Simultaneous silencing of multiple genes in the apple scab fungus, Venturia inaequalis, by expression of RNA with chimeric inverted repeats

NARCIS (Netherlands)

Fitzgerald, A.; Kan, van J.A.L.; Plummer, K.M.

2004-01-01

RNA-mediated gene silencing has been demonstrated in plants, animals, and more recently in filamentous fungi. Here, we report high frequency, RNA-mediated gene silencing in the apple scab fungus, Venturia inaequalis. The green fluorescent protein (GFP) transgene was silenced in a GFP-expressing

Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.

Science.gov (United States)

Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H

2016-06-17

In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.

Gene silencing activity of siRNA polyplexes based on thiolated N,N,N-trimethylated chitosan.

Science.gov (United States)

Varkouhi, Amir K; Verheul, Rolf J; Schiffelers, Raymond M; Lammers, Twan; Storm, Gert; Hennink, Wim E

2010-12-15

N,N,N-Trimethylated chitosan (TMC) is a biodegradable polymer emerging as a promising nonviral vector for nucleic acid and protein delivery. In the present study, we investigated whether the introduction of thiol groups in TMC enhances the extracellular stability of the complexes based on this polymer and promotes the intracellular release of siRNA. The gene silencing activity and the cellular cytotoxicity of polyplexes based on thiolated TMC were compared with those based on the nonthiolated counterpart and the regularly used lipidic transfection agent Lipofectamine. Incubation of H1299 human lung cancer cells expressing firefly luciferase with siRNA/thiolated TMC polyplexes resulted in 60-80% gene silencing activity, whereas complexes based on nonthiolated TMC showed less silencing (40%). The silencing activity of the complexes based on Lipofectamine 2000 was about 60-70%. Importantly, the TMC-SH polyplexes retained their silencing activity in the presence of hyaluronic acid, while nonthiolated TMC polyplexes hardly showed any silencing activity, demonstrating their stability against competing anionic macromolecules. Under the experimental conditions tested, the cytotoxicity of the thiolated and nonthiolated siRNA complexes was lower than those based on Lipofectamine. Given the good extracellular stability and good silencing activity, it is concluded that polyplexes based on TMC-SH are attractive systems for further in vivo evaluations.

MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense

Directory of Open Access Journals (Sweden)

Sheng-Rui Liu

2017-09-01

Full Text Available MicroRNAs (miRNAs are non-coding RNAs of approximately 20–24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant–pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense mechanism. Here, we summarize the current knowledge and recent advances in understanding the roles of miRNAs involved in the plant defense against viruses and viral counter-defense. We also document the application of miRNAs in plant antiviral defense. This review discusses the current understanding of the mechanisms of miRNA-mediated gene silencing and provides insights on the never-ending arms race between plants and viruses.

Evasion of short interfering RNA-directed antiviral silencing in Musa acuminata persistently infected with six distinct banana streak pararetroviruses.

Science.gov (United States)

Rajeswaran, Rajendran; Seguin, Jonathan; Chabannes, Matthieu; Duroy, Pierre-Olivier; Laboureau, Nathalie; Farinelli, Laurent; Iskra-Caruana, Marie-Line; Pooggin, Mikhail M

2014-10-01

Vegetatively propagated crop plants often suffer from infections with persistent RNA and DNA viruses. Such viruses appear to evade the plant defenses that normally restrict viral replication and spread. The major antiviral defense mechanism is based on RNA silencing generating viral short interfering RNAs (siRNAs) that can potentially repress viral genes posttranscriptionally through RNA cleavage and transcriptionally through DNA cytosine methylation. Here we examined the RNA silencing machinery of banana plants persistently infected with six pararetroviruses after many years of vegetative propagation. Using deep sequencing, we reconstructed consensus master genomes of the viruses and characterized virus-derived and endogenous small RNAs. Consistent with the presence of endogenous siRNAs that can potentially establish and maintain DNA methylation, the banana genomic DNA was extensively methylated in both healthy and virus-infected plants. A novel class of abundant 20-nucleotide (nt) endogenous small RNAs with 5'-terminal guanosine was identified. In all virus-infected plants, 21- to 24-nt viral siRNAs accumulated at relatively high levels (up to 22% of the total small RNA population) and covered the entire circular viral DNA genomes in both orientations. The hotspots of 21-nt and 22-nt siRNAs occurred within open reading frame (ORF) I and II and the 5' portion of ORF III, while 24-nt siRNAs were more evenly distributed along the viral genome. Despite the presence of abundant viral siRNAs of different size classes, the viral DNA was largely free of cytosine methylation. Thus, the virus is able to evade siRNA-directed DNA methylation and thereby avoid transcriptional silencing. This evasion of silencing likely contributes to the persistence of pararetroviruses in banana plants. We report that DNA pararetroviruses in Musa acuminata banana plants are able to evade DNA cytosine methylation and transcriptional gene silencing, despite being targeted by the host silencing

RNA-mediated gene silencing signals are not graft transmissible from the rootstock to the scion in greenhouse-grown apple plants Malus sp.

Science.gov (United States)

Flachowsky, Henryk; Tränkner, Conny; Szankowski, Iris; Waidmann, Sascha; Hanke, Magda-Viola; Treutter, Dieter; Fischer, Thilo C

2012-01-01

RNA silencing describes the sequence specific degradation of RNA targets. Silencing is a non-cell autonomous event that is graft transmissible in different plant species. The present study is the first report on systemic acquired dsRNA-mediated gene silencing of transgenic and endogenous gene sequences in a woody plant like apple. Transgenic apple plants overexpressing a hairpin gene construct of the gusA reporter gene were produced. These plants were used as rootstocks and grafted with scions of the gusA overexpressing transgenic apple clone T355. After grafting, we observed a reduction of the gusA gene expression in T355 scions in vitro, but not in T355 scions grown in the greenhouse. Similar results were obtained after silencing of the endogenous Mdans gene in apple that is responsible for anthocyanin biosynthesis. Subsequently, we performed grafting experiments with Mdans silenced rootstocks and red leaf scions of TNR31-35 in order to evaluate graft transmitted silencing of the endogenous Mdans. The results obtained suggested a graft transmission of silencing signals in in vitro shoots. In contrast, no graft transmission of dsRNA-mediated gene silencing signals was detectable in greenhouse-grown plants and in plants grown in an insect protection tent.

Conifers have a unique small RNA silencing signature

OpenAIRE

Dolgosheina, Elena V.; Morin, Ryan D.; Aksay, Gozde; Sahinalp, S. Cenk; Magrini, Vincent; Mardis, Elaine R.; Mattsson, Jim; Unrau, Peter J.

2008-01-01

Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an u...

RNA-mediated gene silencing in Candida albicans: inhibition of hyphae formation by use of RNAi technology.

Science.gov (United States)

Moazeni, Maryam; Khoramizadeh, Mohammad Reza; Kordbacheh, Parivash; Sepehrizadeh, Zargham; Zeraati, Hojat; Noorbakhsh, Fatemeh; Teimoori-Toolabi, Ladan; Rezaie, Sassan

2012-09-01

The introduction of RNA silencing machinery in fungi has led to the promising application of RNAi methodology to knock down essential vital factor or virulence factor genes in the microorganisms. Efg1p is required for development of a true hyphal growth form which is known to be essential for interactions with human host cells and for the yeast's pathogenesis. In this paper, we describe the development of a system for presenting and studying the RNAi function on the EFG1 gene in C. albicans. The 19-nucleotide siRNA was designed on the basis of the cDNA sequence of the EFG1 gene in C. albicans and transfection was performed by use of a modified-PEG/LiAc method. To investigate EFG1 gene silencing in siRNA-treated cells, the yeasts were grown in human serum; to induce germ tubes a solid medium was used with the serum. Quantitative changes in expression of the EFG1 gene were analyzed by measuring the cognate EFG1 mRNA level by use of a quantitative real-time RT-PCR assay. Compared with the positive control, true hyphae formation was significantly reduced by siRNA at concentrations of 1 μM, 500 nM, and 100 nM (P < 0.05). In addition, siRNA at a concentration of 1 μM was revealed to inhibit expression of the EFG1 gene effectively (P < 0.05). On the basis of the potential of post-transcriptional gene silencing to control the expression of specific genes, these techniques may be regarded as promising means of drug discovery, with applications in biomedicine and functional genomics analysis.

Antisense gene silencing

DEFF Research Database (Denmark)

Nielsen, Troels T; Nielsen, Jørgen E

2013-01-01

Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...

GW182-Free microRNA Silencing Complex Controls Post-transcriptional Gene Expression during Caenorhabditis elegans Embryogenesis.

Directory of Open Access Journals (Sweden)

Guillaume Jannot

2016-12-01

Full Text Available MicroRNAs and Argonaute form the microRNA induced silencing complex or miRISC that recruits GW182, causing mRNA degradation and/or translational repression. Despite the clear conservation and molecular significance, it is unknown if miRISC-GW182 interaction is essential for gene silencing during animal development. Using Caenorhabditis elegans to explore this question, we examined the relationship and effect on gene silencing between the GW182 orthologs, AIN-1 and AIN-2, and the microRNA-specific Argonaute, ALG-1. Homology modeling based on human Argonaute structures indicated that ALG-1 possesses conserved Tryptophan-binding Pockets required for GW182 binding. We show in vitro and in vivo that their mutations severely altered the association with AIN-1 and AIN-2. ALG-1 tryptophan-binding pockets mutant animals retained microRNA-binding and processing ability, but were deficient in reporter silencing activity. Interestingly, the ALG-1 tryptophan-binding pockets mutant phenocopied the loss of alg-1 in worms during larval stages, yet was sufficient to rescue embryonic lethality, indicating the dispensability of AINs association with the miRISC at this developmental stage. The dispensability of AINs in miRNA regulation is further demonstrated by the capacity of ALG-1 tryptophan-binding pockets mutant to regulate a target of the embryonic mir-35 microRNA family. Thus, our results demonstrate that the microRNA pathway can act independently of GW182 proteins during C. elegans embryogenesis.

siRNA-mediated Erc gene silencing suppresses tumor growth in Tsc2 mutant renal carcinoma model.

Science.gov (United States)

Imamura, Osamu; Okada, Hiroaki; Takashima, Yuuki; Zhang, Danqing; Kobayashi, Toshiyuki; Hino, Okio

2008-09-18

Silencing of gene expression by small interfering RNAs (siRNAs) is rapidly becoming a powerful tool for genetic analysis and represents a potential strategy for therapeutic product development. However, there are no reports of systemic delivery of siRNAs for stable treatment except short hairpin RNAs (shRNAs). On the other hand, there are many reports of systemic delivery of siRNAs for transient treatment using liposome carriers and others. With regard to shRNAs, a report showed fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Therefore, we decided to use original siRNA microspheres instead of shRNA for stable treatment of disease. In this study, we designed rat-specific siRNA sequences for Erc/mesothelin, which is a tumor-specific gene expressed in the Eker (Tsc2 mutant) rat model of hereditary renal cancer and confirmed the efficacy of gene silencing in vitro. Then, by using siRNA microspheres, we found that the suppression of Erc/mesothelin caused growth inhibition of Tsc2 mutant renal carcinoma cells in tumor implantation experiments in mice.

Growth inhibition of head and neck squamous cell carcinoma cells by sgRNA targeting the cyclin D1 mRNA based on TRUE gene silencing.

Directory of Open Access Journals (Sweden)

Satoshi Iizuka

Full Text Available Head and neck squamous cell carcinoma (HNSCC exhibits increased expression of cyclin D1 (CCND1. Previous studies have shown a correlation between poor prognosis of HNSCC and cyclin D1 overexpression. tRNase ZL-utilizing efficacious gene silencing (TRUE gene silencing is one of the RNA-mediated gene expression control technologies that have therapeutic potential. This technology is based on a unique enzymatic property of mammalian tRNase ZL, which is that it can cleave any target RNA at any desired site by recognizing a pre-tRNA-like complex formed between the target RNA and an artificial small guide RNA (sgRNA. In this study, we designed several sgRNAs targeting human cyclin D1 mRNA to examine growth inhibition of HNSCC cells. Transfection of certain sgRNAs decreased levels of cyclin D1 mRNA and protein in HSC-2 and HSC-3 cells, and also inhibited their proliferation. The combination of these sgRNAs and cisplatin showed more than additive inhibition of cancer cell growth. These findings demonstrate that TRUE gene silencing of cyclin D1 leads to inhibition of the growth of HNSCC cells and suggest that these sgRNAs alone or combined with cisplatin may be a useful new therapy for HNSCCs.

Effective gene silencing activity of prodrug-type 2'-O-methyldithiomethyl siRNA compared with non-prodrug-type 2'-O-methyl siRNA.

Science.gov (United States)

Hayashi, Junsuke; Nishigaki, Misa; Ochi, Yosuke; Wada, Shun-Ichi; Wada, Fumito; Nakagawa, Osamu; Obika, Satoshi; Harada-Shiba, Mariko; Urata, Hidehito

2018-07-01

Small interfering RNAs (siRNAs) are an active agent to induce gene silencing and they have been studied for becoming a biological and therapeutic tool. Various 2'-O-modified RNAs have been extensively studied to improve the nuclease resistance. However, the 2'-O-modified siRNA activities were often decreased by modification, since the bulky 2'-O-modifications inhibit to form a RNA-induced silencing complex (RISC). We developed novel prodrug-type 2'-O-methyldithiomethyl (MDTM) siRNA, which is converted into natural siRNA in an intracellular reducing environment. Prodrug-type 2'-O-MDTM siRNAs modified at the 5'-end side including 5'-end nucleotide and the seed region of the antisense strand exhibited much stronger gene silencing effect than non-prodrug-type 2'-O-methyl (2'-O-Me) siRNAs. Furthermore, the resistances for nuclease digestion of siRNAs were actually enhanced by 2'-O-MDTM modifications. Our results indicate that 2'-O-MDTM modifications improve the stability of siRNA in serum and they are able to be introduced at any positions of siRNA. Copyright © 2018 Elsevier Ltd. All rights reserved.

Efficient transformation and artificial miRNA gene silencing in Lemna minor.

Science.gov (United States)

Cantó-Pastor, A; Mollá-Morales, A; Ernst, E; Dahl, W; Zhai, J; Yan, Y; Meyers, B C; Shanklin, J; Martienssen, R

2015-01-01

Despite rapid doubling time, simple architecture and ease of metabolic labelling, a lack of genetic tools in the Lemnaceae (duckweed) has impeded the full implementation of this organism as a model for biological research. Here, we present technologies to facilitate high-throughput genetic studies in duckweed. We developed a fast and efficient method for producing Lemna minor stable transgenic fronds via Agrobacterium-mediated transformation and regeneration from tissue culture. Additionally, we engineered an artificial microRNA (amiRNA) gene silencing system. We identified a Lemna gibba endogenous miR166 precursor and used it as a backbone to produce amiRNAs. As a proof of concept we induced the silencing of CH42, a magnesium chelatase subunit, using our amiRNA platform. Expression of CH42 in transgenic L. minor fronds was significantly reduced, which resulted in reduction of chlorophyll pigmentation. The techniques presented here will enable tackling future challenges in the biology and biotechnology of Lemnaceae. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

Combination of siRNA-directed Kras oncogene silencing and arsenic-induced apoptosis using a nanomedicine strategy for the effective treatment of pancreatic cancer.

Science.gov (United States)

Zeng, Linjuan; Li, Jingguo; Wang, Yong; Qian, Chenchen; Chen, Yinting; Zhang, Qiubo; Wu, Wei; Lin, Zhong; Liang, Jianzhong; Shuai, Xintao; Huang, Kaihong

2014-02-01

The synergetic inhibitory effects on human pancreatic cancer by nanoparticle-mediated siRNA and arsenic therapy were investigated both in vitro and in vivo. Poly(ethylene glycol)-block-poly(L-lysine) were prepared to form siRNA-complexed polyplex and poly(ethylene glycol)-block-poly(DL-lactide) were prepared to form arsenic-encapsulated vesicle, respectively. Down-regulation of the mutant Kras gene by siRNA caused defective abilities of proliferation, clonal formation, migration, and invasion of pancreatic cancer cells, as well as cell cycle arrest at the G0/G1 phase, which substantially enhanced the apoptosis-inducing effect of arsenic administration. Consequently, co-administration of the two nanomedicines encapsulating siRNA or arsenic showed ideal tumor growth inhibition both in vitro and in vivo as a result of synergistic effect of the siRNA-directed Kras oncogene silencing and arsenic-induced cell apoptosis. These results suggest that the combination of mutant Kras gene silencing and arsenic therapy using nanoparticle-mediated delivery strategy is promising for pancreatic cancer treatment. Treatment of pancreatic cancer remains a major challenge. These authors demonstrate a method that combines a siRNA-based Kras silencing with arsenic delivery to pancreatic cancer cells using nanoparticles, resulting in enhanced apoptosis induction in the treated cells. © 2013.

MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts

Science.gov (United States)

Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng

2014-01-01

Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645

MicroRNA-mediated myostatin silencing in caprine fetal fibroblasts.

Directory of Open Access Journals (Sweden)

Bushuai Zhong

Full Text Available Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi mediated by microRNAs (miRNAs is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN response genes, such as interferon beta (IFN-β and 2'-5'-oligoadenylate synthetase 2 (OAS2, were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats.

The dynamics and efficacy of antiviral RNA silencing: A model study

Directory of Open Access Journals (Sweden)

Hogeweg Paulien

2008-03-01

Full Text Available Abstract Background Mathematical modeling is important to provide insight in the complicated pathway of RNA silencing. RNA silencing is an RNA based mechanism that is widely used by eukaryotes to fight viruses, and to control gene expression. Results We here present the first mathematical model that combines viral growth with RNA silencing. The model involves a plus-strand RNA virus that replicates through a double-strand RNA intermediate. The model of the RNA silencing pathway consists of cleavage of viral RNA into siRNA by Dicer, target cleavage of viral RNA via the RISC complex, and a secondary response. We found that, depending on the strength of the silencing response, different viral growth patterns can occur. Silencing can decrease viral growth, cause oscillations, or clear the virus completely. Our model can explain various observed phenomena, even when they seem contradictory at first: the diverse responses to the removal of RNA dependent RNA polymerase; different viral growth curves; and the great diversity in observed siRNA ratios. Conclusion The model presented here is an important step in the understanding of the natural functioning of RNA silencing in viral infections.

Targeted transfection increases siRNA uptake and gene silencing of primary endothelial cells in vitro--a quantitative study.

Science.gov (United States)

Asgeirsdóttir, Sigridur A; Talman, Eduard G; de Graaf, Inge A; Kamps, Jan A A M; Satchell, Simon C; Mathieson, Peter W; Ruiters, Marcel H J; Molema, Grietje

2010-01-25

Applications of small-interfering RNA (siRNA) call for specific and efficient delivery of siRNA into particular cell types. We developed a novel, non-viral targeting system to deliver siRNA specifically into inflammation-activated endothelial cells. This was achieved by conjugating the cationic amphiphilic lipid SAINT to antibodies recognizing the inflammatory cell adhesion molecule E-selectin. These anti-E-selectin-SAINT lipoplexes (SAINTarg) maintained antigen recognition capacity of the parental antibody in vitro, and ex vivo in human kidney tissue slices subjected to inflammatory conditions. Regular SAINT mediated transfection resulted in efficient gene silencing in human microvascular endothelial cells (HMEC-1) and conditionally immortalized glomerular endothelial cells (ciGEnC). However, primary human umbilical vein endothelial cells (HUVEC) transfected poorly, a phenomenon that we could quantitatively correlate with a cell-type specific capacity to facilitate siRNA uptake. Importantly, SAINTarg increased siRNA uptake and transfection specificity for activated endothelial cells. Transfection with SAINTarg delivered significantly more siRNA into activated HUVEC, compared to transfection with non-targeted SAINT. The enhanced uptake of siRNA was corroborated by improved silencing of both gene- and protein expression of VE-cadherin in activated HUVEC, indicating that SAINTarg delivered functionally active siRNA into endothelial cells. The obtained results demonstrate a successful design of a small nucleotide carrier system with improved and specific siRNA delivery into otherwise difficult-to-transfect primary endothelial cells, which in addition reduced considerably the amount of siRNA needed for gene silencing. Copyright 2009 Elsevier B.V. All rights reserved.

[Small interfering RNA-mediated COX-2 gene silencing enhances chemosensitivity of KB/VCR cells by suppressing MDR-1 gene expression and P-glycoprotein activity].

Science.gov (United States)

Mo, Xianchao; Li, Weizhong

2014-05-01

To investigate the effect of small interfering RNA (siRNA)-mediated COX-2 gene silencing in enhancing the chemosensitivity of KB/VCR cell lines. KB/VCR cells were trasnfected with COX-2 siRNA were examined for expressions of COX-2 and MDR-1 mRNAs with RT-PCR and for Rho-123 accumulation using flow cytometry. MTT assay was used to analyze the proliferation of the transfected KB/VCR cells. Compared with the negative and blank control groups, COX-2 siRNA transfection resulted in significant growth inhibition of KB/VCR cells exposed to vincristine (PKB/VCR cells. COX-2 gene silencing can enhance the chemosensitivity of KB/VCR cells to vincristine, the mechanism of which may involve down-regulated MDR-1 gene expression and inhibition of P-glycoprotein activity.

Short-hairpin RNA-mediated Heat shock protein 90 gene silencing inhibits human breast cancer cell growth in vitro and in vivo

International Nuclear Information System (INIS)

Zuo, Keqiang; Li, Dan; Pulli, Benjamin; Yu, Fei; Cai, Haidong; Yuan, Xueyu; Zhang, Xiaoping; Lv, Zhongwei

2012-01-01

Highlights: ► Hsp90 is over-expressed in human breast cancer. ► The shRNA-mediated gene silencing of Hsp90 resulted in inhibition of cell growth. ► Akt and NF-kB were down-regulation after transfection due to Hsp90 silencing. ► The tumor growth ratio was decline due to Hsp90 silencing. ► The PCNA expression was down-regulation due to Hsp90 silencing. -- Abstract: Hsp90 interacts with proteins that mediate signaling pathways involved in the regulation of essential processes such as proliferation, cell cycle control, angiogenesis and apoptosis. Hsp90 inhibition is therefore an attractive strategy for blocking abnormal pathways that are crucial for cancer cell growth. In the present study, the role of Hsp90 in human breast cancer MCF-7 cells was examined by stably silencing Hsp90 gene expression with an Hsp90-silencing vector (Hsp90-shRNA). RT-PCR and Western blot analyses showed that Hsp90-shRNA specifically and markedly down-regulated Hsp90 mRNA and protein expression. NF-kB and Akt protein levels were down-regulated in Hsp90-shRNA transfected cells, indicating that Hsp90 knockout caused a reduction of survival factors and induced apoptosis. Treatment with Hsp90-shRNA significantly increased apoptotic cell death and caused cell cycle arrest in the G1/S phase in MCF-7 cells, as shown by flow cytometry. Silencing of Hsp90 also reduced cell viability, as determined by MTT assay. In vivo experiments showed that MCF-7 cells stably transfected with Hsp90-shRNA grew slowly in nude mice as compared with control groups. In summary, the Hsp90-shRNA specifically silenced the Hsp90 gene, and inhibited MCF-7 cell growth in vitro and in vivo. Possible molecular mechanisms underlying the effects of Hsp90-shRNA include the degradation of Hsp90 breast cancer-related client proteins, the inhibition of survival signals and the upregulation of apoptotic pathways. shRNA-mediated interference may have potential therapeutic utility in human breast cancer.

Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

Energy Technology Data Exchange (ETDEWEB)

Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

2014-11-14

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

Gene dosage induction of silencing directed against an Arabidopsis Myb transgene in tobacco

Science.gov (United States)

An unexpected reduction in petal pigmentation on petunia plants genetically engineered for enhanced flower color was one of the first experimental demonstrations of the natural process of RNA-associated gene silencing. The obvious visual nature of such alterations to pigment patterns of transgenic ...

RNA silencing is required for Arabidopsis defence against Verticillium wilt disease

NARCIS (Netherlands)

Ellendorff, U.; Fradin, E.F.; Jonge, de R.; Thomma, B.P.H.J.

2009-01-01

RNA silencing is a conserved mechanism in eukaryotes that plays an important role in various biological processes including regulation of gene expression. RNA silencing also plays a role in genome stability and protects plants against invading nucleic acids such as transgenes and viruses. Recently,

Effective Anti-miRNA Oligonucleotides Show High Releasing Rate of MicroRNA from RNA-Induced Silencing Complex.

Science.gov (United States)

Ariyoshi, Jumpei; Matsuyama, Yohei; Kobori, Akio; Murakami, Akira; Sugiyama, Hiroshi; Yamayoshi, Asako

2017-10-01

MicroRNAs (miRNAs) regulate gene expression by forming RNA-induced silencing complexes (RISCs) and have been considered as promising therapeutic targets. MiRNA is an essential component of RISC for the modulation of gene expression. Therefore, the release of miRNA from RISC is considered as an effective method for the inhibition of miRNA functions. In our previous study, we reported that anti-miRNA oligonucleotides (AMOs), which are composed of the 2'-O-methyl (2'-OMe) RNA, could induce the release of miRNA from RISC. However, the mechanisms underlying the miRNA-releasing effects of chemically modified AMOs, which are conventionally used as anti-cancer drugs, are still unclear. In this study, we investigated the relationship between the miRNA releasing rate from RISC and the inhibitory effect on RISC activity (IC 50 ) using conventional chemically modified AMOs. We demonstrated that the miRNA-releasing effects of AMOs are directly proportional to the IC 50 values, and AMOs, which have an ability to promote the release of miRNA from RISC, can effectively inhibit RISC activity in living cells.

Identification of Novel Fibrosis Modifiers by In Vivo siRNA Silencing

Directory of Open Access Journals (Sweden)

Elisabeth H. Vollmann

2017-06-01

Full Text Available Fibrotic diseases contribute to 45% of deaths in the industrialized world, and therefore a better understanding of the pathophysiological mechanisms underlying tissue fibrosis is sorely needed. We aimed to identify novel modifiers of tissue fibrosis expressed by myofibroblasts and their progenitors in their disease microenvironment through RNA silencing in vivo. We leveraged novel biology, targeting genes upregulated during liver and kidney fibrosis in this cell lineage, and employed small interfering RNA (siRNA-formulated lipid nanoparticles technology to silence these genes in carbon-tetrachloride-induced liver fibrosis in mice. We identified five genes, Egr2, Atp1a2, Fkbp10, Fstl1, and Has2, which modified fibrogenesis based on their silencing, resulting in reduced Col1a1 mRNA levels and collagen accumulation in the liver. These genes fell into different groups based on the effects of their silencing on a transcriptional mini-array and histological outcomes. Silencing of Egr2 had the broadest effects in vivo and also reduced fibrogenic gene expression in a human fibroblast cell line. Prior to our study, Egr2, Atp1a2, and Fkbp10 had not been functionally validated in fibrosis in vivo. Thus, our results provide a major advance over the existing knowledge of fibrogenic pathways. Our study is the first example of a targeted siRNA assay to identify novel fibrosis modifiers in vivo.

Hydrophobically Modified siRNAs Silence Huntingtin mRNA in Primary Neurons and Mouse Brain

Directory of Open Access Journals (Sweden)

Julia F Alterman

2015-01-01

Full Text Available Applications of RNA interference for neuroscience research have been limited by a lack of simple and efficient methods to deliver oligonucleotides to primary neurons in culture and to the brain. Here, we show that primary neurons rapidly internalize hydrophobically modified siRNAs (hsiRNAs added directly to the culture medium without lipid formulation. We identify functional hsiRNAs targeting the mRNA of huntingtin, the mutation of which is responsible for Huntington's disease, and show that direct uptake in neurons induces potent and specific silencing in vitro. Moreover, a single injection of unformulated hsiRNA into mouse brain silences Htt mRNA with minimal neuronal toxicity. Thus, hsiRNAs embody a class of therapeutic oligonucleotides that enable simple and straightforward functional studies of genes involved in neuronal biology and neurodegenerative disorders in a native biological context.

Anti-viral RNA silencing: do we look like plants ?

Directory of Open Access Journals (Sweden)

Lecellier Charles-Henri

2006-01-01

Full Text Available Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to be similarly conserved from plants to insects, even in worms, RNA silencing does influence the replication of mammalian viruses but in a particular mode: micro(miRNAs, endogenous small RNAs naturally implicated in translational control, rather than virus-derived small interfering (siRNAs like in other organisms, are involved. In fact, these recent studies even suggest that RNA silencing may be beneficial for viral replication. Accordingly, several large DNA mammalian viruses have been shown to encode their own miRNAs. Here, we summarize the seminal studies that have implicated RNA silencing in viral infection and compare the different eukaryotic responses.

The rde-1 gene, RNA interference, and transposon silencing in C. elegans.

Science.gov (United States)

Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C

1999-10-15

Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.

Gene silencing in primary and metastatic tumors by small interfering RNA delivery in mice: quantitative analysis using melanoma cells expressing firefly and sea pansy luciferases.

Science.gov (United States)

Takahashi, Yuki; Nishikawa, Makiya; Kobayashi, Naoki; Takakura, Yoshinobu

2005-07-20

Silencing of oncogenes or other genes contributing to tumor malignancy or progression by RNA interference (RNAi) offers a promising approach to treating tumor patients. To achieve RNAi-based tumor therapy, a small interfering RNA (siRNA) or siRNA-expressing vector needs to be delivered to tumor cells, but little information about its in vivo delivery has been reported. In this study, we examined whether the expression of the target gene in tumor cells can be suppressed by the delivery of RNAi effectors to primary and metastatic tumor cells. To quantitatively evaluate the RNAi effects in tumor cells, mouse melanoma B16-BL6 cells were stably transfected with both firefly (a model target gene) and sea pansy (an internal standard gene) luciferase genes to obtain B16-BL6/dual Luc cells. The target gene expression in subcutaneous primary tumors of B16-BL6/dual Luc cells was significantly suppressed by direct injection of the RNAi effectors followed by electroporation. The expression in metastatic hepatic tumors was also significantly reduced by an intravenous injection of either RNAi effector by the hydrodynamics-based procedure. These results indicate that the both RNAi effectors have a potential to silence target gene in tumor cells in vivo when successfully delivered to tumor cells.

Strain Specific Factors Control Effector Gene Silencing in Phytophthora sojae.

Directory of Open Access Journals (Sweden)

Sirjana Devi Shrestha

Full Text Available The Phytophthora sojae avirulence gene Avr3a encodes an effector that is capable of triggering immunity on soybean plants carrying the resistance gene Rps3a. P. sojae strains that express Avr3a are avirulent to Rps3a plants, while strains that do not are virulent. To study the inheritance of Avr3a expression and virulence towards Rps3a, genetic crosses and self-fertilizations were performed. A cross between P. sojae strains ACR10 X P7076 causes transgenerational gene silencing of Avr3a allele, and this effect is meiotically stable up to the F5 generation. However, test-crosses of F1 progeny (ACR10 X P7076 with strain P6497 result in the release of silencing of Avr3a. Expression of Avr3a in the progeny is variable and correlates with the phenotypic penetrance of the avirulence trait. The F1 progeny from a direct cross of P6497 X ACR10 segregate for inheritance for Avr3a expression, a result that could not be explained by parental imprinting or heterozygosity. Analysis of small RNA arising from the Avr3a gene sequence in the parental strains and hybrid progeny suggests that the presence of small RNA is necessary but not sufficient for gene silencing. Overall, we conclude that inheritance of the Avr3a gene silenced phenotype relies on factors that are variable among P. sojae strains.

Epigenetic silencing of nucleolar rRNA genes in Alzheimer's disease.

Directory of Open Access Journals (Sweden)

Maciej Pietrzak

Full Text Available Ribosomal deficits are documented in mild cognitive impairment (MCI, which often represents an early stage Alzheimer's disease (AD, as well as in advanced AD. The nucleolar rRNA genes (rDNA, transcription of which is critical for ribosomal biogenesis, are regulated by epigenetic silencing including promoter CpG methylation.To assess whether CpG methylation of the rDNA promoter was dysregulated across the AD spectrum, we analyzed brain samples from 10 MCI-, 23 AD-, and, 24 age-matched control individuals using bisulfite mapping. The rDNA promoter became hypermethylated in cerebro-cortical samples from MCI and AD groups. In parietal cortex, the rDNA promoter was hypermethylated more in MCI than in advanced AD. The cytosine methylation of total genomic DNA was similar in AD, MCI, and control samples. Consistent with a notion that hypermethylation-mediated silencing of the nucleolar chromatin stabilizes rDNA loci, preventing their senescence-associated loss, genomic rDNA content was elevated in cerebrocortical samples from MCI and AD groups.In conclusion, rDNA hypermethylation could be a new epigenetic marker of AD. Moreover, silencing of nucleolar chromatin may occur during early stages of AD pathology and play a role in AD-related ribosomal deficits and, ultimately, dementia.

Gene silencing of HPV16 E6/E7 induced by promoter-targeting siRNA in SiHa cells

OpenAIRE

Hong, D; Lu, W; Ye, F; Hu, Y; Xie, X

2009-01-01

Background: Recently, transcriptional gene silencing induced by small interfering RNA (siRNA) was found in mammalian and human cells. However, previous studies focused on endogenous genes. Methods: In this study, we designed siRNA targeting the promoter of human papillomavirus 16 E6/E7 and transfected it into the cervical cancer cell line, SiHa. E6 and E7 mRNA and protein expression were detected in cells treated by promoter-targeting siRNA. Futhermore, cellular growth, proliferation, apoptos...

Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

Directory of Open Access Journals (Sweden)

Yao Han

Full Text Available MIGS (miRNA-induced gene silencing is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs. MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase and PDS (phytoene desaturase gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant

Investigation of a miRNA-Induced Gene Silencing Technique in Petunia Reveals Alterations in miR173 Precursor Processing and the Accumulation of Secondary siRNAs from Endogenous Genes.

Science.gov (United States)

Han, Yao; Zhang, Bin; Qin, Xiaoting; Li, Mingyang; Guo, Yulong

2015-01-01

MIGS (miRNA-induced gene silencing) is a straightforward and efficient gene silencing technique in Arabidopsis. It works by exploiting miR173 to trigger the production of phasiRNAs (phased small interfering RNAs). MIGS can be used in plant species other than Arabidopsis by co-expression of miR173 and target gene fragments fused to an upstream miR173 target site. However, the efficiency and technical mechanisms have not been thoroughly investigated in other plants. In this work, two vectors, pMIGS-chs and pMIGS-pds, were constructed and transformed into petunia plants. The transgenic plants showed CHS (chalcone synthase) and PDS (phytoene desaturase) gene-silencing phenotypes respectively, indicating that MIGS functions in petunia. MIGS-chs plants were used to investigate the mechanisms of this technique in petunia. Results of 5'- RACE showed that the miR173 target site was cleaved at the expected position and that endogenous CHS genes were cut at multiple positions. Small RNA deep sequencing analysis showed that the processing of Arabidopsis miR173 precursors in MIGS-chs transgenic petunia plants did not occur in exactly the same way as in Arabidopsis, suggesting differences in the machinery of miRNA processing between plant species. Small RNAs in-phase with the miR173 cleavage register were produced immediately downstream from the cleavage site and out-of-phase small RNAs were accumulated at relatively high levels from processing cycle 5 onwards. Secondary siRNAs were generated from multiple sites of endogenous CHS-A and CHS-J genes, indicating that miR173 cleavage induced siRNAs have the same ability to initiate siRNA transitivity as the siRNAs functioning in co-suppression and hpRNA silencing. On account of the simplicity of vector construction and the transitive amplification of signals from endogenous transcripts, MIGS is a good alternative gene silencing method for plants, especially for silencing a cluster of homologous genes with redundant functions.

Pathways of cellular internalisation of liposomes delivered siRNA and effects on siRNA engagement with target mRNA and silencing in cancer cells.

Science.gov (United States)

Alshehri, Abdullah; Grabowska, Anna; Stolnik, Snow

2018-02-28

Design of an efficient delivery system is a generally recognised bottleneck in translation of siRNA technology into clinic. Despite research efforts, cellular processes that determine efficiency of siRNA silencing achieved by different delivery formulations remain unclear. Here, we investigated the mechanism(s) of cellular internalisation of a model siRNA-loaded liposome system in a correlation to the engagement of delivered siRNA with its target and consequent silencing by adopting siRNA molecular beacon technology. Probing of cellular internalisation pathways by a panel of pharmacological inhibitors indicated that clathrin-mediated (dynamin-dependent) endocytosis, macropinocytosis (dynamine independent), and cell membrane cholesterol dependent process(es) (clathrin and caveolea-independent) all play a role in the siRNA-liposomes internalization. The inhibition of either of these entry routes was, in general, mirrored by a reduction in the level of siRNA engagement with its target mRNA, as well as in a reduction of the target gene silencing. A dramatic increase in siRNA engagement with its target RNA was observed on disruption of endosomal membrane (by chloroquine), accompanied with an increased silencing. The work thus illustrates that employing molecular beacon siRNA technology one can start to assess the target RNA engagement - a stage between initial cellular internalization and final gene silencing of siRNA delivery systems.

Nucleases as a barrier to gene silencing in the cotton boll weevil, Anthonomus grandis.

Science.gov (United States)

Almeida Garcia, Rayssa; Lima Pepino Macedo, Leonardo; Cabral do Nascimento, Danila; Gillet, François-Xavier; Moreira-Pinto, Clidia Eduarda; Faheem, Muhammad; Moreschi Basso, Angelina Maria; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

2017-01-01

RNA interference (RNAi) approaches have been applied as a biotechnological tool for controlling plant insect pests via selective gene down regulation. However, the inefficiency of RNAi mechanism in insects is associated with several barriers, including dsRNA delivery and uptake by the cell, dsRNA interaction with the cellular membrane receptor and dsRNA exposure to insect gut nucleases during feeding. The cotton boll weevil (Anthonomus grandis) is a coleopteran in which RNAi-mediated gene silencing does not function efficiently through dsRNA feeding, and the factors involved in the mechanism remain unknown. Herein, we identified three nucleases in the cotton boll weevil transcriptome denoted AgraNuc1, AgraNuc2, and AgraNuc3, and the influences of these nucleases on the gene silencing of A. grandis chitin synthase II (AgraChSII) were evaluated through oral dsRNA feeding trials. A phylogenetic analysis showed that all three nucleases share high similarity with the DNA/RNA non-specific endonuclease family of other insects. These nucleases were found to be mainly expressed in the posterior midgut region of the insect. Two days after nuclease RNAi-mediated gene silencing, dsRNA degradation by the gut juice was substantially reduced. Notably, after nucleases gene silencing, the orally delivered dsRNA against the AgraChSII gene resulted in improved gene silencing efficiency when compared to the control (non-silenced nucleases). The data presented here demonstrates that A. grandis midgut nucleases are effectively one of the main barriers to dsRNA delivery and emphasize the need to develop novel RNAi delivery strategies focusing on protecting the dsRNA from gut nucleases and enhancing its oral delivery and uptake to crop insect pests.

Small RNA-Mediated Epigenetic Myostatin Silencing

Directory of Open Access Journals (Sweden)

Thomas C Roberts

2012-01-01

Full Text Available Myostatin (Mstn is a secreted growth factor that negatively regulates muscle mass and is therefore a potential pharmacological target for the treatment of muscle wasting disorders such as Duchenne muscular dystrophy. Here we describe a novel Mstn blockade approach in which small interfering RNAs (siRNAs complementary to a promoter-associated transcript induce transcriptional gene silencing (TGS in two differentiated mouse muscle cell lines. Silencing is sensitive to treatment with the histone deacetylase inhibitor trichostatin A, and the silent state chromatin mark H3K9me2 is enriched at the Mstn promoter following siRNA transfection, suggesting epigenetic remodeling underlies the silencing effect. These observations suggest that long-term epigenetic silencing may be feasible for Mstn and that TGS is a promising novel therapeutic strategy for the treatment of muscle wasting disorders.

Computational analysis of siRNA recognition by the Ago2 PAZ domain and identification of the determinants of RNA-induced gene silencing.

Directory of Open Access Journals (Sweden)

Mahmoud Kandeel

Full Text Available RNA interference (RNAi is a highly specialized process of protein-siRNA interaction that results in the regulation of gene expression and cleavage of target mRNA. The PAZ domain of the Argonaute proteins binds to the 3' end of siRNA, and during RNAi the attaching end of the siRNA switches between binding and release from its binding pocket. This biphasic interaction of the 3' end of siRNA with the PAZ domain is essential for RNAi activity; however, it remains unclear whether stronger or weaker binding with PAZ domain will facilitate or hinder the overall RNAi process. Here we report the correlation between the binding of modified siRNA 3' overhang analogues and their in vivo RNAi efficacy. We found that higher RNAi efficacy was associated with the parameters of lower Ki value, lower total intermolecular energy, lower free energy, higher hydrogen bonding, smaller total surface of interaction and fewer van der Waals interactions. Electrostatic interaction was a minor contributor to compounds recognition, underscoring the presence of phosphate groups in the modified analogues. Thus, compounds with lower binding affinity are associated with better gene silencing. Lower binding strength along with the smaller interaction surface, higher hydrogen bonding and fewer van der Waals interactions were among the markers for favorable RNAi activity. Within the measured parameters, the interaction surface, van der Waals interactions and inhibition constant showed a statistically significant correlation with measured RNAi efficacy. The considerations provided in this report will be helpful in the design of new compounds with better gene silencing ability.

Impact of target mRNA structure on siRNA silencing efficiency: A large-scale study.

Science.gov (United States)

Gredell, Joseph A; Berger, Angela K; Walton, S Patrick

2008-07-01

The selection of active siRNAs is generally based on identifying siRNAs with certain sequence and structural properties. However, the efficiency of RNA interference has also been shown to depend on the structure of the target mRNA, primarily through studies using exogenous transcripts with well-defined secondary structures in the vicinity of the target sequence. While these studies provide a means for examining the impact of target sequence and structure independently, the predicted secondary structures for these transcripts are often not reflective of structures that form in full-length, native mRNAs where interactions can occur between relatively remote segments of the mRNAs. Here, using a combination of experimental results and analysis of a large dataset, we demonstrate that the accessibility of certain local target structures on the mRNA is an important determinant in the gene silencing ability of siRNAs. siRNAs targeting the enhanced green fluorescent protein were chosen using a minimal siRNA selection algorithm followed by classification based on the predicted minimum free energy structures of the target transcripts. Transfection into HeLa and HepG2 cells revealed that siRNAs targeting regions of the mRNA predicted to have unpaired 5'- and 3'-ends resulted in greater gene silencing than regions predicted to have other types of secondary structure. These results were confirmed by analysis of gene silencing data from previously published siRNAs, which showed that mRNA target regions unpaired at either the 5'-end or 3'-end were silenced, on average, approximately 10% more strongly than target regions unpaired in the center or primarily paired throughout. We found this effect to be independent of the structure of the siRNA guide strand. Taken together, these results suggest minimal requirements for nucleation of hybridization between the siRNA guide strand and mRNA and that both mRNA and guide strand structure should be considered when choosing candidate si

An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing

DEFF Research Database (Denmark)

Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria

2016-01-01

/2 12 min (naked) to t1/2 45 min (single cholesteryl) and t1/2 71 min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing......HSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies...

RNA interference silences Microplitis demolitor bracovirus genes and implicates glc1.8 in disruption of adhesion in infected host cells

International Nuclear Information System (INIS)

Beck, Markus; Strand, Michael R.

2003-01-01

The family Polydnaviridae consists of ds-DNA viruses that are symbiotically associated with certain parasitoid wasps. PDVs are transmitted vertically but also are injected by wasps into hosts where they cause several physiological alterations including immunosuppression. The PDV genes responsible for mediating immunosuppression and other host alterations remain poorly characterized in large measure because viral mutants cannot be produced to study gene function. Here we report the use of RNA interference (RNAi) to specifically silence the glc1.8 and egf1.0 genes from Microplitis demolitor bracovirus (MdBV) in High Five cells derived from the lepidopteran Trichoplusia ni. Dose-response studies indicated that MdBV infects High Five cells and blocks the ability of these cells to adhere to culture plates. This response was very similar to what occurs in two classes of hemocytes, granular cells, and plasmatocytes, after infection by MdBV. Screening of monoclonal antibody (mAb) markers that distinguish different classes of lepidopteran hemocytes indicated that High Five cells cross-react with three mAbs that recognize granular cells from T. ni. Double-stranded RNA (dsRNA) complementary to glc1.8 specifically silenced glc1.8 expression and rescued the adhesive phenotype of High Five cells. Reciprocally, dsRNA complementary to egf1.0 silenced egf1.0 expression but had no effect on adhesion. The simplicity and potency of RNAi could be extremely useful for analysis of other PDV genes

Silencing of SARS-CoV spike gene by small interfering RNA in HEK 293T cells

International Nuclear Information System (INIS)

Qin Zhaoling; Zhao Ping; Zhang Xiaolian; Yu Jianguo; Cao Mingmei; Zhao Lanjuan; Luan Jie; Qi Zhongtian

2004-01-01

Two candidate small interfering RNAs (siRNAs) corresponding to severe acute respiratory syndrome-associated coronavirus (SARS-CoV) spike gene were designed and in vitro transcribed to explore the possibility of silencing SARS-CoV S gene. The plasmid pEGFP-optS, which contains the codon-optimized SARS-CoV S gene and expresses spike-EGFP fusion protein (S-EGFP) as silencing target and expressing reporter, was transfected with siRNAs into HEK 293T cells. At various time points of posttransfection, the levels of S-EGFP expression and amounts of spike mRNA transcript were detected by fluorescence microscopy, flow cytometry, Western blot, and real-time quantitative PCR, respectively. The results showed that the cells transfected with pEGFP-optS expressed S-EGFP fusion protein at a higher level compared with those transfected with pEGFP-S, which contains wildtype SARS-CoV spike gene sequence. The green fluorescence, mean fluorescence intensity, and SARS-CoV S RNA transcripts were found significantly reduced, and the expression of SARS-CoV S glycoprotein was strongly inhibited in those cells co-transfected with either EGFP- or S-specific siRNAs. Our findings demonstrated that the S-specific siRNAs used in this study were able to specifically and effectively inhibit SARS-CoV S glycoprotein expression in cultured cells through blocking the accumulation of S mRNA, which may provide an approach for studies on the functions of SARS-CoV S gene and development of novel prophylactic or therapeutic agents for SARS-CoV

RNA-directed DNA methylation: Mechanisms and functions

KAUST Repository

Mahfouz, Magdy M.

2010-07-01

Epigenetic RNA based gene silencing mechanisms play a major role in genome stability and control of gene expression. Transcriptional gene silencing via RNA-directed DNA methylation (RdDM) guides the epigenetic regulation of the genome in response to disease states, growth, developmental and stress signals. RdDM machinery is composed of proteins that produce and modify 24-nt- long siRNAs, recruit the RdDM complex to genomic targets, methylate DNA and remodel chromatin. The final DNA methylation pattern is determined by either DNA methyltransferase alone or by the combined action of DNA methyltransferases and demethylases. The dynamic interaction between RdDM and demethylases may render the plant epigenome plastic to growth, developmental, and environmental cues. The epigenome plasticity may allow the plant genome to assume many epigenomes and to have the right epigenome at the right time in response to intracellular or extracellular stimuli. This review discusses recent advances in RdDM research and considers future perspectives.

Normalization of Overexpressed α-Synuclein Causing Parkinson's Disease By a Moderate Gene Silencing With RNA Interference

Directory of Open Access Journals (Sweden)

Masaki Takahashi

2015-01-01

Full Text Available The α-synuclein (SNCA gene is a responsible gene for Parkinson's disease (PD; and not only nucleotide variations but also overexpression of SNCA appears to be involved in the pathogenesis of PD. A specific inhibition against mutant SNCA genes carrying nucleotide variations may be feasible by a specific silencing such as an allele-specific RNA interference (RNAi; however, there is no method for restoring the SNCA overexpression to a normal level. Here, we show that an atypical RNAi using small interfering RNAs (siRNAs that confer a moderate level of gene silencing is capable of controlling overexpressed SNCA genes to return to a normal level; named “expression-control RNAi” (ExCont-RNAi. ExCont-RNAi exhibited little or no significant off-target effects in its treated PD patient's fibroblasts that carry SNCA triplication. To further assess the therapeutic effect of ExCont-RNAi, PD-model flies that carried the human SNCA gene underwent an ExCont-RNAi treatment. The treated PD-flies demonstrated a significant improvement in their motor function. Our current findings suggested that ExCont-RNAi might be capable of becoming a novel therapeutic procedure for PD with the SNCA overexpression, and that siRNAs conferring a moderate level of gene silencing to target genes, which have been abandoned as useless siRNAs so far, might be available for controlling abnormally expressed disease-causing genes without producing adverse effects.

Telomeric trans-silencing: an epigenetic repression combining RNA silencing and heterochromatin formation.

Directory of Open Access Journals (Sweden)

Thibaut Josse

2007-09-01

Full Text Available The study of P-element repression in Drosophila melanogaster led to the discovery of the telomeric Trans-Silencing Effect (TSE, a repression mechanism by which a transposon or a transgene inserted in subtelomeric heterochromatin (Telomeric Associated Sequence or TAS has the capacity to repress in trans in the female germline, a homologous transposon, or transgene located in euchromatin. TSE shows variegation among egg chambers in ovaries when silencing is incomplete. Here, we report that TSE displays an epigenetic transmission through meiosis, which involves an extrachromosomal maternally transmitted factor. We show that this silencing is highly sensitive to mutations affecting both heterochromatin formation (Su(var205 encoding Heterochromatin Protein 1 and Su(var3-7 and the repeat-associated small interfering RNA (or rasiRNA silencing pathway (aubergine, homeless, armitage, and piwi. In contrast, TSE is not sensitive to mutations affecting r2d2, which is involved in the small interfering RNA (or siRNA silencing pathway, nor is it sensitive to a mutation in loquacious, which is involved in the micro RNA (or miRNA silencing pathway. These results, taken together with the recent discovery of TAS homologous small RNAs associated to PIWI proteins, support the proposition that TSE involves a repeat-associated small interfering RNA pathway linked to heterochromatin formation, which was co-opted by the P element to establish repression of its own transposition after its recent invasion of the D. melanogaster genome. Therefore, the study of TSE provides insight into the genetic properties of a germline-specific small RNA silencing pathway.

PhOBF1, a petunia ocs element binding factor, plays an important role in antiviral RNA silencing.

Science.gov (United States)

Sun, Daoyang; Li, Shaohua; Niu, Lixin; Reid, Michael S; Zhang, Yanlong; Jiang, Cai-Zhong

2017-02-01

Virus-induced gene silencing (VIGS) is a common reverse genetics strategy for characterizing the function of genes in plants. The detailed mechanism governing RNA silencing efficiency triggered by viruses is largely unclear. Here, we reveal that a petunia (Petunia hybrida) ocs element binding factor, PhOBF1, one of the basic leucine zipper (bZIP) transcription factors, was up-regulated by Tobacco rattle virus (TRV) infection. Simultaneous silencing of PhOBF1 and a reporter gene, phytoene desaturase (PDS) or chalcone synthase (CHS), by TRV-based VIGS led to a failure of the development of leaf photobleaching or the white-corollas phenotype. PhOBF1 silencing caused down-regulation of RNA silencing-related genes, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonautes (AGOs). After inoculation with the TRV-PhPDS, PhOBF1-RNAi lines exhibited a substantially impaired PDS silencing efficiency, whereas overexpression of PhOBF1 resulted in a recovery of the silencing phenotype (photobleaching) in systemic leaves. A compromised resistance to TRV and Tobacco mosaic virus was found in PhOBF1-RNAi lines, while PhOBF1-overexpressing lines displayed an enhanced resistance to their infections. Compared with wild-type plants, PhOBF1-silenced plants accumulated lower levels of free salicylic acid (SA), salicylic acid glucoside, and phenylalanine, contrarily to higher levels of those in plants overexpressing PhOBF1. Furthermore, transcripts of a number of genes associated with the shikimate and phenylpropanoid pathways were decreased or increased in PhOBF1-RNAi or PhOBF1-overexpressing lines, respectively. Taken together, the data suggest that PhOBF1 regulates TRV-induced RNA silencing efficiency through modulation of RDRs, DCLs, and AGOs mediated by the SA biosynthesis pathway. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Strategies underlying RNA silencing suppression by negative strand RNA viruses

NARCIS (Netherlands)

Hemmes, J.C.

2007-01-01

The research described in this thesis focused on the strategies of negative strand RNA viruses to counteract antiviral RNA silencing. In plants and insects, RNA silencing has been shown to act as a sequence specific antiviral defence mechanism that is characterised by the processing of double

The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

Science.gov (United States)

Valli, Adrian; Busnadiego, Idoia; Maliogka, Varvara; Ferrero, Diego; Castón, José R; Rodríguez, José Francisco; García, Juan Antonio

2012-01-01

RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV) displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

KAUST Repository

Jin, Hailing; Zhu, Jian-Kang

2010-01-01

RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host's essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

Silencing of BCR/ABL Chimeric Gene in Human Chronic Myelogenous Leukemia Cell Line K562 by siRNA-Nuclear Export Signal Peptide Conjugates.

Science.gov (United States)

Shinkai, Yasuhiro; Kashihara, Shinichi; Minematsu, Go; Fujii, Hirofumi; Naemura, Madoka; Kotake, Yojiro; Morita, Yasutaka; Ohnuki, Koichiro; Fokina, Alesya A; Stetsenko, Dmitry A; Filichev, Vyacheslav V; Fujii, Masayuki

2017-06-01

Herein we described the synthesis of siRNA-NES (nuclear export signal) peptide conjugates by solid phase fragment coupling and the application of them to silencing of bcr/abl chimeric gene in human chronic myelogenous leukemia cell line K562. Two types of siRNA-NES conjugates were prepared, and both sense strands at 5' ends were covalently linked to a NES peptide derived from TFIIIA and HIV-1 REV, respectively. Significant enhancement of silencing efficiency was observed for both of them. siRNA-TFIIIA NES conjugate suppressed the expression of BCR/ABL gene to 8.3% at 200 nM and 11.6% at 50 nM, and siRNA-HIV-1REV NES conjugate suppressed to 4.0% at 200 nM and 6.3% at 50 nM, whereas native siRNA suppressed to 36.3% at 200 nM and 30.2% at 50 nM. We could also show complex of siRNA-NES conjugate and designed amphiphilic peptide peptideβ7 could be taken up into cells with no cytotoxicity and showed excellent silencing efficiency. We believe that the complex siRNA-NES conjugate and peptideβ7 is a promising candidate for in vivo use and therapeutic applications.

Enhancement of allele discrimination by introduction of nucleotide mismatches into siRNA in allele-specific gene silencing by RNAi.

Directory of Open Access Journals (Sweden)

Yusuke Ohnishi

Full Text Available Allele-specific gene silencing by RNA interference (RNAi is therapeutically useful for specifically inhibiting the expression of disease-associated alleles without suppressing the expression of corresponding wild-type alleles. To realize such allele-specific RNAi (ASP-RNAi, the design and assessment of small interfering RNA (siRNA duplexes conferring ASP-RNAi is vital; however, it is also difficult. In a previous study, we developed an assay system to assess ASP-RNAi with mutant and wild-type reporter alleles encoding the Photinus and Renilla luciferase genes. In line with experiments using the system, we realized that it is necessary and important to enhance allele discrimination between mutant and corresponding wild-type alleles. Here, we describe the improvement of ASP-RNAi against mutant alleles carrying single nucleotide variations by introducing base substitutions into siRNA sequences, where original variations are present in the central position. Artificially mismatched siRNAs or short-hairpin RNAs (shRNAs against mutant alleles of the human Prion Protein (PRNP gene, which appear to be associated with susceptibility to prion diseases, were examined using this assessment system. The data indicates that introduction of a one-base mismatch into the siRNAs and shRNAs was able to enhance discrimination between the mutant and wild-type alleles. Interestingly, the introduced mismatches that conferred marked improvement in ASP-RNAi, appeared to be largely present in the guide siRNA elements, corresponding to the 'seed region' of microRNAs. Due to the essential role of the 'seed region' of microRNAs in their association with target RNAs, it is conceivable that disruption of the base-pairing interactions in the corresponding seed region, as well as the central position (involved in cleavage of target RNAs, of guide siRNA elements could influence allele discrimination. In addition, we also suggest that nucleotide mismatches at the 3'-ends of sense

Characterization of the RNA silencing suppression activity of the Ebola virus VP35 protein in plants and mammalian cells.

Science.gov (United States)

Zhu, Yali; Cherukuri, Nil Celebi; Jackel, Jamie N; Wu, Zetang; Crary, Monica; Buckley, Kenneth J; Bisaro, David M; Parris, Deborah S

2012-03-01

Ebola virus (EBOV) causes a lethal hemorrhagic fever for which there is no approved effective treatment or prevention strategy. EBOV VP35 is a virulence factor that blocks innate antiviral host responses, including the induction of and response to alpha/beta interferon. VP35 is also an RNA silencing suppressor (RSS). By inhibiting microRNA-directed silencing, mammalian virus RSSs have the capacity to alter the cellular environment to benefit replication. A reporter gene containing specific microRNA target sequences was used to demonstrate that prior expression of wild-type VP35 was able to block establishment of microRNA silencing in mammalian cells. In addition, wild-type VP35 C-terminal domain (CTD) protein fusions were shown to bind small interfering RNA (siRNA). Analysis of mutant proteins demonstrated that reporter activity in RSS assays did not correlate with their ability to antagonize double-stranded RNA (dsRNA)-activated protein kinase R (PKR) or bind siRNA. The results suggest that enhanced reporter activity in the presence of VP35 is a composite of nonspecific translational enhancement and silencing suppression. Moreover, most of the specific RSS activity in mammalian cells is RNA binding independent, consistent with VP35's proposed role in sequestering one or more silencing complex proteins. To examine RSS activity in a system without interferon, VP35 was tested in well-characterized plant silencing suppression assays. VP35 was shown to possess potent plant RSS activity, and the activities of mutant proteins correlated strongly, but not exclusively, with RNA binding ability. The results suggest the importance of VP35-protein interactions in blocking silencing in a system (mammalian) that cannot amplify dsRNA.

A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

Science.gov (United States)

Pompey, Justine M; Foda, Bardees; Singh, Upinder

2015-01-01

Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

Directory of Open Access Journals (Sweden)

Justine M Pompey

Full Text Available Dicer enzymes process double-stranded RNA (dsRNA into small RNAs that target gene silencing through the RNA interference (RNAi pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

KAUST Repository

Jin, Hailing

2010-05-01

RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host\\'s essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

Directory of Open Access Journals (Sweden)

Adrian Valli

Full Text Available RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

Antisense targeting of 3' end elements involved in DUX4 mRNA processing is an efficient therapeutic strategy for facioscapulohumeral dystrophy: a new gene-silencing approach.

Science.gov (United States)

Marsollier, Anne-Charlotte; Ciszewski, Lukasz; Mariot, Virginie; Popplewell, Linda; Voit, Thomas; Dickson, George; Dumonceaux, Julie

2016-04-15

Defects in mRNA 3'end formation have been described to alter transcription termination, transport of the mRNA from the nucleus to the cytoplasm, stability of the mRNA and translation efficiency. Therefore, inhibition of polyadenylation may lead to gene silencing. Here, we choose facioscapulohumeral dystrophy (FSHD) as a model to determine whether or not targeting key 3' end elements involved in mRNA processing using antisense oligonucleotide drugs can be used as a strategy for gene silencing within a potentially therapeutic context. FSHD is a gain-of-function disease characterized by the aberrant expression of the Double homeobox 4 (DUX4) transcription factor leading to altered pathogenic deregulation of multiple genes in muscles. Here, we demonstrate that targeting either the mRNA polyadenylation signal and/or cleavage site is an efficient strategy to down-regulate DUX4 expression and to decrease the abnormally high-pathological expression of genes downstream of DUX4. We conclude that targeting key functional 3' end elements involved in pre-mRNA to mRNA maturation with antisense drugs can lead to efficient gene silencing and is thus a potentially effective therapeutic strategy for at least FSHD. Moreover, polyadenylation is a crucial step in the maturation of almost all eukaryotic mRNAs, and thus all mRNAs are virtually eligible for this antisense-mediated knockdown strategy. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Systemic RNAi-mediated Gene Silencing in Nonhuman Primate and Rodent Myeloid Cells

Directory of Open Access Journals (Sweden)

Tatiana I Novobrantseva

2012-01-01

Full Text Available Leukocytes are central regulators of inflammation and the target cells of therapies for key diseases, including autoimmune, cardiovascular, and malignant disorders. Efficient in vivo delivery of small interfering RNA (siRNA to immune cells could thus enable novel treatment strategies with broad applicability. In this report, we develop systemic delivery methods of siRNA encapsulated in lipid nanoparticles (LNP for durable and potent in vivo RNA interference (RNAi-mediated silencing in myeloid cells. This work provides the first demonstration of siRNA-mediated silencing in myeloid cell types of nonhuman primates (NHPs and establishes the feasibility of targeting multiple gene targets in rodent myeloid cells. The therapeutic potential of these formulations was demonstrated using siRNA targeting tumor necrosis factor-α (TNFα which induced substantial attenuation of disease progression comparable to a potent antibody treatment in a mouse model of rheumatoid arthritis (RA. In summary, we demonstrate a broadly applicable and therapeutically relevant platform for silencing disease genes in immune cells.

Tospovirus : induction and suppression of RNA silencing

NARCIS (Netherlands)

Hedil, Marcio

2016-01-01

While infecting their hosts, viruses must deal with host immunity. In plants the antiviral RNA silencing pathway is an important part of plant innate immunity. Tospoviruses are segmented negative-stranded RNA viruses of plants. To counteract the antiviral RNA silencing response in plants,

Host-Induced Silencing of Pathogenicity Genes Enhances Resistance to Fusarium oxysporum Wilt in Tomato.

Science.gov (United States)

Bharti, Poonam; Jyoti, Poonam; Kapoor, Priya; Sharma, Vandana; Shanmugam, V; Yadav, Sudesh Kumar

2017-08-01

This study presents a novel approach of controlling vascular wilt in tomato by RNAi expression directed to pathogenicity genes of Fusarium oxysporum f. sp. lycopersici. Vascular wilt of tomato caused by Fusarium oxysporum f. sp. lycopersici leads to qualitative and quantitative loss of the crop. Limitation in the existing control measures necessitates the development of alternative strategies to increase resistance in the plants against pathogens. Recent findings paved way to RNAi, as a promising method for silencing of pathogenicity genes in fungus and provided effective resistance against fungal pathogens. Here, two important pathogenicity genes FOW2, a Zn(II)2Cys6 family putative transcription regulator, and chsV, a putative myosin motor and a chitin synthase domain, were used for host-induced gene silencing through hairpinRNA cassettes of these genes against Fusarium oxysporum f. sp. lycopersici. HairpinRNAs were assembled in appropriate binary vectors and transformed into tomato plant targeting FOW2 and chsV genes, for two highly pathogenic strains of Fusarium oxysporum viz. TOFOL-IHBT and TOFOL-IVRI. Transgenic tomatoes were analyzed for possible attainment of resistance in transgenic lines against fungal infection. Eight transgenic lines expressing hairpinRNA cassettes showed trivial disease symptoms after 6-8 weeks of infection. Hence, the host-induced posttranscriptional gene silencing of pathogenicity genes in transgenic tomato plants has enhanced their resistance to vascular wilt disease caused by Fusarium oxysporum.

Conifers have a unique small RNA silencing signature.

Science.gov (United States)

Dolgosheina, Elena V; Morin, Ryan D; Aksay, Gozde; Sahinalp, S Cenk; Magrini, Vincent; Mardis, Elaine R; Mattsson, Jim; Unrau, Peter J

2008-08-01

Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an unexpected phylogenetic difference in the size distribution of small RNAs among the vascular plants. By extracting total RNA from freshly growing shoot tissue, we conducted a survey of small RNAs in 24 vascular plant species. We find that conifers, which radiated from the other seed-bearing plants approximately 260 million years ago, fail to produce significant amounts of 24-nucleotide (nt) RNAs that are known to guide DNA methylation and heterochromatin formation in angiosperms. Instead, they synthesize a diverse population of small RNAs that are exactly 21-nt long. This finding was confirmed by high-throughput sequencing of the small RNA sequences from a conifer, Pinus contorta. A conifer EST search revealed the presence of a novel Dicer-like (DCL) family, which may be responsible for the observed change in small RNA expression. No evidence for DCL3, an enzyme that matures 24-nt RNAs in angiosperms, was found. We hypothesize that the diverse class of 21-nt RNAs found in conifers may help to maintain organization of their unusually large genomes.

Delivery of chitosan/dsRNA nanoparticles for silencing of wing development vestigial (vg) gene in Aedes aegypti mosquitoes.

Science.gov (United States)

Ramesh Kumar, D; Saravana Kumar, P; Gandhi, M Rajiv; Al-Dhabi, Naif Abdullah; Paulraj, M Gabriel; Ignacimuthu, S

2016-05-01

RNA interference (RNAi) has been used as a gene silencing strategy by the introduction of long double stranded RNA (dsRNA) for the control of pest insects. The aim of the present study was to examine whether the expression of vg gene which is responsible for wing development, can be repressed by chitosan/dsRNA based nanoparticles in Aedes aegypti. The vestigial gene (vg) was amplified from adult mosquito and cloned in pLitmus28i vector. Genetically engineered recombinant plasmid was transformed into RNase III deficient strain for synthesis of bacterially expressed dsRNA. Nanoparticles were prepared via electrostatic interaction between cationic polymer chitosan and anionic nucleic acids (dsRNA). The formation of chitosan/dsRNAnanoparticles and their size were confirmed by Atomic force microscopy (AFM). Chitosan/dsRNA mediated knockdown of Enhanced Green Fluorescence Protein (EGFP) was demonstrated in Sf21 cells. Further, we tested whether such an approach could be used to target vg gene in Ae. aegypti. The results showed that chitosan/dsRNA caused significant mortality, delayed growth development and caused adult wing-malformation. A qRT-PCR analysis confirmed that the chitosan/dsRNA mediated transcriptional level was downregulated. Our findings suggest that vg gene intervention strategies through RNAi can emerge as viable option for pest control. Copyright © 2016 Elsevier B.V. All rights reserved.

Low-weight polyethylenimine cross-linked 2-hydroxypopyl-ß-cyclodextrin and folic acid as an efficient and nontoxic siRNA carrier for gene silencing and tumor inhibition by VEGF siRNA

Directory of Open Access Journals (Sweden)

Li JM

2013-06-01

Full Text Available Jin-Ming Li, Yuan-Yuan Wang, Wei Zhang, Hua Su, Liang-Nian Ji, Zong-Wan Mao MOE Key Laboratory of Bioinorganic and Synthetic Chemistry, School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou, People's Republic of China Background: Targeted delivery of small interfering RNA (siRNA has been regarded as one of the most important technologies for the development of siRNA therapeutics. However, the need for safe and efficient delivery systems is a barrier to further development of RNA interference therapeutics. In this work, a nontoxic and efficient siRNA carrier delivery system of low molecular weight polyethyleneimine (PEI-600 Da cross-linked with 2-hydroxypopyl-β-cyclodextrin (HP-β-CD and folic acid (FA was synthesized for biomedical application. Methods: The siRNA carrier was prepared using a simple method and characterized by nuclear magnetic resonance and Fourier transform infrared spectroscopy. The siRNA carrier nanoparticles were characterized in terms of morphology, size and zeta potential, stability, efficiency of delivery, and gene silencing efficiency in vitro and in vivo. Results: The siRNA carrier was synthesized successfully. It showed good siRNA binding capacity and ability to protect siRNA. Further, the toxicity of the carrier measured in vitro and in vivo appeared to be negligible, probably because of degradation of the low molecular weight PEI and HP-β-CD in the cytosol. Flow cytometry and confocal microscopy confirmed that the FA receptor-mediated endocytosis of the FA-HP-β-CD-PEI/siRNA complexes was greater than that of the HP-β-CD-PEI/siRNA complexes in FA receptor-enriched HeLa cells. The FA-HP-β-CD-PEI/siRNA complexes also demonstrated excellent gene silencing efficiency in vitro (in the range of 90%, and reduced vascular endothelial growth factor (VEGF protein expression in the presence of 20% serum. FA-HP-β-CD-PEI/siRNA complexes administered via tail vein injection resulted in marked

Host-Induced Gene Silencing of Rice Blast Fungus Magnaporthe oryzae Pathogenicity Genes Mediated by the Brome Mosaic Virus.

Science.gov (United States)

Zhu, Lin; Zhu, Jian; Liu, Zhixue; Wang, Zhengyi; Zhou, Cheng; Wang, Hong

2017-09-26

Magnaporthe oryzae is a devastating plant pathogen, which has a detrimental impact on rice production worldwide. Despite its agronomical importance, some newly-emerging pathotypes often overcome race-specific disease resistance rapidly. It is thus desirable to develop a novel strategy for the long-lasting resistance of rice plants to ever-changing fungal pathogens. Brome mosaic virus (BMV)-induced RNA interference (RNAi) has emerged as a useful tool to study host-resistance genes for rice blast protection. Planta-generated silencing of targeted genes inside biotrophic pathogens can be achieved by expression of M. oryzae -derived gene fragments in the BMV-mediated gene silencing system, a technique termed host-induced gene silencing (HIGS). In this study, the effectiveness of BMV-mediated HIGS in M. oryzae was examined by targeting three predicted pathogenicity genes, MoABC1, MoMAC1 and MoPMK1 . Systemic generation of fungal gene-specific small interfering RNA (siRNA) molecules induced by inoculation of BMV viral vectors inhibited disease development and reduced the transcription of targeted fungal genes after subsequent M. oryzae inoculation. Combined introduction of fungal gene sequences in sense and antisense orientation mediated by the BMV silencing vectors significantly enhanced the efficiency of this host-generated trans-specific RNAi, implying that these fungal genes played crucial roles in pathogenicity. Collectively, our results indicated that BMV-HIGS system was a great strategy for protecting host plants against the invasion of pathogenic fungi.

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

Increased RNA-induced silencing complex (RISC) activity contributes to hepatocellular carcinoma.

Science.gov (United States)

Yoo, Byoung Kwon; Santhekadur, Prasanna K; Gredler, Rachel; Chen, Dong; Emdad, Luni; Bhutia, Sujit; Pannell, Lewis; Fisher, Paul B; Sarkar, Devanand

2011-05-01

There is virtually no effective treatment for advanced hepatocellular carcinoma (HCC) and novel targets need to be identified to develop effective treatment. We recently documented that the oncogene Astrocyte elevated gene-1 (AEG-1) plays a seminal role in hepatocarcinogenesis. Employing yeast two-hybrid assay and coimmunoprecipitation followed by mass spectrometry, we identified staphylococcal nuclease domain containing 1 (SND1), a nuclease in the RNA-induced silencing complex (RISC) facilitating RNAi-mediated gene silencing, as an AEG-1 interacting protein. Coimmunoprecipitation and colocalization studies confirmed that AEG-1 is also a component of RISC and both AEG-1 and SND1 are required for optimum RISC activity facilitating small interfering RNA (siRNA) and micro RNA (miRNA)-mediated silencing of luciferase reporter gene. In 109 human HCC samples SND1 was overexpressed in ≈74% cases compared to normal liver. Correspondingly, significantly higher RISC activity was observed in human HCC cells compared to immortal normal hepatocytes. Increased RISC activity, conferred by AEG-1 or SND1, resulted in increased degradation of tumor suppressor messenger RNAs (mRNAs) that are target of oncomiRs. Inhibition of enzymatic activity of SND1 significantly inhibited proliferation of human HCC cells. As a corollary, stable overexpression of SND1 augmented and siRNA-mediated inhibition of SND1 abrogated growth of human HCC cells in vitro and in vivo, thus revealing a potential role of SND1 in hepatocarcinogenesis. We unravel a novel mechanism that overexpression of AEG-1 and SND1 leading to increased RISC activity might contribute to hepatocarcinogenesis. Targeted inhibition of SND1 enzymatic activity might be developed as an effective therapy for HCC. Copyright © 2011 American Association for the Study of Liver Diseases.

MicroRNA silencing in primates: towards development of novel therapeutics

DEFF Research Database (Denmark)

Petri, Andreas; Lindow, Morten; Kauppinen, Sakari

2009-01-01

MicroRNAs (miRNA) comprise an abundant class of small noncoding RNAs that act as important posttranscriptional regulators of gene expression. Accumulating evidence showing that aberrantly expressed miRNAs play important roles in human cancers underscores them as potential targets for therapeutic ...... intervention. Recent reports on efficient miRNA silencing in rodents and nonhuman primates using high-affinity targeting by chemically modified antisense oligonucleotides highlight the utility of such compounds in the development of miRNA-based cancer therapeutics....

Genetic variability and evolutionary implications of RNA silencing suppressor genes in RNA1 of sweet potato chlorotic stunt virus isolates infecting sweetpotato and related wild species.

Directory of Open Access Journals (Sweden)

Arthur K Tugume

Full Text Available BACKGROUND: The bipartite single-stranded RNA genome of Sweet potato chlorotic stunt virus (SPCSV, genus Crinivirus; Closteroviridae encodes a Class 1 RNase III (RNase3, a putative hydrophobic protein (p7 and a 22-kDa protein (p22 from genes located in RNA1. RNase3 and p22 suppress RNA silencing, the basal antiviral defence mechanism in plants. RNase3 is sufficient to render sweetpotato (Ipomoea batatas virus-susceptible and predisposes it to development of severe diseases following infection with unrelated virus. The incidence, strains and gene content of SPCSV infecting wild plant species have not been studied. METHODOLOGY/PRINCIPAL FINDINGS: Thirty SPCSV isolates were characterized from 10 wild Ipomoea species, Hewittia sublobata or Lepistemon owariensis (family Convolvulaceae in Uganda and compared with 34 local SPCSV isolates infecting sweetpotatoes. All isolates belonged to the East African (EA strain of SPCSV and contained RNase3 and p7, but p22 was not detected in six isolates. The three genes showed only limited genetic variability and the proteins were under purifying selection. SPCSV isolates lacking p22 synergized with Sweet potato feathery mottle virus (SPFMV, genus potyvirus; Potyviridae and caused severe symptoms in co-infected sweetpotato plants. One SPCSV isolate enhanced accumulation of SPFMV, but no severe symptoms developed. A new whitefly-transmitted virus (KML33b encoding an RNase3 homolog (<56% identity to SPCSV RNase3 able to suppresses sense-mediated RNA silencing was detected in I. sinensis. CONCLUSIONS/SIGNIFICANCE: SPCSV isolates infecting wild species and sweetpotato in Uganda were genetically undifferentiated, suggesting inter-species transmission of SPCSV. Most isolates in Uganda contained p22, unlike SPCSV isolates characterized from other countries and continents. Enhanced accumulation of SPFMV and increased disease severity were found to be uncoupled phenotypic outcomes of RNase3-mediated viral synergism in

Surface coating of siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers: enhanced gene silencing and reduced adverse effects in vitro

Science.gov (United States)

Zeng, Xianghui; de Groot, Anne Marit; Sijts, Alice J. A. M.; Broere, Femke; Oude Blenke, Erik; Colombo, Stefano; van Eden, Willem; Franzyk, Henrik; Nielsen, Hanne Mørck; Foged, Camilla

2015-11-01

Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine and homoarginine residues was shown to self-assemble with small interfering RNA (siRNA). The resulting well-defined nanocomplexes were coated with anionic lipids giving rise to net anionic liposomes. These complexes and the corresponding liposomes were optimized towards efficient gene silencing and low adverse effects. The optimal anionic liposomes mediated a high silencing effect, which was comparable to that of the control (cationic Lipofectamine 2000), and did not display any noticeable cytotoxicity and immunogenicity in vitro. In contrast, the corresponding nanocomplexes mediated a reduced silencing effect with a more narrow safety window. The surface coating with anionic lipid bilayers led to partial decomplexation of the siRNA-peptidomimetic nanocomplex core of the liposomes, which facilitated siRNA release. Additionally, the optimal anionic liposomes showed efficient intracellular uptake and endosomal escape. Therefore, these findings suggest that a more efficacious and safe formulation can be achieved by surface coating of the siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers.Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine

A Convenient In Vivo Model Using Small Interfering RNA Silencing to Rapidly Assess Skeletal Gene Function.

Directory of Open Access Journals (Sweden)

Wen Zhang

Full Text Available It is difficult to study bone in vitro because it contains various cell types that engage in cross-talk. Bone biologically links various organs, and it has thus become increasingly evident that skeletal physiology must be studied in an integrative manner in an intact animal. We developed a model using local intraosseous small interfering RNA (siRNA injection to rapidly assess the effects of a target gene on the local skeletal environment. In this model, 160-g male Sprague-Dawley rats were treated for 1-2 weeks. The left tibia received intraosseous injection of a parathyroid hormone 1 receptor (Pth1r or insulin-like growth factor 1 receptor (Igf-1r siRNA transfection complex loaded in poloxamer 407 hydrogel, and the right tibia received the same volume of control siRNA. All the tibias received an intraosseous injection of recombinant human parathyroid hormone (1-34 (rhPTH (1-34 or insulin-like growth factor-1 (IGF-1. Calcein green and alizarin red were injected 6 and 2 days before euthanasia, respectively. IGF-1R and PTH1R expression levels were detected via RT-PCR assays and immunohistochemistry. Bone mineral density (BMD, microstructure, mineral apposition rates (MARs, and strength were determined by dual-energy X-ray absorptiometry, micro-CT, histology and biomechanical tests. The RT-PCR and immunohistochemistry results revealed that IGF-1R and PTH1R expression levels were dramatically diminished in the siRNA-treated left tibias compared to the right tibias (both p<0.05. Using poloxamer 407 hydrogel as a controlled-release system prolonged the silencing effect of a single dose of siRNA; the mRNA expression levels of IGF-1R were lower at two weeks than at one week (p<0.01. The BMD, bone microstructure parameters, MAR and bone strength were significantly decreased in the left tibias compared to the right tibias (all p<0.05. This simple and convenient local intraosseous siRNA injection model achieved gene silencing with very small quantities of

SGS3 Cooperates with RDR6 in Triggering Geminivirus-Induced Gene Silencing and in Suppressing Geminivirus Infection in Nicotiana Benthamiana

Directory of Open Access Journals (Sweden)

Fangfang Li

2017-09-01

Full Text Available RNA silencing has an important role in defending against virus infection in plants. Plants with the deficiency of RNA silencing components often show enhanced susceptibility to viral infections. RNA-dependent RNA polymerase (RDRs mediated-antiviral defense has a pivotal role in resistance to many plant viruses. In RDR6-mediated defense against viral infection, a plant-specific RNA binding protein, Suppressor of Gene Silencing 3 (SGS3, was also found to fight against some viruses in Arabidopsis. In this study, we showed that SGS3 from Nicotiana benthamiana (NbSGS3 is required for sense-RNA induced post-transcriptional gene silencing (S-PTGS and initiating sense-RNA-triggered systemic silencing. Further, the deficiency of NbSGS3 inhibited geminivirus-induced endogenous gene silencing (GIEGS and promoted geminivirus infection. During TRV-mediated NbSGS3 or N. benthamiana RDR6 (NbRDR6 silencing process, we found that their expression can be effectively fine-tuned. Plants with the knock-down of both NbSGS3 and NbRDR6 almost totally blocked GIEGS, and were more susceptible to geminivirus infection. These data suggest that NbSGS3 cooperates with NbRDR6 against GIEGS and geminivirus infection in N. benthamiana, which provides valuable information for breeding geminivirus-resistant plants.

RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

KAUST Repository

Cernilogar, Filippo M.

2013-06-13

Background:Beyond their role in post-transcriptional gene silencing, Dicer and Argonaute, two components of the RNA interference (RNAi) machinery, were shown to be involved in epigenetic regulation of centromeric heterochromatin and transcriptional gene silencing. In particular, RNAi mechanisms appear to play a role in repeat induced silencing and some aspects of Polycomb-mediated gene silencing. However, the functional interplay of RNAi mechanisms and Polycomb group (PcG) pathways at endogenous loci remains to be elucidated.Principal Findings:Here we show that the endogenous Dicer-2/Argonaute-2 RNAi pathway is dispensable for the PcG mediated silencing of the homeotic Bithorax Complex (BX-C). Although Dicer-2 depletion triggers mild transcriptional activation at Polycomb Response Elements (PREs), this does not induce transcriptional changes at PcG-repressed genes. Moreover, Dicer-2 is not needed to maintain global levels of methylation of lysine 27 of histone H3 and does not affect PRE-mediated higher order chromatin structures within the BX-C. Finally bioinformatic analysis, comparing published data sets of PcG targets with Argonaute-2-bound small RNAs reveals no enrichment of these small RNAs at promoter regions associated with PcG proteins.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

The Polerovirus F box protein P0 targets ARGONAUTE1 to suppress RNA silencing.

Science.gov (United States)

Bortolamiol, Diane; Pazhouhandeh, Maghsoud; Marrocco, Katia; Genschik, Pascal; Ziegler-Graff, Véronique

2007-09-18

Plants employ post-transcriptional gene silencing (PTGS) as an antiviral defense response. In this mechanism, viral-derived small RNAs are incorporated into the RNA-induced silencing complex (RISC) to guide degradation of the corresponding viral RNAs. ARGONAUTE1 (AGO1) is a key component of RISC: it carries the RNA slicer activity. As a counter-defense, viruses have evolved various proteins that suppress PTGS. Recently, we showed that the Polerovirus P0 protein carries an F box motif required to form an SCF-like complex, which is also essential for P0's silencing suppressor function. Here, we investigate the molecular mechanism by which P0 impairs PTGS. First we show that P0's expression does not affect the biogenesis of primary siRNAs in an inverted repeat-PTGS assay, but it does affect their activity. Moreover, P0's expression in transformed Arabidopsis plants leads to various developmental abnormalities reminiscent of mutants affected in miRNA pathways, which is accompanied by enhanced levels of several miRNA-target transcripts, suggesting that P0 acts at the level of RISC. Interestingly, ectopic expression of P0 triggered AGO1 protein decay in planta. Finally, we provide evidence that P0 physically interacts with AGO1. Based on these results, we propose that P0 hijacks the host SCF machinery to modulate gene silencing by destabilizing AGO1.

Functional gene silencing mediated by chitosan/siRNA nanocomplexes

Energy Technology Data Exchange (ETDEWEB)

Ji, A M; Su, D; Che, O; Li, W S; Sun, L; Zhang, Z Y; Xu, F [Department of Pharmaceutical Science, Zhujiang Hospital, Southern Medical University, Guangzhou 510282 (China); Yang, B, E-mail: andrewfxu1998@gmail.co [Department of Chemistry, Indiana University-Bloomington, Bloomington, IN 47405 (United States)

2009-10-07

Chitosan/siRNA nanoparticles to knock down FHL2 gene expression were reported in this work. The physicochemical properties such as particle size, surface charge, morphology and complex stability of chitosan nanoparticle-incorporated siRNA were evaluated. Nanoparticles which were formulated with chitosan/siRNA exhibited irregular, lamellar and dendritic structures with a hydrodynamic radius size of about 148 nm and net positive charges with zeta-potential value of 58.5 mV. The knockdown effect of the chitosan/siRNA nanoparticles on gene expression in FHL2 over-expressed human colorectal cancer Lovo cells was investigated. The result showed that FHL2 siRNA formulated within chitosan nanoparticles could knock down about 69.6% FHL2 gene expression, which is very similar to the 68.8% reduced gene expression when siRNA was transfected with liposome Lipofectamine. Western analysis further showed significant FHL-2 protein expression reduced by the chitosan/siRNA nanoparticles. The results also showed that blocking FHL2 expression by siRNA could also inhibit the growth and proliferation of human colorectal cancer Lovo cells. The current results demonstrated that chitosan-based siRNA nanoparticles were a very efficient delivery system for siRNA in vivo as previously reported.

Functional gene silencing mediated by chitosan/siRNA nanocomplexes

International Nuclear Information System (INIS)

Ji, A M; Su, D; Che, O; Li, W S; Sun, L; Zhang, Z Y; Xu, F; Yang, B

2009-01-01

Chitosan/siRNA nanoparticles to knock down FHL2 gene expression were reported in this work. The physicochemical properties such as particle size, surface charge, morphology and complex stability of chitosan nanoparticle-incorporated siRNA were evaluated. Nanoparticles which were formulated with chitosan/siRNA exhibited irregular, lamellar and dendritic structures with a hydrodynamic radius size of about 148 nm and net positive charges with zeta-potential value of 58.5 mV. The knockdown effect of the chitosan/siRNA nanoparticles on gene expression in FHL2 over-expressed human colorectal cancer Lovo cells was investigated. The result showed that FHL2 siRNA formulated within chitosan nanoparticles could knock down about 69.6% FHL2 gene expression, which is very similar to the 68.8% reduced gene expression when siRNA was transfected with liposome Lipofectamine. Western analysis further showed significant FHL-2 protein expression reduced by the chitosan/siRNA nanoparticles. The results also showed that blocking FHL2 expression by siRNA could also inhibit the growth and proliferation of human colorectal cancer Lovo cells. The current results demonstrated that chitosan-based siRNA nanoparticles were a very efficient delivery system for siRNA in vivo as previously reported.

Plasmodium falciparum var Gene Silencing Is Determined by cis DNA Elements That Form Stable and Heritable Interactions ▿

Science.gov (United States)

Swamy, Lakshmi; Amulic, Borko; Deitsch, Kirk W.

2011-01-01

Antigenic variation in the human malaria parasite Plasmodium falciparum depends on the transcriptional regulation of the var gene family. In each individual parasite, mRNA is expressed exclusively from 1 var gene out of ∼60, while the rest of the genes are transcriptionally silenced. Both modifications to chromatin structure and DNA regulatory elements associated with each var gene have been implicated in the organization and maintenance of the silent state. Whether silencing is established at the level of entire chromosomal regions via heterochromatin spreading or at the level of individual var promoters through the action of a silencing element within each var intron has been debated. Here, we consider both possibilities, using clonal parasite lines carrying chromosomally integrated transgenes. We confirm a previous finding that the loss of an adjacent var intron results in var promoter activation and further show that transcriptional activation of a var promoter within a cluster does not affect the transcriptional activity of neighboring var promoters. Our results provide more evidence for the hypothesis that var genes are primarily silenced at the level of an individual gene, rather than by heterochromatin spreading. We also tested the intrinsic directionality of an intron's silencing effect on upstream or downstream var promoters. We found that an intron is capable of silencing in either direction and that, once established, a var promoter-intron pair is stably maintained through many generations, suggesting a possible role in epigenetic memory. This study provides insights into the regulation of endogenous var gene clusters. PMID:21317310

Novel RNA Duplex Locks HIV-1 in a Latent State via Chromatin-mediated Transcriptional Silencing

Directory of Open Access Journals (Sweden)

Chantelle Ahlenstiel

2015-01-01

Full Text Available Transcriptional gene silencing (TGS of mammalian genes can be induced by short interfering RNA (siRNA targeting promoter regions. We previously reported potent TGS of HIV-1 by siRNA (PromA, which targets tandem NF-κB motifs within the viral 5′LTR. In this study, we screened a siRNA panel with the aim of identifying novel 5′LTR targets, to provide multiplexing potential with enhanced viral silencing and application toward developing alternate therapeutic strategies. Systematic examination identified a novel siRNA target, si143, confirmed to induce TGS as the silencing mechanism. TGS was prolonged with virus suppression >12 days, despite a limited ability to induce post- TGS. Epigenetic changes associated with silencing were suggested by partial reversal by histone deacetylase inhibitors and confirmed by chromatin immunoprecipitation analyses, which showed induction of H3K27me3 and H3K9me3, reduction in H3K9Ac, and recruitment of argonaute-1, all characteristic marks of heterochromatin and TGS. Together, these epigenetic changes mimic those associated with HIV-1 latency. Further, robust resistance to reactivation was observed in the J-Lat 9.2 cell latency model, when transduced with shPromA and/or sh143. These data support si/shRNA-mediated TGS approaches to HIV-1 and provide alternate targets to pursue a functional cure, whereby the viral reservoir is locked in latency following antiretroviral therapy cessation.

Silencing of HaAce1 gene by host-delivered artificial microRNA disrupts growth and development of Helicoverpa armigera.

Science.gov (United States)

Saini, Ravi Prakash; Raman, Venkat; Dhandapani, Gurusamy; Malhotra, Era Vaidya; Sreevathsa, Rohini; Kumar, Polumetla Ananda; Sharma, Tilak R; Pattanayak, Debasis

2018-01-01

The polyphagous insect-pest, Helicoverpa armigera, is a serious threat to a number of economically important crops. Chemical application and/or cultivation of Bt transgenic crops are the two strategies available now for insect-pest management. However, environmental pollution and long-term sustainability are major concerns against these two options. RNAi is now considered as a promising technology to complement Bt to tackle insect-pests menace. In this study, we report host-delivered silencing of HaAce1 gene, encoding the predominant isoform of H. armigera acetylcholinesterase, by an artificial microRNA, HaAce1-amiR1. Arabidopsis pre-miRNA164b was modified by replacing miR164b/miR164b* sequences with HaAce1-amiR1/HaAce1-amiR1* sequences. The recombinant HaAce1-preamiRNA1 was put under the control of CaMV 35S promoter and NOS terminator of plant binary vector pBI121, and the resultant vector cassette was used for tobacco transformation. Two transgenic tobacco lines expressing HaAce1-amiR1 was used for detached leaf insect feeding bioassays. Larval mortality of 25% and adult deformity of 20% were observed in transgenic treated insect group over that control tobacco treated insect group. The reduction in the steady-state level of HaAce1 mRNA was 70-80% in the defective adults compared to control. Our results demonstrate promise for host-delivered amiRNA-mediated silencing of HaAce1 gene for H. armigera management.

The RNA silencing pathway: the bits and pieces that matter.

Directory of Open Access Journals (Sweden)

2005-07-01

Full Text Available Cellular pathways are generally proposed on the basis of available experimental knowledge. The proposed pathways, however, may be inadequate to describe the phenomena they are supposed to explain. For instance, by means of concise mathematical models we are able to reveal shortcomings in the current description of the pathway of RNA silencing. The silencing pathway operates by cleaving siRNAs from dsRNA. siRNAs can associate with RISC, leading to the degradation of the target mRNA. We propose and analyze a few small extensions to the pathway: a siRNA degrading RNase, primed amplification of aberrant RNA pieces, and cooperation between aberrant RNA to trigger amplification. These extensions allow for a consistent explanation for various types of silencing phenomena, such as virus induced silencing, transgene and transposon induced silencing, and avoidance of self-reactivity, as well as for differences found between species groups.

Antiviral RNA silencing viral counter defense in plants

NARCIS (Netherlands)

Bucher, E.C.

2006-01-01

The research described in this thesis centres around the mechanism of RNA silencing in relation to virus-host interaction, an area of increasing importance. It shows how this recently disclosed mechanism can be used to produce virus-resistant plants. Based on the activity of the RNA silencing

Alfalfa dwarf cytorhabdovirus P protein is a local and systemic RNA silencing supressor which inhibits programmed RISC activity and prevents transitive amplification of RNA silencing.

Science.gov (United States)

Bejerman, Nicolás; Mann, Krin S; Dietzgen, Ralf G

2016-09-15

Plants employ RNA silencing as an innate defense mechanism against viruses. As a counter-defense, plant viruses have evolved to express RNA silencing suppressor proteins (RSS), which target one or more steps of the silencing pathway. In this study, we show that the phosphoprotein (P) encoded by the negative-sense RNA virus alfalfa dwarf virus (ADV), a species of the genus Cytorhabdovirus, family Rhabdoviridae, is a suppressor of RNA silencing. ADV P has a relatively weak local RSS activity, and does not prevent siRNA accumulation. On the other hand, ADV P strongly suppresses systemic RNA silencing, but does not interfere with the short-distance spread of silencing, which is consistent with its lack of inhibition of siRNA accumulation. The mechanism of suppression appears to involve ADV P binding to RNA-induced silencing complex proteins AGO1 and AGO4 as shown in protein-protein interaction assays when ectopically expressed. In planta, we demonstrate that ADV P likely functions by inhibiting miRNA-guided AGO1 cleavage and prevents transitive amplification by repressing the production of secondary siRNAs. As recently described for lettuce necrotic yellows cytorhabdovirus P, but in contrast to other viral RSS known to disrupt AGO activity, ADV P sequence does not contain any recognizable GW/WG or F-box motifs, which suggests that cytorhabdovirus P proteins may use alternative motifs to bind to AGO proteins. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

International Nuclear Information System (INIS)

Anesti, Anna-Maria; Simpson, Guy R; Price, Toby; Pandha, Hardev S; Coffin, Robert S

2010-01-01

Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEX GM-CSF , we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials

Inhibition of human esophageal squamous cell carcinomas by targeted silencing of tumor enhancer genes: an overview

International Nuclear Information System (INIS)

Islamian, Jalil Pirayesh; Mohammadi, Mohsen; Baradaran, Behzad

2014-01-01

Esophageal cancer has been reported as the ninth most common malignancy and ranks as the sixth most frequent cause of death worldwide. Esophageal cancer treatment involves surgery, chemotherapy, radiation therapy, or combination therapy. Novel strategies are needed to boost the oncologic outcome. Recent advances in the molecular biology of esophageal cancer have documented the role of genetic alterations in tumorigenesis. Oncogenes serve a pivotal function in tumorigenesis. Targeted therapies are directed at the unique molecular signature of cancer cells for enhanced efficacy with low toxicity. RNA interference (RNAi) technology is a powerful tool for silencing endogenous or exogenous genes in mammalian cells. Related results have shown that targeting oncogenes with siRNAs, specifically the mRNA, effectively reduces tumor cell proliferation and induces apoptotic cell death. This article will briefly review studies on silencing tumor enhancer genes related to the induction of esophageal cancer

RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops

OpenAIRE

Guo, Qigao; Liu, Qing; Smith, Neil A.; Liang, Guolu; Wang, Ming-Bo

2016-01-01

Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing ...

Illuminating the gateway of gene silencing: perspective of RNA interference technology in clinical therapeutics.

Science.gov (United States)

Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok

2012-07-01

A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.

Interplays between soil-borne plant viruses and RNA silencing-mediated antiviral defense in roots

Directory of Open Access Journals (Sweden)

Ida Bagus Andika

2016-09-01

Full Text Available Although the majority of plant viruses are transmitted by arthropod vectors and invade the host plants through the aerial parts, there is a considerable number of plant viruses that infect roots via soil-inhabiting vectors such as plasmodiophorids, chytrids, and nematodes. These soil-borne viruses belong to diverse families, and many of them cause serious diseases in major crop plants. Thus, roots are important organs for the life cycle of many viruses. Compared to shoots, roots have a distinct metabolism and particular physiological characteristics due to the differences in development, cell composition, gene expression patterns, and surrounding environmental conditions. RNA silencing is an important innate defense mechanism to combat virus infection in plants, but the specific information on the activities and molecular mechanism of RNA silencing-mediated viral defense in root tissue is still limited. In this review, we summarize and discuss the current knowledge regarding RNA silencing aspects of the interactions between soil-borne viruses and host plants. Overall, research evidence suggests that soil-borne viruses have evolved to adapt to the distinct mechanism of antiviral RNA silencing in roots.

The Ebola virus VP35 protein is a suppressor of RNA silencing

NARCIS (Netherlands)

Haasnoot, J.; Vries, de W.; Geutjes, E.J.; Prins, M.W.; Haan, de P.; Berkhout, B.

2007-01-01

RNA silencing or interference (RNAi) is a gene regulation mechanism in eukaryotes that controls cell differentiation and developmental processes via expression of microRNAs. RNAi also serves as an innate antiviral defence response in plants, nematodes, and insects. This antiviral response is

Small RNA-directed epigenetic natural variation in Arabidopsis thaliana.

Directory of Open Access Journals (Sweden)

Jixian Zhai

2008-04-01

Full Text Available Progress in epigenetics has revealed mechanisms that can heritably regulate gene function independent of genetic alterations. Nevertheless, little is known about the role of epigenetics in evolution. This is due in part to scant data on epigenetic variation among natural populations. In plants, small interfering RNA (siRNA is involved in both the initiation and maintenance of gene silencing by directing DNA methylation and/or histone methylation. Here, we report that, in the model plant Arabidopsis thaliana, a cluster of approximately 24 nt siRNAs found at high levels in the ecotype Landsberg erecta (Ler could direct DNA methylation and heterochromatinization at a hAT element adjacent to the promoter of FLOWERING LOCUS C (FLC, a major repressor of flowering, whereas the same hAT element in ecotype Columbia (Col with almost identical DNA sequence, generates a set of low abundance siRNAs that do not direct these activities. We have called this hAT element MPF for Methylated region near Promoter of FLC, although de novo methylation triggered by an inverted repeat transgene at this region in Col does not alter its FLC expression. DNA methylation of the Ler allele MPF is dependent on genes in known silencing pathways, and such methylation is transmissible to Col by genetic crosses, although with varying degrees of penetrance. A genome-wide comparison of Ler and Col small RNAs identified at least 68 loci matched by a significant level of approximately 24 nt siRNAs present specifically in Ler but not Col, where nearly half of the loci are related to repeat or TE sequences. Methylation analysis revealed that 88% of the examined loci (37 out of 42 were specifically methylated in Ler but not Col, suggesting that small RNA can direct epigenetic differences between two closely related Arabidopsis ecotypes.

Suppressors of RNA silencing encoded by tomato leaf curl ...

Indian Academy of Sciences (India)

2013-01-06

Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.

The C. elegans CSR-1 argonaute pathway counteracts epigenetic silencing to promote germline gene expression.

Science.gov (United States)

Seth, Meetu; Shirayama, Masaki; Gu, Weifeng; Ishidate, Takao; Conte, Darryl; Mello, Craig C

2013-12-23

Organisms can develop adaptive sequence-specific immunity by reexpressing pathogen-specific small RNAs that guide gene silencing. For example, the C. elegans PIWI-Argonaute/piwi-interacting RNA (piRNA) pathway recruits RNA-dependent RNA polymerase (RdRP) to foreign sequences to amplify a transgenerational small-RNA-induced epigenetic silencing signal (termed RNAe). Here, we provide evidence that, in addition to an adaptive memory of silenced sequences, C. elegans can also develop an opposing adaptive memory of expressed/self-mRNAs. We refer to this mechanism, which can prevent or reverse RNAe, as RNA-induced epigenetic gene activation (RNAa). We show that CSR-1, which engages RdRP-amplified small RNAs complementary to germline-expressed mRNAs, is required for RNAa. We show that a transgene with RNAa activity also exhibits accumulation of cognate CSR-1 small RNAs. Our findings suggest that C. elegans adaptively acquires and maintains a transgenerational CSR-1 memory that recognizes and protects self-mRNAs, allowing piRNAs to recognize foreign sequences innately, without the need for prior exposure

A dominant mutation in mediator of paramutation2, one of three second-largest subunits of a plant-specific RNA polymerase, disrupts multiple siRNA silencing processes.

Science.gov (United States)

Sidorenko, Lyudmila; Dorweiler, Jane E; Cigan, A Mark; Arteaga-Vazquez, Mario; Vyas, Meenal; Kermicle, Jerry; Jurcin, Diane; Brzeski, Jan; Cai, Yu; Chandler, Vicki L

2009-11-01

Paramutation involves homologous sequence communication that leads to meiotically heritable transcriptional silencing. We demonstrate that mop2 (mediator of paramutation2), which alters paramutation at multiple loci, encodes a gene similar to Arabidopsis NRPD2/E2, the second-largest subunit of plant-specific RNA polymerases IV and V. In Arabidopsis, Pol-IV and Pol-V play major roles in RNA-mediated silencing and a single second-largest subunit is shared between Pol-IV and Pol-V. Maize encodes three second-largest subunit genes: all three genes potentially encode full length proteins with highly conserved polymerase domains, and each are expressed in multiple overlapping tissues. The isolation of a recessive paramutation mutation in mop2 from a forward genetic screen suggests limited or no functional redundancy of these three genes. Potential alternative Pol-IV/Pol-V-like complexes could provide maize with a greater diversification of RNA-mediated transcriptional silencing machinery relative to Arabidopsis. Mop2-1 disrupts paramutation at multiple loci when heterozygous, whereas previously silenced alleles are only up-regulated when Mop2-1 is homozygous. The dramatic reduction in b1 tandem repeat siRNAs, but no disruption of silencing in Mop2-1 heterozygotes, suggests the major role for tandem repeat siRNAs is not to maintain silencing. Instead, we hypothesize the tandem repeat siRNAs mediate the establishment of the heritable silent state-a process fully disrupted in Mop2-1 heterozygotes. The dominant Mop2-1 mutation, which has a single nucleotide change in a domain highly conserved among all polymerases (E. coli to eukaryotes), disrupts both siRNA biogenesis (Pol-IV-like) and potentially processes downstream (Pol-V-like). These results suggest either the wild-type protein is a subunit in both complexes or the dominant mutant protein disrupts both complexes. Dominant mutations in the same domain in E. coli RNA polymerase suggest a model for Mop2-1 dominance

STAT3 Gene Silencing by Aptamer-siRNA Chimera as Selective Therapeutic for Glioblastoma

Directory of Open Access Journals (Sweden)

Carla Lucia Esposito

2018-03-01

Full Text Available Glioblastoma (GBM is the most frequent and aggressive primary brain tumor in adults, and despite advances in neuro-oncology, the prognosis for patients remains dismal. The signal transducer and activator of transcription-3 (STAT3 has been reported as a key regulator of the highly aggressive mesenchymal GBM subtype, and its direct silencing (by RNAi oligonucleotides has revealed a great potential as an anti-cancer therapy. However, clinical use of oligonucleotide-based therapies is dependent on safer ways for tissue-specific targeting and increased membrane penetration. The objective of this study is to explore the use of nucleic acid aptamers as carriers to specifically drive a STAT3 siRNA to GBM cells in a receptor-dependent manner. Using an aptamer that binds to and antagonizes the oncogenic receptor tyrosine kinase PDGFRβ (Gint4.T, here we describe the design of a novel aptamer-siRNA chimera (Gint4.T-STAT3 to target STAT3. We demonstrate the efficient delivery and silencing of STAT3 in PDGFRβ+ GBM cells. Importantly, the conjugate reduces cell viability and migration in vitro and inhibits tumor growth and angiogenesis in vivo in a subcutaneous xenograft mouse model. Our data reveals Gint4.T-STAT3 conjugate as a novel molecule with great translational potential for GBM therapy.

Persistent interferon transgene expression by RNA interference-mediated silencing of interferon receptors.

Science.gov (United States)

Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu

2010-09-01

The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

2016-11-09

Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

Genome-Wide DNA Methylation Indicates Silencing of Tumor Suppressor Genes in Uterine Leiomyoma

Science.gov (United States)

Navarro, Antonia; Yin, Ping; Monsivais, Diana; Lin, Simon M.; Du, Pan; Wei, Jian-Jun; Bulun, Serdar E.

2012-01-01

Background Uterine leiomyomas, or fibroids, represent the most common benign tumor of the female reproductive tract. Fibroids become symptomatic in 30% of all women and up to 70% of African American women of reproductive age. Epigenetic dysregulation of individual genes has been demonstrated in leiomyoma cells; however, the in vivo genome-wide distribution of such epigenetic abnormalities remains unknown. Principal Findings We characterized and compared genome-wide DNA methylation and mRNA expression profiles in uterine leiomyoma and matched adjacent normal myometrial tissues from 18 African American women. We found 55 genes with differential promoter methylation and concominant differences in mRNA expression in uterine leiomyoma versus normal myometrium. Eighty percent of the identified genes showed an inverse relationship between DNA methylation status and mRNA expression in uterine leiomyoma tissues, and the majority of genes (62%) displayed hypermethylation associated with gene silencing. We selected three genes, the known tumor suppressors KLF11, DLEC1, and KRT19 and verified promoter hypermethylation, mRNA repression and protein expression using bisulfite sequencing, real-time PCR and western blot. Incubation of primary leiomyoma smooth muscle cells with a DNA methyltransferase inhibitor restored KLF11, DLEC1 and KRT19 mRNA levels. Conclusions These results suggest a possible functional role of promoter DNA methylation-mediated gene silencing in the pathogenesis of uterine leiomyoma in African American women. PMID:22428009

AGO/RISC-mediated antiviral RNA silencing in a plant in vitro system.

Science.gov (United States)

Schuck, Jana; Gursinsky, Torsten; Pantaleo, Vitantonio; Burgyán, Jozsef; Behrens, Sven-Erik

2013-05-01

AGO/RISC-mediated antiviral RNA silencing, an important component of the plant's immune response against RNA virus infections, was recapitulated in vitro. Cytoplasmic extracts of tobacco protoplasts were applied that supported Tombusvirus RNA replication, as well as the formation of RNA-induced silencing complexes (RISC) that could be functionally reconstituted with various plant ARGONAUTE (AGO) proteins. For example, when RISC containing AGO1, 2, 3 or 5 were programmed with exogenous siRNAs that specifically targeted the viral RNA, endonucleolytic cleavages occurred and viral replication was inhibited. Antiviral RNA silencing was disabled by the viral silencing suppressor p19 when this was present early during RISC formation. Notably, with replicating viral RNA, only (+)RNA molecules were accessible to RISC, whereas (-)RNA replication intermediates were not. The vulnerability of viral RNAs to RISC activity also depended on the RNA structure of the target sequence. This was most evident when we characterized viral siRNAs (vsiRNAs) that were particularly effective in silencing with AGO1- or AGO2/RISC. These vsiRNAs targeted similar sites, suggesting that accessible parts of the viral (+)RNA may be collectively attacked by different AGO/RISC. The in vitro system was, hence, established as a valuable tool to define and characterize individual molecular determinants of antiviral RNA silencing.

Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

Science.gov (United States)

Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

2007-09-01

The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

Gene silencing of mannose 6-phosphate reductase in the parasitic weed Orobanche aegyptiaca through the production of homologous dsRNA sequences in the host plant.

Science.gov (United States)

Aly, Radi; Cholakh, Hila; Joel, Daniel M; Leibman, Diana; Steinitz, Benjamin; Zelcer, Aaron; Naglis, Anna; Yarden, Oded; Gal-On, Amit

2009-08-01

Orobanche spp. (broomrape) are parasitic plants which subsist on the roots of a wide range of hosts, including tomato, causing severe losses in yield quality and quantity. Large amounts of mannitol accumulate in this parasitic weed during development. Mannose 6-phosphate reductase (M6PR) is a key enzyme in mannitol biosynthesis, and it has been suggested that mannitol accumulation may be very important for Orobanche development. Therefore, the Orobanche M6PR gene is a potential target for efforts to control this parasite. Transgenic tomato plants were produced bearing a gene construct containing a specific 277-bp fragment from Orobanche aegyptiaca M6PR-mRNA, in an inverted-repeat configuration. M6PR-siRNA was detected in three independent transgenic tomato lines in the R1 generation, but was not detected in the parasite. Quantitative RT-PCR analysis showed that the amount of endogenous M6PR mRNA in the tubercles and underground shoots of O. aegyptiaca grown on transgenic host plants was reduced by 60%-80%. Concomitant with M6PR mRNA suppression, there was a significant decrease in mannitol level and a significant increase in the percentage of dead O. aegyptiaca tubercles on the transgenic host plants. The detection of mir390, which is involved with cytoplasmic dsRNA processing, is the first indication of the existence of gene-silencing mechanisms in Orobanche spp. Gene silencing mechanisms are probably involved with the production of decreased levels of M6PR mRNA in the parasites grown on the transformed tomato lines.

Gene-silencing effects of anti-survivin siRNA delivered by RGDV-functionalized nanodiamond carrier in the breast carcinoma cell line MCF-7.

Science.gov (United States)

Bi, Yanzhao; Zhang, Yifan; Cui, Chunying; Ren, Lulu; Jiang, Xueyun

Nanodiamond (ND) is a renowned material in nonviral small interfering RNA (siRNA) carrier field due to its unique physical, chemical, and biological properties. In our previous work, it was proven that ND could deliver siRNA into cells efficiently and downregulate the expression of desired protein. However, synthesizing a high-efficient tumor-targeting carrier using ND is still a challenge. In this study, a novel carrier, NDCONH(CH 2 ) 2 NH-VDGR, was synthesized for siRNA delivery, and its properties were characterized with methods including Fourier transform infrared spectrometry, transmission electron microscopy, scanning electron microscopy, gel retardation assay, differential scanning calorimetry, confocal microscopy, releasing test, real-time polymerase chain reaction (PCR) assay, enzyme-linked immunosorbent assay (ELISA), flow cytometry, cytotoxicity assay, and gene-silencing efficacy assay in vitro and in vivo. The mechanism of NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA-induced tumor apoptosis was evaluated via flow cytometer assay using Annexin V-fluorescein isothiocyanate/propidium iodide staining method. The NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA nanoparticle with 60-110 nm diameter and 35.65±3.90 mV zeta potential was prepared. For real-time PCR assay, the results showed that the expression of survivin mRNA was reduced to 46.77%±6.3%. The expression of survivin protein was downregulated to 48.49%±2.25%, as evaluated by ELISA assay. MTT assay showed that NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA had an inhibitory effect on MCF-7 cell proliferation. According to these results, the survivin-siRNA could be delivered, transported, and released stably, which benefits in increasing the gene-silencing effect. Therefore, as an siRNA carrier, NDCONH(CH 2 ) 2 NH-VDGR was suggested to be used in siRNA delivery system and in cancer treatments.

Gene Silencing in Skin After Deposition of Self-Delivery siRNA With a Motorized Microneedle Array Device

Directory of Open Access Journals (Sweden)

Robyn P Hickerson

2013-01-01

Full Text Available Despite the development of potent siRNAs that effectively target genes responsible for skin disorders, translation to the clinic has been hampered by inefficient delivery through the stratum corneum barrier and into the live cells of the epidermis. Although hypodermic needles can be used to transport siRNA through the stratum corneum, this approach is limited by pain caused by the injection and the small volume of tissue that can be accessed by each injection. The use of microneedle arrays is a less painful method for siRNA delivery, but restricted payload capacity limits this approach to highly potent molecules. To address these challenges, a commercially available motorized microneedle array skin delivery device was evaluated. This device combines the positive elements of both hypodermic needles and microneedle array technologies with little or no pain to the patient. Application of fluorescently tagged self-delivery (sd-siRNA to both human and murine skin resulted in distribution throughout the treated skin. In addition, efficient silencing (78% average reduction of reporter gene expression was achieved in a transgenic fluorescent reporter mouse skin model. These results indicate that this device effectively delivers functional sd-siRNA with an efficiency that predicts successful clinical translation.

Double-stranded RNA uptake through topical application, mediates silencing of five CYP4 genes and suppresses insecticide resistance in Diaphorina citri.

Science.gov (United States)

Killiny, Nabil; Hajeri, Subhas; Tiwari, Siddharth; Gowda, Siddarame; Stelinski, Lukasz L

2014-01-01

Silencing of genes through RNA interference (RNAi) in insects has gained momentum during the past few years. RNAi has been used to cause insect mortality, inhibit insect growth, increase insecticide susceptibility, and prevent the development of insecticide resistance. We investigated the efficacy of topically applied dsRNA to induce RNAi for five Cytochrome P450 genes family 4 (CYP4) in Diaphorina citri. We previously reported that these CYP4 genes are associated with the development of insecticide resistance in D. citri. We targeted five CYP4 genes that share a consensus sequence with one dsRNA construct. Quantitative PCR confirmed suppressed expression of the five CYP4 genes as a result of dsRNA topically applied to the thoracic region of D. citri when compared to the expression levels in a control group. Western blot analysis indicated a reduced signal of cytochrome P450 proteins (45 kDa) in adult D. citri treated with the dsRNA. In addition, oxidase activity and insecticide resistance were reduced for D. citri treated with dsRNA that targeted specific CYP4 genes. Mortality was significantly higher in adults treated with dsRNA than in adults treated with water. Our results indicate that topically applied dsRNA can penetrate the cuticle of D. citri and induce RNAi. These results broaden the scope of RNAi as a mechanism to manage pests by targeting a broad range of genes. The results also support the application of RNAi as a viable tool to overcome insecticide resistance development in D. citri populations. However, further research is needed to develop grower-friendly delivery systems for the application of dsRNA under field conditions. Considering the high specificity of dsRNA, this tool can also be used for management of D. citri by targeting physiologically critical genes involved in growth and development.

Double-stranded RNA uptake through topical application, mediates silencing of five CYP4 genes and suppresses insecticide resistance in Diaphorina citri.

Directory of Open Access Journals (Sweden)

Nabil Killiny

Full Text Available Silencing of genes through RNA interference (RNAi in insects has gained momentum during the past few years. RNAi has been used to cause insect mortality, inhibit insect growth, increase insecticide susceptibility, and prevent the development of insecticide resistance. We investigated the efficacy of topically applied dsRNA to induce RNAi for five Cytochrome P450 genes family 4 (CYP4 in Diaphorina citri. We previously reported that these CYP4 genes are associated with the development of insecticide resistance in D. citri. We targeted five CYP4 genes that share a consensus sequence with one dsRNA construct. Quantitative PCR confirmed suppressed expression of the five CYP4 genes as a result of dsRNA topically applied to the thoracic region of D. citri when compared to the expression levels in a control group. Western blot analysis indicated a reduced signal of cytochrome P450 proteins (45 kDa in adult D. citri treated with the dsRNA. In addition, oxidase activity and insecticide resistance were reduced for D. citri treated with dsRNA that targeted specific CYP4 genes. Mortality was significantly higher in adults treated with dsRNA than in adults treated with water. Our results indicate that topically applied dsRNA can penetrate the cuticle of D. citri and induce RNAi. These results broaden the scope of RNAi as a mechanism to manage pests by targeting a broad range of genes. The results also support the application of RNAi as a viable tool to overcome insecticide resistance development in D. citri populations. However, further research is needed to develop grower-friendly delivery systems for the application of dsRNA under field conditions. Considering the high specificity of dsRNA, this tool can also be used for management of D. citri by targeting physiologically critical genes involved in growth and development.

Detection of the argonaute protein Ago2 and microRNAs in the RNA induced silencing complex (RISC) using a monoclonal antibody.

Science.gov (United States)

Ikeda, Keigo; Satoh, Minoru; Pauley, Kaleb M; Fritzler, Marvin J; Reeves, Westley H; Chan, Edward K L

2006-12-20

MicroRNAs (miRNAs) are short RNA molecules responsible for post-transcriptional gene silencing by the degradation or translational inhibition of their target messenger RNAs (mRNAs). This process of gene silencing, known as RNA interference (RNAi), is mediated by highly conserved Argonaute (Ago) proteins which are the key components of the RNA induced silencing complex (RISC). In humans, Ago2 is responsible for the endonuclease cleavage of targeted mRNA and it interacts with the mRNA-binding protein GW182, which is a marker for cytoplasmic foci referred to as GW bodies (GWBs). We demonstrated that the anti-Ago2 monoclonal antibody 4F9 recognized GWBs in a cell cycle dependent manner and was capable of capturing miRNAs associated with Ago2. Since Ago2 protein is the effector protein of RNAi, anti-Ago2 monoclonal antibody may be useful in capturing functional miRNAs.

PLK-1 Silencing in Bladder Cancer by siRNA Delivered With Exosomes.

Science.gov (United States)

Greco, Kristin A; Franzen, Carrie A; Foreman, Kimberly E; Flanigan, Robert C; Kuo, Paul C; Gupta, Gopal N

2016-05-01

To use exosomes as a vector to deliver small interfering ribonucleic acid (siRNA) to silence the polo-like kinase 1 (PLK-1) gene in bladder cancer cells. Exosomes were isolated from both human embryonic kidney 293 (HEK293) cell and mesenchymal stem cell (MSC) conditioned media. Fluorescently labeled exosomes were co-cultured with bladder cancer and normal epithelial cells and uptake was quantified by image cytometry. PLK-1 siRNA and negative control siRNA were loaded into HEK293 and MSC exosomes using electroporation. An invasive bladder cancer cell line (UMUC3) was co-cultured with the electroporated exosomes. Quantitative reverse transcriptase polymerase chain reaction was performed. Protein analysis was performed by Western blot. Annexin V staining and MTT assays were used to investigate effects on apoptosis and viability. Bladder cancer cell lines internalize an increased percentage of HEK293 exosomes when compared to normal bladder epithelial cells. Treatment of UMUC3 cells with exosomes electroporated with PLK-1 siRNA achieved successful knockdown of PLK-1 mRNA and protein when compared to cells treated with negative control exosomes. HEK293 and MSC exosomes were effectively used as a delivery vector to transport PLK-1 siRNA to bladder cancer cells in vitro, resulting in selective gene silencing of PLK-1. The use of exosomes as a delivery vector for potential intravesical therapy is attractive. Copyright © 2016 Elsevier Inc. All rights reserved.

Silencing effect of shRNA expression vectors with stem length of 21 ...

African Journals Online (AJOL)

Then, the recombinant plasmids were transfected into mouse embryonic fibroblast with lipofection and injected into leg muscle of mouse. The mRNA expression level of the green fluorescent protein gene was checked by real-time quantitative polymerase chain reaction (RT-PCR). The silencing effect of the 29 bp shRNA ...

The RNA gene information: retroelement-microRNA entangling as the RNA quantum code.

Science.gov (United States)

Fujii, Yoichi Robertus

2013-01-01

MicroRNA (miRNA) and retroelements may be a master of regulator in our life, which are evolutionally involved in the origin of species. To support the Darwinism from the aspect of molecular evolution process, it has tremendously been interested in the molecular information of naive RNA. The RNA wave model 2000 consists of four concepts that have altered from original idea of the miRNA genes for crosstalk among embryonic stem cells, their niche cells, and retroelements as a carrier vesicle of the RNA genes. (1) the miRNA gene as a mobile genetic element induces transcriptional and posttranscriptional silencing via networking-processes (no hierarchical architecture); (2) the RNA information supplied by the miRNA genes expands to intracellular, intercellular, intraorgan, interorgan, intraspecies, and interspecies under the cycle of life into the global environment; (3) the mobile miRNAs can self-proliferate; and (4) cells contain two types information as resident and genomic miRNAs. Based on RNA wave, we have developed an interest in investigation of the transformation from RNA information to quantum bits as physicochemical characters of RNA with the measurement of RNA electron spin. When it would have been given that the fundamental bases for the acquired characters in genetics can be controlled by RNA gene information, it may be available to apply for challenging against RNA gene diseases, such as stress-induced diseases.

Efficient and nontoxic biological response carrier delivering TNF-α shRNA for gene silencing in a murine model of rheumatoid arthritis

Directory of Open Access Journals (Sweden)

Jialin Song

2016-08-01

Full Text Available Small interfering RNA (siRNA is an effective and specific method for silencing genes. However, an efficient and nontoxic carrier is needed to deliver the siRNA into the target cells. Tumor necrosis factor α (TNF-α plays a central role in the occurrence and progression of rheumatoid arthritis. In this study, we pre-synthetized a degradable cationic polymer (PDAPEI from 2,6-pyridinedicarboxaldehyde and low molecular weight polyethyleneimine (PEI, Mw=1.8 kDa as a gene vector for the delivery of TNF-α shRNA. The PDAPEI/pDNA complex showed a suitable particle size and stable zeta potential for transfection. In vitro study of the PDAPEI/pDNA complex revealed a lower cytotoxicity and higher transfection efficiency when transfecting TNF-α shRNA to macrophages by significantly down-regulating the expression of TNF-α. Moreover, the complex was extremely efficient in decreasing the severity of arthritis in mice with collagen-induced arthritis (CIA. PDAPEI delivered TNF-α shRNA has great potential in the treatment of rheumatoid arthritis.

The direct effect of Focal Adhesion Kinase (FAK, dominant-negative FAK, FAK-CD and FAK siRNA on gene expression and human MCF-7 breast cancer cell tumorigenesis

Directory of Open Access Journals (Sweden)

Zhang Li

2009-08-01

Full Text Available Abstract Background Focal adhesion kinase (FAK is a non-receptor tyrosine kinase that plays an important role in survival signaling. FAK has been shown to be overexpressed in breast cancer tumors at early stages of tumorigenesis. Methods To study the direct effect of FAK on breast tumorigenesis, we developed Tet-ON (tetracycline-inducible system of MCF-7 breast cancer cells stably transfected with FAK or dominant-negative, C-terminal domain of FAK (FAK-CD, and also FAKsiRNA with silenced FAK MCF-7 stable cell line. Increased expression of FAK in isogenic Tet-inducible MCF-7 cells caused increased cell growth, adhesion and soft agar colony formation in vitro, while expression of dominant-negative FAK inhibitor caused inhibition of these cellular processes. To study the role of induced FAK and FAK-CD in vivo, we inoculated these Tet-inducible cells in nude mice to generate tumors in the presence or absence of doxycycline in the drinking water. FAKsiRNA-MCF-7 cells were also injected into nude mice to generate xenograft tumors. Results Induction of FAK resulted in significant increased tumorigenesis, while induced FAK-CD resulted in decreased tumorigenesis. Taq Man Low Density Array assay demonstrated specific induction of FAKmRNA in MCF-7-Tet-ON-FAK cells. DMP1, encoding cyclin D binding myb-like protein 1 was one of the genes specifically affected by Tet-inducible FAK or FAK-CD in breast xenograft tumors. In addition, silencing of FAK in MCF-7 cells with FAK siRNA caused increased cell rounding, decreased cell viability in vitro and inhibited tumorigenesis in vivo. Importantly, Affymetrix microarray gene profiling analysis using Human Genome U133A GeneChips revealed >4300 genes, known to be involved in apoptosis, cell cycle, and adhesion that were significantly down- or up-regulated (p Conclusion Thus, these data for the first time demonstrate the direct effect of FAK expression and function on MCF-7 breast cancer tumorigenesis in vivo and reveal

Regulation of the activity of the promoter of RNA-induced silencing, C3PO.

Science.gov (United States)

Sahu, Shriya; Williams, Leo; Perez, Alberto; Philip, Finly; Caso, Giuseppe; Zurawsky, Walter; Scarlata, Suzanne

2017-09-01

RNA-induced silencing is a process which allows cells to regulate the synthesis of specific proteins. RNA silencing is promoted by the protein C3PO (component 3 of RISC). We have previously found that phospholipase Cβ, which increases intracellular calcium levels in response to specific G protein signals, inhibits C3PO activity towards certain genes. Understanding the parameters that control C3PO activity and which genes are impacted by G protein activation would help predict which genes are more vulnerable to downregulation. Here, using a library of 10 18 oligonucleotides, we show that C3PO binds oligonucleotides with structural specificity but little sequence specificity. Alternately, C3PO hydrolyzes oligonucleotides with a rate that is sensitive to substrate stability. Importantly, we find that oligonucleotides with higher Tm values are inhibited by bound PLCβ. This finding is supported by microarray analysis in cells over-expressing PLCβ1. Taken together, this study allows predictions of the genes whose post-transcriptional regulation is responsive to the G protein/phospholipase Cβ/calcium signaling pathway. © 2017 The Protein Society.

A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

Science.gov (United States)

Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

2016-05-01

Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

E-cadherin is transcriptionally activated via suppression of ZEB1 transcriptional repressor by small RNA-mediated gene silencing.

Directory of Open Access Journals (Sweden)

Minami Mazda

Full Text Available RNA activation has been reported to be induced by small interfering RNAs (siRNAs that act on the promoters of several genes containing E-cadherin. In this study, we present an alternative mechanism of E-cadherin activation in human PC-3 cells by siRNAs previously reported to possess perfect-complementary sequences to E-cadherin promoter. We found that activation of E-cadherin can be also induced via suppression of ZEB1, which is a transcriptional repressor of E-cadherin, by seed-dependent silencing mechanism of these siRNAs. The functional seed-complementary sites of the siRNAs were found in the coding region in addition to the 3' untranslated region of ZEB1 mRNA. Promoter analyses indicated that E-boxes, which are ZEB1-binding sites, in the upstream promoter region are indispensable for E-cadherin transcription by the siRNAs. Thus, the results caution against ignoring siRNA seed-dependent silencing effects in genome-wide transcriptional regulation. In addition, members of miR-302/372/373/520 family, which have the same seed sequences with one of the siRNAs containing perfect-complementarity to E-cadherin promoter, are also found to activate E-cadherin transcription. Thus, E-cadherin could be upregulated by the suppression of ZEB1 transcriptional repressor by miRNAs in vivo.

Involvement of Multiple Gene-Silencing Pathways in a Paramutation-like Phenomenon in Arabidopsis

Directory of Open Access Journals (Sweden)

Zhimin Zheng

2015-05-01

Full Text Available Paramutation is an epigenetic phenomenon that has been observed in a number of multicellular organisms. The epigenetically silenced state of paramutated alleles is not only meiotically stable but also “infectious” to active homologous alleles. The molecular mechanism of paramutation remains unclear, but components involved in RNA-directed DNA methylation (RdDM are required. Here, we report a multi-copy pRD29A-LUC transgene in Arabidopsis thaliana that behaves like a paramutation locus. The silent state of LUC is induced by mutations in the DNA glycosylase gene ROS1. The silent alleles of LUC are not only meiotically stable but also able to transform active LUC alleles into silent ones, in the absence of ros1 mutations. Maintaining silencing at the LUC gene requires action of multiple pathways besides RdDM. Our study identified specific factors that are involved in the paramutation-like phenomenon and established a model system for the study of paramutation in Arabidopsis.

RNA interference-mediated silencing of speckle-type POZ protein promotes apoptosis of renal cell cancer cells.

Science.gov (United States)

Liu, Xiaoxia; Sun, Guiling; Sun, Xiuju

2016-01-01

This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP) gene on renal cell cancer (RCC) cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA)-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte-macrophage colony-stimulating factor and E-cadherin was significantly increased (Pmatrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial growth factor receptor, matrix metallopeptidase-9, and vascular cell adhesion molecule, which are related to the integrin-mediated cell surface interactions and extracellular matrix organization signaling pathway.

Validation of RNAi Silencing Efficiency Using Gene Array Data shows 18.5% Failure Rate across 429 Independent Experiments

Directory of Open Access Journals (Sweden)

Gyöngyi Munkácsy

2016-01-01

Full Text Available No independent cross-validation of success rate for studies utilizing small interfering RNA (siRNA for gene silencing has been completed before. To assess the influence of experimental parameters like cell line, transfection technique, validation method, and type of control, we have to validate these in a large set of studies. We utilized gene chip data published for siRNA experiments to assess success rate and to compare methods used in these experiments. We searched NCBI GEO for samples with whole transcriptome analysis before and after gene silencing and evaluated the efficiency for the target and off-target genes using the array-based expression data. Wilcoxon signed-rank test was used to assess silencing efficacy and Kruskal–Wallis tests and Spearman rank correlation were used to evaluate study parameters. All together 1,643 samples representing 429 experiments published in 207 studies were evaluated. The fold change (FC of down-regulation of the target gene was above 0.7 in 18.5% and was above 0.5 in 38.7% of experiments. Silencing efficiency was lowest in MCF7 and highest in SW480 cells (FC = 0.59 and FC = 0.30, respectively, P = 9.3E−06. Studies utilizing Western blot for validation performed better than those with quantitative polymerase chain reaction (qPCR or microarray (FC = 0.43, FC = 0.47, and FC = 0.55, respectively, P = 2.8E−04. There was no correlation between type of control, transfection method, publication year, and silencing efficiency. Although gene silencing is a robust feature successfully cross-validated in the majority of experiments, efficiency remained insufficient in a significant proportion of studies. Selection of cell line model and validation method had the highest influence on silencing proficiency.

Manipulation of Cell Physiology Enables Gene Silencing in Well-differentiated Airway Epithelia

Directory of Open Access Journals (Sweden)

Sateesh Krishnamurthy

2012-01-01

Full Text Available The application of RNA interference-based gene silencing to the airway surface epithelium holds great promise to manipulate host and pathogen gene expression for therapeutic purposes. However, well-differentiated airway epithelia display significant barriers to double-stranded small-interfering RNA (siRNA delivery despite testing varied classes of nonviral reagents. In well-differentiated primary pig airway epithelia (PAE or human airway epithelia (HAE grown at the air–liquid interface (ALI, the delivery of a Dicer-substrate small-interfering RNA (DsiRNA duplex against hypoxanthine–guanine phosphoribosyltransferase (HPRT with several nonviral reagents showed minimal uptake and no knockdown of the target. In contrast, poorly differentiated cells (2–5-day post-seeding exhibited significant oligonucleotide internalization and target knockdown. This finding suggested that during differentiation, the barrier properties of the epithelium are modified to an extent that impedes oligonucleotide uptake. We used two methods to overcome this inefficiency. First, we tested the impact of epidermal growth factor (EGF, a known enhancer of macropinocytosis. Treatment of the cells with EGF improved oligonucleotide uptake resulting in significant but modest levels of target knockdown. Secondly, we used the connectivity map (Cmap database to correlate gene expression changes during small molecule treatments on various cells types with genes that change upon mucociliary differentiation. Several different drug classes were identified from this correlative assessment. Well-differentiated epithelia treated with DsiRNAs and LY294002, a PI3K inhibitor, significantly improved gene silencing and concomitantly reduced target protein levels. These novel findings reveal that well-differentiated airway epithelia, normally resistant to siRNA delivery, can be pretreated with small molecules to improve uptake of synthetic oligonucleotide and RNA interference (RNAi responses.

Silencing the Honey Bee (Apis mellifera) Naked Cuticle Gene (nkd) Improves Host Immune Function and Reduces Nosema ceranae Infections

Science.gov (United States)

Li, Wenfeng; Evans, Jay D.; Huang, Qiang; Rodríguez-García, Cristina; Liu, Jie; Hamilton, Michele; Grozinger, Christina M.; Webster, Thomas C.; Su, Songkun

2016-01-01

ABSTRACT Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera, that has been implicated in colony losses worldwide. RNA interference (RNAi), a posttranscriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling infections of parasites and pathogens in honey bees. While previous studies have focused on the silencing of parasite/pathogen virulence factors, we explore here the possibility of silencing a host factor as a mechanism for reducing parasite load. Specifically, we used an RNAi strategy to reduce the expression of a honey bee gene, naked cuticle (nkd), which is a negative regulator of host immune function. Our studies found that nkd mRNA levels in adult bees were upregulated by N. ceranae infection (and thus, the parasite may use this mechanism to suppress host immune function) and that ingestion of double-stranded RNA (dsRNA) specific to nkd efficiently silenced its expression. Furthermore, we found that RNAi-mediated knockdown of nkd transcripts in Nosema-infected bees resulted in upregulation of the expression of several immune genes (Abaecin, Apidaecin, Defensin-1, and PGRP-S2), reduction of Nosema spore loads, and extension of honey bee life span. The results of our studies clearly indicate that silencing the host nkd gene can activate honey bee immune responses, suppress the reproduction of N. ceranae, and improve the overall health of honey bees. This study represents a novel host-derived therapeutic for honey bee disease treatment that merits further exploration. IMPORTANCE Given the critical role of honey bees in the pollination of agricultural crops, it is urgent to develop strategies to prevent the colony decline induced by the infection of parasites/pathogens. Targeting parasites and pathogens directly by RNAi has been proven to be useful for controlling infections in honey bees, but little is known about the disease impacts of RNAi silencing of host factors

Silencing the Honey Bee (Apis mellifera) Naked Cuticle Gene (nkd) Improves Host Immune Function and Reduces Nosema ceranae Infections.

Science.gov (United States)

Li, Wenfeng; Evans, Jay D; Huang, Qiang; Rodríguez-García, Cristina; Liu, Jie; Hamilton, Michele; Grozinger, Christina M; Webster, Thomas C; Su, Songkun; Chen, Yan Ping

2016-11-15

Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera, that has been implicated in colony losses worldwide. RNA interference (RNAi), a posttranscriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling infections of parasites and pathogens in honey bees. While previous studies have focused on the silencing of parasite/pathogen virulence factors, we explore here the possibility of silencing a host factor as a mechanism for reducing parasite load. Specifically, we used an RNAi strategy to reduce the expression of a honey bee gene, naked cuticle (nkd), which is a negative regulator of host immune function. Our studies found that nkd mRNA levels in adult bees were upregulated by N. ceranae infection (and thus, the parasite may use this mechanism to suppress host immune function) and that ingestion of double-stranded RNA (dsRNA) specific to nkd efficiently silenced its expression. Furthermore, we found that RNAi-mediated knockdown of nkd transcripts in Nosema-infected bees resulted in upregulation of the expression of several immune genes (Abaecin, Apidaecin, Defensin-1, and PGRP-S2), reduction of Nosema spore loads, and extension of honey bee life span. The results of our studies clearly indicate that silencing the host nkd gene can activate honey bee immune responses, suppress the reproduction of N. ceranae, and improve the overall health of honey bees. This study represents a novel host-derived therapeutic for honey bee disease treatment that merits further exploration. Given the critical role of honey bees in the pollination of agricultural crops, it is urgent to develop strategies to prevent the colony decline induced by the infection of parasites/pathogens. Targeting parasites and pathogens directly by RNAi has been proven to be useful for controlling infections in honey bees, but little is known about the disease impacts of RNAi silencing of host factors. Here, we demonstrate

In vivo silencing of alpha-synuclein using naked siRNA

Directory of Open Access Journals (Sweden)

Charisse Klaus

2008-11-01

Full Text Available Abstract Background Overexpression of α-synuclein (SNCA in families with multiplication mutations causes parkinsonism and subsequent dementia, characterized by diffuse Lewy Body disease post-mortem. Genetic variability in SNCA contributes to risk of idiopathic Parkinson's disease (PD, possibly as a result of overexpression. SNCA downregulation is therefore a valid therapeutic target for PD. Results We have identified human and murine-specific siRNA molecules which reduce SNCA in vitro. As a proof of concept, we demonstrate that direct infusion of chemically modified (naked, murine-specific siRNA into the hippocampus significantly reduces SNCA levels. Reduction of SNCA in the hippocampus and cortex persists for a minimum of 1 week post-infusion with recovery nearing control levels by 3 weeks post-infusion. Conclusion We have developed naked gene-specific siRNAs that silence expression of SNCA in vivo. This approach may prove beneficial toward our understanding of the endogenous functional equilibrium of SNCA, its role in disease, and eventually as a therapeutic strategy for α-synucleinopathies resulting from SNCA overexpression.

In vivo silencing of alpha-synuclein using naked siRNA

Science.gov (United States)

Lewis, Jada; Melrose, Heather; Bumcrot, David; Hope, Andrew; Zehr, Cynthia; Lincoln, Sarah; Braithwaite, Adam; He, Zhen; Ogholikhan, Sina; Hinkle, Kelly; Kent, Caroline; Toudjarska, Ivanka; Charisse, Klaus; Braich, Ravi; Pandey, Rajendra K; Heckman, Michael; Maraganore, Demetrius M; Crook, Julia; Farrer, Matthew J

2008-01-01

Background Overexpression of α-synuclein (SNCA) in families with multiplication mutations causes parkinsonism and subsequent dementia, characterized by diffuse Lewy Body disease post-mortem. Genetic variability in SNCA contributes to risk of idiopathic Parkinson's disease (PD), possibly as a result of overexpression. SNCA downregulation is therefore a valid therapeutic target for PD. Results We have identified human and murine-specific siRNA molecules which reduce SNCA in vitro. As a proof of concept, we demonstrate that direct infusion of chemically modified (naked), murine-specific siRNA into the hippocampus significantly reduces SNCA levels. Reduction of SNCA in the hippocampus and cortex persists for a minimum of 1 week post-infusion with recovery nearing control levels by 3 weeks post-infusion. Conclusion We have developed naked gene-specific siRNAs that silence expression of SNCA in vivo. This approach may prove beneficial toward our understanding of the endogenous functional equilibrium of SNCA, its role in disease, and eventually as a therapeutic strategy for α-synucleinopathies resulting from SNCA overexpression. PMID:18976489

Elicitation of hypersensitive responses in Nicotiana glutinosa by the suppressor of RNA silencing protein P0 from poleroviruses.

Science.gov (United States)

Wang, Ken-Der; Empleo, Roman; Nguyen, Tan Tri V; Moffett, Peter; Sacco, Melanie Ann

2015-06-01

Plant disease resistance (R) proteins that confer resistance to viruses recognize viral gene products with diverse functions, including viral suppressors of RNA silencing (VSRs). The P0 protein from poleroviruses is a VSR that targets the ARGONAUTE1 (AGO1) protein for degradation, thereby disrupting RNA silencing and antiviral defences. Here, we report resistance against poleroviruses in Nicotiana glutinosa directed against Turnip yellows virus (TuYV) and Potato leafroll virus (PLRV). The P0 proteins from TuYV (P0(T) (u) ), PLRV (P0(PL) ) and Cucurbit aphid-borne yellows virus (P0(CA) ) were found to elicit a hypersensitive response (HR) in N. glutinosa accession TW59, whereas other accessions recognized P0(PL) only. Genetic analysis showed that recognition of P0(T) (u) by a resistance gene designated RPO1 (Resistance to POleroviruses 1) is inherited as a dominant allele. Expression of P0 from a Potato virus X (PVX) expression vector transferred recognition to the recombinant virus on plants expressing RPO1, supporting P0 as the unique Polerovirus factor eliciting resistance. The induction of HR required a functional P0 protein, as P0(T) (u) mutants with substitutions in the F-box motif that abolished VSR activity were unable to elicit HR. We surmised that the broad P0 recognition seen in TW59 and the requirement for the F-box protein motif could indicate detection of P0-induced AGO1 degradation and disruption of RNA silencing; however, other viral silencing suppressors, including the PVX P25 that also causes AGO1 degradation, failed to elicit HR in N. glutinosa. Investigation of P0 elicitation of RPO1 could provide insight into P0 activities within the cell that trigger resistance. © 2014 BSPP AND JOHN WILEY & SONS LTD.

RNA interference: ready to silence cancer?

Science.gov (United States)

Mocellin, Simone; Costa, Rodolfo; Nitti, Donato

2006-01-01

RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.

Gene-silencing effects of anti-survivin siRNA delivered by RGDV-functionalized nanodiamond carrier in the breast carcinoma cell line MCF-7

Directory of Open Access Journals (Sweden)

Bi YZ

2016-11-01

Full Text Available Yanzhao Bi, Yifan Zhang, Chunying Cui, Lulu Ren, Xueyun Jiang School of Chemical Biology and Pharmaceutical Sciences, Capital Medical University, Beijing, People’s Republic of China Abstract: Nanodiamond (ND is a renowned material in nonviral small interfering RNA (siRNA carrier field due to its unique physical, chemical, and biological properties. In our previous work, it was proven that ND could deliver siRNA into cells efficiently and downregulate the expression of desired protein. However, synthesizing a high-efficient tumor-targeting carrier using ND is still a challenge. In this study, a novel carrier, NDCONH(CH22NH-VDGR, was synthesized for siRNA delivery, and its properties were characterized with methods including Fourier transform infrared spectrometry, transmission electron microscopy, scanning electron microscopy, gel retardation assay, differential scanning calorimetry, confocal microscopy, releasing test, real-time polymerase chain reaction (PCR assay, enzyme-linked immunosorbent assay (ELISA, flow cytometry, cytotoxicity assay, and gene-silencing efficacy assay in vitro and in vivo. The mechanism of NDCONH(CH22NH-VDGR/survivin-siRNA-induced tumor apoptosis was evaluated via flow cytometer assay using Annexin V–fluorescein isothiocyanate/propidium iodide staining method. The NDCONH(CH22NH-VDGR/survivin-siRNA nanoparticle with 60–110 nm diameter and 35.65±3.90 mV zeta potential was prepared. For real-time PCR assay, the results showed that the expression of survivin mRNA was reduced to 46.77%±6.3%. The expression of survivin protein was downregulated to 48.49%±2.25%, as evaluated by ELISA assay. MTT assay showed that NDCONH(CH22NH-VDGR/survivin-siRNA had an inhibitory effect on MCF-7 cell proliferation. According to these results, the survivin-siRNA could be delivered, transported, and released stably, which benefits in increasing the gene-silencing effect. Therefore, as an siRNA carrier, NDCONH(CH22NH-VDGR was suggested

Antiviral RNA silencing initiated in the absence of RDE-4, a double-stranded RNA binding protein, in Caenorhabditis elegans.

Science.gov (United States)

Guo, Xunyang; Zhang, Rui; Wang, Jeffrey; Lu, Rui

2013-10-01

Small interfering RNAs (siRNAs) processed from double-stranded RNA (dsRNA) of virus origins mediate potent antiviral defense through a process referred to as RNA interference (RNAi) or RNA silencing in diverse organisms. In the simple invertebrate Caenorhabditis elegans, the RNAi process is initiated by a single Dicer, which partners with the dsRNA binding protein RDE-4 to process dsRNA into viral siRNAs (viRNAs). Notably, in C. elegans this RNA-directed viral immunity (RDVI) also requires a number of worm-specific genes for its full antiviral potential. One such gene is rsd-2 (RNAi spreading defective 2), which was implicated in RDVI in our previous studies. In the current study, we first established an antiviral role by showing that rsd-2 null mutants permitted higher levels of viral RNA accumulation, and that this enhanced viral susceptibility was reversed by ectopic expression of RSD-2. We then examined the relationship of rsd-2 with other known components of RNAi pathways and established that rsd-2 functions in a novel pathway that is independent of rde-4 but likely requires the RNA-dependent RNA polymerase RRF-1, suggesting a critical role for RSD-2 in secondary viRNA biogenesis, likely through coordinated action with RRF-1. Together, these results suggest that RDVI in the single-Dicer organism C. elegans depends on the collective actions of both RDE-4-dependent and RDE-4-independent mechanisms to produce RNAi-inducing viRNAs. Our study reveals, for the first time, a novel siRNA-producing mechanism in C. elegans that bypasses the need for a dsRNA-binding protein.

SAD-3, a Putative Helicase Required for Meiotic Silencing by Unpaired DNA, Interacts with Other Components of the Silencing Machinery

Science.gov (United States)

Hammond, Thomas M.; Xiao, Hua; Boone, Erin C.; Perdue, Tony D.; Pukkila, Patricia J.; Shiu, Patrick K. T.

2011-01-01

In Neurospora crassa, genes lacking a pairing partner during meiosis are suppressed by a process known as meiotic silencing by unpaired DNA (MSUD). To identify novel MSUD components, we have developed a high-throughput reverse-genetic screen for use with the N. crassa knockout library. Here we describe the screening method and the characterization of a gene (sad-3) subsequently discovered. SAD-3 is a putative helicase required for MSUD and sexual spore production. It exists in a complex with other known MSUD proteins in the perinuclear region, a center for meiotic silencing activity. Orthologs of SAD-3 include Schizosaccharomyces pombe Hrr1, a helicase required for RNAi-induced heterochromatin formation. Both SAD-3 and Hrr1 interact with an RNA-directed RNA polymerase and an Argonaute, suggesting that certain aspects of silencing complex formation may be conserved between the two fungal species. PMID:22384347

IBM1, a JmjC domain-containing histone demethylase, is involved in the regulation of RNA-directed DNA methylation through the epigenetic control of RDR2 and DCL3 expression in Arabidopsis

Science.gov (United States)

Fan, Di; Dai, Yan; Wang, Xuncheng; Wang, Zhenjie; He, Hang; Yang, Hongchun; Cao, Ying; Deng, Xing Wang; Ma, Ligeng

2012-01-01

Small RNA-directed DNA methylation (RdDM) is an important epigenetic pathway in Arabidopsis that controls the expression of multiple genes and several developmental processes. RNA-DEPENDENT RNA POLYMERASE 2 (RDR2) and DICER-LIKE 3 (DCL3) are necessary factors in 24-nt small interfering RNA (siRNA) biogenesis, which is part of the RdDM pathway. Here, we found that Increase in BONSAI Methylation 1 (IBM1), a conserved JmjC family histone demethylase, is directly associated with RDR2 and DCL3 chromatin. The mutation of IBM1 induced the hypermethylation of H3K9 and DNA non-CG sites within RDR2 and DCL3, which repressed their expression. A genome-wide analysis suggested that the reduction in RDR2 and DCL3 expression affected siRNA biogenesis in a locus-specific manner and disrupted RdDM-directed gene repression. Together, our results suggest that IBM1 regulates gene expression through two distinct pathways: direct association to protect genes from silencing by preventing the coupling of histone and DNA methylation, and indirect silencing of gene expression through RdDM-directed repression. PMID:22772985

SmD1 Modulates the miRNA Pathway Independently of Its Pre-mRNA Splicing Function.

Directory of Open Access Journals (Sweden)

Xiao-Peng Xiong

2015-08-01

Full Text Available microRNAs (miRNAs are a class of endogenous regulatory RNAs that play a key role in myriad biological processes. Upon transcription, primary miRNA transcripts are sequentially processed by Drosha and Dicer ribonucleases into ~22-24 nt miRNAs. Subsequently, miRNAs are incorporated into the RNA-induced silencing complexes (RISCs that contain Argonaute (AGO family proteins and guide RISC to target RNAs via complementary base pairing, leading to post-transcriptional gene silencing by a combination of translation inhibition and mRNA destabilization. Select pre-mRNA splicing factors have been implicated in small RNA-mediated gene silencing pathways in fission yeast, worms, flies and mammals, but the underlying molecular mechanisms are not well understood. Here, we show that SmD1, a core component of the Drosophila small nuclear ribonucleoprotein particle (snRNP implicated in splicing, is required for miRNA biogenesis and function. SmD1 interacts with both the microprocessor component Pasha and pri-miRNAs, and is indispensable for optimal miRNA biogenesis. Depletion of SmD1 impairs the assembly and function of the miRISC without significantly affecting the expression of major canonical miRNA pathway components. Moreover, SmD1 physically and functionally associates with components of the miRISC, including AGO1 and GW182. Notably, miRNA defects resulting from SmD1 silencing can be uncoupled from defects in pre-mRNA splicing, and the miRNA and splicing machineries are physically and functionally distinct entities. Finally, photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP analysis identifies numerous SmD1-binding events across the transcriptome and reveals direct SmD1-miRNA interactions. Our study suggests that SmD1 plays a direct role in miRNA-mediated gene silencing independently of its pre-mRNA splicing activity and indicates that the dual roles of splicing factors in post-transcriptional gene regulation may be

Engineering of small interfering RNA-loaded lipidoid-poly(DL-lactic-co-glycolic acid) hybrid nanoparticles for highly efficient and safe gene silencing: A quality by design-based approach.

Science.gov (United States)

Thanki, Kaushik; Zeng, Xianghui; Justesen, Sarah; Tejlmann, Sarah; Falkenberg, Emily; Van Driessche, Elize; Mørck Nielsen, Hanne; Franzyk, Henrik; Foged, Camilla

2017-11-01

Safety and efficacy of therapeutics based on RNA interference, e.g., small interfering RNA (siRNA), are dependent on the optimal engineering of the delivery technology, which is used for intracellular delivery of siRNA to the cytosol of target cells. We investigated the hypothesis that commonly used and poorly tolerated cationic lipids might be replaced with more efficacious and safe lipidoids as the lipid component of siRNA-loaded lipid-polymer hybrid nanoparticles (LPNs) for achieving more efficient gene silencing at lower and safer doses. However, formulation design of such a complex formulation is highly challenging due to a strong interplay between several contributing factors. Hence, critical formulation variables, i.e. the lipidoid content and siRNA:lipidoid ratio, were initially identified, followed by a systematic quality-by-design approach to define the optimal operating space (OOS), eventually resulting in the identification of a robust, highly efficacious and safe formulation. A 17-run design of experiment with an I-optimal approach was performed to systematically assess the effect of selected variables on critical quality attributes (CQAs), i.e. physicochemical properties (hydrodynamic size, zeta potential, siRNA encapsulation/loading) and the biological performance (in vitro gene silencing and cell viability). Model fitting of the obtained data to construct predictive models revealed non-linear relationships for all CQAs, which can be readily overlooked in one-factor-at-a-time optimization approaches. The response surface methodology further enabled the identification of an OOS that met the desired quality target product profile. The optimized lipidoid-modified LPNs revealed more than 50-fold higher in vitro gene silencing at well-tolerated doses and approx. a twofold increase in siRNA loading as compared to reference LPNs modified with the commonly used cationic lipid dioleyltrimethylammonium propane (DOTAP). Thus, lipidoid-modified LPNs show highly

The development and application of a multiple gene co-silencing system using endogenous URA3 as a reporter gene in Ganoderma lucidum.

Directory of Open Access Journals (Sweden)

Dashuai Mu

Full Text Available Ganoderma lucidum is one of the most important medicinal mushrooms; however, molecular genetics research on this species has been limited due to a lack of reliable reverse genetic tools. In this study, the endogenous orotidine 5'-monophosphate decarboxylase gene (URA3 was cloned as a silencing reporter, and four gene-silencing methods using hairpin, sense, antisense, and dual promoter constructs, were introduced into G. lucidum through a simple electroporation procedure. A comparison and evaluation of silencing efficiency demonstrated that all of the four methods differentially suppressed the expression of URA3. Our data unequivocally indicate that the dual promoter silencing vector yields the highest rate of URA3 silencing compared with other vectors (up to 81.9%. To highlight the advantages of the dual promoter system, we constructed a co-silencing system based on the dual promoter method and succeeded in co-silencing URA3 and laccase in G. lucidum. The reduction of the mRNA levels of the two genes were correlated. Thus, the screening efficiency for RNAi knockdown of multiple genes may be improved by the co-silencing of an endogenous reporter gene. The molecular tools developed in this study should facilitate the isolation of genes and the characterization of the functions of multiple genes in this pharmaceutically important species, and these tools should be highly useful for the study of other basidiomycetes.

Epigenetic silencing of host cell defense genes enhances intracellular survival of the rickettsial pathogen Anaplasma phagocytophilum.

Directory of Open Access Journals (Sweden)

Jose C Garcia-Garcia

2009-06-01

Full Text Available Intracellular bacteria have evolved mechanisms that promote survival within hostile host environments, often resulting in functional dysregulation and disease. Using the Anaplasma phagocytophilum-infected granulocyte model, we establish a link between host chromatin modifications, defense gene transcription and intracellular bacterial infection. Infection of THP-1 cells with A. phagocytophilum led to silencing of host defense gene expression. Histone deacetylase 1 (HDAC1 expression, activity and binding to the defense gene promoters significantly increased during infection, which resulted in decreased histone H3 acetylation in infected cells. HDAC1 overexpression enhanced infection, whereas pharmacologic and siRNA HDAC1 inhibition significantly decreased bacterial load. HDAC2 does not seem to be involved, since HDAC2 silencing by siRNA had no effect on A. phagocytophilum intracellular propagation. These data indicate that HDAC up-regulation and epigenetic silencing of host cell defense genes is required for A. phagocytophilum infection. Bacterial epigenetic regulation of host cell gene transcription could be a general mechanism that enhances intracellular pathogen survival while altering cell function and promoting disease.

Simultaneous gene silencing of Bcl-2, XIAP and Survivin re-sensitizes pancreatic cancer cells towards apoptosis

International Nuclear Information System (INIS)

Rückert, Felix; Samm, Nicole; Lehner, Anne-Kathrin; Saeger, Hans-Detlev; Grützmann, Robert; Pilarsky, Christian

2010-01-01

Pancreatic ductal adenocarcinoma shows a distinct apoptosis resistance, which contributes significantly to the aggressive nature of this tumor and constrains the effectiveness of new therapeutic strategies. Apoptosis resistance is determined by the net balance of the cells pro-and anti-apoptotic 'control mechanisms'. Numerous dysregulated anti-apoptotic genes have been identified in pancreatic cancer and seem to contribute to the high anti-apoptotic buffering capacity. We aimed to compare the benefit of simultaneous gene silencing (SGS) of several candidate genes with conventional gene silencing of single genes. From literature search we identified the anti-apoptotic genes XIAP, Survivin and Bcl-2 as commonly upregulated in pancreatic cancer. We performed SGS and silencing of single candidate genes using siRNA molecules in two pancreatic cancer cell lines. Effectiveness of SGS was assessed by qRT-PCR and western blotting. Apoptosis induction was measured by flow cytometry and caspase activation. Simultaneous gene silencing reduced expression of the three target genes effectively. Compared to silencing of a single target or control, SGS of these genes resulted in a significant higher induction of apoptosis in pancreatic cancer cells. In the present study we performed a subliminal silencing of different anti-apoptotic target genes simultaneously. Compared to silencing of single target genes, SGS had a significant higher impact on apoptosis induction in pancreatic cancer cells. Thereby, we give further evidence for the concept of an anti-apoptotic buffering capacity of pancreatic cancer cells

RNAi-based therapeutic nanostrategy: IL-8 gene silencing in pancreatic cancer cells using gold nanorods delivery vehicles

International Nuclear Information System (INIS)

Panwar, Nishtha; Yang, Chengbin; Yin, Feng; Chuan, Tjin Swee; Yong, Ken-Tye; Yoon, Ho Sup

2015-01-01

RNA interference (RNAi)-based gene silencing possesses great ability for therapeutic intervention in pancreatic cancer. Among various oncogene mutations, Interleukin-8 (IL-8) gene mutations are found to be overexpressed in many pancreatic cell lines. In this work, we demonstrate IL-8 gene silencing by employing an RNAi-based gene therapy approach and this is achieved by using gold nanorods (AuNRs) for efficient delivery of IL-8 small interfering RNA (siRNA) to the pancreatic cell lines of MiaPaCa-2 and Panc-1. Upon comparing to Panc-1 cells, we found that the dominant expression of the IL-8 gene in MiaPaCa-2 cells resulted in an aggressive behavior towards the processes of cell invasion and metastasis. We have hence investigated the suitability of using AuNRs as novel non-viral nanocarriers for the efficient uptake and delivery of IL-8 siRNA in realizing gene knockdown of both MiaPaCa-2 and Panc-1 cells. Flow cytometry and fluorescence imaging techniques have been applied to confirm transfection and release of IL-8 siRNA. The ratio of AuNRs and siRNA has been optimized and transfection efficiencies as high as 88.40 ± 2.14% have been achieved. Upon successful delivery of IL-8 siRNA into cancer cells, the effects of IL-8 gene knockdown are quantified in terms of gene expression, cell invasion, cell migration and cell apoptosis assays. Statistical comparative studies for both MiaPaCa-2 and Panc-1 cells are presented in this work. IL-8 gene silencing has been demonstrated with knockdown efficiencies of 81.02 ± 10.14% and 75.73 ± 6.41% in MiaPaCa-2 and Panc-1 cells, respectively. Our results are then compared with a commercial transfection reagent, Oligofectamine, serving as positive control. The gene knockdown results illustrate the potential role of AuNRs as non-viral gene delivery vehicles for RNAi-based targeted cancer therapy applications. (paper)

Disruption of prefoldin-2 protein synthesis in root-knot nematodes via host-mediated gene silencing efficiently reduces nematode numbers and thus protects plants.

Science.gov (United States)

Ajjappala, Hemavathi; Chung, Ha Young; Sim, Joon-Soo; Choi, Inchan; Hahn, Bum-Soo

2015-03-01

The aim of this study is to demonstrate the feasibility of down-regulating endogeneous prefoldin-2 root-knot nematode transcripts by expressing dsRNA with sequence identity to the nematode gene in tobacco roots under the influence of strong Arabidopsis ubiquitin (UBQ1) promoter. Root-knot nematodes (RKNs) are sedentary endoparasites infecting a wide range of plant species. They parasitise the root system, thereby disrupting water and nutrient uptake and causing major reductions in crop yields. The most reliable means of controlling RKNs is via the use of soil fumigants such as methyl bromide. With the emergence of RNA interference (RNAi) technology, which permits host-mediated nematode gene silencing, a new strategy to control plant pathogens has become available. In the present study, we investigated host-induced RNAi gene silencing of prefoldin-2 in transgenic Nicotiana benthamiana. Reductions in prefoldin-2 mRNA transcript levels were observed when nematodes were soaked in a dsRNA solution in vitro. Furthermore, nematode reproduction was suppressed in RNAi transgenic lines, as evident by reductions in the numbers of root knots (by 34-60 % in independent RNAi lines) and egg masses (by 33-58 %). Endogenous expression of prefoldin-2, analysed via real-time polymerase chain reaction and Western blotting, revealed that the gene was strongly expressed in the pre-parasitic J2 stage. Our observations demonstrate the relevance and potential importance of targeting the prefoldin gene during the nematode life cycle. The work also suggests that further improvements in silencing efficiency in economically important crops can be accomplished using RNAi directed against plant-parasitic nematodes.

Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins

Directory of Open Access Journals (Sweden)

Marcio Hedil

2016-07-01

Full Text Available The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins.

Science.gov (United States)

Hedil, Marcio; Kormelink, Richard

2016-07-23

The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

Flexible tools for gene expression and silencing in tomato.

Science.gov (United States)

Fernandez, Ana I; Viron, Nicolas; Alhagdow, Moftah; Karimi, Mansour; Jones, Matthew; Amsellem, Ziva; Sicard, Adrien; Czerednik, Anna; Angenent, Gerco; Grierson, Donald; May, Sean; Seymour, Graham; Eshed, Yuval; Lemaire-Chamley, Martine; Rothan, Christophe; Hilson, Pierre

2009-12-01

As a genetic platform, tomato (Solanum lycopersicum) benefits from rich germplasm collections and ease of cultivation and transformation that enable the analysis of biological processes impossible to investigate in other model species. To facilitate the assembly of an open genetic toolbox designed to study Solanaceae, we initiated a joint collection of publicly available gene manipulation tools. We focused on the characterization of promoters expressed at defined time windows during fruit development, for the regulated expression or silencing of genes of interest. Five promoter sequences were captured as entry clones compatible with the versatile MultiSite Gateway format: PPC2, PG, TPRP, and IMA from tomato and CRC from Arabidopsis (Arabidopsis thaliana). Corresponding transcriptional fusions were made with the GUS gene, a nuclear-localized GUS-GFP reporter, and the chimeric LhG4 transcription factor. The activity of the promoters during fruit development and in fruit tissues was confirmed in transgenic tomato lines. Novel Gateway destination vectors were generated for the transcription of artificial microRNA (amiRNA) precursors and hairpin RNAs under the control of these promoters, with schemes only involving Gateway BP and LR Clonase reactions. Efficient silencing of the endogenous phytoene desaturase gene was demonstrated in transgenic tomato lines producing a matching amiRNA under the cauliflower mosaic virus 35S or PPC2 promoter. Lastly, taking advantage of the pOP/LhG4 two-component system, we found that well-characterized flower-specific Arabidopsis promoters drive the expression of reporters in patterns generally compatible with heterologous expression. Tomato lines and plasmids will be distributed through a new Nottingham Arabidopsis Stock Centre service unit dedicated to Solanaceae resources.

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing.

Science.gov (United States)

Hedil, Marcio; Sterken, Mark G; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silencing has only been studied to a limited extent. Here, the NSs proteins of TSWV, groundnut ringspot virus (GRSV) and tomato yellow ring virus (TYRV), representatives for three distinct tospovirus species, have been studied on their ability and strength to suppress local and systemic silencing. A system has been developed to quantify suppression of GFP silencing in Nicotiana benthamiana 16C lines, to allow a comparison of relative RNA silencing suppressor strength. It is shown that NSs of all three tospoviruses are suppressors of local and systemic silencing. Unexpectedly, suppression of systemic RNA silencing by NSsTYRV was just as strong as those by NSsTSWV and NSsGRSV, even though NSsTYRV was expressed in lower amounts. Using the system established, a set of selected NSsTSWV gene constructs mutated in predicted RNA binding domains, as well as NSs from TSWV isolates 160 and 171 (resistance breakers of the Tsw resistance gene), were analyzed for their ability to suppress systemic GFP silencing. The results indicate another mode of RNA silencing suppression by NSs that acts further downstream the biogenesis of siRNAs and their sequestration. The findings are discussed in light of the affinity of NSs for small and long dsRNA, and recent mutant screen of NSsTSWV to map domains required for RSS activity and triggering of Tsw-governed resistance.

Novel siRNA delivery system using a ternary polymer complex with strong silencing effect and no cytotoxicity.

Science.gov (United States)

Kodama, Yukinobu; Shiokawa, Yumi; Nakamura, Tadahiro; Kurosaki, Tomoaki; Aki, Keisei; Nakagawa, Hiroo; Muro, Takahiro; Kitahara, Takashi; Higuchi, Norihide; Sasaki, Hitoshi

2014-01-01

We developed a novel small interfering RNA (siRNA) delivery system using a ternary complex with polyethyleneimine (PEI) and γ-polyglutamic acid (γ-PGA), which showed silencing effect and no cytotoxicity. The binary complexes of siRNA with PEI were approximately 73-102 nm in particle size and 45-52 mV in ζ-potential. The silencing effect of siRNA/PEI complexes increased with an increase of PEI, and siRNA/PEI complexes with a charge ratio greater than 16 showed significant luciferase knockdown in a mouse colon carcinoma cell line regularly expressing luciferase (Colon26/Luc cells). However, strong cytotoxicity and blood agglutination were observed in the siRNA/Lipofectamine complex and siRNA/PEI16 complex. Recharging cationic complexes with an anionic compound was reported to be a promising method for overcoming these toxicities. We therefore prepared ternary complexes of siRNA with PEI (charge ratio 16) by the addition of γ-PGA to reduce cytotoxicity and deliver siRNA. As expected, the cytotoxicity of the ternary complexes decreased with an increase of γ-PGA content, which decreased the ζ-potential of the complexes. A strong silencing effect comparable to siRNA/Lipofectamine complex was discovered in ternary complexes including γ-PGA with an anionic surface charge. The high incorporation of ternary complexes into Colon26/Luc cells was confirmed with fluorescence microcopy. Having achieved knockdown of an exogenously transfected gene, the ability of the complex to mediate knockdown of an endogenous housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), was assessed in B16-F10 cells. The ternary complex (siRNA/PEI16/γ-PGA12 complex) exhibited a significant GAPDH knockdown effect. Thus, we developed a useful siRNA delivery system.

Transgene-induced gene silencing is not affected by a change in ploidy level.

Directory of Open Access Journals (Sweden)

Daniela Pignatta

Full Text Available BACKGROUND: Whole genome duplication, which results in polyploidy, is a common feature of plant populations and a recurring event in the evolution of flowering plants. Polyploidy can result in changes to gene expression and epigenetic instability. Several epigenetic phenomena, occurring at the transcriptional or post-transcriptional level, have been documented in allopolyploids (polyploids derived from species hybrids of Arabidopsis thaliana, yet findings in autopolyploids (polyploids derived from the duplication of the genome of a single species are limited. Here, we tested the hypothesis that an increase in ploidy enhances transgene-induced post-transcriptional gene silencing using autopolyploids of A. thaliana. METHODOLOGY/PRINCIPAL FINDINGS: Diploid and tetraploid individuals of four independent homozygous transgenic lines of A. thaliana transformed with chalcone synthase (CHS inverted repeat (hairpin constructs were generated. For each line diploids and tetraploids were compared for efficiency in post-transcriptional silencing of the endogenous CHS gene. The four lines differed substantially in their silencing efficiency. Yet, diploid and tetraploid plants derived from these plants and containing therefore identical transgene insertions showed no difference in the efficiency silencing CHS as assayed by visual scoring, anthocyanin assays and quantification of CHS mRNA. CONCLUSIONS/SIGNIFICANCE: Our results in A. thaliana indicated that there is no effect of ploidy level on transgene-induced post-transcriptional gene silencing. Our findings that post-transcriptional mechanisms were equally effective in diploids and tetraploids supports the use of transgene-driven post-transcriptional gene silencing as a useful mechanism to modify gene expression in polyploid species.

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

NARCIS (Netherlands)

Hedil, M.; Sterken, M.G.; Ronde, de D.; Lohuis, D.; Kormelink, R.

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS.

Immune modulation through RNA interference-mediated silencing of CD40 in dendritic cells.

Science.gov (United States)

Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Samiee, Shahram; Ataee, Zahra; Tabei, Seyyed Ziyaoddin; Moazzeni, Seyed Mohammad

2009-01-01

RNA interference (RNAi) is an exciting mechanism for knocking down any target gene in transcriptional level. It is now clear that small interfering RNA (siRNA), a 19-21nt long dsRNA, can trigger a degradation process (RNAi) that specifically silences the expression of a cognate mRNA. Our findings in this study showed that down regulation of CD40 gene expression in dendritic cells (DCs) by RNAi culminated to immune modulation. Effective delivery of siRNA into DCs would be a reasonable method for the blocking of CD40 gene expression at the cell surface without any effect on other genes and cell cytotoxicity. The effects of siRNA against CD40 mRNA on the function and phenotype of DCs were investigated. The DCs were separated from the mice spleen and then cultured in vitro. By the means of Lipofectamine2000, siRNA was delivered to the cells and the efficacy of transfection was estimated by flow cytometry. By Annexine V and Propidium Iodide staining, we could evaluate the transfected cells viability. Also, the mRNA expression and protein synthesis were assessed by real-time PCR and flow cytometry, respectively. Knocking down the CD40 gene in the DCs caused an increase in IL-4 production, decrease in IL-12 production and allostimulation activity. All together, these effects would stimulate Th2 cytokines production from allogenic T-cells in vitro.

Assessment of RNAi-induced silencing in banana (Musa spp.).

Science.gov (United States)

Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

2014-09-18

In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target

Diverging affinity of tospovirus RNA silencing suppressor proteins, NSs, for various RNA duplex molecules.

Science.gov (United States)

Schnettler, Esther; Hemmes, Hans; Huismann, Rik; Goldbach, Rob; Prins, Marcel; Kormelink, Richard

2010-11-01

The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs proteins analyzed exhibited affinity to small double-stranded RNA molecules, i.e., small interfering RNAs (siRNAs) and micro-RNA (miRNA)/miRNA* duplexes. Interestingly, the NSs proteins from tomato spotted wilt virus (TSWV), impatiens necrotic spot virus (INSV), and groundnut ringspot virus (GRSV) also showed affinity to long double-stranded RNA (dsRNA), whereas tomato yellow ring virus (TYRV) NSs did not. The TSWV NSs protein was shown to be capable of inhibiting Dicer-mediated cleavage of long dsRNA in vitro. In addition, it suppressed the accumulation of green fluorescent protein (GFP)-specific siRNAs during coinfiltration with an inverted-repeat-GFP RNA construct in Nicotiana benthamiana. In vivo interference of TSWV NSs in the miRNA pathway was shown by suppression of an enhanced GFP (eGFP) miRNA sensor construct. The ability to stabilize miRNA/miRNA* by different tospovirus NSs proteins in vivo was demonstrated by increased accumulation and detection of both miRNA171c and miRNA171c* in tospovirus-infected N. benthamiana. All together, these data suggest that tospoviruses interfere in the RNA silencing pathway by sequestering siRNA and miRNA/miRNA* molecules before they are uploaded into their respective RNA-induced silencing complexes. The observed affinity to long dsRNA for only a subset of the tospoviruses studied is discussed in light of evolutional divergence and their ancestral relation to the animal-infecting members of the Bunyaviridae.

Development of Gold Nanoparticle towards Radioenhancement Therapy, Renal Clearance, siRNA Delivery and Light-Controlled Gene Silencing

Science.gov (United States)

Wang, Jianxin

Gold nanoparticles (GNPs) have been widely studied and used in research for diagnostic, prophylactic or therapeutic purposes. However, they still face many technical challenges before they can be used to effectively address unmet biomedical needs. The theme of this dissertation is focused on addressing challenges of GNPs in clinical translation, and to improve their potential for application in radioenhancement therapy and siRNA delivery. We demonstrate the facile self-assembly of micellar gold nanocapsules using zwitterionic surfactants, with hydrodynamic diameters below 10 nm, which holds promise for good renal clearance to promote the excretion of GNPs in human body. We also prepared PEI- and PEG-coated GNPs and demonstrated their uptake into HeLa cells with exposure to soft X-rays (120 kVp), based on the consideration that the proximity of GNPs to nuclear DNA may be beneficial for enhancing low-energy ionizing radiotherapy. GNP-mediated siRNA delivery may be challenged by nonspecific siRNA desorption during circulation, which can cause off-target effects and immunogenicity. The use of gold nanorods (GNRs) for siRNA delivery also faces challenges like reduced dispersion stability during siRNA functionalization. We developed an effective way to load siRNA onto GNRs at high density, using oleylsulfobetaine (OSB) as an intermediate surfactant and dithiocarbamates (DTCs) as desorption-resistant anchors for siRNA. The GNR?siRNA complexes provided excellent control for laser-triggered gene silencing.

Double silencing of relevant genes suggests the existence of the direct link between DNA replication/repair and central carbon metabolism in human fibroblasts.

Science.gov (United States)

Wieczorek, Aneta; Fornalewicz, Karolina; Mocarski, Łukasz; Łyżeń, Robert; Węgrzyn, Grzegorz

2018-04-15

Genetic evidence for a link between DNA replication and glycolysis has been demonstrated a decade ago in Bacillus subtilis, where temperature-sensitive mutations in genes coding for replication proteins could be suppressed by mutations in genes of glycolytic enzymes. Then, a strong influence of dysfunctions of particular enzymes from the central carbon metabolism (CCM) on DNA replication and repair in Escherichia coli was reported. Therefore, we asked if such a link occurs only in bacteria or it is a more general phenomenon. Here, we demonstrate that effects of silencing (provoked by siRNA) of expression of genes coding for proteins involved in DNA replication and repair (primase, DNA polymerase ι, ligase IV, and topoisomerase IIIβ) on these processes (less efficient entry into the S phase of the cell cycle and decreased level of DNA synthesis) could be suppressed by silencing of specific genes of enzymes from CMM. Silencing of other pairs of replication/repair and CMM genes resulted in enhancement of the negative effects of lower expression levels of replication/repair genes. We suggest that these results may be proposed as a genetic evidence for the link between DNA replication/repair and CMM in human cells, indicating that it is a common biological phenomenon, occurring from bacteria to humans. Copyright © 2018 Elsevier B.V. All rights reserved.

Supervised learning classification models for prediction of plant virus encoded RNA silencing suppressors.

Directory of Open Access Journals (Sweden)

Zeenia Jagga

Full Text Available Viral encoded RNA silencing suppressor proteins interfere with the host RNA silencing machinery, facilitating viral infection by evading host immunity. In plant hosts, the viral proteins have several basic science implications and biotechnology applications. However in silico identification of these proteins is limited by their high sequence diversity. In this study we developed supervised learning based classification models for plant viral RNA silencing suppressor proteins in plant viruses. We developed four classifiers based on supervised learning algorithms: J48, Random Forest, LibSVM and Naïve Bayes algorithms, with enriched model learning by correlation based feature selection. Structural and physicochemical features calculated for experimentally verified primary protein sequences were used to train the classifiers. The training features include amino acid composition; auto correlation coefficients; composition, transition, and distribution of various physicochemical properties; and pseudo amino acid composition. Performance analysis of predictive models based on 10 fold cross-validation and independent data testing revealed that the Random Forest based model was the best and achieved 86.11% overall accuracy and 86.22% balanced accuracy with a remarkably high area under the Receivers Operating Characteristic curve of 0.95 to predict viral RNA silencing suppressor proteins. The prediction models for plant viral RNA silencing suppressors can potentially aid identification of novel viral RNA silencing suppressors, which will provide valuable insights into the mechanism of RNA silencing and could be further explored as potential targets for designing novel antiviral therapeutics. Also, the key subset of identified optimal features may help in determining compositional patterns in the viral proteins which are important determinants for RNA silencing suppressor activities. The best prediction model developed in the study is available as a

A genome-wide analysis of the RNA-guided silencing pathway in coffee reveals insights into its regulatory mechanisms.

Directory of Open Access Journals (Sweden)

Christiane Noronha Fernandes-Brum

Full Text Available microRNAs (miRNAs are derived from self-complementary hairpin structures, while small-interfering RNAs (siRNAs are derived from double-stranded RNA (dsRNA or hairpin precursors. The core mechanism of sRNA production involves DICER-like (DCL in processing the smallRNAs (sRNAs and ARGONAUTE (AGO as effectors of silencing, and siRNA biogenesis also involves action of RNA-Dependent RNA Polymerase (RDR, Pol IV and Pol V in biogenesis. Several other proteins interact with the core proteins to guide sRNA biogenesis, action, and turnover. We aimed to unravel the components and functions of the RNA-guided silencing pathway in a non-model plant species of worldwide economic relevance. The sRNA-guided silencing complex members have been identified in the Coffea canephora genome, and they have been characterized at the structural, functional, and evolutionary levels by computational analyses. Eleven AGO proteins, nine DCL proteins (which include a DCL1-like protein that was not previously annotated, and eight RDR proteins were identified. Another 48 proteins implicated in smallRNA (sRNA pathways were also identified. Furthermore, we identified 235 miRNA precursors and 317 mature miRNAs from 113 MIR families, and we characterized ccp-MIR156, ccp-MIR172, and ccp-MIR390. Target prediction and gene ontology analyses of 2239 putative targets showed that significant pathways in coffee are targeted by miRNAs. We provide evidence of the expansion of the loci related to sRNA pathways, insights into the activities of these proteins by domain and catalytic site analyses, and gene expression analysis. The number of MIR loci and their targeted pathways highlight the importance of miRNAs in coffee. We identified several roles of sRNAs in C. canephora, which offers substantial insight into better understanding the transcriptional and post-transcriptional regulation of this major crop.

The potyviral suppressor of RNA silencing confers enhanced resistance to multiple pathogens

International Nuclear Information System (INIS)

Pruss, Gail J.; Lawrence, Christopher B.; Bass, Troy; Li Qingshun Q.; Bowman, Lewis H.; Vance, Vicki

2004-01-01

Helper component-protease (HC-Pro) is a plant viral suppressor of RNA silencing, and transgenic tobacco expressing HC-Pro has increased susceptibility to a broad range of viral pathogens. Here we report that these plants also exhibit enhanced resistance to unrelated heterologous pathogens. Tobacco mosaic virus (TMV) infection of HC-Pro-expressing plants carrying the N resistance gene results in fewer and smaller lesions compared to controls without HC-Pro. The resistance to TMV is compromised but not eliminated by expression of nahG, which prevents accumulation of salicylic acid (SA), an important defense signaling molecule. HC-Pro-expressing plants are also more resistant to tomato black ring nepovirus (TBRV) and to the oomycete Peronospora tabacina. Enhanced TBRV resistance is SA-independent, whereas the response to P. tabacina is associated with early induction of markers characteristic of SA-dependent defense. Thus, a plant viral suppressor of RNA silencing enhances resistance to multiple pathogens via both SA-dependent and SA-independent mechanisms

The potyviral suppressor of RNA silencing confers enhanced resistance to multiple pathogens.

Science.gov (United States)

Pruss, Gail J; Lawrence, Christopher B; Bass, Troy; Li, Qingshun Q; Bowman, Lewis H; Vance, Vicki

2004-03-01

Helper component-protease (HC-Pro) is a plant viral suppressor of RNA silencing, and transgenic tobacco expressing HC-Pro has increased susceptibility to a broad range of viral pathogens. Here we report that these plants also exhibit enhanced resistance to unrelated heterologous pathogens. Tobacco mosaic virus (TMV) infection of HC-Pro-expressing plants carrying the N resistance gene results in fewer and smaller lesions compared to controls without HC-Pro. The resistance to TMV is compromised but not eliminated by expression of nahG, which prevents accumulation of salicylic acid (SA), an important defense signaling molecule. HC-Pro-expressing plants are also more resistant to tomato black ring nepovirus (TBRV) and to the oomycete Peronospora tabacina. Enhanced TBRV resistance is SA-independent, whereas the response to P. tabacina is associated with early induction of markers characteristic of SA-dependent defense. Thus, a plant viral suppressor of RNA silencing enhances resistance to multiple pathogens via both SA-dependent and SA-independent mechanisms.

RNAi dynamics in Juvenile Fasciola spp. Liver flukes reveals the persistence of gene silencing in vitro.

Directory of Open Access Journals (Sweden)

Paul McVeigh

2014-09-01

Full Text Available Fasciola spp. liver fluke cause pernicious disease in humans and animals. Whilst current control is unsustainable due to anthelmintic resistance, gene silencing (RNA interference, RNAi has the potential to contribute to functional validation of new therapeutic targets. The susceptibility of juvenile Fasciola hepatica to double stranded (dsRNA-induced RNAi has been reported. To exploit this we probe RNAi dynamics, penetrance and persistence with the aim of building a robust platform for reverse genetics in liver fluke. We describe development of standardised RNAi protocols for a commercially-available liver fluke strain (the US Pacific North West Wild Strain, validated via robust transcriptional silencing of seven virulence genes, with in-depth experimental optimisation of three: cathepsin L (FheCatL and B (FheCatB cysteine proteases, and a σ-class glutathione transferase (FheσGST.Robust transcriptional silencing of targets in both F. hepatica and Fasciola gigantica juveniles is achievable following exposure to long (200-320 nt dsRNAs or 27 nt short interfering (siRNAs. Although juveniles are highly RNAi-susceptible, they display slower transcript and protein knockdown dynamics than those reported previously. Knockdown was detectable following as little as 4h exposure to trigger (target-dependent and in all cases silencing persisted for ≥25 days following long dsRNA exposure. Combinatorial silencing of three targets by mixing multiple long dsRNAs was similarly efficient. Despite profound transcriptional suppression, we found a significant time-lag before the occurrence of protein suppression; FheσGST and FheCatL protein suppression were only detectable after 9 and 21 days, respectively.In spite of marked variation in knockdown dynamics, we find that a transient exposure to long dsRNA or siRNA triggers robust RNAi penetrance and persistence in liver fluke NEJs supporting the development of multiple-throughput phenotypic screens for control

High-Throughput Screening of a Luciferase Reporter of Gene Silencing on the Inactive X Chromosome.

Science.gov (United States)

Keegan, Alissa; Plath, Kathrin; Damoiseaux, Robert

2018-01-01

Assays of luciferase gene activity are a sensitive and quantitative reporter system suited to high-throughput screening. We adapted a luciferase assay to a screening strategy for identifying factors that reactivate epigenetically silenced genes. This epigenetic luciferase reporter is subject to endogenous gene silencing mechanisms on the inactive X chromosome (Xi) in primary mouse cells and thus captures the multilayered nature of chromatin silencing in development. Here, we describe the optimization of an Xi-linked luciferase reactivation assay in 384-well format and adaptation of the assay for high-throughput siRNA and chemical screening. Xi-luciferase reactivation screening has applications in stem cell biology and cancer therapy. We have used the approach described here to identify chromatin-modifying proteins and to identify drug combinations that enhance the gene reactivation activity of the DNA demethylating drug 5-aza-2'-deoxycytidine.

Yellow fever virus capsid protein is a potent suppressor of RNA silencing that binds double-stranded RNA.

Science.gov (United States)

Samuel, Glady Hazitha; Wiley, Michael R; Badawi, Atif; Adelman, Zach N; Myles, Kevin M

2016-11-29

Mosquito-borne flaviviruses, including yellow fever virus (YFV), Zika virus (ZIKV), and West Nile virus (WNV), profoundly affect human health. The successful transmission of these viruses to a human host depends on the pathogen's ability to overcome a potentially sterilizing immune response in the vector mosquito. Similar to other invertebrate animals and plants, the mosquito's RNA silencing pathway comprises its primary antiviral defense. Although a diverse range of plant and insect viruses has been found to encode suppressors of RNA silencing, the mechanisms by which flaviviruses antagonize antiviral small RNA pathways in disease vectors are unknown. Here we describe a viral suppressor of RNA silencing (VSR) encoded by the prototype flavivirus, YFV. We show that the YFV capsid (YFC) protein inhibits RNA silencing in the mosquito Aedes aegypti by interfering with Dicer. This VSR activity appears to be broadly conserved in the C proteins of other medically important flaviviruses, including that of ZIKV. These results suggest that a molecular "arms race" between vector and pathogen underlies the continued existence of flaviviruses in nature.

RNA interference-mediated silencing of speckle-type POZ protein promotes apoptosis of renal cell cancer cells

Directory of Open Access Journals (Sweden)

Liu X

2016-04-01

Full Text Available Xiaoxia Liu, Guiling Sun, Xiuju Sun Department of Nephrology, Affiliated Hospital of Weifang Medical University, Weifang, People’s Republic of China Abstract: This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP gene on renal cell cancer (RCC cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte–macrophage colony-stimulating factor and E-cadherin was significantly increased (P<0.05. The relevant signaling pathways were the integrin-mediated cell surface interactions pathway and extracellular matrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial

Effects of gene silencing of CypB on gastric cancer cells.

Science.gov (United States)

Guo, Feng; Zhang, Ying; Zhao, Chun-Na; Li, Lin; Guo, Yan-Jun

2015-04-01

To determine the effect of gene silencing of cyclophilin B (CypB) on growth and proliferation of gastric cancer cells. CypB siRNA lentivirus (LV-CypB-si) and control lentivirus (LV-si-con) were produced. CypB expression in gastric cancer cell lines was detected by Western blot. BGC823 and SGC7901 cells were chosen to be infected with LV-si-con and LV-CypB-si, and stable transfectants were isolated. The cell groups transfected with LV-CypB-siRNA, LV-siRNA-con and transfected no carrier were served as the experimental group, the implicit control group and the blank control group respectively. MTT and colony formation assays were used to examine the effect of CypB on the cell growth and proliferation in vitro. Cell cycle was analyzed with flow cytometry. The expression of VEGFR of BGC823-si and SGC7901-si was detected by Western blot. Gene silencing of CypB can inhibit gastric cancer cell growth, proliferation, cell cycle progress and tumorigenesis. CypB expression level was obviously higher in SGC7901 and BGC823 than MKN28 and GES. These two cell lines were infected with LV-si-con and LV-CypB-si respectively. MTT and cloney formation assays showed a significantly decreased rate of cell proliferation from the forth day or the fifth day in cells transfected with LV-CypB-si (PCypB resulted in slightly decreased percentage of S phase and increased percentage of G1 (PCypB could promote the G1-S transition of gastric cancer cell. In addition, the expression of VEGF of BGC823 and SGC7901 transfected with CypB siRNA was reduced in comparison with the implicit control group and the blank control group. Gene silencing of CypB decreases gastric cancer cells proliferation and in vivo tumorigenesis. These findings indiccate CypB could be a potential biomarker and therapeutic target for gastric cancer. Copyright © 2015 Hainan Medical College. Production and hosting by Elsevier B.V. All rights reserved.

A systemic gene silencing method suitable for high throughput, reverse genetic analyses of gene function in fern gametophytes

Directory of Open Access Journals (Sweden)

Tanurdzic Milos

2004-04-01

Full Text Available Abstract Background Ceratopteris richardii is a useful experimental system for studying gametophyte development and sexual reproduction in plants. However, few tools for cloning mutant genes or disrupting gene function exist for this species. The feasibility of systemic gene silencing as a reverse genetics tool was examined in this study. Results Several DNA constructs targeting a Ceratopteris protoporphyrin IX magnesium chelatase (CrChlI gene that is required for chlorophyll biosynthesis were each introduced into young gametophytes by biolistic delivery. Their transient expression in individual cells resulted in a colorless cell phenotype that affected most cells of the mature gametophyte, including the meristem and gametangia. The colorless phenotype was associated with a 7-fold decrease in the abundance of the endogenous transcript. While a construct designed to promote the transient expression of a CrChlI double stranded, potentially hairpin-forming RNA was found to be the most efficient in systemically silencing the endogenous gene, a plasmid containing the CrChlI cDNA insert alone was sufficient to induce silencing. Bombarded, colorless hermaphroditic gametophytes produced colorless embryos following self-fertilization, demonstrating that the silencing signal could be transmitted through gametogenesis and fertilization. Bombardment of young gametophytes with constructs targeting the Ceratopteris filamentous temperature sensitive (CrFtsZ and uroporphyrin dehydrogenase (CrUrod genes also produced the expected mutant phenotypes. Conclusion A method that induces the systemic silencing of target genes in the Ceratopteris gametophyte is described. It provides a simple, inexpensive and rapid means to test the functions of genes involved in gametophyte development, especially those involved in cellular processes common to all plants.

Smuggling gold nanoparticles across cell types - A new role for exosomes in gene silencing.

Science.gov (United States)

Roma-Rodrigues, Catarina; Pereira, Francisca; Alves de Matos, António P; Fernandes, Marta; Baptista, Pedro V; Fernandes, Alexandra R

2017-05-01

Once released to the extracellular space, exosomes enable the transfer of proteins, lipids and RNA between different cells, being able to modulate the recipient cells' phenotypes. Members of the Rab small GTP-binding protein family, such as RAB27A, are responsible for the coordination of several steps in vesicle trafficking, including budding, mobility, docking and fusion. The use of gold nanoparticles (AuNPs) for gene silencing is considered a cutting-edge technology. Here, AuNPs were functionalized with thiolated oligonucleotides anti-RAB27A (AuNP@PEG@anti-RAB27A) for selective silencing of the gene with a consequent decrease of exosomes´ release by MCF-7 and MDA-MB-453 cells. Furthermore, communication between tumor and normal cells was observed both in terms of alterations in c-Myc gene expression and transportation of the AuNPs, mediating gene silencing in secondary cells. Copyright © 2017 Elsevier Inc. All rights reserved.

An RNA polymerase II-and AGO4-associated protein acts in RNA-directed DNA methylation

KAUST Repository

Gao, Zhihuan

2010-04-21

DNA methylation is an important epigenetic mark in many eukaryotes. In plants, 24-nucleotide small interfering RNAs (siRNAs) bound to the effector protein, Argonaute 4 (AGO4), can direct de novo DNA methylation by the methyltransferase DRM2 (refs 2, 4-6). Here we report a new regulator of RNA-directed DNA methylation (RdDM) in Arabidopsis: RDM1. Loss-of-function mutations in the RDM1 gene impair the accumulation of 24-nucleotide siRNAs, reduce DNA methylation, and release transcriptional gene silencing at RdDM target loci. RDM1 encodes a small protein that seems to bind single-stranded methyl DNA, and associates and co-localizes with RNA polymerase II (Pol II, also known as NRPB), AGO4 and DRM2 in the nucleus. Our results indicate that RDM1 is a component of the RdDM effector complex and may have a role in linking siRNA production with pre-existing or de novo cytosine methylation. Our results also indicate that, although RDM1 and Pol V (also known as NRPE) may function together at some RdDM target sites in the peri-nucleolar siRNA processing centre, Pol II rather than Pol V is associated with the RdDM effector complex at target sites in the nucleoplasm. © 2010 Macmillan Publishers Limited. All rights reserved.

Stability of RNA silencing-based traits after virus infection

DEFF Research Database (Denmark)

Jørgensen, Bodil; Albrechtsen, Merete

2007-01-01

with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...

Paramutation of tobacco transgenes by small RNA-mediated transcriptional gene silencing

Czech Academy of Sciences Publication Activity Database

Crhák Khaitová, Lucie; Fojtová, M.; Křížová, Kateřina; Lunerová Bedřichová, Jana; Fulneček, Jaroslav; Depicker, A.; Kovařík, Aleš

2011-01-01

Roč. 6, č. 5 (2011), s. 650-660 ISSN 1559-2294 R&D Projects: GA ČR(CZ) GD204/09/H002; GA MŠk(CZ) LC06004 Grant - others:GA ČR(CZ) GPP501/11/P667 Program:GP Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : transcriptional gene silencing * transgene epialleles * DNA methylation Subject RIV: BO - Biophysics Impact factor: 4.318, year: 2011

Strategy of gene silencing in cassava for validation of resistance genes

International Nuclear Information System (INIS)

Cortes, Simon; Lopez, Camilo

2010-01-01

Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced

Phenotypic changes associated with RNA interference silencing of chalcone synthase in apple (Malus × domestica).

Science.gov (United States)

Dare, Andrew P; Tomes, Sumathi; Jones, Midori; McGhie, Tony K; Stevenson, David E; Johnson, Ross A; Greenwood, David R; Hellens, Roger P

2013-05-01

We have identified in apple (Malus × domestica) three chalcone synthase (CHS) genes. In order to understand the functional redundancy of this gene family RNA interference knockout lines were generated where all three of these genes were down-regulated. These lines had no detectable anthocyanins and radically reduced concentrations of dihydrochalcones and flavonoids. Surprisingly, down-regulation of CHS also led to major changes in plant development, resulting in plants with shortened internode lengths, smaller leaves and a greatly reduced growth rate. Microscopic analysis revealed that these phenotypic changes extended down to the cellular level, with CHS-silenced lines showing aberrant cellular organisation in the leaves. Fruit collected from one CHS-silenced line was smaller than the 'Royal Gala' controls, lacked flavonoids in the skin and flesh and also had changes in cell morphology. Auxin transport experiments showed increased rates of auxin transport in a CHS-silenced line compared with the 'Royal Gala' control. As flavonoids are well known to be key modulators of auxin transport, we hypothesise that the removal of almost all flavonoids from the plant by CHS silencing creates a vastly altered environment for auxin transport to occur and results in the observed changes in growth and development. © 2013 The Authors The Plant Journal © 2013 Blackwell Publishing Ltd.

The Role of piRNA-Mediated Epigenetic Silencing in the Population Dynamics of Transposable Elements in Drosophila melanogaster.

Directory of Open Access Journals (Sweden)

Yuh Chwen G Lee

2015-06-01

Full Text Available The piwi-interacting RNAs (piRNA are small RNAs that target selfish transposable elements (TEs in many animal genomes. Until now, piRNAs' role in TE population dynamics has only been discussed in the context of their suppression of TE transposition, which alone is not sufficient to account for the skewed frequency spectrum and stable containment of TEs. On the other hand, euchromatic TEs can be epigenetically silenced via piRNA-dependent heterochromatin formation and, similar to the widely known "Position-effect variegation", heterochromatin induced by TEs can "spread" into nearby genes. We hypothesized that the piRNA-mediated spread of heterochromatin from TEs into adjacent genes has deleterious functional effects and leads to selection against individual TEs. Unlike previously identified deleterious effects of TEs due to the physical disruption of DNA, the functional effect we investigated here is mediated through the epigenetic influences of TEs. We found that the repressive chromatin mark, H3K9me, is elevated in sequences adjacent to euchromatic TEs at multiple developmental stages in Drosophila melanogaster. Furthermore, the heterochromatic states of genes depend not only on the number of and distance from adjacent TEs, but also on the likelihood that their nearest TEs are targeted by piRNAs. These variations in chromatin status probably have functional consequences, causing genes near TEs to have lower expression. Importantly, we found stronger selection against TEs that lead to higher H3K9me enrichment of adjacent genes, demonstrating the pervasive evolutionary consequences of TE-induced epigenetic silencing. Because of the intrinsic biological mechanism of piRNA amplification, spread of TE heterochromatin could result in the theoretically required synergistic deleterious effects of TE insertions for stable containment of TE copy number. The indirect deleterious impact of piRNA-mediated epigenetic silencing of TEs is a previously

Nanocapsule-mediated cytosolic siRNA delivery for anti-inflammatory treatment.

Science.gov (United States)

Jiang, Ying; Hardie, Joseph; Liu, Yuanchang; Ray, Moumita; Luo, Xiang; Das, Riddha; Landis, Ryan F; Farkas, Michelle E; Rotello, Vincent M

2018-06-05

The use of nanoparticle-stabilized nanocapsules for cytosolic siRNA delivery for immunomodulation in vitro and in vivo is reported. These NPSCs deliver siRNA directly to the cytosol of macrophages in vitro with concomitant knockdown of gene expression. In vivo studies showed directed delivery of NPSCs to the spleen, enabling gene silencing of macrophages, with preliminary studies showing 70% gene knockdown at a siRNA dose of 0.28 mg/kg. Significantly, the delivery of siRNA targeting tumor necrosis factor-α efficiently silenced TNF-α expression in LPS-challenged mice, demonstrating efficacy in modulating immune response in an organ-selective manner. This research highlights the potential of the NPSC platform for targeted immunotherapy and further manipulation of the immune system. Copyright © 2018 Elsevier B.V. All rights reserved.

Manipulation of saponin biosynthesis by RNA interference-mediated silencing of β-amyrin synthase gene expression in soybean.

Science.gov (United States)

Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao

2011-10-01

Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.

A viral microRNA down-regulates multiple cell cycle genes through mRNA 5'UTRs.

Directory of Open Access Journals (Sweden)

Finn Grey

2010-06-01

Full Text Available Global gene expression data combined with bioinformatic analysis provides strong evidence that mammalian miRNAs mediate repression of gene expression primarily through binding sites within the 3' untranslated region (UTR. Using RNA induced silencing complex immunoprecipitation (RISC-IP techniques we have identified multiple cellular targets for a human cytomegalovirus (HCMV miRNA, miR-US25-1. Strikingly, this miRNA binds target sites primarily within 5'UTRs, mediating significant reduction in gene expression. Intriguingly, many of the genes targeted by miR-US25-1 are associated with cell cycle control, including cyclin E2, BRCC3, EID1, MAPRE2, and CD147, suggesting that miR-US25-1 is targeting genes within a related pathway. Deletion of miR-US25-1 from HCMV results in over expression of cyclin E2 in the context of viral infection. Our studies demonstrate that a viral miRNA mediates translational repression of multiple cellular genes by targeting mRNA 5'UTRs.

Bone marrow mesenchymal stem cells with Nogo-66 receptor gene silencing for repair of spinal cord injury

Science.gov (United States)

Li, Zhiyuan; Zhang, Zhanxiu; Zhao, Lili; Li, Hui; Wang, Suxia; Shen, Yong

2014-01-01

We hypothesized that RNA interference to silence Nogo-66 receptor gene expression in bone marrow mesenchymal stem cells before transplantation might further improve neurological function in rats with spinal cord transection injury. After 2 weeks, the number of neurons and BrdU-positive cells in the Nogo-66 receptor gene silencing group was higher than in the bone marrow mesenchymal stem cell group, and significantly greater compared with the model group. After 4 weeks, behavioral performance was significantly enhanced in the model group. After 8 weeks, the number of horseradish peroxidase-labeled nerve fibers was higher in the Nogo-66 receptor gene silencing group than in the bone marrow mesenchymal stem cell group, and significantly higher than in the model group. The newly formed nerve fibers and myelinated nerve fibers were detectable in the central transverse plane section in the bone marrow mesenchymal stem cell group and in the Nogo-66 receptor gene silencing group. PMID:25206893

Receptor-targeted aptamer-siRNA conjugate-directed transcriptional regulation of HIV-1

Science.gov (United States)

Zhou, Jiehua; Lazar, Daniel; Li, Haitang; Xia, Xin; Satheesan, Sangeetha; Charlins, Paige; O'Mealy, Denis; Akkina, Ramesh; Saayman, Sheena; Weinberg, Marc S.; Rossi, John J.; Morris, Kevin V.

2018-01-01

Gene-based therapies represent a promising therapeutic paradigm for the treatment of HIV-1, as they have the potential to maintain sustained viral inhibition with reduced treatment interventions. Such an option may represent a long-term treatment alternative to highly active antiretroviral therapy. Methods: We previously described a therapeutic approach, referred to as transcriptional gene silencing (TGS), whereby small noncoding RNAs directly inhibit the transcriptional activity of HIV-1 by targeting sites within the viral promoter, specifically the 5' long terminal repeat (LTR). TGS differs from traditional RNA interference (RNAi) in that it is characterized by concomitant silent-state epigenetic marks on histones and DNA. To deliver TGS-inducing RNAs, we developed functional RNA conjugates based on the previously reported dual function of the gp120 (A-1) aptamer conjugated to 27-mer Dicer-substrate anti-HIV-1 siRNA (dsiRNA), LTR-362. Results: We demonstrate here that high levels of processed guide RNAs localize to the nucleus in infected T lymphoblastoid CEM cell line and primary human CD4+ T-cells. Treatment of the aptamer-siRNA conjugates induced TGS with an ~10-fold suppression of viral p24 levels as measured at day 12 post infection. To explore the silencing efficacy of aptamer-siRNA conjugates in vivo, HIV-1-infected humanized NOD/SCID/IL2 rγnull mice (hu-NSG) were treated with the aptamer-siRNA conjugates. Systemic delivery of the A-1-stick-LTR-362 27-mer siRNA conjugates suppressed HIV-1 infection and protected CD4+ T cell levels in viremia hu-NSG mice. Principle conclusions: Collectively these data suggest that the gp120 aptamer-dsiRNA conjugate design is suitable for systemic delivery of small RNAs that can be used to suppress HIV-1. PMID:29556342

High-throughput sequencing of RNA silencing-associated small RNAs in olive (Olea europaea L..

Directory of Open Access Journals (Sweden)

Livia Donaire

Full Text Available Small RNAs (sRNAs of 20 to 25 nucleotides (nt in length maintain genome integrity and control gene expression in a multitude of developmental and physiological processes. Despite RNA silencing has been primarily studied in model plants, the advent of high-throughput sequencing technologies has enabled profiling of the sRNA component of more than 40 plant species. Here, we used deep sequencing and molecular methods to report the first inventory of sRNAs in olive (Olea europaea L.. sRNA libraries prepared from juvenile and adult shoots revealed that the 24-nt class dominates the sRNA transcriptome and atypically accumulates to levels never seen in other plant species, suggesting an active role of heterochromatin silencing in the maintenance and integrity of its large genome. A total of 18 known miRNA families were identified in the libraries. Also, 5 other sRNAs derived from potential hairpin-like precursors remain as plausible miRNA candidates. RNA blots confirmed miRNA expression and suggested tissue- and/or developmental-specific expression patterns. Target mRNAs of conserved miRNAs were computationally predicted among the olive cDNA collection and experimentally validated through endonucleolytic cleavage assays. Finally, we use expression data to uncover genetic components of the miR156, miR172 and miR390/TAS3-derived trans-acting small interfering RNA (tasiRNA regulatory nodes, suggesting that these interactive networks controlling developmental transitions are fully operational in olive.

RNAi-mediated Gene Silencing of Mutant Myotilin Improves Myopathy in LGMD1A Mice

Directory of Open Access Journals (Sweden)

Jian Liu

2014-01-01

Full Text Available Recent progress suggests gene therapy may one day be an option for treating some forms of limb girdle muscular dystrophy (LGMD. Nevertheless, approaches targeting LGMD have so far focused on gene replacement strategies for recessive forms of the disease. In contrast, no attempts have been made to develop molecular therapies for any of the eight dominantly inherited forms of LGMD. Importantly, the emergence of RNA interference (RNAi therapeutics in the last decade provided new tools to combat dominantly inherited LGMDs with molecular therapy. In this study, we describe the first RNAi-based, preclinical gene therapy approach for silencing a gene associated with dominant LGMD. To do this, we developed adeno-associated viral vectors (AAV6 carrying designed therapeutic microRNAs targeting mutant myotilin (MYOT, which is the underlying cause of LGMD type 1A (LGMD1A. Our best MYOT-targeted microRNA vector (called miMYOT significantly reduced mutant myotilin mRNA and soluble protein expression in muscles of LGMD1A mice (the TgT57I model both 3 and 9 months after delivery, demonstrating short- and long-term silencing effects. This MYOT gene silencing subsequently decreased deposition of MYOT-seeded intramuscular protein aggregates, which is the hallmark feature of LGMD1A. Histological improvements were accompanied by significant functional correction, as miMYOT-treated animals showed increased muscle weight and improved specific force in the gastrocnemius, which is one of the most severely affected muscles in TgT57I mice and patients with dominant myotilin mutations. These promising results in a preclinical model of LGMD1A support the further development of RNAi-based molecular therapy as a prospective treatment for LGMD1A. Furthermore, this study sets a foundation that may be refined and adapted to treat other dominant LGMD and related disorders.

Systematic Evaluation of Promising Clinical Trials-Gene Silencing for the Treatment of Glioblastoma.

Science.gov (United States)

Karaarslan, Numan; Yilmaz, Ibrahim; Ozbek, Hanefi; Caliskan, Tezcan; Topuk, Savas; Sirin, Duygu Yasar; Ates, Ozkan

2018-04-06

The aim of this study was to systematically investigate the role of artificial small interfering RNA (siRNA) molecules in glioblastoma treatment and to give a detailed overview of the literature concerning studies performed in this field worldwide in the last 31 years. Articles about clinical trials conducted between December 1, 1949 and November 8, 2017, were identified from the Cochrane Collaboration, the Cochrane Library, Ovid MEDLINE, ProQuest, the National Library of Medicine, and PubMed electronic databases, using the terms "post transcriptional gene silencing," "small interfering RNA," "siRNA," and "glioblastoma," either individually or combined (\\"OR\\" and \\"AND"), without language and country restrictions. Articles that met the examination criteria were included in the study. After descriptive statistical evaluation, the results were reported in frequency (%). After scanning 2.752 articles, five articles were found that met the research criteria. Examination of full texts of the five identified articles provided no sufficient evidence for research conducted with regard to the use of gene silencing via siRNAs in glioblastoma treatment. To be able to evaluate the clinical use of siRNAs, there is an urgent need for in-vivo studies and for trials with randomized, controlled, and clinical designs that provide long-term functional outcomes.

Receptor-targeted liposome-peptide-siRNA nanoparticles represent an efficient delivery system for MRTF silencing in conjunctival fibrosis.

Science.gov (United States)

Yu-Wai-Man, Cynthia; Tagalakis, Aristides D; Manunta, Maria D; Hart, Stephen L; Khaw, Peng T

2016-02-24

There is increasing evidence that the Myocardin-related transcription factor/Serum response factor (MRTF/SRF) pathway plays a key role in fibroblast activation and that knocking down MRTF can lead to reduced scarring and fibrosis. Here, we have developed a receptor-targeted liposome-peptide-siRNA nanoparticle as a non-viral delivery system for MRTF-B siRNA in conjunctival fibrosis. Using 50 nM siRNA, the MRTF-B gene was efficiently silenced by 76% and 72% with LYR and LER nanoparticles, respectively. The silencing efficiency was low when non-targeting peptides or siRNA alone or liposome-siRNA alone were used. LYR and LER nanoparticles also showed higher silencing efficiency than PEGylated LYR-P and LER-P nanoparticles. The nanoparticles were not cytotoxic using different liposomes, targeting peptides, and 50 nM siRNA. Three-dimensional fibroblast-populated collagen matrices were also used as a functional assay to measure contraction in vitro, and showed that MRTF-B LYR nanoparticles completely blocked matrix contraction after a single transfection treatment. In conclusion, this is the first study to develop and show that receptor-targeted liposome-peptide-siRNA nanoparticles represent an efficient and safe non-viral siRNA delivery system that could be used to prevent fibrosis after glaucoma filtration surgery and other contractile scarring conditions in the eye.

Efficient construction of an inverted minimal H1 promoter driven siRNA expression cassette: facilitation of promoter and siRNA sequence exchange.

Directory of Open Access Journals (Sweden)

Hoorig Nassanian

2007-08-01

Full Text Available RNA interference (RNAi, mediated by small interfering RNA (siRNA, is an effective method used to silence gene expression at the post-transcriptional level. Upon introduction into target cells, siRNAs incorporate into the RNA-induced silencing complex (RISC. The antisense strand of the siRNA duplex then "guides" the RISC to the homologous mRNA, leading to target degradation and gene silencing. In recent years, various vector-based siRNA expression systems have been developed which utilize opposing polymerase III promoters to independently drive expression of the sense and antisense strands of the siRNA duplex from the same template.We show here the use of a ligase chain reaction (LCR to develop a new vector system called pInv-H1 in which a DNA sequence encoding a specific siRNA is placed between two inverted minimal human H1 promoters (approximately 100 bp each. Expression of functional siRNAs from this construct has led to efficient silencing of both reporter and endogenous genes. Furthermore, the inverted H1 promoter-siRNA expression cassette was used to generate a retrovirus vector capable of transducing and silencing expression of the targeted protein by>80% in target cells.The unique design of this construct allows for the efficient exchange of siRNA sequences by the directional cloning of short oligonucleotides via asymmetric restriction sites. This provides a convenient way to test the functionality of different siRNA sequences. Delivery of the siRNA cassette by retroviral transduction suggests that a single copy of the siRNA expression cassette efficiently knocks down gene expression at the protein level. We note that this vector system can potentially be used to generate a random siRNA library. The flexibility of the ligase chain reaction suggests that additional control elements can easily be introduced into this siRNA expression cassette.

ABCE1 is a highly conserved RNA silencing suppressor.

Directory of Open Access Journals (Sweden)

Kairi Kärblane

Full Text Available ATP-binding cassette sub-family E member 1 (ABCE1 is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference.

The Ebola virus VP35 protein is a suppressor of RNA silencing.

Directory of Open Access Journals (Sweden)

Joost Haasnoot

2007-06-01

Full Text Available RNA silencing or interference (RNAi is a gene regulation mechanism in eukaryotes that controls cell differentiation and developmental processes via expression of microRNAs. RNAi also serves as an innate antiviral defence response in plants, nematodes, and insects. This antiviral response is triggered by virus-specific double-stranded RNA molecules (dsRNAs that are produced during infection. To overcome antiviral RNAi responses, many plant and insect viruses encode RNA silencing suppressors (RSSs that enable them to replicate at higher titers. Recently, several human viruses were shown to encode RSSs, suggesting that RNAi also serves as an innate defence response in mammals. Here, we demonstrate that the Ebola virus VP35 protein is a suppressor of RNAi in mammalian cells and that its RSS activity is functionally equivalent to that of the HIV-1 Tat protein. We show that VP35 can replace HIV-1 Tat and thereby support the replication of a Tat-minus HIV-1 variant. The VP35 dsRNA-binding domain is required for this RSS activity. Vaccinia virus E3L protein and influenza A virus NS1 protein are also capable of replacing the HIV-1 Tat RSS function. These findings support the hypothesis that RNAi is part of the innate antiviral response in mammalian cells. Moreover, the results indicate that RSSs play a critical role in mammalian virus replication.

Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1

NARCIS (Netherlands)

Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.

2012-01-01

Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes

Enhancement of antiproliferative activity of interferons by RNA interference-mediated silencing of SOCS gene expression in tumor cells.

Science.gov (United States)

Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu

2008-08-01

The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.

A Medicago truncatula rdr6 allele impairs transgene silencing and endogenous phased siRNA production but not development.

Science.gov (United States)

Bustos-Sanmamed, Pilar; Hudik, Elodie; Laffont, Carole; Reynes, Christelle; Sallet, Erika; Wen, Jiangqi; Mysore, Kirankumar S; Camproux, Anne-Claude; Hartmann, Caroline; Gouzy, Jérome; Frugier, Florian; Crespi, Martin; Lelandais-Brière, Christine

2014-12-01

RNA-dependent RNA polymerase 6 (RDR6) and suppressor of gene silencing 3 (SGS3) act together in post-transcriptional transgene silencing mediated by small interfering RNAs (siRNAs) and in biogenesis of various endogenous siRNAs including the tasiARFs, known regulators of auxin responses and plant development. Legumes, the third major crop family worldwide, has been widely improved through transgenic approaches. Here, we isolated rdr6 and sgs3 mutants in the model legume Medicago truncatula. Two sgs3 and one rdr6 alleles led to strong developmental defects and impaired biogenesis of tasiARFs. In contrast, the rdr6.1 homozygous plants produced sufficient amounts of tasiARFs to ensure proper development. High throughput sequencing of small RNAs from this specific mutant identified 354 potential MtRDR6 substrates, for which siRNA production was significantly reduced in the mutant. Among them, we found a large variety of novel phased loci corresponding to protein-encoding genes or transposable elements. Interestingly, measurement of GFP expression revealed that post-transcriptional transgene silencing was reduced in rdr6.1 roots. Hence, this novel mis-sense mutation, affecting a highly conserved amino acid residue in plant RDR6s, may be an interesting tool both to analyse endogenous pha-siRNA functions and to improve transgene expression, at least in legume species. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

OpenAIRE

Hedil, Marcio; Sterken, Mark G.; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard

2015-01-01

RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silen...

The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

International Nuclear Information System (INIS)

Fusaro, Adriana F.; Correa, Regis L.; Nakasugi, Kenlee; Jackson, Craig; Kawchuk, Lawrence; Vaslin, Maite F.S.; Waterhouse, Peter M.

2012-01-01

The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0 PE , in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0 PE has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0 PE destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

Energy Technology Data Exchange (ETDEWEB)

Fusaro, Adriana F. [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Correa, Regis L. [CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Nakasugi, Kenlee; Jackson, Craig [University of Sydney, NSW 2006 (Australia); Kawchuk, Lawrence [Research Centre, Agriculture and Agri-Food Canada, Lethbridge, AB T1J4B1 (Canada); Vaslin, Maite F.S. [Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Waterhouse, Peter M., E-mail: peter.waterhouse@sydney.edu.au [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia)

2012-05-10

The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0{sup PE}, in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0{sup PE} has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0{sup PE} destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

Methylation and silencing of the retinoic acid receptor-β2 gene in cervical cancer

International Nuclear Information System (INIS)

Ivanova, Tatyana; Petrenko, Anatolii; Gritsko, Tatyana; Vinokourova, Svetlana; Eshilev, Ernest; Kobzeva, Vera; Kisseljov, Fjodor; Kisseljova, Natalia

2002-01-01

Expression of the retinoic acid receptor β2 (RAR-β2), a putative tumor suppressor gene, is reduced in various human cancers, including squamous cell carcinomas (SCC) of the uterine cervix. The mechanism of the inhibition of RAR-β2 expression remains obscure. We examined whether methylation of RAR-β2 gene could be responsible for this silencing in cervical SCC. Expression of RAR-β2 mRNA and methylation status of the 5' region of RAR-β2 gene were examined in 20 matched specimens from patients with cervical SCC and in three cervical cancer cell lines by Northern blot analysis and methylation-specific PCR (MSP) assay or Southern blot analysis respectively. In 8 out 20 cervical SCC (40%) the levels of RAR-β2 mRNA were decreased or undetectable in comparison with non-neoplastic cervix tissues. All 8 tumors with reduced levels of RAR-β2 mRNA expression showed methylation of the promoter and the first exon expressed in the RAR-β2 transcript. The RAR-β2 gene from non-neoplastic cervical tissues was mostly unmethylated and expressed, but methylated alleles of the gene were found in three samples of the morphologically normal tissues adjacent to the tumors. Three cervical cancer cell lines with extremely low level of RAR-β2 mRNA expression, SiHA, HeLA and CaSki, also showed methylation of this region of the RAR-β2 gene. These findings suggest that methylation of the 5' region of RAR-β2 gene may contribute to gene silencing and that methylation of this region may be an important and early event in cervical carcinogenesis. These findings may be useful to make retinoids more effective as preventive and therapeutic agents in combination with inhibitors of DNA methylation

siRNA-Mediated Silencing of doublesex during Female Development of the Dengue Vector Mosquito Aedes aegypti.

Directory of Open Access Journals (Sweden)

Keshava Mysore

2015-11-01

Full Text Available The development of sex-specific traits, including the female-specific ability to bite humans and vector disease, is critical for vector mosquito reproduction and pathogen transmission. Doublesex (Dsx, a terminal transcription factor in the sex determination pathway, is known to regulate sex-specific gene expression during development of the dengue fever vector mosquito Aedes aegypti. Here, the effects of developmental siRNA-mediated dsx silencing were assessed in adult females. Targeting of dsx during A. aegypti development resulted in decreased female wing size, a correlate for body size, which is typically larger in females. siRNA-mediated targeting of dsx also resulted in decreased length of the adult female proboscis. Although dsx silencing did not impact female membrane blood feeding or mating behavior in the laboratory, decreased fecundity and fertility correlated with decreased ovary length, ovariole length, and ovariole number in dsx knockdown females. Dsx silencing also resulted in disruption of olfactory system development, as evidenced by reduced length of the female antenna and maxillary palp and the sensilla present on these structures, as well as disrupted odorant receptor expression. Female lifespan, a critical component of the ability of A. aegypti to transmit pathogens, was also significantly reduced in adult females following developmental targeting of dsx. The results of this investigation demonstrate that silencing of dsx during A. aegypti development disrupts multiple sex-specific morphological, physiological, and behavioral traits of adult females, a number of which are directly or indirectly linked to mosquito reproduction and pathogen transmission. Moreover, the olfactory phenotypes observed connect Dsx to development of the olfactory system, suggesting that A. aegypti will be an excellent system in which to further assess the developmental genetics of sex-specific chemosensation.

An Algorithm for Generating Small RNAs Capable of Epigenetically Modulating Transcriptional Gene Silencing and Activation in Human Cells

Directory of Open Access Journals (Sweden)

Amanda Ackley

2013-01-01

Full Text Available Small noncoding antisense RNAs (sasRNAs guide epigenetic silencing complexes to target loci in human cells and modulate gene transcription. When these targeted loci are situated within a promoter, long-term, stable epigenetic silencing of transcription can occur. Recent studies suggest that there exists an endogenous form of such epigenetic regulation in human cells involving long noncoding RNAs. In this article, we present and validate an algorithm for the generation of highly effective sasRNAs that can mimic the endogenous noncoding RNAs involved in the epigenetic regulation of gene expression. We validate this algorithm by targeting several oncogenes including AKT-1, c-MYC, K-RAS, and H-RAS. We also target a long antisense RNA that mediates the epigenetic repression of the tumor suppressor gene DUSP6, silenced in pancreatic cancer. An algorithm that can efficiently design small noncoding RNAs for the epigenetic transcriptional silencing or activation of specific genes has potential therapeutic and experimental applications.

Expression of plasmid-based shRNA against the E1 and nsP1 genes effectively silenced Chikungunya virus replication.

Directory of Open Access Journals (Sweden)

Shirley Lam

Full Text Available BACKGROUND: Chikungunya virus (CHIKV is a re-emerging alphavirus that causes chikungunya fever and persistent arthralgia in humans. Currently, there is no effective vaccine or antiviral against CHIKV infection. Therefore, this study evaluates whether RNA interference which targets at viral genomic level may be a novel antiviral strategy to inhibit the medically important CHIKV infection. METHODS: Plasmid-based small hairpin RNA (shRNA was investigated for its efficacy in inhibiting CHIKV replication. Three shRNAs designed against CHIKV Capsid, E1 and nsP1 genes were transfected to establish stable shRNA-expressing cell clones. Following infection of stable shRNA cells clones with CHIKV at M.O.I. 1, viral plaque assay, Western blotting and transmission electron microscopy were performed. The in vivo efficacy of shRNA against CHIKV replication was also evaluated in a suckling murine model of CHIKV infection. RESULTS: Cell clones expressing shRNAs against CHIKV E1 and nsP1 genes displayed significant inhibition of infectious CHIKV production, while shRNA Capsid demonstrated a modest inhibitory effect as compared to scrambled shRNA cell clones and non-transfected cell controls. Western blot analysis of CHIKV E2 protein expression and transmission electron microscopy of shRNA E1 and nsP1 cell clones collectively demonstrated similar inhibitory trends against CHIKV replication. shRNA E1 showed non cell-type specific anti-CHIKV effects and broad-spectrum silencing against different geographical strains of CHIKV. Furthermore, shRNA E1 clones did not exert any inhibition against Dengue virus and Sindbis virus replication, thus indicating the high specificity of shRNA against CHIKV replication. Moreover, no shRNA-resistant CHIKV mutant was generated after 50 passages of CHIKV in the stable cell clones. More importantly, strong and sustained anti-CHIKV protection was conferred in suckling mice pre-treated with shRNA E1. CONCLUSION: Taken together, these

Silencing of the PiAvr3a effector-encoding gene from Phytophthora infestans by transcriptional fusion to a short interspersed element.

Science.gov (United States)

Vetukuri, Ramesh R; Tian, Zhendong; Avrova, Anna O; Savenkov, Eugene I; Dixelius, Christina; Whisson, Stephen C

2011-12-01

Phytophthora infestans is the notorious oomycete causing late blight of potato and tomato. A large proportion of the P. infestans genome is composed of transposable elements, the activity of which may be controlled by RNA silencing. Accumulation of small RNAs is one of the hallmarks of RNA silencing. Here we demonstrate the presence of small RNAs corresponding to the sequence of a short interspersed retrotransposable element (SINE) suggesting that small RNAs might be involved in silencing of SINEs in P. infestans. This notion was exploited to develop novel tools for gene silencing in P. infestans by engineering transcriptional fusions of the PiAvr3a gene, encoding an RXLR avirulence effector, to the infSINEm retroelement. Transgenic P. infestans lines expressing either 5'-infSINEm::PiAvr3a-3' or 5'-PiAvr3a::SINEm-3' chimeric transcripts initially exhibited partial silencing of PiAvr3a. Over time, PiAvr3a either recovered wild type transcript levels in some lines, or became fully silenced in others. Introduction of an inverted repeat construct was also successful in yielding P. infestans transgenic lines silenced for PiAvr3a. In contrast, constructs expressing antisense or aberrant RNA transcripts failed to initiate silencing of PiAvr3a. Lines exhibiting the most effective silencing of PiAvr3a were either weakly or non-pathogenic on susceptible potato cv. Bintje. This study expands the repertoire of reverse genetics tools available for P. infestans research, and provides insights into a possible mode of variation in effector expression through spread of silencing from adjacent retroelements. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

Post-transcriptional silencing of flavonol synthase mRNA in tobacco leads to fruits with arrested seed set.

Directory of Open Access Journals (Sweden)

Monika Mahajan

Full Text Available Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi through post-transcriptional gene silencing (PTGS of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless

Characterization of a Brome mosaic virus strain and its use as a vector for gene silencing in monocotyledonous hosts.

Science.gov (United States)

Ding, Xin Shun; Schneider, William L; Chaluvadi, Srinivasa Rao; Mian, M A Rouf; Nelson, Richard S

2006-11-01

Virus-induced gene silencing (VIGS) is used to analyze gene function in dicotyledonous plants but less so in monocotyledonous plants (particularly rice and corn), partially due to the limited number of virus expression vectors available. Here, we report the cloning and modification for VIGS of a virus from Festuca arundinacea Schreb. (tall fescue) that caused systemic mosaic symptoms on barley, rice, and a specific cultivar of maize (Va35) under greenhouse conditions. Through sequencing, the virus was determined to be a strain of Brome mosaic virus (BMV). The virus was named F-BMV (F for Festuca), and genetic determinants that controlled the systemic infection of rice were mapped to RNAs 1 and 2 of the tripartite genome. cDNA from RNA 3 of the Russian strain of BMV (R-BMV) was modified to accept inserts from foreign genes. Coinoculation of RNAs 1 and 2 from F-BMV and RNA 3 from R-BMV expressing a portion of a plant gene to leaves of barley, rice, and maize plants resulted in visual silencing-like phenotypes. The visual phenotypes were correlated with decreased target host transcript levels in the corresponding leaves. The VIGS visual phenotype varied from maintained during silencing of actin 1 transcript expression to transient with incomplete penetration through affected tissue during silencing of phytoene desaturase expression. F-BMV RNA 3 was modified to allow greater accumulation of virus while minimizing virus pathogenicity. The modified vector C-BMV(A/G) (C for chimeric) was shown to be useful for VIGS. These BMV vectors will be useful for analysis of gene function in rice and maize for which no VIGS system is reported.

Homology-dependent Gene Silencing in Paramecium

Science.gov (United States)

Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa

1998-01-01

Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389

The Nuclear Cap-Binding Complex Mediates Meiotic Silencing by Unpaired DNA

Directory of Open Access Journals (Sweden)

Logan M. Decker

2017-04-01

Full Text Available In the filamentous fungus Neurospora crassa, cross walls between individual cells are normally incomplete, making the entire fungal network vulnerable to attack by viruses and selfish DNAs. Accordingly, several genome surveillance mechanisms are maintained to help the fungus combat these repetitive elements. One of these defense mechanisms is called meiotic silencing by unpaired DNA (MSUD, which identifies and silences unpaired genes during meiosis. Utilizing common RNA interference (RNAi proteins, such as Dicer and Argonaute, MSUD targets mRNAs homologous to the unpaired sequence to achieve silencing. In this study, we have identified an additional silencing component, namely the cap-binding complex (CBC. Made up of cap-binding proteins CBP20 and CBP80, CBC associates with the 5′ cap of mRNA transcripts in eukaryotes. The loss of CBC leads to a deficiency in MSUD activity, suggesting its role in mediating silencing. As confirmed in this study, CBC is predominantly nuclear, although it is known to travel in and out of the nucleus to facilitate RNA transport. As seen in animals but not in plants, CBP20’s robust nuclear import depends on CBP80 in Neurospora. CBC interacts with a component (Argonaute of the perinuclear meiotic silencing complex (MSC, directly linking the two cellular factors.

HC-Pro silencing suppressor significantly alters the gene expression profile in tobacco leaves and flowers

Directory of Open Access Journals (Sweden)

Lehto Kirsi

2011-04-01

Full Text Available Abstract Background RNA silencing is used in plants as a major defence mechanism against invasive nucleic acids, such as viruses. Accordingly, plant viruses have evolved to produce counter defensive RNA-silencing suppressors (RSSs. These factors interfere in various ways with the RNA silencing machinery in cells, and thereby disturb the microRNA (miRNA mediated endogene regulation and induce developmental and morphological changes in plants. In this study we have explored these effects using previously characterized transgenic tobacco plants which constitutively express (under CaMV 35S promoter the helper component-proteinase (HC-Pro derived from a potyviral genome. The transcript levels of leaves and flowers of these plants were analysed using microarray techniques (Tobacco 4 × 44 k, Agilent. Results Over expression of HC-Pro RSS induced clear phenotypic changes both in growth rate and in leaf and flower morphology of the tobacco plants. The expression of 748 and 332 genes was significantly changed in the leaves and flowers, respectively, in the HC-Pro expressing transgenic plants. Interestingly, these transcriptome alterations in the HC-Pro expressing tobacco plants were similar as those previously detected in plants infected with ssRNA-viruses. Particularly, many defense-related and hormone-responsive genes (e.g. ethylene responsive transcription factor 1, ERF1 were differentially regulated in these plants. Also the expression of several stress-related genes, and genes related to cell wall modifications, protein processing, transcriptional regulation and photosynthesis were strongly altered. Moreover, genes regulating circadian cycle and flowering time were significantly altered, which may have induced a late flowering phenotype in HC-Pro expressing plants. The results also suggest that photosynthetic oxygen evolution, sugar metabolism and energy levels were significantly changed in these transgenic plants. Transcript levels of S

Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

Directory of Open Access Journals (Sweden)

Tatsuya eKon

2014-11-01

Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.

Identification and characterization of two RNA silencing suppressors encoded by ophioviruses

NARCIS (Netherlands)

Robles Luna, Gabriel; Reyes, Carina A.; Peña, Eduardo J.; Ocolotobiche, Eliana; Baeza, Cecilia; Borniego, Maria Belén; Kormelink, Richard; García, María Laura

2017-01-01

Citrus psorosis virus and Mirafiori lettuce big-vein virus are two members of the genus Ophiovirus, family Ophioviridae. So far, how these viruses can interfere in the antiviral RNA silencing pathway is not known. In this study, using a local GFP silencing assay on Nicotiana benthamiana, the

A Protein Complex Required for Polymerase V Transcripts and RNA- Directed DNA Methylation in Arabidopsis

KAUST Repository

Law, Julie A.; Ausí n, Israel; Johnson, Lianna M.; Vashisht, Ajay  A Amar; Zhu, Jian-Kang; Wohlschlegel, James  A A.; Jacobsen, Steven E.

2010-01-01

DNA methylation is an epigenetic modification associated with gene silencing. In Arabidopsis, DNA methylation is established by DOMAINS REARRANGED METHYLTRANSFERASE 2 (DRM2), which is targeted by small interfering RNAs through a pathway termed RNA-directed DNA methylation (RdDM) [1, 2]. Recently, RdDM was shown to require intergenic noncoding (IGN) transcripts that are dependent on the Pol V polymerase. These transcripts are proposed to function as scaffolds for the recruitment of downstream RdDM proteins, including DRM2, to loci that produce both siRNAs and IGN transcripts [3]. However, the mechanism(s) through which Pol V is targeted to specific genomic loci remains largely unknown. Through affinity purification of two known RdDM components, DEFECTIVE IN RNA-DIRECTED DNA METHYLATION 1 (DRD1) [4] and DEFECTIVE IN MERISTEM SILENCING 3 (DMS3) [5, 6], we found that they copurify with each other and with a novel protein, RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex we term DDR. We also found that DRD1 copurified with Pol V subunits and that RDM1, like DRD1 [3] and DMS3 [7], is required for the production of Pol V-dependent transcripts. These results suggest that the DDR complex acts in RdDM at a step upstream of the recruitment or activation of Pol V. © 2010 Elsevier Ltd. All rights reserved.

A Protein Complex Required for Polymerase V Transcripts and RNA- Directed DNA Methylation in Arabidopsis

KAUST Repository

Law, Julie A.

2010-05-01

DNA methylation is an epigenetic modification associated with gene silencing. In Arabidopsis, DNA methylation is established by DOMAINS REARRANGED METHYLTRANSFERASE 2 (DRM2), which is targeted by small interfering RNAs through a pathway termed RNA-directed DNA methylation (RdDM) [1, 2]. Recently, RdDM was shown to require intergenic noncoding (IGN) transcripts that are dependent on the Pol V polymerase. These transcripts are proposed to function as scaffolds for the recruitment of downstream RdDM proteins, including DRM2, to loci that produce both siRNAs and IGN transcripts [3]. However, the mechanism(s) through which Pol V is targeted to specific genomic loci remains largely unknown. Through affinity purification of two known RdDM components, DEFECTIVE IN RNA-DIRECTED DNA METHYLATION 1 (DRD1) [4] and DEFECTIVE IN MERISTEM SILENCING 3 (DMS3) [5, 6], we found that they copurify with each other and with a novel protein, RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex we term DDR. We also found that DRD1 copurified with Pol V subunits and that RDM1, like DRD1 [3] and DMS3 [7], is required for the production of Pol V-dependent transcripts. These results suggest that the DDR complex acts in RdDM at a step upstream of the recruitment or activation of Pol V. © 2010 Elsevier Ltd. All rights reserved.

Disease Control in Animals Using Molecular Technology by Inactivation of ASO, RNAi and ss-siRNA Genes

Directory of Open Access Journals (Sweden)

Muhamad Ali

2014-03-01

Full Text Available Globalization causes high mobility of human and livestock, hence increase the transmission of infectious diseases, including avian influenza, severe acute respiratory syndrome (SARS, and swine influenza. Therefore, prevention of those diseases is required. Vaccines are effective to prevent infectious diseases; however, their development takes a long time and they cannot provide immediate protection in pandemic cases. This paper describes several gene silencing technologies including antisense oligonucleotide (ASO, RNA interference (RNAi and single strand-small interfering RNA (ss-siRNA for controlling diseases. The primary mechanism of these technologies is inhibition of gene expression, typically by causing the destruction of specific RNA molecule of the pathogen. The use of gene silencing technologies is expected to give new alternative that is more effective in eradication of infectious diseases in animals before threaten human being.

Virus-induced gene silencing in diverse maize lines using the Brome Mosaic virus-based silencing vector

Science.gov (United States)

Virus-induced gene silencing (VIGS) is a widely used tool for gene function studies in many plant species, though its use in monocots has been limited. Using a Brome mosaic virus (BMV) vector designed to silence the maize phytoene desaturase gene, a genetically diverse set of maize inbred lines was ...

Characterization of white shrimp Litopenaeus vannamei integrin β and its role in immunomodulation by dsRNA-mediated gene silencing.

Science.gov (United States)

Lin, Yong-Chin; Chen, Jiann-Chu; Chen, Yu-Yuan; Liu, Chun-Hung; Cheng, Winton; Hsu, Chih-Hung; Tsui, Wen-Ching

2013-06-01

The full sequence of white shrimp Litopenaeus vannamei integrin β (LV-B) is 2879bp which encodes 787 amino acids (aa) of the open reading frame (ORF). The mature protein (764 aa) contains (1) an extracellular domain (ED) of 692 aa, (2) a transmembrane domain (TD) of 23 aa, and (3) a cytoplasmic domain (CD) of 49 aa. The cloned LV-B grouped together with crayfish Pacifastacus leniusculus integrin β (PL-B1), but was far away from vertebrate integrin β1, β3, β5, β6, β7, and β8, and another L. vannamei integrin β (LV). A Southern blot analysis indicated that the cloned LV-B was a single copy of genomic DNA. LV-B mRNA was expressed in all tissues, and was highly expressed in haemocytes. LV-B was downregulated in shrimp 24 and 96h after having received white spot syndrome virus (WSSV). LV-B expression by haemocytes of shrimp was higher in the postmoult (A and B) stage, and lower in the premoult (D2/D3) stage. LV-B expression was significantly higher by shrimp reared in 2.5‰ and 5‰ salinities. Shrimp injected with integrin β dsRNA showed gene silencing of integrin β after 36h. LV-B-silenced shrimp showed decreased hyaline cells (HCs), granular cells (GCs, including semi-granular cells), the total haemocyte count (THC), respiratory bursts (RBs), and lysozyme activity, but showed increased RB/HC, superoxide dismutase (SOD) activity/HC, and the phenoloxidase (PO) activity/GC. LV-B-silenced shrimp showed upregulated expressions of lipopolysaccharide- and β-glucan-binding protein (LGBP), peroxinectin (PX), prophenoloxidase I (proPO I), proPO II, proPO-activating enzyme (ppA), α2-macroglobulin (α2-M), cytMnSOD, mtMnSOD, and heat shock protein 70 (HSP70). It was concluded that integrin β plays important roles in proPO activation, phagocytosis, and the antioxidant system for immunomodulation in shrimp. Copyright © 2013 Elsevier Ltd. All rights reserved.

The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing.

Science.gov (United States)

Fusaro, Adriana F; Barton, Deborah A; Nakasugi, Kenlee; Jackson, Craig; Kalischuk, Melanie L; Kawchuk, Lawrence M; Vaslin, Maite F S; Correa, Regis L; Waterhouse, Peter M

2017-10-10

The plant viral family Luteoviridae is divided into three genera: Luteovirus , Polerovirus and Enamovirus . Without assistance from another virus, members of the family are confined to the cells of the host plant's vascular system. The first open reading frame (ORF) of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs) against the plant's viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV), however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant's silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant's anti-viral defense.

Nanosystems based on siRNA silencing HuR expression counteract diabetic retinopathy in rat.

Science.gov (United States)

Amadio, Marialaura; Pascale, Alessia; Cupri, Sarha; Pignatello, Rosario; Osera, Cecilia; D Agata, Velia; D Amico, Agata Grazia; Leggio, Gian Marco; Ruozi, Barbara; Govoni, Stefano; Drago, Filippo; Bucolo, Claudio

2016-09-01

We evaluated whether specifically and directly targeting human antigen R (HuR), a member of embryonic lethal abnormal vision (ELAV) proteins family, may represent a new potential therapeutic strategy to manage diabetic retinopathy. Nanosystems loaded with siRNA silencing HuR expression (lipoplexes), consisting of solid lipid nanoparticles (SLN) and liposomes (SUV) were prepared. Photon correlation spectroscopy analysis, Zeta potential measurement and atomic force microscopy (AFM) studies were carried out to characterize the complexation of siRNA with the lipid nanocarriers. Nanosystems were evaluated by using AFM and scanning electron microscopy. The lipoplexes were injected into the eye of streptozotocin (STZ)-induced diabetic rats. Retinal HuR and VEGF levels were detected by Western blot and ELISA, respectively. Retinal histology was also carried out. The results demonstrated that retinal HuR and VEGF are significantly increased in STZ-rats and are blunted by HuR siRNA treatment. Lipoplexes with a weak positive surface charge and with a 4:1 N/P (cationic lipid nitrogen to siRNA phosphate) ratio exert a better transfection efficiency, significantly dumping retinal HuR and VEGF levels. In conclusion, we demonstrated that siRNA can be efficiently delivered into the rat retina using lipid-based nanocarriers, and some of the lipoplexes loaded with siRNA silencing HuR expression are potential candidates to manage retinal diseases. Copyright © 2016 Elsevier Ltd. All rights reserved.

Platinum Interference with siRNA Non-seed Regions Fine-Tunes Silencing Capacity

DEFF Research Database (Denmark)

Hedman, Hanna K; Kirpekar, Finn; Elmroth, Sofi K C

2011-01-01

expression, and the other one focused on the function of endogenous miRNAs. In both cases, the active molecule consists of a ∼20-nucleotide-long RNA duplex. In the siRNA case, improved systemic stability is of central interest for its further development toward clinical applications. With respect to mi......RNA processing and function, understanding its influence on mRNA targeting and the silencing ability of individual miRNAs, e.g., under pathological conditions, remains a scientific challenge. In the present study, a model system is presented where the influence of the two clinically used anticancer drugs......, cisplatin and oxaliplatin, on siRNA's silencing capacity has been evaluated. More specifically, siRNAs targeting the 3' UTR region of Wnt-5a mRNA (NM_003352) were constructed, and the biologically active antisense RNA strand was pre-platinated. Platinum adducts were detected and characterized...

CXCL12 gene silencing down-regulates metastatic potential via blockage of MAPK/PI3K/AP-1 signaling pathway in colon cancer.

Science.gov (United States)

Ma, J; Su, H; Yu, B; Guo, T; Gong, Z; Qi, J; Zhao, X; Du, J

2018-01-05

To investigate the effect of CXCL12 gene silencing on proliferation,invasion, angiogenesis and the relationship of MAPK/PI3K/AP-1 signaling pathway in colon cancer cells. RT-PCR and Western-blot were used to detect the expression of CXCL12 mRNA and protein in four colon cancer cell lines. Human colon cancer cells were transfected with CXCL12 siRNA carrying by Lipofectamine 2000. The expression of CXCL12 protein was confirmed by immunoblotting. WST-1, invasion and angiogenesis assay were used to examine the effect on proliferation, invasion and angiogenesis in colon cancer cells after CXCL12 siRNA silence, respectively. The phosphorylation of MAPK/PI3K/AP-1 protein levels was detected by Western blotting in CXCL12 siRNA suppression DLD-1 cell. CXCL12 mRNA and proteins were only expressed in DLD-1 colon cancer cell lines. CXCL12 siRNA were transfected into DLD-1 cells, the expression CXCL12 proteins was significantly inhibited (P colon cancer cell. The silencing CXCL12 gene significantly inhibits the proliferation, invasion and angiogenesis ability of some types colon carcinoma cells through down-regulation of MAPK/PI3K/AP-1 signaling pathway.

An efficient viral vector for functional genomic studies of Prunus fruit trees and its induced resistance to Plum pox virus via silencing of a host factor gene.

Science.gov (United States)

Cui, Hongguang; Wang, Aiming

2017-03-01

RNA silencing is a powerful technology for molecular characterization of gene functions in plants. A commonly used approach to the induction of RNA silencing is through genetic transformation. A potent alternative is to use a modified viral vector for virus-induced gene silencing (VIGS) to degrade RNA molecules sharing similar nucleotide sequence. Unfortunately, genomic studies in many allogamous woody perennials such as peach are severely hindered because they have a long juvenile period and are recalcitrant to genetic transformation. Here, we report the development of a viral vector derived from Prunus necrotic ringspot virus (PNRSV), a widespread fruit tree virus that is endemic in all Prunus fruit production countries and regions in the world. We show that the modified PNRSV vector, harbouring the sense-orientated target gene sequence of 100-200 bp in length in genomic RNA3, could efficiently trigger the silencing of a transgene or an endogenous gene in the model plant Nicotiana benthamiana. We further demonstrate that the PNRSV-based vector could be manipulated to silence endogenous genes in peach such as eukaryotic translation initiation factor 4E isoform (eIF(iso)4E), a host factor of many potyviruses including Plum pox virus (PPV). Moreover, the eIF(iso)4E-knocked down peach plants were resistant to PPV. This work opens a potential avenue for the control of virus diseases in perennial trees via viral vector-mediated silencing of host factors, and the PNRSV vector may serve as a powerful molecular tool for functional genomic studies of Prunus fruit trees. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Cowpea mosaic virus RNA-1 acts as an amplicon whose effects can be counteracted by a RNA-2-encoded suppressor of silencing

International Nuclear Information System (INIS)

Liu Li; Grainger, Jef; Canizares, M. Carmen; Angell, Susan M.; Lomonossoff, George P.

2004-01-01

Lines of Nicotiana benthamiana transgenic for full-length copies of both Cowpea mosaic virus (CPMV) genomic RNAs, either singly or together, have been produced. Plants transgenic for both RNAs developed symptoms characteristic of a CPMV infection. When plants transgenic for RNA-1 were agro-inoculated with RNA-2, no infection developed and the plants were also resistant to challenge with CPMV. By contrast, plants transgenic for RNA-2 became infected when agro-inoculated with RNA-1 and were fully susceptible to CPMV infection. The resistance of RNA-1 transgenic plants was shown to be related to the ability of RNA-1 to self-replicate and act as an amplicon. The ability of transgenically expressed RNA-2 to counteract the amplicon effect suggested that it encodes a suppressor of posttranscriptional gene silencing (PTGS). By examining the ability of portions of RNA-2 to reverse PTGS in N. benthamiana, we have identified the small (S) coat protein as the CPMV RNA-2-encoded suppressor of PTGS

Simultaneous Silencing of Xylanase Genes in Botrytis cinerea

Directory of Open Access Journals (Sweden)

Néstor García

2017-12-01

Full Text Available The endo-β-1,4-xylanase BcXyn11A is one of several plant cell-wall degrading enzymes that the phytopathogenic fungus Botrytis cinerea secretes during interaction with its hosts. In addition to its enzymatic activity, this protein also acts as an elicitor of the defense response in plants and has been identified as a virulence factor. In the present work, other four endoxylanase coding genes (Bcxyn11B, Bcxyn11C, Bcxyn10A, and Bcxyn10B were identified in the B. cinerea genome and the expression of all five genes was analyzed by Q-RT- PCR in vitro and in planta. A cross-regulation between xylanase genes was identified analyzing their expression pattern in the ΔBcxyn11A mutant strain and a putative BcXyn11A-dependt induction of Bcxyn10B gene was found. In addition, multiple knockdown strains were obtained for the five endoxylanase genes by transformation of B. cinerea with a chimeric DNA construct composed of 50-nt sequences from the target genes. The silencing of each xylanase gene was analyzed in axenic cultures and during infection and the results showed that the efficiency of the multiple silencing depends on the growth conditions and on the cross-regulation between them. Although the simultaneous silencing of the five genes was observed by Q-RT-PCR when the silenced strains were grown on medium supplemented with tomato extract, the endoxylanase activity measured in the supernatants was reduced only by 40%. Unexpectedly, the silenced strains overexpressed the Bcxyn11A and Bcxyn11C genes during the infection of tomato leaves, making difficult the analysis of the role of the endo-β-1,4-xylanases in the virulence of the fungus.

Silencing abnormal wing disc gene of the Asian citrus psyllid, Diaphorina citri disrupts adult wing development and increases nymph mortality.

Directory of Open Access Journals (Sweden)

Ibrahim El-Shesheny

Full Text Available Huanglongbing (HLB causes considerable economic losses to citrus industries worldwide. Its management depends on controlling of the Asian citrus Psyllid (ACP, the vector of the bacterium, Candidatus Liberibacter asiaticus (CLas, the causal agent of HLB. Silencing genes by RNA interference (RNAi is a promising tool to explore gene functions as well as control pests. In the current study, abnormal wing disc (awd gene associated with wing development in insects is used to interfere with the flight of psyllids. Our study showed that transcription of awd is development-dependent and the highest level was found in the last instar (5(th of the nymphal stage. Micro-application (topical application of dsRNA to 5(th instar of nymphs caused significant nymphal mortality and adult wing-malformation. These adverse effects in ACP were positively correlated with the amounts of dsRNA used. A qRT-PCR analysis confirmed the dsRNA-mediated transcriptional down-regulation of the awd gene. Significant down-regulation was required to induce a wing-malformed phenotype. No effect was found when dsRNA-gfp was used, indicating the specific effect of dsRNA-awd. Our findings suggest a role for awd in ACP wing development and metamorphosis. awd could serve as a potential target for insect management either via direct application of dsRNA or by producing transgenic plants expressing dsRNA-awd. These strategies will help to mitigate HLB by controlling ACP.

A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi.

Science.gov (United States)

Tsai, Hsin-Yue; Chen, Chun-Chieh G; Conte, Darryl; Moresco, James J; Chaves, Daniel A; Mitani, Shohei; Yates, John R; Tsai, Ming-Daw; Mello, Craig C

2015-01-29

Effective silencing by RNA-interference (RNAi) depends on mechanisms that amplify and propagate the silencing signal. In some organisms, small-interfering RNAs (siRNAs) are amplified from target mRNAs by RNA-dependent RNA polymerase (RdRP). Both RdRP recruitment and mRNA silencing require Argonaute proteins, which are generally thought to degrade RNAi targets by directly cleaving them. However, in C. elegans, the enzymatic activity of the primary Argonaute, RDE-1, is not required for silencing activity. We show that RDE-1 can instead recruit an endoribonuclease, RDE-8, to target RNA. RDE-8 can cleave RNA in vitro and is needed for the production of 3' uridylated fragments of target mRNA in vivo. We also find that RDE-8 promotes RdRP activity, thereby ensuring amplification of siRNAs. Together, our findings suggest a model in which RDE-8 cleaves target mRNAs to mediate silencing, while generating 3' uridylated mRNA fragments to serve as templates for the RdRP-directed amplification of the silencing signal. Copyright © 2015 Elsevier Inc. All rights reserved.

Synaptotagmin 11 interacts with components of the RNA-induced silencing complex RISC in clonal pancreatic β-cells.

Science.gov (United States)

Milochau, Alexandra; Lagrée, Valérie; Benassy, Marie-Noëlle; Chaignepain, Stéphane; Papin, Julien; Garcia-Arcos, Itsaso; Lajoix, Anne; Monterrat, Carole; Coudert, Laetitia; Schmitter, Jean-Marie; Ochoa, Begoña; Lang, Jochen

2014-06-27

Synaptotagmins are two C2 domain-containing transmembrane proteins. The function of calcium-sensitive members in the regulation of post-Golgi traffic has been well established whereas little is known about the calcium-insensitive isoforms constituting half of the protein family. Novel binding partners of synaptotagmin 11 were identified in β-cells. A number of them had been assigned previously to ER/Golgi derived-vesicles or linked to RNA synthesis, translation and processing. Whereas the C2A domain interacted with the Q-SNARE Vti1a, the C2B domain of syt11 interacted with the SND1, Ago2 and FMRP, components of the RNA-induced silencing complex (RISC). Binding to SND was direct via its N-terminal tandem repeats. Our data indicate that syt11 may provide a link between gene regulation by microRNAs and membrane traffic. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing

Directory of Open Access Journals (Sweden)

Adriana F. Fusaro

2017-10-01

Full Text Available The plant viral family Luteoviridae is divided into three genera: Luteovirus, Polerovirus and Enamovirus. Without assistance from another virus, members of the family are confined to the cells of the host plant’s vascular system. The first open reading frame (ORF of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs against the plant’s viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV, however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant’s silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant’s anti-viral defense.

A viral suppressor of RNA silencing inhibits ARGONAUTE 1 function by precluding target RNA binding to pre-assembled RISC.

Science.gov (United States)

Kenesi, Erzsébet; Carbonell, Alberto; Lózsa, Rita; Vértessy, Beáta; Lakatos, Lóránt

2017-07-27

In most eukaryotes, RNA silencing is an adaptive immune system regulating key biological processes including antiviral defense. To evade this response, viruses of plants, worms and insects have evolved viral suppressors of RNA silencing proteins (VSRs). Various VSRs, such as P1 from Sweet potato mild mottle virus (SPMMV), inhibit the activity of RNA-induced silencing complexes (RISCs) including an ARGONAUTE (AGO) protein loaded with a small RNA. However, the specific mechanisms explaining this class of inhibition are unknown. Here, we show that SPMMV P1 interacts with AGO1 and AGO2 from Arabidopsis thaliana, but solely interferes with AGO1 function. Moreover, a mutational analysis of a newly identified zinc finger domain in P1 revealed that this domain could represent an effector domain as it is required for P1 suppressor activity but not for AGO1 binding. Finally, a comparative analysis of the target RNA binding capacity of AGO1 in the presence of wild-type or suppressor-defective P1 forms revealed that P1 blocks target RNA binding to AGO1. Our results describe the negative regulation of RISC, the small RNA containing molecular machine. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Silencing of the pentose phosphate pathway genes influences DNA replication in human fibroblasts.

Science.gov (United States)

Fornalewicz, Karolina; Wieczorek, Aneta; Węgrzyn, Grzegorz; Łyżeń, Robert

2017-11-30

Previous reports and our recently published data indicated that some enzymes of glycolysis and the tricarboxylic acid cycle can affect the genome replication process by changing either the efficiency or timing of DNA synthesis in human normal cells. Both these pathways are connected with the pentose phosphate pathway (PPP pathway). The PPP pathway supports cell growth by generating energy and precursors for nucleotides and amino acids. Therefore, we asked if silencing of genes coding for enzymes involved in the pentose phosphate pathway may also affect the control of DNA replication in human fibroblasts. Particular genes coding for PPP pathway enzymes were partially silenced with specific siRNAs. Such cells remained viable. We found that silencing of the H6PD, PRPS1, RPE genes caused less efficient enterance to the S phase and decrease in efficiency of DNA synthesis. On the other hand, in cells treated with siRNA against G6PD, RBKS and TALDO genes, the fraction of cells entering the S phase was increased. However, only in the case of G6PD and TALDO, the ratio of BrdU incorporation to DNA was significantly changed. The presented results together with our previously published studies illustrate the complexity of the influence of genes coding for central carbon metabolism on the control of DNA replication in human fibroblasts, and indicate which of them are especially important in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

Effects of siRNA Silencing of TUG1 and LCAL6 Long Non-coding RNAs on Patient-derived Xenograft of Non-small Cell Lung Cancer.

Science.gov (United States)

Fang, Tian; Huang, Hairong; Li, Xiaoyou; Liao, Jing; Yang, Zhijian; Hoffman, Robert M; Cheng, X I; Liang, Lei; Hu, Wenjuan; Yun, Shifeng

2018-01-01

The aim of the present study was to establish a patient-derived xenograft (PDX) mouse model of non-small cell lung cancer (NSCLC) and investigate the anti-tumor efficacy of silencing of TUG1 and LCAL6 long non-coding RNA in the PDX model. PDXs were established by subcutaneously implanting NSCLC surgical tumor fragments into immunodeficient mice. PDX characterization was performed by histopathological, immunohistochemical and real-time polymerase chain reaction (RT-PCR) analyses for NSCLC subtype-specific markers and expression of LCAL6 and TUG1. Anti-tumor efficacy of siRNA silencing of TUG1 and LCAL6 was also investigated in the PDX model. The effect of TUG1 and LCAL6 silencing on protein expression of proliferation marker Ki67 and HOX-gene family HOXB7 in the tumors was assessed by immunohistochemical staining and Western blotting. Establishment of NSCLC PDX models resulted in 9 of 26 cases (34.6%). Lung squamous cell carcinomas (SCC) had a higher engraftment rate (58.3%) than lung adenocarcinomas (ADC) (18.2%) (pTUG1. The tumor volume and weight were significantly reduced in the TUG1-silenced group as compared to the control group (p0.05). Expression of both TUG1and LCAL6 was reduced by siRNA treatment. Expression of Ki67 and HOXB7 was significantly suppressed in both the TUG1- and LCAL6-silenced groups compared to the control group (pTUG1-silenced group showed more reduced Ki67 expression than the LCAL6-silenced group (pTUG1 and LCAL6. Silencing of TUG1 inhibited both tumor growth and expression of the proliferation marker Ki67 and HOX-gene family HOXB7 in the PDX model of NSCLC. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Silence of the Genes

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 4. Silence of the Genes - 2006 Nobel Prize in Physiology or Medicine. Utpal Nath Saumitra Das. General Article Volume 12 Issue 4 April 2007 pp 6-18. Fulltext. Click here to view fulltext PDF. Permanent link:

SoMART, a web server for miRNA, tasiRNA and target gene analysis in Solanaceae plants

Science.gov (United States)

Plant micro(mi)RNAs and trans-acting small interfering (tasi)RNAs mediate posttranscriptional silencing of genes and play important roles in a variety of biological processes. Although bioinformatics prediction and small (s)RNA cloning are the key approaches used for identification of miRNAs, tasiRN...

Reexamining the P-Element Invasion of Drosophila melanogaster Through the Lens of piRNA Silencing

Science.gov (United States)

Kelleher, Erin S.

2016-01-01

Transposable elements (TEs) are both important drivers of genome evolution and genetic parasites with potentially dramatic consequences for host fitness. The recent explosion of research on regulatory RNAs reveals that small RNA-mediated silencing is a conserved genetic mechanism through which hosts repress TE activity. The invasion of the Drosophila melanogaster genome by P elements, which happened on a historical timescale, represents an incomparable opportunity to understand how small RNA-mediated silencing of TEs evolves. Repression of P-element transposition emerged almost concurrently with its invasion. Recent studies suggest that this repression is implemented in part, and perhaps predominantly, by the Piwi-interacting RNA (piRNA) pathway, a small RNA-mediated silencing pathway that regulates TE activity in many metazoan germlines. In this review, I consider the P-element invasion from both a molecular and evolutionary genetic perspective, reconciling classic studies of P-element regulation with the new mechanistic framework provided by the piRNA pathway. I further explore the utility of the P-element invasion as an exemplar of the evolution of piRNA-mediated silencing. In light of the highly-conserved role for piRNAs in regulating TEs, discoveries from this system have taxonomically broad implications for the evolution of repression. PMID:27516614

Layer-by-layer nanoparticles as an efficient siRNA delivery vehicle for SPARC silencing.

Science.gov (United States)

Tan, Yang Fei; Mundargi, Raghavendra C; Chen, Min Hui Averil; Lessig, Jacqueline; Neu, Björn; Venkatraman, Subbu S; Wong, Tina T

2014-05-14

Efficient and safe delivery systems for siRNA therapeutics remain a challenge. Elevated secreted protein, acidic, and rich in cysteine (SPARC) protein expression is associated with tissue scarring and fibrosis. Here we investigate the feasibility of encapsulating SPARC-siRNA in the bilayers of layer-by-layer (LbL) nanoparticles (NPs) with poly(L-arginine) (ARG) and dextran (DXS) as polyelectrolytes. Cellular binding and uptake of LbL NPs as well as siRNA delivery were studied in FibroGRO cells. siGLO-siRNA and SPARC-siRNA were efficiently coated onto hydroxyapatite nanoparticles. The multilayered NPs were characterized with regard to particle size, zeta potential and surface morphology using dynamic light scattering and transmission electron microscopy. The SPARC-gene silencing and mRNA levels were analyzed using ChemiDOC western blot technique and RT-PCR. The multilayer SPARC-siRNA incorporated nanoparticles are about 200 nm in diameter and are efficiently internalized into FibroGRO cells. Their intracellular fate was also followed by tagging with suitable reporter siRNA as well as with lysotracker dye; confocal microscopy clearly indicates endosomal escape of the particles. Significant (60%) SPARC-gene knock down was achieved by using 0.4 pmole siRNA/μg of LbL NPs in FibroGRO cells and the relative expression of SPARC mRNA reduced significantly (60%) against untreated cells. The cytotoxicity as evaluated by xCelligence real-time cell proliferation and MTT cell assay, indicated that the SPARC-siRNA-loaded LbL NPs are non-toxic. In conclusion, the LbL NP system described provides a promising, safe and efficient delivery platform as a non-viral vector for siRNA delivery that uses biopolymers to enhance the gene knock down efficiency for the development of siRNA therapeutics. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

TGIF1 Gene Silencing in Tendon-Derived Stem Cells Improves the Tendon-to-Bone Insertion Site Regeneration

Directory of Open Access Journals (Sweden)

Liyang Chen

2015-11-01

Full Text Available Background/Aims: The slow healing process of tendon-to-bone junctions can be accelerated via implanted tendon-derived stem cells (TDSCs with silenced transforming growth interacting factor 1 (TGIF1 gene. Tendon-to-bone insertion site is the special form of connective tissues derivatives of common connective progenitors, where TGF-β plays bidirectional effects (chondrogenic or fibrogenic through different signaling pathways at different stages. A recent study revealed that TGF-β directly induces the chondrogenic gene Sox9. However, TGIF1 represses the expression of the cartilage master Sox9 gene and changes its expression rate against the fibrogenesis gene Scleraxis (Scx. Methods: TGIF1 siRNA was transduced or TGIF1 was over-expressed in tendon-derived stem cells. Following suprapinatus tendon repair, rats were either treated with transduced TDSCs or nontransduced TDSCs. Histologic examination and Western blot were performed in both groups. Results: In this study, the silencing of TGIF1 significantly upregulated the chondrogenic genes and markers. Similarly, TGIF1 inhibited TDSC differentiation into cartilage via interactions with TGF-β-activated Smad2 and suppressed the phosphorylation of Smad2. The area of fibrocartilage at the tendon-bone interface was significantly increased in the TGIF1 (- group compared with the control and TGIF1-overexpressing groups in the early stages of the animal model. The interface between the tendon and bone showed a increase of new bone and fibrocartilage in the TGIF1 (- group at 4 weeks. Fibrovascular scar tissue was observed in the TGIF1-overexpressing group and the fibrin glue only group. Low levels of fibrocartilage and fibrovascular scar tissue were found in the TDSCs group. Conclusion: Collectively, this study shows that the tendon-derived stem cell modified with TGIF1 gene silencing has promising effects on tendon-to-bone healing which can be further explored as a therapeutic tool in regenerative medicine.

Recovery of Nicotiana benthamiana plants from a necrotic response induced by a nepovirus is associated with RNA silencing but not with reduced virus titer.

Science.gov (United States)

Jovel, Juan; Walker, Melanie; Sanfaçon, Hélène

2007-11-01

Recovery of plants from virus-induced symptoms is often described as a consequence of RNA silencing, an antiviral defense mechanism. For example, recovery of Nicotiana clevelandii from a nepovirus (tomato black ring virus) is associated with a decreased viral RNA concentration and sequence-specific resistance to further virus infection. In this study, we have characterized the interaction of another nepovirus, tomato ringspot virus (ToRSV), with host defense responses during symptom induction and subsequent recovery. Early in infection, ToRSV induced a necrotic phenotype in Nicotiana benthamiana that showed characteristics typical of a hypersensitive response. RNA silencing was also activated during ToRSV infection, as evidenced by the presence of ToRSV-derived small interfering RNAs (siRNAs) that could direct degradation of ToRSV sequences introduced into sensor constructs. Surprisingly, disappearance of symptoms was not accompanied by a commensurate reduction in viral RNA levels. The stability of ToRSV RNA after recovery was also observed in N. clevelandii and Cucumis sativus and in N. benthamiana plants carrying a functional RNA-dependent RNA polymerase 1 ortholog from Medicago truncatula. In experiments with a reporter transgene (green fluorescent protein), ToRSV did not suppress the initiation or maintenance of transgene silencing, although the movement of the silencing signal was partially hindered. Our results demonstrate that although RNA silencing is active during recovery, reduction of virus titer is not required for the initiation of this phenotype. This scenario adds an unforeseen layer of complexity to the interaction of nepoviruses with the host RNA silencing machinery. The possibility that viral proteins, viral RNAs, and/or virus-derived siRNAs inactivate host defense responses is discussed.

H Ferritin Gene Silencing in a Human Metastatic Melanoma Cell Line: A Proteomic Analysis

DEFF Research Database (Denmark)

Di Sanzo, Maddalena; Gaspari, Marco; Misaggi, Roberta

2011-01-01

Ferritin, the major intracellular iron-storage protein, is made of 24 subunits of two types, H and L. Besides regulating intracellular iron homeostasis, it has been found that ferritin, in particular the H subunit (FHC), is involved in different biological events such as cell differentiation...... and pathologic states (i.e., neurodegeneration and cancer). This study is aimed at investigating the whole-cell proteome of FHC-expressing and sh-RNA-silenced human metastatic melanoma cells (MM07(m)) in the attempt to identify and classify the highest number of proteins directly or indirectly controlled...... of H ferritin signaling pathways and lend support to the hypothesis that specific targeting of this gene might be an attractive and potentially effective strategy for the management of metastatic melanoma....

Silencing of the HER2/neu Gene by siRNA Inhibits Proliferation and Induces Apoptosis in HER2/neu-Overexpressing Breast Cancer Cells

Directory of Open Access Journals (Sweden)

Timo Faltus

2004-11-01

Full Text Available In eukaryotes, double-stranded (ds RNA induces sequence-specific inhibition of gene expression referred to as RNA interference (RNAi. We exploited RNAi to define the role of HER2/neu in the neoplastic proliferation of human breast cancer cells. We transfected SK-BR-3, BT-474, MCF-7, and MDA-MB-468 breast cancer cells with short interfering RNA (siRNA targeted against human HER2/neu and analyzed the specific inhibition of HER2/neu expression by Northern and Western blots. Transfection with HER2/neu-specific siRNA resulted in a sequence-specific decrease in HER2/neu mRNA and protein levels. Moreover, transfection with HER2/neu siRNA caused cell cycle arrest at G0/G1 in the breast cancer cell lines SKBR-3 and BT-474, consistent with a powerful RNA silencing effect. siRNA treatment resulted in an antiproliferative and apoptotic response in cells overexpressing HER2/neu, but had no influence in cells with almost no expression of HER2/neu proteins like MDA-MB-468 cells. These data indicate that HER2/neu function is essential for the proliferation of HER2/neuoverexpressing breast cancer cells. Our observations suggest that siRNA targeted against human HER2/neu may be valuable tools as anti proliferative agents that display activity against neoplastic cells at very low doses.

Hypoxia-inducible bidirectional shRNA expression vector delivery using PEI/chitosan-TBA copolymers for colorectal Cancer gene therapy.

Science.gov (United States)

Javan, Bita; Atyabi, Fatemeh; Shahbazi, Majid

2018-04-12

This investigation was conducted to construct a hypoxia/colorectal dual-specific bidirectional short hairpin RNA (shRNA) expression vector and to transfect it into the colon cancer cell line HT-29 with PEI/chitosan-TBA nanoparticles for the simultaneous knock down of β-catenin and Bcl-2 under hypoxia. To construct a pRNA-bipHRE-CEA vector, the carcinoma embryonic antigen (CEA) promoter designed in two directions and the vascular endothelial growth factor (VEGF) enhancer were inserted between two promoters for hypoxic cancer specific gene expression. To confirm the therapeutic effect of the dual-specific vector, β-catenin and Bcl-2 shRNAs were inserted downstream of each promoter. The physicochemical properties, the cytotoxicity, and the transfection efficiency of these PEI/chitosan-TBA nanoparticles were investigated. In addition, the antitumor effects of the designed vector on the expression of β-catenin and Bcl-2, cell cycle distribution, and apoptosis were investigated in vitro. The silencing effect of the hypoxia-response shRNA expression vector was relatively low (18%-25%) under normoxia, whereas it was significantly increased to approximately 50%-60% in the HT-29 cell line. Moreover, the cancer cells showed significant G0/G1 arrest and increased apoptosis due to gene silencing under hypoxia. Furthermore, MTS assay, fluorescence microscopy images, and flow cytometry analyses confirmed that the PEI/chitosan-TBA blend system provided effective transfection with low cytotoxicity. This novel hypoxia-responsive shRNA expression vector may be useful for RNA interference (RNAi)-based cancer gene therapy in hypoxic colorectal tumors. Moreover, the PEI/chitosan-TBA copolymer might be a promising gene carrier for use in gene transfer in vivo. Copyright © 2017. Published by Elsevier Inc.

RNA-induced silencing complex (RISC) Proteins PACT, TRBP, and Dicer are SRA binding nuclear receptor coregulators.

Science.gov (United States)

Redfern, Andrew D; Colley, Shane M; Beveridge, Dianne J; Ikeda, Naoya; Epis, Michael R; Li, Xia; Foulds, Charles E; Stuart, Lisa M; Barker, Andrew; Russell, Victoria J; Ramsay, Kerry; Kobelke, Simon J; Li, Xiaotao; Hatchell, Esme C; Payne, Christine; Giles, Keith M; Messineo, Adriana; Gatignol, Anne; Lanz, Rainer B; O'Malley, Bert W; Leedman, Peter J

2013-04-16

The cytoplasmic RNA-induced silencing complex (RISC) contains dsRNA binding proteins, including protein kinase RNA activator (PACT), transactivation response RNA binding protein (TRBP), and Dicer, that process pre-microRNAs into mature microRNAs (miRNAs) that target specific mRNA species for regulation. There is increasing evidence for important functional interactions between the miRNA and nuclear receptor (NR) signaling networks, with recent data showing that estrogen, acting through the estrogen receptor, can modulate initial aspects of nuclear miRNA processing. Here, we show that the cytoplasmic RISC proteins PACT, TRBP, and Dicer are steroid receptor RNA activator (SRA) binding NR coregulators that target steroid-responsive promoters and regulate NR activity and downstream gene expression. Furthermore, each of the RISC proteins, together with Argonaute 2, associates with SRA and specific pre-microRNAs in both the nucleus and cytoplasm, providing evidence for links between NR-mediated transcription and some of the factors involved in miRNA processing.

DNA triplet repeats mediate heterochromatin-protein-1-sensitive variegated gene silencing.

Science.gov (United States)

Saveliev, Alexander; Everett, Christopher; Sharpe, Tammy; Webster, Zoë; Festenstein, Richard

2003-04-24

Gene repression is crucial to the maintenance of differentiated cell types in multicellular organisms, whereas aberrant silencing can lead to disease. The organization of DNA into chromatin and heterochromatin is implicated in gene silencing. In chromatin, DNA wraps around histones, creating nucleosomes. Further condensation of chromatin, associated with large blocks of repetitive DNA sequences, is known as heterochromatin. Position effect variegation (PEV) occurs when a gene is located abnormally close to heterochromatin, silencing the affected gene in a proportion of cells. Here we show that the relatively short triplet-repeat expansions found in myotonic dystrophy and Friedreich's ataxia confer variegation of expression on a linked transgene in mice. Silencing was correlated with a decrease in promoter accessibility and was enhanced by the classical PEV modifier heterochromatin protein 1 (HP1). Notably, triplet-repeat-associated variegation was not restricted to classical heterochromatic regions but occurred irrespective of chromosomal location. Because the phenomenon described here shares important features with PEV, the mechanisms underlying heterochromatin-mediated silencing might have a role in gene regulation at many sites throughout the mammalian genome and modulate the extent of gene silencing and hence severity in several triplet-repeat diseases.

Design, synthesis and evaluation of VEGF-siRNA/CRS as a novel vector for gene delivery

Directory of Open Access Journals (Sweden)

Zhao W

2016-11-01

Full Text Available Wen Zhao, Yifan Zhang, Xueyun Jiang, Chunying Cui School of Chemical Biology and Pharmaceutical Sciences, Capital Medical University, Beijing, China Abstract: Small interfering RNA (siRNA delivery is a prospective method in gene therapy, but it has application limitations such as negative charge, water solubility and high molecular weight. In this study, a safe and efficient nano-vector, CRS, was designed and synthesized to facilitate siRNA delivery. Physical and chemical properties of VEGF-siRNA/CRS were characterized by methods including scanning electron microscopy (SEM, transmission electron microscopy, zeta potential (ζ measurement, drug-releasing rate measurement, gel electrophoresis and confocal microscopy. The biological activities were evaluated using cell viability assay, gene-silencing efficacy assay in vitro, real-time polymerase chain reaction, enzyme-linked immunosorbent assay (ELISA and antitumor tests in vivo. The mean nanoparticle size of VEGF-siRNA/CRS was 121.4±0.3 nm with positive ζ potential of 7.69±4.47 mV. The release rate of VEGF-siRNA from VEGF-siRNA/CRS was 82.50% sustained for 48 h in Tris-ethylenediaminetetraacetic acid buffer (pH 8.0. Real-time polymerase chain reaction was used to analyze the efficiency of the transfection, and the result showed that VEGF mRNA expression had been knocked down by 82.36%. The expression of VEGF protein was also recorded to be downregulated to 14.83% using ELISA. The results of cytotoxicity measured by Cell Counting Kit-8 assay showed that VEGF-siRNA/CRS had significant inhibitory effect on HeLa cells. The results of antitumor assays indicated that VEGF-siRNA/CRS exhibited tumor cell growth inhibition in vivo. The results demonstrated that VEGF-siRNA could be delivered and transported by the designed carrier, while siRNA could be released constantly and led to an increasing gene-silencing effect against VEGF gene. In conclusion, VEGF-siRNA/CRS is a promising carrier for siRNA

Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus

Directory of Open Access Journals (Sweden)

Fangquan Wang

2016-05-01

Full Text Available Rice black-streaked dwarf virus (RBSDV belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21–24 nt small interfering RNA (siRNA. By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

Hairpin RNA Targeting Multiple Viral Genes Confers Strong Resistance to Rice Black-Streaked Dwarf Virus.

Science.gov (United States)

Wang, Fangquan; Li, Wenqi; Zhu, Jinyan; Fan, Fangjun; Wang, Jun; Zhong, Weigong; Wang, Ming-Bo; Liu, Qing; Zhu, Qian-Hao; Zhou, Tong; Lan, Ying; Zhou, Yijun; Yang, Jie

2016-05-11

Rice black-streaked dwarf virus (RBSDV) belongs to the genus Fijivirus in the family of Reoviridae and causes severe yield loss in rice-producing areas in Asia. RNA silencing, as a natural defence mechanism against plant viruses, has been successfully exploited for engineering virus resistance in plants, including rice. In this study, we generated transgenic rice lines harbouring a hairpin RNA (hpRNA) construct targeting four RBSDV genes, S1, S2, S6 and S10, encoding the RNA-dependent RNA polymerase, the putative core protein, the RNA silencing suppressor and the outer capsid protein, respectively. Both field nursery and artificial inoculation assays of three generations of the transgenic lines showed that they had strong resistance to RBSDV infection. The RBSDV resistance in the segregating transgenic populations correlated perfectly with the presence of the hpRNA transgene. Furthermore, the hpRNA transgene was expressed in the highly resistant transgenic lines, giving rise to abundant levels of 21-24 nt small interfering RNA (siRNA). By small RNA deep sequencing, the RBSDV-resistant transgenic lines detected siRNAs from all four viral gene sequences in the hpRNA transgene, indicating that the whole chimeric fusion sequence can be efficiently processed by Dicer into siRNAs. Taken together, our results suggest that long hpRNA targeting multiple viral genes can be used to generate stable and durable virus resistance in rice, as well as other plant species.

RNA Interference Screen to Identify Pathways That Enhance or Reduce Nonviral Gene Transfer During Lipofection

OpenAIRE

Barker, Gregory A; Diamond, Scott L

2008-01-01

Some barriers to DNA lipofection are well characterized; however, there is as yet no method of finding unknown pathways that impact the process. A druggable genome small-interfering RNA (siRNA) screen against 5,520 genes was tested for its effect on lipofection of human aortic endothelial cells (HAECs). We found 130 gene targets which, when silenced by pooled siRNAs (three siRNAs per gene), resulted in enhanced luminescence after lipofection (86 gene targets showed reduced expression). In con...

Epigenetic silencing of miRNA-9 is associated with HES1 oncogenic activity and poor prognosis of medulloblastoma.

Science.gov (United States)

Fiaschetti, G; Abela, L; Nonoguchi, N; Dubuc, A M; Remke, M; Boro, A; Grunder, E; Siler, U; Ohgaki, H; Taylor, M D; Baumgartner, M; Shalaby, T; Grotzer, M A

2014-02-04

microRNA-9 is a key regulator of neuronal development aberrantly expressed in brain malignancies, including medulloblastoma. The mechanisms by which microRNA-9 contributes to medulloblastoma pathogenesis remain unclear, and factors that regulate this process have not been delineated. Expression and methylation status of microRNA-9 in medulloblastoma cell lines and primary samples were analysed. The association of microRNA-9 expression with medulloblastoma patients' clinical outcome was assessed, and the impact of microRNA-9 restoration was functionally validated in medulloblastoma cells. microRNA-9 expression is repressed in a large subset of MB samples compared with normal fetal cerebellum. Low microRNA-9 expression correlates significantly with the diagnosis of unfavourable histopathological variants and with poor clinical outcome. microRNA-9 silencing occurs via cancer-specific CpG island hypermethylation. HES1 was identified as a direct target of microRNA-9 in medulloblastoma, and restoration of microRNA-9 was shown to trigger cell cycle arrest, to inhibit clonal growth and to promote medulloblastoma cell differentiation. microRNA-9 is a methylation-silenced tumour suppressor that could be a potential candidate predictive marker for poor prognosis of medulloblastoma. Loss of microRNA-9 may confer a proliferative advantage to tumour cells, and it could possibly contribute to disease pathogenesis. Thus, re-expression of microRNA-9 may constitute a novel epigenetic regulation strategy against medulloblastoma.

Diverging affinity of tospovirus RNA silencing suppressor proteins, NSs, for various RNA duplex molecules

NARCIS (Netherlands)

Schnettler, E.; Hemmes, J.C.; Huisman, R.; Goldbach, R.W.; Prins, M.W.; Kormelink, R.J.M.

2010-01-01

The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs

Two classes of silencing RNAs move between C. elegans tissues

Science.gov (United States)

Jose, Antony M; Garcia, Giancarlo A; Hunter, Craig P

2011-01-01

Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the endonuclease DCR-1, which cleaves long dsRNA into double-stranded short-interfering RNA (ds-siRNA), and the putative nucleotidyltransferase MUT-2 (RDE-3). However, single-stranded siRNA and downstream secondary siRNA produced upon amplification by the RNA-dependent RNA Polymerase RRF-1 do not generate mobile silencing RNA. Restricting inter-tissue transport to long dsRNA and directly processed siRNA intermediates rather than amplified siRNA may serve to modulate the extent of systemic silencing in proportion to available dsRNA. PMID:21984186

Species-independent MicroRNA Gene Discovery

KAUST Repository

Kamanu, Timothy K.

2012-12-01

MicroRNA (miRNA) are a class of small endogenous non-coding RNA that are mainly negative transcriptional and post-transcriptional regulators in both plants and animals. Recent studies have shown that miRNA are involved in different types of cancer and other incurable diseases such as autism and Alzheimer’s. Functional miRNAs are excised from hairpin-like sequences that are known as miRNA genes. There are about 21,000 known miRNA genes, most of which have been determined using experimental methods. miRNA genes are classified into different groups (miRNA families). This study reports about 19,000 unknown miRNA genes in nine species whereby approximately 15,300 predictions were computationally validated to contain at least one experimentally verified functional miRNA product. The predictions are based on a novel computational strategy which relies on miRNA family groupings and exploits the physics and geometry of miRNA genes to unveil the hidden palindromic signals and symmetries in miRNA gene sequences. Unlike conventional computational miRNA gene discovery methods, the algorithm developed here is species-independent: it allows prediction at higher accuracy and resolution from arbitrary RNA/DNA sequences in any species and thus enables examination of repeat-prone genomic regions which are thought to be non-informative or ’junk’ sequences. The information non-redundancy of uni-directional RNA sequences compared to information redundancy of bi-directional DNA is demonstrated, a fact that is overlooked by most pattern discovery algorithms. A novel method for computing upstream and downstream miRNA gene boundaries based on mathematical/statistical functions is suggested, as well as cutoffs for annotation of miRNA genes in different miRNA families. Another tool is proposed to allow hypotheses generation and visualization of data matrices, intra- and inter-species chromosomal distribution of miRNA genes or miRNA families. Our results indicate that: miRNA and miRNA

Phosphorus starvation induces post-transcriptional CHS gene silencing in Petunia corolla.

Science.gov (United States)

Hosokawa, Munetaka; Yamauchi, Takayoshi; Takahama, Masayoshi; Goto, Mariko; Mikano, Sachiko; Yamaguchi, Yuki; Tanaka, Yoshiyuki; Ohno, Sho; Koeda, Sota; Doi, Motoaki; Yazawa, Susumu

2013-05-01

The corolla of Petunia 'Magic Samba' exhibits unstable anthocyanin expression depending on its phosphorus content. Phosphorus deficiency enhanced post-transcriptional gene silencing of chalcone synthase - A in the corolla. Petunia (Petunia hybrida) 'Magic Samba' has unstable red-white bicolored corollas that respond to nutrient deficiency. We grew this cultivar hydroponically using solutions that lacked one or several nutrients to identify the specific nutrient related to anthocyanin expression in corolla. The white area of the corolla widened under phosphorus (P)-deficient conditions. When the P content of the corolla grown under P-deficient conditions dropped to 40 corollas until the plants died. Other elemental deficiencies had no clear effects on anthocyanin suppression in the corolla. After phosphate was resupplied to the P-deficient plants, anthocyanin was restored in the corollas. The expression of chalcone synthase-A (CHS-A) was suppressed in the white area that widened under P-suppressed conditions, whereas the expression of several other genes related to anthocyanin biosynthesis was enhanced more in the white area than in the red area. Reddish leaves and sepals developed under the P-deficient condition, which is a typical P-deficiency symptom. Two genes related to anthocyanin biosynthesis were enhanced in the reddish organs. Small interfering RNA analysis of CHS-A showed that the suppression resulted from post-transcriptional gene silencing (PTGS). Thus, it was hypothesized that the enhancement of anthocyanin biosynthetic gene expression due to P-deficiency triggered PTGS of CHS-A, which resulted in white corolla development.

A unique enhancer boundary complex on the mouse ribosomal RNA genes persists after loss of Rrn3 or UBF and the inactivation of RNA polymerase I transcription.

Science.gov (United States)

Herdman, Chelsea; Mars, Jean-Clement; Stefanovsky, Victor Y; Tremblay, Michel G; Sabourin-Felix, Marianne; Lindsay, Helen; Robinson, Mark D; Moss, Tom

2017-07-01

Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA) genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF) independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state of rDNA chromatin

A unique enhancer boundary complex on the mouse ribosomal RNA genes persists after loss of Rrn3 or UBF and the inactivation of RNA polymerase I transcription.

Directory of Open Access Journals (Sweden)

Chelsea Herdman

2017-07-01

Full Text Available Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state

Computational sequence analysis of predicted long dsRNA transcriptomes of major crops reveals sequence complementarity with human genes.

Science.gov (United States)

Jensen, Peter D; Zhang, Yuanji; Wiggins, B Elizabeth; Petrick, Jay S; Zhu, Jin; Kerstetter, Randall A; Heck, Gregory R; Ivashuta, Sergey I

2013-01-01

Long double-stranded RNAs (long dsRNAs) are precursors for the effector molecules of sequence-specific RNA-based gene silencing in eukaryotes. Plant cells can contain numerous endogenous long dsRNAs. This study demonstrates that such endogenous long dsRNAs in plants have sequence complementarity to human genes. Many of these complementary long dsRNAs have perfect sequence complementarity of at least 21 nucleotides to human genes; enough complementarity to potentially trigger gene silencing in targeted human cells if delivered in functional form. However, the number and diversity of long dsRNA molecules in plant tissue from crops such as lettuce, tomato, corn, soy and rice with complementarity to human genes that have a long history of safe consumption supports a conclusion that long dsRNAs do not present a significant dietary risk.

Enhanced Host-Parasite Resistance Based on Down-Regulation of Phelipanche aegyptiaca Target Genes Is Likely by Mobile Small RNA

Directory of Open Access Journals (Sweden)

Neeraj K. Dubey

2017-09-01

Full Text Available RNA silencing refers to diverse mechanisms that control gene expression at transcriptional and post-transcriptional levels which can also be used in parasitic pathogens of plants that Broomrapes (Orobanche/Phelipanche spp. are holoparasitic plants that subsist on the roots of a variety of agricultural crops and cause severe negative effects on the yield and yield quality of those crops. Effective methods for controlling parasitic weeds are scarce, with only a few known cases of genetic resistance. In the current study, we suggest an improved strategy for the control of parasitic weeds based on trans-specific gene-silencing of three parasite genes at once. We used two strategies to express dsRNA containing selected sequences of three Phelipanche aegyptiaca genes PaACS, PaM6PR, and PaPrx1 (pma: transient expression using Tobacco rattle virus (TRV:pma as a virus-induced gene-silencing vector and stable expression in transgenic tomato Solanum lycopersicum (Mill. plants harboring a hairpin construct (pBINPLUS35:pma. siRNA-mediated transgene-silencing (20–24 nt was detected in the host plants. Our results demonstrate that the quantities of PaACS and PaM6PR transcripts from P. aegyptiaca tubercles grown on transgenic tomato or on TRV-infected Nicotiana benthamiana plants were significantly reduced. However, only partial reductions in the quantity of PaPrx1 transcripts were observed in the parasite tubercles grown on tomato and on N. benthamiana plants. Concomitant with the suppression of the target genes, there were significant decreases in the number and weight of the parasite tubercles that grew on the host plants, in both the transient and the stable experimental systems. The results of the work carried out using both strategies point to the movement of mobile exogenous siRNA from the host to the parasite, leading to the impaired expression of essential parasite target genes.

Agrobacterium mediated transient gene silencing (AMTS in Stevia rebaudiana: insights into steviol glycoside biosynthesis pathway.

Directory of Open Access Journals (Sweden)

Praveen Guleria

Full Text Available Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi based Agrobacterium mediated transient gene silencing (AMTS approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1 genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins.RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3 content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes.SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route.

Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): Characterization of flax miRNA genes.

Science.gov (United States)

Barvkar, Vitthal T; Pardeshi, Varsha C; Kale, Sandip M; Qiu, Shuqing; Rollins, Meaghen; Datla, Raju; Gupta, Vidya S; Kadoo, Narendra Y

2013-04-01

MicroRNAs (miRNAs) are small (20-24 nucleotide long) endogenous regulatory RNAs that play important roles in plant growth and development. They regulate gene expression at the post-transcriptional level by translational repression or target degradation and gene silencing. In this study, we identified 116 conserved miRNAs belonging to 23 families from the flax (Linum usitatissimum L.) genome using a computational approach. The precursor miRNAs varied in length; while most of the mature miRNAs were 21 nucleotide long, intergenic and showed conserved signatures of RNA polymerase II transcripts in their upstream regions. Promoter region analysis of the flax miRNA genes indicated prevalence of MYB transcription factor binding sites. Four miRNA gene clusters containing members of three phylogenetic groups were identified. Further, 142 target genes were predicted for these miRNAs and most of these represent transcriptional regulators. The miRNA encoding genes were expressed in diverse tissues as determined by digital expression analysis as well as real-time PCR. The expression of fourteen miRNAs and nine target genes was independently validated using the quantitative reverse transcription PCR (qRT-PCR). This study suggests that a large number of conserved plant miRNAs are also found in flax and these may play important roles in growth and development of flax.

Silencing of Soybean Raffinose Synthase Gene Reduced Raffinose Family Oligosaccharides and Increased True Metabolizable Energy of Poultry Feed

Directory of Open Access Journals (Sweden)

Michelle F. Valentine

2017-05-01

Full Text Available Soybean [Glycine max (L. Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2, to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets.

Silencing of Soybean Raffinose Synthase Gene Reduced Raffinose Family Oligosaccharides and Increased True Metabolizable Energy of Poultry Feed

Science.gov (United States)

Valentine, Michelle F.; De Tar, Joann R.; Mookkan, Muruganantham; Firman, Jeffre D.; Zhang, Zhanyuan J.

2017-01-01

Soybean [Glycine max (L.) Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2), to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME) in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets. PMID:28559898

Development of Novel Antisense Oligonucleotides for the Functional Regulation of RNA-Induced Silencing Complex (RISC) by Promoting the Release of microRNA from RISC.

Science.gov (United States)

Ariyoshi, Jumpei; Momokawa, Daiki; Eimori, Nao; Kobori, Akio; Murakami, Akira; Yamayoshi, Asako

2015-12-16

MicroRNAs (miRNAs) are known to be important post-transcription regulators of gene expression. Aberrant miRNA expression is associated with pathological disease processes, including carcinogenesis. Therefore, miRNAs are considered significant therapeutic targets for cancer therapy. MiRNAs do not act alone, but exhibit their functions by forming RNA-induced silencing complex (RISC). Thus, the regulation of RISC activity is a promising approach for cancer therapy. MiRNA is a core component of RISC and is an essential to RISC for recognizing target mRNA. Thereby, it is expected that development of the method to promote the release of miRNA from RISC would be an effective approach for inhibition of RISC activity. In this study, we synthesized novel peptide-conjugated oligonucleotides (RINDA-as) to promote the release of miRNA from RISC. RINDA-as showed a high rate of miRNA release from RISC and high level of inhibitory effect on RISC activity.

RNA interference screen to identify pathways that enhance or reduce nonviral gene transfer during lipofection.

Science.gov (United States)

Barker, Gregory A; Diamond, Scott L

2008-09-01

Some barriers to DNA lipofection are well characterized; however, there is as yet no method of finding unknown pathways that impact the process. A druggable genome small-interfering RNA (siRNA) screen against 5,520 genes was tested for its effect on lipofection of human aortic endothelial cells (HAECs). We found 130 gene targets which, when silenced by pooled siRNAs (three siRNAs per gene), resulted in enhanced luminescence after lipofection (86 gene targets showed reduced expression). In confirmation tests with single siRNAs, 18 of the 130 hits showed enhanced lipofection with two or more individual siRNAs in the absence of cytotoxicity. Of these confirmed gene targets, we identified five leading candidates, two of which are isoforms of the regulatory subunit of protein phosphatase 2A (PP2A). The best candidate siRNA targeted the PPP2R2C gene and produced a 65% increase in luminescence from lipofection, with a quantitative PCR-validated knockdown of approximately 76%. Flow cytometric analysis confirmed that the silencing of the PPP2R2C gene resulted in an improvement of 10% in transfection efficiency, thereby demonstrating an increase in the number of transfected cells. These results show that an RNA interference (RNAi) high-throughput screen (HTS) can be applied to nonviral gene transfer. We have also demonstrated that siRNAs can be co-delivered with lipofected DNA to increase the transfection efficiency in vitro.

Silencing of ATM expression by siRNA technique contributes to glioma stem cell radiosensitivity in vitro and in vivo.

Science.gov (United States)

Li, Yan; Li, Luchun; Wu, Zhijuan; Wang, Lulu; Wu, Yongzhong; Li, Dairong; Ma, Uiwen; Shao, Jianghe; Yu, Huiqing; Wang, Donglin

2017-07-01

Evidence has shown that both high expression of the ataxia-telangiectasia mutated (ATM) gene and glioma stem cells (GSCs) are responsible for radioresistance in glioma. Thus, we hypothesized that brain tumor radiosensitivity may be enhanced via silencing of the ATM gene in GSCs. In the present study we successfully induced GSCs from two cell lines and used CD133 and nestin to identify GSCs. A lentivirus was used to deliver siRNA-ATMPuro (A group) to GSCs prior to radiation, while siRNA-HKPuro (N group) and GSCs (C group) were used as negative and blank controls, respectively. RT-qPCR and western blotting were performed to verify the efficiency of the siRNA-ATM technique. The expression of the ATM gene and ATM protein were significantly downregulated post-transfection. Cell Counting Kit-8 (CCK-8) and colony formation assays revealed that the A group demonstrated weak cell proliferation and lower survival fractions post-irradiation compared to the C/N groups. Flow cytometry was used to examine the percentage of cell apoptosis and G2 phase arrest, which were both higher in the A group than in the C/N groups. We found that the comet tail percentage evaluated by comet assay was higher in the A group than in the C/N groups. After radiation treatment, three radiosensitive genes [p53, proliferating cell nuclear antigen (PCNA), survivin] exhibited a decreasing tendency as determined by RT-qPCR. Mice underwent subcutaneous implantation, followed by radiation, and the resulting necrosis and hemorrhage were more obvious in the A group than in the N groups. In conclusion, silencing of ATM via the siRNA technique improved radiosensitivity of GSCs both in vitro and in vivo.

RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

KAUST Repository

Cernilogar, Filippo M.; Burroughs, A. Maxwell; Lanzuolo, Chiara; Breiling, Achim; Imhof, Axel; Orlando, Valerio

2013-01-01

.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

Enhanced whitefly resistance in transgenic tobacco plants expressing double stranded RNA of v-ATPase A gene.

Science.gov (United States)

Thakur, Nidhi; Upadhyay, Santosh Kumar; Verma, Praveen C; Chandrashekar, Krishnappa; Tuli, Rakesh; Singh, Pradhyumna K

2014-01-01

Expression of double strand RNA (dsRNA) designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi), thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci) upon oral feeding. The v-ATPase subunit A (v-ATPaseA) coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops.

Enhanced whitefly resistance in transgenic tobacco plants expressing double stranded RNA of v-ATPase A gene.

Directory of Open Access Journals (Sweden)

Nidhi Thakur

Full Text Available BACKGROUND: Expression of double strand RNA (dsRNA designed against important insect genes in transgenic plants have been shown to give protection against pests through RNA interference (RNAi, thus opening the way for a new generation of insect-resistant crops. We have earlier compared the efficacy of dsRNAs/siRNAs, against a number of target genes, for interference in growth of whitefly (Bemisia tabaci upon oral feeding. The v-ATPase subunit A (v-ATPaseA coding gene was identified as a crucial target. We now report the effectiveness of transgenic tobacco plants expressing siRNA to silence v-ATPaseA gene expression for the control of whitefly infestation. METHODOLOGY/PRINCIPAL FINDINGS: Transgenic tobacco lines were developed for the expression of long dsRNA precursor to make siRNA and knock down the v-ATPaseA mRNA in whitefly. Molecular analysis and insecticidal properties of the transgenic plants established the formation of siRNA targeting the whitefly v-ATPaseA, in the leaves. The transcript level of v-ATPaseA in whiteflies was reduced up to 62% after feeding on the transgenic plants. Heavy infestation of whiteflies on the control plants caused significant loss of sugar content which led to the drooping of leaves. The transgenic plants did not show drooping effect. CONCLUSIONS/SIGNIFICANCE: Host plant derived pest resistance was achieved against whiteflies by genetic transformation of tobacco which generated siRNA against the whitefly v-ATPaseA gene. Transgenic tobacco lines expressing dsRNA of v-ATPaseA, delivered sufficient siRNA to whiteflies feeding on them, mounting a significant silencing response, leading to their mortality. The transcript level of the target gene was reduced in whiteflies feeding on transgenic plants. The strategy can be taken up for genetic engineering of plants to control whiteflies in field crops.

Epigenetic silencing of miRNA-9 is associated with HES1 oncogenic activity and poor prognosis of medulloblastoma

Science.gov (United States)

Fiaschetti, G; Abela, L; Nonoguchi, N; Dubuc, A M; Remke, M; Boro, A; Grunder, E; Siler, U; Ohgaki, H; Taylor, M D; Baumgartner, M; Shalaby, T; Grotzer, M A

2014-01-01

Background: microRNA-9 is a key regulator of neuronal development aberrantly expressed in brain malignancies, including medulloblastoma. The mechanisms by which microRNA-9 contributes to medulloblastoma pathogenesis remain unclear, and factors that regulate this process have not been delineated. Methods: Expression and methylation status of microRNA-9 in medulloblastoma cell lines and primary samples were analysed. The association of microRNA-9 expression with medulloblastoma patients' clinical outcome was assessed, and the impact of microRNA-9 restoration was functionally validated in medulloblastoma cells. Results: microRNA-9 expression is repressed in a large subset of MB samples compared with normal fetal cerebellum. Low microRNA-9 expression correlates significantly with the diagnosis of unfavourable histopathological variants and with poor clinical outcome. microRNA-9 silencing occurs via cancer-specific CpG island hypermethylation. HES1 was identified as a direct target of microRNA-9 in medulloblastoma, and restoration of microRNA-9 was shown to trigger cell cycle arrest, to inhibit clonal growth and to promote medulloblastoma cell differentiation. Conclusions: microRNA-9 is a methylation-silenced tumour suppressor that could be a potential candidate predictive marker for poor prognosis of medulloblastoma. Loss of microRNA-9 may confer a proliferative advantage to tumour cells, and it could possibly contribute to disease pathogenesis. Thus, re-expression of microRNA-9 may constitute a novel epigenetic regulation strategy against medulloblastoma. PMID:24346283

RNA interference: learning gene knock-down from cell physiology

Directory of Open Access Journals (Sweden)

Provenzano Maurizio

2004-11-01

Full Text Available Summary Over the past decade RNA interference (RNAi has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design.

RNA interference: learning gene knock-down from cell physiology

Science.gov (United States)

Mocellin, Simone; Provenzano, Maurizio

2004-01-01

Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080

Functional characterization of endogenous siRNA target genes in Caenorhabditis elegans

Directory of Open Access Journals (Sweden)

Heikkinen Liisa

2008-06-01

Full Text Available Abstract Background Small interfering RNA (siRNA molecules mediate sequence specific silencing in RNA interference (RNAi, a gene regulatory phenomenon observed in almost all organisms. Large scale sequencing of small RNA libraries obtained from C. elegans has revealed that a broad spectrum of siRNAs is endogenously transcribed from genomic sequences. The biological role and molecular diversity of C. elegans endogenous siRNA (endo-siRNA molecules, nonetheless, remain poorly understood. In order to gain insight into their biological function, we annotated two large libraries of endo-siRNA sequences, identified their cognate targets, and performed gene ontology analysis to identify enriched functional categories. Results Systematic trends in categorization of target genes according to the specific length of siRNA sequences were observed: 18- to 22-mer siRNAs were associated with genes required for embryonic development; 23-mers were associated uniquely with post-embryonic development; 24–26-mers were associated with phosphorus metabolism or protein modification. Moreover, we observe that some argonaute related genes associate with siRNAs with multiple reads. Sequence frequency graphs suggest that different lengths of siRNAs share similarities in overall sequence structure: the 5' end begins with G, while the body predominates with U and C. Conclusion These results suggest that the lengths of endogenous siRNA molecules are consequential to their biological functions since the gene ontology categories for their cognate mRNA targets vary depending upon their lengths.

Double-stranded RNA delivery through soaking mediates silencing of the muscle protein 20 and increases mortality to the Asian citrus psyllid, Diaphorina citri.

Science.gov (United States)

Yu, Xiudao; Gowda, Siddarame; Killiny, Nabil

2017-09-01

Asian citrus psyllid, Diaphorina citri Kuwayama, is the most important economic pest of citrus because it transmits Candidatus Liberibacter asiaticus (CLas), the causal agent of huanglongbing (HLB). Silencing genes by RNA interference (RNAi) is a promising approach for controlling D. citri. RNAi-based insect management strategies depend on the selection of suitable target genes. The muscle protein 20 gene DcMP20 was characterized from D. citri in an effort to impair proper muscle development through RNAi. Phylogenetic analysis showed that DcMP20 was more closely related to MP20 from Drosophila compared with its counterpart from other insect species. Developmental expression analysis revealed that transcription of DcMP20 was development dependent and reached a maximum level in the last instar (fourth-fifth) of the nymphal stage. The extent of RNAi in D. citri was dose dependent, with dsRNA-DcMP20 at 75 ng µL -1 being sufficient to knock down endogenous DcMP20 expression, which resulted in significant mortality and reduced body weight that positively correlated with the silencing of DcMP20. No effect was found when dsRNA-GFP or water was used, indicating the specific effect of dsRNA-DcMP20. Our results suggest that dsRNA can be delivered to D. citri through soaking, and DcMP20 is an effective RNAi target to be used in the management of D. citri. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Capturing microRNA targets using an RNA-induced silencing complex (RISC)-trap approach.

Science.gov (United States)

Cambronne, Xiaolu A; Shen, Rongkun; Auer, Paul L; Goodman, Richard H

2012-12-11

Identifying targets is critical for understanding the biological effects of microRNA (miRNA) expression. The challenge lies in characterizing the cohort of targets for a specific miRNA, especially when targets are being actively down-regulated in miRNA- RNA-induced silencing complex (RISC)-messengerRNA (mRNA) complexes. We have developed a robust and versatile strategy called RISCtrap to stabilize and purify targets from this transient interaction. Its utility was demonstrated by determining specific high-confidence target datasets for miR-124, miR-132, and miR-181 that contained known and previously unknown transcripts. Two previously unknown miR-132 targets identified with RISCtrap, adaptor protein CT10 regulator of kinase 1 (CRK1) and tight junction-associated protein 1 (TJAP1), were shown to be endogenously regulated by miR-132 in adult mouse forebrain. The datasets, moreover, differed in the number of targets and in the types and frequency of microRNA recognition element (MRE) motifs, thus revealing a previously underappreciated level of specificity in the target sets regulated by individual miRNAs.

Genome-wide methylation analysis identifies genes silenced in non-seminoma cell lines.

Science.gov (United States)

Noor, Dzul Azri Mohamed; Jeyapalan, Jennie N; Alhazmi, Safiah; Carr, Matthew; Squibb, Benjamin; Wallace, Claire; Tan, Christopher; Cusack, Martin; Hughes, Jaime; Reader, Tom; Shipley, Janet; Sheer, Denise; Scotting, Paul J

2016-01-01

Silencing of genes by DNA methylation is a common phenomenon in many types of cancer. However, the genome-wide effect of DNA methylation on gene expression has been analysed in relatively few cancers. Germ cell tumours (GCTs) are a complex group of malignancies. They are unique in developing from a pluripotent progenitor cell. Previous analyses have suggested that non-seminomas exhibit much higher levels of DNA methylation than seminomas. The genomic targets that are methylated, the extent to which this results in gene silencing and the identity of the silenced genes most likely to play a role in the tumours' biology have not yet been established. In this study, genome-wide methylation and expression analysis of GCT cell lines was combined with gene expression data from primary tumours to address this question. Genome methylation was analysed using the Illumina infinium HumanMethylome450 bead chip system and gene expression was analysed using Affymetrix GeneChip Human Genome U133 Plus 2.0 arrays. Regulation by methylation was confirmed by demethylation using 5-aza-2-deoxycytidine and reverse transcription-quantitative PCR. Large differences in the level of methylation of the CpG islands of individual genes between tumour cell lines correlated well with differential gene expression. Treatment of non-seminoma cells with 5-aza-2-deoxycytidine verified that methylation of all genes tested played a role in their silencing in yolk sac tumour cells and many of these genes were also differentially expressed in primary tumours. Genes silenced by methylation in the various GCT cell lines were identified. Several pluripotency-associated genes were identified as a major functional group of silenced genes.

The bifunctional abiotic stress signalling regulator and endogenous RNA silencing suppressor FIERY1 is required for lateral root formation

KAUST Repository

Chen, Hao

2010-09-28

The Arabidopsis FIERY1 (FRY1) locus was originally identified as a negative regulator of stress-responsive gene expression and later shown to be required for suppression of RNA silencing. In this study we discovered that the FRY1 locus also regulates lateral root formation. Compared with the wild type, fry1 mutant seedlings generated significantly fewer lateral roots under normal growth conditions and also exhibited a dramatically reduced sensitivity to auxin in inducing lateral root initiation. Using transgenic plants that overexpress a yeast homolog of FRY1 that possesses only the 3\\', 5\\'-bisphosphate nucleotidase activity but not the inositol 1-phosphatase activity, we demonstrated that the lateral root phenotypes in fry1 result from loss of the nucleotidase activity. Furthermore, a T-DNA insertion mutant of another RNA silencing suppressor, XRN4 (but not XRN2 or XRN3), which is an exoribonuclease that is inhibited by the substrate of the FRY1 3\\', 5\\'-bisphosphate nucleotidase, exhibits similar lateral root defects. Although fry1 and xrn4 exhibited reduced sensitivity to ethylene, our experiments demonstrated that restoration of ethylene sensitivity in the fry1 mutant is not sufficient to rescue the lateral root phenotypes of fry1. Our results indicate that RNA silencing modulated by FRY1 and XRN4 plays an important role in shaping root architecture. © 2010 Blackwell Publishing Ltd.

Development of marker-free transgenic Jatropha curcas producing curcin-deficient seeds through endosperm-specific RNAi-mediated gene silencing.

Science.gov (United States)

Gu, Keyu; Tian, Dongsheng; Mao, Huizhu; Wu, Lifang; Yin, Zhongchao

2015-10-08

Jatropha curcas L. is a potential biofuel plant and its seed oil is suitable for biodiesel production. Despite this promising application, jatropha seeds contain two major toxic components, namely phorbol esters and curcins. These compounds would reduce commercial value of seed cake and raise safety and environment concerns on jatropha plantation and processing. Curcins are Type I ribosome inactivating proteins. Several curcin genes have been identified in the jatropha genome. Among which, the Curcin 1 (C1) gene is identified to be specifically expressed in endosperm, whereas the Curcin 2A (C2A) is mainly expressed in young leaves. A marker-free RNAi construct carrying a β-estradiol-regulated Cre/loxP system and a C1 promoter-driven RNAi cassette for C1 gene was made and used to generate marker-free transgenic RNAi plants to specifically silence the C1 gene in the endosperm of J. curcas. Plants of transgenic line L1, derived from T0-1, carry two copies of marker-free RNAi cassette, whereas plants of L35, derived from T0-35, harbored one copy of marker-free RNAi cassette and three copies of closely linked and yet truncated Hpt genes. The C1 protein content in endosperm of L1 and L35 seeds was greatly reduced or undetectable, while the C2A proteins in young leaves of T0-1 and T0-35 plants were unaffected. In addition, the C1 mRNA transcripts were undetectable in the endosperm of T3 seeds of L1 and L35. The results demonstrated that the expression of the C1 gene was specifically down-regulated or silenced by the double-stranded RNA-mediated RNA interference generated from the RNAi cassette. The C1 promoter-driven RNAi cassette for the C1 gene in transgenic plants was functional and heritable. Both C1 transcripts and C1 proteins were greatly down-regulated or silenced in the endosperm of transgenic J. curcas. The marker-free transgenic plants and curcin-deficient seeds developed in this study provided a solution for the toxicity of curcins in jatropha seeds and

SiRNAs conjugated with aromatic compounds induce RISC-mediated antisense strand selection and strong gene-silencing activity

Energy Technology Data Exchange (ETDEWEB)

Kubo, Takanori, E-mail: kubo-t@yasuda-u.ac.jp [Faculty of Pharmacy, Yasuda Women' s University, 6-13-1 Yasuhigashi, Asaminami-ku, Hiroshima 731-0153 (Japan); Yanagihara, Kazuyoshi [Faculty of Pharmacy, Yasuda Women' s University, 6-13-1 Yasuhigashi, Asaminami-ku, Hiroshima 731-0153 (Japan); Division of Genetics, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan); Takei, Yoshifumi [Department of Biochemistry, Nagoya University Graduate School of Medicine, 65 Tsurumi-cho, Showa-ku, Nagoya 466-8550 (Japan); Mihara, Keichiro [Department of Hematology and Oncology, Research Institute for Radiation Biology and Medicine, Hiroshima University, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8553 (Japan); Sato, Yuichiro; Seyama, Toshio [Faculty of Pharmacy, Yasuda Women' s University, 6-13-1 Yasuhigashi, Asaminami-ku, Hiroshima 731-0153 (Japan)

2012-10-05

Highlights: Black-Right-Pointing-Pointer SiRNAs conjugated with aromatic compounds (Ar-siRNAs) at 5 Prime -sense strand were synthesized. Black-Right-Pointing-Pointer Ar-siRNAs increased resistance against nuclease degradation. Black-Right-Pointing-Pointer Ar-siRNAs were thermodynamically stable compared with the unmodified siRNA. Black-Right-Pointing-Pointer High levels of cellular uptake and cytoplasmic localization were found. Black-Right-Pointing-Pointer Strong gene-silencing efficacy was exhibited in the Ar-siRNAs. -- Abstract: Short interference RNA (siRNA) is a powerful tool for suppressing gene expression in mammalian cells. In this study, we focused on the development of siRNAs conjugated with aromatic compounds in order to improve the potency of RNAi and thus to overcome several problems with siRNAs, such as cellular delivery and nuclease stability. The siRNAs conjugated with phenyl, hydroxyphenyl, naphthyl, and pyrenyl derivatives showed strong resistance to nuclease degradation, and were thermodynamically stable compared with unmodified siRNA. A high level of membrane permeability in HeLa cells was also observed. Moreover, these siRNAs exhibited enhanced RNAi efficacy, which exceeded that of locked nucleic acid (LNA)-modified siRNAs, against exogenous Renilla luciferase in HeLa cells. In particular, abundant cytoplasmic localization and strong gene-silencing efficacy were found in the siRNAs conjugated with phenyl and hydroxyphenyl derivatives. The novel siRNAs conjugated with aromatic compounds are promising candidates for a new generation of modified siRNAs that can solve many of the problems associated with RNAi technology.

Agrobacterium Mediated Transient Gene Silencing (AMTS) in Stevia rebaudiana: Insights into Steviol Glycoside Biosynthesis Pathway

Science.gov (United States)

Guleria, Praveen; Yadav, Sudesh Kumar

2013-01-01

Background Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi) based Agrobacterium mediated transient gene silencing (AMTS) approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1) genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins. Methodology/Principal Findings RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3) content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes. Conclusions SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route. PMID:24023961

Silencing of mitochondrial NADP+-dependent isocitrate dehydrogenase gene enhances glioma radiosensitivity

International Nuclear Information System (INIS)

Kim, Sung Youl; Yoo, Young Hyun; Park, Jeen-Woo

2013-01-01

Highlights: •Silencing of the IDPm gene enhances IR-induced autophagy in glioma cells. •Autophagy inhibition augmented apoptosis of irradiated glioma cells. •Results offer a redox-active therapeutic strategy for the treatment of cancer. -- Abstract: Reactive oxygen species (ROS) levels are elevated in organisms that have been exposed to ionizing radiation and are protagonists in the induction of cell death. Recently, we demonstrated that the control of mitochondrial redox balance and the cellular defense against oxidative damage are primary functions of mitochondrial NADP + -dependent isocitrate dehydrogenase (IDPm) via the supply of NADPH for antioxidant systems. In the present study, we report an autophagic response to ionizing radiation in A172 glioma cells transfected with small interfering RNA (siRNA) targeting the IDPm gene. Autophagy in A172 transfectant cells was associated with enhanced autophagolysosome formation and GFP–LC3 punctuation/aggregation. Furthermore, we found that the inhibition of autophagy by chloroquine augmented apoptotic cell death of irradiated A172 cells transfected with IDPm siRNA. Taken together, our data suggest that autophagy functions as a survival mechanism in A172 cells against ionizing radiation-induced apoptosis and the sensitizing effect of IDPm siRNA and autophagy inhibitor on the ionizing radiation-induced apoptotic cell death of glioma cells offers a novel redox-active therapeutic strategy for the treatment of cancer

The P0 protein encoded by cotton leafroll dwarf virus (CLRDV) inhibits local but not systemic RNA silencing.

Science.gov (United States)

Delfosse, Verónica C; Agrofoglio, Yamila C; Casse, María F; Kresic, Iván Bonacic; Hopp, H Esteban; Ziegler-Graff, Véronique; Distéfano, Ana J

2014-02-13

Plants employ RNA silencing as a natural defense mechanism against viruses. As a counter-defense, viruses encode silencing suppressor proteins (SSPs) that suppress RNA silencing. Most, but not all, the P0 proteins encoded by poleroviruses have been identified as SSP. In this study, we demonstrated that cotton leafroll dwarf virus (CLRDV, genus Polerovirus) P0 protein suppressed local silencing that was induced by sense or inverted repeat transgenes in Agrobacterium co-infiltration assay in Nicotiana benthamiana plants. A CLRDV full-length infectious cDNA clone that is able to infect N. benthamiana through Agrobacterium-mediated inoculation also inhibited local silencing in co-infiltration assays, suggesting that the P0 protein exhibits similar RNA silencing suppression activity when expressed from the full-length viral genome. On the other hand, the P0 protein did not efficiently inhibit the spread of systemic silencing signals. Moreover, Northern blotting indicated that the P0 protein inhibits the generation of secondary but not primary small interfering RNAs. The study of CLRDV P0 suppression activity may contribute to understanding the molecular mechanisms involved in the induction of cotton blue disease by CLRDV infection. Copyright © 2013 Elsevier B.V. All rights reserved.

Undesired small RNAs originate from an artificial microRNA precursor in transgenic petunia (Petunia hybrida.

Directory of Open Access Journals (Sweden)

Yulong Guo

Full Text Available Although artificial microRNA (amiRNA technology has been used frequently in gene silencing in plants, little research has been devoted to investigating the accuracy of amiRNA precursor processing. In this work, amiRNAchs1 (amiRchs1, based on the Arabidopsis miR319a precursor, was expressed in order to suppress the expression of CHS genes in petunia. The transgenic plants showed the CHS gene-silencing phenotype. A modified 5' RACE technique was used to map small-RNA-directed cleavage sites and to detect processing intermediates of the amiRchs1 precursor. The results showed that the target CHS mRNAs were cut at the expected sites and that the amiRchs1 precursor was processed from loop to base. The accumulation of small RNAs in amiRchs1 transgenic petunia petals was analyzed using the deep-sequencing technique. The results showed that, alongside the accumulation of the desired artificial microRNAs, additional small RNAs that originated from other regions of the amiRNA precursor were also accumulated at high frequency. Some of these had previously been found to be accumulated at low frequency in the products of ath-miR319a precursor processing and some of them were accompanied by 3'-tailing variant. Potential targets of the undesired small RNAs were discovered in petunia and other Solanaceae plants. The findings draw attention to the potential occurrence of undesired target silencing induced by such additional small RNAs when amiRNA technology is used. No appreciable production of secondary small RNAs occurred, despite the fact that amiRchs1 was designed to have perfect complementarity to its CHS-J target. This confirmed that perfect pairing between an amiRNA and its targets is not the trigger for secondary small RNA production. In conjunction with the observation that amiRNAs with perfect complementarity to their target genes show high efficiency and specificity in gene silencing, this finding has an important bearing on future applications of ami

Undesired small RNAs originate from an artificial microRNA precursor in transgenic petunia (Petunia hybrida).

Science.gov (United States)

Guo, Yulong; Han, Yao; Ma, Jing; Wang, Huiping; Sang, Xianchun; Li, Mingyang

2014-01-01

Although artificial microRNA (amiRNA) technology has been used frequently in gene silencing in plants, little research has been devoted to investigating the accuracy of amiRNA precursor processing. In this work, amiRNAchs1 (amiRchs1), based on the Arabidopsis miR319a precursor, was expressed in order to suppress the expression of CHS genes in petunia. The transgenic plants showed the CHS gene-silencing phenotype. A modified 5' RACE technique was used to map small-RNA-directed cleavage sites and to detect processing intermediates of the amiRchs1 precursor. The results showed that the target CHS mRNAs were cut at the expected sites and that the amiRchs1 precursor was processed from loop to base. The accumulation of small RNAs in amiRchs1 transgenic petunia petals was analyzed using the deep-sequencing technique. The results showed that, alongside the accumulation of the desired artificial microRNAs, additional small RNAs that originated from other regions of the amiRNA precursor were also accumulated at high frequency. Some of these had previously been found to be accumulated at low frequency in the products of ath-miR319a precursor processing and some of them were accompanied by 3'-tailing variant. Potential targets of the undesired small RNAs were discovered in petunia and other Solanaceae plants. The findings draw attention to the potential occurrence of undesired target silencing induced by such additional small RNAs when amiRNA technology is used. No appreciable production of secondary small RNAs occurred, despite the fact that amiRchs1 was designed to have perfect complementarity to its CHS-J target. This confirmed that perfect pairing between an amiRNA and its targets is not the trigger for secondary small RNA production. In conjunction with the observation that amiRNAs with perfect complementarity to their target genes show high efficiency and specificity in gene silencing, this finding has an important bearing on future applications of amiRNAs in gene

Small interfering RNA-mediated silencing of nicotinamide phosphoribosyltransferase (NAMPT and lysosomal trafficking regulator (LYST induce growth inhibition and apoptosis in human multiple myeloma cells: A preliminary study

Directory of Open Access Journals (Sweden)

Ivyna Pau Ni Bong

2016-11-01

Full Text Available Multiple myeloma (MM is a malignancy of B lymphocytes or plasma cells. Our array-based comparative genomic hybridization findings revealed chromosomal gains at 7q22.3 and 1q42.3, where nicotinamide (NAM phosphoribosyltransferase (NAMPT and lysosomal trafficking regulator (LYST genes are localized, respectively. This led us to further study the functions of these genes in myeloma cells. NAMPT is a key enzyme involved in nicotinamide adenine dinucleotide salvage pathway, and it is frequently overexpressed in human cancers. In contrast, little is known about the function of LYST in cancer. The expression of LYST is shown to affect lysosomal size, granule size, and autophagy in human cells. In this study, the effects of small interfering RNA (siRNA-mediated silencing of NAMPT and LYST on cell proliferation and apoptosis were evaluated in RPMI 8226 myeloma cells. Transfection efficiencies were determined by quantitative real time reverse transcriptase PCR. Cell proliferation was determined using MTT assay, while apoptosis was analyzed with flow cytometry using Annexin V-fluorescein isothiocyanate/propidium iodide assay. The NAMPT protein expression in siRNA-treated cells was estimated by enzyme-linked immunosorbent assay. Our results showed that NAMPT and LYST were successfully knockdown by siRNA transfection (p < 0.05. NAMPT or LYST gene silencing significantly inhibited cell proliferation and induced apoptosis in RPMI 8226 cells (p < 0.05. Silencing of NAMPT gene also decreased NAMPT protein levels (p < 0.01. Our study demonstrated that NAMPT and LYST play pivotal roles in the molecular pathogenesis of MM. This is the first report describing the possible functions of LYST in myelomagenesis and its potential role as a therapeutic target in MM.

Small interfering RNA-mediated silencing of nicotinamide phosphoribosyltransferase (NAMPT) and lysosomal trafficking regulator (LYST) induce growth inhibition and apoptosis in human multiple myeloma cells: A preliminary study

Science.gov (United States)

Bong, Ivyna Pau Ni; Ng, Ching Ching; Fakiruddin, Shaik Kamal; Lim, Moon Nian; Zakaria, Zubaidah

2016-01-01

Multiple myeloma (MM) is a malignancy of B lymphocytes or plasma cells. Our array-based comparative genomic hybridization findings revealed chromosomal gains at 7q22.3 and 1q42.3, where nicotinamide (NAM) phosphoribosyltransferase (NAMPT) and lysosomal trafficking regulator (LYST) genes are localized, respectively. This led us to further study the fprotein expression in unctions of these genes in myeloma cells. NAMPT is a key enzyme involved in nicotinamide adenine dinucleotide salvage pathway, and it is frequently overexpressed in human cancers. In contrast, little is known about the function of LYST in cancer. The expression of LYST is shown to affect lysosomal size, granule size, and autophagy in human cells. In this study, the effects of small interfering RNA (siRNA)-mediated silencing of NAMPT and LYST on cell proliferation and apoptosis were evaluated in RPMI 8226 myeloma cells. Transfection efficiencies were determined by quantitative real time reverse transcriptase PCR. Cell proliferation was determined using MTT assay, while apoptosis was analyzed with flow cytometry using Annexin V-fluorescein isothiocyanate/propidium iodide assay. The NAMPT protein expression in siRNA-treated cells was estimated by enzyme-linked immunosorbent assay. Our results showed that NAMPT and LYST were successfully knockdown by siRNA transfection (p < 0.05). NAMPT or LYST gene silencing significantly inhibited cell proliferation and induced apoptosis in RPMI 8226 cells (p < 0.05). Silencing of NAMPT gene also decreased NAMPT protein levels (p < 0.01). Our study demonstrated that NAMPT and LYST play pivotal roles in the molecular pathogenesis of MM. This is the first report describing the possible functions of LYST in myelomagenesis and its potential role as a therapeutic target in MM. PMID:27754828

Strengthening Triterpene Saponins Biosynthesis by Over-Expression of Farnesyl Pyrophosphate Synthase Gene and RNA Interference of Cycloartenol Synthase Gene in Panax notoginseng Cells

Directory of Open Access Journals (Sweden)

Yan Yang

2017-04-01

Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.

Expression profiling of c-kit and its impact after esiRNA silencing during gonadal development in catfish.

Science.gov (United States)

Laldinsangi, C; Senthilkumaran, B

2018-04-03

C-kit receptor is a member of a family of growth factor receptors that have tyrosine kinase activity, and are involved in the transduction of growth regulatory signals across plasma membrane by activation of its ligand, kitl/scf. The present study analysed mRNA and protein expression profiles of c-kit in the gonads of catfish, Clarias gariepinus, using real time PCR, in situ hybridization and immunohistochemistry. Tissue distribution analysis revealed higher expression mainly in the catfish gonads. Ontogeny studies showed minimal expression during early developmental stages and highest during 50-75 days post hatch, and the dimorphic expression in gonads decreased gradually till adulthood, which might suggest an important role for this gene around later stages of sex differentiation and gonadal development. Expression of C-kit was analysed at various phases of gonadal cycle in both male and female, which showed minimal expression during the resting phase, and higher expression in male compared to females during the pre-spawning phase. In vitro and in vivo induction using human chorionic gonadotropin elevated the expression of c-kit indicating the regulatory influence of hypothalamo-hypophyseal axis. In vivo transient gene silencing using c-kit-esiRNA in adult catfish during gonadal recrudescence showed a decrease in c-kit expression, which affected the expression level of germ cell meiotic marker sycp3, as well as several factors and steroidogenic enzyme genes involved in germ cell development. Decrease in the levels of serum 11-KT and T were also observed after esiRNA silencing. The findings of this study suggest that c-kit has an important role in the process of germ cell proliferation, development and maturation during gonadal development and recrudescence in catfish. Copyright © 2018. Published by Elsevier Inc.

Chitosan/siRNA nanoparticles encapsulated in PLGA nanofibers for siRNA delivery

DEFF Research Database (Denmark)

Chen, Menglin; Gao, Shan; Dong, Mingdong

2012-01-01

Composite nanofibers of biodegradable poly(d,l-lactic-co-glycolic acid) (PLGA) encapsulating chitosan/siRNA nanoparticles (NPs) were prepared by electrospinning. Acidic/alkaline hydrolysis and a bulk/surface degradation mechanism were investigated in order to achieve an optimized release profile...... for prolonged and efficient gene silencing. Thermo-controlled AFM in situ imaging not only revealed the integrity of the encapsulated chitosan/siRNA polyplex but also shed light on the decreasing Tg of PLGA on the fiber surfaces during release. A triphasic release profile based on bulk erosion was obtained at p......RNA transfection, where the encapsulated chitosan/siRNA NPs exhibited up to 50% EGFP gene silencing activity after 48 h post-transfection on H1299 cells....

Genomic Characterization of Variable Surface Antigens Reveals a Telomere Position Effect as a Prerequisite for RNA Interference-Mediated Silencing in Paramecium tetraurelia

Science.gov (United States)

Baranasic, Damir; Oppermann, Timo; Cheaib, Miriam; Cullum, John; Schmidt, Helmut

2014-01-01

ABSTRACT Antigenic or phenotypic variation is a widespread phenomenon of expression of variable surface protein coats on eukaryotic microbes. To clarify the mechanism behind mutually exclusive gene expression, we characterized the genetic properties of the surface antigen multigene family in the ciliate Paramecium tetraurelia and the epigenetic factors controlling expression and silencing. Genome analysis indicated that the multigene family consists of intrachromosomal and subtelomeric genes; both classes apparently derive from different gene duplication events: whole-genome and intrachromosomal duplication. Expression analysis provides evidence for telomere position effects, because only subtelomeric genes follow mutually exclusive transcription. Microarray analysis of cultures deficient in Rdr3, an RNA-dependent RNA polymerase, in comparison to serotype-pure wild-type cultures, shows cotranscription of a subset of subtelomeric genes, indicating that the telomere position effect is due to a selective occurrence of Rdr3-mediated silencing in subtelomeric regions. We present a model of surface antigen evolution by intrachromosomal gene duplication involving the maintenance of positive selection of structurally relevant regions. Further analysis of chromosome heterogeneity shows that alternative telomere addition regions clearly affect transcription of closely related genes. Consequently, chromosome fragmentation appears to be of crucial importance for surface antigen expression and evolution. Our data suggest that RNAi-mediated control of this genetic network by trans-acting RNAs allows rapid epigenetic adaptation by phenotypic variation in combination with long-term genetic adaptation by Darwinian evolution of antigen genes. PMID:25389173

Down-regulation of osmotin (PR5) gene by virus-induced gene silencing (VIGS) leads to susceptibility of resistant Piper colubrinum Link. to the oomycete pathogen Phytophthora capsici Leonian.

Science.gov (United States)

Anu, K; Jessymol, K K; Chidambareswaren, M; Gayathri, G S; Manjula, S

2015-06-01

Piper colubrinum Link., a distant relative of Piper nigrum L., is immune to the oomycete pathogen Phytophthora capsici Leonian that causes 'quick wilt' in cultivated black pepper (P. nigrum). The osmotin, PR5 gene homologue, earlier identified from P. colubrinum, showed significant overexpression in response to pathogen and defense signalling molecules. The present study focuses on the functional validation of P. colubrinum osmotin (PcOSM) by virus induced gene silencing (VIGS) using Tobacco Rattle Virus (TRV)-based vector. P. colubrinum plants maintained under controlled growth conditions in a growth chamber were infiltrated with Agrobacterium carrying TRV empty vector (control) and TRV vector carrying PcOSM. Three weeks post infiltration, viral movement was confirmed in newly emerged leaves of infiltrated plants by RT-PCR using TRV RNA1 and TRV RNA2 primers. Semi-quantitative RT-PCR confirmed significant down-regulation of PcOSM gene in TRV-PcOSM infiltrated plant compared with the control plants. The control and silenced plants were challenged with Phytophthora capsici which demonstrated that knock-down of PcOSM in P. colubrinum leads to increased fungal mycelial growth in silenced plants compared to control plants, which was accompanied by decreased accumulation of H2O2 as indicated by 3,3'-diaminobenzidine (DAB) staining. Thus, in this study, we demonstrated that Piper colubrinum osmotin gene is required for resisting P. capsici infection and has possible role in hypersensitive cell death response and oxidative burst signaling during infection.

dsRNA silencing of an R2R3-MYB transcription factor affects flower cell shape in a Dendrobium hybrid.

Science.gov (United States)

Lau, Su-Ee; Schwarzacher, Trude; Othman, Rofina Yasmin; Harikrishna, Jennifer Ann

2015-08-11

The R2R3-MYB genes regulate pigmentation and morphogenesis of flowers, including flower and cell shape, and therefore have importance in the development of new varieties of orchids. However, new variety development is limited by the long breeding time required in orchids. In this study, we identified a cDNA, DhMYB1, that is expressed during flower development in a hybrid orchid, Dendrobium hybrida (Dendrobium bobby messina X Dendrobium chao phraya) then used the direct application of dsRNA to observe the effect of gene silencing on flower phenotype and floral epidermal cell shape. Flower bud development in the Dendrobium hybrid was characterised into seven stages and the time of meiosis was determined as between stages 3 to 5 when the bud is approximately half of the mature size. Scanning electron microscopy characterisation of adaxial epidermal cells of the flower perianth, showed that the petals and sepals each are divided into two distinct domains based on cell shape and size, while the labellum comprises seven domains. Thirty-two partial cDNA fragments representing R2R3-MYB gene sequences were isolated from D. hybrida. Phylogenetic analysis revealed that nine of the translated sequences were clustered with MYB sequences that are known to be involved in cell shape development and from these, DhMYB1 was selected for full length cDNA cloning and functional study. Direct application of a 430 bp dsRNA from the 3' region of DhMYB1 to emerging orchid flower buds reduced expression of DhMYB1 RNA compared with untreated control. Scanning electron microscopy of adaxial epidermal cells within domain one of the labellum of flowers treated with DhMYB1 dsRNA showed flattened epidermal cells whilst those of control flowers were conical. DhMYB1 is expressed throughout flower bud development and is involved in the development of the conical cell shape of the epidermal cells of the Dendrobium hybrida flower labellum. The direct application of dsRNA changed the phenotype of

An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

Directory of Open Access Journals (Sweden)

Olga Fernández-Miragall

Full Text Available Pelargonium flower break virus (PFBV, genus Carmovirus has a single-stranded positive-sense genomic RNA (gRNA which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37 which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES. Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

An internal ribosome entry site directs translation of the 3'-gene from Pelargonium flower break virus genomic RNA: implications for infectivity.

Science.gov (United States)

Fernández-Miragall, Olga; Hernández, Carmen

2011-01-01

Pelargonium flower break virus (PFBV, genus Carmovirus) has a single-stranded positive-sense genomic RNA (gRNA) which contains five ORFs. The two 5'-proximal ORFs encode the replicases, two internal ORFs encode movement proteins, and the 3'-proximal ORF encodes a polypeptide (p37) which plays a dual role as capsid protein and as suppressor of RNA silencing. Like other members of family Tombusviridae, carmoviruses express ORFs that are not 5'-proximal from subgenomic RNAs. However, in one case, corresponding to Hisbiscus chlorotic ringspot virus, it has been reported that the 3'-proximal gene can be translated from the gRNA through an internal ribosome entry site (IRES). Here we show that PFBV also holds an IRES that mediates production of p37 from the gRNA, raising the question of whether this translation strategy may be conserved in the genus. The PFBV IRES was functional both in vitro and in vivo and either in the viral context or when inserted into synthetic bicistronic constructs. Through deletion and mutagenesis studies we have found that the IRES is contained within a 80 nt segment and have identified some structural traits that influence IRES function. Interestingly, mutations that diminish IRES activity strongly reduced the infectivity of the virus while the progress of the infection was favoured by mutations potentiating such activity. These results support the biological significance of the IRES-driven p37 translation and suggest that production of the silencing suppressor from the gRNA might allow the virus to early counteract the defence response of the host, thus facilitating pathogen multiplication and spread.

Inhibition of Androgen-Independent Growth of Prostate Cancer by siRNA- Mediated Androgen Receptor Gene Silencing

Science.gov (United States)

2008-02-01

and then photographed using a digital camera . AAV production and infection. To silence AR gene expression, a hairpin- structured expression vector...Sandusky GE, Vessella RL, Neubauer BL. Increased AKT activity contributes to prostate cancer progression by dramatically accelerating prostate tumor...HeNe laser. The spectrograph has an f/2.0 Czerny–Turner imaging spec- trometer plus a thermo-electrically cooled Kodak 0401 CCD camera . The fiberoptic

Development of Agrobacterium-mediated virus-induced gene silencing and performance evaluation of four marker genes in Gossypium barbadense.

Directory of Open Access Journals (Sweden)

Jinhuan Pang

Full Text Available Gossypiumbarbadense is a cultivated cotton species and possesses many desirable traits, including high fiber quality and resistance to pathogens, especially Verticilliumdahliae (a devastating pathogen of Gossypium hirsutum, the main cultivated species. These elite traits are difficult to be introduced into G. hirsutum through classical breeding methods. In addition, genetic transformation of G. barbadense has not been successfully performed. It is therefore important to develop methods for evaluating the function and molecular mechanism of genes in G. barbadense. In this study, we had successfully introduced a virus-induced gene silencing (VIGS system into three cultivars of G. barbadense by inserting marker genes into the tobacco rattle virus (TRV vector. After we optimized the VIGS conditions, including light intensity, photoperiod, seedling age and Agrobacterium strain, 100% of plants agroinfiltrated with the GaPDS silencing vector showed white colored leaves. Three other marker genes, GaCLA1, GaANS and GaANR, were employed to further test this VIGS system in G. barbadense. The transcript levels of the endogenous genes in the silenced plants were reduced by more than 99% compared to control plants; these plants presented phenotypic symptoms 2 weeks after inoculation. We introduced a fusing sequence fragment of GaPDS and GaANR gene silencing vectors into a single plant, which resulted in both photobleaching and brownish coloration. The extent of silencing in plants agroinfiltrated with fusing two-gene-silencing vector was consistent with plants harboring a single gene silencing vector. The development of this VIGS system should promote analysis of gene function in G. barbadense, and help to contribute desirable traits for breeding of G. barbadense and G. hirsutum.

Optimisation of tomato Micro-tom regeneration and selection on glufosinate/Basta and dependency of gene silencing on transgene copy number.

Science.gov (United States)

Khuong, Thi Thu Huong; Crété, Patrice; Robaglia, Christophe; Caffarri, Stefano

2013-09-01

An efficient protocol of transformation and selection of transgenic lines of Micro-tom, a widespread model cultivar for tomato, is reported. RNA interference silencing efficiency and stability have been investigated and correlated with the number of insertions. Given its small size and ease of cultivation, the tomato (Solanum lycopersicon) cultivar Micro-tom is of widespread use as a model tomato plant. To create and screen transgenic plants, different selectable markers are commonly used. The bar marker carrying the resistance to the herbicide glufosinate/Basta, has many advantages, but it has been little utilised and with low efficiency for identification of tomato transgenic plants. Here we describe a procedure for accurate selection of transgenic Micro-tom both in vitro and in soil. Immunoblot, Southern blot and phenotypic analyses showed that 100 % of herbicide-resistant plants were transgenic. In addition, regeneration improvement has been obtained by using 2 mg/l Gibberellic acid in the shoot elongation medium; rooting optimisation on medium containing 1 mg/l IAA allowed up to 97 % of shoots developing strong and very healthy roots after only 10 days. Stable transformation frequency by infection of leaf explants with Agrobacterium reached 12 %. Shoots have been induced by combination of 1 mg/l zeatin-trans and 0.1 mg/l IAA. Somatic embryogenesis of cotyledon on medium containing 1 mg/l zeatin + 2 mg/l IAA is described in Micro-tom. The photosynthetic psbS gene has been used as reporter gene for RNA silencing studies. The efficiency of gene silencing has been found equivalent using three different target gene fragments of 519, 398 and 328 bp. Interestingly, silencing efficiency decreased from T0 to the T3 generation in plants containing multiple copies of the inserted T-DNA, while it was stable in plants containing a single insertion.

Gene silencing of beta-catenin in melanoma cells retards their growth but promotes the formation of pulmonary metastasis in mice.

Science.gov (United States)

Takahashi, Yuki; Nishikawa, Makiya; Suehara, Tetsuya; Takiguchi, Naomi; Takakura, Yoshinobu

2008-11-15

Altered expression of beta-catenin, a key component of the Wnt signaling pathway, is involved in a variety of cancers because increased levels of beta-catenin protein are frequently associated with enhanced cellular proliferation. Although our previous study demonstrated that gene silencing of beta-catenin in melanoma B16-BL6 cells by plasmid DNA (pDNA) expressing short-hairpin RNA targeting the gene (pshbeta-catenin) markedly suppressed their growth in vivo, gene silencing of beta-catenin could promote tumor metastasis by the rearranging cell adhesion complex. In this study, we investigated how silencing of beta-catenin affects metastatic aspects of melanoma cells. Transfection of B16-BL6 cells with pshbeta-catenin significantly reduced the amount of cadherin protein, a cell adhesion molecule binding to beta-catenin, with little change in its mRNA level. Cadherin-derived fragments were detected in culture media of B16-BL6 cells transfected with pshbeta-catenin, suggesting that cadherin is shed from the cell surface when the expression of beta-catenin is reduced. The mobility of B16-BL6 cells transfected with pshbeta-catenin was greater than that of cells transfected with any of the control pDNAs. B16-BL6 cells stably transfected with pshbeta-catenin (B16/pshbeta-catenin) formed less or an equal number of tumor nodules in the lung than cells stably transfected with other plasmids when injected into mice via the tail vein. However, when subcutaneously inoculated, B16/pshbeta-catenin cells formed more nodules in the lung than the other stably transfected cells. These results raise concerns about the gene silencing of beta-catenin for inhibiting tumor growth, because it promotes tumor metastasis by reducing the amount of cadherin in tumor cells. (c) 2008 Wiley-Liss, Inc.

Therapeutic Silencing of Bcl-2 by Systemically Administered siRNA Nanotherapeutics Inhibits Tumor Growth by Autophagy and Apoptosis and Enhances the Efficacy of Chemotherapy in Orthotopic Xenograft Models of ER (− and ER (+ Breast Cancer

Directory of Open Access Journals (Sweden)

Ibrahim Tekedereli

2013-01-01

Full Text Available Bcl-2 is overexpressed in about a half of human cancers and 50–70% of breast cancer patients, thereby conferring resistance to conventional therapies and making it an excellent therapeutic target. Small interfering RNA (siRNA offers novel and powerful tools for specific gene silencing and molecularly targeted therapy. Here, we show that therapeutic silencing of Bcl-2 by systemically administered nanoliposomal (NL-Bcl-2 siRNA (0.15 mg siRNA/kg, intravenous twice a week leads to significant antitumor activity and suppression of growth in both estrogen receptor-negative (ER(− MDA-MB-231 and ER-positive (+ MCF7 breast tumors in orthotopic xenograft models (P < 0.05. A single intravenous injection of NL-Bcl-2-siRNA provided robust and persistent silencing of the target gene expression in xenograft tumors. NL-Bcl-2-siRNA treatment significantly increased the efficacy of chemotherapy when combined with doxorubicin in both MDA-MB-231 and MCF-7 animal models (P < 0.05. NL-Bcl-2-siRNA treatment-induced apoptosis and autophagic cell death, and inhibited cyclin D1, HIF1α and Src/Fak signaling in tumors. In conclusion, our data provide the first evidence that in vivo therapeutic targeting Bcl-2 by systemically administered nanoliposomal-siRNA significantly inhibits growth of both ER(− and ER(+ breast tumors and enhances the efficacy of chemotherapy, suggesting that therapeutic silencing of Bcl-2 by siRNA is a viable approach in breast cancers.

The microRNA and messengerRNA profile of the RNA-induced silencing complex in human primary astrocyte and astrocytoma cells.

Science.gov (United States)

Moser, Joanna J; Fritzler, Marvin J

2010-10-18

GW/P bodies are cytoplasmic ribonucleoprotein-rich foci involved in microRNA (miRNA)-mediated messenger RNA (mRNA) silencing and degradation. The mRNA regulatory functions within GW/P bodies are mediated by GW182 and its binding partner hAgo2 that bind miRNA in the RNA-induced silencing complex (RISC). To date there are no published reports of the profile of miRNA and mRNA targeted to the RISC or a comparison of the RISC-specific miRNA/mRNA profile differences in malignant and non-malignant cells. RISC mRNA and miRNA components were profiled by microarray analysis of malignant human U-87 astrocytoma cells and its non-malignant counterpart, primary human astrocytes. Total cell RNA as well as RNA from immunoprecipitated RISC was analyzed. The novel findings were fourfold: (1) miRNAs were highly enriched in astrocyte RISC compared to U-87 astrocytoma RISC, (2) astrocytoma and primary astrocyte cells each contained unique RISC miRNA profiles as compared to their respective cellular miRNA profiles, (3) miR-195, 10b, 29b, 19b, 34a and 455-3p levels were increased and the miR-181b level was decreased in U-87 astrocytoma RISC as compared to astrocyte RISC, and (4) the RISC contained decreased levels of mRNAs in primary astrocyte and U-87 astrocytoma cells. The observation that miR-34a and miR-195 levels were increased in the RISC of U-87 astrocytoma cells suggests an oncogenic role for these miRNAs. Differential regulation of mRNAs by specific miRNAs is evidenced by the observation that three miR34a-targeted mRNAs and two miR-195-targeted mRNAs were downregulated while one miR-195-targeted mRNA was upregulated. Biological pathway analysis of RISC mRNA components suggests that the RISC plays a pivotal role in malignancy and other conditions. This study points to the importance of the RISC and ultimately GW/P body composition and function in miRNA and mRNA deregulation in astrocytoma cells and possibly in other malignancies.

The microRNA and messengerRNA profile of the RNA-induced silencing complex in human primary astrocyte and astrocytoma cells.

Directory of Open Access Journals (Sweden)

Joanna J Moser

2010-10-01

Full Text Available GW/P bodies are cytoplasmic ribonucleoprotein-rich foci involved in microRNA (miRNA-mediated messenger RNA (mRNA silencing and degradation. The mRNA regulatory functions within GW/P bodies are mediated by GW182 and its binding partner hAgo2 that bind miRNA in the RNA-induced silencing complex (RISC. To date there are no published reports of the profile of miRNA and mRNA targeted to the RISC or a comparison of the RISC-specific miRNA/mRNA profile differences in malignant and non-malignant cells.RISC mRNA and miRNA components were profiled by microarray analysis of malignant human U-87 astrocytoma cells and its non-malignant counterpart, primary human astrocytes. Total cell RNA as well as RNA from immunoprecipitated RISC was analyzed. The novel findings were fourfold: (1 miRNAs were highly enriched in astrocyte RISC compared to U-87 astrocytoma RISC, (2 astrocytoma and primary astrocyte cells each contained unique RISC miRNA profiles as compared to their respective cellular miRNA profiles, (3 miR-195, 10b, 29b, 19b, 34a and 455-3p levels were increased and the miR-181b level was decreased in U-87 astrocytoma RISC as compared to astrocyte RISC, and (4 the RISC contained decreased levels of mRNAs in primary astrocyte and U-87 astrocytoma cells.The observation that miR-34a and miR-195 levels were increased in the RISC of U-87 astrocytoma cells suggests an oncogenic role for these miRNAs. Differential regulation of mRNAs by specific miRNAs is evidenced by the observation that three miR34a-targeted mRNAs and two miR-195-targeted mRNAs were downregulated while one miR-195-targeted mRNA was upregulated. Biological pathway analysis of RISC mRNA components suggests that the RISC plays a pivotal role in malignancy and other conditions. This study points to the importance of the RISC and ultimately GW/P body composition and function in miRNA and mRNA deregulation in astrocytoma cells and possibly in other malignancies.

Enhancer-driven chromatin interactions during development promote escape from silencing by a long non-coding RNA

Directory of Open Access Journals (Sweden)

Korostowski Lisa

2011-11-01

Full Text Available Abstract Background Gene regulation in eukaryotes is a complex process entailing the establishment of transcriptionally silent chromatin domains interspersed with regions of active transcription. Imprinted domains consist of clusters of genes, some of which exhibit parent-of-origin dependent monoallelic expression, while others are biallelic. The Kcnq1 imprinted domain illustrates the complexities of long-range regulation that coexists with local exceptions. A paternally expressed repressive non-coding RNA, Kcnq1ot1, regulates a domain of up to 750 kb, encompassing 14 genes. We study how the Kcnq1 gene, initially silenced by Kcnq1ot1, undergoes tissue-specific escape from imprinting during development. Specifically, we uncover the role of chromosome conformation during these events. Results We show that Kcnq1 transitions from monoallelic to biallelic expression during mid gestation in the developing heart. This transition is not associated with the loss of methylation on the Kcnq1 promoter. However, by exploiting chromosome conformation capture (3C technology, we find tissue-specific and stage-specific chromatin loops between the Kcnq1 promoter and newly identified DNA regulatory elements. These regulatory elements showed in vitro activity in a luciferase assay and in vivo activity in transgenic embryos. Conclusions By exploring the spatial organization of the Kcnq1 locus, our results reveal a novel mechanism by which local activation of genes can override the regional silencing effects of non-coding RNAs.

The RNA helicase Rm62 cooperates with SU(VAR3-9 to re-silence active transcription in Drosophila melanogaster.

Directory of Open Access Journals (Sweden)

Joern Boeke

Full Text Available Gene expression is highly dynamic and many genes show a wide range in expression over several orders of magnitude. This regulation is often mediated by sequence specific transcription factors. In addition, the tight packaging of DNA into chromatin can provide an additional layer of control resulting in a dynamic range of gene expression covering several orders of magnitude. During transcriptional activation, chromatin barriers have to be eliminated to allow an efficient progression of the RNA polymerase. This repressive chromatin structure has to be re-established quickly after it has been activated in order to tightly regulate gene activity. We show that the DExD/H box containing RNA helicase Rm62 is targeted to a site of rapid induction of transcription where it is responsible for an increased degree of methylation at H3K9 at the heat shock locus after removal of the heat shock stimulus. The RNA helicase interacts with the well-characterized histone methyltransferase SU(VAR3-9 via its N-terminus, which provides a potential mechanism for the targeting of H3K9 methylation to highly regulated genes. The recruitment of SU(VAR3-9 through interaction with a RNA helicase to a site of active transcription might be a general mechanism that allows an efficient silencing of highly regulated genes thereby enabling a cell to fine tune its gene activity over a wide range.

Down-regulation of Fusarium oxysporum endogenous genes by Host-Delivered RNA interference enhances disease resistance

Directory of Open Access Journals (Sweden)

Zongli eHu

2015-01-01

Full Text Available Fusarium oxysporum is a devastating pathogen causing extensive yield losses in a variety of crops and development of sustainable, environmentally friendly methods to improve crop resistance is crucial. We have used Host-Derived RNA interference (HD-RNAi technology to partially silence three different genes (FOW2, FRP1 and OPR in the hemi-biotrophic fungus Fusarium oxysporum f. sp. conglutinans. Expression of double stranded RNA molecules targeting fungal pathogen genes was achieved in a number of transgenic Arabidopsis lines. F. oxysporum infecting the transgenic lines displayed substantially reduced mRNA levels on all three targeted genes, with an average of 75%, 83% and 72% reduction for FOW2, FRP1 and OPR respectively. The silencing of pathogen genes had a clear positive effect on the ability of the transgenic lines to fight infection. All transgenic lines displayed enhanced resistance to F. oxysporum with delayed disease symptom development, especially FRP1 and OPR lines. Survival rates after fungal infection were higher in the transgenic lines compared to control wild type plants which consistently showed survival rates of 10%, with FOW2 lines showing 25% survival; FRP1 lines 30-50% survival and FOW2 between 45-70% survival. The down-regulation effect was specific for the targeted genes without unintended effects in related genes. In addition to producing resistant crops, HD-RNAi can provide a useful tool to rapidly screen candidate fungal pathogenicity genes without the need to produce fungal knockout mutants.

Down-regulation of Fusarium oxysporum endogenous genes by Host-Delivered RNA interference enhances disease resistance

Science.gov (United States)

Hu, Zongli; Parekh, Urvi; Maruta, Natsumi; Trusov, Yuri; Botella, Jimmy

2015-01-01

Fusarium oxysporum is a devastating pathogen causing extensive yield losses in a variety of crops and development of sustainable, environmentally friendly methods to improve crop resistance is crucial. We have used Host-Derived RNA interference (HD-RNAi) technology to partially silence three different genes (FOW2, FRP1 and OPR) in the hemi-biotrophic fungus Fusarium oxysporum f. sp. conglutinans. Expression of double stranded RNA molecules targeting fungal pathogen genes was achieved in a number of transgenic Arabidopsis lines. F. oxysporum infecting the transgenic lines displayed substantially reduced mRNA levels on all three targeted genes, with an average of 75%, 83% and 72% reduction for FOW2, FRP1 and OPR respectively. The silencing of pathogen genes had a clear positive effect on the ability of the transgenic lines to fight infection. All transgenic lines displayed enhanced resistance to F. oxysporum with delayed disease symptom development, especially FRP1 and OPR lines. Survival rates after fungal infection were higher in the transgenic lines compared to control wild type plants which consistently showed survival rates of 10%, with FOW2 lines showing 25% survival; FRP1 lines 30-50% survival and FOW2 between 45-70% survival. The down-regulation effect was specific for the targeted genes without unintended effects in related genes. In addition to producing resistant crops, HD-RNAi can provide a useful tool to rapidly screen candidate fungal pathogenicity genes without the need to produce fungal knockout mutants.

Composite potato plants with transgenic roots on non-transgenic shoots: a model system for studying gene silencing in roots.

Science.gov (United States)

Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke; Hühns, Maja; Broer, Inge; Valkonen, Jari P T

2014-12-01

Composite potato plants offer an extremely fast, effective and reliable system for studies on gene functions in roots using antisense or inverted-repeat but not sense constructs for gene inactivation. Composite plants, with transgenic roots on a non-transgenic shoot, can be obtained by shoot explant transformation with Agrobacterium rhizogenes. The aim of this study was to generate composite potato plants (Solanum tuberosum) to be used as a model system in future studies on root-pathogen interactions and gene silencing in the roots. The proportion of transgenic roots among the roots induced was high (80-100%) in the four potato cultivars tested (Albatros, Desirée, Sabina and Saturna). No wild-type adventitious roots were formed at mock inoculation site. All strains of A. rhizogenes tested induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots of composite potato plants expressed significantly higher amounts of β-glucuronidase (GUS) than the roots of a GUS-transgenic potato line event. Silencing of the uidA transgene (GUS) was tested by inducing roots on the GUS-transgenic cv. Albatros event with strains of A. rhizogenes over-expressing either the uidA sense or antisense transcripts, or inverted-repeat or hairpin uidA RNA. The three last mentioned constructs caused 2.5-4.0 fold reduction in the uidA mRNA expression. In contrast, over-expression of uidA resulted in over 3-fold increase in the uidA mRNA and GUS expression, indicating that sense-mediated silencing (co-suppression) was not functional in roots. The results suggest that composite plants offer a useful experimental system for potato research, which has gained little previous attention.

MLH1-Silenced and Non-Silenced Subgroups of Hypermutated Colorectal Carcinomas Have Distinct Mutational Landscapes

Science.gov (United States)

Donehower, Lawrence A.; Creighton, Chad J.; Schultz, Nikolaus; Shinbrot, Eve; Chang, Kyle; Gunaratne, Preethi H.; Muzny, Donna; Sander, Chris; Hamilton, Stanley R.; Gibbs, Richard A.; Wheeler, David

2014-01-01

Approximately 15% of colorectal carcinomas (CRC) exhibit a hypermutated genotype accompanied by high levels of microsatellite instability (MSI-H) and defects in DNA mismatch repair. These tumors, unlike the majority of colorectal carcinomas, are often diploid, exhibit frequent epigenetic silencing of the MLH1 DNA mismatch repair gene, and have a better clinical prognosis. As an adjunct study to The Cancer Genome Atlas consortium that recently analyzed 224 colorectal cancers by whole exome sequencing, we compared the 35 CRC (15.6%) with a hypermutated genotype to those with a non-hypermutated genotype. We found that 22 (63%) of hypermutated CRC exhibited transcriptional silencing of the MLH1 gene, a high frequency of BRAF V600E gene mutations and infrequent APC and KRAS mutations, a mutational pattern significantly different from their non-hypermutated counterparts. However, the remaining 13 (37%) hypermutated CRC lacked MLH1 silencing, contained tumors with the highest mutation rates (“ultramutated” CRC), and exhibited higher incidences of APC and KRAS mutations, but infrequent BRAF mutations. These patterns were confirmed in an independent validation set of 250 exome-sequenced CRC. Analysis of mRNA and microRNA expression signatures revealed that hypermutated CRC with MLH1 silencing had greatly reduced levels of WNT signaling and increased BRAF signaling relative non-hypermutated CRC. Our findings suggest that hypermutated CRC include one subgroup with fundamentally different pathways to malignancy than the majority of CRC. Examination of MLH1 expression status and frequencies of APC, KRAS, and BRAF mutation in CRC may provide a useful diagnostic tool that could supplement the standard microsatellite instability assays and influence therapeutic decisions. PMID:22899370

Increasing the amylose content of durum wheat through silencing of the SBEIIa genes

Directory of Open Access Journals (Sweden)

Masci Stefania

2010-07-01

Full Text Available Abstract Background High amylose starch has attracted particular interest because of its correlation with the amount of Resistant Starch (RS in food. RS plays a role similar to fibre with beneficial effects for human health, providing protection from several diseases such as colon cancer, diabetes, obesity, osteoporosis and cardiovascular diseases. Amylose content can be modified by a targeted manipulation of the starch biosynthetic pathway. In particular, the inactivation of the enzymes involved in amylopectin synthesis can lead to the increase of amylose content. In this work, genes encoding starch branching enzymes of class II (SBEIIa were silenced using the RNA interference (RNAi technique in two cultivars of durum wheat, using two different methods of transformation (biolistic and Agrobacterium. Expression of RNAi transcripts was targeted to the seed endosperm using a tissue-specific promoter. Results Amylose content was markedly increased in the durum wheat transgenic lines exhibiting SBEIIa gene silencing. Moreover the starch granules in these lines were deformed, possessing an irregular and deflated shape and being smaller than those present in the untransformed controls. Two novel granule bound proteins, identified by SDS-PAGE in SBEIIa RNAi lines, were investigated by mass spectrometry and shown to have strong homologies to the waxy proteins. RVA analysis showed new pasting properties associated with high amylose lines in comparison with untransformed controls. Finally, pleiotropic effects on other starch genes were found by semi-quantitative and Real-Time reverse transcription-polymerase chain reaction (RT-PCR. Conclusion We have found that the silencing of SBEIIa genes in durum wheat causes obvious alterations in granule morphology and starch composition, leading to high amylose wheat. Results obtained with two different methods of transformation and in two durum wheat cultivars were comparable.

Silencing of a putative immunophilin gene in the cattle tick Rhipicephalus (Boophilus microplus increases the infection rate of Babesia bovis in larval progeny

Directory of Open Access Journals (Sweden)

Knowles Donald P

2009-11-01

Full Text Available Abstract Background The cattle tick Rhipicephalus (Boophilus microplus is involved in the transmission of the protozoan Babesia bovis, the etiological agent of bovine babesiosis. Interactions between ticks and protozoa are poorly understood and the investigation of tick genes that affect tick fitness and protozoan infection can set the stage for dissecting the molecular interactions between the two species. Results In this study, RNA interference was used to silence R. microplus genes that had been previously shown to be up-regulated in response to B. bovis infection. The silencing of a putative immunophilin gene (Imnp in female ticks fed on a calf acutely infected with B. bovis decreased the hatching rate and survival of larval progeny. Interestingly, Imnp was up-regulated significantly in ovaries of R. microplus in response to B. bovis infection and its silencing in female ticks significantly increased the infection rate of the protozoan in larval progeny. The results also showed that the silencing of a putative Kunitz-type serine protease inhibitor (Spi gene and a putative lipocalin (Lpc gene decreased the fitness of R. microplus females, but had no significant effect on the infection rate of B. bovis in larval progeny. Conclusion The silencing of the Imnp, Spi or Lpc genes decreased the fitness of R. microplus females fed on a calf during acute B. bovis infection. The Imnp gene data suggest that this putative immunophilin gene is involved in the defense system of R. microplus against B. bovis and may play a role in controlling the protozoan infection in tick ovaries and larval progeny.

Stable RNA interference of ErbB-2 gene synergistic with epirubicin suppresses breast cancer growth in vitro and in vivo

International Nuclear Information System (INIS)

Hu Xiaoqu; Su Fengxi; Qin Li; Jia Weijuan; Gong Chang; Yu Fengyan; Guo Jujiang; Song Erwei

2006-01-01

Overexpression of human epidermal growth factor receptor-2 (Her2, ErbB-2) contributes to the progression and metastasis of breast cancer, implying that Her2 gene is a suitable target of RNA interference (RNAi) for breast cancer therapy. Here, we employed plasmid-mediated expression of 2 different Her2-shRNAs (pU6-Her2shRNAs) efficiently silenced the target gene expression on Her2 expressing SKBR-3 breast cancer cells in both mRNA and protein levels. Consequently, pU6-Her2shRNA increased apoptosis and reduced proliferation of SKBR-3 cells assayed by TUNEL and MTT, respectively. In vivo, intra-tumor injection of pU6-Her2shRNA inhibited the growth of SKBR-3 tumors inoculated subcutaneously in nude mice. Furthermore, pU6-Her2shRNA synergized the tumor suppression effect of epirubicin to SKBR-3 cells in vitro and implanted subcutaneously in nude mice. Therefore, we concluded that stable silencing of Her2 gene expression with plasmid expressing shRNA may hold great promise as a novel therapy for Her2 expressing breast cancers alone or in combination with anthracycline chemotherapy

MicroRNA159 can act as a switch or tuning microRNA independently of its abundance in Arabidopsis.

Directory of Open Access Journals (Sweden)

Maria M Alonso-Peral

Full Text Available The efficacy of gene silencing by plant microRNAs (miRNAs is generally assumed to be predominantly determined by their abundance. In Arabidopsis the highly abundant miRNA, miR159, acts as a molecular "switch" in vegetative tissues completely silencing the expression of two GAMYB-like genes, MYB33 and MYB65. Here, we show that miR159 has a diminished silencing efficacy in the seed. Using reporter gene constructs, we determined that MIR159 and MYB33 are co-transcribed in the aleurone and embryo of germinating seeds. However in contrast to vegetative tissues, MYB33 is not completely silenced. Instead, miR159 appears to shape the spatio-temporal expression pattern of MYB33 during seed germination. Transcript profiling in a time course during seed germination in wild-type and a mir159 mutant in which miR159 is almost absent, revealed that transcript levels of the GAMYB-like genes were similar between these two genotypes during germination, but much higher in the mir159 mutant once germination had completed. This attenuation in the silencing of the GAMYB-like genes was not explained by a decrease in mature miR159 levels, which remained constant at all time points during seed germination. We propose that miR159 acts as a tuner of GAMYB-like levels in Arabidopsis germinating seeds and that the activity of this miRNA is attenuated in the seed compared to vegetative tissues. This implies that the efficacy of miRNA-mediated silencing is not solely determined by miRNA abundance and target transcript levels, but is being determined through additional mechanisms.

RNA interference and retinoblastoma-related genes are required for repression of endogenous siRNA targets in Caenorhabditis elegans.

Science.gov (United States)

Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A

2008-12-23

In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans.

Multifunctional triblock co-polymer mP3/4HB-b-PEG-b-lPEI for efficient intracellular siRNA delivery and gene silencing.

Science.gov (United States)

Zhou, Li; Chen, Zhifei; Wang, Feifei; Yang, Xiuqun; Zhang, Biliang

2013-04-01

A non-viral siRNA carrier composed of mono-methoxy-poly (3-hydroxybutyrate-co-4-hydroxybutyrate)-block-polyethylene glycol-block-linear polyethyleneimine (mP3/4HB-b-PEG-b-lPEI) was synthesized using 1800 Da linear polyethyleneimine and evaluated for siRNA delivery. Our study demonstrated that siRNA could be efficiently combined with mP3/4HB-b-PEG-b-lPEI (mAG) co-polymer and was protected from nuclease degradation. The combined siRNA were released from the complexes easily under heparin competition. The particle size of the mAG/siRNA complexes was 158 nm, with a ζ-potential of around 28 mV. Atomic force microscopy images displayed spherical and homogeneously distributed complexes. The mAG block co-polymer displayed low cytotoxicity and efficient cellular uptake of Cy3-siRNA in A549 cells by flow cytometry and confocal microscopy. In vitro transfection efficiency of the block co-polymer was assessed using siRNA against luciferase in cultured A549-Luc, HeLa-Luc, HLF-Luc, A375-Luc and MCF-7-Luc cells. A higher transfection efficiency and lower cytotoxicity was obtained by mAG block co-polymer in five cell lines. Furthermore, a remarkable improvement in luciferase gene silencing efficiency of the mAG complex (up to 90-95%) over that of Lipofectamine™ 2000 (70-82%) was observed in HLF-Luc and A375-Luc cells. Additionally, a mAG/p65-siRNA complex also showed a better capability than Lipofectamine™ 2000/p65-siRNA complex to drastically reduce the p65 mRNA level down to 10-16% in HeLa, U251 and HUVEC cells at an N/P ratio of 70. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

Plant RNA Regulatory Network and RNA Granules in Virus Infection

Directory of Open Access Journals (Sweden)

Kristiina Mäkinen

2017-12-01

Full Text Available Regulation of post-transcriptional gene expression on mRNA level in eukaryotic cells includes translocation, translation, translational repression, storage, mRNA decay, RNA silencing, and nonsense-mediated decay. These processes are associated with various RNA-binding proteins and cytoplasmic ribonucleoprotein complexes many of which are conserved across eukaryotes. Microscopically visible aggregations formed by ribonucleoprotein complexes are termed RNA granules. Stress granules where the translationally inactive mRNAs are stored and processing bodies where mRNA decay may occur present the most studied RNA granule types. Diverse RNP-granules are increasingly being assigned important roles in viral infections. Although the majority of the molecular level studies on the role of RNA granules in viral translation and replication have been conducted in mammalian systems, some studies link also plant virus infection to RNA granules. An increasing body of evidence indicates that plant viruses require components of stress granules and processing bodies for their replication and translation, but how extensively the cellular mRNA regulatory network is utilized by plant viruses has remained largely enigmatic. Antiviral RNA silencing, which is an important regulator of viral RNA stability and expression in plants, is commonly counteracted by viral suppressors of RNA silencing. Some of the RNA silencing suppressors localize to cellular RNA granules and have been proposed to carry out their suppression functions there. Moreover, plant nucleotide-binding leucine-rich repeat protein-mediated virus resistance has been linked to enhanced processing body formation and translational repression of viral RNA. Many interesting questions relate to how the pathways of antiviral RNA silencing leading to viral RNA degradation and/or repression of translation, suppression of RNA silencing and viral RNA translation converge in plants and how different RNA granules and

Plant RNA Regulatory Network and RNA Granules in Virus Infection.

Science.gov (United States)

Mäkinen, Kristiina; Lõhmus, Andres; Pollari, Maija

2017-01-01

Regulation of post-transcriptional gene expression on mRNA level in eukaryotic cells includes translocation, translation, translational repression, storage, mRNA decay, RNA silencing, and nonsense-mediated decay. These processes are associated with various RNA-binding proteins and cytoplasmic ribonucleoprotein complexes many of which are conserved across eukaryotes. Microscopically visible aggregations formed by ribonucleoprotein complexes are termed RNA granules. Stress granules where the translationally inactive mRNAs are stored and processing bodies where mRNA decay may occur present the most studied RNA granule types. Diverse RNP-granules are increasingly being assigned important roles in viral infections. Although the majority of the molecular level studies on the role of RNA granules in viral translation and replication have been conducted in mammalian systems, some studies link also plant virus infection to RNA granules. An increasing body of evidence indicates that plant viruses require components of stress granules and processing bodies for their replication and translation, but how extensively the cellular mRNA regulatory network is utilized by plant viruses has remained largely enigmatic. Antiviral RNA silencing, which is an important regulator of viral RNA stability and expression in plants, is commonly counteracted by viral suppressors of RNA silencing. Some of the RNA silencing suppressors localize to cellular RNA granules and have been proposed to carry out their suppression functions there. Moreover, plant nucleotide-binding leucine-rich repeat protein-mediated virus resistance has been linked to enhanced processing body formation and translational repression of viral RNA. Many interesting questions relate to how the pathways of antiviral RNA silencing leading to viral RNA degradation and/or repression of translation, suppression of RNA silencing and viral RNA translation converge in plants and how different RNA granules and their individual

Two Novel Motifs of Watermelon Silver Mottle Virus NSs Protein Are Responsible for RNA Silencing Suppression and Pathogenicity.

Science.gov (United States)

Huang, Chung-Hao; Hsiao, Weng-Rong; Huang, Ching-Wen; Chen, Kuan-Chun; Lin, Shih-Shun; Chen, Tsung-Chi; Raja, Joseph A J; Wu, Hui-Wen; Yeh, Shyi-Dong

2015-01-01

The NSs protein of Watermelon silver mottle virus (WSMoV) is the RNA silencing suppressor and pathogenicity determinant. In this study, serial deletion and point-mutation mutagenesis of conserved regions (CR) of NSs protein were performed, and the silencing suppression function was analyzed through agroinfiltration in Nicotiana benthamiana plants. We found two amino acid (aa) residues, H113 and Y398, are novel functional residues for RNA silencing suppression. Our further analyses demonstrated that H113 at the common epitope (CE) ((109)KFTMHNQ(117)), which is highly conserved in Asia type tospoviruses, and the benzene ring of Y398 at the C-terminal β-sheet motif ((397)IYFL(400)) affect NSs mRNA stability and protein stability, respectively, and are thus critical for NSs RNA silencing suppression. Additionally, protein expression of other six deleted (ΔCR1-ΔCR6) and five point-mutated (Y15A, Y27A, G180A, R181A and R212A) mutants were hampered and their silencing suppression ability was abolished. The accumulation of the mutant mRNAs and proteins, except Y398A, could be rescued or enhanced by co-infiltration with potyviral suppressor HC-Pro. When assayed with the attenuated Zucchini yellow mosaic virus vector in squash plants, the recombinants carrying individual seven point-mutated NSs proteins displayed symptoms much milder than the recombinant carrying the wild type NSs protein, suggesting that these aa residues also affect viral pathogenicity by suppressing the host silencing mechanism.

Hsc70/Hsp90 chaperone machinery mediates ATP-dependent RISC loading of small RNA duplexes.

Science.gov (United States)

Iwasaki, Shintaro; Kobayashi, Maki; Yoda, Mayuko; Sakaguchi, Yuriko; Katsuma, Susumu; Suzuki, Tsutomu; Tomari, Yukihide

2010-07-30

Small silencing RNAs--small interfering RNAs (siRNAs) or microRNAs (miRNAs)--direct posttranscriptional gene silencing of their mRNA targets as guides for the RNA-induced silencing complex (RISC). Both siRNAs and miRNAs are born double stranded. Surprisingly, loading these small RNA duplexes into Argonaute proteins, the core components of RISC, requires ATP, whereas separating the two small RNA strands within Argonaute does not. Here we show that the Hsc70/Hsp90 chaperone machinery is required to load small RNA duplexes into Argonaute proteins, but not for subsequent strand separation or target cleavage. We envision that the chaperone machinery uses ATP and mediates a conformational opening of Ago proteins so that they can receive bulky small RNA duplexes. Our data suggest that the chaperone machinery may serve as the driving force for the RISC assembly pathway. Copyright 2010 Elsevier Inc. All rights reserved.

Engineering of small interfering RNA-loaded lipidoid-poly(DL-lactic-co-glycolic acid) hybrid nanoparticles for highly efficient and safe gene silencing: A quality by design-based approach

DEFF Research Database (Denmark)

Thanki, Kaushik; Zeng, Xianghui; Justesen, Sarah

2017-01-01

used and poorly tolerated cationic lipids might be replaced with more efficacious and safe lipidoids as the lipid component of siRNA-loaded lipid-polymer hybrid nanoparticles (LPNs) for achieving more efficient gene silencing at lower and safer doses. However, formulation design of such a complex...... formulation is highly challenging due to a strong interplay between several contributing factors. Hence, critical formulation variables, i.e. the lipidoid content and siRNA:lipidoid ratio, were initially identified, followed by a systematic quality-by-design approach to define the optimal operating space (OOS......), eventually resulting in the identification of a robust, highly efficacious and safe formulation. A 17-run design of experiment with an I-optimal approach was performed to systematically assess the effect of selected variables on critical quality attributes (CQAs), i.e. physicochemical properties...

MicroRNA-directed siRNA biogenesis in Caenorhabditis elegans.

Science.gov (United States)

Corrêa, Régis L; Steiner, Florian A; Berezikov, Eugene; Ketting, René F

2010-04-08

RNA interference (RNAi) is a post-transcriptional silencing process, triggered by double-stranded RNA (dsRNA), leading to the destabilization of homologous mRNAs. A distinction has been made between endogenous RNAi-related pathways and the exogenous RNAi pathway, the latter being essential for the experimental use of RNAi. Previous studies have shown that, in Caenorhabditis elegans, a complex containing the enzymes Dicer and the Argonaute RDE-1 process dsRNA. Dicer is responsible for cleaving dsRNA into short interfering RNAs (siRNAs) while RDE-1 acts as the siRNA acceptor. RDE-1 then guides a multi-protein complex to homologous targets to trigger mRNA destabilization. However, endogenous role(s) for RDE-1, if any, have remained unexplored. We here show that RDE-1 functions as a scavenger protein, taking up small RNA molecules from many different sources, including the microRNA (miRNA) pathway. This is in striking contrast to Argonaute proteins functioning directly in the miRNA pathway, ALG-1 and ALG-2: these proteins exclusively bind miRNAs. While playing no significant role in the biogenesis of the main pool of miRNAs, RDE-1 binds endogenous miRNAs and triggers RdRP activity on at least one perfectly matching, endogenous miRNA target. The resulting secondary siRNAs are taken up by a set of Argonaute proteins known to act as siRNA acceptors in exogenous RNAi, resulting in strong mRNA destabilization. Our results show that RDE-1 in an endogenous setting is actively screening the transcriptome using many different small RNAs, including miRNAs, as a guide, with implications for the evolution of transcripts with a potential to be recognized by Dicer.