WorldWideScience

Sample records for rna interference silences

  1. RNA interference: ready to silence cancer?

    Science.gov (United States)

    Mocellin, Simone; Costa, Rodolfo; Nitti, Donato

    2006-01-01

    RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.

  2. Technical advances in trigger-induced RNA interference gene silencing in the parasite Entamoeba histolytica.

    Science.gov (United States)

    Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder

    2016-03-01

    Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016

  3. RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

    KAUST Repository

    Cernilogar, Filippo M.

    2013-06-13

    Background:Beyond their role in post-transcriptional gene silencing, Dicer and Argonaute, two components of the RNA interference (RNAi) machinery, were shown to be involved in epigenetic regulation of centromeric heterochromatin and transcriptional gene silencing. In particular, RNAi mechanisms appear to play a role in repeat induced silencing and some aspects of Polycomb-mediated gene silencing. However, the functional interplay of RNAi mechanisms and Polycomb group (PcG) pathways at endogenous loci remains to be elucidated.Principal Findings:Here we show that the endogenous Dicer-2/Argonaute-2 RNAi pathway is dispensable for the PcG mediated silencing of the homeotic Bithorax Complex (BX-C). Although Dicer-2 depletion triggers mild transcriptional activation at Polycomb Response Elements (PREs), this does not induce transcriptional changes at PcG-repressed genes. Moreover, Dicer-2 is not needed to maintain global levels of methylation of lysine 27 of histone H3 and does not affect PRE-mediated higher order chromatin structures within the BX-C. Finally bioinformatic analysis, comparing published data sets of PcG targets with Argonaute-2-bound small RNAs reveals no enrichment of these small RNAs at promoter regions associated with PcG proteins.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

  4. The rde-1 gene, RNA interference, and transposon silencing in C. elegans.

    Science.gov (United States)

    Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C

    1999-10-15

    Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.

  5. Immune modulation through RNA interference-mediated silencing of CD40 in dendritic cells.

    Science.gov (United States)

    Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Samiee, Shahram; Ataee, Zahra; Tabei, Seyyed Ziyaoddin; Moazzeni, Seyed Mohammad

    2009-01-01

    RNA interference (RNAi) is an exciting mechanism for knocking down any target gene in transcriptional level. It is now clear that small interfering RNA (siRNA), a 19-21nt long dsRNA, can trigger a degradation process (RNAi) that specifically silences the expression of a cognate mRNA. Our findings in this study showed that down regulation of CD40 gene expression in dendritic cells (DCs) by RNAi culminated to immune modulation. Effective delivery of siRNA into DCs would be a reasonable method for the blocking of CD40 gene expression at the cell surface without any effect on other genes and cell cytotoxicity. The effects of siRNA against CD40 mRNA on the function and phenotype of DCs were investigated. The DCs were separated from the mice spleen and then cultured in vitro. By the means of Lipofectamine2000, siRNA was delivered to the cells and the efficacy of transfection was estimated by flow cytometry. By Annexine V and Propidium Iodide staining, we could evaluate the transfected cells viability. Also, the mRNA expression and protein synthesis were assessed by real-time PCR and flow cytometry, respectively. Knocking down the CD40 gene in the DCs caused an increase in IL-4 production, decrease in IL-12 production and allostimulation activity. All together, these effects would stimulate Th2 cytokines production from allogenic T-cells in vitro.

  6. Phenotypic changes associated with RNA interference silencing of chalcone synthase in apple (Malus × domestica).

    Science.gov (United States)

    Dare, Andrew P; Tomes, Sumathi; Jones, Midori; McGhie, Tony K; Stevenson, David E; Johnson, Ross A; Greenwood, David R; Hellens, Roger P

    2013-05-01

    We have identified in apple (Malus × domestica) three chalcone synthase (CHS) genes. In order to understand the functional redundancy of this gene family RNA interference knockout lines were generated where all three of these genes were down-regulated. These lines had no detectable anthocyanins and radically reduced concentrations of dihydrochalcones and flavonoids. Surprisingly, down-regulation of CHS also led to major changes in plant development, resulting in plants with shortened internode lengths, smaller leaves and a greatly reduced growth rate. Microscopic analysis revealed that these phenotypic changes extended down to the cellular level, with CHS-silenced lines showing aberrant cellular organisation in the leaves. Fruit collected from one CHS-silenced line was smaller than the 'Royal Gala' controls, lacked flavonoids in the skin and flesh and also had changes in cell morphology. Auxin transport experiments showed increased rates of auxin transport in a CHS-silenced line compared with the 'Royal Gala' control. As flavonoids are well known to be key modulators of auxin transport, we hypothesise that the removal of almost all flavonoids from the plant by CHS silencing creates a vastly altered environment for auxin transport to occur and results in the observed changes in growth and development. © 2013 The Authors The Plant Journal © 2013 Blackwell Publishing Ltd.

  7. Illuminating the gateway of gene silencing: perspective of RNA interference technology in clinical therapeutics.

    Science.gov (United States)

    Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok

    2012-07-01

    A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.

  8. Platinum Interference with siRNA Non-seed Regions Fine-Tunes Silencing Capacity

    DEFF Research Database (Denmark)

    Hedman, Hanna K; Kirpekar, Finn; Elmroth, Sofi K C

    2011-01-01

    expression, and the other one focused on the function of endogenous miRNAs. In both cases, the active molecule consists of a ∼20-nucleotide-long RNA duplex. In the siRNA case, improved systemic stability is of central interest for its further development toward clinical applications. With respect to mi......RNA processing and function, understanding its influence on mRNA targeting and the silencing ability of individual miRNAs, e.g., under pathological conditions, remains a scientific challenge. In the present study, a model system is presented where the influence of the two clinically used anticancer drugs......, cisplatin and oxaliplatin, on siRNA's silencing capacity has been evaluated. More specifically, siRNAs targeting the 3' UTR region of Wnt-5a mRNA (NM_003352) were constructed, and the biologically active antisense RNA strand was pre-platinated. Platinum adducts were detected and characterized...

  9. RNA interference-mediated silencing of speckle-type POZ protein promotes apoptosis of renal cell cancer cells.

    Science.gov (United States)

    Liu, Xiaoxia; Sun, Guiling; Sun, Xiuju

    2016-01-01

    This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP) gene on renal cell cancer (RCC) cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA)-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte-macrophage colony-stimulating factor and E-cadherin was significantly increased (Pmatrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial growth factor receptor, matrix metallopeptidase-9, and vascular cell adhesion molecule, which are related to the integrin-mediated cell surface interactions and extracellular matrix organization signaling pathway.

  10. Persistent interferon transgene expression by RNA interference-mediated silencing of interferon receptors.

    Science.gov (United States)

    Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu

    2010-09-01

    The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.

  11. Transgenic Sugarcane Resistant to Sorghum mosaic virus Based on Coat Protein Gene Silencing by RNA Interference

    Directory of Open Access Journals (Sweden)

    Jinlong Guo

    2015-01-01

    Full Text Available As one of the critical diseases of sugarcane, sugarcane mosaic disease can lead to serious decline in stalk yield and sucrose content. It is mainly caused by Potyvirus sugarcane mosaic virus (SCMV and/or Sorghum mosaic virus (SrMV, with additional differences in viral strains. RNA interference (RNAi is a novel strategy for producing viral resistant plants. In this study, based on multiple sequence alignment conducted on genomic sequences of different strains and isolates of SrMV, the conserved region of coat protein (CP genes was selected as the target gene and the interference sequence with size of 423 bp in length was obtained through PCR amplification. The RNAi vector pGII00-HACP with an expression cassette containing both hairpin interference sequence and cp4-epsps herbicide-tolerant gene was transferred to sugarcane cultivar ROC22 via Agrobacterium-mediated transformation. After herbicide screening, PCR molecular identification, and artificial inoculation challenge, anti-SrMV positive transgenic lines were successfully obtained. SrMV resistance rate of the transgenic lines with the interference sequence was 87.5% based on SrMV challenge by artificial inoculation. The genetically modified SrMV-resistant lines of cultivar ROC22 provide resistant germplasm for breeding lines and can also serve as resistant lines having the same genetic background for study of resistance mechanisms.

  12. RNA interference-mediated silencing of speckle-type POZ protein promotes apoptosis of renal cell cancer cells

    Directory of Open Access Journals (Sweden)

    Liu X

    2016-04-01

    Full Text Available Xiaoxia Liu, Guiling Sun, Xiuju Sun Department of Nephrology, Affiliated Hospital of Weifang Medical University, Weifang, People’s Republic of China Abstract: This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP gene on renal cell cancer (RCC cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte–macrophage colony-stimulating factor and E-cadherin was significantly increased (P<0.05. The relevant signaling pathways were the integrin-mediated cell surface interactions pathway and extracellular matrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial

  13. Normalization of Overexpressed α-Synuclein Causing Parkinson's Disease By a Moderate Gene Silencing With RNA Interference

    Directory of Open Access Journals (Sweden)

    Masaki Takahashi

    2015-01-01

    Full Text Available The α-synuclein (SNCA gene is a responsible gene for Parkinson's disease (PD; and not only nucleotide variations but also overexpression of SNCA appears to be involved in the pathogenesis of PD. A specific inhibition against mutant SNCA genes carrying nucleotide variations may be feasible by a specific silencing such as an allele-specific RNA interference (RNAi; however, there is no method for restoring the SNCA overexpression to a normal level. Here, we show that an atypical RNAi using small interfering RNAs (siRNAs that confer a moderate level of gene silencing is capable of controlling overexpressed SNCA genes to return to a normal level; named “expression-control RNAi” (ExCont-RNAi. ExCont-RNAi exhibited little or no significant off-target effects in its treated PD patient's fibroblasts that carry SNCA triplication. To further assess the therapeutic effect of ExCont-RNAi, PD-model flies that carried the human SNCA gene underwent an ExCont-RNAi treatment. The treated PD-flies demonstrated a significant improvement in their motor function. Our current findings suggested that ExCont-RNAi might be capable of becoming a novel therapeutic procedure for PD with the SNCA overexpression, and that siRNAs conferring a moderate level of gene silencing to target genes, which have been abandoned as useless siRNAs so far, might be available for controlling abnormally expressed disease-causing genes without producing adverse effects.

  14. RNA-Interference Components Are Dispensable for Transcriptional Silencing of the Drosophila Bithorax-Complex

    KAUST Repository

    Cernilogar, Filippo M.; Burroughs, A. Maxwell; Lanzuolo, Chiara; Breiling, Achim; Imhof, Axel; Orlando, Valerio

    2013-01-01

    .Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.

  15. Specific Silencing of L392V PSEN1 Mutant Allele by RNA Interference

    Directory of Open Access Journals (Sweden)

    Malgorzata Sierant

    2011-01-01

    Full Text Available RNA interference (RNAi technology provides a powerful molecular tool to reduce an expression of selected genes in eukaryotic cells. Short interfering RNAs (siRNAs are the effector molecules that trigger RNAi. Here, we describe siRNAs that discriminate between the wild type and mutant (1174 C→G alleles of human Presenilin1 gene (PSEN1. This mutation, resulting in L392V PSEN1 variant, contributes to early onset familial Alzheimer's disease. Using the dual fluorescence assay, flow cytometry and fluorescent microscopy we identified positions 8th–11th, within the central part of the antisense strand, as the most sensitive to mismatches. 2-Thiouridine chemical modification introduced at the 3′-end of the antisense strand improved the allele discrimination, but wobble base pairing adjacent to the mutation site abolished the siRNA activity. Our data indicate that siRNAs can be designed to discriminate between the wild type and mutant alleles of genes that differ by just a single nucleotide.

  16. RNA interference silencing of CHS greatly alters the growth pattern of apple (Malus x domestica).

    Science.gov (United States)

    Dare, Andrew P; Hellens, Roger P

    2013-08-01

    Plants produce a vast array of phenolic compounds which are essential for their survival on land. One major class of polyphenols are the flavonoids and their formation is dependent on the enzyme chalcone synthase (CHS). In a recent study we silenced the CHS genes of apple (Malus × domestica Borkh.) and observed a loss of pigmentation in the fruit skin, flowers and stems. More surprisingly, highly silenced lines were significantly reduced in size, with small leaves and shortened internode lengths. Chemical analysis also revealed that the transgenic shoots contained greatly reduced concentrations of flavonoids which are known to modulate auxin flow. An auxin transport study verified this, with an increased auxin transport in the CHS-silenced lines. Overall, these findings suggest that auxin transport in apple has adapted to take place in the presence of high endogenous concentrations of flavonoids. Removal of these compounds therefore results in abnormal auxin movement and a highly disrupted growth pattern.

  17. Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

    International Nuclear Information System (INIS)

    Anesti, Anna-Maria; Simpson, Guy R; Price, Toby; Pandha, Hardev S; Coffin, Robert S

    2010-01-01

    Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEX GM-CSF , we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials

  18. Manipulation of saponin biosynthesis by RNA interference-mediated silencing of β-amyrin synthase gene expression in soybean.

    Science.gov (United States)

    Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao

    2011-10-01

    Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.

  19. Enhancement of antiproliferative activity of interferons by RNA interference-mediated silencing of SOCS gene expression in tumor cells.

    Science.gov (United States)

    Takahashi, Yuki; Kaneda, Haruka; Takasuka, Nana; Hattori, Kayoko; Nishikawa, Makiya; Watanabe, Yoshihiko; Takakura, Yoshinobu

    2008-08-01

    The suppressor of cytokine signaling (SOCS) proteins, negative regulators of interferon (IFN)-induced signaling pathways, is involved in IFN resistance of tumor cells. To improve the growth inhibitory effect of IFN-beta and IFN-gamma on a murine melanoma cell line, B16-BL6, and a murine colon carcinoma cell line, Colon26 cells, SOCS-1 and SOCS-3 gene expression in tumor cells was downregulated by transfection of plasmid DNA expressing short hairpin RNA targeting one of these genes (pshSOCS-1 and pshSOCS-3, respectively). Transfection of pshSOCS-1 significantly increased the antiproliferative effect of IFN-gamma on B16-BL6 cells. However, any other combinations of plasmids and IFN had little effect on the growth of B16-BL6 cells. In addition, transfection of pshSOCS-1 and pshSOCS-3 produced little improvement in the effect of IFN on Colon26 cells. To understand the mechanism underlining these findings, the level of SOCS gene expression was measured by real time polymerase chain reaction. Addition of IFN-gamma greatly increased the SOCS-1 mRNA expression in B16-BL6 cells. Taking into account the synergistic effect of pshSOCS-1 and IFN-gamma on the growth of B16-BL6 cells, these findings suggest that IFN-gamma-induced high SOCS-1 gene expression in B16-BL6 cells significantly interferes with the antiproliferative effect of IFN-gamma. These results indicate that silencing SOCS gene expression can be an effective strategy to enhance the antitumor effect of IFN under conditions in which the SOCS gene expression is upregulated by IFN.

  20. Silencing of RhoA and RhoC expression by RNA interference suppresses human colorectal carcinoma growth in vivo

    Directory of Open Access Journals (Sweden)

    Wang Haibo

    2010-09-01

    Full Text Available Abstract Background RhoA and RhoC have been proved to be over-expressed in many solid cancers, including colorectal cancer. The reduction of RhoA and RhoC expression by RNA interference (RNAi resulted growth inhibition of cancer cells. The present study was to evaluate the effect of silencing of RhoA and RhoC expression by RNAi on growth of human colorectal carcinoma (CRC in tumor-bearing nude mice in vivo. Methods To establish HCT116 cell transplantable model, the nude mice were subcutaneously inoculated with 1.0 × 107 HCT116 cells and kept growing till the tumor xenografts reached 5-7 mm in diameter. Then the mice were randomly assigned to three groups(seven mice in each group: (1 normal saline(NS group, (2replication-defective recombinant adenovirus carrying the negative control shRNA (Ad-HK group and (3replication-defective recombinant adenovirus carrying the 4-tandem linked RhoA and RhoC shRNAs (Ad-RhoA-RhoC group. Ad-HK (4 × 108 pfu, 30 ul/mouse, Ad-RhoA-RhoC (4 × 108 pfu, 30 ul/mouse or PBS (30 ul/mouse was injected intratumorally four times once every other day. The weight and volumes of tumor xenografts were recorded. The levels of RhoA and RhoC mRNA transcripts and proteins in tumor xenografts were detected by reverse quantitative transcription polymerase chain reaction (QRT-PCR and immunohistochemical staining respectively. The terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL assay was used to detect the death of cells. Results The xenografts in mice could be seen at 5th day from the implantation of HCT116 cells and all had reached 5-7 mm in size at 9th day. After injection intratumorally, the growth speed of tumor xenografts in Ad-RhoA-RhoC group was significantly delayed compared with those in NS and Ad-HK group(P RhoA and RhoC reduced more in Ad-RhoA-RhoC group than those in NS and Ad-HK group. The relative RhoA and RhoC mRNA transcripts were decreased to 48% and 43% respectively (P RhoA and Rho

  1. RNA interference silences Microplitis demolitor bracovirus genes and implicates glc1.8 in disruption of adhesion in infected host cells

    International Nuclear Information System (INIS)

    Beck, Markus; Strand, Michael R.

    2003-01-01

    The family Polydnaviridae consists of ds-DNA viruses that are symbiotically associated with certain parasitoid wasps. PDVs are transmitted vertically but also are injected by wasps into hosts where they cause several physiological alterations including immunosuppression. The PDV genes responsible for mediating immunosuppression and other host alterations remain poorly characterized in large measure because viral mutants cannot be produced to study gene function. Here we report the use of RNA interference (RNAi) to specifically silence the glc1.8 and egf1.0 genes from Microplitis demolitor bracovirus (MdBV) in High Five cells derived from the lepidopteran Trichoplusia ni. Dose-response studies indicated that MdBV infects High Five cells and blocks the ability of these cells to adhere to culture plates. This response was very similar to what occurs in two classes of hemocytes, granular cells, and plasmatocytes, after infection by MdBV. Screening of monoclonal antibody (mAb) markers that distinguish different classes of lepidopteran hemocytes indicated that High Five cells cross-react with three mAbs that recognize granular cells from T. ni. Double-stranded RNA (dsRNA) complementary to glc1.8 specifically silenced glc1.8 expression and rescued the adhesive phenotype of High Five cells. Reciprocally, dsRNA complementary to egf1.0 silenced egf1.0 expression but had no effect on adhesion. The simplicity and potency of RNAi could be extremely useful for analysis of other PDV genes

  2. Interference RNA (RNAi)-based silencing of endogenous thrombopoietin receptor (Mpl) in Dami cells resulted in decreased hNUDC-mediated megakaryocyte proliferation and differentiation

    International Nuclear Information System (INIS)

    Pang, Shi-Feng; Li, Xiao-Kun; Zhang, Qiang; Yang, Fang; Xu, Peilin

    2009-01-01

    Recently our laboratory reported evidence showing that hNUDC acts as an additional cytokine for thrombopoietin receptor (Mpl). Previously known as the human homolog of a fungal nuclear migration protein, hNUDC plays a critical role in megakaryocyte differentiation and maturation. Here we sought to further clarify the hNUDC-Mpl ligand-receptor relationship by utilizing interference RNA (RNAi) to knockdown Mpl expression in a megakaryocyte cell line. We created U6 promoter driven constructs to express short hairpin RNAs (shRNA) with affinity for different sites on Mpl mRNA. By including Mpl-EGFP fusion protein in these constructs, we were able to effectively screen the shRNA that was most efficient in inhibiting Mpl mRNA expression. This shRNA was subsequently transferred into a lentivirus vector and transduced into Dami cells, a cell line which constitutively expresses endogenous Mpl. This lentiviral vector was also designed to simultaneously express EGFP to monitor transfection efficiency. Our results show that lentivirus can be used to effectively deliver shRNAs into Dami cells and cause specific inhibition of Mpl protein expression after transduction. Furthermore, we show the functional effects of shRNA-mediated Mpl silencing by demonstrating reduced hNUDC stimulated megakaryocyte proliferation and differentiation. Thus, the use of a RNAi knockdown strategy has allowed us to pinpoint the connection of hNUDC with Mpl in the regulation of megakaryocyte maturation.

  3. AGO1, QDE-2, and RDE-1 are related proteins required for post-transcriptional gene silencing in plants, quelling in fungi, and RNA interference in animals.

    Science.gov (United States)

    Fagard, M; Boutet, S; Morel, J B; Bellini, C; Vaucheret, H

    2000-10-10

    Introduction of transgene DNA may lead to specific degradation of RNAs that are homologous to the transgene transcribed sequence through phenomena named post-transcriptional gene silencing (PTGS) in plants, quelling in fungi, and RNA interference (RNAi) in animals. It was shown previously that PTGS, quelling, and RNAi require a set of related proteins (SGS2, QDE-1, and EGO-1, respectively). Here we report the isolation of Arabidopsis mutants impaired in PTGS which are affected at the Argonaute1 (AGO1) locus. AGO1 is similar to QDE-2 required for quelling and RDE-1 required for RNAi. Sequencing of ago1 mutants revealed one amino acid essential for PTGS that is also present in QDE-2 and RDE-1 in a highly conserved motif. Taken together, these results confirm the hypothesis that these processes derive from a common ancestral mechanism that controls expression of invading nucleic acid molecules at the post-transcriptional level. As opposed to rde-1 and qde-2 mutants, which are viable, ago1 mutants display several developmental abnormalities, including sterility. These results raise the possibility that PTGS, or at least some of its elements, could participate in the regulation of gene expression during development in plants.

  4. Gene silencing in non-model insects: Overcoming hurdles using symbiotic bacteria for trauma-free sustainable delivery of RNA interference: Sustained RNA interference in insects mediated by symbiotic bacteria: Applications as a genetic tool and as a biocide.

    Science.gov (United States)

    Whitten, Miranda; Dyson, Paul

    2017-03-01

    Insight into animal biology and development provided by classical genetic analysis of the model organism Drosophila melanogaster was an incentive to develop advanced genetic tools for this insect. But genetic systems for the over one million other known insect species are largely undeveloped. With increasing information about insect genomes resulting from next generation sequencing, RNA interference is now the method of choice for reverse genetics, although it is constrained by the means of delivery of interfering RNA. A recent advance to ensure sustained delivery with minimal experimental intervention or trauma to the insect is to exploit commensal bacteria for symbiont-mediated RNA interference. This technology not only offers an efficient means for RNA interference in insects in laboratory conditions, but also has potential for use in the control of human disease vectors, agricultural pests and pathogens of beneficial insects. © 2017 WILEY Periodicals, Inc.

  5. RNA interference in Lepidoptera

    DEFF Research Database (Denmark)

    Terenius, Ole; Papanicolaou, Alexie; Garbutt, Jennie S.

    2011-01-01

    in RNAi experiments in Lepidoptera are discussed. The review also points to a need to further investigate the mechanism of RNAi in lepidopteran insects and its possible connection to the innate immune response. Our general understanding of RNAi in Lepidoptera will be further aided in the future as our...... experiments have not been collected in such a way that they are possible to analyze. In this review, we have collected detailed data from more than 150 experiments including all to date published and many unpublished experiments. Despite a large variation in the data, trends that are found are that RNAi...... is particularly successful in the family Saturniidae and in genes involved in immunity. On the contrary, gene expression in epidermal tissues seems to be most difficult to silence. In addition, gene silencing by feeding dsRNA requires high concentrations for success. Possible causes for the variability of success...

  6. RNA interference: its use as antiviral therapy

    NARCIS (Netherlands)

    Haasnoot, J.; Berkhout, B.

    2006-01-01

    RNA interference (RNAi) is a sequence-specific gene-silencing mechanism that has been proposed to function as a defence mechanism of eukaryotic cells against viruses and transposons. RNAi was first observed in plants in the form of a mysterious immune response to viral pathogens. But RNAi is more

  7. Inhibition of virus replication by RNA interference

    NARCIS (Netherlands)

    Haasnoot, P. C. Joost; Cupac, Daniel; Berkhout, Ben

    2003-01-01

    RNA interference (RNAi) is a sequence-specific gene-silencing mechanism in eukaryotes, which is believed to function as a defence against viruses and transposons. Since its discovery, RNAi has been developed into a widely used technique for generating genetic knock-outs and for studying gene

  8. Tospovirus : induction and suppression of RNA silencing

    NARCIS (Netherlands)

    Hedil, Marcio

    2016-01-01

    While infecting their hosts, viruses must deal with host immunity. In plants the antiviral RNA silencing pathway is an important part of plant innate immunity. Tospoviruses are segmented negative-stranded RNA viruses of plants. To counteract the antiviral RNA silencing response in plants,

  9. Strategies underlying RNA silencing suppression by negative strand RNA viruses

    NARCIS (Netherlands)

    Hemmes, J.C.

    2007-01-01

    The research described in this thesis focused on the strategies of negative strand RNA viruses to counteract antiviral RNA silencing. In plants and insects, RNA silencing has been shown to act as a sequence specific antiviral defence mechanism that is characterised by the processing of double

  10. Genomic Characterization of Variable Surface Antigens Reveals a Telomere Position Effect as a Prerequisite for RNA Interference-Mediated Silencing in Paramecium tetraurelia

    Science.gov (United States)

    Baranasic, Damir; Oppermann, Timo; Cheaib, Miriam; Cullum, John; Schmidt, Helmut

    2014-01-01

    ABSTRACT Antigenic or phenotypic variation is a widespread phenomenon of expression of variable surface protein coats on eukaryotic microbes. To clarify the mechanism behind mutually exclusive gene expression, we characterized the genetic properties of the surface antigen multigene family in the ciliate Paramecium tetraurelia and the epigenetic factors controlling expression and silencing. Genome analysis indicated that the multigene family consists of intrachromosomal and subtelomeric genes; both classes apparently derive from different gene duplication events: whole-genome and intrachromosomal duplication. Expression analysis provides evidence for telomere position effects, because only subtelomeric genes follow mutually exclusive transcription. Microarray analysis of cultures deficient in Rdr3, an RNA-dependent RNA polymerase, in comparison to serotype-pure wild-type cultures, shows cotranscription of a subset of subtelomeric genes, indicating that the telomere position effect is due to a selective occurrence of Rdr3-mediated silencing in subtelomeric regions. We present a model of surface antigen evolution by intrachromosomal gene duplication involving the maintenance of positive selection of structurally relevant regions. Further analysis of chromosome heterogeneity shows that alternative telomere addition regions clearly affect transcription of closely related genes. Consequently, chromosome fragmentation appears to be of crucial importance for surface antigen expression and evolution. Our data suggest that RNAi-mediated control of this genetic network by trans-acting RNAs allows rapid epigenetic adaptation by phenotypic variation in combination with long-term genetic adaptation by Darwinian evolution of antigen genes. PMID:25389173

  11. RNA interference in designing transgenic crops.

    Science.gov (United States)

    Ali, Nusrat; Datta, Swapan K; Datta, Karabi

    2010-01-01

    RNA interference (RNAi) is a sequence specific gene silencing mechanism, triggered by the introduction of dsRNA leading to mRNA degradation. It helps in switching on and off the targeted gene, which might have significant impact in developmental biology. Discovery of RNAi represents one of the most promising and rapidly advancing frontiers in plant functional genomics and in crop improvement by plant metabolic engineering and also plays an important role in reduction of allergenicity by silencing specific plant allergens. In plants the RNAi technology has been employed successfully in improvement of several plant species- by increasing their nutritional value, overall quality and by conferring resistance against pathogens and diseases. The review gives an insight to the perspective use of the technology in designing crops with innovation, to bring improvement to crop productivity and quality.

  12. Influence of Bxpel1 Gene Silencing by dsRNA Interference on the Development and Pathogenicity of the Pine Wood Nematode, Bursaphelenchus xylophilus

    Science.gov (United States)

    Qiu, Xiu-Wen; Wu, Xiao-Qin; Huang, Lin; Ye, Jian-Ren

    2016-01-01

    As the causal agent of pine wilt disease (PWD), the pine wood nematode (PWN), Bursaphelenchus xylophilus, causes huge economic losses by devastating pine forests worldwide. The pectate lyase gene is essential for successful invasion of their host plants by plant-parasitic nematodes. To demonstrate the role of pectate lyase gene in the PWD process, RNA interference (RNAi) is used to analyze the function of the pectate lyase 1 gene in B. xylophilus (Bxpel1). The efficiency of RNAi was detected by real-time PCR. The result demonstrated that the quantity of B. xylophilus propagated with control solution treatment was 62 times greater than that soaking in double-stranded RNA (dsRNA) after B. xylophilus inoculation in Botrytis cinerea for the first generation (F1). The number of B. xylophilus soaking in control solution was doubled compared to that soaking in Bxpel1 dsRNA four days after inoculation in Pinus thunbergii. The quantity of B. xylophilus was reduced significantly (p < 0.001) after treatment with dsRNAi compared with that using a control solution treatment. Bxpel1 dsRNAi reduced the migration speed and reproduction of B. xylophilus in pine trees. The pathogenicity to P. thunbergii seedling of B. xylophilus was weaker after soaking in dsRNA solution compared with that after soaking in the control solution. Our results suggest that Bxpel1 gene is a significant pathogenic factor in the PWD process and this basic information may facilitate a better understanding of the molecular mechanism of PWD. PMID:26797602

  13. Thermodynamic control of small RNA-mediated gene silencing

    Directory of Open Access Journals (Sweden)

    Kumiko eUi-Tei

    2012-06-01

    Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.

  14. Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.

    Science.gov (United States)

    Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H

    2016-06-17

    In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.

  15. Diverging affinity of tospovirus RNA silencing suppressor proteins, NSs, for various RNA duplex molecules.

    Science.gov (United States)

    Schnettler, Esther; Hemmes, Hans; Huismann, Rik; Goldbach, Rob; Prins, Marcel; Kormelink, Richard

    2010-11-01

    The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs proteins analyzed exhibited affinity to small double-stranded RNA molecules, i.e., small interfering RNAs (siRNAs) and micro-RNA (miRNA)/miRNA* duplexes. Interestingly, the NSs proteins from tomato spotted wilt virus (TSWV), impatiens necrotic spot virus (INSV), and groundnut ringspot virus (GRSV) also showed affinity to long double-stranded RNA (dsRNA), whereas tomato yellow ring virus (TYRV) NSs did not. The TSWV NSs protein was shown to be capable of inhibiting Dicer-mediated cleavage of long dsRNA in vitro. In addition, it suppressed the accumulation of green fluorescent protein (GFP)-specific siRNAs during coinfiltration with an inverted-repeat-GFP RNA construct in Nicotiana benthamiana. In vivo interference of TSWV NSs in the miRNA pathway was shown by suppression of an enhanced GFP (eGFP) miRNA sensor construct. The ability to stabilize miRNA/miRNA* by different tospovirus NSs proteins in vivo was demonstrated by increased accumulation and detection of both miRNA171c and miRNA171c* in tospovirus-infected N. benthamiana. All together, these data suggest that tospoviruses interfere in the RNA silencing pathway by sequestering siRNA and miRNA/miRNA* molecules before they are uploaded into their respective RNA-induced silencing complexes. The observed affinity to long dsRNA for only a subset of the tospoviruses studied is discussed in light of evolutional divergence and their ancestral relation to the animal-infecting members of the Bunyaviridae.

  16. Small RNA-Mediated Epigenetic Myostatin Silencing

    Directory of Open Access Journals (Sweden)

    Thomas C Roberts

    2012-01-01

    Full Text Available Myostatin (Mstn is a secreted growth factor that negatively regulates muscle mass and is therefore a potential pharmacological target for the treatment of muscle wasting disorders such as Duchenne muscular dystrophy. Here we describe a novel Mstn blockade approach in which small interfering RNAs (siRNAs complementary to a promoter-associated transcript induce transcriptional gene silencing (TGS in two differentiated mouse muscle cell lines. Silencing is sensitive to treatment with the histone deacetylase inhibitor trichostatin A, and the silent state chromatin mark H3K9me2 is enriched at the Mstn promoter following siRNA transfection, suggesting epigenetic remodeling underlies the silencing effect. These observations suggest that long-term epigenetic silencing may be feasible for Mstn and that TGS is a promising novel therapeutic strategy for the treatment of muscle wasting disorders.

  17. Alfalfa dwarf cytorhabdovirus P protein is a local and systemic RNA silencing supressor which inhibits programmed RISC activity and prevents transitive amplification of RNA silencing.

    Science.gov (United States)

    Bejerman, Nicolás; Mann, Krin S; Dietzgen, Ralf G

    2016-09-15

    Plants employ RNA silencing as an innate defense mechanism against viruses. As a counter-defense, plant viruses have evolved to express RNA silencing suppressor proteins (RSS), which target one or more steps of the silencing pathway. In this study, we show that the phosphoprotein (P) encoded by the negative-sense RNA virus alfalfa dwarf virus (ADV), a species of the genus Cytorhabdovirus, family Rhabdoviridae, is a suppressor of RNA silencing. ADV P has a relatively weak local RSS activity, and does not prevent siRNA accumulation. On the other hand, ADV P strongly suppresses systemic RNA silencing, but does not interfere with the short-distance spread of silencing, which is consistent with its lack of inhibition of siRNA accumulation. The mechanism of suppression appears to involve ADV P binding to RNA-induced silencing complex proteins AGO1 and AGO4 as shown in protein-protein interaction assays when ectopically expressed. In planta, we demonstrate that ADV P likely functions by inhibiting miRNA-guided AGO1 cleavage and prevents transitive amplification by repressing the production of secondary siRNAs. As recently described for lettuce necrotic yellows cytorhabdovirus P, but in contrast to other viral RSS known to disrupt AGO activity, ADV P sequence does not contain any recognizable GW/WG or F-box motifs, which suggests that cytorhabdovirus P proteins may use alternative motifs to bind to AGO proteins. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

  18. Identification and characterization of two RNA silencing suppressors encoded by ophioviruses

    NARCIS (Netherlands)

    Robles Luna, Gabriel; Reyes, Carina A.; Peña, Eduardo J.; Ocolotobiche, Eliana; Baeza, Cecilia; Borniego, Maria Belén; Kormelink, Richard; García, María Laura

    2017-01-01

    Citrus psorosis virus and Mirafiori lettuce big-vein virus are two members of the genus Ophiovirus, family Ophioviridae. So far, how these viruses can interfere in the antiviral RNA silencing pathway is not known. In this study, using a local GFP silencing assay on Nicotiana benthamiana, the

  19. ABCE1 is a highly conserved RNA silencing suppressor.

    Directory of Open Access Journals (Sweden)

    Kairi Kärblane

    Full Text Available ATP-binding cassette sub-family E member 1 (ABCE1 is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference.

  20. Suppressors of RNA silencing encoded by tomato leaf curl ...

    Indian Academy of Sciences (India)

    2013-01-06

    Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.

  1. Induction of RNA interference in dendritic cells.

    Science.gov (United States)

    Li, Mu; Qian, Hua; Ichim, Thomas E; Ge, Wei-Wen; Popov, Igor A; Rycerz, Katarzyna; Neu, John; White, David; Zhong, Robert; Min, Wei-Ping

    2004-01-01

    Dendritic cells (DC) reside at the center of the immunological universe, possessing the ability both to stimulate and inhibit various types of responses. Tolerogenic/regulatory DC with therapeutic properties can be generated through various means of manipulations in vitro and in vivo. Here we describe several attractive strategies for manipulation of DC using the novel technique of RNA interference (RNAi). Additionally, we overview some of our data regarding yet undescribed characteristics of RNAi in DC such as specific transfection strategies, persistence of gene silencing, and multi-gene silencing. The advantages of using RNAi for DC genetic manipulation gives rise to the promise of generating tailor-made DC that can be used effectively to treat a variety of immunologically mediated diseases.

  2. MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts

    Science.gov (United States)

    Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng

    2014-01-01

    Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645

  3. MicroRNA-mediated myostatin silencing in caprine fetal fibroblasts.

    Directory of Open Access Journals (Sweden)

    Bushuai Zhong

    Full Text Available Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi mediated by microRNAs (miRNAs is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN response genes, such as interferon beta (IFN-β and 2'-5'-oligoadenylate synthetase 2 (OAS2, were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats.

  4. Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

    Science.gov (United States)

    Travella, Silvia; Keller, Beat

    Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

  5. Intervention of radiation‐induced skin fibrosis by RNA interference

    DEFF Research Database (Denmark)

    Nawroth, Isabel

    ‐α (TNFα) production by macrophages might promote RIF. RNA interference (RNAi) is an evolutionary conserved gene‐silencing mechanism capable of degrading mRNA containing a homologous sequence to an exogenously introduced double stranded small interfering RNA (siRNA). These siRNAs can induce RNAi...... and inhibit the expression of target proteins. Therefore, siRNAs are considered as promising therapeutics for treatment of various diseases including genetic and viral diseases, and cancer. In this study, the therapeutic potential of RNA interference was investigated as an intervention strategy for radiation......‐induced skin fibrosis. Chitosan‐based nanoparticles (or polyplexes) formed by self‐assembly with siRNA were applied to overcome extracellular and intracellular barriers and deliver siRNA site‐specific. In this work we show that intraperitoneal administration of chitosan/DsiRNA nanoparticles targeting TNFα...

  6. Conifers have a unique small RNA silencing signature

    OpenAIRE

    Dolgosheina, Elena V.; Morin, Ryan D.; Aksay, Gozde; Sahinalp, S. Cenk; Magrini, Vincent; Mardis, Elaine R.; Mattsson, Jim; Unrau, Peter J.

    2008-01-01

    Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an u...

  7. Small Molecule Modifiers of the microRNA and RNA Interference Pathway

    OpenAIRE

    Deiters, Alexander

    2009-01-01

    Recently, the RNA interference (RNAi) pathway has become the target of small molecule inhibitors and activators. RNAi has been well established as a research tool in the sequence-specific silencing of genes in eukaryotic cells and organisms by using exogenous, small, double-stranded RNA molecules of approximately 20 nucleotides. Moreover, a recently discovered post-transcriptional gene regulatory mechanism employs microRNAs (miRNAs), a class of endogenously expressed small RNA molecules, whic...

  8. The RNA silencing pathway: the bits and pieces that matter.

    Directory of Open Access Journals (Sweden)

    2005-07-01

    Full Text Available Cellular pathways are generally proposed on the basis of available experimental knowledge. The proposed pathways, however, may be inadequate to describe the phenomena they are supposed to explain. For instance, by means of concise mathematical models we are able to reveal shortcomings in the current description of the pathway of RNA silencing. The silencing pathway operates by cleaving siRNAs from dsRNA. siRNAs can associate with RISC, leading to the degradation of the target mRNA. We propose and analyze a few small extensions to the pathway: a siRNA degrading RNase, primed amplification of aberrant RNA pieces, and cooperation between aberrant RNA to trigger amplification. These extensions allow for a consistent explanation for various types of silencing phenomena, such as virus induced silencing, transgene and transposon induced silencing, and avoidance of self-reactivity, as well as for differences found between species groups.

  9. Antiviral RNA silencing viral counter defense in plants

    NARCIS (Netherlands)

    Bucher, E.C.

    2006-01-01

    The research described in this thesis centres around the mechanism of RNA silencing in relation to virus-host interaction, an area of increasing importance. It shows how this recently disclosed mechanism can be used to produce virus-resistant plants. Based on the activity of the RNA silencing

  10. The Ebola virus VP35 protein is a suppressor of RNA silencing

    NARCIS (Netherlands)

    Haasnoot, J.; Vries, de W.; Geutjes, E.J.; Prins, M.W.; Haan, de P.; Berkhout, B.

    2007-01-01

    RNA silencing or interference (RNAi) is a gene regulation mechanism in eukaryotes that controls cell differentiation and developmental processes via expression of microRNAs. RNAi also serves as an innate antiviral defence response in plants, nematodes, and insects. This antiviral response is

  11. Supervised learning classification models for prediction of plant virus encoded RNA silencing suppressors.

    Directory of Open Access Journals (Sweden)

    Zeenia Jagga

    Full Text Available Viral encoded RNA silencing suppressor proteins interfere with the host RNA silencing machinery, facilitating viral infection by evading host immunity. In plant hosts, the viral proteins have several basic science implications and biotechnology applications. However in silico identification of these proteins is limited by their high sequence diversity. In this study we developed supervised learning based classification models for plant viral RNA silencing suppressor proteins in plant viruses. We developed four classifiers based on supervised learning algorithms: J48, Random Forest, LibSVM and Naïve Bayes algorithms, with enriched model learning by correlation based feature selection. Structural and physicochemical features calculated for experimentally verified primary protein sequences were used to train the classifiers. The training features include amino acid composition; auto correlation coefficients; composition, transition, and distribution of various physicochemical properties; and pseudo amino acid composition. Performance analysis of predictive models based on 10 fold cross-validation and independent data testing revealed that the Random Forest based model was the best and achieved 86.11% overall accuracy and 86.22% balanced accuracy with a remarkably high area under the Receivers Operating Characteristic curve of 0.95 to predict viral RNA silencing suppressor proteins. The prediction models for plant viral RNA silencing suppressors can potentially aid identification of novel viral RNA silencing suppressors, which will provide valuable insights into the mechanism of RNA silencing and could be further explored as potential targets for designing novel antiviral therapeutics. Also, the key subset of identified optimal features may help in determining compositional patterns in the viral proteins which are important determinants for RNA silencing suppressor activities. The best prediction model developed in the study is available as a

  12. Drosophila PAF1 Modulates PIWI/piRNA Silencing Capacity.

    Science.gov (United States)

    Clark, Josef P; Rahman, Reazur; Yang, Nachen; Yang, Linda H; Lau, Nelson C

    2017-09-11

    To test the directness of factors in initiating PIWI-directed gene silencing, we employed a Piwi-interacting RNA (piRNA)-targeted reporter assay in Drosophila ovary somatic sheet (OSS) cells [1]. This assay confirmed direct silencing roles for piRNA biogenesis factors and PIWI-associated factors [2-12] but suggested that chromatin-modifying proteins may act downstream of the initial silencing event. Our data also revealed that RNA-polymerase-II-associated proteins like PAF1 and RTF1 antagonize PIWI-directed silencing. PAF1 knockdown enhances PIWI silencing of reporters when piRNAs target the transcript region proximal to the promoter. Loss of PAF1 suppresses endogenous transposable element (TE) transcript maturation, whereas a subset of gene transcripts and long-non-coding RNAs adjacent to TE insertions are affected by PAF1 knockdown in a similar fashion to piRNA-targeted reporters. Additionally, transcription activation at specific TEs and TE-adjacent loci during PIWI knockdown is suppressed when PIWI and PAF1 levels are both reduced. Our study suggests a mechanistic conservation between fission yeast PAF1 repressing AGO1/small interfering RNA (siRNA)-directed silencing [13, 14] and Drosophila PAF1 opposing PIWI/piRNA-directed silencing. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Locus-specific ribosomal RNA gene silencing in nucleolar dominance.

    Directory of Open Access Journals (Sweden)

    Michelle S Lewis

    2007-08-01

    Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.

  14. siRNA-mediated RNA interference in precision-cut tissue slices prepared from mouse lung and kidney

    NARCIS (Netherlands)

    Ruigrok, Mitchel J. R.; Maggan, Nalinie; Willaert, Delphine; Frijlink, Henderik W.; Melgert, Barbro N.; Olinga, Peter; Hinrichs, Wouter L. J.

    Small interfering RNA (siRNA)-mediated RNAi interference (RNAi) is a powerful post-transcriptional gene silencing mechanism which can be used to study the function of genes in vitro (cell cultures) and in vivo (animal models). However, there is a translational gap between these models. Hence, there

  15. Telomeric trans-silencing: an epigenetic repression combining RNA silencing and heterochromatin formation.

    Directory of Open Access Journals (Sweden)

    Thibaut Josse

    2007-09-01

    Full Text Available The study of P-element repression in Drosophila melanogaster led to the discovery of the telomeric Trans-Silencing Effect (TSE, a repression mechanism by which a transposon or a transgene inserted in subtelomeric heterochromatin (Telomeric Associated Sequence or TAS has the capacity to repress in trans in the female germline, a homologous transposon, or transgene located in euchromatin. TSE shows variegation among egg chambers in ovaries when silencing is incomplete. Here, we report that TSE displays an epigenetic transmission through meiosis, which involves an extrachromosomal maternally transmitted factor. We show that this silencing is highly sensitive to mutations affecting both heterochromatin formation (Su(var205 encoding Heterochromatin Protein 1 and Su(var3-7 and the repeat-associated small interfering RNA (or rasiRNA silencing pathway (aubergine, homeless, armitage, and piwi. In contrast, TSE is not sensitive to mutations affecting r2d2, which is involved in the small interfering RNA (or siRNA silencing pathway, nor is it sensitive to a mutation in loquacious, which is involved in the micro RNA (or miRNA silencing pathway. These results, taken together with the recent discovery of TAS homologous small RNAs associated to PIWI proteins, support the proposition that TSE involves a repeat-associated small interfering RNA pathway linked to heterochromatin formation, which was co-opted by the P element to establish repression of its own transposition after its recent invasion of the D. melanogaster genome. Therefore, the study of TSE provides insight into the genetic properties of a germline-specific small RNA silencing pathway.

  16. Branched RNA: A New Architecture for RNA Interference

    Directory of Open Access Journals (Sweden)

    Anna Aviñó

    2011-01-01

    Full Text Available Branched RNAs with two and four strands were synthesized. These structures were used to obtain branched siRNA. The branched siRNA duplexes had similar inhibitory capacity as those of unmodified siRNA duplexes, as deduced from gene silencing experiments of the TNF-α protein. Branched RNAs are considered novel structures for siRNA technology, and they provide an innovative tool for specific gene inhibition. As the method described here is compatible with most RNA modifications described to date, these compounds may be further functionalized to obtain more potent siRNA derivatives and can be attached to suitable delivery systems.

  17. Hydrophobically Modified siRNAs Silence Huntingtin mRNA in Primary Neurons and Mouse Brain

    Directory of Open Access Journals (Sweden)

    Julia F Alterman

    2015-01-01

    Full Text Available Applications of RNA interference for neuroscience research have been limited by a lack of simple and efficient methods to deliver oligonucleotides to primary neurons in culture and to the brain. Here, we show that primary neurons rapidly internalize hydrophobically modified siRNAs (hsiRNAs added directly to the culture medium without lipid formulation. We identify functional hsiRNAs targeting the mRNA of huntingtin, the mutation of which is responsible for Huntington's disease, and show that direct uptake in neurons induces potent and specific silencing in vitro. Moreover, a single injection of unformulated hsiRNA into mouse brain silences Htt mRNA with minimal neuronal toxicity. Thus, hsiRNAs embody a class of therapeutic oligonucleotides that enable simple and straightforward functional studies of genes involved in neuronal biology and neurodegenerative disorders in a native biological context.

  18. RNA interference: learning gene knock-down from cell physiology

    Directory of Open Access Journals (Sweden)

    Provenzano Maurizio

    2004-11-01

    Full Text Available Summary Over the past decade RNA interference (RNAi has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design.

  19. RNA interference: learning gene knock-down from cell physiology

    Science.gov (United States)

    Mocellin, Simone; Provenzano, Maurizio

    2004-01-01

    Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080

  20. A viral suppressor of RNA silencing inhibits ARGONAUTE 1 function by precluding target RNA binding to pre-assembled RISC.

    Science.gov (United States)

    Kenesi, Erzsébet; Carbonell, Alberto; Lózsa, Rita; Vértessy, Beáta; Lakatos, Lóránt

    2017-07-27

    In most eukaryotes, RNA silencing is an adaptive immune system regulating key biological processes including antiviral defense. To evade this response, viruses of plants, worms and insects have evolved viral suppressors of RNA silencing proteins (VSRs). Various VSRs, such as P1 from Sweet potato mild mottle virus (SPMMV), inhibit the activity of RNA-induced silencing complexes (RISCs) including an ARGONAUTE (AGO) protein loaded with a small RNA. However, the specific mechanisms explaining this class of inhibition are unknown. Here, we show that SPMMV P1 interacts with AGO1 and AGO2 from Arabidopsis thaliana, but solely interferes with AGO1 function. Moreover, a mutational analysis of a newly identified zinc finger domain in P1 revealed that this domain could represent an effector domain as it is required for P1 suppressor activity but not for AGO1 binding. Finally, a comparative analysis of the target RNA binding capacity of AGO1 in the presence of wild-type or suppressor-defective P1 forms revealed that P1 blocks target RNA binding to AGO1. Our results describe the negative regulation of RISC, the small RNA containing molecular machine. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Anti-viral RNA silencing: do we look like plants ?

    Directory of Open Access Journals (Sweden)

    Lecellier Charles-Henri

    2006-01-01

    Full Text Available Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to be similarly conserved from plants to insects, even in worms, RNA silencing does influence the replication of mammalian viruses but in a particular mode: micro(miRNAs, endogenous small RNAs naturally implicated in translational control, rather than virus-derived small interfering (siRNAs like in other organisms, are involved. In fact, these recent studies even suggest that RNA silencing may be beneficial for viral replication. Accordingly, several large DNA mammalian viruses have been shown to encode their own miRNAs. Here, we summarize the seminal studies that have implicated RNA silencing in viral infection and compare the different eukaryotic responses.

  2. RNA Interference in Moths: Mechanisms, Applications, and Progress

    Directory of Open Access Journals (Sweden)

    Jin Xu

    2016-10-01

    Full Text Available The vast majority of lepidopterans, about 90%, are moths. Some moths, particularly their caterpillars, are major agricultural and forestry pests in many parts of the world. However, some other members of moths, such as the silkworm Bombyx mori, are famous for their economic value. Fire et al. in 1998 initially found that exogenous double-stranded RNA (dsRNA can silence the homolog endogenous mRNA in organisms, which is called RNA interference (RNAi. Soon after, the RNAi technique proved to be very promising not only in gene function determination but also in pest control. However, later studies demonstrate that performing RNAi in moths is not as straightforward as shown in other insect taxa. Nevertheless, since 2007, especially after 2010, an increasing number of reports have been published that describe successful RNAi experiments in different moth species either on gene function analysis or on pest management exploration. So far, more than 100 peer-reviewed papers have reported successful RNAi experiments in moths, covering 10 families and 25 species. By using classic and novel dsRNA delivery methods, these studies effectively silence the expression of various target genes and determine their function in larval development, reproduction, immunology, resistance against chemicals, and other biological processes. In addition, a number of laboratory and field trials have demonstrated that RNAi is also a potential strategy for moth pest management. In this review, therefore, we summarize and discuss the mechanisms and applications of the RNAi technique in moths by focusing on recent progresses.

  3. RNA Interference and its therapeutic applications

    Directory of Open Access Journals (Sweden)

    Srinivasa Rao T

    2011-10-01

    Full Text Available RNAi is a potent method, requiring only a few molecules of dsRNA per cell to silence the expression. Long molecules of double stranded RNA (dsRNA trigger the process. The dsRNA comes from virus and transposon activity in natural RNAi process, while it can be injected in the cells in experimental processes. The strand of the dsRNA that is identical in sequence to a region in target mRNA molecule is called the sense strand, and the other strand which is complimentary is termed the antisense strand. An enzyme complex called DICER thought to be similar to RNAase III then recognizes dsRNA, and cuts it into roughly 22- nucleotide long fragments. These fragments termed siRNAs for “small interfering RNAs” remain in double stranded duplexes with very short 3' overhangs. However, only one of the two strands, known as the guide strand or antisense strand binds the argonaute protein of RNA-induced silencing complex (RISC and target the complementary mRNA resulting gene silencing. The other anti-guide strand or passenger strand is degraded as a RISC substrate during the process of RISC activation. This form of RNAi is termed as post transcriptional gene silencing (PTGS; other forms are also thought to operate at the genomic or transcriptional level in some organisms. In mammals dsRNA longer than 30 base pairs induces a nonspecific antiviral response. This so-called interferon response results in a nonspecific arrest in translation and induction of apoptosis. This cascade induces a global non-specific suppression of translation, which in turn triggers apoptosis. Interestingly, dsRNAs less than 30 nt in length do not activate the antiviral response and specifically switched off genes in human cells without initiating the acute phase response. Thus these siRNAs are suitable for gene target validation and therapeutic applications in many species, including humans. [Vet. World 2011; 4(5.000: 225-229

  4. Using RNA Interference to Study Protein Function

    OpenAIRE

    Curtis, Carol D.; Nardulli, Ann M.

    2009-01-01

    RNA interference can be extremely useful in determining the function of an endogenously-expressed protein in its normal cellular environment. In this chapter, we describe a method that uses small interfering RNA (siRNA) to knock down mRNA and protein expression in cultured cells so that the effect of a putative regulatory protein on gene expression can be delineated. Methods of assessing the effectiveness of the siRNA procedure using real time quantitative PCR and Western analysis are also in...

  5. Strategies for Improving siRNA-Induced Gene Silencing Efficiency.

    Science.gov (United States)

    Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad

    2017-12-01

    Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.

  6. Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins

    Directory of Open Access Journals (Sweden)

    Marcio Hedil

    2016-07-01

    Full Text Available The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

  7. Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins.

    Science.gov (United States)

    Hedil, Marcio; Kormelink, Richard

    2016-07-23

    The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.

  8. LNA-antisense rivals siRNA for gene silencing

    DEFF Research Database (Denmark)

    Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan

    2004-01-01

    Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been a...

  9. Domain motions of Argonaute, the catalytic engine of RNA interference

    Directory of Open Access Journals (Sweden)

    Wall Michael E

    2007-11-01

    Full Text Available Abstract Background The Argonaute protein is the core component of the RNA-induced silencing complex, playing the central role of cleaving the mRNA target. Visual inspection of static crystal structures already has enabled researchers to suggest conformational changes of Argonaute that might occur during RNA interference. We have taken the next step by performing an all-atom normal mode analysis of the Pyrococcus furiosus and Aquifex aeolicus Argonaute crystal structures, allowing us to quantitatively assess the feasibility of these conformational changes. To perform the analysis, we begin with the energy-minimized X-ray structures. Normal modes are then calculated using an all-atom molecular mechanics force field. Results The analysis reveals low-frequency vibrations that facilitate the accommodation of RNA duplexes – an essential step in target recognition. The Pyrococcus furiosus and Aquifex aeolicus Argonaute proteins both exhibit low-frequency torsion and hinge motions; however, differences in the overall architecture of the proteins cause the detailed dynamics to be significantly different. Conclusion Overall, low-frequency vibrations of Argonaute are consistent with mechanisms within the current reaction cycle model for RNA interference.

  10. Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

    Directory of Open Access Journals (Sweden)

    Jiangyu Wu

    2013-01-01

    Full Text Available RNA interference (RNAi was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc. of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system.

  11. Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

    Science.gov (United States)

    Huang, Weizhe; He, Ziying

    2013-01-01

    RNA interference (RNAi) was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA) are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc.) of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system. PMID:24288498

  12. An RNA-seq transcriptome analysis of histone modifiers and RNA silencing genes in soybean during floral initiation process.

    Directory of Open Access Journals (Sweden)

    Lim Chee Liew

    Full Text Available Epigenetics has been recognised to play vital roles in many plant developmental processes, including floral initiation through the epigenetic regulation of gene expression. The histone modifying proteins that mediate these modifications involve the SET domain-containing histone methyltransferases, JmjC domain-containing demethylase, acetylases and deacetylases. In addition, RNA interference (RNAi-associated genes are also involved in epigenetic regulation via RNA-directed DNA methylation and post-transcriptional gene silencing. Soybean, a major crop legume, requires a short day to induce flowering. How histone modifications regulate the plant response to external cues that initiate flowering is still largely unknown. Here, we used RNA-seq to address the dynamics of transcripts that are potentially involved in the epigenetic programming and RNAi mediated gene silencing during the floral initiation of soybean. Soybean is a paleopolyploid that has been subjected to at least two rounds of whole genome duplication events. We report that the expanded genomic repertoire of histone modifiers and RNA silencing genes in soybean includes 14 histone acetyltransferases, 24 histone deacetylases, 47 histone methyltransferases, 15 protein arginine methyltransferases, 24 JmjC domain-containing demethylases and 47 RNAi-associated genes. To investigate the role of these histone modifiers and RNA silencing genes during floral initiation, we compared the transcriptional dynamics of the leaf and shoot apical meristem at different time points after a short-day treatment. Our data reveal that the extensive activation of genes that are usually involved in the epigenetic programming and RNAi gene silencing in the soybean shoot apical meristem are reprogrammed for floral development following an exposure to inductive conditions.

  13. Conifers have a unique small RNA silencing signature.

    Science.gov (United States)

    Dolgosheina, Elena V; Morin, Ryan D; Aksay, Gozde; Sahinalp, S Cenk; Magrini, Vincent; Mardis, Elaine R; Mattsson, Jim; Unrau, Peter J

    2008-08-01

    Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an unexpected phylogenetic difference in the size distribution of small RNAs among the vascular plants. By extracting total RNA from freshly growing shoot tissue, we conducted a survey of small RNAs in 24 vascular plant species. We find that conifers, which radiated from the other seed-bearing plants approximately 260 million years ago, fail to produce significant amounts of 24-nucleotide (nt) RNAs that are known to guide DNA methylation and heterochromatin formation in angiosperms. Instead, they synthesize a diverse population of small RNAs that are exactly 21-nt long. This finding was confirmed by high-throughput sequencing of the small RNA sequences from a conifer, Pinus contorta. A conifer EST search revealed the presence of a novel Dicer-like (DCL) family, which may be responsible for the observed change in small RNA expression. No evidence for DCL3, an enzyme that matures 24-nt RNAs in angiosperms, was found. We hypothesize that the diverse class of 21-nt RNAs found in conifers may help to maintain organization of their unusually large genomes.

  14. RNA Interference in Insect Vectors for Plant Viruses

    Directory of Open Access Journals (Sweden)

    Surapathrudu Kanakala

    2016-12-01

    Full Text Available Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists.

  15. The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

    International Nuclear Information System (INIS)

    Fusaro, Adriana F.; Correa, Regis L.; Nakasugi, Kenlee; Jackson, Craig; Kawchuk, Lawrence; Vaslin, Maite F.S.; Waterhouse, Peter M.

    2012-01-01

    The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0 PE , in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0 PE has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0 PE destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

  16. Impact of target mRNA structure on siRNA silencing efficiency: A large-scale study.

    Science.gov (United States)

    Gredell, Joseph A; Berger, Angela K; Walton, S Patrick

    2008-07-01

    The selection of active siRNAs is generally based on identifying siRNAs with certain sequence and structural properties. However, the efficiency of RNA interference has also been shown to depend on the structure of the target mRNA, primarily through studies using exogenous transcripts with well-defined secondary structures in the vicinity of the target sequence. While these studies provide a means for examining the impact of target sequence and structure independently, the predicted secondary structures for these transcripts are often not reflective of structures that form in full-length, native mRNAs where interactions can occur between relatively remote segments of the mRNAs. Here, using a combination of experimental results and analysis of a large dataset, we demonstrate that the accessibility of certain local target structures on the mRNA is an important determinant in the gene silencing ability of siRNAs. siRNAs targeting the enhanced green fluorescent protein were chosen using a minimal siRNA selection algorithm followed by classification based on the predicted minimum free energy structures of the target transcripts. Transfection into HeLa and HepG2 cells revealed that siRNAs targeting regions of the mRNA predicted to have unpaired 5'- and 3'-ends resulted in greater gene silencing than regions predicted to have other types of secondary structure. These results were confirmed by analysis of gene silencing data from previously published siRNAs, which showed that mRNA target regions unpaired at either the 5'-end or 3'-end were silenced, on average, approximately 10% more strongly than target regions unpaired in the center or primarily paired throughout. We found this effect to be independent of the structure of the siRNA guide strand. Taken together, these results suggest minimal requirements for nucleation of hybridization between the siRNA guide strand and mRNA and that both mRNA and guide strand structure should be considered when choosing candidate si

  17. RNA interference and Register Machines (extended abstract

    Directory of Open Access Journals (Sweden)

    Masahiro Hamano

    2012-11-01

    Full Text Available RNA interference (RNAi is a mechanism whereby small RNAs (siRNAs directly control gene expression without assistance from proteins. This mechanism consists of interactions between RNAs and small RNAs both of which may be single or double stranded. The target of the mechanism is mRNA to be degraded or aberrated, while the initiator is double stranded RNA (dsRNA to be cleaved into siRNAs. Observing the digital nature of RNAi, we represent RNAi as a Minsky register machine such that (i The two registers hold single and double stranded RNAs respectively, and (ii Machine's instructions are interpreted by interactions of enzyme (Dicer, siRNA (with RISC com- plex and polymerization (RdRp to the appropriate registers. Interpreting RNAi as a computational structure, we can investigate the computational meaning of RNAi, especially its complexity. Initially, the machine is configured as a Chemical Ground Form (CGF, which generates incorrect jumps. To remedy this problem, the system is remodeled as recursive RNAi, in which siRNA targets not only mRNA but also the machine instructional analogues of Dicer and RISC. Finally, probabilistic termination is investigated in the recursive RNAi system.

  18. Steric restrictions of RISC in RNA interference identified with size-expanded RNA nucleobases.

    Science.gov (United States)

    Hernández, Armando R; Peterson, Larryn W; Kool, Eric T

    2012-08-17

    Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC), the key protein complex of RNA interference (RNAi), is of great importance to the development of siRNAs with improved biological and potentially therapeutic function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to -5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3'-end increased activity over that of wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation.

  19. Antiviral RNA silencing initiated in the absence of RDE-4, a double-stranded RNA binding protein, in Caenorhabditis elegans.

    Science.gov (United States)

    Guo, Xunyang; Zhang, Rui; Wang, Jeffrey; Lu, Rui

    2013-10-01

    Small interfering RNAs (siRNAs) processed from double-stranded RNA (dsRNA) of virus origins mediate potent antiviral defense through a process referred to as RNA interference (RNAi) or RNA silencing in diverse organisms. In the simple invertebrate Caenorhabditis elegans, the RNAi process is initiated by a single Dicer, which partners with the dsRNA binding protein RDE-4 to process dsRNA into viral siRNAs (viRNAs). Notably, in C. elegans this RNA-directed viral immunity (RDVI) also requires a number of worm-specific genes for its full antiviral potential. One such gene is rsd-2 (RNAi spreading defective 2), which was implicated in RDVI in our previous studies. In the current study, we first established an antiviral role by showing that rsd-2 null mutants permitted higher levels of viral RNA accumulation, and that this enhanced viral susceptibility was reversed by ectopic expression of RSD-2. We then examined the relationship of rsd-2 with other known components of RNAi pathways and established that rsd-2 functions in a novel pathway that is independent of rde-4 but likely requires the RNA-dependent RNA polymerase RRF-1, suggesting a critical role for RSD-2 in secondary viRNA biogenesis, likely through coordinated action with RRF-1. Together, these results suggest that RDVI in the single-Dicer organism C. elegans depends on the collective actions of both RDE-4-dependent and RDE-4-independent mechanisms to produce RNAi-inducing viRNAs. Our study reveals, for the first time, a novel siRNA-producing mechanism in C. elegans that bypasses the need for a dsRNA-binding protein.

  20. The Ebola virus VP35 protein is a suppressor of RNA silencing.

    Directory of Open Access Journals (Sweden)

    Joost Haasnoot

    2007-06-01

    Full Text Available RNA silencing or interference (RNAi is a gene regulation mechanism in eukaryotes that controls cell differentiation and developmental processes via expression of microRNAs. RNAi also serves as an innate antiviral defence response in plants, nematodes, and insects. This antiviral response is triggered by virus-specific double-stranded RNA molecules (dsRNAs that are produced during infection. To overcome antiviral RNAi responses, many plant and insect viruses encode RNA silencing suppressors (RSSs that enable them to replicate at higher titers. Recently, several human viruses were shown to encode RSSs, suggesting that RNAi also serves as an innate defence response in mammals. Here, we demonstrate that the Ebola virus VP35 protein is a suppressor of RNAi in mammalian cells and that its RSS activity is functionally equivalent to that of the HIV-1 Tat protein. We show that VP35 can replace HIV-1 Tat and thereby support the replication of a Tat-minus HIV-1 variant. The VP35 dsRNA-binding domain is required for this RSS activity. Vaccinia virus E3L protein and influenza A virus NS1 protein are also capable of replacing the HIV-1 Tat RSS function. These findings support the hypothesis that RNAi is part of the innate antiviral response in mammalian cells. Moreover, the results indicate that RSSs play a critical role in mammalian virus replication.

  1. The dynamics and efficacy of antiviral RNA silencing: A model study

    Directory of Open Access Journals (Sweden)

    Hogeweg Paulien

    2008-03-01

    Full Text Available Abstract Background Mathematical modeling is important to provide insight in the complicated pathway of RNA silencing. RNA silencing is an RNA based mechanism that is widely used by eukaryotes to fight viruses, and to control gene expression. Results We here present the first mathematical model that combines viral growth with RNA silencing. The model involves a plus-strand RNA virus that replicates through a double-strand RNA intermediate. The model of the RNA silencing pathway consists of cleavage of viral RNA into siRNA by Dicer, target cleavage of viral RNA via the RISC complex, and a secondary response. We found that, depending on the strength of the silencing response, different viral growth patterns can occur. Silencing can decrease viral growth, cause oscillations, or clear the virus completely. Our model can explain various observed phenomena, even when they seem contradictory at first: the diverse responses to the removal of RNA dependent RNA polymerase; different viral growth curves; and the great diversity in observed siRNA ratios. Conclusion The model presented here is an important step in the understanding of the natural functioning of RNA silencing in viral infections.

  2. The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

    Directory of Open Access Journals (Sweden)

    Adrian Valli

    Full Text Available RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

  3. The VP3 factor from viruses of Birnaviridae family suppresses RNA silencing by binding both long and small RNA duplexes.

    Science.gov (United States)

    Valli, Adrian; Busnadiego, Idoia; Maliogka, Varvara; Ferrero, Diego; Castón, José R; Rodríguez, José Francisco; García, Juan Antonio

    2012-01-01

    RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV) displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.

  4. A simple and robust vector-based shRNA expression system used for RNA interference.

    Science.gov (United States)

    Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

    2013-01-01

    RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  5. A simple and robust vector-based shRNA expression system used for RNA interference.

    Directory of Open Access Journals (Sweden)

    Xue-jun Wang

    Full Text Available BACKGROUND: RNA interference (RNAi mediated by small interfering RNAs (siRNAs or short hairpin RNAs (shRNAs has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. RESULTS: In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. CONCLUSION: This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  6. RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops.

    Science.gov (United States)

    Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo

    2016-12-01

    Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.

  7. Diverging affinity of tospovirus RNA silencing suppressor proteins, NSs, for various RNA duplex molecules

    NARCIS (Netherlands)

    Schnettler, E.; Hemmes, J.C.; Huisman, R.; Goldbach, R.W.; Prins, M.W.; Kormelink, R.J.M.

    2010-01-01

    The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs

  8. Effect of silencing of ATM expression by siRNA on radiosensitivity of human lung adenocarcinoma A549 cells

    International Nuclear Information System (INIS)

    Liu Xiaoqun; Qiao Tiankui

    2014-01-01

    Objective: To investigate the effect of silencing of ataxia-telangiectasia mutated (ATM) expression by plasmid-mediated RNA interference on the radiosensitivity of human lung adenocarcinoma A 549 cells. Methods: Eukaryotic expression plasmid containing ATM small interfering RNA (siRNA) (pSilencer2.1-ATM), as well as pSilencer2.1-nonspecific, was constructed.Lung adenocarcinoma A 549 cells were divided into positive group, negative group,and control group to be transfected with pSilencer2.1-ATM, pSilencer2.1-nonspecific, and no plasmid, respectively. The mRNA and protein expression of ATM was measured by RT-PCR and Western blot, respectively. The change in cell radiosensitivity was observed by colony-forming assay. Cell cycle and cell apoptosis were analyzed by flow cytometry. Results: The eukaryotic expression plasmid containing ATM siRNA was successfully constructed. The RT-PCR and Western blot demonstrated that the expression of ATM was down-regulated in the positive group. The sensitization enhancement ratios (D 0 ratios) for the positive group and negative group were 1.50 and 1.01, respectively. The flow cytometry revealed that the proportions of A 549 cells in G 1 and G 2 /M phases were significantly lower in the positive group than in the control group (51.27% vs 61.85%, P = 0.012; 6.34% vs 10.91%, P = 0.008) and that the apoptosis rate was significantly higher in the positive group than in the control group and negative group (49.31% vs 13.58%, P = 0.000; 49.31% vs 13.17%, P = 0.000). Conclusions: Silencing of ATM expression may increase the radiosensitivity of human lung adenocarcinoma A 549 cells, probably by affecting the cell cycle and promoting cell apoptosis. (authors)

  9. Role of RNA interference (RNAi) in the moss Physcomitrella patens

    KAUST Repository

    Arif, Muhammad Asif; Frank, Wolfgang; Khraiwesh, Basel

    2013-01-01

    RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species. 2013 by the authors; licensee MDPI, Basel, Switzerland.

  10. Role of RNA interference (RNAi) in the moss Physcomitrella patens

    KAUST Repository

    Arif, Muhammad Asif

    2013-01-14

    RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species. 2013 by the authors; licensee MDPI, Basel, Switzerland.

  11. RNA silencing is required for Arabidopsis defence against Verticillium wilt disease

    NARCIS (Netherlands)

    Ellendorff, U.; Fradin, E.F.; Jonge, de R.; Thomma, B.P.H.J.

    2009-01-01

    RNA silencing is a conserved mechanism in eukaryotes that plays an important role in various biological processes including regulation of gene expression. RNA silencing also plays a role in genome stability and protects plants against invading nucleic acids such as transgenes and viruses. Recently,

  12. Detection of the argonaute protein Ago2 and microRNAs in the RNA induced silencing complex (RISC) using a monoclonal antibody.

    Science.gov (United States)

    Ikeda, Keigo; Satoh, Minoru; Pauley, Kaleb M; Fritzler, Marvin J; Reeves, Westley H; Chan, Edward K L

    2006-12-20

    MicroRNAs (miRNAs) are short RNA molecules responsible for post-transcriptional gene silencing by the degradation or translational inhibition of their target messenger RNAs (mRNAs). This process of gene silencing, known as RNA interference (RNAi), is mediated by highly conserved Argonaute (Ago) proteins which are the key components of the RNA induced silencing complex (RISC). In humans, Ago2 is responsible for the endonuclease cleavage of targeted mRNA and it interacts with the mRNA-binding protein GW182, which is a marker for cytoplasmic foci referred to as GW bodies (GWBs). We demonstrated that the anti-Ago2 monoclonal antibody 4F9 recognized GWBs in a cell cycle dependent manner and was capable of capturing miRNAs associated with Ago2. Since Ago2 protein is the effector protein of RNAi, anti-Ago2 monoclonal antibody may be useful in capturing functional miRNAs.

  13. An archaeal CRISPR type III-B system exhibiting distinctive RNA targeting features and mediating dual RNA and DNA interference

    DEFF Research Database (Denmark)

    Peng, Wenfang; Feng, Mingxia; Feng, Xu

    2015-01-01

    CRISPR-Cas systems provide a small RNA-based mechanism to defend against invasive genetic elements in archaea and bacteria. To investigate the in vivo mechanism of RNA interference by two type III-B systems (Cmr-α and Cmr-β) in Sulfolobus islandicus, a genetic assay was developed using plasmids...... carrying an artificial mini-CRISPR (AC) locus with a single spacer. After pAC plasmids were introduced into different strains, Northern analyses confirmed that mature crRNAs were produced from the plasmid-borne CRISPR loci, which then guided gene silencing to target gene expression. Spacer mutagenesis....... islandicus Cmr-α mediated transcription-dependent DNA interference, the Cmr-α constitutes the first CRISPR system exhibiting dual targeting of RNA and DNA....

  14. AGO/RISC-mediated antiviral RNA silencing in a plant in vitro system.

    Science.gov (United States)

    Schuck, Jana; Gursinsky, Torsten; Pantaleo, Vitantonio; Burgyán, Jozsef; Behrens, Sven-Erik

    2013-05-01

    AGO/RISC-mediated antiviral RNA silencing, an important component of the plant's immune response against RNA virus infections, was recapitulated in vitro. Cytoplasmic extracts of tobacco protoplasts were applied that supported Tombusvirus RNA replication, as well as the formation of RNA-induced silencing complexes (RISC) that could be functionally reconstituted with various plant ARGONAUTE (AGO) proteins. For example, when RISC containing AGO1, 2, 3 or 5 were programmed with exogenous siRNAs that specifically targeted the viral RNA, endonucleolytic cleavages occurred and viral replication was inhibited. Antiviral RNA silencing was disabled by the viral silencing suppressor p19 when this was present early during RISC formation. Notably, with replicating viral RNA, only (+)RNA molecules were accessible to RISC, whereas (-)RNA replication intermediates were not. The vulnerability of viral RNAs to RISC activity also depended on the RNA structure of the target sequence. This was most evident when we characterized viral siRNAs (vsiRNAs) that were particularly effective in silencing with AGO1- or AGO2/RISC. These vsiRNAs targeted similar sites, suggesting that accessible parts of the viral (+)RNA may be collectively attacked by different AGO/RISC. The in vitro system was, hence, established as a valuable tool to define and characterize individual molecular determinants of antiviral RNA silencing.

  15. Role of RNA interference in plant improvement.

    Science.gov (United States)

    Jagtap, Umesh Balkrishna; Gurav, Ranjit Gajanan; Bapat, Vishwas Anant

    2011-06-01

    Research to alter crops for their better performance involving modern technology is underway in numerous plants, and achievements in transgenic plants are impacting crop improvements in unparalleled ways. Striking progress has been made using genetic engineering technology over the past two decades in manipulating genes from diverse and exotic sources, and inserting them into crop plants for inducing desirable characteristics. RNA interference (RNAi) has recently been identified as a natural mechanism for regulation of gene expression in all higher organisms from plants to humans and promises greater accuracy and precision to plant improvement. The expression of any gene can be down-regulated in a highly explicit manner exclusive of affecting the expression of any other gene by using RNAi technologies. Additional research in this field has been focused on a number of other areas including microRNAs, hairpin RNA, and promoter methylation. Manipulating new RNAi pathways, which generate small RNA molecules to amend gene expression in crops, can produce new quality traits and having better potentiality of protection against abiotic and biotic stresses. Nutritional improvement, change in morphology, or enhanced secondary metabolite synthesis are some of the other advantages of RNAi technology. In addition to its roles in regulating gene expression, RNAi is also used as a natural defense mechanism against molecular parasites such as jumping genes and viral genetic elements that affect genome stability. Even though much advancement has been made on the field of RNAi over the preceding few years, the full prospective of RNAi for crop improvement remains to be fully realized. The intricacy of RNAi pathway, the molecular machineries, and how it relates to plant development are still to be explained.

  16. Role of RNA interference in plant improvement

    Science.gov (United States)

    Jagtap, Umesh Balkrishna; Gurav, Ranjit Gajanan; Bapat, Vishwas Anant

    2011-06-01

    Research to alter crops for their better performance involving modern technology is underway in numerous plants, and achievements in transgenic plants are impacting crop improvements in unparalleled ways. Striking progress has been made using genetic engineering technology over the past two decades in manipulating genes from diverse and exotic sources, and inserting them into crop plants for inducing desirable characteristics. RNA interference (RNAi) has recently been identified as a natural mechanism for regulation of gene expression in all higher organisms from plants to humans and promises greater accuracy and precision to plant improvement. The expression of any gene can be down-regulated in a highly explicit manner exclusive of affecting the expression of any other gene by using RNAi technologies. Additional research in this field has been focused on a number of other areas including microRNAs, hairpin RNA, and promoter methylation. Manipulating new RNAi pathways, which generate small RNA molecules to amend gene expression in crops, can produce new quality traits and having better potentiality of protection against abiotic and biotic stresses. Nutritional improvement, change in morphology, or enhanced secondary metabolite synthesis are some of the other advantages of RNAi technology. In addition to its roles in regulating gene expression, RNAi is also used as a natural defense mechanism against molecular parasites such as jumping genes and viral genetic elements that affect genome stability. Even though much advancement has been made on the field of RNAi over the preceding few years, the full prospective of RNAi for crop improvement remains to be fully realized. The intricacy of RNAi pathway, the molecular machineries, and how it relates to plant development are still to be explained.

  17. The Enamovirus P0 protein is a silencing suppressor which inhibits local and systemic RNA silencing through AGO1 degradation

    Energy Technology Data Exchange (ETDEWEB)

    Fusaro, Adriana F. [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Correa, Regis L. [CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Nakasugi, Kenlee; Jackson, Craig [University of Sydney, NSW 2006 (Australia); Kawchuk, Lawrence [Research Centre, Agriculture and Agri-Food Canada, Lethbridge, AB T1J4B1 (Canada); Vaslin, Maite F.S. [Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Waterhouse, Peter M., E-mail: peter.waterhouse@sydney.edu.au [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia)

    2012-05-10

    The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0{sup PE}, in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0{sup PE} has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0{sup PE} destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.

  18. RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans.

    Science.gov (United States)

    Tops, Bastiaan B J; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C; Plasterk, Ronald H A; Ketting, René F

    2005-01-01

    In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of approximately 250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step.

  19. RNA interference regulates the cell cycle checkpoint through the RNA export factor, Ptr1, in fission yeast

    Energy Technology Data Exchange (ETDEWEB)

    Iida, Tetsushi, E-mail: tiida@nig.ac.jp [Division of Cytogenetics, National Institute of Genetics, Mishima, 1111 Yata, Mishima 411-8540 (Japan); The Graduate University for Advanced Studies, Sokendai, Mishima, 1111 Yata, Mishima 411-8540 (Japan); Precursory Research for Embryonic Science and Technology (PRESTO), Japan Science and Technology Agency (JST), 4-1-8, Honcho, Kawaguchi-shi, Saitama 332-0012 (Japan); Iida, Naoko [Division of Mutagenesis, National Institute of Genetics, Mishima, 1111 Yata, Mishima 411-8540 (Japan); Tsutsui, Yasuhiro [Department of Life Science, Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, Nagatsuda-cho, Midori-ku, Yokohama 226-8501 (Japan); Yamao, Fumiaki [Division of Mutagenesis, National Institute of Genetics, Mishima, 1111 Yata, Mishima 411-8540 (Japan); The Graduate University for Advanced Studies, Sokendai, Mishima, 1111 Yata, Mishima 411-8540 (Japan); Kobayashi, Takehiko [Division of Cytogenetics, National Institute of Genetics, Mishima, 1111 Yata, Mishima 411-8540 (Japan); The Graduate University for Advanced Studies, Sokendai, Mishima, 1111 Yata, Mishima 411-8540 (Japan)

    2012-10-12

    Highlights: Black-Right-Pointing-Pointer RNAi is linked to the cell cycle checkpoint in fission yeast. Black-Right-Pointing-Pointer Ptr1 co-purifies with Ago1. Black-Right-Pointing-Pointer The ptr1-1 mutation impairs the checkpoint but does not affect gene silencing. Black-Right-Pointing-Pointer ago1{sup +} and ptr1{sup +} regulate the cell cycle checkpoint via the same pathway. Black-Right-Pointing-Pointer Mutations in ago1{sup +} and ptr1{sup +} lead to the nuclear accumulation of poly(A){sup +} RNAs. -- Abstract: Ago1, an effector protein of RNA interference (RNAi), regulates heterochromatin silencing and cell cycle arrest in fission yeast. However, the mechanism by which Ago1 controls cell cycle checkpoint following hydroxyurea (HU) treatment has not been elucidated. In this study, we show that Ago1 and other RNAi factors control cell cycle checkpoint following HU treatment via a mechanism independent of silencing. While silencing requires dcr1{sup +}, the overexpression of ago1{sup +} alleviated the cell cycle defect in dcr1{Delta}. Ago1 interacted with the mRNA export factor, Ptr1. The ptr1-1 mutation impaired cell cycle checkpoint but gene silencing was unaffected. Genetic analysis revealed that the regulation of cell cycle checkpoint by ago1{sup +} is dependent on ptr1{sup +}. Nuclear accumulation of poly(A){sup +} RNAs was detected in mutants of ago1{sup +} and ptr1{sup +}, suggesting there is a functional link between the cell cycle checkpoint and RNAi-mediated RNA quality control.

  20. Silencing VDAC1 Expression by siRNA Inhibits Cancer Cell Proliferation and Tumor Growth In Vivo

    Directory of Open Access Journals (Sweden)

    Tasleem Arif

    2014-01-01

    Full Text Available Alterations in cellular metabolism and bioenergetics are vital for cancer cell growth and motility. Here, the role of the mitochondrial protein voltage-dependent anion channel (VDAC1, a master gatekeeper regulating the flux of metabolites and ions between mitochondria and the cytoplasm, in regulating the growth of several cancer cell lines was investigated by silencing VDAC1 expression using small interfering RNA (siRNA. A single siRNA specific to the human VDAC1 sequence at nanomolar concentrations led to some 90% decrease in VDAC1 levels in the lung A549 and H358, prostate PC-3, colon HCT116, glioblastoma U87, liver HepG2, and pancreas Panc-1 cancer cell lines. VDAC1 silencing persisted 144 hours post-transfection and resulted in profound inhibition of cell growth in cancer but not in noncancerous cells, with up to 90% inhibition being observed over 5 days that was prolonged by a second transfection. Cells expressing low VDAC1 levels showed decreased mitochondrial membrane potential and adenoside triphosphate (ATP levels, suggesting limited metabolite exchange between mitochondria and cytosol. Moreover, cells silenced for VDAC1 expression showed decreased migration, even in the presence of the wound healing accelerator basic fibroblast growth factor (bFGF. VDAC1-siRNA inhibited cancer cell growth in a Matrigel-based assay in host nude mice. Finally, in a xenograft lung cancer mouse model, chemically modified VDAC1-siRNA not only inhibited tumor growth but also resulted in tumor regression. This study thus shows that VDAC1 silencing by means of RNA interference (RNAi dramatically inhibits cancer cell growth and tumor development by disabling the abnormal metabolic behavior of cancer cells, potentially paving the way for a more effective pipeline of anticancer drugs.

  1. A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

    KAUST Repository

    Jin, Hailing; Zhu, Jian-Kang

    2010-01-01

    RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host's essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

  2. A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes

    KAUST Repository

    Jin, Hailing

    2010-05-01

    RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host\\'s essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.

  3. RNA interference-based resistance against a legume mastrevirus

    Directory of Open Access Journals (Sweden)

    Mansoor Shahid

    2011-11-01

    Full Text Available Abstract Background RNA interference (RNAi is a homology-dependant gene silencing mechanism and has been widely used to engineer resistance in plants against RNA viruses. However, its usefulness in delivering resistance against plant DNA viruses belonging to family Geminiviridae is still being debated. Although the RNAi approach has been shown, using a transient assay, to be useful in countering monocotyledonous plant-infecting geminiviruses of the genus Mastrevirus, it has yet to be investigated as a means of delivering resistance to dicot-infecting mastreviruses. Chickpea chlorotic dwarf Pakistan virus (CpCDPKV is a legume-infecting mastrevirus that affects chickpea and other leguminous crops in Pakistan. Results Here a hairpin (hpRNAi construct containing sequences encompassing part of replication-associated protein gene, intergenic region and part of the movement protein gene of CpCDPKV under the control of the Cauliflower mosaic virus 35S promoter has been produced and stably transformed into Nicotiana benthamiana. Plants harboring the hairpin construct were challenged with CpCDPKV. All non-transgenic N. benthamiana plants developed symptoms of CpCDPKV infection within two weeks post-inoculation. In contrast, none of the inoculated transgenic plants showed symptoms of infection and no viral DNA could be detected by Southern hybridization. A real-time quantitative PCR analysis identified very low-level accumulation of viral DNA in the inoculated transgenic plants. Conclusions The results presented show that the RNAi-based resistance strategy is useful in protecting plants from a dicot-infecting mastrevirus. The very low levels of virus detected in plant tissue of transgenic plants distal to the inoculation site suggest that virus movement and/or viral replication was impaired leading to plants that showed no discernible signs of virus infection.

  4. mediated RNA interference in bovine fibroblast cells

    African Journals Online (AJOL)

    Jane

    2011-08-03

    Aug 3, 2011 ... there are lots of problems related to the method of delivery, especially .... Detection of MC4R silencing of Lvsh-MC4R in FBCs. The Auris .... Schwartz MW, Seeley RJ, Woods SC, Weigle DS, Campfield LA, Burn. P, Baskin DG ...

  5. Capturing microRNA targets using an RNA-induced silencing complex (RISC)-trap approach.

    Science.gov (United States)

    Cambronne, Xiaolu A; Shen, Rongkun; Auer, Paul L; Goodman, Richard H

    2012-12-11

    Identifying targets is critical for understanding the biological effects of microRNA (miRNA) expression. The challenge lies in characterizing the cohort of targets for a specific miRNA, especially when targets are being actively down-regulated in miRNA- RNA-induced silencing complex (RISC)-messengerRNA (mRNA) complexes. We have developed a robust and versatile strategy called RISCtrap to stabilize and purify targets from this transient interaction. Its utility was demonstrated by determining specific high-confidence target datasets for miR-124, miR-132, and miR-181 that contained known and previously unknown transcripts. Two previously unknown miR-132 targets identified with RISCtrap, adaptor protein CT10 regulator of kinase 1 (CRK1) and tight junction-associated protein 1 (TJAP1), were shown to be endogenously regulated by miR-132 in adult mouse forebrain. The datasets, moreover, differed in the number of targets and in the types and frequency of microRNA recognition element (MRE) motifs, thus revealing a previously underappreciated level of specificity in the target sets regulated by individual miRNAs.

  6. BIOLOGICAL FUNCTION OF TOMBUSVIRUS-ENCODED SUPPRESSOR OF RNA SILENCING IN PLANTS

    Directory of Open Access Journals (Sweden)

    Omarov R.T.

    2012-08-01

    Full Text Available RNA interference (RNAi plays multiple biological roles in eukaryotic organisms to regulate gene expression. RNAi also operates as a conserved adaptive molecular immune mechanism against invading viruses. The antiviral RNAi pathway is initiated with the generation of virus-derived short-interfering RNAs (siRNAs that are used for subsequent sequence-specific recognition and degradation of the cognate viral RNA molecules. As an efficient counter-defensive strategy, most plant viruses evolved the ability to encode specific proteins capable of interfering with RNAi, and this process is commonly known as RNA silencing suppression. Virus-encoded suppressors of RNAi (VSRs operate at different steps in the RNAi pathway and display distinct biochemical properties that enable these proteins to efficiently interfere with the host-defense system. Tombusvirus-encoded P19 is an important pathogenicity factor, required for symptom development and elicitation of a hypersensitive response in a host-dependent manner. Protein plays a crucial role of TBSV P19 in protecting viral RNA during systemic infection on Nicotiana benthamiana. The X-ray crystallographic studies conducted by two independent groups revealed the existence of a P19-siRNA complex; a conformation whereby caliper tryptophan residues on two subunits of P19 dimers measure and bind 21-nt siRNA duplexes. These structural studies provided the first details on the possible molecular mechanism of any viral suppressor to block RNAi. The association between P19 and siRNAs was also shown to occur in infected plants These and related studies revealed that in general the ability of P19 to efficiently sequester siRNAs influences symptom severity, however this is not a strict correlation in all hosts.The current working model is that during TBSV infection of plants, P19 appropriates abundantly circulating Tombusvirus-derived siRNAs thereby rendering these unavailable to program RISC, to prevent degradation of

  7. The Role of RNA Interference (RNAi in Arbovirus-Vector Interactions

    Directory of Open Access Journals (Sweden)

    Carol D. Blair

    2015-02-01

    Full Text Available RNA interference (RNAi was shown over 18 years ago to be a mechanism by which arbovirus replication and transmission could be controlled in arthropod vectors. During the intervening period, research on RNAi has defined many of the components and mechanisms of this antiviral pathway in arthropods, yet a number of unexplored questions remain. RNAi refers to RNA-mediated regulation of gene expression. Originally, the term described silencing of endogenous genes by introduction of exogenous double-stranded (dsRNA with the same sequence as the gene to be silenced. Further research has shown that RNAi comprises three gene regulation pathways that are mediated by small RNAs: the small interfering (siRNA, micro (miRNA, and Piwi-interacting (piRNA pathways. The exogenous (exo-siRNA pathway is now recognized as a major antiviral innate immune response of arthropods. More recent studies suggest that the piRNA and miRNA pathways might also have important roles in arbovirus-vector interactions. This review will focus on current knowledge of the role of the exo-siRNA pathway as an arthropod vector antiviral response and on emerging research into vector piRNA and miRNA pathway modulation of arbovirus-vector interactions. Although it is assumed that arboviruses must evade the vector’s antiviral RNAi response in order to maintain their natural transmission cycles, the strategies by which this is accomplished are not well defined. RNAi is also an important tool for arthropod gene knock-down in functional genomics studies and in development of arbovirus-resistant mosquito populations. Possible arbovirus strategies for evasion of RNAi and applications of RNAi in functional genomics analysis and arbovirus transmission control will also be reviewed.

  8. Simultaneous silencing of multiple genes in the apple scab fungus, Venturia inaequalis, by expression of RNA with chimeric inverted repeats

    NARCIS (Netherlands)

    Fitzgerald, A.; Kan, van J.A.L.; Plummer, K.M.

    2004-01-01

    RNA-mediated gene silencing has been demonstrated in plants, animals, and more recently in filamentous fungi. Here, we report high frequency, RNA-mediated gene silencing in the apple scab fungus, Venturia inaequalis. The green fluorescent protein (GFP) transgene was silenced in a GFP-expressing

  9. Effective Anti-miRNA Oligonucleotides Show High Releasing Rate of MicroRNA from RNA-Induced Silencing Complex.

    Science.gov (United States)

    Ariyoshi, Jumpei; Matsuyama, Yohei; Kobori, Akio; Murakami, Akira; Sugiyama, Hiroshi; Yamayoshi, Asako

    2017-10-01

    MicroRNAs (miRNAs) regulate gene expression by forming RNA-induced silencing complexes (RISCs) and have been considered as promising therapeutic targets. MiRNA is an essential component of RISC for the modulation of gene expression. Therefore, the release of miRNA from RISC is considered as an effective method for the inhibition of miRNA functions. In our previous study, we reported that anti-miRNA oligonucleotides (AMOs), which are composed of the 2'-O-methyl (2'-OMe) RNA, could induce the release of miRNA from RISC. However, the mechanisms underlying the miRNA-releasing effects of chemically modified AMOs, which are conventionally used as anti-cancer drugs, are still unclear. In this study, we investigated the relationship between the miRNA releasing rate from RISC and the inhibitory effect on RISC activity (IC 50 ) using conventional chemically modified AMOs. We demonstrated that the miRNA-releasing effects of AMOs are directly proportional to the IC 50 values, and AMOs, which have an ability to promote the release of miRNA from RISC, can effectively inhibit RISC activity in living cells.

  10. Stability of RNA silencing-based traits after virus infection

    DEFF Research Database (Denmark)

    Jørgensen, Bodil; Albrechtsen, Merete

    2007-01-01

    with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...

  11. Pathways of cellular internalisation of liposomes delivered siRNA and effects on siRNA engagement with target mRNA and silencing in cancer cells.

    Science.gov (United States)

    Alshehri, Abdullah; Grabowska, Anna; Stolnik, Snow

    2018-02-28

    Design of an efficient delivery system is a generally recognised bottleneck in translation of siRNA technology into clinic. Despite research efforts, cellular processes that determine efficiency of siRNA silencing achieved by different delivery formulations remain unclear. Here, we investigated the mechanism(s) of cellular internalisation of a model siRNA-loaded liposome system in a correlation to the engagement of delivered siRNA with its target and consequent silencing by adopting siRNA molecular beacon technology. Probing of cellular internalisation pathways by a panel of pharmacological inhibitors indicated that clathrin-mediated (dynamin-dependent) endocytosis, macropinocytosis (dynamine independent), and cell membrane cholesterol dependent process(es) (clathrin and caveolea-independent) all play a role in the siRNA-liposomes internalization. The inhibition of either of these entry routes was, in general, mirrored by a reduction in the level of siRNA engagement with its target mRNA, as well as in a reduction of the target gene silencing. A dramatic increase in siRNA engagement with its target RNA was observed on disruption of endosomal membrane (by chloroquine), accompanied with an increased silencing. The work thus illustrates that employing molecular beacon siRNA technology one can start to assess the target RNA engagement - a stage between initial cellular internalization and final gene silencing of siRNA delivery systems.

  12. Improvement of heterologous protein production in Aspergillus oryzae by RNA interference with alpha-amylase genes.

    Science.gov (United States)

    Nemoto, Takashi; Maruyama, Jun-ichi; Kitamoto, Katsuhiko

    2009-11-01

    Aspergillus oryzae RIB40 has three alpha-amylase genes (amyA, amyB, and amyC), and secretes alpha-amylase abundantly. However, large amounts of endogenous secretory proteins such as alpha-amylase can compete with heterologous protein in the secretory pathway and decrease its production yields. In this study, we examined the effects of suppression of alpha-amylase on heterologous protein production in A. oryzae, using the bovine chymosin (CHY) as a reporter heterologous protein. The three alpha-amylase genes in A. oryzae have nearly identical DNA sequences from those promoters to the coding regions. Hence we performed silencing of alpha-amylase genes by RNA interference (RNAi) in the A. oryzae CHY producing strain. The silenced strains exhibited a reduction in alpha-amylase activity and an increase in CHY production in the culture medium. This result suggests that suppression of alpha-amylase is effective in heterologous protein production in A. oryzae.

  13. Delivery of chitosan/dsRNA nanoparticles for silencing of wing development vestigial (vg) gene in Aedes aegypti mosquitoes.

    Science.gov (United States)

    Ramesh Kumar, D; Saravana Kumar, P; Gandhi, M Rajiv; Al-Dhabi, Naif Abdullah; Paulraj, M Gabriel; Ignacimuthu, S

    2016-05-01

    RNA interference (RNAi) has been used as a gene silencing strategy by the introduction of long double stranded RNA (dsRNA) for the control of pest insects. The aim of the present study was to examine whether the expression of vg gene which is responsible for wing development, can be repressed by chitosan/dsRNA based nanoparticles in Aedes aegypti. The vestigial gene (vg) was amplified from adult mosquito and cloned in pLitmus28i vector. Genetically engineered recombinant plasmid was transformed into RNase III deficient strain for synthesis of bacterially expressed dsRNA. Nanoparticles were prepared via electrostatic interaction between cationic polymer chitosan and anionic nucleic acids (dsRNA). The formation of chitosan/dsRNAnanoparticles and their size were confirmed by Atomic force microscopy (AFM). Chitosan/dsRNA mediated knockdown of Enhanced Green Fluorescence Protein (EGFP) was demonstrated in Sf21 cells. Further, we tested whether such an approach could be used to target vg gene in Ae. aegypti. The results showed that chitosan/dsRNA caused significant mortality, delayed growth development and caused adult wing-malformation. A qRT-PCR analysis confirmed that the chitosan/dsRNA mediated transcriptional level was downregulated. Our findings suggest that vg gene intervention strategies through RNAi can emerge as viable option for pest control. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing.

    Science.gov (United States)

    Fusaro, Adriana F; Barton, Deborah A; Nakasugi, Kenlee; Jackson, Craig; Kalischuk, Melanie L; Kawchuk, Lawrence M; Vaslin, Maite F S; Correa, Regis L; Waterhouse, Peter M

    2017-10-10

    The plant viral family Luteoviridae is divided into three genera: Luteovirus , Polerovirus and Enamovirus . Without assistance from another virus, members of the family are confined to the cells of the host plant's vascular system. The first open reading frame (ORF) of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs) against the plant's viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV), however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant's silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant's anti-viral defense.

  15. RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops

    OpenAIRE

    Guo, Qigao; Liu, Qing; Smith, Neil A.; Liang, Guolu; Wang, Ming-Bo

    2016-01-01

    Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing ...

  16. RNA interference in plant parasitic nematodes

    African Journals Online (AJOL)

    STORAGESEVER

    2008-08-04

    Aug 4, 2008 ... grower preference or by government restrictions to limit the environmental ... risks associated with chemical control and (c) the pro- vision of ... certain model organisms. The first ... reproductive system (Lilley et al., 2005b), sperm (Urwin .... interference of dual oxidase in the plant nematode Meloidogyne.

  17. RNA Interference - Towards RNA becoming a Medicine -42 ...

    Indian Academy of Sciences (India)

    research. A brief history of the development ofRNAi is shown in. Box 2. Mechanism of ... new RNA strand using target RNA as the template and thereby converting it ... thought to excise precursor stRNA from their -70 nt stem loop precursor to ...

  18. Characterization of RNA interference in rat PC12 cells

    DEFF Research Database (Denmark)

    Thonberg, Håkan; Schéele, Camilla C; Dahlgren, Cecilia

    2004-01-01

    strand of the siRNA guides a multi-protein complex, RNA-induced silencing complex (RISC), to cleave target mRNA. Although the exact function and composition of RISC is still unclear, it has been shown to include several proteins of the Argonaute protein family. Here we report of a robust system...... of the rat Golgi-ER protein 95 kDa (GERp95), an Argonaute family protein, by siRNA methodology. After GERp95-ablation, sequential knockdown of NPY by siRNA was shown to be impaired. Thus, we report that the GERp95 protein is functionally required for RNAi targeting NPY in rat PC12 cells....

  19. Interspecific RNA interference of SHOOT MERISTEMLESS-like disrupts Cuscuta pentagona plant parasitism.

    Science.gov (United States)

    Alakonya, Amos; Kumar, Ravi; Koenig, Daniel; Kimura, Seisuke; Townsley, Brad; Runo, Steven; Garces, Helena M; Kang, Julie; Yanez, Andrea; David-Schwartz, Rakefet; Machuka, Jesse; Sinha, Neelima

    2012-07-01

    Infection of crop species by parasitic plants is a major agricultural hindrance resulting in substantial crop losses worldwide. Parasitic plants establish vascular connections with the host plant via structures termed haustoria, which allow acquisition of water and nutrients, often to the detriment of the infected host. Despite the agricultural impact of parasitic plants, the molecular and developmental processes by which host/parasitic interactions are established are not well understood. Here, we examine the development and subsequent establishment of haustorial connections by the parasite dodder (Cuscuta pentagona) on tobacco (Nicotiana tabacum) plants. Formation of haustoria in dodder is accompanied by upregulation of dodder KNOTTED-like homeobox transcription factors, including SHOOT MERISTEMLESS-like (STM). We demonstrate interspecific silencing of a STM gene in dodder driven by a vascular-specific promoter in transgenic host plants and find that this silencing disrupts dodder growth. The reduced efficacy of dodder infection on STM RNA interference transgenics results from defects in haustorial connection, development, and establishment. Identification of transgene-specific small RNAs in the parasite, coupled with reduced parasite fecundity and increased growth of the infected host, demonstrates the efficacy of interspecific small RNA-mediated silencing of parasite genes. This technology has the potential to be an effective method of biological control of plant parasite infection.

  20. Identification of Novel Fibrosis Modifiers by In Vivo siRNA Silencing

    Directory of Open Access Journals (Sweden)

    Elisabeth H. Vollmann

    2017-06-01

    Full Text Available Fibrotic diseases contribute to 45% of deaths in the industrialized world, and therefore a better understanding of the pathophysiological mechanisms underlying tissue fibrosis is sorely needed. We aimed to identify novel modifiers of tissue fibrosis expressed by myofibroblasts and their progenitors in their disease microenvironment through RNA silencing in vivo. We leveraged novel biology, targeting genes upregulated during liver and kidney fibrosis in this cell lineage, and employed small interfering RNA (siRNA-formulated lipid nanoparticles technology to silence these genes in carbon-tetrachloride-induced liver fibrosis in mice. We identified five genes, Egr2, Atp1a2, Fkbp10, Fstl1, and Has2, which modified fibrogenesis based on their silencing, resulting in reduced Col1a1 mRNA levels and collagen accumulation in the liver. These genes fell into different groups based on the effects of their silencing on a transcriptional mini-array and histological outcomes. Silencing of Egr2 had the broadest effects in vivo and also reduced fibrogenic gene expression in a human fibroblast cell line. Prior to our study, Egr2, Atp1a2, and Fkbp10 had not been functionally validated in fibrosis in vivo. Thus, our results provide a major advance over the existing knowledge of fibrogenic pathways. Our study is the first example of a targeted siRNA assay to identify novel fibrosis modifiers in vivo.

  1. RNA interference screen to identify pathways that enhance or reduce nonviral gene transfer during lipofection.

    Science.gov (United States)

    Barker, Gregory A; Diamond, Scott L

    2008-09-01

    Some barriers to DNA lipofection are well characterized; however, there is as yet no method of finding unknown pathways that impact the process. A druggable genome small-interfering RNA (siRNA) screen against 5,520 genes was tested for its effect on lipofection of human aortic endothelial cells (HAECs). We found 130 gene targets which, when silenced by pooled siRNAs (three siRNAs per gene), resulted in enhanced luminescence after lipofection (86 gene targets showed reduced expression). In confirmation tests with single siRNAs, 18 of the 130 hits showed enhanced lipofection with two or more individual siRNAs in the absence of cytotoxicity. Of these confirmed gene targets, we identified five leading candidates, two of which are isoforms of the regulatory subunit of protein phosphatase 2A (PP2A). The best candidate siRNA targeted the PPP2R2C gene and produced a 65% increase in luminescence from lipofection, with a quantitative PCR-validated knockdown of approximately 76%. Flow cytometric analysis confirmed that the silencing of the PPP2R2C gene resulted in an improvement of 10% in transfection efficiency, thereby demonstrating an increase in the number of transfected cells. These results show that an RNA interference (RNAi) high-throughput screen (HTS) can be applied to nonviral gene transfer. We have also demonstrated that siRNAs can be co-delivered with lipofected DNA to increase the transfection efficiency in vitro.

  2. Short-hairpin RNA-mediated Heat shock protein 90 gene silencing inhibits human breast cancer cell growth in vitro and in vivo

    International Nuclear Information System (INIS)

    Zuo, Keqiang; Li, Dan; Pulli, Benjamin; Yu, Fei; Cai, Haidong; Yuan, Xueyu; Zhang, Xiaoping; Lv, Zhongwei

    2012-01-01

    Highlights: ► Hsp90 is over-expressed in human breast cancer. ► The shRNA-mediated gene silencing of Hsp90 resulted in inhibition of cell growth. ► Akt and NF-kB were down-regulation after transfection due to Hsp90 silencing. ► The tumor growth ratio was decline due to Hsp90 silencing. ► The PCNA expression was down-regulation due to Hsp90 silencing. -- Abstract: Hsp90 interacts with proteins that mediate signaling pathways involved in the regulation of essential processes such as proliferation, cell cycle control, angiogenesis and apoptosis. Hsp90 inhibition is therefore an attractive strategy for blocking abnormal pathways that are crucial for cancer cell growth. In the present study, the role of Hsp90 in human breast cancer MCF-7 cells was examined by stably silencing Hsp90 gene expression with an Hsp90-silencing vector (Hsp90-shRNA). RT-PCR and Western blot analyses showed that Hsp90-shRNA specifically and markedly down-regulated Hsp90 mRNA and protein expression. NF-kB and Akt protein levels were down-regulated in Hsp90-shRNA transfected cells, indicating that Hsp90 knockout caused a reduction of survival factors and induced apoptosis. Treatment with Hsp90-shRNA significantly increased apoptotic cell death and caused cell cycle arrest in the G1/S phase in MCF-7 cells, as shown by flow cytometry. Silencing of Hsp90 also reduced cell viability, as determined by MTT assay. In vivo experiments showed that MCF-7 cells stably transfected with Hsp90-shRNA grew slowly in nude mice as compared with control groups. In summary, the Hsp90-shRNA specifically silenced the Hsp90 gene, and inhibited MCF-7 cell growth in vitro and in vivo. Possible molecular mechanisms underlying the effects of Hsp90-shRNA include the degradation of Hsp90 breast cancer-related client proteins, the inhibition of survival signals and the upregulation of apoptotic pathways. shRNA-mediated interference may have potential therapeutic utility in human breast cancer.

  3. A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

    Science.gov (United States)

    Pompey, Justine M; Foda, Bardees; Singh, Upinder

    2015-01-01

    Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

  4. A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

    Directory of Open Access Journals (Sweden)

    Justine M Pompey

    Full Text Available Dicer enzymes process double-stranded RNA (dsRNA into small RNAs that target gene silencing through the RNA interference (RNAi pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

  5. RNA interference-mediated intrinsic antiviral immunity in invertebrates.

    Science.gov (United States)

    Nayak, Arabinda; Tassetto, Michel; Kunitomi, Mark; Andino, Raul

    2013-01-01

    In invertebrates such as insects and nematodes, RNA interference (RNAi) provides RNA-based protection against viruses. This form of immunity restricts viral replication and dissemination from infected cells and viruses, in turn, have evolved evasion mechanisms or RNAi suppressors to counteract host defenses. Recent advances indicate that, in addition to RNAi, other related small RNA pathways contribute to antiviral functions in invertebrates. This has led to a deeper understanding of fundamental aspects of small RNA-based antiviral immunity in invertebrates and its contribution to viral spread and pathogenesis.

  6. Neuron-specific RNA interference using lentiviral vectors

    DEFF Research Database (Denmark)

    Nielsen, Troels Tolstrup; Marion, Ingrid van; Hasholt, Lis

    2009-01-01

    BACKGROUND: Viral vectors have been used in several different settings for the delivery of small hairpin (sh) RNAs. However, most vectors have utilized ubiquitously-expressing polymerase (pol) III promoters to drive expression of the hairpin as a result of the strict requirement for precise...... transcriptional initiation and termination. Recently, pol II promoters have been used to construct vectors for RNA interference (RNAi). By embedding the shRNA into a micro RNA-context (miRNA) the endogenous miRNA processing machinery is exploited to achieve the mature synthetic miRNA (smiRNA), thereby expanding...... the possible promoter choices and eventually allowing cell type specific down-regulation of target genes. METHODS: In the present study, we constructed lentiviral vectors expressing smiRNAs under the control of pol II promoters to knockdown gene expression in cell culture and in the brain. RESULTS: We...

  7. Novel RNA Duplex Locks HIV-1 in a Latent State via Chromatin-mediated Transcriptional Silencing

    Directory of Open Access Journals (Sweden)

    Chantelle Ahlenstiel

    2015-01-01

    Full Text Available Transcriptional gene silencing (TGS of mammalian genes can be induced by short interfering RNA (siRNA targeting promoter regions. We previously reported potent TGS of HIV-1 by siRNA (PromA, which targets tandem NF-κB motifs within the viral 5′LTR. In this study, we screened a siRNA panel with the aim of identifying novel 5′LTR targets, to provide multiplexing potential with enhanced viral silencing and application toward developing alternate therapeutic strategies. Systematic examination identified a novel siRNA target, si143, confirmed to induce TGS as the silencing mechanism. TGS was prolonged with virus suppression >12 days, despite a limited ability to induce post- TGS. Epigenetic changes associated with silencing were suggested by partial reversal by histone deacetylase inhibitors and confirmed by chromatin immunoprecipitation analyses, which showed induction of H3K27me3 and H3K9me3, reduction in H3K9Ac, and recruitment of argonaute-1, all characteristic marks of heterochromatin and TGS. Together, these epigenetic changes mimic those associated with HIV-1 latency. Further, robust resistance to reactivation was observed in the J-Lat 9.2 cell latency model, when transduced with shPromA and/or sh143. These data support si/shRNA-mediated TGS approaches to HIV-1 and provide alternate targets to pursue a functional cure, whereby the viral reservoir is locked in latency following antiretroviral therapy cessation.

  8. Dengue virus type 2 infections of Aedes aegypti are modulated by the mosquito's RNA interference pathway.

    Directory of Open Access Journals (Sweden)

    Irma Sánchez-Vargas

    2009-02-01

    Full Text Available A number of studies have shown that both innate and adaptive immune defense mechanisms greatly influence the course of human dengue virus (DENV infections, but little is known about the innate immune response of the mosquito vector Aedes aegypti to arbovirus infection. We present evidence here that a major component of the mosquito innate immune response, RNA interference (RNAi, is an important modulator of mosquito infections. The RNAi response is triggered by double-stranded RNA (dsRNA, which occurs in the cytoplasm as a result of positive-sense RNA virus infection, leading to production of small interfering RNAs (siRNAs. These siRNAs are instrumental in degradation of viral mRNA with sequence homology to the dsRNA trigger and thereby inhibition of virus replication. We show that although dengue virus type 2 (DENV2 infection of Ae. aegypti cultured cells and oral infection of adult mosquitoes generated dsRNA and production of DENV2-specific siRNAs, virus replication and release of infectious virus persisted, suggesting viral circumvention of RNAi. We also show that DENV2 does not completely evade RNAi, since impairing the pathway by silencing expression of dcr2, r2d2, or ago2, genes encoding important sensor and effector proteins in the RNAi pathway, increased virus replication in the vector and decreased the extrinsic incubation period required for virus transmission. Our findings indicate a major role for RNAi as a determinant of DENV transmission by Ae. aegypti.

  9. Yellow fever virus capsid protein is a potent suppressor of RNA silencing that binds double-stranded RNA.

    Science.gov (United States)

    Samuel, Glady Hazitha; Wiley, Michael R; Badawi, Atif; Adelman, Zach N; Myles, Kevin M

    2016-11-29

    Mosquito-borne flaviviruses, including yellow fever virus (YFV), Zika virus (ZIKV), and West Nile virus (WNV), profoundly affect human health. The successful transmission of these viruses to a human host depends on the pathogen's ability to overcome a potentially sterilizing immune response in the vector mosquito. Similar to other invertebrate animals and plants, the mosquito's RNA silencing pathway comprises its primary antiviral defense. Although a diverse range of plant and insect viruses has been found to encode suppressors of RNA silencing, the mechanisms by which flaviviruses antagonize antiviral small RNA pathways in disease vectors are unknown. Here we describe a viral suppressor of RNA silencing (VSR) encoded by the prototype flavivirus, YFV. We show that the YFV capsid (YFC) protein inhibits RNA silencing in the mosquito Aedes aegypti by interfering with Dicer. This VSR activity appears to be broadly conserved in the C proteins of other medically important flaviviruses, including that of ZIKV. These results suggest that a molecular "arms race" between vector and pathogen underlies the continued existence of flaviviruses in nature.

  10. Computational analysis of siRNA recognition by the Ago2 PAZ domain and identification of the determinants of RNA-induced gene silencing.

    Directory of Open Access Journals (Sweden)

    Mahmoud Kandeel

    Full Text Available RNA interference (RNAi is a highly specialized process of protein-siRNA interaction that results in the regulation of gene expression and cleavage of target mRNA. The PAZ domain of the Argonaute proteins binds to the 3' end of siRNA, and during RNAi the attaching end of the siRNA switches between binding and release from its binding pocket. This biphasic interaction of the 3' end of siRNA with the PAZ domain is essential for RNAi activity; however, it remains unclear whether stronger or weaker binding with PAZ domain will facilitate or hinder the overall RNAi process. Here we report the correlation between the binding of modified siRNA 3' overhang analogues and their in vivo RNAi efficacy. We found that higher RNAi efficacy was associated with the parameters of lower Ki value, lower total intermolecular energy, lower free energy, higher hydrogen bonding, smaller total surface of interaction and fewer van der Waals interactions. Electrostatic interaction was a minor contributor to compounds recognition, underscoring the presence of phosphate groups in the modified analogues. Thus, compounds with lower binding affinity are associated with better gene silencing. Lower binding strength along with the smaller interaction surface, higher hydrogen bonding and fewer van der Waals interactions were among the markers for favorable RNAi activity. Within the measured parameters, the interaction surface, van der Waals interactions and inhibition constant showed a statistically significant correlation with measured RNAi efficacy. The considerations provided in this report will be helpful in the design of new compounds with better gene silencing ability.

  11. Functional gene silencing mediated by chitosan/siRNA nanocomplexes

    Energy Technology Data Exchange (ETDEWEB)

    Ji, A M; Su, D; Che, O; Li, W S; Sun, L; Zhang, Z Y; Xu, F [Department of Pharmaceutical Science, Zhujiang Hospital, Southern Medical University, Guangzhou 510282 (China); Yang, B, E-mail: andrewfxu1998@gmail.co [Department of Chemistry, Indiana University-Bloomington, Bloomington, IN 47405 (United States)

    2009-10-07

    Chitosan/siRNA nanoparticles to knock down FHL2 gene expression were reported in this work. The physicochemical properties such as particle size, surface charge, morphology and complex stability of chitosan nanoparticle-incorporated siRNA were evaluated. Nanoparticles which were formulated with chitosan/siRNA exhibited irregular, lamellar and dendritic structures with a hydrodynamic radius size of about 148 nm and net positive charges with zeta-potential value of 58.5 mV. The knockdown effect of the chitosan/siRNA nanoparticles on gene expression in FHL2 over-expressed human colorectal cancer Lovo cells was investigated. The result showed that FHL2 siRNA formulated within chitosan nanoparticles could knock down about 69.6% FHL2 gene expression, which is very similar to the 68.8% reduced gene expression when siRNA was transfected with liposome Lipofectamine. Western analysis further showed significant FHL-2 protein expression reduced by the chitosan/siRNA nanoparticles. The results also showed that blocking FHL2 expression by siRNA could also inhibit the growth and proliferation of human colorectal cancer Lovo cells. The current results demonstrated that chitosan-based siRNA nanoparticles were a very efficient delivery system for siRNA in vivo as previously reported.

  12. Functional gene silencing mediated by chitosan/siRNA nanocomplexes

    International Nuclear Information System (INIS)

    Ji, A M; Su, D; Che, O; Li, W S; Sun, L; Zhang, Z Y; Xu, F; Yang, B

    2009-01-01

    Chitosan/siRNA nanoparticles to knock down FHL2 gene expression were reported in this work. The physicochemical properties such as particle size, surface charge, morphology and complex stability of chitosan nanoparticle-incorporated siRNA were evaluated. Nanoparticles which were formulated with chitosan/siRNA exhibited irregular, lamellar and dendritic structures with a hydrodynamic radius size of about 148 nm and net positive charges with zeta-potential value of 58.5 mV. The knockdown effect of the chitosan/siRNA nanoparticles on gene expression in FHL2 over-expressed human colorectal cancer Lovo cells was investigated. The result showed that FHL2 siRNA formulated within chitosan nanoparticles could knock down about 69.6% FHL2 gene expression, which is very similar to the 68.8% reduced gene expression when siRNA was transfected with liposome Lipofectamine. Western analysis further showed significant FHL-2 protein expression reduced by the chitosan/siRNA nanoparticles. The results also showed that blocking FHL2 expression by siRNA could also inhibit the growth and proliferation of human colorectal cancer Lovo cells. The current results demonstrated that chitosan-based siRNA nanoparticles were a very efficient delivery system for siRNA in vivo as previously reported.

  13. RNA Interference: A Novel Source of Resistance to Combat Plant Parasitic Nematodes

    Directory of Open Access Journals (Sweden)

    Sagar Banerjee

    2017-05-01

    Full Text Available Plant parasitic nematodes cause severe damage and yield loss in major crops all over the world. Available control strategies include use of insecticides/nematicides but these have proved detrimental to the environment, while other strategies like crop rotation and resistant cultivars have serious limitations. This scenario provides an opportunity for the utilization of technological advances like RNA interference (RNAi to engineer resistance against these devastating parasites. First demonstrated in the model free living nematode, Caenorhabtidis elegans; the phenomenon of RNAi has been successfully used to suppress essential genes of plant parasitic nematodes involved in parasitism, nematode development and mRNA metabolism. Synthetic neurotransmitants mixed with dsRNA solutions are used for in vitro RNAi in plant parasitic nematodes with significant success. However, host delivered in planta RNAi has proved to be a pioneering phenomenon to deliver dsRNAs to feeding nematodes and silence the target genes to achieve resistance. Highly enriched genomic databases are exploited to limit off target effects and ensure sequence specific silencing. Technological advances like gene stacking and use of nematode inducible and tissue specific promoters can further enhance the utility of RNAi based transgenics against plant parasitic nematodes.

  14. Differential Contribution of RNA Interference Components in Response to Distinct Fusarium graminearum Virus Infections.

    Science.gov (United States)

    Yu, Jisuk; Lee, Kyung-Mi; Cho, Won Kyong; Park, Ju Yeon; Kim, Kook-Hyung

    2018-05-01

    The mechanisms of RNA interference (RNAi) as a defense response against viruses remain unclear in many plant-pathogenic fungi. In this study, we used reverse genetics and virus-derived small RNA profiling to investigate the contributions of RNAi components to the antiviral response against Fusarium graminearum viruses 1 to 3 (FgV1, -2, and -3). Real-time reverse transcription-quantitative PCR (qRT-PCR) indicated that infection of Fusarium graminearum by FgV1, -2, or -3 differentially induces the gene expression of RNAi components in F. graminearum Transcripts of the DICER-2 and AGO-1 genes of F. graminearum ( FgDICER-2 and FgAGO-1 ) accumulated at lower levels following FgV1 infection than following FgV2 or FgV3 infection. We constructed gene disruption and overexpression mutants for each of the Argonaute and dicer genes and for two RNA-dependent RNA polymerase (RdRP) genes and generated virus-infected strains of each mutant. Interestingly, mycelial growth was significantly faster for the FgV1-infected FgAGO-1 overexpression mutant than for the FgV1-infected wild type, while neither FgV2 nor FgV3 infection altered the colony morphology of the gene deletion and overexpression mutants. FgV1 RNA accumulation was significantly decreased in the FgAGO-1 overexpression mutant. Furthermore, the levels of induction of FgAGO-1 , FgDICER-2 , and some of the FgRdRP genes caused by FgV2 and FgV3 infection were similar to those caused by hairpin RNA-induced gene silencing. Using small RNA sequencing analysis, we documented different patterns of virus-derived small interfering RNA (vsiRNA) production in strains infected with FgV1, -2, and -3. Our results suggest that the Argonaute protein encoded by FgAGO-1 is required for RNAi in F. graminearum , that FgAGO-1 induction differs in response to FgV1, -2, and -3, and that FgAGO-1 might contribute to the accumulation of vsiRNAs in FgV1-infected F. graminearum IMPORTANCE To increase our understanding of how RNAi components in Fusarium

  15. The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing

    Directory of Open Access Journals (Sweden)

    Adriana F. Fusaro

    2017-10-01

    Full Text Available The plant viral family Luteoviridae is divided into three genera: Luteovirus, Polerovirus and Enamovirus. Without assistance from another virus, members of the family are confined to the cells of the host plant’s vascular system. The first open reading frame (ORF of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs against the plant’s viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV, however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant’s silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant’s anti-viral defense.

  16. An intronic microRNA silences genes that are functionally antagonistic to its host gene.

    Science.gov (United States)

    Barik, Sailen

    2008-09-01

    MicroRNAs (miRNAs) are short noncoding RNAs that down-regulate gene expression by silencing specific target mRNAs. While many miRNAs are transcribed from their own genes, nearly half map within introns of 'host' genes, the significance of which remains unclear. We report that transcriptional activation of apoptosis-associated tyrosine kinase (AATK), essential for neuronal differentiation, also generates miR-338 from an AATK gene intron that silences a family of mRNAs whose protein products are negative regulators of neuronal differentiation. We conclude that an intronic miRNA, transcribed together with the host gene mRNA, may serve the interest of its host gene by silencing a cohort of genes that are functionally antagonistic to the host gene itself.

  17. Prokaryotic Argonautes - variations on the RNA interference theme

    Science.gov (United States)

    van der Oost, John; Swarts, Daan C.; Jore, Matthijs M.

    2014-01-01

    The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes. PMID:28357239

  18. Silencing effect of shRNA expression vectors with stem length of 21 ...

    African Journals Online (AJOL)

    Then, the recombinant plasmids were transfected into mouse embryonic fibroblast with lipofection and injected into leg muscle of mouse. The mRNA expression level of the green fluorescent protein gene was checked by real-time quantitative polymerase chain reaction (RT-PCR). The silencing effect of the 29 bp shRNA ...

  19. Interplays between soil-borne plant viruses and RNA silencing-mediated antiviral defense in roots

    Directory of Open Access Journals (Sweden)

    Ida Bagus Andika

    2016-09-01

    Full Text Available Although the majority of plant viruses are transmitted by arthropod vectors and invade the host plants through the aerial parts, there is a considerable number of plant viruses that infect roots via soil-inhabiting vectors such as plasmodiophorids, chytrids, and nematodes. These soil-borne viruses belong to diverse families, and many of them cause serious diseases in major crop plants. Thus, roots are important organs for the life cycle of many viruses. Compared to shoots, roots have a distinct metabolism and particular physiological characteristics due to the differences in development, cell composition, gene expression patterns, and surrounding environmental conditions. RNA silencing is an important innate defense mechanism to combat virus infection in plants, but the specific information on the activities and molecular mechanism of RNA silencing-mediated viral defense in root tissue is still limited. In this review, we summarize and discuss the current knowledge regarding RNA silencing aspects of the interactions between soil-borne viruses and host plants. Overall, research evidence suggests that soil-borne viruses have evolved to adapt to the distinct mechanism of antiviral RNA silencing in roots.

  20. The Polerovirus F box protein P0 targets ARGONAUTE1 to suppress RNA silencing.

    Science.gov (United States)

    Bortolamiol, Diane; Pazhouhandeh, Maghsoud; Marrocco, Katia; Genschik, Pascal; Ziegler-Graff, Véronique

    2007-09-18

    Plants employ post-transcriptional gene silencing (PTGS) as an antiviral defense response. In this mechanism, viral-derived small RNAs are incorporated into the RNA-induced silencing complex (RISC) to guide degradation of the corresponding viral RNAs. ARGONAUTE1 (AGO1) is a key component of RISC: it carries the RNA slicer activity. As a counter-defense, viruses have evolved various proteins that suppress PTGS. Recently, we showed that the Polerovirus P0 protein carries an F box motif required to form an SCF-like complex, which is also essential for P0's silencing suppressor function. Here, we investigate the molecular mechanism by which P0 impairs PTGS. First we show that P0's expression does not affect the biogenesis of primary siRNAs in an inverted repeat-PTGS assay, but it does affect their activity. Moreover, P0's expression in transformed Arabidopsis plants leads to various developmental abnormalities reminiscent of mutants affected in miRNA pathways, which is accompanied by enhanced levels of several miRNA-target transcripts, suggesting that P0 acts at the level of RISC. Interestingly, ectopic expression of P0 triggered AGO1 protein decay in planta. Finally, we provide evidence that P0 physically interacts with AGO1. Based on these results, we propose that P0 hijacks the host SCF machinery to modulate gene silencing by destabilizing AGO1.

  1. Antisense gene silencing

    DEFF Research Database (Denmark)

    Nielsen, Troels T; Nielsen, Jørgen E

    2013-01-01

    Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...

  2. LncRNA-SNHG16 predicts poor prognosis and promotes tumor proliferation through epigenetically silencing p21 in bladder cancer.

    Science.gov (United States)

    Cao, Xianxiang; Xu, Jing; Yue, Dong

    2018-02-01

    More and more evidences have ensured the crucial functions of long non-coding RNAs (lncRNAs) in multiple tumors. It has been discovered that lncRNA-SNHG16 is involved in many tumors. Even so, it is still necessary to study SNHG16 comprehensively in bladder cancer. In terms of our study, the level of SNHG16 both in the tumor tissues and cell lines was measured and the relationship among SNHG16, clinicopathological traits and prognosis was explored. Interference assays were applied to determine the biological functions of SNHG16. It was discovered that the level of SNHG16 was evidently enhanced both in tissues and cell lines of bladder cancer. Patients with highly expressed SNHG16 suffered from poor overall survival. Multivariable Cox proportional hazards regression analysis implied that highly expressed SNHG16 could be used as an independent prognostic marker. It could be known from functional assays that silenced SNHG16 impaired cell proliferation, owing to the effects of SNHG16 on cell cycle and apoptosis. Finally, mechanism experiments revealed that SNHG16 could epigenetically silence the expression of p21. The facts above pointed out that lncRNA-SNHG16 might be quite vital for the diagnosis and development of bladder cancer, and could even become an important therapeutic target for bladder cancer.

  3. RNA interference inhibits herpes simplex virus type 1 isolated from saliva samples and mucocutaneous lesions.

    Science.gov (United States)

    Silva, Amanda Perse da; Lopes, Juliana Freitas; Paula, Vanessa Salete de

    2014-01-01

    The aim of this study was to evaluate the use of RNA interference to inhibit herpes simplex virus type-1 replication in vitro. For herpes simplex virus type-1 gene silencing, three different small interfering RNAs (siRNAs) targeting the herpes simplex virus type-1 UL39 gene (sequence si-UL 39-1, si-UL 39-2, and si-UL 39-3) were used, which encode the large subunit of ribonucleotide reductase, an essential enzyme for DNA synthesis. Herpes simplex virus type-1 was isolated from saliva samples and mucocutaneous lesions from infected patients. All mucocutaneous lesions' samples were positive for herpes simplex virus type-1 by real-time PCR and by virus isolation; all herpes simplex virus type-1 from saliva samples were positive by real-time PCR and 50% were positive by virus isolation. The levels of herpes simplex virus type-1 DNA remaining after siRNA treatment were assessed by real-time PCR, whose results demonstrated that the effect of siRNAs on gene expression depends on siRNA concentration. The three siRNA sequences used were able to inhibit viral replication, assessed by real-time PCR and plaque assays and among them, the sequence si-UL 39-1 was the most effective. This sequence inhibited 99% of herpes simplex virus type-1 replication. The results demonstrate that silencing herpes simplex virus type-1 UL39 expression by siRNAs effectively inhibits herpes simplex virus type-1 replication, suggesting that siRNA based antiviral strategy may be a potential therapeutic alternative. Copyright © 2014. Published by Elsevier Editora Ltda.

  4. RNA interference prevents lipopolysaccharide-induced preprotachykinin gene expression

    International Nuclear Information System (INIS)

    Lai, Y.-L.; Yu, S.C.; Chen, M.-J.

    2003-01-01

    We showed previously that lipopolysaccharide (LPS) induces noncholinergic airway hyperreactivity to capsaicin via an upregulation of tachykinin synthesis. This study was designed to test whether double-stranded preprotachykinin (ds PPT) RNA, RNA interference (RNAi), prevents the LPS-induced alterations. First, cultured primary nodose ganglial cells of newborn Brown-Norway rats were divided into four groups: control; LPS; LPS+RNAi; and LPS+RNAi+liposome. Second, young Brown-Norway rats for the in vivo study were divided into three groups (control; LPS; and LPS+RNAi), and ds PPT RNA was microinjected bilaterally into the nodose ganglia in the LPS+RNAi group. Then, ganglial cells were collected from the culture whereas the nodose ganglia and lungs were sampled from the animals, and PPT mRNA and substance P (SP) levels were analyzed. Also, airway reactivity to capsaicin was performed in vivo. LPS induced significant increases in PPT mRNA and SP levels in vitro and in vivo and an increase in airway reactivity to capsaicin in vivo. However, ds PPT RNA, but not scrambled RNA, prevented all LPS-induced alterations. The effect of ds PPT RNA was not enhanced by liposome in vitro. Therefore, we demonstrated that the local application of RNAi prevents effectively the activation of the noncholinergic system modulating the lungs/airways

  5. RNA interference and retinoblastoma-related genes are required for repression of endogenous siRNA targets in Caenorhabditis elegans.

    Science.gov (United States)

    Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A

    2008-12-23

    In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans.

  6. RNA Interference in Insect Vectors for Plant Viruses

    OpenAIRE

    Kanakala, Surapathrudu; Ghanim, Murad

    2016-01-01

    Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests...

  7. MicroRNA silencing in primates: towards development of novel therapeutics

    DEFF Research Database (Denmark)

    Petri, Andreas; Lindow, Morten; Kauppinen, Sakari

    2009-01-01

    MicroRNAs (miRNA) comprise an abundant class of small noncoding RNAs that act as important posttranscriptional regulators of gene expression. Accumulating evidence showing that aberrantly expressed miRNAs play important roles in human cancers underscores them as potential targets for therapeutic ...... intervention. Recent reports on efficient miRNA silencing in rodents and nonhuman primates using high-affinity targeting by chemically modified antisense oligonucleotides highlight the utility of such compounds in the development of miRNA-based cancer therapeutics....

  8. Aedes aegypti uses RNA interference in defense against Sindbis virus infection.

    Science.gov (United States)

    Campbell, Corey L; Keene, Kimberly M; Brackney, Douglas E; Olson, Ken E; Blair, Carol D; Wilusz, Jeffrey; Foy, Brian D

    2008-03-17

    RNA interference (RNAi) is an important anti-viral defense mechanism. The Aedes aegypti genome encodes RNAi component orthologs, however, most populations of this mosquito are readily infected by, and subsequently transmit flaviviruses and alphaviruses. The goal of this study was to use Ae. aegypti as a model system to determine how the mosquito's anti-viral RNAi pathway interacts with recombinant Sindbis virus (SINV; family Togaviridae, genus Alphavirus). SINV (TR339-eGFP) (+) strand RNA, infectious virus titers and infection rates transiently increased in mosquitoes following dsRNA injection to cognate Ago2, Dcr2, or TSN mRNAs. Detection of SINV RNA-derived small RNAs at 2 and 7 days post-infection in non-silenced mosquitoes provided important confirmation of RNAi pathway activity. Two different recombinant SINV viruses (MRE16-eGFP and TR339-eGFP) with significant differences in infection kinetics were used to delineate vector/virus interactions in the midgut. We show virus-dependent effects on RNAi component transcript and protein levels during infection. Monitoring midgut Ago2, Dcr2, and TSN transcript levels during infection revealed that only TSN transcripts were significantly increased in midguts over blood-fed controls. Ago2 protein levels were depleted immediately following a non-infectious bloodmeal and varied during SINV infection in a virus-dependent manner. We show that silencing RNAi components in Ae. aegypti results in transient increases in SINV replication. Furthermore, Ae. aegypti RNAi is active during SINV infection as indicated by production of virus-specific siRNAs. Lastly, the RNAi response varies in a virus-dependent manner. These data define important features of RNAi anti-viral defense in Ae. aegypti.

  9. Double-stranded RNA interferes in a sequence-specific manner with the infection of representative members of the two viroid families

    International Nuclear Information System (INIS)

    Carbonell, Alberto; Martinez de Alba, Angel-Emilio; Flores, Ricardo; Gago, Selma

    2008-01-01

    Infection by viroids, non-protein-coding circular RNAs, occurs with the accumulation of 21-24 nt viroid-derived small RNAs (vd-sRNAs) with characteristic properties of small interfering RNAs (siRNAs) associated to RNA silencing. The vd-sRNAs most likely derive from dicer-like (DCL) enzymes acting on viroid-specific dsRNA, the key elicitor of RNA silencing, or on the highly structured genomic RNA. Previously, viral dsRNAs delivered mechanically or agroinoculated have been shown to interfere with virus infection in a sequence-specific manner. Here, we report similar results with members of the two families of nuclear- and chloroplast-replicating viroids. Moreover, homologous vd-sRNAs co-delivered mechanically also interfered with one of the viroids examined. The interference was sequence-specific, temperature-dependent and, in some cases, also dependent on the dose of the co-inoculated dsRNA or vd-sRNAs. The sequence-specific nature of these effects suggests the involvement of the RNA induced silencing complex (RISC), which provides sequence specificity to RNA silencing machinery. Therefore, viroid titer in natural infections might be regulated by the concerted action of DCL and RISC. Viroids could have evolved their secondary structure as a compromise between resistance to DCL and RISC, which act preferentially against RNAs with compact and relaxed secondary structures, respectively. In addition, compartmentation, association with proteins or active replication might also help viroids to elude their host RNA silencing machinery

  10. RNA interference for performance enhancement and detection in doping control.

    Science.gov (United States)

    Kohler, Maxie; Schänzer, Wilhelm; Thevis, Mario

    2011-10-01

    RNA interference represents a comparably new route of regulating and manipulating specific gene expression. Promising results were obtained in experimental therapies aim at the treatment of different kinds of diseases including cancer, diabetes mellitus or Dychenne muscular dystrophy. While studies on down-regulation efficiency are often performed by analyzing the regulated protein, the direct detection of small, interfering RNA molecules and antisense oligonucleotides is of great interest for the investigation of the metabolism and degradation and also for the detection of a putative misuse of these molecules in sports. Myostatin down-regulation was shown to result in increased performance and muscle growth and the regulation of several other proteins could be relevant for performance enhancement. This mini-review summarizes current approaches for the mass spectrometric analysis of siRNA and antisense oligonucleotides from biological matrices and the available data on biodistribution, metabolism, and half-life of relevant substances are discussed. Copyright © 2011 John Wiley & Sons, Ltd.

  11. MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense

    Directory of Open Access Journals (Sweden)

    Sheng-Rui Liu

    2017-09-01

    Full Text Available MicroRNAs (miRNAs are non-coding RNAs of approximately 20–24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant–pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense mechanism. Here, we summarize the current knowledge and recent advances in understanding the roles of miRNAs involved in the plant defense against viruses and viral counter-defense. We also document the application of miRNAs in plant antiviral defense. This review discusses the current understanding of the mechanisms of miRNA-mediated gene silencing and provides insights on the never-ending arms race between plants and viruses.

  12. Characterization of the RNA silencing suppression activity of the Ebola virus VP35 protein in plants and mammalian cells.

    Science.gov (United States)

    Zhu, Yali; Cherukuri, Nil Celebi; Jackel, Jamie N; Wu, Zetang; Crary, Monica; Buckley, Kenneth J; Bisaro, David M; Parris, Deborah S

    2012-03-01

    Ebola virus (EBOV) causes a lethal hemorrhagic fever for which there is no approved effective treatment or prevention strategy. EBOV VP35 is a virulence factor that blocks innate antiviral host responses, including the induction of and response to alpha/beta interferon. VP35 is also an RNA silencing suppressor (RSS). By inhibiting microRNA-directed silencing, mammalian virus RSSs have the capacity to alter the cellular environment to benefit replication. A reporter gene containing specific microRNA target sequences was used to demonstrate that prior expression of wild-type VP35 was able to block establishment of microRNA silencing in mammalian cells. In addition, wild-type VP35 C-terminal domain (CTD) protein fusions were shown to bind small interfering RNA (siRNA). Analysis of mutant proteins demonstrated that reporter activity in RSS assays did not correlate with their ability to antagonize double-stranded RNA (dsRNA)-activated protein kinase R (PKR) or bind siRNA. The results suggest that enhanced reporter activity in the presence of VP35 is a composite of nonspecific translational enhancement and silencing suppression. Moreover, most of the specific RSS activity in mammalian cells is RNA binding independent, consistent with VP35's proposed role in sequestering one or more silencing complex proteins. To examine RSS activity in a system without interferon, VP35 was tested in well-characterized plant silencing suppression assays. VP35 was shown to possess potent plant RSS activity, and the activities of mutant proteins correlated strongly, but not exclusively, with RNA binding ability. The results suggest the importance of VP35-protein interactions in blocking silencing in a system (mammalian) that cannot amplify dsRNA.

  13. RNA interference of carboxyesterases causes nymph mortality in the Asian citrus psyllid, Diaphorina citri.

    Science.gov (United States)

    Kishk, Abdelaziz; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Gowda, Siddarame; Killiny, Nabil

    2017-03-01

    Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is an important pest of citrus. In addition, D. citri is the vector of Huanglongbing, a destructive disease in citrus, also known as citrus greening disease caused by Candidatus Liberibacter asiaticus. Huanglongbing causes huge losses for citrus industries. Insecticide application for D. citri is the major strategy to prevent disease spread. The heavy use of insecticides causes development of insecticide resistance. We used RNA interference (RNAi) to silence genes implicated in pesticide resistance in order to increase the susceptibility. The activity of dsRNA to reduce the expression of carboxyesterases including esterases FE4 (EstFE4) and acetylcholinesterases (AChe) in D. citri was investigated. The dsRNA was applied topically to the fourth and fifth instars of nymphs. We targeted several EstFE4 and AChe genes using dsRNA against a consensus sequence for each of them. Five concentrations (25, 50, 75, 100, 125 ng/μl) from both dsRNAs were used. The treatments with the dsRNA caused concentration dependent nymph mortality. The highest gene expression levels of both AChe and EstFE4 were found in the fourth and fifth nymphal instars. Gene expression analysis showed that AChe genes were downregulated in emerged adults from dsRNA-AChe-treated nymphs compared to controls. However, EstFE4 genes were not affected. In the same manner, treatment with dsRNA-EstFE4 reduced expression level of EstFE4 genes in emerged adults from treated nymphs, but did not affect the expression of AChe genes. In the era of environmentally friendly control strategies, RNAi is a new promising venue to reduce pesticide applications. © 2017 Wiley Periodicals, Inc.

  14. HIV-1 RNAs are Not Part of the Argonaute 2 Associated RNA Interference Pathway in Macrophages.

    Directory of Open Access Journals (Sweden)

    Valentina Vongrad

    Full Text Available MiRNAs and other small noncoding RNAs (sncRNAs are key players in post-transcriptional gene regulation. HIV-1 derived small noncoding RNAs (sncRNAs have been described in HIV-1 infected cells, but their biological functions still remain to be elucidated. Here, we approached the question whether viral sncRNAs may play a role in the RNA interference (RNAi pathway or whether viral mRNAs are targeted by cellular miRNAs in human monocyte derived macrophages (MDM.The incorporation of viral sncRNAs and/or their target RNAs into RNA-induced silencing complex was investigated using photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP as well as high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation (HITS-CLIP, which capture Argonaute2-bound miRNAs and their target RNAs. HIV-1 infected monocyte-derived macrophages (MDM were chosen as target cells, as they have previously been shown to express HIV-1 sncRNAs. In addition, we applied small RNA deep sequencing to study differential cellular miRNA expression in HIV-1 infected versus non-infected MDMs.PAR-CLIP and HITS-CLIP data demonstrated the absence of HIV-1 RNAs in Ago2-RISC, although the presence of a multitude of HIV-1 sncRNAs in HIV-1 infected MDMs was confirmed by small RNA sequencing. Small RNA sequencing revealed that 1.4% of all sncRNAs were of HIV-1 origin. However, neither HIV-1 derived sncRNAs nor putative HIV-1 target sequences incorporated into Ago2-RISC were identified suggesting that HIV-1 sncRNAs are not involved in the canonical RNAi pathway nor is HIV-1 targeted by this pathway in HIV-1 infected macrophages.

  15. PLK-1 Silencing in Bladder Cancer by siRNA Delivered With Exosomes.

    Science.gov (United States)

    Greco, Kristin A; Franzen, Carrie A; Foreman, Kimberly E; Flanigan, Robert C; Kuo, Paul C; Gupta, Gopal N

    2016-05-01

    To use exosomes as a vector to deliver small interfering ribonucleic acid (siRNA) to silence the polo-like kinase 1 (PLK-1) gene in bladder cancer cells. Exosomes were isolated from both human embryonic kidney 293 (HEK293) cell and mesenchymal stem cell (MSC) conditioned media. Fluorescently labeled exosomes were co-cultured with bladder cancer and normal epithelial cells and uptake was quantified by image cytometry. PLK-1 siRNA and negative control siRNA were loaded into HEK293 and MSC exosomes using electroporation. An invasive bladder cancer cell line (UMUC3) was co-cultured with the electroporated exosomes. Quantitative reverse transcriptase polymerase chain reaction was performed. Protein analysis was performed by Western blot. Annexin V staining and MTT assays were used to investigate effects on apoptosis and viability. Bladder cancer cell lines internalize an increased percentage of HEK293 exosomes when compared to normal bladder epithelial cells. Treatment of UMUC3 cells with exosomes electroporated with PLK-1 siRNA achieved successful knockdown of PLK-1 mRNA and protein when compared to cells treated with negative control exosomes. HEK293 and MSC exosomes were effectively used as a delivery vector to transport PLK-1 siRNA to bladder cancer cells in vitro, resulting in selective gene silencing of PLK-1. The use of exosomes as a delivery vector for potential intravesical therapy is attractive. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Nanosystems based on siRNA silencing HuR expression counteract diabetic retinopathy in rat.

    Science.gov (United States)

    Amadio, Marialaura; Pascale, Alessia; Cupri, Sarha; Pignatello, Rosario; Osera, Cecilia; D Agata, Velia; D Amico, Agata Grazia; Leggio, Gian Marco; Ruozi, Barbara; Govoni, Stefano; Drago, Filippo; Bucolo, Claudio

    2016-09-01

    We evaluated whether specifically and directly targeting human antigen R (HuR), a member of embryonic lethal abnormal vision (ELAV) proteins family, may represent a new potential therapeutic strategy to manage diabetic retinopathy. Nanosystems loaded with siRNA silencing HuR expression (lipoplexes), consisting of solid lipid nanoparticles (SLN) and liposomes (SUV) were prepared. Photon correlation spectroscopy analysis, Zeta potential measurement and atomic force microscopy (AFM) studies were carried out to characterize the complexation of siRNA with the lipid nanocarriers. Nanosystems were evaluated by using AFM and scanning electron microscopy. The lipoplexes were injected into the eye of streptozotocin (STZ)-induced diabetic rats. Retinal HuR and VEGF levels were detected by Western blot and ELISA, respectively. Retinal histology was also carried out. The results demonstrated that retinal HuR and VEGF are significantly increased in STZ-rats and are blunted by HuR siRNA treatment. Lipoplexes with a weak positive surface charge and with a 4:1 N/P (cationic lipid nitrogen to siRNA phosphate) ratio exert a better transfection efficiency, significantly dumping retinal HuR and VEGF levels. In conclusion, we demonstrated that siRNA can be efficiently delivered into the rat retina using lipid-based nanocarriers, and some of the lipoplexes loaded with siRNA silencing HuR expression are potential candidates to manage retinal diseases. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. High-throughput sequencing of RNA silencing-associated small RNAs in olive (Olea europaea L..

    Directory of Open Access Journals (Sweden)

    Livia Donaire

    Full Text Available Small RNAs (sRNAs of 20 to 25 nucleotides (nt in length maintain genome integrity and control gene expression in a multitude of developmental and physiological processes. Despite RNA silencing has been primarily studied in model plants, the advent of high-throughput sequencing technologies has enabled profiling of the sRNA component of more than 40 plant species. Here, we used deep sequencing and molecular methods to report the first inventory of sRNAs in olive (Olea europaea L.. sRNA libraries prepared from juvenile and adult shoots revealed that the 24-nt class dominates the sRNA transcriptome and atypically accumulates to levels never seen in other plant species, suggesting an active role of heterochromatin silencing in the maintenance and integrity of its large genome. A total of 18 known miRNA families were identified in the libraries. Also, 5 other sRNAs derived from potential hairpin-like precursors remain as plausible miRNA candidates. RNA blots confirmed miRNA expression and suggested tissue- and/or developmental-specific expression patterns. Target mRNAs of conserved miRNAs were computationally predicted among the olive cDNA collection and experimentally validated through endonucleolytic cleavage assays. Finally, we use expression data to uncover genetic components of the miR156, miR172 and miR390/TAS3-derived trans-acting small interfering RNA (tasiRNA regulatory nodes, suggesting that these interactive networks controlling developmental transitions are fully operational in olive.

  18. RNA interference: Applications and advances in insect toxicology and insect pest management.

    Science.gov (United States)

    Kim, Young Ho; Soumaila Issa, Moustapha; Cooper, Anastasia M W; Zhu, Kun Yan

    2015-05-01

    Since its discovery, RNA interference (RNAi) has revolutionized functional genomic studies due to its sequence-specific nature of post-transcriptional gene silencing. In this paper, we provide a comprehensive review of the recent literature and summarize the current knowledge and advances in the applications of RNAi technologies in the field of insect toxicology and insect pest management. Many recent studies have focused on identification and validation of the genes encoding insecticide target proteins, such as acetylcholinesterases, ion channels, Bacillus thuringiensis receptors, and other receptors in the nervous system. RNAi technologies have also been widely applied to reveal the role of genes encoding cytochrome P450 monooxygenases, carboxylesterases, and glutathione S-transferases in insecticide detoxification and resistance. More recently, studies have focused on understanding the mechanism of insecticide-mediated up-regulation of detoxification genes in insects. As RNAi has already shown great potentials for insect pest management, many recent studies have also focused on host-induced gene silencing, in which several RNAi-based transgenic plants have been developed and tested as proof of concept for insect pest management. These studies indicate that RNAi is a valuable tool to address various fundamental questions in insect toxicology and may soon become an effective strategy for insect pest management. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Increased RNA-induced silencing complex (RISC) activity contributes to hepatocellular carcinoma.

    Science.gov (United States)

    Yoo, Byoung Kwon; Santhekadur, Prasanna K; Gredler, Rachel; Chen, Dong; Emdad, Luni; Bhutia, Sujit; Pannell, Lewis; Fisher, Paul B; Sarkar, Devanand

    2011-05-01

    There is virtually no effective treatment for advanced hepatocellular carcinoma (HCC) and novel targets need to be identified to develop effective treatment. We recently documented that the oncogene Astrocyte elevated gene-1 (AEG-1) plays a seminal role in hepatocarcinogenesis. Employing yeast two-hybrid assay and coimmunoprecipitation followed by mass spectrometry, we identified staphylococcal nuclease domain containing 1 (SND1), a nuclease in the RNA-induced silencing complex (RISC) facilitating RNAi-mediated gene silencing, as an AEG-1 interacting protein. Coimmunoprecipitation and colocalization studies confirmed that AEG-1 is also a component of RISC and both AEG-1 and SND1 are required for optimum RISC activity facilitating small interfering RNA (siRNA) and micro RNA (miRNA)-mediated silencing of luciferase reporter gene. In 109 human HCC samples SND1 was overexpressed in ≈74% cases compared to normal liver. Correspondingly, significantly higher RISC activity was observed in human HCC cells compared to immortal normal hepatocytes. Increased RISC activity, conferred by AEG-1 or SND1, resulted in increased degradation of tumor suppressor messenger RNAs (mRNAs) that are target of oncomiRs. Inhibition of enzymatic activity of SND1 significantly inhibited proliferation of human HCC cells. As a corollary, stable overexpression of SND1 augmented and siRNA-mediated inhibition of SND1 abrogated growth of human HCC cells in vitro and in vivo, thus revealing a potential role of SND1 in hepatocarcinogenesis. We unravel a novel mechanism that overexpression of AEG-1 and SND1 leading to increased RISC activity might contribute to hepatocarcinogenesis. Targeted inhibition of SND1 enzymatic activity might be developed as an effective therapy for HCC. Copyright © 2011 American Association for the Study of Liver Diseases.

  20. Characterization of the TRBP domain required for Dicer interaction and function in RNA interference

    Directory of Open Access Journals (Sweden)

    El Far Mohamed

    2009-05-01

    Full Text Available Abstract Background Dicer, Ago2 and TRBP are the minimum components of the human RNA-induced silencing complex (RISC. While Dicer and Ago2 are RNases, TRBP is the double-stranded RNA binding protein (dsRBP that loads small interfering RNA into the RISC. TRBP binds directly to Dicer through its C-terminal domain. Results We show that the TRBP binding site in Dicer is a 165 amino acid (aa region located between the ATPase and the helicase domains. The binding site in TRBP is a 69 aa domain, called C4, located at the C-terminal end of TRBP. The TRBP1 and TRBP2 isoforms, but not TRBPs lacking the C4 site (TRBPsΔC4, co-immunoprecipitated with Dicer. The C4 domain is therefore necessary to bind Dicer, irrespective of the presence of RNA. Immunofluorescence shows that while full-length TRBPs colocalize with Dicer, TRBPsΔC4 do not. tarbp2-/- cells, which do not express TRBP, do not support RNA interference (RNAi mediated by short hairpin or micro RNAs against EGFP. Both TRBPs, but not TRBPsΔC4, were able to rescue RNAi function. In human cells with low RNAi activity, addition of TRBP1 or 2, but not TRBPsΔC4, rescued RNAi function. Conclusion The mapping of the interaction sites between TRBP and Dicer show unique domains that are required for their binding. Since TRBPsΔC4 do not interact or colocalize with Dicer, we suggest that TRBP and Dicer, both dsRBPs, do not interact through bound dsRNA. TRBPs, but not TRBPsΔC4, rescue RNAi activity in RNAi-compromised cells, indicating that the binding of Dicer to TRBP is critical for RNAi function.

  1. Silencing of the HER2/neu Gene by siRNA Inhibits Proliferation and Induces Apoptosis in HER2/neu-Overexpressing Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Timo Faltus

    2004-11-01

    Full Text Available In eukaryotes, double-stranded (ds RNA induces sequence-specific inhibition of gene expression referred to as RNA interference (RNAi. We exploited RNAi to define the role of HER2/neu in the neoplastic proliferation of human breast cancer cells. We transfected SK-BR-3, BT-474, MCF-7, and MDA-MB-468 breast cancer cells with short interfering RNA (siRNA targeted against human HER2/neu and analyzed the specific inhibition of HER2/neu expression by Northern and Western blots. Transfection with HER2/neu-specific siRNA resulted in a sequence-specific decrease in HER2/neu mRNA and protein levels. Moreover, transfection with HER2/neu siRNA caused cell cycle arrest at G0/G1 in the breast cancer cell lines SKBR-3 and BT-474, consistent with a powerful RNA silencing effect. siRNA treatment resulted in an antiproliferative and apoptotic response in cells overexpressing HER2/neu, but had no influence in cells with almost no expression of HER2/neu proteins like MDA-MB-468 cells. These data indicate that HER2/neu function is essential for the proliferation of HER2/neuoverexpressing breast cancer cells. Our observations suggest that siRNA targeted against human HER2/neu may be valuable tools as anti proliferative agents that display activity against neoplastic cells at very low doses.

  2. Specific RNA Interference in Caenorhabditis elegans by Ingested dsRNA Expressed in Bacillus subtilis

    NARCIS (Netherlands)

    Lezzerini, M.; van de Ven, K.; Veerman, M.; Brul, S.; Budovskaya, Y.V.

    2015-01-01

    In nematodes, genome-wide RNAi-screening has been widely used as a rapid and efficient method to identify genes involved in the aging processes. By far the easiest way of inducing RNA interference (RNAi) in Caenorhabditis elegans is by feeding Escherichia coli that expresses specific double stranded

  3. RNA interference targets arbovirus replication in Culicoides cells.

    Science.gov (United States)

    Schnettler, Esther; Ratinier, Maxime; Watson, Mick; Shaw, Andrew E; McFarlane, Melanie; Varela, Mariana; Elliott, Richard M; Palmarini, Massimo; Kohl, Alain

    2013-03-01

    Arboviruses are transmitted to vertebrate hosts by biting arthropod vectors such as mosquitoes, ticks, and midges. These viruses replicate in both arthropods and vertebrates and are thus exposed to different antiviral responses in these organisms. RNA interference (RNAi) is a sequence-specific RNA degradation mechanism that has been shown to play a major role in the antiviral response against arboviruses in mosquitoes. Culicoides midges are important vectors of arboviruses, known to transmit pathogens of humans and livestock such as bluetongue virus (BTV) (Reoviridae), Oropouche virus (Bunyaviridae), and likely the recently discovered Schmallenberg virus (Bunyaviridae). In this study, we investigated whether Culicoides cells possess an antiviral RNAi response and whether this is effective against arboviruses, including those with double-stranded RNA (dsRNA) genomes, such as BTV. Using reporter gene-based assays, we established the presence of a functional RNAi response in Culicoides sonorensis-derived KC cells which is effective in inhibiting BTV infection. Sequencing of small RNAs from KC and Aedes aegypti-derived Aag2 cells infected with BTV or the unrelated Schmallenberg virus resulted in the production of virus-derived small interfering RNAs (viRNAs) of 21 nucleotides, similar to the viRNAs produced during arbovirus infections of mosquitoes. In addition, viRNA profiles strongly suggest that the BTV dsRNA genome is accessible to a Dicer-type nuclease. Thus, we show for the first time that midge cells target arbovirus replication by mounting an antiviral RNAi response mainly resembling that of other insect vectors of arboviruses.

  4. PhOBF1, a petunia ocs element binding factor, plays an important role in antiviral RNA silencing.

    Science.gov (United States)

    Sun, Daoyang; Li, Shaohua; Niu, Lixin; Reid, Michael S; Zhang, Yanlong; Jiang, Cai-Zhong

    2017-02-01

    Virus-induced gene silencing (VIGS) is a common reverse genetics strategy for characterizing the function of genes in plants. The detailed mechanism governing RNA silencing efficiency triggered by viruses is largely unclear. Here, we reveal that a petunia (Petunia hybrida) ocs element binding factor, PhOBF1, one of the basic leucine zipper (bZIP) transcription factors, was up-regulated by Tobacco rattle virus (TRV) infection. Simultaneous silencing of PhOBF1 and a reporter gene, phytoene desaturase (PDS) or chalcone synthase (CHS), by TRV-based VIGS led to a failure of the development of leaf photobleaching or the white-corollas phenotype. PhOBF1 silencing caused down-regulation of RNA silencing-related genes, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonautes (AGOs). After inoculation with the TRV-PhPDS, PhOBF1-RNAi lines exhibited a substantially impaired PDS silencing efficiency, whereas overexpression of PhOBF1 resulted in a recovery of the silencing phenotype (photobleaching) in systemic leaves. A compromised resistance to TRV and Tobacco mosaic virus was found in PhOBF1-RNAi lines, while PhOBF1-overexpressing lines displayed an enhanced resistance to their infections. Compared with wild-type plants, PhOBF1-silenced plants accumulated lower levels of free salicylic acid (SA), salicylic acid glucoside, and phenylalanine, contrarily to higher levels of those in plants overexpressing PhOBF1. Furthermore, transcripts of a number of genes associated with the shikimate and phenylpropanoid pathways were decreased or increased in PhOBF1-RNAi or PhOBF1-overexpressing lines, respectively. Taken together, the data suggest that PhOBF1 regulates TRV-induced RNA silencing efficiency through modulation of RDRs, DCLs, and AGOs mediated by the SA biosynthesis pathway. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  5. A petunia ethylene-responsive element binding factor, PhERF2, plays an important role in antiviral RNA silencing.

    Science.gov (United States)

    Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong

    2016-05-01

    Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  6. Identification of a novel Drosophila gene, beltless, using injectable embryonic and adult RNA interference (RNAi

    Directory of Open Access Journals (Sweden)

    Manev Hari

    2003-08-01

    Full Text Available Abstract Background RNA interference (RNAi is a process triggered by a double-stranded RNA that leads to targeted down-regulation/silencing of gene expression and can be used for functional genomics; i.e. loss-of-function studies. Here we report on the use of RNAi in the identification of a developmentally important novel Drosophila (fruit fly gene (corresponding to a putative gene CG5652/GM06434, that we named beltless based on an embryonic loss-of-function phenotype. Results Beltless mRNA is expressed in all developmental stages except in 0–6 h embryos. In situ RT-PCR localized beltless mRNA in the ventral cord and brain of late stage embryos and in the nervous system, ovaries, and the accessory glands of adult flies. RNAi was induced by injection of short (22 bp beltless double-stranded RNAs into embryos or into adult flies. Embryonic RNAi altered cuticular phenotypes ranging from partially-formed to missing denticle belts (thus beltless of the abdominal segments A2–A4. Embryonic beltless RNAi was lethal. Adult RNAi resulted in the shrinkage of the ovaries by half and reduced the number of eggs laid. We also examined Df(1RK4 flies in which deletion removes 16 genes, including beltless. In some embryos, we observed cuticular abnormalities similar to our findings with beltless RNAi. After differentiating Df(1RK4 embryos into those with visible denticle belts and those missing denticle belts, we assayed the presence of beltless mRNA; no beltless mRNA was detectable in embryos with missing denticle belts. Conclusions We have identified a developmentally important novel Drosophila gene, beltless, which has been characterized in loss-of-function studies using RNA interference. The putative beltless protein shares homologies with the C. elegans nose resistant to fluoxetine (NRF NRF-6 gene, as well as with several uncharacterized C. elegans and Drosophila melanogaster genes, some with prominent acyltransferase domains. Future studies should

  7. Cooler temperatures destabilize RNA interference and increase susceptibility of disease vector mosquitoes to viral infection.

    Directory of Open Access Journals (Sweden)

    Zach N Adelman

    Full Text Available The impact of global climate change on the transmission dynamics of infectious diseases is the subject of extensive debate. The transmission of mosquito-borne viral diseases is particularly complex, with climatic variables directly affecting many parameters associated with the prevalence of disease vectors. While evidence shows that warmer temperatures often decrease the extrinsic incubation period of an arthropod-borne virus (arbovirus, exposure to cooler temperatures often predisposes disease vector mosquitoes to higher infection rates. RNA interference (RNAi pathways are essential to antiviral immunity in the mosquito; however, few experiments have explored the effects of temperature on the RNAi machinery.We utilized transgenic "sensor" strains of Aedes aegypti to examine the role of temperature on RNA silencing. These "sensor" strains express EGFP only when RNAi is inhibited; for example, after knockdown of the effector proteins Dicer-2 (DCR-2 or Argonaute-2 (AGO-2. We observed an increase in EGFP expression in transgenic sensor mosquitoes reared at 18°C as compared with 28°C. Changes in expression were dependent on the presence of an inverted repeat with homology to a portion of the EGFP sequence, as transgenic strains lacking this sequence, the double stranded RNA (dsRNA trigger for RNAi, showed no change in EGFP expression when reared at 18°C. Sequencing small RNAs in sensor mosquitoes reared at low temperature revealed normal processing of dsRNA substrates, suggesting the observed deficiency in RNAi occurs downstream of DCR-2. Rearing at cooler temperatures also predisposed mosquitoes to higher levels of infection with both chikungunya and yellow fever viruses.This data suggest that microclimates, such as those present in mosquito breeding sites, as well as more general climactic variables may influence the dynamics of mosquito-borne viral diseases by affecting the antiviral immunity of disease vectors.

  8. Gene silencing activity of siRNA polyplexes based on thiolated N,N,N-trimethylated chitosan.

    Science.gov (United States)

    Varkouhi, Amir K; Verheul, Rolf J; Schiffelers, Raymond M; Lammers, Twan; Storm, Gert; Hennink, Wim E

    2010-12-15

    N,N,N-Trimethylated chitosan (TMC) is a biodegradable polymer emerging as a promising nonviral vector for nucleic acid and protein delivery. In the present study, we investigated whether the introduction of thiol groups in TMC enhances the extracellular stability of the complexes based on this polymer and promotes the intracellular release of siRNA. The gene silencing activity and the cellular cytotoxicity of polyplexes based on thiolated TMC were compared with those based on the nonthiolated counterpart and the regularly used lipidic transfection agent Lipofectamine. Incubation of H1299 human lung cancer cells expressing firefly luciferase with siRNA/thiolated TMC polyplexes resulted in 60-80% gene silencing activity, whereas complexes based on nonthiolated TMC showed less silencing (40%). The silencing activity of the complexes based on Lipofectamine 2000 was about 60-70%. Importantly, the TMC-SH polyplexes retained their silencing activity in the presence of hyaluronic acid, while nonthiolated TMC polyplexes hardly showed any silencing activity, demonstrating their stability against competing anionic macromolecules. Under the experimental conditions tested, the cytotoxicity of the thiolated and nonthiolated siRNA complexes was lower than those based on Lipofectamine. Given the good extracellular stability and good silencing activity, it is concluded that polyplexes based on TMC-SH are attractive systems for further in vivo evaluations.

  9. The P0 protein encoded by cotton leafroll dwarf virus (CLRDV) inhibits local but not systemic RNA silencing.

    Science.gov (United States)

    Delfosse, Verónica C; Agrofoglio, Yamila C; Casse, María F; Kresic, Iván Bonacic; Hopp, H Esteban; Ziegler-Graff, Véronique; Distéfano, Ana J

    2014-02-13

    Plants employ RNA silencing as a natural defense mechanism against viruses. As a counter-defense, viruses encode silencing suppressor proteins (SSPs) that suppress RNA silencing. Most, but not all, the P0 proteins encoded by poleroviruses have been identified as SSP. In this study, we demonstrated that cotton leafroll dwarf virus (CLRDV, genus Polerovirus) P0 protein suppressed local silencing that was induced by sense or inverted repeat transgenes in Agrobacterium co-infiltration assay in Nicotiana benthamiana plants. A CLRDV full-length infectious cDNA clone that is able to infect N. benthamiana through Agrobacterium-mediated inoculation also inhibited local silencing in co-infiltration assays, suggesting that the P0 protein exhibits similar RNA silencing suppression activity when expressed from the full-length viral genome. On the other hand, the P0 protein did not efficiently inhibit the spread of systemic silencing signals. Moreover, Northern blotting indicated that the P0 protein inhibits the generation of secondary but not primary small interfering RNAs. The study of CLRDV P0 suppression activity may contribute to understanding the molecular mechanisms involved in the induction of cotton blue disease by CLRDV infection. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. The microRNA and messengerRNA profile of the RNA-induced silencing complex in human primary astrocyte and astrocytoma cells.

    Science.gov (United States)

    Moser, Joanna J; Fritzler, Marvin J

    2010-10-18

    GW/P bodies are cytoplasmic ribonucleoprotein-rich foci involved in microRNA (miRNA)-mediated messenger RNA (mRNA) silencing and degradation. The mRNA regulatory functions within GW/P bodies are mediated by GW182 and its binding partner hAgo2 that bind miRNA in the RNA-induced silencing complex (RISC). To date there are no published reports of the profile of miRNA and mRNA targeted to the RISC or a comparison of the RISC-specific miRNA/mRNA profile differences in malignant and non-malignant cells. RISC mRNA and miRNA components were profiled by microarray analysis of malignant human U-87 astrocytoma cells and its non-malignant counterpart, primary human astrocytes. Total cell RNA as well as RNA from immunoprecipitated RISC was analyzed. The novel findings were fourfold: (1) miRNAs were highly enriched in astrocyte RISC compared to U-87 astrocytoma RISC, (2) astrocytoma and primary astrocyte cells each contained unique RISC miRNA profiles as compared to their respective cellular miRNA profiles, (3) miR-195, 10b, 29b, 19b, 34a and 455-3p levels were increased and the miR-181b level was decreased in U-87 astrocytoma RISC as compared to astrocyte RISC, and (4) the RISC contained decreased levels of mRNAs in primary astrocyte and U-87 astrocytoma cells. The observation that miR-34a and miR-195 levels were increased in the RISC of U-87 astrocytoma cells suggests an oncogenic role for these miRNAs. Differential regulation of mRNAs by specific miRNAs is evidenced by the observation that three miR34a-targeted mRNAs and two miR-195-targeted mRNAs were downregulated while one miR-195-targeted mRNA was upregulated. Biological pathway analysis of RISC mRNA components suggests that the RISC plays a pivotal role in malignancy and other conditions. This study points to the importance of the RISC and ultimately GW/P body composition and function in miRNA and mRNA deregulation in astrocytoma cells and possibly in other malignancies.

  11. The microRNA and messengerRNA profile of the RNA-induced silencing complex in human primary astrocyte and astrocytoma cells.

    Directory of Open Access Journals (Sweden)

    Joanna J Moser

    2010-10-01

    Full Text Available GW/P bodies are cytoplasmic ribonucleoprotein-rich foci involved in microRNA (miRNA-mediated messenger RNA (mRNA silencing and degradation. The mRNA regulatory functions within GW/P bodies are mediated by GW182 and its binding partner hAgo2 that bind miRNA in the RNA-induced silencing complex (RISC. To date there are no published reports of the profile of miRNA and mRNA targeted to the RISC or a comparison of the RISC-specific miRNA/mRNA profile differences in malignant and non-malignant cells.RISC mRNA and miRNA components were profiled by microarray analysis of malignant human U-87 astrocytoma cells and its non-malignant counterpart, primary human astrocytes. Total cell RNA as well as RNA from immunoprecipitated RISC was analyzed. The novel findings were fourfold: (1 miRNAs were highly enriched in astrocyte RISC compared to U-87 astrocytoma RISC, (2 astrocytoma and primary astrocyte cells each contained unique RISC miRNA profiles as compared to their respective cellular miRNA profiles, (3 miR-195, 10b, 29b, 19b, 34a and 455-3p levels were increased and the miR-181b level was decreased in U-87 astrocytoma RISC as compared to astrocyte RISC, and (4 the RISC contained decreased levels of mRNAs in primary astrocyte and U-87 astrocytoma cells.The observation that miR-34a and miR-195 levels were increased in the RISC of U-87 astrocytoma cells suggests an oncogenic role for these miRNAs. Differential regulation of mRNAs by specific miRNAs is evidenced by the observation that three miR34a-targeted mRNAs and two miR-195-targeted mRNAs were downregulated while one miR-195-targeted mRNA was upregulated. Biological pathway analysis of RISC mRNA components suggests that the RISC plays a pivotal role in malignancy and other conditions. This study points to the importance of the RISC and ultimately GW/P body composition and function in miRNA and mRNA deregulation in astrocytoma cells and possibly in other malignancies.

  12. Resistance to Sri Lankan Cassava Mosaic Virus (SLCMV) in Genetically Engineered Cassava cv. KU50 through RNA Silencing

    KAUST Repository

    Ntui, Valentine Otang

    2015-04-22

    Cassava ranks fifth among the starch producing crops of the world, its annual bioethanol yield is higher than for any other crop. Cassava cultivar KU50, the most widely grown cultivar for non-food purposes is susceptible to Sri Lankan cassava mosaic virus (SLCMV). The objective of this work was to engineer resistance to SLCMV by RNA interference (RNAi) in order to increase biomass yield, an important aspect for bioethanol production. Here, we produced transgenic KU50 lines expressing dsRNA homologous to the region between the AV2 and AV1 of DNA A of SLCMV. High level expression of dsRNA of SLCMV did not induce any growth abnormality in the transgenic plants. Transgenic lines displayed high levels of resistance to SLCMV compared to the wild-type plants and no virus load could be detected in uninoculated new leaves of the infected resistant lines after PCR amplification and RT-PCR analysis. The agronomic performance of the transgenic lines was unimpaired after inoculation with the virus as the plants presented similar growth when compared to the mock inoculated control plants and revealed no apparent reduction in the amount and weight of tubers produced. We show that the resistance is correlated with post-transcriptional gene silencing because of the production of transgene specific siRNA. The results demonstrate that transgenic lines exhibited high levels of resistance to SLCMV. This resistance coupled with the desirable yield components in the transgenic lines makes them better candidates for exploitation in the production of biomass as well as bioethanol.

  13. Resistance to Sri Lankan Cassava Mosaic Virus (SLCMV) in Genetically Engineered Cassava cv. KU50 through RNA Silencing

    KAUST Repository

    Ntui, Valentine Otang; Kong, Kynet; Khan, Raham Sher; Igawa, Tomoko; Janavi, Gnanaguru Janaky; Rabindran, Ramalingam; Nakamura, Ikuo; Mii, Masahiro

    2015-01-01

    Cassava ranks fifth among the starch producing crops of the world, its annual bioethanol yield is higher than for any other crop. Cassava cultivar KU50, the most widely grown cultivar for non-food purposes is susceptible to Sri Lankan cassava mosaic virus (SLCMV). The objective of this work was to engineer resistance to SLCMV by RNA interference (RNAi) in order to increase biomass yield, an important aspect for bioethanol production. Here, we produced transgenic KU50 lines expressing dsRNA homologous to the region between the AV2 and AV1 of DNA A of SLCMV. High level expression of dsRNA of SLCMV did not induce any growth abnormality in the transgenic plants. Transgenic lines displayed high levels of resistance to SLCMV compared to the wild-type plants and no virus load could be detected in uninoculated new leaves of the infected resistant lines after PCR amplification and RT-PCR analysis. The agronomic performance of the transgenic lines was unimpaired after inoculation with the virus as the plants presented similar growth when compared to the mock inoculated control plants and revealed no apparent reduction in the amount and weight of tubers produced. We show that the resistance is correlated with post-transcriptional gene silencing because of the production of transgene specific siRNA. The results demonstrate that transgenic lines exhibited high levels of resistance to SLCMV. This resistance coupled with the desirable yield components in the transgenic lines makes them better candidates for exploitation in the production of biomass as well as bioethanol.

  14. RNA interference: a promising technique for the improvement of traditional crops.

    Science.gov (United States)

    Katoch, Rajan; Thakur, Neelam

    2013-03-01

    RNA interference (RNAi) is a homology-dependent gene-silencing technology that involves double-stranded RNA directed against a target gene. This technique has emerged as powerful tool in understanding the functions of a number of genes in recent years. For the improvement in the nutritional status of the plants and reduction in the level of antinutrients, the conventional breeding methods were not completely successful in achieving the tissue-specific regulation of some genes. RNAi has shown successful results in a number of plant species for nutritional improvement, change in morphology and alteration in metabolite synthesis. This technology has been applied mostly in genetic engineering of important crop plants, and till date there are no reports of its application for the improvement of traditional/underutilized crops. In this study, we discuss current knowledge of RNAi function and concept and strategies for the improvement of traditional crops. Practical application. Although RNAi has been extensively used for the improvement of popular crops, no attention has been given for the use of this technology for the improvement of underutilized crops. This study describes the importance of use of this technology for the improvement of underutilized crops.

  15. Efficient transformation and artificial miRNA gene silencing in Lemna minor.

    Science.gov (United States)

    Cantó-Pastor, A; Mollá-Morales, A; Ernst, E; Dahl, W; Zhai, J; Yan, Y; Meyers, B C; Shanklin, J; Martienssen, R

    2015-01-01

    Despite rapid doubling time, simple architecture and ease of metabolic labelling, a lack of genetic tools in the Lemnaceae (duckweed) has impeded the full implementation of this organism as a model for biological research. Here, we present technologies to facilitate high-throughput genetic studies in duckweed. We developed a fast and efficient method for producing Lemna minor stable transgenic fronds via Agrobacterium-mediated transformation and regeneration from tissue culture. Additionally, we engineered an artificial microRNA (amiRNA) gene silencing system. We identified a Lemna gibba endogenous miR166 precursor and used it as a backbone to produce amiRNAs. As a proof of concept we induced the silencing of CH42, a magnesium chelatase subunit, using our amiRNA platform. Expression of CH42 in transgenic L. minor fronds was significantly reduced, which resulted in reduction of chlorophyll pigmentation. The techniques presented here will enable tackling future challenges in the biology and biotechnology of Lemnaceae. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  16. Low-weight polyethylenimine cross-linked 2-hydroxypopyl-ß-cyclodextrin and folic acid as an efficient and nontoxic siRNA carrier for gene silencing and tumor inhibition by VEGF siRNA

    Directory of Open Access Journals (Sweden)

    Li JM

    2013-06-01

    Full Text Available Jin-Ming Li, Yuan-Yuan Wang, Wei Zhang, Hua Su, Liang-Nian Ji, Zong-Wan Mao MOE Key Laboratory of Bioinorganic and Synthetic Chemistry, School of Chemistry and Chemical Engineering, Sun Yat-sen University, Guangzhou, People's Republic of China Background: Targeted delivery of small interfering RNA (siRNA has been regarded as one of the most important technologies for the development of siRNA therapeutics. However, the need for safe and efficient delivery systems is a barrier to further development of RNA interference therapeutics. In this work, a nontoxic and efficient siRNA carrier delivery system of low molecular weight polyethyleneimine (PEI-600 Da cross-linked with 2-hydroxypopyl-β-cyclodextrin (HP-β-CD and folic acid (FA was synthesized for biomedical application. Methods: The siRNA carrier was prepared using a simple method and characterized by nuclear magnetic resonance and Fourier transform infrared spectroscopy. The siRNA carrier nanoparticles were characterized in terms of morphology, size and zeta potential, stability, efficiency of delivery, and gene silencing efficiency in vitro and in vivo. Results: The siRNA carrier was synthesized successfully. It showed good siRNA binding capacity and ability to protect siRNA. Further, the toxicity of the carrier measured in vitro and in vivo appeared to be negligible, probably because of degradation of the low molecular weight PEI and HP-β-CD in the cytosol. Flow cytometry and confocal microscopy confirmed that the FA receptor-mediated endocytosis of the FA-HP-β-CD-PEI/siRNA complexes was greater than that of the HP-β-CD-PEI/siRNA complexes in FA receptor-enriched HeLa cells. The FA-HP-β-CD-PEI/siRNA complexes also demonstrated excellent gene silencing efficiency in vitro (in the range of 90%, and reduced vascular endothelial growth factor (VEGF protein expression in the presence of 20% serum. FA-HP-β-CD-PEI/siRNA complexes administered via tail vein injection resulted in marked

  17. Short hairpin RNA interference therapy for ischemic heart disease

    Science.gov (United States)

    Huang, Mei; Chan, Denise; Jia, Fangjun; Xie, Xiaoyan; Li, Zongjin; Hoyt, Grant; Robbins, Robert C.; Chen, Xiaoyuan; Giaccia, Amato; Wu, Joseph C.

    2013-01-01

    Background During hypoxia, upregulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Here we hypothesize that short hairpin RNA (shRNA) interference therapy targeting PHD2 can be used for treatment of myocardial ischemia and this process can be followed noninvasively by molecular imaging. Methods and Results PHD2 was cloned from mouse embryonic stem (ES) cells by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted into the pSuper vector driven by the H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct was used to transfect mouse C2C12 myoblast cell line for in vitro confirmation. Compared to the control short hairpin scramble (shScramble) as control, inhibition of PHD2 increased levels of HIF-1α protein and several downstream angiogenic genes by >30% (P<0.01). Afterwards, shRNA targeting PHD2 (shPHD2) plasmid was injected intramyocardially following ligation of left anterior descending (LAD) artery in mice. Animals were randomized into shPHD2 group (n=20) versus shScramble sequence as control (n=20). Bioluminescence imaging detected transgene expression for 4–5 weeks. Echocardiographic study showed the shPHD2 group had improved fractional shortening compared with the shScramble group at week 4 (33.7%±1.9% vs. 28.4%±2.8%; P<0.05). Postmortem analysis showed increased presence of small capillaries and venules in the infarcted zones by CD31 staining. Finally, Western blot anlaysis of explanted hearts also confirm that animals treated with shPHD2 had significantly higher levels of HIF-1α protein. Conclusions This is the first study to image the biological role of shRNA therapy for improving cardiac function. Inhibition of PHD2 by shRNA led to

  18. CRISPR Interference Efficiently Induces Specific and Reversible Gene Silencing in Human iPSCs

    DEFF Research Database (Denmark)

    Mandegar, Mohammad A.; Huebsch, Nathaniel; Frolov, Ekaterina B.

    2016-01-01

    repression system is tunable and has the potential to silence single alleles. Compared with CRISPR nuclease (CRISPRn), CRISPRi gene repression is more efficient and homogenous across cell populations. The CRISPRi system in iPSCs provides a powerful platform to perform genome-scale screens in a wide range...

  19. Gene silencing in primary and metastatic tumors by small interfering RNA delivery in mice: quantitative analysis using melanoma cells expressing firefly and sea pansy luciferases.

    Science.gov (United States)

    Takahashi, Yuki; Nishikawa, Makiya; Kobayashi, Naoki; Takakura, Yoshinobu

    2005-07-20

    Silencing of oncogenes or other genes contributing to tumor malignancy or progression by RNA interference (RNAi) offers a promising approach to treating tumor patients. To achieve RNAi-based tumor therapy, a small interfering RNA (siRNA) or siRNA-expressing vector needs to be delivered to tumor cells, but little information about its in vivo delivery has been reported. In this study, we examined whether the expression of the target gene in tumor cells can be suppressed by the delivery of RNAi effectors to primary and metastatic tumor cells. To quantitatively evaluate the RNAi effects in tumor cells, mouse melanoma B16-BL6 cells were stably transfected with both firefly (a model target gene) and sea pansy (an internal standard gene) luciferase genes to obtain B16-BL6/dual Luc cells. The target gene expression in subcutaneous primary tumors of B16-BL6/dual Luc cells was significantly suppressed by direct injection of the RNAi effectors followed by electroporation. The expression in metastatic hepatic tumors was also significantly reduced by an intravenous injection of either RNAi effector by the hydrodynamics-based procedure. These results indicate that the both RNAi effectors have a potential to silence target gene in tumor cells in vivo when successfully delivered to tumor cells.

  20. Epigenetic silencing of nucleolar rRNA genes in Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Maciej Pietrzak

    Full Text Available Ribosomal deficits are documented in mild cognitive impairment (MCI, which often represents an early stage Alzheimer's disease (AD, as well as in advanced AD. The nucleolar rRNA genes (rDNA, transcription of which is critical for ribosomal biogenesis, are regulated by epigenetic silencing including promoter CpG methylation.To assess whether CpG methylation of the rDNA promoter was dysregulated across the AD spectrum, we analyzed brain samples from 10 MCI-, 23 AD-, and, 24 age-matched control individuals using bisulfite mapping. The rDNA promoter became hypermethylated in cerebro-cortical samples from MCI and AD groups. In parietal cortex, the rDNA promoter was hypermethylated more in MCI than in advanced AD. The cytosine methylation of total genomic DNA was similar in AD, MCI, and control samples. Consistent with a notion that hypermethylation-mediated silencing of the nucleolar chromatin stabilizes rDNA loci, preventing their senescence-associated loss, genomic rDNA content was elevated in cerebrocortical samples from MCI and AD groups.In conclusion, rDNA hypermethylation could be a new epigenetic marker of AD. Moreover, silencing of nucleolar chromatin may occur during early stages of AD pathology and play a role in AD-related ribosomal deficits and, ultimately, dementia.

  1. Emerging strategies for RNA interference (RNAi) applications in insects.

    Science.gov (United States)

    Nandety, Raja Sekhar; Kuo, Yen-Wen; Nouri, Shahideh; Falk, Bryce W

    2015-01-01

    RNA interference (RNAi) in insects is a gene regulatory process that also plays a vital role in the maintenance and in the regulation of host defenses against invading viruses. Small RNAs determine the specificity of the RNAi through precise recognition of their targets. These small RNAs in insects comprise small interfering RNAs (siRNAs), micro RNAs (miRNAs) and Piwi interacting RNAs (piRNAs) of various lengths. In this review, we have explored different forms of the RNAi inducers that are presently in use, and their applications for an effective and efficient fundamental and practical RNAi research with insects. Further, we reviewed trends in next generation sequencing (NGS) technologies and their importance for insect RNAi, including the identification of novel insect targets as well as insect viruses. Here we also describe a rapidly emerging trend of using plant viruses to deliver the RNAi inducer molecules into insects for an efficient RNAi response.

  2. RNA interference targeting raptor inhibits proliferation of gastric cancer cells

    International Nuclear Information System (INIS)

    Wu, William Ka Kei; Lee, Chung Wa; Cho, Chi Hin; Chan, Francis Ka Leung; Yu, Jun; Sung, Joseph Jao Yiu

    2011-01-01

    Mammalian target of rapamycin complex 1 (mTORC1) is dysregulated in gastric cancer. The biologic function of mTORC1 in gastric carcinogenesis is unclear. Here, we demonstrate that disruption of mTORC1 function by RNA interference-mediated downregulation of raptor substantially inhibited gastric cancer cell proliferation through induction of G 0 /G 1 -phase cell cycle arrest. The anti-proliferative effect was accompanied by concomitant downregulation of activator protein-1 and upregulation of Smad2/3 transcriptional activities. In addition, the expression of cyclin D 3 and p21 Waf1 , which stabilizes cyclin D/cdk4 complex for G 1 -S transition, was reduced by raptor knockdown. In conclusion, disruption of mTORC1 inhibits gastric cancer cell proliferation through multiple pathways. This discovery may have an implication in the application of mTORC1-directed therapy for the treatment of gastric cancer.

  3. PsOr1, a potential target for RNA interference-based pest management.

    Science.gov (United States)

    Zhao, Y Y; Liu, F; Yang, G; You, M S

    2011-02-01

    Insect pests cause billions of dollars in agricultural losses, and attempts to kill them have resulted in growing threats from insecticide resistance, dietary pesticide pollution and environmental destruction. New approaches to control refractory insect pests are therefore needed. The host-plant preferences of insect pests rely on olfaction and are mediated via a seven transmembrane-domain odorant receptor (Or) family. The present study reports the cloning and characterization of PsOr1, the first candidate member of the Or gene family from Phyllotreta striolata, a devastating beetle pest that causes damage worldwide. PsOr1 is remarkably well conserved with respect to other insect orthologues, including DmOr83b from Drosophila melanogaster. These insect orthologues form an essential non-conventional Or sub-family and may play an important and generalized role in insect olfaction. We designed double-stranded (ds) RNA directly against the PsOr1 gene and exploited RNA interference (RNAi) to control P. striolata. The chemotactic behavioural measurements showed that adult beetles were unable to sense the attractant or repellent odour stimulus after microinjection of dsRNA against PsOr1. Reverse Transcription (RT)-PCR analysis showed specific down-regulation of mRNA transcript levels for this gene. Furthermore, host-plant preference experiments confirmed that silencing PsOr1 by RNAi treatment impaired the host-plant preferences of P. striolata for cruciferous vegetables. These results demonstrate that this insect control approach of using RNAi to target PsOr1 and its orthologues might be effective in blocking host-plant-seeking behaviours in diverse insect pests. The results also support the theory that this unique receptor type plays an essential general role in insect olfaction. © 2010 Fujian Agriculture and Forestry University. Insect Molecular Biology © 2010 The Royal Entomological Society.

  4. Strand Analysis, a free online program for the computational identification of the best RNA interference (RNAi targets based on Gibbs free energy

    Directory of Open Access Journals (Sweden)

    Tiago Campos Pereira

    2007-01-01

    Full Text Available The RNA interference (RNAi technique is a recent technology that uses double-stranded RNA molecules to promote potent and specific gene silencing. The application of this technique to molecular biology has increased considerably, from gene function identification to disease treatment. However, not all small interfering RNAs (siRNAs are equally efficient, making target selection an essential procedure. Here we present Strand Analysis (SA, a free online software tool able to identify and classify the best RNAi targets based on Gibbs free energy (deltaG. Furthermore, particular features of the software, such as the free energy landscape and deltaG gradient, may be used to shed light on RNA-induced silencing complex (RISC activity and RNAi mechanisms, which makes the SA software a distinct and innovative tool.

  5. A Convenient In Vivo Model Using Small Interfering RNA Silencing to Rapidly Assess Skeletal Gene Function.

    Directory of Open Access Journals (Sweden)

    Wen Zhang

    Full Text Available It is difficult to study bone in vitro because it contains various cell types that engage in cross-talk. Bone biologically links various organs, and it has thus become increasingly evident that skeletal physiology must be studied in an integrative manner in an intact animal. We developed a model using local intraosseous small interfering RNA (siRNA injection to rapidly assess the effects of a target gene on the local skeletal environment. In this model, 160-g male Sprague-Dawley rats were treated for 1-2 weeks. The left tibia received intraosseous injection of a parathyroid hormone 1 receptor (Pth1r or insulin-like growth factor 1 receptor (Igf-1r siRNA transfection complex loaded in poloxamer 407 hydrogel, and the right tibia received the same volume of control siRNA. All the tibias received an intraosseous injection of recombinant human parathyroid hormone (1-34 (rhPTH (1-34 or insulin-like growth factor-1 (IGF-1. Calcein green and alizarin red were injected 6 and 2 days before euthanasia, respectively. IGF-1R and PTH1R expression levels were detected via RT-PCR assays and immunohistochemistry. Bone mineral density (BMD, microstructure, mineral apposition rates (MARs, and strength were determined by dual-energy X-ray absorptiometry, micro-CT, histology and biomechanical tests. The RT-PCR and immunohistochemistry results revealed that IGF-1R and PTH1R expression levels were dramatically diminished in the siRNA-treated left tibias compared to the right tibias (both p<0.05. Using poloxamer 407 hydrogel as a controlled-release system prolonged the silencing effect of a single dose of siRNA; the mRNA expression levels of IGF-1R were lower at two weeks than at one week (p<0.01. The BMD, bone microstructure parameters, MAR and bone strength were significantly decreased in the left tibias compared to the right tibias (all p<0.05. This simple and convenient local intraosseous siRNA injection model achieved gene silencing with very small quantities of

  6. An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing.

    Science.gov (United States)

    Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria; Dagnæs-Hansen, Frederik; Wengel, Jesper; Malle, Birgitte Mølholm; Kragh-Hansen, Ulrich; Cameron, Jason; Bukrinski, Jens Thostrup; Howard, Kenneth A

    2016-06-28

    Major challenges for the clinical translation of small interfering RNA (siRNA) include overcoming the poor plasma half-life, site-specific delivery and modulation of gene silencing. In this work, we exploit the intrinsic transport properties of human serum albumin to tune the blood circulatory half-life, hepatic accumulation and gene silencing; based on the number of siRNA cholesteryl modifications. We demonstrate by a gel shift assay a strong and specific affinity of recombinant human serum albumin (rHSA) towards cholesteryl-modified siRNA (Kd>1×10(-7)M) dependent on number of modifications. The rHSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies using multiple cholesteryl modifications. A structural-activity-based screen of in vitro EGFP-silencing was used to select optimal siRNA designs containing cholesteryl modifications within the sense strand that were used for in vivo studies. We demonstrate plasma half-life extension in NMRI mice from t1/2 12min (naked) to t1/2 45min (single cholesteryl) and t1/2 71min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing of 28% (rHSA/siRNA) compared to 4% (naked siRNA) 6days post-injection. This work presents a novel albumin-mediated cholesteryl design-based strategy for tuning pharmacokinetics and systemic gene silencing. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. RNA interference: concept to reality in crop improvement.

    Science.gov (United States)

    Saurabh, Satyajit; Vidyarthi, Ambarish S; Prasad, Dinesh

    2014-03-01

    The phenomenon of RNA interference (RNAi) is involved in sequence-specific gene regulation driven by the introduction of dsRNA resulting in inhibition of translation or transcriptional repression. Since the discovery of RNAi and its regulatory potentials, it has become evident that RNAi has immense potential in opening a new vista for crop improvement. RNAi technology is precise, efficient, stable and better than antisense technology. It has been employed successfully to alter the gene expression in plants for better quality traits. The impact of RNAi to improve the crop plants has proved to be a novel approach in combating the biotic and abiotic stresses and the nutritional improvement in terms of bio-fortification and bio-elimination. It has been employed successfully to bring about modifications of several desired traits in different plants. These modifications include nutritional improvements, reduced content of food allergens and toxic compounds, enhanced defence against biotic and abiotic stresses, alteration in morphology, crafting male sterility, enhanced secondary metabolite synthesis and seedless plant varieties. However, crop plants developed by RNAi strategy may create biosafety risks. So, there is a need for risk assessment of GM crops in order to make RNAi a better tool to develop crops with biosafety measures. This article is an attempt to review the RNAi, its biochemistry, and the achievements attributed to the application of RNAi in crop improvement.

  8. Reexamining the P-Element Invasion of Drosophila melanogaster Through the Lens of piRNA Silencing

    Science.gov (United States)

    Kelleher, Erin S.

    2016-01-01

    Transposable elements (TEs) are both important drivers of genome evolution and genetic parasites with potentially dramatic consequences for host fitness. The recent explosion of research on regulatory RNAs reveals that small RNA-mediated silencing is a conserved genetic mechanism through which hosts repress TE activity. The invasion of the Drosophila melanogaster genome by P elements, which happened on a historical timescale, represents an incomparable opportunity to understand how small RNA-mediated silencing of TEs evolves. Repression of P-element transposition emerged almost concurrently with its invasion. Recent studies suggest that this repression is implemented in part, and perhaps predominantly, by the Piwi-interacting RNA (piRNA) pathway, a small RNA-mediated silencing pathway that regulates TE activity in many metazoan germlines. In this review, I consider the P-element invasion from both a molecular and evolutionary genetic perspective, reconciling classic studies of P-element regulation with the new mechanistic framework provided by the piRNA pathway. I further explore the utility of the P-element invasion as an exemplar of the evolution of piRNA-mediated silencing. In light of the highly-conserved role for piRNAs in regulating TEs, discoveries from this system have taxonomically broad implications for the evolution of repression. PMID:27516614

  9. STAT3 Gene Silencing by Aptamer-siRNA Chimera as Selective Therapeutic for Glioblastoma

    Directory of Open Access Journals (Sweden)

    Carla Lucia Esposito

    2018-03-01

    Full Text Available Glioblastoma (GBM is the most frequent and aggressive primary brain tumor in adults, and despite advances in neuro-oncology, the prognosis for patients remains dismal. The signal transducer and activator of transcription-3 (STAT3 has been reported as a key regulator of the highly aggressive mesenchymal GBM subtype, and its direct silencing (by RNAi oligonucleotides has revealed a great potential as an anti-cancer therapy. However, clinical use of oligonucleotide-based therapies is dependent on safer ways for tissue-specific targeting and increased membrane penetration. The objective of this study is to explore the use of nucleic acid aptamers as carriers to specifically drive a STAT3 siRNA to GBM cells in a receptor-dependent manner. Using an aptamer that binds to and antagonizes the oncogenic receptor tyrosine kinase PDGFRβ (Gint4.T, here we describe the design of a novel aptamer-siRNA chimera (Gint4.T-STAT3 to target STAT3. We demonstrate the efficient delivery and silencing of STAT3 in PDGFRβ+ GBM cells. Importantly, the conjugate reduces cell viability and migration in vitro and inhibits tumor growth and angiogenesis in vivo in a subcutaneous xenograft mouse model. Our data reveals Gint4.T-STAT3 conjugate as a novel molecule with great translational potential for GBM therapy.

  10. The potyviral suppressor of RNA silencing confers enhanced resistance to multiple pathogens

    International Nuclear Information System (INIS)

    Pruss, Gail J.; Lawrence, Christopher B.; Bass, Troy; Li Qingshun Q.; Bowman, Lewis H.; Vance, Vicki

    2004-01-01

    Helper component-protease (HC-Pro) is a plant viral suppressor of RNA silencing, and transgenic tobacco expressing HC-Pro has increased susceptibility to a broad range of viral pathogens. Here we report that these plants also exhibit enhanced resistance to unrelated heterologous pathogens. Tobacco mosaic virus (TMV) infection of HC-Pro-expressing plants carrying the N resistance gene results in fewer and smaller lesions compared to controls without HC-Pro. The resistance to TMV is compromised but not eliminated by expression of nahG, which prevents accumulation of salicylic acid (SA), an important defense signaling molecule. HC-Pro-expressing plants are also more resistant to tomato black ring nepovirus (TBRV) and to the oomycete Peronospora tabacina. Enhanced TBRV resistance is SA-independent, whereas the response to P. tabacina is associated with early induction of markers characteristic of SA-dependent defense. Thus, a plant viral suppressor of RNA silencing enhances resistance to multiple pathogens via both SA-dependent and SA-independent mechanisms

  11. The potyviral suppressor of RNA silencing confers enhanced resistance to multiple pathogens.

    Science.gov (United States)

    Pruss, Gail J; Lawrence, Christopher B; Bass, Troy; Li, Qingshun Q; Bowman, Lewis H; Vance, Vicki

    2004-03-01

    Helper component-protease (HC-Pro) is a plant viral suppressor of RNA silencing, and transgenic tobacco expressing HC-Pro has increased susceptibility to a broad range of viral pathogens. Here we report that these plants also exhibit enhanced resistance to unrelated heterologous pathogens. Tobacco mosaic virus (TMV) infection of HC-Pro-expressing plants carrying the N resistance gene results in fewer and smaller lesions compared to controls without HC-Pro. The resistance to TMV is compromised but not eliminated by expression of nahG, which prevents accumulation of salicylic acid (SA), an important defense signaling molecule. HC-Pro-expressing plants are also more resistant to tomato black ring nepovirus (TBRV) and to the oomycete Peronospora tabacina. Enhanced TBRV resistance is SA-independent, whereas the response to P. tabacina is associated with early induction of markers characteristic of SA-dependent defense. Thus, a plant viral suppressor of RNA silencing enhances resistance to multiple pathogens via both SA-dependent and SA-independent mechanisms.

  12. Regulation of the activity of the promoter of RNA-induced silencing, C3PO.

    Science.gov (United States)

    Sahu, Shriya; Williams, Leo; Perez, Alberto; Philip, Finly; Caso, Giuseppe; Zurawsky, Walter; Scarlata, Suzanne

    2017-09-01

    RNA-induced silencing is a process which allows cells to regulate the synthesis of specific proteins. RNA silencing is promoted by the protein C3PO (component 3 of RISC). We have previously found that phospholipase Cβ, which increases intracellular calcium levels in response to specific G protein signals, inhibits C3PO activity towards certain genes. Understanding the parameters that control C3PO activity and which genes are impacted by G protein activation would help predict which genes are more vulnerable to downregulation. Here, using a library of 10 18 oligonucleotides, we show that C3PO binds oligonucleotides with structural specificity but little sequence specificity. Alternately, C3PO hydrolyzes oligonucleotides with a rate that is sensitive to substrate stability. Importantly, we find that oligonucleotides with higher Tm values are inhibited by bound PLCβ. This finding is supported by microarray analysis in cells over-expressing PLCβ1. Taken together, this study allows predictions of the genes whose post-transcriptional regulation is responsive to the G protein/phospholipase Cβ/calcium signaling pathway. © 2017 The Protein Society.

  13. Down-regulation of Fusarium oxysporum endogenous genes by Host-Delivered RNA interference enhances disease resistance

    Directory of Open Access Journals (Sweden)

    Zongli eHu

    2015-01-01

    Full Text Available Fusarium oxysporum is a devastating pathogen causing extensive yield losses in a variety of crops and development of sustainable, environmentally friendly methods to improve crop resistance is crucial. We have used Host-Derived RNA interference (HD-RNAi technology to partially silence three different genes (FOW2, FRP1 and OPR in the hemi-biotrophic fungus Fusarium oxysporum f. sp. conglutinans. Expression of double stranded RNA molecules targeting fungal pathogen genes was achieved in a number of transgenic Arabidopsis lines. F. oxysporum infecting the transgenic lines displayed substantially reduced mRNA levels on all three targeted genes, with an average of 75%, 83% and 72% reduction for FOW2, FRP1 and OPR respectively. The silencing of pathogen genes had a clear positive effect on the ability of the transgenic lines to fight infection. All transgenic lines displayed enhanced resistance to F. oxysporum with delayed disease symptom development, especially FRP1 and OPR lines. Survival rates after fungal infection were higher in the transgenic lines compared to control wild type plants which consistently showed survival rates of 10%, with FOW2 lines showing 25% survival; FRP1 lines 30-50% survival and FOW2 between 45-70% survival. The down-regulation effect was specific for the targeted genes without unintended effects in related genes. In addition to producing resistant crops, HD-RNAi can provide a useful tool to rapidly screen candidate fungal pathogenicity genes without the need to produce fungal knockout mutants.

  14. Down-regulation of Fusarium oxysporum endogenous genes by Host-Delivered RNA interference enhances disease resistance

    Science.gov (United States)

    Hu, Zongli; Parekh, Urvi; Maruta, Natsumi; Trusov, Yuri; Botella, Jimmy

    2015-01-01

    Fusarium oxysporum is a devastating pathogen causing extensive yield losses in a variety of crops and development of sustainable, environmentally friendly methods to improve crop resistance is crucial. We have used Host-Derived RNA interference (HD-RNAi) technology to partially silence three different genes (FOW2, FRP1 and OPR) in the hemi-biotrophic fungus Fusarium oxysporum f. sp. conglutinans. Expression of double stranded RNA molecules targeting fungal pathogen genes was achieved in a number of transgenic Arabidopsis lines. F. oxysporum infecting the transgenic lines displayed substantially reduced mRNA levels on all three targeted genes, with an average of 75%, 83% and 72% reduction for FOW2, FRP1 and OPR respectively. The silencing of pathogen genes had a clear positive effect on the ability of the transgenic lines to fight infection. All transgenic lines displayed enhanced resistance to F. oxysporum with delayed disease symptom development, especially FRP1 and OPR lines. Survival rates after fungal infection were higher in the transgenic lines compared to control wild type plants which consistently showed survival rates of 10%, with FOW2 lines showing 25% survival; FRP1 lines 30-50% survival and FOW2 between 45-70% survival. The down-regulation effect was specific for the targeted genes without unintended effects in related genes. In addition to producing resistant crops, HD-RNAi can provide a useful tool to rapidly screen candidate fungal pathogenicity genes without the need to produce fungal knockout mutants.

  15. RNA interference reveals allatotropin functioning in larvae and adults of Spodoptera frugiperda (Lepidoptera, Noctuidae

    Directory of Open Access Journals (Sweden)

    I.T.E. Hassanien

    2014-05-01

    Full Text Available The allatotropin of S. frugiperda (Spofr-AT and its cDNA sequence were characterized 10 years ago, but no functional analyses of the peptide are available. Here we used the RNA interference technique to study the effects of Spofr-AT gene suppression on juvenile hormone (JH and ecdysteroid titers in the hemolymph of larvae, virgin and mated females, and of males. Spofr-AT gene silencing in last instar larvae resulted in an increase in the amount of JH III and 20-hydroxyecdysone in the hemolymph of the animals, corresponding to an acceleration of the prepupal commitment and transformation to the pupa. Mated females showed much higher JH titers in their hemolymph than virgins and laid almost twice the number of eggs. Spofr-AT gene silencing in freshly ecdysed females led to a further increase in egg production and oviposition, but had only a minor effect on the hemoylmph JH titer. Mated females contain considerable amounts of JH I and JH II in their hemoylmph, which are thought to be received from males during copulation. To confirm this hypothesis, we measured the amount of JH homologs in the male accessory reproductive glands (MARG before mating and in the bursa copulatrix (BC of the female after mating. MARG contained high amounts of JH I and JH II, which are transferred to the BC during copulation. One day after mating, JH disappeared from the BC and was then found in the hemolymph of the females. In conclusion, Spofr-AT acts as a true allatotropin in larvae and adults of both sexes of the armyworm.

  16. A conserved small RNA promotes silencing of the outer membrane protein YbfM

    DEFF Research Database (Denmark)

    Rasmussen, Anders Aamann; Johansen, Jesper; Nielsen, Jesper S

    2009-01-01

    important physiological role of regulatory RNA molecules in Gram-negative bacteria is to modulate the cell surface and/or to prevent accumulation of OMPs in the envelope. Here, we extend the OMP-sRNA network by showing that the expression of the outer membrane protein YbfM is silenced by a conserved sRNA......In the past few years an increasing number of small non-coding RNAs (sRNAs) in enterobacteria have been found to negatively regulate the expression of outer membrane proteins (OMPs) at the post-transcriptional level. These RNAs act under various growth and stress conditions, suggesting that one......, designated MicM (also known as RybC/SroB). The regulation is strictly dependent on the RNA chaperone Hfq, and mutational analysis indicates that MicM sequesters the ribosome binding site of ybfM mRNA by an antisense mechanism. Furthermore, we provide evidence that Hfq strongly enhances the on-rate of duplex...

  17. The microRNA effector RNA-induced silencing complex in hidradenitis suppurativa: a significant dysregulation within active inflammatory lesions.

    Science.gov (United States)

    Hessam, S; Sand, M; Skrygan, M; Bechara, Falk G

    2017-09-01

    Recently, we could show that the expression levels of the key regulators of the microRNA (miRNA) maturation and transport were dysregulated in inflamed hidradenitis suppurativa (HS) tissue (Heyam et al. in Wiley Interdiscip Rev RNA 6:271-289, 2015). The RNA-induced silencing complex (RISC) is the central element of the miRNA pathway and regulates miRNA formation and function. We investigated the expression of the RISC components, namely transactivation-responsive RNA-binding protein-1 (TRBP1), TRBP2, protein activator (PACT) of the interferon-induced protein kinase R, Argonaute RISC Catalytic Component-1 (AGO1) and Component-2 (AGO2), metadherin, and staphylococcal nuclease and Tudor domain-containing-1 (SND1) in inflamed HS tissue compared to healthy and psoriatic controls by real-time reverse transcription polymerase chain reaction. Expression levels of all investigated components were significantly lower in lesional HS skin (n = 18) compared to healthy controls (n = 10). TRBP1, PACT, AGO1, AGO2, and SND1 expression levels were significantly down-regulated in lesional HS skin compared to healthy-appearing perilesional skin (n = 7). TRBP2 and SND1 expression levels were significantly lower in healthy-appearing perilesional skin compared to healthy controls. In lesional HS skin, expression levels of PACT, AGO1, and AGO2 were significantly lower compared to psoriatic skin (n = 10). In summary, our data showed that all investigated components of RISC are dysregulated in the skin of HS patients, providing support for the hypothesis that miRNAs may have a pathological role in the inflammatory pathogenesis of HS.

  18. Layer-by-layer nanoparticles as an efficient siRNA delivery vehicle for SPARC silencing.

    Science.gov (United States)

    Tan, Yang Fei; Mundargi, Raghavendra C; Chen, Min Hui Averil; Lessig, Jacqueline; Neu, Björn; Venkatraman, Subbu S; Wong, Tina T

    2014-05-14

    Efficient and safe delivery systems for siRNA therapeutics remain a challenge. Elevated secreted protein, acidic, and rich in cysteine (SPARC) protein expression is associated with tissue scarring and fibrosis. Here we investigate the feasibility of encapsulating SPARC-siRNA in the bilayers of layer-by-layer (LbL) nanoparticles (NPs) with poly(L-arginine) (ARG) and dextran (DXS) as polyelectrolytes. Cellular binding and uptake of LbL NPs as well as siRNA delivery were studied in FibroGRO cells. siGLO-siRNA and SPARC-siRNA were efficiently coated onto hydroxyapatite nanoparticles. The multilayered NPs were characterized with regard to particle size, zeta potential and surface morphology using dynamic light scattering and transmission electron microscopy. The SPARC-gene silencing and mRNA levels were analyzed using ChemiDOC western blot technique and RT-PCR. The multilayer SPARC-siRNA incorporated nanoparticles are about 200 nm in diameter and are efficiently internalized into FibroGRO cells. Their intracellular fate was also followed by tagging with suitable reporter siRNA as well as with lysotracker dye; confocal microscopy clearly indicates endosomal escape of the particles. Significant (60%) SPARC-gene knock down was achieved by using 0.4 pmole siRNA/μg of LbL NPs in FibroGRO cells and the relative expression of SPARC mRNA reduced significantly (60%) against untreated cells. The cytotoxicity as evaluated by xCelligence real-time cell proliferation and MTT cell assay, indicated that the SPARC-siRNA-loaded LbL NPs are non-toxic. In conclusion, the LbL NP system described provides a promising, safe and efficient delivery platform as a non-viral vector for siRNA delivery that uses biopolymers to enhance the gene knock down efficiency for the development of siRNA therapeutics. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Enhancement of allele discrimination by introduction of nucleotide mismatches into siRNA in allele-specific gene silencing by RNAi.

    Directory of Open Access Journals (Sweden)

    Yusuke Ohnishi

    Full Text Available Allele-specific gene silencing by RNA interference (RNAi is therapeutically useful for specifically inhibiting the expression of disease-associated alleles without suppressing the expression of corresponding wild-type alleles. To realize such allele-specific RNAi (ASP-RNAi, the design and assessment of small interfering RNA (siRNA duplexes conferring ASP-RNAi is vital; however, it is also difficult. In a previous study, we developed an assay system to assess ASP-RNAi with mutant and wild-type reporter alleles encoding the Photinus and Renilla luciferase genes. In line with experiments using the system, we realized that it is necessary and important to enhance allele discrimination between mutant and corresponding wild-type alleles. Here, we describe the improvement of ASP-RNAi against mutant alleles carrying single nucleotide variations by introducing base substitutions into siRNA sequences, where original variations are present in the central position. Artificially mismatched siRNAs or short-hairpin RNAs (shRNAs against mutant alleles of the human Prion Protein (PRNP gene, which appear to be associated with susceptibility to prion diseases, were examined using this assessment system. The data indicates that introduction of a one-base mismatch into the siRNAs and shRNAs was able to enhance discrimination between the mutant and wild-type alleles. Interestingly, the introduced mismatches that conferred marked improvement in ASP-RNAi, appeared to be largely present in the guide siRNA elements, corresponding to the 'seed region' of microRNAs. Due to the essential role of the 'seed region' of microRNAs in their association with target RNAs, it is conceivable that disruption of the base-pairing interactions in the corresponding seed region, as well as the central position (involved in cleavage of target RNAs, of guide siRNA elements could influence allele discrimination. In addition, we also suggest that nucleotide mismatches at the 3'-ends of sense

  20. Deep sequencing uncovers commonality in small RNA profiles between transgene-induced and naturally occurring RNA silencing of chalcone synthase-A gene in petunia.

    Science.gov (United States)

    Kasai, Megumi; Matsumura, Hideo; Yoshida, Kentaro; Terauchi, Ryohei; Taneda, Akito; Kanazawa, Akira

    2013-01-30

    Introduction of a transgene that transcribes RNA homologous to an endogenous gene in the plant genome can induce silencing of both genes, a phenomenon termed cosuppression. Cosuppression was first discovered in transgenic petunia plants transformed with the CHS-A gene encoding chalcone synthase, in which nonpigmented sectors in flowers or completely white flowers are produced. Some of the flower-color patterns observed in transgenic petunias having CHS-A cosuppression resemble those in existing nontransgenic varieties. Although the mechanism by which white sectors are generated in nontransgenic petunia is known to be due to RNA silencing of the CHS-A gene as in cosuppression, whether the same trigger(s) and/or pattern of RNA degradation are involved in these phenomena has not been known. Here, we addressed this question using deep-sequencing and bioinformatic analyses of small RNAs. We analyzed short interfering RNAs (siRNAs) produced in nonpigmented sectors of petal tissues in transgenic petunia plants that have CHS-A cosuppression and a nontransgenic petunia variety Red Star, that has naturally occurring CHS-A RNA silencing. In both silencing systems, 21-nt and 22-nt siRNAs were the most and the second-most abundant size classes, respectively. CHS-A siRNA production was confined to exon 2, indicating that RNA degradation through the RNA silencing pathway occurred in this exon. Common siRNAs were detected in cosuppression and naturally occurring RNA silencing, and their ranks based on the number of siRNAs in these plants were correlated with each other. Noticeably, highly abundant siRNAs were common in these systems. Phased siRNAs were detected in multiple phases at multiple sites, and some of the ends of the regions that produced phased siRNAs were conserved. The features of siRNA production found to be common to cosuppression and naturally occurring silencing of the CHS-A gene indicate mechanistic similarities between these silencing systems especially in the

  1. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

    Science.gov (United States)

    Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J

    2015-01-01

    In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  2. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

    Directory of Open Access Journals (Sweden)

    Sha Lu

    Full Text Available In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  3. Interspecific RNA Interference of SHOOT MERISTEMLESS-Like Disrupts Cuscuta pentagona Plant Parasitism[C][W][OA

    Science.gov (United States)

    Alakonya, Amos; Kumar, Ravi; Koenig, Daniel; Kimura, Seisuke; Townsley, Brad; Runo, Steven; Garces, Helena M.; Kang, Julie; Yanez, Andrea; David-Schwartz, Rakefet; Machuka, Jesse; Sinha, Neelima

    2012-01-01

    Infection of crop species by parasitic plants is a major agricultural hindrance resulting in substantial crop losses worldwide. Parasitic plants establish vascular connections with the host plant via structures termed haustoria, which allow acquisition of water and nutrients, often to the detriment of the infected host. Despite the agricultural impact of parasitic plants, the molecular and developmental processes by which host/parasitic interactions are established are not well understood. Here, we examine the development and subsequent establishment of haustorial connections by the parasite dodder (Cuscuta pentagona) on tobacco (Nicotiana tabacum) plants. Formation of haustoria in dodder is accompanied by upregulation of dodder KNOTTED-like homeobox transcription factors, including SHOOT MERISTEMLESS-like (STM). We demonstrate interspecific silencing of a STM gene in dodder driven by a vascular-specific promoter in transgenic host plants and find that this silencing disrupts dodder growth. The reduced efficacy of dodder infection on STM RNA interference transgenics results from defects in haustorial connection, development, and establishment. Identification of transgene-specific small RNAs in the parasite, coupled with reduced parasite fecundity and increased growth of the infected host, demonstrates the efficacy of interspecific small RNA–mediated silencing of parasite genes. This technology has the potential to be an effective method of biological control of plant parasite infection. PMID:22822208

  4. RNA virus interference via CRISPR/Cas13a system in plants

    KAUST Repository

    Aman, Rashid; Ali, Zahir; Butt, Haroon; Mahas, Ahmed; Aljedaani, Fatimah R.; Khan, Muhammad Zuhaib; Ding, Shouwei; Mahfouz, Magdy M.

    2018-01-01

    -crRNAs into functional crRNAs.Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses and for other RNA manipulations in plants.

  5. Epigenetic silencing of miRNA-9 is associated with HES1 oncogenic activity and poor prognosis of medulloblastoma

    Science.gov (United States)

    Fiaschetti, G; Abela, L; Nonoguchi, N; Dubuc, A M; Remke, M; Boro, A; Grunder, E; Siler, U; Ohgaki, H; Taylor, M D; Baumgartner, M; Shalaby, T; Grotzer, M A

    2014-01-01

    Background: microRNA-9 is a key regulator of neuronal development aberrantly expressed in brain malignancies, including medulloblastoma. The mechanisms by which microRNA-9 contributes to medulloblastoma pathogenesis remain unclear, and factors that regulate this process have not been delineated. Methods: Expression and methylation status of microRNA-9 in medulloblastoma cell lines and primary samples were analysed. The association of microRNA-9 expression with medulloblastoma patients' clinical outcome was assessed, and the impact of microRNA-9 restoration was functionally validated in medulloblastoma cells. Results: microRNA-9 expression is repressed in a large subset of MB samples compared with normal fetal cerebellum. Low microRNA-9 expression correlates significantly with the diagnosis of unfavourable histopathological variants and with poor clinical outcome. microRNA-9 silencing occurs via cancer-specific CpG island hypermethylation. HES1 was identified as a direct target of microRNA-9 in medulloblastoma, and restoration of microRNA-9 was shown to trigger cell cycle arrest, to inhibit clonal growth and to promote medulloblastoma cell differentiation. Conclusions: microRNA-9 is a methylation-silenced tumour suppressor that could be a potential candidate predictive marker for poor prognosis of medulloblastoma. Loss of microRNA-9 may confer a proliferative advantage to tumour cells, and it could possibly contribute to disease pathogenesis. Thus, re-expression of microRNA-9 may constitute a novel epigenetic regulation strategy against medulloblastoma. PMID:24346283

  6. Epigenetic silencing of miRNA-9 is associated with HES1 oncogenic activity and poor prognosis of medulloblastoma.

    Science.gov (United States)

    Fiaschetti, G; Abela, L; Nonoguchi, N; Dubuc, A M; Remke, M; Boro, A; Grunder, E; Siler, U; Ohgaki, H; Taylor, M D; Baumgartner, M; Shalaby, T; Grotzer, M A

    2014-02-04

    microRNA-9 is a key regulator of neuronal development aberrantly expressed in brain malignancies, including medulloblastoma. The mechanisms by which microRNA-9 contributes to medulloblastoma pathogenesis remain unclear, and factors that regulate this process have not been delineated. Expression and methylation status of microRNA-9 in medulloblastoma cell lines and primary samples were analysed. The association of microRNA-9 expression with medulloblastoma patients' clinical outcome was assessed, and the impact of microRNA-9 restoration was functionally validated in medulloblastoma cells. microRNA-9 expression is repressed in a large subset of MB samples compared with normal fetal cerebellum. Low microRNA-9 expression correlates significantly with the diagnosis of unfavourable histopathological variants and with poor clinical outcome. microRNA-9 silencing occurs via cancer-specific CpG island hypermethylation. HES1 was identified as a direct target of microRNA-9 in medulloblastoma, and restoration of microRNA-9 was shown to trigger cell cycle arrest, to inhibit clonal growth and to promote medulloblastoma cell differentiation. microRNA-9 is a methylation-silenced tumour suppressor that could be a potential candidate predictive marker for poor prognosis of medulloblastoma. Loss of microRNA-9 may confer a proliferative advantage to tumour cells, and it could possibly contribute to disease pathogenesis. Thus, re-expression of microRNA-9 may constitute a novel epigenetic regulation strategy against medulloblastoma.

  7. Understanding the core of RNA interference: The dynamic aspects of Argonaute-mediated processes

    KAUST Repository

    Zhu, Lizhe

    2016-10-05

    At the core of RNA interference, the Argonaute proteins (Ago) load and utilize small guide nucleic acids to silence mRNAs or cleave foreign nucleic acids in a sequence specific manner. In recent years, based on extensive structural studies of Ago and its interaction with the nucleic acids, considerable progress has been made to reveal the dynamic aspects of various Ago-mediated processes. Here we review these novel insights into the guide-strand loading, duplex unwinding, and effects of seed mismatch, with a focus on two representative Agos, the human Ago 2 (hAgo2) and the bacterial Thermus thermophilus Ago (TtAgo). In particular, comprehensive molecular simulation studies revealed that although sharing similar overall structures, the two Agos have vastly different conformational landscapes and guide-strand loading mechanisms because of the distinct rigidity of their L1-PAZ hinge. Given the central role of the PAZ motions in regulating the exposure of the nucleic acid binding channel, these findings exemplify the importance of protein motions in distinguishing the overlapping, yet distinct, mechanisms of Ago-mediated processes in different organisms.

  8. Receptor-targeted liposome-peptide-siRNA nanoparticles represent an efficient delivery system for MRTF silencing in conjunctival fibrosis.

    Science.gov (United States)

    Yu-Wai-Man, Cynthia; Tagalakis, Aristides D; Manunta, Maria D; Hart, Stephen L; Khaw, Peng T

    2016-02-24

    There is increasing evidence that the Myocardin-related transcription factor/Serum response factor (MRTF/SRF) pathway plays a key role in fibroblast activation and that knocking down MRTF can lead to reduced scarring and fibrosis. Here, we have developed a receptor-targeted liposome-peptide-siRNA nanoparticle as a non-viral delivery system for MRTF-B siRNA in conjunctival fibrosis. Using 50 nM siRNA, the MRTF-B gene was efficiently silenced by 76% and 72% with LYR and LER nanoparticles, respectively. The silencing efficiency was low when non-targeting peptides or siRNA alone or liposome-siRNA alone were used. LYR and LER nanoparticles also showed higher silencing efficiency than PEGylated LYR-P and LER-P nanoparticles. The nanoparticles were not cytotoxic using different liposomes, targeting peptides, and 50 nM siRNA. Three-dimensional fibroblast-populated collagen matrices were also used as a functional assay to measure contraction in vitro, and showed that MRTF-B LYR nanoparticles completely blocked matrix contraction after a single transfection treatment. In conclusion, this is the first study to develop and show that receptor-targeted liposome-peptide-siRNA nanoparticles represent an efficient and safe non-viral siRNA delivery system that could be used to prevent fibrosis after glaucoma filtration surgery and other contractile scarring conditions in the eye.

  9. Retention and loss of RNA interference pathways in trypanosomatid protozoans.

    Directory of Open Access Journals (Sweden)

    Lon-Fye Lye

    2010-10-01

    Full Text Available RNA interference (RNAi pathways are widespread in metaozoans but the genes required show variable occurrence or activity in eukaryotic microbes, including many pathogens. While some Leishmania lack RNAi activity and Argonaute or Dicer genes, we show that Leishmania braziliensis and other species within the Leishmania subgenus Viannia elaborate active RNAi machinery. Strong attenuation of expression from a variety of reporter and endogenous genes was seen. As expected, RNAi knockdowns of the sole Argonaute gene implicated this protein in RNAi. The potential for functional genetics was established by testing RNAi knockdown lines lacking the paraflagellar rod, a key component of the parasite flagellum. This sets the stage for the systematic manipulation of gene expression through RNAi in these predominantly diploid asexual organisms, and may also allow selective RNAi-based chemotherapy. Functional evolutionary surveys of RNAi genes established that RNAi activity was lost after the separation of the Leishmania subgenus Viannia from the remaining Leishmania species, a divergence associated with profound changes in the parasite infectious cycle and virulence. The genus Leishmania therefore offers an accessible system for testing hypothesis about forces that may select for the loss of RNAi during evolution, such as invasion by viruses, changes in genome plasticity mediated by transposable elements and gene amplification (including those mediating drug resistance, and/or alterations in parasite virulence.

  10. Dysregulated RNA-Induced Silencing Complex (RISC) Assembly within CNS Corresponds with Abnormal miRNA Expression during Autoimmune Demyelination.

    Science.gov (United States)

    Lewkowicz, Przemysław; Cwiklińska, Hanna; Mycko, Marcin P; Cichalewska, Maria; Domowicz, Małgorzata; Lewkowicz, Natalia; Jurewicz, Anna; Selmaj, Krzysztof W

    2015-05-13

    MicroRNAs (miRNAs) associate with Argonaute (Ago), GW182, and FXR1 proteins to form RNA-induced silencing complexes (RISCs). RISCs represent a critical checkpoint in the regulation and bioavailability of miRNAs. Recent studies have revealed dysregulation of miRNAs in multiple sclerosis (MS) and its animal model, experimental autoimmune encephalomyelitis (EAE); however, the function of RISCs in EAE and MS is largely unknown. Here, we examined the expression of Ago, GW182, and FXR1 in CNS tissue, oligodendrocytes (OLs), brain-infiltrating T lymphocytes, and CD3(+)splenocytes (SCs) of EAE mic, and found that global RISC protein levels were significantly dysregulated. Specifically, Ago2 and FXR1 levels were decreased in OLs and brain-infiltrating T cells in EAE mice. Accordingly, assembly of Ago2/GW182/FXR1 complexes in EAE brain tissues was disrupted, as confirmed by immunoprecipitation experiments. In parallel with alterations in RISC complex content in OLs, we found downregulation of miRNAs essential for differentiation and survival of OLs and myelin synthesis. In brain-infiltrating T lymphocytes, aberrant RISC formation contributed to miRNA-dependent proinflammatory helper T-cell polarization. In CD3(+) SCs, we found increased expression of both Ago2 and FXR1 in EAE compared with nonimmunized mice. Therefore, our results demonstrate a gradient in expression of miRNA between primary activated T cells in the periphery and polarized CNS-infiltrating T cells. These results suggest that, in polarized autoreactive effector T cells, miRNA synthesis is inhibited in response to dysregulated RISC assembly, allowing these cells to maintain a highly specific proinflammatory program. Therefore, our findings may provide a mechanism that leads to miRNA dysregulation in EAE/MS. Copyright © 2015 the authors 0270-6474/15/357521-17$15.00/0.

  11. Delivery of dsRNA through topical feeding for RNA interference in the citrus sap piercing-sucking hemipteran, Diaphorina citri.

    Science.gov (United States)

    Killiny, Nabil; Kishk, Abdelaziz

    2017-06-01

    RNA interference (RNAi) is a powerful means to study functional genomics in insects. The delivery of dsRNA is a challenging step in the development of RNAi assay. Here, we describe a new delivery method to increase the effectiveness of RNAi in the Asian citrus psyllid Diaphorina citri. Bromophenol blue droplets were topically applied to fifth instar nymphs and adults on the ventral side of the thorax between the three pairs of legs. In addition to video recordings that showed sucking of the bromophenol blue by the stylets, dissected guts turned blue indicating that the uptake was through feeding. Thus, we called the method topical feeding. We targeted the abnormal wing disc gene (awd), also called nucleoside diphosphate kinase (NDPK), as a reporter gene to prove the uptake of dsRNA via this method of delivery. Our results showed that dsRNA-awd caused reduction of awd expression and nymph mortality. Survival and lifespan of adults emerged from treated nymphs and treated adults were affected. Silencing awd caused wing malformation in the adults emerged from treated nymphs. Topical feeding as a delivery of dsRNA is highly efficient for both nymphs and adults. The described method could be used to increase the efficiency of RNAi in D. citri and other sap piercing-sucking hemipterans. © 2017 Wiley Periodicals, Inc.

  12. Post-transcriptional silencing of flavonol synthase mRNA in tobacco leads to fruits with arrested seed set.

    Directory of Open Access Journals (Sweden)

    Monika Mahajan

    Full Text Available Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi through post-transcriptional gene silencing (PTGS of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless

  13. RNA interference gene therapy in dominant retinitis pigmentosa and cone-rod dystrophy mouse models caused by GCAP1 mutations

    Directory of Open Access Journals (Sweden)

    Li eJiang

    2014-04-01

    Full Text Available RNA interference (RNAi knockdown is an efficacious therapeutic strategy for silencing genes causative for dominant retinal dystrophies. To test this, we used self-complementary (sc AAV2/8 vector to develop an RNAi-based therapy in two dominant retinal degeneration mouse models. The allele-specific model expresses transgenic bovine GCAP1(Y99C establishing a rapid RP-like phenotype, whereas the nonallele-specific model expresses mouse GCAP1(L151F producing a slowly progressing cone/rod dystrophy (CORD. The late onset GCAP1(L151F-CORD mimics the dystrophy observed in human GCAP1-CORD patients. Subretinal injection of scAAV2/8 carrying shRNA expression cassettes specific for bovine or mouse GCAP1 showed strong expression at one week post-injection. In both allele-specific (GCAP1(Y99C-RP and nonallele-specific (GCAP1(L151F-CORD models of dominant retinal dystrophy, RNAi-mediated gene silencing enhanced photoreceptor survival, delayed onset of degeneration and improved visual function. Such results provide a proof of concept toward effective RNAi-based gene therapy mediated by scAAV2/8 for dominant retinal disease based on GCAP1 mutation. Further, nonallele-specific RNAi knockdown of GCAP1 may prove generally applicable toward the rescue of any human GCAP1-based dominant cone-rod dystrophy.

  14. Double-stranded RNA uptake through topical application, mediates silencing of five CYP4 genes and suppresses insecticide resistance in Diaphorina citri.

    Science.gov (United States)

    Killiny, Nabil; Hajeri, Subhas; Tiwari, Siddharth; Gowda, Siddarame; Stelinski, Lukasz L

    2014-01-01

    Silencing of genes through RNA interference (RNAi) in insects has gained momentum during the past few years. RNAi has been used to cause insect mortality, inhibit insect growth, increase insecticide susceptibility, and prevent the development of insecticide resistance. We investigated the efficacy of topically applied dsRNA to induce RNAi for five Cytochrome P450 genes family 4 (CYP4) in Diaphorina citri. We previously reported that these CYP4 genes are associated with the development of insecticide resistance in D. citri. We targeted five CYP4 genes that share a consensus sequence with one dsRNA construct. Quantitative PCR confirmed suppressed expression of the five CYP4 genes as a result of dsRNA topically applied to the thoracic region of D. citri when compared to the expression levels in a control group. Western blot analysis indicated a reduced signal of cytochrome P450 proteins (45 kDa) in adult D. citri treated with the dsRNA. In addition, oxidase activity and insecticide resistance were reduced for D. citri treated with dsRNA that targeted specific CYP4 genes. Mortality was significantly higher in adults treated with dsRNA than in adults treated with water. Our results indicate that topically applied dsRNA can penetrate the cuticle of D. citri and induce RNAi. These results broaden the scope of RNAi as a mechanism to manage pests by targeting a broad range of genes. The results also support the application of RNAi as a viable tool to overcome insecticide resistance development in D. citri populations. However, further research is needed to develop grower-friendly delivery systems for the application of dsRNA under field conditions. Considering the high specificity of dsRNA, this tool can also be used for management of D. citri by targeting physiologically critical genes involved in growth and development.

  15. Double-stranded RNA uptake through topical application, mediates silencing of five CYP4 genes and suppresses insecticide resistance in Diaphorina citri.

    Directory of Open Access Journals (Sweden)

    Nabil Killiny

    Full Text Available Silencing of genes through RNA interference (RNAi in insects has gained momentum during the past few years. RNAi has been used to cause insect mortality, inhibit insect growth, increase insecticide susceptibility, and prevent the development of insecticide resistance. We investigated the efficacy of topically applied dsRNA to induce RNAi for five Cytochrome P450 genes family 4 (CYP4 in Diaphorina citri. We previously reported that these CYP4 genes are associated with the development of insecticide resistance in D. citri. We targeted five CYP4 genes that share a consensus sequence with one dsRNA construct. Quantitative PCR confirmed suppressed expression of the five CYP4 genes as a result of dsRNA topically applied to the thoracic region of D. citri when compared to the expression levels in a control group. Western blot analysis indicated a reduced signal of cytochrome P450 proteins (45 kDa in adult D. citri treated with the dsRNA. In addition, oxidase activity and insecticide resistance were reduced for D. citri treated with dsRNA that targeted specific CYP4 genes. Mortality was significantly higher in adults treated with dsRNA than in adults treated with water. Our results indicate that topically applied dsRNA can penetrate the cuticle of D. citri and induce RNAi. These results broaden the scope of RNAi as a mechanism to manage pests by targeting a broad range of genes. The results also support the application of RNAi as a viable tool to overcome insecticide resistance development in D. citri populations. However, further research is needed to develop grower-friendly delivery systems for the application of dsRNA under field conditions. Considering the high specificity of dsRNA, this tool can also be used for management of D. citri by targeting physiologically critical genes involved in growth and development.

  16. Soilborne wheat mosaic virus (SBWMV 19K protein belongs to a class of cysteine rich proteins that suppress RNA silencing

    Directory of Open Access Journals (Sweden)

    Howard Amanda

    2005-03-01

    Full Text Available Abstract Amino acid sequence analyses indicate that the Soilborne wheat mosaic virus (SBWMV 19K protein is a cysteine-rich protein (CRP and shares sequence homology with CRPs derived from furo-, hordei-, peclu- and tobraviruses. Since the hordei- and pecluvirus CRPs were shown to be pathogenesis factors and/or suppressors of RNA silencing, experiments were conducted to determine if the SBWMV 19K CRP has similar activities. The SBWMV 19K CRP was introduced into the Potato virus X (PVX viral vector and inoculated to tobacco plants. The SBWMV 19K CRP aggravated PVX-induced symptoms and restored green fluorescent protein (GFP expression to GFP silenced tissues. These observations indicate that the SBWMV 19K CRP is a pathogenicity determinant and a suppressor of RNA silencing.

  17. Growth inhibition of head and neck squamous cell carcinoma cells by sgRNA targeting the cyclin D1 mRNA based on TRUE gene silencing.

    Directory of Open Access Journals (Sweden)

    Satoshi Iizuka

    Full Text Available Head and neck squamous cell carcinoma (HNSCC exhibits increased expression of cyclin D1 (CCND1. Previous studies have shown a correlation between poor prognosis of HNSCC and cyclin D1 overexpression. tRNase ZL-utilizing efficacious gene silencing (TRUE gene silencing is one of the RNA-mediated gene expression control technologies that have therapeutic potential. This technology is based on a unique enzymatic property of mammalian tRNase ZL, which is that it can cleave any target RNA at any desired site by recognizing a pre-tRNA-like complex formed between the target RNA and an artificial small guide RNA (sgRNA. In this study, we designed several sgRNAs targeting human cyclin D1 mRNA to examine growth inhibition of HNSCC cells. Transfection of certain sgRNAs decreased levels of cyclin D1 mRNA and protein in HSC-2 and HSC-3 cells, and also inhibited their proliferation. The combination of these sgRNAs and cisplatin showed more than additive inhibition of cancer cell growth. These findings demonstrate that TRUE gene silencing of cyclin D1 leads to inhibition of the growth of HNSCC cells and suggest that these sgRNAs alone or combined with cisplatin may be a useful new therapy for HNSCCs.

  18. RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?

    Directory of Open Access Journals (Sweden)

    Unnikrishnan Unniyampurath

    2016-02-01

    Full Text Available The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR and the CRISPR-associated protein 9 (Cas9 (CRISPR/Cas9 system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term.

  19. Novel siRNA delivery system using a ternary polymer complex with strong silencing effect and no cytotoxicity.

    Science.gov (United States)

    Kodama, Yukinobu; Shiokawa, Yumi; Nakamura, Tadahiro; Kurosaki, Tomoaki; Aki, Keisei; Nakagawa, Hiroo; Muro, Takahiro; Kitahara, Takashi; Higuchi, Norihide; Sasaki, Hitoshi

    2014-01-01

    We developed a novel small interfering RNA (siRNA) delivery system using a ternary complex with polyethyleneimine (PEI) and γ-polyglutamic acid (γ-PGA), which showed silencing effect and no cytotoxicity. The binary complexes of siRNA with PEI were approximately 73-102 nm in particle size and 45-52 mV in ζ-potential. The silencing effect of siRNA/PEI complexes increased with an increase of PEI, and siRNA/PEI complexes with a charge ratio greater than 16 showed significant luciferase knockdown in a mouse colon carcinoma cell line regularly expressing luciferase (Colon26/Luc cells). However, strong cytotoxicity and blood agglutination were observed in the siRNA/Lipofectamine complex and siRNA/PEI16 complex. Recharging cationic complexes with an anionic compound was reported to be a promising method for overcoming these toxicities. We therefore prepared ternary complexes of siRNA with PEI (charge ratio 16) by the addition of γ-PGA to reduce cytotoxicity and deliver siRNA. As expected, the cytotoxicity of the ternary complexes decreased with an increase of γ-PGA content, which decreased the ζ-potential of the complexes. A strong silencing effect comparable to siRNA/Lipofectamine complex was discovered in ternary complexes including γ-PGA with an anionic surface charge. The high incorporation of ternary complexes into Colon26/Luc cells was confirmed with fluorescence microcopy. Having achieved knockdown of an exogenously transfected gene, the ability of the complex to mediate knockdown of an endogenous housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), was assessed in B16-F10 cells. The ternary complex (siRNA/PEI16/γ-PGA12 complex) exhibited a significant GAPDH knockdown effect. Thus, we developed a useful siRNA delivery system.

  20. Transcriptome analysis in cotton boll weevil (Anthonomus grandis and RNA interference in insect pests.

    Directory of Open Access Journals (Sweden)

    Alexandre Augusto Pereira Firmino

    Full Text Available Cotton plants are subjected to the attack of several insect pests. In Brazil, the cotton boll weevil, Anthonomus grandis, is the most important cotton pest. The use of insecticidal proteins and gene silencing by interference RNA (RNAi as techniques for insect control are promising strategies, which has been applied in the last few years. For this insect, there are not much available molecular information on databases. Using 454-pyrosequencing methodology, the transcriptome of all developmental stages of the insect pest, A. grandis, was analyzed. The A. grandis transcriptome analysis resulted in more than 500.000 reads and a data set of high quality 20,841 contigs. After sequence assembly and annotation, around 10,600 contigs had at least one BLAST hit against NCBI non-redundant protein database and 65.7% was similar to Tribolium castaneum sequences. A comparison of A. grandis, Drosophila melanogaster and Bombyx mori protein families' data showed higher similarity to dipteran than to lepidopteran sequences. Several contigs of genes encoding proteins involved in RNAi mechanism were found. PAZ Domains sequences extracted from the transcriptome showed high similarity and conservation for the most important functional and structural motifs when compared to PAZ Domains from 5 species. Two SID-like contigs were phylogenetically analyzed and grouped with T. castaneum SID-like proteins. No RdRP gene was found. A contig matching chitin synthase 1 was mined from the transcriptome. dsRNA microinjection of a chitin synthase gene to A. grandis female adults resulted in normal oviposition of unviable eggs and malformed alive larvae that were unable to develop in artificial diet. This is the first study that characterizes the transcriptome of the coleopteran, A. grandis. A new and representative transcriptome database for this insect pest is now available. All data support the state of the art of RNAi mechanism in insects.

  1. Transcriptome analysis in cotton boll weevil (Anthonomus grandis) and RNA interference in insect pests.

    Science.gov (United States)

    Firmino, Alexandre Augusto Pereira; Fonseca, Fernando Campos de Assis; de Macedo, Leonardo Lima Pepino; Coelho, Roberta Ramos; Antonino de Souza, José Dijair; Togawa, Roberto Coiti; Silva-Junior, Orzenil Bonfim; Pappas, Georgios Joannis; da Silva, Maria Cristina Mattar; Engler, Gilbert; Grossi-de-Sa, Maria Fatima

    2013-01-01

    Cotton plants are subjected to the attack of several insect pests. In Brazil, the cotton boll weevil, Anthonomus grandis, is the most important cotton pest. The use of insecticidal proteins and gene silencing by interference RNA (RNAi) as techniques for insect control are promising strategies, which has been applied in the last few years. For this insect, there are not much available molecular information on databases. Using 454-pyrosequencing methodology, the transcriptome of all developmental stages of the insect pest, A. grandis, was analyzed. The A. grandis transcriptome analysis resulted in more than 500.000 reads and a data set of high quality 20,841 contigs. After sequence assembly and annotation, around 10,600 contigs had at least one BLAST hit against NCBI non-redundant protein database and 65.7% was similar to Tribolium castaneum sequences. A comparison of A. grandis, Drosophila melanogaster and Bombyx mori protein families' data showed higher similarity to dipteran than to lepidopteran sequences. Several contigs of genes encoding proteins involved in RNAi mechanism were found. PAZ Domains sequences extracted from the transcriptome showed high similarity and conservation for the most important functional and structural motifs when compared to PAZ Domains from 5 species. Two SID-like contigs were phylogenetically analyzed and grouped with T. castaneum SID-like proteins. No RdRP gene was found. A contig matching chitin synthase 1 was mined from the transcriptome. dsRNA microinjection of a chitin synthase gene to A. grandis female adults resulted in normal oviposition of unviable eggs and malformed alive larvae that were unable to develop in artificial diet. This is the first study that characterizes the transcriptome of the coleopteran, A. grandis. A new and representative transcriptome database for this insect pest is now available. All data support the state of the art of RNAi mechanism in insects.

  2. Two Novel Motifs of Watermelon Silver Mottle Virus NSs Protein Are Responsible for RNA Silencing Suppression and Pathogenicity.

    Science.gov (United States)

    Huang, Chung-Hao; Hsiao, Weng-Rong; Huang, Ching-Wen; Chen, Kuan-Chun; Lin, Shih-Shun; Chen, Tsung-Chi; Raja, Joseph A J; Wu, Hui-Wen; Yeh, Shyi-Dong

    2015-01-01

    The NSs protein of Watermelon silver mottle virus (WSMoV) is the RNA silencing suppressor and pathogenicity determinant. In this study, serial deletion and point-mutation mutagenesis of conserved regions (CR) of NSs protein were performed, and the silencing suppression function was analyzed through agroinfiltration in Nicotiana benthamiana plants. We found two amino acid (aa) residues, H113 and Y398, are novel functional residues for RNA silencing suppression. Our further analyses demonstrated that H113 at the common epitope (CE) ((109)KFTMHNQ(117)), which is highly conserved in Asia type tospoviruses, and the benzene ring of Y398 at the C-terminal β-sheet motif ((397)IYFL(400)) affect NSs mRNA stability and protein stability, respectively, and are thus critical for NSs RNA silencing suppression. Additionally, protein expression of other six deleted (ΔCR1-ΔCR6) and five point-mutated (Y15A, Y27A, G180A, R181A and R212A) mutants were hampered and their silencing suppression ability was abolished. The accumulation of the mutant mRNAs and proteins, except Y398A, could be rescued or enhanced by co-infiltration with potyviral suppressor HC-Pro. When assayed with the attenuated Zucchini yellow mosaic virus vector in squash plants, the recombinants carrying individual seven point-mutated NSs proteins displayed symptoms much milder than the recombinant carrying the wild type NSs protein, suggesting that these aa residues also affect viral pathogenicity by suppressing the host silencing mechanism.

  3. Immunoregulation by interference RNA (iRNA – mechanisms, role, perspective

    Directory of Open Access Journals (Sweden)

    Emilia Sikora

    2011-08-01

    Full Text Available The functioning of an organism depends on the precise control mechanisms, constantly adjusted to the actual state. Therefore, there is a need for efficient communication between both adjacent and distant cells, which may be executed by proteins such as hormones, neurotransmitters and cytokines. Recently another means of regulation has emerged – short regulatory RNAs (srRNAs. Although discovered only a couple of years ago, the mechanism of RNA interference has already become a topic of thousands of publications, defining its roles in both physiological and pathological processes, such as cancerogenesis and autoimmunization.RNAs regulating cell function may be coded in its genome (both exons and introns or be introduced from the external environment. In mammals microRNAs (miRNAs cooperate with proteins from the Ago/PIWI family to form effector ribonucleoprotein complexes, and owing to their complementarity to the target mRNA, control genes’ expression at the posttranscriptional level, either through the suppression of mRNA translation or through mRNA degradation.SrRNAs are crucial regulators throughout the development of immune cells, starting from hematopoietic stem cells, up to the effector cells of the adaptive immune response. Moreover, some of the regulatory cells perform their function by releasing miRNAs, which are then transported to the target cells, possibly enclosed in the exosomes.

  4. Heterologous RNA-silencing suppressors from both plant- and animal-infecting viruses support plum pox virus infection.

    Science.gov (United States)

    Maliogka, Varvara I; Calvo, María; Carbonell, Alberto; García, Juan Antonio; Valli, Adrian

    2012-07-01

    HCPro, the RNA-silencing suppressor (RSS) of viruses belonging to the genus Potyvirus in the family Potyviridae, is a multifunctional protein presumably involved in all essential steps of the viral infection cycle. Recent studies have shown that plum pox potyvirus (PPV) HCPro can be replaced successfully by cucumber vein yellowing ipomovirus P1b, a sequence-unrelated RSS from a virus of the same family. In order to gain insight into the requirement of a particular RSS to establish a successful potyviral infection, we tested the ability of different heterologous RSSs from both plant- and animal-infecting viruses to substitute for HCPro. Making use of engineered PPV chimeras, we show that PPV HCPro can be replaced functionally by some, but not all, unrelated RSSs, including the NS1 protein of the mammal-infecting influenza A virus. Interestingly, the capacity of a particular RSS to replace HCPro does not correlate strictly with its RNA silencing-suppression strength. Altogether, our results suggest that not all suppression strategies are equally suitable for efficient escape of PPV from the RNA-silencing machinery. The approach followed here, based on using PPV chimeras in which an under-consideration RSS substitutes for HCPro, could further help to study the function of diverse RSSs in a 'highly sensitive' RNA-silencing context, such as that taking place in plant cells during the process of a viral infection.

  5. Double-stranded RNA delivery through soaking mediates silencing of the muscle protein 20 and increases mortality to the Asian citrus psyllid, Diaphorina citri.

    Science.gov (United States)

    Yu, Xiudao; Gowda, Siddarame; Killiny, Nabil

    2017-09-01

    Asian citrus psyllid, Diaphorina citri Kuwayama, is the most important economic pest of citrus because it transmits Candidatus Liberibacter asiaticus (CLas), the causal agent of huanglongbing (HLB). Silencing genes by RNA interference (RNAi) is a promising approach for controlling D. citri. RNAi-based insect management strategies depend on the selection of suitable target genes. The muscle protein 20 gene DcMP20 was characterized from D. citri in an effort to impair proper muscle development through RNAi. Phylogenetic analysis showed that DcMP20 was more closely related to MP20 from Drosophila compared with its counterpart from other insect species. Developmental expression analysis revealed that transcription of DcMP20 was development dependent and reached a maximum level in the last instar (fourth-fifth) of the nymphal stage. The extent of RNAi in D. citri was dose dependent, with dsRNA-DcMP20 at 75 ng µL -1 being sufficient to knock down endogenous DcMP20 expression, which resulted in significant mortality and reduced body weight that positively correlated with the silencing of DcMP20. No effect was found when dsRNA-GFP or water was used, indicating the specific effect of dsRNA-DcMP20. Our results suggest that dsRNA can be delivered to D. citri through soaking, and DcMP20 is an effective RNAi target to be used in the management of D. citri. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  6. RNA interference in a maize pathogen reduces toxin production

    Science.gov (United States)

    The fungus Fusarium verticillioides can produce fumonisin mycotoxins in ears under certain environmental conditions. Because fumonisins are unhealthy for humans and livestock, control strategies with nominal risk to the environment are needed to reduce fumonisin exposure. Host-induced gene silencing...

  7. Evasion of short interfering RNA-directed antiviral silencing in Musa acuminata persistently infected with six distinct banana streak pararetroviruses.

    Science.gov (United States)

    Rajeswaran, Rajendran; Seguin, Jonathan; Chabannes, Matthieu; Duroy, Pierre-Olivier; Laboureau, Nathalie; Farinelli, Laurent; Iskra-Caruana, Marie-Line; Pooggin, Mikhail M

    2014-10-01

    Vegetatively propagated crop plants often suffer from infections with persistent RNA and DNA viruses. Such viruses appear to evade the plant defenses that normally restrict viral replication and spread. The major antiviral defense mechanism is based on RNA silencing generating viral short interfering RNAs (siRNAs) that can potentially repress viral genes posttranscriptionally through RNA cleavage and transcriptionally through DNA cytosine methylation. Here we examined the RNA silencing machinery of banana plants persistently infected with six pararetroviruses after many years of vegetative propagation. Using deep sequencing, we reconstructed consensus master genomes of the viruses and characterized virus-derived and endogenous small RNAs. Consistent with the presence of endogenous siRNAs that can potentially establish and maintain DNA methylation, the banana genomic DNA was extensively methylated in both healthy and virus-infected plants. A novel class of abundant 20-nucleotide (nt) endogenous small RNAs with 5'-terminal guanosine was identified. In all virus-infected plants, 21- to 24-nt viral siRNAs accumulated at relatively high levels (up to 22% of the total small RNA population) and covered the entire circular viral DNA genomes in both orientations. The hotspots of 21-nt and 22-nt siRNAs occurred within open reading frame (ORF) I and II and the 5' portion of ORF III, while 24-nt siRNAs were more evenly distributed along the viral genome. Despite the presence of abundant viral siRNAs of different size classes, the viral DNA was largely free of cytosine methylation. Thus, the virus is able to evade siRNA-directed DNA methylation and thereby avoid transcriptional silencing. This evasion of silencing likely contributes to the persistence of pararetroviruses in banana plants. We report that DNA pararetroviruses in Musa acuminata banana plants are able to evade DNA cytosine methylation and transcriptional gene silencing, despite being targeted by the host silencing

  8. Radiation enhancement effect of RNA interference for HIF-1α on the transplant tumor

    International Nuclear Information System (INIS)

    Ren Ruimei; Sun Xindong; Zhao Hanxi; Yan Qingxia; Huang Guangwu

    2008-01-01

    Objective: To determine and explore the radiation enhancement of RNA interference for HIF-1α on the transplant tumor using polycationic polyethylenimine (PEI), as a new kind of gene vector. Methods: SPCA-1 nude mouse model was used. 160 nude mice bearing SPCA-1 were randomly divided into 4 treated groups and 1 control groups, each group had 32 mice. The expression of HIF-1α was studied by immunohistochemical method after RNA interference for HIF-1α. The differences of the volume, weight, survival time of the transplant tumor were studied among the simple radiation group, the simple RNA interference for HIF- 1α group and the combination of radiation and RNA interference for HIF-1α. Results: The expression of HIF-1α was decreased after RNA interference for HIF-1α. RNA interference for HIF-1α combined with radiation decreased the volume, weight of the transplant tumor, and prolonged its survival time period significantly than other methods. Conclusions: RNA interference targeting HIF-1α might enhance the radiosensitivity of the transplant tumor using PEI as a new kind of gene vector in vitro. (authors)

  9. Targeted transfection increases siRNA uptake and gene silencing of primary endothelial cells in vitro--a quantitative study.

    Science.gov (United States)

    Asgeirsdóttir, Sigridur A; Talman, Eduard G; de Graaf, Inge A; Kamps, Jan A A M; Satchell, Simon C; Mathieson, Peter W; Ruiters, Marcel H J; Molema, Grietje

    2010-01-25

    Applications of small-interfering RNA (siRNA) call for specific and efficient delivery of siRNA into particular cell types. We developed a novel, non-viral targeting system to deliver siRNA specifically into inflammation-activated endothelial cells. This was achieved by conjugating the cationic amphiphilic lipid SAINT to antibodies recognizing the inflammatory cell adhesion molecule E-selectin. These anti-E-selectin-SAINT lipoplexes (SAINTarg) maintained antigen recognition capacity of the parental antibody in vitro, and ex vivo in human kidney tissue slices subjected to inflammatory conditions. Regular SAINT mediated transfection resulted in efficient gene silencing in human microvascular endothelial cells (HMEC-1) and conditionally immortalized glomerular endothelial cells (ciGEnC). However, primary human umbilical vein endothelial cells (HUVEC) transfected poorly, a phenomenon that we could quantitatively correlate with a cell-type specific capacity to facilitate siRNA uptake. Importantly, SAINTarg increased siRNA uptake and transfection specificity for activated endothelial cells. Transfection with SAINTarg delivered significantly more siRNA into activated HUVEC, compared to transfection with non-targeted SAINT. The enhanced uptake of siRNA was corroborated by improved silencing of both gene- and protein expression of VE-cadherin in activated HUVEC, indicating that SAINTarg delivered functionally active siRNA into endothelial cells. The obtained results demonstrate a successful design of a small nucleotide carrier system with improved and specific siRNA delivery into otherwise difficult-to-transfect primary endothelial cells, which in addition reduced considerably the amount of siRNA needed for gene silencing. Copyright 2009 Elsevier B.V. All rights reserved.

  10. Knockdown of TFIIS by RNA silencing inhibits cancer cell proliferation and induces apoptosis

    International Nuclear Information System (INIS)

    Hubbard, Kyle; Catalano, Jennifer; Puri, Raj K; Gnatt, Averell

    2008-01-01

    A common element among cancer cells is the presence of improperly controlled transcription. In these cells, the degree of specific activation of some genes is abnormal, and altering the aberrant transcription may therefore directly target cancer. TFIIS is a transcription elongation factor, which directly binds the transcription motor, RNA Polymerase II and allows it to read through various transcription arrest sites. We report on RNA interference of TFIIS, a transcription elongation factor, and its affect on proliferation of cancer cells in culture. RNA interference was performed by transfecting siRNA to specifically knock down TFIIS expression in MCF7, MCF10A, PL45 and A549 cells. Levels of TFIIS expression were determined by the Quantigene method, and relative protein levels of TFIIS, c-myc and p53 were determined by C-ELISA. Induction of apoptosis was determined by an enzymatic Caspase 3/7 assay, as well as a non-enzymatic assay detecting cytoplasmic mono- and oligonucleosomes. A gene array analysis was conducted for effects of TFIIS siRNA on MCF7 and MCF10A cell lines. Knockdown of TFIIS reduced cancer cell proliferation in breast, lung and pancreatic cancer cell lines. More specifically, TFIIS knockdown in the MCF7 breast cancer cell line induced cancer cell death and increased c-myc and p53 expression whereas TFIIS knockdown in the non-cancerous breast cell line MCF10A was less affected. Differential effects of TFIIS knockdown in MCF7 and MCF10A cells included the estrogenic, c-myc and p53 pathways, as observed by C-ELISA and gene array, and were likely involved in MCF7 cell-death. Although transcription is a fundamental process, targeting select core transcription factors may provide for a new and potent avenue for cancer therapeutics. In the present study, knockdown of TFIIS inhibited cancer cell proliferation, suggesting that TFIIS could be studied as a potential cancer target within the transcription machinery

  11. GW182-Free microRNA Silencing Complex Controls Post-transcriptional Gene Expression during Caenorhabditis elegans Embryogenesis.

    Directory of Open Access Journals (Sweden)

    Guillaume Jannot

    2016-12-01

    Full Text Available MicroRNAs and Argonaute form the microRNA induced silencing complex or miRISC that recruits GW182, causing mRNA degradation and/or translational repression. Despite the clear conservation and molecular significance, it is unknown if miRISC-GW182 interaction is essential for gene silencing during animal development. Using Caenorhabditis elegans to explore this question, we examined the relationship and effect on gene silencing between the GW182 orthologs, AIN-1 and AIN-2, and the microRNA-specific Argonaute, ALG-1. Homology modeling based on human Argonaute structures indicated that ALG-1 possesses conserved Tryptophan-binding Pockets required for GW182 binding. We show in vitro and in vivo that their mutations severely altered the association with AIN-1 and AIN-2. ALG-1 tryptophan-binding pockets mutant animals retained microRNA-binding and processing ability, but were deficient in reporter silencing activity. Interestingly, the ALG-1 tryptophan-binding pockets mutant phenocopied the loss of alg-1 in worms during larval stages, yet was sufficient to rescue embryonic lethality, indicating the dispensability of AINs association with the miRISC at this developmental stage. The dispensability of AINs in miRNA regulation is further demonstrated by the capacity of ALG-1 tryptophan-binding pockets mutant to regulate a target of the embryonic mir-35 microRNA family. Thus, our results demonstrate that the microRNA pathway can act independently of GW182 proteins during C. elegans embryogenesis.

  12. RNA Interference: A Promising Tool in the Control of Important Vector Born Diseases Zika, Dengue Fever, and Malaria

    Directory of Open Access Journals (Sweden)

    Jalil Nejati

    2017-05-01

    Full Text Available Background and Objectives: RNA interference is a process, in which a molecule of double-stranded RNA prevents the expression of a particular gene and leads to its silencing. Application of this technology in the control of disease-carrying insects is rising in agriculture and medical sciences. Also, its application in control of insect-borne diseases could be considered as a new, important, and effective approach. In this article, it was attempted to study the mechanisms of RNA interference, routs of its delivery to insects, as well as its application in genetic control of disease vector insects. Methods: In this study, 71 indexed articles in databases, such as Pubmed, SID, Scopus, Science direct, and Google scholar, were used. Results: dsRNA could be delivered to insect body through three routes of oral, injection, and Impregnation. The mechanism of dsRNA entrance into the cells has considerable effect on the success and applicability of this technique. Identification of host-parasite relationship in the insect body is one of the important applications of RNAi in medical entomology. Conclusion: Although, there is a considerable number of researches on RNAi in the agricultural pests field, studies on insect vectors of human diseases have been mostly in-vivo. However, application of RNAi is suggested as a new, safe and applicable approach, alone or along with other methods. Certainly, further researches in this field can pave the way for enforcement measures in the control of disease vectors, especially Zika, dengue fever, and malaria in the not so distant future.

  13. In vivo silencing of alpha-synuclein using naked siRNA

    Directory of Open Access Journals (Sweden)

    Charisse Klaus

    2008-11-01

    Full Text Available Abstract Background Overexpression of α-synuclein (SNCA in families with multiplication mutations causes parkinsonism and subsequent dementia, characterized by diffuse Lewy Body disease post-mortem. Genetic variability in SNCA contributes to risk of idiopathic Parkinson's disease (PD, possibly as a result of overexpression. SNCA downregulation is therefore a valid therapeutic target for PD. Results We have identified human and murine-specific siRNA molecules which reduce SNCA in vitro. As a proof of concept, we demonstrate that direct infusion of chemically modified (naked, murine-specific siRNA into the hippocampus significantly reduces SNCA levels. Reduction of SNCA in the hippocampus and cortex persists for a minimum of 1 week post-infusion with recovery nearing control levels by 3 weeks post-infusion. Conclusion We have developed naked gene-specific siRNAs that silence expression of SNCA in vivo. This approach may prove beneficial toward our understanding of the endogenous functional equilibrium of SNCA, its role in disease, and eventually as a therapeutic strategy for α-synucleinopathies resulting from SNCA overexpression.

  14. In vivo silencing of alpha-synuclein using naked siRNA

    Science.gov (United States)

    Lewis, Jada; Melrose, Heather; Bumcrot, David; Hope, Andrew; Zehr, Cynthia; Lincoln, Sarah; Braithwaite, Adam; He, Zhen; Ogholikhan, Sina; Hinkle, Kelly; Kent, Caroline; Toudjarska, Ivanka; Charisse, Klaus; Braich, Ravi; Pandey, Rajendra K; Heckman, Michael; Maraganore, Demetrius M; Crook, Julia; Farrer, Matthew J

    2008-01-01

    Background Overexpression of α-synuclein (SNCA) in families with multiplication mutations causes parkinsonism and subsequent dementia, characterized by diffuse Lewy Body disease post-mortem. Genetic variability in SNCA contributes to risk of idiopathic Parkinson's disease (PD), possibly as a result of overexpression. SNCA downregulation is therefore a valid therapeutic target for PD. Results We have identified human and murine-specific siRNA molecules which reduce SNCA in vitro. As a proof of concept, we demonstrate that direct infusion of chemically modified (naked), murine-specific siRNA into the hippocampus significantly reduces SNCA levels. Reduction of SNCA in the hippocampus and cortex persists for a minimum of 1 week post-infusion with recovery nearing control levels by 3 weeks post-infusion. Conclusion We have developed naked gene-specific siRNAs that silence expression of SNCA in vivo. This approach may prove beneficial toward our understanding of the endogenous functional equilibrium of SNCA, its role in disease, and eventually as a therapeutic strategy for α-synucleinopathies resulting from SNCA overexpression. PMID:18976489

  15. Two classes of silencing RNAs move between C. elegans tissues

    Science.gov (United States)

    Jose, Antony M; Garcia, Giancarlo A; Hunter, Craig P

    2011-01-01

    Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the endonuclease DCR-1, which cleaves long dsRNA into double-stranded short-interfering RNA (ds-siRNA), and the putative nucleotidyltransferase MUT-2 (RDE-3). However, single-stranded siRNA and downstream secondary siRNA produced upon amplification by the RNA-dependent RNA Polymerase RRF-1 do not generate mobile silencing RNA. Restricting inter-tissue transport to long dsRNA and directly processed siRNA intermediates rather than amplified siRNA may serve to modulate the extent of systemic silencing in proportion to available dsRNA. PMID:21984186

  16. The RNA silencing enzyme RNA polymerase v is required for plant immunity.

    Directory of Open Access Journals (Sweden)

    Ana López

    2011-12-01

    Full Text Available RNA-directed DNA methylation (RdDM is an epigenetic control mechanism driven by small interfering RNAs (siRNAs that influence gene function. In plants, little is known of the involvement of the RdDM pathway in regulating traits related to immune responses. In a genetic screen designed to reveal factors regulating immunity in Arabidopsis thaliana, we identified NRPD2 as the OVEREXPRESSOR OF CATIONIC PEROXIDASE 1 (OCP1. NRPD2 encodes the second largest subunit of the plant-specific RNA Polymerases IV and V (Pol IV and Pol V, which are crucial for the RdDM pathway. The ocp1 and nrpd2 mutants showed increases in disease susceptibility when confronted with the necrotrophic fungal pathogens Botrytis cinerea and Plectosphaerella cucumerina. Studies were extended to other mutants affected in different steps of the RdDM pathway, such as nrpd1, nrpe1, ago4, drd1, rdr2, and drm1drm2 mutants. Our results indicate that all the mutants studied, with the exception of nrpd1, phenocopy the nrpd2 mutants; and they suggest that, while Pol V complex is required for plant immunity, Pol IV appears dispensable. Moreover, Pol V defective mutants, but not Pol IV mutants, show enhanced disease resistance towards the bacterial pathogen Pseudomonas syringae DC3000. Interestingly, salicylic acid (SA-mediated defenses effective against PsDC3000 are enhanced in Pol V defective mutants, whereas jasmonic acid (JA-mediated defenses that protect against fungi are reduced. Chromatin immunoprecipitation analysis revealed that, through differential histone modifications, SA-related defense genes are poised for enhanced activation in Pol V defective mutants and provide clues for understanding the regulation of gene priming during defense. Our results highlight the importance of epigenetic control as an additional layer of complexity in the regulation of plant immunity and point towards multiple components of the RdDM pathway being involved in plant immunity based on genetic evidence

  17. The RNA silencing enzyme RNA polymerase v is required for plant immunity.

    Science.gov (United States)

    López, Ana; Ramírez, Vicente; García-Andrade, Javier; Flors, Victor; Vera, Pablo

    2011-12-01

    RNA-directed DNA methylation (RdDM) is an epigenetic control mechanism driven by small interfering RNAs (siRNAs) that influence gene function. In plants, little is known of the involvement of the RdDM pathway in regulating traits related to immune responses. In a genetic screen designed to reveal factors regulating immunity in Arabidopsis thaliana, we identified NRPD2 as the OVEREXPRESSOR OF CATIONIC PEROXIDASE 1 (OCP1). NRPD2 encodes the second largest subunit of the plant-specific RNA Polymerases IV and V (Pol IV and Pol V), which are crucial for the RdDM pathway. The ocp1 and nrpd2 mutants showed increases in disease susceptibility when confronted with the necrotrophic fungal pathogens Botrytis cinerea and Plectosphaerella cucumerina. Studies were extended to other mutants affected in different steps of the RdDM pathway, such as nrpd1, nrpe1, ago4, drd1, rdr2, and drm1drm2 mutants. Our results indicate that all the mutants studied, with the exception of nrpd1, phenocopy the nrpd2 mutants; and they suggest that, while Pol V complex is required for plant immunity, Pol IV appears dispensable. Moreover, Pol V defective mutants, but not Pol IV mutants, show enhanced disease resistance towards the bacterial pathogen Pseudomonas syringae DC3000. Interestingly, salicylic acid (SA)-mediated defenses effective against PsDC3000 are enhanced in Pol V defective mutants, whereas jasmonic acid (JA)-mediated defenses that protect against fungi are reduced. Chromatin immunoprecipitation analysis revealed that, through differential histone modifications, SA-related defense genes are poised for enhanced activation in Pol V defective mutants and provide clues for understanding the regulation of gene priming during defense. Our results highlight the importance of epigenetic control as an additional layer of complexity in the regulation of plant immunity and point towards multiple components of the RdDM pathway being involved in plant immunity based on genetic evidence, but whether

  18. Bugs Are Not to Be Silenced: Small RNA Pathways and Antiviral Responses in Insects.

    Science.gov (United States)

    Mongelli, Vanesa; Saleh, Maria-Carla

    2016-09-29

    Like every other organism on Earth, insects are infected with viruses, and they rely on RNA interference (RNAi) mechanisms to circumvent viral infections. A remarkable characteristic of RNAi is that it is both broadly acting, because it is triggered by double-stranded RNA molecules derived from virtually any virus, and extremely specific, because it targets only the particular viral sequence that initiated the process. Reviews covering the different facets of the RNAi antiviral immune response in insects have been published elsewhere. In this review, we build a framework to guide future investigation. We focus on the remaining questions and avenues of research that need to be addressed to move the field forward, including issues such as the activity of viral suppressors of RNAi, comparative genomics, the development of detailed maps of the subcellular localization of viral replication complexes with the RNAi machinery, and the regulation of the antiviral RNAi response.

  19. CRISPR/Cas13 as a Tool for RNA Interference

    KAUST Repository

    Ali, Zahir; Mahas, Ahmed; Mahfouz, Magdy M.

    2018-01-01

    Almost all biological processes involve RNA, making it crucial to develop tools for manipulation of the transcriptome. The bacterial CRISPR/Cas13 system was recently rewired to facilitate RNA manipulation in eukaryotes, including plants. We discuss

  20. Effective gene silencing activity of prodrug-type 2'-O-methyldithiomethyl siRNA compared with non-prodrug-type 2'-O-methyl siRNA.

    Science.gov (United States)

    Hayashi, Junsuke; Nishigaki, Misa; Ochi, Yosuke; Wada, Shun-Ichi; Wada, Fumito; Nakagawa, Osamu; Obika, Satoshi; Harada-Shiba, Mariko; Urata, Hidehito

    2018-07-01

    Small interfering RNAs (siRNAs) are an active agent to induce gene silencing and they have been studied for becoming a biological and therapeutic tool. Various 2'-O-modified RNAs have been extensively studied to improve the nuclease resistance. However, the 2'-O-modified siRNA activities were often decreased by modification, since the bulky 2'-O-modifications inhibit to form a RNA-induced silencing complex (RISC). We developed novel prodrug-type 2'-O-methyldithiomethyl (MDTM) siRNA, which is converted into natural siRNA in an intracellular reducing environment. Prodrug-type 2'-O-MDTM siRNAs modified at the 5'-end side including 5'-end nucleotide and the seed region of the antisense strand exhibited much stronger gene silencing effect than non-prodrug-type 2'-O-methyl (2'-O-Me) siRNAs. Furthermore, the resistances for nuclease digestion of siRNAs were actually enhanced by 2'-O-MDTM modifications. Our results indicate that 2'-O-MDTM modifications improve the stability of siRNA in serum and they are able to be introduced at any positions of siRNA. Copyright © 2018 Elsevier Ltd. All rights reserved.

  1. AGO6 functions in RNA-mediated transcriptional gene silencing in shoot and root meristems in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Changho Eun

    Full Text Available RNA-directed DNA methylation (RdDM is a small interfering RNA (siRNA-mediated epigenetic modification that contributes to transposon silencing in plants. RdDM requires a complex transcriptional machinery that includes specialized RNA polymerases, named Pol IV and Pol V, as well as chromatin remodelling proteins, transcription factors, RNA binding proteins, and other plant-specific proteins whose functions are not yet clarified. In Arabidopsis thaliana, DICER-LIKE3 and members of the ARGONAUTE4 group of ARGONAUTE (AGO proteins are involved, respectively, in generating and using 24-nt siRNAs that trigger methylation and transcriptional gene silencing of homologous promoter sequences. AGO4 is the main AGO protein implicated in the RdDM pathway. Here we report the identification of the related AGO6 in a forward genetic screen for mutants defective in RdDM and transcriptional gene silencing in shoot and root apical meristems in Arabidopsis thaliana. The identification of AGO6, and not AGO4, in our screen is consistent with the primary expression of AGO6 in shoot and root growing points.

  2. Expression of plasmid-based shRNA against the E1 and nsP1 genes effectively silenced Chikungunya virus replication.

    Directory of Open Access Journals (Sweden)

    Shirley Lam

    Full Text Available BACKGROUND: Chikungunya virus (CHIKV is a re-emerging alphavirus that causes chikungunya fever and persistent arthralgia in humans. Currently, there is no effective vaccine or antiviral against CHIKV infection. Therefore, this study evaluates whether RNA interference which targets at viral genomic level may be a novel antiviral strategy to inhibit the medically important CHIKV infection. METHODS: Plasmid-based small hairpin RNA (shRNA was investigated for its efficacy in inhibiting CHIKV replication. Three shRNAs designed against CHIKV Capsid, E1 and nsP1 genes were transfected to establish stable shRNA-expressing cell clones. Following infection of stable shRNA cells clones with CHIKV at M.O.I. 1, viral plaque assay, Western blotting and transmission electron microscopy were performed. The in vivo efficacy of shRNA against CHIKV replication was also evaluated in a suckling murine model of CHIKV infection. RESULTS: Cell clones expressing shRNAs against CHIKV E1 and nsP1 genes displayed significant inhibition of infectious CHIKV production, while shRNA Capsid demonstrated a modest inhibitory effect as compared to scrambled shRNA cell clones and non-transfected cell controls. Western blot analysis of CHIKV E2 protein expression and transmission electron microscopy of shRNA E1 and nsP1 cell clones collectively demonstrated similar inhibitory trends against CHIKV replication. shRNA E1 showed non cell-type specific anti-CHIKV effects and broad-spectrum silencing against different geographical strains of CHIKV. Furthermore, shRNA E1 clones did not exert any inhibition against Dengue virus and Sindbis virus replication, thus indicating the high specificity of shRNA against CHIKV replication. Moreover, no shRNA-resistant CHIKV mutant was generated after 50 passages of CHIKV in the stable cell clones. More importantly, strong and sustained anti-CHIKV protection was conferred in suckling mice pre-treated with shRNA E1. CONCLUSION: Taken together, these

  3. Advances in RNA interference technology and its impact on nutritional improvement, disease and insect control in plants.

    Science.gov (United States)

    Katoch, Rajan; Thakur, Neelam

    2013-03-01

    This review highlights the advances in the knowledge of RNA interference (RNAi) and discusses recent progress on the functionality of different components RNAi machinery operating in the organisms. The silencing of genes by RNA interference has become the technology of choice for investigation of gene functions in different organisms. The refinement in the knowledge of the endogenous RNAi pathways in plants along with the development of new strategies and applications for the improvement of nutritional value of important agricultural crops through suppression of genes in different plants have opened new vistas for nutritional security. The improvement in the nutritional status of the plants and reduction in the level of toxins or antinutrients was desired for long, but the available technology was not completely successful in achieving the tissue specific regulation of some genes. In the recent years, a number of economically important crop plants have been tested successfully for improving plant nutritional value through metabolic engineering using RNAi. The implications of this technology for crop improvement programs, including nutritional enrichment, reduction of antinutrients, disease, and insect control have been successfully tested in variety of crops with commercial considerations. The enhancement of the nutraceutical traits for the desired health benefits in common crop plants through manipulation of gene expression has been elaborated in this article. The tremendous potential with RNAi technology is expected to revolutionize the modern agriculture for meeting the growing challenges is discussed.

  4. CRISPR/Cas13 as a Tool for RNA Interference

    KAUST Repository

    Ali, Zahir

    2018-03-28

    Almost all biological processes involve RNA, making it crucial to develop tools for manipulation of the transcriptome. The bacterial CRISPR/Cas13 system was recently rewired to facilitate RNA manipulation in eukaryotes, including plants. We discuss here the opportunities and limitations of using CRISPR/Cas13 in plants for various types of RNA manipulation.

  5. RNA interference of acetylcholinesterase in the Asian citrus psyllid, Diaphorina citri, increases its susceptibility to carbamate and organophosphate insecticides.

    Science.gov (United States)

    Kishk, Abdelaziz; Hijaz, Faraj; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Killiny, Nabil

    2017-11-01

    The Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Lividae) transmits the Candidatus Liberibacter asiaticus, which causes citrus greening disease or Huanglongbing, (HLB). To date, there is no efficient cure for HLB disease and the control of D. citri using insecticides became the most important tools for the management of HLB. However, the extensive use of insecticides could increase D. citri resistance to these insecticides. The objective of this study was to investigate the effect of RNA interference of acetylcholinesterase (AChE) on the mortality and susceptibility of D. citri to the four major insecticides used in Florida. In this study, we used a consensus sequence derived from the two AChE genes and cholinesterase 2-like (ChE-2-like) gene to target all of the three genes. Treatment with dsRNA-AChE increased the mortality percentages of both nymphs and adults of D. citri. The mortality percentage increased with the increase in the concentration of applied dsRNA-AChE, and the highest mortality (> 60%) was observed at the highest applied concentration (125ng/μl). Treatments of nymphs or adults with dsRNA-AChE down-regulated the expression of the three targeted genes of D. citri. Silencing of AChE and ChE in D. citri nymphs increased the susceptibility of emerged adults to chlorpyrifos and carbaryl, which act as AChE inhibitors. However, treatment with dsRNA-AChE did not increase the susceptibility of emerged adults to imidacloprid, which acts as an agonist of nicotinic acetylcholine receptors. In the same manner, treatment of adults with dsRNA-AChE increased their susceptibility to chlorpyrifos and carbaryl, but did not affect their susceptibility to imidacloprid. The ANOVA did not show any significant increase in susceptibility of D. citri adults to fenpropathrin after treatment with dsRNA-AChE, either as nymphs or as adults. However, simple linear regression showed that treatment with dsRNA-AChE increased D. citri susceptibility to fenpropathrin

  6. Stable RNA interference of ErbB-2 gene synergistic with epirubicin suppresses breast cancer growth in vitro and in vivo

    International Nuclear Information System (INIS)

    Hu Xiaoqu; Su Fengxi; Qin Li; Jia Weijuan; Gong Chang; Yu Fengyan; Guo Jujiang; Song Erwei

    2006-01-01

    Overexpression of human epidermal growth factor receptor-2 (Her2, ErbB-2) contributes to the progression and metastasis of breast cancer, implying that Her2 gene is a suitable target of RNA interference (RNAi) for breast cancer therapy. Here, we employed plasmid-mediated expression of 2 different Her2-shRNAs (pU6-Her2shRNAs) efficiently silenced the target gene expression on Her2 expressing SKBR-3 breast cancer cells in both mRNA and protein levels. Consequently, pU6-Her2shRNA increased apoptosis and reduced proliferation of SKBR-3 cells assayed by TUNEL and MTT, respectively. In vivo, intra-tumor injection of pU6-Her2shRNA inhibited the growth of SKBR-3 tumors inoculated subcutaneously in nude mice. Furthermore, pU6-Her2shRNA synergized the tumor suppression effect of epirubicin to SKBR-3 cells in vitro and implanted subcutaneously in nude mice. Therefore, we concluded that stable silencing of Her2 gene expression with plasmid expressing shRNA may hold great promise as a novel therapy for Her2 expressing breast cancers alone or in combination with anthracycline chemotherapy

  7. Decreased expression of RNA interference machinery, Dicer and Drosha, is associated with poor outcome in ovarian cancer patients

    Energy Technology Data Exchange (ETDEWEB)

    Merritt, William M.; Lin, Yvonne G.; Han, Liz Y.; Kamat, Aparna A.; Spannuth, Whitney A.; Schmandt, Rosemarie; Urbauer, Diana; Pennacchio, Len A.; Cheng, Jan-Fang; Zeidan, Alexandra; Wang, Hua; Mueller, Peter; Lenburg, Marc E.; Gray, Joe W.; Mok, Samuel; Birrer, Michael J.; Lopez-Berestein, Gabriel; Coleman, Robert L.; Bar-Eli, Menashe; Sood, Anil K.

    2008-05-06

    The clinical and functional significance of RNA interference (RNAi) machinery, Dicer and Drosha, in ovarian cancer is not known and was examined. Dicer and Drosha expression was measured in ovarian cancer cell lines (n=8) and invasive epithelial ovarian cancer specimens (n=111) and correlated with clinical outcome. Validation was performed with previously published cohorts of ovarian, breast, and lung cancer patients. Anti-Galectin-3 siRNA and shRNA transfections were used for in vitro functional studies. Dicer and Drosha mRNA and protein levels were decreased in 37% to 63% of ovarian cancer cell lines and in 60% and 51% of human ovarian cancer specimens, respectively. Low Dicer was significantly associated with advanced tumor stage (p=0.007), and low Drosha with suboptimal surgical cytoreduction (p=0.02). Tumors with both high Dicer and Drosha were associated with increased median patient survival (>11 years vs. 2.66 years for other groups; p<0.001). In multivariate analysis, high Dicer (HR=0.48; p=0.02), high-grade histology (HR=2.46; p=0.03), and poor chemoresponse (HR=3.95; p<0.001) were identified as independent predictors of disease-specific survival. Findings of poor clinical outcome with low Dicer expression were validated in separate cohorts of cancer patients. Galectin-3 silencing with siRNA transfection was superior to shRNA in cell lines with low Dicer (78-95% vs. 4-8% compared to non-targeting sequences), and similar in cell lines with high Dicer. Our findings demonstrate the clinical and functional impact of RNAi machinery alterations in ovarian carcinoma and support the use of siRNA constructs that do not require endogenous Dicer and Drosha for therapeutic applications.

  8. An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing

    DEFF Research Database (Denmark)

    Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria

    2016-01-01

    /2 12 min (naked) to t1/2 45 min (single cholesteryl) and t1/2 71 min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing......HSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies...

  9. Dicer and Argonaute Genes Involved in RNA Interference in the Entomopathogenic Fungus Metarhizium robertsii.

    Science.gov (United States)

    Meng, Huimin; Wang, Zhangxun; Wang, Yulong; Zhu, Hong; Huang, Bo

    2017-04-01

    RNA interference (RNAi) is a gene-silencing mechanism that plays an important role in gene regulation in a number of eukaryotic organisms. Two core components, Dicer and Argonaute, are central in the RNAi machinery. However, the physiological roles of Dicer and Argonaute in the entomopathogenic fungus Metarhizium robertsii have remained unclear. Here, the roles of genes encoding Dicer ( M. robertsii dcl1 [ Mrdcl1 ] and Mrdcl2 ) and Argonaute ( Mrago1 and Mrago2 ) proteins in M. robertsii were investigated. The results showed that the Dicer-like protein MrDCL2 and Argonaute protein MrAGO1 are the major components of the RNAi process occurring in M. robertsii The Dicer and Argonaute genes were not involved in the regulation of growth and diverse abiotic stress response in M. robertsii under the tested conditions. Moreover, our results showed that the Dicer and Argonaute gene mutants demonstrated reduced abilities to produce conidia, compared to the wild type (WT) and the gene-rescued mutant. In particular, the conidial yields in the Δ dcl2 and Δ ago1 mutants were reduced by 55.8% and 59.3%, respectively, compared with those from the control strains. Subsequently, for the WT and Δ dcl2 mutant strains, digital gene expression (DGE) profiling analysis of the stage of mycelium growth and conidiogenesis revealed that modest changes occur in development or metabolism processes, which may explain the reduction in conidiation in the Δ dcl2 mutant. In addition, we further applied high-throughput sequencing technology to identify small RNAs (sRNAs) that are differentially expressed in the WT and the Δ dcl2 mutant and found that 4 known microRNA-like small RNAs (milRNAs) and 8 novel milRNAs were Mrdcl2 dependent in M. robertsii IMPORTANCE The identification and characterization of components in RNAi have contributed significantly to our understanding of the mechanism and functions of RNAi in eukaryotes. Here, we found that Dicer and Argonaute genes play an important role

  10. RNA interference can rebalance the nitrogen sink of maize seeds without losing hard endosperm.

    Directory of Open Access Journals (Sweden)

    Yongrui Wu

    Full Text Available BACKGROUND: One of the goals of plant breeding is to create crops to provide better nutrition for humans and livestock. Insufficient intake of protein is one of the most severe factors affecting the growth and development of children in developing countries. More than a century ago, in 1896, Hopkins initiated the well-known Illinois long-term selection for maize seed protein concentration, yielding four protein strains. By continuously accumulating QTLs, Illinois High Protein (IHP reached a protein level 2.5-fold higher than normal maize, with the most increased fraction being the zein protein, which was shown to contain no lysine soon after the long-term selection program initiated. Therefore, IHP is of little value for feeding humans and monogastric animals. Although high-lysine lines of non-vitreous mutants were based on reduced zeins, the kernel soft texture precluded their practical use. Kernel hardness in opaque 2 (o2 could be restored in quality protein maize (QPM with quantitative trait loci called o2 modifiers (Mo2s, but those did not increase total protein levels. METHODS: The most predominant zeins are the 22- and 19-kDa α-zeins. To achieve a combination of desired traits, we used RNA interference (RNAi against both α-zeins in IHP and evaluated the silencing effect by SDS-PAGE. Total protein, amino acid composition and kernel texture were analyzed. CONCLUSIONS: The α-zeins were dramatically reduced, but the high total seed protein level remained unchanged by complementary increase of non-zein proteins. Moreover, the residual zein levels still allowed for a vitreous hard seed. Such dramatic rebalancing of the nitrogen sink could have a major impact in world food supply.

  11. Argonaute Utilization for miRNA Silencing Is Determined by Phosphorylation-Dependent Recruitment of LIM-Domain-Containing Proteins

    Directory of Open Access Journals (Sweden)

    Katherine S. Bridge

    2017-07-01

    Full Text Available As core components of the microRNA-induced silencing complex (miRISC, Argonaute (AGO proteins interact with TNRC6 proteins, recruiting other effectors of translational repression/mRNA destabilization. Here, we show that LIMD1 coordinates the assembly of an AGO-TNRC6 containing miRISC complex by binding both proteins simultaneously at distinct interfaces. Phosphorylation of AGO2 at Ser 387 by Akt3 induces LIMD1 binding, which in turn enables AGO2 to interact with TNRC6A and downstream effector DDX6. Conservation of this serine in AGO1 and 4 indicates this mechanism may be a fundamental requirement for AGO function and miRISC assembly. Upon CRISPR-Cas9-mediated knockout of LIMD1, AGO2 miRNA-silencing function is lost and miRNA silencing becomes dependent on a complex formed by AGO3 and the LIMD1 family member WTIP. The switch to AGO3 utilization occurs due to the presence of a glutamic acid residue (E390 on the interaction interface, which allows AGO3 to bind to LIMD1, AJUBA, and WTIP irrespective of Akt signaling.

  12. A Medicago truncatula rdr6 allele impairs transgene silencing and endogenous phased siRNA production but not development.

    Science.gov (United States)

    Bustos-Sanmamed, Pilar; Hudik, Elodie; Laffont, Carole; Reynes, Christelle; Sallet, Erika; Wen, Jiangqi; Mysore, Kirankumar S; Camproux, Anne-Claude; Hartmann, Caroline; Gouzy, Jérome; Frugier, Florian; Crespi, Martin; Lelandais-Brière, Christine

    2014-12-01

    RNA-dependent RNA polymerase 6 (RDR6) and suppressor of gene silencing 3 (SGS3) act together in post-transcriptional transgene silencing mediated by small interfering RNAs (siRNAs) and in biogenesis of various endogenous siRNAs including the tasiARFs, known regulators of auxin responses and plant development. Legumes, the third major crop family worldwide, has been widely improved through transgenic approaches. Here, we isolated rdr6 and sgs3 mutants in the model legume Medicago truncatula. Two sgs3 and one rdr6 alleles led to strong developmental defects and impaired biogenesis of tasiARFs. In contrast, the rdr6.1 homozygous plants produced sufficient amounts of tasiARFs to ensure proper development. High throughput sequencing of small RNAs from this specific mutant identified 354 potential MtRDR6 substrates, for which siRNA production was significantly reduced in the mutant. Among them, we found a large variety of novel phased loci corresponding to protein-encoding genes or transposable elements. Interestingly, measurement of GFP expression revealed that post-transcriptional transgene silencing was reduced in rdr6.1 roots. Hence, this novel mis-sense mutation, affecting a highly conserved amino acid residue in plant RDR6s, may be an interesting tool both to analyse endogenous pha-siRNA functions and to improve transgene expression, at least in legume species. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  13. Transcriptome analysis and RNA interference of cockroach phototransduction indicate three opsins and suggest a major role for TRPL channels

    Directory of Open Access Journals (Sweden)

    Andrew S French

    2015-07-01

    Full Text Available Our current understanding of insect phototransduction is based on a small number of species, but insects occupy many different visual environments. We created the retinal transcriptome of a nocturnal insect, the cockroach, Periplaneta americana to identify proteins involved in the earliest stages of compound eye phototransduction, and test the hypothesis that different visual environments are reflected in different molecular contributions to function. We assembled five novel mRNAs: two green opsins, one UV opsin, and one each TRP and TRPL ion channel homologs. One green opsin mRNA (pGO1 was 100-1000 times more abundant than the other opsins (pGO2 and pUVO, while pTRPL mRNA was 10 times more abundant than pTRP, estimated by transcriptome analysis or quantitative PCR (qPCR. Electroretinograms were used to record photoreceptor responses. Gene-specific in vivo RNA interference (RNAi was achieved by injecting long (596-708 bp double-stranded RNA into head hemolymph, and verified by qPCR. RNAi of the most abundant green opsin reduced both green opsins by more than 97% without affecting UV opsin, and gave a maximal reduction of 75% in ERG amplitude seven days after injection that persisted for at least 19 days. RNAi of pTRP and pTRPL genes each specifically reduced the corresponding mRNA by 90%. Electroretinogram reduction by pTRPL RNAi was slower than for opsin, reaching 75% attenuation by 21 days, without recovery at 29 days. pTRP RNAi attenuated ERG much less; only 30% after 21 days. Combined pTRP plus pTRPL RNAi gave only weak evidence of any cooperative interactions. We conclude that silencing retinal genes by in vivo RNAi using long dsRNA is effective, that visible light transduction in Periplaneta is dominated by pGO1, and that pTRPL plays a major role in cockroach phototransduction.

  14. A novel RNA transcript with antiapoptotic function is silenced in fragile X syndrome.

    Directory of Open Access Journals (Sweden)

    Ahmad M Khalil

    2008-01-01

    Full Text Available Several genome-wide transcriptomics efforts have shown that a large percentage of the mammalian genome is transcribed into RNAs, however, only a small percentage (1-2% of these RNAs is translated into proteins. Currently there is an intense interest in characterizing the function of the different classes of noncoding RNAs and their relevance to human disease. Using genomic approaches we discovered FMR4, a primate-specific noncoding RNA transcript (2.4 kb that resides upstream and likely shares a bidirectional promoter with FMR1. FMR4 is a product of RNA polymerase II and has a similar half-life to FMR1. The CGG expansion in the 5' UTR of FMR1 appears to affect transcription in both directions as we found FMR4, similar to FMR1, to be silenced in fragile X patients and up-regulated in premutation carriers. Knockdown of FMR4 by several siRNAs did not affect FMR1 expression, nor vice versa, suggesting that FMR4 is not a direct regulatory transcript for FMR1. However, FMR4 markedly affected human cell proliferation in vitro; siRNAs knockdown of FMR4 resulted in alterations in the cell cycle and increased apoptosis, while the overexpression of FMR4 caused an increase in cell proliferation. Collectively, our results demonstrate an antiapoptotic function of FMR4 and provide evidence that a well-studied genomic locus can show unexpected functional complexity. It cannot be excluded that altered FMR4 expression might contribute to aspects of the clinical presentation of fragile X syndrome and/or related disorders.

  15. RNA-mediated gene silencing signals are not graft transmissible from the rootstock to the scion in greenhouse-grown apple plants Malus sp.

    Science.gov (United States)

    Flachowsky, Henryk; Tränkner, Conny; Szankowski, Iris; Waidmann, Sascha; Hanke, Magda-Viola; Treutter, Dieter; Fischer, Thilo C

    2012-01-01

    RNA silencing describes the sequence specific degradation of RNA targets. Silencing is a non-cell autonomous event that is graft transmissible in different plant species. The present study is the first report on systemic acquired dsRNA-mediated gene silencing of transgenic and endogenous gene sequences in a woody plant like apple. Transgenic apple plants overexpressing a hairpin gene construct of the gusA reporter gene were produced. These plants were used as rootstocks and grafted with scions of the gusA overexpressing transgenic apple clone T355. After grafting, we observed a reduction of the gusA gene expression in T355 scions in vitro, but not in T355 scions grown in the greenhouse. Similar results were obtained after silencing of the endogenous Mdans gene in apple that is responsible for anthocyanin biosynthesis. Subsequently, we performed grafting experiments with Mdans silenced rootstocks and red leaf scions of TNR31-35 in order to evaluate graft transmitted silencing of the endogenous Mdans. The results obtained suggested a graft transmission of silencing signals in in vitro shoots. In contrast, no graft transmission of dsRNA-mediated gene silencing signals was detectable in greenhouse-grown plants and in plants grown in an insect protection tent.

  16. A genome-wide analysis of the RNA-guided silencing pathway in coffee reveals insights into its regulatory mechanisms.

    Directory of Open Access Journals (Sweden)

    Christiane Noronha Fernandes-Brum

    Full Text Available microRNAs (miRNAs are derived from self-complementary hairpin structures, while small-interfering RNAs (siRNAs are derived from double-stranded RNA (dsRNA or hairpin precursors. The core mechanism of sRNA production involves DICER-like (DCL in processing the smallRNAs (sRNAs and ARGONAUTE (AGO as effectors of silencing, and siRNA biogenesis also involves action of RNA-Dependent RNA Polymerase (RDR, Pol IV and Pol V in biogenesis. Several other proteins interact with the core proteins to guide sRNA biogenesis, action, and turnover. We aimed to unravel the components and functions of the RNA-guided silencing pathway in a non-model plant species of worldwide economic relevance. The sRNA-guided silencing complex members have been identified in the Coffea canephora genome, and they have been characterized at the structural, functional, and evolutionary levels by computational analyses. Eleven AGO proteins, nine DCL proteins (which include a DCL1-like protein that was not previously annotated, and eight RDR proteins were identified. Another 48 proteins implicated in smallRNA (sRNA pathways were also identified. Furthermore, we identified 235 miRNA precursors and 317 mature miRNAs from 113 MIR families, and we characterized ccp-MIR156, ccp-MIR172, and ccp-MIR390. Target prediction and gene ontology analyses of 2239 putative targets showed that significant pathways in coffee are targeted by miRNAs. We provide evidence of the expansion of the loci related to sRNA pathways, insights into the activities of these proteins by domain and catalytic site analyses, and gene expression analysis. The number of MIR loci and their targeted pathways highlight the importance of miRNAs in coffee. We identified several roles of sRNAs in C. canephora, which offers substantial insight into better understanding the transcriptional and post-transcriptional regulation of this major crop.

  17. siRNA-mediated Erc gene silencing suppresses tumor growth in Tsc2 mutant renal carcinoma model.

    Science.gov (United States)

    Imamura, Osamu; Okada, Hiroaki; Takashima, Yuuki; Zhang, Danqing; Kobayashi, Toshiyuki; Hino, Okio

    2008-09-18

    Silencing of gene expression by small interfering RNAs (siRNAs) is rapidly becoming a powerful tool for genetic analysis and represents a potential strategy for therapeutic product development. However, there are no reports of systemic delivery of siRNAs for stable treatment except short hairpin RNAs (shRNAs). On the other hand, there are many reports of systemic delivery of siRNAs for transient treatment using liposome carriers and others. With regard to shRNAs, a report showed fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Therefore, we decided to use original siRNA microspheres instead of shRNA for stable treatment of disease. In this study, we designed rat-specific siRNA sequences for Erc/mesothelin, which is a tumor-specific gene expressed in the Eker (Tsc2 mutant) rat model of hereditary renal cancer and confirmed the efficacy of gene silencing in vitro. Then, by using siRNA microspheres, we found that the suppression of Erc/mesothelin caused growth inhibition of Tsc2 mutant renal carcinoma cells in tumor implantation experiments in mice.

  18. RNA virus interference via CRISPR/Cas13a system in plants

    KAUST Repository

    Aman, Rashid

    2018-01-04

    CRISPR/Cas systems confer immunity against invading nucleic acids and phages in bacteria and archaea. CRISPR/Cas13a (known previously as C2c2) is a class 2 type VI-A ribonuclease capable of targeting and cleaving single-stranded RNA (ssRNA) molecules of the phage genome. Here, we employ CRISPR/Cas13a to engineer interference with an RNA virus, Turnip Mosaic Virus (TuMV), in plants.CRISPR/Cas13a produces interference against green fluorescent protein (GFP)-expressing TuMV in transient assays and stable overexpression lines of Nicotiana benthamiana. CRISPR RNA (crRNAs) targeting the HC-Pro and GFP sequences exhibit better interference than those targeting other regions such as coat protein (CP) sequence. Cas13a can also process pre-crRNAs into functional crRNAs.Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses and for other RNA manipulations in plants.

  19. Oral cancer cells may rewire alternative metabolic pathways to survive from siRNA silencing of metabolic enzymes

    International Nuclear Information System (INIS)

    Zhang, Min; Chai, Yang D; Brumbaugh, Jeffrey; Liu, Xiaojun; Rabii, Ramin; Feng, Sizhe; Misuno, Kaori; Messadi, Diana; Hu, Shen

    2014-01-01

    Cancer cells may undergo metabolic adaptations that support their growth as well as drug resistance properties. The purpose of this study is to test if oral cancer cells can overcome the metabolic defects introduced by using small interfering RNA (siRNA) to knock down their expression of important metabolic enzymes. UM1 and UM2 oral cancer cells were transfected with siRNA to transketolase (TKT) or siRNA to adenylate kinase (AK2), and Western blotting was used to confirm the knockdown. Cellular uptake of glucose and glutamine and production of lactate were compared between the cancer cells with either TKT or AK2 knockdown and those transfected with control siRNA. Statistical analysis was performed with student T-test. Despite the defect in the pentose phosphate pathway caused by siRNA knockdown of TKT, the survived UM1 or UM2 cells utilized more glucose and glutamine and secreted a significantly higher amount of lactate than the cells transferred with control siRNA. We also demonstrated that siRNA knockdown of AK2 constrained the proliferation of UM1 and UM2 cells but similarly led to an increased uptake of glucose/glutamine and production of lactate by the UM1 or UM2 cells survived from siRNA silencing of AK2. Our results indicate that the metabolic defects introduced by siRNA silencing of metabolic enzymes TKT or AK2 may be compensated by alternative feedback metabolic mechanisms, suggesting that cancer cells may overcome single defective pathways through secondary metabolic network adaptations. The highly robust nature of oral cancer cell metabolism implies that a systematic medical approach targeting multiple metabolic pathways may be needed to accomplish the continued improvement of cancer treatment

  20. Polycomb complexes and silencing mechanisms

    DEFF Research Database (Denmark)

    Lund, Anders H; van Lohuizen, Maarten

    2004-01-01

    Advances in the past couple of years have brought important new knowledge on the mechanisms by which Polycomb-group proteins regulate gene expression and on the consequences of their actions. The discovery of histone methylation imprints specific for Polycomb and Trithorax complexes has provided...... mechanistic insight on how this ancient epigenetic memory system acts to repress and indicates that it may share mechanistic aspects with other silencing and genome-protective processes, such as RNA interference....

  1. The bifunctional abiotic stress signalling regulator and endogenous RNA silencing suppressor FIERY1 is required for lateral root formation

    KAUST Repository

    Chen, Hao

    2010-09-28

    The Arabidopsis FIERY1 (FRY1) locus was originally identified as a negative regulator of stress-responsive gene expression and later shown to be required for suppression of RNA silencing. In this study we discovered that the FRY1 locus also regulates lateral root formation. Compared with the wild type, fry1 mutant seedlings generated significantly fewer lateral roots under normal growth conditions and also exhibited a dramatically reduced sensitivity to auxin in inducing lateral root initiation. Using transgenic plants that overexpress a yeast homolog of FRY1 that possesses only the 3\\', 5\\'-bisphosphate nucleotidase activity but not the inositol 1-phosphatase activity, we demonstrated that the lateral root phenotypes in fry1 result from loss of the nucleotidase activity. Furthermore, a T-DNA insertion mutant of another RNA silencing suppressor, XRN4 (but not XRN2 or XRN3), which is an exoribonuclease that is inhibited by the substrate of the FRY1 3\\', 5\\'-bisphosphate nucleotidase, exhibits similar lateral root defects. Although fry1 and xrn4 exhibited reduced sensitivity to ethylene, our experiments demonstrated that restoration of ethylene sensitivity in the fry1 mutant is not sufficient to rescue the lateral root phenotypes of fry1. Our results indicate that RNA silencing modulated by FRY1 and XRN4 plays an important role in shaping root architecture. © 2010 Blackwell Publishing Ltd.

  2. Application of RNA interference in treating human diseases

    Indian Academy of Sciences (India)

    ference than either strand individually. After injection into ... antisense strand to messenger RNAs (mRNAs) that bear ... processing of longer dsRNA and stem loop precursors (Nov- ... RNAi has several applications in biomedical research,.

  3. RNA-mediated gene silencing in Candida albicans: inhibition of hyphae formation by use of RNAi technology.

    Science.gov (United States)

    Moazeni, Maryam; Khoramizadeh, Mohammad Reza; Kordbacheh, Parivash; Sepehrizadeh, Zargham; Zeraati, Hojat; Noorbakhsh, Fatemeh; Teimoori-Toolabi, Ladan; Rezaie, Sassan

    2012-09-01

    The introduction of RNA silencing machinery in fungi has led to the promising application of RNAi methodology to knock down essential vital factor or virulence factor genes in the microorganisms. Efg1p is required for development of a true hyphal growth form which is known to be essential for interactions with human host cells and for the yeast's pathogenesis. In this paper, we describe the development of a system for presenting and studying the RNAi function on the EFG1 gene in C. albicans. The 19-nucleotide siRNA was designed on the basis of the cDNA sequence of the EFG1 gene in C. albicans and transfection was performed by use of a modified-PEG/LiAc method. To investigate EFG1 gene silencing in siRNA-treated cells, the yeasts were grown in human serum; to induce germ tubes a solid medium was used with the serum. Quantitative changes in expression of the EFG1 gene were analyzed by measuring the cognate EFG1 mRNA level by use of a quantitative real-time RT-PCR assay. Compared with the positive control, true hyphae formation was significantly reduced by siRNA at concentrations of 1 μM, 500 nM, and 100 nM (P < 0.05). In addition, siRNA at a concentration of 1 μM was revealed to inhibit expression of the EFG1 gene effectively (P < 0.05). On the basis of the potential of post-transcriptional gene silencing to control the expression of specific genes, these techniques may be regarded as promising means of drug discovery, with applications in biomedicine and functional genomics analysis.

  4. Review of the RNA Interference Pathway in Molluscs Including Some Possibilities for Use in Bivalves in Aquaculture

    Directory of Open Access Journals (Sweden)

    Leigh Owens

    2015-03-01

    Full Text Available Generalised reviews of RNA interference (RNAi in invertebrates, and for use in aquaculture, have taken for granted that RNAi pathways operate in molluscs, but inspection of such reviews show little specific evidence of such activity in molluscs. This review was to understand what specific research had been conducted on RNAi in molluscs, particularly with regard to aquaculture. There were questions of whether RNAi in molluscs functions similarly to the paradigm established for most eukaryotes or, alternatively, was it more similar to the ecdozoa and how RNAi may relate to disease control in aquaculture? RNAi in molluscs appears to have been only investigated in about 14 species, mostly as a gene silencing phenomenon. We can infer that microRNAs including let-7 are functional in molluscs. The genes/proteins involved in the actual RNAi pathways have only been rudimentarily investigated, so how homologous the genes and proteins are to other metazoa is unknown. Furthermore, how many different genes for each activity in the RNAi pathway are also unknown? The cephalopods have been greatly overlooked with only a single RNAi gene-silencing study found. The long dsRNA-linked interferon pathways seem to be present in molluscs, unlike some other invertebrates and could be used to reduce disease states in aquaculture. In particular, interferon regulatory factor genes have been found in molluscs of aquacultural importance such as Crassostrea, Mytilus, Pinctada and Haliotis. Two possible aquaculture scenarios are discussed, zoonotic norovirus and ostreid herpesvirus 1 to illustrate the possibilities. The entire field of RNAi in molluscs looks ripe for scientific exploitation and practical application.

  5. RNA virus interference via CRISPR/Cas13a system in plants

    KAUST Repository

    Aman, Rashid

    2017-11-04

    CRISPR/Cas systems confer immunity against invading nucleic acids and phages in bacteria and archaea. CRISPR/Cas13a (known previously as C2c2) is a class 2 type VI-A ribonuclease capable of targeting and cleaving single stranded RNA (ssRNA) molecules of the phage genome. Here, we employ CRISPR/Cas13a to engineer interference with an RNA virus, Turnip Mosaic Virus (TuMV), in plants. CRISPR/Cas13a produced interference against green fluorescent protein (GFP) expressing TuMV in transient assays and stable overexpression lines of Nicotiana benthamiana. crRNAs targeting the HC-Pro and GFP sequences exhibited better interference than those targeting other regions such as coat protein (CP) sequence. Cas13a can also process pre-crRNAs into functional crRNAs. Our data indicate that CRISPR/Cas13a can be used for engineering interference against RNA viruses, providing a potential novel mechanism for RNA-guided immunity against RNA viruses, and for other RNA manipulations in plants.

  6. Elicitation of hypersensitive responses in Nicotiana glutinosa by the suppressor of RNA silencing protein P0 from poleroviruses.

    Science.gov (United States)

    Wang, Ken-Der; Empleo, Roman; Nguyen, Tan Tri V; Moffett, Peter; Sacco, Melanie Ann

    2015-06-01

    Plant disease resistance (R) proteins that confer resistance to viruses recognize viral gene products with diverse functions, including viral suppressors of RNA silencing (VSRs). The P0 protein from poleroviruses is a VSR that targets the ARGONAUTE1 (AGO1) protein for degradation, thereby disrupting RNA silencing and antiviral defences. Here, we report resistance against poleroviruses in Nicotiana glutinosa directed against Turnip yellows virus (TuYV) and Potato leafroll virus (PLRV). The P0 proteins from TuYV (P0(T) (u) ), PLRV (P0(PL) ) and Cucurbit aphid-borne yellows virus (P0(CA) ) were found to elicit a hypersensitive response (HR) in N. glutinosa accession TW59, whereas other accessions recognized P0(PL) only. Genetic analysis showed that recognition of P0(T) (u) by a resistance gene designated RPO1 (Resistance to POleroviruses 1) is inherited as a dominant allele. Expression of P0 from a Potato virus X (PVX) expression vector transferred recognition to the recombinant virus on plants expressing RPO1, supporting P0 as the unique Polerovirus factor eliciting resistance. The induction of HR required a functional P0 protein, as P0(T) (u) mutants with substitutions in the F-box motif that abolished VSR activity were unable to elicit HR. We surmised that the broad P0 recognition seen in TW59 and the requirement for the F-box protein motif could indicate detection of P0-induced AGO1 degradation and disruption of RNA silencing; however, other viral silencing suppressors, including the PVX P25 that also causes AGO1 degradation, failed to elicit HR in N. glutinosa. Investigation of P0 elicitation of RPO1 could provide insight into P0 activities within the cell that trigger resistance. © 2014 BSPP AND JOHN WILEY & SONS LTD.

  7. An SGS3-like protein functions in RNA-directed DNA methylation and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Zheng, Zhimin

    2010-01-06

    RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.

  8. RNA-induced silencing complex (RISC) Proteins PACT, TRBP, and Dicer are SRA binding nuclear receptor coregulators.

    Science.gov (United States)

    Redfern, Andrew D; Colley, Shane M; Beveridge, Dianne J; Ikeda, Naoya; Epis, Michael R; Li, Xia; Foulds, Charles E; Stuart, Lisa M; Barker, Andrew; Russell, Victoria J; Ramsay, Kerry; Kobelke, Simon J; Li, Xiaotao; Hatchell, Esme C; Payne, Christine; Giles, Keith M; Messineo, Adriana; Gatignol, Anne; Lanz, Rainer B; O'Malley, Bert W; Leedman, Peter J

    2013-04-16

    The cytoplasmic RNA-induced silencing complex (RISC) contains dsRNA binding proteins, including protein kinase RNA activator (PACT), transactivation response RNA binding protein (TRBP), and Dicer, that process pre-microRNAs into mature microRNAs (miRNAs) that target specific mRNA species for regulation. There is increasing evidence for important functional interactions between the miRNA and nuclear receptor (NR) signaling networks, with recent data showing that estrogen, acting through the estrogen receptor, can modulate initial aspects of nuclear miRNA processing. Here, we show that the cytoplasmic RISC proteins PACT, TRBP, and Dicer are steroid receptor RNA activator (SRA) binding NR coregulators that target steroid-responsive promoters and regulate NR activity and downstream gene expression. Furthermore, each of the RISC proteins, together with Argonaute 2, associates with SRA and specific pre-microRNAs in both the nucleus and cytoplasm, providing evidence for links between NR-mediated transcription and some of the factors involved in miRNA processing.

  9. The Role of piRNA-Mediated Epigenetic Silencing in the Population Dynamics of Transposable Elements in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Yuh Chwen G Lee

    2015-06-01

    Full Text Available The piwi-interacting RNAs (piRNA are small RNAs that target selfish transposable elements (TEs in many animal genomes. Until now, piRNAs' role in TE population dynamics has only been discussed in the context of their suppression of TE transposition, which alone is not sufficient to account for the skewed frequency spectrum and stable containment of TEs. On the other hand, euchromatic TEs can be epigenetically silenced via piRNA-dependent heterochromatin formation and, similar to the widely known "Position-effect variegation", heterochromatin induced by TEs can "spread" into nearby genes. We hypothesized that the piRNA-mediated spread of heterochromatin from TEs into adjacent genes has deleterious functional effects and leads to selection against individual TEs. Unlike previously identified deleterious effects of TEs due to the physical disruption of DNA, the functional effect we investigated here is mediated through the epigenetic influences of TEs. We found that the repressive chromatin mark, H3K9me, is elevated in sequences adjacent to euchromatic TEs at multiple developmental stages in Drosophila melanogaster. Furthermore, the heterochromatic states of genes depend not only on the number of and distance from adjacent TEs, but also on the likelihood that their nearest TEs are targeted by piRNAs. These variations in chromatin status probably have functional consequences, causing genes near TEs to have lower expression. Importantly, we found stronger selection against TEs that lead to higher H3K9me enrichment of adjacent genes, demonstrating the pervasive evolutionary consequences of TE-induced epigenetic silencing. Because of the intrinsic biological mechanism of piRNA amplification, spread of TE heterochromatin could result in the theoretically required synergistic deleterious effects of TE insertions for stable containment of TE copy number. The indirect deleterious impact of piRNA-mediated epigenetic silencing of TEs is a previously

  10. RNA Interference Screen to Identify Pathways That Enhance or Reduce Nonviral Gene Transfer During Lipofection

    OpenAIRE

    Barker, Gregory A; Diamond, Scott L

    2008-01-01

    Some barriers to DNA lipofection are well characterized; however, there is as yet no method of finding unknown pathways that impact the process. A druggable genome small-interfering RNA (siRNA) screen against 5,520 genes was tested for its effect on lipofection of human aortic endothelial cells (HAECs). We found 130 gene targets which, when silenced by pooled siRNAs (three siRNAs per gene), resulted in enhanced luminescence after lipofection (86 gene targets showed reduced expression). In con...

  11. Impact of Subolesin and Cystatin Knockdown by RNA Interference in Adult Female Haemaphysalis longicornis (Acari: Ixodidae on Blood Engorgement and Reproduction

    Directory of Open Access Journals (Sweden)

    Md. Khalesur Rahman

    2018-04-01

    Full Text Available Currently, multi-antigenic vaccine use is the method of choice for the strategic control of ticks. Therefore, determining the efficacy of combined antigens is a promising avenue of research in the development of anti-tick vaccines. The antigen responsible for blood intake and reproduction has proven suitable as a vaccine antigen. It has been shown to silence Haemaphysalis longicornis salivary cystatin (HlSC-1 and subolesin by RNA interference. Adult unfed female ticks were injected with double-stranded RNA of (A subolesin, (B cystatin, (C subolesin plus cystatin, and (D injection buffer, then fed alongside normal unfed males up to spontaneous drop-down. The percentage of knockdowns was determined by real-time polymerase chain reaction. Sixty-three percent and 53% knockdown rates were observed in subolesin and cystatin double-stranded RNA-injected ticks respectively, while 32 and 26% knockdown rates of subolesin and cystatin transcript were observed in subolesin plus cystatin double-stranded RNA-injected ticks. Subolesin and/or cystatin knockdown causes a significant (p < 0.05 reduction in tick engorgement, egg mass weight, and egg conversion ratio. Most importantly, combined silencing did not act synergistically, but caused a similarly significant (p < 0.05 reduction in tick engorgement, egg mass weight, and egg conversion ratio. Therefore, the elucidation of multiple antigens may be helpful in the future of vaccines.

  12. Application of RNA interference methodology to investigate and ...

    Indian Academy of Sciences (India)

    Specific fragments of the sugarcane mosaic virus (SCMV) coat protein gene (cp) were amplified by reverse transcription-polymerase chain reaction and used to construct a marker free small interfering RNA complex expression vector against SCMV. In planta transformation was performed on maize (Zea mays) inbred line ...

  13. Analysis of Tomato spotted wilt virus NSs protein indicates the importance of the N-terminal domain for avirulence and RNA silencing suppression.

    Science.gov (United States)

    de Ronde, Dryas; Pasquier, Adrien; Ying, Su; Butterbach, Patrick; Lohuis, Dick; Kormelink, Richard

    2014-02-01

    Recently, Tomato spotted wilt virus (TSWV) nonstructural protein NSs has been identified unambiguously as an avirulence (Avr) determinant for Tomato spotted wilt (Tsw)-based resistance. The observation that NSs from two natural resistance-breaking isolates had lost RNA silencing suppressor (RSS) activity and Avr suggested a link between the two functions. To test this, a large set of NSs mutants was generated by alanine substitutions in NSs from resistance-inducing wild-type strains (NSs(RI) ), amino acid reversions in NSs from resistance-breaking strains (NSs(RB)), domain deletions and swapping. Testing these mutants for their ability to suppress green fluorescent protein (GFP) silencing and to trigger a Tsw-mediated hypersensitive response (HR) revealed that the two functions can be separated. Changes in the N-terminal domain were found to be detrimental for both activities and indicated the importance of this domain, additionally supported by domain swapping between NSs(RI) and NSs(RB). Swapping domains between the closely related Tospovirus Groundnut ringspot virus (GRSV) NSs and TSWV NSs(RI) showed that Avr functionality could not simply be transferred between species. Although deletion of the C-terminal domain rendered NSs completely dysfunctional, only a few single-amino-acid mutations in the C-terminus affected both functions. Mutation of a GW/WG motif (position 17/18) rendered NSs completely dysfunctional for RSS and Avr activity, and indicated a putative interaction between NSs and Argonaute 1 (AGO1), and its importance in TSWV virulence and viral counter defence against RNA interference. © 2013 BSPP AND JOHN WILEY & SONS LTD.

  14. Biochemical and single-molecule analyses of the RNA silencing suppressing activity of CrPV-1A.

    Science.gov (United States)

    Watanabe, Mariko; Iwakawa, Hiro-Oki; Tadakuma, Hisashi; Tomari, Yukihide

    2017-10-13

    Viruses often encode viral silencing suppressors (VSSs) to counteract the hosts' RNA silencing activity. The cricket paralysis virus 1A protein (CrPV-1A) is a unique VSS that binds to a specific Argonaute protein (Ago)-the core of the RNA-induced silencing complex (RISC)-in insects to suppress its target cleavage reaction. However, the precise molecular mechanism of CrPV-1A action remains unclear. Here we utilized biochemical and single-molecule imaging approaches to analyze the effect of CrPV-1A during target recognition and cleavage by Drosophila Ago2-RISC. Our results suggest that CrPV-1A obstructs the initial target searching by Ago2-RISC via base pairing in the seed region. The combination of biochemistry and single-molecule imaging may help to pave the way for mechanistic understanding of VSSs with diverse functions. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Inhibition of osteoclastogenesis by RNA interference targeting RANK

    Directory of Open Access Journals (Sweden)

    Ma Ruofan

    2012-08-01

    Full Text Available Abstract Background Osteoclasts and osteoblasts regulate bone resorption and formation to allow bone remodeling and homeostasis. The balance between bone resorption and formation is disturbed by abnormal recruitment of osteoclasts. Osteoclast differentiation is dependent on the receptor activator of nuclear factor NF-kappa B (RANK ligand (RANKL as well as the macrophage colony-stimulating factor (M-CSF. The RANKL/RANK system and RANK signaling induce osteoclast formation mediated by various cytokines. The RANK/RANKL pathway has been primarily implicated in metabolic, degenerative and neoplastic bone disorders or osteolysis. The central role of RANK/RANKL interaction in osteoclastogenesis makes RANK an attractive target for potential therapies in treatment of osteolysis. The purpose of this study was to assess the effect of inhibition of RANK expression in mouse bone marrow macrophages on osteoclast differentiation and bone resorption. Methods Three pairs of short hairpin RNAs (shRNA targeting RANK were designed and synthesized. The optimal shRNA was selected among three pairs of shRNAs by RANK expression analyzed by Western blot and Real-time PCR. We investigated suppression of osteoclastogenesis of mouse bone marrow macrophages (BMMs using the optimal shRNA by targeting RANK. Results Among the three shRANKs examined, shRANK-3 significantly suppressed [88.3%] the RANK expression (p Conclusions These findings suggest that retrovirus-mediated shRNA targeting RANK inhibits osteoclast differentiation and osteolysis. It may appear an attractive target for preventing osteolysis in humans with a potential clinical application.

  16. Development of Gold Nanoparticle towards Radioenhancement Therapy, Renal Clearance, siRNA Delivery and Light-Controlled Gene Silencing

    Science.gov (United States)

    Wang, Jianxin

    Gold nanoparticles (GNPs) have been widely studied and used in research for diagnostic, prophylactic or therapeutic purposes. However, they still face many technical challenges before they can be used to effectively address unmet biomedical needs. The theme of this dissertation is focused on addressing challenges of GNPs in clinical translation, and to improve their potential for application in radioenhancement therapy and siRNA delivery. We demonstrate the facile self-assembly of micellar gold nanocapsules using zwitterionic surfactants, with hydrodynamic diameters below 10 nm, which holds promise for good renal clearance to promote the excretion of GNPs in human body. We also prepared PEI- and PEG-coated GNPs and demonstrated their uptake into HeLa cells with exposure to soft X-rays (120 kVp), based on the consideration that the proximity of GNPs to nuclear DNA may be beneficial for enhancing low-energy ionizing radiotherapy. GNP-mediated siRNA delivery may be challenged by nonspecific siRNA desorption during circulation, which can cause off-target effects and immunogenicity. The use of gold nanorods (GNRs) for siRNA delivery also faces challenges like reduced dispersion stability during siRNA functionalization. We developed an effective way to load siRNA onto GNRs at high density, using oleylsulfobetaine (OSB) as an intermediate surfactant and dithiocarbamates (DTCs) as desorption-resistant anchors for siRNA. The GNR?siRNA complexes provided excellent control for laser-triggered gene silencing.

  17. Cowpea mosaic virus RNA-1 acts as an amplicon whose effects can be counteracted by a RNA-2-encoded suppressor of silencing

    International Nuclear Information System (INIS)

    Liu Li; Grainger, Jef; Canizares, M. Carmen; Angell, Susan M.; Lomonossoff, George P.

    2004-01-01

    Lines of Nicotiana benthamiana transgenic for full-length copies of both Cowpea mosaic virus (CPMV) genomic RNAs, either singly or together, have been produced. Plants transgenic for both RNAs developed symptoms characteristic of a CPMV infection. When plants transgenic for RNA-1 were agro-inoculated with RNA-2, no infection developed and the plants were also resistant to challenge with CPMV. By contrast, plants transgenic for RNA-2 became infected when agro-inoculated with RNA-1 and were fully susceptible to CPMV infection. The resistance of RNA-1 transgenic plants was shown to be related to the ability of RNA-1 to self-replicate and act as an amplicon. The ability of transgenically expressed RNA-2 to counteract the amplicon effect suggested that it encodes a suppressor of posttranscriptional gene silencing (PTGS). By examining the ability of portions of RNA-2 to reverse PTGS in N. benthamiana, we have identified the small (S) coat protein as the CPMV RNA-2-encoded suppressor of PTGS

  18. Chronic Cardiac-Targeted RNA Interference for the Treatment of Heart Failure Restores Cardiac Function and Reduces Pathological Hypertrophy

    Science.gov (United States)

    Suckau, Lennart; Fechner, Henry; Chemaly, Elie; Krohn, Stefanie; Hadri, Lahouaria; Kockskämper, Jens; Westermann, Dirk; Bisping, Egbert; Ly, Hung; Wang, Xiaomin; Kawase, Yoshiaki; Chen, Jiqiu; Liang, Lifan; Sipo, Isaac; Vetter, Roland; Weger, Stefan; Kurreck, Jens; Erdmann, Volker; Tschope, Carsten; Pieske, Burkert; Lebeche, Djamel; Schultheiss, Heinz-Peter; Hajjar, Roger J.; Poller, Wolfgang Ch.

    2009-01-01

    Background RNA interference (RNAi) has the potential to be a novel therapeutic strategy in diverse areas of medicine. We report on targeted RNAi for the treatment of heart failure (HF), an important disorder in humans resulting from multiple etiologies. Successful treatment of HF is demonstrated in a rat model of transaortic banding by RNAi targeting of phospholamban (PLB), a key regulator of cardiac Ca2+ homeostasis. Whereas gene therapy rests on recombinant protein expression as its basic principle, RNAi therapy employs regulatory RNAs to achieve its effect. Methods and Results We describe structural requirements to obtain high RNAi activity from adenoviral (AdV) and adeno-associated virus (AAV9) vectors and show that an AdV short hairpin RNA vector (AdV-shRNA) silenced PLB in cardiomyocytes (NRCMs) and improved hemodynamics in HF rats 1 month after aortic root injection. For simplified long-term therapy we developed a dimeric cardiotropic AAV vector (rAAV9-shPLB) delivering RNAi activity to the heart via intravenous injection. Cardiac PLB protein was reduced to 25% and SERCA2a suppression in the HF groups was rescued. In contrast to traditional vectors rAAV9 shows high affinity for myocardium, but low affinity for liver and other organs. rAAV9-shPLB therapy restored diastolic (LVEDP, dp/dtmin, Tau) and systolic (fractional shortening) functional parameters to normal range. The massive cardiac dilation was normalized and the cardiac hypertrophy, cardiomyocyte diameter and cardiac fibrosis significantly reduced. Importantly, there was no evidence of microRNA deregulation or hepatotoxicity during these RNAi therapies. Conclusion Our data show, for the first time, high efficacy of an RNAi therapeutic strategy in a cardiac disease. PMID:19237664

  19. siRNA-Mediated Silencing of doublesex during Female Development of the Dengue Vector Mosquito Aedes aegypti.

    Directory of Open Access Journals (Sweden)

    Keshava Mysore

    2015-11-01

    Full Text Available The development of sex-specific traits, including the female-specific ability to bite humans and vector disease, is critical for vector mosquito reproduction and pathogen transmission. Doublesex (Dsx, a terminal transcription factor in the sex determination pathway, is known to regulate sex-specific gene expression during development of the dengue fever vector mosquito Aedes aegypti. Here, the effects of developmental siRNA-mediated dsx silencing were assessed in adult females. Targeting of dsx during A. aegypti development resulted in decreased female wing size, a correlate for body size, which is typically larger in females. siRNA-mediated targeting of dsx also resulted in decreased length of the adult female proboscis. Although dsx silencing did not impact female membrane blood feeding or mating behavior in the laboratory, decreased fecundity and fertility correlated with decreased ovary length, ovariole length, and ovariole number in dsx knockdown females. Dsx silencing also resulted in disruption of olfactory system development, as evidenced by reduced length of the female antenna and maxillary palp and the sensilla present on these structures, as well as disrupted odorant receptor expression. Female lifespan, a critical component of the ability of A. aegypti to transmit pathogens, was also significantly reduced in adult females following developmental targeting of dsx. The results of this investigation demonstrate that silencing of dsx during A. aegypti development disrupts multiple sex-specific morphological, physiological, and behavioral traits of adult females, a number of which are directly or indirectly linked to mosquito reproduction and pathogen transmission. Moreover, the olfactory phenotypes observed connect Dsx to development of the olfactory system, suggesting that A. aegypti will be an excellent system in which to further assess the developmental genetics of sex-specific chemosensation.

  20. [RNA interference of HERC4 inhibits proliferation, apoptosis and migration of cervical cancer Hela cells].

    Science.gov (United States)

    Wei, Min; Zhang, Yan-Ling; Chen, Lan; Cai, Cui-Xia; Wang, Han-Duo

    2016-02-20

    To explore the effects of silencing HERC4 on the proliferation, apoptosis, and migration of cervical cancer cell line Hela and the possible molecular mechanisms. Three HERC4-specific small interfering RNAs (siRNAs) were transfected into Hela cells, and HERC4 expression in the cells was examined with Western blotting. CCK-8 assay, annexin V-FITC/PI assay, and wound healing assay were used to assess the effect of HERC4 silencing on the proliferation, apoptosis and migration ability of Hela cells. The expression levels of cyclin D1 and Bcl-2 in the cells were detected using Western blotting. Transfection of siRNA-3 resulted in significantly decreased HERC4 protein expression (PHela cells, increased the apoptosis rate (PHela cells in vitro, and the underlying mechanisms may involve the down-regulation of cyclin D1 and Bcl-2.

  1. E-cadherin is transcriptionally activated via suppression of ZEB1 transcriptional repressor by small RNA-mediated gene silencing.

    Directory of Open Access Journals (Sweden)

    Minami Mazda

    Full Text Available RNA activation has been reported to be induced by small interfering RNAs (siRNAs that act on the promoters of several genes containing E-cadherin. In this study, we present an alternative mechanism of E-cadherin activation in human PC-3 cells by siRNAs previously reported to possess perfect-complementary sequences to E-cadherin promoter. We found that activation of E-cadherin can be also induced via suppression of ZEB1, which is a transcriptional repressor of E-cadherin, by seed-dependent silencing mechanism of these siRNAs. The functional seed-complementary sites of the siRNAs were found in the coding region in addition to the 3' untranslated region of ZEB1 mRNA. Promoter analyses indicated that E-boxes, which are ZEB1-binding sites, in the upstream promoter region are indispensable for E-cadherin transcription by the siRNAs. Thus, the results caution against ignoring siRNA seed-dependent silencing effects in genome-wide transcriptional regulation. In addition, members of miR-302/372/373/520 family, which have the same seed sequences with one of the siRNAs containing perfect-complementarity to E-cadherin promoter, are also found to activate E-cadherin transcription. Thus, E-cadherin could be upregulated by the suppression of ZEB1 transcriptional repressor by miRNAs in vivo.

  2. Recovery of Nicotiana benthamiana plants from a necrotic response induced by a nepovirus is associated with RNA silencing but not with reduced virus titer.

    Science.gov (United States)

    Jovel, Juan; Walker, Melanie; Sanfaçon, Hélène

    2007-11-01

    Recovery of plants from virus-induced symptoms is often described as a consequence of RNA silencing, an antiviral defense mechanism. For example, recovery of Nicotiana clevelandii from a nepovirus (tomato black ring virus) is associated with a decreased viral RNA concentration and sequence-specific resistance to further virus infection. In this study, we have characterized the interaction of another nepovirus, tomato ringspot virus (ToRSV), with host defense responses during symptom induction and subsequent recovery. Early in infection, ToRSV induced a necrotic phenotype in Nicotiana benthamiana that showed characteristics typical of a hypersensitive response. RNA silencing was also activated during ToRSV infection, as evidenced by the presence of ToRSV-derived small interfering RNAs (siRNAs) that could direct degradation of ToRSV sequences introduced into sensor constructs. Surprisingly, disappearance of symptoms was not accompanied by a commensurate reduction in viral RNA levels. The stability of ToRSV RNA after recovery was also observed in N. clevelandii and Cucumis sativus and in N. benthamiana plants carrying a functional RNA-dependent RNA polymerase 1 ortholog from Medicago truncatula. In experiments with a reporter transgene (green fluorescent protein), ToRSV did not suppress the initiation or maintenance of transgene silencing, although the movement of the silencing signal was partially hindered. Our results demonstrate that although RNA silencing is active during recovery, reduction of virus titer is not required for the initiation of this phenotype. This scenario adds an unforeseen layer of complexity to the interaction of nepoviruses with the host RNA silencing machinery. The possibility that viral proteins, viral RNAs, and/or virus-derived siRNAs inactivate host defense responses is discussed.

  3. Persistent ER stress induces the spliced leader RNA silencing pathway (SLS, leading to programmed cell death in Trypanosoma brucei.

    Directory of Open Access Journals (Sweden)

    Hanoch Goldshmidt

    2010-01-01

    Full Text Available Trypanosomes are parasites that cycle between the insect host (procyclic form and mammalian host (bloodstream form. These parasites lack conventional transcription regulation, including factors that induce the unfolded protein response (UPR. However, they possess a stress response mechanism, the spliced leader RNA silencing (SLS pathway. SLS elicits shut-off of spliced leader RNA (SL RNA transcription by perturbing the binding of the transcription factor tSNAP42 to its cognate promoter, thus eliminating trans-splicing of all mRNAs. Induction of endoplasmic reticulum (ER stress in procyclic trypanosomes elicits changes in the transcriptome similar to those induced by conventional UPR found in other eukaryotes. The mechanism of up-regulation under ER stress is dependent on differential stabilization of mRNAs. The transcriptome changes are accompanied by ER dilation and elevation in the ER chaperone, BiP. Prolonged ER stress induces SLS pathway. RNAi silencing of SEC63, a factor that participates in protein translocation across the ER membrane, or SEC61, the translocation channel, also induces SLS. Silencing of these genes or prolonged ER stress led to programmed cell death (PCD, evident by exposure of phosphatidyl serine, DNA laddering, increase in reactive oxygen species (ROS production, increase in cytoplasmic Ca(2+, and decrease in mitochondrial membrane potential, as well as typical morphological changes observed by transmission electron microscopy (TEM. ER stress response is also induced in the bloodstream form and if the stress persists it leads to SLS. We propose that prolonged ER stress induces SLS, which serves as a unique death pathway, replacing the conventional caspase-mediated PCD observed in higher eukaryotes.

  4. Accumulation of dsRNA in endosomes contributes to inefficient RNA interference in the fall armyworm, Spodoptera frugiperda.

    Science.gov (United States)

    Yoon, June-Sun; Gurusamy, Dhandapani; Palli, Subba Reddy

    2017-11-01

    RNA interference (RNAi) efficiency varies among insects studied. The barriers for successful RNAi include the presence of double-stranded ribonucleases (dsRNase) in the lumen and hemolymph that could potentially digest double-stranded RNA (dsRNA) and the variability in the transport of dsRNA into and within the cells. We recently showed that the dsRNAs are transported into lepidopteran cells, but they are not processed into small interference RNAs (siRNAs) because they are trapped in acidic bodies. In the current study, we focused on the identification of acidic bodies in which dsRNAs accumulate in Sf9 cells. Time-lapse imaging studies showed that dsRNAs enter Sf9 cells and accumulate in acidic bodies within 20 min after their addition to the medium. CypHer-5E-labeled dsRNA also accumulated in the midgut and fat body dissected from Spodoptera frugiperda larvae with similar patterns observed in Sf9 cells. Pharmacological inhibitor assays showed that the dsRNAs use clathrin mediated endocytosis pathway for transport into the cells. We investigated the potential dsRNA accumulation sites employing LysoTracker and double labeling experiments using the constructs to express a fusion of green fluorescence protein with early or late endosomal marker proteins and CypHer-5E-labeled dsRNA. Interestingly, CypHer-5E-labeled dsRNA accumulated predominantly in early and late endosomes. These data suggest that entrapment of internalized dsRNA in endosomes is one of the major factors contributing to inefficient RNAi response in lepidopteran insects. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Delivery of siRNA silencing P-gp in peptide-functionalized nanoparticles causes efflux modulation at the blood-brain barrier

    DEFF Research Database (Denmark)

    Gomes, Maria João; Kennedy, Patrick J; Martins, Susana

    2017-01-01

    AIM: Explore the use of transferrin-receptor peptide-functionalized nanoparticles (NPs) targeting blood-brain barrier (BBB) as siRNA carriers to silence P-glycoprotein (P-gp). MATERIALS & METHODS: Permeability experiments were assessed through a developed BBB cell-based model; P-gp mRNA expression...

  6. Exosomes: Nanoparticulate tools for RNA interference and drug delivery.

    Science.gov (United States)

    Shahabipour, Fahimeh; Barati, Nastaran; Johnston, Thomas P; Derosa, Giuseppe; Maffioli, Pamela; Sahebkar, Amirhossein

    2017-07-01

    Exosomes are naturally occurring extracellular vesicles released by most mammalian cells in all body fluids. Exosomes are known as key mediators in cell-cell communication and facilitate the transfer of genetic and biochemical information between distant cells. Structurally, exosomes are composed of lipids, proteins, and also several types of RNAs which enable these vesicles to serve as important disease biomarkers. Moreover, exosomes have emerged as novel drug and gene delivery tools owing to their multiple advantages over conventional delivery systems. Recently, increasing attention has been focused on exosomes for the delivery of drugs, including therapeutic recombinant proteins, to various target tissues. Exosomes are also promising vehicles for the delivery of microRNAs and small interfering RNAs, which is usually hampered by rapid degradation of these RNAs, as well as inefficient tissue specificity of currently available delivery strategies. This review highlights the most recent accomplishments and trends in the use of exosomes for the delivery of drugs and therapeutic RNA molecules. © 2017 Wiley Periodicals, Inc.

  7. A Simple Laboratory Practical to Illustrate RNA Mediated Gene Interference Using Drosophila Cell Culture

    Science.gov (United States)

    Buluwela, Laki; Kamalati, Tahereh; Photiou, Andy; Heathcote, Dean A.; Jones, Michael D.; Ali, Simak

    2010-01-01

    RNA mediated gene interference (RNAi) is now a key tool in eukaryotic cell and molecular biology research. This article describes a five session laboratory practical, spread over a seven day period, to introduce and illustrate the technique. During the exercise, students working in small groups purify PCR products that encode "in vitro"…

  8. Production of high-amylose maize lines using RNA interference in ...

    African Journals Online (AJOL)

    amylose maize lines with a low T-DNA copy number, demonstrating that RNAi is an efficient method for the production of high-amylose maize lines. Key words: Maize, high-amylose, RNA interference, starch branching enzyme gene sbe2a.

  9. Development of Novel Antisense Oligonucleotides for the Functional Regulation of RNA-Induced Silencing Complex (RISC) by Promoting the Release of microRNA from RISC.

    Science.gov (United States)

    Ariyoshi, Jumpei; Momokawa, Daiki; Eimori, Nao; Kobori, Akio; Murakami, Akira; Yamayoshi, Asako

    2015-12-16

    MicroRNAs (miRNAs) are known to be important post-transcription regulators of gene expression. Aberrant miRNA expression is associated with pathological disease processes, including carcinogenesis. Therefore, miRNAs are considered significant therapeutic targets for cancer therapy. MiRNAs do not act alone, but exhibit their functions by forming RNA-induced silencing complex (RISC). Thus, the regulation of RISC activity is a promising approach for cancer therapy. MiRNA is a core component of RISC and is an essential to RISC for recognizing target mRNA. Thereby, it is expected that development of the method to promote the release of miRNA from RISC would be an effective approach for inhibition of RISC activity. In this study, we synthesized novel peptide-conjugated oligonucleotides (RINDA-as) to promote the release of miRNA from RISC. RINDA-as showed a high rate of miRNA release from RISC and high level of inhibitory effect on RISC activity.

  10. Salicylic acid-mediated and RNA-silencing defense mechanisms cooperate in the restriction of systemic spread of plum pox virus in tobacco.

    Science.gov (United States)

    Alamillo, Josefa M; Saénz, Pilar; García, Juan Antonio

    2006-10-01

    Plum pox virus (PPV) is able to replicate in inoculated leaves of Nicotiana tabacum, but is defective in systemic movement in this host. However, PPV produces a systemic infection in transgenic tobacco expressing the silencing suppressor P1/HC-Pro from tobacco etch virus (TEV). In this work we show that PPV is able to move to upper non-inoculated leaves of tobacco plants expressing bacterial salicylate hydroxylase (NahG) that degrades salicylic acid (SA). Replication and accumulation of PPV is higher in the locally infected leaves of plants deficient in SA or expressing TEV P1/HC-Pro silencing suppressor. Accumulation of viral derived small RNAs was reduced in the NahG transgenic plants, suggesting that SA might act as an enhancer of the RNA-silencing antiviral defense in tobacco. Besides, expression of SA-mediated defense transcripts, such as those of pathogenesis-related (PR) proteins PR-1 and PR-2 or alternative oxidase-1, as well as that of the putative RNA-dependent RNA polymerase NtRDR1, is induced in response to PPV infection, and the expression patterns of these defense transcripts are altered in the TEV P1/HC-Pro transgenic plants. Long-distance movement of PPV is highly enhanced in NahG x P1/HC-Pro double-transgenic plants and systemic symptoms in these plants reveal that the expression of an RNA-silencing suppressor and the lack of SA produce additive but distinct effects. Our results suggest that SA might act as an enhancer of the RNA-silencing antiviral defense in tobacco, and that silencing suppressors, such as P1/HC-Pro, also alter the SA-mediated defense. Both an RNA-silencing and an SA-mediated defense mechanism could act together to limit PPV infection.

  11. Cellular toxicity following application of adeno-associated viral vector-mediated RNA interference in the nervous system

    Directory of Open Access Journals (Sweden)

    Verhaagen Joost

    2010-02-01

    Full Text Available Abstract Background After a spinal cord lesion, axon regeneration is inhibited by the presence of a diversity of inhibitory molecules in the lesion environment. At and around the lesion site myelin-associated inhibitors, chondroitin sulfate proteoglycans (CSPGs and several axon guidance molecules, including all members of the secreted (class 3 Semaphorins, are expressed. Interfering with multiple inhibitory signals could potentially enhance the previously reported beneficial effects of blocking single molecules. RNA interference (RNAi is a tool that can be used to simultaneously silence expression of multiple genes. In this study we aimed to employ adeno-associated virus (AAV mediated expression of short hairpin RNAs (shRNAs to target all Semaphorin class 3 signaling by knocking down its receptors, Neuropilin 1 (Npn-1 and Neuropilin 2 (Npn-2. Results We have successfully generated shRNAs that knock down Npn-1 and Npn-2 in a neuronal cell line. We detected substantial knockdown of Npn-2 mRNA when AAV5 viral vector particles expressing Npn-2 specific shRNAs were injected in dorsal root ganglia (DRG of the rat. Unexpectedly however, AAV1-mediated expression of Npn-2 shRNAs and a control shRNA in the red nucleus resulted in an adverse tissue response and neuronal degeneration. The observed toxicity was dose dependent and was not seen with control GFP expressing AAV vectors, implicating the shRNAs as the causative toxic agents. Conclusions RNAi is a powerful tool to knock down Semaphorin receptor expression in neuronal cells in vitro and in vivo. However, when shRNAs are expressed at high levels in CNS neurons, they trigger an adverse tissue response leading to neuronal degradation.

  12. The silence of MUC2 mRNA induced by promoter hypermethylation associated with HBV in Hepatocellular Carcinoma

    Directory of Open Access Journals (Sweden)

    Ling Yang

    2013-01-01

    Full Text Available Abstract Background To evaluate the promoter methylation status of MUC2 gene and mRNA expression in patients with hepatocellular carcinoma. Methods We analyzed MUC2 methylation by MSP, and MUC2 mRNA by real-time PCR in 74 HCC. Results MUC2 mRNA were lower in HCC tissues (Mean -ΔCt = −4.70 than that in Non-HCC tissues (Mean -ΔCt = −2.98. Expression of MUC2 was elevated in only 23 (31.08% of the 74 HCC patients. MUC2 promoter was hypermethylated in 62.2% (46/74 of HCCs, and in only 18.9% (14/74 of non-tumor samples. MUC2 mRNA were lower in HCC patients with hypermethylation (Mean -ΔΔCt = −2.25 than those with demethylation (Mean -ΔΔCt = −0.22, and there is a decreased tendency for MUC2 mRNA in HCC patients with promoter hypermethylation (p = 0.011. There was a significantly correlation found between MUC2 mRNA and HBV and AFP in HCC. The loss of MUC2 mRNA and hypermethylation could be poor prognostic factors. After treated by 5-Aza-CdR and TSA, we found that MUC2 mRNA induced significantly in 7721, Huh7 and HepG2 cells. Conclusion The results suggested that MUC2 mRNA silenced by promoter hypermethylation is associated with high levels HBV in HCC.

  13. AAV-based shRNA silencing of NF-κB ameliorates muscle pathologies in mdx mice.

    Science.gov (United States)

    Yang, Q; Tang, Y; Imbrogno, K; Lu, A; Proto, J D; Chen, A; Guo, F; Fu, F H; Huard, J; Wang, B

    2012-12-01

    Chronic inflammation, promoted by an upregulated NF-kappa B (NF-κB) pathway, has a key role in Duchenne muscular dystrophy (DMD) patients' pathogenesis. Blocking the NF-κB pathway has been shown to be a viable approach to diminish chronic inflammation and necrosis in the dystrophin-defective mdx mouse, a murine DMD model. In this study, we used the recombinant adeno-associated virus serotype 9 (AAV9) carrying an short hairpin RNA (shRNA) specifically targeting the messenger RNA of NF-κB/p65 (p65-shRNA), the major subunit of NF-κB associated with chronic inflammation in mdx mice. We examined whether i.m. AAV9-mediated delivery of p65-shRNA could decrease NF-κB activation, allowing for amelioration of muscle pathologies in 1- and 4-month-old mdx mice. At 1 month after treatment, NF-κB/p65 levels were significantly decreased by AAV gene transfer of p65-shRNA in the two ages of treatment groups, with necrosis significantly decreased compared with controls. Quantitative analysis revealed that central nucleation (CN) of the myofibers of p65-shRNA-treated 1-month-old mdx muscles was reduced from 67 to 34%, but the level of CN was not significantly decreased in treated 4-month-old mdx mice. Moreover, delivery of the p65-shRNA enhanced the capacity of myofiber regeneration in old mdx mice treated at 4 months of age when the dystrophic myofibers were most exhausted; however, such p65 silencing diminished the myofiber regeneration in young mdx mice treated at 1 month of age. Taken together, these findings demonstrate that the AAV-mediated delivery of p65-shRNA has the capacity to ameliorate muscle pathologies in mdx mice by selectively reducing NF-κB/p65 activity.

  14. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  15. α-Fetoprotein promoter-driven Cre/LoxP-switched RNA interference for hepatocellular carcinoma tissue-specific target therapy.

    Directory of Open Access Journals (Sweden)

    Yuan-Fei Peng

    Full Text Available RNA interference (RNAi has recently emerged as a potential treatment modality for hepatocellular carcinoma (HCC therapy, but the lack of cellular targets and sustained efficacy limits its application. The purpose of this study is to develop an HCC tissue-specific RNAi system and investigate its possibility for HCC treatment.Two different HCC-specific RNAi systems in which therapeutic miRNA or shRNA against target gene (Beclin 1 was directly or indirectly driven by alpha-fetoprotein promoter (AFP-miRNA and AFP-Cre/LoxP-shRNA were constructed. Human HCC cell lines (HepG2, Hep3B and HCCLM3 and non-HCC cell lines (L-02, Hela and SW1116 were infected with the systems. The effectiveness and tissue-specificity of the systems were examined by Q-PCR and western blot analysis. The efficacy of the systems was further tested in mouse model of HCC by intravenous or intratumoral administration. The feasibility of the system for HCC treatment was evaluated by applying the system as adjuvant therapy to enhance sorafenib treatment. An AFP-Cre/LoxP-shRNA system targeting Atg5 gene (AFP-Cre/LoxP-shRNA-Atg5 was constructed and its efficacy in sensitizing HCC cells (MHCC97L/PLC to sorafenib treatment was examined by apoptosis assay in vitro and tumorigenesis assay in vivo.The AFP-miRNA system could silence target gene (Beclin 1 but required a high titer which was lethal to target cells. The AFP-Cre/LoxP-shRNA system could efficiently knockdown target gene while maintain high HCC specificity. Intratumoral injection of the AFP-Cre/LoxP-shRNA system could efficiently silence target gene (Beclin 1 in vivo while intravenous administration could not. The AFP-Cre/LoxP-shRNA system target Atg5 gene could significantly sensitize MHCC97L/PLC cells to sorafenib-induced apoptosis in vitro and tumor growth suppression in vivo.An efficient HCC tissue-specific RNAi system (AFP-Cre/LoxP-shRNA was successfully established. The system provides a usable tool for HCC-specific RNAi

  16. Downregulation of cinnamyl-alcohol dehydrogenase in switchgrass by RNA silencing results in enhanced glucose release after cellulase treatment.

    Directory of Open Access Journals (Sweden)

    Aaron J Saathoff

    Full Text Available Cinnamyl alcohol dehydrogenase (CAD catalyzes the last step in monolignol biosynthesis and genetic evidence indicates CAD deficiency in grasses both decreases overall lignin, alters lignin structure and increases enzymatic recovery of sugars. To ascertain the effect of CAD downregulation in switchgrass, RNA mediated silencing of CAD was induced through Agrobacterium mediated transformation of cv. "Alamo" with an inverted repeat construct containing a fragment derived from the coding sequence of PviCAD2. The resulting primary transformants accumulated less CAD RNA transcript and protein than control transformants and were demonstrated to be stably transformed with between 1 and 5 copies of the T-DNA. CAD activity against coniferaldehyde, and sinapaldehyde in stems of silenced lines was significantly reduced as was overall lignin and cutin. Glucose release from ground samples pretreated with ammonium hydroxide and digested with cellulases was greater than in control transformants. When stained with the lignin and cutin specific stain phloroglucinol-HCl the staining intensity of one line indicated greater incorporation of hydroxycinnamyl aldehydes in the lignin.

  17. Downregulation of cinnamyl-alcohol dehydrogenase in switchgrass by RNA silencing results in enhanced glucose release after cellulase treatment.

    Science.gov (United States)

    Saathoff, Aaron J; Sarath, Gautam; Chow, Elaine K; Dien, Bruce S; Tobias, Christian M

    2011-01-27

    Cinnamyl alcohol dehydrogenase (CAD) catalyzes the last step in monolignol biosynthesis and genetic evidence indicates CAD deficiency in grasses both decreases overall lignin, alters lignin structure and increases enzymatic recovery of sugars. To ascertain the effect of CAD downregulation in switchgrass, RNA mediated silencing of CAD was induced through Agrobacterium mediated transformation of cv. "Alamo" with an inverted repeat construct containing a fragment derived from the coding sequence of PviCAD2. The resulting primary transformants accumulated less CAD RNA transcript and protein than control transformants and were demonstrated to be stably transformed with between 1 and 5 copies of the T-DNA. CAD activity against coniferaldehyde, and sinapaldehyde in stems of silenced lines was significantly reduced as was overall lignin and cutin. Glucose release from ground samples pretreated with ammonium hydroxide and digested with cellulases was greater than in control transformants. When stained with the lignin and cutin specific stain phloroglucinol-HCl the staining intensity of one line indicated greater incorporation of hydroxycinnamyl aldehydes in the lignin.

  18. [Lentivirus-mediated shRNA silencing of LAMP2A inhibits the proliferation of multiple myeloma cells].

    Science.gov (United States)

    Li, Lixuan; Li, Jia

    2015-05-01

    To study the effects of lentivirus-mediated short hairpin RNA (shRNA) silencing of lysosome-associated membrane protein type 2A (LAMP2A) expression on the proliferation of multiple myeloma cells. The constructed shRNA lentiviral vector was applied to infect human multiple myeloma cell line MM.1S, and stable expression cell line was obtained by puromycin screening. Western blotting was used to verify the inhibitory effect on LAMP2A protein expression. MTT assay was conducted to detect the effect of knocked-down LAMP2A on MM.1S cell proliferation, and the anti-tumor potency of suberoylanilide hydroxamic acid (SAHA) against the obtained MM.1S LAMP2A(shRNA) stable cell line. Lactate assay was performed to observe the impact of low LAMP2A expression on cell glycolysis. The stable cell line with low LAMP2A expression were obtained with the constructed human LAMP2A-shRNA lentiviral vector. Down-regulation of LAMP2A expression significantly inhibited MM.1S cell proliferation and enhanced the anti-tumor activity of SAHA. Interestingly, decreased LAMP2A expression also inhibited MM.1S cell lactic acid secretion. Down-regulation of LAMP2A expression could inhibit cell proliferation in multiple myeloma cells.

  19. Silencing of ATM expression by siRNA technique contributes to glioma stem cell radiosensitivity in vitro and in vivo.

    Science.gov (United States)

    Li, Yan; Li, Luchun; Wu, Zhijuan; Wang, Lulu; Wu, Yongzhong; Li, Dairong; Ma, Uiwen; Shao, Jianghe; Yu, Huiqing; Wang, Donglin

    2017-07-01

    Evidence has shown that both high expression of the ataxia-telangiectasia mutated (ATM) gene and glioma stem cells (GSCs) are responsible for radioresistance in glioma. Thus, we hypothesized that brain tumor radiosensitivity may be enhanced via silencing of the ATM gene in GSCs. In the present study we successfully induced GSCs from two cell lines and used CD133 and nestin to identify GSCs. A lentivirus was used to deliver siRNA-ATMPuro (A group) to GSCs prior to radiation, while siRNA-HKPuro (N group) and GSCs (C group) were used as negative and blank controls, respectively. RT-qPCR and western blotting were performed to verify the efficiency of the siRNA-ATM technique. The expression of the ATM gene and ATM protein were significantly downregulated post-transfection. Cell Counting Kit-8 (CCK-8) and colony formation assays revealed that the A group demonstrated weak cell proliferation and lower survival fractions post-irradiation compared to the C/N groups. Flow cytometry was used to examine the percentage of cell apoptosis and G2 phase arrest, which were both higher in the A group than in the C/N groups. We found that the comet tail percentage evaluated by comet assay was higher in the A group than in the C/N groups. After radiation treatment, three radiosensitive genes [p53, proliferating cell nuclear antigen (PCNA), survivin] exhibited a decreasing tendency as determined by RT-qPCR. Mice underwent subcutaneous implantation, followed by radiation, and the resulting necrosis and hemorrhage were more obvious in the A group than in the N groups. In conclusion, silencing of ATM via the siRNA technique improved radiosensitivity of GSCs both in vitro and in vivo.

  20. Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.

    Science.gov (United States)

    Parrish, S; Fire, A

    2001-10-01

    RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed.

  1. In vivo therapeutic efficacy of TNFα silencing by folate-PEG-chitosan-DEAE/siRNA nanoparticles in arthritic mice.

    Science.gov (United States)

    Shi, Qin; Rondon-Cavanzo, Elsa-Patricia; Dalla Picola, Isadora Pfeifer; Tiera, Marcio José; Zhang, Xiaoling; Dai, Kerong; Benabdoune, Houda Abir; Benderdour, Mohamed; Fernandes, Julio Cesar

    2018-01-01

    Tumor necrosis factor-alpha (TNFα), a pro-inflammatory cytokine, has been shown to play a role in the pathophysiology of rheumatoid arthritis. Silencing TNFα expression with small interfering RNA (siRNA) is a promising approach to treatment of the condition. Towards this end, our team has developed a modified chitosan (CH) nanocarrier, deploying folic acid, diethylethylamine (DEAE) and polyethylene glycol (PEG) (folate-PEG-CH-DEAE 15 ). The gene carrier protects siRNA against nuclease destruction, its ligands facilitate siRNA uptake via cell surface receptors, and it provides improved solubility at neutral pH with transport of its load into target cells. In the present study, nanoparticles were prepared with siRNA-TNFα, DEAE, and folic acid-CH derivative. Nanoparticle size and zeta potential were verified by dynamic light scattering. Their TNFα-knockdown effects were tested in a murine collagen antibody-induced arthritis model. TNFα expression was examined along with measurements of various cartilage and bone turnover markers by performing histology and microcomputed tomography analysis. We demonstrated that folate-PEG-CH-DEAE 15 /siRNA nanoparticles did not alter cell viability, and significantly decreased inflammation, as demonstrated by improved clinical scores and lower TNFα protein concentrations in target tissues. This siRNA nanocarrier also decreased articular cartilage destruction and bone loss. The results indicate that folate-PEG-CH-DEAE 15 nanoparticles are a safe and effective platform for nonviral gene delivery of siRNA, and their potential clinical applications warrant further investigation.

  2. Effective silencing of ENaC by siRNA delivered with epithelial-targeted nanocomplexes in human cystic fibrosis cells and in mouse lung.

    Science.gov (United States)

    Tagalakis, Aristides D; Munye, Mustafa M; Ivanova, Rositsa; Chen, Hanpeng; Smith, Claire M; Aldossary, Ahmad M; Rosa, Luca Z; Moulding, Dale; Barnes, Josephine L; Kafetzis, Konstantinos N; Jones, Stuart A; Baines, Deborah L; Moss, Guy W J; O'Callaghan, Christopher; McAnulty, Robin J; Hart, Stephen L

    2018-05-10

    Loss of the cystic fibrosis transmembrane conductance regulator in cystic fibrosis (CF) leads to hyperabsorption of sodium and fluid from the airway due to upregulation of the epithelial sodium channel (ENaC). Thickened mucus and depleted airway surface liquid (ASL) then lead to impaired mucociliary clearance. ENaC regulation is thus a promising target for CF therapy. Our aim was to develop siRNA nanocomplexes that mediate effective silencing of airway epithelial ENaC in vitro and in vivo with functional correction of epithelial ion and fluid transport. We investigated translocation of nanocomplexes through mucus and their transfection efficiency in primary CF epithelial cells grown at air-liquid interface (ALI).Short interfering RNA (SiRNA)-mediated silencing was examined by quantitative RT-PCR and western analysis of ENaC. Transepithelial potential (V t ), short circuit current (I sc ), ASL depth and ciliary beat frequency (CBF) were measured for functional analysis. Inflammation was analysed by histological analysis of normal mouse lung tissue sections. Nanocomplexes translocated more rapidly than siRNA alone through mucus. Transfections of primary CF epithelial cells with nanocomplexes targeting αENaC siRNA, reduced αENaC and βENaC mRNA by 30%. Transfections reduced V t , the amiloride-sensitive I sc and mucus protein concentration while increasing ASL depth and CBF to normal levels. A single dose of siRNA in mouse lung silenced ENaC by approximately 30%, which persisted for at least 7 days. Three doses of siRNA increased silencing to approximately 50%. Nanoparticle-mediated delivery of ENaCsiRNA to ALI cultures corrected aspects of the mucociliary defect in human CF cells and offers effective delivery and silencing in vivo. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  3. RNA interference analyses suggest a transcript-specific regulatory role for mitochondrial RNA-binding proteins MRP1 and MRP2 in RNA editing and other RNA processing in Trypanosoma brucei

    NARCIS (Netherlands)

    Vondrusková, Eva; van den Burg, Janny; Zíková, Alena; Ernst, Nancy Lewis; Stuart, Kenneth; Benne, Rob; Lukes, Julius

    2005-01-01

    Mitochondrial RNA-binding proteins MRP1 and MRP2 occur in a heteromeric complex that appears to play a role in U-insertion/deletion editing in trypanosomes. Reduction in the levels of MRP1 (gBP21) and/or MRP2 (gBP25) mRNA by RNA interference in procyclic Trypanosoma brucei resulted in severe growth

  4. Genetic variability and evolutionary implications of RNA silencing suppressor genes in RNA1 of sweet potato chlorotic stunt virus isolates infecting sweetpotato and related wild species.

    Directory of Open Access Journals (Sweden)

    Arthur K Tugume

    Full Text Available BACKGROUND: The bipartite single-stranded RNA genome of Sweet potato chlorotic stunt virus (SPCSV, genus Crinivirus; Closteroviridae encodes a Class 1 RNase III (RNase3, a putative hydrophobic protein (p7 and a 22-kDa protein (p22 from genes located in RNA1. RNase3 and p22 suppress RNA silencing, the basal antiviral defence mechanism in plants. RNase3 is sufficient to render sweetpotato (Ipomoea batatas virus-susceptible and predisposes it to development of severe diseases following infection with unrelated virus. The incidence, strains and gene content of SPCSV infecting wild plant species have not been studied. METHODOLOGY/PRINCIPAL FINDINGS: Thirty SPCSV isolates were characterized from 10 wild Ipomoea species, Hewittia sublobata or Lepistemon owariensis (family Convolvulaceae in Uganda and compared with 34 local SPCSV isolates infecting sweetpotatoes. All isolates belonged to the East African (EA strain of SPCSV and contained RNase3 and p7, but p22 was not detected in six isolates. The three genes showed only limited genetic variability and the proteins were under purifying selection. SPCSV isolates lacking p22 synergized with Sweet potato feathery mottle virus (SPFMV, genus potyvirus; Potyviridae and caused severe symptoms in co-infected sweetpotato plants. One SPCSV isolate enhanced accumulation of SPFMV, but no severe symptoms developed. A new whitefly-transmitted virus (KML33b encoding an RNase3 homolog (<56% identity to SPCSV RNase3 able to suppresses sense-mediated RNA silencing was detected in I. sinensis. CONCLUSIONS/SIGNIFICANCE: SPCSV isolates infecting wild species and sweetpotato in Uganda were genetically undifferentiated, suggesting inter-species transmission of SPCSV. Most isolates in Uganda contained p22, unlike SPCSV isolates characterized from other countries and continents. Enhanced accumulation of SPFMV and increased disease severity were found to be uncoupled phenotypic outcomes of RNase3-mediated viral synergism in

  5. Inhibition of CD147 expression by RNA interference reduces proliferation, invasion and increases chemosensitivity in cancer stem cell-like HT-29 cells.

    Science.gov (United States)

    Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui

    2015-10-01

    The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.

  6. DICER-ARGONAUTE2 complex in continuous fluorogenic assays of RNA interference enzymes.

    Directory of Open Access Journals (Sweden)

    Mark A Bernard

    Full Text Available Mechanistic studies of RNA processing in the RNA-Induced Silencing Complex (RISC have been hindered by lack of methods for continuous monitoring of enzymatic activity. "Quencherless" fluorogenic substrates of RNAi enzymes enable continuous monitoring of enzymatic reactions for detailed kinetics studies. Recombinant RISC enzymes cleave the fluorogenic substrates targeting human thymidylate synthase (TYMS and hypoxia-inducible factor 1-α subunit (HIF1A. Using fluorogenic dsRNA DICER substrates and fluorogenic siRNA, DICER+ARGONAUTE2 mixtures exhibit synergistic enzymatic activity relative to either enzyme alone, and addition of TRBP does not enhance the apparent activity. Titration of AGO2 and DICER in enzyme assays suggests that AGO2 and DICER form a functional high-affinity complex in equimolar ratio. DICER and DICER+AGO2 exhibit Michaelis-Menten kinetics with DICER substrates. However, AGO2 cannot process the fluorogenic siRNA without DICER enzyme, suggesting that AGO2 cannot self-load siRNA into its active site. The DICER+AGO2 combination processes the fluorogenic siRNA substrate (Km=74 nM with substrate inhibition kinetics (Ki=105 nM, demonstrating experimentally that siRNA binds two different sites that affect Dicing and AGO2-loading reactions in RISC. This result suggests that siRNA (product of DICER bound in the active site of DICER may undergo direct transfer (as AGO2 substrate to the active site of AGO2 in the DICER+AGO2 complex. Competitive substrate assays indicate that DICER+AGO2 cleavage of fluorogenic siRNA is specific, since unlabeled siRNA and DICER substrates serve as competing substrates that cause a concentration-dependent decrease in fluorescent rates. Competitive substrate assays of a series of DICER substrates in vitro were correlated with cell-based assays of HIF1A mRNA knockdown (log-log slope=0.29, suggesting that improved DICER substrate designs with 10-fold greater processing by the DICER+AGO2 complex can provide a

  7. Development of functional genomic tools in trematodes: RNA interference and luciferase reporter gene activity in Fasciola hepatica.

    Directory of Open Access Journals (Sweden)

    Gabriel Rinaldi

    2008-07-01

    Full Text Available The growing availability of sequence information from diverse parasites through genomic and transcriptomic projects offer new opportunities for the identification of key mediators in the parasite-host interaction. Functional genomics approaches and methods for the manipulation of genes are essential tools for deciphering the roles of genes and to identify new intervention targets in parasites. Exciting advances in functional genomics for parasitic helminths are starting to occur, with transgene expression and RNA interference (RNAi reported in several species of nematodes, but the area is still in its infancy in flatworms, with reports in just three species. While advancing in model organisms, there is a need to rapidly extend these technologies to other parasites responsible for several chronic diseases of humans and cattle. In order to extend these approaches to less well studied parasitic worms, we developed a test method for the presence of a viable RNAi pathway by silencing the exogenous reporter gene, firefly luciferase (fLUC. We established the method in the human blood fluke Schistosoma mansoni and then confirmed its utility in the liver fluke Fasciola hepatica. We transformed newly excysted juveniles of F. hepatica by electroporation with mRNA of fLUC and three hours later were able to detect luciferase enzyme activity, concentrated mainly in the digestive ceca. Subsequently, we tested the presence of an active RNAi pathway in F. hepatica by knocking down the exogenous luciferase activity by introduction into the transformed parasites of double-stranded RNA (dsRNA specific for fLUC. In addition, we tested the RNAi pathway targeting an endogenous F. hepatica gene encoding leucine aminopeptidase (FhLAP, and observed a significant reduction in specific mRNA levels. In summary, these studies demonstrated the utility of RNAi targeting reporter fLUC as a reporter gene assay to establish the presence of an intact RNAi pathway in helminth

  8. Engineering of small interfering RNA-loaded lipidoid-poly(DL-lactic-co-glycolic acid) hybrid nanoparticles for highly efficient and safe gene silencing: A quality by design-based approach.

    Science.gov (United States)

    Thanki, Kaushik; Zeng, Xianghui; Justesen, Sarah; Tejlmann, Sarah; Falkenberg, Emily; Van Driessche, Elize; Mørck Nielsen, Hanne; Franzyk, Henrik; Foged, Camilla

    2017-11-01

    Safety and efficacy of therapeutics based on RNA interference, e.g., small interfering RNA (siRNA), are dependent on the optimal engineering of the delivery technology, which is used for intracellular delivery of siRNA to the cytosol of target cells. We investigated the hypothesis that commonly used and poorly tolerated cationic lipids might be replaced with more efficacious and safe lipidoids as the lipid component of siRNA-loaded lipid-polymer hybrid nanoparticles (LPNs) for achieving more efficient gene silencing at lower and safer doses. However, formulation design of such a complex formulation is highly challenging due to a strong interplay between several contributing factors. Hence, critical formulation variables, i.e. the lipidoid content and siRNA:lipidoid ratio, were initially identified, followed by a systematic quality-by-design approach to define the optimal operating space (OOS), eventually resulting in the identification of a robust, highly efficacious and safe formulation. A 17-run design of experiment with an I-optimal approach was performed to systematically assess the effect of selected variables on critical quality attributes (CQAs), i.e. physicochemical properties (hydrodynamic size, zeta potential, siRNA encapsulation/loading) and the biological performance (in vitro gene silencing and cell viability). Model fitting of the obtained data to construct predictive models revealed non-linear relationships for all CQAs, which can be readily overlooked in one-factor-at-a-time optimization approaches. The response surface methodology further enabled the identification of an OOS that met the desired quality target product profile. The optimized lipidoid-modified LPNs revealed more than 50-fold higher in vitro gene silencing at well-tolerated doses and approx. a twofold increase in siRNA loading as compared to reference LPNs modified with the commonly used cationic lipid dioleyltrimethylammonium propane (DOTAP). Thus, lipidoid-modified LPNs show highly

  9. Gene Silencing in Skin After Deposition of Self-Delivery siRNA With a Motorized Microneedle Array Device

    Directory of Open Access Journals (Sweden)

    Robyn P Hickerson

    2013-01-01

    Full Text Available Despite the development of potent siRNAs that effectively target genes responsible for skin disorders, translation to the clinic has been hampered by inefficient delivery through the stratum corneum barrier and into the live cells of the epidermis. Although hypodermic needles can be used to transport siRNA through the stratum corneum, this approach is limited by pain caused by the injection and the small volume of tissue that can be accessed by each injection. The use of microneedle arrays is a less painful method for siRNA delivery, but restricted payload capacity limits this approach to highly potent molecules. To address these challenges, a commercially available motorized microneedle array skin delivery device was evaluated. This device combines the positive elements of both hypodermic needles and microneedle array technologies with little or no pain to the patient. Application of fluorescently tagged self-delivery (sd-siRNA to both human and murine skin resulted in distribution throughout the treated skin. In addition, efficient silencing (78% average reduction of reporter gene expression was achieved in a transgenic fluorescent reporter mouse skin model. These results indicate that this device effectively delivers functional sd-siRNA with an efficiency that predicts successful clinical translation.

  10. Silencing of SARS-CoV spike gene by small interfering RNA in HEK 293T cells

    International Nuclear Information System (INIS)

    Qin Zhaoling; Zhao Ping; Zhang Xiaolian; Yu Jianguo; Cao Mingmei; Zhao Lanjuan; Luan Jie; Qi Zhongtian

    2004-01-01

    Two candidate small interfering RNAs (siRNAs) corresponding to severe acute respiratory syndrome-associated coronavirus (SARS-CoV) spike gene were designed and in vitro transcribed to explore the possibility of silencing SARS-CoV S gene. The plasmid pEGFP-optS, which contains the codon-optimized SARS-CoV S gene and expresses spike-EGFP fusion protein (S-EGFP) as silencing target and expressing reporter, was transfected with siRNAs into HEK 293T cells. At various time points of posttransfection, the levels of S-EGFP expression and amounts of spike mRNA transcript were detected by fluorescence microscopy, flow cytometry, Western blot, and real-time quantitative PCR, respectively. The results showed that the cells transfected with pEGFP-optS expressed S-EGFP fusion protein at a higher level compared with those transfected with pEGFP-S, which contains wildtype SARS-CoV spike gene sequence. The green fluorescence, mean fluorescence intensity, and SARS-CoV S RNA transcripts were found significantly reduced, and the expression of SARS-CoV S glycoprotein was strongly inhibited in those cells co-transfected with either EGFP- or S-specific siRNAs. Our findings demonstrated that the S-specific siRNAs used in this study were able to specifically and effectively inhibit SARS-CoV S glycoprotein expression in cultured cells through blocking the accumulation of S mRNA, which may provide an approach for studies on the functions of SARS-CoV S gene and development of novel prophylactic or therapeutic agents for SARS-CoV

  11. Expression profiling of c-kit and its impact after esiRNA silencing during gonadal development in catfish.

    Science.gov (United States)

    Laldinsangi, C; Senthilkumaran, B

    2018-04-03

    C-kit receptor is a member of a family of growth factor receptors that have tyrosine kinase activity, and are involved in the transduction of growth regulatory signals across plasma membrane by activation of its ligand, kitl/scf. The present study analysed mRNA and protein expression profiles of c-kit in the gonads of catfish, Clarias gariepinus, using real time PCR, in situ hybridization and immunohistochemistry. Tissue distribution analysis revealed higher expression mainly in the catfish gonads. Ontogeny studies showed minimal expression during early developmental stages and highest during 50-75 days post hatch, and the dimorphic expression in gonads decreased gradually till adulthood, which might suggest an important role for this gene around later stages of sex differentiation and gonadal development. Expression of C-kit was analysed at various phases of gonadal cycle in both male and female, which showed minimal expression during the resting phase, and higher expression in male compared to females during the pre-spawning phase. In vitro and in vivo induction using human chorionic gonadotropin elevated the expression of c-kit indicating the regulatory influence of hypothalamo-hypophyseal axis. In vivo transient gene silencing using c-kit-esiRNA in adult catfish during gonadal recrudescence showed a decrease in c-kit expression, which affected the expression level of germ cell meiotic marker sycp3, as well as several factors and steroidogenic enzyme genes involved in germ cell development. Decrease in the levels of serum 11-KT and T were also observed after esiRNA silencing. The findings of this study suggest that c-kit has an important role in the process of germ cell proliferation, development and maturation during gonadal development and recrudescence in catfish. Copyright © 2018. Published by Elsevier Inc.

  12. Gene silencing of HPV16 E6/E7 induced by promoter-targeting siRNA in SiHa cells

    OpenAIRE

    Hong, D; Lu, W; Ye, F; Hu, Y; Xie, X

    2009-01-01

    Background: Recently, transcriptional gene silencing induced by small interfering RNA (siRNA) was found in mammalian and human cells. However, previous studies focused on endogenous genes. Methods: In this study, we designed siRNA targeting the promoter of human papillomavirus 16 E6/E7 and transfected it into the cervical cancer cell line, SiHa. E6 and E7 mRNA and protein expression were detected in cells treated by promoter-targeting siRNA. Futhermore, cellular growth, proliferation, apoptos...

  13. Global effects of the CSR-1 RNA interference pathway on the transcriptional landscape.

    Science.gov (United States)

    Cecere, Germano; Hoersch, Sebastian; O'Keeffe, Sean; Sachidanandam, Ravi; Grishok, Alla

    2014-04-01

    Argonaute proteins and their small RNA cofactors short interfering RNAs are known to inhibit gene expression at the transcriptional and post-transcriptional levels. In Caenorhabditis elegans, the Argonaute CSR-1 binds thousands of endogenous siRNAs (endo-siRNAs) that are antisense to germline transcripts. However, its role in gene expression regulation remains controversial. Here we used genome-wide profiling of nascent RNA transcripts and found that the CSR-1 RNA interference pathway promoted sense-oriented RNA polymerase II transcription. Moreover, a loss of CSR-1 function resulted in global increase in antisense transcription and ectopic transcription of silent chromatin domains, which led to reduced chromatin incorporation of centromere-specific histone H3. On the basis of these findings, we propose that the CSR-1 pathway helps maintain the directionality of active transcription, thereby propagating the distinction between transcriptionally active and silent genomic regions.

  14. Identification of nonviable genes affecting touch sensitivity in Caenorhabditis elegans using neuronally enhanced feeding RNA interference.

    Science.gov (United States)

    Chen, Xiaoyin; Cuadros, Margarete Diaz; Chalfie, Martin

    2015-01-09

    Caenorhabditis elegans senses gentle touch along the body via six touch receptor neurons. Although genetic screens and microarray analyses have identified several genes needed for touch sensitivity, these methods miss pleiotropic genes that are essential for the viability, movement, or fertility of the animals. We used neuronally enhanced feeding RNA interference to screen genes that cause lethality or paralysis when mutated, and we identified 61 such genes affecting touch sensitivity, including five positive controls. We confirmed 18 genes by using available alleles, and further studied one of them, tag-170, now renamed txdc-9. txdc-9 preferentially affects anterior touch response but is needed for tubulin acetylation and microtubule formation in both the anterior and posterior touch receptor neurons. Our results indicate that neuronally enhanced feeding RNA interference screens complement traditional mutageneses by identifying additional nonviable genes needed for specific neuronal functions. Copyright © 2015 Chen et al.

  15. Polymer nanoparticles for drug and small silencing RNA delivery to treat cancers of different phenotypes

    Science.gov (United States)

    Devulapally, Rammohan; Paulmurugan, Ramasamy

    2013-01-01

    Advances in nanotechnology have provided powerful and efficient tools in development of cancer diagnosis and therapy. There are numerous nanocarriers that are currently approved for clinical use in cancer therapy. In recent years, biodegradable polymer nanoparticles (NPs) have attracted a considerable attention for their ability to function as a possible carrier for target-specific delivery of various drugs, genes, proteins, peptides, vaccines, and other biomolecules in humans without much toxicity. This review will specifically focus on the recent advances in polymer-based nanocarriers for various drugs and small silencing RNA’s loading and delivery to treat different types of cancer. PMID:23996830

  16. Paramutation of tobacco transgenes by small RNA-mediated transcriptional gene silencing

    Czech Academy of Sciences Publication Activity Database

    Crhák Khaitová, Lucie; Fojtová, M.; Křížová, Kateřina; Lunerová Bedřichová, Jana; Fulneček, Jaroslav; Depicker, A.; Kovařík, Aleš

    2011-01-01

    Roč. 6, č. 5 (2011), s. 650-660 ISSN 1559-2294 R&D Projects: GA ČR(CZ) GD204/09/H002; GA MŠk(CZ) LC06004 Grant - others:GA ČR(CZ) GPP501/11/P667 Program:GP Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : transcriptional gene silencing * transgene epialleles * DNA methylation Subject RIV: BO - Biophysics Impact factor: 4.318, year: 2011

  17. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  18. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  19. Enhancer-driven chromatin interactions during development promote escape from silencing by a long non-coding RNA

    Directory of Open Access Journals (Sweden)

    Korostowski Lisa

    2011-11-01

    Full Text Available Abstract Background Gene regulation in eukaryotes is a complex process entailing the establishment of transcriptionally silent chromatin domains interspersed with regions of active transcription. Imprinted domains consist of clusters of genes, some of which exhibit parent-of-origin dependent monoallelic expression, while others are biallelic. The Kcnq1 imprinted domain illustrates the complexities of long-range regulation that coexists with local exceptions. A paternally expressed repressive non-coding RNA, Kcnq1ot1, regulates a domain of up to 750 kb, encompassing 14 genes. We study how the Kcnq1 gene, initially silenced by Kcnq1ot1, undergoes tissue-specific escape from imprinting during development. Specifically, we uncover the role of chromosome conformation during these events. Results We show that Kcnq1 transitions from monoallelic to biallelic expression during mid gestation in the developing heart. This transition is not associated with the loss of methylation on the Kcnq1 promoter. However, by exploiting chromosome conformation capture (3C technology, we find tissue-specific and stage-specific chromatin loops between the Kcnq1 promoter and newly identified DNA regulatory elements. These regulatory elements showed in vitro activity in a luciferase assay and in vivo activity in transgenic embryos. Conclusions By exploring the spatial organization of the Kcnq1 locus, our results reveal a novel mechanism by which local activation of genes can override the regional silencing effects of non-coding RNAs.

  20. RNA interference: a new strategy in the evolutionary arms race between human control strategies and insect pests.

    Science.gov (United States)

    Machado, Vilmar; Rodríguez-García, María Juliana; Sánchez-García, Francisco Javier; Galan, Jose

    2014-01-01

    The relationship between humans and the insect pests of cultivated plants may be considered to be an indirect coevolutionary process, i.e., an arms race. Over time, humans have developed several strategies to minimize the negative impacts of insects on agricultural production. However, insects have made adaptive responses via the evolution of resistance to insecticides, and more recently against Bacillus thuriengiensis. Thus, we need to continuously invest resources in the development of new strategies for crop protection. Recent advances in genomics have demonstrated the possibility of a new weapon or strategy in this war, i.e., gene silencing, which involves blocking the expression of specific genes via mRNA inactivation. In the last decade, several studies have demonstrated the effectiveness of this strategy in the control of different species of insects. However, several technical difficulties need to be overcome to transform this potential into reality, such as the selection of target genes, the concentration of dsRNA, the nucleotide sequence of the dsRNA, the length of dsRNA, persistence in the insect body, and the life stage of the target species where gene silencing is most efficient. This study analyzes several aspects related to the use of gene silencing in pest control and it includes an overview of the inactivation process, as well as the problems that need to be resolved to transform gene silencing into an effective pest control method.

  1. Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection

    DEFF Research Database (Denmark)

    Lanford, Robert E; Hildebrandt-Eriksen, Elisabeth S; Petri, Andreas

    2010-01-01

    The liver-expressed microRNA-122 (miR-122) is essential for hepatitis C virus (HCV) RNA accumulation in cultured liver cells, but its potential as a target for antiviral intervention has not been assessed. We found that treatment of chronically infected chimpanzees with a locked nucleic acid (LNA...

  2. Silencing of Tumor Necrosis Factor Receptor 1 by siRNA in EC109 Cells Affects Cell Proliferation and Apoptosis

    Directory of Open Access Journals (Sweden)

    Ma Changhui

    2009-01-01

    Full Text Available Tumor necrosis factor receptor 1 (TNFR1 is a membrane receptor able to bind TNF-α or TNF-β. TNFR1 can suppress apoptosis by activating the NF-κB or JNK/SAPK signal transduction pathway, or it can induce apoptosis through a series of caspase cascade reactions; the particular effect may depend on the cell line. In the present study, we first showed that TNFR1 is expressed at both the gene and protein levels in the esophageal carcinoma cell line EC109. Then, by applying a specific siRNA, we silenced the expression of TNFR1; this resulted in a significant time-dependent promotion of cell proliferation and downregulation of the apoptotic rate. These results suggest that TNFR1 is strongly expressed in the EC109 cell line and that it may play an apoptosis-mediating role, which may be suppressed by highly activated NF-κB.

  3. Silencing of BCR/ABL Chimeric Gene in Human Chronic Myelogenous Leukemia Cell Line K562 by siRNA-Nuclear Export Signal Peptide Conjugates.

    Science.gov (United States)

    Shinkai, Yasuhiro; Kashihara, Shinichi; Minematsu, Go; Fujii, Hirofumi; Naemura, Madoka; Kotake, Yojiro; Morita, Yasutaka; Ohnuki, Koichiro; Fokina, Alesya A; Stetsenko, Dmitry A; Filichev, Vyacheslav V; Fujii, Masayuki

    2017-06-01

    Herein we described the synthesis of siRNA-NES (nuclear export signal) peptide conjugates by solid phase fragment coupling and the application of them to silencing of bcr/abl chimeric gene in human chronic myelogenous leukemia cell line K562. Two types of siRNA-NES conjugates were prepared, and both sense strands at 5' ends were covalently linked to a NES peptide derived from TFIIIA and HIV-1 REV, respectively. Significant enhancement of silencing efficiency was observed for both of them. siRNA-TFIIIA NES conjugate suppressed the expression of BCR/ABL gene to 8.3% at 200 nM and 11.6% at 50 nM, and siRNA-HIV-1REV NES conjugate suppressed to 4.0% at 200 nM and 6.3% at 50 nM, whereas native siRNA suppressed to 36.3% at 200 nM and 30.2% at 50 nM. We could also show complex of siRNA-NES conjugate and designed amphiphilic peptide peptideβ7 could be taken up into cells with no cytotoxicity and showed excellent silencing efficiency. We believe that the complex siRNA-NES conjugate and peptideβ7 is a promising candidate for in vivo use and therapeutic applications.

  4. Efficient nanoparticle mediated sustained RNA interference in human primary endothelial cells

    Energy Technology Data Exchange (ETDEWEB)

    Mukerjee, Anindita; Shankardas, Jwalitha; Ranjan, Amalendu P; Vishwanatha, Jamboor K, E-mail: Jamboor.vishwanatha@unthsc.edu [Department of Molecular Biology and Immunology and Institute for Cancer Research, Graduate School of Biomedical Sciences, University of North Texas Health Science Center, Fort Worth, TX 76107 (United States)

    2011-11-04

    Endothelium forms an important target for drug and/or gene therapy since endothelial cells play critical roles in angiogenesis and vascular functions and are associated with various pathophysiological conditions. RNA mediated gene silencing presents a new therapeutic approach to overcome many such diseases, but the major challenge of such an approach is to ensure minimal toxicity and effective transfection efficiency of short hairpin RNA (shRNA) to primary endothelial cells. In the present study, we formulated shAnnexin A2 loaded poly(D,L-lactide-co-glycolide) (PLGA) nanoparticles which produced intracellular small interfering RNA (siRNA) against Annexin A2 and brought about the downregulation of Annexin A2. The per cent encapsulation of the plasmid within the nanoparticle was found to be 57.65%. We compared our nanoparticle based transfections with Lipofectamine mediated transfection, and our studies show that nanoparticle based transfection efficiency is very high ({approx}97%) and is more sustained compared to conventional Lipofectamine mediated transfections in primary retinal microvascular endothelial cells and human cancer cell lines. Our findings also show that the shAnnexin A2 loaded PLGA nanoparticles had minimal toxicity with almost 95% of cells being viable 24 h post-transfection while Lipofectamine based transfections resulted in only 30% viable cells. Therefore, PLGA nanoparticle based transfection may be used for efficient siRNA transfection to human primary endothelial and cancer cells. This may serve as a potential adjuvant treatment option for diseases such as diabetic retinopathy, retinopathy of prematurity and age related macular degeneration besides various cancers.

  5. Efficient nanoparticle mediated sustained RNA interference in human primary endothelial cells

    Science.gov (United States)

    Mukerjee, Anindita; Shankardas, Jwalitha; Ranjan, Amalendu P.; Vishwanatha, Jamboor K.

    2011-11-01

    Endothelium forms an important target for drug and/or gene therapy since endothelial cells play critical roles in angiogenesis and vascular functions and are associated with various pathophysiological conditions. RNA mediated gene silencing presents a new therapeutic approach to overcome many such diseases, but the major challenge of such an approach is to ensure minimal toxicity and effective transfection efficiency of short hairpin RNA (shRNA) to primary endothelial cells. In the present study, we formulated shAnnexin A2 loaded poly(D,L-lactide-co-glycolide) (PLGA) nanoparticles which produced intracellular small interfering RNA (siRNA) against Annexin A2 and brought about the downregulation of Annexin A2. The per cent encapsulation of the plasmid within the nanoparticle was found to be 57.65%. We compared our nanoparticle based transfections with Lipofectamine mediated transfection, and our studies show that nanoparticle based transfection efficiency is very high (~97%) and is more sustained compared to conventional Lipofectamine mediated transfections in primary retinal microvascular endothelial cells and human cancer cell lines. Our findings also show that the shAnnexin A2 loaded PLGA nanoparticles had minimal toxicity with almost 95% of cells being viable 24 h post-transfection while Lipofectamine based transfections resulted in only 30% viable cells. Therefore, PLGA nanoparticle based transfection may be used for efficient siRNA transfection to human primary endothelial and cancer cells. This may serve as a potential adjuvant treatment option for diseases such as diabetic retinopathy, retinopathy of prematurity and age related macular degeneration besides various cancers.

  6. Efficient nanoparticle mediated sustained RNA interference in human primary endothelial cells

    International Nuclear Information System (INIS)

    Mukerjee, Anindita; Shankardas, Jwalitha; Ranjan, Amalendu P; Vishwanatha, Jamboor K

    2011-01-01

    Endothelium forms an important target for drug and/or gene therapy since endothelial cells play critical roles in angiogenesis and vascular functions and are associated with various pathophysiological conditions. RNA mediated gene silencing presents a new therapeutic approach to overcome many such diseases, but the major challenge of such an approach is to ensure minimal toxicity and effective transfection efficiency of short hairpin RNA (shRNA) to primary endothelial cells. In the present study, we formulated shAnnexin A2 loaded poly(D,L-lactide-co-glycolide) (PLGA) nanoparticles which produced intracellular small interfering RNA (siRNA) against Annexin A2 and brought about the downregulation of Annexin A2. The per cent encapsulation of the plasmid within the nanoparticle was found to be 57.65%. We compared our nanoparticle based transfections with Lipofectamine mediated transfection, and our studies show that nanoparticle based transfection efficiency is very high (∼97%) and is more sustained compared to conventional Lipofectamine mediated transfections in primary retinal microvascular endothelial cells and human cancer cell lines. Our findings also show that the shAnnexin A2 loaded PLGA nanoparticles had minimal toxicity with almost 95% of cells being viable 24 h post-transfection while Lipofectamine based transfections resulted in only 30% viable cells. Therefore, PLGA nanoparticle based transfection may be used for efficient siRNA transfection to human primary endothelial and cancer cells. This may serve as a potential adjuvant treatment option for diseases such as diabetic retinopathy, retinopathy of prematurity and age related macular degeneration besides various cancers.

  7. In vivo therapeutic efficacy of TNFα silencing by folate-PEG-chitosan-DEAE/siRNA nanoparticles in arthritic mice

    Directory of Open Access Journals (Sweden)

    Shi Q

    2018-01-01

    Full Text Available Qin Shi,1 Elsa-Patricia Rondon-Cavanzo,1 Isadora Pfeifer Dalla Picola,1,2 Marcio José Tiera,2 Xiaoling Zhang,3 Kerong Dai,4 Houda Abir Benabdoune,1 Mohamed Benderdour,1 Julio Cesar Fernandes1 1Orthopedic Research Laboratory, Hôpital du Sacré-Coeur de Montréal, Université de Montréal, Montréal, QC, Canada; 2Department of Chemistry and Environmental Sciences, UNESP-São Paulo State University, São José do Rio Preto, Brazil; 3Orthopedic Cellular and Molecular Biology Laboratories, Institute of Health Sciences, Chinese Academy of Sciences and Shanghai Jiao Tong University School of Medicine, Shanghai, 4Department of Orthopedics, Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China Background: Tumor necrosis factor-alpha (TNFα, a pro-inflammatory cytokine, has been shown to play a role in the pathophysiology of rheumatoid arthritis. Silencing TNFα expression with small interfering RNA (siRNA is a promising approach to treatment of the condition. Methods: Towards this end, our team has developed a modified chitosan (CH nanocarrier, deploying folic acid, diethylethylamine (DEAE and polyethylene glycol (PEG (folate-PEG-CH-DEAE15. The gene carrier protects siRNA against nuclease destruction, its ligands facilitate siRNA uptake via cell surface receptors, and it provides improved solubility at neutral pH with transport of its load into target cells. In the present study, nanoparticles were prepared with siRNA-TNFα, DEAE, and folic acid-CH derivative. Nanoparticle size and zeta potential were verified by dynamic light scattering. Their TNFα-knockdown effects were tested in a murine collagen antibody-induced arthritis model. TNFα expression was examined along with measurements of various cartilage and bone turnover markers by performing histology and microcomputed tomography analysis.Results: We demonstrated that folate-PEG-CH-DEAE15/siRNA nanoparticles did not alter cell viability, and significantly

  8. Spliced leader RNA silencing (SLS - a programmed cell death pathway in Trypanosoma brucei that is induced upon ER stress

    Directory of Open Access Journals (Sweden)

    Michaeli Shulamit

    2012-05-01

    Full Text Available Abstract Trypanosoma brucei is the causative agent of African sleeping sickness. The parasite cycles between its insect (procyclic form and mammalian hosts (bloodstream form. Trypanosomes lack conventional transcription regulation, and their genes are transcribed in polycistronic units that are processed by trans-splicing and polyadenylation. In trans-splicing, which is essential for processing of each mRNA, an exon, the spliced leader (SL is added to all mRNAs from a small RNA, the SL RNA. Trypanosomes lack the machinery for the unfolded protein response (UPR, which in other eukaryotes is induced under endoplasmic reticulum (ER stress. Trypanosomes respond to such stress by changing the stability of mRNAs, which are essential for coping with the stress. However, under severe ER stress that is induced by blocking translocation of proteins to the ER, treatment of cells with chemicals that induce misfolding in the ER, or extreme pH, trypanosomes elicit the spliced leader silencing (SLS pathway. In SLS, the transcription of the SL RNA gene is extinguished, and tSNAP42, a specific SL RNA transcription factor, fails to bind to its cognate promoter. SLS leads to complete shut-off of trans-splicing. In this review, I discuss the UPR in mammals and compare it to the ER stress response in T. brucei leading to SLS. I summarize the evidence supporting the notion that SLS is a programmed cell death (PCD pathway that is utilized by the parasites to substitute for the apoptosis observed in higher eukaryotes under prolonged ER stress. I present the hypothesis that SLS evolved to expedite the death process, and rapidly remove from the population unfit parasites that, by elimination via SLS, cause minimal damage to the parasite population.

  9. [Small interfering RNA-mediated COX-2 gene silencing enhances chemosensitivity of KB/VCR cells by suppressing MDR-1 gene expression and P-glycoprotein activity].

    Science.gov (United States)

    Mo, Xianchao; Li, Weizhong

    2014-05-01

    To investigate the effect of small interfering RNA (siRNA)-mediated COX-2 gene silencing in enhancing the chemosensitivity of KB/VCR cell lines. KB/VCR cells were trasnfected with COX-2 siRNA were examined for expressions of COX-2 and MDR-1 mRNAs with RT-PCR and for Rho-123 accumulation using flow cytometry. MTT assay was used to analyze the proliferation of the transfected KB/VCR cells. Compared with the negative and blank control groups, COX-2 siRNA transfection resulted in significant growth inhibition of KB/VCR cells exposed to vincristine (PKB/VCR cells. COX-2 gene silencing can enhance the chemosensitivity of KB/VCR cells to vincristine, the mechanism of which may involve down-regulated MDR-1 gene expression and inhibition of P-glycoprotein activity.

  10. Characterization of white shrimp Litopenaeus vannamei integrin β and its role in immunomodulation by dsRNA-mediated gene silencing.

    Science.gov (United States)

    Lin, Yong-Chin; Chen, Jiann-Chu; Chen, Yu-Yuan; Liu, Chun-Hung; Cheng, Winton; Hsu, Chih-Hung; Tsui, Wen-Ching

    2013-06-01

    The full sequence of white shrimp Litopenaeus vannamei integrin β (LV-B) is 2879bp which encodes 787 amino acids (aa) of the open reading frame (ORF). The mature protein (764 aa) contains (1) an extracellular domain (ED) of 692 aa, (2) a transmembrane domain (TD) of 23 aa, and (3) a cytoplasmic domain (CD) of 49 aa. The cloned LV-B grouped together with crayfish Pacifastacus leniusculus integrin β (PL-B1), but was far away from vertebrate integrin β1, β3, β5, β6, β7, and β8, and another L. vannamei integrin β (LV). A Southern blot analysis indicated that the cloned LV-B was a single copy of genomic DNA. LV-B mRNA was expressed in all tissues, and was highly expressed in haemocytes. LV-B was downregulated in shrimp 24 and 96h after having received white spot syndrome virus (WSSV). LV-B expression by haemocytes of shrimp was higher in the postmoult (A and B) stage, and lower in the premoult (D2/D3) stage. LV-B expression was significantly higher by shrimp reared in 2.5‰ and 5‰ salinities. Shrimp injected with integrin β dsRNA showed gene silencing of integrin β after 36h. LV-B-silenced shrimp showed decreased hyaline cells (HCs), granular cells (GCs, including semi-granular cells), the total haemocyte count (THC), respiratory bursts (RBs), and lysozyme activity, but showed increased RB/HC, superoxide dismutase (SOD) activity/HC, and the phenoloxidase (PO) activity/GC. LV-B-silenced shrimp showed upregulated expressions of lipopolysaccharide- and β-glucan-binding protein (LGBP), peroxinectin (PX), prophenoloxidase I (proPO I), proPO II, proPO-activating enzyme (ppA), α2-macroglobulin (α2-M), cytMnSOD, mtMnSOD, and heat shock protein 70 (HSP70). It was concluded that integrin β plays important roles in proPO activation, phagocytosis, and the antioxidant system for immunomodulation in shrimp. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. Interferência por RNA: uma nova alternativa para terapia nas doenças reumáticas RNA interference: a new alternative for rheumatic diseases therapy

    Directory of Open Access Journals (Sweden)

    Natália Regine de França

    2010-12-01

    Full Text Available A interferência por RNA (RNAi é um mecanismo de silenciamento gênico pós-transcricional conservado durante a evolução. Esse mecanismo, recentemente descrito, é mediado por pequenos RNAs de fita dupla (dsRNAs capazes de reconhecer especificamente uma sequência de mRNA-alvo e mediar sua clivagem ou repressão traducional. O emprego da RNAi como uma ferramenta de terapia gênica tem sido muito estudado, especialmente em infecções virais, câncer, desordens genéticas herdadas, doenças cardiovasculares e mesmo em doenças reumáticas. Aliados aos dados do genoma humano, os conhecimentos do silenciamento gênico mediado por RNAi podem permitir a determinação funcional de praticamente qualquer gene expresso em uma célula e sua implicação para o funcionamento e homeostase celular. Vários estudos terapêuticos in vitro e in vivo em modelos de doenças autoimunes vêm sendo realizados com resultados encorajadores. As vias de quebra de tolerância e inflamação são alvos potenciais para terapia com RNAi em doenças inflamatórias e autoimunes. Nesta revisão vamos recordar os princípios básicos da RNAi e discutir os aspectos que levaram ao desenvolvimento de propostas terapêuticas baseadas em RNAi, começando pelos estudos in vitro de desenvolvimento de ferramentas e identificação de alvos, chegando até os estudos pré-clínicos de disponibilização da droga in vivo, e testes em células humanas e modelos animais de doenças autoimunes. Por fim, vamos revisar os últimos avanços da experiência clínica da terapia com RNAiRNA interference (RNAi is a post-transcriptional gene silencing mechanism preserved during evolution. This mechanism, recently described, is mediated by small double-stranded RNAs (dsRNAs that can specifically recognize a target mRNA sequence and mediate its cleavage or translational repression. The use of RNAi as a tool for gene therapy has been extensively studied, especially in viral infections, cancer

  12. Analysis of Tomato spotted wilt virus NSs protein indicates the importance of the N-terminal for avirulence and RNA silencing suppression

    NARCIS (Netherlands)

    Ronde, de D.; Pasquier, A.; Ying, S.; Butterbach, P.B.E.; Lohuis, D.; Kormelink, R.J.M.

    2014-01-01

    Recently, Tomato spotted wilt virus (TSWV) nonstructural protein NSs has been identified unambiguously as an avirulence (Avr) determinant for Tomato spotted wilt (Tsw)-based resistance. The observation that NSs from two natural resistance-breaking isolates had lost RNA silencing suppressor (RSS)

  13. Phenotypic silencing of cytoplasmic genes using sequence-specific double-stranded short interfering RNA and its application in the reverse genetics of wild type negative-strand RNA viruses

    Directory of Open Access Journals (Sweden)

    Barik Sailen

    2001-12-01

    Full Text Available Abstract Background Post-transcriptional gene silencing (PTGS by short interfering RNA has opened up new directions in the phenotypic mutation of cellular genes. However, its efficacy on non-nuclear genes and its effect on the interferon pathway remain unexplored. Since directed mutation of RNA genomes is not possible through conventional mutagenesis, we have tested sequence-specific 21-nucleotide long double-stranded RNAs (dsRNAs for their ability to silence cytoplasmic RNA genomes. Results Short dsRNAs were generated against specific mRNAs of respiratory syncytial virus, a nonsegmented negative-stranded RNA virus with a cytoplasmic life cycle. At nanomolar concentrations, the dsRNAs specifically abrogated expression of the corresponding viral proteins, and produced the expected mutant phenotype ex vivo. The dsRNAs did not induce an interferon response, and did not inhibit cellular gene expression. The ablation of the viral proteins correlated with the loss of the specific mRNAs. In contrast, viral genomic and antigenomic RNA, which are encapsidated, were not directly affected. Conclusions Synthetic inhibitory dsRNAs are effective in specific silencing of RNA genomes that are exclusively cytoplasmic and transcribed by RNA-dependent RNA polymerases. RNA-directed RNA gene silencing does not require cloning, expression, and mutagenesis of viral cDNA, and thus, will allow the generation of phenotypic null mutants of specific RNA viral genes under normal infection conditions and at any point in the infection cycle. This will, for the first time, permit functional genomic studies, attenuated infections, reverse genetic analysis, and studies of host-virus signaling pathways using a wild type RNA virus, unencumbered by any superinfecting virus.

  14. Shortcomings of short hairpin RNA-based transgenic RNA interference in mouse oocytes

    Czech Academy of Sciences Publication Activity Database

    Sarnová, Lenka; Malík, Radek; Sedláček, Radislav; Svoboda, Petr

    2010-01-01

    Roč. 9, č. 8 (2010), s. 1-10 ISSN 1477-5751 R&D Project s: GA MŠk ME09039 Grant - others:EMBO SDIG(DE) project 1483 Institutional research plan: CEZ:AV0Z50520514 Keywords : transgenic RNAi * shRNA * oocyte Subject RIV: EB - Genetics ; Molecular Biology http://www.jnrbm.com/content/9/1/8

  15. Shortcomings of short hairpin RNA-based transgenic RNA interference in mouse oocytes

    Czech Academy of Sciences Publication Activity Database

    Sarnová, Lenka; Malík, Radek; Sedláček, Radislav; Svoboda, Petr

    2010-01-01

    Roč. 9, č. 8 (2010), s. 1-10 ISSN 1477-5751 R&D Projects: GA MŠk ME09039 Grant - others:EMBO SDIG(DE) project 1483 Institutional research plan: CEZ:AV0Z50520514 Keywords : transgenic RNAi * shRNA * oocyte Subject RIV: EB - Genetics ; Molecular Biology http://www.jnrbm.com/content/9/1/8

  16. Non-Target Effects of Green Fluorescent Protein (GFP-Derived Double-Stranded RNA (dsRNA-GFP Used in Honey Bee RNA Interference (RNAi Assays

    Directory of Open Access Journals (Sweden)

    Francis M. F. Nunes

    2013-01-01

    Full Text Available RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP-derived double-stranded RNA (dsRNA-GFP is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control.

  17. Non-Target Effects of Green Fluorescent Protein (GFP)-Derived Double-Stranded RNA (dsRNA-GFP) Used in Honey Bee RNA Interference (RNAi) Assays.

    Science.gov (United States)

    Nunes, Francis M F; Aleixo, Aline C; Barchuk, Angel R; Bomtorin, Ana D; Grozinger, Christina M; Simões, Zilá L P

    2013-01-04

    RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control.

  18. Combination of siRNA-directed Kras oncogene silencing and arsenic-induced apoptosis using a nanomedicine strategy for the effective treatment of pancreatic cancer.

    Science.gov (United States)

    Zeng, Linjuan; Li, Jingguo; Wang, Yong; Qian, Chenchen; Chen, Yinting; Zhang, Qiubo; Wu, Wei; Lin, Zhong; Liang, Jianzhong; Shuai, Xintao; Huang, Kaihong

    2014-02-01

    The synergetic inhibitory effects on human pancreatic cancer by nanoparticle-mediated siRNA and arsenic therapy were investigated both in vitro and in vivo. Poly(ethylene glycol)-block-poly(L-lysine) were prepared to form siRNA-complexed polyplex and poly(ethylene glycol)-block-poly(DL-lactide) were prepared to form arsenic-encapsulated vesicle, respectively. Down-regulation of the mutant Kras gene by siRNA caused defective abilities of proliferation, clonal formation, migration, and invasion of pancreatic cancer cells, as well as cell cycle arrest at the G0/G1 phase, which substantially enhanced the apoptosis-inducing effect of arsenic administration. Consequently, co-administration of the two nanomedicines encapsulating siRNA or arsenic showed ideal tumor growth inhibition both in vitro and in vivo as a result of synergistic effect of the siRNA-directed Kras oncogene silencing and arsenic-induced cell apoptosis. These results suggest that the combination of mutant Kras gene silencing and arsenic therapy using nanoparticle-mediated delivery strategy is promising for pancreatic cancer treatment. Treatment of pancreatic cancer remains a major challenge. These authors demonstrate a method that combines a siRNA-based Kras silencing with arsenic delivery to pancreatic cancer cells using nanoparticles, resulting in enhanced apoptosis induction in the treated cells. © 2013.

  19. A long noncoding RNA contributes to neuropathic pain by silencing Kcna2 in primary afferent neurons

    Science.gov (United States)

    Zhao, Xiuli; Tang, Zongxiang; Zhang, Hongkang; Atianjoh, Fidelis E.; Zhao, Jian-Yuan; Liang, Lingli; Wang, Wei; Guan, Xiaowei; Kao, Sheng-Chin; Tiwari, Vinod; Gao, Yong-Jing; Hoffman, Paul N.; Cui, Hengmi; Li, Min; Dong, Xinzhong; Tao, Yuan-Xiang

    2013-01-01

    Neuropathic pain is a refractory disease characterized by maladaptive changes in gene transcription and translation within the sensory pathway. Long noncoding RNAs (lncRNAs) are emerging as new players in gene regulation, but how lncRNAs operate in the development of neuropathic pain is unclear. Here we identify a conserved lncRNA for Kcna2 (named Kcna2 antisense RNA) in first-order sensory neurons of rat dorsal root ganglion (DRG). Peripheral nerve injury increases Kcna2 antisense RNA expression in injured DRG through activation of myeloid zinc finger protein 1, a transcription factor that binds to Kcna2 antisense RNA gene promoter. Mimicking this increase downregulates Kcna2, reduces total Kv current, increases excitability in DRG neurons, and produces neuropathic pain symptoms. Blocking this increase reverses nerve injury-induced downregulation of DRG Kcna2 and attenuates development and maintenance of neuropathic pain. These findings suggest native Kcna2 antisense RNA as a new therapeutic target for the treatment of neuropathic pain. PMID:23792947

  20. Strengthening Triterpene Saponins Biosynthesis by Over-Expression of Farnesyl Pyrophosphate Synthase Gene and RNA Interference of Cycloartenol Synthase Gene in Panax notoginseng Cells

    Directory of Open Access Journals (Sweden)

    Yan Yang

    2017-04-01

    Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.

  1. Identification of chemosensory receptor genes in Manduca sexta and knockdown by RNA interference

    Directory of Open Access Journals (Sweden)

    Howlett Natalie

    2012-05-01

    Full Text Available Abstract Background Insects detect environmental chemicals via a large and rapidly evolving family of chemosensory receptor proteins. Although our understanding of the molecular genetic basis for Drosophila chemoreception has increased enormously in the last decade, similar understanding in other insects remains limited. The tobacco hornworm, Manduca sexta, has long been an important model for insect chemosensation, particularly from ecological, behavioral, and physiological standpoints. It is also a major agricultural pest on solanaceous crops. However, little sequence information and lack of genetic tools has prevented molecular genetic analysis in this species. The ability to connect molecular genetic mechanisms, including potential lineage-specific changes in chemosensory genes, to ecologically relevant behaviors and specializations in M. sexta would be greatly beneficial. Results Here, we sequenced transcriptomes from adult and larval chemosensory tissues and identified chemosensory genes based on sequence homology. We also used dsRNA feeding as a method to induce RNA interference in larval chemosensory tissues. Conclusions We report identification of new chemosensory receptor genes including 17 novel odorant receptors and one novel gustatory receptor. Further, we demonstrate that systemic RNA interference can be used in larval olfactory neurons to reduce expression of chemosensory receptor transcripts. Together, our results further the development of M. sexta as a model for functional analysis of insect chemosensation.

  2. Synaptotagmin 11 interacts with components of the RNA-induced silencing complex RISC in clonal pancreatic β-cells.

    Science.gov (United States)

    Milochau, Alexandra; Lagrée, Valérie; Benassy, Marie-Noëlle; Chaignepain, Stéphane; Papin, Julien; Garcia-Arcos, Itsaso; Lajoix, Anne; Monterrat, Carole; Coudert, Laetitia; Schmitter, Jean-Marie; Ochoa, Begoña; Lang, Jochen

    2014-06-27

    Synaptotagmins are two C2 domain-containing transmembrane proteins. The function of calcium-sensitive members in the regulation of post-Golgi traffic has been well established whereas little is known about the calcium-insensitive isoforms constituting half of the protein family. Novel binding partners of synaptotagmin 11 were identified in β-cells. A number of them had been assigned previously to ER/Golgi derived-vesicles or linked to RNA synthesis, translation and processing. Whereas the C2A domain interacted with the Q-SNARE Vti1a, the C2B domain of syt11 interacted with the SND1, Ago2 and FMRP, components of the RNA-induced silencing complex (RISC). Binding to SND was direct via its N-terminal tandem repeats. Our data indicate that syt11 may provide a link between gene regulation by microRNAs and membrane traffic. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  3. Arabidopsis RNA Polymerase V Mediates Enhanced Compaction and Silencing of Geminivirus and Transposon Chromatin during Host Recovery from Infection.

    Science.gov (United States)

    Coursey, Tami; Regedanz, Elizabeth; Bisaro, David M

    2018-04-01

    Plants employ RNA-directed DNA methylation (RdDM) and dimethylation of histone 3 lysine 9 (H3K9me2) to silence geminiviruses and transposable elements (TEs). We previously showed that canonical RdDM (Pol IV-RdDM) involving RNA polymerases IV and V (Pol IV and Pol V) is required for Arabidopsis thaliana to recover from infection with Beet curly top virus lacking a suppressor protein that inhibits methylation (BCTV L2 - ). Recovery, which is characterized by reduced viral DNA levels and symptom remission, allows normal floral development. Here, we used formaldehyde-assisted isolation of regulatory elements (FAIRE) to confirm that >90% of BCTV L2 - chromatin is highly compacted during recovery, and a micrococcal nuclease-chromatin immunoprecipitation assay showed that this is largely due to increased nucleosome occupancy. Physical compaction correlated with augmented cytosine and H3K9 methylation and with reduced viral gene expression. We additionally demonstrated that these phenomena are dependent on Pol V and by extension the Pol IV-RdDM pathway. BCTV L2 - was also used to evaluate the impact of viral infection on host loci, including repressed retrotransposons Ta3 and Athila6A Remarkably, an unexpected Pol V-dependent hypersuppression of these TEs was observed, resulting in transcript levels even lower than those detected in uninfected plants. Hypersuppression is likely to be especially important for natural recovery from wild-type geminiviruses, as viral L2 and AL2 proteins cause ectopic TE expression. Thus, Pol IV-RdDM targets both viral and TE chromatin during recovery, simultaneously silencing the majority of viral genomes and maintaining host genome integrity by enforcing tighter control of TEs in future reproductive tissues. IMPORTANCE In plants, RdDM pathways use small RNAs to target cytosine and H3K9 methylation, thereby silencing DNA virus genomes and transposable elements (TEs). Further, Pol IV-RdDM involving Pol IV and Pol V is a key aspect of host

  4. Short-hairpin RNA-mediated stable silencing of Grb2 impairs cell growth and DNA synthesis

    International Nuclear Information System (INIS)

    Di Fulvio, Mauricio; Henkels, Karen M.; Gomez-Cambronero, Julian

    2007-01-01

    Grb2 is an SH2-SH3 protein adaptor responsible for linking growth factor receptors with intracellular signaling cascades. To study the role of Grb2 in cell growth, we have generated a new COS7 cell line (COS7 shGrb2 ), based on RNAi technology, as null mutations in mammalian Grb2 genes are lethal in early development. This novel cell line continuously expresses a short hairpin RNA that targets endogenous Grb2. Stable COS7 shGrb2 cells had the shGrb2 integrated into the genomic DNA and carried on SiL construct (made refractory to the shRNA-mediated interference), but not with an SH2-deficient mutant (R86K). Thus, a viable knock-down and rescue protocol has demonstrated that Grb2 is crucial for cell proliferation

  5. Robust RNA silencing-mediated resistance to Plum pox virus under variable abiotic and biotic conditions.

    Science.gov (United States)

    Di Nicola, Elisa; Tavazza, Mario; Lucioli, Alessandra; Salandri, Laura; Ilardi, Vincenza

    2014-10-01

    Some abiotic and biotic conditions are known to have a negative impact on post-transcriptional gene silencing (PTGS), thus representing a potential concern for the production of stable engineered virus resistance traits. However, depending on the strategy followed to achieve PTGS of the transgene, different responses to external conditions can be expected. In the present study, we utilized the Nicotiana benthamiana–Plum pox virus (PPV) pathosystem to evaluate in detail the stability of intron-hairpin(ihp)-mediated virus resistance under conditions known to adversely affect PTGS. The ihp plants grown at low or high temperatures were fully resistant to multiple PPV challenges, different PPV inoculum concentrations and even to a PPV isolate differing from the ihp construct by more than 28% at the nucleotide level. In addition, infections of ihp plants with viruses belonging to Cucumovirus, Potyvirus or Tombusvirus, all known to affect PTGS at different steps, were not able to defeat PPV resistance. Low temperatures did not affect the accumulation of transgenic small interfering RNAs (siRNAs), whereas a clear increase in the amount of siRNAs was observed during infections sustained by Cucumber mosaic virus and Potato virus Y. Our results show that the above stress factors do not represent an important concern for the production,through ihp-PTGS technology, of transgenic plants having robust virus resistance traits.

  6. Exonuclease-mediated degradation of nascent RNA silences genes linked to severe malaria

    DEFF Research Database (Denmark)

    Zhang, Qingfeng; Siegel, T Nicolai; Martins, Rafael M

    2014-01-01

    -coding RNA. The presence of stable upsA var transcripts overcomes monoallelic expression, resulting in the simultaneous expression of both upsA and upsC type PfEMP1 proteins on the surface of individual infected red blood cells. In addition, we observe an inverse relationship between transcript levels of Pf...

  7. Influence of silencing the MC4R gene by lentivirusmediated RNA ...

    African Journals Online (AJOL)

    Melanocortin receptor 4 (MC4R) is a key element in the mechanisms used to regulate both aspects of keeping the balance between energy uptake and energy expenditure. MC4R was knocked down by lentivirus-mediated shRNA expressing plasmids, which were controlled by the U6 promoter in bovine fibroblast cells, and ...

  8. Gene Silencing in Adult Aedes aegypti Mosquitoes Through Oral Delivery of Double-Stranded RNA

    Science.gov (United States)

    2012-01-01

    able to reduce resistance to permethrin in Plutella xylostella. To develop dsRNA as a means of population con- trol of mosquitoes, either alone or in...diamondback moth, Plutella xylostella, reduces larval resistance to permethrin. Insect Biochem. Mol. Biol. 39, 38–46. Blandin S, Moita LF, Kocher T, Wilm M

  9. Novel targeted therapy for neuroblastoma: silencing the MXD3 gene using siRNA.

    Science.gov (United States)

    Duong, Connie; Yoshida, Sakiko; Chen, Cathy; Barisone, Gustavo; Diaz, Elva; Li, Yueju; Beckett, Laurel; Chung, Jong; Antony, Reuben; Nolta, Jan; Nitin, Nitin; Satake, Noriko

    2017-09-01

    BackgroundNeuroblastoma is the second most common extracranial cancer in children. Current therapies for neuroblastoma, which use a combination of chemotherapy drugs, have limitations for high-risk subtypes and can cause significant long-term adverse effects in young patients. Therefore, a new therapy is needed. In this study, we investigated the transcription factor MXD3 as a potential therapeutic target in neuroblastoma.MethodsMXD3 expression was analyzed in five neuroblastoma cell lines by immunocytochemistry and quantitative real-time reverse transcription PCR, and in 18 primary patient tumor samples by immunohistochemistry. We developed nanocomplexes using siRNA and superparamagnetic iron oxide nanoparticles to target MXD3 in neuroblastoma cell lines in vitro as a single-agent therapeutic and in combination with doxorubicin, vincristine, cisplatin, or maphosphamide-common drugs used in current neuroblastoma treatment.ResultsMXD3 was highly expressed in neuroblastoma cell lines and in patient tumors that had high-risk features. Neuroblastoma cells treated in vitro with the MXD3 siRNA nanocomplexes showed MXD3 protein knockdown and resulted in cell apoptosis. Furthermore, on combining MXD3 siRNA nanocomplexes with each of the four drugs, all showed additive efficacy.ConclusionThese results indicate that MXD3 is a potential new target and that the use of MXD3 siRNA nanocomplexes is a novel therapeutic approach for neuroblastoma.

  10. APC/C-mediated degradation of dsRNA-binding protein 4 (DRB4 involved in RNA silencing.

    Directory of Open Access Journals (Sweden)

    Katia Marrocco

    Full Text Available Selective protein degradation via the ubiquitin-26S proteasome is a major mechanism underlying DNA replication and cell division in all Eukaryotes. In particular, the APC/C (Anaphase Promoting Complex or Cyclosome is a master ubiquitin protein ligase (E3 that targets regulatory proteins for degradation allowing sister chromatid separation and exit from mitosis. Interestingly, recent work also indicates that the APC/C remains active in differentiated animal and plant cells. However, its role in post-mitotic cells remains elusive and only a few substrates have been characterized.In order to identify novel APC/C substrates, we performed a yeast two-hybrid screen using as the bait Arabidopsis APC10/DOC1, one core subunit of the APC/C, which is required for substrate recruitment. This screen identified DRB4, a double-stranded RNA binding protein involved in the biogenesis of different classes of small RNA (sRNA. This protein interaction was further confirmed in vitro and in plant cells. Moreover, APC10 interacts with DRB4 through the second dsRNA binding motif (dsRBD2 of DRB4, which is also required for its homodimerization and binding to its Dicer partner DCL4. We further showed that DRB4 protein accumulates when the proteasome is inactivated and, most importantly, we found that DRB4 stability depends on APC/C activity. Hence, depletion of Arabidopsis APC/C activity by RNAi leads to a strong accumulation of endogenous DRB4, far beyond its normal level of accumulation. However, we could not detect any defects in sRNA production in lines where DRB4 was overexpressed.Our work identified a first plant substrate of the APC/C, which is not a regulator of the cell cycle. Though we cannot exclude that APC/C-dependent degradation of DRB4 has some regulatory roles under specific growth conditions, our work rather points to a housekeeping function of APC/C in maintaining precise cellular-protein concentrations and homeostasis of DRB4.

  11. RNA interference-based therapeutics for human immunodeficiency virus HIV-1 treatment: synthetic siRNA or vector-based shRNA?

    Science.gov (United States)

    Subramanya, Sandesh; Kim, Sang-Soo; Manjunath, N; Shankar, Premlata

    2010-02-01

    Despite the clinical benefits of highly active antiretroviral therapy (HAART), the prospect of life-long antiretroviral treatment poses significant problems, which has spurred interest in developing new drugs and strategies to treat HIV infection and eliminate persistent viral reservoirs. RNAi has emerged as a therapeutic possibility for HIV. We discuss progress in overcoming hurdles to translating transient and stable RNAi enabling technologies to clinical application for HIV; covering the past 2 - 3 years. HIV inhibition can be achieved by transfection of chemically or enzymatically synthesized siRNAs or by DNA-based vector systems expressing short hairpin RNAs (shRNAs) that are processed intracellularly into siRNA. We compare these approaches, focusing on technical and safety issues that will guide the choice of strategy for clinical use. Introduction of synthetic siRNA into cells or its stable endogenous production using vector-driven shRNA have been shown to suppress HIV replication in vitro and, in some instances, in vivo. Each method has advantages and limitations in terms of ease of delivery, duration of silencing, emergence of escape mutants and potential toxicity. Both appear to have potential as future therapeutics for HIV, once the technical and safety issues of each approach are overcome.

  12. Reversal of pathology in CHMP2B-mediated frontotemporal dementia patient cells using RNA interference

    DEFF Research Database (Denmark)

    Nielsen, Troels Tolstrup; Mizielinska, Sarah; Hasholt, Lis

    2012-01-01

    role in the pathogenesis of the disease. METHODS: In the present study, we used lentiviral vectors to efficiently knockdown CHMP2B by delivering microRNA embedded small hairpin RNAs. RESULTS: We show that CHMP2B can be efficiently knocked down in patient fibroblasts using an RNA interference approach......BACKGROUND: Frontotemporal dementia is the second most common form of young-onset dementia after Alzheimer's disease, and several genetic forms of frontotemporal dementia are known. A rare genetic variant is caused by a point mutation in the CHMP2B gene. CHMP2B is a component of the ESCRT......-III complex, which is involved in endosomal trafficking of proteins targeted for degradation in lysosomes. Mutations in CHMP2B result in abnormal endosomal structures in patient fibroblasts and patient brains, probably through a gain-of-function mechanism, suggesting that the endosomal pathway plays a central...

  13. A fast, simple method for screening radiation susceptibility genes by RNA interference

    International Nuclear Information System (INIS)

    Tsuji, Atsushi B.; Sudo, Hitomi; Sugyo, Aya; Otsuki, Marika; Miyagishi, Makoto; Taira, Kazunari; Imai, Takashi; Harada, Yoshi-nobu

    2005-01-01

    Radiotherapy can cause unacceptable levels of damage to normal tissues in some cancer patients. To understand the molecular mechanisms underlying radiation-induced physiological responses, and to be able to predict the radiation susceptibility of normal tissues in individual patients, it is important to identify a comprehensive set of genes responsible for radiation susceptibility. We have developed a simple and rapid 96-well screening protocol using cell proliferation assays and RNA interference to identify genes associated with radiation susceptibility. We evaluated the performance of alamarBlue-, BrdU-, and sulforhodamine B-based cell proliferation assays using the 96-well format. Each proliferation assay detected the known radiation susceptibility gene, PRKDC. In a trial screen using 28 shRNA vectors, another known gene, CDKN1A, and one new radiation susceptibility gene, ATP5G3, were identified. Our results indicate that this method may be useful for large-scale screens designed to identify novel radiation susceptibility genes

  14. In vivo silencing of alpha-synuclein using naked siRNA

    OpenAIRE

    Charisse Klaus; Toudjarska Ivanka; Kent Caroline; Hinkle Kelly; Ogholikhan Sina; He Zhen; Braithwaite Adam; Lincoln Sarah; Zehr Cynthia; Hope Andrew; Bumcrot David; Melrose Heather; Lewis Jada; Braich Ravi; Pandey Rajendra K

    2008-01-01

    Abstract Background Overexpression of α-synuclein (SNCA) in families with multiplication mutations causes parkinsonism and subsequent dementia, characterized by diffuse Lewy Body disease post-mortem. Genetic variability in SNCA contributes to risk of idiopathic Parkinson's disease (PD), possibly as a result of overexpression. SNCA downregulation is therefore a valid therapeutic target for PD. Results We have identified human and murine-specific siRNA molecules which reduce SNCA in vitro. As a...

  15. Transitive RNA silencing signals induce cytosine methylation of a transgenic but not an endogenous target

    Czech Academy of Sciences Publication Activity Database

    Vermeersch, L.; De Winne, N.; Nolf, J.; Bleys, A.; Kovařík, Aleš; Depicker, A.

    2013-01-01

    Roč. 74, č. 5 (2013), s. 867-879 ISSN 0960-7412 R&D Projects: GA ČR GBP501/12/G090 Institutional research plan: CEZ:AV0Z50040702 Institutional support: RVO:68081707 Keywords : DIRECTED DNA METHYLATION * POTATO-VIRUS-X * DOUBLE-STRANDED-RNA Subject RIV: BO - Biophysics Impact factor: 6.815, year: 2013

  16. Tumor-specific RNA interference targeting Pokemon suppresses tumor growth and induces apoptosis in prostate cancer.

    Science.gov (United States)

    Li, Yining; Xu, Shuxiong; Wang, Xiangwei; Shi, Hua; Sun, Zhaolin; Yang, Zhao

    2013-02-01

    To explore the exact mechanism of Pokemon in prostate cancer. Pokemon is a member of the POK family of transcriptional repressors. Its main function is suppression of the p14ARF (alternate reading frame) tumor suppressor gene. Although Pokemon expression has been found to be increased in various types of lymphoma, the exact mechanism of the gene in prostate cancer is not clear. In the present study, prostate cancer cells were transfected with the specific short hairpin ribonucleic acid (RNA) expression vector targeting Pokemon. The expression of Pokemon messenger RNA and its protein was detected by semiquantitative reverse transcriptase-polymerase chain reaction and Western blotting, respectively. The cell growth and cell apoptosis were also examined using the methyl thiazolyl tetrazolium assay and flow cytometry. The results demonstrated that specific RNA interference (RNAi) could decrease the expression levels of Pokemon gene messenger RNA and protein in prostate cancer cells. In addition, that specific RNAi significantly inhibited the cell proliferation and increased the apoptotic rate. In vivo experiments showed that specific RNAi inhibited the tumorigenicity of prostate cancer cells and significantly suppressed tumor growth. Therefore, an RNAi-targeted Pokemon gene strategy could be a potential approach to prostate cancer therapy. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Functional regulation of RNA-induced silencing complex by photoreactive oligonucleotides.

    Science.gov (United States)

    Matsuyama, Yohei; Yamayoshi, Asako; Kobori, Akio; Murakami, Akira

    2014-02-01

    We developed a novel method for regulation of RISC function by photoreactive oligonucleotides (Ps-Oligo) containing 2'-O-psoralenylmethoxyethyl adenosine (Aps). We observed that inhibitory effects of Ps-Oligos on RISC function were enhanced by UV-irradiation compared with 2'-O-methyl-oligonucleotide without Aps. These results suggest Ps-Oligo inhibited RISC function by cross-linking effect, and we propose that the concept described in this report may be promising and applicable one to regulate the small RNA-mediated post-transcriptional regulation. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  18. A large-scale RNA interference screen identifies genes that regulate autophagy at different stages.

    Science.gov (United States)

    Guo, Sujuan; Pridham, Kevin J; Virbasius, Ching-Man; He, Bin; Zhang, Liqing; Varmark, Hanne; Green, Michael R; Sheng, Zhi

    2018-02-12

    Dysregulated autophagy is central to the pathogenesis and therapeutic development of cancer. However, how autophagy is regulated in cancer is not well understood and genes that modulate cancer autophagy are not fully defined. To gain more insights into autophagy regulation in cancer, we performed a large-scale RNA interference screen in K562 human chronic myeloid leukemia cells using monodansylcadaverine staining, an autophagy-detecting approach equivalent to immunoblotting of the autophagy marker LC3B or fluorescence microscopy of GFP-LC3B. By coupling monodansylcadaverine staining with fluorescence-activated cell sorting, we successfully isolated autophagic K562 cells where we identified 336 short hairpin RNAs. After candidate validation using Cyto-ID fluorescence spectrophotometry, LC3B immunoblotting, and quantitative RT-PCR, 82 genes were identified as autophagy-regulating genes. 20 genes have been reported previously and the remaining 62 candidates are novel autophagy mediators. Bioinformatic analyses revealed that most candidate genes were involved in molecular pathways regulating autophagy, rather than directly participating in the autophagy process. Further autophagy flux assays revealed that 57 autophagy-regulating genes suppressed autophagy initiation, whereas 21 candidates promoted autophagy maturation. Our RNA interference screen identifies identified genes that regulate autophagy at different stages, which helps decode autophagy regulation in cancer and offers novel avenues to develop autophagy-related therapies for cancer.

  19. Structure of the Cmr2 Subunit of the CRISPR-Cas RNA Silencing Complex

    Energy Technology Data Exchange (ETDEWEB)

    Cocozaki, Alexis I.; Ramia, Nancy F.; Shao, Yaming; Hale, Caryn R.; Terns, Rebecca M.; Terns, Michael P.; Li, Hong (FSU); (Georgia)

    2012-08-10

    Cmr2 is the largest and an essential subunit of a CRISPR RNA-Cas protein complex (the Cmr complex) that cleaves foreign RNA to protect prokaryotes from invading genetic elements. Cmr2 is thought to be the catalytic subunit of the effector complex because of its N-terminal HD nuclease domain. Here, however, we report that the HD domain of Cmr2 is not required for cleavage by the complex in vitro. The 2.3 {angstrom} crystal structure of Pyrococcus furiosus Cmr2 (lacking the HD domain) reveals two adenylyl cyclase-like and two {alpha}-helical domains. The adenylyl cyclase-like domains are arranged as in homodimeric adenylyl cyclases and bind ADP and divalent metals. However, mutagenesis studies show that the metal- and ADP-coordinating residues of Cmr2 are also not critical for cleavage by the complex. Our findings suggest that another component provides the catalytic function and that the essential role by Cmr2 does not require the identified ADP- or metal-binding or HD domains in vitro.

  20. Inhalable delivery of AAV-based MRP4/ABCC4 silencing RNA prevents monocrotaline-induced pulmonary hypertension

    Directory of Open Access Journals (Sweden)

    Caroline Claude

    Full Text Available The ATP-binding cassette transporter MRP4 (encoded by ABCC4 regulates membrane cyclic nucleotides concentrations in arterial cells including smooth muscle cells. MRP4/ABCC4 deficient mice display a reduction in smooth muscle cells proliferation and a prevention of pulmonary hypertension in response to hypoxia. We aimed to study gene transfer of a MRP4/ABCC4 silencing RNA via intratracheal delivery of aerosolized adeno-associated virus 1 (AAV1.shMRP4 or AAV1.control in a monocrotaline-induced model of pulmonary hypertension in rats. Gene transfer was performed at the time of monocrotaline administration and the effect on the development of pulmonary vascular remodeling was assessed 35 days later. AAV1.shMRP4 dose-dependently reduced right ventricular systolic pressure and hypertrophy with a significant reduction with the higher doses (i.e., >1011 DRP/animal as compared to AAV1.control. The higher dose of AAV1.shMRP4 was also associated with a significant reduction in distal pulmonary arteries remodeling. AAV1.shMRP4 was finally associated with a reduction in the expression of ANF, a marker of cardiac hypertrophy. Collectively, these results support a therapeutic potential for downregulation of MRP4 for the treatment of pulmonary artery hypertension.

  1. Allele-specific Gene Silencing of Mutant mRNA Restores Cellular Function in Ullrich Congenital Muscular Dystrophy Fibroblasts

    Directory of Open Access Journals (Sweden)

    Satoru Noguchi

    2014-01-01

    Full Text Available Ullrich congenital muscular dystrophy (UCMD is an inherited muscle disorder characterized clinically by muscle weakness, distal joint hyperlaxity, and proximal joint contractures. Sporadic and recessive mutations in the three collagen VI genes, COL6A1, COL6A2, and COL6A3, are reported to be causative. In the sporadic forms, a heterozygous point mutation causing glycine substitution in the triple helical domain has been identified in higher rate. In this study, we examined the efficacy of siRNAs, which target point mutation site, on specific knockdown toward transcripts from mutant allele and evaluated consequent cellular phenotype of UCMD fibroblasts. We evaluated the effect of siRNAs targeted to silence-specific COL6A1 alleles in UCMD fibroblasts, where simultaneous expression of both wild-type and mutant collagen VI resulted in defective collagen localization. Addition of mutant-specific siRNAs allowed normal extracellular localization of collagen VI surrounding fibroblasts, suggesting selective inhibition of mutant collagen VI. Targeting the single-nucleotide COL6A1 c.850G>A (p.G284R mutation responsible a sporadic autosomal dominant form of UCMD can potently and selectively block expression of mutant collagen VI. These results suggest that allele-specific knockdown of the mutant mRNA can potentially be considered as a therapeutic procedure in UCMD due to COL6A1 point mutations.

  2. shRNA-mediated EMMPRIN silencing inhibits human leukemic monocyte lymphoma U937 cell proliferation and increases chemosensitivity to adriamycin.

    Science.gov (United States)

    Gao, Hui; Jiang, Qixiao; Han, Yantao; Peng, Jianjun; Wang, Chunbo

    2015-03-01

    EMMPRIN is a widely distributed cell surface glycoprotein, which plays an important role in tumor progression and confers resistance to some chemotherapeutic drugs. Recent studies have shown that EMMPRIN overexpression indicates poor prognosis in acute myeloid leukemia (AML). However, little was known on the role of EMMPRIN in leukemia. Human leukemia cell line U937 was stably transfected with a EMMPRIN-targeted shRNA-containing vector to investigate the effect of EMMPRIN on cellular functions. EMMPRIN expression was monitored by qRT-PCR and Western blotting. Cell viability and proliferation were determined by trypan blue exclusion and BrdU labeling, respectively. Cell cycle and apoptosis were analyzed by flow cytometry. Cytotoxicity of chemotherapeutic agent adriamycin on cells was assessed by MTT assay. Knockdown of EMMPRIN gene significantly inhibited cell viability and decreased cell proliferation. Fluorescence-activated cell-sorting analysis revealed that the reduced EMMPRIN expression resulted in cell cycle arrest at G1 phase and induced apoptosis. Meanwhile, western blotting analysis showed that EMMPRIN knockdown was associated with downregulation of cell cycle- and apoptosis-related molecules including cyclin D1, cyclin E, as well as increase in cleavage of caspase-3 and PARP. This study also showed that silencing of EMMPRIN sensitized U937 cells to Adriamycin. EMMPRIN is involved in proliferation, growth, and chemosensitivity of human AML line U937, indicating that EMMPRIN may be a promising therapeutic target for AML.

  3. Silencing of GPNMB by siRNA Inhibits the Formation of Melanosomes in Melanocytes in a MITF-Independent Fashion

    Science.gov (United States)

    Zhu, Cansheng; Yuan, Xiaoying; Li, Dongguang; Gu, Weijie; Ma, Huimin; Xie, Xin; Gao, Tianwen

    2012-01-01

    Background Melanosomes are specialized membrane-surrounded organelles, which are involved in the synthesis, storage and transport of melanin. Glycoprotein (transmembrane) non-metastatic melanoma protein b (GPNMB), a melanosome-specific structural protein, shares significant amino acid sequence homology with Pmel-17. Proteomic analysis demonstrated that GPNMB is present in all stages (I-IV) of melanosomes. However, little is known about the role of GPNMB in melanosomes. Methodology/Principal Findings Using real-time quantitative PCR, Western blotting and immunofluorescence analysis, we demonstrated that the expression of GPNMB in PIG1 melanocytes was up-regulated by ultraviolet B (UVB) radiation. Transmission electron microscopy analysis showed that the total number of melanosomes in PIG1 melanocytes was sharply reduced by GPNMB-siRNA transfection. Simultaneously, the expression levels of tyrosinase (Tyr), tyrosinase related protein 1 (Trp1), Pmel17/gp100 and ocular albinism type 1 protein (OA1) were all significantly attenuated. But the expression of microphthalmia-associated transcription factor (MITF) was up-regulated. Intriguingly, in GPNMB silenced PIG1 melanocytes, UVB radiation sharply reduced MITF expression. Conclusion Our present work revealed that the GPNMB was critical for the formation of melanosomes. And GPNMB expression down-regulation attenuated melanosome formation in a MITF-independent fashion. PMID:22912767

  4. Short Hairpin RNA Silencing of PHD-2 Improves Neovascularization and Functional Outcomes in Diabetic Wounds and Ischemic Limbs.

    Directory of Open Access Journals (Sweden)

    Kevin J Paik

    Full Text Available The transcription factor hypoxia-inducible factor 1-alpha (HIF-1α is responsible for the downstream expression of over 60 genes that regulate cell survival and metabolism in hypoxic conditions as well as those that enhance angiogenesis to alleviate hypoxia. However, under normoxic conditions, HIF-1α is hydroxylated by prolyl hydroxylase 2, and subsequently degraded, with a biological half-life of less than five minutes. Here we investigated the therapeutic potential of inhibiting HIF-1α degradation through short hairpin RNA silencing of PHD-2 in the setting of diabetic wounds and limb ischemia. Treatment of diabetic mouse fibroblasts with shPHD-2 in vitro resulted in decreased levels of PHD-2 transcript demonstrated by qRT-PCR, higher levels of HIF-1α as measured by western blot, and higher expression of the downstream angiogenic genes SDF-1 and VEGFα, as measured by qRT-PCR. In vivo, shPHD-2 accelerated healing of full thickness excisional wounds in diabetic mice compared to shScr control, (14.33 ± 0.45 days vs. 19 ± 0.33 days and was associated with an increased vascular density. Delivery of shPHD-2 also resulted in improved perfusion of ischemic hind limbs compared to shScr, prevention of distal digit tip necrosis, and increased survival of muscle tissue. Knockdown of PHD-2 through shRNA treatment has the potential to stimulate angiogenesis through overexpression of HIF-1α and upregulation of pro-angiogenic genes downstream of HIF-1α, and may represent a viable, non-viral approach to gene therapy for ischemia related applications.

  5. Antisense targeting of 3' end elements involved in DUX4 mRNA processing is an efficient therapeutic strategy for facioscapulohumeral dystrophy: a new gene-silencing approach.

    Science.gov (United States)

    Marsollier, Anne-Charlotte; Ciszewski, Lukasz; Mariot, Virginie; Popplewell, Linda; Voit, Thomas; Dickson, George; Dumonceaux, Julie

    2016-04-15

    Defects in mRNA 3'end formation have been described to alter transcription termination, transport of the mRNA from the nucleus to the cytoplasm, stability of the mRNA and translation efficiency. Therefore, inhibition of polyadenylation may lead to gene silencing. Here, we choose facioscapulohumeral dystrophy (FSHD) as a model to determine whether or not targeting key 3' end elements involved in mRNA processing using antisense oligonucleotide drugs can be used as a strategy for gene silencing within a potentially therapeutic context. FSHD is a gain-of-function disease characterized by the aberrant expression of the Double homeobox 4 (DUX4) transcription factor leading to altered pathogenic deregulation of multiple genes in muscles. Here, we demonstrate that targeting either the mRNA polyadenylation signal and/or cleavage site is an efficient strategy to down-regulate DUX4 expression and to decrease the abnormally high-pathological expression of genes downstream of DUX4. We conclude that targeting key functional 3' end elements involved in pre-mRNA to mRNA maturation with antisense drugs can lead to efficient gene silencing and is thus a potentially effective therapeutic strategy for at least FSHD. Moreover, polyadenylation is a crucial step in the maturation of almost all eukaryotic mRNAs, and thus all mRNAs are virtually eligible for this antisense-mediated knockdown strategy. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  6. Noncoding Subgenomic Flavivirus RNA Is Processed by the Mosquito RNA Interference Machinery and Determines West Nile Virus Transmission by Culex pipiens Mosquitoes.

    Science.gov (United States)

    Göertz, G P; Fros, J J; Miesen, P; Vogels, C B F; van der Bent, M L; Geertsema, C; Koenraadt, C J M; van Rij, R P; van Oers, M M; Pijlman, G P

    2016-11-15

    Flaviviruses, such as Zika virus, yellow fever virus, dengue virus, and West Nile virus (WNV), are a serious concern for human health. Flaviviruses produce an abundant noncoding subgenomic flavivirus RNA (sfRNA) in infected cells. sfRNA results from stalling of the host 5'-3' exoribonuclease XRN1/Pacman on conserved RNA structures in the 3' untranslated region (UTR) of the viral genomic RNA. sfRNA production is conserved in insect-specific, mosquito-borne, and tick-borne flaviviruses and flaviviruses with no known vector, suggesting a pivotal role for sfRNA in the flavivirus life cycle. Here, we investigated the function of sfRNA during WNV infection of Culex pipiens mosquitoes and evaluated its role in determining vector competence. An sfRNA1-deficient WNV was generated that displayed growth kinetics similar to those of wild-type WNV in both RNA interference (RNAi)-competent and -compromised mosquito cell lines. Small-RNA deep sequencing of WNV-infected mosquitoes indicated an active small interfering RNA (siRNA)-based antiviral response for both the wild-type and sfRNA1-deficient viruses. Additionally, we provide the first evidence that sfRNA is an RNAi substrate in vivo Two reproducible small-RNA hot spots within the 3' UTR/sfRNA of the wild-type virus mapped to RNA stem-loops SL-III and 3' SL, which stick out of the three-dimensional (3D) sfRNA structure model. Importantly, we demonstrate that sfRNA-deficient WNV displays significantly decreased infection and transmission rates in vivo when administered via the blood meal. Finally, we show that transmission and infection rates are not affected by sfRNA after intrathoracic injection, thereby identifying sfRNA as a key driver to overcome the mosquito midgut infection barrier. This is the first report to describe a key biological function of sfRNA for flavivirus infection of the arthropod vector, providing an explanation for the strict conservation of sfRNA production. Understanding the flavivirus transmission

  7. C6/36 Aedes albopictus cells have a dysfunctional antiviral RNA interference response.

    Directory of Open Access Journals (Sweden)

    Doug E Brackney

    2010-10-01

    Full Text Available Mosquitoes rely on RNA interference (RNAi as their primary defense against viral infections. To this end, the combination of RNAi and invertebrate cell culture systems has become an invaluable tool in studying virus-vector interactions. Nevertheless, a recent study failed to detect an active RNAi response to West Nile virus (WNV infection in C6/36 (Aedes albopictus cells, a mosquito cell line frequently used to study arthropod-borne viruses (arboviruses. Therefore, we sought to determine if WNV actively evades the host's RNAi response or if C6/36 cells have a dysfunctional RNAi pathway. C6/36 and Drosophila melanogaster S2 cells were infected with WNV (Flaviviridae, Sindbis virus (SINV, Togaviridae and La Crosse virus (LACV, Bunyaviridae and total RNA recovered from cell lysates. Small RNA (sRNA libraries were constructed and subjected to high-throughput sequencing. In S2 cells, virus-derived small interfering RNAs (viRNAs from all three viruses were predominantly 21 nt in length, a hallmark of the RNAi pathway. However, in C6/36 cells, viRNAs were primarily 17 nt in length from WNV infected cells and 26-27 nt in length in SINV and LACV infected cells. Furthermore, the origin (positive or negative viral strand and distribution (position along viral genome of S2 cell generated viRNA populations was consistent with previously published studies, but the profile of sRNAs isolated from C6/36 cells was altered. In total, these results suggest that C6/36 cells lack a functional antiviral RNAi response. These findings are analogous to the type-I interferon deficiency described in Vero (African green monkey kidney cells and suggest that C6/36 cells may fail to accurately model mosquito-arbovirus interactions at the molecular level.

  8. CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.

    Science.gov (United States)

    Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A

    2014-05-06

    In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.

  9. Pulmonary administration of small interfering RNA : The route to go?

    NARCIS (Netherlands)

    Ruigrok, Mitchel; Frijlink, Henderik W.; Hinrichs, Wouter

    2016-01-01

    Ever since the discovery of RNA interference (RNAi), which is a post-transcriptional gene silencing mechanism, researchers have been studying the therapeutic potential of using small interfering RNA (siRNA) to treat diseases that are characterized by excessive gene expression. Excessive gene

  10. Specific degradation of 3' regions of GUS mRNA in posttranscriptionally silenced tobacco lines may be related to 5'-3' spreading of silencing

    DEFF Research Database (Denmark)

    Braunstein, Thomas Hartig; Moury, Benoit; Johannessen, Marina

    2002-01-01

    background, we have performed detailed analyses of target regions in three spontaneously beta-glucuronidase (GUS) silencing tobacco lines of different origin. From quantitative cosuppression experiments, we show that the main target region in all three tobacco lines is found within the 3' half of the GUS...... VIGS. Surprisingly, only evidence for spreading of the target region in the 5'-3' direction was obtained. This finding may help explain why the majority of target regions examined to date lie within the 3' region of transgenes....

  11. Changes in Oleic Acid Content of Transgenic Soybeans by Antisense RNA Mediated Posttranscriptional Gene Silencing

    Directory of Open Access Journals (Sweden)

    Ling Zhang

    2014-01-01

    Full Text Available The Delta-12 oleate desaturase gene (FAD2-1, which converts oleic acid into linoleic acid, is the key enzyme determining the fatty acid composition of seed oil. In this study, we inhibited the expression of endogenous Delta-12 oleate desaturase GmFad2-1b gene by using antisense RNA in soybean Williams 82. By employing the soybean cotyledonary-node method, a part of the cDNA of soybean GmFad2-1b 801 bp was cloned for the construction of a pCAMBIA3300 vector under the soybean seed promoter BCSP. Leaf painting, LibertyLink strip, PCR, Southern blot, qRT-PCR, and fatty acid analysis were used to detect the insertion and expression of GmFad2-1b in the transgenic soybean lines. The results indicate that the metabolically engineered plants exhibited a significant increase in oleic acid (up to 51.71% and a reduction in palmitic acid (to <3% in their seed oil content. No structural differences were observed between the fatty acids of the transgenic and the nontransgenic oil extracts.

  12. Phytophthora suppressor of RNA silencing 2 is a conserved RxLR effector that promotes infection in soybean and Arabidopsis thaliana.

    Science.gov (United States)

    Xiong, Qin; Ye, Wenwu; Choi, Duseok; Wong, James; Qiao, Yongli; Tao, Kai; Wang, Yuanchao; Ma, Wenbo

    2014-12-01

    The genus Phytophthora consists of notorious and emerging pathogens of economically important crops. Each Phytophthora genome encodes several hundreds of cytoplasmic effectors, which are believed to manipulate plant immune response inside the host cells. However, the majority of Phytophthora effectors remain functionally uncharacterized. We recently discovered two effectors from the soybean stem and root rot pathogen Phytophthora sojae with the activity to suppress RNA silencing in plants. These effectors are designated Phytophthora suppressor of RNA silencing (PSRs). Here, we report that the P. sojae PSR2 (PsPSR2) belongs to a conserved and widespread effector family in Phytophthora. A PsPSR2-like effector produced by P. infestans (PiPSR2) can also suppress RNA silencing in plants and promote Phytophthora infection, suggesting that the PSR2 family effectors have conserved functions in plant hosts. Using Agrobacterium rhizogenes-mediated hairy roots induction, we demonstrated that the expression of PsPSR2 rendered hypersusceptibility of soybean to P. sojae. Enhanced susceptibility was also observed in PsPSR2-expressing Arabidopsis thaliana plants during Phytophthora but not bacterial infection. These experiments provide strong evidence that PSR2 is a conserved Phytophthora effector family that performs important virulence functions specifically during Phytophthora infection of various plant hosts.

  13. Evaluation of locked nucleic acid-modified small interfering RNA in vitro and in vivo

    NARCIS (Netherlands)

    Mook, Olaf R.; Baas, Frank; de Wissel, Marit B.; Fluiter, Kees

    2007-01-01

    RNA interference has become widely used as an experimental tool to study gene function. In addition, small interfering RNA (siRNA) may have great potential for the treatment of diseases. Recently, it was shown that siRNA can be used to mediate gene silencing in mouse models. Locally administered

  14. Surface coating of siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers: enhanced gene silencing and reduced adverse effects in vitro

    Science.gov (United States)

    Zeng, Xianghui; de Groot, Anne Marit; Sijts, Alice J. A. M.; Broere, Femke; Oude Blenke, Erik; Colombo, Stefano; van Eden, Willem; Franzyk, Henrik; Nielsen, Hanne Mørck; Foged, Camilla

    2015-11-01

    Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine and homoarginine residues was shown to self-assemble with small interfering RNA (siRNA). The resulting well-defined nanocomplexes were coated with anionic lipids giving rise to net anionic liposomes. These complexes and the corresponding liposomes were optimized towards efficient gene silencing and low adverse effects. The optimal anionic liposomes mediated a high silencing effect, which was comparable to that of the control (cationic Lipofectamine 2000), and did not display any noticeable cytotoxicity and immunogenicity in vitro. In contrast, the corresponding nanocomplexes mediated a reduced silencing effect with a more narrow safety window. The surface coating with anionic lipid bilayers led to partial decomplexation of the siRNA-peptidomimetic nanocomplex core of the liposomes, which facilitated siRNA release. Additionally, the optimal anionic liposomes showed efficient intracellular uptake and endosomal escape. Therefore, these findings suggest that a more efficacious and safe formulation can be achieved by surface coating of the siRNA-peptidomimetic nano-self-assemblies with anionic lipid bilayers.Cationic vectors have demonstrated the potential to facilitate intracellular delivery of therapeutic oligonucleotides. However, enhanced transfection efficiency is usually associated with adverse effects, which also proves to be a challenge for vectors based on cationic peptides. In this study a series of proteolytically stable palmitoylated α-peptide/β-peptoid peptidomimetics with a systematically varied number of repeating lysine

  15. Expression profiling and cross-species RNA interference (RNAi of desiccation-induced transcripts in the anhydrobiotic nematode Aphelenchus avenae

    Directory of Open Access Journals (Sweden)

    Culleton Bridget A

    2010-01-01

    Full Text Available Abstract Background Some organisms can survive extreme desiccation by entering a state of suspended animation known as anhydrobiosis. The free-living mycophagous nematode Aphelenchus avenae can be induced to enter anhydrobiosis by pre-exposure to moderate reductions in relative humidity (RH prior to extreme desiccation. This preconditioning phase is thought to allow modification of the transcriptome by activation of genes required for desiccation tolerance. Results To identify such genes, a panel of expressed sequence tags (ESTs enriched for sequences upregulated in A. avenae during preconditioning was created. A subset of 30 genes with significant matches in databases, together with a number of apparently novel sequences, were chosen for further study. Several of the recognisable genes are associated with water stress, encoding, for example, two new hydrophilic proteins related to the late embryogenesis abundant (LEA protein family. Expression studies confirmed EST panel members to be upregulated by evaporative water loss, and the majority of genes was also induced by osmotic stress and cold, but rather fewer by heat. We attempted to use RNA interference (RNAi to demonstrate the importance of this gene set for anhydrobiosis, but found A. avenae to be recalcitrant with the techniques used. Instead, therefore, we developed a cross-species RNAi procedure using A. avenae sequences in another anhydrobiotic nematode, Panagrolaimus superbus, which is amenable to gene silencing. Of 20 A. avenae ESTs screened, a significant reduction in survival of desiccation in treated P. superbus populations was observed with two sequences, one of which was novel, while the other encoded a glutathione peroxidase. To confirm a role for glutathione peroxidases in anhydrobiosis, RNAi with cognate sequences from P. superbus was performed and was also shown to reduce desiccation tolerance in this species. Conclusions This study has identified and characterised the

  16. Reconstruction of gene regulatory modules from RNA silencing of IFN-α modulators: experimental set-up and inference method.

    Science.gov (United States)

    Grassi, Angela; Di Camillo, Barbara; Ciccarese, Francesco; Agnusdei, Valentina; Zanovello, Paola; Amadori, Alberto; Finesso, Lorenzo; Indraccolo, Stefano; Toffolo, Gianna Maria

    2016-03-12

    Inference of gene regulation from expression data may help to unravel regulatory mechanisms involved in complex diseases or in the action of specific drugs. A challenging task for many researchers working in the field of systems biology is to build up an experiment with a limited budget and produce a dataset suitable to reconstruct putative regulatory modules worth of biological validation. Here, we focus on small-scale gene expression screens and we introduce a novel experimental set-up and a customized method of analysis to make inference on regulatory modules starting from genetic perturbation data, e.g. knockdown and overexpression data. To illustrate the utility of our strategy, it was applied to produce and analyze a dataset of quantitative real-time RT-PCR data, in which interferon-α (IFN-α) transcriptional response in endothelial cells is investigated by RNA silencing of two candidate IFN-α modulators, STAT1 and IFIH1. A putative regulatory module was reconstructed by our method, revealing an intriguing feed-forward loop, in which STAT1 regulates IFIH1 and they both negatively regulate IFNAR1. STAT1 regulation on IFNAR1 was object of experimental validation at the protein level. Detailed description of the experimental set-up and of the analysis procedure is reported, with the intent to be of inspiration for other scientists who want to realize similar experiments to reconstruct gene regulatory modules starting from perturbations of possible regulators. Application of our approach to the study of IFN-α transcriptional response modulators in endothelial cells has led to many interesting novel findings and new biological hypotheses worth of validation.

  17. Assessment of RNAi-induced silencing in banana (Musa spp.).

    Science.gov (United States)

    Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

    2014-09-18

    In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target

  18. RNA Interference Technology to Control Pest Sea Lampreys - A Proof-of-Concept

    Science.gov (United States)

    Heath, George; Childs, Darcy; Docker, Margaret F.; McCauley, David W.; Whyard, Steven

    2014-01-01

    The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0–fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species. PMID:24505485

  19. RNA interference technology to control pest sea lampreys--a proof-of-concept.

    Directory of Open Access Journals (Sweden)

    George Heath

    Full Text Available The parasitic sea lamprey (Petromyzon marinus has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin reduced transcript levels 2.5, 3.6, and 5.0-fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species.

  20. RNA interference technology to control pest sea lampreys--a proof-of-concept.

    Science.gov (United States)

    Heath, George; Childs, Darcy; Docker, Margaret F; McCauley, David W; Whyard, Steven

    2014-01-01

    The parasitic sea lamprey (Petromyzon marinus) has caused extensive losses to commercial fish stocks of the upper Great Lakes of North America. Methods of controlling the sea lamprey include trapping, barriers to prevent migration, and use of a chemical lampricide (3-trifluoromethyl-4-nitrophenol) to kill the filter-feeding larvae. Concerns about the non-specificity of these methods have prompted continued development of species-specific methods to control lampreys outside their native range. In this study, we considered the utility of RNA interference to develop a sea lamprey-specific lampricide. Injection of six different short interfering, double-stranded RNAs (siRNAs) into lamprey embryos first confirmed that the siRNAs could reduce the targeted transcript levels by more than 50%. Two size classes of lamprey larvae were then fed the siRNAs complexed with liposomes, and three of the siRNAs (targeting elongation factor 1α, calmodulin, and α-actinin) reduced transcript levels 2.5, 3.6, and 5.0-fold, respectively, within the lamprey midsections. This is not only the first demonstration of RNAi in lampreys, but it is also the first example of delivery of siRNAs to a non-mammalian vertebrate through feeding formulations. One of the siRNA treatments also caused increased mortality of the larvae following a single feeding of siRNAs, which suggests that prolonged or multiple feedings of siRNAs could be used to kill filter-feeding larvae within streams, following development of a slow-release formulation. The genes targeted in this study are highly conserved across many species, and only serve as a proof-of-concept demonstration that siRNAs can be used in lampreys. Given that RNA interference is a sequence-specific phenomenon, it should be possible to design siRNAs that selectively target gene sequences that are unique to sea lampreys, and thus develop a technology to control these pests without adversely affecting non-target species.

  1. RNA interference screen identifies Abl kinase and PDGFR signaling in Chlamydia trachomatis entry.

    Directory of Open Access Journals (Sweden)

    Cherilyn A Elwell

    2008-03-01

    Full Text Available The strain designated Chlamydia trachomatis serovar L2 that was used for experiments in this paper is Chlamydia muridarum, a species closely related to C. trachomatis (and formerly termed the Mouse Pneumonitis strain of C. trachomatis. This conclusion was verified by deep sequencing and by PCR using species-specific primers. All data presented in the results section that refer to C. trachomatis should be interpreted as referring to C. muridarum. Since C. muridarum TARP lacks the consensus tyrosine repeats present in C. trachomatis TARP, we cannot make any conclusions about the role of TARP phosphorylation and C. muridarum entry. However, the conclusion that C. trachomatis L2 TARP is a target of Abl kinase is still valid as these experiments were performed with C. trachomatis L2 TARP [corrected]. To elucidate the mechanisms involved in early events in Chlamydia trachomatis infection, we conducted a large scale unbiased RNA interference screen in Drosophila melanogaster S2 cells. This allowed identification of candidate host factors in a simple non-redundant, genetically tractable system. From a library of 7,216 double stranded RNAs (dsRNA, we identified approximately 226 host genes, including two tyrosine kinases, Abelson (Abl kinase and PDGF- and VEGF-receptor related (Pvr, a homolog of the Platelet-derived growth factor receptor (PDGFR. We further examined the role of these two kinases in C. trachomatis binding and internalization into mammalian cells. Both kinases are phosphorylated upon infection and recruited to the site of bacterial attachment, but their roles in the infectious process are distinct. We provide evidence that PDGFRbeta may function as a receptor, as inhibition of PDGFRbeta by RNA interference or by PDGFRbeta neutralizing antibodies significantly reduces bacterial binding, whereas depletion of Abl kinase has no effect on binding. Bacterial internalization can occur through activation of PDGFRbeta or through independent

  2. Small Interference RNA Targeting TLR4 Gene Effectively Attenuates Pulmonary Inflammation in a Rat Model

    Directory of Open Access Journals (Sweden)

    Feixiang Wu

    2012-01-01

    Full Text Available Objective. The present study was to investigate the feasibility of adenovirus-mediated small interference RNA (siRNA targeting Toll-like receptor 4 (TLR4 gene in ameliorating lipopolysaccharide- (LPS- induced acute lung injury (ALI. Methods. In vitro, alveolar macrophages (AMs were treated with Ad-siTLR4 and Ad-EFGP, respectively, for 12 h, 24 h, and 48 h, and then with LPS (100 ng/mL for 2 h, and the function and expression of TLR4 were evaluated. In vivo, rats received intratracheal injection of 300 μL of normal saline (control group, 300 μL of Ad-EGFP (Ad-EGFP group, or 300 μL of Ad-siTLR4 (Ad-siTLR4 group and then were intravenously treated with LPS (50 mg/kg to induce ALI. Results. Ad-siTLR4 treatment significantly reduced TLR4 expression and production of proinflammatory cytokines following LPS treatment both in vitro and in vivo. Significant alleviation of tissue edema, microvascular protein leakage, and neutrophil infiltration was observed in the AdsiTLR4-treated animals. Conclusion. TLR4 plays a critical role in LPS-induced ALI, and transfection of Ad-siTLR4 can effectively downregulate TLR4 expression in vitro and in vivo, accompanied by alleviation of LPS-induced lung injury. These findings suggest that TLR4 may serve as a potential target in the treatment of ALI and RNA interfering targeting TLR4 expression represents a therapeutic strategy.

  3. A dominant mutation in mediator of paramutation2, one of three second-largest subunits of a plant-specific RNA polymerase, disrupts multiple siRNA silencing processes.

    Science.gov (United States)

    Sidorenko, Lyudmila; Dorweiler, Jane E; Cigan, A Mark; Arteaga-Vazquez, Mario; Vyas, Meenal; Kermicle, Jerry; Jurcin, Diane; Brzeski, Jan; Cai, Yu; Chandler, Vicki L

    2009-11-01

    Paramutation involves homologous sequence communication that leads to meiotically heritable transcriptional silencing. We demonstrate that mop2 (mediator of paramutation2), which alters paramutation at multiple loci, encodes a gene similar to Arabidopsis NRPD2/E2, the second-largest subunit of plant-specific RNA polymerases IV and V. In Arabidopsis, Pol-IV and Pol-V play major roles in RNA-mediated silencing and a single second-largest subunit is shared between Pol-IV and Pol-V. Maize encodes three second-largest subunit genes: all three genes potentially encode full length proteins with highly conserved polymerase domains, and each are expressed in multiple overlapping tissues. The isolation of a recessive paramutation mutation in mop2 from a forward genetic screen suggests limited or no functional redundancy of these three genes. Potential alternative Pol-IV/Pol-V-like complexes could provide maize with a greater diversification of RNA-mediated transcriptional silencing machinery relative to Arabidopsis. Mop2-1 disrupts paramutation at multiple loci when heterozygous, whereas previously silenced alleles are only up-regulated when Mop2-1 is homozygous. The dramatic reduction in b1 tandem repeat siRNAs, but no disruption of silencing in Mop2-1 heterozygotes, suggests the major role for tandem repeat siRNAs is not to maintain silencing. Instead, we hypothesize the tandem repeat siRNAs mediate the establishment of the heritable silent state-a process fully disrupted in Mop2-1 heterozygotes. The dominant Mop2-1 mutation, which has a single nucleotide change in a domain highly conserved among all polymerases (E. coli to eukaryotes), disrupts both siRNA biogenesis (Pol-IV-like) and potentially processes downstream (Pol-V-like). These results suggest either the wild-type protein is a subunit in both complexes or the dominant mutant protein disrupts both complexes. Dominant mutations in the same domain in E. coli RNA polymerase suggest a model for Mop2-1 dominance

  4. Small interfering RNA-mediated silencing of nicotinamide phosphoribosyltransferase (NAMPT and lysosomal trafficking regulator (LYST induce growth inhibition and apoptosis in human multiple myeloma cells: A preliminary study

    Directory of Open Access Journals (Sweden)

    Ivyna Pau Ni Bong

    2016-11-01

    Full Text Available Multiple myeloma (MM is a malignancy of B lymphocytes or plasma cells. Our array-based comparative genomic hybridization findings revealed chromosomal gains at 7q22.3 and 1q42.3, where nicotinamide (NAM phosphoribosyltransferase (NAMPT and lysosomal trafficking regulator (LYST genes are localized, respectively. This led us to further study the functions of these genes in myeloma cells. NAMPT is a key enzyme involved in nicotinamide adenine dinucleotide salvage pathway, and it is frequently overexpressed in human cancers. In contrast, little is known about the function of LYST in cancer. The expression of LYST is shown to affect lysosomal size, granule size, and autophagy in human cells. In this study, the effects of small interfering RNA (siRNA-mediated silencing of NAMPT and LYST on cell proliferation and apoptosis were evaluated in RPMI 8226 myeloma cells. Transfection efficiencies were determined by quantitative real time reverse transcriptase PCR. Cell proliferation was determined using MTT assay, while apoptosis was analyzed with flow cytometry using Annexin V-fluorescein isothiocyanate/propidium iodide assay. The NAMPT protein expression in siRNA-treated cells was estimated by enzyme-linked immunosorbent assay. Our results showed that NAMPT and LYST were successfully knockdown by siRNA transfection (p < 0.05. NAMPT or LYST gene silencing significantly inhibited cell proliferation and induced apoptosis in RPMI 8226 cells (p < 0.05. Silencing of NAMPT gene also decreased NAMPT protein levels (p < 0.01. Our study demonstrated that NAMPT and LYST play pivotal roles in the molecular pathogenesis of MM. This is the first report describing the possible functions of LYST in myelomagenesis and its potential role as a therapeutic target in MM.

  5. Small interfering RNA-mediated silencing of nicotinamide phosphoribosyltransferase (NAMPT) and lysosomal trafficking regulator (LYST) induce growth inhibition and apoptosis in human multiple myeloma cells: A preliminary study

    Science.gov (United States)

    Bong, Ivyna Pau Ni; Ng, Ching Ching; Fakiruddin, Shaik Kamal; Lim, Moon Nian; Zakaria, Zubaidah

    2016-01-01

    Multiple myeloma (MM) is a malignancy of B lymphocytes or plasma cells. Our array-based comparative genomic hybridization findings revealed chromosomal gains at 7q22.3 and 1q42.3, where nicotinamide (NAM) phosphoribosyltransferase (NAMPT) and lysosomal trafficking regulator (LYST) genes are localized, respectively. This led us to further study the fprotein expression in unctions of these genes in myeloma cells. NAMPT is a key enzyme involved in nicotinamide adenine dinucleotide salvage pathway, and it is frequently overexpressed in human cancers. In contrast, little is known about the function of LYST in cancer. The expression of LYST is shown to affect lysosomal size, granule size, and autophagy in human cells. In this study, the effects of small interfering RNA (siRNA)-mediated silencing of NAMPT and LYST on cell proliferation and apoptosis were evaluated in RPMI 8226 myeloma cells. Transfection efficiencies were determined by quantitative real time reverse transcriptase PCR. Cell proliferation was determined using MTT assay, while apoptosis was analyzed with flow cytometry using Annexin V-fluorescein isothiocyanate/propidium iodide assay. The NAMPT protein expression in siRNA-treated cells was estimated by enzyme-linked immunosorbent assay. Our results showed that NAMPT and LYST were successfully knockdown by siRNA transfection (p < 0.05). NAMPT or LYST gene silencing significantly inhibited cell proliferation and induced apoptosis in RPMI 8226 cells (p < 0.05). Silencing of NAMPT gene also decreased NAMPT protein levels (p < 0.01). Our study demonstrated that NAMPT and LYST play pivotal roles in the molecular pathogenesis of MM. This is the first report describing the possible functions of LYST in myelomagenesis and its potential role as a therapeutic target in MM. PMID:27754828

  6. RNA Interference Based Approach to Down Regulate Osmoregulators of Whitefly (Bemisia tabaci): Potential Technology for the Control of Whitefly

    Science.gov (United States)

    Over the past decade RNA interference (RNAi) technology has emerged as a successful tool not only for functional genomics, but in planta expression of short interfering RNAs (siRNAs) could offer potential for insect pest management. Insects feeding exclusively on plant sap depend on osmotic pressure...

  7. Structural Dynamics of the GW182 Silencing Domain Including its RNA Recognition motif (RRM) Revealed by Hydrogen-Deuterium Exchange Mass Spectrometry

    Science.gov (United States)

    Cieplak-Rotowska, Maja K.; Tarnowski, Krzysztof; Rubin, Marcin; Fabian, Marc R.; Sonenberg, Nahum; Dadlez, Michal; Niedzwiecka, Anna

    2018-01-01

    The human GW182 protein plays an essential role in micro(mi)RNA-dependent gene silencing. miRNA silencing is mediated, in part, by a GW182 C-terminal region called the silencing domain, which interacts with the poly(A) binding protein and the CCR4-NOT deadenylase complex to repress protein synthesis. Structural studies of this GW182 fragment are challenging due to its predicted intrinsically disordered character, except for its RRM domain. However, detailed insights into the properties of proteins containing disordered regions can be provided by hydrogen-deuterium exchange mass spectrometry (HDX/MS). In this work, we applied HDX/MS to define the structural state of the GW182 silencing domain. HDX/MS analysis revealed that this domain is clearly divided into a natively unstructured part, including the CCR4-NOT interacting motif 1, and a distinct RRM domain. The GW182 RRM has a very dynamic structure, since water molecules can penetrate the whole domain in 2 h. The finding of this high structural dynamics sheds new light on the RRM structure. Though this domain is one of the most frequently occurring canonical protein domains in eukaryotes, these results are - to our knowledge - the first HDX/MS characteristics of an RRM. The HDX/MS studies show also that the α2 helix of the RRM can display EX1 behavior after a freezing-thawing cycle. This means that the RRM structure is sensitive to environmental conditions and can change its conformation, which suggests that the state of the RRM containing proteins should be checked by HDX/MS in regard of the conformational uniformity. [Figure not available: see fulltext.

  8. Amino acid sequence motifs essential for P0-mediated suppression of RNA silencing in an isolate of potato leafroll virus from Inner Mongolia.

    Science.gov (United States)

    Zhuo, Tao; Li, Yuan-Yuan; Xiang, Hai-Ying; Wu, Zhan-Yu; Wang, Xian-Bin; Wang, Ying; Zhang, Yong-Liang; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

    2014-06-01

    Polerovirus P0 suppressors of host gene silencing contain a consensus F-box-like motif with Leu/Pro (L/P) requirements for suppressor activity. The Inner Mongolian Potato leafroll virus (PLRV) P0 protein (P0(PL-IM)) has an unusual F-box-like motif that contains a Trp/Gly (W/G) sequence and an additional GW/WG-like motif (G139/W140/G141) that is lacking in other P0 proteins. We used Agrobacterium infiltration-mediated RNA silencing assays to establish that P0(PL-IM) has a strong suppressor activity. Mutagenesis experiments demonstrated that the P0(PL-IM) F-box-like motif encompasses amino acids 76-LPRHLHYECLEWGLLCG THP-95, and that the suppressor activity is abolished by L76A, W87A, or G88A substitution. The suppressor activity is also weakened substantially by mutations within the G139/W140/G141 region and is eliminated by a mutation (F220R) in a C-terminal conserved sequence of P0(PL-IM). As has been observed with other P0 proteins, P0(PL-IM) suppression is correlated with reduced accumulation of the host AGO1-silencing complex protein. However, P0(PL-IM) fails to bind SKP1, which functions in a proteasome pathway that may be involved in AGO1 degradation. These results suggest that P0(PL-IM) may suppress RNA silencing by using an alternative pathway to target AGO1 for degradation. Our results help improve our understanding of the molecular mechanisms involved in PLRV infection.

  9. Mimic Phosphorylation of a βC1 Protein Encoded by TYLCCNB Impairs Its Functions as a Viral Suppressor of RNA Silencing and a Symptom Determinant.

    Science.gov (United States)

    Zhong, Xueting; Wang, Zhan Qi; Xiao, Ruyuan; Cao, Linge; Wang, Yaqin; Xie, Yan; Zhou, Xueping

    2017-08-15

    Phosphorylation of the βC1 protein encoded by the betasatellite of tomato yellow leaf curl China virus (TYLCCNB-βC1) by SNF1-related protein kinase 1 (SnRK1) plays a critical role in defense of host plants against geminivirus infection in Nicotiana benthamiana However, how phosphorylation of TYLCCNB-βC1 impacts its pathogenic functions during viral infection remains elusive. In this study, we identified two additional tyrosine residues in TYLCCNB-βC1 that are phosphorylated by SnRK1. The effects of TYLCCNB-βC1 phosphorylation on its functions as a viral suppressor of RNA silencing (VSR) and a symptom determinant were investigated via phosphorylation mimic mutants in N. benthamiana plants. Mutations that mimic phosphorylation of TYLCCNB-βC1 at tyrosine 5 and tyrosine 110 attenuated disease symptoms during viral infection. The phosphorylation mimics weakened the ability of TYLCCNB-βC1 to reverse transcriptional gene silencing and to suppress posttranscriptional gene silencing and abolished its interaction with N. benthamiana ASYMMETRIC LEAVES 1 in N. benthamiana leaves. The mimic phosphorylation of TYLCCNB-βC1 had no impact on its protein stability, subcellular localization, or self-association. Our data establish an inhibitory effect of phosphorylation of TYLCCNB-βC1 on its pathogenic functions as a VSR and a symptom determinant and provide a mechanistic explanation of how SnRK1 functions as a host defense factor. IMPORTANCE Tomato yellow leaf curl China virus (TYLCCNV), which causes a severe yellow leaf curl disease in China, is a monopartite geminivirus associated with the betasatellite (TYLCCNB). TYLCCNB encodes a single pathogenicity protein, βC1 (TYLCCNB-βC1), which functions as both a viral suppressor of RNA silencing (VSR) and a symptom determinant. Here, we show that mimicking phosphorylation of TYLCCNB-βC1 weakens its ability to reverse transcriptional gene silencing, to suppress posttranscriptional gene silencing, and to interact with N

  10. Silencing honey bee naked cuticle (nkd) reduces Nosema ceranae replication and disease levels

    Science.gov (United States)

    Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera that has been implicated in alarming colony losses worldwide. RNA interference (RNAi), a post-transcriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling in...

  11. Viral RNA silencing suppression

    NARCIS (Netherlands)

    Hedil, Marcio; Kormelink, Richard

    2016-01-01

    The Bunyaviridae is a family of arboviruses including both plant-and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative

  12. Gene-silencing effects of anti-survivin siRNA delivered by RGDV-functionalized nanodiamond carrier in the breast carcinoma cell line MCF-7

    Directory of Open Access Journals (Sweden)

    Bi YZ

    2016-11-01

    Full Text Available Yanzhao Bi, Yifan Zhang, Chunying Cui, Lulu Ren, Xueyun Jiang School of Chemical Biology and Pharmaceutical Sciences, Capital Medical University, Beijing, People’s Republic of China Abstract: Nanodiamond (ND is a renowned material in nonviral small interfering RNA (siRNA carrier field due to its unique physical, chemical, and biological properties. In our previous work, it was proven that ND could deliver siRNA into cells efficiently and downregulate the expression of desired protein. However, synthesizing a high-efficient tumor-targeting carrier using ND is still a challenge. In this study, a novel carrier, NDCONH(CH22NH-VDGR, was synthesized for siRNA delivery, and its properties were characterized with methods including Fourier transform infrared spectrometry, transmission electron microscopy, scanning electron microscopy, gel retardation assay, differential scanning calorimetry, confocal microscopy, releasing test, real-time polymerase chain reaction (PCR assay, enzyme-linked immunosorbent assay (ELISA, flow cytometry, cytotoxicity assay, and gene-silencing efficacy assay in vitro and in vivo. The mechanism of NDCONH(CH22NH-VDGR/survivin-siRNA-induced tumor apoptosis was evaluated via flow cytometer assay using Annexin V–fluorescein isothiocyanate/propidium iodide staining method. The NDCONH(CH22NH-VDGR/survivin-siRNA nanoparticle with 60–110 nm diameter and 35.65±3.90 mV zeta potential was prepared. For real-time PCR assay, the results showed that the expression of survivin mRNA was reduced to 46.77%±6.3%. The expression of survivin protein was downregulated to 48.49%±2.25%, as evaluated by ELISA assay. MTT assay showed that NDCONH(CH22NH-VDGR/survivin-siRNA had an inhibitory effect on MCF-7 cell proliferation. According to these results, the survivin-siRNA could be delivered, transported, and released stably, which benefits in increasing the gene-silencing effect. Therefore, as an siRNA carrier, NDCONH(CH22NH-VDGR was suggested

  13. Silencing of cytosolic NADP(+)-dependent isocitrate dehydrogenase by small interfering RNA enhances the sensitivity of HeLa cells toward staurosporine.

    Science.gov (United States)

    Lee, Su-Min; Park, Sin Young; Shin, Seoung Woo; Kil, In Sup; Yang, Eun Sun; Park, Jeen-Woo

    2009-02-01

    Staurosporine induces the production of reactive oxygen species, which play an important causative role in apoptotic cell death. Recently, it was demonstrated that the control of cellular redox balance and the defense against oxidative damage is one of the primary functions of cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) by supplying NADPH for antioxidant systems. The present report shows that silencing of IDPc expression in HeLa cells greatly enhances apoptosis induced by staurosporine. Transfection of HeLa cells with an IDPc small interfering RNA (siRNA) markedly decreased activity of IDPc, enhancing the susceptibility of staurosporine-induced apoptosis reflected by DNA fragmentation, cellular redox status and the modulation of apoptotic marker proteins. These results indicate that IDPc may play an important role in regulating the apoptosis induced by staurosporine and the sensitizing effect of IDPc siRNA on the apoptotic cell death of HeLa cells offers the possibility of developing a modifier of cancer chemotherapy.

  14. Gene silencing of mannose 6-phosphate reductase in the parasitic weed Orobanche aegyptiaca through the production of homologous dsRNA sequences in the host plant.

    Science.gov (United States)

    Aly, Radi; Cholakh, Hila; Joel, Daniel M; Leibman, Diana; Steinitz, Benjamin; Zelcer, Aaron; Naglis, Anna; Yarden, Oded; Gal-On, Amit

    2009-08-01

    Orobanche spp. (broomrape) are parasitic plants which subsist on the roots of a wide range of hosts, including tomato, causing severe losses in yield quality and quantity. Large amounts of mannitol accumulate in this parasitic weed during development. Mannose 6-phosphate reductase (M6PR) is a key enzyme in mannitol biosynthesis, and it has been suggested that mannitol accumulation may be very important for Orobanche development. Therefore, the Orobanche M6PR gene is a potential target for efforts to control this parasite. Transgenic tomato plants were produced bearing a gene construct containing a specific 277-bp fragment from Orobanche aegyptiaca M6PR-mRNA, in an inverted-repeat configuration. M6PR-siRNA was detected in three independent transgenic tomato lines in the R1 generation, but was not detected in the parasite. Quantitative RT-PCR analysis showed that the amount of endogenous M6PR mRNA in the tubercles and underground shoots of O. aegyptiaca grown on transgenic host plants was reduced by 60%-80%. Concomitant with M6PR mRNA suppression, there was a significant decrease in mannitol level and a significant increase in the percentage of dead O. aegyptiaca tubercles on the transgenic host plants. The detection of mir390, which is involved with cytoplasmic dsRNA processing, is the first indication of the existence of gene-silencing mechanisms in Orobanche spp. Gene silencing mechanisms are probably involved with the production of decreased levels of M6PR mRNA in the parasites grown on the transformed tomato lines.

  15. Gene-silencing effects of anti-survivin siRNA delivered by RGDV-functionalized nanodiamond carrier in the breast carcinoma cell line MCF-7.

    Science.gov (United States)

    Bi, Yanzhao; Zhang, Yifan; Cui, Chunying; Ren, Lulu; Jiang, Xueyun

    Nanodiamond (ND) is a renowned material in nonviral small interfering RNA (siRNA) carrier field due to its unique physical, chemical, and biological properties. In our previous work, it was proven that ND could deliver siRNA into cells efficiently and downregulate the expression of desired protein. However, synthesizing a high-efficient tumor-targeting carrier using ND is still a challenge. In this study, a novel carrier, NDCONH(CH 2 ) 2 NH-VDGR, was synthesized for siRNA delivery, and its properties were characterized with methods including Fourier transform infrared spectrometry, transmission electron microscopy, scanning electron microscopy, gel retardation assay, differential scanning calorimetry, confocal microscopy, releasing test, real-time polymerase chain reaction (PCR) assay, enzyme-linked immunosorbent assay (ELISA), flow cytometry, cytotoxicity assay, and gene-silencing efficacy assay in vitro and in vivo. The mechanism of NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA-induced tumor apoptosis was evaluated via flow cytometer assay using Annexin V-fluorescein isothiocyanate/propidium iodide staining method. The NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA nanoparticle with 60-110 nm diameter and 35.65±3.90 mV zeta potential was prepared. For real-time PCR assay, the results showed that the expression of survivin mRNA was reduced to 46.77%±6.3%. The expression of survivin protein was downregulated to 48.49%±2.25%, as evaluated by ELISA assay. MTT assay showed that NDCONH(CH 2 ) 2 NH-VDGR/survivin-siRNA had an inhibitory effect on MCF-7 cell proliferation. According to these results, the survivin-siRNA could be delivered, transported, and released stably, which benefits in increasing the gene-silencing effect. Therefore, as an siRNA carrier, NDCONH(CH 2 ) 2 NH-VDGR was suggested to be used in siRNA delivery system and in cancer treatments.

  16. Induction of cell death by tospoviral protein NSs and the motif critical for cell death does not control RNA silencing suppression activity.

    Science.gov (United States)

    Singh, Ajeet; Permar, Vipin; Jain, R K; Goswami, Suneha; Kumar, Ranjeet Ranjan; Canto, Tomas; Palukaitis, Peter; Praveen, Shelly

    2017-08-01

    Groundnut bud necrosis virus induces necrotic symptoms in different hosts. Previous studies showed reactive oxygen species-mediated programmed cell death (PCD) resulted in necrotic symptoms. Transgenic expression of viral protein NSs mimics viral symptoms. Here, we showed a role for NSs in influencing oxidative burst in the cell, by analyzing H 2 O 2 accumulation, activities of antioxidant enzymes and expression levels of vacuolar processing enzymes, H 2 O 2 -responsive microRNA 319a.2 plus its possible target metacaspase-8. The role of NSs in PCD, was shown using two NSs mutants: one in the Trp/GH3 motif (a homologue of pro-apototic domain) (NSs S189R ) and the other in a non-Trp/GH3 motif (NSs L172R ). Tobacco rattle virus (TRV) expressing NSs S189R enhanced the PCD response, but not TRV-NSs L172R , while RNA silencing suppression activity was lost in TRV-NSs L172R , but not in TRV-NSs S189R . Therefore, we propose dual roles of NSs in RNA silencing suppression and induction of cell death, controlled by different motifs. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Knockdown of E2f1 by RNA interference impairs proliferation of rat cells in vitro

    Directory of Open Access Journals (Sweden)

    Luciana dos Reis Vasques

    2010-01-01

    Full Text Available E2F1 plays a key role in cell-cycle regulation in mammals, since its transcription factor activity controls genes required for DNA synthesis and apoptosis. E2F1 deregulation is a common feature among different tumor types and can be a major cause of cell proliferation. Thus, blocking E2F1 expression by RNA interference represents a promising therapeutic approach. In this study, the introduction of specific short hairpin RNAs (shRNAs reduced E2f1 expression by up to 77%, and impaired rat glioma cell proliferation by approximately 70%, as compared to control cells. Furthermore, we investigated the expression of E2f1 target genes, Cyclin A and Cyclin E. Cyclin A was found to be down-regulated, whereas Cyclin E had similar expression to control cells, indicating that gene(s other than E2f1 control its transcription. Other E2f family members, E2f2 and E2f3, which have been classified in the same subgroup of transcriptional activators, were also analyzed. Expression of both E2f2 and E2f3 was similar to control cells, showing no cross-inactivation or up-regulation to compensate for the absence of E2f1. Nevertheless, their expression was insufficient to maintain the initial proliferation potential. Taken together, our results suggest that shE2f1 is a promising therapy to control tumor cell proliferation.

  18. Host Recognition Responses of Western (Family: Chrysomelidae) Corn Rootworm Larvae to RNA Interference and Bt Corn.

    Science.gov (United States)

    Zukoff, Sarah N; Zukoff, Anthony L

    2017-01-01

    Western corn rootworm Diabrotica virgifera virgifera LeConte is an important pest of corn whose larvae exhibit particular quantifiable patterns of locomotion after exposure to, and removal from, host roots and nonhost roots. Using EthoVision software, the behavior and locomotion of the western corn rootworm larvae was analyzed to determine the level of host recognition to germinated roots of differing corn hybrids containing either rootworm targeted Bt genes, RNA interference (RNAi) technology, the stack of both Bt and RNAi, or the isoline of these. The behavior of the rootworm larvae indicated a significant host preference response to all corn hybrids (with or without insecticidal traits) compared to the filter paper and oat roots. A weaker host response to the RNAi corn roots was observed in the susceptible larvae when compared to the resistant larvae, but not for the Bt + RNAi vector stack. Additionally, the resistant larvae demonstrated a weaker host response to the isoline corn roots when compared to the susceptible larvae. Although weaker, these host responses were significantly different from those observed in the negative controls, indicating that all hybrids tested do contain the contact cues necessary to elicit a host preference response by both Cry3Bb1-resistant and Cry3Bb1-susceptible larvae that would work to hinder resistance development in refuge in a bag fields. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America.

  19. Increased keratinocyte proliferation initiated through downregulation of desmoplakin by RNA interference

    International Nuclear Information System (INIS)

    Wan Hong; South, Andrew P.; Hart, Ian R.

    2007-01-01

    The intercellular adhesive junction desmosomes are essential for the maintenance of tissue structure and integrity in skin. Desmoplakin (Dp) is a major obligate plaque protein which plays a fundamental role in anchoring intermediate filaments to desmosomal cadherins. Evidence from hereditary human disease caused by mutations in the gene encoding Dp, e.g. Dp haploinsufficiency, suggests that alterations in Dp expression result not only in the disruption of tissue structure and integrity but also could evoke changes in keratinocyte proliferation. We have used transient RNA interference (RNAi) to downregulate Dp specifically in HaCaT keratinocytes. We showed that this Dp downregulation also caused reduced expression of several other desmosomal proteins. Increased cell proliferation and enhanced G 1 -to-S-phase entry in the cell cycle, as monitored by colonial cellular density and BrdU incorporation, were seen in Dp RNAi-treated cells. These proliferative changes were associated with elevated phospho-ERK1/2 and phospho-Akt levels. Furthermore, this increase in phospho-ERK/1/2 and phospho-Akt levels was sustained in Dp RNAi-treated cells at confluence whereas in control cells there was a significant reduction in phosphorylation of ERK1/2. This study indicates that Dp may participate in the regulation of keratinocyte cell proliferation by, in part at least, regulating cell cycle progression

  20. RNA interference-based therapeutics: new strategies to fight infectious disease.

    Science.gov (United States)

    López-Fraga, M; Wright, N; Jiménez, A

    2008-12-01

    For many years, there has been an ongoing search for new compounds that can selectively alter gene expression as a new way to treat human disease by addressing targets that are otherwise "undruggable" with traditional pharmaceutical approaches involving small molecules or proteins. RNA interference (RNAi) strategies have raised a lot of attention and several compounds are currently being tested in clinical trials. Viruses are the obvious target for RNAi-therapy, as most are difficult to treat with conventional drugs, they become rapidly resistant to drug treatment and their genes differ substantially from human genes, minimizing side effects. Antisense strategy offers very high target specificity, i.e., any viral sequence could potentially be targeted using the complementary oligonucleotide sequence. Consequently, new antisense-based therapeutics have the potential to lead a revolution in the anti-infective drug development field. Additionally, the relatively short turnaround for efficacy testing of potential RNAi molecules and that any pathogen is theoretically amenable to rapid targeting, make them invaluable tools for treating a wide range of diseases. This review will focus on some of the current efforts to treat infectious disease with RNAi-based therapies and some of the obstacles that have appeared on the road to successful clinical intervention.

  1. Silencing of microRNA-155 in mice during acute inflammatory response leads to derepression of c/ebp Beta and down-regulation of G-CSF

    DEFF Research Database (Denmark)

    Worm, Jesper; Stenvang, Jan; Petri, Andreas

    2009-01-01

    microRNA-155 (miR-155) has been implicated as a central regulator of the immune system, but its function during acute inflammatory responses is still poorly understood. Here we show that exposure of cultured macrophages and mice to lipopolysaccharide (LPS) leads to up-regulation of miR-155......-stimulating factor (G-CSF), a central regulator of granulopoiesis during inflammatory responses. Consistent with these data, we show that silencing of miR-155 in LPS-treated mice by systemically administered LNA-antimiR results in derepression of the c/ebp Beta isoforms and down-regulation of G-CSF expression...

  2. GUItars: a GUI tool for analysis of high-throughput RNA interference screening data.

    Directory of Open Access Journals (Sweden)

    Asli N Goktug

    Full Text Available High-throughput RNA interference (RNAi screening has become a widely used approach to elucidating gene functions. However, analysis and annotation of large data sets generated from these screens has been a challenge for researchers without a programming background. Over the years, numerous data analysis methods were produced for plate quality control and hit selection and implemented by a few open-access software packages. Recently, strictly standardized mean difference (SSMD has become a widely used method for RNAi screening analysis mainly due to its better control of false negative and false positive rates and its ability to quantify RNAi effects with a statistical basis. We have developed GUItars to enable researchers without a programming background to use SSMD as both a plate quality and a hit selection metric to analyze large data sets.The software is accompanied by an intuitive graphical user interface for easy and rapid analysis workflow. SSMD analysis methods have been provided to the users along with traditionally-used z-score, normalized percent activity, and t-test methods for hit selection. GUItars is capable of analyzing large-scale data sets from screens with or without replicates. The software is designed to automatically generate and save numerous graphical outputs known to be among the most informative high-throughput data visualization tools capturing plate-wise and screen-wise performances. Graphical outputs are also written in HTML format for easy access, and a comprehensive summary of screening results is written into tab-delimited output files.With GUItars, we demonstrated robust SSMD-based analysis workflow on a 3840-gene small interfering RNA (siRNA library and identified 200 siRNAs that increased and 150 siRNAs that decreased the assay activities with moderate to stronger effects. GUItars enables rapid analysis and illustration of data from large- or small-scale RNAi screens using SSMD and other traditional analysis

  3. Establishment and Evaluation of Stable Cell Lines Inhibiting Foot-and-Mouth Disease Virus by RNA Interference

    Directory of Open Access Journals (Sweden)

    Yuan-xing Gu

    2014-01-01

    Full Text Available RNA interference (RNAi has been proved to be a powerful tool for foot-and-mouth disease virus FMDV inhibition in vitro and in vivo. We established five stable baby hamster kidney 21 cell lines (BHK-21 containing five short hairpin RNAs (shRNAs expression plasmids (p3D1shRNA, p3D2shRNA, p3D3shRNA, p3D4shRNA, and p3D5shRNA targeting 3D gene of FMDV. Immunofluorescent assay, virus titration, and real-time quantitative reverse transcription polymerase chain reaction (Q-RT-PCR were conducted to detect the effect of shRNAs on FMDV replication. After challenged with FMDV of O/CHA/99, two cell lines (p3D1shRNA and p3D4shRNA showed a significant reduction in the synthesis of viral protein and RNA, accompanied by a sharp decrease in viral yield, and the inhibition could last for at least thirty passages. We developed an efficient procedure for the establishment and evaluation of stable cell lines for anti-FMDV research based on RNAi technology, which can be a candidate method for anti-FMDV research.

  4. Efficient and nontoxic biological response carrier delivering TNF-α shRNA for gene silencing in a murine model of rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    Jialin Song

    2016-08-01

    Full Text Available Small interfering RNA (siRNA is an effective and specific method for silencing genes. However, an efficient and nontoxic carrier is needed to deliver the siRNA into the target cells. Tumor necrosis factor α (TNF-α plays a central role in the occurrence and progression of rheumatoid arthritis. In this study, we pre-synthetized a degradable cationic polymer (PDAPEI from 2,6-pyridinedicarboxaldehyde and low molecular weight polyethyleneimine (PEI, Mw=1.8 kDa as a gene vector for the delivery of TNF-α shRNA. The PDAPEI/pDNA complex showed a suitable particle size and stable zeta potential for transfection. In vitro study of the PDAPEI/pDNA complex revealed a lower cytotoxicity and higher transfection efficiency when transfecting TNF-α shRNA to macrophages by significantly down-regulating the expression of TNF-α. Moreover, the complex was extremely efficient in decreasing the severity of arthritis in mice with collagen-induced arthritis (CIA. PDAPEI delivered TNF-α shRNA has great potential in the treatment of rheumatoid arthritis.

  5. RNA interference silencing of chalcone synthase, the first step in the flavonoid biosynthesis pathway, leads to parthenocarpic tomato fruits

    NARCIS (Netherlands)

    Schijlen, E.G.W.M.; Vos, de C.H.; Martens, S.; Jonker, H.H.; Rosin, F.M.A.; Molthoff, J.W.; Tikunov, Y.M.; Angenent, G.C.; Tunen, van A.J.; Bovy, A.G.

    2007-01-01

    Parthenocarpy, the formation of seedless fruits in the absence of functional fertilization, is a desirable trait for several important crop plants, including tomato (Solanum lycopersicum). Seedless fruits can be of great value for consumers, the processing industry, and breeding companies. In this

  6. Silencing of HaAce1 gene by host-delivered artificial microRNA disrupts growth and development of Helicoverpa armigera.

    Science.gov (United States)

    Saini, Ravi Prakash; Raman, Venkat; Dhandapani, Gurusamy; Malhotra, Era Vaidya; Sreevathsa, Rohini; Kumar, Polumetla Ananda; Sharma, Tilak R; Pattanayak, Debasis

    2018-01-01

    The polyphagous insect-pest, Helicoverpa armigera, is a serious threat to a number of economically important crops. Chemical application and/or cultivation of Bt transgenic crops are the two strategies available now for insect-pest management. However, environmental pollution and long-term sustainability are major concerns against these two options. RNAi is now considered as a promising technology to complement Bt to tackle insect-pests menace. In this study, we report host-delivered silencing of HaAce1 gene, encoding the predominant isoform of H. armigera acetylcholinesterase, by an artificial microRNA, HaAce1-amiR1. Arabidopsis pre-miRNA164b was modified by replacing miR164b/miR164b* sequences with HaAce1-amiR1/HaAce1-amiR1* sequences. The recombinant HaAce1-preamiRNA1 was put under the control of CaMV 35S promoter and NOS terminator of plant binary vector pBI121, and the resultant vector cassette was used for tobacco transformation. Two transgenic tobacco lines expressing HaAce1-amiR1 was used for detached leaf insect feeding bioassays. Larval mortality of 25% and adult deformity of 20% were observed in transgenic treated insect group over that control tobacco treated insect group. The reduction in the steady-state level of HaAce1 mRNA was 70-80% in the defective adults compared to control. Our results demonstrate promise for host-delivered amiRNA-mediated silencing of HaAce1 gene for H. armigera management.

  7. Microbial Disruption of Autophagy Alters Expression of the RISC Component AGO2, a Critical Regulator of the miRNA Silencing Pathway.

    Science.gov (United States)

    Sibony, Michal; Abdullah, Majd; Greenfield, Laura; Raju, Deepa; Wu, Ted; Rodrigues, David M; Galindo-Mata, Esther; Mascarenhas, Heidi; Philpott, Dana J; Silverberg, Mark S; Jones, Nicola L

    2015-12-01

    Autophagy is implicated in Crohn's disease (CD) pathogenesis. Recent evidence suggests autophagy regulates the microRNA (miRNA)-induced silencing complex (miRISC). Therefore, autophagy may play a novel role in CD by regulating expression of miRISC, thereby altering miRNA silencing. As microbes associated with CD can alter autophagy, we hypothesized that microbial disruption of autophagy affects the critical miRISC component AGO2. AGO2 expression was assessed in epithelial and immune cells, and intestinal organoids with disrupted autophagy. Microarray technology was used to determine the expression of downstream miRNAs in cells with defective autophagy. Increased AGO2 was detected in autophagy-deficient ATG5-/- and ATG16-/- mouse embryonic fibroblast cells (MEFs) in comparison with wild-type MEFs. Chemical agents and VacA toxin, which disrupt autophagy, increased AGO2 expression in MEFs, epithelial cells lines, and human monocytes, respectively. Increased AGO2 was also detected in ATG7-/- intestinal organoids, in comparison with wild-type organoids. Five miRNAs were differentially expressed in autophagy-deficient MEFs. Pathway enrichment analysis of the differentially expressed miRNAs implicated signaling pathways previously associated with CD. Taken together, our results suggest that autophagy is involved in the regulation of the critical miRISC component AGO2 in epithelial and immune cells and primary intestinal epithelial cells. We propose a mechanism by which autophagy alters miRNA expression, which likely impacts the regulation of CD-associated pathways. Furthermore, as enteric microbial products can manipulate autophagy and AGO2, our findings suggest a novel mechanism by which enteric microbes could influence miRNA to promote disease.

  8. Targeted transfection increases siRNA uptake and gene silencing of primary endothelial cells in vitro - A quantitative study

    NARCIS (Netherlands)

    Asgeirsdottir, Sigridur A.; Talman, Eduard G.; de Graaf, Inge A.; Kamps, Jan A. A. M.; Satchell, Simon C.; Mathieson, Peter W.; Ruiters, Marcel H. J.; Molema, Grietje

    2010-01-01

    Applications of small-interfering RNA (siRNA) call for specific and efficient delivery of siRNA into particular cell types. We developed a novel, non-viral targeting system to deliver siRNA specifically into inflammation-activated endothelial cells. This was achieved by conjugating the cationic

  9. Nucleases as a barrier to gene silencing in the cotton boll weevil, Anthonomus grandis.

    Science.gov (United States)

    Almeida Garcia, Rayssa; Lima Pepino Macedo, Leonardo; Cabral do Nascimento, Danila; Gillet, François-Xavier; Moreira-Pinto, Clidia Eduarda; Faheem, Muhammad; Moreschi Basso, Angelina Maria; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

    2017-01-01

    RNA interference (RNAi) approaches have been applied as a biotechnological tool for controlling plant insect pests via selective gene down regulation. However, the inefficiency of RNAi mechanism in insects is associated with several barriers, including dsRNA delivery and uptake by the cell, dsRNA interaction with the cellular membrane receptor and dsRNA exposure to insect gut nucleases during feeding. The cotton boll weevil (Anthonomus grandis) is a coleopteran in which RNAi-mediated gene silencing does not function efficiently through dsRNA feeding, and the factors involved in the mechanism remain unknown. Herein, we identified three nucleases in the cotton boll weevil transcriptome denoted AgraNuc1, AgraNuc2, and AgraNuc3, and the influences of these nucleases on the gene silencing of A. grandis chitin synthase II (AgraChSII) were evaluated through oral dsRNA feeding trials. A phylogenetic analysis showed that all three nucleases share high similarity with the DNA/RNA non-specific endonuclease family of other insects. These nucleases were found to be mainly expressed in the posterior midgut region of the insect. Two days after nuclease RNAi-mediated gene silencing, dsRNA degradation by the gut juice was substantially reduced. Notably, after nucleases gene silencing, the orally delivered dsRNA against the AgraChSII gene resulted in improved gene silencing efficiency when compared to the control (non-silenced nucleases). The data presented here demonstrates that A. grandis midgut nucleases are effectively one of the main barriers to dsRNA delivery and emphasize the need to develop novel RNAi delivery strategies focusing on protecting the dsRNA from gut nucleases and enhancing its oral delivery and uptake to crop insect pests.

  10. Effect of Circular RNA UBAP2 Silencing on Proliferation and Invasion of Human Lung Cancer A549 Cells and Its Mechanism

    Directory of Open Access Journals (Sweden)

    Yujing YIN

    2017-12-01

    Full Text Available Background and objective It has been proven that circular RNAs (circRNAs play an important role on the process of many types cancer and circUBAP2 was a cancer-promoting circRNA, however, the role and mechanism in lung cancer was not clear. The aim of this study is to investigate the effects of circUBAP2 on cell proliferation and invasion of human lung cancer A549 cells. Methods CCK-8 assay was employed to detect the effect of circUBAP2 sliencing on cell proliferation of A549 cells. Fow cytometry was applied to detect the impact of circUBAP2 sliencing on cell cycle and cell anoikis, and Transwell invasion assay was applied to determine cell invasion of A549 cells. We also employed Western blot and Real-time PCR to determine the expressions of CDK6, cyclin D1, p27 and c-IAP1, Bcl-2, Survivin, Bax, FAK, Rac1 and MMP2, and the activities of JNK and ERK1/2, luciferase report gene assay was used to detect the targets. Results CCK-8 assay showed that the inhibition of cell proliferation in the circUBAP2-siRNA group compared to untreated group and siRNA control group. Results of cell cycle detected by flow cytometry showed that cell cycle arrestd at G0/G1 after circUBAP2 silencing, cell apoptosis rate increased also. We also found that after circUBAP2 silencing, cell invasion of A549 cells was significantly inhibited. Western blot and Real-time PCR results showed that expression of CDK6, cyclin D1, c-IAP1, Bcl-2, Survivin, FAK, Rac1 and MMP2 were down-regulated, and the expression of p27 and Bax were up-regulated. Moreover, the activities of JNK and ERK1/2 were inhibited because of circUBAP2 silencing, the target genes were miR-339-5p, miR-96-3p and miR-135b-3p. Conclusion CircUBAP2 plays an important role in the proliferation and invasion of human lung cancer. Silencing of circUBAP2 might be a novel target for molecular targeted therapy of patients with lung cancer.

  11. A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi.

    Science.gov (United States)

    Tsai, Hsin-Yue; Chen, Chun-Chieh G; Conte, Darryl; Moresco, James J; Chaves, Daniel A; Mitani, Shohei; Yates, John R; Tsai, Ming-Daw; Mello, Craig C

    2015-01-29

    Effective silencing by RNA-interference (RNAi) depends on mechanisms that amplify and propagate the silencing signal. In some organisms, small-interfering RNAs (siRNAs) are amplified from target mRNAs by RNA-dependent RNA polymerase (RdRP). Both RdRP recruitment and mRNA silencing require Argonaute proteins, which are generally thought to degrade RNAi targets by directly cleaving them. However, in C. elegans, the enzymatic activity of the primary Argonaute, RDE-1, is not required for silencing activity. We show that RDE-1 can instead recruit an endoribonuclease, RDE-8, to target RNA. RDE-8 can cleave RNA in vitro and is needed for the production of 3' uridylated fragments of target mRNA in vivo. We also find that RDE-8 promotes RdRP activity, thereby ensuring amplification of siRNAs. Together, our findings suggest a model in which RDE-8 cleaves target mRNAs to mediate silencing, while generating 3' uridylated mRNA fragments to serve as templates for the RdRP-directed amplification of the silencing signal. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Combining RNA interference and kinase inhibitors against cell signalling components involved in cancer

    International Nuclear Information System (INIS)

    O'Grady, Michael; Raha, Debasish; Hanson, Bonnie J; Bunting, Michaeline; Hanson, George T

    2005-01-01

    The transcription factor activator protein-1 (AP-1) has been implicated in a large variety of biological processes including oncogenic transformation. The tyrosine kinases of the epidermal growth factor receptor (EGFR) constitute the beginning of one signal transduction cascade leading to AP-1 activation and are known to control cell proliferation and differentiation. Drug discovery efforts targeting this receptor and other pathway components have centred on monoclonal antibodies and small molecule inhibitors. Resistance to such inhibitors has already been observed, guiding the prediction of their use in combination therapies with other targeted agents such as RNA interference (RNAi). This study examines the use of RNAi and kinase inhibitors for qualification of components involved in the EGFR/AP-1 pathway of ME180 cells, and their inhibitory effects when evaluated individually or in tandem against multiple components of this important disease-related pathway. AP-1 activation was assessed using an ME180 cell line stably transfected with a beta-lactamase reporter gene under the control of AP-1 response element following epidermal growth factor (EGF) stimulation. Immunocytochemistry allowed for further quantification of small molecule inhibition on a cellular protein level. RNAi and RT-qPCR experiments were performed to assess the amount of knockdown on an mRNA level, and immunocytochemistry was used to reveal cellular protein levels for the targeted pathway components. Increased potency of kinase inhibitors was shown by combining RNAi directed towards EGFR and small molecule inhibitors acting at proximal or distal points in the pathway. After cellular stimulation with EGF and analysis at the level of AP-1 activation using a β-lactamase reporter gene, a 10–12 fold shift or 2.5–3 fold shift toward greater potency in the IC 50 was observed for EGFR and MEK-1 inhibitors, respectively, in the presence of RNAi targeting EGFR. EGFR pathway components were qualified as

  13. Defective RNA particles derived from Tomato black ring virus genome interfere with the replication of parental virus.

    Science.gov (United States)

    Hasiów-Jaroszewska, Beata; Minicka, Julia; Zarzyńska-Nowak, Aleksandra; Budzyńska, Daria; Elena, Santiago F

    2018-05-02

    Tomato black ring virus (TBRV) is the only member of the Nepovirus genus that is known to form defective RNA particles (D RNAs) during replication. Here, de novo generation of D RNAs was observed during prolonged passages of TBRV isolates originated from Solanum lycopersicum and Lactuca sativa in Chenopodium quinoa plants. D RNAs of about 500 nt derived by a single deletion in the RNA1 molecule and contained a portion of the 5' untranslated region and viral replicase, and almost the entire 3' non-coding region. Short regions of sequence complementarity were found at the 5' and 3' junction borders, which can facilitate formation of the D RNAs. Moreover, in this study we analyzed the effects of D RNAs on TBRV replication and symptoms development of infected plants. C. quinoa, S. lycopersicum, Nicotiana tabacum, and L. sativa were infected with the original TBRV isolates (TBRV-D RNA) and those containing additional D RNA particles (TBRV + D RNA). The viral accumulation in particular hosts was measured up to 28 days post inoculation by RT-qPCR. Statistical analyses revealed that D RNAs interfere with TBRV replication and thus should be referred to as defective interfering particles. The magnitude of the interference effect depends on the interplay between TBRV isolate and host species. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Downregulation of CD147 expression by RNA interference inhibits HT29 cell proliferation, invasion and tumorigenicity in vitro and in vivo.

    Science.gov (United States)

    Li, Rui; Pan, Yuqin; He, Bangshun; Xu, Yeqiong; Gao, Tianyi; Song, Guoqi; Sun, Huiling; Deng, Qiwen; Wang, Shukui

    2013-12-01

    We investigated the effect of CD147 silencing on HT29 cell proliferation and invasion. We constructed a novel short hairpin RNA (shRNA) expression vector pYr-mir30-shRNA. The plasmid was transferred to HT29 cells. The expression of CD147, MCT1 (lactate transporters monocarboxylate transporter 1) and MCT4 (lactate transporters monocarboxylate transporter 4) were monitored by quantitative PCR and western blotting, respectively. The MMP-2 (matrix metalloproteinase-2) and MMP-9 (matrix metalloproteinase-9) activities were determined by gelatin zymography assay, while the intracellular lactate concentration was determined by the lactic acid assay kit. WST-8 assay was used to determine the HT29 cell proliferation and the chemosensitivity. Invasion assay was used to determine the invasion of HT29 cells. In addition, we established a colorectal cancer model, and detected CD147 expression in vivo. The results showed that the expression of CD147 and MCT1 was significantly reduced at both mRNA and protein levels, and also the activity of MMP-2 and MMP-9 was reduced. The proliferation and invasion were decreased, but chemosensitivity to cisplatin was increased. In vivo, the CD147 expression was also significantly decreased, and reduced the tumor growth after CD147 gene silencing. The results demonstrated that silencing of CD147 expression inhibited the proliferation and invasion, suggesting CD147 silencing might be an adjuvant gene therapy strategy to chemotherapy.

  15. Inhibition of Androgen-Independent Growth of Prostate Cancer by siRNA- Mediated Androgen Receptor Gene Silencing

    Science.gov (United States)

    2008-02-01

    and then photographed using a digital camera . AAV production and infection. To silence AR gene expression, a hairpin- structured expression vector...Sandusky GE, Vessella RL, Neubauer BL. Increased AKT activity contributes to prostate cancer progression by dramatically accelerating prostate tumor...HeNe laser. The spectrograph has an f/2.0 Czerny–Turner imaging spec- trometer plus a thermo-electrically cooled Kodak 0401 CCD camera . The fiberoptic

  16. Effects of siRNA Silencing of TUG1 and LCAL6 Long Non-coding RNAs on Patient-derived Xenograft of Non-small Cell Lung Cancer.

    Science.gov (United States)

    Fang, Tian; Huang, Hairong; Li, Xiaoyou; Liao, Jing; Yang, Zhijian; Hoffman, Robert M; Cheng, X I; Liang, Lei; Hu, Wenjuan; Yun, Shifeng

    2018-01-01

    The aim of the present study was to establish a patient-derived xenograft (PDX) mouse model of non-small cell lung cancer (NSCLC) and investigate the anti-tumor efficacy of silencing of TUG1 and LCAL6 long non-coding RNA in the PDX model. PDXs were established by subcutaneously implanting NSCLC surgical tumor fragments into immunodeficient mice. PDX characterization was performed by histopathological, immunohistochemical and real-time polymerase chain reaction (RT-PCR) analyses for NSCLC subtype-specific markers and expression of LCAL6 and TUG1. Anti-tumor efficacy of siRNA silencing of TUG1 and LCAL6 was also investigated in the PDX model. The effect of TUG1 and LCAL6 silencing on protein expression of proliferation marker Ki67 and HOX-gene family HOXB7 in the tumors was assessed by immunohistochemical staining and Western blotting. Establishment of NSCLC PDX models resulted in 9 of 26 cases (34.6%). Lung squamous cell carcinomas (SCC) had a higher engraftment rate (58.3%) than lung adenocarcinomas (ADC) (18.2%) (pTUG1. The tumor volume and weight were significantly reduced in the TUG1-silenced group as compared to the control group (p0.05). Expression of both TUG1and LCAL6 was reduced by siRNA treatment. Expression of Ki67 and HOXB7 was significantly suppressed in both the TUG1- and LCAL6-silenced groups compared to the control group (pTUG1-silenced group showed more reduced Ki67 expression than the LCAL6-silenced group (pTUG1 and LCAL6. Silencing of TUG1 inhibited both tumor growth and expression of the proliferation marker Ki67 and HOX-gene family HOXB7 in the PDX model of NSCLC. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  17. Silence multiple

    DEFF Research Database (Denmark)

    Søndergaard, Katia Dupret

    The article highlights the importance of silences in the processes of innovation in organizations, and the claim is that silence and the absence of talk distribute authority, responsibility and decisions. The act of silencing is conceptualised as a central “configurating actor”. Using an Actor......-Network Theoretical approach to organization studies silence is conceptualised as both a means and an effect of innovative efforts. It is a way of ordering practices. Thus silencing is thought of as a central potential change agent both in composing a kind of specific organizational collectivity and in composing new...... working practices more generally. In line with the approach to destabilise the mundane, invisible and taken-for-granted aspects of innovative efforts in organisations (crucial for ANT and foucauldian post-structuralism more broadly), this article suggests to non-silence the silence and make...

  18. The double-stranded RNA binding protein RDE-4 can act cell autonomously during feeding RNAi in C. elegans.

    Science.gov (United States)

    Raman, Pravrutha; Zaghab, Soriayah M; Traver, Edward C; Jose, Antony M

    2017-08-21

    Long double-stranded RNA (dsRNA) can silence genes of matching sequence upon ingestion in many invertebrates and is therefore being developed as a pesticide. Such feeding RNA interference (RNAi) is best understood in the worm Caenorhabditis elegans, where the dsRNA-binding protein RDE-4 initiates silencing by recruiting an endonuclease to process long dsRNA into short dsRNA. These short dsRNAs are thought to move between cells because muscle-specific rescue of rde-4 using repetitive transgenes enables silencing in other tissues. Here, we extend this observation using additional promoters, report an inhibitory effect of repetitive transgenes, and discover conditions for cell-autonomous silencing in animals with tissue-specific rescue of rde-4. While expression of rde-4(+) in intestine, hypodermis, or neurons using a repetitive transgene can enable silencing also in unrescued tissues, silencing can be inhibited wihin tissues that express a repetitive transgene. Single-copy transgenes that express rde-4(+) in body-wall muscles or hypodermis, however, enable silencing selectively in the rescued tissue but not in other tissues. These results suggest that silencing by the movement of short dsRNA between cells is not an obligatory feature of feeding RNAi in C. elegans. We speculate that similar control of dsRNA movement could modulate tissue-specific silencing by feeding RNAi in other invertebrates. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Control of HIV-1 env RNA splicing and transport: investigating the role of hnRNP A1 in exon splicing silencer (ESS3a) function

    International Nuclear Information System (INIS)

    Asai, Kengo; Platt, Craig; Cochrane, Alan

    2003-01-01

    The control of HIV-1 viral RNA splicing and transport plays an important role in the successful replication of the virus. Previous studies have identified both an exon splicing enhancer (ESE) and a bipartite exon splicing silencer (ESS3a and ESS3b) within the terminal exon of HIV-1 that are involved in modulating both splicing and Rev-mediated export of viral RNA. To define the mechanism of ESS3a function, experiments were carried out to better define the cis and trans components required for ESS3a activity. Mutations throughout the 30-nt element resulted in partial loss of ESS function. Combining mutations was found to have an additive effect, suggesting the presence of multiple binding sites. Analysis of interacting factors identified hnRNP A1 as one component of the complex that modulates ESS3a activity. However, subsequent binding analyses determined that hnRNP A1 interacts with only one portion of ESS3a, suggesting the involvement of another host factor. Parallel analysis of the effect of the mutations on Rev-mediated export determined that there is not a direct correlation between the effect of the mutations on splicing and RNA transport. Consistent with this hypothesis, replacement of ESS3a with consensus hnRNP A1 binding sites was found to be insufficient to block Rev-mediated RNA export

  20. The RNA helicase Rm62 cooperates with SU(VAR3-9 to re-silence active transcription in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Joern Boeke

    Full Text Available Gene expression is highly dynamic and many genes show a wide range in expression over several orders of magnitude. This regulation is often mediated by sequence specific transcription factors. In addition, the tight packaging of DNA into chromatin can provide an additional layer of control resulting in a dynamic range of gene expression covering several orders of magnitude. During transcriptional activation, chromatin barriers have to be eliminated to allow an efficient progression of the RNA polymerase. This repressive chromatin structure has to be re-established quickly after it has been activated in order to tightly regulate gene activity. We show that the DExD/H box containing RNA helicase Rm62 is targeted to a site of rapid induction of transcription where it is responsible for an increased degree of methylation at H3K9 at the heat shock locus after removal of the heat shock stimulus. The RNA helicase interacts with the well-characterized histone methyltransferase SU(VAR3-9 via its N-terminus, which provides a potential mechanism for the targeting of H3K9 methylation to highly regulated genes. The recruitment of SU(VAR3-9 through interaction with a RNA helicase to a site of active transcription might be a general mechanism that allows an efficient silencing of highly regulated genes thereby enabling a cell to fine tune its gene activity over a wide range.

  1. [Expression of Jagged1 mRNA in human epithelial ovarian carcinoma tissues and effect of RNA interference of Jagged1 on growth of xenograft in nude mice].

    Science.gov (United States)

    Liu, G Y; Gao, Z H; Li, L; Song, T T; Sheng, X G

    2016-06-25

    To investigate the expression of Jagged1 in human epithelial ovarian carcinoma tissues and the effect of Jagged1 on growth of xenograft in nude mice. (1) Forty-eight cases of ovarian cancer and 30 cases of patients with benign epithelial ovarian tumor in the Henan Province Xinxiang Central Hospital during Feb. 2011 to Mar. 2014 were enrolled in this study. The mRNA expression of Jagged1, Notch1 and the downstream target genes Hes1, Hey1 were analyzed by using realtime PCR method. (2) The ovarian cancer xenograft models in nude mice were constructed by injecting SKOV3 cells in axillary subcutaneouswere. The nude mice were randomly divided into Jagged1 interference group, blank plasmid group and control group. Each group had 10 mice. They were transfected with pcDNA3.1(+)-siRNA-Jagged1, blank plasmid pDC3.1 and phosphate buffer, respectively. The tumor volumes and tumor masses were measured 14 days after transfection and the inhibition rate was calculated. The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues after transfection in each group was detected by using realtime PCR technique and the relative protein expression of Jagged1, Notch1, Hes1 and Hey1 in xenograft tissues was detected by utilizing western blot method. (1) The relative mRNA expression of Jagged1, Notch1, Hes1 and Hey1 in ovarian cancer tissues were higher than benign ovarian tumor tissues, the differences were statistically significant (Ptissues of nude micein Jagged1 interference group were lower than that in the other two groups, the differences were statistically significant (Ptissues of nude mice among the three groups (P>0.05). Jagged1 is highly expressed in epithelial ovarian carcinoma. Jagged1 gene interference in xenograft tumor can inhibit ovarian cancer cell growth and improve tumor suppressor rate, which probably play roles by inhibiting Notch1 signaling pathway.

  2. Lentivirus-mediated RNA interference of vascular endothelial growth factor in monkey eyes with iris neovascularization.

    Science.gov (United States)

    Yuan, Meng-Ke; Tao, Yong; Yu, Wen-Zhen; Kai, Wang; Jiang, Yan-Rong

    2010-08-25

    To explore the in vivo anti-angiogenesis effects resulting from lentivirus-mediated RNAi of vascular endothelial growth factor (VEGF) in monkeys with iris neovascularization (INV). Five specific recombinant lentiviral vectors for RNA interference, targeting Macaca mulatta VEGFA, were designed and the one with best knock down efficacy (LV-GFP-VEGFi1) in H1299 cells and RF/6A cells was selected by real-time PCR for in vivo use. A laser-induced retinal vein occlusion model was established in one eye of seven cynomolgus monkeys. In monkeys number 1, 3, and 5 (Group 1), the virus (1x10(8) particles) was intravitreally injected into the preretinal space of the animal's eye immediately after laser coagulation; and in monkeys number 2, 4, and 6 (Group 2), the virus (1x10(8) particles) was injected at 10 days after laser coagulation. In monkey number 7, a blank control injection was performed. In monkeys number 1 and 2, virus without RNAi sequence was used; in monkeys number 3 and 4, virus with nonspecific RNAi sequence was used; and in monkeys 5 and 6, LV-GFP-VEGFi1 was used. In monkey number 5, at 23 days after laser treatment, no obvious INV was observed, while fluorescein angiography of the iris revealed high fluorescence at the margin of pupil and point posterior synechiae. At 50 days after laser treatment, only a slight ectropion uvea was found. However, in the other eyes, obvious INV or hyphema was observed. The densities of new iridic vessels all significantly varied: between monkey number 5 and number 3 (36.01+/-4.49/mm(2) versus 48.68+/-9.30/mm(2), p=0.025), between monkey number 3 and monkey number 7 (48.68+/-9.30/mm(2) versus 74.38+/-9.23/mm(2), p=0.002), and between monkey number 5 and number 7 (36.01+/-4.49/mm(2) versus 74.38+/-9.23/mm(2), p<0.001). Lentivirus-mediated RNAi of VEGF may be a new strategy to treat iris neovascularization, while further studies are needed to investigate the long-term effect.

  3. [Inhibitory effect of RNA interference targeting GFI-1 on the proliferation of atypical chronic myelogenous leukemia NT1 cells].

    Science.gov (United States)

    Yang, X; Liu, H; Lin, Z H; Qian, J; Xu, X R

    2016-08-01

    To investigate the inhibitory effects of RNA interference targeting GFI-1 on growth and proliferation of atypical chronic myelogenous leukemia (aCML) NT1 cells. NT1 cells were transfected with PBS and liposome complex (vehicle group), scrambled siRNA and liposome complex (negative control, NC group), and GFI-1 siRNA and liposome complex (GFI-1 siRNA group), respectively. Real-time quantitative RT-PCR (qRT-PCR) and Western blot were performed to examine the expression levels of GFI-1 mRNA and protein, respectively. The proliferation abilities of NT1 cells of the three groups were evaluated by MTT assay. The cell cycle in cells of the three groups was analyzed by flow cytometry. Moreover, nude mouse xenograft model was used to detect the tumor formation ability in the three group cells. Quantitative real-time PCR data showed that the expression level of GFI-1 mRNA in GFI-1 siRNA group was significantly lower than those of NC group and vehicle group [(0.367±0.017) vs. (0.918±0.006) and (1.010±0.005), respectively, (PNT1 cells in the GFI-1 siRNA group (0.667±0.059) was significantly lower than those of the NC group (1.096±0.049) and vehicle group (1.193±0.064, P=0.023). Flow cytometry data showed that sub-G1 and G0/G1 phase proportions of the GFI-1 siRNA group were significantly higher than those of the NC and vehicle groups [sub-G1: (8.2±2.5)% vs. (1.9±1.3)% and (2.0±3.6)%, respectively, (PNT1 cells, which may provide a new therapeutic target for atypical chronic myelogenous leukemia.

  4. MeCP2 silencing of LncRNA H19 controls hepatic stellate cell proliferation by targeting IGF1R

    International Nuclear Information System (INIS)

    Yang, Jing-Jing; Liu, Li-Ping; Tao, Hui; Hu, Wei; Shi, Peng; Deng, Zi-Yu; Li, Jun

    2016-01-01

    Highlights: • H19 plays a key role in HSCs proliferation and fibrosis. • MeCP2/H19 axis involvement in HSCs activation and fibrosis. • MeCP2 negative controls H19 expression in activated HSCs. • Identification of IGF1R as new target of H19 in HSC. - Abstract: Methyl-CpG-binding protein 2 (MeCP2) plays a key role in liver fibrosis. However, the potential mechanism of MeCP2 in liver fibrosis remains unclear. Early reports suggest that LncRNA H19 is important epigenetic regulator with critical roles in cell proliferation, but its role in hepatic fibrosis remains elusive. Sprague-Dawley rats liver fibrosis was generated by 12-weeks treatment with CCl 4 intraperitoneal injection. HSC-T6 cells were used in vitro study. The expression levels of MeCP2, H19, IGF1R, α-SMA, and Col1A1 were estimated by Western blotting, qRT-PCR and Immunohistochemistry. HSC-T6 cells were transfected with MeCP2-siRNA, pEGF-C1-MeCP2, pEX-3-H19, and H19-siRNA. Finally, cell proliferation ability was assessed by the MTT assay. Here, we found that H19 was significantly down-regulated in HSCs and fibrosis tissues, and an opposite pattern is observed for MeCP2 and IGF1R. Silencing of MeCP2 blocked HSCs proliferation. Knockdown of MeCP2 elevated H19 expression in activated HSCs, and over-expression of MeCP2 inhibited H19 expression in activated HSCs. Moreover, we investigated the effect of H19 on IGF1R expression. Overexpression of H19 in HSCs repressed the expression of IGF1R, and an opposite pattern is observed for H19 silenced. In addition, we reported that overexpression of H19 inhibited the TGF-β1-induced proliferation of HSCs. Furthermore, MeCP2 negative regulation of H19 by targeting the protein IGF1R. Taken together, these results demonstrated that MeCP2 silencing of H19 can alter the IGF1R overexpression, thus contributing to HSCs proliferation. These data could suggest the development of combination therapies that target the MeCP2.

  5. Overcoming cisplatin resistance in non-small cell lung cancer with Mad2 silencing siRNA delivered systemically using EGFR-targeted chitosan nanoparticles.

    Science.gov (United States)

    Nascimento, Ana Vanessa; Singh, Amit; Bousbaa, Hassan; Ferreira, Domingos; Sarmento, Bruno; Amiji, Mansoor M

    2017-01-01

    Efficiency of chemotherapy is often limited by low therapeutic index of the drug as well as emergence of inherent and acquired drug resistance in cancer cells. As a common strategy to overcome drug resistance, higher doses of chemo-agents are administered. However, adverse side effects are usually increased as a consequence. A potentially effective approach is to combine chemotherapy with other therapeutic strategies such as small interfering RNAs (siRNAs) that allow the use of lower yet efficient doses of the anticancer drugs. We previously developed epidermal growth factor receptor (EGFR)-targeted chitosan (CS) nanoparticles as a versatile delivery system for silencing the essential mitotic checkpoint gene Mad2, and induce cell death. Here, we tested this system as a single therapy and in combination with cisplatin in cisplatin sensitive and resistant lung cancer models, and characterized its in vivo efficacy and safety. Combination treatment resulted in significant improvement in tumor inhibition that was strikingly more effective in cisplatin-resistant tumors. Importantly, effective cisplatin dosage was dramatically reduced in the co-therapy regimen resulting in negligible toxic effects from the drug as confirmed by parameters such as body weight gain, biochemical markers of hepatic and renal function, and histopathology of liver/kidney/spleen tissues. Overall, we demonstrate that the combination of Mad2 siRNA-loaded CS nanoparticles strategy with chemotherapeutic agents such as cisplatin constitutes an efficient and safe approach for the treatment of drug resistant tumors. Lung cancer remains one of the leading killers in the United States and around the world. Platinum agents, including cisplatin, are the first line treatment in lung cancer, including non-small cell lung cancer (NSCLC), which is the predominant form of lung cancer. In this study, we have evaluated Mad2 cell-cycle checkpoint gene silencing using small interfering RNA (siRNA) delivered

  6. Multifunctional triblock co-polymer mP3/4HB-b-PEG-b-lPEI for efficient intracellular siRNA delivery and gene silencing.

    Science.gov (United States)

    Zhou, Li; Chen, Zhifei; Wang, Feifei; Yang, Xiuqun; Zhang, Biliang

    2013-04-01

    A non-viral siRNA carrier composed of mono-methoxy-poly (3-hydroxybutyrate-co-4-hydroxybutyrate)-block-polyethylene glycol-block-linear polyethyleneimine (mP3/4HB-b-PEG-b-lPEI) was synthesized using 1800 Da linear polyethyleneimine and evaluated for siRNA delivery. Our study demonstrated that siRNA could be efficiently combined with mP3/4HB-b-PEG-b-lPEI (mAG) co-polymer and was protected from nuclease degradation. The combined siRNA were released from the complexes easily under heparin competition. The particle size of the mAG/siRNA complexes was 158 nm, with a ζ-potential of around 28 mV. Atomic force microscopy images displayed spherical and homogeneously distributed complexes. The mAG block co-polymer displayed low cytotoxicity and efficient cellular uptake of Cy3-siRNA in A549 cells by flow cytometry and confocal microscopy. In vitro transfection efficiency of the block co-polymer was assessed using siRNA against luciferase in cultured A549-Luc, HeLa-Luc, HLF-Luc, A375-Luc and MCF-7-Luc cells. A higher transfection efficiency and lower cytotoxicity was obtained by mAG block co-polymer in five cell lines. Furthermore, a remarkable improvement in luciferase gene silencing efficiency of the mAG complex (up to 90-95%) over that of Lipofectamine™ 2000 (70-82%) was observed in HLF-Luc and A375-Luc cells. Additionally, a mAG/p65-siRNA complex also showed a better capability than Lipofectamine™ 2000/p65-siRNA complex to drastically reduce the p65 mRNA level down to 10-16% in HeLa, U251 and HUVEC cells at an N/P ratio of 70. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  7. Transduction of hematopoietic stem cells to stimulate RNA interference against feline infectious peritonitis.

    Science.gov (United States)

    Anis, Eman A; Dhar, Madhu; Legendre, Alfred M; Wilkes, Rebecca P

    2017-06-01

    Objectives The goals of the study were: (1) to develop and evaluate non-replicating lentivirus vectors coding for feline coronavirus (FCoV)-specific micro (mi)RNA as a potential antiviral therapy for feline infectious peritonitis (FIP); (2) to assess the feasibility of transducing hematopoietic stem cells (HSCs) with ex vivo introduction of the miRNA-expressing lentivirus vector; and (3) to assess the ability of the expressed miRNA to inhibit FCoV replication in HSCs in vitro. Methods HSCs were obtained from feline bone marrow and replicated in vitro. Three lentiviruses were constructed, each expressing a different anti-FCoV miRNA. HSCs were stably transduced with the miRNA-expressing lentivirus vector that produced the most effective viral inhibition in a feline cell line. The effectiveness of the transduction and the expression of anti-FCoV miRNA were tested by infecting the HSCs with two different strains of FCoV. The inhibition of coronavirus replication was determined by relative quantification of the inhibition of intracellular viral genomic RNA synthesis using real-time, reverse-transcription PCR. The assessment of virus replication inhibition was determined via titration of extracellular virus using the TCID 50 assay. Results Inhibition of FCoV was most significant in feline cells expressing miRNA-L2 that targeted the viral leader sequence, 48 h postinfection. miRNA-L2 expression in stably transduced HSCs resulted in 90% and 92% reductions in FIPV WSU 79-1146 genomic RNA synthesis and extracellular virus production, respectively, as well as 74% and 80% reduction in FECV WSU 79-1683 genomic RNA synthesis and extracellular virus production, respectively, as compared with an infected negative control sample producing non-targeting miRNA. Conclusions and relevance These preliminary results show that genetic modification of HSCs for constitutive production of anti-coronavirus miRNA will reduce FCoV replication.

  8. Identification of a novel cytochrome P450 CYP321B1 gene from tobacco cutworm (Spodoptera litura) and RNA interference to evaluate its role in commonly used insecticides.

    Science.gov (United States)

    Wang, Rui-Long; Zhu-Salzman, Keyan; Baerson, Scott R; Xin, Xiao-Wei; Li, Jun; Su, Yi-Juan; Zeng, Ren-Sen

    2017-04-01

    Insect cytochrome P450 monooxygenases (CYPs or P450s) play an important role in detoxifying insecticides leading to resistance in insect populations. A polyphagous pest, Spodoptera litura, has developed resistance to a wide range of insecticides. In the present study, a novel P450 gene, CYP321B1, was cloned from S. litura. The function of CYP321B1 was assessed using RNA interference (RNAi) and monitoring resistance levels for three commonly used insecticides, including chlorpyrifos, β-cypermethrin and methomyl. The full-length complementary DNA sequence of CYP321B1 is 1814 bp long with an open reading frame of 1 488 bp encoding 495 amino acid residues. Quantitative reverse-transcriptase polymerase chain reaction analyses during larval and pupal development indicated that CYP321B1 expression was highest in the midgut of fifth-instar larvae, followed by fat body and cuticle. The expression of CYP321B1 in the midgut was up-regulated by chlorpyrifos, β-cypermethrin and methomyl with both lethal concentration at 15% (LC 15 ) (50, 100 and 150 μg/mL, respectively) and 50%(LC 50 ) dosages (100, 200 and 300 μg/mL, respectively). Addition of piperonyl butoxide (PBO) significantly increased the toxicity of chlorpyrifos, β-cypermethrin and methomyl to S. litura, suggesting a marked synergism of the three insecticides with PBO and P450-mediated detoxification. RNAi-mediated silencing of CYP321B1 further increased mortality by 25.6% and 38.9% when the fifth-instar larvae were exposed to chlorpyrifos and β-cypermethrin, respectively, at the LC 50 dose levels. The results demonstrate that CYP321B1 might play an important role in chlorpyrifos and β-cypermethrin detoxification in S. litura. © 2016 Institute of Zoology, Chinese Academy of Sciences.

  9. Therapeutic Silencing of Bcl-2 by Systemically Administered siRNA Nanotherapeutics Inhibits Tumor Growth by Autophagy and Apoptosis and Enhances the Efficacy of Chemotherapy in Orthotopic Xenograft Models of ER (− and ER (+ Breast Cancer

    Directory of Open Access Journals (Sweden)

    Ibrahim Tekedereli

    2013-01-01

    Full Text Available Bcl-2 is overexpressed in about a half of human cancers and 50–70% of breast cancer patients, thereby conferring resistance to conventional therapies and making it an excellent therapeutic target. Small interfering RNA (siRNA offers novel and powerful tools for specific gene silencing and molecularly targeted therapy. Here, we show that therapeutic silencing of Bcl-2 by systemically administered nanoliposomal (NL-Bcl-2 siRNA (0.15 mg siRNA/kg, intravenous twice a week leads to significant antitumor activity and suppression of growth in both estrogen receptor-negative (ER(− MDA-MB-231 and ER-positive (+ MCF7 breast tumors in orthotopic xenograft models (P < 0.05. A single intravenous injection of NL-Bcl-2-siRNA provided robust and persistent silencing of the target gene expression in xenograft tumors. NL-Bcl-2-siRNA treatment significantly increased the efficacy of chemotherapy when combined with doxorubicin in both MDA-MB-231 and MCF-7 animal models (P < 0.05. NL-Bcl-2-siRNA treatment-induced apoptosis and autophagic cell death, and inhibited cyclin D1, HIF1α and Src/Fak signaling in tumors. In conclusion, our data provide the first evidence that in vivo therapeutic targeting Bcl-2 by systemically administered nanoliposomal-siRNA significantly inhibits growth of both ER(− and ER(+ breast tumors and enhances the efficacy of chemotherapy, suggesting that therapeutic silencing of Bcl-2 by siRNA is a viable approach in breast cancers.

  10. The Nuclear Cap-Binding Complex Mediates Meiotic Silencing by Unpaired DNA

    Directory of Open Access Journals (Sweden)

    Logan M. Decker

    2017-04-01

    Full Text Available In the filamentous fungus Neurospora crassa, cross walls between individual cells are normally incomplete, making the entire fungal network vulnerable to attack by viruses and selfish DNAs. Accordingly, several genome surveillance mechanisms are maintained to help the fungus combat these repetitive elements. One of these defense mechanisms is called meiotic silencing by unpaired DNA (MSUD, which identifies and silences unpaired genes during meiosis. Utilizing common RNA interference (RNAi proteins, such as Dicer and Argonaute, MSUD targets mRNAs homologous to the unpaired sequence to achieve silencing. In this study, we have identified an additional silencing component, namely the cap-binding complex (CBC. Made up of cap-binding proteins CBP20 and CBP80, CBC associates with the 5′ cap of mRNA transcripts in eukaryotes. The loss of CBC leads to a deficiency in MSUD activity, suggesting its role in mediating silencing. As confirmed in this study, CBC is predominantly nuclear, although it is known to travel in and out of the nucleus to facilitate RNA transport. As seen in animals but not in plants, CBP20’s robust nuclear import depends on CBP80 in Neurospora. CBC interacts with a component (Argonaute of the perinuclear meiotic silencing complex (MSC, directly linking the two cellular factors.

  11. Improving model predictions for RNA interference activities that use support vector machine regression by combining and filtering features

    Directory of Open Access Journals (Sweden)

    Peek Andrew S

    2007-06-01

    Full Text Available Abstract Background RNA interference (RNAi is a naturally occurring phenomenon that results in the suppression of a target RNA sequence utilizing a variety of possible methods and pathways. To dissect the factors that result in effective siRNA sequences a regression kernel Support Vector Machine (SVM approach was used to quantitatively model RNA interference activities. Results Eight overall feature mapping methods were compared in their abilities to build SVM regression models that predict published siRNA activities. The primary factors in predictive SVM models are position specific nucleotide compositions. The secondary factors are position independent sequence motifs (N-grams and guide strand to passenger strand sequence thermodynamics. Finally, the factors that are least contributory but are still predictive of efficacy are measures of intramolecular guide strand secondary structure and target strand secondary structure. Of these, the site of the 5' most base of the guide strand is the most informative. Conclusion The capacity of specific feature mapping methods and their ability to build predictive models of RNAi activity suggests a relative biological importance of these features. Some feature mapping methods are more informative in building predictive models and overall t-test filtering provides a method to remove some noisy features or make comparisons among datasets. Together, these features can yield predictive SVM regression models with increased predictive accuracy between predicted and observed activities both within datasets by cross validation, and between independently collected RNAi activity datasets. Feature filtering to remove features should be approached carefully in that it is possible to reduce feature set size without substantially reducing predictive models, but the features retained in the candidate models become increasingly distinct. Software to perform feature prediction and SVM training and testing on nucleic acid

  12. Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing

    NARCIS (Netherlands)

    Hedil, M.; Sterken, M.G.; Ronde, de D.; Lohuis, D.; Kormelink, R.

    2015-01-01

    RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS.

  13. Crystallization and preliminary X-ray diffraction analysis of the CRISPR-Cas RNA-silencing Cmr complex.

    Science.gov (United States)

    Osawa, Takuo; Inanaga, Hideko; Numata, Tomoyuki

    2015-06-01

    Clustered regularly interspaced short palindromic repeat (CRISPR)-derived RNA (crRNA) and CRISPR-associated (Cas) proteins constitute a prokaryotic adaptive immune system (CRISPR-Cas system) that targets and degrades invading genetic elements. The type III-B CRISPR-Cas Cmr complex, composed of the six Cas proteins (Cmr1-Cmr6) and a crRNA, captures and cleaves RNA complementary to the crRNA guide sequence. Here, a Cmr1-deficient functional Cmr (CmrΔ1) complex composed of Pyrococcus furiosus Cmr2-Cmr3, Archaeoglobus fulgidus Cmr4-Cmr5-Cmr6 and the 39-mer P. furiosus 7.01-crRNA was prepared. The CmrΔ1 complex was cocrystallized with single-stranded DNA (ssDNA) complementary to the crRNA guide by the vapour-diffusion method. The crystals diffracted to 2.1 Å resolution using synchrotron radiation at the Photon Factory. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 75.5, b = 76.2, c = 139.2 Å, α = 90.3, β = 104.8, γ = 118.6°. The asymmetric unit of the crystals is expected to contain one CmrΔ1-ssDNA complex, with a Matthews coefficient of 2.03 Å(3) Da(-1) and a solvent content of 39.5%.

  14. Enhancement of Gene Silencing Effect and Membrane Permeability by Peptide-Conjugated 27-Nucleotide Small Interfering RNA

    Directory of Open Access Journals (Sweden)

    Toshio Seyama

    2012-09-01

    Full Text Available Two different sizes of siRNAs, of which one type was 21-nucleotide (nt siRNA containing 2-nt dangling ends and the other type was 27-nt siRNA with blunt ends, were conjugated with a nuclear export signal peptide of HIV-1 Rev at the 5′-sense end. Processing by Dicer enzyme, cell membrane permeability, and RNAi efficiency of the peptide-conjugated siRNAs were examined. Dicer cleaved the peptide-conjugated 27-nt siRNA leading to the release of 21-nt siRNA, whereas the peptide-conjugated 21-nt siRNA was not cleaved. High membrane permeability and cytoplasmic localization was found in the conjugates. Moreover, the peptide-conjugated 27-nt siRNA showed increased potency of RNAi in comparison with the nonmodified 21-nt and 27-nt siRNAs, whereas the peptide-conjugated 21-nt siRNA showed decreased RNAi efficacy. This potent RNAi efficacy is probably owing to acceleration of RISC through recognition by Dicer, as well as to the improvement of cell membrane permeability and intracellular accumulation.

  15. Interference by clustered regularly interspaced short palindromic repeat (CRISPR) RNA is governed by a seed sequence

    NARCIS (Netherlands)

    Semenova, E.V.; Jore, M.M.; Westra, E.R.; Oost, van der J.; Brouns, S.J.J.

    2011-01-01

    Prokaryotic clustered regularly interspaced short palindromic repeat (CRISPR)/Cas (CRISPR-associated sequences) systems provide adaptive immunity against viruses when a spacer sequence of small CRISPR RNA (crRNA) matches a protospacer sequence in the viral genome. Viruses that escape CRISPR/Cas

  16. RNA Interference towards the Potato Psyllid, Bactericera cockerelli, Is Induced in Plants Infected with Recombinant Tobacco mosaic virus (TMV)

    Science.gov (United States)

    Wuriyanghan, Hada; Falk, Bryce W.

    2013-01-01

    The potato/tomato psyllid, Bactericera cockerelli (B. cockerelli), is an important plant pest and the vector of the phloem-limited bacterium Candidatus Liberibacter psyllaurous (solanacearum), which is associated with the zebra chip disease of potatoes. Previously, we reported induction of RNA interference effects in B. cockerelli via in vitro-prepared dsRNA/siRNAs after intrathoracic injection, and after feeding of artificial diets containing these effector RNAs. In order to deliver RNAi effectors via plant hosts and to rapidly identify effective target sequences in plant-feeding B. cockerelli, here we developed a plant virus vector-based in planta system for evaluating candidate sequences. We show that recombinant Tobacco mosaic virus (TMV) containing B. cockerelli sequences can efficiently infect and generate small interfering RNAs in tomato (Solanum lycopersicum), tomatillo (Physalis philadelphica) and tobacco (Nicotiana tabacum) plants, and more importantly delivery of interfering sequences via TMV induces RNAi effects, as measured by actin and V-ATPase mRNA reductions, in B. cockerelli feeding on these plants. RNAi effects were primarily detected in the B. cockerelli guts. In contrast to our results with TMV, recombinant Potato virus X (PVX) and Tobacco rattle virus (TRV) did not give robust infections in all plants and did not induce detectable RNAi effects in B. cockerelli. The greatest RNA interference effects were observed when B. cockerelli nymphs were allowed to feed on leaf discs collected from inoculated or lower expanded leaves from corresponding TMV-infected plants. Tomatillo plants infected with recombinant TMV containing B. cockerelli actin or V-ATPase sequences also showed phenotypic effects resulting in decreased B. cockerelli progeny production as compared to plants infected by recombinant TMV containing GFP. These results showed that RNAi effects can be achieved in plants against the phloem feeder, B. cockerelli, and the TMV-plant system will

  17. Experimental study of APE1 RNA interference enhancing the sensitivity of neutron radiation in osteosarcoma

    International Nuclear Information System (INIS)

    Wang Dong; Qing Yi; Zhong Zhaoyang; Li Zengpeng; Zhang Xinhong; Yang Yuxin

    2007-01-01

    Objective: To knock down APE1 gene expression in HOS cells, and explore its antitumor effects in combination with 252 Cf neutron radiotherapy. Methods: pSilence APE1 siBNA plasmid was transfected into HOS cells by SuperFect Transfection liposome. The transfected HOS cells were irradiated by 252 Cf neutron, then MTY assay, clone formation assay and alkaline comet assay were used to detect the radiobiological reaction, and cell apoptosis was detected with flow cytometry. Results: The D 37 value was 3.02 vs. 2.42 in the control and transfected HOS cells respectively after irradiation with 252 Cf neutron, the DMF value is 1.43. The tail moments and cell apoptosis rate at 200, 500 and 1000 cGy showed significant difference between the two groups (P 252 Cf neutron radiotherapy may be a promising approach to therapy of human osteosarcoma in the future. (authors)

  18. Major and minor crRNA annealing sites facilitate low stringency DNA protospacer binding prior to Type I-A CRISPR-Cas interference in Sulfolobus

    DEFF Research Database (Denmark)

    Mousaei, Marzieh; Deng, Ling; She, Qunxin

    2016-01-01

    The stringency of crRNA-protospacer DNA base pair matching required for effective CRISPR-Cas interference is relatively low in crenarchaeal Sulfolobus species in contrast to that required in some bacteria. To understand its biological significance we studied crRNA-protospacer interactions...... in Sulfolobus islandicus REY15A which carries multiple, and functionally diverse, interference complexes. A range of mismatches were introduced into a vector-borne protospacer that was identical to spacer 1 of CRISPR locus 2, with a cognate CCN PAM sequence. Two important crRNA annealing regions were identified...

  19. RNA interference for the control of whiteflies (Bemisia tabaci) by oral ...

    Indian Academy of Sciences (India)

    respective primers (table 2), and actin served as the internal control. Each reaction ..... emerged adults and variation in the quality and the quantity of siRNA synthesized ... Environment News Service, 21 August (countercurrents.org). Febvay G ...

  20. Combinatorial RNA Interference Therapy Prevents Selection of Pre-existing HBV Variants in Human Liver Chimeric Mice

    Science.gov (United States)

    Shih, Yao-Ming; Sun, Cheng-Pu; Chou, Hui-Hsien; Wu, Tzu-Hui; Chen, Chun-Chi; Wu, Ping-Yi; Enya Chen, Yu-Chen; Bissig, Karl-Dimiter; Tao, Mi-Hua

    2015-01-01

    Selection of escape mutants with mutations within the target sequence could abolish the antiviral RNA interference activity. Here, we investigated the impact of a pre-existing shRNA-resistant HBV variant on the efficacy of shRNA therapy. We previously identified a highly potent shRNA, S1, which, when delivered by an adeno-associated viral vector, effectively inhibits HBV replication in HBV transgenic mice. We applied the “PICKY” software to systemically screen the HBV genome, then used hydrodynamic transfection and HBV transgenic mice to identify additional six highly potent shRNAs. Human liver chimeric mice were infected with a mixture of wild-type and T472C HBV, a S1-resistant HBV variant, and then treated with a single or combined shRNAs. The presence of T472C mutant compromised the therapeutic efficacy of S1 and resulted in replacement of serum wild-type HBV by T472C HBV. In contrast, combinatorial therapy using S1 and P28, one of six potent shRNAs, markedly reduced titers for both wild-type and T472C HBV. Interestingly, treatment with P28 alone led to the emergence of escape mutants with mutations in the P28 target region. Our results demonstrate that combinatorial RNAi therapy can minimize the escape of resistant viral mutants in chronic HBV patients. PMID:26482836

  1. Inhibition of endothelial cell proliferation by targeting Rac1 GTPase with small interference RNA in tumor cells

    International Nuclear Information System (INIS)

    Xue Yan; Bi Feng; Zhang Xueyong; Pan Yanglin; Liu Na; Zheng Yi; Fan Daiming

    2004-01-01

    Hypoxia-induced angiogenesis plays an important role in the malignancy of solid tumors. A number of recent studies including our own have suggested that Rho family small GTPases are involved in this process, and Rac1, a prominent member of the Rho family, may be critical in regulating hypoxia-induced gene activation of several angiogenesis factors and tumor suppressors. To further define Rac1 function in angiogenesis and to explore novel approaches to modulate angiogenesis, we employed the small interference RNA technique to knock down gene expression of Rac1 in gastric cancer cell line AGS that expresses a high level of Rac1. Both the mRNA and protein levels of Rac1 in the AGS cells were decreased dramatically after transfection with a Rac1-specific siRNA vector. When the conditioned medium derived from the Rac1 downregulated AGS cells was applied to the human endothelial cells, it could significantly inhibit the cell proliferation. Further study proved that, VEGF and HIF-1α, two angiogenesis promoting factors, were found to be downregulated whereas p53 and VHL, which are tumor suppressors and angiogenesis inhibitors, were upregulated in the Rac1 siRNA transfected cells. Our results suggest that Rac1 may be involved in angiogenesis by controlling the expression of angiogenesis-related factors and provide a possible strategy for the treatment of tumor angiogenesis by targeting the Rac1 GTPase

  2. RNA interference targeting cytosolic NADP(+)-dependent isocitrate dehydrogenase exerts anti-obesity effect in vitro and in vivo.

    Science.gov (United States)

    Nam, Woo Suk; Park, Kwon Moo; Park, Jeen-Woo

    2012-08-01

    A metabolic abnormality in lipid biosynthesis is frequently associated with obesity and hyperlipidemia. Nicotinamide adenine dinucleotide phosphate-oxidase (NADPH) is an essential reducing equivalent for numerous enzymes required in fat and cholesterol biosynthesis. Cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) has been proposed as a key enzyme for supplying cytosolic NADPH. We report here that knockdown of IDPc expression by Ribonucleic acid (RNA) interference (RNAi) inhibited adipocyte differentiation and lipogenesis in 3T3-L1 preadipocytes and mice. Attenuated IDPc expression by IDPc small interfering RNA (siRNA) resulted in a reduction of differentiation and triglyceride level and adipogenic protein expression as well as suppression of glucose uptake in cultured adipocytes. In addition, the attenuation of Nox activity and Reactive oxygen species (ROS) generation accompanied with knockdown of IDPc was associated with inhibition of adipogenesis and lipogenesis. The loss of body weight and the reduction of triglyceride level were also observed in diet-induced obese mice transduced with IDPc short-hairpin (shRNA). Taken together, the inhibiting effect of RNAi targeting IDPc on adipogenesis and lipid biosynthesis is considered to be of therapeutic value in the treatment and prevention of obesity and obesity-associated metabolic syndrome. © 2012 Elsevier B.V. All rights reserved.

  3. RNAi-mediated silencing of enolase confirms its biological importance in Clonorchis sinensis.

    Science.gov (United States)

    Wang, Xiaoyun; Chen, Wenjun; Tian, Yanli; Huang, Yan; Li, Xuerong; Yu, Xinbing

    2014-04-01

    Clonorchis sinensis (C. sinensis) infection is still a common public health problem in freshwater fish consumption areas in Asian countries. More molecular evidence are required to speed up the prevention strategies to control this kind of infectious disease. In the present study, to confirm the biological importance of Csenolase followed by our previous observations of the key metabolic enzyme, we explored the RNA silence effect of the Csenolase-derived RNA interference (RNAi) in C. sinensis. The extramembranous region aa105-226 was selected as the target sequence of RNA silence. Csenolase-derived double strand RNA (dsRNA-Csenolase, 366 bp) was synthetized and delivered into C. sinensis by soaking approach. The penetration of dsRNA into adult worms and metacercariae was tracked using fluorescently labeled RNA. Western blotting and qRT-PCR experiments were performed to determine dsRNA-Csenolase-silencing effect. Our results showed that, after incubating for 120 h, dsRNA-Csenolase could effectively target and downregulate the expression of Csenolase in both adult worms (P sinensis adult worms (P sinensis, allowing further applications in identifying functional genes in C. sinensis.

  4. Long non-coding RNA TUG1 is up-regulated in hepatocellular carcinoma and promotes cell growth and apoptosis by epigenetically silencing of KLF2.

    Science.gov (United States)

    Huang, Ming-De; Chen, Wen-Ming; Qi, Fu-Zhen; Sun, Ming; Xu, Tong-Peng; Ma, Pei; Shu, Yong-Qian

    2015-09-04

    Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related death worldwide, and the biology of this cancer remains poorly understood. Recent evidence indicates that long non-coding RNAs (lncRNAs) are found to be dysregulated in a variety of cancers, including HCC. Taurine Up-regulated Gene 1 (TUG1), a 7.1-kb lncRNA, recruiting and binding to polycomb repressive complex 2 (PRC2), is found to be disregulated in non-small cell lung carcinoma (NSCLC) and esophageal squamous cell carcinoma (ESCC). However, its clinical significance and potential role in HCC remain unclear. In this study, expression of TUG1 was analyzed in 77 HCC tissues and matched normal tissues by using quantitative polymerase chain reaction (qPCR). TUG1 expression was up-regulated in HCC tissues and the higher expression of TUG1 was significantly correlated with tumor size and Barcelona Clinic Liver Cancer (BCLC) stage. Moreover, silencing of TUG1 expression inhibited HCC cell proliferation, colony formation, tumorigenicity and induced apoptosis in HCC cell lines. We also found that TUG1 overexpression was induced by nuclear transcription factor SP1 and TUG1 could epigeneticly repress Kruppel-like factor 2 (KLF2) transcription in HCC cells by binding with PRC2 and recruiting it to KLF2 promoter region. Our results suggest that lncRNA TUG1, as a growth regulator, may serve as a new diagnostic biomarker and therapy target for HCC.

  5. Performative Silences

    DEFF Research Database (Denmark)

    Dupret, Katia

    2018-01-01

    static nor neutral. It has performative effects. Silencing as an act, rather than a noun, is conceptualised as a central ‘configurating actor’ of change. Through the description of minute details from a videotaped supervision session in the mental healthcare sector, it is shown how different performative...... configurations of silence makes people relate to each other in new ways and influence new work practices. In spite of its somewhat immaterial connotations, using an Actor-Network Theory approach to organization studies, silencing is conceptualised as both a means and an effect of change efforts, which are socio...

  6. Xist RNA is confined to the nuclear territory of the silenced X chromosome throughout the cell cycle

    NARCIS (Netherlands)

    I.H. Jonkers (Iris); K. Monkhorst (Kim); E. Rentmeester (Eveline); J.A. Grootegoed (Anton); F.G. Grosveld (Frank); J.H. Gribnau (Joost)

    2008-01-01

    textabstractIn mammalian female cells, one X chromosome is inactivated to prevent a dose difference in the expression of X-encoded proteins between males and females. Xist RNA, required for X chromosome inactivation, is transcribed from the future inactivated X chromosome (Xi), where it spreads in

  7. A novel artificial microRNA expressing AAV vector for phospholamban silencing in cardiomyocytes improves Ca2+ uptake into the sarcoplasmic reticulum.

    Directory of Open Access Journals (Sweden)

    Tobias Gröβl

    Full Text Available In failing rat hearts, post-transcriptonal inhibition of phospholamban (PLB expression by AAV9 vector-mediated cardiac delivery of short hairpin RNAs directed against PLB (shPLBr improves both impaired SERCA2a controlled Ca2+ cycling and contractile dysfunction. Cardiac delivery of shPLB, however, was reported to cause cardiac toxicity in canines. Thus we developed a new AAV vector, scAAV6-amiR155-PLBr, expressing a novel engineered artificial microRNA (amiR155-PLBr directed against PLB under control of a heart-specific hybrid promoter. Its PLB silencing efficiency and safety were compared with those of an AAV vector expressing shPLBr (scAAV6-shPLBr from an ubiquitously active U6 promoter. Investigations were carried out in cultured neonatal rat cardiomyocytes (CM over a period of 14 days. Compared to shPLBr, amiR155-PLBr was expressed at a significantly lower level, resulting in delayed and less pronounced PLB silencing. Despite decreased knockdown efficiency of scAAV6-amiR155-PLBr, a similar increase of the SERCA2a-catalyzed Ca2+ uptake into sarcoplasmic reticulum (SR vesicles was observed for both the shPLBr and amiR155-PLBr vectors. Proteomic analysis confirmed PLB silencing of both therapeutic vectors and revealed that shPLBr, but not the amiR155-PLBr vector, increased the proinflammatory proteins STAT3, STAT1 and activated STAT1 phosphorylation at the key amino acid residue Tyr701. Quantitative RT-PCR analysis detected alterations in the expression of several cardiac microRNAs after treatment of CM with scAAV6-shPLBr and scAAV6-amiR155-PLBr, as well as after treatment with its related amiR155- and shRNAs-expressing control AAV vectors. The results demonstrate that scAAV6-amiR155-PLBr is capable of enhancing the Ca2+ transport function of the cardiac SR PLB/SERCA2a system as efficiently as scAAV6-shPLBr while offering a superior safety profile.

  8. Identification of a novel cytochrome P450 gene, CYP321E1 from the diamondback moth, Plutella xylostella (L.) and RNA interference to evaluate its role in chlorantraniliprole resistance.

    Science.gov (United States)

    Hu, Z; Lin, Q; Chen, H; Li, Z; Yin, F; Feng, X

    2014-12-01

    Insect cytochrome P450 monooxygenases (P450s) play an important role in catalysis of many reactions leading to insecticides resistance. Our previous studies on transcriptome analysis of chlorantraniliprole-resistant development in the diamondback moth, Plutella xylostella revealed that up-regulation of cytochrome P450s are one of the main factors leading to the development of chlorantraniliprole resistance. Here, we report for the first time a novel cytochrome P450 gene CYP321E1, which belongs to the cytochrome P450 gene family CYP321. Real-time quantitative PCR (RT-qPCR) analyses indicated that CYP321E1 was expressed at all developmental stages of P. xylostella but was highest in the fourth-instar larvae; furthermore, the relatively high expression was observed in the midgut of the fourth-instar larvae, followed by fat bodies and epidermis. The expression of CYP321E1 in P. xylostella was differentially affected by three representative insecticides, including alphamethrin, abamectin and chlorantraniliprole. Among them, the exposure to chlorantraniliprole resulted in the largest transcript level of this cytochrome P450 gene. The findings suggested potential involvement of CYP321E1 in chlorantraniliprole resistance of P. xylostella. To assess the functional link of CYP321E1 to chlorantraniliprole resistance, RNA interference (RNAi)-mediated gene silencing by double stranded RNA (dsRNA) injecting was used. Results revealed that injection delivery of dsRNA can greatly reduce gene expression after 24 h. As a consequence of RNAi, a significant increment in mortality of larvae injected CYP321E1 dsRNA was observed after 24 h of exposure to chlorantraniliprole. These results strongly support our notion that this novel cytochrome P450 gene plays an important role in chlorantraniliprole detoxification in the diamondback moth and is partly responsible for its resistance.

  9. Expression levels of the microRNA maturing microprocessor complex component DGCR8 and the RNA-induced silencing complex (RISC) components argonaute-1, argonaute-2, PACT, TARBP1, and TARBP2 in epithelial skin cancer.

    Science.gov (United States)

    Sand, Michael; Skrygan, Marina; Georgas, Dimitrios; Arenz, Christoph; Gambichler, Thilo; Sand, Daniel; Altmeyer, Peter; Bechara, Falk G

    2012-11-01

    The microprocessor complex mediates intranuclear biogenesis of precursor microRNAs from the primary microRNA transcript. Extranuclear, mature microRNAs are incorporated into the RNA-induced silencing complex (RISC) before interaction with complementary target mRNA leads to transcriptional repression or cleavage. In this study, we investigated the expression profiles of the microprocessor complex subunit DiGeorge syndrome critical region gene 8 (DGCR8) and the RISC components argonaute-1 (AGO1), argonaute-2 (AGO2), as well as double-stranded RNA-binding proteins PACT, TARBP1, and TARBP2 in epithelial skin cancer and its premalignant stage. Patients with premalignant actinic keratoses (AK, n = 6), basal cell carcinomas (BCC, n = 15), and squamous cell carcinomas (SCC, n = 7) were included in the study. Punch biopsies were harvested from the center of the tumors (lesional), from healthy skin sites (intraindividual controls), and from healthy skin sites in a healthy control group (n = 16; interindividual control). The DGCR8, AGO1, AGO2, PACT, TARBP1, and TARBP2 mRNA expression levels were detected by quantitative real-time reverse transcriptase polymerase chain reaction. The DGCR8, AGO1, AGO2, PACT, and TARBP1 expression levels were significantly higher in the AK, BCC, and SCC groups than the healthy controls (P  0.05). This study indicates that major components of the miRNA pathway, such as the microprocessor complex and RISC, are dysregulated in epithelial skin cancer. Copyright © 2011 Wiley Periodicals, Inc.

  10. Comparison of dengue virus type 2-specific small RNAs from RNA interference-competent and -incompetent mosquito cells.

    Directory of Open Access Journals (Sweden)

    Jaclyn C Scott

    2010-10-01

    Full Text Available The exogenous RNA interference (RNAi pathway is an important antiviral defense against arboviruses in mosquitoes, and virus-specific small interfering (siRNAs are key components of this pathway. Understanding the biogenesis of siRNAs in mosquitoes could have important ramifications in using RNAi to control arbovirus transmission. Using deep sequencing technology, we characterized dengue virus type 2 (DENV2-specific small RNAs produced during infection of Aedes aegypti mosquitoes and A. aegypti Aag2 cell cultures and compared them to those produced in the C6/36 Aedes albopictus cell line. We show that the size and mixed polarity of virus-specific small RNAs from DENV-infected A. aegypti cells indicate that they are products of Dicer-2 (Dcr2 cleavage of long dsRNA, whereas C6/36 cells generate DENV2-specific small RNAs that are longer and predominantly positive polarity, suggesting that they originate from a different small RNA pathway. Examination of virus-specific small RNAs after infection of the two mosquito cell lines with the insect-only flavivirus cell fusing agent virus (CFAV corroborated these findings. An in vitro assay also showed that Aag2 A. aegypti cells are capable of siRNA production, while C6/36 A. albopictus cells exhibit inefficient Dcr2 cleavage of long dsRNA. Defective expression or function of Dcr2, the key initiator of the RNAi pathway, might explain the comparatively robust growth of arthropod-borne viruses in the C6/36 cell line, which has been used frequently as a surrogate for studying molecular interactions between arboviruses and cells of their mosquito hosts.

  11. Study of RNA interference inhibiting rat ovarian androgen biosynthesis by depressing 17alpha-hydroxylase/17, 20-lyase activity in vivo

    Directory of Open Access Journals (Sweden)

    Yang Xing

    2009-07-01

    Full Text Available Abstract Background 17alpha-hydroxylase/17, 20-lyase encoded by CYP17 is the key enzyme in androgen biosynthesis pathway. Previous studies demonstrated the accentuation of the enzyme in patients with polycystic ovary syndrome (PCOS was the most important mechanism of androgen excess. We chose CYP17 as the therapeutic target, trying to suppress the activity of 17alpha-hydroxylase/17, 20-lyase and inhibit androgen biosynthesis by silencing the expression of CYP17 in the rat ovary. Methods Three CYP17-targeting and one negative control oligonucleotides were designed and used in the present study. The silence efficiency of lentivirus shRNA was assessed by qRT-PCR, Western blotting and hormone assay. After subcapsular injection of lentivirus shRNA in rat ovary, the delivery efficiency was evaluated by GFP fluorescence and qPCR. Total RNA was extracted from rat ovary for CYP17 mRNA determination and rat serum was collected for hormone measurement. Results In total, three CYP17-targeting lentivirus shRNAs were synthesized. The results showed that all of them had a silencing effect on CYP17 mRNA and protein. Moreover, androstenedione secreted by rat theca interstitial cells (TIC in the RNAi group declined significantly compared with that in the control group. Two weeks after rat ovarian subcapsular injection of chosen CYP17 shRNA, the GFP fluorescence of frozen ovarian sections could be seen clearly under fluorescence microscope. It also showed that the GFP DNA level increased significantly, and its relative expression level was 7.42 times higher than that in the control group. Simultaneously, shRNA treatment significantly decreased CYP17 mRNA and protein levels at 61% and 54%, respectively. Hormone assay showed that all the levels of androstenedione, 17-hydroxyprogesterone and testosterone declined to a certain degree, but progesterone levels declined significantly. Conclusion The present study proves for the first time that ovarian androgen

  12. Reduction of IgE binding and nonpromotion of Aspergillus flavus fungal growth by simultaneously silencing Ara h 2 and Ara h 6 in peanut.

    Science.gov (United States)

    The most potent peanut allergens, Ara h 2 and 6, were silenced in transgenic plants by RNA interference. Three independent transgenic lines were recovered after microprojectile bombardment, of which two contained single, integrated copies of the transgene. The third line contained multiple copies ...

  13. Downregulation of telomerase activity in human promyelocytic cell line using RNA interference.

    Science.gov (United States)

    Miri-Moghaddam, E; Deezagi, A; Soheili, Z S

    2009-12-01

    Telomerase is a ribonucleoprotein complex. It consists of two main components, human telomerase reverse transcriptase (hTERT) and human telomerase RNA. High telomerase activity is present in most malignant cells, but it is barely detectable in majority of somatic cells. The direct correlation between telomerase reactivation and carcinogens has made hTERT a key target for anticancer therapeutic studies. In this study, for the first time, we evaluated the ability of the new generation of short interfering RNA (siRNA) to regulate telomerase activity in the human promyelocytic leukemia cell line (HL-60). Transient transfection cell line by hTERT siRNAs resulted in statistically significant suppression of hTERT messenger RNAs which were detected by quantitative real-time polymerase chain reaction, while the expressed hTERT protein levels were measured by flow cytometry. The results of telomeric repeat amplification protocol showed that telomerase activity was significantly reduced upon transfection of the HL-60 cell line with hTERT siRNAs. The results of this study showed that telomerase activity and cell proliferation were efficiently inhibited in the hTERT si