a GW/WG motif (position 17/18) rendered NSs completely dysfunctional for RSS and Avr activity, and indicated a putative interaction between NSs and Argonaute 1 (AGO1), and its importance in TSWV virulence and viral counter defence against RNA interference. © 2013 BSPP AND JOHN WILEY & SONS LTD.

Tomato Spotted Wilt Virus NSs Protein Supports Infection and Systemic Movement of a Potyvirus and Is a Symptom Determinant.

Science.gov (United States)

Garcia-Ruiz, Hernan; Gabriel Peralta, Sergio M; Harte-Maxwell, Patricia A

2018-03-14

Plant viruses are inducers and targets of antiviral RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressor proteins that interfere with antiviral RNA silencing. The NSs protein is an RNA silencing suppressor in orthotospoviruses, such as the tomato spotted wilt virus (TSWV). The mechanism of RNA silencing suppression by NSs and its role in virus infection and movement are poorly understood. Here, we cloned and tagged TSWV NSs and expressed it from a GFP-tagged turnip mosaic virus (TuMV-GFP) carrying either a wild-type or suppressor-deficient (AS9) helper component proteinase (HC-Pro). When expressed in cis, NSs restored pathogenicity and promoted systemic infection of suppressor-deficient TuMV-AS9-GFP in Nicotiana benthamiana and Arabidopsis thaliana . Inactivating mutations were introduced in NSs RNA-binding domain one. A genetic analysis with active and suppressor-deficient NSs, in combination with wild-type and mutant plants lacking essential components of the RNA silencing machinery, showed that the NSs insert is stable when expressed from a potyvirus. NSs can functionally replace potyviral HC-Pro, condition virus susceptibility, and promote systemic infection and symptom development by suppressing antiviral RNA silencing through a mechanism that partially overlaps that of potyviral HC-Pro. The results presented provide new insight into the mechanism of silencing suppression by NSs and its effect on virus infection.

The tumor suppressors p33ING1 and p33ING2 interact with alien in vivo and enhance alien-mediated gene silencing.

Science.gov (United States)

Fegers, Inga; Kob, Robert; Eckey, Maren; Schmidt, Oliver; Goeman, Frauke; Papaioannou, Maria; Escher, Niko; von Eggeling, Ferdinand; Melle, Christian; Baniahmad, Aria

2007-11-01

The tumor suppressor p33ING1 is involved in DNA repair and cell cycle regulation. Furthermore, p33ING1 is a transcriptional silencer that recognizes the histone mark for trimethylated lysine 4 at histone H3. Interestingly, expression of p33ING1 and p33ING2 is able to induce premature senescence in primary human fibroblasts. The corepressor Alien is involved in gene silencing mediated by selected members of nuclear hormone receptors. In addition, Alien acts as a corepressor for E2F1, a member of the E2F cell cycle regulatory family. Furthermore, recent findings suggest that Alien is complexed with transcription factors participating in DNA repair and chromatin. Here, using a proteomic approach by surface-enhanced laser desorption ionization and mass spectrometry (SELDI-MS) combined with immunological techniques, we show that Alien interacts in vivo with the tumor suppressor p33ING1 as well as with the related tumor suppressor candidate p33ING2. The interaction of Alien with p33ING1 and p33ING2 was confirmed in vitro with GST-pull-down, suggesting a direct binding of Alien to these factors. The binding domain was mapped to a central region of Alien. Functionally, the expression of p33ING1 or p33ING2 enhances the Alien-mediated silencing, suggesting that the interaction plays a role in transcriptional regulation. Thus, the findings suggest that the identified interaction between Alien and the tumor suppressors p33ING1 and p33ING2 reveals a novel cellular protein network.

[Small interfering RNA-mediated COX-2 gene silencing enhances chemosensitivity of KB/VCR cells by suppressing MDR-1 gene expression and P-glycoprotein activity].

Science.gov (United States)

Mo, Xianchao; Li, Weizhong

2014-05-01

To investigate the effect of small interfering RNA (siRNA)-mediated COX-2 gene silencing in enhancing the chemosensitivity of KB/VCR cell lines. KB/VCR cells were trasnfected with COX-2 siRNA were examined for expressions of COX-2 and MDR-1 mRNAs with RT-PCR and for Rho-123 accumulation using flow cytometry. MTT assay was used to analyze the proliferation of the transfected KB/VCR cells. Compared with the negative and blank control groups, COX-2 siRNA transfection resulted in significant growth inhibition of KB/VCR cells exposed to vincristine (PKB/VCR cells. COX-2 gene silencing can enhance the chemosensitivity of KB/VCR cells to vincristine, the mechanism of which may involve down-regulated MDR-1 gene expression and inhibition of P-glycoprotein activity.

GW182-Free microRNA Silencing Complex Controls Post-transcriptional Gene Expression during Caenorhabditis elegans Embryogenesis.

Directory of Open Access Journals (Sweden)

Guillaume Jannot

2016-12-01

Full Text Available MicroRNAs and Argonaute form the microRNA induced silencing complex or miRISC that recruits GW182, causing mRNA degradation and/or translational repression. Despite the clear conservation and molecular significance, it is unknown if miRISC-GW182 interaction is essential for gene silencing during animal development. Using Caenorhabditis elegans to explore this question, we examined the relationship and effect on gene silencing between the GW182 orthologs, AIN-1 and AIN-2, and the microRNA-specific Argonaute, ALG-1. Homology modeling based on human Argonaute structures indicated that ALG-1 possesses conserved Tryptophan-binding Pockets required for GW182 binding. We show in vitro and in vivo that their mutations severely altered the association with AIN-1 and AIN-2. ALG-1 tryptophan-binding pockets mutant animals retained microRNA-binding and processing ability, but were deficient in reporter silencing activity. Interestingly, the ALG-1 tryptophan-binding pockets mutant phenocopied the loss of alg-1 in worms during larval stages, yet was sufficient to rescue embryonic lethality, indicating the dispensability of AINs association with the miRISC at this developmental stage. The dispensability of AINs in miRNA regulation is further demonstrated by the capacity of ALG-1 tryptophan-binding pockets mutant to regulate a target of the embryonic mir-35 microRNA family. Thus, our results demonstrate that the microRNA pathway can act independently of GW182 proteins during C. elegans embryogenesis.

SGS3 Cooperates with RDR6 in Triggering Geminivirus-Induced Gene Silencing and in Suppressing Geminivirus Infection in Nicotiana Benthamiana

Directory of Open Access Journals (Sweden)

Fangfang Li

2017-09-01

Full Text Available RNA silencing has an important role in defending against virus infection in plants. Plants with the deficiency of RNA silencing components often show enhanced susceptibility to viral infections. RNA-dependent RNA polymerase (RDRs mediated-antiviral defense has a pivotal role in resistance to many plant viruses. In RDR6-mediated defense against viral infection, a plant-specific RNA binding protein, Suppressor of Gene Silencing 3 (SGS3, was also found to fight against some viruses in Arabidopsis. In this study, we showed that SGS3 from Nicotiana benthamiana (NbSGS3 is required for sense-RNA induced post-transcriptional gene silencing (S-PTGS and initiating sense-RNA-triggered systemic silencing. Further, the deficiency of NbSGS3 inhibited geminivirus-induced endogenous gene silencing (GIEGS and promoted geminivirus infection. During TRV-mediated NbSGS3 or N. benthamiana RDR6 (NbRDR6 silencing process, we found that their expression can be effectively fine-tuned. Plants with the knock-down of both NbSGS3 and NbRDR6 almost totally blocked GIEGS, and were more susceptible to geminivirus infection. These data suggest that NbSGS3 cooperates with NbRDR6 against GIEGS and geminivirus infection in N. benthamiana, which provides valuable information for breeding geminivirus-resistant plants.

Identification of Novel Fibrosis Modifiers by In Vivo siRNA Silencing

Directory of Open Access Journals (Sweden)

Elisabeth H. Vollmann

2017-06-01

Full Text Available Fibrotic diseases contribute to 45% of deaths in the industrialized world, and therefore a better understanding of the pathophysiological mechanisms underlying tissue fibrosis is sorely needed. We aimed to identify novel modifiers of tissue fibrosis expressed by myofibroblasts and their progenitors in their disease microenvironment through RNA silencing in vivo. We leveraged novel biology, targeting genes upregulated during liver and kidney fibrosis in this cell lineage, and employed small interfering RNA (siRNA-formulated lipid nanoparticles technology to silence these genes in carbon-tetrachloride-induced liver fibrosis in mice. We identified five genes, Egr2, Atp1a2, Fkbp10, Fstl1, and Has2, which modified fibrogenesis based on their silencing, resulting in reduced Col1a1 mRNA levels and collagen accumulation in the liver. These genes fell into different groups based on the effects of their silencing on a transcriptional mini-array and histological outcomes. Silencing of Egr2 had the broadest effects in vivo and also reduced fibrogenic gene expression in a human fibroblast cell line. Prior to our study, Egr2, Atp1a2, and Fkbp10 had not been functionally validated in fibrosis in vivo. Thus, our results provide a major advance over the existing knowledge of fibrogenic pathways. Our study is the first example of a targeted siRNA assay to identify novel fibrosis modifiers in vivo.

The microRNA effector RNA-induced silencing complex in hidradenitis suppurativa: a significant dysregulation within active inflammatory lesions.

Science.gov (United States)

Hessam, S; Sand, M; Skrygan, M; Bechara, Falk G

2017-09-01

Recently, we could show that the expression levels of the key regulators of the microRNA (miRNA) maturation and transport were dysregulated in inflamed hidradenitis suppurativa (HS) tissue (Heyam et al. in Wiley Interdiscip Rev RNA 6:271-289, 2015). The RNA-induced silencing complex (RISC) is the central element of the miRNA pathway and regulates miRNA formation and function. We investigated the expression of the RISC components, namely transactivation-responsive RNA-binding protein-1 (TRBP1), TRBP2, protein activator (PACT) of the interferon-induced protein kinase R, Argonaute RISC Catalytic Component-1 (AGO1) and Component-2 (AGO2), metadherin, and staphylococcal nuclease and Tudor domain-containing-1 (SND1) in inflamed HS tissue compared to healthy and psoriatic controls by real-time reverse transcription polymerase chain reaction. Expression levels of all investigated components were significantly lower in lesional HS skin (n = 18) compared to healthy controls (n = 10). TRBP1, PACT, AGO1, AGO2, and SND1 expression levels were significantly down-regulated in lesional HS skin compared to healthy-appearing perilesional skin (n = 7). TRBP2 and SND1 expression levels were significantly lower in healthy-appearing perilesional skin compared to healthy controls. In lesional HS skin, expression levels of PACT, AGO1, and AGO2 were significantly lower compared to psoriatic skin (n = 10). In summary, our data showed that all investigated components of RISC are dysregulated in the skin of HS patients, providing support for the hypothesis that miRNAs may have a pathological role in the inflammatory pathogenesis of HS.

Induction of cell death by tospoviral protein NSs and the motif critical for cell death does not control RNA silencing suppression activity.

Science.gov (United States)

Singh, Ajeet; Permar, Vipin; Jain, R K; Goswami, Suneha; Kumar, Ranjeet Ranjan; Canto, Tomas; Palukaitis, Peter; Praveen, Shelly

2017-08-01

Groundnut bud necrosis virus induces necrotic symptoms in different hosts. Previous studies showed reactive oxygen species-mediated programmed cell death (PCD) resulted in necrotic symptoms. Transgenic expression of viral protein NSs mimics viral symptoms. Here, we showed a role for NSs in influencing oxidative burst in the cell, by analyzing H 2 O 2 accumulation, activities of antioxidant enzymes and expression levels of vacuolar processing enzymes, H 2 O 2 -responsive microRNA 319a.2 plus its possible target metacaspase-8. The role of NSs in PCD, was shown using two NSs mutants: one in the Trp/GH3 motif (a homologue of pro-apototic domain) (NSs S189R ) and the other in a non-Trp/GH3 motif (NSs L172R ). Tobacco rattle virus (TRV) expressing NSs S189R enhanced the PCD response, but not TRV-NSs L172R , while RNA silencing suppression activity was lost in TRV-NSs L172R , but not in TRV-NSs S189R . Therefore, we propose dual roles of NSs in RNA silencing suppression and induction of cell death, controlled by different motifs. Copyright © 2017 Elsevier Inc. All rights reserved.

A single mutation in the 15S rRNA gene confers nonsense suppressor activity and interacts with mRF1 the release factor in yeast mitochondria

Directory of Open Access Journals (Sweden)

Ali Gargouri

2015-08-01

Full Text Available We have determined the nucleotide sequence of the mim3-1 mitochondrial ribosomal suppressor, acting on ochre mitochondrial mutations and one frameshift mutation in Saccharomyces cerevisiae. The 15s rRNA suppressor gene contains a G633 to C transversion. Yeast mitochondrial G633 corresponds to G517 of the E.coli 15S rRNA, which is occupied by an invariant G in all known small rRNA sequences. Interestingly, this mutation has occurred at the same position as the known MSU1 mitochondrial suppressor which changes G633 to A. The suppressor mutation lies in a highly conserved region of the rRNA, known in E.coli as the 530-loop, interacting with the S4, S5 and S12 ribosomal proteins. We also show an interesting interaction between the mitochondrial mim3-1 and the nuclear nam3-1 suppressors, both of which have the same action spectrum on mitochondrial mutations: nam3-1 abolishes the suppressor effect when present with mim3-1 in the same haploid cell. We discuss these results in the light of the nature of Nam3, identified by [1] as the yeast mitochondrial translation release factor. A hypothetical mechanism of suppression by "ribosome shifting" is also discussed in view of the nature of mutations suppressed and not suppressed.

Crop-associated virus reduces the rooting depth of non-crop perennial native grass more than non-crop-associated virus with known viral suppressor of RNA silencing (VSR).

Science.gov (United States)

Malmstrom, Carolyn M; Bigelow, Patrick; Trębicki, Piotr; Busch, Anna K; Friel, Colleen; Cole, Ellen; Abdel-Azim, Heba; Phillippo, Colin; Alexander, Helen M

2017-09-15

As agricultural acreage expanded and came to dominate landscapes across the world, viruses gained opportunities to move between crop and wild native plants. In the Midwestern USA, virus exchange currently occurs between widespread annual Poaceae crops and remnant native perennial prairie grasses now under consideration as bioenergy feedstocks. In this region, the common aphid species Rhopalosiphum padi L. (the bird cherry-oat aphid) transmits several virus species in the family Luteoviridae, including Barley yellow dwarf virus (BYDV-PAV, genus Luteovirus) and Cereal yellow dwarf virus (CYDV-RPV and -RPS, genus Polerovirus). The yellow dwarf virus (YDV) species in these two genera share genetic similarities in their 3'-ends, but diverge in the 5'-regions. Most notably, CYDVs encode a P0 viral suppressor of RNA silencing (VSR) absent in BYDV-PAV. Because BYDV-PAV has been reported more frequently in annual cereals and CYDVs in perennial non-crop grasses, we examine the hypothesis that the viruses' genetic differences reflect different affinities for crop and non-crop hosts. Specifically, we ask (i) whether CYDVs might persist within and affect a native non-crop grass more strongly than BYDV-PAV, on the grounds that the polerovirus VSR could better moderate the defenses of a well-defended perennial, and (ii) whether the opposite pattern of effects might occur in a less defended annual crop. Because previous work found that the VSR of CYDV-RPS possessed greater silencing suppressor efficiency than that of CYDV-RPV, we further explored (iii) whether a novel grass-associated CYDV-RPS isolate would influence a native non-crop grass more strongly than a comparable CYDV-RPV isolate. In growth chamber studies, we found support for this hypothesis: only grass-associated CYDV-RPS stunted the shoots and crowns of Panicum virgatum L. (switchgrass), a perennial native North American prairie grass, whereas crop-associated BYDV-PAV (and coinfection with BYDV-PAV and CYDV-RPS) most

Deep sequencing uncovers commonality in small RNA profiles between transgene-induced and naturally occurring RNA silencing of chalcone synthase-A gene in petunia.

Science.gov (United States)

Kasai, Megumi; Matsumura, Hideo; Yoshida, Kentaro; Terauchi, Ryohei; Taneda, Akito; Kanazawa, Akira

2013-01-30

Introduction of a transgene that transcribes RNA homologous to an endogenous gene in the plant genome can induce silencing of both genes, a phenomenon termed cosuppression. Cosuppression was first discovered in transgenic petunia plants transformed with the CHS-A gene encoding chalcone synthase, in which nonpigmented sectors in flowers or completely white flowers are produced. Some of the flower-color patterns observed in transgenic petunias having CHS-A cosuppression resemble those in existing nontransgenic varieties. Although the mechanism by which white sectors are generated in nontransgenic petunia is known to be due to RNA silencing of the CHS-A gene as in cosuppression, whether the same trigger(s) and/or pattern of RNA degradation are involved in these phenomena has not been known. Here, we addressed this question using deep-sequencing and bioinformatic analyses of small RNAs. We analyzed short interfering RNAs (siRNAs) produced in nonpigmented sectors of petal tissues in transgenic petunia plants that have CHS-A cosuppression and a nontransgenic petunia variety Red Star, that has naturally occurring CHS-A RNA silencing. In both silencing systems, 21-nt and 22-nt siRNAs were the most and the second-most abundant size classes, respectively. CHS-A siRNA production was confined to exon 2, indicating that RNA degradation through the RNA silencing pathway occurred in this exon. Common siRNAs were detected in cosuppression and naturally occurring RNA silencing, and their ranks based on the number of siRNAs in these plants were correlated with each other. Noticeably, highly abundant siRNAs were common in these systems. Phased siRNAs were detected in multiple phases at multiple sites, and some of the ends of the regions that produced phased siRNAs were conserved. The features of siRNA production found to be common to cosuppression and naturally occurring silencing of the CHS-A gene indicate mechanistic similarities between these silencing systems especially in the

Genome-wide analysis of histone H3 acetylation patterns in AML identifies PRDX2 as an epigenetically silenced tumor suppressor gene

DEFF Research Database (Denmark)

Agrawal-Singh, Shuchi; Isken, Fabienne; Agelopoulos, Konstantin

2012-01-01

to have lower H3Ac levels in AML compared with progenitor cells, which suggested that a large number of genes are epigenetically silenced in AML. Intriguingly, we identified peroxiredoxin 2 (PRDX2) as a novel potential tumor suppressor gene in AML. H3Ac was decreased at the PRDX2 gene promoter in AML......With the use of ChIP on microarray assays in primary leukemia samples, we report that acute myeloid leukemia (AML) blasts exhibit significant alterations in histone H3 acetylation (H3Ac) levels at > 1000 genomic loci compared with CD34+ progenitor cells. Importantly, core promoter regions tended......, which correlated with low mRNA and protein expression. We also observed DNA hypermethylation at the PRDX2 promoter in AML. Low protein expression of the antioxidant PRDX2 gene was clinically associated with poor prognosis in patients with AML. Functionally, PRDX2 acted as inhibitor of myeloid cell...

Recovery of Nicotiana benthamiana plants from a necrotic response induced by a nepovirus is associated with RNA silencing but not with reduced virus titer.

Science.gov (United States)

Jovel, Juan; Walker, Melanie; Sanfaçon, Hélène

2007-11-01

Recovery of plants from virus-induced symptoms is often described as a consequence of RNA silencing, an antiviral defense mechanism. For example, recovery of Nicotiana clevelandii from a nepovirus (tomato black ring virus) is associated with a decreased viral RNA concentration and sequence-specific resistance to further virus infection. In this study, we have characterized the interaction of another nepovirus, tomato ringspot virus (ToRSV), with host defense responses during symptom induction and subsequent recovery. Early in infection, ToRSV induced a necrotic phenotype in Nicotiana benthamiana that showed characteristics typical of a hypersensitive response. RNA silencing was also activated during ToRSV infection, as evidenced by the presence of ToRSV-derived small interfering RNAs (siRNAs) that could direct degradation of ToRSV sequences introduced into sensor constructs. Surprisingly, disappearance of symptoms was not accompanied by a commensurate reduction in viral RNA levels. The stability of ToRSV RNA after recovery was also observed in N. clevelandii and Cucumis sativus and in N. benthamiana plants carrying a functional RNA-dependent RNA polymerase 1 ortholog from Medicago truncatula. In experiments with a reporter transgene (green fluorescent protein), ToRSV did not suppress the initiation or maintenance of transgene silencing, although the movement of the silencing signal was partially hindered. Our results demonstrate that although RNA silencing is active during recovery, reduction of virus titer is not required for the initiation of this phenotype. This scenario adds an unforeseen layer of complexity to the interaction of nepoviruses with the host RNA silencing machinery. The possibility that viral proteins, viral RNAs, and/or virus-derived siRNAs inactivate host defense responses is discussed.

LNA-antisense rivals siRNA for gene silencing

DEFF Research Database (Denmark)

Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan

2004-01-01

Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been a...

ETS transcription factors control transcription of EZH2 and epigenetic silencing of the tumor suppressor gene Nkx3.1 in prostate cancer.

Directory of Open Access Journals (Sweden)

Paolo Kunderfranco

2010-05-01

Full Text Available ETS transcription factors regulate important signaling pathways involved in cell differentiation and development in many tissues and have emerged as important players in prostate cancer. However, the biological impact of ETS factors in prostate tumorigenesis is still debated.We performed an analysis of the ETS gene family using microarray data and real-time PCR in normal and tumor tissues along with functional studies in normal and cancer cell lines to understand the impact in prostate tumorigenesis and identify key targets of these transcription factors. We found frequent dysregulation of ETS genes with oncogenic (i.e., ERG and ESE1 and tumor suppressor (i.e., ESE3 properties in prostate tumors compared to normal prostate. Tumor subgroups (i.e., ERG(high, ESE1(high, ESE3(low and NoETS tumors were identified on the basis of their ETS expression status and showed distinct transcriptional and biological features. ERG(high and ESE3(low tumors had the most robust gene signatures with both distinct and overlapping features. Integrating genomic data with functional studies in multiple cell lines, we demonstrated that ERG and ESE3 controlled in opposite direction transcription of the Polycomb Group protein EZH2, a key gene in development, differentiation, stem cell biology and tumorigenesis. We further demonstrated that the prostate-specific tumor suppressor gene Nkx3.1 was controlled by ERG and ESE3 both directly and through induction of EZH2.These findings provide new insights into the role of the ETS transcriptional network in prostate tumorigenesis and uncover previously unrecognized links between aberrant expression of ETS factors, deregulation of epigenetic effectors and silencing of tumor suppressor genes. The link between aberrant ETS activity and epigenetic gene silencing may be relevant for the clinical management of prostate cancer and design of new therapeutic strategies.

The slicer activity of ARGONAUTE1 is required specifically for the phasing, not production, of trans-acting short interfering RNAs in Arabidopsis

DEFF Research Database (Denmark)

Arribas Hernandez, Laura; Marchais, Antonin; Poulsen, Christian

2016-01-01

ARGONAUTE1 (AGO1) mediates posttranscriptional silencing by microRNAs (miRNAs) and short interfering RNAS (siRNAs). AGO1-catalyzed RNA cleavage (slicing) represses miRNA targets, but current models also highlight the roles of slicing in formation of siRNAs and siRNA-AGO1 complexes. miRNA-guided s......ARGONAUTE1 (AGO1) mediates posttranscriptional silencing by microRNAs (miRNAs) and short interfering RNAS (siRNAs). AGO1-catalyzed RNA cleavage (slicing) represses miRNA targets, but current models also highlight the roles of slicing in formation of siRNAs and siRNA-AGO1 complexes. mi...... is required for assembly of active AGO1-siRNA complexes in vivo, and many AGO1-bound siRNAs are trimmed in the absence of slicer activity. Remarkably, seedlings defective in AGO1 slicer activity produce abundant siRNAs from tasiRNA loci in vivo. These siRNAs depend on RDR6 and SUPPRESSOR OF GENE SILENCING3...

High-throughput sequencing of RNA silencing-associated small RNAs in olive (Olea europaea L..

Directory of Open Access Journals (Sweden)

Livia Donaire

Full Text Available Small RNAs (sRNAs of 20 to 25 nucleotides (nt in length maintain genome integrity and control gene expression in a multitude of developmental and physiological processes. Despite RNA silencing has been primarily studied in model plants, the advent of high-throughput sequencing technologies has enabled profiling of the sRNA component of more than 40 plant species. Here, we used deep sequencing and molecular methods to report the first inventory of sRNAs in olive (Olea europaea L.. sRNA libraries prepared from juvenile and adult shoots revealed that the 24-nt class dominates the sRNA transcriptome and atypically accumulates to levels never seen in other plant species, suggesting an active role of heterochromatin silencing in the maintenance and integrity of its large genome. A total of 18 known miRNA families were identified in the libraries. Also, 5 other sRNAs derived from potential hairpin-like precursors remain as plausible miRNA candidates. RNA blots confirmed miRNA expression and suggested tissue- and/or developmental-specific expression patterns. Target mRNAs of conserved miRNAs were computationally predicted among the olive cDNA collection and experimentally validated through endonucleolytic cleavage assays. Finally, we use expression data to uncover genetic components of the miR156, miR172 and miR390/TAS3-derived trans-acting small interfering RNA (tasiRNA regulatory nodes, suggesting that these interactive networks controlling developmental transitions are fully operational in olive.

Enhancement of antiproliferative activity of interferons by RNA interference-mediated silencing of SOCS gene expression in tumor cells.

Science.gov (United States)

Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu

2008-08-01

The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.

Receptor-targeted liposome-peptide-siRNA nanoparticles represent an efficient delivery system for MRTF silencing in conjunctival fibrosis.

Science.gov (United States)

Yu-Wai-Man, Cynthia; Tagalakis, Aristides D; Manunta, Maria D; Hart, Stephen L; Khaw, Peng T

2016-02-24

There is increasing evidence that the Myocardin-related transcription factor/Serum response factor (MRTF/SRF) pathway plays a key role in fibroblast activation and that knocking down MRTF can lead to reduced scarring and fibrosis. Here, we have developed a receptor-targeted liposome-peptide-siRNA nanoparticle as a non-viral delivery system for MRTF-B siRNA in conjunctival fibrosis. Using 50 nM siRNA, the MRTF-B gene was efficiently silenced by 76% and 72% with LYR and LER nanoparticles, respectively. The silencing efficiency was low when non-targeting peptides or siRNA alone or liposome-siRNA alone were used. LYR and LER nanoparticles also showed higher silencing efficiency than PEGylated LYR-P and LER-P nanoparticles. The nanoparticles were not cytotoxic using different liposomes, targeting peptides, and 50 nM siRNA. Three-dimensional fibroblast-populated collagen matrices were also used as a functional assay to measure contraction in vitro, and showed that MRTF-B LYR nanoparticles completely blocked matrix contraction after a single transfection treatment. In conclusion, this is the first study to develop and show that receptor-targeted liposome-peptide-siRNA nanoparticles represent an efficient and safe non-viral siRNA delivery system that could be used to prevent fibrosis after glaucoma filtration surgery and other contractile scarring conditions in the eye.

Dissecting epigenetic silencing complexity in the mouse lung cancer suppressor gene Cadm1.

Directory of Open Access Journals (Sweden)

Stella Marie Reamon-Buettner

Full Text Available Disease-oriented functional analysis of epigenetic factors and their regulatory mechanisms in aberrant silencing is a prerequisite for better diagnostics and therapy. Yet, the precise mechanisms are still unclear and complex, involving the interplay of several effectors including nucleosome positioning, DNA methylation, histone variants and histone modifications. We investigated the epigenetic silencing complexity in the tumor suppressor gene Cadm1 in mouse lung cancer progenitor cell lines, exhibiting promoter hypermethylation associated with transcriptional repression, but mostly unresponsive to demethylating drug treatments. After predicting nucleosome positions and transcription factor binding sites along the Cadm1 promoter, we carried out single-molecule mapping with DNA methyltransferase M.SssI, which revealed in silent promoters high nucleosome occupancy and occlusion of transcription factor binding sites. Furthermore, M.SssI maps of promoters varied within and among the different lung cancer cell lines. Chromatin analysis with micrococcal nuclease also indicated variations in nucleosome positioning to have implications in the binding of transcription factors near nucleosome borders. Chromatin immunoprecipitation showed that histone variants (H2A.Z and H3.3, and opposing histone modification marks (H3K4me3 and H3K27me3 all colocalized in the same nucleosome positions that is reminiscent of epigenetic plasticity in embryonic stem cells. Altogether, epigenetic silencing complexity in the promoter region of Cadm1 is not only defined by DNA hypermethylation, but high nucleosome occupancy, altered nucleosome positioning, and 'bivalent' histone modifications, also likely contributed in the transcriptional repression of this gene in the lung cancer cells. Our results will help define therapeutic intervention strategies using epigenetic drugs in lung cancer.

The Putative PAX8/PPARγ Fusion Oncoprotein Exhibits Partial Tumor Suppressor Activity through Up-Regulation of Micro-RNA-122 and Dominant-Negative PPARγ Activity.

Science.gov (United States)

Reddi, Honey V; Madde, Pranathi; Milosevic, Dragana; Hackbarth, Jennifer S; Algeciras-Schimnich, Alicia; McIver, Bryan; Grebe, Stefan K G; Eberhardt, Norman L

2011-01-01

In vitro studies have demonstrated that the PAX8/PPARγ fusion protein (PPFP), which occurs frequently in follicular thyroid carcinomas (FTC), exhibits oncogenic activity. However, paradoxically, a meta-analysis of extant tumor outcome studies indicates that 68% of FTC-expressing PPFP are minimally invasive compared to only 32% of those lacking PPFP (χ(2) = 6.86, P = 0.008), suggesting that PPFP favorably impacts FTC outcomes. In studies designed to distinguish benign thyroid neoplasms from thyroid carcinomas, the previously identified tumor suppressor miR-122, a major liver micro-RNA (miR) that is decreased in hepatocellular carcinoma, was increased 8.9-fold (P negative PPARγ mutant in WRO cells was less effective than PPFP at inhibiting xenograft tumor progression (1.8-fold [P negative PPARγ activity. Up-regulation of miR-122 negatively regulates ADAM-17, a known downstream target, in thyroid cells, suggesting an antiangiogenic mechanism in thyroid carcinoma. This latter inference is directly supported by reduced CD-31 expression in WRO xenografts expressing PPFP, miR-122, and DN-PPARγ. We conclude that, in addition to its apparent oncogenic potential in vitro, PPFP exhibits paradoxical tumor suppressor activity in vivo, mediated by multiple mechanisms including up-regulation of miR-122 and dominant-negative inhibition of PPARγ activity.

LACTB, a novel epigenetic silenced tumor suppressor, inhibits colorectal cancer progression by attenuating MDM2-mediated p53 ubiquitination and degradation.

Science.gov (United States)

Zeng, Kaixuan; Chen, Xiaoxiang; Hu, Xiuxiu; Liu, Xiangxiang; Xu, Tao; Sun, Huiling; Pan, Yuqin; He, Bangshun; Wang, Shukui

2018-06-13

Colorectal cancer (CRC) is one of the most common aggressive malignancies. Like other solid tumors, inactivation of tumor suppressor genes and activation of oncogenes occur during CRC development and progression. Recently, a novel tumor suppressor, LACTB, was proposed to inhibit tumor progression, but the functional and clinical significance of this tumor suppressor in CRC remains unexplored. Herein, we found LACTB was significantly downregulated in CRC due to promoter methylation and histone deacetylation, which was associated with metastasis and advanced clinical stage. CRC patients with low LACTB expression had poorer overall survival and LACTB also determined to be an independent prognostic factor for poorer outcome. Ectopic expression of LACTB suppressed CRC cells proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT) in vitro and inhibited CRC growth and metastasis in vivo, while knockout of LACTB by CRISPR/Cas9 gene editing technique resulted in an opposite phenotype. Interestingly, LACTB could exert antitumorigenic effect only in HCT116 and HCT8 cells harboring wild-type TP53, but not in HT29 and SW480 cells harboring mutant TP53 or HCT116 p53 -/- cells. Mechanistic studies demonstrated that LACTB could directly bind to the C terminus of p53 to inhibit p53 degradation by preventing MDM2 from interacting with p53. Moreover, ablation of p53 attenuated the antitumorigenic effects of LACTB overexpression in CRC. Collectively, our findings successfully demonstrate for the first time that LACTB is a novel epigenetic silenced tumor suppressor through modulating the stability of p53, supporting the pursuit of LACTB as a potential therapeutic target for CRC.

RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops

OpenAIRE

Guo, Qigao; Liu, Qing; Smith, Neil A.; Liang, Guolu; Wang, Ming-Bo

2016-01-01

Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing ...

MicroRNA silencing in primates: towards development of novel therapeutics

DEFF Research Database (Denmark)

Petri, Andreas; Lindow, Morten; Kauppinen, Sakari

2009-01-01

MicroRNAs (miRNA) comprise an abundant class of small noncoding RNAs that act as important posttranscriptional regulators of gene expression. Accumulating evidence showing that aberrantly expressed miRNAs play important roles in human cancers underscores them as potential targets for therapeutic ...... intervention. Recent reports on efficient miRNA silencing in rodents and nonhuman primates using high-affinity targeting by chemically modified antisense oligonucleotides highlight the utility of such compounds in the development of miRNA-based cancer therapeutics....

RNA-induced silencing complex (RISC) Proteins PACT, TRBP, and Dicer are SRA binding nuclear receptor coregulators.

Science.gov (United States)

Redfern, Andrew D; Colley, Shane M; Beveridge, Dianne J; Ikeda, Naoya; Epis, Michael R; Li, Xia; Foulds, Charles E; Stuart, Lisa M; Barker, Andrew; Russell, Victoria J; Ramsay, Kerry; Kobelke, Simon J; Li, Xiaotao; Hatchell, Esme C; Payne, Christine; Giles, Keith M; Messineo, Adriana; Gatignol, Anne; Lanz, Rainer B; O'Malley, Bert W; Leedman, Peter J

2013-04-16

The cytoplasmic RNA-induced silencing complex (RISC) contains dsRNA binding proteins, including protein kinase RNA activator (PACT), transactivation response RNA binding protein (TRBP), and Dicer, that process pre-microRNAs into mature microRNAs (miRNAs) that target specific mRNA species for regulation. There is increasing evidence for important functional interactions between the miRNA and nuclear receptor (NR) signaling networks, with recent data showing that estrogen, acting through the estrogen receptor, can modulate initial aspects of nuclear miRNA processing. Here, we show that the cytoplasmic RISC proteins PACT, TRBP, and Dicer are steroid receptor RNA activator (SRA) binding NR coregulators that target steroid-responsive promoters and regulate NR activity and downstream gene expression. Furthermore, each of the RISC proteins, together with Argonaute 2, associates with SRA and specific pre-microRNAs in both the nucleus and cytoplasm, providing evidence for links between NR-mediated transcription and some of the factors involved in miRNA processing.

A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

Science.gov (United States)

Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

2016-05-01

Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi.

Science.gov (United States)

Tsai, Hsin-Yue; Chen, Chun-Chieh G; Conte, Darryl; Moresco, James J; Chaves, Daniel A; Mitani, Shohei; Yates, John R; Tsai, Ming-Daw; Mello, Craig C

2015-01-29

Effective silencing by RNA-interference (RNAi) depends on mechanisms that amplify and propagate the silencing signal. In some organisms, small-interfering RNAs (siRNAs) are amplified from target mRNAs by RNA-dependent RNA polymerase (RdRP). Both RdRP recruitment and mRNA silencing require Argonaute proteins, which are generally thought to degrade RNAi targets by directly cleaving them. However, in C. elegans, the enzymatic activity of the primary Argonaute, RDE-1, is not required for silencing activity. We show that RDE-1 can instead recruit an endoribonuclease, RDE-8, to target RNA. RDE-8 can cleave RNA in vitro and is needed for the production of 3' uridylated fragments of target mRNA in vivo. We also find that RDE-8 promotes RdRP activity, thereby ensuring amplification of siRNAs. Together, our findings suggest a model in which RDE-8 cleaves target mRNAs to mediate silencing, while generating 3' uridylated mRNA fragments to serve as templates for the RdRP-directed amplification of the silencing signal. Copyright © 2015 Elsevier Inc. All rights reserved.

RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

KAUST Repository

Cernilogar, Filippo M.

2013-06-13

Background:Beyond their role in post-transcriptional gene silencing, Dicer and Argonaute, two components of the RNA interference (RNAi) machinery, were shown to be involved in epigenetic regulation of centromeric heterochromatin and transcriptional gene silencing. In particular, RNAi mechanisms appear to play a role in repeat induced silencing and some aspects of Polycomb-mediated gene silencing. However, the functional interplay of RNAi mechanisms and Polycomb group (PcG) pathways at endogenous loci remains to be elucidated.Principal Findings:Here we show that the endogenous Dicer-2/Argonaute-2 RNAi pathway is dispensable for the PcG mediated silencing of the homeotic Bithorax Complex (BX-C). Although Dicer-2 depletion triggers mild transcriptional activation at Polycomb Response Elements (PREs), this does not induce transcriptional changes at PcG-repressed genes. Moreover, Dicer-2 is not needed to maintain global levels of methylation of lysine 27 of histone H3 and does not affect PRE-mediated higher order chromatin structures within the BX-C. Finally bioinformatic analysis, comparing published data sets of PcG targets with Argonaute-2-bound small RNAs reveals no enrichment of these small RNAs at promoter regions associated with PcG proteins.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

PhOBF1, a petunia ocs element binding factor, plays an important role in antiviral RNA silencing.

Science.gov (United States)

Sun, Daoyang; Li, Shaohua; Niu, Lixin; Reid, Michael S; Zhang, Yanlong; Jiang, Cai-Zhong

2017-02-01

Virus-induced gene silencing (VIGS) is a common reverse genetics strategy for characterizing the function of genes in plants. The detailed mechanism governing RNA silencing efficiency triggered by viruses is largely unclear. Here, we reveal that a petunia (Petunia hybrida) ocs element binding factor, PhOBF1, one of the basic leucine zipper (bZIP) transcription factors, was up-regulated by Tobacco rattle virus (TRV) infection. Simultaneous silencing of PhOBF1 and a reporter gene, phytoene desaturase (PDS) or chalcone synthase (CHS), by TRV-based VIGS led to a failure of the development of leaf photobleaching or the white-corollas phenotype. PhOBF1 silencing caused down-regulation of RNA silencing-related genes, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonautes (AGOs). After inoculation with the TRV-PhPDS, PhOBF1-RNAi lines exhibited a substantially impaired PDS silencing efficiency, whereas overexpression of PhOBF1 resulted in a recovery of the silencing phenotype (photobleaching) in systemic leaves. A compromised resistance to TRV and Tobacco mosaic virus was found in PhOBF1-RNAi lines, while PhOBF1-overexpressing lines displayed an enhanced resistance to their infections. Compared with wild-type plants, PhOBF1-silenced plants accumulated lower levels of free salicylic acid (SA), salicylic acid glucoside, and phenylalanine, contrarily to higher levels of those in plants overexpressing PhOBF1. Furthermore, transcripts of a number of genes associated with the shikimate and phenylpropanoid pathways were decreased or increased in PhOBF1-RNAi or PhOBF1-overexpressing lines, respectively. Taken together, the data suggest that PhOBF1 regulates TRV-induced RNA silencing efficiency through modulation of RDRs, DCLs, and AGOs mediated by the SA biosynthesis pathway. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Phytophthora effector targets a novel component of small RNA pathway in plants to promote infection.

Science.gov (United States)

Qiao, Yongli; Shi, Jinxia; Zhai, Yi; Hou, Yingnan; Ma, Wenbo

2015-05-05

A broad range of parasites rely on the functions of effector proteins to subvert host immune response and facilitate disease development. The notorious Phytophthora pathogens evolved effectors with RNA silencing suppression activity to promote infection in plant hosts. Here we report that the Phytophthora Suppressor of RNA Silencing 1 (PSR1) can bind to an evolutionarily conserved nuclear protein containing the aspartate-glutamate-alanine-histidine-box RNA helicase domain in plants. This protein, designated PSR1-Interacting Protein 1 (PINP1), regulates the accumulation of both microRNAs and endogenous small interfering RNAs in Arabidopsis. A null mutation of PINP1 causes embryonic lethality, and silencing of PINP1 leads to developmental defects and hypersusceptibility to Phytophthora infection. These phenotypes are reminiscent of transgenic plants expressing PSR1, supporting PINP1 as a direct virulence target of PSR1. We further demonstrate that the localization of the Dicer-like 1 protein complex is impaired in the nucleus of PINP1-silenced or PSR1-expressing cells, indicating that PINP1 may facilitate small RNA processing by affecting the assembly of dicing complexes. A similar function of PINP1 homologous genes in development and immunity was also observed in Nicotiana benthamiana. These findings highlight PINP1 as a previously unidentified component of RNA silencing that regulates distinct classes of small RNAs in plants. Importantly, Phytophthora has evolved effectors to target PINP1 in order to promote infection.

Computational analysis of siRNA recognition by the Ago2 PAZ domain and identification of the determinants of RNA-induced gene silencing.

Directory of Open Access Journals (Sweden)

Mahmoud Kandeel

Full Text Available RNA interference (RNAi is a highly specialized process of protein-siRNA interaction that results in the regulation of gene expression and cleavage of target mRNA. The PAZ domain of the Argonaute proteins binds to the 3' end of siRNA, and during RNAi the attaching end of the siRNA switches between binding and release from its binding pocket. This biphasic interaction of the 3' end of siRNA with the PAZ domain is essential for RNAi activity; however, it remains unclear whether stronger or weaker binding with PAZ domain will facilitate or hinder the overall RNAi process. Here we report the correlation between the binding of modified siRNA 3' overhang analogues and their in vivo RNAi efficacy. We found that higher RNAi efficacy was associated with the parameters of lower Ki value, lower total intermolecular energy, lower free energy, higher hydrogen bonding, smaller total surface of interaction and fewer van der Waals interactions. Electrostatic interaction was a minor contributor to compounds recognition, underscoring the presence of phosphate groups in the modified analogues. Thus, compounds with lower binding affinity are associated with better gene silencing. Lower binding strength along with the smaller interaction surface, higher hydrogen bonding and fewer van der Waals interactions were among the markers for favorable RNAi activity. Within the measured parameters, the interaction surface, van der Waals interactions and inhibition constant showed a statistically significant correlation with measured RNAi efficacy. The considerations provided in this report will be helpful in the design of new compounds with better gene silencing ability.

A silencing suppressor protein (NSs) of a tospovirus enhances baculovirus replication in permissive and semipermissive insect cell lines.

Science.gov (United States)

Oliveira, Virgínia Carla; Bartasson, Lorrainy; de Castro, Maria Elita Batista; Corrêa, José Raimundo; Ribeiro, Bergmann Morais; Resende, Renato Oliveira

2011-01-01

The nonstructural protein (NSs) of the Tomato spotted wilt virus (TSWV) has been identified as an RNAi suppressor in plant cells. A recombinant Autographa californica multiple nucleopolyhedrovirus (AcMNPV) designated vAcNSs, containing the NSs gene under the control of the viral polyhedrin (polh) gene promoter, was constructed and the effects of NSs in permissive, semipermissive and nonpermissive insect cells to vAcNSs infection were evaluated. vAcNSs produced more budded virus when compared to wild type in semipermissive cells. Co-infection of vAcNSs with wild type baculoviruses clearly enhanced polyhedra production in all host cells. Confocal microscopy analysis showed that NSs accumulated in abundance in the cytoplasm of permissive and semipermissive cells. In contrast, high amounts of NSs were detected in the nuclei of nonpermissive cells. Co-infection of vAcNSs with a recombinant AcMNPV containing the enhanced green fluorescent protein (egfp) gene, significantly increased EGFP expression in semipermissive cells and in Anticarsia gemmatalis-hemocytes. Absence of small RNA molecules of egfp transcripts in this cell line and in a permissive cell line indicates the suppression of gene silencing activity. On the other hand, vAcNSs was not able to suppress RNAi in a nonpermissive cell line. Our data showed that NSs protein of TSWV facilitates baculovirus replication in different lepidopteran cell lines, and these results indicate that NSs could play a similar role during TSWV-infection in its thrips vector. Copyright © 2010 Elsevier B.V. All rights reserved.

Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

International Nuclear Information System (INIS)

Anesti, Anna-Maria; Simpson, Guy R; Price, Toby; Pandha, Hardev S; Coffin, Robert S

2010-01-01

Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEX GM-CSF , we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials

The RNA helicase Rm62 cooperates with SU(VAR3-9 to re-silence active transcription in Drosophila melanogaster.

Directory of Open Access Journals (Sweden)

Joern Boeke

Full Text Available Gene expression is highly dynamic and many genes show a wide range in expression over several orders of magnitude. This regulation is often mediated by sequence specific transcription factors. In addition, the tight packaging of DNA into chromatin can provide an additional layer of control resulting in a dynamic range of gene expression covering several orders of magnitude. During transcriptional activation, chromatin barriers have to be eliminated to allow an efficient progression of the RNA polymerase. This repressive chromatin structure has to be re-established quickly after it has been activated in order to tightly regulate gene activity. We show that the DExD/H box containing RNA helicase Rm62 is targeted to a site of rapid induction of transcription where it is responsible for an increased degree of methylation at H3K9 at the heat shock locus after removal of the heat shock stimulus. The RNA helicase interacts with the well-characterized histone methyltransferase SU(VAR3-9 via its N-terminus, which provides a potential mechanism for the targeting of H3K9 methylation to highly regulated genes. The recruitment of SU(VAR3-9 through interaction with a RNA helicase to a site of active transcription might be a general mechanism that allows an efficient silencing of highly regulated genes thereby enabling a cell to fine tune its gene activity over a wide range.

A genome-wide analysis of the RNA-guided silencing pathway in coffee reveals insights into its regulatory mechanisms.

Directory of Open Access Journals (Sweden)

Christiane Noronha Fernandes-Brum

Full Text Available microRNAs (miRNAs are derived from self-complementary hairpin structures, while small-interfering RNAs (siRNAs are derived from double-stranded RNA (dsRNA or hairpin precursors. The core mechanism of sRNA production involves DICER-like (DCL in processing the smallRNAs (sRNAs and ARGONAUTE (AGO as effectors of silencing, and siRNA biogenesis also involves action of RNA-Dependent RNA Polymerase (RDR, Pol IV and Pol V in biogenesis. Several other proteins interact with the core proteins to guide sRNA biogenesis, action, and turnover. We aimed to unravel the components and functions of the RNA-guided silencing pathway in a non-model plant species of worldwide economic relevance. The sRNA-guided silencing complex members have been identified in the Coffea canephora genome, and they have been characterized at the structural, functional, and evolutionary levels by computational analyses. Eleven AGO proteins, nine DCL proteins (which include a DCL1-like protein that was not previously annotated, and eight RDR proteins were identified. Another 48 proteins implicated in smallRNA (sRNA pathways were also identified. Furthermore, we identified 235 miRNA precursors and 317 mature miRNAs from 113 MIR families, and we characterized ccp-MIR156, ccp-MIR172, and ccp-MIR390. Target prediction and gene ontology analyses of 2239 putative targets showed that significant pathways in coffee are targeted by miRNAs. We provide evidence of the expansion of the loci related to sRNA pathways, insights into the activities of these proteins by domain and catalytic site analyses, and gene expression analysis. The number of MIR loci and their targeted pathways highlight the importance of miRNAs in coffee. We identified several roles of sRNAs in C. canephora, which offers substantial insight into better understanding the transcriptional and post-transcriptional regulation of this major crop.

Novel RNA Duplex Locks HIV-1 in a Latent State via Chromatin-mediated Transcriptional Silencing

Directory of Open Access Journals (Sweden)

Chantelle Ahlenstiel

2015-01-01

Full Text Available Transcriptional gene silencing (TGS of mammalian genes can be induced by short interfering RNA (siRNA targeting promoter regions. We previously reported potent TGS of HIV-1 by siRNA (PromA, which targets tandem NF-κB motifs within the viral 5′LTR. In this study, we screened a siRNA panel with the aim of identifying novel 5′LTR targets, to provide multiplexing potential with enhanced viral silencing and application toward developing alternate therapeutic strategies. Systematic examination identified a novel siRNA target, si143, confirmed to induce TGS as the silencing mechanism. TGS was prolonged with virus suppression >12 days, despite a limited ability to induce post- TGS. Epigenetic changes associated with silencing were suggested by partial reversal by histone deacetylase inhibitors and confirmed by chromatin immunoprecipitation analyses, which showed induction of H3K27me3 and H3K9me3, reduction in H3K9Ac, and recruitment of argonaute-1, all characteristic marks of heterochromatin and TGS. Together, these epigenetic changes mimic those associated with HIV-1 latency. Further, robust resistance to reactivation was observed in the J-Lat 9.2 cell latency model, when transduced with shPromA and/or sh143. These data support si/shRNA-mediated TGS approaches to HIV-1 and provide alternate targets to pursue a functional cure, whereby the viral reservoir is locked in latency following antiretroviral therapy cessation.

Assessment of RNAi-induced silencing in banana (Musa spp.).

Science.gov (United States)

Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

2014-09-18

In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target

Simultaneous silencing of multiple genes in the apple scab fungus, Venturia inaequalis, by expression of RNA with chimeric inverted repeats

NARCIS (Netherlands)

Fitzgerald, A.; Kan, van J.A.L.; Plummer, K.M.

2004-01-01

RNA-mediated gene silencing has been demonstrated in plants, animals, and more recently in filamentous fungi. Here, we report high frequency, RNA-mediated gene silencing in the apple scab fungus, Venturia inaequalis. The green fluorescent protein (GFP) transgene was silenced in a GFP-expressing

Histone Methylation and Epigenetic Silencing in Breast Cancer

National Research Council Canada - National Science Library

Simon, Jeffrey A; Lange, Carol A

2008-01-01

.... EZH2 is a histone methyltransferase which modifies lysine-27 of histone H3 an epigenetic mark which is generally linked to gene silencing and is implicated in tumor suppressor silencing during breast cancer progression...

Multi-gene epigenetic silencing of tumor suppressor genes in T-cell lymphoma cells; delayed expression of the p16 protein upon reversal of the silencing

DEFF Research Database (Denmark)

Nagasawa, T; Zhang, Q; Raghunath, P N

2006-01-01

To understand better T-cell lymphomagenesis, we examined promoter CpG methylation and mRNA expression of closely related genes encoding p16, p15, and p14 tumor suppressor genes in cultured malignant T-cells that were derived from cutaneous, adult type, and anaplastic lymphoma kinase (ALK)-express...

Development of Novel Antisense Oligonucleotides for the Functional Regulation of RNA-Induced Silencing Complex (RISC) by Promoting the Release of microRNA from RISC.

Science.gov (United States)

Ariyoshi, Jumpei; Momokawa, Daiki; Eimori, Nao; Kobori, Akio; Murakami, Akira; Yamayoshi, Asako

2015-12-16

MicroRNAs (miRNAs) are known to be important post-transcription regulators of gene expression. Aberrant miRNA expression is associated with pathological disease processes, including carcinogenesis. Therefore, miRNAs are considered significant therapeutic targets for cancer therapy. MiRNAs do not act alone, but exhibit their functions by forming RNA-induced silencing complex (RISC). Thus, the regulation of RISC activity is a promising approach for cancer therapy. MiRNA is a core component of RISC and is an essential to RISC for recognizing target mRNA. Thereby, it is expected that development of the method to promote the release of miRNA from RISC would be an effective approach for inhibition of RISC activity. In this study, we synthesized novel peptide-conjugated oligonucleotides (RINDA-as) to promote the release of miRNA from RISC. RINDA-as showed a high rate of miRNA release from RISC and high level of inhibitory effect on RISC activity.

Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

Science.gov (United States)

Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J

2015-01-01

In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

Directory of Open Access Journals (Sweden)

Sha Lu

Full Text Available In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

DEFF Research Database (Denmark)

Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

2015-01-01

) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

Efficient transformation and artificial miRNA gene silencing in Lemna minor.

Science.gov (United States)

Cantó-Pastor, A; Mollá-Morales, A; Ernst, E; Dahl, W; Zhai, J; Yan, Y; Meyers, B C; Shanklin, J; Martienssen, R

2015-01-01

Despite rapid doubling time, simple architecture and ease of metabolic labelling, a lack of genetic tools in the Lemnaceae (duckweed) has impeded the full implementation of this organism as a model for biological research. Here, we present technologies to facilitate high-throughput genetic studies in duckweed. We developed a fast and efficient method for producing Lemna minor stable transgenic fronds via Agrobacterium-mediated transformation and regeneration from tissue culture. Additionally, we engineered an artificial microRNA (amiRNA) gene silencing system. We identified a Lemna gibba endogenous miR166 precursor and used it as a backbone to produce amiRNAs. As a proof of concept we induced the silencing of CH42, a magnesium chelatase subunit, using our amiRNA platform. Expression of CH42 in transgenic L. minor fronds was significantly reduced, which resulted in reduction of chlorophyll pigmentation. The techniques presented here will enable tackling future challenges in the biology and biotechnology of Lemnaceae. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

PHTS, a novel putative tumor suppressor, is involved in the transformation reversion of HeLaHF cells independently of the p53 pathway

International Nuclear Information System (INIS)

Yu Dehua; Fan, Wufang; Liu, Guohong; Nguy, Vivian; Chatterton, Jon E.; Long Shilong; Ke, Ning; Meyhack, Bernd; Bruengger, Adrian; Brachat, Arndt; Wong-Staal, Flossie; Li, Qi-Xiang

2006-01-01

HeLaHF is a non-transformed revertant of HeLa cells, likely resulting from the activation of a putative tumor suppressor(s). p53 protein was stabilized in this revertant and reactivated for certain transactivation functions. Although p53 stabilization has not conclusively been linked to the reversion, it is clear that the genes in p53 pathway are involved. The present study confirms the direct role of p53 in HeLaHF reversion by demonstrating that RNAi-mediated p53 silencing partially restores anchorage-independent growth potential of the revertant through the suppression of anoikis. In addition, we identified a novel gene, named PHTS, with putative tumor suppressor properties, and showed that this gene is also involved in HeLaHF reversion independently of the p53 pathway. Expression profiling revealed that PHTS is one of the genes that is up-regulated in HeLaHF but not in HeLa. It encodes a putative protein with CD59-like domains. RNAi-mediated PHTS silencing resulted in the partial restoration of transformation (anchorage-independent growth) in HeLaHF cells, similar to that of p53 gene silencing, implying its tumor suppressor effect. However, the observed increased transformation potential by PHTS silencing appears to be due to an increased anchorage-independent proliferation rate rather than suppression of anoikis, unlike the effect of p53 silencing. p53 silencing did not affect PHTS gene expression, and vice versa, suggesting PHTS may function in a new and p53-independent tumor suppressor pathway. Furthermore, over-expression of PHTS in different cancer cell lines, in addition to HeLa, reduces cell growth likely via induced apoptosis, confirming the broad PHTS tumor suppressor properties

Hydrophobically Modified siRNAs Silence Huntingtin mRNA in Primary Neurons and Mouse Brain

Directory of Open Access Journals (Sweden)

Julia F Alterman

2015-01-01

Full Text Available Applications of RNA interference for neuroscience research have been limited by a lack of simple and efficient methods to deliver oligonucleotides to primary neurons in culture and to the brain. Here, we show that primary neurons rapidly internalize hydrophobically modified siRNAs (hsiRNAs added directly to the culture medium without lipid formulation. We identify functional hsiRNAs targeting the mRNA of huntingtin, the mutation of which is responsible for Huntington's disease, and show that direct uptake in neurons induces potent and specific silencing in vitro. Moreover, a single injection of unformulated hsiRNA into mouse brain silences Htt mRNA with minimal neuronal toxicity. Thus, hsiRNAs embody a class of therapeutic oligonucleotides that enable simple and straightforward functional studies of genes involved in neuronal biology and neurodegenerative disorders in a native biological context.

Persistent interferon transgene expression by RNA interference-mediated silencing of interferon receptors.

Science.gov (United States)

Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu

2010-09-01

The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.

The microRNA and messengerRNA profile of the RNA-induced silencing complex in human primary astrocyte and astrocytoma cells.

Science.gov (United States)

Moser, Joanna J; Fritzler, Marvin J

2010-10-18

GW/P bodies are cytoplasmic ribonucleoprotein-rich foci involved in microRNA (miRNA)-mediated messenger RNA (mRNA) silencing and degradation. The mRNA regulatory functions within GW/P bodies are mediated by GW182 and its binding partner hAgo2 that bind miRNA in the RNA-induced silencing complex (RISC). To date there are no published reports of the profile of miRNA and mRNA targeted to the RISC or a comparison of the RISC-specific miRNA/mRNA profile differences in malignant and non-malignant cells. RISC mRNA and miRNA components were profiled by microarray analysis of malignant human U-87 astrocytoma cells and its non-malignant counterpart, primary human astrocytes. Total cell RNA as well as RNA from immunoprecipitated RISC was analyzed. The novel findings were fourfold: (1) miRNAs were highly enriched in astrocyte RISC compared to U-87 astrocytoma RISC, (2) astrocytoma and primary astrocyte cells each contained unique RISC miRNA profiles as compared to their respective cellular miRNA profiles, (3) miR-195, 10b, 29b, 19b, 34a and 455-3p levels were increased and the miR-181b level was decreased in U-87 astrocytoma RISC as compared to astrocyte RISC, and (4) the RISC contained decreased levels of mRNAs in primary astrocyte and U-87 astrocytoma cells. The observation that miR-34a and miR-195 levels were increased in the RISC of U-87 astrocytoma cells suggests an oncogenic role for these miRNAs. Differential regulation of mRNAs by specific miRNAs is evidenced by the observation that three miR34a-targeted mRNAs and two miR-195-targeted mRNAs were downregulated while one miR-195-targeted mRNA was upregulated. Biological pathway analysis of RISC mRNA components suggests that the RISC plays a pivotal role in malignancy and other conditions. This study points to the importance of the RISC and ultimately GW/P body composition and function in miRNA and mRNA deregulation in astrocytoma cells and possibly in other malignancies.

The microRNA and messengerRNA profile of the RNA-induced silencing complex in human primary astrocyte and astrocytoma cells.

Directory of Open Access Journals (Sweden)

Joanna J Moser

2010-10-01

Full Text Available GW/P bodies are cytoplasmic ribonucleoprotein-rich foci involved in microRNA (miRNA-mediated messenger RNA (mRNA silencing and degradation. The mRNA regulatory functions within GW/P bodies are mediated by GW182 and its binding partner hAgo2 that bind miRNA in the RNA-induced silencing complex (RISC. To date there are no published reports of the profile of miRNA and mRNA targeted to the RISC or a comparison of the RISC-specific miRNA/mRNA profile differences in malignant and non-malignant cells.RISC mRNA and miRNA components were profiled by microarray analysis of malignant human U-87 astrocytoma cells and its non-malignant counterpart, primary human astrocytes. Total cell RNA as well as RNA from immunoprecipitated RISC was analyzed. The novel findings were fourfold: (1 miRNAs were highly enriched in astrocyte RISC compared to U-87 astrocytoma RISC, (2 astrocytoma and primary astrocyte cells each contained unique RISC miRNA profiles as compared to their respective cellular miRNA profiles, (3 miR-195, 10b, 29b, 19b, 34a and 455-3p levels were increased and the miR-181b level was decreased in U-87 astrocytoma RISC as compared to astrocyte RISC, and (4 the RISC contained decreased levels of mRNAs in primary astrocyte and U-87 astrocytoma cells.The observation that miR-34a and miR-195 levels were increased in the RISC of U-87 astrocytoma cells suggests an oncogenic role for these miRNAs. Differential regulation of mRNAs by specific miRNAs is evidenced by the observation that three miR34a-targeted mRNAs and two miR-195-targeted mRNAs were downregulated while one miR-195-targeted mRNA was upregulated. Biological pathway analysis of RISC mRNA components suggests that the RISC plays a pivotal role in malignancy and other conditions. This study points to the importance of the RISC and ultimately GW/P body composition and function in miRNA and mRNA deregulation in astrocytoma cells and possibly in other malignancies.

The influence of cis-acting P1 protein and translational elements on the expression of Potato virus Y helper-component proteinase (HCPro) in heterologous systems and its suppression of silencing activity.

Science.gov (United States)

Tena Fernández, Fátima; González, Inmaculada; Doblas, Paula; Rodríguez, César; Sahana, Nandita; Kaur, Harpreet; Tenllado, Francisco; Praveen, Shelly; Canto, Tomas

2013-06-01

In the Potyvirus genus, the P1 protein is the first N-terminal product processed from the viral polyprotein, followed by the helper-component proteinase (HCPro). In silencing suppression patch assays, we found that Potato virus Y (PVY) HCPro expressed from a P1-HCPro sequence increased the accumulation of a reporter gene, whereas protein expressed from an HCPro sequence did not, even with P1 supplied in trans. This enhancing effect of P1 has been noted in other potyviruses, but has remained unexplained. We analysed the accumulation of PVY HCPro in infiltrated tissues and found that it was higher when expressed from P1-HCPro than from HCPro sequences. Co-expression of heterologous suppressors increased the steady-state level of mRNA expressed from the HCPro sequence, but not that of protein. This suggests that, in the absence of P1 upstream, either HCPro acquires a conformation that affects negatively its activity or stability, or that its translation is reduced. To test these options, we purified HCPro expressed in the presence or absence of upstream P1, and found no difference in purification pattern and final soluble state. By contrast, alteration of the Kozak context in the HCPro mRNA sequence to favour translation increased partially suppressor accumulation and activity. Furthermore, protein activity was not lower than in protein expressed from P1-HCPro sequences. Thus, a direct role for P1 on HCPro suppressor activity or stability, by influencing its conformation during translation, can be excluded. However, P1 could still have an indirect effect favouring HCPro accumulation. Our data highlight the relevance of cis-acting translational elements in the heterologous expression of HCPro. © 2013 BSPP AND JOHN WILEY & SONS LTD.

Epigenetic identification of ZNF545 as a functional tumor suppressor in multiple myeloma via activation of p53 signaling pathway

Energy Technology Data Exchange (ETDEWEB)

Fan, Yu [Chongqing Key Laboratory of Molecular Oncology and Epigenetics, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Zhan, Qian [The Center for Clinical Molecular Medical Detection, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Xu, Hongying [Chongqing Key Laboratory of Molecular Oncology and Epigenetics, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Li, Lili; Li, Chen [Cancer Epigenetics Laboratory, Department of Clinical Oncology, Sir YK Pao Center for Cancer and Li Ka Shing Institute of Health Sciences, The Chinese University of Hong Kong and CUHK Shenzhen Research Institute (Hong Kong); Xiao, Qian; Xiang, Shili; Hui, Tianli [Chongqing Key Laboratory of Molecular Oncology and Epigenetics, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Xiang, Tingxiu, E-mail: larissaxiang@163.com [Chongqing Key Laboratory of Molecular Oncology and Epigenetics, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China); Ren, Guosheng, E-mail: rengs726@126.com [Chongqing Key Laboratory of Molecular Oncology and Epigenetics, The First Affiliated Hospital of Chongqing Medical University, Chongqing (China)

2016-06-10

The KRAB–zinc-finger protein ZNF545 was recently identified as a potential suppressor gene in several tumors. However, the regulatory mechanisms of ZNF545 in tumorigenesis remain unclear. In this study, we investigated the expression and roles of ZNF545 in multiple myeloma (MM). ZNF545 was frequently downregulated in MM tissues compared with non-tumor bone marrow tissues. ZNF545 expression was silenced by promoter methylation in MM cell lines, and could be restored by demethylation treatment. ZNF545 methylation was detected in 28.3% of MM tissues, compared with 4.3% of normal bone marrow tissues. ZNF545 transcriptionally activated the p53 signaling pathway but had no effect on Akt in MM, whereas ectopic expression of ZNF545 in silenced cells suppressed their proliferation and induced apoptosis. We therefore identified ZNF545 as a novel tumor suppressor inhibiting tumor growth through activation of the p53 pathway in MM. Moreover, tumor-specific methylation of ZNF545 may represent an epigenetic biomarker for MM diagnosis, and a potential target for specific therapy. -- Highlights: •Downregulated ZNF545 in MM tissues and cell lines and ectopic expression of ZNF545 suppresses tumor growth. •Tumor-specific methylation of ZNF545 represents an epigenetic biomarker for MM diagnosis, and a potential target for specific therapy. •ZNF545 exerts its tumor suppressive effects via transcriptional activating p53 pathway.

Epigenetic identification of ZNF545 as a functional tumor suppressor in multiple myeloma via activation of p53 signaling pathway

International Nuclear Information System (INIS)

Fan, Yu; Zhan, Qian; Xu, Hongying; Li, Lili; Li, Chen; Xiao, Qian; Xiang, Shili; Hui, Tianli; Xiang, Tingxiu; Ren, Guosheng

2016-01-01

The KRAB–zinc-finger protein ZNF545 was recently identified as a potential suppressor gene in several tumors. However, the regulatory mechanisms of ZNF545 in tumorigenesis remain unclear. In this study, we investigated the expression and roles of ZNF545 in multiple myeloma (MM). ZNF545 was frequently downregulated in MM tissues compared with non-tumor bone marrow tissues. ZNF545 expression was silenced by promoter methylation in MM cell lines, and could be restored by demethylation treatment. ZNF545 methylation was detected in 28.3% of MM tissues, compared with 4.3% of normal bone marrow tissues. ZNF545 transcriptionally activated the p53 signaling pathway but had no effect on Akt in MM, whereas ectopic expression of ZNF545 in silenced cells suppressed their proliferation and induced apoptosis. We therefore identified ZNF545 as a novel tumor suppressor inhibiting tumor growth through activation of the p53 pathway in MM. Moreover, tumor-specific methylation of ZNF545 may represent an epigenetic biomarker for MM diagnosis, and a potential target for specific therapy. -- Highlights: •Downregulated ZNF545 in MM tissues and cell lines and ectopic expression of ZNF545 suppresses tumor growth. •Tumor-specific methylation of ZNF545 represents an epigenetic biomarker for MM diagnosis, and a potential target for specific therapy. •ZNF545 exerts its tumor suppressive effects via transcriptional activating p53 pathway.

AGO6 functions in RNA-mediated transcriptional gene silencing in shoot and root meristems in Arabidopsis thaliana.

Directory of Open Access Journals (Sweden)

Changho Eun

Full Text Available RNA-directed DNA methylation (RdDM is a small interfering RNA (siRNA-mediated epigenetic modification that contributes to transposon silencing in plants. RdDM requires a complex transcriptional machinery that includes specialized RNA polymerases, named Pol IV and Pol V, as well as chromatin remodelling proteins, transcription factors, RNA binding proteins, and other plant-specific proteins whose functions are not yet clarified. In Arabidopsis thaliana, DICER-LIKE3 and members of the ARGONAUTE4 group of ARGONAUTE (AGO proteins are involved, respectively, in generating and using 24-nt siRNAs that trigger methylation and transcriptional gene silencing of homologous promoter sequences. AGO4 is the main AGO protein implicated in the RdDM pathway. Here we report the identification of the related AGO6 in a forward genetic screen for mutants defective in RdDM and transcriptional gene silencing in shoot and root apical meristems in Arabidopsis thaliana. The identification of AGO6, and not AGO4, in our screen is consistent with the primary expression of AGO6 in shoot and root growing points.

An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

Directory of Open Access Journals (Sweden)

Olga Fernández-Miragall

Full Text Available Pelargonium flower break virus (PFBV, genus Carmovirus has a single-stranded positive-sense genomic RNA (gRNA which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37 which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES. Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

Science.gov (United States)

Fernández-Miragall, Olga; Hernández, Carmen

2011-01-01

Pelargonium flower break virus (PFBV, genus Carmovirus) has a single-stranded positive-sense genomic RNA (gRNA) which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37) which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES). Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

Short-hairpin RNA-mediated Heat shock protein 90 gene silencing inhibits human breast cancer cell growth in vitro and in vivo

International Nuclear Information System (INIS)

Zuo, Keqiang; Li, Dan; Pulli, Benjamin; Yu, Fei; Cai, Haidong; Yuan, Xueyu; Zhang, Xiaoping; Lv, Zhongwei

2012-01-01

Highlights: ► Hsp90 is over-expressed in human breast cancer. ► The shRNA-mediated gene silencing of Hsp90 resulted in inhibition of cell growth. ► Akt and NF-kB were down-regulation after transfection due to Hsp90 silencing. ► The tumor growth ratio was decline due to Hsp90 silencing. ► The PCNA expression was down-regulation due to Hsp90 silencing. -- Abstract: Hsp90 interacts with proteins that mediate signaling pathways involved in the regulation of essential processes such as proliferation, cell cycle control, angiogenesis and apoptosis. Hsp90 inhibition is therefore an attractive strategy for blocking abnormal pathways that are crucial for cancer cell growth. In the present study, the role of Hsp90 in human breast cancer MCF-7 cells was examined by stably silencing Hsp90 gene expression with an Hsp90-silencing vector (Hsp90-shRNA). RT-PCR and Western blot analyses showed that Hsp90-shRNA specifically and markedly down-regulated Hsp90 mRNA and protein expression. NF-kB and Akt protein levels were down-regulated in Hsp90-shRNA transfected cells, indicating that Hsp90 knockout caused a reduction of survival factors and induced apoptosis. Treatment with Hsp90-shRNA significantly increased apoptotic cell death and caused cell cycle arrest in the G1/S phase in MCF-7 cells, as shown by flow cytometry. Silencing of Hsp90 also reduced cell viability, as determined by MTT assay. In vivo experiments showed that MCF-7 cells stably transfected with Hsp90-shRNA grew slowly in nude mice as compared with control groups. In summary, the Hsp90-shRNA specifically silenced the Hsp90 gene, and inhibited MCF-7 cell growth in vitro and in vivo. Possible molecular mechanisms underlying the effects of Hsp90-shRNA include the degradation of Hsp90 breast cancer-related client proteins, the inhibition of survival signals and the upregulation of apoptotic pathways. shRNA-mediated interference may have potential therapeutic utility in human breast cancer.

Growth inhibition of head and neck squamous cell carcinoma cells by sgRNA targeting the cyclin D1 mRNA based on TRUE gene silencing.

Directory of Open Access Journals (Sweden)

Satoshi Iizuka

Full Text Available Head and neck squamous cell carcinoma (HNSCC exhibits increased expression of cyclin D1 (CCND1. Previous studies have shown a correlation between poor prognosis of HNSCC and cyclin D1 overexpression. tRNase ZL-utilizing efficacious gene silencing (TRUE gene silencing is one of the RNA-mediated gene expression control technologies that have therapeutic potential. This technology is based on a unique enzymatic property of mammalian tRNase ZL, which is that it can cleave any target RNA at any desired site by recognizing a pre-tRNA-like complex formed between the target RNA and an artificial small guide RNA (sgRNA. In this study, we designed several sgRNAs targeting human cyclin D1 mRNA to examine growth inhibition of HNSCC cells. Transfection of certain sgRNAs decreased levels of cyclin D1 mRNA and protein in HSC-2 and HSC-3 cells, and also inhibited their proliferation. The combination of these sgRNAs and cisplatin showed more than additive inhibition of cancer cell growth. These findings demonstrate that TRUE gene silencing of cyclin D1 leads to inhibition of the growth of HNSCC cells and suggest that these sgRNAs alone or combined with cisplatin may be a useful new therapy for HNSCCs.

Phenotypic silencing of cytoplasmic genes using sequence-specific double-stranded short interfering RNA and its application in the reverse genetics of wild type negative-strand RNA viruses

Directory of Open Access Journals (Sweden)

Barik Sailen

2001-12-01

Full Text Available Abstract Background Post-transcriptional gene silencing (PTGS by short interfering RNA has opened up new directions in the phenotypic mutation of cellular genes. However, its efficacy on non-nuclear genes and its effect on the interferon pathway remain unexplored. Since directed mutation of RNA genomes is not possible through conventional mutagenesis, we have tested sequence-specific 21-nucleotide long double-stranded RNAs (dsRNAs for their ability to silence cytoplasmic RNA genomes. Results Short dsRNAs were generated against specific mRNAs of respiratory syncytial virus, a nonsegmented negative-stranded RNA virus with a cytoplasmic life cycle. At nanomolar concentrations, the dsRNAs specifically abrogated expression of the corresponding viral proteins, and produced the expected mutant phenotype ex vivo. The dsRNAs did not induce an interferon response, and did not inhibit cellular gene expression. The ablation of the viral proteins correlated with the loss of the specific mRNAs. In contrast, viral genomic and antigenomic RNA, which are encapsidated, were not directly affected. Conclusions Synthetic inhibitory dsRNAs are effective in specific silencing of RNA genomes that are exclusively cytoplasmic and transcribed by RNA-dependent RNA polymerases. RNA-directed RNA gene silencing does not require cloning, expression, and mutagenesis of viral cDNA, and thus, will allow the generation of phenotypic null mutants of specific RNA viral genes under normal infection conditions and at any point in the infection cycle. This will, for the first time, permit functional genomic studies, attenuated infections, reverse genetic analysis, and studies of host-virus signaling pathways using a wild type RNA virus, unencumbered by any superinfecting virus.

RNA interference: ready to silence cancer?

Science.gov (United States)

Mocellin, Simone; Costa, Rodolfo; Nitti, Donato

2006-01-01

RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.

RNA-mediated gene silencing signals are not graft transmissible from the rootstock to the scion in greenhouse-grown apple plants Malus sp.

Science.gov (United States)

Flachowsky, Henryk; Tränkner, Conny; Szankowski, Iris; Waidmann, Sascha; Hanke, Magda-Viola; Treutter, Dieter; Fischer, Thilo C

2012-01-01

RNA silencing describes the sequence specific degradation of RNA targets. Silencing is a non-cell autonomous event that is graft transmissible in different plant species. The present study is the first report on systemic acquired dsRNA-mediated gene silencing of transgenic and endogenous gene sequences in a woody plant like apple. Transgenic apple plants overexpressing a hairpin gene construct of the gusA reporter gene were produced. These plants were used as rootstocks and grafted with scions of the gusA overexpressing transgenic apple clone T355. After grafting, we observed a reduction of the gusA gene expression in T355 scions in vitro, but not in T355 scions grown in the greenhouse. Similar results were obtained after silencing of the endogenous Mdans gene in apple that is responsible for anthocyanin biosynthesis. Subsequently, we performed grafting experiments with Mdans silenced rootstocks and red leaf scions of TNR31-35 in order to evaluate graft transmitted silencing of the endogenous Mdans. The results obtained suggested a graft transmission of silencing signals in in vitro shoots. In contrast, no graft transmission of dsRNA-mediated gene silencing signals was detectable in greenhouse-grown plants and in plants grown in an insect protection tent.

RNA interference-mediated silencing of speckle-type POZ protein promotes apoptosis of renal cell cancer cells.

Science.gov (United States)

Liu, Xiaoxia; Sun, Guiling; Sun, Xiuju

2016-01-01

This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP) gene on renal cell cancer (RCC) cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA)-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte-macrophage colony-stimulating factor and E-cadherin was significantly increased (Pmatrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial growth factor receptor, matrix metallopeptidase-9, and vascular cell adhesion molecule, which are related to the integrin-mediated cell surface interactions and extracellular matrix organization signaling pathway.

PLK-1 Silencing in Bladder Cancer by siRNA Delivered With Exosomes.

Science.gov (United States)

Greco, Kristin A; Franzen, Carrie A; Foreman, Kimberly E; Flanigan, Robert C; Kuo, Paul C; Gupta, Gopal N

2016-05-01

To use exosomes as a vector to deliver small interfering ribonucleic acid (siRNA) to silence the polo-like kinase 1 (PLK-1) gene in bladder cancer cells. Exosomes were isolated from both human embryonic kidney 293 (HEK293) cell and mesenchymal stem cell (MSC) conditioned media. Fluorescently labeled exosomes were co-cultured with bladder cancer and normal epithelial cells and uptake was quantified by image cytometry. PLK-1 siRNA and negative control siRNA were loaded into HEK293 and MSC exosomes using electroporation. An invasive bladder cancer cell line (UMUC3) was co-cultured with the electroporated exosomes. Quantitative reverse transcriptase polymerase chain reaction was performed. Protein analysis was performed by Western blot. Annexin V staining and MTT assays were used to investigate effects on apoptosis and viability. Bladder cancer cell lines internalize an increased percentage of HEK293 exosomes when compared to normal bladder epithelial cells. Treatment of UMUC3 cells with exosomes electroporated with PLK-1 siRNA achieved successful knockdown of PLK-1 mRNA and protein when compared to cells treated with negative control exosomes. HEK293 and MSC exosomes were effectively used as a delivery vector to transport PLK-1 siRNA to bladder cancer cells in vitro, resulting in selective gene silencing of PLK-1. The use of exosomes as a delivery vector for potential intravesical therapy is attractive. Copyright © 2016 Elsevier Inc. All rights reserved.

Effect of silencing of ATM expression by siRNA on radiosensitivity of human lung adenocarcinoma A549 cells

International Nuclear Information System (INIS)

Liu Xiaoqun; Qiao Tiankui

2014-01-01

Objective: To investigate the effect of silencing of ataxia-telangiectasia mutated (ATM) expression by plasmid-mediated RNA interference on the radiosensitivity of human lung adenocarcinoma A 549 cells. Methods: Eukaryotic expression plasmid containing ATM small interfering RNA (siRNA) (pSilencer2.1-ATM), as well as pSilencer2.1-nonspecific, was constructed.Lung adenocarcinoma A 549 cells were divided into positive group, negative group,and control group to be transfected with pSilencer2.1-ATM, pSilencer2.1-nonspecific, and no plasmid, respectively. The mRNA and protein expression of ATM was measured by RT-PCR and Western blot, respectively. The change in cell radiosensitivity was observed by colony-forming assay. Cell cycle and cell apoptosis were analyzed by flow cytometry. Results: The eukaryotic expression plasmid containing ATM siRNA was successfully constructed. The RT-PCR and Western blot demonstrated that the expression of ATM was down-regulated in the positive group. The sensitization enhancement ratios (D 0 ratios) for the positive group and negative group were 1.50 and 1.01, respectively. The flow cytometry revealed that the proportions of A 549 cells in G 1 and G 2 /M phases were significantly lower in the positive group than in the control group (51.27% vs 61.85%, P = 0.012; 6.34% vs 10.91%, P = 0.008) and that the apoptosis rate was significantly higher in the positive group than in the control group and negative group (49.31% vs 13.58%, P = 0.000; 49.31% vs 13.17%, P = 0.000). Conclusions: Silencing of ATM expression may increase the radiosensitivity of human lung adenocarcinoma A 549 cells, probably by affecting the cell cycle and promoting cell apoptosis. (authors)

Silencing VDAC1 Expression by siRNA Inhibits Cancer Cell Proliferation and Tumor Growth In Vivo

Directory of Open Access Journals (Sweden)

Tasleem Arif

2014-01-01

Full Text Available Alterations in cellular metabolism and bioenergetics are vital for cancer cell growth and motility. Here, the role of the mitochondrial protein voltage-dependent anion channel (VDAC1, a master gatekeeper regulating the flux of metabolites and ions between mitochondria and the cytoplasm, in regulating the growth of several cancer cell lines was investigated by silencing VDAC1 expression using small interfering RNA (siRNA. A single siRNA specific to the human VDAC1 sequence at nanomolar concentrations led to some 90% decrease in VDAC1 levels in the lung A549 and H358, prostate PC-3, colon HCT116, glioblastoma U87, liver HepG2, and pancreas Panc-1 cancer cell lines. VDAC1 silencing persisted 144 hours post-transfection and resulted in profound inhibition of cell growth in cancer but not in noncancerous cells, with up to 90% inhibition being observed over 5 days that was prolonged by a second transfection. Cells expressing low VDAC1 levels showed decreased mitochondrial membrane potential and adenoside triphosphate (ATP levels, suggesting limited metabolite exchange between mitochondria and cytosol. Moreover, cells silenced for VDAC1 expression showed decreased migration, even in the presence of the wound healing accelerator basic fibroblast growth factor (bFGF. VDAC1-siRNA inhibited cancer cell growth in a Matrigel-based assay in host nude mice. Finally, in a xenograft lung cancer mouse model, chemically modified VDAC1-siRNA not only inhibited tumor growth but also resulted in tumor regression. This study thus shows that VDAC1 silencing by means of RNA interference (RNAi dramatically inhibits cancer cell growth and tumor development by disabling the abnormal metabolic behavior of cancer cells, potentially paving the way for a more effective pipeline of anticancer drugs.

MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense

Directory of Open Access Journals (Sweden)

Sheng-Rui Liu

2017-09-01

Full Text Available MicroRNAs (miRNAs are non-coding RNAs of approximately 20–24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant–pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense mechanism. Here, we summarize the current knowledge and recent advances in understanding the roles of miRNAs involved in the plant defense against viruses and viral counter-defense. We also document the application of miRNAs in plant antiviral defense. This review discusses the current understanding of the mechanisms of miRNA-mediated gene silencing and provides insights on the never-ending arms race between plants and viruses.

Promoter hypermethylation of KLF4 inactivates its tumor suppressor function in cervical carcinogenesis.

Directory of Open Access Journals (Sweden)

Wen-Ting Yang

Full Text Available OBJECTIVE: The KLF4 gene has been shown to be inactivated in cervical carcinogenesis as a tumor suppressor. However, the mechanism of KLF4 silencing in cervical carcinomas has not yet been identified. DNA methylation plays a key role in stable suppression of gene expression. METHODS: The methylation status of the KLF4 promoter CpG islands was analyzed by bisulfite sequencing (BSQ in tissues of normal cervix and cervical cancer. KLF4 gene expression was detected by RT-PCR, immunohistochemistry and western blot. KLF4 promoter methylation in cervical cancer cell line was determined by BSQ and methylation-specific polymerase chain reaction (MS-PCR. Cell proliferation ability was detected by cell growth curve and MTT assay. RESULTS: The methylated allele was found in 41.90% of 24 cervical cancer tissues but only in 11.11% of 11 normal cervix tissues (P<0.005. KLF4 mRNA levels were significantly reduced in cervical cancer tissues compared with normal cervix tissues (P<0.01 and KLF4 mRNA expression showed a significant negative correlation with the promoter hypermethylation (r = -0.486, P = 0.003. Cervical cancer cell lines also showed a significant negative correlation between KLF4 expression and hypermethylation. After treatment with the demethylating agent 5-Azacytidine (5-Aza, the expression of KLF4 in the cervical cancer cell lines at both mRNA and protein levels was drastically increased, the cell proliferation ability was inhibited and the chemosensitivity for cisplatin was significantly increased. CONCLUSION: KLF4 gene is inactivated by methylation-induced silencing mechanisms in a large subset of cervical carcinomas and KLF4 promoter hypermethylation inactivates the gene's function as a tumor suppressor in cervical carcinogenesis.

Frequent silencing of the candidate tumor suppressor TRIM58 by promoter methylation in early-stage lung adenocarcinoma.

Science.gov (United States)

Kajiura, Koichiro; Masuda, Kiyoshi; Naruto, Takuya; Kohmoto, Tomohiro; Watabnabe, Miki; Tsuboi, Mitsuhiro; Takizawa, Hiromitsu; Kondo, Kazuya; Tangoku, Akira; Imoto, Issei

2017-01-10

In this study, we aimed to identify novel drivers that would be epigenetically altered through aberrant methylation in early-stage lung adenocarcinoma (LADC), regardless of the presence or absence of tobacco smoking-induced epigenetic field defects. Through genome-wide screening for aberrantly methylated CpG islands (CGIs) in 12 clinically uniform, stage-I LADC cases affecting six non-smokers and six smokers, we identified candidate tumor-suppressor genes (TSGs) inactivated by hypermethylation. Through systematic expression analyses of those candidates in panels of additional tumor samples and cell lines treated or not treated with 5-aza-deoxycitidine followed by validation analyses of cancer-specific silencing by CGI hypermethylation using a public database, we identified TRIM58 as the most prominent candidate for TSG. TRIM58 was robustly silenced by hypermethylation even in early-stage primary LADC, and the restoration of TRIM58 expression in LADC cell lines inhibited cell growth in vitro and in vivo in anchorage-dependent and -independent manners. Our findings suggest that aberrant inactivation of TRIM58 consequent to CGI hypermethylation might stimulate the early carcinogenesis of LADC regardless of smoking status; furthermore, TRIM58 methylation might be a possible early diagnostic and epigenetic therapeutic target in LADC.

FXR silencing in human colon cancer by DNA methylation and KRAS signaling.

Science.gov (United States)

Bailey, Ann M; Zhan, Le; Maru, Dipen; Shureiqi, Imad; Pickering, Curtis R; Kiriakova, Galina; Izzo, Julie; He, Nan; Wei, Caimiao; Baladandayuthapani, Veerabhadran; Liang, Han; Kopetz, Scott; Powis, Garth; Guo, Grace L

2014-01-01

Farnesoid X receptor (FXR) is a bile acid nuclear receptor described through mouse knockout studies as a tumor suppressor for the development of colon adenocarcinomas. This study investigates the regulation of FXR in the development of human colon cancer. We used immunohistochemistry of FXR in normal tissue (n = 238), polyps (n = 32), and adenocarcinomas, staged I-IV (n = 43, 39, 68, and 9), of the colon; RT-quantitative PCR, reverse-phase protein array, and Western blot analysis in 15 colon cancer cell lines; NR1H4 promoter methylation and mRNA expression in colon cancer samples from The Cancer Genome Atlas; DNA methyltransferase inhibition; methyl-DNA immunoprecipitation (MeDIP); bisulfite sequencing; and V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) knockdown assessment to investigate FXR regulation in colon cancer development. Immunohistochemistry and quantitative RT-PCR revealed that expression and function of FXR was reduced in precancerous lesions and silenced in a majority of stage I-IV tumors. FXR expression negatively correlated with phosphatidylinositol-4, 5-bisphosphate 3 kinase signaling and the epithelial-to-mesenchymal transition. The NR1H4 promoter is methylated in ~12% colon cancer The Cancer Genome Atlas samples, and methylation patterns segregate with tumor subtypes. Inhibition of DNA methylation and KRAS silencing both increased FXR expression. FXR expression is decreased early in human colon cancer progression, and both DNA methylation and KRAS signaling may be contributing factors to FXR silencing. FXR potentially suppresses epithelial-to-mesenchymal transition and other oncogenic signaling cascades, and restoration of FXR activity, by blocking silencing mechanisms or increasing residual FXR activity, represents promising therapeutic options for the treatment of colon cancer.

High SINE RNA Expression Correlates with Post-Transcriptional Downregulation of BRCA1

Directory of Open Access Journals (Sweden)

Giovanni Bosco

2013-04-01

Full Text Available Short Interspersed Nuclear Elements (SINEs are non-autonomous retrotransposons that comprise a large fraction of the human genome. SINEs are demethylated in human disease, but whether SINEs become transcriptionally induced and how the resulting transcripts may affect the expression of protein coding genes is unknown. Here, we show that downregulation of the mRNA of the tumor suppressor gene BRCA1 is associated with increased transcription of SINEs and production of sense and antisense SINE small RNAs. We find that BRCA1 mRNA is post-transcriptionally down-regulated in a Dicer and Drosha dependent manner and that expression of a SINE inverted repeat with sequence identity to a BRCA1 intron is sufficient for downregulation of BRCA1 mRNA. These observations suggest that transcriptional activation of SINEs could contribute to a novel mechanism of RNA mediated post-transcriptional silencing of human genes.

A dominant mutation in mediator of paramutation2, one of three second-largest subunits of a plant-specific RNA polymerase, disrupts multiple siRNA silencing processes.

Science.gov (United States)

Sidorenko, Lyudmila; Dorweiler, Jane E; Cigan, A Mark; Arteaga-Vazquez, Mario; Vyas, Meenal; Kermicle, Jerry; Jurcin, Diane; Brzeski, Jan; Cai, Yu; Chandler, Vicki L

2009-11-01

Paramutation involves homologous sequence communication that leads to meiotically heritable transcriptional silencing. We demonstrate that mop2 (mediator of paramutation2), which alters paramutation at multiple loci, encodes a gene similar to Arabidopsis NRPD2/E2, the second-largest subunit of plant-specific RNA polymerases IV and V. In Arabidopsis, Pol-IV and Pol-V play major roles in RNA-mediated silencing and a single second-largest subunit is shared between Pol-IV and Pol-V. Maize encodes three second-largest subunit genes: all three genes potentially encode full length proteins with highly conserved polymerase domains, and each are expressed in multiple overlapping tissues. The isolation of a recessive paramutation mutation in mop2 from a forward genetic screen suggests limited or no functional redundancy of these three genes. Potential alternative Pol-IV/Pol-V-like complexes could provide maize with a greater diversification of RNA-mediated transcriptional silencing machinery relative to Arabidopsis. Mop2-1 disrupts paramutation at multiple loci when heterozygous, whereas previously silenced alleles are only up-regulated when Mop2-1 is homozygous. The dramatic reduction in b1 tandem repeat siRNAs, but no disruption of silencing in Mop2-1 heterozygotes, suggests the major role for tandem repeat siRNAs is not to maintain silencing. Instead, we hypothesize the tandem repeat siRNAs mediate the establishment of the heritable silent state-a process fully disrupted in Mop2-1 heterozygotes. The dominant Mop2-1 mutation, which has a single nucleotide change in a domain highly conserved among all polymerases (E. coli to eukaryotes), disrupts both siRNA biogenesis (Pol-IV-like) and potentially processes downstream (Pol-V-like). These results suggest either the wild-type protein is a subunit in both complexes or the dominant mutant protein disrupts both complexes. Dominant mutations in the same domain in E. coli RNA polymerase suggest a model for Mop2-1 dominance

Immune modulation through RNA interference-mediated silencing of CD40 in dendritic cells.

Science.gov (United States)

Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Samiee, Shahram; Ataee, Zahra; Tabei, Seyyed Ziyaoddin; Moazzeni, Seyed Mohammad

2009-01-01

RNA interference (RNAi) is an exciting mechanism for knocking down any target gene in transcriptional level. It is now clear that small interfering RNA (siRNA), a 19-21nt long dsRNA, can trigger a degradation process (RNAi) that specifically silences the expression of a cognate mRNA. Our findings in this study showed that down regulation of CD40 gene expression in dendritic cells (DCs) by RNAi culminated to immune modulation. Effective delivery of siRNA into DCs would be a reasonable method for the blocking of CD40 gene expression at the cell surface without any effect on other genes and cell cytotoxicity. The effects of siRNA against CD40 mRNA on the function and phenotype of DCs were investigated. The DCs were separated from the mice spleen and then cultured in vitro. By the means of Lipofectamine2000, siRNA was delivered to the cells and the efficacy of transfection was estimated by flow cytometry. By Annexine V and Propidium Iodide staining, we could evaluate the transfected cells viability. Also, the mRNA expression and protein synthesis were assessed by real-time PCR and flow cytometry, respectively. Knocking down the CD40 gene in the DCs caused an increase in IL-4 production, decrease in IL-12 production and allostimulation activity. All together, these effects would stimulate Th2 cytokines production from allogenic T-cells in vitro.

Evasion of short interfering RNA-directed antiviral silencing in Musa acuminata persistently infected with six distinct banana streak pararetroviruses.

Science.gov (United States)

Rajeswaran, Rajendran; Seguin, Jonathan; Chabannes, Matthieu; Duroy, Pierre-Olivier; Laboureau, Nathalie; Farinelli, Laurent; Iskra-Caruana, Marie-Line; Pooggin, Mikhail M

2014-10-01

Vegetatively propagated crop plants often suffer from infections with persistent RNA and DNA viruses. Such viruses appear to evade the plant defenses that normally restrict viral replication and spread. The major antiviral defense mechanism is based on RNA silencing generating viral short interfering RNAs (siRNAs) that can potentially repress viral genes posttranscriptionally through RNA cleavage and transcriptionally through DNA cytosine methylation. Here we examined the RNA silencing machinery of banana plants persistently infected with six pararetroviruses after many years of vegetative propagation. Using deep sequencing, we reconstructed consensus master genomes of the viruses and characterized virus-derived and endogenous small RNAs. Consistent with the presence of endogenous siRNAs that can potentially establish and maintain DNA methylation, the banana genomic DNA was extensively methylated in both healthy and virus-infected plants. A novel class of abundant 20-nucleotide (nt) endogenous small RNAs with 5'-terminal guanosine was identified. In all virus-infected plants, 21- to 24-nt viral siRNAs accumulated at relatively high levels (up to 22% of the total small RNA population) and covered the entire circular viral DNA genomes in both orientations. The hotspots of 21-nt and 22-nt siRNAs occurred within open reading frame (ORF) I and II and the 5' portion of ORF III, while 24-nt siRNAs were more evenly distributed along the viral genome. Despite the presence of abundant viral siRNAs of different size classes, the viral DNA was largely free of cytosine methylation. Thus, the virus is able to evade siRNA-directed DNA methylation and thereby avoid transcriptional silencing. This evasion of silencing likely contributes to the persistence of pararetroviruses in banana plants. We report that DNA pararetroviruses in Musa acuminata banana plants are able to evade DNA cytosine methylation and transcriptional gene silencing, despite being targeted by the host silencing

Argonaute Utilization for miRNA Silencing Is Determined by Phosphorylation-Dependent Recruitment of LIM-Domain-Containing Proteins

Directory of Open Access Journals (Sweden)

Katherine S. Bridge

2017-07-01

Full Text Available As core components of the microRNA-induced silencing complex (miRISC, Argonaute (AGO proteins interact with TNRC6 proteins, recruiting other effectors of translational repression/mRNA destabilization. Here, we show that LIMD1 coordinates the assembly of an AGO-TNRC6 containing miRISC complex by binding both proteins simultaneously at distinct interfaces. Phosphorylation of AGO2 at Ser 387 by Akt3 induces LIMD1 binding, which in turn enables AGO2 to interact with TNRC6A and downstream effector DDX6. Conservation of this serine in AGO1 and 4 indicates this mechanism may be a fundamental requirement for AGO function and miRISC assembly. Upon CRISPR-Cas9-mediated knockout of LIMD1, AGO2 miRNA-silencing function is lost and miRNA silencing becomes dependent on a complex formed by AGO3 and the LIMD1 family member WTIP. The switch to AGO3 utilization occurs due to the presence of a glutamic acid residue (E390 on the interaction interface, which allows AGO3 to bind to LIMD1, AJUBA, and WTIP irrespective of Akt signaling.

siRNA-mediated Erc gene silencing suppresses tumor growth in Tsc2 mutant renal carcinoma model.

Science.gov (United States)

Imamura, Osamu; Okada, Hiroaki; Takashima, Yuuki; Zhang, Danqing; Kobayashi, Toshiyuki; Hino, Okio

2008-09-18

Silencing of gene expression by small interfering RNAs (siRNAs) is rapidly becoming a powerful tool for genetic analysis and represents a potential strategy for therapeutic product development. However, there are no reports of systemic delivery of siRNAs for stable treatment except short hairpin RNAs (shRNAs). On the other hand, there are many reports of systemic delivery of siRNAs for transient treatment using liposome carriers and others. With regard to shRNAs, a report showed fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Therefore, we decided to use original siRNA microspheres instead of shRNA for stable treatment of disease. In this study, we designed rat-specific siRNA sequences for Erc/mesothelin, which is a tumor-specific gene expressed in the Eker (Tsc2 mutant) rat model of hereditary renal cancer and confirmed the efficacy of gene silencing in vitro. Then, by using siRNA microspheres, we found that the suppression of Erc/mesothelin caused growth inhibition of Tsc2 mutant renal carcinoma cells in tumor implantation experiments in mice.

Novel siRNA delivery system using a ternary polymer complex with strong silencing effect and no cytotoxicity.

Science.gov (United States)

Kodama, Yukinobu; Shiokawa, Yumi; Nakamura, Tadahiro; Kurosaki, Tomoaki; Aki, Keisei; Nakagawa, Hiroo; Muro, Takahiro; Kitahara, Takashi; Higuchi, Norihide; Sasaki, Hitoshi

2014-01-01

We developed a novel small interfering RNA (siRNA) delivery system using a ternary complex with polyethyleneimine (PEI) and γ-polyglutamic acid (γ-PGA), which showed silencing effect and no cytotoxicity. The binary complexes of siRNA with PEI were approximately 73-102 nm in particle size and 45-52 mV in ζ-potential. The silencing effect of siRNA/PEI complexes increased with an increase of PEI, and siRNA/PEI complexes with a charge ratio greater than 16 showed significant luciferase knockdown in a mouse colon carcinoma cell line regularly expressing luciferase (Colon26/Luc cells). However, strong cytotoxicity and blood agglutination were observed in the siRNA/Lipofectamine complex and siRNA/PEI16 complex. Recharging cationic complexes with an anionic compound was reported to be a promising method for overcoming these toxicities. We therefore prepared ternary complexes of siRNA with PEI (charge ratio 16) by the addition of γ-PGA to reduce cytotoxicity and deliver siRNA. As expected, the cytotoxicity of the ternary complexes decreased with an increase of γ-PGA content, which decreased the ζ-potential of the complexes. A strong silencing effect comparable to siRNA/Lipofectamine complex was discovered in ternary complexes including γ-PGA with an anionic surface charge. The high incorporation of ternary complexes into Colon26/Luc cells was confirmed with fluorescence microcopy. Having achieved knockdown of an exogenously transfected gene, the ability of the complex to mediate knockdown of an endogenous housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), was assessed in B16-F10 cells. The ternary complex (siRNA/PEI16/γ-PGA12 complex) exhibited a significant GAPDH knockdown effect. Thus, we developed a useful siRNA delivery system.

Technical advances in trigger-induced RNA interference gene silencing in the parasite Entamoeba histolytica.

Science.gov (United States)

Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder

2016-03-01

Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016

Silencing effect of shRNA expression vectors with stem length of 21 ...

African Journals Online (AJOL)

Then, the recombinant plasmids were transfected into mouse embryonic fibroblast with lipofection and injected into leg muscle of mouse. The mRNA expression level of the green fluorescent protein gene was checked by real-time quantitative polymerase chain reaction (RT-PCR). The silencing effect of the 29 bp shRNA ...

Nanosystems based on siRNA silencing HuR expression counteract diabetic retinopathy in rat.

Science.gov (United States)

Amadio, Marialaura; Pascale, Alessia; Cupri, Sarha; Pignatello, Rosario; Osera, Cecilia; D Agata, Velia; D Amico, Agata Grazia; Leggio, Gian Marco; Ruozi, Barbara; Govoni, Stefano; Drago, Filippo; Bucolo, Claudio

2016-09-01

We evaluated whether specifically and directly targeting human antigen R (HuR), a member of embryonic lethal abnormal vision (ELAV) proteins family, may represent a new potential therapeutic strategy to manage diabetic retinopathy. Nanosystems loaded with siRNA silencing HuR expression (lipoplexes), consisting of solid lipid nanoparticles (SLN) and liposomes (SUV) were prepared. Photon correlation spectroscopy analysis, Zeta potential measurement and atomic force microscopy (AFM) studies were carried out to characterize the complexation of siRNA with the lipid nanocarriers. Nanosystems were evaluated by using AFM and scanning electron microscopy. The lipoplexes were injected into the eye of streptozotocin (STZ)-induced diabetic rats. Retinal HuR and VEGF levels were detected by Western blot and ELISA, respectively. Retinal histology was also carried out. The results demonstrated that retinal HuR and VEGF are significantly increased in STZ-rats and are blunted by HuR siRNA treatment. Lipoplexes with a weak positive surface charge and with a 4:1 N/P (cationic lipid nitrogen to siRNA phosphate) ratio exert a better transfection efficiency, significantly dumping retinal HuR and VEGF levels. In conclusion, we demonstrated that siRNA can be efficiently delivered into the rat retina using lipid-based nanocarriers, and some of the lipoplexes loaded with siRNA silencing HuR expression are potential candidates to manage retinal diseases. Copyright © 2016 Elsevier Ltd. All rights reserved.

Detection of the argonaute protein Ago2 and microRNAs in the RNA induced silencing complex (RISC) using a monoclonal antibody.

Science.gov (United States)

Ikeda, Keigo; Satoh, Minoru; Pauley, Kaleb M; Fritzler, Marvin J; Reeves, Westley H; Chan, Edward K L

2006-12-20

MicroRNAs (miRNAs) are short RNA molecules responsible for post-transcriptional gene silencing by the degradation or translational inhibition of their target messenger RNAs (mRNAs). This process of gene silencing, known as RNA interference (RNAi), is mediated by highly conserved Argonaute (Ago) proteins which are the key components of the RNA induced silencing complex (RISC). In humans, Ago2 is responsible for the endonuclease cleavage of targeted mRNA and it interacts with the mRNA-binding protein GW182, which is a marker for cytoplasmic foci referred to as GW bodies (GWBs). We demonstrated that the anti-Ago2 monoclonal antibody 4F9 recognized GWBs in a cell cycle dependent manner and was capable of capturing miRNAs associated with Ago2. Since Ago2 protein is the effector protein of RNAi, anti-Ago2 monoclonal antibody may be useful in capturing functional miRNAs.

Genistein up-regulates tumor suppressor microRNA-574-3p in prostate cancer.

Directory of Open Access Journals (Sweden)

Takeshi Chiyomaru

Full Text Available Genistein has been shown to inhibit cancers both in vitro and in vivo, by altering the expression of several microRNAs (miRNAs. In this study, we focused on tumor suppressor miRNAs regulated by genistein and investigated their function in prostate cancer (PCa and target pathways. Using miRNA microarray analysis and real-time RT-PCR we observed that miR-574-3p was significantly up-regulated in PCa cells treated with genistein compared with vehicle control. The expression of miR-574-3p was significantly lower in PCa cell lines and clinical PCa tissues compared with normal prostate cells (RWPE-1 and adjacent normal tissues. Low expression level of miR-574-3p was correlated with advanced tumor stage and higher Gleason score in PCa specimens. Re-expression of miR-574-3p in PCa cells significantly inhibited cell proliferation, migration and invasion in vitro and in vivo. miR-574-3p restoration induced apoptosis through reducing Bcl-xL and activating caspase-9 and caspase-3. Using GeneCodis software analysis, several pathways affected by miR-574-3p were identified, such as 'Pathways in cancer', 'Jak-STAT signaling pathway', and 'Wnt signaling pathway'. Luciferase reporter assays demonstrated that miR-574-3p directly binds to the 3' UTR of several target genes (such as RAC1, EGFR and EP300 that are components of 'Pathways in cancer'. Quantitative real-time PCR and Western analysis showed that the mRNA and protein expression levels of the three target genes in PCa cells were markedly down-regulated with miR-574-3p. Loss-of-function studies demonstrated that the three target genes significantly affect cell proliferation, migration and invasion in PCa cell lines. Our results show that genistein up-regulates tumor suppressor miR-574-3p expression targeting several cell signaling pathways. These findings enhance understanding of how genistein regulates with miRNA in PCa.

RNA interference-mediated silencing of speckle-type POZ protein promotes apoptosis of renal cell cancer cells

Directory of Open Access Journals (Sweden)

Liu X

2016-04-01

Full Text Available Xiaoxia Liu, Guiling Sun, Xiuju Sun Department of Nephrology, Affiliated Hospital of Weifang Medical University, Weifang, People’s Republic of China Abstract: This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP gene on renal cell cancer (RCC cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte–macrophage colony-stimulating factor and E-cadherin was significantly increased (P<0.05. The relevant signaling pathways were the integrin-mediated cell surface interactions pathway and extracellular matrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial

Non-Invasive Delivery of dsRNA into De-Waxed Tick Eggs by Electroporation

Science.gov (United States)

Ruiz, Newton; de Abreu, Leonardo Araujo; Parizi, Luís Fernando; Kim, Tae Kwon; Mulenga, Albert; Braz, Gloria Regina Cardoso; Vaz, Itabajara da Silva; Logullo, Carlos

2015-01-01

RNA interference-mediated gene silencing was shown to be an efficient tool for validation of targets that may become anti-tick vaccine components. Here, we demonstrate the application of this approach in the validation of components of molecular signaling cascades, such as the Protein Kinase B (AKT) / Glycogen Synthase Kinase (GSK) axis during tick embryogenesis. It was shown that heptane and hypochlorite treatment of tick eggs can remove wax, affecting corium integrity and but not embryo development. Evidence of AKT and GSK dsRNA delivery into de-waxed eggs of via electroporation is provided. Primers designed to amplify part of the dsRNA delivered into the electroporated eggs dsRNA confirmed its entry in eggs. In addition, it was shown that electroporation is able to deliver the fluorescent stain, 4',6-diamidino-2-phenylindole (DAPI). To confirm gene silencing, a second set of primers was designed outside the dsRNA sequence of target gene. In this assay, the suppression of AKT and GSK transcripts (approximately 50% reduction in both genes) was demonstrated in 7-day-old eggs. Interestingly, silencing of GSK in 7-day-old eggs caused 25% reduction in hatching. Additionally, the effect of silencing AKT and GSK on embryo energy metabolism was evaluated. As expected, knockdown of AKT, which down regulates GSK, the suppressor of glycogen synthesis, decreased glycogen content in electroporated eggs. These data demonstrate that electroporation of de-waxed R. microplus eggs could be used for gene silencing in tick embryos, and improve the knowledge about arthropod embryogenesis. PMID:26091260

Bugs Are Not to Be Silenced: Small RNA Pathways and Antiviral Responses in Insects.

Science.gov (United States)

Mongelli, Vanesa; Saleh, Maria-Carla

2016-09-29

Like every other organism on Earth, insects are infected with viruses, and they rely on RNA interference (RNAi) mechanisms to circumvent viral infections. A remarkable characteristic of RNAi is that it is both broadly acting, because it is triggered by double-stranded RNA molecules derived from virtually any virus, and extremely specific, because it targets only the particular viral sequence that initiated the process. Reviews covering the different facets of the RNAi antiviral immune response in insects have been published elsewhere. In this review, we build a framework to guide future investigation. We focus on the remaining questions and avenues of research that need to be addressed to move the field forward, including issues such as the activity of viral suppressors of RNAi, comparative genomics, the development of detailed maps of the subcellular localization of viral replication complexes with the RNAi machinery, and the regulation of the antiviral RNAi response.

Epigenetic silencing of nucleolar rRNA genes in Alzheimer's disease.

Directory of Open Access Journals (Sweden)

Maciej Pietrzak

Full Text Available Ribosomal deficits are documented in mild cognitive impairment (MCI, which often represents an early stage Alzheimer's disease (AD, as well as in advanced AD. The nucleolar rRNA genes (rDNA, transcription of which is critical for ribosomal biogenesis, are regulated by epigenetic silencing including promoter CpG methylation.To assess whether CpG methylation of the rDNA promoter was dysregulated across the AD spectrum, we analyzed brain samples from 10 MCI-, 23 AD-, and, 24 age-matched control individuals using bisulfite mapping. The rDNA promoter became hypermethylated in cerebro-cortical samples from MCI and AD groups. In parietal cortex, the rDNA promoter was hypermethylated more in MCI than in advanced AD. The cytosine methylation of total genomic DNA was similar in AD, MCI, and control samples. Consistent with a notion that hypermethylation-mediated silencing of the nucleolar chromatin stabilizes rDNA loci, preventing their senescence-associated loss, genomic rDNA content was elevated in cerebrocortical samples from MCI and AD groups.In conclusion, rDNA hypermethylation could be a new epigenetic marker of AD. Moreover, silencing of nucleolar chromatin may occur during early stages of AD pathology and play a role in AD-related ribosomal deficits and, ultimately, dementia.

STAT3 Gene Silencing by Aptamer-siRNA Chimera as Selective Therapeutic for Glioblastoma

Directory of Open Access Journals (Sweden)

Carla Lucia Esposito

2018-03-01

Full Text Available Glioblastoma (GBM is the most frequent and aggressive primary brain tumor in adults, and despite advances in neuro-oncology, the prognosis for patients remains dismal. The signal transducer and activator of transcription-3 (STAT3 has been reported as a key regulator of the highly aggressive mesenchymal GBM subtype, and its direct silencing (by RNAi oligonucleotides has revealed a great potential as an anti-cancer therapy. However, clinical use of oligonucleotide-based therapies is dependent on safer ways for tissue-specific targeting and increased membrane penetration. The objective of this study is to explore the use of nucleic acid aptamers as carriers to specifically drive a STAT3 siRNA to GBM cells in a receptor-dependent manner. Using an aptamer that binds to and antagonizes the oncogenic receptor tyrosine kinase PDGFRβ (Gint4.T, here we describe the design of a novel aptamer-siRNA chimera (Gint4.T-STAT3 to target STAT3. We demonstrate the efficient delivery and silencing of STAT3 in PDGFRβ+ GBM cells. Importantly, the conjugate reduces cell viability and migration in vitro and inhibits tumor growth and angiogenesis in vivo in a subcutaneous xenograft mouse model. Our data reveals Gint4.T-STAT3 conjugate as a novel molecule with great translational potential for GBM therapy.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

Energy Technology Data Exchange (ETDEWEB)

Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

2014-11-14

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Effective silencing of ENaC by siRNA delivered with epithelial-targeted nanocomplexes in human cystic fibrosis cells and in mouse lung.

Science.gov (United States)

Tagalakis, Aristides D; Munye, Mustafa M; Ivanova, Rositsa; Chen, Hanpeng; Smith, Claire M; Aldossary, Ahmad M; Rosa, Luca Z; Moulding, Dale; Barnes, Josephine L; Kafetzis, Konstantinos N; Jones, Stuart A; Baines, Deborah L; Moss, Guy W J; O'Callaghan, Christopher; McAnulty, Robin J; Hart, Stephen L

2018-05-10

Loss of the cystic fibrosis transmembrane conductance regulator in cystic fibrosis (CF) leads to hyperabsorption of sodium and fluid from the airway due to upregulation of the epithelial sodium channel (ENaC). Thickened mucus and depleted airway surface liquid (ASL) then lead to impaired mucociliary clearance. ENaC regulation is thus a promising target for CF therapy. Our aim was to develop siRNA nanocomplexes that mediate effective silencing of airway epithelial ENaC in vitro and in vivo with functional correction of epithelial ion and fluid transport. We investigated translocation of nanocomplexes through mucus and their transfection efficiency in primary CF epithelial cells grown at air-liquid interface (ALI).Short interfering RNA (SiRNA)-mediated silencing was examined by quantitative RT-PCR and western analysis of ENaC. Transepithelial potential (V t ), short circuit current (I sc ), ASL depth and ciliary beat frequency (CBF) were measured for functional analysis. Inflammation was analysed by histological analysis of normal mouse lung tissue sections. Nanocomplexes translocated more rapidly than siRNA alone through mucus. Transfections of primary CF epithelial cells with nanocomplexes targeting αENaC siRNA, reduced αENaC and βENaC mRNA by 30%. Transfections reduced V t , the amiloride-sensitive I sc and mucus protein concentration while increasing ASL depth and CBF to normal levels. A single dose of siRNA in mouse lung silenced ENaC by approximately 30%, which persisted for at least 7 days. Three doses of siRNA increased silencing to approximately 50%. Nanoparticle-mediated delivery of ENaCsiRNA to ALI cultures corrected aspects of the mucociliary defect in human CF cells and offers effective delivery and silencing in vivo. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

RNA-mediated gene silencing in Candida albicans: inhibition of hyphae formation by use of RNAi technology.

Science.gov (United States)

Moazeni, Maryam; Khoramizadeh, Mohammad Reza; Kordbacheh, Parivash; Sepehrizadeh, Zargham; Zeraati, Hojat; Noorbakhsh, Fatemeh; Teimoori-Toolabi, Ladan; Rezaie, Sassan

2012-09-01

The introduction of RNA silencing machinery in fungi has led to the promising application of RNAi methodology to knock down essential vital factor or virulence factor genes in the microorganisms. Efg1p is required for development of a true hyphal growth form which is known to be essential for interactions with human host cells and for the yeast's pathogenesis. In this paper, we describe the development of a system for presenting and studying the RNAi function on the EFG1 gene in C. albicans. The 19-nucleotide siRNA was designed on the basis of the cDNA sequence of the EFG1 gene in C. albicans and transfection was performed by use of a modified-PEG/LiAc method. To investigate EFG1 gene silencing in siRNA-treated cells, the yeasts were grown in human serum; to induce germ tubes a solid medium was used with the serum. Quantitative changes in expression of the EFG1 gene were analyzed by measuring the cognate EFG1 mRNA level by use of a quantitative real-time RT-PCR assay. Compared with the positive control, true hyphae formation was significantly reduced by siRNA at concentrations of 1 μM, 500 nM, and 100 nM (P < 0.05). In addition, siRNA at a concentration of 1 μM was revealed to inhibit expression of the EFG1 gene effectively (P < 0.05). On the basis of the potential of post-transcriptional gene silencing to control the expression of specific genes, these techniques may be regarded as promising means of drug discovery, with applications in biomedicine and functional genomics analysis.

Immunopurification of the suppressor tRNA dependent rabbit β-globin readthrough protein

International Nuclear Information System (INIS)

Hatfield, D.; Thorgeirsson, S.S.; Copeland, T.D.; Oroszlan, S.; Bustin, M.

1988-01-01

In mammalian cells, the rabbit β-globin readthrough protein is the only known example of a naturally occurring readthrough protein which does not involve a viral system. To provide an efficient means for its isolation, detection, and study, the authors elicited specific antibodies against this unique protein. The 22 amino acid peptide corresponding to the readthrough portion of this protein was synthesized, coupled to keyhole limpet hemocyanin, and injected into sheep. Specific antibodies to the peptide were produced as demonstrated by the enzyme-linked immunosorbent assay technique and by immunoblotting. The antibodies did not react with globin. The rabbit β-globin readthrough protein was separated from globin and other reticulocyte proteins by polyacrylamide gel electrophoresis and visualized by silver staining or by labeling with [ 35 S] methionine. Incorporation of [ 35 S] methionine into the readthrough protein was significantly enhanced upon addition of an opal suppressor tRNA to reticulocyte lysates. Immunoblotting revealed that the readthrough protein also occurs in lysates without added suppressor tRNA. The antibodies were purified on an affi-gel column which had been coupled with the peptide antigen. The readthrough protein was then purified from reticulocytes by immunoaffinity chromatography and by high-performance liquid chromatography. The results provide conclusive evidence that the β-globin readthrough protein is naturally occurring in rabbit reticulocytes

The silencing suppressor (NSs) protein of the plant virus Tomato spotted wilt virus enhances heterologous protein expression and baculovirus pathogenicity in cells and lepidopteran insects.

Science.gov (United States)

de Oliveira, Virgínia Carla; da Silva Morgado, Fabricio; Ardisson-Araújo, Daniel Mendes Pereira; Resende, Renato Oliveira; Ribeiro, Bergmann Morais

2015-11-01

In this work, we showed that cell death induced by a recombinant (vAcNSs) Autographa californica multiple nucleopolyhedrovirus (AcMNPV) expressing the silencing suppressor (NSs) protein of Tomato spotted wilt virus (TSWV) was enhanced on permissive and semipermissive cell lines. The expression of a heterologous gene (firefly luciferase) during co-infection of insect cells with vAcNSs and a second recombinant baculovirus (vAgppolhfluc) was shown to increase when compared to single vAgppolhfluc infections. Furthermore, the vAcNSs mean time-to-death values were significantly lower than those for wild-type AcMNPV on larvae of Spodoptera frugiperda and Anticarsia gemmatalis. These results showed that the TSWV-NSs protein could efficiently increase heterologous protein expression in insect cells as well as baculovirus pathogenicity and virulence, probably by suppressing the gene-silencing machinery in insects.

Downregulation of cinnamyl-alcohol dehydrogenase in switchgrass by RNA silencing results in enhanced glucose release after cellulase treatment.

Directory of Open Access Journals (Sweden)

Aaron J Saathoff

Full Text Available Cinnamyl alcohol dehydrogenase (CAD catalyzes the last step in monolignol biosynthesis and genetic evidence indicates CAD deficiency in grasses both decreases overall lignin, alters lignin structure and increases enzymatic recovery of sugars. To ascertain the effect of CAD downregulation in switchgrass, RNA mediated silencing of CAD was induced through Agrobacterium mediated transformation of cv. "Alamo" with an inverted repeat construct containing a fragment derived from the coding sequence of PviCAD2. The resulting primary transformants accumulated less CAD RNA transcript and protein than control transformants and were demonstrated to be stably transformed with between 1 and 5 copies of the T-DNA. CAD activity against coniferaldehyde, and sinapaldehyde in stems of silenced lines was significantly reduced as was overall lignin and cutin. Glucose release from ground samples pretreated with ammonium hydroxide and digested with cellulases was greater than in control transformants. When stained with the lignin and cutin specific stain phloroglucinol-HCl the staining intensity of one line indicated greater incorporation of hydroxycinnamyl aldehydes in the lignin.

Downregulation of cinnamyl-alcohol dehydrogenase in switchgrass by RNA silencing results in enhanced glucose release after cellulase treatment.

Science.gov (United States)

Saathoff, Aaron J; Sarath, Gautam; Chow, Elaine K; Dien, Bruce S; Tobias, Christian M

2011-01-27

Cinnamyl alcohol dehydrogenase (CAD) catalyzes the last step in monolignol biosynthesis and genetic evidence indicates CAD deficiency in grasses both decreases overall lignin, alters lignin structure and increases enzymatic recovery of sugars. To ascertain the effect of CAD downregulation in switchgrass, RNA mediated silencing of CAD was induced through Agrobacterium mediated transformation of cv. "Alamo" with an inverted repeat construct containing a fragment derived from the coding sequence of PviCAD2. The resulting primary transformants accumulated less CAD RNA transcript and protein than control transformants and were demonstrated to be stably transformed with between 1 and 5 copies of the T-DNA. CAD activity against coniferaldehyde, and sinapaldehyde in stems of silenced lines was significantly reduced as was overall lignin and cutin. Glucose release from ground samples pretreated with ammonium hydroxide and digested with cellulases was greater than in control transformants. When stained with the lignin and cutin specific stain phloroglucinol-HCl the staining intensity of one line indicated greater incorporation of hydroxycinnamyl aldehydes in the lignin.

TFPI-2 is a putative tumor suppressor gene frequently inactivated by promoter hypermethylation in nasopharyngeal carcinoma

International Nuclear Information System (INIS)

Wang, Shumin; Ma, Ning; Murata, Mariko; Huang, Guangwu; Zhang, Zhe; Xiao, Xue; Zhou, Xiaoying; Huang, Tingting; Du, Chunping; Yu, Nana; Mo, Yingxi; Lin, Longde; Zhang, Jinyan

2010-01-01

Epigenetic silencing of tumor suppressor genes play important roles in NPC tumorgenesis. Tissue factor pathway inhibitor-2 (TFPI-2), is a protease inhibitor. Recently, TFPI-2 was suggested to be a tumor suppressor gene involved in tumorigenesis and metastasis in some cancers. In this study, we investigated whether TFPI-2 was inactivated epigenetically in nasopharyngeal carcinoma (NPC). Transcriptional expression levels of TFPI-2 was evaluated by RT-PCR. Methylation status were investigated by methylation specific PCR and bisulfate genomic sequencing. The role of TFPI-2 as a tumor suppressor gene in NPC was addressed by re-introducing TFPI-2 expression into the NPC cell line CNE2. TFPI-2 mRNA transcription was inactivated in NPC cell lines. TFPI-2 was aberrantly methylated in 66.7% (4/6) NPC cell lines and 88.6% (62/70) of NPC primary tumors, but not in normal nasopharyngeal epithelia. TFPI-2 expression could be restored in NPC cells after demethylation treatment. Ectopic expression of TFPI-2 in NPC cells induced apoptosis and inhibited cell proliferation, colony formation and cell migration. Epigenetic inactivation of TFPI-2 by promoter hypermethylation is a frequent and tumor specific event in NPC. TFPI-2 might be considering as a putative tumor suppressor gene in NPC

The epigenetic modifier PRDM5 functions as a tumor suppressor through modulating WNT/β-catenin signaling and is frequently silenced in multiple tumors.

Directory of Open Access Journals (Sweden)

Xing-sheng Shu

Full Text Available BACKGROUND: PRDM (PRDI-BF1 and RIZ domain containing proteins are zinc finger proteins involved in multiple cellular regulations by acting as epigenetic modifiers. We studied a recently identified PRDM member PRDM5 for its epigenetic abnormality and tumor suppressive functions in multiple tumorigeneses. METHODOLOGY/PRINCIPAL FINDINGS: Semi-quantitative RT-PCR showed that PRDM5 was broadly expressed in human normal tissues, but frequently silenced or downregulated in multiple carcinoma cell lines due to promoter CpG methylation, including 80% (4/5 nasopharyngeal, 44% (8/18 esophageal, 76% (13/17 gastric, 50% (2/4 cervical, and 25% (3/12 hepatocellular carcinoma cell lines, but not in any immortalized normal epithelial cell lines. PRDM5 expression could be restored by 5-aza-2'-deoxycytidine demethylation treatment in silenced cell lines. PRDM5 methylation was frequently detected by methylation-specific PCR (MSP in multiple primary tumors, including 93% (43/46 nasopharyngeal, 58% (25/43 esophageal, 88% (37/42 gastric and 63% (29/46 hepatocellular tumors. PRDM5 was further found a stress-responsive gene, but its response was impaired when the promoter was methylated. Ectopic PRDM5 expression significantly inhibited tumor cell clonogenicity, accompanied by the inhibition of TCF/β-catenin-dependent transcription and downregulation of CDK4, TWIST1 and MDM2 oncogenes, while knocking down of PRDM5 expression lead to increased cell proliferation. ChIP assay showed that PRDM5 bound to its target gene promoters and suppressed their transcription. An inverse correlation between the expression of PRDM5 and activated β-catenin was also observed in cell lines. CONCLUSIONS/SIGNIFICANCE: PRDM5 functions as a tumor suppressor at least partially through antagonizing aberrant WNT/β-catenin signaling and oncogene expression. Frequent epigenetic silencing of PRDM5 is involved in multiple tumorigeneses, which could serve as a tumor biomarker.

Arabidopsis RNA Polymerase V Mediates Enhanced Compaction and Silencing of Geminivirus and Transposon Chromatin during Host Recovery from Infection.

Science.gov (United States)

Coursey, Tami; Regedanz, Elizabeth; Bisaro, David M

2018-04-01

Plants employ RNA-directed DNA methylation (RdDM) and dimethylation of histone 3 lysine 9 (H3K9me2) to silence geminiviruses and transposable elements (TEs). We previously showed that canonical RdDM (Pol IV-RdDM) involving RNA polymerases IV and V (Pol IV and Pol V) is required for Arabidopsis thaliana to recover from infection with Beet curly top virus lacking a suppressor protein that inhibits methylation (BCTV L2 - ). Recovery, which is characterized by reduced viral DNA levels and symptom remission, allows normal floral development. Here, we used formaldehyde-assisted isolation of regulatory elements (FAIRE) to confirm that >90% of BCTV L2 - chromatin is highly compacted during recovery, and a micrococcal nuclease-chromatin immunoprecipitation assay showed that this is largely due to increased nucleosome occupancy. Physical compaction correlated with augmented cytosine and H3K9 methylation and with reduced viral gene expression. We additionally demonstrated that these phenomena are dependent on Pol V and by extension the Pol IV-RdDM pathway. BCTV L2 - was also used to evaluate the impact of viral infection on host loci, including repressed retrotransposons Ta3 and Athila6A Remarkably, an unexpected Pol V-dependent hypersuppression of these TEs was observed, resulting in transcript levels even lower than those detected in uninfected plants. Hypersuppression is likely to be especially important for natural recovery from wild-type geminiviruses, as viral L2 and AL2 proteins cause ectopic TE expression. Thus, Pol IV-RdDM targets both viral and TE chromatin during recovery, simultaneously silencing the majority of viral genomes and maintaining host genome integrity by enforcing tighter control of TEs in future reproductive tissues. IMPORTANCE In plants, RdDM pathways use small RNAs to target cytosine and H3K9 methylation, thereby silencing DNA virus genomes and transposable elements (TEs). Further, Pol IV-RdDM involving Pol IV and Pol V is a key aspect of host

MeCP2 silencing of LncRNA H19 controls hepatic stellate cell proliferation by targeting IGF1R

International Nuclear Information System (INIS)

Yang, Jing-Jing; Liu, Li-Ping; Tao, Hui; Hu, Wei; Shi, Peng; Deng, Zi-Yu; Li, Jun

2016-01-01

Highlights: • H19 plays a key role in HSCs proliferation and fibrosis. • MeCP2/H19 axis involvement in HSCs activation and fibrosis. • MeCP2 negative controls H19 expression in activated HSCs. • Identification of IGF1R as new target of H19 in HSC. - Abstract: Methyl-CpG-binding protein 2 (MeCP2) plays a key role in liver fibrosis. However, the potential mechanism of MeCP2 in liver fibrosis remains unclear. Early reports suggest that LncRNA H19 is important epigenetic regulator with critical roles in cell proliferation, but its role in hepatic fibrosis remains elusive. Sprague-Dawley rats liver fibrosis was generated by 12-weeks treatment with CCl 4 intraperitoneal injection. HSC-T6 cells were used in vitro study. The expression levels of MeCP2, H19, IGF1R, α-SMA, and Col1A1 were estimated by Western blotting, qRT-PCR and Immunohistochemistry. HSC-T6 cells were transfected with MeCP2-siRNA, pEGF-C1-MeCP2, pEX-3-H19, and H19-siRNA. Finally, cell proliferation ability was assessed by the MTT assay. Here, we found that H19 was significantly down-regulated in HSCs and fibrosis tissues, and an opposite pattern is observed for MeCP2 and IGF1R. Silencing of MeCP2 blocked HSCs proliferation. Knockdown of MeCP2 elevated H19 expression in activated HSCs, and over-expression of MeCP2 inhibited H19 expression in activated HSCs. Moreover, we investigated the effect of H19 on IGF1R expression. Overexpression of H19 in HSCs repressed the expression of IGF1R, and an opposite pattern is observed for H19 silenced. In addition, we reported that overexpression of H19 inhibited the TGF-β1-induced proliferation of HSCs. Furthermore, MeCP2 negative regulation of H19 by targeting the protein IGF1R. Taken together, these results demonstrated that MeCP2 silencing of H19 can alter the IGF1R overexpression, thus contributing to HSCs proliferation. These data could suggest the development of combination therapies that target the MeCP2.

AAV-based shRNA silencing of NF-κB ameliorates muscle pathologies in mdx mice.

Science.gov (United States)

Yang, Q; Tang, Y; Imbrogno, K; Lu, A; Proto, J D; Chen, A; Guo, F; Fu, F H; Huard, J; Wang, B

2012-12-01

Chronic inflammation, promoted by an upregulated NF-kappa B (NF-κB) pathway, has a key role in Duchenne muscular dystrophy (DMD) patients' pathogenesis. Blocking the NF-κB pathway has been shown to be a viable approach to diminish chronic inflammation and necrosis in the dystrophin-defective mdx mouse, a murine DMD model. In this study, we used the recombinant adeno-associated virus serotype 9 (AAV9) carrying an short hairpin RNA (shRNA) specifically targeting the messenger RNA of NF-κB/p65 (p65-shRNA), the major subunit of NF-κB associated with chronic inflammation in mdx mice. We examined whether i.m. AAV9-mediated delivery of p65-shRNA could decrease NF-κB activation, allowing for amelioration of muscle pathologies in 1- and 4-month-old mdx mice. At 1 month after treatment, NF-κB/p65 levels were significantly decreased by AAV gene transfer of p65-shRNA in the two ages of treatment groups, with necrosis significantly decreased compared with controls. Quantitative analysis revealed that central nucleation (CN) of the myofibers of p65-shRNA-treated 1-month-old mdx muscles was reduced from 67 to 34%, but the level of CN was not significantly decreased in treated 4-month-old mdx mice. Moreover, delivery of the p65-shRNA enhanced the capacity of myofiber regeneration in old mdx mice treated at 4 months of age when the dystrophic myofibers were most exhausted; however, such p65 silencing diminished the myofiber regeneration in young mdx mice treated at 1 month of age. Taken together, these findings demonstrate that the AAV-mediated delivery of p65-shRNA has the capacity to ameliorate muscle pathologies in mdx mice by selectively reducing NF-κB/p65 activity.

Novel siRNA formulation to effectively knockdown mutant p53 in osteosarcoma.

Science.gov (United States)

Kundu, Anup K; Iyer, Swathi V; Chandra, Sruti; Adhikari, Amit S; Iwakuma, Tomoo; Mandal, Tarun K

2017-01-01

The tumor suppressor p53 plays a crucial role in the development of osteosarcoma. The primary objective of this study is to develop and optimize lipid based nanoparticle formulations that can carry siRNA and effectively silence mutant p53 in 318-1, a murine osteosarcoma cell line. The nanoparticles were composed of a mixture of two lipids (cholesterol and DOTAP) and either PLGA or PLGA-PEG and prepared by using an EmulsiFlex-B3 high pressure homogenizer. A series of studies that include using different nanoparticles, different amount of siRNAs, cell numbers, incubation time, transfection media volume, and storage temperature was performed to optimize the gene silencing efficiency. Replacement of lipids by PLGA or PLGA-PEG decreased the particle size and overall cytotoxicity. Among all lipid-polymer nanoformulations, nanoparticles with 10% PLGA showed highest mutant p53 knockdown efficiency while maintaining higher cell viability when a nanoparticle to siRNA ratio equal to 6.8:0.66 and 75 nM siRNA was used. With long term storage the mutant p53 knockdown efficiency decreased to a greater extent. This study warrants a future evaluation of this formulation for gene silencing efficiency of mutant p53 in tissue culture and animal models for the treatment of osteosarcoma.

Novel siRNA formulation to effectively knockdown mutant p53 in osteosarcoma.

Directory of Open Access Journals (Sweden)

Anup K Kundu

Full Text Available The tumor suppressor p53 plays a crucial role in the development of osteosarcoma. The primary objective of this study is to develop and optimize lipid based nanoparticle formulations that can carry siRNA and effectively silence mutant p53 in 318-1, a murine osteosarcoma cell line.The nanoparticles were composed of a mixture of two lipids (cholesterol and DOTAP and either PLGA or PLGA-PEG and prepared by using an EmulsiFlex-B3 high pressure homogenizer. A series of studies that include using different nanoparticles, different amount of siRNAs, cell numbers, incubation time, transfection media volume, and storage temperature was performed to optimize the gene silencing efficiency.Replacement of lipids by PLGA or PLGA-PEG decreased the particle size and overall cytotoxicity. Among all lipid-polymer nanoformulations, nanoparticles with 10% PLGA showed highest mutant p53 knockdown efficiency while maintaining higher cell viability when a nanoparticle to siRNA ratio equal to 6.8:0.66 and 75 nM siRNA was used. With long term storage the mutant p53 knockdown efficiency decreased to a greater extent.This study warrants a future evaluation of this formulation for gene silencing efficiency of mutant p53 in tissue culture and animal models for the treatment of osteosarcoma.

Characterization of white shrimp Litopenaeus vannamei integrin β and its role in immunomodulation by dsRNA-mediated gene silencing.

Science.gov (United States)

Lin, Yong-Chin; Chen, Jiann-Chu; Chen, Yu-Yuan; Liu, Chun-Hung; Cheng, Winton; Hsu, Chih-Hung; Tsui, Wen-Ching

2013-06-01

The full sequence of white shrimp Litopenaeus vannamei integrin β (LV-B) is 2879bp which encodes 787 amino acids (aa) of the open reading frame (ORF). The mature protein (764 aa) contains (1) an extracellular domain (ED) of 692 aa, (2) a transmembrane domain (TD) of 23 aa, and (3) a cytoplasmic domain (CD) of 49 aa. The cloned LV-B grouped together with crayfish Pacifastacus leniusculus integrin β (PL-B1), but was far away from vertebrate integrin β1, β3, β5, β6, β7, and β8, and another L. vannamei integrin β (LV). A Southern blot analysis indicated that the cloned LV-B was a single copy of genomic DNA. LV-B mRNA was expressed in all tissues, and was highly expressed in haemocytes. LV-B was downregulated in shrimp 24 and 96h after having received white spot syndrome virus (WSSV). LV-B expression by haemocytes of shrimp was higher in the postmoult (A and B) stage, and lower in the premoult (D2/D3) stage. LV-B expression was significantly higher by shrimp reared in 2.5‰ and 5‰ salinities. Shrimp injected with integrin β dsRNA showed gene silencing of integrin β after 36h. LV-B-silenced shrimp showed decreased hyaline cells (HCs), granular cells (GCs, including semi-granular cells), the total haemocyte count (THC), respiratory bursts (RBs), and lysozyme activity, but showed increased RB/HC, superoxide dismutase (SOD) activity/HC, and the phenoloxidase (PO) activity/GC. LV-B-silenced shrimp showed upregulated expressions of lipopolysaccharide- and β-glucan-binding protein (LGBP), peroxinectin (PX), prophenoloxidase I (proPO I), proPO II, proPO-activating enzyme (ppA), α2-macroglobulin (α2-M), cytMnSOD, mtMnSOD, and heat shock protein 70 (HSP70). It was concluded that integrin β plays important roles in proPO activation, phagocytosis, and the antioxidant system for immunomodulation in shrimp. Copyright © 2013 Elsevier Ltd. All rights reserved.

Interference in plant defense and development by non-structural protein NSs of Groundnut bud necrosis virus.

Science.gov (United States)

Goswami, Suneha; Sahana, Nandita; Pandey, Vanita; Doblas, Paula; Jain, R K; Palukaitis, Peter; Canto, Tomas; Praveen, Shelly

2012-01-01

Groundnut bud necrosis virus (GBNV) infects a large number of leguminous and solanaceous plants. To elucidate the biological function of the non-structural protein encoded by the S RNA of GBNV (NSs), we studied its role in RNA silencing suppression and in viral pathogenesis. Our results demonstrated that GBNV NSs functions as a suppressor of RNA silencing using the agroinfiltration patch assay. An in silico analysis suggested the presence of pro-apoptotic protein Reaper-like sequences in the GBNV NSs, which were known to be present in animal infecting bunyaviruses. Utilizing NSs mutants, we demonstrated that a Leu-rich domain was required for RNA silencing suppression activity, but not the non-overlapping Trp/GH3 motif of the Reaper-like sequence. To investigate the role of NSs in symptom development we generated transgenic tomato expressing the GBNV NSs and showed that the expression of NSs in tomato mimics symptoms induced by infection with GBNV, such as leaf senescence and necrosis. As leaf senescence is controlled by miR319 regulation of the transcription factor TCP1, we assessed the accumulation of both RNAs in transgenic NSs-expressing and GBNV-infected tomato plants. In both types of plants the levels of miR319 decreased, while the levels of TCP1 transcripts increased. We propose that GBNV-NSs affects miRNA biogenesis through its RNA silencing suppressor activity and interferes with TCP1-regulated leaf developmental pathways. Copyright © 2011 Elsevier B.V. All rights reserved.

Two classes of silencing RNAs move between C. elegans tissues

Science.gov (United States)

Jose, Antony M; Garcia, Giancarlo A; Hunter, Craig P

2011-01-01

Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the endonuclease DCR-1, which cleaves long dsRNA into double-stranded short-interfering RNA (ds-siRNA), and the putative nucleotidyltransferase MUT-2 (RDE-3). However, single-stranded siRNA and downstream secondary siRNA produced upon amplification by the RNA-dependent RNA Polymerase RRF-1 do not generate mobile silencing RNA. Restricting inter-tissue transport to long dsRNA and directly processed siRNA intermediates rather than amplified siRNA may serve to modulate the extent of systemic silencing in proportion to available dsRNA. PMID:21984186

A conserved small RNA promotes silencing of the outer membrane protein YbfM

DEFF Research Database (Denmark)

Rasmussen, Anders Aamann; Johansen, Jesper; Nielsen, Jesper S

2009-01-01

important physiological role of regulatory RNA molecules in Gram-negative bacteria is to modulate the cell surface and/or to prevent accumulation of OMPs in the envelope. Here, we extend the OMP-sRNA network by showing that the expression of the outer membrane protein YbfM is silenced by a conserved sRNA......In the past few years an increasing number of small non-coding RNAs (sRNAs) in enterobacteria have been found to negatively regulate the expression of outer membrane proteins (OMPs) at the post-transcriptional level. These RNAs act under various growth and stress conditions, suggesting that one......, designated MicM (also known as RybC/SroB). The regulation is strictly dependent on the RNA chaperone Hfq, and mutational analysis indicates that MicM sequesters the ribosome binding site of ybfM mRNA by an antisense mechanism. Furthermore, we provide evidence that Hfq strongly enhances the on-rate of duplex...

An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing

DEFF Research Database (Denmark)

Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria

2016-01-01

/2 12 min (naked) to t1/2 45 min (single cholesteryl) and t1/2 71 min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing......HSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies...

Delivery of siRNA silencing P-gp in peptide-functionalized nanoparticles causes efflux modulation at the blood-brain barrier

DEFF Research Database (Denmark)

Gomes, Maria João; Kennedy, Patrick J; Martins, Susana

2017-01-01

AIM: Explore the use of transferrin-receptor peptide-functionalized nanoparticles (NPs) targeting blood-brain barrier (BBB) as siRNA carriers to silence P-glycoprotein (P-gp). MATERIALS & METHODS: Permeability experiments were assessed through a developed BBB cell-based model; P-gp mRNA expression...

Insights on ornithine decarboxylase silencing as a potential strategy for targeting retinoblastoma.

Science.gov (United States)

Muthukumaran, Sivashanmugam; Bhuvanasundar, Renganathan; Umashankar, Vetrivel; Sulochana, K N

2018-02-01

Ornithine Decarboxylase (ODC) is a key enzyme involved in polyamine synthesis and is reported to be up regulated in several cancers. However, the effect of ODC gene silencing in retinoblastoma is to be understood for utilization in therapeutic applications. Hence, in this study, a novel siRNA (small interference RNA) targeting ODC was designed and validated in Human Y79 retinoblastoma cells for its effects on intracellular polyamine levels, Matrix Metalloproteinase 2 & 9 activity and Cell cycle. The designed siRNA showed efficient silencing of ODC mRNA expression and protein levels in Y79 cells. It also showed significant reduction of intracellular polyamine levels and altered levels of oncogenic LIN28b expression. By this study, a regulatory loop is proposed, wherein, ODC silencing in Y79 cells to result in decreased polyamine levels, thereby, leading to altered protein levels of Lin28b, MMP-2 and MMP-9, which falls in line with earlier studies in neuroblastoma. Thus, by this study, we propose ODC silencing as a prospective strategy for targeting retinoblastoma. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Surface coating of siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers: enhanced gene silencing and reduced adverse effects in vitro

Science.gov (United States)

Zeng, Xianghui; de Groot, Anne Marit; Sijts, Alice J. A. M.; Broere, Femke; Oude Blenke, Erik; Colombo, Stefano; van Eden, Willem; Franzyk, Henrik; Nielsen, Hanne Mørck; Foged, Camilla

2015-11-01

Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine and homoarginine residues was shown to self-assemble with small interfering RNA (siRNA). The resulting well-defined nanocomplexes were coated with anionic lipids giving rise to net anionic liposomes. These complexes and the corresponding liposomes were optimized towards efficient gene silencing and low adverse effects. The optimal anionic liposomes mediated a high silencing effect, which was comparable to that of the control (cationic Lipofectamine 2000), and did not display any noticeable cytotoxicity and immunogenicity in vitro. In contrast, the corresponding nanocomplexes mediated a reduced silencing effect with a more narrow safety window. The surface coating with anionic lipid bilayers led to partial decomplexation of the siRNA-peptidomimetic nanocomplex core of the liposomes, which facilitated siRNA release. Additionally, the optimal anionic liposomes showed efficient intracellular uptake and endosomal escape. Therefore, these findings suggest that a more efficacious and safe formulation can be achieved by surface coating of the siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers.Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine

The Nuclear Cap-Binding Complex Mediates Meiotic Silencing by Unpaired DNA

Directory of Open Access Journals (Sweden)

Logan M. Decker

2017-04-01

Full Text Available In the filamentous fungus Neurospora crassa, cross walls between individual cells are normally incomplete, making the entire fungal network vulnerable to attack by viruses and selfish DNAs. Accordingly, several genome surveillance mechanisms are maintained to help the fungus combat these repetitive elements. One of these defense mechanisms is called meiotic silencing by unpaired DNA (MSUD, which identifies and silences unpaired genes during meiosis. Utilizing common RNA interference (RNAi proteins, such as Dicer and Argonaute, MSUD targets mRNAs homologous to the unpaired sequence to achieve silencing. In this study, we have identified an additional silencing component, namely the cap-binding complex (CBC. Made up of cap-binding proteins CBP20 and CBP80, CBC associates with the 5′ cap of mRNA transcripts in eukaryotes. The loss of CBC leads to a deficiency in MSUD activity, suggesting its role in mediating silencing. As confirmed in this study, CBC is predominantly nuclear, although it is known to travel in and out of the nucleus to facilitate RNA transport. As seen in animals but not in plants, CBP20’s robust nuclear import depends on CBP80 in Neurospora. CBC interacts with a component (Argonaute of the perinuclear meiotic silencing complex (MSC, directly linking the two cellular factors.

Expression profiling of c-kit and its impact after esiRNA silencing during gonadal development in catfish.

Science.gov (United States)

Laldinsangi, C; Senthilkumaran, B

2018-04-03

C-kit receptor is a member of a family of growth factor receptors that have tyrosine kinase activity, and are involved in the transduction of growth regulatory signals across plasma membrane by activation of its ligand, kitl/scf. The present study analysed mRNA and protein expression profiles of c-kit in the gonads of catfish, Clarias gariepinus, using real time PCR, in situ hybridization and immunohistochemistry. Tissue distribution analysis revealed higher expression mainly in the catfish gonads. Ontogeny studies showed minimal expression during early developmental stages and highest during 50-75 days post hatch, and the dimorphic expression in gonads decreased gradually till adulthood, which might suggest an important role for this gene around later stages of sex differentiation and gonadal development. Expression of C-kit was analysed at various phases of gonadal cycle in both male and female, which showed minimal expression during the resting phase, and higher expression in male compared to females during the pre-spawning phase. In vitro and in vivo induction using human chorionic gonadotropin elevated the expression of c-kit indicating the regulatory influence of hypothalamo-hypophyseal axis. In vivo transient gene silencing using c-kit-esiRNA in adult catfish during gonadal recrudescence showed a decrease in c-kit expression, which affected the expression level of germ cell meiotic marker sycp3, as well as several factors and steroidogenic enzyme genes involved in germ cell development. Decrease in the levels of serum 11-KT and T were also observed after esiRNA silencing. The findings of this study suggest that c-kit has an important role in the process of germ cell proliferation, development and maturation during gonadal development and recrudescence in catfish. Copyright © 2018. Published by Elsevier Inc.

SAD-3, a Putative Helicase Required for Meiotic Silencing by Unpaired DNA, Interacts with Other Components of the Silencing Machinery

Science.gov (United States)

Hammond, Thomas M.; Xiao, Hua; Boone, Erin C.; Perdue, Tony D.; Pukkila, Patricia J.; Shiu, Patrick K. T.

2011-01-01

In Neurospora crassa, genes lacking a pairing partner during meiosis are suppressed by a process known as meiotic silencing by unpaired DNA (MSUD). To identify novel MSUD components, we have developed a high-throughput reverse-genetic screen for use with the N. crassa knockout library. Here we describe the screening method and the characterization of a gene (sad-3) subsequently discovered. SAD-3 is a putative helicase required for MSUD and sexual spore production. It exists in a complex with other known MSUD proteins in the perinuclear region, a center for meiotic silencing activity. Orthologs of SAD-3 include Schizosaccharomyces pombe Hrr1, a helicase required for RNAi-induced heterochromatin formation. Both SAD-3 and Hrr1 interact with an RNA-directed RNA polymerase and an Argonaute, suggesting that certain aspects of silencing complex formation may be conserved between the two fungal species. PMID:22384347

Silencing of BCR/ABL Chimeric Gene in Human Chronic Myelogenous Leukemia Cell Line K562 by siRNA-Nuclear Export Signal Peptide Conjugates.

Science.gov (United States)

Shinkai, Yasuhiro; Kashihara, Shinichi; Minematsu, Go; Fujii, Hirofumi; Naemura, Madoka; Kotake, Yojiro; Morita, Yasutaka; Ohnuki, Koichiro; Fokina, Alesya A; Stetsenko, Dmitry A; Filichev, Vyacheslav V; Fujii, Masayuki

2017-06-01

Herein we described the synthesis of siRNA-NES (nuclear export signal) peptide conjugates by solid phase fragment coupling and the application of them to silencing of bcr/abl chimeric gene in human chronic myelogenous leukemia cell line K562. Two types of siRNA-NES conjugates were prepared, and both sense strands at 5' ends were covalently linked to a NES peptide derived from TFIIIA and HIV-1 REV, respectively. Significant enhancement of silencing efficiency was observed for both of them. siRNA-TFIIIA NES conjugate suppressed the expression of BCR/ABL gene to 8.3% at 200 nM and 11.6% at 50 nM, and siRNA-HIV-1REV NES conjugate suppressed to 4.0% at 200 nM and 6.3% at 50 nM, whereas native siRNA suppressed to 36.3% at 200 nM and 30.2% at 50 nM. We could also show complex of siRNA-NES conjugate and designed amphiphilic peptide peptideβ7 could be taken up into cells with no cytotoxicity and showed excellent silencing efficiency. We believe that the complex siRNA-NES conjugate and peptideβ7 is a promising candidate for in vivo use and therapeutic applications.

Reduced rates of gene loss, gene silencing, and gene mutation in Dnmt1-deficient embryonic stem cells

NARCIS (Netherlands)

Chan, M.F.; van Amerongen, R.; Nijjar, T.; Cuppen, E.; Jones, P.A.; Laird, P.W.

2001-01-01

Tumor suppressor gene inactivation is a crucial event in oncogenesis. Gene inactivation mechanisms include events resulting in loss of heterozygosity (LOH), gene mutation, and transcriptional silencing. The contribution of each of these different pathways varies among tumor suppressor genes and by

Effect of Circular RNA UBAP2 Silencing on Proliferation and Invasion of Human Lung Cancer A549 Cells and Its Mechanism

Directory of Open Access Journals (Sweden)

Yujing YIN

2017-12-01

Full Text Available Background and objective It has been proven that circular RNAs (circRNAs play an important role on the process of many types cancer and circUBAP2 was a cancer-promoting circRNA, however, the role and mechanism in lung cancer was not clear. The aim of this study is to investigate the effects of circUBAP2 on cell proliferation and invasion of human lung cancer A549 cells. Methods CCK-8 assay was employed to detect the effect of circUBAP2 sliencing on cell proliferation of A549 cells. Fow cytometry was applied to detect the impact of circUBAP2 sliencing on cell cycle and cell anoikis, and Transwell invasion assay was applied to determine cell invasion of A549 cells. We also employed Western blot and Real-time PCR to determine the expressions of CDK6, cyclin D1, p27 and c-IAP1, Bcl-2, Survivin, Bax, FAK, Rac1 and MMP2, and the activities of JNK and ERK1/2, luciferase report gene assay was used to detect the targets. Results CCK-8 assay showed that the inhibition of cell proliferation in the circUBAP2-siRNA group compared to untreated group and siRNA control group. Results of cell cycle detected by flow cytometry showed that cell cycle arrestd at G0/G1 after circUBAP2 silencing, cell apoptosis rate increased also. We also found that after circUBAP2 silencing, cell invasion of A549 cells was significantly inhibited. Western blot and Real-time PCR results showed that expression of CDK6, cyclin D1, c-IAP1, Bcl-2, Survivin, FAK, Rac1 and MMP2 were down-regulated, and the expression of p27 and Bax were up-regulated. Moreover, the activities of JNK and ERK1/2 were inhibited because of circUBAP2 silencing, the target genes were miR-339-5p, miR-96-3p and miR-135b-3p. Conclusion CircUBAP2 plays an important role in the proliferation and invasion of human lung cancer. Silencing of circUBAP2 might be a novel target for molecular targeted therapy of patients with lung cancer.

The C. elegans CSR-1 argonaute pathway counteracts epigenetic silencing to promote germline gene expression.

Science.gov (United States)

Seth, Meetu; Shirayama, Masaki; Gu, Weifeng; Ishidate, Takao; Conte, Darryl; Mello, Craig C

2013-12-23

Organisms can develop adaptive sequence-specific immunity by reexpressing pathogen-specific small RNAs that guide gene silencing. For example, the C. elegans PIWI-Argonaute/piwi-interacting RNA (piRNA) pathway recruits RNA-dependent RNA polymerase (RdRP) to foreign sequences to amplify a transgenerational small-RNA-induced epigenetic silencing signal (termed RNAe). Here, we provide evidence that, in addition to an adaptive memory of silenced sequences, C. elegans can also develop an opposing adaptive memory of expressed/self-mRNAs. We refer to this mechanism, which can prevent or reverse RNAe, as RNA-induced epigenetic gene activation (RNAa). We show that CSR-1, which engages RdRP-amplified small RNAs complementary to germline-expressed mRNAs, is required for RNAa. We show that a transgene with RNAa activity also exhibits accumulation of cognate CSR-1 small RNAs. Our findings suggest that C. elegans adaptively acquires and maintains a transgenerational CSR-1 memory that recognizes and protects self-mRNAs, allowing piRNAs to recognize foreign sequences innately, without the need for prior exposure

Gene silencing of HPV16 E6/E7 induced by promoter-targeting siRNA in SiHa cells

OpenAIRE

Hong, D; Lu, W; Ye, F; Hu, Y; Xie, X

2009-01-01

Background: Recently, transcriptional gene silencing induced by small interfering RNA (siRNA) was found in mammalian and human cells. However, previous studies focused on endogenous genes. Methods: In this study, we designed siRNA targeting the promoter of human papillomavirus 16 E6/E7 and transfected it into the cervical cancer cell line, SiHa. E6 and E7 mRNA and protein expression were detected in cells treated by promoter-targeting siRNA. Futhermore, cellular growth, proliferation, apoptos...

[Lentivirus-mediated shRNA silencing of LAMP2A inhibits the proliferation of multiple myeloma cells].

Science.gov (United States)

Li, Lixuan; Li, Jia

2015-05-01

To study the effects of lentivirus-mediated short hairpin RNA (shRNA) silencing of lysosome-associated membrane protein type 2A (LAMP2A) expression on the proliferation of multiple myeloma cells. The constructed shRNA lentiviral vector was applied to infect human multiple myeloma cell line MM.1S, and stable expression cell line was obtained by puromycin screening. Western blotting was used to verify the inhibitory effect on LAMP2A protein expression. MTT assay was conducted to detect the effect of knocked-down LAMP2A on MM.1S cell proliferation, and the anti-tumor potency of suberoylanilide hydroxamic acid (SAHA) against the obtained MM.1S LAMP2A(shRNA) stable cell line. Lactate assay was performed to observe the impact of low LAMP2A expression on cell glycolysis. The stable cell line with low LAMP2A expression were obtained with the constructed human LAMP2A-shRNA lentiviral vector. Down-regulation of LAMP2A expression significantly inhibited MM.1S cell proliferation and enhanced the anti-tumor activity of SAHA. Interestingly, decreased LAMP2A expression also inhibited MM.1S cell lactic acid secretion. Down-regulation of LAMP2A expression could inhibit cell proliferation in multiple myeloma cells.

Silencing of reversion-inducing cysteine-rich protein with Kazal motifs stimulates hyperplastic phenotypes through activation of epidermal growth factor receptor and hypoxia-inducible factor-2α.

Directory of Open Access Journals (Sweden)

You Mie Lee

Full Text Available Reversion-inducing cysteine-rich protein with Kazal motifs (RECK, a tumor suppressor is down-regulated by the oncogenic signals and hypoxia, but the biological function of RECK in early tumorigenic hyperplastic phenotypes is largely unknown. Knockdown of RECK by small interfering RNA (siRECK or hypoxia significantly promoted cell proliferation in various normal epithelial cells. Hypoxia as well as knockdown of RECK by siRNA increased the cell cycle progression, the levels of cyclin D1 and c-Myc, and the phosphorylation of Rb protein (p-pRb, but decreased the expression of p21(cip1, p27(kip1, and p16(ink4A. HIF-2α was upregulated by knockdown of RECK, indicating HIF-2α is a downstream target of RECK. As knockdown of RECK induced the activation of epidermal growth factor receptor (EGFR and treatment of an EGFR kinase inhibitor, gefitinib, suppressed HIF-2α expression induced by the silencing of RECK, we can suggest that the RECK silenicng-EGFR-HIF-2α axis might be a key molecular mechanism to induce hyperplastic phenotype of epithelial cells. It was also found that shRNA of RECK induced larger and more numerous colonies than control cells in an anchorage-independent colony formation assay. Using a xenograft assay, epithelial cells with stably transfected with shRNA of RECK formed a solid mass earlier and larger than those with control cells in nude mice. In conclusion, the suppression of RECK may promote the development of early tumorigenic hyperplastic characteristics in hypoxic stress.

A genome-wide shRNA screen identifies GAS1 as a novel melanoma metastasis suppressor gene.

Science.gov (United States)

Gobeil, Stephane; Zhu, Xiaochun; Doillon, Charles J; Green, Michael R

2008-11-01

Metastasis suppressor genes inhibit one or more steps required for metastasis without affecting primary tumor formation. Due to the complexity of the metastatic process, the development of experimental approaches for identifying genes involved in metastasis prevention has been challenging. Here we describe a genome-wide RNAi screening strategy to identify candidate metastasis suppressor genes. Following expression in weakly metastatic B16-F0 mouse melanoma cells, shRNAs were selected based upon enhanced satellite colony formation in a three-dimensional cell culture system and confirmed in a mouse experimental metastasis assay. Using this approach we discovered 22 genes whose knockdown increased metastasis without affecting primary tumor growth. We focused on one of these genes, Gas1 (Growth arrest-specific 1), because we found that it was substantially down-regulated in highly metastatic B16-F10 melanoma cells, which contributed to the high metastatic potential of this mouse cell line. We further demonstrated that Gas1 has all the expected properties of a melanoma tumor suppressor including: suppression of metastasis in a spontaneous metastasis assay, promotion of apoptosis following dissemination of cells to secondary sites, and frequent down-regulation in human melanoma metastasis-derived cell lines and metastatic tumor samples. Thus, we developed a genome-wide shRNA screening strategy that enables the discovery of new metastasis suppressor genes.

Therapeutic Silencing of Bcl-2 by Systemically Administered siRNA Nanotherapeutics Inhibits Tumor Growth by Autophagy and Apoptosis and Enhances the Efficacy of Chemotherapy in Orthotopic Xenograft Models of ER (− and ER (+ Breast Cancer

Directory of Open Access Journals (Sweden)

Ibrahim Tekedereli

2013-01-01

Full Text Available Bcl-2 is overexpressed in about a half of human cancers and 50–70% of breast cancer patients, thereby conferring resistance to conventional therapies and making it an excellent therapeutic target. Small interfering RNA (siRNA offers novel and powerful tools for specific gene silencing and molecularly targeted therapy. Here, we show that therapeutic silencing of Bcl-2 by systemically administered nanoliposomal (NL-Bcl-2 siRNA (0.15 mg siRNA/kg, intravenous twice a week leads to significant antitumor activity and suppression of growth in both estrogen receptor-negative (ER(− MDA-MB-231 and ER-positive (+ MCF7 breast tumors in orthotopic xenograft models (P < 0.05. A single intravenous injection of NL-Bcl-2-siRNA provided robust and persistent silencing of the target gene expression in xenograft tumors. NL-Bcl-2-siRNA treatment significantly increased the efficacy of chemotherapy when combined with doxorubicin in both MDA-MB-231 and MCF-7 animal models (P < 0.05. NL-Bcl-2-siRNA treatment-induced apoptosis and autophagic cell death, and inhibited cyclin D1, HIF1α and Src/Fak signaling in tumors. In conclusion, our data provide the first evidence that in vivo therapeutic targeting Bcl-2 by systemically administered nanoliposomal-siRNA significantly inhibits growth of both ER(− and ER(+ breast tumors and enhances the efficacy of chemotherapy, suggesting that therapeutic silencing of Bcl-2 by siRNA is a viable approach in breast cancers.

Combination of siRNA-directed Kras oncogene silencing and arsenic-induced apoptosis using a nanomedicine strategy for the effective treatment of pancreatic cancer.

Science.gov (United States)

Zeng, Linjuan; Li, Jingguo; Wang, Yong; Qian, Chenchen; Chen, Yinting; Zhang, Qiubo; Wu, Wei; Lin, Zhong; Liang, Jianzhong; Shuai, Xintao; Huang, Kaihong

2014-02-01

The synergetic inhibitory effects on human pancreatic cancer by nanoparticle-mediated siRNA and arsenic therapy were investigated both in vitro and in vivo. Poly(ethylene glycol)-block-poly(L-lysine) were prepared to form siRNA-complexed polyplex and poly(ethylene glycol)-block-poly(DL-lactide) were prepared to form arsenic-encapsulated vesicle, respectively. Down-regulation of the mutant Kras gene by siRNA caused defective abilities of proliferation, clonal formation, migration, and invasion of pancreatic cancer cells, as well as cell cycle arrest at the G0/G1 phase, which substantially enhanced the apoptosis-inducing effect of arsenic administration. Consequently, co-administration of the two nanomedicines encapsulating siRNA or arsenic showed ideal tumor growth inhibition both in vitro and in vivo as a result of synergistic effect of the siRNA-directed Kras oncogene silencing and arsenic-induced cell apoptosis. These results suggest that the combination of mutant Kras gene silencing and arsenic therapy using nanoparticle-mediated delivery strategy is promising for pancreatic cancer treatment. Treatment of pancreatic cancer remains a major challenge. These authors demonstrate a method that combines a siRNA-based Kras silencing with arsenic delivery to pancreatic cancer cells using nanoparticles, resulting in enhanced apoptosis induction in the treated cells. © 2013.

Dysregulated RNA-Induced Silencing Complex (RISC) Assembly within CNS Corresponds with Abnormal miRNA Expression during Autoimmune Demyelination.

Science.gov (United States)

Lewkowicz, Przemysław; Cwiklińska, Hanna; Mycko, Marcin P; Cichalewska, Maria; Domowicz, Małgorzata; Lewkowicz, Natalia; Jurewicz, Anna; Selmaj, Krzysztof W

2015-05-13

MicroRNAs (miRNAs) associate with Argonaute (Ago), GW182, and FXR1 proteins to form RNA-induced silencing complexes (RISCs). RISCs represent a critical checkpoint in the regulation and bioavailability of miRNAs. Recent studies have revealed dysregulation of miRNAs in multiple sclerosis (MS) and its animal model, experimental autoimmune encephalomyelitis (EAE); however, the function of RISCs in EAE and MS is largely unknown. Here, we examined the expression of Ago, GW182, and FXR1 in CNS tissue, oligodendrocytes (OLs), brain-infiltrating T lymphocytes, and CD3(+)splenocytes (SCs) of EAE mic, and found that global RISC protein levels were significantly dysregulated. Specifically, Ago2 and FXR1 levels were decreased in OLs and brain-infiltrating T cells in EAE mice. Accordingly, assembly of Ago2/GW182/FXR1 complexes in EAE brain tissues was disrupted, as confirmed by immunoprecipitation experiments. In parallel with alterations in RISC complex content in OLs, we found downregulation of miRNAs essential for differentiation and survival of OLs and myelin synthesis. In brain-infiltrating T lymphocytes, aberrant RISC formation contributed to miRNA-dependent proinflammatory helper T-cell polarization. In CD3(+) SCs, we found increased expression of both Ago2 and FXR1 in EAE compared with nonimmunized mice. Therefore, our results demonstrate a gradient in expression of miRNA between primary activated T cells in the periphery and polarized CNS-infiltrating T cells. These results suggest that, in polarized autoreactive effector T cells, miRNA synthesis is inhibited in response to dysregulated RISC assembly, allowing these cells to maintain a highly specific proinflammatory program. Therefore, our findings may provide a mechanism that leads to miRNA dysregulation in EAE/MS. Copyright © 2015 the authors 0270-6474/15/357521-17$15.00/0.

Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

Directory of Open Access Journals (Sweden)

Tatsuya eKon

2014-11-01

Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.

The rde-1 gene, RNA interference, and transposon silencing in C. elegans.

Science.gov (United States)

Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C

1999-10-15

Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.

Enhancer-driven chromatin interactions during development promote escape from silencing by a long non-coding RNA

Directory of Open Access Journals (Sweden)

Korostowski Lisa

2011-11-01

Full Text Available Abstract Background Gene regulation in eukaryotes is a complex process entailing the establishment of transcriptionally silent chromatin domains interspersed with regions of active transcription. Imprinted domains consist of clusters of genes, some of which exhibit parent-of-origin dependent monoallelic expression, while others are biallelic. The Kcnq1 imprinted domain illustrates the complexities of long-range regulation that coexists with local exceptions. A paternally expressed repressive non-coding RNA, Kcnq1ot1, regulates a domain of up to 750 kb, encompassing 14 genes. We study how the Kcnq1 gene, initially silenced by Kcnq1ot1, undergoes tissue-specific escape from imprinting during development. Specifically, we uncover the role of chromosome conformation during these events. Results We show that Kcnq1 transitions from monoallelic to biallelic expression during mid gestation in the developing heart. This transition is not associated with the loss of methylation on the Kcnq1 promoter. However, by exploiting chromosome conformation capture (3C technology, we find tissue-specific and stage-specific chromatin loops between the Kcnq1 promoter and newly identified DNA regulatory elements. These regulatory elements showed in vitro activity in a luciferase assay and in vivo activity in transgenic embryos. Conclusions By exploring the spatial organization of the Kcnq1 locus, our results reveal a novel mechanism by which local activation of genes can override the regional silencing effects of non-coding RNAs.

Oral cancer cells may rewire alternative metabolic pathways to survive from siRNA silencing of metabolic enzymes

International Nuclear Information System (INIS)

Zhang, Min; Chai, Yang D; Brumbaugh, Jeffrey; Liu, Xiaojun; Rabii, Ramin; Feng, Sizhe; Misuno, Kaori; Messadi, Diana; Hu, Shen

2014-01-01

Cancer cells may undergo metabolic adaptations that support their growth as well as drug resistance properties. The purpose of this study is to test if oral cancer cells can overcome the metabolic defects introduced by using small interfering RNA (siRNA) to knock down their expression of important metabolic enzymes. UM1 and UM2 oral cancer cells were transfected with siRNA to transketolase (TKT) or siRNA to adenylate kinase (AK2), and Western blotting was used to confirm the knockdown. Cellular uptake of glucose and glutamine and production of lactate were compared between the cancer cells with either TKT or AK2 knockdown and those transfected with control siRNA. Statistical analysis was performed with student T-test. Despite the defect in the pentose phosphate pathway caused by siRNA knockdown of TKT, the survived UM1 or UM2 cells utilized more glucose and glutamine and secreted a significantly higher amount of lactate than the cells transferred with control siRNA. We also demonstrated that siRNA knockdown of AK2 constrained the proliferation of UM1 and UM2 cells but similarly led to an increased uptake of glucose/glutamine and production of lactate by the UM1 or UM2 cells survived from siRNA silencing of AK2. Our results indicate that the metabolic defects introduced by siRNA silencing of metabolic enzymes TKT or AK2 may be compensated by alternative feedback metabolic mechanisms, suggesting that cancer cells may overcome single defective pathways through secondary metabolic network adaptations. The highly robust nature of oral cancer cell metabolism implies that a systematic medical approach targeting multiple metabolic pathways may be needed to accomplish the continued improvement of cancer treatment

Chitosan/siRNA nanoparticles encapsulated in PLGA nanofibers for siRNA delivery

DEFF Research Database (Denmark)

Chen, Menglin; Gao, Shan; Dong, Mingdong

2012-01-01

Composite nanofibers of biodegradable poly(d,l-lactic-co-glycolic acid) (PLGA) encapsulating chitosan/siRNA nanoparticles (NPs) were prepared by electrospinning. Acidic/alkaline hydrolysis and a bulk/surface degradation mechanism were investigated in order to achieve an optimized release profile...... for prolonged and efficient gene silencing. Thermo-controlled AFM in situ imaging not only revealed the integrity of the encapsulated chitosan/siRNA polyplex but also shed light on the decreasing Tg of PLGA on the fiber surfaces during release. A triphasic release profile based on bulk erosion was obtained at p......RNA transfection, where the encapsulated chitosan/siRNA NPs exhibited up to 50% EGFP gene silencing activity after 48 h post-transfection on H1299 cells....

Epigenetic silencing of MAL, a putative tumor suppressor gene, can contribute to human epithelium cell carcinoma

Directory of Open Access Journals (Sweden)

Zhang Jun

2010-11-01

Full Text Available Abstract Background To identify new and useful candidate biomarkers in head and neck squamous cell carcinoma (HNSCC, we performed a genome-wide survey and found that Myelin and lymphocyte-associated protein (MAL was a gene that was markedly down-regulated in HNSCC. Hence, we investigated the mechanism of MAL silencing and the effects of MAL on the proliferation, invasion, and apoptotic potential in HNSCC. Results MAL was significantly down-regulated in 91.7% of HNSCC specimens at the mRNA level as compared with adjacent normal tissues (P = 0.0004. Moreover, the relative transcript levels of the MAL gene were remarkably decreased by five-fold in nine HNSCC cell lines as compared with normal head and neck epithelium cells. MAL gene expression was restored in 44%, 67%, and 89% in HNSCC cell lines treated with TSA, 5-Aza-dC, and TSA plus 5-Aza-dC, respectively. Furthermore, bisulfate-treated DNA sequencing demonstrated that the two CpG islands (that is, M1 and M2 located in MAL promoter region were completely methylated in the HNSCC cell lines (CpG methylated ratio was more than 90%, and only one CpG island (that is, M1 was partially methylated in HNSCC tissues (CpG methylated ratio between 20% and 90%. A significant reduction in cell proliferation and a change in the cell cycle profile were also observed in MAL transfectants. Matrigel assay demonstrated that the invasiveness of HNSCC cells significantly decreased. A significant increase in the population of apoptotic cells was observed in MAL transfected cells. The exogenous expression of the MAL gene suppressed malignant phenotypes, while the cell death induced by MAL gene transfer was a result of apoptosis as demonstrated by the induction of cleavage of the poly (that is, ADP-ribose polymerase. Additionally, tumor growth was suppressed in cells expressing MAL as compared with cells not expressing MAL. Conclusion Our data suggest that the epigenetic inactivation of MAL, as a candidate tumor

Musashi-2 Silencing Exerts Potent Activity against Acute Myeloid Leukemia and Enhances Chemosensitivity to Daunorubicin.

Directory of Open Access Journals (Sweden)

Yixiang Han

Full Text Available RNA-binding protein Musashi-2 (Msi2 is known to play a critical role in leukemogenesis and contributes to poor clinical prognosis in acute myeloid leukemia (AML. However, the effect of Msi2 silencing on treatment for AML still remains poorly understood. In this study, we used lentivirus-mediated RNA interference targeting Msi2 to investigate the resulting changes in cellular processes and the underlying mechanisms in AML cell lines as well as primary AML cells isolated from AML patients. We found that Msi2 was highly expressed in AML cells, and its depletion inhibited Ki-67 expression and resulted in decreased in vitro and in vivo proliferation. Msi2 silencing induced cell cycle arrest in G0/G1 phase, with decreased Cyclin D1 and increased p21 expression. Msi2 silencing induced apoptosis through down-regulation of Bcl-2 expression and up-regulation of Bax expression. Suppression of Akt, Erk1/2 and p38 phosphorylation also contributed to apoptosis mediated by Msi2 silencing. Finally, Msi2 silencing in AML cells also enhanced their chemosensitivity to daunorubicin. Conclusively, our data suggest that Msi2 is a promising target for gene therapy to optimize conventional chemotherapeutics in AML treatment.

In vivo silencing of alpha-synuclein using naked siRNA

Directory of Open Access Journals (Sweden)

Charisse Klaus

2008-11-01

Full Text Available Abstract Background Overexpression of α-synuclein (SNCA in families with multiplication mutations causes parkinsonism and subsequent dementia, characterized by diffuse Lewy Body disease post-mortem. Genetic variability in SNCA contributes to risk of idiopathic Parkinson's disease (PD, possibly as a result of overexpression. SNCA downregulation is therefore a valid therapeutic target for PD. Results We have identified human and murine-specific siRNA molecules which reduce SNCA in vitro. As a proof of concept, we demonstrate that direct infusion of chemically modified (naked, murine-specific siRNA into the hippocampus significantly reduces SNCA levels. Reduction of SNCA in the hippocampus and cortex persists for a minimum of 1 week post-infusion with recovery nearing control levels by 3 weeks post-infusion. Conclusion We have developed naked gene-specific siRNAs that silence expression of SNCA in vivo. This approach may prove beneficial toward our understanding of the endogenous functional equilibrium of SNCA, its role in disease, and eventually as a therapeutic strategy for α-synucleinopathies resulting from SNCA overexpression.

In vivo silencing of alpha-synuclein using naked siRNA

Science.gov (United States)

Lewis, Jada; Melrose, Heather; Bumcrot, David; Hope, Andrew; Zehr, Cynthia; Lincoln, Sarah; Braithwaite, Adam; He, Zhen; Ogholikhan, Sina; Hinkle, Kelly; Kent, Caroline; Toudjarska, Ivanka; Charisse, Klaus; Braich, Ravi; Pandey, Rajendra K; Heckman, Michael; Maraganore, Demetrius M; Crook, Julia; Farrer, Matthew J

2008-01-01

Background Overexpression of α-synuclein (SNCA) in families with multiplication mutations causes parkinsonism and subsequent dementia, characterized by diffuse Lewy Body disease post-mortem. Genetic variability in SNCA contributes to risk of idiopathic Parkinson's disease (PD), possibly as a result of overexpression. SNCA downregulation is therefore a valid therapeutic target for PD. Results We have identified human and murine-specific siRNA molecules which reduce SNCA in vitro. As a proof of concept, we demonstrate that direct infusion of chemically modified (naked), murine-specific siRNA into the hippocampus significantly reduces SNCA levels. Reduction of SNCA in the hippocampus and cortex persists for a minimum of 1 week post-infusion with recovery nearing control levels by 3 weeks post-infusion. Conclusion We have developed naked gene-specific siRNAs that silence expression of SNCA in vivo. This approach may prove beneficial toward our understanding of the endogenous functional equilibrium of SNCA, its role in disease, and eventually as a therapeutic strategy for α-synucleinopathies resulting from SNCA overexpression. PMID:18976489

Phenotypic changes associated with RNA interference silencing of chalcone synthase in apple (Malus × domestica).

Science.gov (United States)

Dare, Andrew P; Tomes, Sumathi; Jones, Midori; McGhie, Tony K; Stevenson, David E; Johnson, Ross A; Greenwood, David R; Hellens, Roger P

2013-05-01

We have identified in apple (Malus × domestica) three chalcone synthase (CHS) genes. In order to understand the functional redundancy of this gene family RNA interference knockout lines were generated where all three of these genes were down-regulated. These lines had no detectable anthocyanins and radically reduced concentrations of dihydrochalcones and flavonoids. Surprisingly, down-regulation of CHS also led to major changes in plant development, resulting in plants with shortened internode lengths, smaller leaves and a greatly reduced growth rate. Microscopic analysis revealed that these phenotypic changes extended down to the cellular level, with CHS-silenced lines showing aberrant cellular organisation in the leaves. Fruit collected from one CHS-silenced line was smaller than the 'Royal Gala' controls, lacked flavonoids in the skin and flesh and also had changes in cell morphology. Auxin transport experiments showed increased rates of auxin transport in a CHS-silenced line compared with the 'Royal Gala' control. As flavonoids are well known to be key modulators of auxin transport, we hypothesise that the removal of almost all flavonoids from the plant by CHS silencing creates a vastly altered environment for auxin transport to occur and results in the observed changes in growth and development. © 2013 The Authors The Plant Journal © 2013 Blackwell Publishing Ltd.

miRNA-like duplexes as RNAi triggers with improved specificity

Directory of Open Access Journals (Sweden)

Juan G. Betancur

2012-07-01

Full Text Available siRNA duplexes, the most common triggers of RNA interference, are first loaded into an Argonaute (Ago protein and then undergo unwinding via passenger strand cleavage, which requires the slicer activity of the Ago protein. In mammals, only Ago2 out of the four Ago proteins possesses such slicer activity. In contrast, miRNA/miRNA* duplexes often contain central mismatches that prevent slicer-dependent unwinding. Instead, mismatches in specific regions (seed and 3´-mid regions promote efficient slicer-independent unwinding by any of the four mammalian Ago proteins. Both slicer-dependent and slicer-independent unwinding mechanisms produce guide-containing RNA-induced silencing complex (RISC, which silences target mRNAs by cleavage, translational repression, and/or deadenylation that leads to mRNA decay. In this review, we summarize our current knowledge of the RISC assembly pathways, and describe a simple method to rationally design artificial miRNA/miRNA*-like duplexes and highlight its benefits to reduce the unwanted off-target effects without compromising the specific target silencing activity.

Tumor suppressors: enhancers or suppressors of regeneration?

Science.gov (United States)

Pomerantz, Jason H.; Blau, Helen M.

2013-01-01

Tumor suppressors are so named because cancers occur in their absence, but these genes also have important functions in development, metabolism and tissue homeostasis. Here, we discuss known and potential functions of tumor suppressor genes during tissue regeneration, focusing on the evolutionarily conserved tumor suppressors pRb1, p53, Pten and Hippo. We propose that their activity is essential for tissue regeneration. This is in contrast to suggestions that tumor suppression is a trade-off for regenerative capacity. We also hypothesize that certain aspects of tumor suppressor pathways inhibit regenerative processes in mammals, and that transient targeted modification of these pathways could be fruitfully exploited to enhance processes that are important to regenerative medicine. PMID:23715544

Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus

Directory of Open Access Journals (Sweden)

Fangquan Wang

2016-05-01

Full Text Available Rice black-streaked dwarf virus (RBSDV belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21–24 nt small interfering RNA (siRNA. By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus.

Science.gov (United States)

Wang, Fangquan; Li, Wenqi; Zhu, Jinyan; Fan, Fangjun; Wang, Jun; Zhong, Weigong; Wang, Ming-Bo; Liu, Qing; Zhu, Qian-Hao; Zhou, Tong; Lan, Ying; Zhou, Yijun; Yang, Jie

2016-05-11

Rice black-streaked dwarf virus (RBSDV) belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA) construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21-24 nt small interfering RNA (siRNA). By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

Negative regulation of TLR4 via targeting of the proinflammatory tumor suppressor PDCD4 by the microRNA miR-21.

LENUS (Irish Health Repository)

Sheedy, FJ

2009-11-29

The tumor suppressor PDCD4 is a proinflammatory protein that promotes activation of the transcription factor NF-kappaB and suppresses interleukin 10 (IL-10). Here we found that mice deficient in PDCD4 were protected from lipopolysaccharide (LPS)-induced death. The induction of NF-kappaB and IL-6 by LPS required PDCD4, whereas LPS enhanced IL-10 induction in cells lacking PDCD4. Treatment of human peripheral blood mononuclear cells with LPS resulted in lower PDCD4 expression, which was due to induction of the microRNA miR-21 via the adaptor MyD88 and NF-kappaB. Transfection of cells with a miR-21 precursor blocked NF-kappaB activity and promoted IL-10 production in response to LPS, whereas transfection with antisense oligonucleotides to miR-21 or targeted protection of the miR-21 site in Pdcd4 mRNA had the opposite effect. Thus, miR-21 regulates PDCD4 expression after LPS stimulation.

RNA interference silences Microplitis demolitor bracovirus genes and implicates glc1.8 in disruption of adhesion in infected host cells

International Nuclear Information System (INIS)

Beck, Markus; Strand, Michael R.

2003-01-01

The family Polydnaviridae consists of ds-DNA viruses that are symbiotically associated with certain parasitoid wasps. PDVs are transmitted vertically but also are injected by wasps into hosts where they cause several physiological alterations including immunosuppression. The PDV genes responsible for mediating immunosuppression and other host alterations remain poorly characterized in large measure because viral mutants cannot be produced to study gene function. Here we report the use of RNA interference (RNAi) to specifically silence the glc1.8 and egf1.0 genes from Microplitis demolitor bracovirus (MdBV) in High Five cells derived from the lepidopteran Trichoplusia ni. Dose-response studies indicated that MdBV infects High Five cells and blocks the ability of these cells to adhere to culture plates. This response was very similar to what occurs in two classes of hemocytes, granular cells, and plasmatocytes, after infection by MdBV. Screening of monoclonal antibody (mAb) markers that distinguish different classes of lepidopteran hemocytes indicated that High Five cells cross-react with three mAbs that recognize granular cells from T. ni. Double-stranded RNA (dsRNA) complementary to glc1.8 specifically silenced glc1.8 expression and rescued the adhesive phenotype of High Five cells. Reciprocally, dsRNA complementary to egf1.0 silenced egf1.0 expression but had no effect on adhesion. The simplicity and potency of RNAi could be extremely useful for analysis of other PDV genes

Effects of siRNA Silencing of TUG1 and LCAL6 Long Non-coding RNAs on Patient-derived Xenograft of Non-small Cell Lung Cancer.

Science.gov (United States)

Fang, Tian; Huang, Hairong; Li, Xiaoyou; Liao, Jing; Yang, Zhijian; Hoffman, Robert M; Cheng, X I; Liang, Lei; Hu, Wenjuan; Yun, Shifeng

2018-01-01

The aim of the present study was to establish a patient-derived xenograft (PDX) mouse model of non-small cell lung cancer (NSCLC) and investigate the anti-tumor efficacy of silencing of TUG1 and LCAL6 long non-coding RNA in the PDX model. PDXs were established by subcutaneously implanting NSCLC surgical tumor fragments into immunodeficient mice. PDX characterization was performed by histopathological, immunohistochemical and real-time polymerase chain reaction (RT-PCR) analyses for NSCLC subtype-specific markers and expression of LCAL6 and TUG1. Anti-tumor efficacy of siRNA silencing of TUG1 and LCAL6 was also investigated in the PDX model. The effect of TUG1 and LCAL6 silencing on protein expression of proliferation marker Ki67 and HOX-gene family HOXB7 in the tumors was assessed by immunohistochemical staining and Western blotting. Establishment of NSCLC PDX models resulted in 9 of 26 cases (34.6%). Lung squamous cell carcinomas (SCC) had a higher engraftment rate (58.3%) than lung adenocarcinomas (ADC) (18.2%) (pTUG1. The tumor volume and weight were significantly reduced in the TUG1-silenced group as compared to the control group (p0.05). Expression of both TUG1and LCAL6 was reduced by siRNA treatment. Expression of Ki67 and HOXB7 was significantly suppressed in both the TUG1- and LCAL6-silenced groups compared to the control group (pTUG1-silenced group showed more reduced Ki67 expression than the LCAL6-silenced group (pTUG1 and LCAL6. Silencing of TUG1 inhibited both tumor growth and expression of the proliferation marker Ki67 and HOX-gene family HOXB7 in the PDX model of NSCLC. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

siRNA-Mediated Silencing of doublesex during Female Development of the Dengue Vector Mosquito Aedes aegypti.

Directory of Open Access Journals (Sweden)

Keshava Mysore

2015-11-01

Full Text Available The development of sex-specific traits, including the female-specific ability to bite humans and vector disease, is critical for vector mosquito reproduction and pathogen transmission. Doublesex (Dsx, a terminal transcription factor in the sex determination pathway, is known to regulate sex-specific gene expression during development of the dengue fever vector mosquito Aedes aegypti. Here, the effects of developmental siRNA-mediated dsx silencing were assessed in adult females. Targeting of dsx during A. aegypti development resulted in decreased female wing size, a correlate for body size, which is typically larger in females. siRNA-mediated targeting of dsx also resulted in decreased length of the adult female proboscis. Although dsx silencing did not impact female membrane blood feeding or mating behavior in the laboratory, decreased fecundity and fertility correlated with decreased ovary length, ovariole length, and ovariole number in dsx knockdown females. Dsx silencing also resulted in disruption of olfactory system development, as evidenced by reduced length of the female antenna and maxillary palp and the sensilla present on these structures, as well as disrupted odorant receptor expression. Female lifespan, a critical component of the ability of A. aegypti to transmit pathogens, was also significantly reduced in adult females following developmental targeting of dsx. The results of this investigation demonstrate that silencing of dsx during A. aegypti development disrupts multiple sex-specific morphological, physiological, and behavioral traits of adult females, a number of which are directly or indirectly linked to mosquito reproduction and pathogen transmission. Moreover, the olfactory phenotypes observed connect Dsx to development of the olfactory system, suggesting that A. aegypti will be an excellent system in which to further assess the developmental genetics of sex-specific chemosensation.

Antiviral RNA silencing initiated in the absence of RDE-4, a double-stranded RNA binding protein, in Caenorhabditis elegans.

Science.gov (United States)

Guo, Xunyang; Zhang, Rui; Wang, Jeffrey; Lu, Rui

2013-10-01

Small interfering RNAs (siRNAs) processed from double-stranded RNA (dsRNA) of virus origins mediate potent antiviral defense through a process referred to as RNA interference (RNAi) or RNA silencing in diverse organisms. In the simple invertebrate Caenorhabditis elegans, the RNAi process is initiated by a single Dicer, which partners with the dsRNA binding protein RDE-4 to process dsRNA into viral siRNAs (viRNAs). Notably, in C. elegans this RNA-directed viral immunity (RDVI) also requires a number of worm-specific genes for its full antiviral potential. One such gene is rsd-2 (RNAi spreading defective 2), which was implicated in RDVI in our previous studies. In the current study, we first established an antiviral role by showing that rsd-2 null mutants permitted higher levels of viral RNA accumulation, and that this enhanced viral susceptibility was reversed by ectopic expression of RSD-2. We then examined the relationship of rsd-2 with other known components of RNAi pathways and established that rsd-2 functions in a novel pathway that is independent of rde-4 but likely requires the RNA-dependent RNA polymerase RRF-1, suggesting a critical role for RSD-2 in secondary viRNA biogenesis, likely through coordinated action with RRF-1. Together, these results suggest that RDVI in the single-Dicer organism C. elegans depends on the collective actions of both RDE-4-dependent and RDE-4-independent mechanisms to produce RNAi-inducing viRNAs. Our study reveals, for the first time, a novel siRNA-producing mechanism in C. elegans that bypasses the need for a dsRNA-binding protein.

The human ARF tumor suppressor senses blastema activity and suppresses epimorphic tissue regeneration

Science.gov (United States)

Hesse, Robert G; Kouklis, Gayle K; Ahituv, Nadav; Pomerantz, Jason H

2015-01-01

The control of proliferation and differentiation by tumor suppressor genes suggests that evolution of divergent tumor suppressor repertoires could influence species’ regenerative capacity. To directly test that premise, we humanized the zebrafish p53 pathway by introducing regulatory and coding sequences of the human tumor suppressor ARF into the zebrafish genome. ARF was dormant during development, in uninjured adult fins, and during wound healing, but was highly expressed in the blastema during epimorphic fin regeneration after amputation. Regenerative, but not developmental signals resulted in binding of zebrafish E2f to the human ARF promoter and activated conserved ARF-dependent Tp53 functions. The context-dependent activation of ARF did not affect growth and development but inhibited regeneration, an unexpected distinct tumor suppressor response to regenerative versus developmental environments. The antagonistic pleiotropic characteristics of ARF as both tumor and regeneration suppressor imply that inducing epimorphic regeneration clinically would require modulation of ARF –p53 axis activation. DOI: http://dx.doi.org/10.7554/eLife.07702.001 PMID:26575287

MicroRNA, SND1, and alterations in translational regulation in colon carcinogenesis

International Nuclear Information System (INIS)

Tsuchiya, Naoto; Nakagama, Hitoshi

2010-01-01

Post-transcriptional regulation of gene expression by microRNA (miRNA) has recently attracted major interest in relation to its involvement in cancer development. miRNA is a member of small non-coding RNA, consists of 22-24 nucleotides and regulates expression of target mRNA species in a post-transcriptional manner by being incorporated with RNA-induced silencing complex (RISC). Staphylococcal nuclease homology domain containing 1 (SND1), a component of RISC, is frequently up-regulated in human colon cancers and also chemically induced colon cancers in animals. We here showed that SDN1 is involved in miRNA-mediated gene suppression and overexpression of SND1 in colon cancer cells causes down-regulation of APC without altering APC mRNA levels. As for the miRNA expression profile in human colon cancer, miR-34a was among the list of down-regulated miRNA. Expression of miR-34a is tightly regulated by p53, and ectopic expression of miR-34a in colon cancer cells causes remarkable reduction of cell proliferation and induces senescence-like phenotypes. MiR-34a also participates in the positive feedback loop of the p53 tumor suppressor network. This circuitry mechanism for p53 activation is of interest in understanding the tumor suppressive function of miR-34a in colon carcinogenesis. miRNA should also be considered as novel anti-cancer agents in tumor suppressive therapeutic applications.

Soluble suppressor supernatants elaborated by concanavalin A-activated human mononuclear cells. Characterization of a soluble suppressor of B cell immunoglobulin production

International Nuclear Information System (INIS)

Fleisher, T.A.; Greene, W.C.; Blaese, R.M.; Waldmann, T.A.

1981-01-01

Human peripheral blood mononuclear cells (PBMC) activated with the mitogenic lectin concanavalin A (Con A) elaborate a soluble immune suppressor supernatant (SISS) that contains at least 2 distinct suppressor factors. One of these, SISS-B, inhibits polyclonal B cell immunoglobulin production, whereas the other, SISS-T, suppresses T cell proliferation to both mitogens and antigens. The latter mediator is discussed in the companion paper. Characteristics of the human soluble suppressor of B cell immunoglobulin production (SISS-B) include: 1) inhibition by a noncytotoxic mechanism, 2) loss of activity in the presence of the monosaccharide L-rhamnose, 3) appearance within 8 to 16 hr after the addition of Con A, 4) elaboration by cells irradiated with 500 or 2000 rads, 5) production by highly purified T cells, 6) stability at pH 2.5 but instability at 56/sup o/C, and 7) m.w. of 60 to 80,000. These data indicate that after Con A activation, selected T cells not only become potent suppressor cells, but also generate a soluble saccharide-specific factor(s) that inhibits polyclonal immunoglobulin production by human B cells

Low-weight polyethylenimine cross-linked 2-hydroxypopyl-ß-cyclodextrin and folic acid as an efficient and nontoxic siRNA carrier for gene silencing and tumor inhibition by VEGF siRNA

Directory of Open Access Journals (Sweden)

Li JM

2013-06-01

Full Text Available Jin-Ming Li, Yuan-Yuan Wang, Wei Zhang, Hua Su, Liang-Nian Ji, Zong-Wan Mao MOE Key Laboratory of Bioinorganic and Synthetic Chemistry, School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou, People's Republic of China Background: Targeted delivery of small interfering RNA (siRNA has been regarded as one of the most important technologies for the development of siRNA therapeutics. However, the need for safe and efficient delivery systems is a barrier to further development of RNA interference therapeutics. In this work, a nontoxic and efficient siRNA carrier delivery system of low molecular weight polyethyleneimine (PEI-600 Da cross-linked with 2-hydroxypopyl-β-cyclodextrin (HP-β-CD and folic acid (FA was synthesized for biomedical application. Methods: The siRNA carrier was prepared using a simple method and characterized by nuclear magnetic resonance and Fourier transform infrared spectroscopy. The siRNA carrier nanoparticles were characterized in terms of morphology, size and zeta potential, stability, efficiency of delivery, and gene silencing efficiency in vitro and in vivo. Results: The siRNA carrier was synthesized successfully. It showed good siRNA binding capacity and ability to protect siRNA. Further, the toxicity of the carrier measured in vitro and in vivo appeared to be negligible, probably because of degradation of the low molecular weight PEI and HP-β-CD in the cytosol. Flow cytometry and confocal microscopy confirmed that the FA receptor-mediated endocytosis of the FA-HP-β-CD-PEI/siRNA complexes was greater than that of the HP-β-CD-PEI/siRNA complexes in FA receptor-enriched HeLa cells. The FA-HP-β-CD-PEI/siRNA complexes also demonstrated excellent gene silencing efficiency in vitro (in the range of 90%, and reduced vascular endothelial growth factor (VEGF protein expression in the presence of 20% serum. FA-HP-β-CD-PEI/siRNA complexes administered via tail vein injection resulted in marked

Enhancement of allele discrimination by introduction of nucleotide mismatches into siRNA in allele-specific gene silencing by RNAi.

Directory of Open Access Journals (Sweden)

Yusuke Ohnishi

Full Text Available Allele-specific gene silencing by RNA interference (RNAi is therapeutically useful for specifically inhibiting the expression of disease-associated alleles without suppressing the expression of corresponding wild-type alleles. To realize such allele-specific RNAi (ASP-RNAi, the design and assessment of small interfering RNA (siRNA duplexes conferring ASP-RNAi is vital; however, it is also difficult. In a previous study, we developed an assay system to assess ASP-RNAi with mutant and wild-type reporter alleles encoding the Photinus and Renilla luciferase genes. In line with experiments using the system, we realized that it is necessary and important to enhance allele discrimination between mutant and corresponding wild-type alleles. Here, we describe the improvement of ASP-RNAi against mutant alleles carrying single nucleotide variations by introducing base substitutions into siRNA sequences, where original variations are present in the central position. Artificially mismatched siRNAs or short-hairpin RNAs (shRNAs against mutant alleles of the human Prion Protein (PRNP gene, which appear to be associated with susceptibility to prion diseases, were examined using this assessment system. The data indicates that introduction of a one-base mismatch into the siRNAs and shRNAs was able to enhance discrimination between the mutant and wild-type alleles. Interestingly, the introduced mismatches that conferred marked improvement in ASP-RNAi, appeared to be largely present in the guide siRNA elements, corresponding to the 'seed region' of microRNAs. Due to the essential role of the 'seed region' of microRNAs in their association with target RNAs, it is conceivable that disruption of the base-pairing interactions in the corresponding seed region, as well as the central position (involved in cleavage of target RNAs, of guide siRNA elements could influence allele discrimination. In addition, we also suggest that nucleotide mismatches at the 3'-ends of sense

The Role of piRNA-Mediated Epigenetic Silencing in the Population Dynamics of Transposable Elements in Drosophila melanogaster.

Directory of Open Access Journals (Sweden)

Yuh Chwen G Lee

2015-06-01

Full Text Available The piwi-interacting RNAs (piRNA are small RNAs that target selfish transposable elements (TEs in many animal genomes. Until now, piRNAs' role in TE population dynamics has only been discussed in the context of their suppression of TE transposition, which alone is not sufficient to account for the skewed frequency spectrum and stable containment of TEs. On the other hand, euchromatic TEs can be epigenetically silenced via piRNA-dependent heterochromatin formation and, similar to the widely known "Position-effect variegation", heterochromatin induced by TEs can "spread" into nearby genes. We hypothesized that the piRNA-mediated spread of heterochromatin from TEs into adjacent genes has deleterious functional effects and leads to selection against individual TEs. Unlike previously identified deleterious effects of TEs due to the physical disruption of DNA, the functional effect we investigated here is mediated through the epigenetic influences of TEs. We found that the repressive chromatin mark, H3K9me, is elevated in sequences adjacent to euchromatic TEs at multiple developmental stages in Drosophila melanogaster. Furthermore, the heterochromatic states of genes depend not only on the number of and distance from adjacent TEs, but also on the likelihood that their nearest TEs are targeted by piRNAs. These variations in chromatin status probably have functional consequences, causing genes near TEs to have lower expression. Importantly, we found stronger selection against TEs that lead to higher H3K9me enrichment of adjacent genes, demonstrating the pervasive evolutionary consequences of TE-induced epigenetic silencing. Because of the intrinsic biological mechanism of piRNA amplification, spread of TE heterochromatin could result in the theoretically required synergistic deleterious effects of TE insertions for stable containment of TE copy number. The indirect deleterious impact of piRNA-mediated epigenetic silencing of TEs is a previously

Autoantigen La promotes efficient RNAi, antiviral response, and transposon silencing by facilitating multiple-turnover RISC catalysis.

Science.gov (United States)

Liu, Ying; Tan, Huiling; Tian, Hui; Liang, Chunyang; Chen, She; Liu, Qinghua

2011-11-04

The effector of RNA interference (RNAi) is the RNA-induced silencing complex (RISC). C3PO promotes the activation of RISC by degrading the Argonaute2 (Ago2)-nicked passenger strand of duplex siRNA. Active RISC is a multiple-turnover enzyme that uses the guide strand of siRNA to direct the Ago2-mediated sequence-specific cleavage of complementary mRNA. How this effector step of RNAi is regulated is currently unknown. Here, we used the human Ago2 minimal RISC system to purify Sjögren's syndrome antigen B (SSB)/autoantigen La as an activator of the RISC-mediated mRNA cleavage activity. Our reconstitution studies showed that La could promote multiple-turnover RISC catalysis by facilitating the release of cleaved mRNA from RISC. Moreover, we demonstrated that La was required for efficient RNAi, antiviral defense, and transposon silencing in vivo. Taken together, the findings of C3PO and La reveal a general concept that regulatory factors are required to remove Ago2-cleaved products to assemble or restore active RISC. Copyright © 2011 Elsevier Inc. All rights reserved.

RNA Interference and its therapeutic applications

Directory of Open Access Journals (Sweden)

Srinivasa Rao T

2011-10-01

Full Text Available RNAi is a potent method, requiring only a few molecules of dsRNA per cell to silence the expression. Long molecules of double stranded RNA (dsRNA trigger the process. The dsRNA comes from virus and transposon activity in natural RNAi process, while it can be injected in the cells in experimental processes. The strand of the dsRNA that is identical in sequence to a region in target mRNA molecule is called the sense strand, and the other strand which is complimentary is termed the antisense strand. An enzyme complex called DICER thought to be similar to RNAase III then recognizes dsRNA, and cuts it into roughly 22- nucleotide long fragments. These fragments termed siRNAs for “small interfering RNAs” remain in double stranded duplexes with very short 3' overhangs. However, only one of the two strands, known as the guide strand or antisense strand binds the argonaute protein of RNA-induced silencing complex (RISC and target the complementary mRNA resulting gene silencing. The other anti-guide strand or passenger strand is degraded as a RISC substrate during the process of RISC activation. This form of RNAi is termed as post transcriptional gene silencing (PTGS; other forms are also thought to operate at the genomic or transcriptional level in some organisms. In mammals dsRNA longer than 30 base pairs induces a nonspecific antiviral response. This so-called interferon response results in a nonspecific arrest in translation and induction of apoptosis. This cascade induces a global non-specific suppression of translation, which in turn triggers apoptosis. Interestingly, dsRNAs less than 30 nt in length do not activate the antiviral response and specifically switched off genes in human cells without initiating the acute phase response. Thus these siRNAs are suitable for gene target validation and therapeutic applications in many species, including humans. [Vet. World 2011; 4(5.000: 225-229

Expression of Cucumber mosaic virus suppressor 2b alters FWA methylation and its siRNA accumulation in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

Sadia Hamera

2016-11-01

Full Text Available The Cucumber mosaic virus (CMV suppressor 2b co-localizes with AGO4 in cytoplasmic and nuclear fractions of Arabidopsis thaliana. Biochemical fractionation of A. thaliana cellular extracts revealed that 2b and AGO4 coexist in multiple size exclusions. 2b transgenic A. thaliana exhibited an enhanced accumulation of 24nt siRNAs from flowering wageningen (FWA and other heterochromatic loci. These plants also exhibited hypo-methylation of an endogenous- as well as transgene-FWA promoter at non-CG sites. In corroboration, both transgenic 2b and CMV infection affected the regulation of transposons which mimics the ago4 phenotype. In conclusion, 2b perturbs plant defense by interfering with AGO4-regulated transcriptional gene silencing.

SmD1 Modulates the miRNA Pathway Independently of Its Pre-mRNA Splicing Function.

Directory of Open Access Journals (Sweden)

Xiao-Peng Xiong

2015-08-01

Full Text Available microRNAs (miRNAs are a class of endogenous regulatory RNAs that play a key role in myriad biological processes. Upon transcription, primary miRNA transcripts are sequentially processed by Drosha and Dicer ribonucleases into ~22-24 nt miRNAs. Subsequently, miRNAs are incorporated into the RNA-induced silencing complexes (RISCs that contain Argonaute (AGO family proteins and guide RISC to target RNAs via complementary base pairing, leading to post-transcriptional gene silencing by a combination of translation inhibition and mRNA destabilization. Select pre-mRNA splicing factors have been implicated in small RNA-mediated gene silencing pathways in fission yeast, worms, flies and mammals, but the underlying molecular mechanisms are not well understood. Here, we show that SmD1, a core component of the Drosophila small nuclear ribonucleoprotein particle (snRNP implicated in splicing, is required for miRNA biogenesis and function. SmD1 interacts with both the microprocessor component Pasha and pri-miRNAs, and is indispensable for optimal miRNA biogenesis. Depletion of SmD1 impairs the assembly and function of the miRISC without significantly affecting the expression of major canonical miRNA pathway components. Moreover, SmD1 physically and functionally associates with components of the miRISC, including AGO1 and GW182. Notably, miRNA defects resulting from SmD1 silencing can be uncoupled from defects in pre-mRNA splicing, and the miRNA and splicing machineries are physically and functionally distinct entities. Finally, photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP analysis identifies numerous SmD1-binding events across the transcriptome and reveals direct SmD1-miRNA interactions. Our study suggests that SmD1 plays a direct role in miRNA-mediated gene silencing independently of its pre-mRNA splicing activity and indicates that the dual roles of splicing factors in post-transcriptional gene regulation may be

Post-transcriptional silencing of flavonol synthase mRNA in tobacco leads to fruits with arrested seed set.

Directory of Open Access Journals (Sweden)

Monika Mahajan

Full Text Available Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi through post-transcriptional gene silencing (PTGS of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless

A Convenient In Vivo Model Using Small Interfering RNA Silencing to Rapidly Assess Skeletal Gene Function.

Directory of Open Access Journals (Sweden)

Wen Zhang

Full Text Available It is difficult to study bone in vitro because it contains various cell types that engage in cross-talk. Bone biologically links various organs, and it has thus become increasingly evident that skeletal physiology must be studied in an integrative manner in an intact animal. We developed a model using local intraosseous small interfering RNA (siRNA injection to rapidly assess the effects of a target gene on the local skeletal environment. In this model, 160-g male Sprague-Dawley rats were treated for 1-2 weeks. The left tibia received intraosseous injection of a parathyroid hormone 1 receptor (Pth1r or insulin-like growth factor 1 receptor (Igf-1r siRNA transfection complex loaded in poloxamer 407 hydrogel, and the right tibia received the same volume of control siRNA. All the tibias received an intraosseous injection of recombinant human parathyroid hormone (1-34 (rhPTH (1-34 or insulin-like growth factor-1 (IGF-1. Calcein green and alizarin red were injected 6 and 2 days before euthanasia, respectively. IGF-1R and PTH1R expression levels were detected via RT-PCR assays and immunohistochemistry. Bone mineral density (BMD, microstructure, mineral apposition rates (MARs, and strength were determined by dual-energy X-ray absorptiometry, micro-CT, histology and biomechanical tests. The RT-PCR and immunohistochemistry results revealed that IGF-1R and PTH1R expression levels were dramatically diminished in the siRNA-treated left tibias compared to the right tibias (both p<0.05. Using poloxamer 407 hydrogel as a controlled-release system prolonged the silencing effect of a single dose of siRNA; the mRNA expression levels of IGF-1R were lower at two weeks than at one week (p<0.01. The BMD, bone microstructure parameters, MAR and bone strength were significantly decreased in the left tibias compared to the right tibias (all p<0.05. This simple and convenient local intraosseous siRNA injection model achieved gene silencing with very small quantities of

Silencing of cytosolic NADP(+)-dependent isocitrate dehydrogenase by small interfering RNA enhances the sensitivity of HeLa cells toward staurosporine.

Science.gov (United States)

Lee, Su-Min; Park, Sin Young; Shin, Seoung Woo; Kil, In Sup; Yang, Eun Sun; Park, Jeen-Woo

2009-02-01

Staurosporine induces the production of reactive oxygen species, which play an important causative role in apoptotic cell death. Recently, it was demonstrated that the control of cellular redox balance and the defense against oxidative damage is one of the primary functions of cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) by supplying NADPH for antioxidant systems. The present report shows that silencing of IDPc expression in HeLa cells greatly enhances apoptosis induced by staurosporine. Transfection of HeLa cells with an IDPc small interfering RNA (siRNA) markedly decreased activity of IDPc, enhancing the susceptibility of staurosporine-induced apoptosis reflected by DNA fragmentation, cellular redox status and the modulation of apoptotic marker proteins. These results indicate that IDPc may play an important role in regulating the apoptosis induced by staurosporine and the sensitizing effect of IDPc siRNA on the apoptotic cell death of HeLa cells offers the possibility of developing a modifier of cancer chemotherapy.

Active compressor engine silencer reduces exhaust noise

International Nuclear Information System (INIS)

Denenberg, J.N.; Miller, S.K.; Jay, M.A.

1994-01-01

An active industrial silencer on a compressor engine at a Tenneco Gas station has reduced low-frequency 'rumbling' noise by 8 dB during trials while lowering backpressure about 90$. This 8 dB reduction of the piston firing frequency corresponds to a more than 80% decrease in emitted acoustic power. The silencing unit, installed on one of six engines at the station near Eden, N.Y., continues in operation. Based on the results, the manufacturer is identifying additional compressor sites for further tests. This paper reviews this project

Viral Delivery of dsRNA for Control of Insect Agricultural Pests and Vectors of Human Disease: Prospects and Challenges

Directory of Open Access Journals (Sweden)

Anna Kolliopoulou

2017-06-01

Full Text Available RNAi is applied as a new and safe method for pest control in agriculture but efficiency and specificity of delivery of dsRNA trigger remains a critical issue. Various agents have been proposed to augment dsRNA delivery, such as engineered micro-organisms and synthetic nanoparticles, but the use of viruses has received relatively little attention. Here we present a critical view of the potential of the use of recombinant viruses for efficient and specific delivery of dsRNA. First of all, it requires the availability of plasmid-based reverse genetics systems for virus production, of which an overview is presented. For RNA viruses, their application seems to be straightforward since dsRNA is produced as an intermediate molecule during viral replication, but DNA viruses also have potential through the production of RNA hairpins after transcription. However, application of recombinant virus for dsRNA delivery may not be straightforward in many cases, since viruses can encode RNAi suppressors, and virus-induced silencing effects can be determined by the properties of the encoded RNAi suppressor. An alternative is virus-like particles that retain the efficiency and specificity determinants of natural virions but have encapsidated non-replicating RNA. Finally, the use of viruses raises important safety issues which need to be addressed before application can proceed.

Transient Co-Expression of Post-Transcriptional Gene Silencing Suppressors for Increased in Planta Expression of a Recombinant Anthrax Receptor Fusion Protein

Directory of Open Access Journals (Sweden)

Kittipong Rattanaporn

2011-08-01

Full Text Available Potential epidemics of infectious diseases and the constant threat of bioterrorism demand rapid, scalable, and cost-efficient manufacturing of therapeutic proteins. Molecular farming of tobacco plants provides an alternative for the recombinant production of therapeutics. We have developed a transient production platform that uses Agrobacterium infiltration of Nicotiana benthamiana plants to express a novel anthrax receptor decoy protein (immunoadhesin, CMG2-Fc. This chimeric fusion protein, designed to protect against the deadly anthrax toxins, is composed of the von Willebrand factor A (VWA domain of human capillary morphogenesis 2 (CMG2, an effective anthrax toxin receptor, and the Fc region of human immunoglobulin G (IgG. We evaluated, in N. benthamiana intact plants and detached leaves, the expression of CMG2-Fc under the control of the constitutive CaMV 35S promoter, and the co-expression of CMG2-Fc with nine different viral suppressors of post-transcriptional gene silencing (PTGS: p1, p10, p19, p21, p24, p25, p38, 2b, and HCPro. Overall, transient CMG2-Fc expression was higher on intact plants than detached leaves. Maximum expression was observed with p1 co-expression at 3.5 days post-infiltration (DPI, with a level of 0.56 g CMG2-Fc per kg of leaf fresh weight and 1.5% of the total soluble protein, a ten-fold increase in expression when compared to absence of suppression. Co-expression with the p25 PTGS suppressor also significantly increased the CMG2-Fc expression level after just 3.5 DPI.

Transient co-expression of post-transcriptional gene silencing suppressors for increased in planta expression of a recombinant anthrax receptor fusion protein.

Science.gov (United States)

Arzola, Lucas; Chen, Junxing; Rattanaporn, Kittipong; Maclean, James M; McDonald, Karen A

2011-01-01

Potential epidemics of infectious diseases and the constant threat of bioterrorism demand rapid, scalable, and cost-efficient manufacturing of therapeutic proteins. Molecular farming of tobacco plants provides an alternative for the recombinant production of therapeutics. We have developed a transient production platform that uses Agrobacterium infiltration of Nicotiana benthamiana plants to express a novel anthrax receptor decoy protein (immunoadhesin), CMG2-Fc. This chimeric fusion protein, designed to protect against the deadly anthrax toxins, is composed of the von Willebrand factor A (VWA) domain of human capillary morphogenesis 2 (CMG2), an effective anthrax toxin receptor, and the Fc region of human immunoglobulin G (IgG). We evaluated, in N. benthamiana intact plants and detached leaves, the expression of CMG2-Fc under the control of the constitutive CaMV 35S promoter, and the co-expression of CMG2-Fc with nine different viral suppressors of post-transcriptional gene silencing (PTGS): p1, p10, p19, p21, p24, p25, p38, 2b, and HCPro. Overall, transient CMG2-Fc expression was higher on intact plants than detached leaves. Maximum expression was observed with p1 co-expression at 3.5 days post-infiltration (DPI), with a level of 0.56 g CMG2-Fc per kg of leaf fresh weight and 1.5% of the total soluble protein, a ten-fold increase in expression when compared to absence of suppression. Co-expression with the p25 PTGS suppressor also significantly increased the CMG2-Fc expression level after just 3.5 DPI.

Arsenic silences hepatic PDK4 expression through activation of histone H3K9 methylatransferase G9a

Energy Technology Data Exchange (ETDEWEB)

Zhang, Xi; Wu, Jianguo; Choiniere, Jonathan [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); Yang, Zhihong [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); Veterans Affairs Connecticut Healthcare System, West Haven, CT 06516 (United States); Huang, Yi [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang 325035 (China); Bennett, Jason [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); Wang, Li, E-mail: li.wang@uconn.edu [Department of Physiology and Neurobiology and The Institute for Systems Genomics, University of Connecticut, Storrs, CT 062696 (United States); Veterans Affairs Connecticut Healthcare System, West Haven, CT 06516 (United States); School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang 325035 (China); Department of Internal Medicine, Section of Digestive Diseases, Yale University, New Haven, CT 06520 (United States)

2016-08-01

It is well established that increased liver cancer incidence is strongly associated with epigenetic silencing of tumor suppressor genes; the latter is contributed by the environmental exposure to arsenic. Pyruvate dehydrogenase kinase 4 (PDK4) is a mitochondrial protein that regulates the TCA cycle. However, the epigenetic mechanisms mediated by arsenic to control PDK4 expression remain elusive. In the present study, we showed that histone methyltransferase G9a- and Suv39H-mediated histone H3 lysine 9 (H3K9) methylations contributed to PDK4 silencing in hepatic cells. The PDK4 expression was induced by G9a inhibitor BRD4770 (BRD) and Suv39H inhibitor Chaetocin (CHA). In contrast, arsenic exposure decreased PDK4 expression by inducing G9a and increasing H3K9 di- and tri-methylations levels (H3K9me2/3). In addition, arsenic exposure antagonizes the effect of BRD by enhancing the enrichment of H3K9me2/3 in the PKD4 promoter. Moreover, knockdown of G9a using siRNA induced PDK4 expression in HCC cells. Furthermore, arsenic decreased hepatic PDK4 expression as well as diminished the induction of PDK4 by BRD in mouse liver and hepatocytes. Overall, the results suggest that arsenic causes aberrant repressive histone modification to silence PDK4 in both HCC cells and in mouse liver. - Graphical abstract: Schematic showing arsenic-mediated epigenetic pathway that inhibits PDK4 expression. (A) BRD induces PDK4 expression by decreasing G9a protein and histone H3K9me2 and H3K9me3 levels as well as diminishing their recruitment to the PDK4 promoter. (B) Arsenic counteracts the effect of BRD by increasing histone H3K9me2 and H3K9me3 levels as well as enhancing their enrichment to the PDK4 promoter. Display Omitted - Highlights: • Histone methyltrasferase G9a inhibitor BRD induces PDK4 expression. • Arsenic decreases PDK4 expression and increases H3K9me2 and me3 levels. • Arsenic enhances H3K9me2/me3 enrichment in the PDK4 promoter. • Arsenic antagonizes the activation of

Arsenic silences hepatic PDK4 expression through activation of histone H3K9 methylatransferase G9a

International Nuclear Information System (INIS)

Zhang, Xi; Wu, Jianguo; Choiniere, Jonathan; Yang, Zhihong; Huang, Yi; Bennett, Jason; Wang, Li

2016-01-01

It is well established that increased liver cancer incidence is strongly associated with epigenetic silencing of tumor suppressor genes; the latter is contributed by the environmental exposure to arsenic. Pyruvate dehydrogenase kinase 4 (PDK4) is a mitochondrial protein that regulates the TCA cycle. However, the epigenetic mechanisms mediated by arsenic to control PDK4 expression remain elusive. In the present study, we showed that histone methyltransferase G9a- and Suv39H-mediated histone H3 lysine 9 (H3K9) methylations contributed to PDK4 silencing in hepatic cells. The PDK4 expression was induced by G9a inhibitor BRD4770 (BRD) and Suv39H inhibitor Chaetocin (CHA). In contrast, arsenic exposure decreased PDK4 expression by inducing G9a and increasing H3K9 di- and tri-methylations levels (H3K9me2/3). In addition, arsenic exposure antagonizes the effect of BRD by enhancing the enrichment of H3K9me2/3 in the PKD4 promoter. Moreover, knockdown of G9a using siRNA induced PDK4 expression in HCC cells. Furthermore, arsenic decreased hepatic PDK4 expression as well as diminished the induction of PDK4 by BRD in mouse liver and hepatocytes. Overall, the results suggest that arsenic causes aberrant repressive histone modification to silence PDK4 in both HCC cells and in mouse liver. - Graphical abstract: Schematic showing arsenic-mediated epigenetic pathway that inhibits PDK4 expression. (A) BRD induces PDK4 expression by decreasing G9a protein and histone H3K9me2 and H3K9me3 levels as well as diminishing their recruitment to the PDK4 promoter. (B) Arsenic counteracts the effect of BRD by increasing histone H3K9me2 and H3K9me3 levels as well as enhancing their enrichment to the PDK4 promoter. Display Omitted - Highlights: • Histone methyltrasferase G9a inhibitor BRD induces PDK4 expression. • Arsenic decreases PDK4 expression and increases H3K9me2 and me3 levels. • Arsenic enhances H3K9me2/me3 enrichment in the PDK4 promoter. • Arsenic antagonizes the activation of

Methylation and silencing of the retinoic acid receptor-β2 gene in cervical cancer

International Nuclear Information System (INIS)

Ivanova, Tatyana; Petrenko, Anatolii; Gritsko, Tatyana; Vinokourova, Svetlana; Eshilev, Ernest; Kobzeva, Vera; Kisseljov, Fjodor; Kisseljova, Natalia

2002-01-01

Expression of the retinoic acid receptor β2 (RAR-β2), a putative tumor suppressor gene, is reduced in various human cancers, including squamous cell carcinomas (SCC) of the uterine cervix. The mechanism of the inhibition of RAR-β2 expression remains obscure. We examined whether methylation of RAR-β2 gene could be responsible for this silencing in cervical SCC. Expression of RAR-β2 mRNA and methylation status of the 5' region of RAR-β2 gene were examined in 20 matched specimens from patients with cervical SCC and in three cervical cancer cell lines by Northern blot analysis and methylation-specific PCR (MSP) assay or Southern blot analysis respectively. In 8 out 20 cervical SCC (40%) the levels of RAR-β2 mRNA were decreased or undetectable in comparison with non-neoplastic cervix tissues. All 8 tumors with reduced levels of RAR-β2 mRNA expression showed methylation of the promoter and the first exon expressed in the RAR-β2 transcript. The RAR-β2 gene from non-neoplastic cervical tissues was mostly unmethylated and expressed, but methylated alleles of the gene were found in three samples of the morphologically normal tissues adjacent to the tumors. Three cervical cancer cell lines with extremely low level of RAR-β2 mRNA expression, SiHA, HeLA and CaSki, also showed methylation of this region of the RAR-β2 gene. These findings suggest that methylation of the 5' region of RAR-β2 gene may contribute to gene silencing and that methylation of this region may be an important and early event in cervical carcinogenesis. These findings may be useful to make retinoids more effective as preventive and therapeutic agents in combination with inhibitors of DNA methylation

Ataxia-telangiectasia mutated (ATM) silencing promotes neuroblastoma progression through a MYCN independent mechanism

Science.gov (United States)

Mandriota, Stefano J.; Valentijn, Linda J.; Lesne, Laurence; Betts, David R.; Marino, Denis; Boudal-Khoshbeen, Mary; London, Wendy B.; Rougemont, Anne-Laure; Attiyeh, Edward F.; Maris, John M.; Hogarty, Michael D.; Koster, Jan; Molenaar, Jan J.; Versteeg, Rogier

2015-01-01

Neuroblastoma, a childhood cancer with highly heterogeneous biology and clinical behavior, is characterized by genomic aberrations including amplification of MYCN. Hemizygous deletion of chromosome 11q is a well-established, independent marker of poor prognosis. While 11q22-q23 is the most frequently deleted region, the neuroblastoma tumor suppressor in this region remains to be identified. Chromosome bands 11q22-q23 contain ATM, a cell cycle checkpoint kinase and tumor suppressor playing a pivotal role in the DNA damage response. Here, we report that haploinsufficiency of ATM in neuroblastoma correlates with lower ATM expression, event-free survival, and overall survival. ATM loss occurs in high stage neuroblastoma without MYCN amplification. In SK-N-SH, CLB-Ga and GI-ME-N human neuroblastoma cells, stable ATM silencing promotes neuroblastoma progression in soft agar assays, and in subcutaneous xenografts in nude mice. This effect is dependent on the extent of ATM silencing and does not appear to involve MYCN. Our findings identify ATM as a potential haploinsufficient neuroblastoma tumor suppressor, whose inactivation mirrors the increased aggressiveness associated with 11q deletion in neuroblastoma. PMID:26053094

Histone methylation-mediated silencing of miR-139 enhances invasion of non-small-cell lung cancer

International Nuclear Information System (INIS)

Watanabe, Kousuke; Amano, Yosuke; Ishikawa, Rie; Sunohara, Mitsuhiro; Kage, Hidenori; Ichinose, Junji; Sano, Atsushi; Nakajima, Jun; Fukayama, Masashi; Yatomi, Yutaka; Nagase, Takahide; Ohishi, Nobuya; Takai, Daiya

2015-01-01

MicroRNA expression is frequently altered in human cancers, and some microRNAs act as oncogenes or tumor suppressors. MiR-139-5p (denoted thereafter as miR-139) has recently been reported to function as a tumor suppressor in several types of human cancer (hepatocellular carcinoma, colorectal cancer, breast cancer, and gastric cancer), but its function in non-small-cell lung cancer (NSCLC) and the mechanism of its suppression have not been studied in detail. MiR-139 was suppressed frequently in primary NSCLCs. MiR-139 is located within the intron of PDE2A and its expression was significantly correlated with the expression of PDE2A. A chromatin immunoprecipitation assay revealed that miR-139 was epigenetically silenced by histone H3 lysine 27 trimethylation (H3K27me3) of its host gene PDE2A and this process was independent of promoter DNA methylation. Pharmacological inhibition of both histone methylation and deacetylation-induced miR-139 with its host gene PDE2A. Ectopic expression of miR-139 in lung cancer cell lines did not affect the proliferation nor the migration but significantly suppressed the invasion through the extracellular matrix. In primary NSCLCs, decreased expression of miR-139 was significantly associated with distant lymph node metastasis and histological invasiveness (lymphatic invasion and vascular invasion) on both univariate and multivariate analyses. Collectively, these results suggest that H3K27me3-mediated silencing of miR-139 enhances an invasive and metastatic phenotype of NSCLC

Antisense targeting of 3' end elements involved in DUX4 mRNA processing is an efficient therapeutic strategy for facioscapulohumeral dystrophy: a new gene-silencing approach.

Science.gov (United States)

Marsollier, Anne-Charlotte; Ciszewski, Lukasz; Mariot, Virginie; Popplewell, Linda; Voit, Thomas; Dickson, George; Dumonceaux, Julie

2016-04-15

Defects in mRNA 3'end formation have been described to alter transcription termination, transport of the mRNA from the nucleus to the cytoplasm, stability of the mRNA and translation efficiency. Therefore, inhibition of polyadenylation may lead to gene silencing. Here, we choose facioscapulohumeral dystrophy (FSHD) as a model to determine whether or not targeting key 3' end elements involved in mRNA processing using antisense oligonucleotide drugs can be used as a strategy for gene silencing within a potentially therapeutic context. FSHD is a gain-of-function disease characterized by the aberrant expression of the Double homeobox 4 (DUX4) transcription factor leading to altered pathogenic deregulation of multiple genes in muscles. Here, we demonstrate that targeting either the mRNA polyadenylation signal and/or cleavage site is an efficient strategy to down-regulate DUX4 expression and to decrease the abnormally high-pathological expression of genes downstream of DUX4. We conclude that targeting key functional 3' end elements involved in pre-mRNA to mRNA maturation with antisense drugs can lead to efficient gene silencing and is thus a potentially effective therapeutic strategy for at least FSHD. Moreover, polyadenylation is a crucial step in the maturation of almost all eukaryotic mRNAs, and thus all mRNAs are virtually eligible for this antisense-mediated knockdown strategy. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

DCL2- and RDR6-dependent transitive silencing of SMXL4 and SMXL5 in Arabidopsis dcl4 mutants causes defective phloem transport and carbohydrate over-accumulation.

Science.gov (United States)

Wu, Yu-Yi; Hou, Bo-Han; Lee, Wen-Chi; Lu, Shin-Hua; Yang, Chen-Jui; Vaucheret, Hervé; Chen, Ho-Ming

2017-06-01

DICER-LIKE (DCL) enzymes process double-stranded RNA into small RNAs that act as regulators of gene expression. Arabidopsis DCL4 and DCL2 each allow the post-transcriptional gene silencing (PTGS) of viruses and transgenes, but primary PTGS-prone DCL4 outcompetes transitive PTGS-prone DCL2 in wild-type plants. This hierarchy likely prevents DCL2 having any detrimental effects on endogenous genes. Indeed, dcl4 mutants exhibit developmental defects and increased sensitivity to genotoxic stress. In this study, the mechanism underlying dcl4 defects was investigated using genetic, biochemical and high-throughput sequencing approaches. We show that the purple phenotype of dcl4 leaves correlates with carbohydrate over-accumulation and defective phloem transport, and depends on the activity of SUPPRESSOR OF GENE SILENCING 3, RNA-DEPENDENT RNA POLYMERASE 6 (RDR6) and DCL2. This phenotype correlates with the downregulation of two genes expressed in the apex and the vasculature, SMAX1-LIKE 4 (SMXL4) and SMXL5, and the accumulation of DCL2- and RDR6-dependent small interfering RNAs derived from these two genes. Supporting a causal effect, smxl4 smxl5 double mutants exhibit leaf pigmentation, enhanced starch accumulation and defective phloem transport, similar to dcl4 plants. Overall, this study elucidates the detrimental action of DCL2 when DCL4 is absent, and indicates that DCL4 outcompeting DCL2 in wild-type plants is crucial to prevent the degradation of endogenous transcripts by DCL2- and RDR6-dependent transitive PTGS. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

The origin and effect of small RNA signaling in plants

Directory of Open Access Journals (Sweden)

Jean-Sébastien eParent

2012-08-01

Full Text Available Given their sessile condition, land plants need to integrate environmental cues rapidly and send signal throughout the organism to modify their metabolism accordingly. Small RNA (sRNA molecules are among the messengers that plant cells use to carry such signals. These molecules originate from fold-back stem-loops transcribed from endogenous loci or from perfect double-stranded RNA produced through the action of RNA-dependent RNA polymerases. Once produced, sRNAs associate with Argonaute and other proteins to form the RNA-induced silencing complex (RISC that executes silencing of complementary RNA molecules. Depending on the nature of the RNA target and the Argonaute protein involved, RISC triggers either DNA methylation and chromatin modification (leading to transcriptional gene silencing, TGS or RNA cleavage or translational inhibition (leading to post-transcriptional gene silencing, PTGS. In some cases, sRNAs move to neighboring cells and/or to the vascular tissues for long-distance trafficking. Many genes are involved in the biogenesis of sRNAs and recent studies have shown that both their origin and their protein partners have great influence on their activity and range. Here we summarize the work done to uncover the mode of action of the different classes of small RNA with special emphasis on their movement and how plants can take advantage of their mobility. We also review the various genetic requirements needed for production, movement and perception of the silencing signal.

Interactions between the HIV-1 Unspliced mRNA and Host mRNA Decay Machineries

Directory of Open Access Journals (Sweden)

Daniela Toro-Ascuy

2016-11-01

Full Text Available The human immunodeficiency virus type-1 (HIV-1 unspliced transcript is used both as mRNA for the synthesis of structural proteins and as the packaged genome. Given the presence of retained introns and instability AU-rich sequences, this viral transcript is normally retained and degraded in the nucleus of host cells unless the viral protein REV is present. As such, the stability of the HIV-1 unspliced mRNA must be particularly controlled in the nucleus and the cytoplasm in order to ensure proper levels of this viral mRNA for translation and viral particle formation. During its journey, the HIV-1 unspliced mRNA assembles into highly specific messenger ribonucleoproteins (mRNPs containing many different host proteins, amongst which are well-known regulators of cytoplasmic mRNA decay pathways such as up-frameshift suppressor 1 homolog (UPF1, Staufen double-stranded RNA binding protein 1/2 (STAU1/2, or components of miRNA-induced silencing complex (miRISC and processing bodies (PBs. More recently, the HIV-1 unspliced mRNA was shown to contain N6-methyladenosine (m6A, allowing the recruitment of YTH N6-methyladenosine RNA binding protein 2 (YTHDF2, an m6A reader host protein involved in mRNA decay. Interestingly, these host proteins involved in mRNA decay were shown to play positive roles in viral gene expression and viral particle assembly, suggesting that HIV-1 interacts with mRNA decay components to successfully accomplish viral replication. This review summarizes the state of the art in terms of the interactions between HIV-1 unspliced mRNA and components of different host mRNA decay machineries.

Small Molecule Modifiers of the microRNA and RNA Interference Pathway

OpenAIRE

Deiters, Alexander

2009-01-01

Recently, the RNA interference (RNAi) pathway has become the target of small molecule inhibitors and activators. RNAi has been well established as a research tool in the sequence-specific silencing of genes in eukaryotic cells and organisms by using exogenous, small, double-stranded RNA molecules of approximately 20 nucleotides. Moreover, a recently discovered post-transcriptional gene regulatory mechanism employs microRNAs (miRNAs), a class of endogenously expressed small RNA molecules, whic...

Epidermal growth factor receptor signaling promotes metastatic prostate cancer through microRNA-96-mediated downregulation of the tumor suppressor ETV6.

Science.gov (United States)

Tsai, Yuan-Chin; Chen, Wei-Yu; Siu, Man Kit; Tsai, Hong-Yuan; Yin, Juan Juan; Huang, Jiaoti; Liu, Yen-Nien

2017-01-01

It has been suggested that ETV6 serves as a tumor suppressor; however, its molecular regulation and cellular functions remain unclear. We used prostate cancer as a model system and demonstrated a molecular mechanism in which ETV6 can be regulated by epidermal growth factor receptor (EGFR) signaling through microRNA-96 (miR-96)-mediated downregulation. In addition, EGFR acts as a transcriptional coactivator that binds to the promoter of primary miR-96 and transcriptionally regulates miR-96 levels. We analyzed two sets of clinical prostate cancer samples, confirmed association patterns that were consistent with the EGFR-miR-96-ETV6 signaling model and demonstrated that the reduced ETV6 levels were associated with malignant prostate cancer. Based on results derived from multiple approaches, we identified the biological functions of ETV6 as a tumor suppressor that inhibits proliferation and metastasis in prostate cancer. We present a molecular mechanism in which EGFR activation leads to the induction of miR-96 expression and suppression of ETV6, which contributes to prostate cancer progression. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Layer-by-layer nanoparticles as an efficient siRNA delivery vehicle for SPARC silencing.

Science.gov (United States)

Tan, Yang Fei; Mundargi, Raghavendra C; Chen, Min Hui Averil; Lessig, Jacqueline; Neu, Björn; Venkatraman, Subbu S; Wong, Tina T

2014-05-14

Efficient and safe delivery systems for siRNA therapeutics remain a challenge. Elevated secreted protein, acidic, and rich in cysteine (SPARC) protein expression is associated with tissue scarring and fibrosis. Here we investigate the feasibility of encapsulating SPARC-siRNA in the bilayers of layer-by-layer (LbL) nanoparticles (NPs) with poly(L-arginine) (ARG) and dextran (DXS) as polyelectrolytes. Cellular binding and uptake of LbL NPs as well as siRNA delivery were studied in FibroGRO cells. siGLO-siRNA and SPARC-siRNA were efficiently coated onto hydroxyapatite nanoparticles. The multilayered NPs were characterized with regard to particle size, zeta potential and surface morphology using dynamic light scattering and transmission electron microscopy. The SPARC-gene silencing and mRNA levels were analyzed using ChemiDOC western blot technique and RT-PCR. The multilayer SPARC-siRNA incorporated nanoparticles are about 200 nm in diameter and are efficiently internalized into FibroGRO cells. Their intracellular fate was also followed by tagging with suitable reporter siRNA as well as with lysotracker dye; confocal microscopy clearly indicates endosomal escape of the particles. Significant (60%) SPARC-gene knock down was achieved by using 0.4 pmole siRNA/μg of LbL NPs in FibroGRO cells and the relative expression of SPARC mRNA reduced significantly (60%) against untreated cells. The cytotoxicity as evaluated by xCelligence real-time cell proliferation and MTT cell assay, indicated that the SPARC-siRNA-loaded LbL NPs are non-toxic. In conclusion, the LbL NP system described provides a promising, safe and efficient delivery platform as a non-viral vector for siRNA delivery that uses biopolymers to enhance the gene knock down efficiency for the development of siRNA therapeutics. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Persistent ER stress induces the spliced leader RNA silencing pathway (SLS, leading to programmed cell death in Trypanosoma brucei.

Directory of Open Access Journals (Sweden)

Hanoch Goldshmidt

2010-01-01

Full Text Available Trypanosomes are parasites that cycle between the insect host (procyclic form and mammalian host (bloodstream form. These parasites lack conventional transcription regulation, including factors that induce the unfolded protein response (UPR. However, they possess a stress response mechanism, the spliced leader RNA silencing (SLS pathway. SLS elicits shut-off of spliced leader RNA (SL RNA transcription by perturbing the binding of the transcription factor tSNAP42 to its cognate promoter, thus eliminating trans-splicing of all mRNAs. Induction of endoplasmic reticulum (ER stress in procyclic trypanosomes elicits changes in the transcriptome similar to those induced by conventional UPR found in other eukaryotes. The mechanism of up-regulation under ER stress is dependent on differential stabilization of mRNAs. The transcriptome changes are accompanied by ER dilation and elevation in the ER chaperone, BiP. Prolonged ER stress induces SLS pathway. RNAi silencing of SEC63, a factor that participates in protein translocation across the ER membrane, or SEC61, the translocation channel, also induces SLS. Silencing of these genes or prolonged ER stress led to programmed cell death (PCD, evident by exposure of phosphatidyl serine, DNA laddering, increase in reactive oxygen species (ROS production, increase in cytoplasmic Ca(2+, and decrease in mitochondrial membrane potential, as well as typical morphological changes observed by transmission electron microscopy (TEM. ER stress response is also induced in the bloodstream form and if the stress persists it leads to SLS. We propose that prolonged ER stress induces SLS, which serves as a unique death pathway, replacing the conventional caspase-mediated PCD observed in higher eukaryotes.

DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

KAUST Repository

Liu, Qian; Wang, Junguo; Miki, Daisuke; Xia, Ran; Yu, Wenxiang; He, Junna; Zheng, Zhimin; Zhu, Jian-Kang; Gonga, Zhizhong

2010-01-01

Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

KAUST Repository

Liu, Qian

2010-07-01

Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

Silencing NPAS2 promotes cell growth and invasion in DLD-1 cells and correlated with poor prognosis of colorectal cancer

International Nuclear Information System (INIS)

Xue, Xiaofeng; Liu, Fei; Han, Ye; Li, Pu; Yuan, Bin; Wang, Xu; Chen, Yan; Kuang, Yuting; Zhi, Qiaoming; Zhao, Hong

2014-01-01

Highlights: • NPAS2 mRNA was down-regulated in clinical colorectal cancer tissues. • Low NPAS2 level was associated with the tumor size, TNM stage and distance metastasis in CRC. • Silencing NPAS2 promoted cell proliferation, the wound healing and cell invasion abilities. - Abstract: Emerging evidences show that circadian rhythm disorder is an important factor of tumor initiation and development. Neuronal PAS domain protein2 (NPAS2), which is the largest circadian gene, has been proved to be a novel prognostic biomarker in breast cancer and non-Hodgkin’s lymphoma. However, the potential functions of NPAS2 in colorectal cancer are still unknown. In our present study, we detected the mRNA expressions of NPAS2 in 108 CRC patients by RT-PCR, and found that NPAS2 expression was significantly down-regulated in tumor tissues than that in NATs. Clinicopathologic analysis revealed that low expression of NPAS2 was associated with the tumor size, TNM stage and tumor distance metastasis in colorectal cancer (p < 0.05). Furthermore, we effectively down-regulated NPAS2 mRNA expression by transfecting RNA interfere fragments into DLD-1 cells, and our results in vitro demonstrated that silencing NPAS2 expression could promote cell proliferation, cell invasion and increase the wound healing ability (p < 0.05). However, down-regulating NPAS2 expression did not influence the apoptotic rate in DLD-1 cells (p > 0.05). In conclusion, our study suggested that NPAS2, functioned as a potential tumor suppressor gene, could serve as a promising target and potential prognostic indicator for colorectal cancer

Silencing NPAS2 promotes cell growth and invasion in DLD-1 cells and correlated with poor prognosis of colorectal cancer

Energy Technology Data Exchange (ETDEWEB)

Xue, Xiaofeng [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Liu, Fei [Department of Gastroenterology, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Han, Ye [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Li, Pu [Shanghai Key Laboratory of Gastric Neoplasms, Shanghai Institute of Digestive Surgery, Department of Surgery, Ruijin Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200025 (China); Yuan, Bin; Wang, Xu; Chen, Yan; Kuang, Yuting [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Zhi, Qiaoming, E-mail: strexboy@163.com [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China); Zhao, Hong, E-mail: zhaohong600@sina.com [Department of General Surgery, The First Affiliated Hospital of Soochow University, Suzhou 215006 (China)

2014-07-25

Highlights: • NPAS2 mRNA was down-regulated in clinical colorectal cancer tissues. • Low NPAS2 level was associated with the tumor size, TNM stage and distance metastasis in CRC. • Silencing NPAS2 promoted cell proliferation, the wound healing and cell invasion abilities. - Abstract: Emerging evidences show that circadian rhythm disorder is an important factor of tumor initiation and development. Neuronal PAS domain protein2 (NPAS2), which is the largest circadian gene, has been proved to be a novel prognostic biomarker in breast cancer and non-Hodgkin’s lymphoma. However, the potential functions of NPAS2 in colorectal cancer are still unknown. In our present study, we detected the mRNA expressions of NPAS2 in 108 CRC patients by RT-PCR, and found that NPAS2 expression was significantly down-regulated in tumor tissues than that in NATs. Clinicopathologic analysis revealed that low expression of NPAS2 was associated with the tumor size, TNM stage and tumor distance metastasis in colorectal cancer (p < 0.05). Furthermore, we effectively down-regulated NPAS2 mRNA expression by transfecting RNA interfere fragments into DLD-1 cells, and our results in vitro demonstrated that silencing NPAS2 expression could promote cell proliferation, cell invasion and increase the wound healing ability (p < 0.05). However, down-regulating NPAS2 expression did not influence the apoptotic rate in DLD-1 cells (p > 0.05). In conclusion, our study suggested that NPAS2, functioned as a potential tumor suppressor gene, could serve as a promising target and potential prognostic indicator for colorectal cancer.

Targeting oncomiRNAs and mimicking tumor suppressor miRNAs: New trends in the development of miRNA therapeutic strategies in oncology (Review)

Science.gov (United States)

GAMBARI, ROBERTO; BROGNARA, ELEONORA; SPANDIDOS, DEMETRIOS A.; FABBRI, ENRICA

2016-01-01

MicroRNA (miRNA or miR) therapeutics in cancer are based on targeting or mimicking miRNAs involved in cancer onset, progression, angiogenesis, epithelial-mesenchymal transition and metastasis. Several studies conclusively have demonstrated that miRNAs are deeply involved in tumor onset and progression, either behaving as tumor-promoting miRNAs (oncomiRNAs and metastamiRNAs) or as tumor suppressor miRNAs. This review focuses on the most promising examples potentially leading to the development of anticancer, miRNA-based therapeutic protocols. The inhibition of miRNA activity can be readily achieved by the use of miRNA inhibitors and oligomers, including RNA, DNA and DNA analogues (miRNA antisense therapy), small molecule inhibitors, miRNA sponges or through miRNA masking. On the contrary, the enhancement of miRNA function (miRNA replacement therapy) can be achieved by the use of modified miRNA mimetics, such as plasmid or lentiviral vectors carrying miRNA sequences. Combination strategies have been recently developed based on the observation that i) the combined administration of different antagomiR molecules induces greater antitumor effects and ii) some anti-miR molecules can sensitize drug-resistant tumor cell lines to therapeutic drugs. In this review, we discuss two additional issues: i) the combination of miRNA replacement therapy with drug administration and ii) the combination of antagomiR and miRNA replacement therapy. One of the solid results emerging from different independent studies is that miRNA replacement therapy can enhance the antitumor effects of the antitumor drugs. The second important conclusion of the reviewed studies is that the combination of anti-miRNA and miRNA replacement strategies may lead to excellent results, in terms of antitumor effects. PMID:27175518

Silencing of SARS-CoV spike gene by small interfering RNA in HEK 293T cells

International Nuclear Information System (INIS)

Qin Zhaoling; Zhao Ping; Zhang Xiaolian; Yu Jianguo; Cao Mingmei; Zhao Lanjuan; Luan Jie; Qi Zhongtian

2004-01-01

Two candidate small interfering RNAs (siRNAs) corresponding to severe acute respiratory syndrome-associated coronavirus (SARS-CoV) spike gene were designed and in vitro transcribed to explore the possibility of silencing SARS-CoV S gene. The plasmid pEGFP-optS, which contains the codon-optimized SARS-CoV S gene and expresses spike-EGFP fusion protein (S-EGFP) as silencing target and expressing reporter, was transfected with siRNAs into HEK 293T cells. At various time points of posttransfection, the levels of S-EGFP expression and amounts of spike mRNA transcript were detected by fluorescence microscopy, flow cytometry, Western blot, and real-time quantitative PCR, respectively. The results showed that the cells transfected with pEGFP-optS expressed S-EGFP fusion protein at a higher level compared with those transfected with pEGFP-S, which contains wildtype SARS-CoV spike gene sequence. The green fluorescence, mean fluorescence intensity, and SARS-CoV S RNA transcripts were found significantly reduced, and the expression of SARS-CoV S glycoprotein was strongly inhibited in those cells co-transfected with either EGFP- or S-specific siRNAs. Our findings demonstrated that the S-specific siRNAs used in this study were able to specifically and effectively inhibit SARS-CoV S glycoprotein expression in cultured cells through blocking the accumulation of S mRNA, which may provide an approach for studies on the functions of SARS-CoV S gene and development of novel prophylactic or therapeutic agents for SARS-CoV

Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

Directory of Open Access Journals (Sweden)

Yao Han

Full Text Available MIGS (miRNA-induced gene silencing is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs. MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase and PDS (phytoene desaturase gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant

Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

Science.gov (United States)

Han, Yao; Zhang, Bin; Qin, Xiaoting; Li, Mingyang; Guo, Yulong

2015-01-01

MIGS (miRNA-induced gene silencing) is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs). MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase) and PDS (phytoene desaturase) gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant functions.

Nucleases as a barrier to gene silencing in the cotton boll weevil, Anthonomus grandis.

Science.gov (United States)

Almeida Garcia, Rayssa; Lima Pepino Macedo, Leonardo; Cabral do Nascimento, Danila; Gillet, François-Xavier; Moreira-Pinto, Clidia Eduarda; Faheem, Muhammad; Moreschi Basso, Angelina Maria; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

2017-01-01

RNA interference (RNAi) approaches have been applied as a biotechnological tool for controlling plant insect pests via selective gene down regulation. However, the inefficiency of RNAi mechanism in insects is associated with several barriers, including dsRNA delivery and uptake by the cell, dsRNA interaction with the cellular membrane receptor and dsRNA exposure to insect gut nucleases during feeding. The cotton boll weevil (Anthonomus grandis) is a coleopteran in which RNAi-mediated gene silencing does not function efficiently through dsRNA feeding, and the factors involved in the mechanism remain unknown. Herein, we identified three nucleases in the cotton boll weevil transcriptome denoted AgraNuc1, AgraNuc2, and AgraNuc3, and the influences of these nucleases on the gene silencing of A. grandis chitin synthase II (AgraChSII) were evaluated through oral dsRNA feeding trials. A phylogenetic analysis showed that all three nucleases share high similarity with the DNA/RNA non-specific endonuclease family of other insects. These nucleases were found to be mainly expressed in the posterior midgut region of the insect. Two days after nuclease RNAi-mediated gene silencing, dsRNA degradation by the gut juice was substantially reduced. Notably, after nucleases gene silencing, the orally delivered dsRNA against the AgraChSII gene resulted in improved gene silencing efficiency when compared to the control (non-silenced nucleases). The data presented here demonstrates that A. grandis midgut nucleases are effectively one of the main barriers to dsRNA delivery and emphasize the need to develop novel RNAi delivery strategies focusing on protecting the dsRNA from gut nucleases and enhancing its oral delivery and uptake to crop insect pests.

Silencing of HaAce1 gene by host-delivered artificial microRNA disrupts growth and development of Helicoverpa armigera.

Science.gov (United States)

Saini, Ravi Prakash; Raman, Venkat; Dhandapani, Gurusamy; Malhotra, Era Vaidya; Sreevathsa, Rohini; Kumar, Polumetla Ananda; Sharma, Tilak R; Pattanayak, Debasis

2018-01-01

The polyphagous insect-pest, Helicoverpa armigera, is a serious threat to a number of economically important crops. Chemical application and/or cultivation of Bt transgenic crops are the two strategies available now for insect-pest management. However, environmental pollution and long-term sustainability are major concerns against these two options. RNAi is now considered as a promising technology to complement Bt to tackle insect-pests menace. In this study, we report host-delivered silencing of HaAce1 gene, encoding the predominant isoform of H. armigera acetylcholinesterase, by an artificial microRNA, HaAce1-amiR1. Arabidopsis pre-miRNA164b was modified by replacing miR164b/miR164b* sequences with HaAce1-amiR1/HaAce1-amiR1* sequences. The recombinant HaAce1-preamiRNA1 was put under the control of CaMV 35S promoter and NOS terminator of plant binary vector pBI121, and the resultant vector cassette was used for tobacco transformation. Two transgenic tobacco lines expressing HaAce1-amiR1 was used for detached leaf insect feeding bioassays. Larval mortality of 25% and adult deformity of 20% were observed in transgenic treated insect group over that control tobacco treated insect group. The reduction in the steady-state level of HaAce1 mRNA was 70-80% in the defective adults compared to control. Our results demonstrate promise for host-delivered amiRNA-mediated silencing of HaAce1 gene for H. armigera management.

Antisense gene silencing

DEFF Research Database (Denmark)

Nielsen, Troels T; Nielsen, Jørgen E

2013-01-01

Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...

Which Plant Proteins Are Involved in Antiviral Defense? Review on In Vivo and In Vitro Activities of Selected Plant Proteins against Viruses

Directory of Open Access Journals (Sweden)

Oskar Musidlak

2017-11-01

Full Text Available Plants have evolved a variety of defense mechanisms to tackle virus attack. Endogenous plant proteins can function as virus suppressors. Different types of proteins mediate defense responses against plant viruses. Pathogenesis-related (PR proteins are activated upon pathogen infections or in different stress situations and their production is one of many components in plant defense. Ribosome-inactivating proteins (RIPs suppress translation by enzymatically damaging ribosomes and they have been found to have antiviral activity. RNA-binding proteins (RBPs bind to target RNAs via specialized RNA-binding domain and can directly or indirectly function in plant defense system against RNA viruses. Proteins involved in silencing machinery, namely Dicer-like (DCL proteins, Argonaute (AGO proteins, and RNA-dependent RNA polymerases (RDRs confer innate antiviral defense in plants as they are able to degrade foreign RNA of viral origin. This review aims to provide a comprehensive and up-to-date picture of plant proteins participating in antiviral defense. As a result we discuss proteins conferring plant antiviral resistance and their potential future applications in different fields of life including agriculture and medicine.

Expression of human ARGONAUTE 2 inhibits endogenous microRNA activity in Arabidopsis

Directory of Open Access Journals (Sweden)

Ira eDeveson

2013-04-01

Full Text Available Plant and animal microRNA (miRNA pathways share many analogous components, the ARGONAUTE (AGO proteins being foremost among them. We sought to ascertain the degree of functional conservation shared by Homo sapiens ARGONAUTE 2 (HsAGO2 and Arabidopsis thaliana ARGONAUTE 1 (AtAGO1, which are the predominant AGO family members involved with miRNA activity in their respective species. Transgenic Arabidopsis plants expressing HsAGO2 were indistinguishable from counterparts over-expressing AtAGO1, each group exhibiting the morphological and molecular hallmarks of miRNA-pathway loss-of-function alleles. However, unlike AtAGO1, HsAGO2 was unable to rescue the ago1-27 allele. We conclude that, despite the evolutionary gulf between them, HsAGO2 is likely capable of interacting with some component/s of the Arabidopsis miRNA pathway, thereby perturbing its operation, although differences have arisen such that HsAGO2 alone is insufficient to confer efficient silencing of miRNA targets in planta.

Long non-coding RNA APTR promotes the activation of hepatic stellate cells and the progression of liver fibrosis

Energy Technology Data Exchange (ETDEWEB)

Yu, Fujun [Department of Gastroenterology, Jinshan Hospital of Fudan University, Jinshan, Shanghai, 201508 (China); Zheng, Jianjian [Wenzhou Key Laboratory of Surgery, The First Affiliated Hospital of Wenzhou Medical University, Wenzhou, 325000 (China); Mao, Yuqing [Department of Gastroenterology, Jinshan Hospital of Fudan University, Jinshan, Shanghai, 201508 (China); Dong, Peihong [Department of Infectious Diseases, The First Affiliated Hospital of Wenzhou Medical University, Wenzhou, 325000 (China); Li, Guojun [Department of Hepatology, Ningbo Yinzhou Second Hospital, Ningbo, 315000 (China); Lu, Zhongqiu [Department of Emergency, The First Affiliated Hospital of Wenzhou Medical University, Wenzhou, 325000 (China); Guo, Chuanyong; Liu, Zhanju [Department of Gastroenterology, Shanghai Tenth People' s Hospital, Tongji University School of Medicine, Shanghai, 200072 (China); Fan, Xiaoming, E-mail: ktsqdph@163.com [Department of Gastroenterology, Jinshan Hospital of Fudan University, Jinshan, Shanghai, 201508 (China)

2015-08-07

In this study, we aimed at assessing a role of Alu-mediated p21 transcriptional regulator (APTR) in hepatofibrogenesis. APTR was upregulated in fibrotic liver samples and activated hepatic stellate cells (HSCs). Knockdown of APTR inhibited the activation of HSCs in vitro and mitigated the accumulation of collagen in vivo. Importantly, APTR silencing could abrogate TGF-β{sub 1}-induced upregulation of α-SMA in HSCs. In addition, inhibition of cell cycle and cell proliferation by APTR knockdown was attenuated by p21 siRNA1 in primary HSCs. Finally, serum APTR levels were increased in patients with liver cirrhosis, indicating a potential biomarker for liver cirrhosis. Collectively, evidence is proposed for a new biological role of APTR in hepatofibrogenesis. - Highlights: • APTR is upregulated in fibrotic liver tissues and activated HSCs. • APTR silencing inhibits HSC activation and the progression of liver fibrosis. • Antifibrotic effect of APTR silencing is achieved by increasing p21.

Yeast Tdh3 (glyceraldehyde 3-phosphate dehydrogenase is a Sir2-interacting factor that regulates transcriptional silencing and rDNA recombination.

Directory of Open Access Journals (Sweden)

Alison E Ringel

Full Text Available Sir2 is an NAD(+-dependent histone deacetylase required to mediate transcriptional silencing and suppress rDNA recombination in budding yeast. We previously identified Tdh3, a glyceraldehyde 3-phosphate dehydrogenase (GAPDH, as a high expression suppressor of the lethality caused by Sir2 overexpression in yeast cells. Here we show that Tdh3 interacts with Sir2, localizes to silent chromatin in a Sir2-dependent manner, and promotes normal silencing at the telomere and rDNA. Characterization of specific TDH3 alleles suggests that Tdh3's influence on silencing requires nuclear localization but does not correlate with its catalytic activity. Interestingly, a genetic assay suggests that Tdh3, an NAD(+-binding protein, influences nuclear NAD(+ levels; we speculate that Tdh3 links nuclear Sir2 with NAD(+ from the cytoplasm.

Biochemical analysis of NSs from different tospoviruses

NARCIS (Netherlands)

Hedil, Marcio; Ronde, de Dryas; Kormelink, Richard

2017-01-01

Tospoviruses suppress antiviral RNA interference by coding for an RNA silencing suppressor (NSs) protein. Previously, using NSs-containing crude plant and insect cell extracts, the affinity of NSs for double-stranded (ds)RNA molecules was demonstrated by electrophoretic mobility shifts assays

Silencing of the HER2/neu Gene by siRNA Inhibits Proliferation and Induces Apoptosis in HER2/neu-Overexpressing Breast Cancer Cells

Directory of Open Access Journals (Sweden)

Timo Faltus

2004-11-01

Full Text Available In eukaryotes, double-stranded (ds RNA induces sequence-specific inhibition of gene expression referred to as RNA interference (RNAi. We exploited RNAi to define the role of HER2/neu in the neoplastic proliferation of human breast cancer cells. We transfected SK-BR-3, BT-474, MCF-7, and MDA-MB-468 breast cancer cells with short interfering RNA (siRNA targeted against human HER2/neu and analyzed the specific inhibition of HER2/neu expression by Northern and Western blots. Transfection with HER2/neu-specific siRNA resulted in a sequence-specific decrease in HER2/neu mRNA and protein levels. Moreover, transfection with HER2/neu siRNA caused cell cycle arrest at G0/G1 in the breast cancer cell lines SKBR-3 and BT-474, consistent with a powerful RNA silencing effect. siRNA treatment resulted in an antiproliferative and apoptotic response in cells overexpressing HER2/neu, but had no influence in cells with almost no expression of HER2/neu proteins like MDA-MB-468 cells. These data indicate that HER2/neu function is essential for the proliferation of HER2/neuoverexpressing breast cancer cells. Our observations suggest that siRNA targeted against human HER2/neu may be valuable tools as anti proliferative agents that display activity against neoplastic cells at very low doses.

RNAi-mediated silencing of enolase confirms its biological importance in Clonorchis sinensis.

Science.gov (United States)

Wang, Xiaoyun; Chen, Wenjun; Tian, Yanli; Huang, Yan; Li, Xuerong; Yu, Xinbing

2014-04-01

Clonorchis sinensis (C. sinensis) infection is still a common public health problem in freshwater fish consumption areas in Asian countries. More molecular evidence are required to speed up the prevention strategies to control this kind of infectious disease. In the present study, to confirm the biological importance of Csenolase followed by our previous observations of the key metabolic enzyme, we explored the RNA silence effect of the Csenolase-derived RNA interference (RNAi) in C. sinensis. The extramembranous region aa105-226 was selected as the target sequence of RNA silence. Csenolase-derived double strand RNA (dsRNA-Csenolase, 366 bp) was synthetized and delivered into C. sinensis by soaking approach. The penetration of dsRNA into adult worms and metacercariae was tracked using fluorescently labeled RNA. Western blotting and qRT-PCR experiments were performed to determine dsRNA-Csenolase-silencing effect. Our results showed that, after incubating for 120 h, dsRNA-Csenolase could effectively target and downregulate the expression of Csenolase in both adult worms (P sinensis adult worms (P sinensis, allowing further applications in identifying functional genes in C. sinensis.

The Ras effector RASSF2 is a novel tumor-suppressor gene in human colorectal cancer.

Science.gov (United States)

Akino, Kimishige; Toyota, Minoru; Suzuki, Hiromu; Mita, Hiroaki; Sasaki, Yasushi; Ohe-Toyota, Mutsumi; Issa, Jean-Pierre J; Hinoda, Yuji; Imai, Kohzoh; Tokino, Takashi

2005-07-01

Activation of Ras signaling is a hallmark of colorectal cancer (CRC), but the roles of negative regulators of Ras are not fully understood. Our aim was to address that question by surveying genetic and epigenetic alterations of Ras-Ras effector genes in CRC cells. The expression and methylation status of 6 RASSF family genes were examined using RT-PCR and bisulfite PCR in CRC cell lines and in primary CRCs and colorectal adenomas. Colony formation assays and flow cytometry were used to assess the tumor suppressor activities of RASSF1 and RASSF2. Immunofluorescence microscopy was used to determine the effect of altered RASSF2 expression on cell morphology. Mutations of K- ras , BRAF, and p53 were identified using single-strand conformation analysis and direct sequencing. Aberrant methylation and histone deacetylation of RASSF2 was associated with the gene's silencing in CRC. The activities of RASSF2, which were distinct from those of RASSF1, included induction of morphologic changes and apoptosis; moreover, its ability to prevent cell transformation suggests that RASSF2 acts as a tumor suppressor in CRC. Primary CRCs that showed K- ras /BRAF mutations also frequently showed RASSF2 methylation, and inactivation of RASSF2 enhanced K- ras -induced oncogenic transformation. RASSF2 methylation was also frequently identified in colorectal adenomas. RASSF2 is a novel tumor suppressor gene that regulates Ras signaling and plays a pivotal role in the early stages of colorectal tumorigenesis.

Gene-silencing effects of anti-survivin siRNA delivered by RGDV-functionalized nanodiamond carrier in the breast carcinoma cell line MCF-7.

Science.gov (United States)

Bi, Yanzhao; Zhang, Yifan; Cui, Chunying; Ren, Lulu; Jiang, Xueyun

Nanodiamond (ND) is a renowned material in nonviral small interfering RNA (siRNA) carrier field due to its unique physical, chemical, and biological properties. In our previous work, it was proven that ND could deliver siRNA into cells efficiently and downregulate the expression of desired protein. However, synthesizing a high-efficient tumor-targeting carrier using ND is still a challenge. In this study, a novel carrier, NDCONH(CH 2 ) 2 NH-VDGR, was synthesized for siRNA delivery, and its properties were characterized with methods including Fourier transform infrared spectrometry, transmission electron microscopy, scanning electron microscopy, gel retardation assay, differential scanning calorimetry, confocal microscopy, releasing test, real-time polymerase chain reaction (PCR) assay, enzyme-linked immunosorbent assay (ELISA), flow cytometry, cytotoxicity assay, and gene-silencing efficacy assay in vitro and in vivo. The mechanism of NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA-induced tumor apoptosis was evaluated via flow cytometer assay using Annexin V-fluorescein isothiocyanate/propidium iodide staining method. The NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA nanoparticle with 60-110 nm diameter and 35.65±3.90 mV zeta potential was prepared. For real-time PCR assay, the results showed that the expression of survivin mRNA was reduced to 46.77%±6.3%. The expression of survivin protein was downregulated to 48.49%±2.25%, as evaluated by ELISA assay. MTT assay showed that NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA had an inhibitory effect on MCF-7 cell proliferation. According to these results, the survivin-siRNA could be delivered, transported, and released stably, which benefits in increasing the gene-silencing effect. Therefore, as an siRNA carrier, NDCONH(CH 2 ) 2 NH-VDGR was suggested to be used in siRNA delivery system and in cancer treatments.

Alloantigen-specific suppressor T cells are not inhibited by cyclosporin A, but do require IL 2 for activation

International Nuclear Information System (INIS)

Bucy, R.P.

1986-01-01

Alloantigen-specific suppressor T cells are activated from normal murine spleen cells in mixed lymphocyte reactions (MLR). These T cells are radioresistant and suppress the activation of cytotoxic T lymphocytes (CTL) in second primary MLR cultures. This report demonstrates that cyclosporin A (CsA) blocks the activation of these suppressor cells at a dose of 1 microgram/ml. However, reconstitution of CsA blocked cultures with IL 2 restores the activation of the suppressor T cells, but fails to significantly restore the activation of CTL in these same cultures. This differential activation requirement was used to establish T cell lines that demonstrate enriched suppressor cell activity but depletion of CTL activity. These findings are discussed in terms of the mechanism of action of CsA in these distinct T cell subsets and the relevance to models of allograft unresponsiveness

Modulation of histone methylation and MLH1 gene silencing by hexavalent chromium

International Nuclear Information System (INIS)

Sun Hong; Zhou Xue; Chen Haobin; Li Qin; Costa, Max

2009-01-01

Hexavalent chromium [Cr(VI)] is a mutagen and carcinogen, and occupational exposure can lead to lung cancers and other adverse health effects. Genetic changes resulting from DNA damage have been proposed as an important mechanism that mediates chromate's carcinogenicity. Here we show that chromate exposure of human lung A549 cells increased global levels of di- and tri-methylated histone H3 lysine 9 (H3K9) and lysine 4 (H3K4) but decreased the levels of tri-methylated histone H3 lysine 27 (H3K27) and di-methylated histone H3 arginine 2 (H3R2). Most interestingly, H3K9 dimethylation was enriched in the human MLH1 gene promoter following chromate exposure and this was correlated with decreased MLH1 mRNA expression. Chromate exposure increased the protein as well as mRNA levels of G9a a histone methyltransferase that specifically methylates H3K9. This Cr(VI)-induced increase in G9a may account for the global elevation of H3K9 dimethylation. Furthermore, supplementation with ascorbate, the primary reductant of Cr(VI) and also an essential cofactor for the histone demethylase activity, partially reversed the H3K9 dimethylation induced by chromate. Thus our studies suggest that Cr(VI) may target histone methyltransferases and demethylases, which in turn affect both global and gene promoter specific histone methylation, leading to the silencing of specific tumor suppressor genes such as MLH1.

MicroRNA159 can act as a switch or tuning microRNA independently of its abundance in Arabidopsis.

Directory of Open Access Journals (Sweden)

Maria M Alonso-Peral

Full Text Available The efficacy of gene silencing by plant microRNAs (miRNAs is generally assumed to be predominantly determined by their abundance. In Arabidopsis the highly abundant miRNA, miR159, acts as a molecular "switch" in vegetative tissues completely silencing the expression of two GAMYB-like genes, MYB33 and MYB65. Here, we show that miR159 has a diminished silencing efficacy in the seed. Using reporter gene constructs, we determined that MIR159 and MYB33 are co-transcribed in the aleurone and embryo of germinating seeds. However in contrast to vegetative tissues, MYB33 is not completely silenced. Instead, miR159 appears to shape the spatio-temporal expression pattern of MYB33 during seed germination. Transcript profiling in a time course during seed germination in wild-type and a mir159 mutant in which miR159 is almost absent, revealed that transcript levels of the GAMYB-like genes were similar between these two genotypes during germination, but much higher in the mir159 mutant once germination had completed. This attenuation in the silencing of the GAMYB-like genes was not explained by a decrease in mature miR159 levels, which remained constant at all time points during seed germination. We propose that miR159 acts as a tuner of GAMYB-like levels in Arabidopsis germinating seeds and that the activity of this miRNA is attenuated in the seed compared to vegetative tissues. This implies that the efficacy of miRNA-mediated silencing is not solely determined by miRNA abundance and target transcript levels, but is being determined through additional mechanisms.

Systemic RNAi-mediated Gene Silencing in Nonhuman Primate and Rodent Myeloid Cells

Directory of Open Access Journals (Sweden)

Tatiana I Novobrantseva

2012-01-01

Full Text Available Leukocytes are central regulators of inflammation and the target cells of therapies for key diseases, including autoimmune, cardiovascular, and malignant disorders. Efficient in vivo delivery of small interfering RNA (siRNA to immune cells could thus enable novel treatment strategies with broad applicability. In this report, we develop systemic delivery methods of siRNA encapsulated in lipid nanoparticles (LNP for durable and potent in vivo RNA interference (RNAi-mediated silencing in myeloid cells. This work provides the first demonstration of siRNA-mediated silencing in myeloid cell types of nonhuman primates (NHPs and establishes the feasibility of targeting multiple gene targets in rodent myeloid cells. The therapeutic potential of these formulations was demonstrated using siRNA targeting tumor necrosis factor-α (TNFα which induced substantial attenuation of disease progression comparable to a potent antibody treatment in a mouse model of rheumatoid arthritis (RA. In summary, we demonstrate a broadly applicable and therapeutically relevant platform for silencing disease genes in immune cells.

Switching of dominant retrotransposon silencing strategies from posttranscriptional to transcriptional mechanisms during male germ-cell development in mice.

Directory of Open Access Journals (Sweden)

Kota Inoue

2017-07-01

Full Text Available Mammalian genomes harbor millions of retrotransposon copies, some of which are transpositionally active. In mouse prospermatogonia, PIWI-interacting small RNAs (piRNAs combat retrotransposon activity to maintain the genomic integrity. The piRNA system destroys retrotransposon-derived RNAs and guides de novo DNA methylation at some retrotransposon promoters. However, it remains unclear whether DNA methylation contributes to retrotransposon silencing in prospermatogonia. We have performed comprehensive studies of DNA methylation and polyA(+ RNAs (transcriptome in developing male germ cells from Pld6/Mitopld and Dnmt3l knockout mice, which are defective in piRNA biogenesis and de novo DNA methylation, respectively. The Dnmt3l mutation greatly reduced DNA methylation levels at most retrotransposons, but its impact on their RNA abundance was limited in prospermatogonia. In Pld6 mutant germ cells, although only a few retrotransposons exhibited reduced DNA methylation, many showed increased expression at the RNA level. More detailed analysis of RNA sequencing, nascent RNA quantification, profiling of cleaved RNA ends, and the results obtained from double knockout mice suggest that PLD6 works mainly at the posttranscriptional level. The increase in retrotransposon expression was larger in Pld6 mutants than it was in Dnmt3l mutants, suggesting that RNA degradation by the piRNA system plays a more important role than does DNA methylation in prospermatogonia. However, DNA methylation had a long-term effect: hypomethylation caused by the Pld6 or Dnmt3l mutation resulted in increased retrotransposon expression in meiotic spermatocytes. Thus, posttranscriptional silencing plays an important role in the early stage of germ cell development, then transcriptional silencing becomes important in later stages. In addition, intergenic and intronic retrotransposon sequences, in particular those containing the antisense L1 promoters, drove ectopic expression of nearby

p38 mitogen-activated protein kinase (p38MAPK) upregulates catalase levels in response to low dose H2O2 treatment through enhancement of mRNA stability.

Science.gov (United States)

Sen, Prosenjit; Chakraborty, Prabir Kumar; Raha, Sanghamitra

2005-08-15

V79 fibroblasts were repetitively stressed through multiple exposures to a low dose (30 microM) H2O2 in culture for 4 weeks. Catalase activity, protein levels and mRNA levels increased markedly (5-6-fold) during this time and these augmentations were inhibited by the simultaneous presence of SB203580, an inhibitor of p38 mitogen-activated protein kinase (p38MAPK). p38MAPK became dually phosphorylated and ATF-2, a p38MAPK substrate also became increasingly phosphorylated over the repetitive stress period. Short interfering RNA that induced effective silencing of p38MAPK, was used to silence p38MAPK in V79 fibroblasts. Silencing of p38MAPK drastically hindered the elevation in catalase (protein and mRNA) levels observed after a single low dose (50 microM) of H2O. The rise in catalase mRNA levels induced by low concentration (single and multiple dose) H2O2 treatment was established to be unconnected with transcriptional upregulation but was brought forth primarily by an enhancement in catalase mRNA stability through the action of p38MAPK. Therefore, our data strongly indicate that activation of p38MAPK is a key controlling step in the upregulation of catalase levels by low dose H2O2 treatment.

Concanavalin A-induced and spontaneous suppressor cell activities in peripheral blood lymphocytes and spleen cells from gastric cancer patients.

Science.gov (United States)

Toge, T; Hamamoto, S; Itagaki, E; Yajima, K; Tanada, M; Nakane, H; Kohno, H; Nakanishi, K; Hattori, T

1983-11-01

In 173 gastric cancer patients, activities of Concanavalin-A-induced suppressor cells (Con-AS) and spontaneous suppressor cells (SpS) in peripheral blood lymphocytes (PBL), splenic vein lymphocytes (SVL), and spleen cells (SCs) were investigated. Suppressions by Con-AS in PBL were significantly effective in patients of Stages III and IV, while suppressions by SpS were effective in patients with recurrent tumors. Thus, in PBLs of cancer patients, suppressor precursors, which are considered to be activated in vitro by Concanavalin-A, seemed to appear with the advances of the disease, and SpS activities, which could be already activated in vivo, seemed to increase in the terminal stage. In SCs, increased activities of Con-AS, but normal activities of SpS, were observed, and these suppressor-cell populations consisted of glass nonadherent cells. Suppressor activities of SCs would be due to suppressor T-cells, not to other types of cells. Furthermore, Con-AS existed in the medium-sized lymphocytes, which were fractionated on the basis of cell size, while SpS in the large-sized lymphocytes. A higher proportion of T-cells, bearing Fc receptors for IgG, was observed in the larger-sized lymphocyte fractions. Cell numbers in the large-sized lymphocyte fraction tended to increase with the advances of tumors. From these results, it is suggested that higher presence of suppressor precursors and the increase of SpS activities may occur in cancer patients, depending on the tumor advancing.

FHL2 silencing reduces Wnt signaling and osteosarcoma tumorigenesis in vitro and in vivo.

Directory of Open Access Journals (Sweden)

Julia Brun

Full Text Available BACKGROUND: The molecular mechanisms that are involved in the growth and invasiveness of osteosarcoma, an aggressive and invasive primary bone tumor, are not fully understood. The transcriptional co-factor FHL2 (four and a half LIM domains protein 2 acts as an oncoprotein or as a tumor suppressor depending on the tissue context. In this study, we investigated the role of FHL2 in tumorigenesis in osteosarcoma model. METHODOLOGY/PRINCIPAL FINDINGS: Western blot analyses showed that FHL2 is expressed above normal in most human and murine osteosarcoma cells. Tissue microarray analysis revealed that FHL2 protein expression is high in human osteosarcoma and correlates with osteosarcoma aggressiveness. In murine osteosarcoma cells, FHL2 silencing using shRNA decreased canonical Wnt/β-catenin signaling and reduced the expression of Wnt responsive genes as well as of the key Wnt molecules Wnt5a and Wnt10b. This effect resulted in inhibition of osteosarcoma cell proliferation, invasion and migration in vitro. Using xenograft experiments, we showed that FHL2 silencing markedly reduced tumor growth and lung metastasis occurence in mice. The anti-oncogenic effect of FHL2 silencing in vivo was associated with reduced cell proliferation and decreased Wnt signaling in the tumors. CONCLUSION/SIGNIFICANCE: Our findings demonstrate that FHL2 acts as an oncogene in osteosarcoma cells and contributes to tumorigenesis through Wnt signaling. More importantly, FHL2 depletion greatly reduces tumor cell growth and metastasis, which raises the potential therapeutic interest of targeting FHL2 to efficiently impact primary bone tumors.

Structural Dynamics of the GW182 Silencing Domain Including its RNA Recognition motif (RRM) Revealed by Hydrogen-Deuterium Exchange Mass Spectrometry

Science.gov (United States)

Cieplak-Rotowska, Maja K.; Tarnowski, Krzysztof; Rubin, Marcin; Fabian, Marc R.; Sonenberg, Nahum; Dadlez, Michal; Niedzwiecka, Anna

2018-01-01

The human GW182 protein plays an essential role in micro(mi)RNA-dependent gene silencing. miRNA silencing is mediated, in part, by a GW182 C-terminal region called the silencing domain, which interacts with the poly(A) binding protein and the CCR4-NOT deadenylase complex to repress protein synthesis. Structural studies of this GW182 fragment are challenging due to its predicted intrinsically disordered character, except for its RRM domain. However, detailed insights into the properties of proteins containing disordered regions can be provided by hydrogen-deuterium exchange mass spectrometry (HDX/MS). In this work, we applied HDX/MS to define the structural state of the GW182 silencing domain. HDX/MS analysis revealed that this domain is clearly divided into a natively unstructured part, including the CCR4-NOT interacting motif 1, and a distinct RRM domain. The GW182 RRM has a very dynamic structure, since water molecules can penetrate the whole domain in 2 h. The finding of this high structural dynamics sheds new light on the RRM structure. Though this domain is one of the most frequently occurring canonical protein domains in eukaryotes, these results are - to our knowledge - the first HDX/MS characteristics of an RRM. The HDX/MS studies show also that the α2 helix of the RRM can display EX1 behavior after a freezing-thawing cycle. This means that the RRM structure is sensitive to environmental conditions and can change its conformation, which suggests that the state of the RRM containing proteins should be checked by HDX/MS in regard of the conformational uniformity. [Figure not available: see fulltext.

SFRP Tumour Suppressor Genes Are Potential Plasma-Based Epigenetic Biomarkers for Malignant Pleural Mesothelioma

Directory of Open Access Journals (Sweden)

Yuen Yee Cheng

2017-01-01

Full Text Available Malignant pleural mesothelioma (MPM is associated with asbestos exposure. Asbestos can induce chronic inflammation which in turn can lead to silencing of tumour suppressor genes. Wnt signaling pathway can be affected by chronic inflammation and is aberrantly activated in many cancers including colon and MPM. SFRP genes are antagonists of Wnt pathway, and SFRPs are potential tumour suppressors in colon, gastric, breast, ovarian, and lung cancers and mesothelioma. This study investigated the expression and DNA methylation of SFRP genes in MPM cells lines with and without demethylation treatment. Sixty-six patient FFPE samples were analysed and have showed methylation of SFRP2 (56% and SFRP5 (70% in MPM. SFRP2 and SFRP5 tumour-suppressive activity in eleven MPM lines was confirmed, and long-term asbestos exposure led to reduced expression of the SFRP1 and SFRP2 genes in the mesothelium (MeT-5A via epigenetic alterations. Finally, DNA methylation of SFRPs is detectable in MPM patient plasma samples, with methylated SFRP2 and SFRP5 showing a tendency towards greater abundance in patients. These data suggested that SFRP genes have tumour-suppresive activity in MPM and that methylated DNA from SFRP gene promoters has the potential to serve as a biomarker for MPM patient plasma.

Galectin-3 mediates cross-talk between K-Ras and Let-7c tumor suppressor microRNA.

Directory of Open Access Journals (Sweden)

Ran Levy

Full Text Available BACKGROUND: Galectin-3 (Gal-3 and active (GTP-bound K-Ras contribute to the malignant phenotype of many human tumors by increasing the rate of cell proliferation, survival, and migration. These Gal-3-mediated effects result from a selective binding to K-Ras.GTP, causing increased nanoclustering in the cell membrane and leading to robust Ras signaling. Regulation of the interactions between Gal-3 and active K-Ras is not fully understood. METHODS AND FINDINGS: To gain a better understanding of what regulates the critical interactions between these two proteins, we examined the role of Gal-3 in the regulation of K-Ras by using Gal-3-knockout mouse embryonic-fibroblasts (Gal-3-/- MEFs and/or Gal-3/Gal-1 double-knockout MEFs. We found that knockout of Gal-3 induced strong downregulation (∼60% of K-Ras and K-Ras.GTP. The downregulation was somewhat more marked in the double-knockout MEFs, in which we also detected robust inhibition(∼50% of ERK and Akt activation. These additional effects are probably attributable to inhibition of the weak interactions of K-Ras.GTP with Gal-1. Re-expression of Gal-3 reversed the phenotype of the Gal-3-/- MEFs and dramatically reduced the disappearance of K-Ras in the presence of cycloheximide to the levels seen in wild-type MEFs. Furthermore, phosphorylation of Gal-3 by casein kinase-1 (CK-1 induced translocation of Gal-3 from the nucleus to the cytoplasm and the plasma membrane, leading to K-Ras stabilization accompanied by downregulation of the tumor suppressor miRNA let-7c, known to negatively control K-Ras transcription. CONCLUSIONS: Our results suggest a novel cross-talk between Gal-3-mediated downregulation of let 7c microRNA (which in turn negatively regulates K-Ras transcription and elucidates the association among Gal-3 let-7c and K-Ras transcription/translation, cellular compartmentalization and activity.

Gene-silencing effects of anti-survivin siRNA delivered by RGDV-functionalized nanodiamond carrier in the breast carcinoma cell line MCF-7

Directory of Open Access Journals (Sweden)

Bi YZ

2016-11-01

Full Text Available Yanzhao Bi, Yifan Zhang, Chunying Cui, Lulu Ren, Xueyun Jiang School of Chemical Biology and Pharmaceutical Sciences, Capital Medical University, Beijing, People’s Republic of China Abstract: Nanodiamond (ND is a renowned material in nonviral small interfering RNA (siRNA carrier field due to its unique physical, chemical, and biological properties. In our previous work, it was proven that ND could deliver siRNA into cells efficiently and downregulate the expression of desired protein. However, synthesizing a high-efficient tumor-targeting carrier using ND is still a challenge. In this study, a novel carrier, NDCONH(CH22NH-VDGR, was synthesized for siRNA delivery, and its properties were characterized with methods including Fourier transform infrared spectrometry, transmission electron microscopy, scanning electron microscopy, gel retardation assay, differential scanning calorimetry, confocal microscopy, releasing test, real-time polymerase chain reaction (PCR assay, enzyme-linked immunosorbent assay (ELISA, flow cytometry, cytotoxicity assay, and gene-silencing efficacy assay in vitro and in vivo. The mechanism of NDCONH(CH22NH-VDGR/survivin-siRNA-induced tumor apoptosis was evaluated via flow cytometer assay using Annexin V–fluorescein isothiocyanate/propidium iodide staining method. The NDCONH(CH22NH-VDGR/survivin-siRNA nanoparticle with 60–110 nm diameter and 35.65±3.90 mV zeta potential was prepared. For real-time PCR assay, the results showed that the expression of survivin mRNA was reduced to 46.77%±6.3%. The expression of survivin protein was downregulated to 48.49%±2.25%, as evaluated by ELISA assay. MTT assay showed that NDCONH(CH22NH-VDGR/survivin-siRNA had an inhibitory effect on MCF-7 cell proliferation. According to these results, the survivin-siRNA could be delivered, transported, and released stably, which benefits in increasing the gene-silencing effect. Therefore, as an siRNA carrier, NDCONH(CH22NH-VDGR was suggested

Presence of activating KRAS mutations correlates significantly with expression of tumour suppressor genes DCN and TPM1 in colorectal cancer

Directory of Open Access Journals (Sweden)

Rems Miran

2009-08-01

Full Text Available Abstract Background Despite identification of the major genes and pathways involved in the development of colorectal cancer (CRC, it has become obvious that several steps in these pathways might be bypassed by other as yet unknown genetic events that lead towards CRC. Therefore we wanted to improve our understanding of the genetic mechanisms of CRC development. Methods We used microarrays to identify novel genes involved in the development of CRC. Real time PCR was used for mRNA expression as well as to search for chromosomal abnormalities within candidate genes. The correlation between the expression obtained by real time PCR and the presence of the KRAS mutation was investigated. Results We detected significant previously undescribed underexpression in CRC for genes SLC26A3, TPM1 and DCN, with a suggested tumour suppressor role. We also describe the correlation between TPM1 and DCN expression and the presence of KRAS mutations in CRC. When searching for chromosomal abnormalities, we found deletion of the TPM1 gene in one case of CRC, but no deletions of DCN and SLC26A3 were found. Conclusion Our study provides further evidence of decreased mRNA expression of three important tumour suppressor genes in cases of CRC, thus implicating them in the development of this type of cancer. Moreover, we found underexpression of the TPM1 gene in a case of CRCs without KRAS mutations, showing that TPM1 might serve as an alternative path of development of CRC. This downregulation could in some cases be mediated by deletion of the TPM1 gene. On the other hand, the correlation of DCN underexpression with the presence of KRAS mutations suggests that DCN expression is affected by the presence of activating KRAS mutations, lowering the amount of the important tumour suppressor protein decorin.

Silencing of the PiAvr3a effector-encoding gene from Phytophthora infestans by transcriptional fusion to a short interspersed element.

Science.gov (United States)

Vetukuri, Ramesh R; Tian, Zhendong; Avrova, Anna O; Savenkov, Eugene I; Dixelius, Christina; Whisson, Stephen C

2011-12-01

Phytophthora infestans is the notorious oomycete causing late blight of potato and tomato. A large proportion of the P. infestans genome is composed of transposable elements, the activity of which may be controlled by RNA silencing. Accumulation of small RNAs is one of the hallmarks of RNA silencing. Here we demonstrate the presence of small RNAs corresponding to the sequence of a short interspersed retrotransposable element (SINE) suggesting that small RNAs might be involved in silencing of SINEs in P. infestans. This notion was exploited to develop novel tools for gene silencing in P. infestans by engineering transcriptional fusions of the PiAvr3a gene, encoding an RXLR avirulence effector, to the infSINEm retroelement. Transgenic P. infestans lines expressing either 5'-infSINEm::PiAvr3a-3' or 5'-PiAvr3a::SINEm-3' chimeric transcripts initially exhibited partial silencing of PiAvr3a. Over time, PiAvr3a either recovered wild type transcript levels in some lines, or became fully silenced in others. Introduction of an inverted repeat construct was also successful in yielding P. infestans transgenic lines silenced for PiAvr3a. In contrast, constructs expressing antisense or aberrant RNA transcripts failed to initiate silencing of PiAvr3a. Lines exhibiting the most effective silencing of PiAvr3a were either weakly or non-pathogenic on susceptible potato cv. Bintje. This study expands the repertoire of reverse genetics tools available for P. infestans research, and provides insights into a possible mode of variation in effector expression through spread of silencing from adjacent retroelements. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

The silence of MUC2 mRNA induced by promoter hypermethylation associated with HBV in Hepatocellular Carcinoma

Directory of Open Access Journals (Sweden)

Ling Yang

2013-01-01

Full Text Available Abstract Background To evaluate the promoter methylation status of MUC2 gene and mRNA expression in patients with hepatocellular carcinoma. Methods We analyzed MUC2 methylation by MSP, and MUC2 mRNA by real-time PCR in 74 HCC. Results MUC2 mRNA were lower in HCC tissues (Mean -ΔCt = −4.70 than that in Non-HCC tissues (Mean -ΔCt = −2.98. Expression of MUC2 was elevated in only 23 (31.08% of the 74 HCC patients. MUC2 promoter was hypermethylated in 62.2% (46/74 of HCCs, and in only 18.9% (14/74 of non-tumor samples. MUC2 mRNA were lower in HCC patients with hypermethylation (Mean -ΔΔCt = −2.25 than those with demethylation (Mean -ΔΔCt = −0.22, and there is a decreased tendency for MUC2 mRNA in HCC patients with promoter hypermethylation (p = 0.011. There was a significantly correlation found between MUC2 mRNA and HBV and AFP in HCC. The loss of MUC2 mRNA and hypermethylation could be poor prognostic factors. After treated by 5-Aza-CdR and TSA, we found that MUC2 mRNA induced significantly in 7721, Huh7 and HepG2 cells. Conclusion The results suggested that MUC2 mRNA silenced by promoter hypermethylation is associated with high levels HBV in HCC.

Illuminating the gateway of gene silencing: perspective of RNA interference technology in clinical therapeutics.

Science.gov (United States)

Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok

2012-07-01

A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.

Anti-proliferative and pro-apoptotic activity of whole extract and isolated indicaxanthin from Opuntia ficus-indica associated with re-activation of the onco-suppressor p16(INK4a) gene in human colorectal carcinoma (Caco-2) cells.

Science.gov (United States)

Naselli, Flores; Tesoriere, Luisa; Caradonna, Fabio; Bellavia, Daniele; Attanzio, Alessandro; Gentile, Carla; Livrea, Maria A

2014-07-18

Phytochemicals may exert chemo-preventive effects on cells of the gastro-intestinal tract by modulating epigenome-regulated gene expression. The effect of the aqueous extract from the edible fruit of Opuntia ficus-indica (OFI extract), and of its betalain pigment indicaxanthin (Ind), on proliferation of human colon cancer Caco-2 cells has been investigated. Whole extract and Ind caused a dose-dependent apoptosis of proliferating cells at nutritionally relevant amounts, with IC50 400±25 mg fresh pulp equivalents/mL, and 115±15 μM (n=9), respectively, without toxicity for post-confluent differentiated cells. Ind accounted for ∼80% of the effect of the whole extract. Ind did not cause oxidative stress in proliferating Caco-2 cells. Epigenomic activity of Ind was evident as de-methylation of the tumor suppressor p16(INK4a) gene promoter, reactivation of the silenced mRNA expression and accumulation of p16(INK4a), a major controller of cell cycle. As a consequence, decrease of hyper-phosphorylated, in favor of the hypo-phosphorylated retinoblastoma was observed, with unaltered level of the cycline-dependent kinase CDK4. Cell cycle showed arrest in the G2/M-phase. Dietary cactus pear fruit and Ind may have chemo-preventive potential in intestinal cells. Copyright © 2014 Elsevier Inc. All rights reserved.

Involvement of activation of PKR in HBx-siRNA-mediated innate immune effects on HBV inhibition.

Directory of Open Access Journals (Sweden)

Qiuju Han

Full Text Available RNA interference (RNAi of virus-specific genes offers the possibility of developing a new anti-hepatitis B virus (anti-HBV therapy. Recent studies have revealed that siRNAs can induce an innate immune response in vitro and in vivo. Here, HBVx (HBx mRNA expression and HBV replication were significantly inhibited, followed by the enhancement of expression of type I interferons (IFNs, IFN-stimulated genes (ISG15 and ISG56 and proinflammatory cytokines after HepG2.2.15 cells were transfected with chemically synthesized HBx-siRNAs. Transfection with HBx-siRNAs also significantly increased expression of dsRNA-dependent protein kinase R (PKR in HepG2.2.15 cells, followed by activation of downstream signaling events such as eukaryotic initiation factor 2α (eIF2-α. In PKR-over-expressing HepG2.2.15 cells, HBx-siRNAs exerted more potent inhibitory effects on HBV replication and greater production of type I IFNs. By contrast, the inhibitory effect of HBx-siRNAs on HBV replication was attenuated when PKR was inhibited or silenced, demonstrating that HBx-siRNAs greatly promoted PKR activation, leading to the higher production of type I IFN. Therefore, we concluded that PKR is involved in the innate immune effects mediated by HBx-siRNAs and further contributes to HBV inhibition. The bifunctional siRNAs with both gene silencing and innate immune activation properties may represent a new potential strategy for treatment of HBV.

RNA interference and retinoblastoma-related genes are required for repression of endogenous siRNA targets in Caenorhabditis elegans.

Science.gov (United States)

Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A

2008-12-23

In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans.

Delivery of chitosan/dsRNA nanoparticles for silencing of wing development vestigial (vg) gene in Aedes aegypti mosquitoes.

Science.gov (United States)

Ramesh Kumar, D; Saravana Kumar, P; Gandhi, M Rajiv; Al-Dhabi, Naif Abdullah; Paulraj, M Gabriel; Ignacimuthu, S

2016-05-01

RNA interference (RNAi) has been used as a gene silencing strategy by the introduction of long double stranded RNA (dsRNA) for the control of pest insects. The aim of the present study was to examine whether the expression of vg gene which is responsible for wing development, can be repressed by chitosan/dsRNA based nanoparticles in Aedes aegypti. The vestigial gene (vg) was amplified from adult mosquito and cloned in pLitmus28i vector. Genetically engineered recombinant plasmid was transformed into RNase III deficient strain for synthesis of bacterially expressed dsRNA. Nanoparticles were prepared via electrostatic interaction between cationic polymer chitosan and anionic nucleic acids (dsRNA). The formation of chitosan/dsRNAnanoparticles and their size were confirmed by Atomic force microscopy (AFM). Chitosan/dsRNA mediated knockdown of Enhanced Green Fluorescence Protein (EGFP) was demonstrated in Sf21 cells. Further, we tested whether such an approach could be used to target vg gene in Ae. aegypti. The results showed that chitosan/dsRNA caused significant mortality, delayed growth development and caused adult wing-malformation. A qRT-PCR analysis confirmed that the chitosan/dsRNA mediated transcriptional level was downregulated. Our findings suggest that vg gene intervention strategies through RNAi can emerge as viable option for pest control. Copyright © 2016 Elsevier B.V. All rights reserved.

Silencing of Tumor Necrosis Factor Receptor 1 by siRNA in EC109 Cells Affects Cell Proliferation and Apoptosis

Directory of Open Access Journals (Sweden)

Ma Changhui

2009-01-01

Full Text Available Tumor necrosis factor receptor 1 (TNFR1 is a membrane receptor able to bind TNF-α or TNF-β. TNFR1 can suppress apoptosis by activating the NF-κB or JNK/SAPK signal transduction pathway, or it can induce apoptosis through a series of caspase cascade reactions; the particular effect may depend on the cell line. In the present study, we first showed that TNFR1 is expressed at both the gene and protein levels in the esophageal carcinoma cell line EC109. Then, by applying a specific siRNA, we silenced the expression of TNFR1; this resulted in a significant time-dependent promotion of cell proliferation and downregulation of the apoptotic rate. These results suggest that TNFR1 is strongly expressed in the EC109 cell line and that it may play an apoptosis-mediating role, which may be suppressed by highly activated NF-κB.

Normalization of Overexpressed α-Synuclein Causing Parkinson's Disease By a Moderate Gene Silencing With RNA Interference

Directory of Open Access Journals (Sweden)

Masaki Takahashi

2015-01-01

Full Text Available The α-synuclein (SNCA gene is a responsible gene for Parkinson's disease (PD; and not only nucleotide variations but also overexpression of SNCA appears to be involved in the pathogenesis of PD. A specific inhibition against mutant SNCA genes carrying nucleotide variations may be feasible by a specific silencing such as an allele-specific RNA interference (RNAi; however, there is no method for restoring the SNCA overexpression to a normal level. Here, we show that an atypical RNAi using small interfering RNAs (siRNAs that confer a moderate level of gene silencing is capable of controlling overexpressed SNCA genes to return to a normal level; named “expression-control RNAi” (ExCont-RNAi. ExCont-RNAi exhibited little or no significant off-target effects in its treated PD patient's fibroblasts that carry SNCA triplication. To further assess the therapeutic effect of ExCont-RNAi, PD-model flies that carried the human SNCA gene underwent an ExCont-RNAi treatment. The treated PD-flies demonstrated a significant improvement in their motor function. Our current findings suggested that ExCont-RNAi might be capable of becoming a novel therapeutic procedure for PD with the SNCA overexpression, and that siRNAs conferring a moderate level of gene silencing to target genes, which have been abandoned as useless siRNAs so far, might be available for controlling abnormally expressed disease-causing genes without producing adverse effects.

Study of RNA interference inhibiting rat ovarian androgen biosynthesis by depressing 17alpha-hydroxylase/17, 20-lyase activity in vivo

Directory of Open Access Journals (Sweden)

Yang Xing

2009-07-01

Full Text Available Abstract Background 17alpha-hydroxylase/17, 20-lyase encoded by CYP17 is the key enzyme in androgen biosynthesis pathway. Previous studies demonstrated the accentuation of the enzyme in patients with polycystic ovary syndrome (PCOS was the most important mechanism of androgen excess. We chose CYP17 as the therapeutic target, trying to suppress the activity of 17alpha-hydroxylase/17, 20-lyase and inhibit androgen biosynthesis by silencing the expression of CYP17 in the rat ovary. Methods Three CYP17-targeting and one negative control oligonucleotides were designed and used in the present study. The silence efficiency of lentivirus shRNA was assessed by qRT-PCR, Western blotting and hormone assay. After subcapsular injection of lentivirus shRNA in rat ovary, the delivery efficiency was evaluated by GFP fluorescence and qPCR. Total RNA was extracted from rat ovary for CYP17 mRNA determination and rat serum was collected for hormone measurement. Results In total, three CYP17-targeting lentivirus shRNAs were synthesized. The results showed that all of them had a silencing effect on CYP17 mRNA and protein. Moreover, androstenedione secreted by rat theca interstitial cells (TIC in the RNAi group declined significantly compared with that in the control group. Two weeks after rat ovarian subcapsular injection of chosen CYP17 shRNA, the GFP fluorescence of frozen ovarian sections could be seen clearly under fluorescence microscope. It also showed that the GFP DNA level increased significantly, and its relative expression level was 7.42 times higher than that in the control group. Simultaneously, shRNA treatment significantly decreased CYP17 mRNA and protein levels at 61% and 54%, respectively. Hormone assay showed that all the levels of androstenedione, 17-hydroxyprogesterone and testosterone declined to a certain degree, but progesterone levels declined significantly. Conclusion The present study proves for the first time that ovarian androgen

Confirming the RNAi-mediated mechanism of action of siRNA-based cancer therapeutics in mice.

Science.gov (United States)

Judge, Adam D; Robbins, Marjorie; Tavakoli, Iran; Levi, Jasna; Hu, Lina; Fronda, Anna; Ambegia, Ellen; McClintock, Kevin; MacLachlan, Ian

2009-03-01

siRNAs that specifically silence the expression of cancer-related genes offer a therapeutic approach in oncology. However, it remains critical to determine the true mechanism of their therapeutic effects. Here, we describe the preclinical development of chemically modified siRNA targeting the essential cell-cycle proteins polo-like kinase 1 (PLK1) and kinesin spindle protein (KSP) in mice. siRNA formulated in stable nucleic acid lipid particles (SNALP) displayed potent antitumor efficacy in both hepatic and subcutaneous tumor models. This was correlated with target gene silencing following a single intravenous administration that was sufficient to cause extensive mitotic disruption and tumor cell apoptosis. Our siRNA formulations induced no measurable immune response, minimizing the potential for nonspecific effects. Additionally, RNAi-specific mRNA cleavage products were found in tumor cells, and their presence correlated with the duration of target mRNA silencing. Histological biomarkers confirmed that RNAi-mediated gene silencing effectively inhibited the target's biological activity. This report supports an RNAi-mediated mechanism of action for siRNA antitumor effects, suggesting a new methodology for targeting other key genes in cancer development with siRNA-based therapeutics.

Small silencing RNAs: an expanding universe.

Science.gov (United States)

Ghildiyal, Megha; Zamore, Phillip D

2009-02-01

Since the discovery in 1993 of the first small silencing RNA, a dizzying number of small RNA classes have been identified, including microRNAs (miRNAs), small interfering RNAs (siRNAs) and Piwi-interacting RNAs (piRNAs). These classes differ in their biogenesis, their modes of target regulation and in the biological pathways they regulate. There is a growing realization that, despite their differences, these distinct small RNA pathways are interconnected, and that small RNA pathways compete and collaborate as they regulate genes and protect the genome from external and internal threats.

Development of Gold Nanoparticle towards Radioenhancement Therapy, Renal Clearance, siRNA Delivery and Light-Controlled Gene Silencing

Science.gov (United States)

Wang, Jianxin

Gold nanoparticles (GNPs) have been widely studied and used in research for diagnostic, prophylactic or therapeutic purposes. However, they still face many technical challenges before they can be used to effectively address unmet biomedical needs. The theme of this dissertation is focused on addressing challenges of GNPs in clinical translation, and to improve their potential for application in radioenhancement therapy and siRNA delivery. We demonstrate the facile self-assembly of micellar gold nanocapsules using zwitterionic surfactants, with hydrodynamic diameters below 10 nm, which holds promise for good renal clearance to promote the excretion of GNPs in human body. We also prepared PEI- and PEG-coated GNPs and demonstrated their uptake into HeLa cells with exposure to soft X-rays (120 kVp), based on the consideration that the proximity of GNPs to nuclear DNA may be beneficial for enhancing low-energy ionizing radiotherapy. GNP-mediated siRNA delivery may be challenged by nonspecific siRNA desorption during circulation, which can cause off-target effects and immunogenicity. The use of gold nanorods (GNRs) for siRNA delivery also faces challenges like reduced dispersion stability during siRNA functionalization. We developed an effective way to load siRNA onto GNRs at high density, using oleylsulfobetaine (OSB) as an intermediate surfactant and dithiocarbamates (DTCs) as desorption-resistant anchors for siRNA. The GNR?siRNA complexes provided excellent control for laser-triggered gene silencing.

Double-stranded RNA uptake through topical application, mediates silencing of five CYP4 genes and suppresses insecticide resistance in Diaphorina citri.

Science.gov (United States)

Killiny, Nabil; Hajeri, Subhas; Tiwari, Siddharth; Gowda, Siddarame; Stelinski, Lukasz L

2014-01-01

Silencing of genes through RNA interference (RNAi) in insects has gained momentum during the past few years. RNAi has been used to cause insect mortality, inhibit insect growth, increase insecticide susceptibility, and prevent the development of insecticide resistance. We investigated the efficacy of topically applied dsRNA to induce RNAi for five Cytochrome P450 genes family 4 (CYP4) in Diaphorina citri. We previously reported that these CYP4 genes are associated with the development of insecticide resistance in D. citri. We targeted five CYP4 genes that share a consensus sequence with one dsRNA construct. Quantitative PCR confirmed suppressed expression of the five CYP4 genes as a result of dsRNA topically applied to the thoracic region of D. citri when compared to the expression levels in a control group. Western blot analysis indicated a reduced signal of cytochrome P450 proteins (45 kDa) in adult D. citri treated with the dsRNA. In addition, oxidase activity and insecticide resistance were reduced for D. citri treated with dsRNA that targeted specific CYP4 genes. Mortality was significantly higher in adults treated with dsRNA than in adults treated with water. Our results indicate that topically applied dsRNA can penetrate the cuticle of D. citri and induce RNAi. These results broaden the scope of RNAi as a mechanism to manage pests by targeting a broad range of genes. The results also support the application of RNAi as a viable tool to overcome insecticide resistance development in D. citri populations. However, further research is needed to develop grower-friendly delivery systems for the application of dsRNA under field conditions. Considering the high specificity of dsRNA, this tool can also be used for management of D. citri by targeting physiologically critical genes involved in growth and development.

Double-stranded RNA uptake through topical application, mediates silencing of five CYP4 genes and suppresses insecticide resistance in Diaphorina citri.

Directory of Open Access Journals (Sweden)

Nabil Killiny

Full Text Available Silencing of genes through RNA interference (RNAi in insects has gained momentum during the past few years. RNAi has been used to cause insect mortality, inhibit insect growth, increase insecticide susceptibility, and prevent the development of insecticide resistance. We investigated the efficacy of topically applied dsRNA to induce RNAi for five Cytochrome P450 genes family 4 (CYP4 in Diaphorina citri. We previously reported that these CYP4 genes are associated with the development of insecticide resistance in D. citri. We targeted five CYP4 genes that share a consensus sequence with one dsRNA construct. Quantitative PCR confirmed suppressed expression of the five CYP4 genes as a result of dsRNA topically applied to the thoracic region of D. citri when compared to the expression levels in a control group. Western blot analysis indicated a reduced signal of cytochrome P450 proteins (45 kDa in adult D. citri treated with the dsRNA. In addition, oxidase activity and insecticide resistance were reduced for D. citri treated with dsRNA that targeted specific CYP4 genes. Mortality was significantly higher in adults treated with dsRNA than in adults treated with water. Our results indicate that topically applied dsRNA can penetrate the cuticle of D. citri and induce RNAi. These results broaden the scope of RNAi as a mechanism to manage pests by targeting a broad range of genes. The results also support the application of RNAi as a viable tool to overcome insecticide resistance development in D. citri populations. However, further research is needed to develop grower-friendly delivery systems for the application of dsRNA under field conditions. Considering the high specificity of dsRNA, this tool can also be used for management of D. citri by targeting physiologically critical genes involved in growth and development.

Double-stranded RNA delivery through soaking mediates silencing of the muscle protein 20 and increases mortality to the Asian citrus psyllid, Diaphorina citri.

Science.gov (United States)

Yu, Xiudao; Gowda, Siddarame; Killiny, Nabil

2017-09-01

Asian citrus psyllid, Diaphorina citri Kuwayama, is the most important economic pest of citrus because it transmits Candidatus Liberibacter asiaticus (CLas), the causal agent of huanglongbing (HLB). Silencing genes by RNA interference (RNAi) is a promising approach for controlling D. citri. RNAi-based insect management strategies depend on the selection of suitable target genes. The muscle protein 20 gene DcMP20 was characterized from D. citri in an effort to impair proper muscle development through RNAi. Phylogenetic analysis showed that DcMP20 was more closely related to MP20 from Drosophila compared with its counterpart from other insect species. Developmental expression analysis revealed that transcription of DcMP20 was development dependent and reached a maximum level in the last instar (fourth-fifth) of the nymphal stage. The extent of RNAi in D. citri was dose dependent, with dsRNA-DcMP20 at 75 ng µL -1 being sufficient to knock down endogenous DcMP20 expression, which resulted in significant mortality and reduced body weight that positively correlated with the silencing of DcMP20. No effect was found when dsRNA-GFP or water was used, indicating the specific effect of dsRNA-DcMP20. Our results suggest that dsRNA can be delivered to D. citri through soaking, and DcMP20 is an effective RNAi target to be used in the management of D. citri. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Microbial Disruption of Autophagy Alters Expression of the RISC Component AGO2, a Critical Regulator of the miRNA Silencing Pathway.

Science.gov (United States)

Sibony, Michal; Abdullah, Majd; Greenfield, Laura; Raju, Deepa; Wu, Ted; Rodrigues, David M; Galindo-Mata, Esther; Mascarenhas, Heidi; Philpott, Dana J; Silverberg, Mark S; Jones, Nicola L

2015-12-01

Autophagy is implicated in Crohn's disease (CD) pathogenesis. Recent evidence suggests autophagy regulates the microRNA (miRNA)-induced silencing complex (miRISC). Therefore, autophagy may play a novel role in CD by regulating expression of miRISC, thereby altering miRNA silencing. As microbes associated with CD can alter autophagy, we hypothesized that microbial disruption of autophagy affects the critical miRISC component AGO2. AGO2 expression was assessed in epithelial and immune cells, and intestinal organoids with disrupted autophagy. Microarray technology was used to determine the expression of downstream miRNAs in cells with defective autophagy. Increased AGO2 was detected in autophagy-deficient ATG5-/- and ATG16-/- mouse embryonic fibroblast cells (MEFs) in comparison with wild-type MEFs. Chemical agents and VacA toxin, which disrupt autophagy, increased AGO2 expression in MEFs, epithelial cells lines, and human monocytes, respectively. Increased AGO2 was also detected in ATG7-/- intestinal organoids, in comparison with wild-type organoids. Five miRNAs were differentially expressed in autophagy-deficient MEFs. Pathway enrichment analysis of the differentially expressed miRNAs implicated signaling pathways previously associated with CD. Taken together, our results suggest that autophagy is involved in the regulation of the critical miRISC component AGO2 in epithelial and immune cells and primary intestinal epithelial cells. We propose a mechanism by which autophagy alters miRNA expression, which likely impacts the regulation of CD-associated pathways. Furthermore, as enteric microbial products can manipulate autophagy and AGO2, our findings suggest a novel mechanism by which enteric microbes could influence miRNA to promote disease.

DA-Raf, a dominant-negative antagonist of the Ras-ERK pathway, is a putative tumor suppressor.

Science.gov (United States)

Kanno, Emiri; Kawasaki, Osamu; Takahashi, Kazuya; Takano, Kazunori; Endo, Takeshi

2018-01-01

Activating mutations of RAS genes, particularly KRAS, are detected with high frequency in human tumors. Mutated Ras proteins constitutively activate the ERK pathway (Raf-MEK-ERK phosphorylation cascade), leading to cellular transformation and tumorigenesis. DA-Raf1 (DA-Raf) is a splicing variant of A-Raf and contains the Ras-binding domain (RBD) but lacks the kinase domain. Accordingly, DA-Raf antagonizes the Ras-ERK pathway in a dominant-negative fashion and suppresses constitutively activated K-Ras-induced cellular transformation. Thus, we have addressed whether DA-Raf serves as a tumor suppressor of Ras-induced tumorigenesis. DA-Raf(R52Q), which is generated from a single nucleotide polymorphism (SNP) in the RBD, and DA-Raf(R52W), a mutant detected in a lung cancer, neither bound to active K-Ras nor interfered with the activation of the ERK pathway. They were incapable of suppressing activated K-Ras-induced cellular transformation and tumorigenesis in mice, in which K-Ras-transformed cells were transplanted. Furthermore, although DA-Raf was highly expressed in lung alveolar epithelial type 2 (AE2) cells, its expression was silenced in AE2-derived lung adenocarcinoma cell lines with oncogenic KRAS mutations. These results suggest that DA-Raf represents a tumor suppressor protein against Ras-induced tumorigenesis. Copyright © 2017 Elsevier Inc. All rights reserved.

RNA Polymerase III Output Is Functionally Linked to tRNA Dimethyl-G26 Modification.

Directory of Open Access Journals (Sweden)

Aneeshkumar G Arimbasseri

2015-12-01

Full Text Available Control of the differential abundance or activity of tRNAs can be important determinants of gene regulation. RNA polymerase (RNAP III synthesizes all tRNAs in eukaryotes and it derepression is associated with cancer. Maf1 is a conserved general repressor of RNAP III under the control of the target of rapamycin (TOR that acts to integrate transcriptional output and protein synthetic demand toward metabolic economy. Studies in budding yeast have indicated that the global tRNA gene activation that occurs with derepression of RNAP III via maf1-deletion is accompanied by a paradoxical loss of tRNA-mediated nonsense suppressor activity, manifested as an antisuppression phenotype, by an unknown mechanism. We show that maf1-antisuppression also occurs in the fission yeast S. pombe amidst general activation of RNAP III. We used tRNA-HydroSeq to document that little changes occurred in the relative levels of different tRNAs in maf1Δ cells. By contrast, the efficiency of N2,N2-dimethyl G26 (m(22G26 modification on certain tRNAs was decreased in response to maf1-deletion and associated with antisuppression, and was validated by other methods. Over-expression of Trm1, which produces m(22G26, reversed maf1-antisuppression. A model that emerges is that competition by increased tRNA levels in maf1Δ cells leads to m(22G26 hypomodification due to limiting Trm1, reducing the activity of suppressor-tRNASerUCA and accounting for antisuppression. Consistent with this, we show that RNAP III mutations associated with hypomyelinating leukodystrophy decrease tRNA transcription, increase m(22G26 efficiency and reverse antisuppression. Extending this more broadly, we show that a decrease in tRNA synthesis by treatment with rapamycin leads to increased m(22G26 modification and that this response is conserved among highly divergent yeasts and human cells.

3' fragment of miR173-programmed RISC-cleaved RNA is protected from degradation in a complex with RISC and SGS3.

Science.gov (United States)

Yoshikawa, Manabu; Iki, Taichiro; Tsutsui, Yasuhiro; Miyashita, Kyoko; Poethig, R Scott; Habu, Yoshiki; Ishikawa, Masayuki

2013-03-05

trans-acting small interfering RNAs (tasiRNAs) are plant-specific endogenous siRNAs produced via a unique pathway whose first step is the microRNA (miRNA)-programmed RNA-induced silencing complex (RISC)-mediated cleavage of tasiRNA gene (TAS) transcripts. One of the products is subsequently transformed into tasiRNAs by a pathway that requires several factors including SUPPRESSOR OF GENE SILENCING3 (SGS3) and RNA-DEPENDENT RNA POLYMERASE6. Here, using in vitro assembled ARGONAUTE (AGO)1-RISCs, we show that SGS3 is recruited onto RISCs only when they bind target RNA. Following cleavage by miRNA173 (miR173)-programmed RISC, SGS3 was found in complexes containing cleaved TAS2 RNA and RISC. The 3' cleavage fragment (the source of tasiRNAs) was protected from degradation in this complex. Depletion of SGS3 did not affect TAS2 RNA cleavage by miR173-programmed RISC, but did affect the stability of the 3' cleavage fragment. When the 3' nucleotide of 22-nt miR173 was deleted or the corresponding nucleotide in TAS2 RNA was mutated, the complex was not observed and the 3' cleavage fragment was degraded. Importantly, these changes in miR173 or TAS2 RNA are known to lead to a loss of tasiRNA production in vivo. These results suggest that (i) SGS3 associates with AGO1-RISC via the double-stranded RNA formed by the 3'-terminal nucleotides of 22-nt miR173 and corresponding target RNA, which probably protrudes from the AGO1-RISC molecular surface, (ii) SGS3 protects the 3' cleavage fragment of TAS2 RNA from degradation, and (iii) the observed SGS3-dependent stabilization of the 3' fragment of TAS2 RNA is key to tasiRNA production.

Silencing of poly(ADP-ribose) glycohydrolase sensitizes lung cancer cells to radiation through the abrogation of DNA damage checkpoint

Energy Technology Data Exchange (ETDEWEB)

Nakadate, Yusuke [Shien-Lab, National Cancer Center Hospital, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan); Department of Bioengineering, Graduate School of Engineering, Osaka City University, 3-3-138 Sugimoto, Sumiyoshi-ku, Osaka 558-8585 (Japan); Kodera, Yasuo; Kitamura, Yuka [Shien-Lab, National Cancer Center Hospital, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan); Tachibana, Taro [Department of Bioengineering, Graduate School of Engineering, Osaka City University, 3-3-138 Sugimoto, Sumiyoshi-ku, Osaka 558-8585 (Japan); Tamura, Tomohide [Division of Thoracic Oncology, National Cancer Center Hospital, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan); Koizumi, Fumiaki, E-mail: fkoizumi@ncc.go.jp [Division of Thoracic Oncology, National Cancer Center Hospital, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan)

2013-11-29

Highlights: •Radiosensitization by PARG silencing was observed in multiple lung cancer cells. •PAR accumulation was enhanced by PARG silencing after DNA damage. •Radiation-induced G2/M arrest and checkpoint activation were impaired by PARG siRNA. -- Abstract: Poly(ADP-ribose) glycohydrolase (PARG) is a major enzyme that plays a role in the degradation of poly(ADP-ribose) (PAR). PARG deficiency reportedly sensitizes cells to the effects of radiation. In lung cancer, however, it has not been fully elucidated. Here, we investigated whether PARG siRNA contributes to an increased radiosensitivity using 8 lung cancer cell lines. Among them, the silencing of PARG induced a radiosensitizing effect in 5 cell lines. Radiation-induced G2/M arrest was largely suppressed by PARG siRNA in PC-14 and A427 cells, which exhibited significantly enhanced radiosensitivity in response to PARG knockdown. On the other hand, a similar effect was not observed in H520 cells, which did not exhibit a radiosensitizing effect. Consistent with a cell cycle analysis, radiation-induced checkpoint signals were not well activated in the PC-14 and A427 cells when treated with PARG siRNA. These results suggest that the increased sensitivity to radiation induced by PARG knockdown occurs through the abrogation of radiation-induced G2/M arrest and checkpoint activation in lung cancer cells. Our findings indicate that PARG could be a potential target for lung cancer treatments when used in combination with radiotherapy.

Silencing of ATM expression by siRNA technique contributes to glioma stem cell radiosensitivity in vitro and in vivo.

Science.gov (United States)

Li, Yan; Li, Luchun; Wu, Zhijuan; Wang, Lulu; Wu, Yongzhong; Li, Dairong; Ma, Uiwen; Shao, Jianghe; Yu, Huiqing; Wang, Donglin

2017-07-01

Evidence has shown that both high expression of the ataxia-telangiectasia mutated (ATM) gene and glioma stem cells (GSCs) are responsible for radioresistance in glioma. Thus, we hypothesized that brain tumor radiosensitivity may be enhanced via silencing of the ATM gene in GSCs. In the present study we successfully induced GSCs from two cell lines and used CD133 and nestin to identify GSCs. A lentivirus was used to deliver siRNA-ATMPuro (A group) to GSCs prior to radiation, while siRNA-HKPuro (N group) and GSCs (C group) were used as negative and blank controls, respectively. RT-qPCR and western blotting were performed to verify the efficiency of the siRNA-ATM technique. The expression of the ATM gene and ATM protein were significantly downregulated post-transfection. Cell Counting Kit-8 (CCK-8) and colony formation assays revealed that the A group demonstrated weak cell proliferation and lower survival fractions post-irradiation compared to the C/N groups. Flow cytometry was used to examine the percentage of cell apoptosis and G2 phase arrest, which were both higher in the A group than in the C/N groups. We found that the comet tail percentage evaluated by comet assay was higher in the A group than in the C/N groups. After radiation treatment, three radiosensitive genes [p53, proliferating cell nuclear antigen (PCNA), survivin] exhibited a decreasing tendency as determined by RT-qPCR. Mice underwent subcutaneous implantation, followed by radiation, and the resulting necrosis and hemorrhage were more obvious in the A group than in the N groups. In conclusion, silencing of ATM via the siRNA technique improved radiosensitivity of GSCs both in vitro and in vivo.

Engineering of small interfering RNA-loaded lipidoid-poly(DL-lactic-co-glycolic acid) hybrid nanoparticles for highly efficient and safe gene silencing: A quality by design-based approach.

Science.gov (United States)

Thanki, Kaushik; Zeng, Xianghui; Justesen, Sarah; Tejlmann, Sarah; Falkenberg, Emily; Van Driessche, Elize; Mørck Nielsen, Hanne; Franzyk, Henrik; Foged, Camilla

2017-11-01

Safety and efficacy of therapeutics based on RNA interference, e.g., small interfering RNA (siRNA), are dependent on the optimal engineering of the delivery technology, which is used for intracellular delivery of siRNA to the cytosol of target cells. We investigated the hypothesis that commonly used and poorly tolerated cationic lipids might be replaced with more efficacious and safe lipidoids as the lipid component of siRNA-loaded lipid-polymer hybrid nanoparticles (LPNs) for achieving more efficient gene silencing at lower and safer doses. However, formulation design of such a complex formulation is highly challenging due to a strong interplay between several contributing factors. Hence, critical formulation variables, i.e. the lipidoid content and siRNA:lipidoid ratio, were initially identified, followed by a systematic quality-by-design approach to define the optimal operating space (OOS), eventually resulting in the identification of a robust, highly efficacious and safe formulation. A 17-run design of experiment with an I-optimal approach was performed to systematically assess the effect of selected variables on critical quality attributes (CQAs), i.e. physicochemical properties (hydrodynamic size, zeta potential, siRNA encapsulation/loading) and the biological performance (in vitro gene silencing and cell viability). Model fitting of the obtained data to construct predictive models revealed non-linear relationships for all CQAs, which can be readily overlooked in one-factor-at-a-time optimization approaches. The response surface methodology further enabled the identification of an OOS that met the desired quality target product profile. The optimized lipidoid-modified LPNs revealed more than 50-fold higher in vitro gene silencing at well-tolerated doses and approx. a twofold increase in siRNA loading as compared to reference LPNs modified with the commonly used cationic lipid dioleyltrimethylammonium propane (DOTAP). Thus, lipidoid-modified LPNs show highly