The DEAD-Box RNA Helicase DDX3 Interacts with m6A RNA Demethylase ALKBH5
Directory of Open Access Journals (Sweden)
Abdullah Shah
2017-01-01
Full Text Available DDX3 is a member of the family of DEAD-box RNA helicases. DDX3 is a multifaceted helicase and plays essential roles in key biological processes such as cell cycle, stress response, apoptosis, and RNA metabolism. In this study, we found that DDX3 interacted with ALKBH5, an m6A RNA demethylase. The ATP domain of DDX3 and DSBH domain of ALKBH5 were indispensable to their interaction with each other. Furthermore, DDX3 could modulate the demethylation of mRNAs. We also showed that DDX3 regulated the methylation status of microRNAs and there was an interaction between DDX3 and AGO2. The dynamics of m6A RNA modification is still a field demanding further investigation, and here, we add a link by showing that RNA demethylation can be regulated by proteins such as DDX3.
Energy Technology Data Exchange (ETDEWEB)
Wang, Daojing; Huang, Jing; Hu, Zhi
2011-11-15
RNA helicase DDX5 (also p68) is involved in all aspects of RNA metabolism and serves as a transcriptional co-regulator, but its functional role in breast cancer remains elusive. Here, we report an integrative biology study of DDX5 in breast cancer, encompassing quantitative proteomics, global MicroRNA profiling, and detailed biochemical characterization of cell lines and human tissues. We showed that protein expression of DDX5 increased progressively from the luminal to basal breast cancer cell lines, and correlated positively with that of CD44 in the basal subtypes. Through immunohistochemistry analyses of tissue microarrays containing over 200 invasive human ductal carcinomas, we observed that DDX5 was upregulated in the majority of malignant tissues, and its expression correlated strongly with those of Ki67 and EGFR in the triple-negative tumors. We demonstrated that DDX5 regulated a subset of MicroRNAs including miR-21 and miR-182 in basal breast cancer cells. Knockdown of DDX5 resulted in reorganization of actin cytoskeleton and reduction of cellular proliferation. The effects were accompanied by upregulation of tumor suppressor PDCD4 (a known miR-21 target); as well as upregulation of cofilin and profilin, two key proteins involved in actin polymerization and cytoskeleton maintenance, as a consequence of miR-182 downregulation. Treatment with miR-182 inhibitors resulted in morphologic phenotypes resembling those induced by DDX5 knockdown. Using bioinformatics tools for pathway and network analyses, we confirmed that the network for regulation of actin cytoskeleton was predominantly enriched for the predicted downstream targets of miR-182. Our results reveal a new functional role of DDX5 in breast cancer via the DDX5→miR-182→actin cytoskeleton pathway, and suggest the potential clinical utility of DDX5 and its downstream MicroRNAs in the theranostics of breast cancer.
An ATR-dependent function for the Ddx19 RNA helicase in nuclear R-loop metabolism.
Hodroj, Dana; Recolin, Bénédicte; Serhal, Kamar; Martinez, Susan; Tsanov, Nikolay; Abou Merhi, Raghida; Maiorano, Domenico
2017-05-02
Coordination between transcription and replication is crucial in the maintenance of genome integrity. Disturbance of these processes leads to accumulation of aberrant DNA:RNA hybrids (R-loops) that, if unresolved, generate DNA damage and genomic instability. Here we report a novel, unexpected role for the nucleopore-associated mRNA export factor Ddx19 in removing nuclear R-loops formed upon replication stress or DNA damage. We show, in live cells, that Ddx19 transiently relocalizes from the nucleopore to the nucleus upon DNA damage, in an ATR/Chk1-dependent manner, and that Ddx19 nuclear relocalization is required to clear R-loops. Ddx19 depletion induces R-loop accumulation, proliferation-dependent DNA damage and defects in replication fork progression. Further, we show that Ddx19 resolves R-loops in vitro via its helicase activity. Furthermore, mutation of a residue phosphorylated by Chk1 in Ddx19 disrupts its interaction with Nup214 and allows its nuclear relocalization. Finally, we show that Ddx19 operates in resolving R-loops independently of the RNA helicase senataxin. Altogether these observations put forward a novel, ATR-dependent function for Ddx19 in R-loop metabolism to preserve genome integrity in mammalian cells. © 2017 The Authors.
Energy Technology Data Exchange (ETDEWEB)
Kellner, Markus; Rohrmoser, Michaela [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Forné, Ignasi [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Voss, Kirsten; Burger, Kaspar; Mühl, Bastian; Gruber-Eber, Anita [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany); Kremmer, Elisabeth [Institute of Molecular Immunology, Helmholtz Center Munich, Marchioninistr. 25, Munich 81377 (Germany); Imhof, Axel [Adolf Butenandt Institute, Ludwig Maximilians University of Munich, Center for Integrated Protein Science Munich (CIPSM), Schillerstr. 44, Munich 80336 (Germany); Eick, Dirk, E-mail: eick@helmholtz-muenchen.de [Department of Molecular Epigenetics, Helmholtz Center Munich, Center for Integrated Protein Science Munich (CIPSM), Marchioninistr. 25, Munich 81377 (Germany)
2015-05-15
PeBoW, a trimeric complex consisting of pescadillo (Pes1), block of proliferation (Bop1), and the WD repeat protein 12 (WDR12), is essential for processing and maturation of mammalian 5.8S and 28S ribosomal RNAs. Applying a mass spectrometric analysis, we identified the DEAD-box helicase DDX27 as stably associated factor of the PeBoW-complex. DDX27 interacts with the PeBoW-complex via an evolutionary conserved F×F motif in the N-terminal domain and is recruited to the nucleolus via its basic C-terminal domain. This recruitment is RNA-dependent and occurs independently of the PeBoW-complex. Interestingly, knockdown of DDX27, but not of Pes1, induces the accumulation of an extended form of the primary 47S rRNA. We conclude that DDX27 can interact specifically with the Pes1 and Bop1 but fulfils critical function(s) for proper 3′ end formation of 47S rRNA independently of the PeBoW-complex. - Highlights: • DEAD-box helicase DDX27 is a new constituent of the PeBoW-complex. • The N-terminal F×F motif of DDX27 interacts with the PeBoW components Pes1 and Bop1. • Nucleolar anchoring of DDX27 via its basic C-terminal domain is RNA dependent. • Knockdown of DDX27 induces a specific defect in 3′ end formation of 47S rRNA.
Comparative structural analysis of human DEAD-box RNA helicases.
Schütz, Patrick; Karlberg, Tobias; van den Berg, Susanne; Collins, Ruairi; Lehtiö, Lari; Högbom, Martin; Holmberg-Schiavone, Lovisa; Tempel, Wolfram; Park, Hee-Won; Hammarström, Martin; Moche, Martin; Thorsell, Ann-Gerd; Schüler, Herwig
2010-09-30
DEAD-box RNA helicases play various, often critical, roles in all processes where RNAs are involved. Members of this family of proteins are linked to human disease, including cancer and viral infections. DEAD-box proteins contain two conserved domains that both contribute to RNA and ATP binding. Despite recent advances the molecular details of how these enzymes convert chemical energy into RNA remodeling is unknown. We present crystal structures of the isolated DEAD-domains of human DDX2A/eIF4A1, DDX2B/eIF4A2, DDX5, DDX10/DBP4, DDX18/myc-regulated DEAD-box protein, DDX20, DDX47, DDX52/ROK1, and DDX53/CAGE, and of the helicase domains of DDX25 and DDX41. Together with prior knowledge this enables a family-wide comparative structural analysis. We propose a general mechanism for opening of the RNA binding site. This analysis also provides insights into the diversity of DExD/H- proteins, with implications for understanding the functions of individual family members.
Comparative structural analysis of human DEAD-box RNA helicases.
Directory of Open Access Journals (Sweden)
Patrick Schütz
2010-09-01
Full Text Available DEAD-box RNA helicases play various, often critical, roles in all processes where RNAs are involved. Members of this family of proteins are linked to human disease, including cancer and viral infections. DEAD-box proteins contain two conserved domains that both contribute to RNA and ATP binding. Despite recent advances the molecular details of how these enzymes convert chemical energy into RNA remodeling is unknown. We present crystal structures of the isolated DEAD-domains of human DDX2A/eIF4A1, DDX2B/eIF4A2, DDX5, DDX10/DBP4, DDX18/myc-regulated DEAD-box protein, DDX20, DDX47, DDX52/ROK1, and DDX53/CAGE, and of the helicase domains of DDX25 and DDX41. Together with prior knowledge this enables a family-wide comparative structural analysis. We propose a general mechanism for opening of the RNA binding site. This analysis also provides insights into the diversity of DExD/H- proteins, with implications for understanding the functions of individual family members.
RNA helicase DDX3 is a regulatory subunit of casein kinase 1 in Wnt-beta-catenin signaling
Cruciat, C.M.; Dolde, C.; de Groot, R.E.; Ohkawara, B.; Reinhard, C.; Korswagen, H.C.; Niehrs, C.
2013-01-01
Casein kinase 1 (CK1) members play key roles in numerous biological processes. They are considered "rogue" kinases, because their enzymatic activity appears unregulated. Contrary to this notion, we have identified the DEAD-box RNA helicase DDX3 as a regulator of the Wnt-beta-catenin network, where
MOV10 RNA helicase is a potent inhibitor of retrotransposition in cells.
Directory of Open Access Journals (Sweden)
John L Goodier
Full Text Available MOV10 protein, a putative RNA helicase and component of the RNA-induced silencing complex (RISC, inhibits retrovirus replication. We show that MOV10 also severely restricts human LINE1 (L1, Alu, and SVA retrotransposons. MOV10 associates with the L1 ribonucleoprotein particle, along with other RNA helicases including DDX5, DHX9, DDX17, DDX21, and DDX39A. However, unlike MOV10, these other helicases do not strongly inhibit retrotransposition, an activity dependent upon intact helicase domains. MOV10 association with retrotransposons is further supported by its colocalization with L1 ORF1 protein in stress granules, by cytoplasmic structures associated with RNA silencing, and by the ability of MOV10 to reduce endogenous and ectopic L1 expression. The majority of the human genome is repetitive DNA, most of which is the detritus of millions of years of accumulated retrotransposition. Retrotransposons remain active mutagens, and their insertion can disrupt gene function. Therefore, the host has evolved defense mechanisms to protect against retrotransposition, an arsenal we are only beginning to understand. With homologs in other vertebrates, insects, and plants, MOV10 may represent an ancient and innate form of immunity against both infective viruses and endogenous retroelements.
Energy Technology Data Exchange (ETDEWEB)
Kellner, Julian N.; Meinhart, Anton, E-mail: anton.meinhart@mpimf-heidelberg.mpg.de [Max Planck Institute for Medical Research, Jahnstrasse 29, 69120 Heidelberg (Germany)
2015-08-25
The structure of the SPRY domain of the human RNA helicase DDX1 was determined at 2.0 Å resolution. The SPRY domain provides a putative protein–protein interaction platform within DDX1 that differs from other SPRY domains in its structure and conserved regions. The human RNA helicase DDX1 in the DEAD-box family plays an important role in RNA processing and has been associated with HIV-1 replication and tumour progression. Whereas previously described DEAD-box proteins have a structurally conserved core, DDX1 shows a unique structural feature: a large SPRY-domain insertion in its RecA-like consensus fold. SPRY domains are known to function as protein–protein interaction platforms. Here, the crystal structure of the SPRY domain of human DDX1 (hDSPRY) is reported at 2.0 Å resolution. The structure reveals two layers of concave, antiparallel β-sheets that stack onto each other and a third β-sheet beneath the β-sandwich. A comparison with SPRY-domain structures from other eukaryotic proteins showed that the general β-sandwich fold is conserved; however, differences were detected in the loop regions, which were identified in other SPRY domains to be essential for interaction with cognate partners. In contrast, in hDSPRY these loop regions are not strictly conserved across species. Interestingly, though, a conserved patch of positive surface charge is found that may replace the connecting loops as a protein–protein interaction surface. The data presented here comprise the first structural information on DDX1 and provide insights into the unique domain architecture of this DEAD-box protein. By providing the structure of a putative interaction domain of DDX1, this work will serve as a basis for further studies of the interaction network within the hetero-oligomeric complexes of DDX1 and of its recruitment to the HIV-1 Rev protein as a viral replication factor.
Acquired Dependence of Acute Myeloid Leukemia on the DEAD-Box RNA Helicase DDX5
Directory of Open Access Journals (Sweden)
Anthony Mazurek
2014-06-01
Full Text Available Acute myeloid leukemia (AML therapy involves compounds that are cytotoxic to both normal and cancer cells, and relapsed AML is resistant to subsequent chemotherapy. Thus, agents are needed that selectively kill AML cells with minimal toxicity. Here, we report that AML is dependent on DDX5 and that inhibiting DDX5 expression slows AML cell proliferation in vitro and AML progression in vivo but is not toxic to cells from normal bone marrow. Inhibition of DDX5 expression in AML cells induces apoptosis via induction of reactive oxygen species (ROS. This apoptotic response can be blocked either by BCL2 overexpression or treatment with the ROS scavenger N-acetyl-L-cysteine. Combining DDX5 knockdown with a BCL2 family inhibitor cooperates to induce cell death in AML cells. By inhibiting DDX5 expression in vivo, we show that DDX5 is dispensable for normal hematopoiesis and tissue homeostasis. These results validate DDX5 as a potential target for blocking AML.
Hodroj, Dana; Serhal, Kamar; Maiorano, Domenico
2017-09-03
The DEAD-box Helicase 19 (Ddx19) gene codes for an RNA helicase involved in both mRNA (mRNA) export from the nucleus into the cytoplasm and in mRNA translation. In unperturbed cells, Ddx19 localizes in the cytoplasm and at the cytoplasmic face of the nuclear pore. Here we review recent findings related to an additional Ddx19 function in the nucleus in resolving RNA:DNA hybrids (R-loops) generated during collision between transcription and replication, and upon DNA damage. Activation of a DNA damage response pathway dependent upon the ATR kinase, a major regulator of replication fork progression, stimulates translocation of the Ddx19 protein from the cytoplasm into the nucleus. Only nuclear Ddx19 is competent to resolve R-loops, and down regulation of Ddx19 expression induces DNA double strand breaks only in proliferating cells. Overall these observations put forward Ddx19 as an important novel mediator of the crosstalk between transcription and replication.
DDX6 regulates sequestered nuclear CUG-expanded DMPK-mRNA in dystrophia myotonica type 1
DEFF Research Database (Denmark)
Pettersson, Olof Joakim; Aagaard, Lars; Andrejeva, Diana
2014-01-01
RNA to ‘sponge’ splicing factors of the muscleblind family. Although nuclear aggregation of CUG-containing mRNPs in distinct foci is a hallmark of DM1, the mechanisms of their homeostasis have not been completely elucidated. Here we show that a DEAD-box helicase, DDX6, interacts with CUG triplet-repeat m......RNA in primary fibroblasts from DM1 patients and with CUG–RNA in vitro. DDX6 overexpression relieves DM1 mis-splicing, and causes a significant reduction in nuclear DMPK-mRNA foci. Conversely, knockdown of endogenous DDX6 leads to a significant increase in DMPK-mRNA foci count and to increased sequestration...... in vitro in an adenosinetriphosphate-dependent manner, suggesting that DDX6 can remodel and release nuclear DMPK messenger ribonucleoprotein foci, leading to normalization of pathogenic alternative splicing events...
Evolution of the DEAD box helicase family in chicken: chickens have no DHX9 ortholog.
Sato, Haruko; Oshiumi, Hiroyuki; Takaki, Hiromi; Hikono, Hirokazu; Seya, Tsukasa
2015-10-01
Viral RNA represents a pattern molecule that can be recognized by RNA sensors in innate immunity. Humans and mice possess cytoplasmic DNA/RNA sensors for detecting viral replication. There are a number of DEAD (Asp-Glu-Ala-Asp; DExD/H) box-type helicases in mammals, among which retinoic acid-inducible gene 1 (RIG-I) and melanoma differentiation-associated protein 5 (MDA50) are indispensable for RNA sensing; however, they are functionally supported by a number of sensors that directly bind viral RNA or replicative RNA intermediates to convey signals to RIG-I and MDA5. Some DEAD box helicase members recognize DNA irrespective of the origin. These sensors transmit IFN-inducing signals through adaptors, including mitochondrial antiviral signaling. Viral double-stranded RNAs are reportedly sensed by the helicases DDX1, DDX21, DHX36, DHX9, DDX3, DDX41, LGP2 and DDX60, in addition to RIG-I and MDA5, and induce type I IFNs, thereby blocking viral replication. Humans and mice have all nucleic acid sensors listed here. In the RNA sensing system in chicken, it was found in the present study that most DEAD box helicases are conserved; however, DHX9 is genetically deficient in addition to reported RIG-I. Based on the current genome databases, similar DHX9 deficiency was observed in ducks and several other bird species. Because chicken, but not duck, was found to be deficient in RIG-I, the RNA-sensing system of chicken lacks RIG-I and DHX9 and is thus more fragile than that of duck or mammal. DHX9 may generally compensate for the function of RIG-I and deficiency of DHX9 possibly participates in exacerbations of viral infection such as influenza in chickens. © 2015 The Societies and Wiley Publishing Asia Pty Ltd.
Directory of Open Access Journals (Sweden)
Rebecca Bish
2015-07-01
Full Text Available DDX6 (p54/RCK is a human RNA helicase with central roles in mRNA decay and translation repression. To help our understanding of how DDX6 performs these multiple functions, we conducted the first unbiased, large-scale study to map the DDX6-centric protein-protein interactome using immunoprecipitation and mass spectrometry. Using DDX6 as bait, we identify a high-confidence and high-quality set of protein interaction partners which are enriched for functions in RNA metabolism and ribosomal proteins. The screen is highly specific, maximizing the number of true positives, as demonstrated by the validation of 81% (47/58 of the RNA-independent interactors through known functions and interactions. Importantly, we minimize the number of indirect interaction partners through use of a nuclease-based digestion to eliminate RNA. We describe eleven new interactors, including proteins involved in splicing which is an as-yet unknown role for DDX6. We validated and characterized in more detail the interaction of DDX6 with Nuclear fragile X mental retardation-interacting protein 2 (NUFIP2 and with two previously uncharacterized proteins, FAM195A and FAM195B (here referred to as granulin-1 and granulin-2, or GRAN1 and GRAN2. We show that NUFIP2, GRAN1, and GRAN2 are not P-body components, but re-localize to stress granules upon exposure to stress, suggesting a function in translation repression in the cellular stress response. Using a complementary analysis that resolved DDX6’s multiple complex memberships, we further validated these interaction partners and the presence of splicing factors. As DDX6 also interacts with the E3 SUMO ligase TIF1β, we tested for and observed a significant enrichment of sumoylation amongst DDX6’s interaction partners. Our results represent the most comprehensive screen for direct interaction partners of a key regulator of RNA life cycle and localization, highlighting new stress granule components and possible DDX6 functions
Copsey, Alice C; Cooper, Simon; Parker, Robert; Lineham, Ella; Lapworth, Cuzack; Jallad, Deema; Sweet, Steve; Morley, Simon J
2017-08-30
DDX3X, a helicase, can interact directly with mRNA and translation initiation factors, regulating the selective translation of mRNAs that contain a structured 5' untranslated region. This activity modulates the expression of mRNAs controlling cell cycle progression and mRNAs regulating actin dynamics, contributing to cell adhesion and motility. Previously, we have shown that ribosomes and translation initiation factors localise to the leading edge of migrating fibroblasts in loci enriched with actively translating ribosomes, thereby promoting steady-state levels of ArpC2 and Rac1 proteins at the leading edge of cells during spreading. As DDX3X can regulate Rac1 levels, cell motility and metastasis, we have examined DDX3X protein interactions and localisation using many complementary approaches. We now show that DDX3X can physically interact and co-localise with poly(A)-binding protein 1 and caprin-1 at the leading edge of spreading cells. Furthermore, as depletion of DDX3X leads to decreased cell motility, this provides a functional link between DDX3X, caprin-1 and initiation factors at the leading edge of migrating cells to promote cell migration and spreading. © 2017 The Author(s).
The RNA helicase DDX1 is involved in restricted HIV-1 Rev function in human astrocytes
International Nuclear Information System (INIS)
Fang Jianhua; Acheampong, Edward; Dave, Rajnish; Wang Fengxiang; Mukhtar, Muhammad; Pomerantz, Roger J.
2005-01-01
Productive infection by human immunodeficiency virus type I (HIV-1) in the central nervous system (CNS) involves mainly macrophages and microglial cells. A frequency of less than 10% of human astrocytes is estimated to be infectable with HIV-1. Nonetheless, this relatively low percentage of infected astrocytes, but associated with a large total number of astrocytic cells in the CNS, makes human astrocytes a critical part in the analyses of potential HIV-1 reservoirs in vivo. Investigations in astrocytic cell lines and primary human fetal astrocytes revealed that limited HIV-1 replication in these cells resulted from low-level viral entry, transcription, viral protein processing, and virion maturation. Of note, a low ratio of unspliced versus spliced HIV-1-specific RNA was also investigated, as Rev appeared to act aberrantly in astrocytes, via loss of nuclear and/or nucleolar localization and diminished Rev-mediated function. Host cellular machinery enabling Rev function has become critical for elucidation of diminished Rev activity, especially for those factors leading to RNA metabolism. We have recently identified a DEAD-box protein, DDX1, as a Rev cellular co-factor and now have explored its potential importance in astrocytes. Cells were infected with HIV-1 pseudotyped with envelope glycoproteins of amphotropic murine leukemia viruses (MLV). Semi-quantitative reverse transcriptase-polymerase chain reactions (RT-PCR) for unspliced, singly-spliced, and multiply-spliced RNA clearly showed a lower ratio of unspliced/singly-spliced over multiply-spliced HIV-1-specific RNA in human astrocytes as compared to Rev-permissive, non-glial control cells. As well, the cellular localization of Rev in astrocytes was cytoplasmically dominant as compared to that of Rev-permissive, non-glial controls. This endogenous level of DDX1 expression in astrocytes was demonstrated directly to lead to a shift of Rev sub-cellular distribution dominance from nuclear and/or nucleolar to
DDX3X Biomarker Correlates with Poor Survival in Human Gliomas
Directory of Open Access Journals (Sweden)
Dueng-Yuan Hueng
2015-07-01
Full Text Available Primary high-grade gliomas possess invasive growth and lead to unfavorable survival outcome. The investigation of biomarkers for prediction of survival outcome in patients with gliomas is important for clinical assessment. The DEAD (Asp-Glu-Ala-Asp box helicase 3, X-linked (DDX3X controls tumor migration, proliferation, and progression. However, the role of DDX3X in defining the pathological grading and survival outcome in patients with human gliomas is not yet clarified. We analyzed the DDX3X gene expression, WHO pathological grading, and overall survival from de-linked data. Further validation was done using quantitative RT-PCR of cDNA from normal brain and glioma, and immunohistochemical (IHC staining of tissue microarray. Statistical analysis of GEO datasets showed that DDX3X mRNA expression demonstrated statistically higher in WHO grade IV (n = 81 than in non-tumor controls (n = 23, p = 1.13 × 10−10. Moreover, DDX3X level was also higher in WHO grade III (n = 19 than in non-tumor controls (p = 2.43 × 10−5. Kaplan–Meier survival analysis showed poor survival in patients with high DDX3X mRNA levels (n = 24 than in those with low DDX3X expression (n = 53 (median survival, 115 vs. 58 weeks, p = 0.0009, by log-rank test, hazard ratio: 0.3507, 95% CI: 0.1893–0.6496. Furthermore, DDX3X mRNA expression and protein production significantly increased in glioma cells compared with normal brain tissue examined by quantitative RT-PCR, and Western blot. IHC staining showed highly staining of high-grade glioma in comparison with normal brain tissue. Taken together, DDX3X expression level positively correlates with WHO pathologic grading and poor survival outcome, indicating that DDX3X is a valuable biomarker in human gliomas.
Uson, Maria Loressa; Ordonez, Heather; Shuman, Stewart
2015-10-01
Mycobacteria have a large and distinctive ensemble of DNA helicases that function in DNA replication, repair, and recombination. Little is known about the roster of RNA helicases in mycobacteria or their roles in RNA transactions. The 912-amino-acid Mycobacterium smegmatis HelY (MSMEG_3885) protein is a bacterial homolog of the Mtr4 and Ski2 helicases that regulate RNA 3' processing and turnover by the eukaryal exosome. Here we characterize HelY as an RNA-stimulated ATPase/dATPase and an ATP/dATP-dependent 3'-to-5' helicase. HelY requires a 3' single-strand RNA tail (a loading RNA strand) to displace the complementary strand of a tailed RNA:RNA or RNA:DNA duplex. The findings that HelY ATPase is unresponsive to a DNA polynucleotide cofactor and that HelY is unable to unwind a 3'-tailed duplex in which the loading strand is DNA distinguish HelY from other mycobacterial nucleoside triphosphatases/helicases characterized previously. The biochemical properties of HelY, which resemble those of Mtr4/Ski2, hint at a role for HelY in mycobacterial RNA catabolism. RNA helicases play crucial roles in transcription, RNA processing, and translation by virtue of their ability to alter RNA secondary structure or remodel RNA-protein interactions. In eukarya, the RNA helicases Mtr4 and Ski2 regulate RNA 3' resection by the exosome. Mycobacterium smegmatis HelY, a bacterial homolog of Mtr4/Ski2, is characterized here as a unidirectional helicase, powered by RNA-dependent ATP/dATP hydrolysis, that tracks 3' to 5' along a loading RNA strand to displace the complementary strand of a tailed RNA:RNA or RNA:DNA duplex. The biochemical properties of HelY suggest a role in bacterial RNA transactions. HelY homologs are present in pathogenic mycobacteria (e.g., M. tuberculosis and M. leprae) and are widely prevalent in Actinobacteria and Cyanobacteria but occur sporadically elsewhere in the bacterial domain. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Karow, Anne R; Theissen, Bettina; Klostermeier, Dagmar
2007-01-01
RNA helicases mediate structural rearrangements of RNA or RNA-protein complexes at the expense of ATP hydrolysis. Members of the DEAD box helicase family consist of two flexibly connected helicase domains. They share nine conserved sequence motifs that are involved in nucleotide binding and hydrolysis, RNA binding, and helicase activity. Most of these motifs line the cleft between the two helicase domains, and extensive communication between them is required for RNA unwinding. The two helicase domains of the Bacillus subtilis RNA helicase YxiN were produced separately as intein fusions, and a functional RNA helicase was generated by expressed protein ligation. The ligated helicase binds adenine nucleotides with very similar affinities to the wild-type protein. Importantly, its intrinsically low ATPase activity is stimulated by RNA, and the Michaelis-Menten parameters are similar to those of the wild-type. Finally, ligated YxiN unwinds a minimal RNA substrate to an extent comparable to that of the wild-type helicase, confirming authentic interdomain communication.
Analysis list: Ddx5 [Chip-atlas[Archive
Lifescience Database Archive (English)
Full Text Available Ddx5 Blood + mm9 http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/target/Ddx5.1.tsv h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/mm9/target/Ddx5.5.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/target/Dd...x5.10.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/colo/Ddx5.Blood.tsv http://dbarchive.biosciencedbc.jp/kyushu-u/mm9/colo/Blood.gml ...
DDX4 (DEAD box polypeptide 4) colocalizes with cancer stem cell marker CD133 in ovarian cancers
International Nuclear Information System (INIS)
Kim, Ki Hyung; Kang, Yun-Jeong; Jo, Jin-Ok; Ock, Mee Sun; Moon, Soo Hyun; Suh, Dong Soo; Yoon, Man Soo; Park, Eun-Sil; Jeong, Namkung; Eo, Wan-Kyu; Kim, Heung Yeol; Cha, Hee-Jae
2014-01-01
Highlights: • Germ cell marker DDX4 was significantly increased in ovarian cancer. • Ovarian cancer stem cell marker CD133 was significantly increased in ovarian cancer. • DDX4 and CD133 were mostly colocalized in various types of ovarian cancer tissues. • CD133 positive ovarian cancer cells also express DDX4 whereas CD133-negative cells did not possess DDX4. • Germ cell marker DDX4 has the potential of ovarian cancer stem cell marker. - Abstract: DDX4 (DEAD box polypeptide 4), characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), is an RNA helicase which is implicated in various cellular processes involving the alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. DDX4 is known to be a germ cell-specific protein and is used as a sorting marker of germline stem cells for the production of oocytes. A recent report about DDX4 in ovarian cancer showed that DDX4 is overexpressed in epithelial ovarian cancer and disrupts a DNA damage-induced G2 checkpoint. We investigated the relationship between DDX4 and ovarian cancer stem cells by analyzing the expression patterns of DDX4 and the cancer stem cell marker CD133 in ovarian cancers via tissue microarray. Both DDX4 and CD133 were significantly increased in ovarian cancer compared to benign tumors, and showed similar patterns of expression. In addition, DDX4 and CD133 were mostly colocalized in various types of ovarian cancer tissues. Furthermore, almost all CD133 positive ovarian cancer cells also express DDX4 whereas CD133-negative cells did not possess DDX4, suggesting a strong possibility that DDX4 plays an important role in cancer stem cells, and/or can be used as an ovarian cancer stem cell marker
Accessory factors of cytoplasmic viral RNA sensors required for antiviral innate immune response
Directory of Open Access Journals (Sweden)
Hiroyuki eOshiumi
2016-05-01
Full Text Available Type I interferon (IFN induces many antiviral factors in host cells. RIG-I-like receptors (RLRs are cytoplasmic viral RNA sensors that trigger the signal to induce the innate immune response that includes type I IFN production. RIG-I and MDA5 are RLRs that form nucleoprotein filaments along viral double-stranded RNA, resulting in the activation of MAVS adaptor molecule. The MAVS protein forms a prion-like aggregation structure, leading to type I IFN production. RIG-I and MDA5 undergo post-translational modification. TRIM25 and Riplet ubiquitin ligases deliver a K63-linked polyubiquitin moiety to the RIG-I N-terminal caspase activation and recruitment domains (CARDs and C-terminal region; the polyubiquitin chain then stabilizes the two-CARD tetramer structure required for MAVS assembly. MDA5 activation is regulated by phosphorylation. RIOK3 is a protein kinase that phosphorylates the MDA5 protein in a steady state, and PP1α/γ dephosphorylate this protein, resulting in its activation. RIG-I and MDA5 require cytoplasmic RNA helicases for their efficient activation. LGP2, another RLR, is an RNA helicase involved in RLR signaling. This protein does not possess N-terminal CARDs and thus cannot trigger downstream signaling by itself. Recent studies have revealed that this protein modulates MDA5 filament formation, resulting in enhanced type I IFN production. Several other cytoplasmic RNA helicases are involved in RLR signaling. DDX3, DHX29, DHX36, and DDX60 RNA helicases have been reported to be involved in RLR-mediated type I IFN production after viral infection. However, the underlying mechanism is largely unknown. Future studies are required to reveal the role of RNA helicases in the RLR signaling pathway.
Xia, Hongjie; Wang, Peipei; Wang, Guang-Chuan; Yang, Jie; Sun, Xianlin; Wu, Wenzhe; Qiu, Yang; Shu, Ting; Zhao, Xiaolu; Yin, Lei; Qin, Cheng-Feng; Hu, Yuanyang; Zhou, Xi
2015-01-01
RNA helicases and chaperones are the two major classes of RNA remodeling proteins, which function to remodel RNA structures and/or RNA-protein interactions, and are required for all aspects of RNA metabolism. Although some virus-encoded RNA helicases/chaperones have been predicted or identified, their RNA remodeling activities in vitro and functions in the viral life cycle remain largely elusive. Enteroviruses are a large group of positive-stranded RNA viruses in the Picornaviridae family, which includes numerous important human pathogens. Herein, we report that the nonstructural protein 2CATPase of enterovirus 71 (EV71), which is the major causative pathogen of hand-foot-and-mouth disease and has been regarded as the most important neurotropic enterovirus after poliovirus eradication, functions not only as an RNA helicase that 3′-to-5′ unwinds RNA helices in an adenosine triphosphate (ATP)-dependent manner, but also as an RNA chaperone that destabilizes helices bidirectionally and facilitates strand annealing and complex RNA structure formation independently of ATP. We also determined that the helicase activity is based on the EV71 2CATPase middle domain, whereas the C-terminus is indispensable for its RNA chaperoning activity. By promoting RNA template recycling, 2CATPase facilitated EV71 RNA synthesis in vitro; when 2CATPase helicase activity was impaired, EV71 RNA replication and virion production were mostly abolished in cells, indicating that 2CATPase-mediated RNA remodeling plays a critical role in the enteroviral life cycle. Furthermore, the RNA helicase and chaperoning activities of 2CATPase are also conserved in coxsackie A virus 16 (CAV16), another important enterovirus. Altogether, our findings are the first to demonstrate the RNA helicase and chaperoning activities associated with enterovirus 2CATPase, and our study provides both in vitro and cellular evidence for their potential roles during viral RNA replication. These findings increase our
Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii
Directory of Open Access Journals (Sweden)
Jie Chen
2014-03-01
Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.
Directory of Open Access Journals (Sweden)
Koon-Guan Lee
2015-02-01
Full Text Available The innate immune system senses cytosolic dsDNA and bacterial cyclic dinucleotides and initiates signaling via the adaptor STING to induce type 1 interferon (IFN response. We demonstrate here that BTK-deficient cells have impaired IFN-β production and TBK1/IRF3 activation when stimulated with agonists or infected with pathogens that activate STING signaling. BTK interacts with STING and DDX41 helicase. The kinase and SH3/SH2 interaction domains of BTK bind, respectively, the DEAD-box domain of DDX41 and transmembrane region of STING. BTK phosphorylates DDX41, and its kinase activities are critical for STING-mediated IFN-β production. We show that Tyr364 and Tyr414 of DDX41 are critical for its recognition of AT-rich DNA and binding to STING, and tandem mass spectrometry identifies Tyr414 as the BTK phosphorylation site. Modeling studies further indicate that phospho-Tyr414 strengthens DDX41’s interaction with STING. Hence, BTK plays a critical role in the activation of DDX41 helicase and STING signaling.
Pène, Véronique; Li, Qisheng; Sodroski, Catherine; Hsu, Ching-Sheng; Liang, T Jake
2015-05-01
The ubiquitous ATP-dependent RNA helicase DDX3X is involved in many cellular functions, including innate immunity, and is a pivotal host factor for hepatitis C virus (HCV) infection. Recently, we showed that DDX3X specifically recognizes the HCV 3' untranslated region (UTR), leading to the activation of IKK-α and a cascade of lipogenic signaling to facilitate lipid droplet biogenesis and viral assembly (Q. Li, V. Pene, S. Krishnamurthy, H. Cha, and T. J. Liang, Nat Med 19:722-729, 2013, http://dx.doi.org/10.1038/nm.3190). The interaction of DDX3X with HCV core protein seems to be dispensable for its proviral role. In this study, through systematic imaging and biochemical and virologic approaches, we identified a dynamic association between DDX3X and various cellular compartments and viral elements mediating multiple functions of DDX3X in productive HCV infection. Upon HCV infection, the HCV 3'UTR interacts with DDX3X and IKK-α, which redistribute to speckle-like cytoplasmic structures shown to be stress granules (SGs). As viral proteins accumulate in infected cells, DDX3X granules together with SG-associated proteins redistribute and colocalize with HCV core protein around lipid droplets (LDs). IKK-α, however, does not relocate to the LD but translocates to the nucleus. In HCV-infected cells, various HCV nonstructural proteins also interact or colocalize with DDX3X in close proximity to SGs and LDs, consistent with the tight juxtaposition of the replication complex and the assembly site at the surface of LDs. Short interfering RNA (siRNA)-mediated silencing of DDX3X and multiple SG components markedly inhibits HCV infection. Our data suggest that DDX3X initiates a multifaceted cellular program involving dynamic associations with HCV RNA and proteins, IKK-α, SG, and LD surfaces for its crucial role in the HCV life cycle. IMPORTANCE DDX3X is a proviral host factor for HCV infection. Recently, we showed that DDX3X binds to the HCV 3'UTR, activating IKK-α and
Preliminary crystallographic characterization of an RNA helicase from Kunjin virus
International Nuclear Information System (INIS)
Mastrangelo, Eloise; Bollati, Michela; Milani, Mario; Brisbarre, Nadège; Lamballerie, Xavier de; Coutard, Bruno; Canard, Bruno; Khromykh, Alexander; Bolognesi, Martino
2006-01-01
The C-terminal 440 amino acids of the NS3 protein from Kunjin virus (Flaviviridae) code for a helicase. The protein has been overexpressed and crystallized. Characterization of the isolated monoclinic crystal form and diffraction data (at 3.0 Å resolution) are presented, together with a preliminary molecular-replacement solution. Kunjin virus is a member of the Flavivirus genus and is an Australian variant of West Nile virus. The C-terminal domain of the Kunjin virus NS3 protein displays helicase activity. The protein is thought to separate daughter and template RNA strands, assisting the initiation of replication by unwinding RNA secondary structure in the 3′ nontranslated region. Expression, purification and preliminary crystallographic characterization of the NS3 helicase domain are reported. It is shown that Kunjin virus helicase may adopt a dimeric assembly in absence of nucleic acids, oligomerization being a means to provide the helicases with multiple nucleic acid-binding capability, facilitating translocation along the RNA strands. Kunjin virus NS3 helicase domain is an attractive model for studying the molecular mechanisms of flavivirus replication, while simultaneously providing a new basis for the rational development of anti-flaviviral compounds
DEFF Research Database (Denmark)
He, Yangzi
and ligates the neighbouring exons to generate mature mRNAs. Prp43 is an RNA helicase of the DEAH/RHA family. In yeast, once mRNAs are released, Prp43 catalyzes the disassembly of spliceosomes. The 18S, 5.8S and 25S rRNAs are transcribed as a single polycistronic transcript—the 35S pre......-rRNA. It is nucleolytically cleaved and chemically modified to generate mature rRNAs, which assemble with ribosomal proteins to form the ribosome. Prp43 is required for the processing of the 18S rRNA. Using X-ray crystallography, I determined a high resolution structure of Prp43 bound to ADP, the first structure of a DEAH....../RHA helicase. It defined the conserved structural features of all DEAH/RHA helicases, and unveiled a novel nucleotide binding site. Additionally a preliminary low resolution structure of a ternary complex comprising Prp43, a non-hydrolyzable ATP analogue, and a single-stranded RNA, was obtained. The ribosome...
Ordonez, Heather; Shuman, Stewart
2013-05-17
We are interested in the distinctive roster of helicases of Mycobacterium, a genus of the phylum Actinobacteria that includes the human pathogen Mycobacterium tuberculosis and its avirulent relative Mycobacterium smegmatis. Here, we identify and characterize M. smegmatis Lhr as the exemplar of a novel clade of superfamily II helicases, by virtue of its biochemical specificities and signature domain organization. Lhr is a 1507-amino acid monomeric nucleic acid-dependent ATPase that uses the energy of ATP hydrolysis to drive unidirectional 3'-to-5' translocation along single strand DNA and to unwind duplexes en route. The ATPase is more active in the presence of calcium than magnesium. ATP hydrolysis is triggered by either single strand DNA or single strand RNA, yet the apparent affinity for a DNA activator is 11-fold higher than for an RNA strand of identical size and nucleobase sequence. Lhr is 8-fold better at unwinding an RNA:DNA hybrid than it is at displacing a DNA:DNA duplex of identical nucleobase sequence. The truncated derivative Lhr-(1-856) is an autonomous ATPase, 3'-to-5' translocase, and RNA:DNA helicase. Lhr-(1-856) is 100-fold better RNA:DNA helicase than DNA:DNA helicase. Lhr homologs are found in bacteria representing eight different phyla, being especially prevalent in Actinobacteria (including M. tuberculosis) and Proteobacteria (including Escherichia coli).
Unzippers, Resolvers and Sensors: A Structural and Functional Biochemistry Tale of RNA Helicases
Directory of Open Access Journals (Sweden)
Ana Lúcia Leitão
2015-01-01
Full Text Available The centrality of RNA within the biological world is an irrefutable fact that currently attracts increasing attention from the scientific community. The panoply of functional RNAs requires the existence of specific biological caretakers, RNA helicases, devoted to maintain the proper folding of those molecules, resolving unstable structures. However, evolution has taken advantage of the specific position and characteristics of RNA helicases to develop new functions for these proteins, which are at the interface of the basic processes for transference of information from DNA to proteins. RNA helicases are involved in many biologically relevant processes, not only as RNA chaperones, but also as signal transducers, scaffolds of molecular complexes, and regulatory elements. Structural biology studies during the last decade, founded in X-ray crystallography, have characterized in detail several RNA-helicases. This comprehensive review summarizes the structural knowledge accumulated in the last two decades within this family of proteins, with special emphasis on the structure-function relationships of the most widely-studied families of RNA helicases: the DEAD-box, RIG-I-like and viral NS3 classes.
Directory of Open Access Journals (Sweden)
Robert J Ihry
Full Text Available Steroid hormones act, through their respective nuclear receptors, to regulate target gene expression. Despite their critical role in development, physiology, and disease, however, it is still unclear how these systemic cues are refined into tissue-specific responses. We identified a mutation in the evolutionarily conserved DEAD box RNA helicase belle/DDX3 that disrupts a subset of responses to the steroid hormone ecdysone during Drosophila melanogaster metamorphosis. We demonstrate that belle directly regulates translation of E74A, an ets transcription factor and critical component of the ecdysone-induced transcriptional cascade. Although E74A mRNA accumulates to abnormally high levels in belle mutant tissues, no E74A protein is detectable, resulting in misregulation of E74A-dependent ecdysone response genes. The accumulation of E74A mRNA in belle mutant salivary glands is a result of auto-regulation, fulfilling a prediction made by Ashburner nearly 40 years ago. In this model, Ashburner postulates that, in addition to regulating secondary response genes, protein products of primary response genes like E74A also inhibit their own ecdysone-induced transcription. Moreover, although ecdysone-triggered transcription of E74A appears to be ubiquitous during metamorphosis, belle-dependent translation of E74A mRNA is spatially restricted. These results demonstrate that translational control plays a critical, and previously unknown, role in refining transcriptional responses to the steroid hormone ecdysone.
Bhushan, Lokesh; Abraham, Ambily; Choudhury, Nirupam Roy; Rana, Vipin Singh; Mukherjee, Sunil Kumar; Savithri, Handanahal Subbarao
2015-04-01
The nonstructural protein NSs, encoded by the S RNA of groundnut bud necrosis virus (GBNV) (genus Tospovirus, family Bunyaviridae) has earlier been shown to possess nucleic-acid-stimulated NTPase and 5' α phosphatase activity. ATP hydrolysis is an essential function of a true helicase. Therefore, NSs was tested for DNA helicase activity. The results demonstrated that GBNV NSs possesses bidirectional DNA helicase activity. An alanine mutation in the Walker A motif (K189A rNSs) decreased DNA helicase activity substantially, whereas a mutation in the Walker B motif resulted in a marginal decrease in this activity. The parallel loss of the helicase and ATPase activity in the K189A mutant confirms that NSs acts as a non-canonical DNA helicase. Furthermore, both the wild-type and K189A NSs could function as RNA silencing suppressors, demonstrating that the suppressor activity of NSs is independent of its helicase or ATPase activity. This is the first report of a true helicase from a negative-sense RNA virus.
Islam, M Nurul; Fox, David; Guo, Rong; Enomoto, Takemi; Wang, Weidong
2010-05-01
The RecQL5 helicase is essential for maintaining genome stability and reducing cancer risk. To elucidate its mechanism of action, we purified a RecQL5-associated complex and identified its major component as RNA polymerase II (Pol II). Bioinformatics and structural modeling-guided mutagenesis revealed two conserved regions in RecQL5 as KIX and SRI domains, already known in transcriptional regulators for Pol II. The RecQL5-KIX domain binds both initiation (Pol IIa) and elongation (Pol IIo) forms of the polymerase, whereas the RecQL5-SRI domain interacts only with the elongation form. Fully functional RecQL5 requires both helicase activity and associations with the initiation polymerase, because mutants lacking either activity are partially defective in the suppression of sister chromatid exchange and resistance to camptothecin-induced DNA damage, and mutants lacking both activities are completely defective. We propose that RecQL5 promotes genome stabilization through two parallel mechanisms: by participation in homologous recombination-dependent DNA repair as a RecQ helicase and by regulating the initiation of Pol II to reduce transcription-associated replication impairment and recombination.
Directory of Open Access Journals (Sweden)
Irene Briguglio
2011-01-01
Full Text Available Many viral pathogens encode the motor proteins named RNA helicases which display various functions in genome replication. General strategies to design specific and selective drugs targeting helicase for the treatment of viral infections could act via one or more of the following mechanisms: inhibition of the NTPase activity, by interferences with ATP binding and therefore by limiting the energy required for the unwinding and translocation, or by allosteric mechanism and therefore by stabilizing the conformation of the enzyme in low helicase activity state; inhibition of nucleic acids binding to the helicase; inhibition of coupling of ATP hydrolysis to unwinding; inhibition of unwinding by sterically blocking helicase translocation. Recently, by in vitro screening studies, it has been reported that several benzotriazole, imidazole, imidazodiazepine, phenothiazine, quinoline, anthracycline, triphenylmethane, tropolone, pyrrole, acridone, small peptide, and Bananin derivatives are endowed with helicase inhibition of pathogen viruses belonging to Flaviviridae, Coronaviridae, and Picornaviridae families.
Neumann, Bettina; Wu, Haijia; Hackmann, Alexandra; Krebber, Heike
2016-01-01
The DEAD-box RNA-helicase Dbp5/Rat8 is known for its function in nuclear mRNA export, where it displaces the export receptor Mex67 from the mRNA at the cytoplasmic side of the nuclear pore complex (NPC). Here we show that Dbp5 is also required for the nuclear export of both pre-ribosomal subunits. Yeast temperature-sensitive dbp5 mutants accumulate both ribosomal particles in their nuclei. Furthermore, Dbp5 genetically and physically interacts with known ribosomal transport factors such as Nmd3. Similar to mRNA export we show that also for ribosomal transport Dbp5 is required at the cytoplasmic side of the NPC. However, unlike its role in mRNA export, Dbp5 does not seem to undergo its ATPase cycle for this function, as ATPase-deficient dbp5 mutants that selectively inhibit mRNA export do not affect ribosomal transport. Furthermore, mutants of GLE1, the ATPase stimulating factor of Dbp5, show no major ribosomal export defects. Consequently, while Dbp5 uses its ATPase cycle to displace the export receptor Mex67 from the translocated mRNAs, Mex67 remains bound to ribosomal subunits upon transit to the cytoplasm, where it is detectable on translating ribosomes. Therefore, we propose a model, in which Dbp5 supports ribosomal transport by capturing ribosomal subunits upon their cytoplasmic appearance at the NPC, possibly by binding export factors such as Mex67. Thus, our findings reveal that although different ribonucleoparticles, mRNAs and pre-ribosomal subunits, use shared export factors, they utilize different transport mechanisms.
Seo, Mihwa; Seo, Keunhee; Hwang, Wooseon; Koo, Hee Jung; Hahm, Jeong-Hoon; Yang, Jae-Seong; Han, Seong Kyu; Hwang, Daehee; Kim, Sanguk; Jang, Sung Key; Lee, Yoontae; Nam, Hong Gil; Lee, Seung-Jae V.
2015-01-01
The homeostatic maintenance of the genomic DNA is crucial for regulating aging processes. However, the role of RNA homeostasis in aging processes remains unknown. RNA helicases are a large family of enzymes that regulate the biogenesis and homeostasis of RNA. However, the functional significance of RNA helicases in aging has not been explored. Here, we report that a large fraction of RNA helicases regulate the lifespan of Caenorhabditis elegans. In particular, we show that a DEAD-box RNA helicase, helicase 1 (HEL-1), promotes longevity by specifically activating the DAF-16/forkhead box O (FOXO) transcription factor signaling pathway. We find that HEL-1 is required for the longevity conferred by reduced insulin/insulin-like growth factor 1 (IGF-1) signaling (IIS) and is sufficient for extending lifespan. We further show that the expression of HEL-1 in the intestine and neurons contributes to longevity. HEL-1 enhances the induction of a large fraction of DAF-16 target genes. Thus, the RNA helicase HEL-1 appears to promote longevity in response to decreased IIS as a transcription coregulator of DAF-16. Because HEL-1 and IIS are evolutionarily well conserved, a similar mechanism for longevity regulation via an RNA helicase-dependent regulation of FOXO signaling may operate in mammals, including humans. PMID:26195740
The Smc5/6 complex regulates the yeast Mph1 helicase at RNA-DNA hybrid-mediated DNA damage
DEFF Research Database (Denmark)
Lafuente-Barquero, Juan; Luke-Glaser, Sarah; Graf, Marco
2017-01-01
of Fanconi anemia protein M (FANCM), is required for cell viability in the absence of RNase H enzymes. The integrity of the Mph1 helicase domain is crucial to prevent the accumulation of RNA-DNA hybrids and RNA-DNA hybrid-dependent DNA damage, as determined by Rad52 foci. Mph1 forms foci when RNA-DNA hybrids...
A Co-Opted DEAD-Box RNA helicase enhances tombusvirus plus-strand synthesis.
Directory of Open Access Journals (Sweden)
Nikolay Kovalev
2012-02-01
Full Text Available Replication of plus-strand RNA viruses depends on recruited host factors that aid several critical steps during replication. In this paper, we show that an essential translation factor, Ded1p DEAD-box RNA helicase of yeast, directly affects replication of Tomato bushy stunt virus (TBSV. To separate the role of Ded1p in viral protein translation from its putative replication function, we utilized a cell-free TBSV replication assay and recombinant Ded1p. The in vitro data show that Ded1p plays a role in enhancing plus-strand synthesis by the viral replicase. We also find that Ded1p is a component of the tombusvirus replicase complex and Ded1p binds to the 3'-end of the viral minus-stranded RNA. The data obtained with wt and ATPase deficient Ded1p mutants support the model that Ded1p unwinds local structures at the 3'-end of the TBSV (-RNA, rendering the RNA compatible for initiation of (+-strand synthesis. Interestingly, we find that Ded1p and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, which is another host factor for TBSV, play non-overlapping functions to enhance (+-strand synthesis. Altogether, the two host factors enhance TBSV replication synergistically by interacting with the viral (-RNA and the replication proteins. In addition, we have developed an in vitro assay for Flock house virus (FHV, a small RNA virus of insects, that also demonstrated positive effect on FHV replicase activity by the added Ded1p helicase. Thus, two small RNA viruses, which do not code for their own helicases, seems to recruit a host RNA helicase to aid their replication in infected cells.
Directory of Open Access Journals (Sweden)
Alicia Pérez-González
Full Text Available hCLE/C14orf166 is a nuclear and cytoplasmic protein that interacts with the RNAP II, modulates nuclear RNA metabolism and is present in cytoplasmic RNA granules involved in localized translation. Here we have studied whether hCLE shares common interactors in the nucleus and the cytosol, which could shed light on its participation in the sequential phases of RNA metabolism. Nuclear and cytoplasmic purified hCLE-associated factors were identified and proteins involved in mRNA metabolism, motor-related proteins, cytoskeletal and translation-related factors were found. Purified hCLE complexes also contain RNAs and as expected some hCLE-interacting proteins (DDX1, HSPC117, FAM98B were found both in the nucleus and the cytoplasm. Moreover, endogenous hCLE fractionates in protein complexes together with DDX1, HSPC117 and FAM98B and silencing of hCLE down-regulates their nuclear and cytosolic accumulation levels. Using a photoactivatable hCLE-GFP protein, nuclear import and export of hCLE was observed indicating that hCLE is a shuttling protein. Interestingly, hCLE nuclear import required active transcription, as did the import of DDX1, HSPC117 and FAM98B proteins. The data indicate that hCLE probably as a complex with DDX1, HSPC117 and FAM98B shuttles between the nucleus and the cytoplasm transporting RNAs suggesting that this complex has a prominent role on nuclear and cytoplasmic RNA fate.
Interplay of cis- and trans-regulatory mechanisms in the spliceosomal RNA helicase Brr2.
Absmeier, Eva; Becke, Christian; Wollenhaupt, Jan; Santos, Karine F; Wahl, Markus C
2017-01-02
RNA helicase Brr2 is implicated in multiple phases of pre-mRNA splicing and thus requires tight regulation. Brr2 can be auto-inhibited via a large N-terminal region folding back onto its helicase core and auto-activated by a catalytically inactive C-terminal helicase cassette. Furthermore, it can be regulated in trans by the Jab1 domain of the Prp8 protein, which can inhibit Brr2 by intermittently inserting a C-terminal tail in the enzyme's RNA-binding tunnel or activate the helicase after removal of this tail. Presently it is unclear, whether these regulatory mechanisms functionally interact and to which extent they are evolutionarily conserved. Here, we report crystal structures of Saccharomyces cerevisiae and Chaetomium thermophilum Brr2-Jab1 complexes, demonstrating that Jab1-based inhibition of Brr2 presumably takes effect in all eukaryotes but is implemented via organism-specific molecular contacts. Moreover, the structures show that Brr2 auto-inhibition can act in concert with Jab1-mediated inhibition, and suggest that the N-terminal region influences how the Jab1 C-terminal tail interacts at the RNA-binding tunnel. Systematic RNA binding and unwinding studies revealed that the N-terminal region and the Jab1 C-terminal tail specifically interfere with accommodation of double-stranded and single-stranded regions of an RNA substrate, respectively, mutually reinforcing each other. Additionally, such analyses show that regulation based on the N-terminal region requires the presence of the inactive C-terminal helicase cassette. Together, our results outline an intricate system of regulatory mechanisms, which control Brr2 activities during snRNP assembly and splicing.
Directory of Open Access Journals (Sweden)
Glenn Hauk
Full Text Available The DEAD-box RNA helicase Ded1, which is essential in yeast and known as DDX3 in humans, shuttles between the nucleus and cytoplasm and takes part in several basic processes including RNA processing and translation. A key interacting partner of Ded1 is the exportin Xpo1, which together with the GTP-bound state of the small GTPase Ran, facilitates unidirectional transport of Ded1 out of the nucleus. Here we demonstrate that Xpo1 and Ran[GTP] together reduce the RNA-stimulated ATPase and helicase activities of Ded1. Binding and inhibition of Ded1 by Xpo1 depend on the affinity of the Ded1 nuclear export sequence (NES for Xpo1 and the presence of Ran[GTP]. Association with Xpo1/Ran[GTP] reduces RNA-stimulated ATPase activity of Ded1 by increasing the apparent KM for the RNA substrate. Despite the increased KM, the Ded1:Xpo1:Ran[GTP] ternary complex retains the ability to bind single stranded RNA, suggesting that Xpo1/Ran[GTP] may modulate the substrate specificity of Ded1. These results demonstrate that, in addition to transport, exportins such as Xpo1 also have the capability to alter enzymatic activities of their cargo.
Directory of Open Access Journals (Sweden)
Haifeng Wang
Full Text Available Viral infection leads to induction of pattern-recognition receptor signaling, which leads to interferon regulatory factor (IRF activation and ultimately interferon (IFN production. To establish infection, many viruses have strategies to evade the innate immunity. For the hepatitis B virus (HBV, which causes chronic infection in the liver, the evasion strategy remains uncertain. We now show that HBV polymerase (Pol blocks IRF signaling, indicating that HBV Pol is the viral molecule that effectively counteracts host innate immune response. In particular, HBV Pol inhibits TANK-binding kinase 1 (TBK1/IkappaB kinase-epsilon (IKKepsilon, the effector kinases of IRF signaling. Intriguingly, HBV Pol inhibits TBK1/IKKepsilon activity by disrupting the interaction between IKKepsilon and DDX3 DEAD box RNA helicase, which was recently shown to augment TBK1/IKKepsilon activity. This unexpected role of HBV Pol may explain how HBV evades innate immune response in the early phase of the infection. A therapeutic implication of this work is that a strategy to interfere with the HBV Pol-DDX3 interaction might lead to the resolution of life-long persistent infection.
International Nuclear Information System (INIS)
Greer, Amy E.; Hearing, Patrick; Ketner, Gary
2011-01-01
The adenovirus E4 11 k protein, product of E4 ORF3, is required in infection for processes including normal accumulation of viral late mRNAs. 11 k restructures both the nucleus and cytoplasm of infected cells by relocalizing specific host cell target proteins, most strikingly components of nuclear PML oncogenic domains. It is likely that in many cases relocalization inactivates target proteins to produce 11 k's effects, although the mechanism and targets for stimulation of late mRNA accumulation is unknown. We have identified a new set of proteins relocalized by 11 k: at least five protein components of cytoplasmic mRNA processing bodies (p-bodies) are found in 11 k-induced cytoplasmic aggresomes, sites where proteins are inactivated or destroyed. One of these p-body proteins, RNA helicase Ddx6, binds 11 k, suggesting a mechanism for relocalization. Because p-bodies are sites for mRNA degradation, their modification by 11 k may provide an explanation for the role of 11 k in viral late mRNA accumulation.
Molecular determinants of nucleolar translocation of RNA helicase A
International Nuclear Information System (INIS)
Liu Zhe; Kenworthy, Rachael; Green, Christopher; Tang, Hengli
2007-01-01
RNA helicase A (RHA) is a member of the DEAH-box family of DNA/RNA helicases involved in multiple cellular processes and the life cycles of many viruses. The subcellular localization of RHA is dynamic despite its steady-state concentration in the nucleoplasm. We have previously shown that it shuttles rapidly between the nucleus and the cytoplasm by virtue of a bidirectional nuclear transport domain (NTD) located in its carboxyl terminus. Here, we investigate the molecular determinants for its translocation within the nucleus and, more specifically, its redistribution from the nucleoplasm to nucleolus or the perinucleolar region. We found that low temperature treatment, transcription inhibition or replication of hepatitis C virus caused the intranuclear redistribution of the protein, suggesting that RHA shuttles between the nucleolus and nucleoplasm and becomes trapped in the nucleolus or the perinucleolar region upon blockade of transport to the nucleoplasm. Both the NTD and ATPase activity were essential for RHA's transport to the nucleolus or perinucleolar region. One of the double-stranded RNA binding domains (dsRBD II) was also required for this nucleolar translocation (NoT) phenotype. RNA interference studies revealed that RHA is essential for survival of cultured hepatoma cells and the ATPase activity appears to be important for this critical role
MacNair, Laura; Xiao, Shangxi; Miletic, Denise; Ghani, Mahdi; Julien, Jean-Pierre; Keith, Julia; Zinman, Lorne; Rogaeva, Ekaterina; Robertson, Janice
2016-01-01
Tar DNA-binding protein 43 (TDP-43) is an RNA-binding protein normally localized to the nucleus of cells, where it elicits functions related to RNA metabolism such as transcriptional regulation and alternative splicing. In amyotrophic lateral sclerosis, TDP-43 is mislocalized from the nucleus to the cytoplasm of diseased motor neurons, forming ubiquitinated inclusions. Although mutations in the gene encoding TDP-43, TARDBP, are found in amyotrophic lateral sclerosis, these are rare. However, TDP-43 pathology is common to over 95% of amyotrophic lateral sclerosis cases, suggesting that abnormalities of TDP-43 play an active role in disease pathogenesis. It is our hypothesis that a loss of TDP-43 from the nucleus of affected motor neurons in amyotrophic lateral sclerosis will lead to changes in RNA processing and expression. Identifying these changes could uncover molecular pathways that underpin motor neuron degeneration. Here we have used translating ribosome affinity purification coupled with microarray analysis to identify the mRNAs being actively translated in motor neurons of mutant TDP-43(A315T) mice compared to age-matched non-transgenic littermates. No significant changes were found at 5 months (presymptomatic) of age, but at 10 months (symptomatic) the translational profile revealed significant changes in genes involved in RNA metabolic process, immune response and cell cycle regulation. Of 28 differentially expressed genes, seven had a ≥ 2-fold change; four were validated by immunofluorescence labelling of motor neurons in TDP-43(A315T) mice, and two of these were confirmed by immunohistochemistry in amyotrophic lateral sclerosis cases. Both of these identified genes, DDX58 and MTHFSD, are RNA-binding proteins, and we show that TDP-43 binds to their respective mRNAs and we identify MTHFSD as a novel component of stress granules. This discovery-based approach has for the first time revealed translational changes in motor neurons of a TDP-43 mouse model
Xu, Ruirui; Zhang, Shizhong; Huang, Jinguang; Zheng, Chengchao
2013-01-01
RNA helicases are enzymes that are thought to unwind double-stranded RNA molecules in an energy-dependent fashion through the hydrolysis of NTP. RNA helicases are associated with all processes involving RNA molecules, including nuclear transcription, editing, splicing, ribosome biogenesis, RNA export, and organelle gene expression. The involvement of RNA helicase in response to stress and in plant growth and development has been reported previously. While their importance in Arabidopsis and Oryza sativa has been partially studied, the function of RNA helicase proteins is poorly understood in Zea mays and Glycine max. In this study, we identified a total of RNA helicase genes in Arabidopsis and other crop species genome by genome-wide comparative in silico analysis. We classified the RNA helicase genes into three subfamilies according to the structural features of the motif II region, such as DEAD-box, DEAH-box and DExD/H-box, and different species showed different patterns of alternative splicing. Secondly, chromosome location analysis showed that the RNA helicase protein genes were distributed across all chromosomes with different densities in the four species. Thirdly, phylogenetic tree analyses identified the relevant homologs of DEAD-box, DEAH-box and DExD/H-box RNA helicase proteins in each of the four species. Fourthly, microarray expression data showed that many of these predicted RNA helicase genes were expressed in different developmental stages and different tissues under normal growth conditions. Finally, real-time quantitative PCR analysis showed that the expression levels of 10 genes in Arabidopsis and 13 genes in Zea mays were in close agreement with the microarray expression data. To our knowledge, this is the first report of a comparative genome-wide analysis of the RNA helicase gene family in Arabidopsis, Oryza sativa, Zea mays and Glycine max. This study provides valuable information for understanding the classification and putative functions of
DEAD-Box RNA Helicases are among the Constituents of the Tobacco Pollen mRNA Storing Bodies
Czech Academy of Sciences Publication Activity Database
Hafidh, Said; Potěšil, D.; Zdráhal, Z.; Honys, David
2013-01-01
Roč. 1, č. 3 (2013) ISSN 2329-9029 R&D Projects: GA ČR GPP501/11/P321; GA ČR(CZ) GAP501/11/1462; GA MŠk(CZ) ED1.1.00/02.0068; GA MŠk(CZ) LD13049 Institutional support: RVO:61389030 Keywords : Translation * mRNA storage * RNA helicase Subject RIV: EB - Genetics ; Molecular Biology
Fu, Qinqin; Yuan, Y Adam
2013-03-01
Intensive research interest has focused on small RNA-processing machinery and the RNA-induced silencing complex (RISC), key cellular machines in RNAi pathways. However, the structural mechanism regarding RISC assembly, the primary step linking small RNA processing and RNA-mediated gene silencing, is largely unknown. Human RNA helicase A (DHX9) was reported to function as an RISC-loading factor, and such function is mediated mainly by its dsRNA-binding domains (dsRBDs). Here, we report the crystal structures of human RNA helicase A (RHA) dsRBD1 and dsRBD2 domains in complex with dsRNAs, respectively. Structural analysis not only reveals higher siRNA duplex-binding affinity displayed by dsRBD1, but also identifies a crystallographic dsRBD1 pair of physiological significance in cooperatively recognizing dsRNAs. Structural observations are further validated by isothermal titration calorimetric (ITC) assay. Moreover, co-immunoprecipitation (co-IP) assay coupled with mutagenesis demonstrated that both dsRBDs are required for RISC association, and such association is mediated by dsRNA. Hence, our structural and functional efforts have revealed a potential working model for siRNA recognition by RHA tandem dsRBDs, and together they provide direct structural insights into RISC assembly facilitated by RHA.
The eIF4AIII RNA helicase is a critical determinant of human cytomegalovirus replication
Energy Technology Data Exchange (ETDEWEB)
Ziehr, Ben; Lenarcic, Erik; Cecil, Chad; Moorman, Nathaniel J., E-mail: nmoorman@med.unc.edu
2016-02-15
Human cytomegalovirus (HCMV) was recently shown to encode a large number of spliced mRNAs. While the nuclear export of unspliced viral transcripts has been extensively studied, the role of host mRNA export factors in HCMV mRNA trafficking remains poorly defined. We found that the eIF4AIII RNA helicase, a component of the exon junction complex, was necessary for efficient virus replication. Depletion of eIF4AIII limited viral DNA accumulation, export of viral mRNAs from the nucleus, and the production of progeny virus. However eIF4AIII was dispensable for the association of viral transcripts with ribosomes. We found that pateamine A, a natural compound that inhibits both eIF4AI/II and eIF4AIII, has potent antiviral activity and inhibits HCMV replication throughout the virus lytic cycle. Our results demonstrate that eIF4AIII is required for efficient HCMV replication, and suggest that eIF4A family helicases may be a new class of targets for the development of host-directed antiviral therapeutics. - Highlights: • The host eIF4AIII RNA helicase is required for efficient HCMV replication. • Depleting eIF4AIII inhibited the nuclear export of HCMV mRNAs. • HCMV mRNAs did not require eIF4AIII to associate with polyribosomes. • The eIF4A family helicases may be new targets for host-directed antiviral drugs.
The eIF4AIII RNA helicase is a critical determinant of human cytomegalovirus replication
International Nuclear Information System (INIS)
Ziehr, Ben; Lenarcic, Erik; Cecil, Chad; Moorman, Nathaniel J.
2016-01-01
Human cytomegalovirus (HCMV) was recently shown to encode a large number of spliced mRNAs. While the nuclear export of unspliced viral transcripts has been extensively studied, the role of host mRNA export factors in HCMV mRNA trafficking remains poorly defined. We found that the eIF4AIII RNA helicase, a component of the exon junction complex, was necessary for efficient virus replication. Depletion of eIF4AIII limited viral DNA accumulation, export of viral mRNAs from the nucleus, and the production of progeny virus. However eIF4AIII was dispensable for the association of viral transcripts with ribosomes. We found that pateamine A, a natural compound that inhibits both eIF4AI/II and eIF4AIII, has potent antiviral activity and inhibits HCMV replication throughout the virus lytic cycle. Our results demonstrate that eIF4AIII is required for efficient HCMV replication, and suggest that eIF4A family helicases may be a new class of targets for the development of host-directed antiviral therapeutics. - Highlights: • The host eIF4AIII RNA helicase is required for efficient HCMV replication. • Depleting eIF4AIII inhibited the nuclear export of HCMV mRNAs. • HCMV mRNAs did not require eIF4AIII to associate with polyribosomes. • The eIF4A family helicases may be new targets for host-directed antiviral drugs.
Substrate-assisted mechanism of RNP disruption by the spliceosomal Brr2 RNA helicase
Theuser, Matthias; Höbartner, Claudia; Wahl, Markus C.; Santos, Karine F.
2016-01-01
The Brr2 RNA helicase disrupts the U4/U6 di-small nuclear RNA–protein complex (di-snRNP) during spliceosome activation via ATP-driven translocation on the U4 snRNA strand. However, it is unclear how bound proteins influence U4/U6 unwinding, which regions of the U4/U6 duplex the helicase actively unwinds, and whether U4/U6 components are released as individual molecules or as subcomplexes. Here, we set up a recombinant Brr2-mediated U4/U6 di-snRNP disruption system, showing that sequential addition of the U4/U6 proteins small nuclear ribonucleoprotein-associated protein 1 (Snu13), pre-mRNA processing factor 31 (Prp31), and Prp3 to U4/U6 di-snRNA leads to a stepwise decrease of Brr2-mediated U4/U6 unwinding, but that unwinding is largely restored by a Brr2 cofactor, the C-terminal Jab1/MPN domain of the Prp8 protein. Brr2-mediated U4/U6 unwinding was strongly inhibited by mutations in U4/U6 di-snRNAs that diminish the ability of U6 snRNA to adopt an alternative conformation but leave the number and kind of U4/U6 base pairs unchanged. Irrespective of the presence of the cofactor, the helicase segregated a Prp3-Prp31-Snu13-U4/U6 RNP into an intact Prp31-Snu13-U4 snRNA particle, free Prp3, and free U6 snRNA. Together, these observations suggest that Brr2 translocates only a limited distance on the U4 snRNA strand and does not actively release RNA-bound proteins. Unwinding is then completed by the partially displaced U6 snRNA adopting an alternative conformation, which leads to dismantling of the Prp3-binding site on U4/U6 di-snRNA but leaves the Prp31- and Snu13-binding sites on U4 snRNA unaffected. In this fashion, Brr2 can activate the spliceosome by stripping U6 snRNA of all precatalytic binding partners, while minimizing logistic requirements for U4/U6 di-snRNP reassembly after splicing. PMID:27354531
The Q Motif Is Involved in DNA Binding but Not ATP Binding in ChlR1 Helicase.
Directory of Open Access Journals (Sweden)
Hao Ding
Full Text Available Helicases are molecular motors that couple the energy of ATP hydrolysis to the unwinding of structured DNA or RNA and chromatin remodeling. The conversion of energy derived from ATP hydrolysis into unwinding and remodeling is coordinated by seven sequence motifs (I, Ia, II, III, IV, V, and VI. The Q motif, consisting of nine amino acids (GFXXPXPIQ with an invariant glutamine (Q residue, has been identified in some, but not all helicases. Compared to the seven well-recognized conserved helicase motifs, the role of the Q motif is less acknowledged. Mutations in the human ChlR1 (DDX11 gene are associated with a unique genetic disorder known as Warsaw Breakage Syndrome, which is characterized by cellular defects in genome maintenance. To examine the roles of the Q motif in ChlR1 helicase, we performed site directed mutagenesis of glutamine to alanine at residue 23 in the Q motif of ChlR1. ChlR1 recombinant protein was overexpressed and purified from HEK293T cells. ChlR1-Q23A mutant abolished the helicase activity of ChlR1 and displayed reduced DNA binding ability. The mutant showed impaired ATPase activity but normal ATP binding. A thermal shift assay revealed that ChlR1-Q23A has a melting point value similar to ChlR1-WT. Partial proteolysis mapping demonstrated that ChlR1-WT and Q23A have a similar globular structure, although some subtle conformational differences in these two proteins are evident. Finally, we found ChlR1 exists and functions as a monomer in solution, which is different from FANCJ, in which the Q motif is involved in protein dimerization. Taken together, our results suggest that the Q motif is involved in DNA binding but not ATP binding in ChlR1 helicase.
Crystal structures of the methyltransferase and helicase from the ZIKA 1947 MR766 Uganda strain
Energy Technology Data Exchange (ETDEWEB)
Bukrejewska, Malgorzata; Derewenda, Urszula; Radwanska, Malwina; Engel, Daniel A.; Derewenda, Zygmunt S.
2017-08-15
Two nonstructural proteins encoded by
Gu, Lili; Fullam, Anthony; McCormack, Niamh; Höhn, Yvette; Schröder, Martina
2017-02-15
The human DEAD-box helicase 3 (DDX3) has been shown to contribute to type I interferon (IFN) induction downstream from antiviral pattern recognition receptors. It binds to TANK-binding kinase 1 and IκB-kinase-ε (IKKε), the two key kinases mediating activation of IFN regulatory factor (IRF) 3 and IRF7. We previously demonstrated that DDX3 facilitates IKKε activation downstream from RIG-I and then links the activated kinase to IRF3. In the present study, we probed the interactions between DDX3 and other key signalling molecules in the RIG-I pathway and identified a novel direct interaction between DDX3 and TNF receptor-associated factor 3 (TRAF3) mediated by a TRAF-interaction motif in the N-terminus of DDX3, which was required for TRAF3 ubiquitination. Interestingly, we observed two waves of K63-linked TRAF3 ubiquitination following RIG-I activation by Sendai virus (SeV) infection, both of which were suppressed by DDX3 knockdown. We also investigated the spatiotemporal formation of endogenous downstream signalling complexes containing the mitochondrial antiviral signalling (MAVS) adaptor, DDX3, IκB-kinase-ε (IKKε), TRAF3 and IRF3. DDX3 was recruited to MAVS early after SeV infection, suggesting that it might mediate subsequent recruitment of other molecules. Indeed, knockdown of DDX3 prevented the formation of TRAF3-MAVS and TRAF3-IKKε complexes. Based on our data, we propose that early TRAF3 ubiquitination is required for the formation of a stable MAVS-TRAF3 complex, while the second wave of TRAF3 ubiquitination mediates IRF3 recruitment and activation. Our study characterises DDX3 as a multifunctional adaptor molecule that co-ordinates assembly of different TRAF3, IKKε and IRF3-containing signalling complexes downstream from MAVS. Additionally, it provides novel insights into the role of TRAF3 in RIG-I signalling. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.
Tang, Jieting; Chen, Huarong; Wong, Chi-Chun; Liu, Dabin; Li, Tong; Wang, Xiaohong; Ji, Jiafu; Sung, Joseph Jy; Fang, Jing-Yuan; Yu, Jun
2018-03-14
Copy number alterations (CNAs) are crucial for colorectal cancer (CRC) development. In this study, DEAD box polypeptide 27 (DDX27) was identified to be highly amplified in both TCGA CRC (474/615) and primary CRC (47/103), which was positively correlated with its mRNA overexpression. High DDX27 mRNA (N = 199) and protein expression (N = 260) predicted poor survival in CRC patients. Ectopic expression of DDX27 increased CRC cells proliferation, migration and invasion, but suppressed apoptosis. Conversely, silencing of DDX27 exerted opposite effects in vitro and significantly inhibited murine xenograft tumor growth and lung metastasis in vivo. Up-regulation of DDX27 enhanced and prolonged TNF-α-mediated NF-κB signaling. Nucleophosmin (NPM1) was identified as a binding partner of DDX27. DDX27 increased nuclear NPM1 and NF-κB-p65 interaction to enhance DNA binding activity of NF-κB. Silencing NPM1 abrogated DDX27-activating NF-κB signaling and its tumor-promoting function. Together, DDX27 is overexpressed and plays a pivotal oncogenic role in CRC.
Structural basis of Zika virus helicase in recognizing its substrates
Directory of Open Access Journals (Sweden)
Hongliang Tian
2016-07-01
Full Text Available Abstract The recent explosive outbreak of Zika virus (ZIKV infection has been reported in South and Central America and the Caribbean. Neonatal microcephaly associated with ZIKV infection has already caused a public health emergency of international concern. No specific vaccines or drugs are currently available to treat ZIKV infection. The ZIKV helicase, which plays a pivotal role in viral RNA replication, is an attractive target for therapy. We determined the crystal structures of ZIKV helicase-ATP-Mn2+ and ZIKV helicase-RNA. This is the first structure of any flavivirus helicase bound to ATP. Comparisons with related flavivirus helicases have shown that although the critical P-loop in the active site has variable conformations among different species, it adopts an identical mode to recognize ATP/Mn2+. The structure of ZIKV helicase-RNA has revealed that upon RNA binding, rotations of the motor domains can cause significant conformational changes. Strikingly, although ZIKV and dengue virus (DENV apo-helicases share conserved residues for RNA binding, their different manners of motor domain rotations result in distinct individual modes for RNA recognition. It suggests that flavivirus helicases could have evolved a conserved engine to convert chemical energy from nucleoside triphosphate to mechanical energy for RNA unwinding, but different motor domain rotations result in variable RNA recognition modes to adapt to individual viral replication.
Functional interaction between Smad, CREB binding protein, and p68 RNA helicase
International Nuclear Information System (INIS)
Warner, Dennis R.; Bhattacherjee, Vasker; Yin, Xiaolong; Singh, Saurabh; Mukhopadhyay, Partha; Pisano, M. Michele; Greene, Robert M.
2004-01-01
The transforming growth factors β control a diversity of biological processes including cellular proliferation, differentiation, apoptosis, and extracellular matrix production, and are critical effectors of embryonic patterning and development, including that of the orofacial region. TGFβ superfamily members signal through specific cell surface receptors that phosphorylate the cytoplasmic Smad proteins, resulting in their translocation to the nucleus and interaction with promoters of TGFβ-responsive genes. Subsequent alterations in transcription are cell type-specific and dependent on recruitment to the Smad/transcription factor complex of coactivators, such as CBP and p300, or corepressors, such as c-ski and SnoN. Since the affinity of Smads for DNA is generally low, additional accessory proteins that facilitate Smad/DNA binding are required, and are often cell- and tissue-specific. In order to identify novel Smad 3 binding proteins in developing orofacial tissue, a yeast two hybrid assay was employed in which the MH2 domain of Smad 3 was used to screen an expression library derived from mouse embryonic orofacial tissue. The RNA helicase, p68, was identified as a unique Smad binding protein, and the specificity of the interaction was confirmed through various in vitro and in vivo assays. Co-expression of Smad 3 and a CBP-Gal4 DNA binding domain fusion protein in a Gal4-luciferase reporter assay resulted in increased TGFβ-stimulated reporter gene transcription. Moreover, co-expression of p68 RNA helicase along with Smad 3 and CBP-Gal4 resulted in synergistic activation of Gal4-luciferase reporter expression. Collectively, these data indicate that the RNA helicase, p68, can directly interact with Smad 3 resulting in formation of a transcriptionally active ternary complex containing Smad 3, p68, and CBP. This offers a means of enhancing TGFβ-mediated cellular responses in developing orofacial tissue
The nuclear import of RNA helicase A is mediated by importin-α3
International Nuclear Information System (INIS)
Aratani, Satoko; Oishi, Takayuki; Fujita, Hidetoshi; Nakazawa, Minako; Fujii, Ryouji; Imamoto, Naoko; Yoneda, Yoshihiro; Fukamizu, Akiyoshi; Nakajima, Toshihiro
2006-01-01
RNA helicase A (RHA), an ATPase/helicase, regulates the gene expression at various steps including transcriptional activation and RNA processing. RHA is known to shuttle between the nucleus and cytoplasm. We identified the nuclear localization signal (NLS) of RHA and analyzed the nuclear import mechanisms. The NLS of RHA (RHA-NLS) consisting of 19 amino acid residues is highly conserved through species and does not have the consensus classical NLS. In vitro nuclear import assays revealed that the nuclear import of RHA was Ran-dependent and mediated with the classical importin-α/β-dependent pathway. The binding assay indicated that the basic residues in RHA-NLS were used for interaction with importin-α. Furthermore, the nuclear import of RHA-NLS was supported by importin-α1 and preferentially importin-α3. Our results indicate that the nuclear import of RHA is mediated by the importin-α3/importin-β-dependent pathway and suggest that the specificity for importin may regulate the functions of cargo proteins
Identification of NPM and DDX5 as Therapeutic Targets in TSC
2017-12-01
Medical Research and Materiel Command Fort Detrick, Maryland 21702-5012 DISTRIBUTION STATEMENT: Approved for Public Release; Distribution Unlimited...9. SPONSORING / MONITORING AGENCY NAME(S) AND ADDRESS(ES) 10. SPONSOR/MONITOR’S ACRONYM(S) U.S. Army Medical Research and Materiel Command Fort...complexes in TSC cells. 15. SUBJECT TERMS NPM, DDX5, TSC, chemical library , split-luciferase 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT
DEAD-box RNA helicase is dispensable for mitochondrial translation in Trypanosoma brucei
Czech Academy of Sciences Publication Activity Database
Richterová, Lenka; Vávrová, Zuzana; Lukeš, Julius
2011-01-01
Roč. 127, č. 1 (2011), 300-303 ISSN 0014-4894 R&D Projects: GA ČR GA204/09/1667; GA MŠk LC07032; GA MŠk 2B06129 Institutional research plan: CEZ:AV0Z60220518 Keywords : Trypanosoma * Mitochondrial translation * RNA helicase * Cytochrome c oxidase * Mitochondrion Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.122, year: 2011
Directory of Open Access Journals (Sweden)
Cecilia Zampedri
2016-10-01
Full Text Available Stress granules are cytoplasmic foci that directly respond to the protein synthesis status of the cell. Various environmental insults, such as oxidative stress or extreme heat, block protein synthesis; consequently, mRNA will stall in translation, and stress granules will immediately form and become enriched with mRNAs. P54 DEAD box RNA helicases are components of RNA granules such as P-bodies and stress granules. We studied the expression, in cytoplasmic foci, of both zebrafish P54 RNA helicases (P54a and P54b during development and found that they are expressed in cytoplasmic granules under both normal conditions and stress conditions. In zebrafish embryos exposed to heat shock, some proportion of P54a and P54b helicases move to larger granules that exhibit the properties of genuine stress granules. Knockdown of P54a and/or P54b in zebrafish embryos produces developmental abnormalities restricted to the posterior trunk; further, these embryos do not form stress granules, and their survival upon exposure to heat-shock conditions is compromised. Our observations fit the model that cells lacking stress granules have no resilience or ability to recover once the stress has ended, indicating that stress granules play an essential role in the way organisms adapt to a changing environment.
Structural basis for the function of DEAH helicases
DEFF Research Database (Denmark)
He, Yangzi; Andersen, Gregers Rom; Nielsen, Klaus Hvid
2010-01-01
DEAH helicases participate in pre‐messenger RNA splicing and ribosome biogenesis. The structure of yeast Prp43p‐ADP reveals the homology of DEAH helicases to DNA helicases and the presence of an oligonucleotide‐binding motif. A β‐hairpin from the second RecA domain is wedged between two carboxy......‐terminal domains and blocks access to the occluded RNA binding site formed by the RecA domains and a C‐terminal domain. ATP binding and hydrolysis are likely to induce conformational changes in the hairpin that are important for RNA unwinding or ribonucleoprotein remodelling. The structure of Prp43p provides...
Götze, Michael; Dufourt, Jérémy; Ihling, Christian; Rammelt, Christiane; Pierson, Stephanie; Sambrani, Nagraj; Temme, Claudia; Sinz, Andrea; Simonelig, Martine; Wahle, Elmar
2017-10-01
Translational repression of maternal mRNAs is an essential regulatory mechanism during early embryonic development. Repression of the Drosophila nanos mRNA, required for the formation of the anterior-posterior body axis, depends on the protein Smaug binding to two Smaug recognition elements (SREs) in the nanos 3' UTR. In a comprehensive mass spectrometric analysis of the SRE-dependent repressor complex, we identified Smaug, Cup, Me31B, Trailer hitch, eIF4E, and PABPC, in agreement with earlier data. As a novel component, the RNA-dependent ATPase Belle (DDX3) was found, and its involvement in deadenylation and repression of nanos was confirmed in vivo. Smaug, Cup, and Belle bound stoichiometrically to the SREs, independently of RNA length. Binding of Me31B and Tral was also SRE-dependent, but their amounts were proportional to the length of the RNA and equimolar to each other. We suggest that "coating" of the RNA by a Me31B•Tral complex may be at the core of repression. © 2017 Götze et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Hwang, Kyo Seon; Lee, Sang-Myung; Eom, Kilho; Lee, Jeong Hoon; Lee, Yoon-Sik; Park, Jung Ho; Yoon, Dae Sung; Kim, Tae Song
2007-11-30
We report the nanomechanical microcantilevers operated in vibration modes (oscillation) with use of RNA aptamers as receptor molecules for label-free detection of hepatitis C virus (HCV) helicase. The nanomechanical detection principle is that the ligand-receptor binding on the microcantilever surface induces the dynamic response change of microcantilevers. We implemented the label-free detection of HCV helicase in the low concentration as much as 100 pg/ml from measuring the dynamic response change of microcantilevers. Moreover, from the recent studies showing that the ligand-receptor binding generates the surface stress on the microcantilever, we estimate the surface stress, on the oscillating microcantilevers, induced by ligand-receptor binding, i.e. binding between HCV helicase and RNA aptamer. In this article, it is suggested that the oscillating microcantilevers with use of RNA aptamers as receptor molecules may enable one to implement the sensitive label-free detection of very small amount of small-scale proteins.
Directory of Open Access Journals (Sweden)
Mahendran Botlagunta
2011-03-01
Full Text Available DEAD box protein, DDX3, is aberrantly expressed in breast cancer cells ranging from weakly invasive to aggressive phenotypes and functions as an important regulator of cancer cell growth and survival. Here, we demonstrate that hypoxia inducible factor-1α is a transcriptional activator of DDX3 in breast cancer cells. Within the promoter region of the human DDX3 gene, we identified three putative hypoxia inducible factor-1 responsive elements. By luciferase reporter assays in combination with mutated hypoxia inducible factor-1 responsive elements, we determined that the hypoxia inducible factor-1 responsive element at position -153 relative to the translation start site is essential for transcriptional activation of DDX3 under hypoxic conditions. We also demonstrated that hypoxia inducible factor-1 binds to the DDX3 promoter and that the binding is specific, as revealed by siRNA against hypoxia inducible factor-1 and chromatin immunoprecipitation assays. Thus, the activation of DDX3 expression during hypoxia is due to the direct binding of hypoxia inducible factor-1 to hypoxia responsive elements in the DDX3 promoter. In addition, we observed a significant overlap in the protein expression pattern of hypoxia inducible factor-1α and DDX3 in MDA-MB-231 xenograft tumors. Taken together, our results demonstrate, for the first time, the role of DDX3 as a hypoxia-inducible gene that exhibits enhanced expression through the interaction of hypoxia inducible factor-1 with hypoxia inducible factor-1 responsive elements in its promoter region.
RNA helicase A is not required for RISC activity.
Liang, Xue-Hai; Crooke, Stanley T
2013-10-01
It has been shown that siRNAs can compete with each other or with endogenous miRNAs for RISC components. This competition may complicate the interpretations of phenotypes observed through siRNA-mediated knockdown of genes, especially those genes implicated in the RISC pathway. In this study, we re-examined the function of RNA helicase A (RHA), which has been previously proposed to function in RISC loading based on siRNA-mediated knockdown studies. Here we show that reduced RISC activity or loading of siRNAs was observed only in cells depleted of RHA using siRNA, but not using RNaseH-dependent antisense oligonucleotides (ASOs), suggesting that the impaired RISC function stems from the competition between pre-existing and newly transfected siRNAs, but not from reduction of the RHA protein. This view is further supported by the findings that cells depleted of a control protein, NCL1, using siRNA, but not ASO, exhibited similar defects on the loading and activity of a subsequently transfected siRNA. Transfection of RHA or NCL1 siRNAs, but not ASOs, reduced the levels of endogenous miRNAs, suggesting a competition mechanism. As a positive control, we showed that reduction of MOV10 by either siRNA or ASO decreased siRNA activity, confirming its role in RISC function. Together, our results indicate that RHA is not required for RISC activity or loading, and suggest that proper controls are required when using siRNAs to functionalize genes to avoid competition effects. © 2013. Published by Elsevier B.V. All rights reserved.
RIG-I-Like Receptor Signaling in Singleton-Merten Syndrome
Directory of Open Access Journals (Sweden)
Changming Lu
2017-09-01
Full Text Available Singleton-Merten syndrome (SMS is an autosomal dominant, multi-system innate immune disorder characterized by early and severe aortic and valvular calcification, dental and skeletal abnormalities, psoriasis, glaucoma, and other varying clinical findings. Recently we identified a specific gain-of-function mutation in IFIH1, interferon induced with helicase C domain 1, segregated with this disease. SMS disease without hallmark dental anomalies, termed atypical SMS, has recently been reported caused by variants in DDX58, DEXD/H-box helicase 58. IFIH1 and DDX58 encode retinoic acid-inducible gene I (RIG-I-like receptors family members melanoma differentiation-associated gene 5 and RIG-I, respectively. These cytosolic pattern recognition receptors function in viral RNA detection initiating an innate immune response through independent pathways that promote type I and type III interferon expression and proinflammatory cytokines. In this review, we focus on SMS as an innate immune disorder summarizing clinical features, molecular aspects of the pathogenetic pathway and discussing underlying mechanisms of the disease.
International Nuclear Information System (INIS)
Gai, Muhuizi; Bo, Qifang; Qi, Lixia
2016-01-01
Ovarian cancer contributes to the majority of ovarian cancer, while the molecular mechanisms remain elusive. Recently, some DEAD box protein 1 has been reported play a tumor suppressor role in ovarian cancer progression. However, the functions of DEAD box protein (DDX) members in ovarian cancer development remain largely unknown. In current study, we retrieved GEO databases and surprisingly found that DDX10 is significantly down-regulated in ovarian cancer tissues compared with normal ovary. These findings suggest that DDX10 might also play a suppressive role in ovarian cancer. We then validated the down-regulated expression pattern of DDX10 in fresh ovarian cancer tissues. Furthermore, both loss- and gain-functions assays reveal that the down-regulated DDX10 could promote ovarian cancer proliferation in vitro and the xenograft subcutaneous tumor formation assays confirmed these findings in vivo. In addition, we found that DDX10 is epigenetic silenced by miR-155-5p in ovarian cancer. Moreover, we further preliminary illustrated that down-regulated DDX10 promotes ovarian cancer cell proliferation through Akt/NF-κB pathway. Taken together, in current study, we found a novel tumor suppressor, DDX10, is epigenetic silenced by miR-155-5p in ovarian cancer, and the down-regulated expression pattern of DDX10 promotes ovarian cancer proliferation through Akt/NF-κB pathway. Our findings shed the light that DDX families might be a novel for ovarian cancer treatment. - Highlights: • A novel DEAD box protein, DDX10 is significantly down-regulated in ovarian cancer tissues. • Down-regulated DDX10 promotes ovarian cancer cell proliferation and growth both in vitro and in vivo. • miR-155-5p is highly expressed in ovarian cancer tissues and epigenetically targets DDX10. • DDX10 and miR-155-5p regulates Akt/p65 axis in ovarian cancer cells.
Energy Technology Data Exchange (ETDEWEB)
Gai, Muhuizi; Bo, Qifang; Qi, Lixia, E-mail: lixiaqi_dph@sina.com
2016-01-22
Ovarian cancer contributes to the majority of ovarian cancer, while the molecular mechanisms remain elusive. Recently, some DEAD box protein 1 has been reported play a tumor suppressor role in ovarian cancer progression. However, the functions of DEAD box protein (DDX) members in ovarian cancer development remain largely unknown. In current study, we retrieved GEO databases and surprisingly found that DDX10 is significantly down-regulated in ovarian cancer tissues compared with normal ovary. These findings suggest that DDX10 might also play a suppressive role in ovarian cancer. We then validated the down-regulated expression pattern of DDX10 in fresh ovarian cancer tissues. Furthermore, both loss- and gain-functions assays reveal that the down-regulated DDX10 could promote ovarian cancer proliferation in vitro and the xenograft subcutaneous tumor formation assays confirmed these findings in vivo. In addition, we found that DDX10 is epigenetic silenced by miR-155-5p in ovarian cancer. Moreover, we further preliminary illustrated that down-regulated DDX10 promotes ovarian cancer cell proliferation through Akt/NF-κB pathway. Taken together, in current study, we found a novel tumor suppressor, DDX10, is epigenetic silenced by miR-155-5p in ovarian cancer, and the down-regulated expression pattern of DDX10 promotes ovarian cancer proliferation through Akt/NF-κB pathway. Our findings shed the light that DDX families might be a novel for ovarian cancer treatment. - Highlights: • A novel DEAD box protein, DDX10 is significantly down-regulated in ovarian cancer tissues. • Down-regulated DDX10 promotes ovarian cancer cell proliferation and growth both in vitro and in vivo. • miR-155-5p is highly expressed in ovarian cancer tissues and epigenetically targets DDX10. • DDX10 and miR-155-5p regulates Akt/p65 axis in ovarian cancer cells.
Directory of Open Access Journals (Sweden)
Cornelia Kilchert
2015-12-01
Full Text Available In eukaryotic cells, inefficient splicing is surprisingly common and leads to the degradation of transcripts with retained introns. How pre-mRNAs are committed to nuclear decay is unknown. Here, we uncover a mechanism by which specific intron-containing transcripts are targeted for nuclear degradation in fission yeast. Sequence elements within these “decay-promoting” introns co-transcriptionally recruit the exosome specificity factor Mmi1, which induces degradation of the unspliced precursor and leads to a reduction in the levels of the spliced mRNA. This mechanism negatively regulates levels of the RNA helicase DDX5/Dbp2 to promote cell survival in response to stress. In contrast, fast removal of decay-promoting introns by co-transcriptional splicing precludes Mmi1 recruitment and relieves negative expression regulation. We propose that decay-promoting introns facilitate the regulation of gene expression. Based on the identification of multiple additional Mmi1 targets, including mRNAs, long non-coding RNAs, and sn/snoRNAs, we suggest a general role in RNA regulation for Mmi1 through transcript degradation.
A DEAD box protein facilitates HIV-1 replication as a cellular co-factor of Rev
International Nuclear Information System (INIS)
Fang Jianhua; Kubota, Satoshi; Yang Bin; Zhou Naiming; Zhang Hui; Godbout, Roseline; Pomerantz, Roger J.
2004-01-01
HIV-1 Rev escorts unspliced viral mRNAs out of the nucleus of infected cells, which allows formation of infectious HIV-1 virions. We have identified a putative DEAD box (Asp-Glu-Ala-Asp) RNA helicase, DDX1, as a cellular co-factor of Rev, through yeast and mammalian two-hybrid systems using the N-terminal motif of Rev as 'bait'. DDX1 is not a functional homolog of HIV-1 Rev, but down-regulation of DDX1 resulted in an alternative splicing pattern of Rev-responsive element (RRE)-containing mRNA, and attenuation of Gag p24 antigen production from HLfb rev(-) cells rescued by exogenous Rev. Co-transfection of a DDX1 expression vector with HIV-1 significantly increased viral production. DDX1 binding to Rev, as well as to the RRE, strongly suggest that DDX1 affects Rev function through the Rev-RRE axis. Moreover, down-regulation of DDX1 altered the steady state subcellular distribution of Rev, from nuclear/nucleolar to cytoplasmic dominance. These findings indicate that DDX1 is a critical cellular co-factor for Rev function, which maintains the proper subcellular distribution of this lentiviral regulatory protein. Therefore, alterations in DDX1-Rev interactions could induce HIV-1 persistence and targeting DDX1 may lead to rationally designed and novel anti-HIV-1 strategies and therapeutics
Directory of Open Access Journals (Sweden)
Hideaki Tokunaga
2016-01-01
Full Text Available The aging-induced decrease in axonal myelination/remyelination is due to impaired recruitment and differentiation of oligodendrocyte progenitor cells (OPCs. Our previous studies have shown that a monoclonal antibody to DEAD (Asp-Glu-Ala-Asp box polypeptide 54 (Ddx54, a member of the DEAD box family of RNA helicases, (1 specifically labels oligodendrocyte lineages, (2 binds to mRNA and protein isoforms of myelin basic proteins (MBP, and (3 regulates migration of OPCs from ventricular zone to corpus callosum in mice. It has also been demonstrated that specific loss of a 21.5 kDa MBP isoform (MBP21.5 reflects demyelination status, and oral administration of an extract of Chinpi, citrus unshiu peel, reversed the aging-induced demyelination. Here, we report that Chinpi treatment induced a specific increase in the MBP21.5, led to the reappearance of Ddx54-expressing cells in ventricular-subventricular zone and corpus callosum of aged mice, and promoted remyelination. Treatment of in vitro OPC cultures with Chinpi constituents, hesperidin plus narirutin, led to an increase in 5-bromo-2′-deoxyuridine incorporation in Ddx54-expressing OPCs, but not in NG2- or Olig2-expressing cell populations. The present study suggests that Ddx54 plays crucial role in remyelination. Furthermore, Chinpi and Chinpi-containing herbal medicines may be a therapeutic option for the aging-induced demyelination diseases.
Liu, Chenggang
2012-04-03
Dicer-Like1 (DCL1), an RNaseIII endonuclease, and Hyponastic Leaves1 (HYL1), a double-stranded RNA-binding protein, are core components of the plant microRNA (miRNA) biogenesis machinery. hyl1 mutants accumulate low levels of miRNAs and display pleiotropic developmental phenotypes. We report the identification of five new hyl1 suppressor mutants, all of which are alleles of DCL1. These new alleles affect either the helicase or the RNaseIIIa domains of DCL1, highlighting the critical functions of these domains. Biochemical analysis of the DCL1 suppressor variants reveals that they process the primary transcript (pri-miRNA) more efficiently than wild-type DCL1, with both higher Kcat and lower Km values. The DCL1 variants largely rescue wild-type miRNA accumulation levels in vivo, but do not rescue the MIRNA processing precision defects of the hyl1 mutant. In vitro, the helicase domain confers ATP dependence on DCL1-catalyzed MIRNA processing, attenuates DCL1 cleavage activity, and is required for precise MIRNA processing of some substrates. © 2012 American Society of Plant Biologists.
Directory of Open Access Journals (Sweden)
Joern Boeke
Full Text Available Gene expression is highly dynamic and many genes show a wide range in expression over several orders of magnitude. This regulation is often mediated by sequence specific transcription factors. In addition, the tight packaging of DNA into chromatin can provide an additional layer of control resulting in a dynamic range of gene expression covering several orders of magnitude. During transcriptional activation, chromatin barriers have to be eliminated to allow an efficient progression of the RNA polymerase. This repressive chromatin structure has to be re-established quickly after it has been activated in order to tightly regulate gene activity. We show that the DExD/H box containing RNA helicase Rm62 is targeted to a site of rapid induction of transcription where it is responsible for an increased degree of methylation at H3K9 at the heat shock locus after removal of the heat shock stimulus. The RNA helicase interacts with the well-characterized histone methyltransferase SU(VAR3-9 via its N-terminus, which provides a potential mechanism for the targeting of H3K9 methylation to highly regulated genes. The recruitment of SU(VAR3-9 through interaction with a RNA helicase to a site of active transcription might be a general mechanism that allows an efficient silencing of highly regulated genes thereby enabling a cell to fine tune its gene activity over a wide range.
Structure-Based Mutational Analysis of the Hepatitis C Virus NS3 Helicase
Tai, Chun-Ling; Pan, Wen-Ching; Liaw, Shwu-Huey; Yang, Ueng-Cheng; Hwang, Lih-Hwa; Chen, Ding-Shinn
2001-01-01
The carboxyl terminus of the hepatitis C virus (HCV) nonstructural protein 3 (NS3) possesses ATP-dependent RNA helicase activity. Based on the conserved sequence motifs and the crystal structures of the helicase domain, 17 mutants of the HCV NS3 helicase were generated. The ATP hydrolysis, RNA binding, and RNA unwinding activities of the mutant proteins were examined in vitro to determine the functional role of the mutated residues. The data revealed that Lys-210 in the Walker A motif and Asp-290, Glu-291, and His-293 in the Walker B motif were crucial to ATPase activity and that Thr-322 and Thr-324 in motif III and Arg-461 in motif VI significantly influenced ATPase activity. When the pairing between His-293 and Gln-460, referred to as gatekeepers, was replaced with the Asp-293/His-460 pair, which makes the NS3 helicase more like the DEAD helicase subgroup, ATPase activity was not restored. It thus indicated that the whole microenvironment surrounding the gatekeepers, rather than the residues per se, was important to the enzymatic activities. Arg-461 and Trp-501 are important residues for RNA binding, while Val-432 may only play a coadjutant role. The data demonstrated that RNA helicase activity was possibly abolished by the loss of ATPase activity or by reduced RNA binding activity. Nevertheless, a low threshold level of ATPase activity was found sufficient for helicase activity. Results in this study provide a valuable reference for efforts under way to develop anti-HCV therapeutic drugs targeting NS3. PMID:11483774
Purification and crystallization of Kokobera virus helicase
International Nuclear Information System (INIS)
De Colibus, Luigi; Speroni, Silvia; Coutard, Bruno; Forrester, Naomi L.; Gould, Ernest; Canard, Bruno; Mattevi, Andrea
2007-01-01
Kokobera virus is a mosquito-borne flavivirus belonging, like West Nile virus, to the Japanese encephalitis virus serocomplex. Crystals of the Kokobera virus helicase domain were obtained by the hanging-drop vapour-diffusion method and exhibit a diffraction limit of 2.3 Å. Kokobera virus is a mosquito-borne flavivirus belonging, like West Nile virus, to the Japanese encephalitis virus serocomplex. The flavivirus genus is characterized by a positive-sense single-stranded RNA genome. The unique open reading frame of the viral RNA is transcribed and translated as a single polyprotein which is post-translationally cleaved to yield three structural and seven nonstructural proteins, one of which is the NS3 gene that encodes a C-terminal helicase domain consisting of 431 amino acids. Helicase inhibitors are potential antiviral drugs as the helicase is essential to viral replication. Crystals of the Kokobera virus helicase domain were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P3 1 21 (or P3 2 21), with unit-cell parameters a = 88.6, c = 138.6 Å, and exhibit a diffraction limit of 2.3 Å
Purification and crystallization of Kokobera virus helicase
Energy Technology Data Exchange (ETDEWEB)
De Colibus, Luigi; Speroni, Silvia [Department of Genetics and Microbiology, University of Pavia, Via Ferrata 1, 27100 Pavia (Italy); Coutard, Bruno [Architecture et Fonction des Macromolécules Biologiques, UMR 6098 CNRS et Université Aix-Marseille I et II, ESIL, Campus de Luminy, 13288 Marseille CEDEX 09 (France); Forrester, Naomi L.; Gould, Ernest [Centre for Ecology and Hydrology (formerly Institute of Virology), Mansfield Road, Oxford OX1 3SR (United Kingdom); Canard, Bruno [Architecture et Fonction des Macromolécules Biologiques, UMR 6098 CNRS et Université Aix-Marseille I et II, ESIL, Campus de Luminy, 13288 Marseille CEDEX 09 (France); Mattevi, Andrea, E-mail: mattevi@ipvgen.unipv.it [Department of Genetics and Microbiology, University of Pavia, Via Ferrata 1, 27100 Pavia (Italy)
2007-03-01
Kokobera virus is a mosquito-borne flavivirus belonging, like West Nile virus, to the Japanese encephalitis virus serocomplex. Crystals of the Kokobera virus helicase domain were obtained by the hanging-drop vapour-diffusion method and exhibit a diffraction limit of 2.3 Å. Kokobera virus is a mosquito-borne flavivirus belonging, like West Nile virus, to the Japanese encephalitis virus serocomplex. The flavivirus genus is characterized by a positive-sense single-stranded RNA genome. The unique open reading frame of the viral RNA is transcribed and translated as a single polyprotein which is post-translationally cleaved to yield three structural and seven nonstructural proteins, one of which is the NS3 gene that encodes a C-terminal helicase domain consisting of 431 amino acids. Helicase inhibitors are potential antiviral drugs as the helicase is essential to viral replication. Crystals of the Kokobera virus helicase domain were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P3{sub 1}21 (or P3{sub 2}21), with unit-cell parameters a = 88.6, c = 138.6 Å, and exhibit a diffraction limit of 2.3 Å.
Directory of Open Access Journals (Sweden)
Emmanuel O Ariyo
Full Text Available Nucleic acids rich in guanine are able to fold into unique structures known as G-quadruplexes. G-quadruplexes consist of four tracts of guanylates arranged in parallel or antiparallel strands that are aligned in stacked G-quartet planes. The structure is further stabilized by Hoogsteen hydrogen bonds and monovalent cations centered between the planes. RHAU (RNA helicase associated with AU-rich element is a member of the ATP-dependent DExH/D family of RNA helicases and can bind and resolve G-quadruplexes. RHAU contains a core helicase domain with an N-terminal extension that enables recognition and full binding affinity to RNA and DNA G-quadruplexes. PITX1, a member of the bicoid class of homeobox proteins, is a transcriptional activator active during development of vertebrates, chiefly in the anterior pituitary gland and several other organs. We have previously demonstrated that RHAU regulates PITX1 levels through interaction with G-quadruplexes at the 3'-end of the PITX1 mRNA. To understand the structural basis of G-quadruplex recognition by RHAU, we characterize a purified minimal PITX1 G-quadruplex using a variety of biophysical techniques including electrophoretic mobility shift assays, UV-VIS spectroscopy, circular dichroism, dynamic light scattering, small angle X-ray scattering and nuclear magnetic resonance spectroscopy. Our biophysical analysis provides evidence that the RNA G-quadruplex, but not its DNA counterpart, can adopt a parallel orientation, and that only the RNA can interact with N-terminal domain of RHAU via the tetrad face of the G-quadruplex. This work extends our insight into how the N-terminal region of RHAU recognizes parallel G-quadruplexes.
Directory of Open Access Journals (Sweden)
Kengo Morohashi
Full Text Available BACKGROUND: Cyclosporin A (CsA is well known as an immunosuppressive drug useful for allogeneic transplantation. It has been reported that CsA inhibits hepatitis C virus (HCV genome replication, which indicates that cellular targets of CsA regulate the viral replication. However, the regulation mechanisms of HCV replication governed by CsA target proteins have not been fully understood. PRINCIPAL FINDINGS: Here we show a chemical biology approach that elucidates a novel mechanism of HCV replication. We developed a phage display screening to investigate compound-peptide interaction and identified a novel cellular target molecule of CsA. This protein, named CsA associated helicase-like protein (CAHL, possessed RNA-dependent ATPase activity that was negated by treatment with CsA. The downregulation of CAHL in the cells resulted in a decrease of HCV genome replication. CAHL formed a complex with HCV-derived RNA polymerase NS5B and host-derived cyclophilin B (CyPB, known as a cellular cofactor for HCV replication, to regulate NS5B-CyPB interaction. CONCLUSIONS: We found a cellular factor, CAHL, as CsA associated helicase-like protein, which would form trimer complex with CyPB and NS5B of HCV. The strategy using a chemical compound and identifying its target molecule by our phage display analysis is useful to reveal a novel mechanism underlying cellular and viral physiology.
Morohashi, Kengo; Sahara, Hiroeki; Watashi, Koichi; Iwabata, Kazuki; Sunoki, Takashi; Kuramochi, Kouji; Takakusagi, Kaori; Miyashita, Hiroki; Sato, Noriyuki; Tanabe, Atsushi; Shimotohno, Kunitada; Kobayashi, Susumu; Sakaguchi, Kengo; Sugawara, Fumio
2011-04-29
Cyclosporin A (CsA) is well known as an immunosuppressive drug useful for allogeneic transplantation. It has been reported that CsA inhibits hepatitis C virus (HCV) genome replication, which indicates that cellular targets of CsA regulate the viral replication. However, the regulation mechanisms of HCV replication governed by CsA target proteins have not been fully understood. Here we show a chemical biology approach that elucidates a novel mechanism of HCV replication. We developed a phage display screening to investigate compound-peptide interaction and identified a novel cellular target molecule of CsA. This protein, named CsA associated helicase-like protein (CAHL), possessed RNA-dependent ATPase activity that was negated by treatment with CsA. The downregulation of CAHL in the cells resulted in a decrease of HCV genome replication. CAHL formed a complex with HCV-derived RNA polymerase NS5B and host-derived cyclophilin B (CyPB), known as a cellular cofactor for HCV replication, to regulate NS5B-CyPB interaction. We found a cellular factor, CAHL, as CsA associated helicase-like protein, which would form trimer complex with CyPB and NS5B of HCV. The strategy using a chemical compound and identifying its target molecule by our phage display analysis is useful to reveal a novel mechanism underlying cellular and viral physiology.
Xu, Ling; Wang, Lijun; Peng, Junhui; Li, Fudong; Wu, Lijie; Zhang, Beibei; Lv, Mengqi; Zhang, Jiahai; Gong, Qingguo; Zhang, Rongguang; Zuo, Xiaobing; Zhang, Zhiyong; Wu, Jihui; Tang, Yajun; Shi, Yunyu
2017-12-05
CsdA has been proposed to be essential for the biogenesis of ribosome and gene regulation after cold shock. However, the structure of CsdA and the function of its long C-terminal regions are still unclear. Here, we solved all of the domain structures of CsdA and found two previously uncharacterized auxiliary domains: a dimerization domain (DD) and an RNA-binding domain (RBD). Small-angle X-ray scattering experiments helped to track the conformational flexibilities of the helicase core domains and C-terminal regions. Biochemical assays revealed that DD is indispensable for stabilizing the CsdA dimeric structure. We also demonstrate for the first time that CsdA functions as a stable dimer at low temperature. The C-terminal regions are critical for RNA binding and efficient enzymatic activities. CsdA_RBD could specifically bind to the regions with a preference for single-stranded G-rich RNA, which may help to bring the helicase core to unwind the adjacent duplex. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Beiyu Liu
2009-09-01
Full Text Available Trypanosoma brucei's mitochondrial genome, kinetoplast DNA (kDNA, is a giant network of catenated DNA rings. The network consists of a few thousand 1 kb minicircles and several dozen 23 kb maxicircles. Here we report that TbPIF5, one of T. brucei's six mitochondrial proteins related to Saccharomyces cerevisiae mitochondrial DNA helicase ScPIF1, is involved in minicircle lagging strand synthesis. Like its yeast homolog, TbPIF5 is a 5' to 3' DNA helicase. Together with other enzymes thought to be involved in Okazaki fragment processing, TbPIF5 localizes in vivo to the antipodal sites flanking the kDNA. Minicircles in wild type cells replicate unidirectionally as theta-structures and are unusual in that Okazaki fragments are not joined until after the progeny minicircles have segregated. We now report that overexpression of TbPIF5 causes premature removal of RNA primers and joining of Okazaki fragments on theta structures. Further elongation of the lagging strand is blocked, but the leading strand is completed and the minicircle progeny, one with a truncated H strand (ranging from 0.1 to 1 kb, are segregated. The minicircles with a truncated H strand electrophorese on an agarose gel as a smear. This replication defect is associated with kinetoplast shrinkage and eventual slowing of cell growth. We propose that TbPIF5 unwinds RNA primers after lagging strand synthesis, thus facilitating processing of Okazaki fragments.
Hathaichoti, Sasiphen; Visitnonthachai, Daranee; Ngamsiri, Pronrumpa; Niyomchan, Apichaya; Tsogtbayar, Oyu; Wisessaowapak, Churaibhon; Watcharasit, Piyajit; Satayavivad, Jutamaad
2017-08-01
Paraquat (PQ) is a bipyridyl derivative herbicide known to cause lung toxicity partly through induction of apoptosis. Here we demonstrated that PQ caused apoptosis in A549 cells. PQ increased cleavage of caspase-8 and Bid, indicating caspase-8 activation and truncated Bid, the two key mediators of extrinsic apoptosis. Additionally, PQ treatment caused an increase in DR5 (death receptor-5) and caspase-8 interaction, indicating formation of DISC (death-inducing signaling complex). These results indicate that PQ induces apoptosis through extrinsic pathway in A549 cells. Moreover, PQ drastically increased DR5 expression and membrane localization. Furthermore, PQ caused prominent concentration dependent reductions of DDX3 (the DEAD box protein-3) and GSK3 (glycogen synthase kinase-3) which can associate with DR5 and prevent DISC formation. Additionally, PQ decreased DR5-DDX3 interaction, suggesting a reduction of DDX3/GSK3 anti-apoptotic complex. Inhibition of GSK3, which is known to promote extrinsic apoptosis by its pharmacological inhibitor, BIO accentuated PQ-induced apoptosis. Moreover, GSK3 inhibition caused a further decrease in PQ-reduced DR5-DDX3 interaction. Taken together, these results suggest that PQ may induce extrinsic pathway of apoptosis in A549 cells through upregulation of DR5 and repression of anti-apoptotic proteins, DDX3/GSK3 leading to reduction of anti-apoptotic complex. Copyright © 2017 Elsevier Ltd. All rights reserved.
FAIR-DDX, Double Diffusion Cross-Sections Scattering Matrix Generated from ENDF/B-4 or JENDL-2
International Nuclear Information System (INIS)
Minami, Kazuyoshi; Yamano, Naoki
2001-01-01
1 - Description of program or function: FAIR-DDX produces double differential (energy and angle) cross sections (DDX) in the form of group-to-group scattering matrices using the evaluated nuclear data libraries JENDL-2 or ENDF/B-IV. The DDX form is useful for verification of the evaluated data, such as the inelastic scattering, through comparison with the experimental DDX values. 2 - Method of solution: DDX uses the file 4 data (angular distribution of secondary neutrons) and the energy and momentum conservation laws. For continuum region reactions, file 5 (energy spectrum of secondary neutrons) is used. To express the angular distribution of secondary neutrons in group-to-group scattering matrices FAIR-DDX adopts a direct angular representation method. 3 - Restrictions on the complexity of the problem: The maximum number of energy groups is 200
Zhang, Qianjun; Meng, Xiuhua; Li, Delin; Chen, Shaoyin; Luo, Jianmin; Zhu, Linjie; Singer, Robert H; Gu, Wei
2017-06-09
Local translation of specific mRNAs is regulated by dynamic changes in their subcellular localization, and these changes are due to complex mechanisms controlling cytoplasmic mRNA transport. The budding yeast Saccharomyces cerevisiae is well suited to studying these mechanisms because many of its transcripts are transported from the mother cell to the budding daughter cell. Here, we investigated the translational control of ASH1 mRNA after transport and localization. We show that although ASH1 transcripts were translated after they reached the bud tip, some mRNAs were bound by the RNA-binding protein Puf6 and were non-polysomal. We also found that the DEAD-box helicase Dhh1 complexed with the untranslated ASH1 mRNA and Puf6. Loss of Dhh1 affected local translation of ASH1 mRNA and resulted in delocalization of ASH1 transcript in the bud. Forcibly shifting the non-polysomal ASH1 mRNA into polysomes was associated with Dhh1 dissociation. We further demonstrated that Dhh1 is not recruited to ASH1 mRNA co-transcriptionally, suggesting that it could bind to ASH1 mRNA within the cytoplasm. Of note, Dhh1 bound to the 5'-UTR of ASH1 mRNA and inhibited its translation in vitro These results suggest that after localization to the bud tip, a portion of the localized ASH1 mRNA becomes translationally inactive because of binding of Dhh1 and Puf6 to the 5'- and 3'-UTRs of ASH1 mRNA. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Enzymatic activities and DNA substrate specificity of Mycobacterium tuberculosis DNA helicase XPB.
Balasingham, Seetha V; Zegeye, Ephrem Debebe; Homberset, Håvard; Rossi, Marie L; Laerdahl, Jon K; Bohr, Vilhelm A; Tønjum, Tone
2012-01-01
XPB, also known as ERCC3 and RAD25, is a 3' → 5' DNA repair helicase belonging to the superfamily 2 of helicases. XPB is an essential core subunit of the eukaryotic basal transcription factor complex TFIIH. It has two well-established functions: in the context of damaged DNA, XPB facilitates nucleotide excision repair by unwinding double stranded DNA (dsDNA) surrounding a DNA lesion; while in the context of actively transcribing genes, XPB facilitates initiation of RNA polymerase II transcription at gene promoters. Human and other eukaryotic XPB homologs are relatively well characterized compared to conserved homologs found in mycobacteria and archaea. However, more insight into the function of bacterial helicases is central to understanding the mechanism of DNA metabolism and pathogenesis in general. Here, we characterized Mycobacterium tuberculosis XPB (Mtb XPB), a 3'→5' DNA helicase with DNA-dependent ATPase activity. Mtb XPB efficiently catalyzed DNA unwinding in the presence of significant excess of enzyme. The unwinding activity was fueled by ATP or dATP in the presence of Mg(2+)/Mn(2+). Consistent with the 3'→5' polarity of this bacterial XPB helicase, the enzyme required a DNA substrate with a 3' overhang of 15 nucleotides or more. Although Mtb XPB efficiently unwound DNA model substrates with a 3' DNA tail, it was not active on substrates containing a 3' RNA tail. We also found that Mtb XPB efficiently catalyzed ATP-independent annealing of complementary DNA strands. These observations significantly enhance our understanding of the biological roles of Mtb XPB.
Enzymatic activities and DNA substrate specificity of Mycobacterium tuberculosis DNA helicase XPB.
Directory of Open Access Journals (Sweden)
Seetha V Balasingham
Full Text Available XPB, also known as ERCC3 and RAD25, is a 3' → 5' DNA repair helicase belonging to the superfamily 2 of helicases. XPB is an essential core subunit of the eukaryotic basal transcription factor complex TFIIH. It has two well-established functions: in the context of damaged DNA, XPB facilitates nucleotide excision repair by unwinding double stranded DNA (dsDNA surrounding a DNA lesion; while in the context of actively transcribing genes, XPB facilitates initiation of RNA polymerase II transcription at gene promoters. Human and other eukaryotic XPB homologs are relatively well characterized compared to conserved homologs found in mycobacteria and archaea. However, more insight into the function of bacterial helicases is central to understanding the mechanism of DNA metabolism and pathogenesis in general. Here, we characterized Mycobacterium tuberculosis XPB (Mtb XPB, a 3'→5' DNA helicase with DNA-dependent ATPase activity. Mtb XPB efficiently catalyzed DNA unwinding in the presence of significant excess of enzyme. The unwinding activity was fueled by ATP or dATP in the presence of Mg(2+/Mn(2+. Consistent with the 3'→5' polarity of this bacterial XPB helicase, the enzyme required a DNA substrate with a 3' overhang of 15 nucleotides or more. Although Mtb XPB efficiently unwound DNA model substrates with a 3' DNA tail, it was not active on substrates containing a 3' RNA tail. We also found that Mtb XPB efficiently catalyzed ATP-independent annealing of complementary DNA strands. These observations significantly enhance our understanding of the biological roles of Mtb XPB.
Kinetic discrimination of self/non-self RNA by the ATPase activity of RIG-I and MDA5.
Louber, Jade; Brunel, Joanna; Uchikawa, Emiko; Cusack, Stephen; Gerlier, Denis
2015-07-28
The cytoplasmic RIG-like receptors are responsible for the early detection of viruses and other intracellular microbes by activating the innate immune response mediated by type I interferons (IFNs). RIG-I and MDA5 detect virus-specific RNA motifs with short 5'-tri/diphosphorylated, blunt-end double-stranded RNA (dsRNA) and >0.5-2 kb long dsRNA as canonical agonists, respectively. However, in vitro, they can bind to many RNA species, while in cells there is an activation threshold. As SF2 helicase/ATPase family members, ATP hydrolysis is dependent on co-operative RNA and ATP binding. Whereas simultaneous ATP and cognate RNA binding is sufficient to activate RIG-I by releasing autoinhibition of the signaling domains, the physiological role of the ATPase activity of RIG-I and MDA5 remains controversial. A cross-analysis of a rationally designed panel of RNA binding and ATPase mutants and truncated receptors, using type I IFN promoter activation as readout, allows us to refine our understanding of the structure-function relationships of RIG-I and MDA5. RNA activation of RIG-I depends on multiple critical RNA binding sites in its helicase domain as confirmed by functional evidence using novel mutations. We found that RIG-I or MDA5 mutants with low ATP hydrolysis activity exhibit constitutive activity but this was fully reverted when associated with mutations preventing RNA binding to the helicase domain. We propose that the turnover kinetics of the ATPase domain enables the discrimination of self/non-self RNA by both RIG-I and MDA5. Non-cognate, possibly self, RNA binding would lead to fast ATP turnover and RNA disassociation and thus insufficient time for the caspase activation and recruitment domains (CARDs) to promote downstream signaling, whereas tighter cognate RNA binding provides a longer time window for downstream events to be engaged. The exquisite fine-tuning of RIG-I and MDA5 RNA-dependent ATPase activity coupled to CARD release allows a robust IFN response
Howles, Paul A; Gebbie, Leigh K; Collings, David A; Varsani, Arvind; Broad, Ronan C; Ohms, Stephen; Birch, Rosemary J; Cork, Ann H; Arioli, Tony; Williamson, Richard E
2016-05-01
The putative RNA helicase encoded by the Arabidopsis gene At1g32490 is a homolog of the yeast splicing RNA helicases Prp2 and Prp22. We isolated a temperature-sensitive allele (rsw12) of the gene in a screen for root radial swelling mutants. Plants containing this allele grown at the restrictive temperature showed weak radial swelling, were stunted with reduced root elongation, and contained reduced levels of cellulose. The role of the protein was further explored by microarray analysis. By using both fold change cutoffs and a weighted gene coexpression network analysis (WGCNA) to investigate coexpression of genes, we found that the radial swelling phenotype was not linked to genes usually associated with primary cell wall biosynthesis. Instead, the mutation has strong effects on expression of secondary cell wall related genes. Many genes potentially associated with secondary walls were present in the most significant WGCNA module, as were genes coding for arabinogalactans and proteins with GPI anchors. The proportion of up-regulated genes that possess introns in rsw12 was above that expected if splicing was unrelated to the activity of the RNA helicase, suggesting that the helicase does indeed play a role in splicing in Arabidopsis. The phenotype may be due to a change in the expression of one or more genes coding for cell wall proteins.
Helicase-dependent amplification of nucleic acids.
Cao, Yun; Kim, Hyun-Jin; Li, Ying; Kong, Huimin; Lemieux, Bertrand
2013-10-11
Helicase-dependent amplification (HDA) is a novel method for the isothermal in vitro amplification of nucleic acids. The HDA reaction selectively amplifies a target sequence by extension of two oligonucleotide primers. Unlike the polymerase chain reaction (PCR), HDA uses a helicase enzyme to separate the deoxyribonucleic acid (DNA) strands, rather than heat denaturation. This allows DNA amplification without the need for thermal cycling. The helicase used in HDA is a helicase super family II protein obtained from a thermophilic organism, Thermoanaerobacter tengcongensis (TteUvrD). This thermostable helicase is capable of unwinding blunt-end nucleic acid substrates at elevated temperatures (60° to 65°C). The HDA reaction can also be coupled with reverse transcription for ribonucleic acid (RNA) amplification. The products of this reaction can be detected during the reaction using fluorescent probes when incubations are conducted in a fluorimeter. Alternatively, products can be detected after amplification using a disposable amplicon containment device that contains an embedded lateral flow strip. Copyright © 2013 John Wiley & Sons, Inc.
GINS complex protein Sld5 recruits SIK1 to activate MCM helicase during DNA replication.
Joshi, Kiranmai; Shah, Varun Jayeshkumar; Maddika, Subbareddy
2016-12-01
In eukaryotes, proper loading and activation of MCM helicase at chromosomal origins plays a central role in DNA replication. Activation of MCM helicase requires its association with CDC45-GINS complex, but the mechanism of how this complex activates MCM helicase is poorly understood. Here we identified SIK1 (salt-inducible kinase 1), an AMPK related protein kinase, as a molecular link that connects GINS complex with MCM helicase activity. We demonstrated that Sld5 a component of GINS complex interacts with SIK1 and recruits it to the sites of DNA replication at the onset of S phase. Depletion of SIK1 leads to defective DNA replication. Further, we showed that SIK1 phosphorylates MCM2 at five conserved residues at its N-terminus, which is essential for the activation of MCM helicase. Collectively, our results suggest SIK1 as a novel integral component of CMG replicative helicase during eukaryotic DNA replication. Copyright © 2016 Elsevier Inc. All rights reserved.
Uncoupling of Protease trans-Cleavage and Helicase Activities in Pestivirus NS3.
Zheng, Fengwei; Lu, Guoliang; Li, Ling; Gong, Peng; Pan, Zishu
2017-11-01
The nonstructural protein NS3 from the Flaviviridae family is a multifunctional protein that contains an N-terminal protease and a C-terminal helicase, playing essential roles in viral polyprotein processing and genome replication. Here we report a full-length crystal structure of the classical swine fever virus (CSFV) NS3 in complex with its NS4A protease cofactor segment (PCS) at a 2.35-Å resolution. The structure reveals a previously unidentified ∼2,200-Å 2 intramolecular protease-helicase interface comprising three clusters of interactions, representing a "closed" global conformation related to the NS3-NS4A cis -cleavage event. Although this conformation is incompatible with protease trans -cleavage, it appears to be functionally important and beneficial to the helicase activity, as the mutations designed to perturb this conformation impaired both the helicase activities in vitro and virus production in vivo Our work reveals important features of protease-helicase coordination in pestivirus NS3 and provides a key basis for how different conformational states may explicitly contribute to certain functions of this natural protease-helicase fusion protein. IMPORTANCE Many RNA viruses encode helicases to aid their RNA genome replication and transcription by unwinding structured RNA. Being naturally fused to a protease participating in viral polyprotein processing, the NS3 helicases encoded by the Flaviviridae family viruses are unique. Therefore, how these two enzyme modules coordinate in a single polypeptide is of particular interest. Here we report a previously unidentified conformation of pestivirus NS3 in complex with its NS4A protease cofactor segment (PCS). This conformational state is related to the protease cis -cleavage event and is optimal for the function of helicase. This work provides an important basis to understand how different enzymatic activities of NS3 may be achieved by the coordination between the protease and helicase through different
Energy Technology Data Exchange (ETDEWEB)
Zhou, Ting; Ren, Xiaoming; Adams, Rebecca L.; Pyle, Anna Marie; Ou, J. -H. James
2017-10-25
Hepatitis C viruses (HCV) encode a helicase enzyme that is essential for viral replication and assembly (nonstructural protein 3 [NS3]). This helicase has become the focus of extensive basic research on the general helicase mechanism, and it is also of interest as a novel drug target. Despite the importance of this protein, mechanistic work on NS3 has been conducted almost exclusively on variants from HCV genotype 1. Our understanding of NS3 from the highly active HCV strains that are used to study HCV genetics and mechanism in cell culture (such as JFH-1) is lacking. We therefore set out to determine whether NS3 from the replicatively efficient genotype 2a strain JFH-1 displays novel functional or structural properties. Using biochemical assays for RNA binding and duplex unwinding, we show that JFH-1 NS3 binds RNA much more rapidly than the previously studied NS3 variants from genotype 1b. Unlike NS3 variants from other genotypes, JFH-1 NS3 binds RNA with high affinity in a functionally active form that is capable of immediately unwinding RNA duplexes without undergoing rate-limiting conformational changes that precede activation. Unlike other superfamily 2 (SF2) helicases, JFH-1 NS3 does not require long 3' overhangs, and it unwinds duplexes that are flanked by only a few nucleotides, as in the folded HCV genome. To understand the physical basis for this, we solved the crystal structure of JFH-1 NS3, revealing a novel conformation that contains an open, positively charged RNA binding cleft that is primed for productive interaction with RNA targets, potentially explaining robust replication by HCV JFH-1.
Senataxin, the ortholog of a yeast RNA helicase, is mutant in ataxia-ocular apraxia 2.
Moreira, Maria-Céu; Klur, Sandra; Watanabe, Mitsunori; Németh, Andrea H; Le Ber, Isabelle; Moniz, José-Carlos; Tranchant, Christine; Aubourg, Patrick; Tazir, Meriem; Schöls, Lüdger; Pandolfo, Massimo; Schulz, Jörg B; Pouget, Jean; Calvas, Patrick; Shizuka-Ikeda, Masami; Shoji, Mikio; Tanaka, Makoto; Izatt, Louise; Shaw, Christopher E; M'Zahem, Abderrahim; Dunne, Eimear; Bomont, Pascale; Benhassine, Traki; Bouslam, Naïma; Stevanin, Giovanni; Brice, Alexis; Guimarães, João; Mendonça, Pedro; Barbot, Clara; Coutinho, Paula; Sequeiros, Jorge; Dürr, Alexandra; Warter, Jean-Marie; Koenig, Michel
2004-03-01
Ataxia-ocular apraxia 2 (AOA2) was recently identified as a new autosomal recessive ataxia. We have now identified causative mutations in 15 families, which allows us to clinically define this entity by onset between 10 and 22 years, cerebellar atrophy, axonal sensorimotor neuropathy, oculomotor apraxia and elevated alpha-fetoprotein (AFP). Ten of the fifteen mutations cause premature termination of a large DEAxQ-box helicase, the human ortholog of yeast Sen1p, involved in RNA maturation and termination.
Directory of Open Access Journals (Sweden)
Yoko Matsumura
2016-07-01
Full Text Available Although the DEAD-box RNA helicase family is ubiquitous in eukaryotes, its developmental role remains unelucidated. Here, we report that cooperative action between the Arabidopsis nucleolar protein RH10, an ortholog of human DEAD-box RNA helicase DDX47, and the epigenetic repressor complex of ASYMMETRIC-LEAVES1 (AS1 and AS2 (AS1-AS2 is critical to repress abaxial (ventral genes ETT/ARF3 and ARF4, which leads to adaxial (dorsal development in leaf primordia at shoot apices. Double mutations of rh10-1 and as2 (or as1 synergistically up-regulated the abaxial genes, which generated abaxialized filamentous leaves with loss of the adaxial domain. DDX47 is part of the small subunit processome (SSUP that mediates rRNA biogenesis. In rh10-1 we found various defects in SSUP-related events, such as: accumulation of 35S/33S rRNA precursors; reduction in the 18S/25S ratio; and nucleolar hypertrophy. Double mutants of as2 with mutations of genes that encode other candidate SSUP-related components such as nucleolin and putative rRNA methyltransferase exhibited similar synergistic defects caused by up-regulation of ETT/ARF3 and ARF4. These results suggest a tight link between putative SSUP and AS1-AS2 in repression of the abaxial-determining genes for cell fate decisions for adaxial development.
Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen
2012-08-01
Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.
Czech Academy of Sciences Publication Activity Database
Kanagaraj, R.; Huehn, D.; Mackellar, A.; Menigatti, M.; Zheng, L.; Urban, Václav; Shevelev, Igor; Greenleaf, A.L.; Janščák, Pavel
2010-01-01
Roč. 38, č. 22 (2010), s. 8131-8140 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Grant - others:SNSF(CH) 3100A0-116008; NIH(US) GM040505 Institutional research plan: CEZ:AV0Z50520514 Keywords : RECQ5 DNA helicase * transcription * genome stability Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 7.836, year: 2010
Rottlerin upregulates DDX3 expression in hepatocellular carcinoma.
Wang, Zhong; Shen, Gen-Hai; Xie, Jia-Ming; Li, Bin; Gao, Quan-Gen
2018-01-01
Rottlerin has been reported to exert its anti-tumor activity in various types of human cancers. However, the underlying molecular mechanism has not been fully elucidated. In the current study, we explored whether rottlerin exhibits its tumor suppressive function in hepatocellular carcinoma cells. Our MTT assay results showed that rottlerin inhibited cell growth in hepatocellular carcinoma cells. Moreover, we found that rottlerin induced cell apoptosis and caused cell cycle arrest at G1 phase. Furthermore, our wound healing assay result demonstrated that rottlerin retarded cell migration in hepatocellular carcinoma cells. Additionally, rottlerin suppressed cell migration and invasion. Notably, we found that rottlerin upregulated DDX3 expression and subsequently downregulated Cyclin D1 expression and increased p21 level. Importantly, down-regulation of DDX3 abrogated the rottlerin-mediated tumor suppressive function, whereas overexpression of DDX3 promoted the anti-tumor activity of rottlerin. Our study suggests that rottlerin exhibits its anti-cancer activity partly due to upregulation of DDX3 in hepatocellular carcinoma cells. Copyright © 2017 Elsevier Inc. All rights reserved.
PBDE: Structure-Activity Studies for the Inhibition of Hepatitis C Virus NS3 Helicase
Directory of Open Access Journals (Sweden)
Kazi Abdus Salam
2014-04-01
Full Text Available The helicase portion of the hepatitis C virus nonstructural protein 3 (NS3 is considered one of the most validated targets for developing direct acting antiviral agents. We isolated polybrominated diphenyl ether (PBDE 1 from a marine sponge as an NS3 helicase inhibitor. In this study, we evaluated the inhibitory effects of PBDE (1 on the essential activities of NS3 protein such as RNA helicase, ATPase, and RNA binding activities. The structure-activity relationship analysis of PBDE (1 against the HCV ATPase revealed that the biphenyl ring, bromine, and phenolic hydroxyl group on the benzene backbone might be a basic scaffold for the inhibitory potency.
Functional 5' UTR mRNA structures in eukaryotic translation regulation and how to find them.
Leppek, Kathrin; Das, Rhiju; Barna, Maria
2018-03-01
RNA molecules can fold into intricate shapes that can provide an additional layer of control of gene expression beyond that of their sequence. In this Review, we discuss the current mechanistic understanding of structures in 5' untranslated regions (UTRs) of eukaryotic mRNAs and the emerging methodologies used to explore them. These structures may regulate cap-dependent translation initiation through helicase-mediated remodelling of RNA structures and higher-order RNA interactions, as well as cap-independent translation initiation through internal ribosome entry sites (IRESs), mRNA modifications and other specialized translation pathways. We discuss known 5' UTR RNA structures and how new structure probing technologies coupled with prospective validation, particularly compensatory mutagenesis, are likely to identify classes of structured RNA elements that shape post-transcriptional control of gene expression and the development of multicellular organisms.
The Drosophila Helicase MLE Targets Hairpin Structures in Genomic Transcripts.
Directory of Open Access Journals (Sweden)
Simona Cugusi
2016-01-01
Full Text Available RNA hairpins are a common type of secondary structures that play a role in every aspect of RNA biochemistry including RNA editing, mRNA stability, localization and translation of transcripts, and in the activation of the RNA interference (RNAi and microRNA (miRNA pathways. Participation in these functions often requires restructuring the RNA molecules by the association of single-strand (ss RNA-binding proteins or by the action of helicases. The Drosophila MLE helicase has long been identified as a member of the MSL complex responsible for dosage compensation. The complex includes one of two long non-coding RNAs and MLE was shown to remodel the roX RNA hairpin structures in order to initiate assembly of the complex. Here we report that this function of MLE may apply to the hairpins present in the primary RNA transcripts that generate the small molecules responsible for RNA interference. Using stocks from the Transgenic RNAi Project and the Vienna Drosophila Research Center, we show that MLE specifically targets hairpin RNAs at their site of transcription. The association of MLE at these sites is independent of sequence and chromosome location. We use two functional assays to test the biological relevance of this association and determine that MLE participates in the RNAi pathway.
HTLV-1 Tax plugs and freezes UPF1 helicase leading to nonsense-mediated mRNA decay inhibition.
Fiorini, Francesca; Robin, Jean-Philippe; Kanaan, Joanne; Borowiak, Malgorzata; Croquette, Vincent; Le Hir, Hervé; Jalinot, Pierre; Mocquet, Vincent
2018-01-30
Up-Frameshift Suppressor 1 Homolog (UPF1) is a key factor for nonsense-mediated mRNA decay (NMD), a cellular process that can actively degrade mRNAs. Here, we study NMD inhibition during infection by human T-cell lymphotropic virus type I (HTLV-1) and characterise the influence of the retroviral Tax factor on UPF1 activity. Tax interacts with the central helicase core domain of UPF1 and might plug the RNA channel of UPF1, reducing its affinity for nucleic acids. Furthermore, using a single-molecule approach, we show that the sequential interaction of Tax with a RNA-bound UPF1 freezes UPF1: this latter is less sensitive to the presence of ATP and shows translocation defects, highlighting the importance of this feature for NMD. These mechanistic insights reveal how HTLV-1 hijacks the central component of NMD to ensure expression of its own genome.
PROF-DD, Generator of Multigroup Cross-Sections Library DDX for MORSE-DD, ANISN-DD, DOT-DD
International Nuclear Information System (INIS)
Mori, Takamasa; Nakagawa, Masayuki; Ishiguro, Yukio
2002-01-01
1 - Description of program or function: The code system PROF-DD generates a multi-group double-differential cross section library DDX from evaluated data in ENDF/B-IV or ENDF/B-V format. The system consists of the following five modules: PROF-DDX is the main module of the system. It calculates the multigroup DDX and stores them on a master PDS file. MCFILEF generates a control file for PROF-DDX, which contains energy group and angle bin structures. SPINPTF prepares an input data file for PROF-DDX by combining the control file with other input data. DDXLIBMK edits a DDX library from the master PDS file for transport calculations. RESENDD performs resonance cross section and Doppler broadening calculations. 2 - Restrictions on the complexity of the problem: The numbers of energy groups and angle bins are less than 150 and 40, respectively
Functional 5′ UTR mRNA structures in eukaryotic translation regulation and how to find them
Leppek, Kathrin; Das, Rhiju; Barna, Maria
2017-01-01
RNA molecules can fold into intricate shapes that can provide an additional layer of control of gene expression beyond that of their sequence. In this Review, we discuss the current mechanistic understanding of structures in 5′ untranslated regions (UTRs) of eukaryotic mRNAs and the emerging methodologies used to explore them. These structures may regulate cap-dependent translation initiation through helicase-mediated remodelling of RNA structures and higher-order RNA interactions, as well as cap-independent translation initiation through internal ribosome entry sites (IRESs), mRNA modifications and other specialized translation pathways. We discuss known 5′ UTR RNA structures and how new structure probing technologies coupled with prospective validation, particularly compensatory mutagenesis, are likely to identify classes of structured RNA elements that shape post-transcriptional control of gene expression and the development of multicellular organisms. PMID:29165424
A new role for FBP21 as regulator of Brr2 helicase activity.
Henning, Lisa M; Santos, Karine F; Sticht, Jana; Jehle, Stefanie; Lee, Chung-Tien; Wittwer, Malte; Urlaub, Henning; Stelzl, Ulrich; Wahl, Markus C; Freund, Christian
2017-07-27
Splicing of eukaryotic pre-mRNA is carried out by the spliceosome, which assembles stepwise on each splicing substrate. This requires the concerted action of snRNPs and non-snRNP accessory proteins, the functions of which are often not well understood. Of special interest are B complex factors that enter the spliceosome prior to catalytic activation and may alter splicing kinetics and splice site selection. One of these proteins is FBP21, for which we identified several spliceosomal binding partners in a yeast-two-hybrid screen, among them the RNA helicase Brr2. Biochemical and biophysical analyses revealed that an intrinsically disordered region of FBP21 binds to an extended surface of the C-terminal Sec63 unit of Brr2. Additional contacts in the C-terminal helicase cassette are required for allosteric inhibition of Brr2 helicase activity. Furthermore, the direct interaction between FBP21 and the U4/U6 di-snRNA was found to reduce the pool of unwound U4/U6 di-snRNA. Our results suggest FBP21 as a novel key player in the regulation of Brr2. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
Mandy Jeske
2015-07-01
Full Text Available In many animals, the germ plasm segregates germline from soma during early development. Oskar protein is known for its ability to induce germ plasm formation and germ cells in Drosophila. However, the molecular basis of germ plasm formation remains unclear. Here, we show that Oskar is an RNA-binding protein in vivo, crosslinking to nanos, polar granule component, and germ cell-less mRNAs, each of which has a role in germline formation. Furthermore, we present high-resolution crystal structures of the two Oskar domains. RNA-binding maps in vitro to the C-terminal domain, which shows structural similarity to SGNH hydrolases. The highly conserved N-terminal LOTUS domain forms dimers and mediates Oskar interaction with the germline-specific RNA helicase Vasa in vitro. Our findings suggest a dual function of Oskar in RNA and Vasa binding, providing molecular clues to its germ plasm function.
International Nuclear Information System (INIS)
Nagahama, Masami; Yamazoe, Takeshi; Hara, Yoshimitsu; Tani, Katsuko; Tsuji, Akihiko; Tagaya, Mitsuo
2006-01-01
Nuclear VCP/p97-like protein 2 (NVL2) is a member of the chaperone-like AAA-ATPase family with two conserved ATP-binding modules. Our previous studies have shown that NVL2 is localized to the nucleolus by interacting with ribosomal protein L5 and may participate in ribosome synthesis, a process involving various non-ribosomal factors including chaperones and RNA helicases. Here, we show that NVL2 is associated with pre-ribosomal particles in the nucleus. Moreover, we used yeast two-hybrid and co-immunoprecipitation assays to identify an NVL2-interacting protein that could yield insights into NVL2 function in ribosome biogenesis. We found that NVL2 interacts with DOB1, a DExD/H-box RNA helicase, whose yeast homologue functions in a late stage of the 60S subunit synthesis. DOB1 can interact with a second ATP-binding module mutant of NVL2, which shows a dominant negative effect on ribosome synthesis. In contrast, it cannot interact with a first ATP-binding module mutant, which does not show the dominant negative effect. When the dominant negative mutant of NVL2 was overexpressed in cells, DOB1 appeared to remain associated with nuclear pre-ribosomal particles. Such accumulation was not observed upon overexpression of wild-type NVL2 or a nondominant-negative mutant. Taken together, our results suggest that NVL2 might regulate the association/dissociation reaction of DOB1 with pre-ribosomal particles by acting as a molecular chaperone
MRE11 complex links RECQ5 helicase to sites of DNA damage
Czech Academy of Sciences Publication Activity Database
Zheng, L.; Kanagaraj, R.; Mihaljevic, B.; Schwendener, S.; Sartori, A.A.; Gerrits, B.; Shevelev, Igor; Janščák, Pavel
2009-01-01
Roč. 37, č. 8 (2009), s. 2645-2657 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565 Institutional research plan: CEZ:AV0Z50520514 Keywords : homologous recombination, * RECQ5 helicase * MRE11 * DNA repair Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 7.479, year: 2009
International Nuclear Information System (INIS)
Kim, Jaehee; Jeon, Soonmee; Yang, Yun-Seok; Kim, Jinmi
2004-01-01
The major biochemical activities ascribed to Kem1p/Xrn1p of Saccharomyces cerevisiae are 5'-3' exoribonuclease functioning in RNA turnover and a microtubule-binding protein. Mutational analysis has shown that Kem1p/Xrn1p participates in microtubule-related functions such as nuclear fusion (karyogamy) during mating, chromosome transmission, and spindle pole body duplication. Here, evidence is presented that Kem1p plays a specific role in nuclear fusion by affecting, at the posttranscriptional level, the pheromone induction of the karyogamy-specific transcription factor Kar4p and the expression of Rok1p, a putative RNA helicase. We found that Rok1p itself also affects the pheromone induction of Kar4p and thereby participates in nuclear fusion. Analysis of the active-site mutations, xrn1-D206A or D208A, shows that nuclear fusion as well as the Rok1p synthesis do not require the exoribonuclease activity of Kem1p. Our data provide an important insight into the gene-specific regulatory function mediated by the general RNA-modulating enzymes
Directory of Open Access Journals (Sweden)
Dimitrios Vlachakis
2013-05-01
Full Text Available Viral RNA helicases are involved in duplex unwinding during the RNA replication of the virus. It is suggested that these helicases represent very promising antiviral targets. Viruses of the flaviviridae family are the causative agents of many common and devastating diseases, including hepatitis, yellow fever and dengue fever. As there is currently no available anti-Flaviviridae therapy, there is urgent need for the development of efficient anti-viral pharmaceutical strategies. Herein, we report the complete phylogenetic analysis across flaviviridae alongside a more in-depth evolutionary study that revealed a series of conserved and invariant amino acids that are predicted to be key to the function of the helicase. Structural molecular modelling analysis revealed the strategic significance of these residues based on their relative positioning on the 3D structures of the helicase enzymes, which may be used as pharmacological targets. We previously reported a novel series of highly potent HCV helicase inhibitors, and we now re-assess their antiviral potential using the 3D structural model of the invariant helicase residues. It was found that the most active compound of the series, compound C4, exhibited an IC50 in the submicromolar range, whereas its stereoisomer (compound C12 was completely inactive. Useful insights were obtained from molecular modelling and conformational search studies via molecular dynamics simulations. C12 tends to bend and lock in an almost “U” shape conformation, failing to establish vital interactions with the active site of HCV. On the contrary, C4 spends most of its conformational time in a straight, more rigid formation that allows it to successfully block the passage of the oligonucleotide in the ssRNA channel of the HCV helicase. This study paves the way and provides the necessary framework for the in-depth analysis required to enable the future design of new and potent anti-viral agents.
Characterization of a novel single-stranded RNA mycovirus in pleurotus ostreatus
International Nuclear Information System (INIS)
Yu, Hyun Jae; Lim, Dongbin; Lee, Hyun-Sook
2003-01-01
A mycovirus, named oyster mushroom spherical virus (OMSV), was isolated from cultivated oyster mushrooms with a severe epidemic of oyster mushroom Die-back disease. OMSV was a 27-nm spherical virus encapsidating a single-stranded RNA (ssRNA) of 5.784 kb with a coat protein of approximately 28.5 kDa. The nucleotide sequence of the virus revealed that its genomic RNA was positive strand, containing 5784 bases with seven open reading frames (ORF). ORF1 had the motifs of RNA-dependent RNA polymerases (RdRp) and helicase. ORF2 encoded a coat protein. ORF3 to 7 could encode putative polypeptides of approximately 12, 12.5, 21, 14.5, and 23 kDa, respectively, but none of them showed significant similarity to any other known polypeptides. The 5' end of the viral RNA was uncapped and the 3' end was polyadenylated with 74 bases. Genomic structure and organization and the derived amino acid sequence of RdRp and helicase domain were similar to those of tymoviruses, a plant virus group
Tabara, Hiroaki; Yigit, Erbay; Siomi, Haruhiko; Mello, Craig C
2002-06-28
Double-stranded (ds) RNA induces potent gene silencing, termed RNA interference (RNAi). At an early step in RNAi, an RNaseIII-related enzyme, Dicer (DCR-1), processes long-trigger dsRNA into small interfering RNAs (siRNAs). DCR-1 is also required for processing endogenous regulatory RNAs called miRNAs, but how DCR-1 recognizes its endogenous and foreign substrates is not yet understood. Here we show that the C. elegans RNAi pathway gene, rde-4, encodes a dsRNA binding protein that interacts during RNAi with RNA identical to the trigger dsRNA. RDE-4 protein also interacts in vivo with DCR-1, RDE-1, and a conserved DExH-box helicase. Our findings suggest a model in which RDE-4 and RDE-1 function together to detect and retain foreign dsRNA and to present this dsRNA to DCR-1 for processing.
Tissue-selective effects of nucleolar stress and rDNA damage in developmental disorders.
Calo, Eliezer; Gu, Bo; Bowen, Margot E; Aryan, Fardin; Zalc, Antoine; Liang, Jialiang; Flynn, Ryan A; Swigut, Tomek; Chang, Howard Y; Attardi, Laura D; Wysocka, Joanna
2018-02-01
Many craniofacial disorders are caused by heterozygous mutations in general regulators of housekeeping cellular functions such as transcription or ribosome biogenesis. Although it is understood that many of these malformations are a consequence of defects in cranial neural crest cells, a cell type that gives rise to most of the facial structures during embryogenesis, the mechanism underlying cell-type selectivity of these defects remains largely unknown. By exploring molecular functions of DDX21, a DEAD-box RNA helicase involved in control of both RNA polymerase (Pol) I- and II-dependent transcriptional arms of ribosome biogenesis, we uncovered a previously unappreciated mechanism linking nucleolar dysfunction, ribosomal DNA (rDNA) damage, and craniofacial malformations. Here we demonstrate that genetic perturbations associated with Treacher Collins syndrome, a craniofacial disorder caused by heterozygous mutations in components of the Pol I transcriptional machinery or its cofactor TCOF1 (ref. 1), lead to relocalization of DDX21 from the nucleolus to the nucleoplasm, its loss from the chromatin targets, as well as inhibition of rRNA processing and downregulation of ribosomal protein gene transcription. These effects are cell-type-selective, cell-autonomous, and involve activation of p53 tumour-suppressor protein. We further show that cranial neural crest cells are sensitized to p53-mediated apoptosis, but blocking DDX21 loss from the nucleolus and chromatin rescues both the susceptibility to apoptosis and the craniofacial phenotypes associated with Treacher Collins syndrome. This mechanism is not restricted to cranial neural crest cells, as blood formation is also hypersensitive to loss of DDX21 functions. Accordingly, ribosomal gene perturbations associated with Diamond-Blackfan anaemia disrupt DDX21 localization. At the molecular level, we demonstrate that impaired rRNA synthesis elicits a DNA damage response, and that rDNA damage results in tissue-selective and
Halim, Sobia A.; Khan, Shanza; Khan, Ajmal; Wadood, Abdul; Mabood, Fazal; Hussain, Javid; Al-Harrasi, Ahmed
2017-10-01
Dengue fever is an emerging public health concern, with several million viral infections occur annually, for which no effective therapy currently exist. Non-structural protein 3 (NS-3) Helicase encoded by the dengue virus (DENV) is considered as a potential drug target to design new and effective drugs against dengue. Helicase is involved in unwinding of dengue RNA. This study was conducted to design new NS-3 Helicase inhibitor by in silico ligand- and structure based approaches. Initially ligand-based pharmacophore model was generated that was used to screen a set of 1201474 compounds collected from ZINC Database. The compounds matched with the pharmacophore model were docked into the active site of NS-3 helicase. Based on docking scores and binding interactions, twenty five compounds are suggested to be potential inhibitors of NS3 Helicase. The pharmacokinetic properties of these hits were predicted. The selected hits revealed acceptable ADMET properties. This study identified potential inhibitors of NS-3 Helicase in silico, and can be helpful in the treatment of Dengue.
Yang, Zunyi; McLendon, Chris; Hutter, Daniel; Bradley, Kevin M.; Hoshika, Shuichi; Frye, Carole; Benner, Steven A.
2015-01-01
Assays that target DNA or RNA (xNA) are highly sensitive, as small amounts of xNA can be amplified by PCR. Unfortunately, PCR is inconvenient in low resource environments, requiring equipment and power that may not be available in these environments. However, isothermal procedures that avoid thermal cycling are often confounded by primer dimers, off-target priming, and other artifacts. Here, we show how a “self avoiding molecular recognition system” (SAMRS) eliminates these artifacts to give clean amplicons in a helicase-dependent isothermal amplification (SAMRS-HDA). We also show that incorporating SAMRS into the 3′-ends of primers facilitates the design and screening of primers for HDA assays. Finally, we show that SAMRS-HDA can be twofold multiplexed, something difficult to achieve with HDA using standard primers. This shows that SAMRS-HDA is a more versatile approach than standard HDA with a broader applicability for xNA-targeted diagnostics and research. PMID:25953623
Yakovleva, Lyudmila; Shuman, Stewart
2012-08-01
Bacterial DNA helicases are nucleic acid-dependent NTPases that play important roles in DNA replication, recombination and repair. We are interested in the DNA helicases of Mycobacteria, a genus of the phylum Actinobacteria, which includes the human pathogen Mycobacterium tuberculosis and its avirulent relative Mycobacterium smegmatis. Here, we identify and characterize M. smegmatis SftH, a superfamily II helicase with a distinctive domain structure, comprising an N-terminal NTPase domain and a C-terminal DUF1998 domain (containing a putative tetracysteine metal-binding motif). We show that SftH is a monomeric DNA-dependent ATPase/dATPase that translocates 3' to 5' on single-stranded DNA and has 3' to 5' helicase activity. SftH homologs are found in bacteria representing 12 different phyla, being especially prevalent in Actinobacteria (including M. tuberculosis). SftH homologs are evident in more than 30 genera of Archaea. Among eukarya, SftH homologs are present in plants and fungi.
Energy Technology Data Exchange (ETDEWEB)
Wasmuth, Elizabeth V. [Structural Biology Program, Sloan Kettering Institute, Memorial Sloan Kettering Cancer Center, New York, United States; Zinder, John C. [Structural Biology Program, Sloan Kettering Institute, Memorial Sloan Kettering Cancer Center, New York, United States; Tri-Institutional Training Program in Chemical Biology, Memorial Sloan Kettering Cancer Center, New York, United States; Zattas, Dimitrios [Structural Biology Program, Sloan Kettering Institute, Memorial Sloan Kettering Cancer Center, New York, United States; Das, Mom [Structural Biology Program, Sloan Kettering Institute, Memorial Sloan Kettering Cancer Center, New York, United States; Lima, Christopher D. [Structural Biology Program, Sloan Kettering Institute, Memorial Sloan Kettering Cancer Center, New York, United States; Howard Hughes Medical Institute, Memorial Sloan Kettering Cancer Center, New York, United States
2017-07-25
Nuclear RNA exosomes catalyze a range of RNA processing and decay activities that are coordinated in part by cofactors, including Mpp6, Rrp47, and the Mtr4 RNA helicase. Mpp6 interacts with the nine-subunit exosome core, while Rrp47 stabilizes the exoribonuclease Rrp6 and recruits Mtr4, but it is less clear if these cofactors work together. Using biochemistry with Saccharomyces cerevisiae proteins, we show that Rrp47 and Mpp6 stimulate exosome-mediated RNA decay, albeit with unique dependencies on elements within the nuclear exosome. Mpp6-exosomes can recruit Mtr4, while Mpp6 and Rrp47 each contribute to Mtr4-dependent RNA decay, with maximal Mtr4-dependent decay observed with both cofactors. The 3.3 Å structure of a twelve-subunit nuclear Mpp6 exosome bound to RNA shows the central region of Mpp6 bound to the exosome core, positioning its Mtr4 recruitment domain next to Rrp6 and the exosome central channel. Genetic analysis reveals interactions that are largely consistent with our model.
Li, Lei; Wang, Jin; Jia, Zhihui; Shaw, Neil
2018-04-01
Recent studies suggest a link between infection by Zika virus (ZIKV) and the development of neurological complications. The lack of ZIKV-specific therapeutics has alarmed healthcare professionals worldwide. Here, crystal structures of apo and AMPPNP- and Mn 2+ -bound forms of the essential helicase of ZIKV refined to 1.78 and 1.3 Å resolution, respectively, are reported. The structures reveal a conserved trimodular topology of the helicase. ATP and Mn 2+ are tethered between two RecA-like domains by conserved hydrogen-bonding interactions. The binding of ligands induces the movement of backbone Cα and side-chain atoms. Numerous solvent molecules are observed in the vicinity of the AMPPNP, suggesting a role in catalysis. These high-resolution structures could be useful for the design of inhibitors targeting the helicase of ZIKV for the treatment of infections caused by ZIKV.
DEFF Research Database (Denmark)
Larsen, Nicolai Balle; Hickson, Ian D
2013-01-01
The RecQ family of DNA helicases is highly conserved throughout -evolution, and is important for the maintenance of genome stability. In humans, five RecQ family members have been identified: BLM, WRN, RECQ4, RECQ1 and RECQ5. Defects in three of these give rise to Bloom's syndrome (BLM), Werner...
X-ray structure of the pestivirus NS3 helicase and its conformation in solution.
Tortorici, M Alejandra; Duquerroy, Stéphane; Kwok, Jane; Vonrhein, Clemens; Perez, Javier; Lamp, Benjamin; Bricogne, Gerard; Rümenapf, Till; Vachette, Patrice; Rey, Félix A
2015-04-01
Pestiviruses form a genus in the Flaviviridae family of small enveloped viruses with a positive-sense single-stranded RNA genome. Viral replication in this family requires the activity of a superfamily 2 RNA helicase contained in the C-terminal domain of nonstructural protein 3 (NS3). NS3 features two conserved RecA-like domains (D1 and D2) with ATPase activity, plus a third domain (D3) that is important for unwinding nucleic acid duplexes. We report here the X-ray structure of the pestivirus NS3 helicase domain (pNS3h) at a 2.5-Å resolution. The structure deviates significantly from that of NS3 of other genera in the Flaviviridae family in D3, as it contains two important insertions that result in a narrower nucleic acid binding groove. We also show that mutations in pNS3h that rescue viruses from which the core protein is deleted map to D3, suggesting that this domain may be involved in interactions that facilitate particle assembly. Finally, structural comparisons of the enzyme in different crystalline environments, together with the findings of small-angle X-ray-scattering studies in solution, show that D2 is mobile with respect to the rest of the enzyme, oscillating between closed and open conformations. Binding of a nonhydrolyzable ATP analog locks pNS3h in a conformation that is more compact than the closest apo-form in our crystals. Together, our results provide new insight and bring up new questions about pNS3h function during pestivirus replication. Although pestivirus infections impose an important toll on the livestock industry worldwide, little information is available about the nonstructural proteins essential for viral replication, such as the NS3 helicase. We provide here a comparative structural and functional analysis of pNS3h with respect to its orthologs in other viruses of the same family, the flaviviruses and hepatitis C virus. Our studies reveal differences in the nucleic acid binding groove that could have implications for understanding the
DEFF Research Database (Denmark)
Gueler, B; Sonne, S B; Zimmer, J
2012-01-01
are believed to originate from fetal gonocytes.METHODSDDX3Y protein expression was analysed during development in different tissues by western blotting. The localization of DDX3Y in normal fetal and prepubertal testis tissue of different ages as well as in a series of distinct TGCT tissue samples (CIS......, classical seminoma, spermatocytic seminoma, teratoma and embryonal carcinoma) was performed by immunohistochemistry.RESULTSGerm cell-specific expression of DDX3Y protein was revealed in fetal prospermatogonia but not in gonocytes and not before the 17th gestational week. After birth, DDX3Y was expressed......, but not in somatically differentiated non-seminomas, consistent with its germ-cell specific function.CONCLUSIONSThe fetal germ cell DDX3Y expression suggests a role in early spermatogonial proliferation and implies that, in men with AZFa deletion, germ cell depletion may begin prenatally. The strong expression of DDX3Y...
Snijders Blok, Lot; Madsen, Erik; Juusola, Jane; Gilissen, Christian; Baralle, Diana; Reijnders, Margot R F; Venselaar, Hanka; Helsmoortel, Céline; Cho, Megan T; Hoischen, Alexander; Vissers, Lisenka E L M; Koemans, Tom S; Wissink-Lindhout, Willemijn; Eichler, Evan E; Romano, Corrado; Van Esch, Hilde; Stumpel, Connie; Vreeburg, Maaike; Smeets, Eric; Oberndorff, Karin; van Bon, Bregje W M; Shaw, Marie; Gecz, Jozef; Haan, Eric; Bienek, Melanie; Jensen, Corinna; Loeys, Bart L; Van Dijck, Anke; Innes, A Micheil; Racher, Hilary; Vermeer, Sascha; Di Donato, Nataliya; Rump, Andreas; Tatton-Brown, Katrina; Parker, Michael J; Henderson, Alex; Lynch, Sally A; Fryer, Alan; Ross, Alison; Vasudevan, Pradeep; Kini, Usha; Newbury-Ecob, Ruth; Chandler, Kate; Male, Alison; Dijkstra, Sybe; Schieving, Jolanda; Giltay, Jacques; van Gassen, Koen L I; Schuurs-Hoeijmakers, Janneke; Tan, Perciliz L; Pediaditakis, Igor; Haas, Stefan A; Retterer, Kyle; Reed, Patrick; Monaghan, Kristin G; Haverfield, Eden; Natowicz, Marvin; Myers, Angela; Kruer, Michael C; Stein, Quinn; Strauss, Kevin A; Brigatti, Karlla W; Keating, Katherine; Burton, Barbara K; Kim, Katherine H; Charrow, Joel; Norman, Jennifer; Foster-Barber, Audrey; Kline, Antonie D; Kimball, Amy; Zackai, Elaine; Harr, Margaret; Fox, Joyce; McLaughlin, Julie; Lindstrom, Kristin; Haude, Katrina M; van Roozendaal, Kees; Brunner, Han; Chung, Wendy K; Kooy, R Frank; Pfundt, Rolph; Kalscheuer, Vera; Mehta, Sarju G; Katsanis, Nicholas; Kleefstra, Tjitske
2015-08-06
Intellectual disability (ID) affects approximately 1%-3% of humans with a gender bias toward males. Previous studies have identified mutations in more than 100 genes on the X chromosome in males with ID, but there is less evidence for de novo mutations on the X chromosome causing ID in females. In this study we present 35 unique deleterious de novo mutations in DDX3X identified by whole exome sequencing in 38 females with ID and various other features including hypotonia, movement disorders, behavior problems, corpus callosum hypoplasia, and epilepsy. Based on our findings, mutations in DDX3X are one of the more common causes of ID, accounting for 1%-3% of unexplained ID in females. Although no de novo DDX3X mutations were identified in males, we present three families with segregating missense mutations in DDX3X, suggestive of an X-linked recessive inheritance pattern. In these families, all males with the DDX3X variant had ID, whereas carrier females were unaffected. To explore the pathogenic mechanisms accounting for the differences in disease transmission and phenotype between affected females and affected males with DDX3X missense variants, we used canonical Wnt defects in zebrafish as a surrogate measure of DDX3X function in vivo. We demonstrate a consistent loss-of-function effect of all tested de novo mutations on the Wnt pathway, and we further show a differential effect by gender. The differential activity possibly reflects a dose-dependent effect of DDX3X expression in the context of functional mosaic females versus one-copy males, which reflects the complex biological nature of DDX3X mutations. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Yang, Zunyi; McLendon, Chris; Hutter, Daniel; Bradley, Kevin M; Hoshika, Shuichi; Frye, Carole B; Benner, Steven A
2015-06-15
Assays that detect DNA or RNA (xNA) are highly sensitive, as small amounts of xNA can be amplified by PCR. Unfortunately, PCR is inconvenient in low-resource environments, and requires equipment and power that might not be available in these environments. Isothermal procedures, which avoid thermal cycling, are often confounded by primer dimers, off-target priming, and other artifacts. Here, we show how a "self avoiding molecular recognition system" (SAMRS) eliminates these artifacts and gives clean amplicons in a helicase-dependent isothermal amplification (SAMRS-HDA). We also show that incorporating SAMRS into the 3'-ends of primers facilitates the design and screening of primers for HDA assays. Finally, we show that SAMRS-HDA can be twofold multiplexed, difficult to achieve with HDA using standard primers. Thus, SAMRS-HDA is a more versatile approach than standard HDA, with a broader applicability for xNA-targeted diagnostics and research. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Physical interaction of RECQ5 helicase with RAD51 facilitates its anti-recombinase activity
Czech Academy of Sciences Publication Activity Database
Schwendener, S.; Raynard, S.; Paliwal, S.; Cheng, A.; Kanagaraj, R.; Shevelev, Igor; Stark, J.M.; Sung, P.; Janscak, P.
2010-01-01
Roč. 285, č. 21 (2010), s. 15739-15745 ISSN 0021-9258 Grant - others:NIH(US) R01CA120954; NIH(US) ES015632; SNSF(CH) 3100A0-116008 Institutional research plan: CEZ:AV0Z50520514 Keywords : DNA helicase * double-strand breaks * homologous recombination Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.328, year: 2010
Directory of Open Access Journals (Sweden)
Atsushi Furuta
2014-01-01
Full Text Available Hepatitis C virus (HCV is an important etiological agent that is responsible for the development of chronic hepatitis, liver cirrhosis, and hepatocellular carcinoma. HCV nonstructural protein 3 (NS3 helicase is a possible target for novel drug development due to its essential role in viral replication. In this study, we identified halisulfate 3 (hal3 and suvanine as novel NS3 helicase inhibitors, with IC50 values of 4 and 3 µM, respectively, from a marine sponge by screening extracts of marine organisms. Both hal3 and suvanine inhibited the ATPase, RNA binding, and serine protease activities of NS3 helicase with IC50 values of 8, 8, and 14 µM, and 7, 3, and 34 µM, respectively. However, the dengue virus (DENV NS3 helicase, which shares a catalytic core (consisting mainly of ATPase and RNA binding sites with HCV NS3 helicase, was not inhibited by hal3 and suvanine, even at concentrations of 100 µM. Therefore, we conclude that hal3 and suvanine specifically inhibit HCV NS3 helicase via an interaction with an allosteric site in NS3 rather than binding to the catalytic core. This led to the inhibition of all NS3 activities, presumably by inducing conformational changes.
Dicer uses distinct modules for recognizing dsRNA termini.
Sinha, Niladri K; Iwasa, Janet; Shen, Peter S; Bass, Brenda L
2018-01-19
Invertebrates rely on Dicer to cleave viral double-stranded RNA (dsRNA), and Drosophila Dicer-2 distinguishes dsRNA substrates by their termini. Blunt termini promote processive cleavage, while 3' overhanging termini are cleaved distributively. To understand this discrimination, we used cryo-electron microscopy to solve structures of Drosophila Dicer-2 alone and in complex with blunt dsRNA. Whereas the Platform-PAZ domains have been considered the only Dicer domains that bind dsRNA termini, unexpectedly, we found that the helicase domain is required for binding blunt, but not 3' overhanging, termini. We further showed that blunt dsRNA is locally unwound and threaded through the helicase domain in an adenosine triphosphate-dependent manner. Our studies reveal a previously unrecognized mechanism for optimizing antiviral defense and set the stage for the discovery of helicase-dependent functions in other Dicers. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Directory of Open Access Journals (Sweden)
Tara Kashav
2009-10-01
Full Text Available Replication initiation is a crucial step in genome duplication and homohexameric DnaB helicase plays a central role in the replication initiation process by unwinding the duplex DNA and interacting with several other proteins during the process of replication. N-terminal domain of DnaB is critical for helicase activity and for DnaG primase interactions. We present here the crystal structure of the N-terminal domain (NTD of H. pylori DnaB (HpDnaB helicase at 2.2 A resolution and compare the structural differences among helicases and correlate with the functional differences. The structural details of NTD suggest that the linker region between NTD and C-terminal helicase domain plays a vital role in accurate assembly of NTD dimers. The sequence analysis of the linker regions from several helicases reveals that they should form four helix bundles. We also report the characterization of H. pylori DnaG primase and study the helicase-primase interactions, where HpDnaG primase stimulates DNA unwinding activity of HpDnaB suggesting presence of helicase-primase cohort at the replication fork. The protein-protein interaction study of C-terminal domain of primase and different deletion constructs of helicase suggests that linker is essential for proper conformation of NTD to interact strongly with HpDnaG. The surface charge distribution on the primase binding surface of NTDs of various helicases suggests that DnaB-DnaG interaction and stability of the complex is most probably charge dependent. Structure of the linker and helicase-primase interactions indicate that HpDnaB differs greatly from E.coli DnaB despite both belong to gram negative bacteria.
Mitochondrial helicases and mitochondrial genome maintenance
DEFF Research Database (Denmark)
de Souza-Pinto, Nadja C; Aamann, Maria Diget; Kulikowicz, Tomasz
2010-01-01
Helicases are essential enzymes that utilize the energy of nucleotide hydrolysis to drive unwinding of nucleic acid duplexes. Helicases play roles in all aspects of DNA metabolism including DNA repair, DNA replication and transcription. The subcellular locations and functions of several helicases...
Soares, Emilie; Schwartz, Annie; Nollmann, Marcello; Margeat, Emmanuel; Boudvillain, Marc
2014-08-01
Rho is a ring-shaped, ATP-dependent RNA helicase/translocase that dissociates transcriptional complexes in bacteria. How RNA recognition is coupled to ATP hydrolysis and translocation in Rho is unclear. Here, we develop and use a new combinatorial approach, called time-resolved Nucleotide Analog Interference Probing (trNAIP), to unmask RNA molecular determinants of catalytic Rho function. We identify a regulatory step in the translocation cycle involving recruitment of the 2'-hydroxyl group of the incoming 3'-RNA nucleotide by a Rho subunit. We propose that this step arises from the intrinsic weakness of one of the subunit interfaces caused by asymmetric, split-ring arrangement of primary RNA tethers around the Rho hexamer. Translocation is at highest stake every seventh nucleotide when the weak interface engages the incoming 3'-RNA nucleotide or breaks, depending on RNA threading constraints in the Rho pore. This substrate-governed, 'test to run' iterative mechanism offers a new perspective on how a ring-translocase may function or be regulated. It also illustrates the interest and versatility of the new trNAIP methodology to unveil the molecular mechanisms of complex RNA-based systems. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Banroques, Josette; Doère, Monique; Dreyfus, Marc; Linder, Patrick; Tanner, N Kyle
2010-03-05
Motif III in the putative helicases of superfamily 2 is highly conserved in both its sequence and its structural context. It typically consists of the sequence alcohol-alanine-alcohol (S/T-A-S/T). Historically, it was thought to link ATPase activity with a "helicase" strand displacement activity that disrupts RNA or DNA duplexes. DEAD-box proteins constitute the largest family of superfamily 2; they are RNA-dependent ATPases and ATP-dependent RNA binding proteins that, in some cases, are able to disrupt short RNA duplexes. We made mutations of motif III (S-A-T) in the yeast DEAD-box protein Ded1 and analyzed in vivo phenotypes and in vitro properties. Moreover, we made a tertiary model of Ded1 based on the solved structure of Vasa. We used Ded1 because it has relatively high ATPase and RNA binding activities; it is able to displace moderately stable duplexes at a large excess of substrate. We find that the alanine and the threonine in the second and third positions of motif III are more important than the serine, but that mutations of all three residues have strong phenotypes. We purified the wild-type and various mutants expressed in Escherichia coli. We found that motif III mutations affect the RNA-dependent hydrolysis of ATP (k(cat)), but not the affinity for ATP (K(m)). Moreover, mutations alter and reduce the affinity for single-stranded RNA and subsequently reduce the ability to disrupt duplexes. We obtained intragenic suppressors of the S-A-C mutant that compensate for the mutation by enhancing the affinity for ATP and RNA. We conclude that motif III and the binding energy of gamma-PO(4) of ATP are used to coordinate motifs I, II, and VI and the two RecA-like domains to create a high-affinity single-stranded RNA binding site. It also may help activate the beta,gamma-phosphoanhydride bond of ATP. (c) 2009 Elsevier Ltd. All rights reserved.
Saccharomyces cerevisiae Hrq1 requires a long 3′-tailed DNA substrate for helicase activity
International Nuclear Information System (INIS)
Kwon, Sung-Hun; Choi, Do-Hee; Lee, Rina; Bae, Sung-Ho
2012-01-01
Highlights: ► Hrq1 has intrinsic 3′–5′ helicase and DNA strand annealing activities. ► Hrq1 requires a long 3′-tail for efficient DNA unwinding. ► Helicase activity of Hrq1 is stimulated by a fork structure. ► Hrq1 is a moderately processive helicase. -- Abstract: RecQ helicases are well conserved proteins from bacteria to human and function in various DNA metabolism for maintenance of genome stability. Five RecQ helicases are found in humans, whereas only one RecQ helicase has been described in lower eukaryotes. However, recent studies predicted the presence of a second RecQ helicase, Hrq1, in fungal genomes and verified it as a functional gene in fission yeast. Here we show that 3′–5′ helicase activity is intrinsically associated with Hrq1 of Saccharomyces cerevisiae. We also determined several biochemical properties of Hrq1 helicase distinguishable from those of other RecQ helicase members. Hrq1 is able to unwind relatively long duplex DNA up to 120-bp and is significantly stimulated by a preexisting fork structure. Further, the most striking feature of Hrq1 is its absolute requirement for a long 3′-tail (⩾70-nt) for efficient unwinding of duplex DNA. We also found that Hrq1 has potent DNA strand annealing activity. Our results indicate that Hrq1 has vigorous helicase activity that deserves further characterization to expand our understanding of RecQ helicases.
Structural and functional analysis of the human spliceosomal DEAD-box helicase Prp28
Energy Technology Data Exchange (ETDEWEB)
Möhlmann, Sina [Georg-August-University Göttingen, Justus-von-Liebig Weg 11, 37077 Göttingen (Germany); Mathew, Rebecca [Max-Planck-Institute for Biophysical Chemistry, Am Fassberg, 37077 Göttingen (Germany); Neumann, Piotr; Schmitt, Andreas [Georg-August-University Göttingen, Justus-von-Liebig Weg 11, 37077 Göttingen (Germany); Lührmann, Reinhard [Max-Planck-Institute for Biophysical Chemistry, Am Fassberg, 37077 Göttingen (Germany); Ficner, Ralf, E-mail: rficner@uni-goettingen.de [Georg-August-University Göttingen, Justus-von-Liebig Weg 11, 37077 Göttingen (Germany)
2014-06-01
The crystal structure of the helicase domain of the human spliceosomal DEAD-box protein Prp28 was solved by SAD. The binding of ADP and ATP by Prp28 was studied biochemically and analysed with regard to the crystal structure. The DEAD-box protein Prp28 is essential for pre-mRNA splicing as it plays a key role in the formation of an active spliceosome. Prp28 participates in the release of the U1 snRNP from the 5′-splice site during association of the U5·U4/U6 tri-snRNP, which is a crucial step in the transition from a pre-catalytic spliceosome to an activated spliceosome. Here, it is demonstrated that the purified helicase domain of human Prp28 (hPrp28ΔN) binds ADP, whereas binding of ATP and ATPase activity could not be detected. ATP binding could not be observed for purified full-length hPrp28 either, but within an assembled spliceosomal complex hPrp28 gains ATP-binding activity. In order to understand the structural basis for the ATP-binding deficiency of isolated hPrp28, the crystal structure of hPrp28ΔN was determined at 2.0 Å resolution. In the crystal the helicase domain adopts a wide-open conformation, as the two RecA-like domains are extraordinarily displaced from the productive ATPase conformation. Binding of ATP is hindered by a closed conformation of the P-loop, which occupies the space required for the γ-phosphate of ATP.
Directory of Open Access Journals (Sweden)
Katja Müller
Full Text Available Malaria is a vector-borne infectious disease caused by unicellular, obligate intracellular parasites of the genus Plasmodium. During host switch the malaria parasite employs specialized latent stages that colonize the new host environment. Previous work has established that gametocytes, sexually differentiated stages that are taken up by the mosquito vector, control expression of genes required for mosquito colonization by translational repression. Sexual parasite development is controlled by a DEAD-box RNA helicase of the DDX6 family, termed DOZI. Latency of sporozoites, the transmission stage injected during an infectious blood meal, is controlled by the eIF2alpha kinase IK2, a general inhibitor of protein synthesis. Whether RNA-binding proteins participate in translational regulation in sporozoites remains to be studied. Here, we investigated the roles of two RNA-binding proteins of the Puf-family, Plasmodium Puf1 and Puf2, during sporozoite stage conversion. Our data reveal that, in the rodent malaria parasite P. berghei, Puf2 participates in the regulation of IK2 and inhibits premature sporozoite transformation. Inside mosquito salivary glands puf2⁻ sporozoites transform over time to round forms resembling early intra-hepatic stages. As a result, mutant parasites display strong defects in initiating a malaria infection. In contrast, Puf1 is dispensable in vivo throughout the entire Plasmodium life cycle. Our findings support the notion of a central role for Puf2 in parasite latency during switch between the insect and mammalian hosts.
Schulte, B.M.; Gielen, P.R.; Kers-Rebel, E.D.; Prosser, A.C.; Lind, K.; Flodstrom-Tullberg, M.; Tack, C.J.J.; Elving, L.D.; Adema, G.J.
2016-01-01
In children at risk for type 1 diabetes, innate immune activity is detected before seroconversion. Enterovirus infections have been linked to diabetes development, and a polymorphism (A946T) in the innate immune sensor recognizing enterovirus RNA, interferon-induced with helicase C domain 1/melanoma
Beran, Rudolf K F; Bruno, Michael M; Bowers, Heath A; Jankowsky, Eckhard; Pyle, Anna Marie
2006-05-12
The NS3 helicase is essential for replication of the hepatitis C virus. This multifunctional Superfamily 2 helicase protein unwinds nucleic acid duplexes in a stepwise, ATP-dependent manner. Although kinetic features of its mechanism are beginning to emerge, little is known about the physical determinants for NS3 translocation along a strand of nucleic acid. For example, it is not known whether NS3 can traverse covalent or physical discontinuities on the tracking strand. Here we provide evidence that NS3 translocates with a mechanism that is different from its well-studied relative, the Vaccinia helicase NPH-II. Like NPH-II, NS3 translocates along the loading strand (the strand bearing the 3'-overhang) and it fails to unwind substrates that contain nicks, or covalent discontinuities in the loading strand. However, unlike NPH-II, NS3 readily unwinds RNA duplexes that contain long stretches of polyglycol, which are moieties that bear no resemblance to nucleic acid. Whether located on the tracking strand, the top strand, or both, long polyglycol regions fail to disrupt the function of NS3. This suggests that NS3 does not require the continuous formation of specific contacts with the ribose-phosphate backbone as it translocates along an RNA duplex, which is an observation consistent with the large NS3 kinetic step size (18 base-pairs). Rather, once NS3 loads onto a substrate, the helicase can translocate along the loading strand of an RNA duplex like a monorail train following a track. Bumps in the track do not significantly disturb NS3 unwinding, but a break in the track de-rails the helicase.
G.S. Winkler (Sebastiaan); U. Fiedler; W. Vermeulen (Wim); F. Coin (Frédéric); R.D. Wood (Richard); H.T.M. Timmers (Marc); G. Weeda (Geert); J.H.J. Hoeijmakers (Jan); S.J. Araú jo; J-M. Egly (Jean-Marc)
2000-01-01
textabstractTFIIH is a multisubunit protein complex involved in RNA polymerase II transcription and nucleotide excision repair, which removes a wide variety of DNA lesions including UV-induced photoproducts. Mutations in the DNA-dependent ATPase/helicase subunits of TFIIH, XPB and
Human SUV3 helicase regulates growth rate of the HeLa cells and can localize in the nucleoli.
Szewczyk, Maciej; Fedoryszak-Kuśka, Natalia; Tkaczuk, Katarzyna; Dobrucki, Jurek; Waligórska, Agnieszka; Stępień, Piotr P
2017-01-01
The human SUV3 helicase (SUV3, hSUV3, SUPV3L1) is a DNA/RNA unwinding enzyme belonging to the class of DexH-box helicases. It localizes predominantly in the mitochondria, where it forms an RNA-degrading complex called mitochondrial degradosome with exonuclease PNP (polynucleotide phosphorylase). Association of this complex with the polyA polymerase can modulate mitochondrial polyA tails. Silencing of the SUV3 gene was shown to inhibit the cell cycle and to induce apoptosis in human cell lines. However, since small amounts of the SUV3 helicase were found in the cell nuclei, it was not clear whether the observed phenotypes of SUV3 depletion were of mitochondrial or nuclear origin. In order to answer this question we have designed gene constructs able to inhibit the SUV3 activity exclusively in the cell nuclei. The results indicate that the observed growth rate impairment upon SUV3 depletion is due to its nuclear function(s). Unexpectedly, overexpression of the nuclear-targeted wild-type copies of the SUV3 gene resulted in a higher growth rate. In addition, we demonstrate that the SUV3 helicase can be found in the HeLa cell nucleoli, but it is not detectable in the DNA-repair foci. Our results indicate that the nucleolar-associated human SUV3 protein is an important factor in regulation of the cell cycle.
Saccharomyces cerevisiae Hrq1 requires a long 3'-tailed DNA substrate for helicase activity.
Kwon, Sung-Hun; Choi, Do-Hee; Lee, Rina; Bae, Sung-Ho
2012-10-26
RecQ helicases are well conserved proteins from bacteria to human and function in various DNA metabolism for maintenance of genome stability. Five RecQ helicases are found in humans, whereas only one RecQ helicase has been described in lower eukaryotes. However, recent studies predicted the presence of a second RecQ helicase, Hrq1, in fungal genomes and verified it as a functional gene in fission yeast. Here we show that 3'-5' helicase activity is intrinsically associated with Hrq1 of Saccharomyces cerevisiae. We also determined several biochemical properties of Hrq1 helicase distinguishable from those of other RecQ helicase members. Hrq1 is able to unwind relatively long duplex DNA up to 120-bp and is significantly stimulated by a preexisting fork structure. Further, the most striking feature of Hrq1 is its absolute requirement for a long 3'-tail (⩾70-nt) for efficient unwinding of duplex DNA. We also found that Hrq1 has potent DNA strand annealing activity. Our results indicate that Hrq1 has vigorous helicase activity that deserves further characterization to expand our understanding of RecQ helicases. Copyright © 2012 Elsevier Inc. All rights reserved.
Deka, Jashmini; Mojumdar, Aditya; Parisse, Pietro; Onesti, Silvia; Casalis, Loredana
2017-03-01
Helicase are essential enzymes which are widespread in all life-forms. Due to their central role in nucleic acid metabolism, they are emerging as important targets for anti-viral, antibacterial and anti-cancer drugs. The development of easy, cheap, fast and robust biochemical assays to measure helicase activity, overcoming the limitations of the current methods, is a pre-requisite for the discovery of helicase inhibitors through high-throughput screenings. We have developed a method which exploits the optical properties of DNA-conjugated gold nanoparticles (AuNP) and meets the required criteria. The method was tested with the catalytic domain of the human RecQ4 helicase and compared with a conventional FRET-based assay. The AuNP-based assay produced similar results but is simpler, more robust and cheaper than FRET. Therefore, our nanotechnology-based platform shows the potential to provide a useful alternative to the existing conventional methods for following helicase activity and to screen small-molecule libraries as potential helicase inhibitors.
Energy Technology Data Exchange (ETDEWEB)
Hood, Iris V.; Berger, James M.
2016-05-31
Replisome assembly requires the loading of replicative hexameric helicases onto origins by AAA+ ATPases. How loader activity is appropriately controlled remains unclear. Here, we use structural and biochemical analyses to establish how an antimicrobial phage protein interferes with the function of the
Chen, Yan; Carrington-Lawrence, Stacy D; Bai, Ping; Weller, Sandra K
2005-07-01
Herpes simplex virus type 1 (HSV-1) encodes a heterotrimeric helicase-primase (UL5/8/52) complex. UL5 contains seven motifs found in helicase superfamily 1, and UL52 contains conserved motifs found in primases. The contributions of each subunit to the biochemical activities of the complex, however, remain unclear. We have previously demonstrated that a mutation in the putative zinc finger at UL52 C terminus abrogates not only primase but also ATPase, helicase, and DNA-binding activities of a UL5/UL52 subcomplex, indicating a complex interdependence between the two subunits. To test this hypothesis and to further investigate the role of the zinc finger in the enzymatic activities of the helicase-primase, a series of mutations were constructed in this motif. They differed in their ability to complement a UL52 null virus: totally defective, partial complementation, and potentiating. In this study, four of these mutants were studied biochemically after expression and purification from insect cells infected with recombinant baculoviruses. All mutants show greatly reduced primase activity. Complementation-defective mutants exhibited severe defects in ATPase, helicase, and DNA-binding activities. Partially complementing mutants displayed intermediate levels of these activities, except that one showed a wild-type level of helicase activity. These data suggest that the UL52 zinc finger motif plays an important role in the activities of the helicase-primase complex. The observation that mutations in UL52 affected helicase, ATPase, and DNA-binding activities indicates that UL52 binding to DNA via the zinc finger may be necessary for loading UL5. Alternatively, UL5 and UL52 may share a DNA-binding interface.
Crystal structure of Middle East respiratory syndrome coronavirus helicase.
Directory of Open Access Journals (Sweden)
Wei Hao
2017-06-01
Full Text Available Middle East respiratory syndrome coronavirus (MERS-CoV remains a threat to public health worldwide; however, effective vaccine or drug against CoVs remains unavailable. CoV helicase is one of the three evolutionary most conserved proteins in nidoviruses, thus making it an important target for drug development. We report here the first structure of full-length coronavirus helicase, MERS-CoV nsp13. MERS-CoV helicase has multiple domains, including an N-terminal Cys/His rich domain (CH with three zinc atoms, a beta-barrel domain and a C-terminal SF1 helicase core with two RecA-like subdomains. Our structural analyses show that while the domain organization of nsp13 is conserved throughout nidoviruses, the individual domains of nsp13 are closely related to the equivalent eukaryotic domains of Upf1 helicases. The most distinctive feature differentiating CoV helicases from eukaryotic Upf1 helicases is the interaction between CH domain and helicase core.
Directory of Open Access Journals (Sweden)
Soumya Rudra
Full Text Available The conserved family of cohesin proteins that mediate sister chromatid cohesion requires Scc2, Scc4 for chromatin-association and Eco1/Ctf7 for conversion to a tethering competent state. A popular model, based on the notion that cohesins form huge ring-like structures, is that Scc2, Scc4 function is essential only during G1 such that sister chromatid cohesion results simply from DNA replisome passage through pre-loaded cohesin rings. In such a scenario, cohesin deposition during G1 is temporally uncoupled from Eco1-dependent establishment reactions that occur during S-phase. Chl1 DNA helicase (homolog of human ChlR1/DDX11 and BACH1/BRIP1/FANCJ helicases implicated in Fanconi anemia, breast and ovarian cancer and Warsaw Breakage Syndrome plays a critical role in sister chromatid cohesion, however, the mechanism through which Chl1 promotes cohesion remains poorly understood. Here, we report that Chl1 promotes Scc2 loading unto DNA such that both Scc2 and cohesin enrichment to chromatin are defective in chl1 mutant cells. The results further show that both Chl1 expression and chromatin-recruitment are tightly regulated through the cell cycle, peaking during S-phase. Importantly, kinetic ChIP studies reveals that Chl1 is required for Scc2 chromatin-association specifically during S-phase, but not during G1. Despite normal chromatin enrichment of both Scc2 and cohesin during G1, chl1 mutant cells exhibit severe chromosome segregation and cohesion defects--revealing that G1-loaded cohesins is insufficient to promote cohesion. Based on these findings, we propose a new model wherein S-phase cohesin loading occurs during DNA replication and in concert with both cohesion establishment and chromatin assembly reactions--challenging the notion that DNA replication fork navigates through or around pre-loaded cohesin rings.
Identification of Hydroxyanthraquinones as Novel Inhibitors of Hepatitis C Virus NS3 Helicase
Furuta, Atsushi; Tsubuki, Masayoshi; Endoh, Miduki; Miyamoto, Tatsuki; Tanaka, Junichi; Abdus Salam, Kazi; Akimitsu, Nobuyoshi; Tani, Hidenori; Yamashita, Atsuya; Moriishi, Kohji; Nakakoshi, Masamichi; Sekiguchi, Yuji; Tsuneda, Satoshi; Noda, Naohiro
2015-01-01
Hepatitis C virus (HCV) is an important etiological agent of severe liver diseases, including cirrhosis and hepatocellular carcinoma. The HCV genome encodes nonstructural protein 3 (NS3) helicase, which is a potential anti-HCV drug target because its enzymatic activity is essential for viral replication. Some anthracyclines are known to be NS3 helicase inhibitors and have a hydroxyanthraquinone moiety in their structures; mitoxantrone, a hydroxyanthraquinone analogue, is also known to inhibit NS3 helicase. Therefore, we hypothesized that the hydroxyanthraquinone moiety alone could also inhibit NS3 helicase. Here, we performed a structure–activity relationship study on a series of hydroxyanthraquinones by using a fluorescence-based helicase assay. Hydroxyanthraquinones inhibited NS3 helicase with IC50 values in the micromolar range. The inhibitory activity varied depending on the number and position of the phenolic hydroxyl groups, and among different hydroxyanthraquinones examined, 1,4,5,8-tetrahydroxyanthraquinone strongly inhibited NS3 helicase with an IC50 value of 6 µM. Furthermore, hypericin and sennidin A, which both have two hydroxyanthraquinone-like moieties, were found to exert even stronger inhibition with IC50 values of 3 and 0.8 µM, respectively. These results indicate that the hydroxyanthraquinone moiety can inhibit NS3 helicase and suggest that several key chemical structures are important for the inhibition. PMID:26262613
Identification of Hydroxyanthraquinones as Novel Inhibitors of Hepatitis C Virus NS3 Helicase
Directory of Open Access Journals (Sweden)
Atsushi Furuta
2015-08-01
Full Text Available Hepatitis C virus (HCV is an important etiological agent of severe liver diseases, including cirrhosis and hepatocellular carcinoma. The HCV genome encodes nonstructural protein 3 (NS3 helicase, which is a potential anti-HCV drug target because its enzymatic activity is essential for viral replication. Some anthracyclines are known to be NS3 helicase inhibitors and have a hydroxyanthraquinone moiety in their structures; mitoxantrone, a hydroxyanthraquinone analogue, is also known to inhibit NS3 helicase. Therefore, we hypothesized that the hydroxyanthraquinone moiety alone could also inhibit NS3 helicase. Here, we performed a structure–activity relationship study on a series of hydroxyanthraquinones by using a fluorescence-based helicase assay. Hydroxyanthraquinones inhibited NS3 helicase with IC50 values in the micromolar range. The inhibitory activity varied depending on the number and position of the phenolic hydroxyl groups, and among different hydroxyanthraquinones examined, 1,4,5,8-tetrahydroxyanthraquinone strongly inhibited NS3 helicase with an IC50 value of 6 µM. Furthermore, hypericin and sennidin A, which both have two hydroxyanthraquinone-like moieties, were found to exert even stronger inhibition with IC50 values of 3 and 0.8 µM, respectively. These results indicate that the hydroxyanthraquinone moiety can inhibit NS3 helicase and suggest that several key chemical structures are important for the inhibition.
In vivo mapping of the functional regions of the DEAD-box helicase Vasa
Directory of Open Access Journals (Sweden)
Mehrnoush Dehghani
2015-03-01
Full Text Available The maternally expressed Drosophila melanogaster DEAD-box helicase Vasa (Vas is necessary for many cellular and developmental processes, including specification of primordial germ cells (pole cells, posterior patterning of the embryo, piRNA-mediated repression of transposon-encoded mRNAs, translational activation of gurken (grk mRNA, and completion of oogenesis itself. Vas protein accumulates in the perinuclear nuage in nurse cells soon after their specification, and then at stage 10 Vas translocates to the posterior pole plasm of the oocyte. We produced a series of transgenic constructs encoding eGFP-Vas proteins carrying mutations affecting different regions of the protein, and analyzed in vivo which Vas functions each could support. We identified novel domains in the N- and C-terminal regions of the protein that are essential for localization, transposon repression, posterior patterning, and pole cell specification. One such functional region, the most C-terminal seven amino acids, is specific to Vas orthologues and is thus critical to distinguishing Vas from other closely related DEAD-box helicases. Surprisingly, we also found that many eGFP-Vas proteins carrying mutations that would be expected to abrogate DEAD-box helicase function localized to the nuage and posterior pole, and retained the capacity to support oogenesis, although they did not function in embryonic patterning, pole cell specification, grk activation, or transposon repression. We conclude from these experiments that Vas, a multifunctional protein, uses different domains and different molecular associations to carry out its various cellular and developmental roles.
International Nuclear Information System (INIS)
Kanno, Yuichiro; Serikawa, Takafumi; Inajima, Jun; Inouye, Yoshio
2012-01-01
Highlights: ► DP97 interacts with nuclear receptor CAR. ► DP97 enhances CAR-mediated transcriptional activation. ► DP97 synergistically enhances transactivity of CAR by the co-expression of SRC-1 or PGC1α. ► DP97 is a gene-selective co-activator for hCAR. -- Abstract: The constitutive androstane receptor (CAR) plays a key role in the expression of xenobiotic/steroid and drug metabolizing enzymes and their transporters. In this study, we demonstrated that DP97, a member of the DEAD box DNA/RNA helicase protein family, is a novel CAR-interacting protein. Using HepG2 cells expressing human CAR in the presence of tetracycline, we showed that knockdown of DP97 with small interfering RNAs suppressed tetracycline-inducible mRNA expression of CYP2B6 and UGT1A1 but not CYP3A4. Thus, DP97 was found to be a gene (or promoter)-selective co-activator for hCAR. DP97-mediated CAR transactivation was synergistically enhanced by the co-expression of SRC-1 or PGC1α, therefore it might act as mediator between hCAR and appropriate co-activators.
Ordonez, Heather; Unciuleac, Mihaela; Shuman, Stewart
2012-05-01
The Escherichia coli RecQ DNA helicase participates in a pathway of DNA repair that operates in parallel to the recombination pathway driven by the multisubunit helicase-nuclease machine RecBCD. The model mycobacterium Mycobacterium smegmatis executes homologous recombination in the absence of its helicase-nuclease machine AdnAB, though it lacks a homolog of E. coli RecQ. Here, we identify and characterize M. smegmatis RqlH, a RecQ-like helicase with a distinctive domain structure. The 691-amino acid RqlH polypeptide consists of a RecQ-like ATPase domain (amino acids 1-346) and tetracysteine zinc-binding domain (amino acids 435-499), separated by an RqlH-specific linker. RqlH lacks the C-terminal HRDC domain found in E. coli RecQ. Rather, the RqlH C-domain resembles bacterial ComF proteins and includes a phosphoribosyltransferase-like module. We show that RqlH is a DNA-dependent ATPase/dATPase that translocates 3'-5' on single-stranded DNA and has 3'-5' helicase activity. These functions inhere to RqlH-(1-505), a monomeric motor unit comprising the ATPase, linker and zinc-binding domains. RqlH homologs are distributed widely among bacterial taxa. The mycobacteria that encode RqlH lack a classical RecQ, though many other Actinobacteria have both RqlH and RecQ. Whereas E. coli K12 encodes RecQ but lacks a homolog of RqlH, other strains of E. coli have both RqlH and RecQ.
International Nuclear Information System (INIS)
Zhang, Yuan; Palla, Mirkó; Liao, Jung-Chi; Sun, Andrew
2013-01-01
DEAD-box RNA helicases are ATP-dependent proteins implicated in nearly all aspects of RNA metabolism. The yeast DEAD-box helicase Mss116 is unique in its functions of splicing group I and group II introns and activating mRNA translation, but the structural understanding of why it performs these unique functions remains unclear. Here we used sequence analysis and molecular dynamics simulation to identify residues in the flexible linker specific for yeast Mss116, potentially associated with its unique functions. We first identified residues that are 100% conserved in Mss116 of different species of the Saccharomycetaceae family. The amino acids of these conserved residues were then compared with the amino acids of the corresponding residue positions of other RNA helicases to identify residues that have distinct amino acids from other DEAD-box proteins. Four residues in the flexible linker, i.e. N334, E335, P336 and H339, are conserved and Mss116-specific. Molecular dynamics simulation was conducted for the wild-type Mss116 structure and mutant models to examine mutational effects of the linker on the conformational equilibrium. Relatively short MD simulation runs (within 20 ns) were enough for us to observe mutational effects, suggesting serious structural perturbations by these mutations. The mutation of E335 depletes the interactions between E335 and K95 in domain 1. The interactions between N334/P336 and N496/I497 of domain 2 are also abolished by mutation. Our results suggest that tight interactions between the Mss116-specific flexible linker and the two RecA-like domains may be mechanically required to crimp RNA for the unique RNA processes of yeast Mss116. (paper)
Zhang, Yuan; Palla, Mirkó; Sun, Andrew; Liao, Jung-Chi
2013-09-01
DEAD-box RNA helicases are ATP-dependent proteins implicated in nearly all aspects of RNA metabolism. The yeast DEAD-box helicase Mss116 is unique in its functions of splicing group I and group II introns and activating mRNA translation, but the structural understanding of why it performs these unique functions remains unclear. Here we used sequence analysis and molecular dynamics simulation to identify residues in the flexible linker specific for yeast Mss116, potentially associated with its unique functions. We first identified residues that are 100% conserved in Mss116 of different species of the Saccharomycetaceae family. The amino acids of these conserved residues were then compared with the amino acids of the corresponding residue positions of other RNA helicases to identify residues that have distinct amino acids from other DEAD-box proteins. Four residues in the flexible linker, i.e. N334, E335, P336 and H339, are conserved and Mss116-specific. Molecular dynamics simulation was conducted for the wild-type Mss116 structure and mutant models to examine mutational effects of the linker on the conformational equilibrium. Relatively short MD simulation runs (within 20 ns) were enough for us to observe mutational effects, suggesting serious structural perturbations by these mutations. The mutation of E335 depletes the interactions between E335 and K95 in domain 1. The interactions between N334/P336 and N496/I497 of domain 2 are also abolished by mutation. Our results suggest that tight interactions between the Mss116-specific flexible linker and the two RecA-like domains may be mechanically required to crimp RNA for the unique RNA processes of yeast Mss116.
Velocity and processivity of helicase unwinding of double-stranded nucleic acids
International Nuclear Information System (INIS)
Betterton, M D; Juelicher, F
2005-01-01
Helicases are molecular motors which unwind double-stranded nucleic acids (dsNA) in cells. Many helicases move with directional bias on single-stranded (ss) nucleic acids, and couple their directional translocation to strand separation. A model of the coupling between translocation and unwinding uses an interaction potential to represent passive and active helicase mechanisms. A passive helicase must wait for thermal fluctuations to open dsNA base pairs before it can advance and inhibit NA closing. An active helicase directly destabilizes dsNA base pairs, accelerating the opening rate. Here we extend this model to include helicase unbinding from the nucleic-acid strand. The helicase processivity depends on the form of the interaction potential. A passive helicase has a mean attachment time which does not change between ss translocation and ds unwinding, while an active helicase in general shows a decrease in attachment time during unwinding relative to ss translocation. In addition, we describe how helicase unwinding velocity and processivity vary if the base-pair binding free energy is changed
Navy DD(X) and CG(X) Program: Background and Issues for Congress
National Research Council Canada - National Science Library
O'Rourke, Ronald
2005-01-01
The FY2006-FY2011 Future Years Defense Plan (FYDP) reduces planned DD(X) destroyer procurement to one ship per year in FY2007-FY2011 and accelerates procurement of the first CG(X) cruiser to FY2011...
Plötner, Björn; Nurmi, Markus; Fischer, Axel; Watanabe, Mutsumi; Schneeberger, Korbinian; Holm, Svante; Vaid, Neha; Schöttler, Mark Aurel; Walther, Dirk; Hoefgen, Rainer; Weigel, Detlef; Laitinen, Roosa A E
2017-07-01
Hybrids often differ in fitness from their parents. They may be superior, translating into hybrid vigour or heterosis, but they may also be markedly inferior, because of hybrid weakness or incompatibility. The underlying genetic causes for the latter can often be traced back to genes that evolve rapidly because of sexual or host-pathogen conflicts. Hybrid weakness may manifest itself only in later generations, in a phenomenon called hybrid breakdown. We have characterized a case of hybrid breakdown among two Arabidopsis thaliana accessions, Shahdara (Sha, Tajikistan) and Lövvik-5 (Lov-5, Northern Sweden). In addition to chlorosis, a fraction of the F 2 plants have defects in leaf and embryo development, and reduced photosynthetic efficiency. Hybrid chlorosis is due to two major-effect loci, of which one, originating from Lov-5, appears to encode an RNA helicase (AtRH18). To examine the role of the chlorosis allele in the Lövvik area, in addition to eight accessions collected in 2009, we collected another 240 accessions from 15 collections sites, including Lövvik, from Northern Sweden in 2015. Genotyping revealed that Lövvik collection site is separated from the rest. Crosses between 109 accessions from this area and Sha revealed 85 cases of hybrid chlorosis, indicating that the chlorosis-causing allele is common in this area. These results suggest that hybrid breakdown alleles not only occur at rapidly evolving loci, but also at genes that code for conserved processes. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
Czech Academy of Sciences Publication Activity Database
Paliwal, S.; Kanagaraj, R.; Sturzenegger, A.; Burdová, Kamila; Janščák, Pavel
2014-01-01
Roč. 42, č. 4 (2014), s. 2380-2390 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565; GA ČR GAP305/10/0281 Grant - others:Swiss National Science Foundation(CH) 31003A-129747; Swiss National Science Foundation(CH) 31003A_146206 Institutional support: RVO:68378050 Keywords : Human RECQ5 helicase * DNA double-strand breaks * mitotic homologous recombination Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014
Schertzer, Michael; Jouravleva, Karina; Perderiset, Mylene; Dingli, Florent; Loew, Damarys; Le Guen, Tangui; Bardoni, Barbara; de Villartay, Jean-Pierre; Revy, Patrick; Londoño-Vallejo, Arturo
2015-02-18
Hoyeraal-Hreidarsson syndrome (HHS) is a severe form of Dyskeratosis congenita characterized by developmental defects, bone marrow failure and immunodeficiency and has been associated with telomere dysfunction. Recently, mutations in Regulator of Telomere ELongation helicase 1 (RTEL1), a helicase first identified in Mus musculus as being responsible for the maintenance of long telomeres, have been identified in several HHS patients. Here we show that RTEL1 is required for the export and the correct cytoplasmic trafficking of the small nuclear (sn) RNA pre-U2, a component of the major spliceosome complex. RTEL1-HHS cells show abnormal subcellular partitioning of pre-U2, defects in the recycling of ribonucleotide proteins (RNP) in the cytoplasm and splicing defects. While most of these phenotypes can be suppressed by re-expressing the wild-type protein in RTEL1-HHS cells, expression of RTEL1 mutated variants in immortalized cells provokes cytoplasmic mislocalizations of pre-U2 and other RNP components, as well as splicing defects, thus phenocopying RTEL1-HHS cellular defects. Strikingly, expression of a cytoplasmic form of RTEL1 is sufficient to correct RNP mislocalizations both in RTEL1-HHS cells and in cells expressing nuclear mutated forms of RTEL1. This work unravels completely unanticipated roles for RTEL1 in RNP trafficking and strongly suggests that defects in RNP biogenesis pathways contribute to the pathology of HHS. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Membrane recognition and dynamics of the RNA degradosome
Strahl, H.; Turlan, C.; Khalid, S.; Bond, P.J.; Kebalo, J.M.; Peyron, P.; Poljak, L.; Bouvier, M.; Hamoen, L.; Luisi, B.F.; Carpousis, A.J.
2015-01-01
RNase E, which is the central component of the multienzyme RNA degradosome, serves as a scaffold for interaction with other enzymes involved in mRNA degradation including the DEAD-box RNA helicase RhlB. Epifluorescence microscopy under live cell conditions shows that RNase E and RhlB are membrane
Prasanth, K Reddisiva; Barajas, Daniel; Nagy, Peter D
2015-03-01
RNA viruses co-opt a large number of cellular proteins that affect virus replication and, in some cases, viral genetic recombination. RNA recombination helps viruses in an evolutionary arms race with the host's antiviral responses and adaptation of viruses to new hosts. Tombusviruses and a yeast model host are used to identify cellular factors affecting RNA virus replication and RNA recombination. In this study, we have examined the role of the conserved Rpn11p metalloprotease subunit of the proteasome, which couples deubiquitination and degradation of proteasome substrates, in tombusvirus replication and recombination in Saccharomyces cerevisiae and plants. Depletion or mutations of Rpn11p lead to the rapid formation of viral RNA recombinants in combination with reduced levels of viral RNA replication in yeast or in vitro based on cell extracts. Rpn11p interacts with the viral replication proteins and is recruited to the viral replicase complex (VRC). Analysis of the multifunctional Rpn11p has revealed that the primary role of Rpn11p is to act as a "matchmaker" that brings the viral p92(pol) replication protein and the DDX3-like Ded1p/RH20 DEAD box helicases into VRCs. Overexpression of Ded1p can complement the defect observed in rpn11 mutant yeast by reducing TBSV recombination. This suggests that Rpn11p can suppress tombusvirus recombination via facilitating the recruitment of the cellular Ded1p helicase, which is a strong suppressor of viral recombination, into VRCs. Overall, this work demonstrates that the co-opted Rpn11p, which is involved in the assembly of the functional proteasome, also functions in the proper assembly of the tombusvirus VRCs. RNA viruses evolve rapidly due to genetic changes based on mutations and RNA recombination. Viral genetic recombination helps viruses in an evolutionary arms race with the host's antiviral responses and facilitates adaptation of viruses to new hosts. Cellular factors affect viral RNA recombination, although the role
Ledoux, Sarah; Guthrie, Christine
2016-06-03
Brr2 is an RNA-dependent ATPase required to unwind the U4/U6 snRNA duplex during spliceosome assembly. Mutations within the ratchet helix of the Brr2 RNA binding channel result in a form of degenerative human blindness known as retinitis pigmentosa (RP). The biochemical consequences of these mutations on Brr2's RNA binding, helicase, and ATPase activity have not yet been characterized. Therefore, we identified the largest construct of Brr2 that is soluble in vitro, which truncates the first 247 amino acids of the N terminus (Δ247-Brr2), to characterize the effects of the RP mutations on Brr2 activity. The Δ247-Brr2 RP mutants exhibit a gradient of severity of weakened RNA binding, reduced helicase activity, and reduced ATPase activity compared with wild type Δ247-Brr2. The globular C-terminal Jab1/Mpn1-like domain of Prp8 increases the ability of Δ247-Brr2 to bind the U4/U6 snRNA duplex at high pH and increases Δ247-Brr2's RNA-dependent ATPase activity and the extent of RNA unwinding. However, this domain of Prp8 does not differentially affect the Δ247-Brr2 RP mutants compared with the wild type Δ247-Brr2. When stimulated by Prp8, wild type Δ247-Brr2 is able to unwind long stable duplexes in vitro, and even the RP mutants capable of binding RNA with tight affinity are incapable of fully unwinding short duplex RNAs. Our data suggest that the RP mutations within the ratchet helix impair Brr2 translocation through RNA helices. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
RNases and Helicases in Gram-Positive Bacteria.
Durand, Sylvain; Condon, Ciaran
2018-04-01
RNases are key enzymes involved in RNA maturation and degradation. Although they play a crucial role in all domains of life, bacteria, archaea, and eukaryotes have evolved with their own sets of RNases and proteins modulating their activities. In bacteria, these enzymes allow modulation of gene expression to adapt to rapidly changing environments. Today, >20 RNases have been identified in both Escherichia coli and Bacillus subtilis , the paradigms of the Gram-negative and Gram-positive bacteria, respectively. However, only a handful of these enzymes are common to these two organisms and some of them are essential to only one. Moreover, although sets of RNases can be very similar in closely related bacteria such as the Firmicutes Staphylococcus aureus and B. subtilis , the relative importance of individual enzymes in posttranscriptional regulation in these organisms varies. In this review, we detail the role of the main RNases involved in RNA maturation and degradation in Gram-positive bacteria, with an emphasis on the roles of RNase J1, RNase III, and RNase Y. We also discuss how other proteins such as helicases can modulate the RNA-degradation activities of these enzymes.
International Nuclear Information System (INIS)
Tuteja, N.
2005-01-01
Soil salinity is an increasing threat for agriculture and is a major factor in reducing plant productivity; therefore, it is necessary to obtain salinity-tolerant varieties. A typical characteristic of soil salinity is the induction of multiple stress- inducible genes. Some of the genes encoding osmolytes, ion channels or enzymes are able to confer salinity-tolerant phenotypes when transferred to sensitive plants. As salinity stress affects the cellular gene-expression machinery, it is evident that molecules involved in nucleic acid processing including helicases, are likely to be affected as well. DNA helicases unwind duplex DNA and are involved in replication, repair, recombination and transcription while RNA helicases unfold the secondary structures in RNA and are involved in transcription, ribosome biogenesis and translation initiation. We have earlier reported the isolation of a pea DNA helicase 45 (PDH45) that exhibits striking homology with eIF-4A (Plant J. 24:219-230,2000). Here we report that PDH45 mRNA is induced in pea seedlings in response to high salt and its over- expression driven by a constitutive CAMV-355-promoter in tobacco plants confers salinity tolerance, thus suggesting a new pathway for manipulating stress tolerance in crop plants. The T0 transgenic plants showed high-levels of PDH45 protein in normal and stress conditions, as compared to wild type (WT) plants. The T0 transgenics also showed tolerance to high salinity as tested by a leaf disc senescence assay. The T1 transgenics were able to grow to maturity and set normal viable seeds under continuous salinity stress, without any reduction in plant yield, in terms of seed weight. Measurement of Na/sup +/ ions in different parts of the plant showed higher accumulation in the old leaves and negligible in seeds of T1 transgenic lines as compared with the WT plants. The possible mechanism of salinity tolerance will be discussed. Over-expression of PDH45 provides a possible example of the
Energy Technology Data Exchange (ETDEWEB)
Kanno, Yuichiro, E-mail: ykanno@phar.toho-u.ac.jp [Faculty of Pharmaceutical Sciences, Toho University, Chiba (Japan); Serikawa, Takafumi; Inajima, Jun; Inouye, Yoshio [Faculty of Pharmaceutical Sciences, Toho University, Chiba (Japan)
2012-09-14
Highlights: Black-Right-Pointing-Pointer DP97 interacts with nuclear receptor CAR. Black-Right-Pointing-Pointer DP97 enhances CAR-mediated transcriptional activation. Black-Right-Pointing-Pointer DP97 synergistically enhances transactivity of CAR by the co-expression of SRC-1 or PGC1{alpha}. Black-Right-Pointing-Pointer DP97 is a gene-selective co-activator for hCAR. -- Abstract: The constitutive androstane receptor (CAR) plays a key role in the expression of xenobiotic/steroid and drug metabolizing enzymes and their transporters. In this study, we demonstrated that DP97, a member of the DEAD box DNA/RNA helicase protein family, is a novel CAR-interacting protein. Using HepG2 cells expressing human CAR in the presence of tetracycline, we showed that knockdown of DP97 with small interfering RNAs suppressed tetracycline-inducible mRNA expression of CYP2B6 and UGT1A1 but not CYP3A4. Thus, DP97 was found to be a gene (or promoter)-selective co-activator for hCAR. DP97-mediated CAR transactivation was synergistically enhanced by the co-expression of SRC-1 or PGC1{alpha}, therefore it might act as mediator between hCAR and appropriate co-activators.
International Nuclear Information System (INIS)
Tani, Hidenori; Akimitsu, Nobuyoshi; Fujita, Osamu; Matsuda, Yasuyoshi; Miyata, Ryo; Tsuneda, Satoshi; Igarashi, Masayuki; Sekiguchi, Yuji; Noda, Naohiro
2009-01-01
We have developed a novel high-throughput screening assay of hepatitis C virus (HCV) nonstructural protein 3 (NS3) helicase inhibitors using the fluorescence-quenching phenomenon via photoinduced electron transfer between fluorescent dyes and guanine bases. We prepared double-stranded DNA (dsDNA) with a 5'-fluorescent-dye (BODIPY FL)-labeled strand hybridized with a complementary strand, the 3'-end of which has guanine bases. When dsDNA is unwound by helicase, the dye emits fluorescence owing to its release from the guanine bases. Our results demonstrate that this assay is suitable for quantitative assay of HCV NS3 helicase activity and useful for high-throughput screening for inhibitors. Furthermore, we applied this assay to the screening for NS3 helicase inhibitors from cell extracts of microorganisms, and found several cell extracts containing potential inhibitors.
Physical and functional interactions of Caenorhabditis elegans WRN-1 helicase with RPA-1.
Hyun, Moonjung; Park, Sojin; Kim, Eunsun; Kim, Do-Hyung; Lee, Se-Jin; Koo, Hyeon-Sook; Seo, Yeon-Soo; Ahn, Byungchan
2012-02-21
The Caenorhabditis elegans Werner syndrome protein, WRN-1, a member of the RecQ helicase family, has a 3'-5' DNA helicase activity. Worms with defective wrn-1 exhibit premature aging phenotypes and an increased level of genome instability. In response to DNA damage, WRN-1 participates in the initial stages of checkpoint activation in concert with C. elegans replication protein A (RPA-1). WRN-1 helicase is stimulated by RPA-1 on long DNA duplex substrates. However, the mechanism by which RPA-1 stimulates DNA unwinding and the function of the WRN-1-RPA-1 interaction are not clearly understood. We have found that WRN-1 physically interacts with two RPA-1 subunits, CeRPA73 and CeRPA32; however, full-length WRN-1 helicase activity is stimulated by only the CeRPA73 subunit, while the WRN-1(162-1056) fragment that harbors the helicase activity requires both the CeRPA73 and CeRPA32 subunits for the stimulation. We also found that the CeRPA73(1-464) fragment can stimulate WRN-1 helicase activity and that residues 335-464 of CeRPA73 are important for physical interaction with WRN-1. Because CeRPA73 and the CeRPA73(1-464) fragment are able to bind single-stranded DNA (ssDNA), the stimulation of WRN-1 helicase by RPA-1 is most likely due to the ssDNA binding activity of CeRPA73 and the direct interaction of WRN-1 and CeRPA73.
Cas3 is a single-stranded DNA nuclease and ATP-dependent helicase in the CRISPR/Cas immune system.
Sinkunas, Tomas; Gasiunas, Giedrius; Fremaux, Christophe; Barrangou, Rodolphe; Horvath, Philippe; Siksnys, Virginijus
2011-04-06
Clustered regularly interspaced short palindromic repeat (CRISPR) is a recently discovered adaptive prokaryotic immune system that provides acquired immunity against foreign nucleic acids by utilizing small guide crRNAs (CRISPR RNAs) to interfere with invading viruses and plasmids. In Escherichia coli, Cas3 is essential for crRNA-guided interference with virus proliferation. Cas3 contains N-terminal HD phosphohydrolase and C-terminal Superfamily 2 (SF2) helicase domains. Here, we provide the first report of the cloning, expression, purification and in vitro functional analysis of the Cas3 protein of the Streptococcus thermophilus CRISPR4 (Ecoli subtype) system. Cas3 possesses a single-stranded DNA (ssDNA)-stimulated ATPase activity, which is coupled to unwinding of DNA/DNA and RNA/DNA duplexes. Cas3 also shows ATP-independent nuclease activity located in the HD domain with a preference for ssDNA substrates. To dissect the contribution of individual domains, Cas3 separation-of-function mutants (ATPase(+)/nuclease(-) and ATPase(-)/nuclease(+)) were obtained by site-directed mutagenesis. We propose that the Cas3 ATPase/helicase domain acts as a motor protein, which assists delivery of the nuclease activity to Cascade-crRNA complex targeting foreign DNA.
Jefferson, Matthew; Donaszi-Ivanov, Andras; Pollen, Sean; Dalmay, Tamas; Saalbach, Gerhard; Powell, Penny P
2014-09-01
The viral N-terminal protease N(pro) of pestiviruses counteracts cellular antiviral defenses through inhibition of IRF3. Here we used mass spectrometry to identify a new role for N(pro) through its interaction with over 55 associated proteins, mainly ribosomal proteins and ribonucleoproteins, including RNA helicase A (DHX9), Y-box binding protein (YBX1), DDX3, DDX5, eIF3, IGF2BP1, multiple myeloma tumor protein 2, interleukin enhancer binding factor 3 (IEBP3), guanine nucleotide binding protein 3, and polyadenylate-binding protein 1 (PABP-1). These are components of the translation machinery, ribonucleoprotein particles (RNPs), and stress granules. Significantly, we found that stress granule formation was inhibited in MDBK cells infected with a noncytopathic bovine viral diarrhea virus (BVDV) strain, Kyle. However, ribonucleoproteins binding to N(pro) did not inhibit these proteins from aggregating into stress granules. N(pro) interacted with YBX1 though its TRASH domain, since the mutant C112R protein with an inactive TRASH domain no longer redistributed to stress granules. Interestingly, RNA helicase A and La autoantigen relocated from a nuclear location to form cytoplasmic granules with N(pro). To address a proviral role for N(pro) in RNP granules, we investigated whether N(pro) affected RNA interference (RNAi), since interacting proteins are involved in RISC function during RNA silencing. Using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) silencing with small interfering RNAs (siRNAs) followed by Northern blotting of GAPDH, expression of N(pro) had no effect on RNAi silencing activity, contrasting with other viral suppressors of interferon. We propose that N(pro) is involved with virus RNA translation in the cytoplasm for virus particle production, and when translation is inhibited following stress, it redistributes to the replication complex. Although the pestivirus N-terminal protease, N(pro), has been shown to have an important role in degrading IRF3 to
Hammond, Thomas M.; Xiao, Hua; Boone, Erin C.; Perdue, Tony D.; Pukkila, Patricia J.; Shiu, Patrick K. T.
2011-01-01
In Neurospora crassa, genes lacking a pairing partner during meiosis are suppressed by a process known as meiotic silencing by unpaired DNA (MSUD). To identify novel MSUD components, we have developed a high-throughput reverse-genetic screen for use with the N. crassa knockout library. Here we describe the screening method and the characterization of a gene (sad-3) subsequently discovered. SAD-3 is a putative helicase required for MSUD and sexual spore production. It exists in a complex with other known MSUD proteins in the perinuclear region, a center for meiotic silencing activity. Orthologs of SAD-3 include Schizosaccharomyces pombe Hrr1, a helicase required for RNAi-induced heterochromatin formation. Both SAD-3 and Hrr1 interact with an RNA-directed RNA polymerase and an Argonaute, suggesting that certain aspects of silencing complex formation may be conserved between the two fungal species. PMID:22384347
Lifescience Database Archive (English)
Full Text Available 1 [HSA:1663] [KO:K11273] ... Fanconi anemia and Roberts syndrome are described i...ion stress. It is caused by defective DDX11/ChlR1, a XPD helicase family member. In Warsaw breakage syndrome, features of Fanconi ane...mia (chromosomal breakage) and Roberts syndrome (sister
Schertzer , Michael; Jouravleva , Karina; Perderiset , Mylène; Dingli , Florent; Loew , Damarys; Le Guen , Tangui; Bardoni , Barbara; De Villartay , Jean-Pierre; Revy , Patrick; Londono-Vallejo , Arturo
2015-01-01
International audience; Hoyeraal-Hreidarsson syndrome (HHS) is a severe form of Dyskeratosis congenita characterized by developmental defects, bone marrow failure and im-munodeficiency and has been associated with telom-ere dysfunction. Recently, mutations in Regulator of Telomere ELongation helicase 1 (RTEL1), a helicase first identified in Mus musculus as being responsible for the maintenance of long telomeres, have been identified in several HHS patients. Here we show that RTEL1 is require...
Molecular Dynamics of the ZIKA Virus NS3 Helicase
Raubenolt, Bryan; Rick, Steven; The Rick Group Team
The recent outbreaks of the ZIKA virus (ZIKV) and its connection to microcephaly in newborns has raised its awareness as a global threat and many scientific research efforts are currently underway in attempt to create a vaccine. Molecular Dynamics is a powerful method of investigating the physical behavior of protein complexes. ZIKV is comprised of 3 structural and 7 nonstructural proteins. The NS3 helicase protein appears to play a significant role in the replication complex and its inhibition could be a crucial source of antiviral drug design. This research primarily focuses on studying the structural dynamics, over the course of few hundred nanoseconds, of NS3 helicase in the free state, as well as in complex form with human ssRNA, ATP, and an analogue of GTP. RMSD and RMSF plots of each simulation will provide details on the forces involved in the overall stability of the active and inactive states. Furthermore, free energy calculations on a per residue level will reveal the most interactive residues between states and ultimately the primary driving force behind these interactions. Together these analyses will provide highly relevant information on the binding surface chemistry and thus serve as the basis for potential drug design.
Novel benzoxazole inhibitor of dengue virus replication that targets the NS3 helicase.
Byrd, Chelsea M; Grosenbach, Douglas W; Berhanu, Aklile; Dai, Dongcheng; Jones, Kevin F; Cardwell, Kara B; Schneider, Christine; Yang, Guang; Tyavanagimatt, Shanthakumar; Harver, Chris; Wineinger, Kristin A; Page, Jessica; Stavale, Eric; Stone, Melialani A; Fuller, Kathleen P; Lovejoy, Candace; Leeds, Janet M; Hruby, Dennis E; Jordan, Robert
2013-04-01
Dengue virus (DENV) is the predominant mosquito-borne viral pathogen that infects humans with an estimated 50 to 100 million infections per year worldwide. Over the past 50 years, the incidence of dengue disease has increased dramatically and the virus is now endemic in more than 100 countries. Moreover, multiple serotypes of DENV are now found in the same geographic region, increasing the likelihood of more severe forms of disease. Despite extensive research, there are still no approved vaccines or therapeutics commercially available to treat DENV infection. Here we report the results of a high-throughput screen of a chemical compound library using a whole-virus assay that identified a novel small-molecule inhibitor of DENV, ST-610, that potently and selectively inhibits all four serotypes of DENV replication in vitro. Sequence analysis of drug-resistant virus isolates has identified a single point mutation, A263T, in the NS3 helicase domain that confers resistance to this compound. ST-610 inhibits DENV NS3 helicase RNA unwinding activity in a molecular-beacon-based helicase assay but does not inhibit nucleoside triphosphatase activity based on a malachite green ATPase assay. ST-610 is nonmutagenic, is well tolerated (nontoxic) in mice, and has shown efficacy in a sublethal murine model of DENV infection with the ability to significantly reduce viremia and viral load compared to vehicle controls.
DEFF Research Database (Denmark)
Di Marco, Stefano; Hasanova, Zdenka; Kanagaraj, Radhakrishnan
2017-01-01
The MUS81-EME1 endonuclease cleaves late replication intermediates at common fragile sites (CFSs) during early mitosis to trigger DNA-repair synthesis that ensures faithful chromosome segregation. Here, we show that these DNA transactions are promoted by RECQ5 DNA helicase in a manner dependent...... on its Ser727 phosphorylation by CDK1. Upon replication stress, RECQ5 associates with CFSs in early mitosis through its physical interaction with MUS81 and promotes MUS81-dependent mitotic DNA synthesis. RECQ5 depletion or mutational inactivation of its ATP-binding site, RAD51-interacting domain...
Yakovleva, Lyudmila; Shuman, Stewart
2012-01-01
Bacterial DNA helicases are nucleic acid-dependent NTPases that play important roles in DNA replication, recombination and repair. We are interested in the DNA helicases of Mycobacteria, a genus of the phylum Actinobacteria, which includes the human pathogen Mycobacterium tuberculosis and its avirulent relative Mycobacterium smegmatis. Here, we identify and characterize M. smegmatis SftH, a superfamily II helicase with a distinctive domain structure, comprising an N-terminal NTPase domain and...
Le Guen, Tangui; Jullien, Laurent; Schertzer, Mike; Lefebvre, Axelle; Kermasson, Laetitia; de Villartay, Jean-Pierre; Londoño-Vallejo, Arturo; Revy, Patrick
2013-12-01
RTEL1 (regulator of telomere length helicase 1) is a DNA helicase that has been identified more than 10 years ago. Many works since, mainly in the nematode Caenorhabditis elegans and the mouse, have highlighted its role in chromosomal stability, maintenance of telomere length, and DNA repair. Recently, four laboratories have characterized RTEL1 mutations in patients with dyskeratosis congenita (DC) and Hoyeraal-Hreidarsson (HH) syndrome, a rare and severe variant of DC. We here summarize the current knowledge on RTEL1 and discuss the possible other functions that RTEL1 could play. © 2013 médecine/sciences – Inserm.
Genome-wide identification of SF1 and SF2 helicases from archaea.
Chamieh, Hala; Ibrahim, Hiba; Kozah, Juliana
2016-01-15
Archaea microorganisms have long been used as model organisms for the study of protein molecular machines. Archaeal proteins are particularly appealing to study since archaea, even though prokaryotic, possess eukaryotic-like cellular processes. Super Family I (SF1) and Super Family II (SF2) helicase families have been studied in many model organisms, little is known about their presence and distribution in archaea. We performed an exhaustive search of homologs of SF1 and SF2 helicase proteins in 95 complete archaeal genomes. In the present study, we identified the complete sets of SF1 and SF2 helicases in archaea. Comparative analysis between archaea, human and the bacteria E. coli SF1 and SF2 helicases, resulted in the identification of seven helicase families conserved among representatives of the domains of life. This analysis suggests that these helicase families are highly conserved throughout evolution. We highlight the conserved motifs of each family and characteristic domains of the detected families. Distribution of SF1/SF2 families show that Ski2-like, Lhr, Sfth and Rad3-like helicases are ubiquitous among archaeal genomes while the other families are specific to certain archaeal groups. We also report the presence of a novel SF2 helicase specific to archaea domain named Archaea Specific Helicase (ASH). Phylogenetic analysis indicated that ASH has evolved in Euryarchaeota and is evolutionary related to the Ski2-like family with specific characteristic domains. Our study provides the first exhaustive analysis of SF1 and SF2 helicases from archaea. It expands the variety of SF1 and SF2 archaeal helicases known to exist to date and provides a starting point for new biochemical and genetic studies needed to validate their biological functions. Copyright © 2015 Elsevier B.V. All rights reserved.
Close encounters for the first time: Helicase interactions with DNA damage.
Khan, Irfan; Sommers, Joshua A; Brosh, Robert M
2015-09-01
DNA helicases are molecular motors that harness the energy of nucleoside triphosphate hydrolysis to unwinding structured DNA molecules that must be resolved during cellular replication, DNA repair, recombination, and transcription. In vivo, DNA helicases are expected to encounter a wide spectrum of covalent DNA modifications to the sugar phosphate backbone or the nitrogenous bases; these modifications can be induced by endogenous biochemical processes or exposure to environmental agents. The frequency of lesion abundance can vary depending on the lesion type. Certain adducts such as oxidative base modifications can be quite numerous, and their effects can be helix-distorting or subtle perturbations to DNA structure. Helicase encounters with specific DNA lesions and more novel forms of DNA damage will be discussed. We will also review the battery of assays that have been used to characterize helicase-catalyzed unwinding of damaged DNA substrates. Characterization of the effects of specific DNA adducts on unwinding by various DNA repair and replication helicases has proven to be insightful for understanding mechanistic and biological aspects of helicase function in cellular DNA metabolism. Published by Elsevier B.V.
Overcoming natural replication barriers: differential helicase requirements.
Anand, Ranjith P; Shah, Kartik A; Niu, Hengyao; Sung, Patrick; Mirkin, Sergei M; Freudenreich, Catherine H
2012-02-01
DNA sequences that form secondary structures or bind protein complexes are known barriers to replication and potential inducers of genome instability. In order to determine which helicases facilitate DNA replication across these barriers, we analyzed fork progression through them in wild-type and mutant yeast cells, using 2-dimensional gel-electrophoretic analysis of the replication intermediates. We show that the Srs2 protein facilitates replication of hairpin-forming CGG/CCG repeats and prevents chromosome fragility at the repeat, whereas it does not affect replication of G-quadruplex forming sequences or a protein-bound repeat. Srs2 helicase activity is required for hairpin unwinding and fork progression. Also, the PCNA binding domain of Srs2 is required for its in vivo role of replication through hairpins. In contrast, the absence of Sgs1 or Pif1 helicases did not inhibit replication through structural barriers, though Pif1 did facilitate replication of a telomeric protein barrier. Interestingly, replication through a protein barrier but not a DNA structure barrier was modulated by nucleotide pool levels, illuminating a different mechanism by which cells can regulate fork progression through protein-mediated stall sites. Our analyses reveal fundamental differences in the replication of DNA structural versus protein barriers, with Srs2 helicase activity exclusively required for fork progression through hairpin structures.
Directory of Open Access Journals (Sweden)
Macovei Anca
2012-10-01
Full Text Available Abstract Background Rice (Oryza sativa L., one of the most important food crop in the world, is considered to be a salt-sensitive crop. Excess levels of salt adversely affect all the major metabolic activities, including cell wall damage, cytoplasmic lysis and genomic stability. In order to cope with salt stress, plants have evolved high degrees of developmental plasticity, including adaptation via cascades of molecular networks and changes in gene expression profiles. Posttranscriptional regulation, through the activity of microRNAs, also plays an important role in the plant response to salinity conditions. MicroRNAs are small endogenous RNAs that modulate gene expression and are involved in the most essential physiological processes, including plant development and adaptation to environmental changes. Results In the present study, we investigated the expression profiles of osa-MIR414, osa-MIR408 and osa-MIR164e along with their targeted genes, under salinity stress conditions in wild type and transgenic rice plants ectopically expressing the PDH45 (Pea DNA Helicase gene. The present miRNAs were predicted to target the OsABP (ATP-Binding Protein, OsDSHCT (DOB1/SK12/helY-like DEAD-box Helicase and OsDBH (DEAD-Box Helicase genes, included in the DEAD-box helicase family. An in silico characterization of the proteins was performed and the miRNAs predicted targets were validated by RLM-5′RACE. The qRT-PCR analysis showed that the OsABP, OsDBH and OsDSHCT genes were up-regulated in response to 100 and 200 mM NaCl treatments. The present study also highlighted an increased accumulation of the gene transcripts in wild type plants, with the exception of the OsABP mRNA which showed the highest level (15.1-fold change compared to control in the transgenic plants treated with 200 mM NaCl. Salinity treatments also affected the expression of osa-MIR414, osa-MIR164e and osa-MIR408, found to be significantly down-regulated, although the changes in miRNA
Biswas, N; Weller, S K
2001-05-18
Herpes simplex virus type 1 encodes a heterotrimeric helicase-primase complex composed of the products of the UL5, UL52, and UL8 genes. The UL5 protein contains seven motifs found in all members of helicase Superfamily 1 (SF1), and the UL52 protein contains several conserved motifs found in primases; however, the contributions of each subunit to the biochemical activities of the subcomplex are not clear. In this work, the DNA binding properties of wild type and mutant subcomplexes were examined using single-stranded, duplex, and forked substrates. A gel mobility shift assay indicated that the UL5-UL52 subcomplex binds more efficiently to the forked substrate than to either single strand or duplex DNA. Although nucleotides are not absolutely required for DNA binding, ADP stimulated the binding of UL5-UL52 to single strand DNA whereas ATP, ADP, and adenosine 5'-O-(thiotriphosphate) stimulated the binding to a forked substrate. We have previously shown that both subunits contact single-stranded DNA in a photocross-linking assay (Biswas, N., and Weller, S. K. (1999) J. Biol. Chem. 274, 8068-8076). In this study, photocross-linking assays with forked substrates indicate that the UL5 and UL52 subunits contact the forked substrates at different positions, UL52 at the single-stranded DNA tail and UL5 near the junction between single-stranded and double-stranded DNA. Neither subunit was able to cross-link a forked substrate when 5-iododeoxyuridine was located within the duplex portion. Photocross-linking experiments with subcomplexes containing mutant versions of UL5 and wild type UL52 indicated that the integrity of the ATP binding region is important for DNA binding of both subunits. These results support our previous proposal that UL5 and UL52 exhibit a complex interdependence for DNA binding (Biswas, N., and Weller, S. K. (1999) J. Biol. Chem. 274, 8068-8076) and indicate that the UL52 subunit may play a more active role in helicase activity than had previously been
Exosome RNA Released by Hepatocytes Regulates Innate Immune Responses to Hepatitis B Virus Infection
Directory of Open Access Journals (Sweden)
Takahisa Kouwaki
2016-08-01
Full Text Available The innate immune system is essential for controlling viral infection. Hepatitis B virus (HBV persistently infects human hepatocytes and causes hepatocellular carcinoma. However, the innate immune response to HBV infection in vivo remains unclear. Using a tree shrew animal model, we showed that HBV infection induced hepatic interferon (IFN-γ expression during early infection. Our in vitro study demonstrated that hepatic NK cells produced IFN-γ in response to HBV only in the presence of hepatic F4/80+ cells. Moreover, extracellular vesicles released from HBV-infected hepatocytes contained viral nucleic acids and induced NKG2D ligand expression in macrophages by stimulating MyD88, TICAM-1, and MAVS-dependent pathways. In addition, depletion of exosomes from extracellular vesicles markedly reduced NKG2D ligand expression, suggesting the importance of exosomes for NK cell activation. In contrast, infection of hepatocytes with HBV increased immunoregulatory microRNA levels in extracellular vesicles and exosomes, which were transferred to macrophages, thereby suppressing IL-12p35 mRNA expression in macrophages to counteract the host innate immune response. IFN-γ increased the hepatic expression of DDX60 and augmented the DDX60-dependent degradation of cytoplasmic HBV RNA. Our results elucidated the crucial role of exosomes in antiviral innate immune response against HBV.
Isolation and Characterization of Pepper Genes Interacting with the CMV-P1 Helicase Domain.
Directory of Open Access Journals (Sweden)
Yoomi Choi
Full Text Available Cucumber mosaic virus (CMV is a destructive pathogen affecting Capsicum annuum (pepper production. The pepper Cmr1 gene confers resistance to most CMV strains, but is overcome by CMV-P1 in a process dependent on the CMV-P1 RNA1 helicase domain (P1 helicase. Here, to identify host factors involved in CMV-P1 infection in pepper, a yeast two-hybrid library derived from a C. annuum 'Bukang' cDNA library was screened, producing a total of 76 potential clones interacting with the P1 helicase. Beta-galactosidase filter lift assay, PCR screening, and sequencing analysis narrowed the candidates to 10 genes putatively involved in virus infection. The candidate host genes were silenced in Nicotiana benthamiana plants that were then inoculated with CMV-P1 tagged with the green fluorescent protein (GFP. Plants silenced for seven of the genes showed development comparable to N. benthamiana wild type, whereas plants silenced for the other three genes showed developmental defects including stunting and severe distortion. Silencing formate dehydrogenase and calreticulin-3 precursor led to reduced virus accumulation. Formate dehydrogenase-silenced plants showed local infection in inoculated leaves, but not in upper (systemic leaves. In the calreticulin-3 precursor-silenced plants, infection was not observed in either the inoculated or the upper leaves. Our results demonstrate that formate dehydrogenase and calreticulin-3 precursor are required for CMV-P1 infection.
The DEAD-Box Protein CYT-19 Uses Arginine Residues in Its C-Tail To Tether RNA Substrates.
Busa, Veronica F; Rector, Maxwell J; Russell, Rick
2017-07-18
DEAD-box proteins are nonprocessive RNA helicases that play diverse roles in cellular processes. The Neurospora crassa DEAD-box protein CYT-19 promotes mitochondrial group I intron splicing and functions as a general RNA chaperone. CYT-19 includes a disordered, arginine-rich "C-tail" that binds RNA, positioning the helicase core to capture and unwind nearby RNA helices. Here we probed the C-tail further by varying the number and positions of arginines within it. We found that removing sets of as few as four of the 11 arginines reduced RNA unwinding activity (k cat /K M ) to a degree equivalent to that seen upon removal of the C-tail, suggesting that a minimum or "threshold" number of arginines is required. In addition, a mutant with 16 arginines displayed RNA unwinding activity greater than that of wild-type CYT-19. The C-tail modifications impacted unwinding only of RNA helices within constructs that included an adjacent helix or structured RNA element that would allow C-tail binding, indicating that the helicase core remained active in the mutants. In addition, changes in RNA unwinding efficiency of the mutants were mirrored by changes in functional RNA affinity, as determined from the RNA concentration dependence of ATPase activity, suggesting that the C-tail functions primarily to increase RNA affinity. Interestingly, the salt concentration dependence of RNA unwinding activity is unaffected by C-tail composition, suggesting that the C-tail uses primarily hydrogen bonding, not electrostatic interactions, to bind double-stranded RNA. Our results provide insights into how an unstructured C-tail contributes to DEAD-box protein activity and suggest parallels with other families of RNA- and DNA-binding proteins.
The ribosome uses two active mechanisms to unwind messenger RNA during translation.
Qu, Xiaohui; Wen, Jin-Der; Lancaster, Laura; Noller, Harry F; Bustamante, Carlos; Tinoco, Ignacio
2011-07-06
The ribosome translates the genetic information encoded in messenger RNA into protein. Folded structures in the coding region of an mRNA represent a kinetic barrier that lowers the peptide elongation rate, as the ribosome must disrupt structures it encounters in the mRNA at its entry site to allow translocation to the next codon. Such structures are exploited by the cell to create diverse strategies for translation regulation, such as programmed frameshifting, the modulation of protein expression levels, ribosome localization and co-translational protein folding. Although strand separation activity is inherent to the ribosome, requiring no exogenous helicases, its mechanism is still unknown. Here, using a single-molecule optical tweezers assay on mRNA hairpins, we find that the translation rate of identical codons at the decoding centre is greatly influenced by the GC content of folded structures at the mRNA entry site. Furthermore, force applied to the ends of the hairpin to favour its unfolding significantly speeds translation. Quantitative analysis of the force dependence of its helicase activity reveals that the ribosome, unlike previously studied helicases, uses two distinct active mechanisms to unwind mRNA structure: it destabilizes the helical junction at the mRNA entry site by biasing its thermal fluctuations towards the open state, increasing the probability of the ribosome translocating unhindered; and it mechanically pulls apart the mRNA single strands of the closed junction during the conformational changes that accompany ribosome translocation. The second of these mechanisms ensures a minimal basal rate of translation in the cell; specialized, mechanically stable structures are required to stall the ribosome temporarily. Our results establish a quantitative mechanical basis for understanding the mechanism of regulation of the elongation rate of translation by structured mRNAs. ©2011 Macmillan Publishers Limited. All rights reserved
Cristini, Agnese; Groh, Matthias; Kristiansen, Maiken S; Gromak, Natalia
2018-05-08
R-loops comprise an RNA/DNA hybrid and displaced single-stranded DNA. They play important biological roles and are implicated in pathology. Even so, proteins recognizing these structures are largely undefined. Using affinity purification with the S9.6 antibody coupled to mass spectrometry, we defined the RNA/DNA hybrid interactome in HeLa cells. This consists of known R-loop-associated factors SRSF1, FACT, and Top1, and yet uncharacterized interactors, including helicases, RNA processing, DNA repair, and chromatin factors. We validate specific examples of these interactors and characterize their involvement in R-loop biology. A top candidate DHX9 helicase promotes R-loop suppression and transcriptional termination. DHX9 interacts with PARP1, and both proteins prevent R-loop-associated DNA damage. DHX9 and other interactome helicases are overexpressed in cancer, linking R-loop-mediated DNA damage and disease. Our RNA/DNA hybrid interactome provides a powerful resource to study R-loop biology in health and disease. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Conserved helicase domain of human RecQ4 is required for strand annealing-independent DNA unwinding
DEFF Research Database (Denmark)
Rossi, Marie L; Ghosh, Avik K; Kulikowicz, Tomasz
2010-01-01
Humans have five members of the well conserved RecQ helicase family: RecQ1, Bloom syndrome protein (BLM), Werner syndrome protein (WRN), RecQ4, and RecQ5, which are all known for their roles in maintaining genome stability. BLM, WRN, and RecQ4 are associated with premature aging and cancer...... provide the first evidence that human RecQ4's unwinding is independent of strand annealing, and that it does not require the presence of excess ssDNA. Moreover, we demonstrate that a point mutation of the conserved lysine in the Walker A motif abolished helicase activity, implying that not the N...... activities and protein partners of RecQ4 are conserved with those of the other RecQ helicases....
Cooperation of DNA-PKcs and WRN helicase in the maintenance of telomeric D-loops
DEFF Research Database (Denmark)
Kusumoto-Matsuo, Rika; Opresko, Patricia L; Ramsden, Dale
2010-01-01
Werner syndrome is an inherited human progeriod syndrome caused by mutations in the gene encoding the Werner Syndrome protein, WRN. It has both 3'-5' DNA helicase and exonuclease activities, and is suggested to have roles in many aspects of DNA metabolism, including DNA repair and telomere...... D-loop model substrate. In addition, the length of telomeric G-tails decreases in DNA-PKcs knockdown cells, and this phenotype is reversed by overexpression of WRN helicase. These results suggest that WRN and DNA-PKcs may cooperatively prevent G-tail shortening in vivo....
A Brownian motor mechanism of translocation and strand separation by hepatitis C virus helicase.
Levin, Mikhail K; Gurjar, Madhura; Patel, Smita S
2005-05-01
Helicases translocate along their nucleic acid substrates using the energy of ATP hydrolysis and by changing conformations of their nucleic acid-binding sites. Our goal is to characterize the conformational changes of hepatitis C virus (HCV) helicase at different stages of ATPase cycle and to determine how they lead to translocation. We have reported that ATP binding reduces HCV helicase affinity for nucleic acid. Now we identify the stage of the ATPase cycle responsible for translocation and unwinding. We show that a rapid directional movement occurs upon helicase binding to DNA in the absence of ATP, resulting in opening of several base pairs. We propose that HCV helicase translocates as a Brownian motor with a simple two-stroke cycle. The directional movement step is fueled by single-stranded DNA binding energy while ATP binding allows for a brief period of random movement that prepares the helicase for the next cycle.
Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas
2015-07-01
In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.
Nucleolin inhibits G4 oligonucleotide unwinding by Werner helicase.
Directory of Open Access Journals (Sweden)
Fred E Indig
Full Text Available The Werner protein (WRNp, a member of the RecQ helicase family, is strongly associated with the nucleolus, as is nucleolin (NCL, an important nucleolar constituent protein. Both WRNp and NCL respond to the effects of DNA damaging agents. Therefore, we have investigated if these nuclear proteins interact and if this interaction has a possible functional significance in DNA damage repair.Here we report that WRNp interacts with the RNA-binding protein, NCL, based on immunoprecipitation, immunofluorescent co-localization in live and fixed cells, and direct binding of purified WRNp to nucleolin. We also map the binding region to the C-terminal domains of both proteins. Furthermore, treatment of U2OS cells with 15 µM of the Topoisomerase I inhibitor, camptothecin, causes the dissociation of the nucleolin-Werner complex in the nucleolus, followed by partial re-association in the nucleoplasm. Other DNA damaging agents, such as hydroxyurea, Mitomycin C, and aphidicolin do not have these effects. Nucleolin or its C-terminal fragment affected the helicase, but not the exonuclease activity of WRNp, by inhibiting WRN unwinding of G4 tetraplex DNA structures, as seen in activity assays and electrophoretic mobility shift assays (EMSA.These data suggest that nucleolin may regulate G4 DNA unwinding by WRNp, possibly in response to certain DNA damaging agents. We postulate that the NCL-WRNp complex may contain an inactive form of WRNp, which is released from the nucleolus upon DNA damage. Then, when required, WRNp is released from inhibition and can participate in the DNA repair processes.
Staphylococcal SCCmec elements encode an active MCM-like helicase and thus may be replicative
Energy Technology Data Exchange (ETDEWEB)
Mir-Sanchis, Ignacio; Roman, Christina A.; Misiura, Agnieszka; Pigli, Ying Z.; Boyle-Vavra, Susan; Rice , Phoebe A. (UC)
2016-08-29
Methicillin-resistant Staphylococcus aureus (MRSA) is a public-health threat worldwide. Although the mobile genomic island responsible for this phenotype, staphylococcal cassette chromosome (SCC), has been thought to be nonreplicative, we predicted DNA-replication-related functions for some of the conserved proteins encoded by SCC. We show that one of these, Cch, is homologous to the self-loading initiator helicases of an unrelated family of genomic islands, that it is an active 3'-to-5' helicase and that the adjacent ORF encodes a single-stranded DNA–binding protein. Our 2.9-Å crystal structure of intact Cch shows that it forms a hexameric ring. Cch, like the archaeal and eukaryotic MCM-family replicative helicases, belongs to the pre–sensor II insert clade of AAA+ ATPases. Additionally, we found that SCC elements are part of a broader family of mobile elements, all of which encode a replication initiator upstream of their recombinases. Replication after excision would enhance the efficiency of horizontal gene transfer.
Dna2 nuclease-helicase structure, mechanism and regulation by Rpa.
Zhou, Chun; Pourmal, Sergei; Pavletich, Nikola P
2015-11-02
The Dna2 nuclease-helicase maintains genomic integrity by processing DNA double-strand breaks, Okazaki fragments and stalled replication forks. Dna2 requires ssDNA ends, and is dependent on the ssDNA-binding protein Rpa, which controls cleavage polarity. Here we present the 2.3 Å structure of intact mouse Dna2 bound to a 15-nucleotide ssDNA. The nuclease active site is embedded in a long, narrow tunnel through which the DNA has to thread. The helicase domain is required for DNA binding but not threading. We also present the structure of a flexibly-tethered Dna2-Rpa interaction that recruits Dna2 to Rpa-coated DNA. We establish that a second Dna2-Rpa interaction is mutually exclusive with Rpa-DNA interactions and mediates the displacement of Rpa from ssDNA. This interaction occurs at the nuclease tunnel entrance and the 5' end of the Rpa-DNA complex. Hence, it only displaces Rpa from the 5' but not 3' end, explaining how Rpa regulates cleavage polarity.
Spliceosome SNRNP200 Promotes Viral RNA Sensing and IRF3 Activation of Antiviral Response.
Directory of Open Access Journals (Sweden)
Nicolas Tremblay
2016-07-01
Full Text Available Spliceosomal SNRNP200 is a Ski2-like RNA helicase that is associated with retinitis pigmentosa 33 (RP33. Here we found that SNRNP200 promotes viral RNA sensing and IRF3 activation through the ability of its amino-terminal Sec63 domain (Sec63-1 to bind RNA and to interact with TBK1. We show that SNRNP200 relocalizes into TBK1-containing cytoplasmic structures upon infection, in contrast to the RP33-associated S1087L mutant, which is also unable to rescue antiviral response of SNRNP200 knockdown cells. This functional rescue correlates with the Sec63-1-mediated binding of viral RNA. The hindered IFN-β production of knockdown cells was further confirmed in peripheral blood cells of RP33 patients bearing missense mutation in SNRNP200 upon infection with Sendai virus (SeV. This work identifies a novel immunoregulatory role of the spliceosomal SNRNP200 helicase as an RNA sensor and TBK1 adaptor for the activation of IRF3-mediated antiviral innate response.
Sharwood, Robert E.; Hotto, Amber M.; Bollenbach, Thomas J.; Stern, David B.
2011-01-01
Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3′-to-5′ exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNAArg, raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S–AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1. PMID:21148395
Gongadze, G M
2011-12-01
5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.
Distinct functions of human RecQ helicases during DNA replication.
Urban, Vaclav; Dobrovolna, Jana; Janscak, Pavel
2017-06-01
DNA replication is the most vulnerable process of DNA metabolism in proliferating cells and therefore it is tightly controlled and coordinated with processes that maintain genomic stability. Human RecQ helicases are among the most important factors involved in the maintenance of replication fork integrity, especially under conditions of replication stress. RecQ helicases promote recovery of replication forks being stalled due to different replication roadblocks of either exogenous or endogenous source. They prevent generation of aberrant replication fork structures and replication fork collapse, and are involved in proper checkpoint signaling. The essential role of human RecQ helicases in the genome maintenance during DNA replication is underlined by association of defects in their function with cancer predisposition. Copyright © 2016 Elsevier B.V. All rights reserved.
Pan, Ankita; Saw, Wuan Geok; Subramanian Manimekalai, Malathy Sony; Grüber, Ardina; Joon, Shin; Matsui, Tsutomu; Weiss, Thomas M; Grüber, Gerhard
2017-05-01
Dengue virus (DENV), which has four serotypes (DENV-1 to DENV-4), is the causative agent of the viral infection dengue. DENV nonstructural protein 3 (NS3) comprises a serine protease domain and an RNA helicase domain which has nucleotide triphosphatase activities that are essential for RNA replication and viral assembly. Here, solution X-ray scattering was used to provide insight into the overall structure and flexibility of the entire NS3 and its recombinant helicase and protease domains for Dengue virus serotypes 2 and 4 in solution. The DENV-2 and DENV-4 NS3 forms are elongated and flexible in solution. The importance of the linker residues in flexibility and domain-domain arrangement was shown by the compactness of the individual protease and helicase domains. Swapping of the 174 PPAVP 179 linker stretch of the related Hepatitis C virus (HCV) NS3 into DENV-2 NS3 did not alter the elongated shape of the engineered mutant. Conformational alterations owing to RNA binding are described in the protease domain, which undergoes substantial conformational alterations that are required for the optimal catalysis of bound RNA. Finally, the effects of ATPase inhibitors on the enzymatically active DENV-2 and DENV-4 NS3 and the individual helicases are presented, and insight into the allosteric effect of the inhibitor quercetin is provided.
MCM Paradox: Abundance of Eukaryotic Replicative Helicases and Genomic Integrity.
Das, Mitali; Singh, Sunita; Pradhan, Satyajit; Narayan, Gopeshwar
2014-01-01
As a crucial component of DNA replication licensing system, minichromosome maintenance (MCM) 2-7 complex acts as the eukaryotic DNA replicative helicase. The six related MCM proteins form a heterohexamer and bind with ORC, CDC6, and Cdt1 to form the prereplication complex. Although the MCMs are well known as replicative helicases, their overabundance and distribution patterns on chromatin present a paradox called the "MCM paradox." Several approaches had been taken to solve the MCM paradox and describe the purpose of excess MCMs distributed beyond the replication origins. Alternative functions of these MCMs rather than a helicase had also been proposed. This review focuses on several models and concepts generated to solve the MCM paradox coinciding with their helicase function and provides insight into the concept that excess MCMs are meant for licensing dormant origins as a backup during replication stress. Finally, we extend our view towards the effect of alteration of MCM level. Though an excess MCM constituent is needed for normal cells to withstand stress, there must be a delineation of the threshold level in normal and malignant cells. This review also outlooks the future prospects to better understand the MCM biology.
The DEAD box helicase RDE-12 promotes amplification of RNAi in cytoplasmic foci in C. elegans.
Yang, Huan; Vallandingham, Jim; Shiu, Philip; Li, Hua; Hunter, Craig P; Mak, Ho Yi
2014-04-14
RNAi is a potent mechanism for downregulating gene expression. Conserved RNAi pathway components are found in animals, plants, fungi, and other eukaryotes. In C. elegans, the RNAi response is greatly amplified by the synthesis of abundant secondary small interfering RNAs (siRNAs). Exogenous double-stranded RNA is processed by Dicer and RDE-1/Argonaute into primary siRNA that guides target mRNA recognition. The RDE-10/RDE-11 complex and the RNA-dependent RNA polymerase RRF-1 then engage the target mRNA for secondary siRNA synthesis. However, the molecular link between primary siRNA production and secondary siRNA synthesis remains largely unknown. Furthermore, it is unclear whether the subcellular sites for target mRNA recognition and degradation coincide with sites where siRNA synthesis and amplification occur. In the C. elegans germline, cytoplasmic P granules at the nuclear pores and perinuclear Mutator foci contribute to target mRNA surveillance and siRNA amplification, respectively. We report that RDE-12, a conserved phenylalanine-glycine (FG) domain-containing DEAD box helicase, localizes in P granules and cytoplasmic foci that are enriched in RSD-6 but are excluded from the Mutator foci. Our results suggest that RDE-12 promotes secondary siRNA synthesis by orchestrating the recruitment of RDE-10 and RRF-1 to primary siRNA-targeted mRNA in distinct cytoplasmic compartments. Copyright © 2014 Elsevier Ltd. All rights reserved.
Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav
2002-12-01
The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.
DDX11L: a novel transcript family emerging from human subtelomeric regions
Directory of Open Access Journals (Sweden)
D'Urso Michele
2009-05-01
Full Text Available Abstract Background The subtelomeric regions of human chromosomes exhibit an extraordinary plasticity. To date, due to the high GC content and to the presence of telomeric repeats, the subtelomeric sequences are underrepresented in the genomic libraries and consequently their sequences are incomplete in the finished human genome sequence, and still much remains to be learned about subtelomere organization, evolution and function. Indeed, only in recent years, several studies have disclosed, within human subtelomeres, novel gene family members. Results During a project aimed to analyze genes located in the telomeric region of the long arm of the human X chromosome, we have identified a novel transcript family, DDX11L, members of which map to 1pter, 2q13/14.1, 2qter, 3qter, 6pter, 9pter/9qter, 11pter, 12pter, 15qter, 16pter, 17pter, 19pter, 20pter/20qter, Xpter/Xqter and Yqter. Furthermore, we partially sequenced the underrepresented subtelomeres of human chromosomes showing a common evolutionary origin. Conclusion Our data indicate that an ancestral gene, originated as a rearranged portion of the primate DDX11 gene, and propagated along many subtelomeric locations, is emerging within subtelomeres of human chromosomes, defining a novel gene family. These findings support the possibility that the high plasticity of these regions, sites of DNA exchange among different chromosomes, could trigger the emergence of new genes.
Hsu, Yi-Feng; Chen, Yun-Chu; Hsiao, Yu-Chun; Wang, Bing-Jyun; Lin, Shih-Yun; Cheng, Wan-Hsing; Jauh, Guang-Yuh; Harada, John J; Wang, Co-Shine
2014-01-01
The Arabidopsis thaliana T-DNA insertion mutant rh57-1 exhibited hypersensitivity to glucose (Glc) and abscisic acid (ABA). The other two rh57 mutants also showed Glc hypersensitivity similar to rh57-1, strongly suggesting that the Glc-hypersensitive feature of these mutants results from mutation of AtRH57. rh57-1 and rh57-3 displayed severely impaired seedling growth when grown in Glc concentrations higher than 3%. The gene, AtRH57 (At3g09720), was expressed in all Arabidopsis organs and its transcript was significantly induced by ABA, high Glc and salt. The new AtRH57 belongs to class II DEAD-box RNA helicase gene family. Transient expression of AtRH57-EGFP (enhanced green fluorescent protein) in onion cells indicated that AtRH57 was localized in the nucleus and nucleolus. Purified AtRH57-His protein was shown to unwind double-stranded RNA independent of ATP in vitro. The ABA biosynthesis inhibitor fluridone profoundly redeemed seedling growth arrest mediated by sugar. rh57-1 showed increased ABA levels when exposed to high Glc. Quantitative real time polymerase chain reaction analysis showed that AtRH57 acts in a signaling network downstream of HXK1. A feedback inhibition of ABA accumulation mediated by AtRH57 exists within the sugar-mediated ABA signaling. AtRH57 mutation and high Glc conditions additively caused a severe defect in small ribosomal subunit formation. The accumulation of abnormal pre-rRNA and resistance to protein synthesis-related antibiotics were observed in rh57 mutants and in the wild-type Col-0 under high Glc conditions. These results suggested that AtRH57 plays an important role in rRNA biogenesis in Arabidopsis and participates in response to sugar involving Glc- and ABA signaling during germination and seedling growth. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.
Cruz-Reyes, Jorge; Mooers, Blaine H.M.; Abu-Adas, Zakaria; Kumar, Vikas; Gulati, Shelly
2016-01-01
Multi-zinc finger proteins are an emerging class of cofactors in DEAH-RHA RNA helicases across highly divergent eukaryotic lineages. DEAH-RHA helicase•zinc finger cofactor partnerships predate the split of kinetoplastid protozoa, which include several human pathogens, from other eukaryotic lineages 100–400 Ma. Despite a long evolutionary history, the prototypical DEAH-RHA domains remain highly conserved. This short review focuses on a recently identified DEAH-RHA helicase•zinc finger cofactor system in kinetoplastid RNA editing, and its potential functional parallels with analogous systems in embryogenesis control in nematodes and antivirus protection in humans. PMID:27540585
Directory of Open Access Journals (Sweden)
Manjula Pandey
2014-03-01
Full Text Available By simultaneously measuring DNA synthesis and dNTP hydrolysis, we show that T7 DNA polymerase and T7 gp4 helicase move in sync during leading-strand synthesis, taking one-nucleotide steps and hydrolyzing one dNTP per base-pair unwound/copied. The cooperative catalysis enables the helicase and polymerase to move at a uniformly fast rate without guanine:cytosine (GC dependency or idling with futile NTP hydrolysis. We show that the helicase and polymerase are located close to the replication fork junction. This architecture enables the polymerase to use its strand-displacement synthesis to increase the unwinding rate, whereas the helicase aids this process by translocating along single-stranded DNA and trapping the unwound bases. Thus, in contrast to the helicase-only unwinding model, our results suggest a model in which the helicase and polymerase are moving in one-nucleotide steps, DNA synthesis drives fork unwinding, and a role of the helicase is to trap the unwound bases and prevent DNA reannealing.
RecQ helicases and cellular responses to DNA damage
International Nuclear Information System (INIS)
Wu, Leonard; Hickson, Ian D.
2002-01-01
The faithful replication of the genome is essential for the survival of all organisms. It is not surprising therefore that numerous mechanisms have evolved to ensure that duplication of the genome occurs with only minimal risk of mutation induction. One mechanism of genome destabilization is replication fork demise, which can occur when a translocating fork meets a lesion or adduct in the template. Indeed, the collapse of replication forks has been suggested to occur in every replicative cell cycle making this a potentially significant problem for all proliferating cells. The RecQ helicases, which are essential for the maintenance of genome stability, are thought to function during DNA replication. In particular, RecQ helicase mutants display replication defects and have phenotypes consistent with an inability to efficiently reinitiate replication following replication fork demise. Here, we review some current models for how replication fork repair might be effected, and discuss potential roles for RecQ helicases in this process
A role for the fission yeast Rqh1 helicase in chromosome segregation
DEFF Research Database (Denmark)
Win, Thein Z; Mankouri, Hocine W; Hickson, Ian D
2005-01-01
Schizosaccharomyces pombe Rqh1 protein is a member of the RecQ DNA helicase family. Members of this protein family are mutated in several human genome instability syndromes, including Bloom, Werner and Rothmund-Thomson syndromes. RecQ helicases participate in recombination repair of stalled...
Mutation and Methylation Analysis of the Chromodomain-Helicase-DNA Binding 5 Gene in Ovarian Cancer
Directory of Open Access Journals (Sweden)
Kylie L. Gorringe
2008-11-01
Full Text Available Chromodomain, helicase, DNA binding 5 (CHD5 is a member of a subclass of the chromatin remodeling Swi/Snf proteins and has recently been proposed as a tumor suppressor in a diverse range of human cancers. We analyzed all 41 coding exons of CHD5 for somatic mutations in 123 primary ovarian cancers as well as 60 primary breast cancers using high-resolution melt analysis. We also examined methylation of the CHD5 promoter in 48 ovarian cancer samples by methylation-specific single-stranded conformation polymorphism and bisulfite sequencing. In contrast to previous studies, no mutations were identified in the breast cancers, but somatic heterozygous missense mutations were identified in 3 of 123 ovarian cancers. We identified promoter methylation in 3 of 45 samples with normal CHD5 and in 2 of 3 samples with CHD5 mutation, suggesting these tumors may have biallelic inactivation of CHD5. Hemizygous copy number loss at CHD5 occurred in 6 of 85 samples as assessed by single nucleotide polymorphism array. Tumors with CHD5 mutation or methylation were more likely to have mutation of KRAS or BRAF (P = .04. The aggregate frequency of CHD5 haploinsufficiency or inactivation is 16.2% in ovarian cancer. Thus, CHD5 may play a role as a tumor suppressor gene in ovarian cancer; however, it is likely that there is another target of the frequent copy number neutral loss of heterozygosity observed at 1p36.
Energy Technology Data Exchange (ETDEWEB)
Tainer, John; Fan, Li; Fuss, Jill O.; Cheng, Quen J.; Arvai, Andrew S.; Hammel, Michal; Roberts, Victoria A.; Cooper, Priscilla K.; Tainer, John A.
2008-06-02
Mutations in XPD helicase, required for nucleotide excision repair (NER) as part of the transcription/repair complex TFIIH, cause three distinct phenotypes: cancer-prone xeroderma pigmentosum (XP), or aging disorders Cockayne syndrome (CS), and trichothiodystrophy (TTD). To clarify molecular differences underlying these diseases, we determined crystal structures of the XPD catalytic core from Sulfolobus acidocaldarius and measured mutant enzyme activities. Substrate-binding grooves separate adjacent Rad51/RecA-like helicase domains (HD1, HD2) and an arch formed by 4FeS and Arch domains. XP mutations map along the HD1 ATP-binding edge and HD2 DNA-binding channel and impair helicase activity essential for NER. XP/CS mutations both impair helicase activity and likely affect HD2 functional movement. TTD mutants lose or retain helicase activity but map to sites in all four domains expected to cause framework defects impacting TFIIH integrity. These results provide a foundation for understanding disease consequences of mutations in XPD and related 4Fe-4S helicases including FancJ.
Energy Technology Data Exchange (ETDEWEB)
Fan, L.; Fuss, J.O.; Cheng, Q.J.; Arvai, A.S.; Hammel, M.; Roberts, V.A.; Cooper, P.K.; Tainer, J.A.
2009-05-18
Mutations in XPD helicase, required for nucleotide excision repair (NER) as part of the transcription/repair complex TFIIH, cause three distinct phenotypes: cancer-prone xeroderma pigmentosum (XP), or aging disorders Cockayne syndrome (CS), and trichothiodystrophy (TTD). To clarify molecular differences underlying these diseases, we determined crystal structures of the XPD catalytic core from Sulfolobus acidocaldarius and measured mutant enzyme activities. Substrate-binding grooves separate adjacent Rad51/RecA-like helicase domains (HD1, HD2) and an arch formed by 4FeS and Arch domains. XP mutations map along the HD1 ATP-binding edge and HD2 DNA-binding channel and impair helicase activity essential for NER. XP/CS mutations both impair helicase activity and likely affect HD2 functional movement. TTD mutants lose or retain helicase activity but map to sites in all four domains expected to cause framework defects impacting TFIIH integrity. These results provide a foundation for understanding disease consequences of mutations in XPD and related 4Fe-4S helicases including FancJ.
Directory of Open Access Journals (Sweden)
Stefanie Gerstberger
2017-10-01
Full Text Available Non-coding RNA biogenesis in higher eukaryotes has not been fully characterized. Here, we studied the Drosophila melanogaster Rexo5 (CG8368 protein, a metazoan-specific member of the DEDDh 3′-5′ single-stranded RNA exonucleases, by genetic, biochemical, and RNA-sequencing approaches. Rexo5 is required for small nucleolar RNA (snoRNA and rRNA biogenesis and is essential in D. melanogaster. Loss-of-function mutants accumulate improperly 3′ end-trimmed 28S rRNA, 5S rRNA, and snoRNA precursors in vivo. Rexo5 is ubiquitously expressed at low levels in somatic metazoan cells but extremely elevated in male and female germ cells. Loss of Rexo5 leads to increased nucleolar size, genomic instability, defective ribosome subunit export, and larval death. Loss of germline expression compromises gonadal growth and meiotic entry during germline development.
ARCPHdb: A comprehensive protein database for SF1 and SF2 helicase from archaea.
Moukhtar, Mirna; Chaar, Wafi; Abdel-Razzak, Ziad; Khalil, Mohamad; Taha, Samir; Chamieh, Hala
2017-01-01
Superfamily 1 and Superfamily 2 helicases, two of the largest helicase protein families, play vital roles in many biological processes including replication, transcription and translation. Study of helicase proteins in the model microorganisms of archaea have largely contributed to the understanding of their function, architecture and assembly. Based on a large phylogenomics approach, we have identified and classified all SF1 and SF2 protein families in ninety five sequenced archaea genomes. Here we developed an online webserver linked to a specialized protein database named ARCPHdb to provide access for SF1 and SF2 helicase families from archaea. ARCPHdb was implemented using MySQL relational database. Web interfaces were developed using Netbeans. Data were stored according to UniProt accession numbers, NCBI Ref Seq ID, PDB IDs and Entrez Databases. A user-friendly interactive web interface has been developed to browse, search and download archaeal helicase protein sequences, their available 3D structure models, and related documentation available in the literature provided by ARCPHdb. The database provides direct links to matching external databases. The ARCPHdb is the first online database to compile all protein information on SF1 and SF2 helicase from archaea in one platform. This database provides essential resource information for all researchers interested in the field. Copyright © 2016 Elsevier Ltd. All rights reserved.
Wu, Xinghai; Chen, Chanfa; Xiao, Xizhi; Deng, Ming Jun
2016-11-01
A protocol for the reverse transcription-helicase-dependent amplification (RT-HDA) of isothermal DNA was developed for the detection of tomato spotted wilt virus (TSWV). Specific primers, which were based on the highly conserved region of the N gene sequence in TSWV, were used for the amplification of virus's RNA. The LOD of RT-HDA, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP), and reverse transcriptase-polymerase chain reaction (RT-PCR) assays were conducted using 10-fold serial dilution of RNA eluates. TSWV sensitivity in RT-HDA and RT-LAMP was 4 pg RNA compared with 40 pg RNA in RT-PCR. The specificity of RT-HDA for TSWV was high, showing no cross-reactivity with other tomato and Tospovirus viruses including cucumber mosaic virus (CMV), tomato black ring virus (TBRV), tomato mosaic virus (ToMV), or impatiens necrotic spot virus (INSV). The RT-HDA method is effective for the detection of TSWV in plant samples and is a potential tool for early and rapid detection of TSWV.
International Nuclear Information System (INIS)
Lin, Yen-Chen; Naveen, Vankadari; Hsiao, Chwan-Deng
2016-01-01
During DNA replication, bacterial helicase is recruited as a complex in association with loader proteins to unwind the parental duplex. Previous structural studies have reported saturated 6:6 helicase-loader complexes with different conformations. However, structural information on the sub-stoichiometric conformations of these previously-documented helicase-loader complexes remains elusive. Here, with the aid of single particle electron-microscopy (EM) image reconstruction, we present the Geobacillus kaustophilus HTA426 helicase-loader (DnaC-DnaI) complex with a 6:2 binding stoichiometry in the presence of ATPγS. In the 19 Å resolution EM map, the undistorted and unopened helicase ring holds a robust loader density above the C-terminal RecA-like domain. Meanwhile, the path of the central DNA binding channel appears to be obstructed by the reconstructed loader density, implying its potential role as a checkpoint conformation to prevent the loading of immature complex onto DNA. Our data also reveals that the bound nucleotides and the consequently induced conformational changes in the helicase hexamer are essential for active association with loader proteins. These observations provide fundamental insights into the formation of the helicase-loader complex in bacteria that regulates the DNA replication process. - Highlights: • Helicase-loader complex structure with 6:2 sub-stoichiometry is resolved by EM. • Helicase hexamer in 6:2 sub-stoichiometry is constricted and un-opened. • 6:2 binding ratio of helicase-loader complex could act as a DNA loading checkpoint. • Nucleotides stabilize helicase-loader complex at low protein concentrations.
Energy Technology Data Exchange (ETDEWEB)
Lin, Yen-Chen [Institute of Molecular Biology, Academia Sinica, Taipei 115, Taiwan (China); Naveen, Vankadari [Institute of Molecular Biology, Academia Sinica, Taipei 115, Taiwan (China); Molecular Cell Biology, Taiwan International Graduate Program, Institute of Molecular Biology, Academia Sinica, and Graduate Institute of Life Sciences, National Defense Medical Center, Taipei, Taiwan (China); Hsiao, Chwan-Deng, E-mail: hsiao@gate.sinica.edu.tw [Institute of Molecular Biology, Academia Sinica, Taipei 115, Taiwan (China); Molecular Cell Biology, Taiwan International Graduate Program, Institute of Molecular Biology, Academia Sinica, and Graduate Institute of Life Sciences, National Defense Medical Center, Taipei, Taiwan (China)
2016-04-22
During DNA replication, bacterial helicase is recruited as a complex in association with loader proteins to unwind the parental duplex. Previous structural studies have reported saturated 6:6 helicase-loader complexes with different conformations. However, structural information on the sub-stoichiometric conformations of these previously-documented helicase-loader complexes remains elusive. Here, with the aid of single particle electron-microscopy (EM) image reconstruction, we present the Geobacillus kaustophilus HTA426 helicase-loader (DnaC-DnaI) complex with a 6:2 binding stoichiometry in the presence of ATPγS. In the 19 Å resolution EM map, the undistorted and unopened helicase ring holds a robust loader density above the C-terminal RecA-like domain. Meanwhile, the path of the central DNA binding channel appears to be obstructed by the reconstructed loader density, implying its potential role as a checkpoint conformation to prevent the loading of immature complex onto DNA. Our data also reveals that the bound nucleotides and the consequently induced conformational changes in the helicase hexamer are essential for active association with loader proteins. These observations provide fundamental insights into the formation of the helicase-loader complex in bacteria that regulates the DNA replication process. - Highlights: • Helicase-loader complex structure with 6:2 sub-stoichiometry is resolved by EM. • Helicase hexamer in 6:2 sub-stoichiometry is constricted and un-opened. • 6:2 binding ratio of helicase-loader complex could act as a DNA loading checkpoint. • Nucleotides stabilize helicase-loader complex at low protein concentrations.
Fitzgerald, Megan E; Rawling, David C; Potapova, Olga; Ren, Xiaoming; Kohlway, Andrew; Pyle, Anna Marie
2017-02-17
RIG-I is an innate immune receptor that detects and responds to infection by deadly RNA viruses such as influenza, and Hepatitis C. In the cytoplasm, RIG-I is faced with a difficult challenge: it must sensitively detect viral RNA while ignoring the abundance of host RNA. It has been suggested that RIG-I has a ‘proof-reading’ mechanism for rejecting host RNA targets, and that disruptions of this selectivity filter give rise to autoimmune diseases. Here, we directly monitor RNA proof-reading by RIG-I and we show that it is controlled by a set of conserved amino acids that couple RNA and ATP binding to the protein (Motif III). Mutations of this motif directly modulate proof-reading by eliminating or enhancing selectivity for viral RNA, with major implications for autoimmune disease and cancer. More broadly, the results provide a physical explanation for the ATP-gated behavior of SF2 RNA helicases and receptor proteins.
Directory of Open Access Journals (Sweden)
Yoriko Nishida
Full Text Available There are no reports of proteomic analyses of inflamed islets in type 1 diabetes.Proteins expressed in the islets of enterovirus-associated fulminant type 1 diabetes (FT1DM with extensive insulitis were identified by laser-capture microdissection mass spectrometry using formalin-fixed paraffin-embedded pancreatic tissues.Thirty-eight proteins were identified solely in FT1DM islets, most of which have not been previously linked to type 1 diabetes. Five protein-protein interacting clusters were identified, and the cellular localization of selected proteins was validated immunohistochemically. Migratory activity-related proteins, including plastin-2 (LCP1, moesin (MSN, lamin-B1 (LMNB1, Ras GTPase-activating-like protein (IQGAP1 and others, were identified in CD8+ T cells and CD68+ macrophages infiltrated to inflamed FT1DM islets. Proteins involved in successive signaling in innate/adaptive immunity were identified, including SAM domain and HD domain-containing protein 1 (SAMHD1, Ras GTPase-activating-like protein (IQGAP1, proteasome activator complex subunit 1 (PSME1, HLA class I histocompatibility antigen (HLA-C, and signal transducer and activator of transcription 1-alpha/beta (STAT1. Angiogenic (thymidine phosphorylase (TYMP and anti-angiogenic (tryptophan-tRNA ligase (WARS factors were identified in migrating CD8+ T cells and CD68+ macrophages. Proteins related to virus replication and cell proliferation, including probable ATP-dependent RNA helicase DEAD box helicase 5 (DDX5 and heterogeneous nuclear ribonucleoprotein H (HNRNPH1, were identified. The anti-apoptotic protein T-complex protein 1 subunit epsilon (CCT5, the anti-oxidative enzyme 6-phosphogluconate dehydrogenase (PDG, and the anti-viral and anti-apoptotic proteins serpin B6 (SERPINB6 and heat shock 70 kDa protein1-like (HSPA1L, were identified in FT1DM-affected islet cells.The identified FT1DM-characterizing proteins include those involved in aggressive beta cell destruction through
Directory of Open Access Journals (Sweden)
Lu Wang
2016-09-01
Full Text Available Objective: To study the effect of taxanes combined with platinum chemotherapy on serum human epididymal protein 4 (HE4, 毩-fetoprotein (AFP, DEAD box polypeptide 4 (DDX4, cluster of differentiation 133 (CD133, carcinoembryonic antigen (CEA and T lymphocyte subsets in patients with epithelial ovarian cancer (EOC. Methods: A total of 80 EOC patients in our hospital from October 2014 to January 2016 were enrolled in this study. The subjects were divided into control group (n=40 and experiment group (n=40 randomly. Patients in control group were treated with platinum, the experiment group were treated with taxanes combined with platinum chemotherapy. With 21 days as a course of treatment, the two groups were treated for 4 courses. The clinical curative effect after treatment of the two groups was compared. The serum HE4, AFP, DDX4, CD133, CEA levels and peripheral blood CD3+, CD4+, CD8+ cells of the two groups before and after treatment were compared. Results: There were no significantly differences of the serum HE4, AFP, DDX4, CD133, CEA level and peripheral blood CD3+, CD4+, CD8+ cells of the two groups before treatment (P>0.05. The serum HE4, AFP, DDX4, CD133 and CEA level of the two groups after treatment were significantly lower than before treatment (P<0.05, and that of experiment were significantly lower than control group (P<0.05. The peripheral blood CD3+, CD4+ and CD8+ cells of the two groups after treatment were significantly lower than before treatment (P<0.05, and that of experiment were significantly higher than control group (P<0.05. Conclusions: Taxanes combined with platinum chemotherapy can significantly reduce the serum HE4, AFP, DDX4, CD133 and CEA levels, improve peripheral blood CD3+, CD4+ and CD8+ levels of patients with epithelial ovarian cancer, and it is worthy clinical application.
Raikwar, Shailendra; Srivastava, Vineet K.; Gill, Sarvajeet S.; Tuteja, Renu; Tuteja, Narendra
2015-01-01
Genetic material always remains at the risk of spontaneous or induced damage which challenges the normal functioning of DNA molecule, thus, DNA repair is vital to protect the organisms against genetic damage. Helicases, the unique molecular motors, are emerged as prospective molecules to engineer stress tolerance in plants and are involved in nucleic acid metabolism including DNA repair. The repair helicase, XPB is an evolutionary conserved protein present in different organisms, including pl...
DEFF Research Database (Denmark)
Syed, Salahuddin; Madsen, Claus Desler; Rasmussen, Lene J.
2016-01-01
hydroxyurea. This novel Rrm3 function is independent of its established role as an ATPase/helicase in facilitating replication fork progression through polymerase blocking obstacles. Using quantitative mass spectrometry and genetic analyses, we find that the homologous recombination factor Rdh54 and Rad5...
Chou, Y. C.
2018-04-01
The asymmetry in the two-layered ring structure of helicases and the random thermal fluctuations of the helicase and DNA molecules are considered as the bases for the generation of the force required for translocation of the ring-shaped helicase on DNA. The helicase comprises a channel at its center with two unequal ends, through which strands of DNA can pass. The random collisions between the portion of the DNA strand in the central channel and the wall of the channel generate an impulsive force toward the small end. This impulsive force is the starting point for the helicase to translocate along the DNA with the small end in front. Such a physical mechanism may serve as a complementary for the chemomechanical mechanism of the translocation of helicase on DNA. When the helicase arrives at the junction of ssDNA and dsDNA (a fork), the collision between the helicase and the closest base pair may produce a sufficient impulsive force to break the weak hydrogen bond of the base pair. Thus, the helicase may advance and repeat the process of unwinding the dsDNA strand. This mechanism was tested in a macroscopic simulation system where the helicase was simulated using a truncated-cone structure and DNA was simulated with bead chains. Many features of translocation and unwinding such as translocation on ssDNA and dsDNA, unwinding of dsDNA, rewinding, strand switching, and Holliday junction resolution were reproduced.
Shailendra eRaikwar; Vineet Kumar Shrivastava; Sarvajeet Singh Gill; Renu eTuteja; Narendra eTuteja; Narendra eTuteja
2015-01-01
Genetic material always remains at the risk of spontaneous or induced damage which challenges the normal functioning of DNA molecule, thus, DNA repair is vital to protect the organisms against genetic damage. DNA hHelicases, the unique molecular motors, are emerged as potentialprospective molecules to engineer stress tolerance in plants and are involved in a variety of DNA nucleic acid metabolismc processes including DNA repair. The DNA repair helicase, OsXPB2 is an evolutionary conserved pr...
Analysis of RNA binding by the dengue virus NS5 RNA capping enzyme.
Directory of Open Access Journals (Sweden)
Brittney R Henderson
Full Text Available Flaviviruses are small, capped positive sense RNA viruses that replicate in the cytoplasm of infected cells. Dengue virus and other related flaviviruses have evolved RNA capping enzymes to form the viral RNA cap structure that protects the viral genome and directs efficient viral polyprotein translation. The N-terminal domain of NS5 possesses the methyltransferase and guanylyltransferase activities necessary for forming mature RNA cap structures. The mechanism for flavivirus guanylyltransferase activity is currently unknown, and how the capping enzyme binds its diphosphorylated RNA substrate is important for deciphering how the flavivirus guanylyltransferase functions. In this report we examine how flavivirus NS5 N-terminal capping enzymes bind to the 5' end of the viral RNA using a fluorescence polarization-based RNA binding assay. We observed that the K(D for RNA binding is approximately 200 nM Dengue, Yellow Fever, and West Nile virus capping enzymes. Removal of one or both of the 5' phosphates reduces binding affinity, indicating that the terminal phosphates contribute significantly to binding. RNA binding affinity is negatively affected by the presence of GTP or ATP and positively affected by S-adensyl methoninine (SAM. Structural superpositioning of the dengue virus capping enzyme with the Vaccinia virus VP39 protein bound to RNA suggests how the flavivirus capping enzyme may bind RNA, and mutagenesis analysis of residues in the putative RNA binding site demonstrate that several basic residues are critical for RNA binding. Several mutants show differential binding to 5' di-, mono-, and un-phosphorylated RNAs. The mode of RNA binding appears similar to that found with other methyltransferase enzymes, and a discussion of diphosphorylated RNA binding is presented.
Developmental regulation of Xenopus 5S RNA genes
International Nuclear Information System (INIS)
Wormington, W.M.; Schlissel, M.; Brown, D.D.
1983-01-01
In this paper it is demonstrated that the actively transcribed fraction of somatic 5S RNA genes in somatic-cell chromatin is complexed stably with all required factors, so that the addition of only purified RNA polymerase III is needed to support somatic 5S RNA synthesis in vitro. Oocyte 5S RNA genes in somatic-cell chromatin appear to lack these factors, since their activation in salt-washed somatic-cell chromatin depends on exogeneous transciption factors in addition to RNA polymerase III. The developmental control of 5S RNA genes is established over a period beginning with the onset of 5S RNA synthesis in late blastula embryos, and this control is reproduced in vitro using chromatin templates isolated from appropriate stages. We propose that a decreasing concentration of the 5S-specific transcription factor during embryogenesis contributes to the inactivation of oocyte 5S RNA genes. 12 references, 4 figures, 1 table
5S rRNA-derived and tRNA-derived SINEs in fruit bats.
Gogolevsky, Konstantin P; Vassetzky, Nikita S; Kramerov, Dmitri A
2009-05-01
Most short retroposons (SINEs) descend from cellular tRNA of 7SL RNA. Here, four new SINEs were found in megabats (Megachiroptera) but neither in microbats nor in other mammals. Two of them, MEG-RS and MEG-RL, descend from another cellular RNA, 5S rRNA; one (MEG-T2) is a tRNA-derived SINE; and MEG-TR is a hybrid tRNA/5S rRNA SINE. Insertion locus analysis suggests that these SINEs were active in the recent fruit bat evolution. Analysis of MEG-RS and MEG-RL in comparison with other few 5S rRNA-derived SINEs demonstrates that the internal RNA polymerase III promoter is their most invariant region, while the secondary structure is more variable. The mechanisms underlying the modular structure of these and other SINEs as well as their variation are discussed. The scenario of evolution of MEG SINEs is proposed.
Tuteja, Narendra; Banu, Mst Sufara Akhter; Huda, Kazi Md Kamrul; Gill, Sarvajeet Singh; Jain, Parul; Pham, Xuan Hoi; Tuteja, Renu
2014-01-01
The DEAD-box helicases are required mostly in all aspects of RNA and DNA metabolism and they play a significant role in various abiotic stresses, including salinity. The p68 is an important member of the DEAD-box proteins family and, in animal system, it is involved in RNA metabolism including pre-RNA processing and splicing. In plant system, it has not been well characterized. Here we report the cloning and characterization of p68 from pea (Pisum sativum) and its novel function in salinity stress tolerance in plant. The pea p68 protein self-interacts and is localized in the cytosol as well as the surrounding of cell nucleus. The transcript of pea p68 is upregulated in response to high salinity stress in pea. Overexpression of p68 driven by constitutive cauliflower mosaic virus-35S promoter in tobacco transgenic plants confers enhanced tolerances to salinity stress by improving the growth, photosynthesis and antioxidant machinery. Under stress treatment, pea p68 overexpressing tobacco accumulated higher K+ and lower Na+ level than the wild-type plants. Reactive oxygen species (ROS) accumulation was remarkably regulated by the overexpression of pea p68 under salinity stress conditions, as shown from TBARS content, electrolyte leakage, hydrogen peroxide accumulation and 8-OHdG content and antioxidant enzyme activities. To the best of our knowledge this is the first direct report, which provides the novel function of pea p68 helicase in salinity stress tolerance. The results suggest that p68 can also be exploited for engineering abiotic stress tolerance in crop plants of economic importance.
A bioinformatic survey of RNA-binding proteins in Plasmodium.
Reddy, B P Niranjan; Shrestha, Sony; Hart, Kevin J; Liang, Xiaoying; Kemirembe, Karen; Cui, Liwang; Lindner, Scott E
2015-11-02
The malaria parasites in the genus Plasmodium have a very complicated life cycle involving an invertebrate vector and a vertebrate host. RNA-binding proteins (RBPs) are critical factors involved in every aspect of the development of these parasites. However, very few RBPs have been functionally characterized to date in the human parasite Plasmodium falciparum. Using different bioinformatic methods and tools we searched P. falciparum genome to list and annotate RBPs. A representative 3D models for each of the RBD domain identified in P. falciparum was created using I-TESSAR and SWISS-MODEL. Microarray and RNAseq data analysis pertaining PfRBPs was performed using MeV software. Finally, Cytoscape was used to create protein-protein interaction network for CITH-Dozi and Caf1-CCR4-Not complexes. We report the identification of 189 putative RBP genes belonging to 13 different families in Plasmodium, which comprise 3.5% of all annotated genes. Almost 90% (169/189) of these genes belong to six prominent RBP classes, namely RNA recognition motifs, DEAD/H-box RNA helicases, K homology, Zinc finger, Puf and Alba gene families. Interestingly, almost all of the identified RNA-binding helicases and KH genes have cognate homologs in model species, suggesting their evolutionary conservation. Exploration of the existing P. falciparum blood-stage transcriptomes revealed that most RBPs have peak mRNA expression levels early during the intraerythrocytic development cycle, which taper off in later stages. Nearly 27% of RBPs have elevated expression in gametocytes, while 47 and 24% have elevated mRNA expression in ookinete and asexual stages. Comparative interactome analyses using human and Plasmodium protein-protein interaction datasets suggest extensive conservation of the PfCITH/PfDOZI and PfCaf1-CCR4-NOT complexes. The Plasmodium parasites possess a large number of putative RBPs belonging to most of RBP families identified so far, suggesting the presence of extensive post
Yang, Mu; Wang, Ganggang
2016-09-15
The DnaB helicase from Bacillus stearothermophilus (DnaBBst) was a model protein for studying the bacterial DNA replication. In this work, a non-radioactive method for measuring ATPase activity of DnaBBst helicase was described. The working parameters and conditions were optimized. Furthermore, this method was applied to investigate effects of DnaG primase, ssDNA and helicase loader protein (DnaI) on ATPase activity of DnaBBst. Our results showed this method was sensitive and efficient. Moreover, it is suitable for the investigation of functional interaction between DnaB and related factors. Copyright © 2016 Elsevier Inc. All rights reserved.
Helicase properties of the Escherichia coli UvrAb protein complex
International Nuclear Information System (INIS)
Oh, E.Y.; Grossman, L.
1987-01-01
The Escherichia coli UvrA protein has an associated ATPase activity with a turnover number affected by the presence of UvrB protein as well as by DNA. Specifically, the structure of DNA significantly influences the turnover rate of the UvrAB ATPase activity. Double-stranded DNA maximally activates the turnover rate 10-fold whereas single-stranded DNA maximally activates the turnover rate 20-fold, suggesting that the mode of interaction of UvrAB protein with different DNAs is distinctive. We have previously shown that the UvrAB protein complex, driven by the binding energy of ATP, can locally unwind supercoiled DNA. The nature of the DNA unwinding activity and single-stranded DNA activation of ATPase activity suggest potential helicase activity. In the presence of a number of helicase substrates, the UvrAB complex, indeed, manifests a strand-displacement activity-unwinding short duplexes and D-loop DNA, thereby generating component DNA structures. The energy for the activity is derived from ATP or dATP hydrolysis. Unlike the E. coli DnaB, the UvrAB helicase is sensitive to UV-induced photoproducts
In TFIIH, XPD helicase is exclusively devoted to DNA repair.
Directory of Open Access Journals (Sweden)
Jochen Kuper
2014-09-01
Full Text Available The eukaryotic XPD helicase is an essential subunit of TFIIH involved in both transcription and nucleotide excision repair (NER. Mutations in human XPD are associated with several inherited diseases such as xeroderma pigmentosum, Cockayne syndrome, and trichothiodystrophy. We performed a comparative analysis of XPD from Homo sapiens and Chaetomium thermophilum (a closely related thermostable fungal orthologue to decipher the different molecular prerequisites necessary for either transcription or DNA repair. In vitro and in vivo assays demonstrate that mutations in the 4Fe4S cluster domain of XPD abrogate the NER function of TFIIH and do not affect its transcriptional activity. We show that the p44-dependent activation of XPD is promoted by the stimulation of its ATPase activity. Furthermore, we clearly demonstrate that XPD requires DNA binding, ATPase, and helicase activity to function in NER. In contrast, these enzymatic properties are dispensable for transcription initiation. XPD helicase is thus exclusively devoted to NER and merely acts as a structural scaffold to maintain TFIIH integrity during transcription.
Jung, Hana; Lee, Jin A; Choi, Seoyoon; Lee, Hyunwoo; Ahn, Byungchan
2014-01-01
Mutations in three human RecQ genes are implicated in heritable human syndromes. Mutations in BLM, a RecQ gene, cause Bloom syndrome (BS), which is characterized by short stature, cancer predisposition, and sensitivity to sunlight. BLM is a RecQ DNA helicase that, with interacting proteins, is able to dissolve various DNA structures including double Holliday junctions. A BLM ortholog, him-6, has been identified in Caenorhabditis elegans, but little is known about its enzymatic activities or its in vivo roles. By purifying recombinant HIM-6 and performing biochemical assays, we determined that the HIM-6 has DNA-dependent ATPase activity HIM-6 and helicase activity that proceeds in the 3'-5' direction and needs at least five 3' overhanging nucleotides. HIM-6 is also able to unwind DNA structures including D-loops and Holliday junctions. Worms with him-6 mutations were defective in recovering the cell cycle arrest after HU treatment. These activities strongly support in vivo roles for HIM-6 in processing recombination intermediates.
Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav
2002-01-01
The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in ...
International Nuclear Information System (INIS)
Ferrero, Diego; Buxaderas, Mònica; Rodriguez, José F.; Verdaguer, Núria
2012-01-01
The RNA-dependent RNA polymerase of Thosea asigna virus has been purified and crystallized in two different crystal forms. Preliminary characterization of P2 1 2 1 2 and C222 1 crystals is reported. Co-crystallization experiments in the presence of lutetium produced a heavy-atom derivative suitable for structure determination. Thosea asigna virus (TaV) is a positive-sense, single-stranded RNA (ssRNA) virus that belongs to the Permutotetravirus genera within the recently created Permutotetraviridae family. The genome of TaV consists of an RNA segment of about 5.700 nucleotides with two open reading frames, encoding for the replicase and capsid protein. The particular TaV replicase does not contain N7-methyl transferase and helicase domains but includes a structurally unique RNA-dependent RNA polymerase (RdRp) with a sequence permutation in the domain where the active site is anchored. This architecture is also found in double-stranded RNA viruses of the Birnaviridae family. Here we report the purification and preliminary crystallographic studies TaV RdRp. The enzyme was crystallized by the sitting-drop vapour diffusion method using PEG 8K and lithium sulfate as precipitants. Two different crystal forms were obtained: native RdRp crystallized in space group P2 1 2 1 2 and diffracts up to 2.1 Å and the RdRp-Lu 3+ derivative co-crystals belong to the C222 1 space group, diffracting to 3.0 Å resolution. The structure of TaV RdRp represents the first structure of a non-canonical RdRp from ssRNA viruses
Ciganda, Martin; Williams, Noreen
2012-01-01
The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041
Directory of Open Access Journals (Sweden)
Mahrou Sadri
2015-02-01
Full Text Available Objective(s: Hepatitis C is a major cause of liver failure worldwide. Current therapies applied for this disease are not fully effective and produce side effects in most cases. Non-structural protein 3 helicase (NS3 of HCV is one of the key enzymes in viral replication and infection. Therefore, this region is a promising target to design new drugs and therapies against HCV infection. The aim of this study was cloning and expression of HCV NS3 helicase fragment in Escherichia coli BL21 (DE3 using pET102/D-TOPO expression vector and studying immunoreactivity of the expressed antigen in Iranian infected with hepatitis C. Materials and Methods: The viral RNA was extracted from the serum of HCV infected patient. The NS3 helicase region was amplified by RT-PCR. The PCR product was directionally cloned into the expression vector pET102/D-TOPO and transformed into the BL21 strain of E. coli (DE3. The transformed bacteria were then induced by adding 1mM isopropyl-β-D-thiogalactopyranoside (IPTG into the culture medium to enhance the protein expression. SDS-PAGE and western blotting were carried out to identify the protein under investigation, and finally purified recombinant fusion protein was used as the antigen for ELISA method. Results: Theinsertion of theDNA fragment of the NS3 regioninto the expression vectorwas further confirmed by PCR and sequencing. SDS-PAGE analysis showed the successful expression of the recombinant protein of interest. Furthermore, immunoreactivity of fusion NS3 helicase was confirmed by ELISA and western blotting. Conclusion: It seems that this recombinant protein could be a useful source of antigen for future studies on HCV diagnosis and therapy.
Increased 5S rRNA oxidation in Alzheimer's disease.
Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R
2012-01-01
It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.
Naboulsi, Wael; Megger, Dominik A; Bracht, Thilo; Kohl, Michael; Turewicz, Michael; Eisenacher, Martin; Voss, Don Marvin; Schlaak, Jörg F; Hoffmann, Andreas-Claudius; Weber, Frank; Baba, Hideo A; Meyer, Helmut E; Sitek, Barbara
2016-01-04
Hepatocellular carcinoma (HCC) is one of the most aggressive tumors, and the treatment outcome of this disease is improved when the cancer is diagnosed at an early stage. This requires biomarkers allowing an accurate and early tumor diagnosis. To identify potential markers for such applications, we analyzed a patient cohort consisting of 50 patients (50 HCC and 50 adjacent nontumorous tissue samples as controls) using two independent proteomics approaches. We performed label-free discovery analysis on 19 HCC and corresponding tissue samples. The data were analyzed considering events known to take place in early events of HCC development, such as abnormal regulation of Wnt/b-catenin and activation of receptor tyrosine kinases (RTKs). 31 proteins were selected for verification experiments. For this analysis, the second set of the patient cohort (31 HCC and corresponding tissue samples) was analyzed using selected (multiple) reaction monitoring (SRM/MRM). We present the overexpression of ATP-dependent RNA helicase (DDX39), Fibulin-5 (FBLN5), myristoylated alanine-rich C-kinase substrate (MARCKS), and Serpin H1 (SERPINH1) in HCC for the first time. We demonstrate Versican core protein (VCAN) to be significantly associated with well differentiated and low-stage HCC. We revealed for the first time the evidence of VCAN as a potential biomarker for early-HCC diagnosis.
CYP3A5 mRNA degradation by nonsense-mediated mRNA decay.
Busi, Florent; Cresteil, Thierry
2005-09-01
The total CYP3A5 mRNA level is significantly greater in carriers of the CYP3A5*1 allele than in CYP3A5*3 homozygotes. Most of the CYP3A5*3 mRNA includes an intronic sequence (exon 3B) containing premature termination codons (PTCs) between exons 3 and 4. Two models were used to investigate the degradation of CYP3A5 mRNA: a CYP3A5 minigene consisting of CYP3A5 exons and introns 3 to 6 transfected into MCF7 cells, and the endogenous CYP3A5 gene expressed in HepG2 cells. The 3'-untranslated region g.31611C>T mutation has no effect on CYP3A5 mRNA decay. Splice variants containing exon 3B were more unstable than wild-type (wt) CYP3A5 mRNA. Cycloheximide prevents the recognition of PTCs by ribosomes: in transfected MCF7 and HepG2 cells, cycloheximide slowed down the degradation of exon 3B-containing splice variants, suggesting the participation of nonsense-mediated decay (NMD). When PTCs were removed from pseudoexon 3B or when UPF1 small interfering RNA was used to impair the NMD mechanism, the decay of the splice variant was reduced, confirming the involvement of NMD in the degradation of CYP3A5 splice variants. Induction could represent a source of variability for CYP3A5 expression and could modify the proportion of splice variants. The extent of CYP3A5 induction was investigated after exposure to barbiturates or steroids: CYP3A4 was markedly induced in a pediatric population compared with untreated neonates. However, no effect could be detected in either the total CYP3A5 RNA, the proportion of splice variant RNA, or the protein level. Therefore, in these carriers, induction is unlikely to switch on the phenotypic CYP3A5 expression in carriers of CYP3A5*3/*3.
Thakur, Roshan Singh; Desingu, Ambika; Basavaraju, Shivakumar; Subramanya, Shreelakshmi; Rao, Desirazu N; Nagaraju, Ganesh
2014-09-05
The significance of G-quadruplexes and the helicases that resolve G4 structures in prokaryotes is poorly understood. The Mycobacterium tuberculosis genome is GC-rich and contains >10,000 sequences that have the potential to form G4 structures. In Escherichia coli, RecQ helicase unwinds G4 structures. However, RecQ is absent in M. tuberculosis, and the helicase that participates in G4 resolution in M. tuberculosis is obscure. Here, we show that M. tuberculosis DinG (MtDinG) exhibits high affinity for ssDNA and ssDNA translocation with a 5' → 3' polarity. Interestingly, MtDinG unwinds overhangs, flap structures, and forked duplexes but fails to unwind linear duplex DNA. Our data with DNase I footprinting provide mechanistic insights and suggest that MtDinG is a 5' → 3' polarity helicase. Notably, in contrast to E. coli DinG, MtDinG catalyzes unwinding of replication fork and Holliday junction structures. Strikingly, we find that MtDinG resolves intermolecular G4 structures. These data suggest that MtDinG is a multifunctional structure-specific helicase that unwinds model structures of DNA replication, repair, and recombination as well as G4 structures. We finally demonstrate that promoter sequences of M. tuberculosis PE_PGRS2, mce1R, and moeB1 genes contain G4 structures, implying that G4 structures may regulate gene expression in M. tuberculosis. We discuss these data and implicate targeting G4 structures and DinG helicase in M. tuberculosis could be a novel therapeutic strategy for culminating the infection with this pathogen. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Mukherjee, Sourav; Weiner, Warren S; Schroeder, Chad E; Simpson, Denise S; Hanson, Alicia M; Sweeney, Noreena L; Marvin, Rachel K; Ndjomou, Jean; Kolli, Rajesh; Isailovic, Dragan; Schoenen, Frank J; Frick, David N
2014-10-17
The hepatitis C virus (HCV) nonstructural protein 3 (NS3) is both a protease, which cleaves viral and host proteins, and a helicase that separates nucleic acid strands, using ATP hydrolysis to fuel the reaction. Many antiviral drugs, and compounds in clinical trials, target the NS3 protease, but few helicase inhibitors that function as antivirals have been reported. This study focuses on the analysis of the mechanism by which ebselen (2-phenyl-1,2-benzisoselenazol-3-one), a compound previously shown to be a HCV antiviral agent, inhibits the NS3 helicase. Ebselen inhibited the abilities of NS3 to unwind nucleic acids, to bind nucleic acids, and to hydrolyze ATP, and about 1 μM ebselen was sufficient to inhibit each of these activities by 50%. However, ebselen had no effect on the activity of the NS3 protease, even at 100 times higher ebselen concentrations. At concentrations below 10 μM, the ability of ebselen to inhibit HCV helicase was reversible, but prolonged incubation of HCV helicase with higher ebselen concentrations led to irreversible inhibition and the formation of covalent adducts between ebselen and all 14 cysteines present in HCV helicase. Ebselen analogues with sulfur replacing the selenium were just as potent HCV helicase inhibitors as ebselen, but the length of the linker between the phenyl and benzisoselenazol rings was critical. Modifications of the phenyl ring also affected compound potency over 30-fold, and ebselen was a far more potent helicase inhibitor than other, structurally unrelated, thiol-modifying agents. Ebselen analogues were also more effective antiviral agents, and they were less toxic to hepatocytes than ebselen. Although the above structure-activity relationship studies suggest that ebselen targets a specific site on NS3, we were unable to confirm binding to either the NS3 ATP binding site or nucleic acid binding cleft by examining the effects of ebselen on NS3 proteins lacking key cysteines.
International Nuclear Information System (INIS)
Lawrence, Paul; Conderino, Joseph S.; Rieder, Elizabeth
2014-01-01
Previously, RNA helicase A (RHA) re-localization from the nucleus to the cytoplasm in foot-and-mouth disease virus (FMDV) infected cells was shown to coincide with loss of RHA methylated arginine residues at its C-terminus. The potential interaction between RHA and Jumonji C-domain (JmjC) protein 6 (JMJD6) arginine demethylase in infected cells was investigated. Treatment with N-oxalylglycine (NOG) inhibitor of JmjC demethylases prevented FMDV-induced RHA demethylation and re-localization, and also decreased viral protein synthesis and virus titers. Physical interaction between JMJD6 and RHA was demonstrated via reciprocal co-immunoprecipitation, where RHA preferentially bound JMJD6 monomers. Nuclear efflux of demethylated RHA (DM-RHA) coincided with nuclear influx of JMJD6, which was not observed using another picornavirus. A modified biochemical assay demonstrated JMJD6 induced dose-dependent demethylation of RHA and two RHA-derived isoforms, which could be inhibited by NOG. We propose a role for JMJD6 in RHA demethylation stimulated by FMDV, that appears to facilitate virus replication. - Highlights: • We examined the role of JMJD6 in FMDV-induced RHA demethylation process. • Using an arginine demethylation assay showed that JMJD6 is involved in RHA demethylation. • A demethylases inhibitor reduced cytoplasmic accumulation of RHA and FMDV titers
Energy Technology Data Exchange (ETDEWEB)
Lawrence, Paul; Conderino, Joseph S.; Rieder, Elizabeth, E-mail: elizabeth.rieder@ars.usda.gov
2014-03-15
Previously, RNA helicase A (RHA) re-localization from the nucleus to the cytoplasm in foot-and-mouth disease virus (FMDV) infected cells was shown to coincide with loss of RHA methylated arginine residues at its C-terminus. The potential interaction between RHA and Jumonji C-domain (JmjC) protein 6 (JMJD6) arginine demethylase in infected cells was investigated. Treatment with N-oxalylglycine (NOG) inhibitor of JmjC demethylases prevented FMDV-induced RHA demethylation and re-localization, and also decreased viral protein synthesis and virus titers. Physical interaction between JMJD6 and RHA was demonstrated via reciprocal co-immunoprecipitation, where RHA preferentially bound JMJD6 monomers. Nuclear efflux of demethylated RHA (DM-RHA) coincided with nuclear influx of JMJD6, which was not observed using another picornavirus. A modified biochemical assay demonstrated JMJD6 induced dose-dependent demethylation of RHA and two RHA-derived isoforms, which could be inhibited by NOG. We propose a role for JMJD6 in RHA demethylation stimulated by FMDV, that appears to facilitate virus replication. - Highlights: • We examined the role of JMJD6 in FMDV-induced RHA demethylation process. • Using an arginine demethylation assay showed that JMJD6 is involved in RHA demethylation. • A demethylases inhibitor reduced cytoplasmic accumulation of RHA and FMDV titers.
Directory of Open Access Journals (Sweden)
Narendra Tuteja
Full Text Available The DEAD-box helicases are required mostly in all aspects of RNA and DNA metabolism and they play a significant role in various abiotic stresses, including salinity. The p68 is an important member of the DEAD-box proteins family and, in animal system, it is involved in RNA metabolism including pre-RNA processing and splicing. In plant system, it has not been well characterized. Here we report the cloning and characterization of p68 from pea (Pisum sativum and its novel function in salinity stress tolerance in plant.The pea p68 protein self-interacts and is localized in the cytosol as well as the surrounding of cell nucleus. The transcript of pea p68 is upregulated in response to high salinity stress in pea. Overexpression of p68 driven by constitutive cauliflower mosaic virus-35S promoter in tobacco transgenic plants confers enhanced tolerances to salinity stress by improving the growth, photosynthesis and antioxidant machinery. Under stress treatment, pea p68 overexpressing tobacco accumulated higher K+ and lower Na+ level than the wild-type plants. Reactive oxygen species (ROS accumulation was remarkably regulated by the overexpression of pea p68 under salinity stress conditions, as shown from TBARS content, electrolyte leakage, hydrogen peroxide accumulation and 8-OHdG content and antioxidant enzyme activities.To the best of our knowledge this is the first direct report, which provides the novel function of pea p68 helicase in salinity stress tolerance. The results suggest that p68 can also be exploited for engineering abiotic stress tolerance in crop plants of economic importance.
The helicase domain of Polθ counteracts RPA to promote alt-NHEJ.
Mateos-Gomez, Pedro A; Kent, Tatiana; Deng, Sarah K; McDevitt, Shane; Kashkina, Ekaterina; Hoang, Trung M; Pomerantz, Richard T; Sfeir, Agnel
2017-12-01
Mammalian polymerase theta (Polθ) is a multifunctional enzyme that promotes error-prone DNA repair by alternative nonhomologous end joining (alt-NHEJ). Here we present structure-function analyses that reveal that, in addition to the polymerase domain, Polθ-helicase activity plays a central role during double-strand break (DSB) repair. Our results show that the helicase domain promotes chromosomal translocations by alt-NHEJ in mouse embryonic stem cells and also suppresses CRISPR-Cas9- mediated gene targeting by homologous recombination (HR). In vitro assays demonstrate that Polθ-helicase activity facilitates the removal of RPA from resected DSBs to allow their annealing and subsequent joining by alt-NHEJ. Consistent with an antagonistic role for RPA during alt-NHEJ, inhibition of RPA1 enhances end joining and suppresses recombination. Taken together, our results reveal that the balance between HR and alt-NHEJ is controlled by opposing activities of Polθ and RPA, providing further insight into the regulation of repair-pathway choice in mammalian cells.
Crystal structure of the FeS cluster-containing nucleotide excision repair helicase XPD.
Directory of Open Access Journals (Sweden)
Stefanie C Wolski
2008-06-01
Full Text Available DNA damage recognition by the nucleotide excision repair pathway requires an initial step identifying helical distortions in the DNA and a proofreading step verifying the presence of a lesion. This proofreading step is accomplished in eukaryotes by the TFIIH complex. The critical damage recognition component of TFIIH is the XPD protein, a DNA helicase that unwinds DNA and identifies the damage. Here, we describe the crystal structure of an archaeal XPD protein with high sequence identity to the human XPD protein that reveals how the structural helicase framework is combined with additional elements for strand separation and DNA scanning. Two RecA-like helicase domains are complemented by a 4Fe4S cluster domain, which has been implicated in damage recognition, and an alpha-helical domain. The first helicase domain together with the helical and 4Fe4S-cluster-containing domains form a central hole with a diameter sufficient in size to allow passage of a single stranded DNA. Based on our results, we suggest a model of how DNA is bound to the XPD protein, and can rationalize several of the mutations in the human XPD gene that lead to one of three severe diseases, xeroderma pigmentosum, Cockayne syndrome, and trichothiodystrophy.
DNA binding and unwinding by Hel308 helicase requires dual functions of a winged helix domain.
Northall, Sarah J; Buckley, Ryan; Jones, Nathan; Penedo, J Carlos; Soultanas, Panos; Bolt, Edward L
2017-09-01
Hel308 helicases promote genome stability linked to DNA replication in archaea, and have homologues in metazoans. In the crystal structure of archaeal Hel308 bound to a tailed DNA duplex, core helicase domains encircle single-stranded DNA (ssDNA) in a "ratchet" for directional translocation. A winged helix domain (WHD) is also present, but its function is mysterious. We investigated the WHD in full-length Hel308, identifying that mutations in a solvent exposed α-helix resulted in reduced DNA binding and unwinding activities. When isolated from the rest of Hel308, the WHD protein alone bound to duplex DNA but not ssDNA, and DNA binding by WHD protein was abolished by the same mutations as were analyzed in full-length Hel308. Isolated WHD from a human Hel308 homologue (HelQ) also bound to duplex DNA. By disrupting the interface between the Hel308 WHD and a RecA-like domain, a topology typical of Ski2 helicases, we show that this is crucial for ATPase and helicase activities. The data suggest a model in which the WHD promotes activity of Hel308 directly, through binding to duplex DNA that is distinct from ssDNA binding by core helicase, and indirectly through interaction with the RecA-like domain. We propose how the WHD may contribute to ssDNA translocation, resulting in DNA helicase activity or in removal of other DNA bound proteins by "reeling" ssDNA. Copyright © 2017 Elsevier B.V. All rights reserved.
DNA unwinding by ring-shaped T4 helicase gp41 is hindered by tension on the occluded strand.
Ribeck, Noah; Saleh, Omar A
2013-01-01
The replicative helicase for bacteriophage T4 is gp41, which is a ring-shaped hexameric motor protein that achieves unwinding of dsDNA by translocating along one strand of ssDNA while forcing the opposite strand to the outside of the ring. While much study has been dedicated to the mechanism of binding and translocation along the ssDNA strand encircled by ring-shaped helicases, relatively little is known about the nature of the interaction with the opposite, 'occluded' strand. Here, we investigate the interplay between the bacteriophage T4 helicase gp41 and the ss/dsDNA fork by measuring, at the single-molecule level, DNA unwinding events on stretched DNA tethers in multiple geometries. We find that gp41 activity is significantly dependent on the geometry and tension of the occluded strand, suggesting an interaction between gp41 and the occluded strand that stimulates the helicase. However, the geometry dependence of gp41 activity is the opposite of that found previously for the E. coli hexameric helicase DnaB. Namely, tension applied between the occluded strand and dsDNA stem inhibits unwinding activity by gp41, while tension pulling apart the two ssDNA tails does not hinder its activity. This implies a distinct variation in helicase-occluded strand interactions among superfamily IV helicases, and we propose a speculative model for this interaction that is consistent with both the data presented here on gp41 and the data that had been previously reported for DnaB.
Structural mechanisms of human RecQ helicases WRN and BLM
Directory of Open Access Journals (Sweden)
Ken eKitano
2014-10-01
Full Text Available The RecQ family DNA helicases WRN (Werner syndrome protein and BLM (Bloom syndrome protein play a key role in protecting the genome against deleterious changes. In humans, mutations in these proteins lead to rare genetic diseases associated with cancer predisposition and accelerated aging. WRN and BLM are distinguished from other helicases by possessing signature tandem domains toward the C terminus, referred to as the RecQ C-terminal (RQC and helicase-and-ribonuclease D-C-terminal (HRDC domains. Although the precise function of the HRDC domain remains unclear, the previous crystal structure of a WRN RQC-DNA complex visualized a central role for the RQC domain in recognizing, binding and unwinding DNA at branch points. In particular, a prominent hairpin structure (the β-wing within the RQC winged-helix motif acts as a scalpel to induce the unpairing of a Watson-Crick base pair at the DNA duplex terminus. A similar RQC-DNA interaction was also observed in the recent crystal structure of a BLM-DNA complex. I review the latest structures of WRN and BLM, and then provide a docking simulation of BLM with a Holliday junction. The model offers an explanation for the efficient branch migration activity of the RecQ family toward recombination and repair intermediates.
The C-terminal domain of the Bloom syndrome DNA helicase is essential for genomic stability
Directory of Open Access Journals (Sweden)
Noonan James P
2001-07-01
Full Text Available Abstract Background Bloom syndrome is a rare cancer-prone disorder in which the cells of affected persons have a high frequency of somatic mutation and genomic instability. Bloom syndrome cells have a distinctive high frequency of sister chromatid exchange and quadriradial formation. BLM, the protein altered in BS, is a member of the RecQ DNA helicase family, whose members share an average of 40% identity in the helicase domain and have divergent N-terminal and C-terminal flanking regions of variable lengths. The BLM DNA helicase has been shown to localize to the ND10 (nuclear domain 10 or PML (promyelocytic leukemia nuclear bodies, where it associates with TOPIIIα, and to the nucleolus. Results This report demonstrates that the N-terminal domain of BLM is responsible for localization of the protein to the nuclear bodies, while the C-terminal domain directs the protein to the nucleolus. Deletions of the N-terminal domain of BLM have little effect on sister chromatid exchange frequency and chromosome stability as compared to helicase and C-terminal mutations which can increase SCE frequency and chromosome abnormalities. Conclusion The helicase activity and the C-terminal domain of BLM are critical for maintaining genomic stability as measured by the sister chromatid exchange assay. The localization of BLM into the nucleolus by the C-terminal domain appears to be more important to genomic stability than localization in the nuclear bodies.
Reed, Jonathan C; Westergreen, Nick; Barajas, Brook C; Ressler, Dylan T B; Phuong, Daryl J; Swain, John V; Lingappa, Vishwanath R; Lingappa, Jaisri R
2018-05-01
During immature capsid assembly in cells, human immunodeficiency virus type 1 (HIV-1) Gag co-opts a host RNA granule, forming a pathway of intracellular assembly intermediates containing host components, including two cellular facilitators of assembly, ABCE1 and DDX6. A similar assembly pathway has been observed for other primate lentiviruses. Here we asked whether feline immunodeficiency virus (FIV), a nonprimate lentivirus, also forms RNA granule-derived capsid assembly intermediates. First, we showed that the released FIV immature capsid and a large FIV Gag-containing intracellular complex are unstable during analysis, unlike for HIV-1. We identified harvest conditions, including in situ cross-linking, that overcame this problem, revealing a series of FIV Gag-containing complexes corresponding in size to HIV-1 assembly intermediates. Previously, we showed that assembly-defective HIV-1 Gag mutants are arrested at specific assembly intermediates; here we identified four assembly-defective FIV Gag mutants, including three not previously studied, and demonstrated that they appear to be arrested at the same intermediate as the cognate HIV-1 mutants. Further evidence that these FIV Gag-containing complexes correspond to assembly intermediates came from coimmunoprecipitations demonstrating that endogenous ABCE1 and the RNA granule protein DDX6 are associated with FIV Gag, as shown previously for HIV-1 Gag, but are not associated with a ribosomal protein, at steady state. Additionally, we showed that FIV Gag associates with another RNA granule protein, DCP2. Finally, we validated the FIV Gag-ABCE1 and FIV Gag-DCP2 interactions with proximity ligation assays demonstrating colocalization in situ Together, these data support a model in which primate and nonprimate lentiviruses form intracellular capsid assembly intermediates derived from nontranslating host RNA granules. IMPORTANCE Like HIV-1 Gag, FIV Gag assembles into immature capsids; however, it is not known whether
Energy Technology Data Exchange (ETDEWEB)
Ahn, Byungchan, E-mail: bbccahn@mail.ulsan.ac.kr [Department of Life Sciences, University of Ulsan, Ulsan (Korea, Republic of); Bohr, Vilhelm A. [Laboratory of Molecular Gerontology, Biomedical Research Center, National Institute on Aging, Baltimore, MD (United States)
2011-08-12
Highlights: {yields} In this study, we investigated the effect of a DNA secondary structure on the two WRN activities. {yields} We found that a DNA secondary structure of the displaced strand during unwinding stimulates WRN helicase without coordinate action of WRN exonuclease. {yields} These results imply that WRN helicase and exonuclease activities can act independently. -- Abstract: Werner syndrome (WS) is an autosomal recessive premature aging disorder characterized by aging-related phenotypes and genomic instability. WS is caused by mutations in a gene encoding a nuclear protein, Werner syndrome protein (WRN), a member of the RecQ helicase family, that interestingly possesses both helicase and exonuclease activities. Previous studies have shown that the two activities act in concert on a single substrate. We investigated the effect of a DNA secondary structure on the two WRN activities and found that a DNA secondary structure of the displaced strand during unwinding stimulates WRN helicase without coordinate action of WRN exonuclease. These results imply that WRN helicase and exonuclease activities can act independently, and we propose that the uncoordinated action may be relevant to the in vivo activity of WRN.
You, Zhiying; De Falco, Mariarosaria; Kamada, Katsuhiko; Pisani, Francesca M.; Masai, Hisao
2013-01-01
The Mini-chromosome maintenance (Mcm) proteins are essential as central components for the DNA unwinding machinery during eukaryotic DNA replication. DNA primase activity is required at the DNA replication fork to synthesize short RNA primers for DNA chain elongation on the lagging strand. Although direct physical and functional interactions between helicase and primase have been known in many prokaryotic and viral systems, potential interactions between helicase and primase have not been explored in eukaryotes. Using purified Mcm and DNA primase complexes, a direct physical interaction is detected in pull-down assays between the Mcm2∼7 complex and the hetero-dimeric DNA primase composed of the p48 and p58 subunits. The Mcm4/6/7 complex co-sediments with the primase and the DNA polymerase α-primase complex in glycerol gradient centrifugation and forms a Mcm4/6/7-primase-DNA ternary complex in gel-shift assays. Both the Mcm4/6/7 and Mcm2∼7 complexes stimulate RNA primer synthesis by DNA primase in vitro. However, primase inhibits the Mcm4/6/7 helicase activity and this inhibition is abolished by the addition of competitor DNA. In contrast, the ATP hydrolysis activity of Mcm4/6/7 complex is not affected by primase. Mcm and primase proteins mutually stimulate their DNA-binding activities. Our findings indicate that a direct physical interaction between primase and Mcm proteins may facilitate priming reaction by the former protein, suggesting that efficient DNA synthesis through helicase-primase interactions may be conserved in eukaryotic chromosomes. PMID:23977294
Directory of Open Access Journals (Sweden)
Zhiying You
Full Text Available The Mini-chromosome maintenance (Mcm proteins are essential as central components for the DNA unwinding machinery during eukaryotic DNA replication. DNA primase activity is required at the DNA replication fork to synthesize short RNA primers for DNA chain elongation on the lagging strand. Although direct physical and functional interactions between helicase and primase have been known in many prokaryotic and viral systems, potential interactions between helicase and primase have not been explored in eukaryotes. Using purified Mcm and DNA primase complexes, a direct physical interaction is detected in pull-down assays between the Mcm2~7 complex and the hetero-dimeric DNA primase composed of the p48 and p58 subunits. The Mcm4/6/7 complex co-sediments with the primase and the DNA polymerase α-primase complex in glycerol gradient centrifugation and forms a Mcm4/6/7-primase-DNA ternary complex in gel-shift assays. Both the Mcm4/6/7 and Mcm2~7 complexes stimulate RNA primer synthesis by DNA primase in vitro. However, primase inhibits the Mcm4/6/7 helicase activity and this inhibition is abolished by the addition of competitor DNA. In contrast, the ATP hydrolysis activity of Mcm4/6/7 complex is not affected by primase. Mcm and primase proteins mutually stimulate their DNA-binding activities. Our findings indicate that a direct physical interaction between primase and Mcm proteins may facilitate priming reaction by the former protein, suggesting that efficient DNA synthesis through helicase-primase interactions may be conserved in eukaryotic chromosomes.
Covalent Chemical 5'-Functionalization of RNA with Diazo Reagents.
Gampe, Christian M; Hollis-Symynkywicz, Micah; Zécri, Frédéric
2016-08-22
Functionalization of RNA at the 5'-terminus is important for analytical and therapeutic purposes. Currently, these RNAs are synthesized de novo starting with a chemically functionalized 5'-nucleotide, which is incorporated into RNA using chemical synthesis or biochemical techniques. Methods for direct chemical modification of native RNA would provide an attractive alternative but are currently underexplored. Herein, we report that diazo compounds can be used to selectively alkylate the 5'-phosphate of ribo(oligo)nucleotides to give RNA labelled through a native phosphate ester bond. We applied this method to functionalize oligonucleotides with biotin and an orthosteric inhibitor of the eukaryotic initiation factor 4E (eIF4E), an enzyme involved in mRNA recognition. The modified RNA binds to eIF4E, demonstrating the utility of this labelling technique to modulate biological activity of RNA. This method complements existing techniques and may be used to chemically introduce a broad range of functional handles at the 5'-end of RNA. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Seol, Yeonee; Strub, Marie-Paule; Neuman, Keir C.
2016-01-01
Magnetic tweezers is a versatile and easy to implement single-molecule technique that has become increasingly prevalent in the study of nucleic acid based molecular motors. Here, we provide a description of the magnetic tweezers instrument and guidelines for measuring and analyzing DNA helicase activity. Along with experimental methods, we describe a robust method of single-molecule trajectory analysis based on the Student’s t-test that accommodates continuous transitions in addition to the discrete transitions assumed in most widely employed analysis routines. To illustrate the single-molecule unwinding assay and the analysis routine, we provide DNA unwinding measurements of Escherichia coli RecQ helicase under a variety of conditions (Na+, ATP, temperature, and DNA substrate geometry). These examples reveal that DNA unwinding measurements under various conditions can aid in elucidating the unwinding mechanism of DNA helicase but also emphasize that environmental effects on DNA helicase activity must be considered in relation to in vivo activity and mechanism. PMID:27131595
Mammalian ChlR1 has a role in heterochromatin organization
International Nuclear Information System (INIS)
Inoue, Akira; Hyle, Judith; Lechner, Mark S.; Lahti, Jill M.
2011-01-01
The ChlR1 DNA helicase, encoded by DDX11 gene, which is responsible for Warsaw breakage syndrome (WABS), has a role in sister-chromatid cohesion. In this study, we show that human ChlR1 deficient cells exhibit abnormal heterochromatin organization. While constitutive heterochromatin is discretely localized at perinuclear and perinucleolar regions in control HeLa cells, ChlR1-depleted cells showed dispersed localization of constitutive heterochromatin accompanied by disrupted centromere clustering. Cells isolated from Ddx11 -/- embryos also exhibited diffuse localization of centromeres and heterochromatin foci. Similar abnormalities were found in HeLa cells depleted of combinations of HP1α and HP1β. Immunofluorescence and chromatin immunoprecipitation showed a decreased level of HP1α at pericentric regions in ChlR1-depleted cells. Trimethyl-histone H3 at lysine 9 (H3K9-me3) was also modestly decreased at pericentric sequences. The abnormality in pericentric heterochromatin was further supported by decreased DNA methylation within major satellite repeats of Ddx11 -/- embryos. Furthermore, micrococcal nuclease (MNase) assay revealed a decreased chromatin density at the telomeres. These data suggest that in addition to a role in sister-chromatid cohesion, ChlR1 is also involved in the proper formation of heterochromatin, which in turn contributes to global nuclear organization and pleiotropic effects. -- Highlights: → New role for ChlR1 (DDX11), a cohesinopathy gene, in heterochromatin organization. → Loss of ChlR1 altered heterochromatin localization and centromere clustering. → Reduced ChlR1 levels also reduced HP1α and H3K9-me3 binding to pericentric DNA. → Decreased DNA methylation was found in pericentric repeats of Ddx11 -/- embryos. → These findings will aid in understanding the pathogenesis of Warsaw breakage syndrome.
Awate, Sanket; Brosh, Robert M
2017-06-08
Helicases and translocases use the energy of nucleoside triphosphate binding and hydrolysis to unwind/resolve structured nucleic acids or move along a single-stranded or double-stranded polynucleotide chain, respectively. These molecular motors facilitate a variety of transactions including replication, DNA repair, recombination, and transcription. A key partner of eukaryotic DNA helicases/translocases is the single-stranded DNA binding protein Replication Protein A (RPA). Biochemical, genetic, and cell biological assays have demonstrated that RPA interacts with these human molecular motors physically and functionally, and their association is enriched in cells undergoing replication stress. The roles of DNA helicases/translocases are orchestrated with RPA in pathways of nucleic acid metabolism. RPA stimulates helicase-catalyzed DNA unwinding, enlists translocases to sites of action, and modulates their activities in DNA repair, fork remodeling, checkpoint activation, and telomere maintenance. The dynamic interplay between DNA helicases/translocases and RPA is just beginning to be understood at the molecular and cellular levels, and there is still much to be learned, which may inform potential therapeutic strategies.
LARP6 Meets Collagen mRNA: Specific Regulation of Type I Collagen Expression
Directory of Open Access Journals (Sweden)
Yujie Zhang
2016-03-01
Full Text Available Type I collagen is the most abundant structural protein in all vertebrates, but its constitutive rate of synthesis is low due to long half-life of the protein (60–70 days. However, several hundred fold increased production of type I collagen is often seen in reparative or reactive fibrosis. The mechanism which is responsible for this dramatic upregulation is complex, including multiple levels of regulation. However, posttranscriptional regulation evidently plays a predominant role. Posttranscriptional regulation comprises processing, transport, stabilization and translation of mRNAs and is executed by RNA binding proteins. There are about 800 RNA binding proteins, but only one, La ribonucleoprotein domain family member 6 (LARP6, is specifically involved in type I collagen regulation. In the 5′untranslated region (5’UTR of mRNAs encoding for type I and type III collagens there is an evolutionally conserved stem-loop (SL structure; this structure is not found in any other mRNA, including any other collagen mRNA. LARP6 binds to the 5′SL in sequence specific manner to regulate stability of collagen mRNAs and their translatability. Here, we will review current understanding of how is LARP6 involved in posttranscriptional regulation of collagen mRNAs. We will also discuss how other proteins recruited by LARP6, including nonmuscle myosin, vimentin, serine threonine kinase receptor associated protein (STRAP, 25 kD FK506 binding protein (FKBP25 and RNA helicase A (RHA, contribute to this process.
Functional Dynamics of Hexameric Helicase Probed by Hydrogen Exchange and Simulation
Radou, Gaël; Dreyer, Frauke N.; Tuma, Roman; Paci, Emanuele
2014-01-01
The biological function of large macromolecular assemblies depends on their structure and their dynamics over a broad range of timescales; for this reason, it is a significant challenge to investigate these assemblies using conventional experimental techniques. One of the most promising experimental techniques is hydrogen-deuterium exchange detected by mass spectrometry. Here, we describe to our knowledge a new computational method for quantitative interpretation of deuterium exchange kinetics and apply it to a hexameric viral helicase P4 that unwinds and translocates RNA into a virus capsid at the expense of ATP hydrolysis. Room-temperature dynamics probed by a hundred nanoseconds of all-atom molecular dynamics simulations is sufficient to predict the exchange kinetics of most sequence fragments and provide a residue-level interpretation of the low-resolution experimental results. The strategy presented here is also a valuable tool to validate experimental data, e.g., assignments, and to probe mechanisms that cannot be observed by x-ray crystallography, or that occur over timescales longer than those that can be realistically simulated, such as the opening of the hexameric ring. PMID:25140434
Exportin-5 mediates nuclear export of SRP RNA in vertebrates.
Takeiwa, Toshihiko; Taniguchi, Ichiro; Ohno, Mutsuhito
2015-04-01
The signal recognition particle is a ribonucleoprotein complex that is essential for the translocation of nascent proteins into the endoplasmic reticulum. It has been shown that the RNA component (SRP RNA) is exported from the nucleus by CRM1 in the budding yeast. However, how SRP RNA is exported in higher species has been elusive. Here, we show that SRP RNA does not use the CRM1 pathway in Xenopus oocytes. Instead, SRP RNA uses the same export pathway as pre-miRNA and tRNA as showed by cross-competition experiments. Consistently, the recombinant Exportin-5 protein specifically stimulated export of SRP RNA as well as of pre-miRNA and tRNA, whereas an antibody raised against Exportin-5 specifically inhibited export of the same RNA species. Moreover, biotinylated SRP RNA can pull down Exportin-5 but not CRM1 from HeLa cell nuclear extracts in a RanGTP-dependent manner. These results, taken together, strongly suggest that the principal export receptor for SRP RNA in vertebrates is Exportin-5 unlike in the budding yeast. © 2015 The Authors. Genes to Cells published by Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd.
International Nuclear Information System (INIS)
Kanno, Yuichiro; Inajima, Jun; Kato, Sayaka; Matsumoto, Maika; Tokumoto, Chikako; Kure, Yuki; Inouye, Yoshio
2015-01-01
The constitutive androstane receptor (CAR) plays a key role in the expression of xenobiotic/steroid and drug metabolizing enzymes and their transporters. In this study, we demonstrated that protein arginine methyltransferase 5 (PRMT5) is a novel CAR-interacting protein. Furthermore, the PRMT-dependent induction of a CAR reporter gene, which was independent of methyltransferase activity, was enhanced in the presence of steroid receptor coactivator 1 (SRC1), peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC-1α) or DEAD box DNA/RNA helicase DP97. Using tetracycline inducible-hCAR system in HepG2 cells, we showed that knockdown of PRMT5 with small interfering RNA suppressed tetracycline -induced mRNA expression of CYP2B6 but not of CYP2C9 or CYP3A4. PRMT5 enhanced phenobarbital-mediated transactivation of a phenobarbital-responsive enhancer module (PBREM)-driven reporter gene in co-operation with PGC-1α in rat primary hepatocytes. Based on these findings, we suggest PRMT5 to be a gene (or promoter)-selective coactivator of CAR by mediating the formation of complexes between hCAR and appropriate coactivators. - Highlights: • Nuclear receptor CAR interact with PRMT5. • PRMT5 enhances transcriptional activity of CAR. • PRMT5 synergistically enhances transactivity of CAR by the co-expression of SRC-1, DP97 or PGC1α. • PRMT5 is a gene-selective co-activator for hCAR
Energy Technology Data Exchange (ETDEWEB)
Kanno, Yuichiro, E-mail: ykanno@phar.toho-u.ac.jp; Inajima, Jun; Kato, Sayaka; Matsumoto, Maika; Tokumoto, Chikako; Kure, Yuki; Inouye, Yoshio
2015-03-27
The constitutive androstane receptor (CAR) plays a key role in the expression of xenobiotic/steroid and drug metabolizing enzymes and their transporters. In this study, we demonstrated that protein arginine methyltransferase 5 (PRMT5) is a novel CAR-interacting protein. Furthermore, the PRMT-dependent induction of a CAR reporter gene, which was independent of methyltransferase activity, was enhanced in the presence of steroid receptor coactivator 1 (SRC1), peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC-1α) or DEAD box DNA/RNA helicase DP97. Using tetracycline inducible-hCAR system in HepG2 cells, we showed that knockdown of PRMT5 with small interfering RNA suppressed tetracycline -induced mRNA expression of CYP2B6 but not of CYP2C9 or CYP3A4. PRMT5 enhanced phenobarbital-mediated transactivation of a phenobarbital-responsive enhancer module (PBREM)-driven reporter gene in co-operation with PGC-1α in rat primary hepatocytes. Based on these findings, we suggest PRMT5 to be a gene (or promoter)-selective coactivator of CAR by mediating the formation of complexes between hCAR and appropriate coactivators. - Highlights: • Nuclear receptor CAR interact with PRMT5. • PRMT5 enhances transcriptional activity of CAR. • PRMT5 synergistically enhances transactivity of CAR by the co-expression of SRC-1, DP97 or PGC1α. • PRMT5 is a gene-selective co-activator for hCAR.
Xu, Yuli; Gristwood, Tamzin; Hodgson, Ben; Trinidad, Jonathan C; Albers, Sonja-Verena; Bell, Stephen D
2016-11-22
The regulated recruitment of Cdc45 and GINS is key to activating the eukaryotic MCM(2-7) replicative helicase. We demonstrate that the homohexameric archaeal MCM helicase associates with orthologs of GINS and Cdc45 in vivo and in vitro. Association of these factors with MCM robustly stimulates the MCM helicase activity. In contrast to the situation in eukaryotes, archaeal Cdc45 and GINS form an extremely stable complex before binding MCM. Further, the archaeal GINS•Cdc45 complex contains two copies of Cdc45. Our analyses give insight into the function and evolution of the conserved core of the archaeal/eukaryotic replisome.
Xia, Yisui; Niu, Yanling; Cui, Jiamin; Fu, Yang; Chen, Xiaojiang S; Lou, Huiqiang; Cao, Qinhong
2015-01-01
Lysine methylation and methyltransferases are widespread in the third domain of life, archaea. Nevertheless, the effects of methylation on archaeal proteins wait to be defined. Here, we report that recombinant sisMCM, an archaeal homolog of Mcm2-7 eukaryotic replicative helicase, is methylated by aKMT4 in vitro. Mono-methylation of these lysine residues occurs coincidently in the endogenous sisMCM protein purified from the hyperthermophilic Sulfolobus islandicus cells as indicated by mass spectra. The helicase activity of mini-chromosome maintenance (MCM) is stimulated by methylation, particularly at temperatures over 70°C. The methylated MCM shows optimal DNA unwinding activity after heat-treatment between 76 and 82°C, which correlates well with the typical growth temperatures of hyperthermophilic Sulfolobus. After methylation, the half life of MCM helicase is dramatically extended at 80°C. The methylated sites are located on the accessible protein surface, which might modulate the intra- and inter- molecular interactions through changing the hydrophobicity and surface charge. Furthermore, the methylation-mimic mutants of MCM show heat resistance helicase activity comparable to the methylated MCM. These data provide the biochemical evidence that posttranslational modifications such as methylation may enhance kinetic stability of proteins under the elevated growth temperatures of hyperthermophilic archaea.
Mechanism of Archaeal MCM Helicase Recruitment to DNA Replication Origins
Samson, Rachel Y.; Abeyrathne, Priyanka D.; Bell, Stephen D.
2015-01-01
Summary Cellular DNA replication origins direct the recruitment of replicative helicases via the action of initiator proteins belonging to the AAA+ superfamily of ATPases. Archaea have a simplified subset of the eukaryotic DNA replication machinery proteins and possess initiators that appear ancestral to both eukaryotic Orc1 and Cdc6. We have reconstituted origin-dependent recruitment of the homohexameric archaeal MCM in vitro with purified recombinant proteins. Using this system, we reveal that archaeal Orc1-1 fulfills both Orc1 and Cdc6 functions by binding to a replication origin and directly recruiting MCM helicase. We identify the interaction interface between these proteins and reveal how ATP binding by Orc1-1 modulates recruitment of MCM. Additionally, we provide evidence that an open-ring form of the archaeal MCM homohexamer is loaded at origins. PMID:26725007
Costa, Alessandro; Renault, Ludovic; Swuec, Paolo; Petojevic, Tatjana; Pesavento, James J; Ilves, Ivar; MacLellan-Gibson, Kirsty; Fleck, Roland A; Botchan, Michael R; Berger, James M
2014-01-01
The Cdc45/Mcm2-7/GINS (CMG) helicase separates DNA strands during replication in eukaryotes. How the CMG is assembled and engages DNA substrates remains unclear. Using electron microscopy, we have determined the structure of the CMG in the presence of ATPγS and a DNA duplex bearing a 3′ single-stranded tail. The structure shows that the MCM subunits of the CMG bind preferentially to single-stranded DNA, establishes the polarity by which DNA enters into the Mcm2-7 pore, and explains how Cdc45 helps prevent DNA from dissociating from the helicase. The Mcm2-7 subcomplex forms a cracked-ring, right-handed spiral when DNA and nucleotide are bound, revealing unexpected congruencies between the CMG and both bacterial DnaB helicases and the AAA+ motor of the eukaryotic proteasome. The existence of a subpopulation of dimeric CMGs establishes the subunit register of Mcm2-7 double hexamers and together with the spiral form highlights how Mcm2-7 transitions through different conformational and assembly states as it matures into a functional helicase. DOI: http://dx.doi.org/10.7554/eLife.03273.001 PMID:25117490
Miller, Justin M.; Enemark, Eric J.
2015-01-01
In eukaryotes, the replicative helicase is the large multisubunit CMG complex consisting of the Mcm2–7 hexameric ring, Cdc45, and the tetrameric GINS complex. The Mcm2–7 ring assembles from six different, related proteins and forms the core of this complex. In archaea, a homologous MCM hexameric ring functions as the replicative helicase at the replication fork. Archaeal MCM proteins form thermostable homohexamers, facilitating their use as models of the eukaryotic Mcm2–7 helicase. Here we review archaeal MCM helicase structure and function and how the archaeal findings relate to the eukaryotic Mcm2–7 ring. PMID:26539061
Fishburn, James; Tomko, Eric; Galburt, Eric; Hahn, Steven
2015-03-31
Formation of the RNA polymerase II (Pol II) open complex (OC) requires DNA unwinding mediated by the transcription factor TFIIH helicase-related subunit XPB/Ssl2. Because XPB/Ssl2 binds DNA downstream from the location of DNA unwinding, it cannot function using a conventional helicase mechanism. Here we show that yeast TFIIH contains an Ssl2-dependent double-stranded DNA translocase activity. Ssl2 tracks along one DNA strand in the 5' → 3' direction, implying it uses the nontemplate promoter strand to reel downstream DNA into the Pol II cleft, creating torsional strain and leading to DNA unwinding. Analysis of the Ssl2 and DNA-dependent ATPase activity of TFIIH suggests that Ssl2 has a processivity of approximately one DNA turn, consistent with the length of DNA unwound during transcription initiation. Our results can explain why maintaining the OC requires continuous ATP hydrolysis and the function of TFIIH in promoter escape. Our results also suggest that XPB/Ssl2 uses this translocase mechanism during DNA repair rather than physically wedging open damaged DNA.
Non-B DNA Secondary Structures and Their Resolution by RecQ Helicases
Directory of Open Access Journals (Sweden)
Sudha Sharma
2011-01-01
Full Text Available In addition to the canonical B-form structure first described by Watson and Crick, DNA can adopt a number of alternative structures. These non-B-form DNA secondary structures form spontaneously on tracts of repeat sequences that are abundant in genomes. In addition, structured forms of DNA with intrastrand pairing may arise on single-stranded DNA produced transiently during various cellular processes. Such secondary structures have a range of biological functions but also induce genetic instability. Increasing evidence suggests that genomic instabilities induced by non-B DNA secondary structures result in predisposition to diseases. Secondary DNA structures also represent a new class of molecular targets for DNA-interactive compounds that might be useful for targeting telomeres and transcriptional control. The equilibrium between the duplex DNA and formation of multistranded non-B-form structures is partly dependent upon the helicases that unwind (resolve these alternate DNA structures. With special focus on tetraplex, triplex, and cruciform, this paper summarizes the incidence of non-B DNA structures and their association with genomic instability and emphasizes the roles of RecQ-like DNA helicases in genome maintenance by resolution of DNA secondary structures. In future, RecQ helicases are anticipated to be additional molecular targets for cancer chemotherapeutics.
International Nuclear Information System (INIS)
Iwasaki, Shin
1984-01-01
Measurements of double differential cross sections (DDX) for several intermediate and heavy nuclei have been performed at 15 MeV in the Dynamitron Laboratory at Tohoku University. Comparison of the experimental data with the evaluated nuclear data file, ENDF/B-IV revealed that the data file could not reproduce the experimental ones, particularly in the angular distributions. Nuclear model calculation showed that the preequilibrium process was important in the present incident energy region. Measurements have been performed for titanium, niobium, molybdenum, lead, and thorium (in progress), including the light elements, carbon and aluminum. (author)
5S ribosomal RNA database Y2K.
Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A
2000-01-01
This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.
Ogino, Minako; Ogino, Tomoaki
2017-03-15
The GDP polyribonucleotidyltransferase (PRNTase) domain of the multifunctional L protein of rhabdoviruses, such as vesicular stomatitis virus (VSV) and rabies virus, catalyzes the transfer of 5'-phospho-RNA (pRNA) from 5'-triphospho-RNA (pppRNA) to GDP via a covalent enzyme-pRNA intermediate to generate a 5'-cap structure (GpppA). Here, using an improved oligo-RNA capping assay with the VSV L protein, we showed that the Michaelis constants for GDP and pppAACAG (VSV mRNA-start sequence) are 0.03 and 0.4 μM, respectively. A competition assay between GDP and GDP analogues in the GpppA formation and pRNA transfer assay using GDP analogues as pRNA acceptors indicated that the PRNTase domain recognizes the C-2-amino group, but not the C-6-oxo group, N-1-hydrogen, or N-7-nitrogen, of GDP for the cap formation. 2,6-Diaminopurine-riboside (DAP), 7-deazaguanosine (7-deaza-G), and 7-methylguanosine (m 7 G) diphosphates efficiently accepted pRNA, resulting in the formation of DAPpppA, 7-deaza-GpppA, and m 7 GpppA (cap 0), respectively. Furthermore, either the 2'- or 3'-hydroxyl group of GDP was found to be required for efficient pRNA transfer. A 5'-diphosphate form of antiviral ribavirin weakly inhibited the GpppA formation but did not act as a pRNA acceptor. These results indicate that the PRNTase domain has a unique guanosine-binding mode different from that of eukaryotic mRNA capping enzyme, guanylyltransferase. IMPORTANCE mRNAs of nonsegmented negative-strand (NNS) RNA viruses, such as VSV, possess a fully methylated cap structure, which is required for mRNA stability, efficient translation, and evasion of antiviral innate immunity in host cells. GDP polyribonucleotidyltransferase (PRNTase) is an unconventional mRNA capping enzyme of NNS RNA viruses that is distinct from the eukaryotic mRNA capping enzyme, guanylyltransferase. In this study, we studied the pRNA acceptor specificity of VSV PRNTase using various GDP analogues and identified chemical groups of GDP as
Time of action of 4.5 S RNA in Escherichia coli translation
DEFF Research Database (Denmark)
Brown, S
1989-01-01
A new class of suppressor mutants helps to define the role of 4.5 S RNA in translation. The suppressors reduce the requirement for 4.5 S RNA by increasing the intracellular concentration of uncharged tRNA. Suppression probably occurs by prolonging the period in which translating ribosomes have...... translocated but not yet released the uncharged tRNA, indicating that this is the point at which 4.5 S RNA enters translation. The release of 4.5 S RNA from polysomes is affected by antibiotics that inhibit protein synthesis. The antibiotic-sensitivity of this release indicates that 4.5 S RNA exits...... the ribosome following translocation and prior to release of protein synthesis elongation factor G. These results indicate that 4.5 S RNA acts immediately after ribosomal translocation. A model is proposed in which 4.5 S RNA stabilizes the post-translocation state by replacing 23 S ribosomal RNA as a binding...
Schulte, Barbara M; Gielen, Paul R; Kers-Rebel, Esther D; Prosser, Amy C; Lind, Katharina; Flodström-Tullberg, Malin; Tack, Cees J; Elving, Lammy D; Adema, Gosse J
2016-09-01
In children at risk for type 1 diabetes, innate immune activity is detected before seroconversion. Enterovirus infections have been linked to diabetes development, and a polymorphism (A946T) in the innate immune sensor recognizing enterovirus RNA, interferon-induced with helicase C domain 1/melanoma differentiation-associated protein 5, predisposes to disease. We hypothesized that the strength of innate antienteroviral responses is affected in autoimmune type 1 diabetes patients and linked to the A946T polymorphism. We compared induction of interferon-stimulated genes (ISGs) in peripheral blood mononuclear cells (PBMCs) and dendritic cells (DCs) in healthy individuals and diabetes patients upon stimulation with enterovirus, enterovirus-antibody complexes, or ligands mimicking infection in relation to the A946T polymorphism. Overall, PBMCs of diabetes patients and healthy donors showed comparable ISG induction upon stimulation. No differences were observed in DCs. Interestingly, the data imply that the magnitude of responses to enterovirus and enterovirus-antibody complexes in PBMCs is critically influenced by the A946T polymorphism and elevated in heterozygotes compared to TT homozygous individuals in autoimmune diabetes patients, but not healthy controls. These data imply an intrinsic difference in the responses to enterovirus and enterovirus-antibody complexes in diabetes patients carrying a TT risk genotype compared to heterozygotes that may influence control of enterovirus clearance.
Kanamori, Hiroshi; Yuhashi, Kazuhito; Ohnishi, Shin; Koike, Kazuhiko; Kodama, Tatsuhiko
2010-05-01
The hepatitis C virus NS5B RNA-dependent RNA polymerase (RdRp) is a key enzyme involved in viral replication. Interaction between NS5B RdRp and the viral RNA sequence is likely to be an important step in viral RNA replication. The C-terminal half of the NS5B-coding sequence, which contains the important cis-acting replication element, has been identified as an NS5B-binding sequence. In the present study, we confirm the specific binding of NS5B to one of the RNA stem-loop structures in the region, 5BSL3.2. In addition, we show that NS5B binds to the complementary strand of 5BSL3.2 (5BSL3.2N). The bulge structure of 5BSL3.2N was shown to be indispensable for tight binding to NS5B. In vitro RdRp activity was inhibited by 5BSL3.2N, indicating the importance of the RNA element in the polymerization by RdRp. These results suggest the involvement of the RNA stem-loop structure of the negative strand in the replication process.
Directory of Open Access Journals (Sweden)
Brewster Aaron S
2010-08-01
Full Text Available Abstract Background The mini-chromosome maintenance protein (MCM complex is an essential replicative helicase for DNA replication in Archaea and Eukaryotes. While the eukaryotic complex consists of six homologous proteins (MCM2-7, the archaeon Sulfolobus solfataricus has only one MCM protein (ssoMCM, six subunits of which form a homohexamer. We have recently reported a 4.35Å crystal structure of the near full-length ssoMCM. The structure reveals a total of four β-hairpins per subunit, three of which are located within the main channel or side channels of the ssoMCM hexamer model generated based on the symmetry of the N-terminal Methanothermobacter thermautotrophicus (mtMCM structure. The fourth β-hairpin, however, is located on the exterior of the hexamer, near the exit of the putative side channels and next to the ATP binding pocket. Results In order to better understand this hairpin's role in DNA binding and helicase activity, we performed a detailed mutational and biochemical analysis of nine residues on this exterior β-hairpin (EXT-hp. We examined the activities of the mutants related to their helicase function, including hexamerization, ATPase, DNA binding and helicase activities. The assays showed that some of the residues on this EXT-hp play a role for DNA binding as well as for helicase activity. Conclusions These results implicate several current theories regarding helicase activity by this critical hexameric enzyme. As the data suggest that EXT-hp is involved in DNA binding, the results reported here imply that the EXT-hp located near the exterior exit of the side channels may play a role in contacting DNA substrate in a manner that affects DNA unwinding.
Lasalde, Clarivel; Rivera, Andrea V; León, Alfredo J; González-Feliciano, José A; Estrella, Luis A; Rodríguez-Cruz, Eva N; Correa, María E; Cajigas, Iván J; Bracho, Dina P; Vega, Irving E; Wilkinson, Miles F; González, Carlos I
2014-02-01
One third of inherited genetic diseases are caused by mRNAs harboring premature termination codons as a result of nonsense mutations. These aberrant mRNAs are degraded by the Nonsense-Mediated mRNA Decay (NMD) pathway. A central component of the NMD pathway is Upf1, an RNA-dependent ATPase and helicase. Upf1 is a known phosphorylated protein, but only portions of this large protein have been examined for phosphorylation sites and the functional relevance of its phosphorylation has not been elucidated in Saccharomyces cerevisiae. Using tandem mass spectrometry analyses, we report the identification of 11 putative phosphorylated sites in S. cerevisiae Upf1. Five of these phosphorylated residues are located within the ATPase and helicase domains and are conserved in higher eukaryotes, suggesting a biological significance for their phosphorylation. Indeed, functional analysis demonstrated that a small carboxy-terminal motif harboring at least three phosphorylated amino acids is important for three Upf1 functions: ATPase activity, NMD activity and the ability to promote translation termination efficiency. We provide evidence that two tyrosines within this phospho-motif (Y-738 and Y-742) act redundantly to promote ATP hydrolysis, NMD efficiency and translation termination fidelity.
Qiao, Qi; Yan, Yanhua; Guo, Jinmei; Du, Shuqiang; Zhang, Jiangtao; Jia, Ruyue; Ren, Haimin; Qiao, Yuanbiao; Li, Qingshan
2017-06-01
Programmed '-1' ribosomal frameshifting is necessary for expressing the pol gene overlapped from a gag of human immunodeficiency virus. A viral RNA structure that requires base pairing across the overlapping sequence region suggests a mechanism of regulating ribosome and helicase traffic during expression. To get precise roles of an element around the frameshift site, a review on architecture of the frameshifting RNA is performed in combination of reported information with augments of a representative set of 19 viral samples. In spite of a different length for the viral RNAs, a canonical comparison on the element sequence allocation is performed for viewing variability associations between virus genotypes. Additionally, recent and historical insights recognized in frameshifting regulation are looked back as for indel and single nucleotide polymorphism of RNA. As specially noted, structural changes at a frameshift site, the spacer sequence, and a three-helix junction element, as well as two Watson-Crick base pairs near a bulge and a C-G pair close a loop, are the most vital strategies for the virus frameshifting regulations. All of structural changes, which are dependent upon specific sequence variations, facilitate an elucidation about the RNA element conformation-dependent mechanism for frameshifting. These facts on disrupting base pair interactions also allow solving the problem of competition between ribosome and helicase on a same RNA template, common to single-stranded RNA viruses. In a broad perspective, each new insight of frameshifting regulation in the competition systems introduced by the RNA element construct changes will offer a compelling target for antiviral therapy.
BLM helicase suppresses recombination at G-quadruplex motifs in transcribed genes
van Wietmarschen, Niek; Merzouk, Sarra; Halsema, Nancy; Spierings, Diana C J; Guryev, Victor; Lansdorp, Peter M
2018-01-01
Bloom syndrome is a cancer predisposition disorder caused by mutations in the BLM helicase gene. Cells from persons with Bloom syndrome exhibit striking genomic instability characterized by excessive sister chromatid exchange events (SCEs). We applied single-cell DNA template strand sequencing
Directory of Open Access Journals (Sweden)
Morra Rosa
2011-04-01
Full Text Available Abstract Background The male-specific lethal (MSL complex of Drosophila remodels the chromatin of the X chromosome in males to enhance the level of transcription of most X-linked genes, and thereby achieve dosage compensation. The core complex consists of five proteins and one of two non-coding RNAs. One of the proteins, MOF (males absent on the first, is a histone acetyltransferase that specifically acetylates histone H4 at lysine 16. Another protein, maleless (MLE, is an ATP-dependent helicase with the ability to unwind DNA/RNA or RNA/RNA substrates in vitro. Recently, we showed that the ATPase activity of MLE is sufficient for the hypertranscription of genes adjacent to a high-affinity site by MSL complexes located at that site. The helicase activity is required for the spreading of the complex to the hundreds of positions along the X chromosome, where it is normally found. In this study, to further understand the role of MLE in the function of the MSL complex, we analyzed its relationship to the other complex components by creating a series of deletions or mutations in its putative functional domains, and testing their effect on the distribution and function of the complex in vivo. Results The presence of the RB2 RNA-binding domain is necessary for the association of the MSL3 protein with the other complex subunits. In its absence, the activity of the MOF subunit was compromised, and the complex failed to acetylate histone H4 at lysine 16. Deletion of the RB1 RNA-binding domain resulted in complexes that maintained substantial acetylation activity but failed to spread beyond the high-affinity sites. Flies bearing this mutation exhibited low levels of roX RNAs, indicating that these RNAs failed to associate with the proteins of the complex and were degraded, or that MLE contributes to their synthesis. Deletion of the glycine-rich C-terminal region, which contains a nuclear localization sequence, caused a substantial level of retention of the
Szymanski, Maciej; Karlowski, Wojciech M
2016-01-01
In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.
Directory of Open Access Journals (Sweden)
Marija Maric
2017-03-01
Full Text Available Disassembly of the Cdc45-MCM-GINS (CMG DNA helicase is the key regulated step during DNA replication termination in eukaryotes, involving ubiquitylation of the Mcm7 helicase subunit, leading to a disassembly process that requires the Cdc48 “segregase”. Here, we employ a screen to identify partners of budding yeast Cdc48 that are important for disassembly of ubiquitylated CMG helicase at the end of chromosome replication. We demonstrate that the ubiquitin-binding Ufd1-Npl4 complex recruits Cdc48 to ubiquitylated CMG. Ubiquitylation of CMG in yeast cell extracts is dependent upon lysine 29 of Mcm7, which is the only detectable site of ubiquitylation both in vitro and in vivo (though in vivo other sites can be modified when K29 is mutated. Mutation of K29 abrogates in vitro recruitment of Ufd1-Npl4-Cdc48 to the CMG helicase, supporting a model whereby Ufd1-Npl4 recruits Cdc48 to ubiquitylated CMG at the end of chromosome replication, thereby driving the disassembly reaction.
Mukherjee, Sourav; Weiner, Warren S.; Schroeder, Chad E.; Simpson, Denise S.; Hanson, Alicia M.; Sweeney, Noreena L.; Marvin, Rachel K.; Ndjomou, Jean; Kolli, Rajesh; Isailovic, Dragan; Schoenen, Frank J.; Frick, David N.
2014-01-01
The hepatitis C virus (HCV) nonstructural protein 3 (NS3) is both a protease, which cleaves viral and host proteins, and a helicase that separates nucleic acid strands, using ATP hydrolysis to fuel the reaction. Many antiviral drugs, and compounds in clinical trials, target the NS3 protease, but few helicase inhibitors that function as antivirals have been reported. This study focuses on the analysis of the mechanism by which ebselen (2-phenyl-1,2-benzisoselenazol-3-one), a compound previousl...
Ogino, Minako
2017-01-01
ABSTRACT The GDP polyribonucleotidyltransferase (PRNTase) domain of the multifunctional L protein of rhabdoviruses, such as vesicular stomatitis virus (VSV) and rabies virus, catalyzes the transfer of 5′-phospho-RNA (pRNA) from 5′-triphospho-RNA (pppRNA) to GDP via a covalent enzyme-pRNA intermediate to generate a 5′-cap structure (GpppA). Here, using an improved oligo-RNA capping assay with the VSV L protein, we showed that the Michaelis constants for GDP and pppAACAG (VSV mRNA-start sequence) are 0.03 and 0.4 μM, respectively. A competition assay between GDP and GDP analogues in the GpppA formation and pRNA transfer assay using GDP analogues as pRNA acceptors indicated that the PRNTase domain recognizes the C-2-amino group, but not the C-6-oxo group, N-1-hydrogen, or N-7-nitrogen, of GDP for the cap formation. 2,6-Diaminopurine-riboside (DAP), 7-deazaguanosine (7-deaza-G), and 7-methylguanosine (m7G) diphosphates efficiently accepted pRNA, resulting in the formation of DAPpppA, 7-deaza-GpppA, and m7GpppA (cap 0), respectively. Furthermore, either the 2′- or 3′-hydroxyl group of GDP was found to be required for efficient pRNA transfer. A 5′-diphosphate form of antiviral ribavirin weakly inhibited the GpppA formation but did not act as a pRNA acceptor. These results indicate that the PRNTase domain has a unique guanosine-binding mode different from that of eukaryotic mRNA capping enzyme, guanylyltransferase. IMPORTANCE mRNAs of nonsegmented negative-strand (NNS) RNA viruses, such as VSV, possess a fully methylated cap structure, which is required for mRNA stability, efficient translation, and evasion of antiviral innate immunity in host cells. GDP polyribonucleotidyltransferase (PRNTase) is an unconventional mRNA capping enzyme of NNS RNA viruses that is distinct from the eukaryotic mRNA capping enzyme, guanylyltransferase. In this study, we studied the pRNA acceptor specificity of VSV PRNTase using various GDP analogues and identified chemical groups
Strand-specific RNA-seq analysis of the Lactobacillus delbrueckii subsp. bulgaricus transcriptome.
Zheng, Huajun; Liu, Enuo; Shi, Tao; Ye, Luyi; Konno, Tomonobu; Oda, Munehiro; Ji, Zai-Si
2016-02-01
Lactobacillus delbrueckii subsp. bulgaricus 2038 (Lb. bulgaricus 2038) is an industrial bacterium that is used as a starter for dairy products. We proposed several hypotheses concerning its industrial features previously. Here, we utilized RNA-seq to explore the transcriptome of Lb. bulgaricus 2038 from four different growth phases under whey conditions. The most abundantly expressed genes in the four stages were mainly involved in translation (for the logarithmic stage), glycolysis (for control/lag stages), lactic acid production (all the four stages), and 10-formyl tetrahydrofolate production (for the stationary stage). The high expression of genes like d-lactate dehydrogenase was thought as a result of energy production, and consistent expression of EPS synthesis genes, the restriction-modification (RM) system and the CRISPR/Cas system were validated for explaining the advantage of this strain in yoghurt production. Several postulations, like NADPH production through GapN bypass, converting aspartate into carbon-skeleton intermediates, and formate production through degrading GTP, were proved not working under these culture conditions. The high expression of helicase genes and co-expressed amino acids/oligopeptides transporting proteins indicated that the helicase might mediate the strain obtaining nitrogen source from the environment. The transport system of Lb. bulgaricus 2038 was found to be regulated by antisense RNA, hinting the potential application of non-coding RNA in regulating lactic acid bacteria (LAB) gene expression. Our study has primarily uncovered Lb. bulgaricus 2038 transcriptome, which could gain a better understanding of the regulation system in Lb. bulgaricus and promote its industrial application.
Energy Technology Data Exchange (ETDEWEB)
Karpus, Olga N.; Hsiao, Cheng-Chih; Kort, Hanneke de; Tak, Paul P.; Hamann, Jörg, E-mail: j.hamann@amc.uva.nl
2016-08-26
Fibroblast-like synoviocytes (FLS) express functional membranous and cytoplasmic sensors for double-stranded (ds)RNA. Notably, FLS undergo apoptosis upon transfection with the synthetic dsRNA analog poly(I:C). We here studied the mechanism of intracellular poly(I:C) recognition and subsequent cell death in FLS. FLS responded similarly to poly(I:C) or 3pRNA transfection; however, only intracellular delivery of poly(I:C) induced significant cell death, accompanied by upregulation of pro-apoptotic proteins Puma and Noxa, caspase 3 cleavage, and nuclear segregation. Knockdown of the DExD/H-box helicase MDA5 did not affect the response to intracellular poly(I:C); in contrast, knockdown of RIG-I abrogated the response to 3pRNA. Knockdown of the downstream adaptor proteins IPS, STING, and TRIF or inhibition of TBK1 did not affect the response to intracellular poly(I:C), while knockdown of IFNAR blocked intracellular poly(I:C)-mediated signaling and cell death. We conclude that a so far unknown intracellular sensor recognizes linear dsRNA and induces apoptosis in FLS. - Highlights: • Intracellular poly(I:C) and 3pRNA evoke immune responses in FLS. • Only intracellular delivery of poly(I:C) induces FLS apoptosis. • FLS do not require MDA5 for their response to intracellular poly(I:C). • FLS respond to intracellular poly(I:C) independent of IPS and STING. • An unknown intracellular sensor recognizes linear dsRNA in FLS.
Evolution of primary and secondary structures in 5S and 5.8S rRNA
International Nuclear Information System (INIS)
Curtiss, W.C.
1986-01-01
The secondary structure of Bombyx mori 5S rRNA was studied using the sing-strand specific S1 nuclease and the base pair specific cobra venom ribonuclease. The RNA was end-labeled with [ 32 P] at either the 5' or 3' end and sequenced using enzymatic digestion techniques. These enzymatic data coupled with thermodynamic structure prediction were used to generate a secondary structure for 5S rRNA. A computer algorithm has been implemented to aid in the comparison of a large set of homologous RNAs. Eukaryotic 5S rRNA sequences from thirty four diverse species were compared by (1) alignment or the sequences, (2) the positions of substitutions were located with respect to the aligned sequence and secondary structure, and (3) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. Eukaryotic 5S rRNA was found to have significant sequence variation throughout much of the molecule while maintaining a relatively constant secondary structure. A detailed analysis of the sequence and structure variability in each region of the molecule is presented
Epstein-Barr virus nuclear antigen 3C stabilizes Gemin3 to block p53-mediated apoptosis.
Directory of Open Access Journals (Sweden)
Qiliang Cai
2011-12-01
Full Text Available The Epstein-Barr nuclear antigen 3C (EBNA3C, one of the essential latent antigens for Epstein-Barr virus (EBV-induced immortalization of primary human B lymphocytes in vitro, has been implicated in regulating cell proliferation and anti-apoptosis via interaction with several cellular and viral factors. Gemin3 (also named DDX20 or DP103 is a member of DEAD RNA helicase family which exhibits diverse cellular functions including DNA transcription, recombination and repair, and RNA metabolism. Gemin3 was initially identified as a binding partner to EBNA2 and EBNA3C. However, the mechanism by which EBNA3C regulates Gemin3 function remains unclear. Here, we report that EBNA3C directly interacts with Gemin3 through its C-terminal domains. This interaction results in increased stability of Gemin3 and its accumulation in both B lymphoma cells and EBV transformed lymphoblastoid cell lines (LCLs. Moreover, EBNA3C promotes formation of a complex with p53 and Gemin3 which blocks the DNA-binding affinity of p53. Small hairpin RNA based knockdown of Gemin3 in B lymphoma or LCL cells remarkably attenuates the ability of EBNA3C to inhibit the transcription activity of p53 on its downstream genes p21 and Bax, as well as apoptosis. These findings provide the first evidence that Gemin3 may be a common target of oncogenic viruses for driving cell proliferation and anti-apoptotic activities.
3'-5' RNA degradation pathways in human cells
DEFF Research Database (Denmark)
Lubas, Michal Szymon
RNA synthesis and degradation are key steps in the regulation of gene expression in all living organisms. During the course of his PhD studies, Michal Lubas centred his research on the nuclear and cytoplasmic RNA turnover of both noncoding and coding RNAs in human cells. His proteomic studies...... revealed the interaction network of the main 3'-5' RNA degradation machinery – the RNA exosome complex. One of the key findings was the identification and characterisation of the Nuclear Exosome Targeting (NEXT) complex, important for nuclear functions of the exosome. Michal Lubas also studied the role...
Role of the hydrophilic channels of simian virus 40 T-antigen helicase in DNA replication.
Wang, Weiping; Manna, David; Simmons, Daniel T
2007-05-01
The simian virus 40 (SV40) hexameric helicase consists of a central channel and six hydrophilic channels located between adjacent large tier domains within each hexamer. To study the function of the hydrophilic channels in SV40 DNA replication, a series of single-point substitutions were introduced at sites not directly involved in protein-protein contacts. The mutants were characterized biochemically in various ways. All mutants oligomerized normally in the absence of DNA. Interestingly, 8 of the 10 mutants failed to unwind an origin-containing DNA fragment and nine of them were totally unable to support SV40 DNA replication in vitro. The mutants fell into four classes based on their biochemical properties. Class A mutants bound DNA normally and had normal ATPase and helicase activities but failed to unwind origin DNA and support SV40 DNA replication. Class B mutants were compromised in single-stranded DNA and origin DNA binding at low protein concentrations. They were defective in helicase activity and unwinding of the origin and in supporting DNA replication. Class C and D mutants possessed higher-than-normal single-stranded DNA binding activity at low protein concentrations. The class C mutants failed to separate origin DNA and support DNA replication. The class D mutants unwound origin DNA normally but were compromised in their ability to support DNA replication. Taken together, these results suggest that the hydrophilic channels have an active role in the unwinding of SV40 DNA from the origin and the placement of the resulting single strands within the helicase.
A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex
Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen
2012-01-01
P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981
A viral microRNA down-regulates multiple cell cycle genes through mRNA 5'UTRs.
Directory of Open Access Journals (Sweden)
Finn Grey
2010-06-01
Full Text Available Global gene expression data combined with bioinformatic analysis provides strong evidence that mammalian miRNAs mediate repression of gene expression primarily through binding sites within the 3' untranslated region (UTR. Using RNA induced silencing complex immunoprecipitation (RISC-IP techniques we have identified multiple cellular targets for a human cytomegalovirus (HCMV miRNA, miR-US25-1. Strikingly, this miRNA binds target sites primarily within 5'UTRs, mediating significant reduction in gene expression. Intriguingly, many of the genes targeted by miR-US25-1 are associated with cell cycle control, including cyclin E2, BRCC3, EID1, MAPRE2, and CD147, suggesting that miR-US25-1 is targeting genes within a related pathway. Deletion of miR-US25-1 from HCMV results in over expression of cyclin E2 in the context of viral infection. Our studies demonstrate that a viral miRNA mediates translational repression of multiple cellular genes by targeting mRNA 5'UTRs.
DEFF Research Database (Denmark)
Rosenthal, Andrew S; Dexheimer, Thomas S; Gileadi, Opher
2013-01-01
complementary strands of duplex DNA as well as atypical DNA structures such as Holliday junctions. Mutations of the BLM gene can result in Bloom syndrome, an autosomal recessive disorder associated with cancer predisposition. BLM-deficient cells exhibit increased sensitivity to DNA damaging agents indicating...... and related analogs, which possess potent BLM inhibition and exhibit selectivity over related helicases. Moreover, these compounds demonstrated cellular activity by inducing sister chromatid exchanges, a hallmark of Bloom syndrome....
Di Terlizzi, B; Skrzeczkowski, L J; Mink, G I; Scott, S W; Zimmerman, M T
2001-01-01
In addition to the four RNAs known to be encapsidated by Prunus necrotic ringspot virus (PNRSV) and Apple mosaic virus (ApMV), an additional small RNA (RNA 5) was present in purified preparations of several isolates of both viruses. RNA 5 was always produced following infection of a susceptible host by an artificial mixture of RNAs 1, 2, 3, and 4 indicating that it was a product of viral replication. RNA 5 does not activate the infectivity of mixtures that contain the three genomic RNAs (RNA 1 + RNA 2 + RNA 3) nor does it appear to modify symptom expression. Results from hybridization studies suggested that RNA 5 had partial sequence homology with RNAs 1, 2, 3, and 4. Cloning and sequencing the RNA 5 of isolate CH 57/1-M of PNRSV, and the 3' termini of the RNA 1, RNA 2 and RNA 3 of this isolate indicated that it was a copy of the 3' untranslated terminal region (3'-UTR) of the genomic RNA 3.
Escherichia coli and Neisseria gonorrhoeae UvrD helicase unwinds G4 DNA structures.
Shukla, Kaustubh; Thakur, Roshan Singh; Ganguli, Debayan; Rao, Desirazu Narasimha; Nagaraju, Ganesh
2017-10-18
G-quadruplex (G4) secondary structures have been implicated in various biological processes, including gene expression, DNA replication and telomere maintenance. However, unresolved G4 structures impede replication progression which can lead to the generation of DNA double-strand breaks and genome instability. Helicases have been shown to resolve G4 structures to facilitate faithful duplication of the genome. Escherichia coli UvrD (EcUvrD) helicase plays a crucial role in nucleotide excision repair, mismatch repair and in the regulation of homologous recombination. Here, we demonstrate a novel role of E. coli and Neisseria gonorrhoeae UvrD in resolving G4 tetraplexes. EcUvrD and N gonorrhoeae UvrD were proficient in unwinding previously characterized tetramolecular G4 structures. Notably, EcUvrD was equally efficient in resolving tetramolecular and bimolecular G4 DNA that were derived from the potential G4-forming sequences from the genome of E. coli Interestingly, in addition to resolving intermolecular G4 structures, EcUvrD was robust in unwinding intramolecular G4 structures. These data for the first time provide evidence for the role of UvrD in the resolution of G4 structures, which has implications for the in vivo role of UvrD helicase in G4 DNA resolution and genome maintenance. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.
Human RecQL4 helicase plays critical roles in prostate carcinogenesis
DEFF Research Database (Denmark)
Su, Yanrong; Meador, Jarah A; Calaf, Gloria M
2010-01-01
Prostate cancer is the second leading cause of cancer-associated deaths among men in the western countries. Here, we report that human RecQL4 helicase, which is implicated in the pathogenesis of a subset of cancer-prone Rothmund-Thomson syndrome, is highly elevated in metastatic prostate cancer c...
Directory of Open Access Journals (Sweden)
Katherine S. Bridge
2017-07-01
Full Text Available As core components of the microRNA-induced silencing complex (miRISC, Argonaute (AGO proteins interact with TNRC6 proteins, recruiting other effectors of translational repression/mRNA destabilization. Here, we show that LIMD1 coordinates the assembly of an AGO-TNRC6 containing miRISC complex by binding both proteins simultaneously at distinct interfaces. Phosphorylation of AGO2 at Ser 387 by Akt3 induces LIMD1 binding, which in turn enables AGO2 to interact with TNRC6A and downstream effector DDX6. Conservation of this serine in AGO1 and 4 indicates this mechanism may be a fundamental requirement for AGO function and miRISC assembly. Upon CRISPR-Cas9-mediated knockout of LIMD1, AGO2 miRNA-silencing function is lost and miRNA silencing becomes dependent on a complex formed by AGO3 and the LIMD1 family member WTIP. The switch to AGO3 utilization occurs due to the presence of a glutamic acid residue (E390 on the interaction interface, which allows AGO3 to bind to LIMD1, AJUBA, and WTIP irrespective of Akt signaling.
The MCM Helicase Motor of the Eukaryotic Replisome.
Abid Ali, Ferdos; Costa, Alessandro
2016-05-08
The MCM motor of the CMG helicase powers ahead of the eukaryotic replication machinery to unwind DNA, in a process that requires ATP hydrolysis. The reconstitution of DNA replication in vitro has established the succession of events that lead to replication origin activation by the MCM and recent studies have started to elucidate the structural basis of duplex DNA unwinding. Despite the exciting progress, how the MCM translocates on DNA remains a matter of debate. Copyright © 2016. Published by Elsevier Ltd.
Secondary structure of 5S RNA: NMR experiments on RNA molecules partially labeled with Nitrogen-15
International Nuclear Information System (INIS)
Gewirth, D.T.; Abo, S.R.; Leontis, N.B.; Moore, P.B.
1987-01-01
A method has been found for reassembling fragment 1 of Escherichia coli 5S RNA from mixtures containing strand III (bases 69-87) and the complex consisting of strand II (bases 89-120) and strand IV (bases 1-11). The reassembled molecule is identical with unreconstituted fragment 1. With this technique, fragment 1 molecules have been constructed 15 N-labeled either in strand III or in the strand II-strand IV complex. Spectroscopic data obtained with these partially labeled molecules show that the terminal helix of 5S RNA includes the GU and GC base pairs at positions 9 and 10 which the standard model for 5S secondary structure predicts but that these base pairs are unstable both in the fragment and in native 5S RNA. The data also assign three resonances to the helix V region of the molecule (bases 70-77 and 99-106). None of these resonances has a normal chemical shift even though two of them correspond to AU or GU base pairs in the standard model. The implications of these findings for the authors understanding of the structure of 5S RNA and its complex with ribosomal protein L25 are discussed
Directory of Open Access Journals (Sweden)
Stern David B
2010-09-01
Full Text Available Abstract Background The roles of non-coding RNAs in regulating gene expression have been extensively studied in both prokaryotes and eukaryotes, however few reports exist as to their roles in organellar gene regulation. Evidence for accumulation of natural antisense RNAs (asRNAs in chloroplasts comes from the expressed sequence tag database and cDNA libraries, while functional data have been largely obtained from artificial asRNAs. In this study, we used Nicotiana tabacum to investigate the effect on sense strand transcripts of overexpressing a natural chloroplast asRNA, AS5, which is complementary to the region which encodes the 5S rRNA and tRNAArg. Results AS5-overexpressing (AS5ox plants obtained by chloroplast transformation exhibited slower growth and slightly pale green leaves. Analysis of AS5 transcripts revealed four distinct species in wild-type (WT and AS5ox plants, and additional AS5ox-specific products. Of the corresponding sense strand transcripts, tRNAArg overaccumulated several-fold in transgenic plants whereas 5S rRNA was unaffected. However, run-on transcription showed that the 5S-trnR region was transcribed four-fold more in the AS5ox plants compared to WT, indicating that overexpression of AS5 was associated with decreased stability of 5S rRNA. In addition, polysome analysis of the transformants showed less 5S rRNA and rbcL mRNA associated with ribosomes. Conclusions Our results suggest that AS5 can modulate 5S rRNA levels, giving it the potential to affect Chloroplast translation and plant growth. More globally, overexpression of asRNAs via chloroplast transformation may be a useful strategy for defining their functions.
MDA5 Detects the Double-Stranded RNA Replicative Form in Picornavirus-Infected Cells
Directory of Open Access Journals (Sweden)
Qian Feng
2012-11-01
Full Text Available RIG-I and MDA5 are cytosolic RNA sensors that play a critical role in innate antiviral responses. Major advances have been made in identifying RIG-I ligands, but our knowledge of the ligands for MDA5 remains restricted to data from transfection experiments mostly using poly(I:C, a synthetic dsRNA mimic. Here, we dissected the IFN-α/β-stimulatory activity of different viral RNA species produced during picornavirus infection, both by RNA transfection and in infected cells in which specific steps of viral RNA replication were inhibited. Our results show that the incoming genomic plus-strand RNA does not activate MDA5, but minus-strand RNA synthesis and production of the 7.5 kbp replicative form trigger a strong IFN-α/β response. IFN-α/β production does not rely on plus-strand RNA synthesis and thus generation of the partially double-stranded replicative intermediate. This study reports MDA5 activation by a natural RNA ligand under physiological conditions.
Distinct functions of human RecQ helicases during DNA replication
Czech Academy of Sciences Publication Activity Database
Urban, Václav; Dobrovolná, Jana; Janščák, Pavel
2017-01-01
Roč. 225, červen (2017), s. 20-26 ISSN 0301-4622 R&D Projects: GA ČR(CZ) GA14-05743S; GA MŠk LH14037 Institutional support: RVO:68378050 Keywords : DNA replication * Replication stress * RecQ helicases * Genomic instability * Cancer Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Biochemistry and molecular biology Impact factor: 2.402, year: 2016
Toxin MqsR Cleaves Single-Stranded mRNA with Various 5 Ends
2016-08-24
either protein ORIGINAL RESEARCH Toxin MqsR cleaves single- stranded mRNA with various 5’ ends Nityananda Chowdhury1,*, Brian W. Kwan1,*, Louise C...in which a single 5′- GCU site was predicted to be single- stranded (ssRNA), double- stranded (dsRNA), in the loop of a stem - loop (slRNA), or in a...single- stranded 5′- GCU sites since cleavage was approximately 20- fold higher than cleavage seen with the 5′- GCU site in the stem - loop and
Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry
DEFF Research Database (Denmark)
Kirpekar, F; Douthwaite, S; Roepstorff, P
2000-01-01
RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus...... that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated......, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here....
Zhu, Xiao; Kong, Qingming; Xie, Liwei; Chen, Zhihong; Li, Hongmei; Zhu, Zhu; Huang, Yongmei; Lan, Feifei; Luo, Haiqing; Zhan, Jingting; Ding, Hongrong; Lei, Jinli; Xiao, Qin; Fu, Weiming; Fan, Wenguo; Zhang, Jinfang; Luo, Hui
2018-01-01
Previous studies showed that the low expressions of chromodomain-helicase-DNA-binding protein 5 (CHD5) were intensively associated with deteriorative biologic and clinical characteristics as well as outcomes in many tumors. The aim of this study is to determine whether CHD5 single nucleotide polymorphisms (SNPs) contribute to the prognosis of hepatocellular carcima (HCC). The SNPs were selected according to their linkage disequilibrium (LD) in the targeted next-generation sequencing (NGS) and then genotyped with TaqMan probers. We revealed a rare haplotype AG in CHD5 (SNPs: rs12564469-rs9434711) was markedly associated with HCC prognosis. The univariate and multivariate regression analyses revealed the patients with worse overall survival time were those with tumor metastasis and haplotype AG, as well as cirrhosis, poor differentiation and IV-TNM stage. Based on the available public databases, we discovered the significant association between haplotype AG and CHD5 mRNA expressions only existed in Chinese. These data proposed that the potentially genetic haplotype might functionally contribute to HCC prognosis and CHD5 mRNA expressions. PMID:29568352
Pankovics, Péter; Simmonds, Peter
2011-01-01
A novel positive-sense, single-stranded RNA (+ssRNA) virus (Halastavi árva RNA virus, HalV; JN000306) with di-cistronic genome organization was serendipitously identified in intestinal contents of freshwater carps (Cyprinus carpio) fished by line-fishing from fishpond “Lőrinte halastó” located in Veszprém County, Hungary. The complete nucleotide (nt) sequence of the genomic RNA is 9565 nt in length and contains two long - non-in-frame - open reading frames (ORFs), which are separated by an intergenic region. The ORF1 (replicase) is preceded by an untranslated sequence of 827 nt, while an untranslated region of 139 nt follows the ORF2 (capsid proteins). The deduced amino acid (aa) sequences of the ORFs showed only low (less than 32%) and partial similarity to the non-structural (2C-like helicase, 3C-like cystein protease and 3D-like RNA dependent RNA polymerase) and structural proteins (VP2/VP4/VP3) of virus families in Picornavirales especially to members of the viruses with dicistronic genome. Halastavi árva RNA virus is present in intestinal contents of omnivorous freshwater carps but the origin and the host species of this virus remains unknown. The unique viral sequence and the actual position indicate that Halastavi árva RNA virus seems to be the first member of a new di-cistronic ssRNA virus. Further studies are required to investigate the specific host species (and spectrum), ecology and role of Halastavi árva RNA virus in the nature. PMID:22195010
DEFF Research Database (Denmark)
Jensen, Martin Borch; Dunn, Christopher A; Keijzers, Guido
2012-01-01
RECQL4 is one of five members of the human RecQ helicase family, and is implicated in three syndromes displaying accelerating aging, developmental abnormalities and a predisposition to cancer. In this study, we purified three variants of RECQL4 carrying previously reported patient mutations....... These three mutant proteins were analyzed for the known biochemical activities of RECQL4: DNA binding, unwinding of duplex DNA, ATP hydrolysis and annealing of simplex DNA. Further, the mutant proteins were evaluated for stability and recruitment to sites of laser-induced DNA damage. One mutant was helicase...
Base pairing and structural insights into the 5-formylcytosine in RNA duplex
Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia
2016-01-01
Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978
Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1
Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.
2012-01-01
Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes
The ribosome structure controls and directs mRNA entry, translocation and exit dynamics
International Nuclear Information System (INIS)
Kurkcuoglu, Ozge; Doruker, Pemra; Jernigan, Robert L; Sen, Taner Z; Kloczkowski, Andrzej
2008-01-01
The protein-synthesizing ribosome undergoes large motions to effect the translocation of tRNAs and mRNA; here, the domain motions of this system are explored with a coarse-grained elastic network model using normal mode analysis. Crystal structures are used to construct various model systems of the 70S complex with/without tRNA, elongation factor Tu and the ribosomal proteins. Computed motions reveal the well-known ratchet-like rotational motion of the large subunits, as well as the head rotation of the small subunit and the high flexibility of the L1 and L7/L12 stalks, even in the absence of ribosomal proteins. This result indicates that these experimentally observed motions during translocation are inherently controlled by the ribosomal shape and only partially dependent upon GTP hydrolysis. Normal mode analysis further reveals the mobility of A- and P-tRNAs to increase in the absence of the E-tRNA. In addition, the dynamics of the E-tRNA is affected by the absence of the ribosomal protein L1. The mRNA in the entrance tunnel interacts directly with helicase proteins S3 and S4, which constrain the mRNA in a clamp-like fashion, as well as with protein S5, which likely orients the mRNA to ensure correct translation. The ribosomal proteins S7, S11 and S18 may also be involved in assuring translation fidelity by constraining the mRNA at the exit site of the channel. The mRNA also interacts with the 16S 3' end forming the Shine–Dalgarno complex at the initiation step; the 3' end may act as a 'hook' to reel in the mRNA to facilitate its exit
HCV RNA traffic and association with NS5A in living cells
Energy Technology Data Exchange (ETDEWEB)
Fiches, Guillaume N.; Eyre, Nicholas S.; Aloia, Amanda L.; Van Der Hoek, Kylie [Department of Molecular and Cellular Biology, Research Centre for Infectious Diseases, University of Adelaide, Adelaide and Centre for Cancer Biology, SA Pathology, Adelaide, SA (Australia); Betz-Stablein, Brigit; Luciani, Fabio [Systems Immunology, School of Medical Sciences, University of New South Wales, Sydney, NSW (Australia); Chopra, Abha [Institute for Immunology and infectious diseases (IIID), Murdoch University, Perth, WA (Australia); Beard, Michael R., E-mail: michael.beard@adelaide.edu.au [Department of Molecular and Cellular Biology, Research Centre for Infectious Diseases, University of Adelaide, Adelaide and Centre for Cancer Biology, SA Pathology, Adelaide, SA (Australia)
2016-06-15
The spatiotemporal dynamics of Hepatitis C Virus (HCV) RNA localisation are poorly understood. To address this we engineered HCV genomes harbouring MS2 bacteriophage RNA stem-loops within the 3′-untranslated region to allow tracking of HCV RNA via specific interaction with a MS2-Coat-mCherry fusion protein. Despite the impact of these insertions on viral fitness, live imaging revealed that replication of tagged-HCV genomes induced specific redistribution of the mCherry-tagged-MS2-Coat protein to motile and static foci. Further analysis showed that HCV RNA was associated with NS5A in both static and motile structures while a subset of motile NS5A structures was devoid of HCV RNA. Further investigation of viral RNA traffic with respect to lipid droplets (LDs) revealed HCV RNA-positive structures in close association with LDs. These studies provide new insights into the dynamics of HCV RNA traffic with NS5A and LDs and provide a platform for future investigations of HCV replication and assembly. - Highlights: • HCV can tolerate can bacteriophage MS2 stem-loop insertions within the 3′ UTR. • MS2 stem-loop containing HCV genomes allow for real-time imaging of HCV RNA. • HCV RNA is both static and motile and associates with NS5A and lipid droplets.
HCV RNA traffic and association with NS5A in living cells
International Nuclear Information System (INIS)
Fiches, Guillaume N.; Eyre, Nicholas S.; Aloia, Amanda L.; Van Der Hoek, Kylie; Betz-Stablein, Brigit; Luciani, Fabio; Chopra, Abha; Beard, Michael R.
2016-01-01
The spatiotemporal dynamics of Hepatitis C Virus (HCV) RNA localisation are poorly understood. To address this we engineered HCV genomes harbouring MS2 bacteriophage RNA stem-loops within the 3′-untranslated region to allow tracking of HCV RNA via specific interaction with a MS2-Coat-mCherry fusion protein. Despite the impact of these insertions on viral fitness, live imaging revealed that replication of tagged-HCV genomes induced specific redistribution of the mCherry-tagged-MS2-Coat protein to motile and static foci. Further analysis showed that HCV RNA was associated with NS5A in both static and motile structures while a subset of motile NS5A structures was devoid of HCV RNA. Further investigation of viral RNA traffic with respect to lipid droplets (LDs) revealed HCV RNA-positive structures in close association with LDs. These studies provide new insights into the dynamics of HCV RNA traffic with NS5A and LDs and provide a platform for future investigations of HCV replication and assembly. - Highlights: • HCV can tolerate can bacteriophage MS2 stem-loop insertions within the 3′ UTR. • MS2 stem-loop containing HCV genomes allow for real-time imaging of HCV RNA. • HCV RNA is both static and motile and associates with NS5A and lipid droplets.
Cross-linking of L5 protein to 5 S RNA in rat liver 60-S subunits by ultraviolet irradiation
International Nuclear Information System (INIS)
Terao, K.; Uchiumi, T.; Ogata, K.
1980-01-01
After rat liver 60-S ribosomal subunits were irradiated with ultraviolet light at 254 nm, they were treated with EDTA and then subjected to sucrose density-gradient centrifugation to isolate 5 S RNA-protein complex. When 5 S RNA-protein was analyzed by SDS-acrylamide gel electrophoresis which dissociated noncovalent 5 S RNA-protein, two protein bands were observed. The one showed a slower mobility than the protein band (L5) of 5 S RNA-protein from non-irradiated 60 S subunit and the other showed the same mobility as L5 protein. Since the former band was shown to be specific to ultraviolet-irradiation, it was considered as cross-linked 5 S RNA-protein. After the two protein bands were iodinated with 125 I, labeled protein was extracted and treated with RNAase. Thereafter, it was analyzed by two-dimensional acrylamide gel electrophoresis, followed by autoradiography. The results indicate that the protein component of cross-linked 5 S RNA-protein is L5 protein (ribosomal protein); these proteins are designated according to the proposed uniform nomenclature. (Auth.)
An Archaea 5S rRNA analog is stably expressed in Escherichia coli
Yang, Y.; Fox, G. E.
1996-01-01
Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.
Chen, Zihao; Ju, Hongping; Yu, Shan; Zhao, Ting; Jing, Xiaojie; Li, Ping; Jia, Jing; Li, Nan; Tan, Bibo; Li, Yong
2018-03-13
Gastric cancer (GC) is one of a major global health problem especially in Asia. Nowadays, long non-coding RNA has gained significantly attention in the current research climate such as carcinogenesis. This research desired to explore the mechanism of Prader-Willi region non-protein coding RNA 1 (PWRN1) on regulating GC process. Differentially expressed lncRNAs in GC tissues were screened out through microarray analysis. The RNA and protein expression level was detected by qRT-PCR and western blot. Cell proliferation, apoptosis rate, metastasis abilities were respectively determined by CCK8, flow cytometry, wound healing and transwell assay. The luciferase reporter system was used to verify the targeting relationships between PWRN1, miR-425-5p and PTEN RIP assay was performed to prove whether PWRN1 acted as a competitive endogenous RNA (ceRNA) of miR-425-5p. Tumor xenograft model and immunohistochemistry were developed to study the influence of PWRN1 on tumor growth in vivo Microarray analysis determined that PWRN1 was different expressed between GC tissues and adjacent tissues. QRT-PCR revealed PWRN1 low expression in GC tissues and cells. PWRN1 up-regulated could reduce proliferation and metastasis and increased apoptosis in GC cells, while miR-425-5p had reverse effects. The RIP assay indicated that PWRN1 may target an oncogene miR-425-5p. The tumor xenograft assay found that up-regulated PWRN1 suppressed the tumor growth. The bioinformatic analysis, luciferase assay and western blot indicated that PWRN1 affected PTEN/Akt/MDM2/p53 axis via suppressing miR-425-5p. Our findings suggested that PWRN1 functioned as a ceRNA targeting to miR-425-5p and suppressed GC development via p53 signaling pathway. ©2018 The Author(s).
5S rRNA gene arrangements in protists: a case of nonadaptive evolution.
Drouin, Guy; Tsang, Corey
2012-06-01
Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.
The Role of Exportin-5 in MicroRNA Biogenesis and Cancer
Directory of Open Access Journals (Sweden)
Ke Wu
2018-04-01
Full Text Available MicroRNAs (miRNAs are conserved small non-coding RNAs that play an important role in the regulation of gene expression and participate in a variety of biological processes. The biogenesis of miRNAs is tightly controlled at multiple steps, such as transcription of miRNA genes, processing by Drosha and Dicer, and transportation of precursor miRNAs (pre-miRNAs from the nucleus to the cytoplasm by exportin-5 (XPO5. Given the critical role of nuclear export of pre-miRNAs in miRNA biogenesis, any alterations of XPO5, resulting from either genetic mutation, epigenetic change, abnormal expression level or posttranslational modification, could affect miRNA expression and thus have profound effects on tumorigenesis. Importantly, XPO5 phosphorylation by ERK kinase and its cis/trans isomerization by the prolyl isomerase Pin1 impair XPO5′s nucleo-to-cytoplasmic transport ability of pre-miRNAs, leading to downregulation of mature miRNAs in hepatocellular carcinoma. In this review, we focus on how XPO5 transports pre-miRNAs in the cells and summarize the dysregulation of XPO5 in human tumors. Keywords: Exportin-5, MicroRNA, Biogenesis, Dysregulation, Cancer
Cdt1 stabilizes an open MCM ring for helicase loading.
Frigola, Jordi; He, Jun; Kinkelin, Kerstin; Pye, Valerie E; Renault, Ludovic; Douglas, Max E; Remus, Dirk; Cherepanov, Peter; Costa, Alessandro; Diffley, John F X
2017-06-23
ORC, Cdc6 and Cdt1 act together to load hexameric MCM, the motor of the eukaryotic replicative helicase, into double hexamers at replication origins. Here we show that Cdt1 interacts with MCM subunits Mcm2, 4 and 6, which both destabilizes the Mcm2-5 interface and inhibits MCM ATPase activity. Using X-ray crystallography, we show that Cdt1 contains two winged-helix domains in the C-terminal half of the protein and a catalytically inactive dioxygenase-related N-terminal domain, which is important for MCM loading, but not for subsequent replication. We used these structures together with single-particle electron microscopy to generate three-dimensional models of MCM complexes. These show that Cdt1 stabilizes MCM in a left-handed spiral open at the Mcm2-5 gate. We propose that Cdt1 acts as a brace, holding MCM open for DNA entry and bound to ATP until ORC-Cdc6 triggers ATP hydrolysis by MCM, promoting both Cdt1 ejection and MCM ring closure.
PML tumor suppressor protein is required for HCV production
International Nuclear Information System (INIS)
Kuroki, Misao; Ariumi, Yasuo; Hijikata, Makoto; Ikeda, Masanori; Dansako, Hiromichi; Wakita, Takaji; Shimotohno, Kunitada; Kato, Nobuyuki
2013-01-01
Highlights: ► PML tumor suppressor protein is required for HCV production. ► PML is dispensable for HCV RNA replication. ► HCV could not alter formation of PML-NBs. ► INI1 and DDX5, PML-related proteins, are involved in HCV life cycle. -- Abstract: PML tumor suppressor protein, which forms discrete nuclear structures termed PML-nuclear bodies, has been associated with several cellular functions, including cell proliferation, apoptosis and antiviral defense. Recently, it was reported that the HCV core protein colocalizes with PML in PML-NBs and abrogates the PML function through interaction with PML. However, role(s) of PML in HCV life cycle is unknown. To test whether or not PML affects HCV life cycle, we examined the level of secreted HCV core and the infectivity of HCV in the culture supernatants as well as the level of HCV RNA in HuH-7-derived RSc cells, in which HCV-JFH1 can infect and efficiently replicate, stably expressing short hairpin RNA targeted to PML. In this context, the level of secreted HCV core and the infectivity in the supernatants from PML knockdown cells was remarkably reduced, whereas the level of HCV RNA in the PML knockdown cells was not significantly affected in spite of very effective knockdown of PML. In fact, we showed that PML is unrelated to HCV RNA replication using the subgenomic HCV-JFH1 replicon RNA, JRN/3-5B. Furthermore, the infectivity of HCV-like particle in the culture supernatants was significantly reduced in PML knockdown JRN/3-5B cells expressing core to NS2 coding region of HCV-JFH1 genome using the trans-packaging system. Finally, we also demonstrated that INI1 and DDX5, the PML-related proteins, are involved in HCV production. Taken together, these findings suggest that PML is required for HCV production.
Directory of Open Access Journals (Sweden)
Galiano V
2016-10-01
Full Text Available Vicente Galiano,1 Pablo Garcia-Valtanen,2 Vicente Micol,3,4 José Antonio Encinar3 1Physics and Computer Architecture Department, Miguel Hernández University (UMH, Elche, Spain; 2Experimental Therapeutics Laboratory, Hanson and Sansom Institute for Health Research, School of Pharmacy and Medical Science, University of South Australia, Adelaide, Australia; 3Molecular and Cell Biology Institute, Miguel Hernández University (UMH, Elche, Spain; 4CIBER: CB12/03/30038, Physiopathology of the Obesity and Nutrition, CIBERobn, Instituto de Salud Carlos III, Palma de Mallorca, Spain Abstract: The dengue virus (DENV nonstructural protein 5 (NS5 contains both an N-terminal methyltransferase domain and a C-terminal RNA-dependent RNA polymerase domain. Polymerase activity is responsible for viral RNA synthesis by a de novo initiation mechanism and represents an attractive target for antiviral therapy. The incidence of DENV has grown rapidly and it is now estimated that half of the human population is at risk of becoming infected with this virus. Despite this, there are no effective drugs to treat DENV infections. The present in silico study aimed at finding new inhibitors of the NS5 RNA-dependent RNA polymerase of the four serotypes of DENV. We used a chemical library comprising 372,792 nonnucleotide compounds (around 325,319 natural compounds to perform molecular docking experiments against a binding site of the RNA template tunnel of the virus polymerase. Compounds with high negative free energy variation (ΔG <-10.5 kcal/mol were selected as putative inhibitors. Additional filters for favorable druggability and good absorption, distribution, metabolism, excretion, and toxicity were applied. Finally, after the screening process was completed, we identified 39 compounds as lead DENV polymerase inhibitor candidates. Potentially, these compounds could act as efficient DENV polymerase inhibitors in vitro and in vivo. Keywords: virtual screening, molecular
Mapping posttranscriptional modifications in 5S ribosomal RNA by MALDI mass spectrometry.
Kirpekar, F; Douthwaite, S; Roepstorff, P
2000-02-01
We present a method to screen RNA for posttranscriptional modifications based on Matrix Assisted Laser Desorption/Ionization mass spectrometry (MALDI-MS). After the RNA is digested to completion with a nucleotide-specific RNase, the fragments are analyzed by mass spectrometry. A comparison of the observed mass data with the data predicted from the gene sequence identifies fragments harboring modified nucleotides. Fragments larger than dinucleotides were valuable for the identification of posttranscriptional modifications. A more refined mapping of RNA modifications can be obtained by using two RNases in parallel combined with further fragmentation by Post Source Decay (PSD). This approach allows fast and sensitive screening of a purified RNA for posttranscriptional modification, and has been applied on 5S rRNA from two thermophilic microorganisms, the bacterium Bacillus stearothermophilus and the archaeon Sulfolobus acidocaldarius, as well as the halophile archaea Halobacterium halobium and Haloarcula marismortui. One S. acidocaldarius posttranscriptional modification was identified and was further characterized by PSD as a methylation of cytidine32. The modified C is located in a region that is clearly conserved with respect to both sequence and position in B. stearothermophilus and H. halobium and to some degree also in H. marismortui. However, no analogous modification was identified in the latter three organisms. We further find that the 5' end of H. halobium 5S rRNA is dephosphorylated, in contrast to the other 5S rRNA species investigated. The method additionally gives an immediate indication of whether the expected RNA sequence is in agreement with the observed fragment masses. Discrepancies with two of the published 5S rRNA sequences were identified and are reported here.
Directory of Open Access Journals (Sweden)
Jacob Thomas
Full Text Available Integrative and conjugative elements (ICEs are agents of horizontal gene transfer and have major roles in evolution and acquisition of new traits, including antibiotic resistances. ICEs are found integrated in a host chromosome and can excise and transfer to recipient bacteria via conjugation. Conjugation involves nicking of the ICE origin of transfer (oriT by the ICE-encoded relaxase and transfer of the nicked single strand of ICE DNA. For ICEBs1 of Bacillus subtilis, nicking of oriT by the ICEBs1 relaxase NicK also initiates rolling circle replication. This autonomous replication of ICEBs1 is critical for stability of the excised element in growing cells. We found a conserved and previously uncharacterized ICE gene that is required for conjugation and replication of ICEBs1. Our results indicate that this gene, helP (formerly ydcP, encodes a helicase processivity factor that enables the host-encoded helicase PcrA to unwind the double-stranded ICEBs1 DNA. HelP was required for both conjugation and replication of ICEBs1, and HelP and NicK were the only ICEBs1 proteins needed for replication from ICEBs1 oriT. Using chromatin immunoprecipitation, we measured association of HelP, NicK, PcrA, and the host-encoded single-strand DNA binding protein Ssb with ICEBs1. We found that NicK was required for association of HelP and PcrA with ICEBs1 DNA. HelP was required for association of PcrA and Ssb with ICEBs1 regions distal, but not proximal, to oriT, indicating that PcrA needs HelP to progress beyond nicked oriT and unwind ICEBs1. In vitro, HelP directly stimulated the helicase activity of the PcrA homologue UvrD. Our findings demonstrate that HelP is a helicase processivity factor needed for efficient unwinding of ICEBs1 for conjugation and replication. Homologues of HelP and PcrA-type helicases are encoded on many known and putative ICEs. We propose that these factors are essential for ICE conjugation, replication, and genetic stability.
Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes
Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.
1976-01-01
Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.
Directory of Open Access Journals (Sweden)
Hong-Wei Ma
2017-06-01
Full Text Available Hantaviruses encompass rodent-borne zoonotic pathogens that cause severe hemorrhagic fever disease with high mortality rates in humans. Detection of infectious virus titer lays a solid foundation for virology and immunology researches. Canonical methods to assess viral titers rely on visible cytopathic effects (CPE, but Hantaan virus (HTNV, the prototype hantavirus maintains a relatively sluggish life cycle and does not produce CPE in cell culture. Here, an in-cell Western (ICW assay was utilized to rapidly measure the expression of viral proteins in infected cells and to establish a novel approach to detect viral titers. Compared with classical approaches, the ICW assay is accurate and time- and cost-effective. Furthermore, the ICW assay provided a high-throughput platform to screen and identify antiviral molecules. Potential antiviral roles of several DExD/H box helicase family members were investigated using the ICW assay, and the results indicated that DDX21 and DDX60 reinforced IFN responses and exerted anti-hantaviral effects, whereas DDX50 probably promoted HTNV replication. Additionally, the ICW assay was also applied to assess NAb titers in patients and vaccine recipients. Patients with prompt production of NAbs tended to have favorable disease outcomes. Modest NAb titers were found in vaccinees, indicating that current vaccines still require improvements as they cannot prime host humoral immunity with high efficiency. Taken together, our results indicate that the use of the ICW assay to evaluate non-CPE Hantaan virus titer demonstrates a significant improvement over current infectivity approaches and a novel technique to screen antiviral molecules and detect NAb efficacies.
DEFF Research Database (Denmark)
Douthwaite, S; Garrett, R A; Wagner, R
1979-01-01
An RNA fragment, constituting three subfragments of nucleotide sequences 1-11, 69-87 and 89-120, is the most ribonuclease-resistant part of the native 5S RNA of Escherichia coli, at 0 degrees C. A smaller fragment of nucleotide sequence 69-87 and 90-110 is ribonuclease-resistant at 25 degrees....... Degradation of the L25-5S RNA complex with ribonuclease A or T2 yielded RNA fragments similar to those of the free 5S RNA at 0 degrees C and 25 degrees C; moreover L25 remained strongly bound to both RNA fragments and also produced some opening of the RNA structure in at least two positions. Protein L18...... initially protected most of the 5S RNA against ribonuclease digestion, at 0 degrees C, but was then gradually released prior to the formation of the larger RNA fragment. It cannot be concluded, therefore, as it was earlier (Gray et al., 1973), that this RNA fragment contains the primary binding site of L18....
Malecki, Michal; Jedrzejczak, Robert; Stepien, Piotr P; Golik, Pawel
2007-09-07
The mitochondrial degradosome (mtEXO), the main RNA-degrading complex of yeast mitochondria, is composed of two subunits: an exoribonuclease encoded by the DSS1 gene and an RNA helicase encoded by the SUV3 gene. We expressed both subunits of the yeast mitochondrial degradosome in Escherichia coli, reconstituted the complex in vitro and analyzed the RNase, ATPase and helicase activities of the two subunits separately and in complex. The results reveal a very strong functional interdependence. For every enzymatic activity, we observed significant changes when the relevant protein was present in the complex, compared to the activity measured for the protein alone. The ATPase activity of Suv3p is stimulated by RNA and its background activity in the absence of RNA is reduced greatly when the protein is in the complex with Dss1p. The Suv3 protein alone does not display RNA-unwinding activity and the 3' to 5' directional helicase activity requiring a free 3' single-stranded substrate becomes apparent only when Suv3p is in complex with Dss1p. The Dss1 protein alone does have some basal exoribonuclease activity, which is not ATP-dependent, but in the presence of Suv3p the activity of the entire complex is enhanced greatly and is entirely ATP-dependent, with no residual activity observed in the absence of ATP. Such absolute ATP-dependence is unique among known exoribonuclease complexes. On the basis of these results, we propose a model in which the Suv3p RNA helicase acts as a molecular motor feeding the substrate to the catalytic centre of the RNase subunit.
BLM helicase measures DNA unwound before switching strands and hRPA promotes unwinding reinitiation
Czech Academy of Sciences Publication Activity Database
Yodh, J.G.; Stevens, B.C.; Kanagaraj, R.; Janščák, Pavel; Ha, T.
2009-01-01
Roč. 28, č. 4 (2009), s. 405-416 ISSN 0261-4189 Institutional research plan: CEZ:AV0Z50520514 Keywords : Bloom syndrome * FRET * helicase * hRPA * single molecule Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 8.993, year: 2009
Energy Technology Data Exchange (ETDEWEB)
McLaughlin, Krystle J.; Nash, Rebekah P.; Redinbo, Mathew R. (UNC)
2014-06-16
The widespread development of multidrug-resistant bacteria is a major health emergency. Conjugative DNA plasmids, which harbor a wide range of antibiotic resistance genes, also encode the protein factors necessary to orchestrate the propagation of plasmid DNA between bacterial cells through conjugative transfer. Successful conjugative DNA transfer depends on key catalytic components to nick one strand of the duplex DNA plasmid and separate the DNA strands while cell-to-cell transfer occurs. The TraI protein from the conjugative Salmonella plasmid pCU1 fulfills these key catalytic roles, as it contains both single-stranded DNA-nicking relaxase and ATP-dependent helicase domains within a single, 1,078-residue polypeptide. In this work, we unraveled the helicase determinants of Salmonella pCU1 TraI through DNA binding, ATPase, and DNA strand separation assays. TraI binds DNA substrates with high affinity in a manner influenced by nucleic acid length and the presence of a DNA hairpin structure adjacent to the nick site. TraI selectively hydrolyzes ATP, and mutations in conserved helicase motifs eliminate ATPase activity. Surprisingly, the absence of a relatively short (144-residue) domain at the extreme C terminus of the protein severely diminishes ATP-dependent strand separation. Collectively, these data define the helicase motifs of the conjugative factor TraI from Salmonella pCU1 and reveal a previously uncharacterized C-terminal functional domain that uncouples ATP hydrolysis from strand separation activity.
Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago
2016-12-01
Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.
Chen, Tao
2015-07-30
MicroRNAs are a class of small regulatory RNAs that are generated from primary miRNA (pri-miRNA) transcripts with a stem-loop structure. Accuracy of the processing of pri-miRNA into mature miRNA in plants can be enhanced by SERRATE (SE) and HYPONASTIC LEAVES 1 (HYL1). HYL1 activity is regulated by the FIERY2 (FRY2)/RNA polymerase II C-terminal domain phosphatase-like 1 (CPL1). Here, we discover that HIGH OSMOTIC STRESS GENE EXPRESSION 5 (HOS5) and two serine/arginine-rich splicing factors RS40 and RS41, previously shown to be involved in pre-mRNA splicing, affect the biogenesis of a subset of miRNA. These proteins are required for correct miRNA strand selection and the maintenance of miRNA levels. FRY2 dephosphorylates HOS5 whose phosphorylation status affects its subnuclear localization. HOS5 and the RS proteins bind both intronless and intron-containing pri-miRNAs. Importantly, all of these splicing-related factors directly interact with both HYL1 and SE in nuclear splicing speckles. Our results indicate that these splicing factors are directly involved in the biogenesis of a group of miRNA.
Characterization of the ptr5+ gene involved in nuclear mRNA export in fission yeast
International Nuclear Information System (INIS)
Watanabe, Nobuyoshi; Ikeda, Terumasa; Mizuki, Fumitaka; Tani, Tokio
2012-01-01
Highlights: ► We cloned the ptr5 + gene involved in nuclear mRNA export in fission yeast. ► The ptr5 + gene was found to encode nucleoporin 85 (Nup85). ► Seh1p and Mlo3p are multi-copy suppressors for the ptr5 mutation. ► Ptr5p/Nup85p functions in nuclear mRNA export through the mRNA export factor Rae1p. ► Ptr5p/Nup85p interacts genetically with pre-mRNA splicing factors. -- Abstract: To analyze the mechanisms of mRNA export from the nucleus to the cytoplasm, we have isolated eleven mutants, ptr [poly(A) + RNA transport] 1 to 11, which accumulate poly(A) + RNA in the nucleus at a nonpermissive temperature in Schizosaccharomyces pombe. Of those, the ptr5–1 mutant shows dots- or a ring-like accumulation of poly(A) + RNA at the nuclear periphery after shifting to the nonpermissive temperature. We cloned the ptr5 + gene and found that it encodes a component of the nuclear pore complex (NPC), nucleoporin 85 (Nup85). The ptr5–1 mutant shows no defects in protein transport, suggesting the specific involvement of Ptr5p/Nup85p in nuclear mRNA export in S. pombe. We identified Seh1p, a nucleoporin interacting with Nup85p, an mRNA-binding protein Mlo3p, and Sac3p, a component of the TREX-2 complex involved in coupling of nuclear mRNA export with transcription, as multi-copy suppressors for the ptr5–1 mutation. In addition, we found that the ptr5–1 mutation is synthetically lethal with a mutation of the mRNA export factor Rae1p, and that the double mutant exaggerates defective nuclear mRNA export, suggesting that Ptr5p/Nup85p is involved in nuclear mRNA export through Rae1p. Interestingly, the ptr5–1 mutation also showed synthetic effects with several prp pre-mRNA splicing mutations, suggesting a functional linkage between the NPCs and the splicing apparatus in the yeast nucleus.
International Nuclear Information System (INIS)
Santi, D.V.; Hardy, L.W.
1987-01-01
tRNA (Ura-5-) methyltransferase catalyzes the transfer of a methyl group from S-adenosylmethionine (AdoMet) to the 5-carbon of a specific Urd residue in tRNA. This results in stoichiometric release of tritium from [5- 3 H] Urd-labeled substrate tRNA isolated from methyltransferase-deficient Escherichia coli. The enzyme also catalyzes an AdoMet-independent exchange reaction between [5- 3 H]-Urd-labeled substrate tRNA and protons of water at a rate that is about 1% that of the normal methylation reaction, but with identical stoichiometry. S-Adenosylhomocysteine inhibits the rate of the exchange reaction by 2-3-fold, whereas an analog having the sulfur of AdoMet replaced by nitrogen accelerates the exchange reaction 9-fold. In the presence (but not absence) of AdoMet, 5-fluorouracil-substituted tRNA (FUra-tRNA) leads to the first-order inactivation of the enzyme. This is accompanied by the formation of a stable covalent complex containing the enzyme, FUra-tRNA, and the methyl group AdoMet. A mechanism for catalysis is proposed that explains both the 5-H exchange reaction and the inhibition by FUra-tRNA: the enzyme forms a covalent Michael adduct with substrate or inhibitor tRNA by attack of a nucleophilic group of the enzyme at carbon 6 of the pyrimidine residue to be modified. As a result, an anion equivalent is generated at carbon 5 that is sufficiently reactive to be methylated by AdoMet. Preliminary experiments and precedents suggest that the nucleophilic catalyst of the enzyme is a thiol group of cysteine. The potent irreversible inhibition by FUra-tRNA suggest that a mechanism for the RNA effects of FUra may also involve irreversible inhibition of RNA-modifying enzymes
Stimulation of Pol III-dependent 5S rRNA and U6 snRNA gene expression by AP-1 transcription factors.
Ahuja, Richa; Kumar, Vijay
2017-07-01
RNA polymerase III transcribes structurally diverse group of essential noncoding RNAs including 5S ribosomal RNA (5SrRNA) and U6 snRNA. These noncoding RNAs are involved in RNA processing and ribosome biogenesis, thus, coupling Pol III activity to the rate of protein synthesis, cell growth, and proliferation. Even though a few Pol II-associated transcription factors have been reported to participate in Pol III-dependent transcription, its activation by activator protein 1 (AP-1) factors, c-Fos and c-Jun, has remained unexplored. Here, we show that c-Fos and c-Jun bind to specific sites in the regulatory regions of 5S rRNA (type I) and U6 snRNA (type III) gene promoters and stimulate their transcription. Our chromatin immunoprecipitation studies suggested that endogenous AP-1 factors bind to their cognate promoter elements during the G1/S transition of cell cycle apparently synchronous with Pol III transcriptional activity. Furthermore, the interaction of c-Jun with histone acetyltransferase p300 promoted the recruitment of p300/CBP complex on the promoters and facilitated the occupancy of Pol III transcriptional machinery via histone acetylation and chromatin remodeling. The findings of our study, together, suggest that AP-1 factors are novel regulators of Pol III-driven 5S rRNA and U6 snRNA expression with a potential role in cell proliferation. © 2017 Federation of European Biochemical Societies.
Genetic selection and DNA sequences of 4.5S RNA homologs
DEFF Research Database (Denmark)
Brown, S; Thon, G; Tolentino, E
1989-01-01
A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...
Hayakawa-Yano, Yoshika; Suyama, Satoshi; Nogami, Masahiro; Yugami, Masato; Koya, Ikuko; Furukawa, Takako; Zhou, Li; Abe, Manabu; Sakimura, Kenji; Takebayashi, Hirohide; Nakanishi, Atsushi; Okano, Hideyuki; Yano, Masato
2017-09-15
Cell type-specific transcriptomes are enabled by the action of multiple regulators, which are frequently expressed within restricted tissue regions. In the present study, we identify one such regulator, Quaking 5 (Qki5), as an RNA-binding protein (RNABP) that is expressed in early embryonic neural stem cells and subsequently down-regulated during neurogenesis. mRNA sequencing analysis in neural stem cell culture indicates that Qki proteins play supporting roles in the neural stem cell transcriptome and various forms of mRNA processing that may result from regionally restricted expression and subcellular localization. Also, our in utero electroporation gain-of-function study suggests that the nuclear-type Qki isoform Qki5 supports the neural stem cell state. We next performed in vivo transcriptome-wide protein-RNA interaction mapping to search for direct targets of Qki5 and elucidate how Qki5 regulates neural stem cell function. Combined with our transcriptome analysis, this mapping analysis yielded a bona fide map of Qki5-RNA interaction at single-nucleotide resolution, the identification of 892 Qki5 direct target genes, and an accurate Qki5-dependent alternative splicing rule in the developing brain. Last, our target gene list provides the first compelling evidence that Qki5 is associated with specific biological events; namely, cell-cell adhesion. This prediction was confirmed by histological analysis of mice in which Qki proteins were genetically ablated, which revealed disruption of the apical surface of the lateral wall in the developing brain. These data collectively indicate that Qki5 regulates communication between neural stem cells by mediating numerous RNA processing events and suggest new links between splicing regulation and neural stem cell states. © 2017 Hayakawa-Yano et al.; Published by Cold Spring Harbor Laboratory Press.
Viral unmasking of cellular 5S rRNA pseudogene transcripts induces RIG-I-mediated immunity.
Chiang, Jessica J; Sparrer, Konstantin M J; van Gent, Michiel; Lässig, Charlotte; Huang, Teng; Osterrieder, Nikolaus; Hopfner, Karl-Peter; Gack, Michaela U
2018-01-01
The sensor RIG-I detects double-stranded RNA derived from RNA viruses. Although RIG-I is also known to have a role in the antiviral response to DNA viruses, physiological RNA species recognized by RIG-I during infection with a DNA virus are largely unknown. Using next-generation RNA sequencing (RNAseq), we found that host-derived RNAs, most prominently 5S ribosomal RNA pseudogene 141 (RNA5SP141), bound to RIG-I during infection with herpes simplex virus 1 (HSV-1). Infection with HSV-1 induced relocalization of RNA5SP141 from the nucleus to the cytoplasm, and virus-induced shutoff of host protein synthesis downregulated the abundance of RNA5SP141-interacting proteins, which allowed RNA5SP141 to bind RIG-I and induce the expression of type I interferons. Silencing of RNA5SP141 strongly dampened the antiviral response to HSV-1 and the related virus Epstein-Barr virus (EBV), as well as influenza A virus (IAV). Our findings reveal that antiviral immunity can be triggered by host RNAs that are unshielded following depletion of their respective binding proteins by the virus.
How many 5S rRNA genes and pseudogenes are there in ''Aspergillus nidulans''?
International Nuclear Information System (INIS)
Pelczar, P.; Fiett, J.; Bartnik, E.
1994-01-01
We have estimated the number of 5S rRNA genes in ''Aspergillus nidulans'' using two-dimensional agarose gel electrophoresis and hybridization to appropriate probes, representing the 5'-halves, the 3'-halves of the 5S rRNA sequence and a sequence found at the 3'-end of all known. ''A. nidulans'' pseudogenes (block C). We have found 23 5S rRNA genes, 15 pseudogenes consisting of the 5'-half of the 5S rRNA sequence (of which 3 are flanked by block C) and 12 copies of block C which do not seem to be in the vicinity of 5S rRNA sequences. This number of genes is much lower than our earlier estimates, and makes our previously analyzed sample of 9 sequenced genes and 3 pseudogenes much more representative. (author). 7 refs, 1 fig
Liu, Long; Tian, Jiao; Nan, Hao; Tian, Mengmeng; Li, Yuan; Xu, Xiaodong; Huang, Baicheng; Zhou, Enmin; Hiscox, Julian A; Chen, Hongying
2016-06-01
Porcine reproductive and respiratory syndrome virus (PRRSV) nucleocapsid (N) protein is the main component of the viral capsid to encapsulate viral RNA, and it is also a multifunctional protein involved in the regulation of host cell processes. Nonstructural protein 9 (Nsp9) is the RNA-dependent RNA polymerase that plays a critical role in viral RNA transcription and replication. In this study, we demonstrate that PRRSV N protein is bound to Nsp9 by protein-protein interaction and that the contacting surface on Nsp9 is located in the two predicted α-helixes formed by 48 residues at the C-terminal end of the protein. Mutagenesis analyses identified E646, E608, and E611 on Nsp9 and Q85 on the N protein as the pivotal residues participating in the N-Nsp9 interaction. By overexpressing the N protein binding fragment of Nsp9 in infected Marc-145 cells, the synthesis of viral RNAs, as well as the production of infectious progeny viruses, was dramatically inhibited, suggesting that Nsp9-N protein association is involved in the process of viral RNA production. In addition, we show that PRRSV N interacts with cellular RNA helicase DHX9 and redistributes the protein into the cytoplasm. Knockdown of DHX9 increased the ratio of short subgenomic mRNAs (sgmRNAs); in contrast, DHX9 overexpression benefited the synthesis of longer sgmRNAs and the viral genomic RNA (gRNA). These results imply that DHX9 is recruited by the N protein in PRRSV infection to regulate viral RNA synthesis. We postulate that N and DHX9 may act as antiattenuation factors for the continuous elongation of nascent transcript during negative-strand RNA synthesis. It is unclear whether the N protein of PRRSV is involved in regulation of the viral RNA production process. In this report, we demonstrate that the N protein of the arterivirus PRRSV participates in viral RNA replication and transcription through interacting with Nsp9 and its RdRp and recruiting cellular RNA helicase to promote the production of
Hia, Fabian; Chionh, Yok Hian; Pang, Yan Ling Joy; DeMott, Michael S; McBee, Megan E; Dedon, Peter C
2015-03-11
A major challenge in the study of mycobacterial RNA biology is the lack of a comprehensive RNA isolation method that overcomes the unusual cell wall to faithfully yield the full spectrum of non-coding RNA (ncRNA) species. Here, we describe a simple and robust procedure optimized for the isolation of total ncRNA, including 5S, 16S and 23S ribosomal RNA (rRNA) and tRNA, from mycobacteria, using Mycobacterium bovis BCG to illustrate the method. Based on a combination of mechanical disruption and liquid and solid-phase technologies, the method produces all major species of ncRNA in high yield and with high integrity, enabling direct chemical and sequence analysis of the ncRNA species. The reproducibility of the method with BCG was evident in bioanalyzer electrophoretic analysis of isolated RNA, which revealed quantitatively significant differences in the ncRNA profiles of exponentially growing and non-replicating hypoxic bacilli. The method also overcame an historical inconsistency in 5S rRNA isolation, with direct sequencing revealing a novel post-transcriptional processing of 5S rRNA to its functional form and with chemical analysis revealing seven post-transcriptional ribonucleoside modifications in the 5S rRNA. This optimized RNA isolation procedure thus provides a means to more rigorously explore the biology of ncRNA species in mycobacteria. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Liu, Chenggang; Axtell, Michael J.; Fedoroff, Nina V.
2012-01-01
Dicer-Like1 (DCL1), an RNaseIII endonuclease, and Hyponastic Leaves1 (HYL1), a double-stranded RNA-binding protein, are core components of the plant microRNA (miRNA) biogenesis machinery. hyl1 mutants accumulate low levels of miRNAs and display
Directory of Open Access Journals (Sweden)
Ye Hong
2016-03-01
Full Text Available Meiotic recombination is essential for the repair of programmed double strand breaks (DSBs to generate crossovers (COs during meiosis. The efficient processing of meiotic recombination intermediates not only needs various resolvases but also requires proper meiotic chromosome structure. The Smc5/6 complex belongs to the structural maintenance of chromosome (SMC family and is closely related to cohesin and condensin. Although the Smc5/6 complex has been implicated in the processing of recombination intermediates during meiosis, it is not known how Smc5/6 controls meiotic DSB repair. Here, using Caenorhabditis elegans we show that the SMC-5/6 complex acts synergistically with HIM-6, an ortholog of the human Bloom syndrome helicase (BLM during meiotic recombination. The concerted action of the SMC-5/6 complex and HIM-6 is important for processing recombination intermediates, CO regulation and bivalent maturation. Careful examination of meiotic chromosomal morphology reveals an accumulation of inter-chromosomal bridges in smc-5; him-6 double mutants, leading to compromised chromosome segregation during meiotic cell divisions. Interestingly, we found that the lethality of smc-5; him-6 can be rescued by loss of the conserved BRCA1 ortholog BRC-1. Furthermore, the combined deletion of smc-5 and him-6 leads to an irregular distribution of condensin and to chromosome decondensation defects reminiscent of condensin depletion. Lethality conferred by condensin depletion can also be rescued by BRC-1 depletion. Our results suggest that SMC-5/6 and HIM-6 can synergistically regulate recombination intermediate metabolism and suppress ectopic recombination by controlling chromosome architecture during meiosis.
Hong, Ye; Sonneville, Remi; Agostinho, Ana; Meier, Bettina; Wang, Bin; Blow, J Julian; Gartner, Anton
2016-03-01
Meiotic recombination is essential for the repair of programmed double strand breaks (DSBs) to generate crossovers (COs) during meiosis. The efficient processing of meiotic recombination intermediates not only needs various resolvases but also requires proper meiotic chromosome structure. The Smc5/6 complex belongs to the structural maintenance of chromosome (SMC) family and is closely related to cohesin and condensin. Although the Smc5/6 complex has been implicated in the processing of recombination intermediates during meiosis, it is not known how Smc5/6 controls meiotic DSB repair. Here, using Caenorhabditis elegans we show that the SMC-5/6 complex acts synergistically with HIM-6, an ortholog of the human Bloom syndrome helicase (BLM) during meiotic recombination. The concerted action of the SMC-5/6 complex and HIM-6 is important for processing recombination intermediates, CO regulation and bivalent maturation. Careful examination of meiotic chromosomal morphology reveals an accumulation of inter-chromosomal bridges in smc-5; him-6 double mutants, leading to compromised chromosome segregation during meiotic cell divisions. Interestingly, we found that the lethality of smc-5; him-6 can be rescued by loss of the conserved BRCA1 ortholog BRC-1. Furthermore, the combined deletion of smc-5 and him-6 leads to an irregular distribution of condensin and to chromosome decondensation defects reminiscent of condensin depletion. Lethality conferred by condensin depletion can also be rescued by BRC-1 depletion. Our results suggest that SMC-5/6 and HIM-6 can synergistically regulate recombination intermediate metabolism and suppress ectopic recombination by controlling chromosome architecture during meiosis.
Yoshikatsu, Yuki; Ishida, Yo-ichi; Sudo, Haruka; Yuasa, Keizo; Tsuji, Akihiko; Nagahama, Masami
2015-08-28
Nuclear VCP-like 2 (NVL2) is a member of the chaperone-like AAA-ATPase family and is involved in the biosynthesis of 60S ribosomal subunits in mammalian cells. We previously showed the interaction of NVL2 with a DExD/H-box RNA helicase MTR4/DOB1, which is a known cofactor for an exoribonuclease complex, the exosome. This finding implicated NVL2 in RNA metabolic processes during ribosome biogenesis. In the present study, we found that a series of mutations within the ATPase domain of NVL2 causes a defect in pre-rRNA processing into mature 28S and 5.8S rRNAs. Co-immunoprecipitation analysis showed that NVL2 was associated with the nuclear exosome complex, which includes RRP6 as a nucleus-specific catalytic subunit. This interaction was prevented by depleting either MTR4 or RRP6, indicating their essential role in mediating this interaction with NVL2. Additionally, knockdown of MPP6, another cofactor for the nuclear exosome, also prevented the interaction by causing MTR4 to dissociate from the nuclear exosome. These results suggest that NVL2 is involved in pre-rRNA processing by associating with the nuclear exosome complex and that MPP6 is required for maintaining the integrity of this rRNA processing complex. Copyright © 2015 Elsevier Inc. All rights reserved.
A Small Molecule Inhibitor of the BLM Helicase Modulates Chromosome Stability in Human Cells
DEFF Research Database (Denmark)
Nguyen, Giang Huong; Dexheimer, Thomas S; Rosenthal, Andrew S
2013-01-01
The Bloom's syndrome protein, BLM, is a member of the conserved RecQ helicase family. Although cell lines lacking BLM exist, these exhibit progressive genomic instability that makes distinguishing primary from secondary effects of BLM loss problematic. In order to be able to acutely disable BLM f...
Interaction between the helicases genetically linked to Fanconi anemia group J and Bloom's syndrome
DEFF Research Database (Denmark)
Suhasini, Avvaru N; Rawtani, Nina A; Wu, Yuliang
2011-01-01
Bloom's syndrome (BS) and Fanconi anemia (FA) are autosomal recessive disorders characterized by cancer and chromosomal instability. BS and FA group J arise from mutations in the BLM and FANCJ genes, respectively, which encode DNA helicases. In this work, FANCJ and BLM were found to interact...
Branscheid, Anja; Marchais, Antonin; Schott, Gregory; Lange, Heike; Gagliardi, Dominique; Andersen, Stig Uggerhøj; Voinnet, Olivier; Brodersen, Peter
2015-12-15
Small regulatory RNAs are fundamental in eukaryotic and prokaryotic gene regulation. In plants, an important element of post-transcriptional control is effected by 20-24 nt microRNAs (miRNAs) and short interfering RNAs (siRNAs) bound to the ARGONAUTE1 (AGO1) protein in an RNA induced silencing complex (RISC). AGO1 may cleave target mRNAs with small RNA complementarity, but the fate of the resulting cleavage fragments remains incompletely understood. Here, we show that SKI2, SKI3 and SKI8, subunits of a cytoplasmic cofactor of the RNA exosome, are required for degradation of RISC 5', but not 3'-cleavage fragments in Arabidopsis. In the absence of SKI2 activity, many miRNA targets produce siRNAs via the RNA-dependent RNA polymerase 6 (RDR6) pathway. These siRNAs are low-abundant, and map close to the cleavage site. In most cases, siRNAs were produced 5' to the cleavage site, but several examples of 3'-spreading were also identified. These observations suggest that siRNAs do not simply derive from RDR6 action on stable 5'-cleavage fragments and hence that SKI2 has a direct role in limiting secondary siRNA production in addition to its function in mediating degradation of 5'-cleavage fragments. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Requirement for the E1 Helicase C-Terminal Domain in Papillomavirus DNA Replication In Vivo.
Bergvall, Monika; Gagnon, David; Titolo, Steve; Lehoux, Michaël; D'Abramo, Claudia M; Melendy, Thomas; Archambault, Jacques
2016-01-06
The papillomavirus (PV) E1 helicase contains a conserved C-terminal domain (CTD), located next to its ATP-binding site, whose function in vivo is still poorly understood. The CTD is comprised of an alpha helix followed by an acidic region (AR) and a C-terminal extension termed the C-tail. Recent biochemical studies on bovine papillomavirus 1 (BPV1) E1 showed that the AR and C-tail regulate the oligomerization of the protein into a double hexamer at the origin. In this study, we assessed the importance of the CTD of human papillomavirus 11 (HPV11) E1 in vivo, using a cell-based DNA replication assay. Our results indicate that combined deletion of the AR and C-tail drastically reduces DNA replication, by 85%, and that further truncation into the alpha-helical region compromises the structural integrity of the E1 helicase domain and its interaction with E2. Surprisingly, removal of the C-tail alone or mutation of highly conserved residues within the domain still allows significant levels of DNA replication (55%). This is in contrast to the absolute requirement for the C-tail reported for BPV1 E1 in vitro and confirmed here in vivo. Characterization of chimeric proteins in which the AR and C-tail from HPV11 E1 were replaced by those of BPV1 indicated that while the function of the AR is transferable, that of the C-tail is not. Collectively, these findings define the contribution of the three CTD subdomains to the DNA replication activity of E1 in vivo and suggest that the function of the C-tail has evolved in a PV type-specific manner. While much is known about hexameric DNA helicases from superfamily 3, the papillomavirus E1 helicase contains a unique C-terminal domain (CTD) adjacent to its ATP-binding site. We show here that this CTD is important for the DNA replication activity of HPV11 E1 in vivo and that it can be divided into three functional subdomains that roughly correspond to the three conserved regions of the CTD: an alpha helix, needed for the structural
Requirement for the E1 Helicase C-Terminal Domain in Papillomavirus DNA Replication In Vivo
Bergvall, Monika; Gagnon, David; Titolo, Steve; Lehoux, Michaël; D'Abramo, Claudia M.
2016-01-01
ABSTRACT The papillomavirus (PV) E1 helicase contains a conserved C-terminal domain (CTD), located next to its ATP-binding site, whose function in vivo is still poorly understood. The CTD is comprised of an alpha helix followed by an acidic region (AR) and a C-terminal extension termed the C-tail. Recent biochemical studies on bovine papillomavirus 1 (BPV1) E1 showed that the AR and C-tail regulate the oligomerization of the protein into a double hexamer at the origin. In this study, we assessed the importance of the CTD of human papillomavirus 11 (HPV11) E1 in vivo, using a cell-based DNA replication assay. Our results indicate that combined deletion of the AR and C-tail drastically reduces DNA replication, by 85%, and that further truncation into the alpha-helical region compromises the structural integrity of the E1 helicase domain and its interaction with E2. Surprisingly, removal of the C-tail alone or mutation of highly conserved residues within the domain still allows significant levels of DNA replication (55%). This is in contrast to the absolute requirement for the C-tail reported for BPV1 E1 in vitro and confirmed here in vivo. Characterization of chimeric proteins in which the AR and C-tail from HPV11 E1 were replaced by those of BPV1 indicated that while the function of the AR is transferable, that of the C-tail is not. Collectively, these findings define the contribution of the three CTD subdomains to the DNA replication activity of E1 in vivo and suggest that the function of the C-tail has evolved in a PV type-specific manner. IMPORTANCE While much is known about hexameric DNA helicases from superfamily 3, the papillomavirus E1 helicase contains a unique C-terminal domain (CTD) adjacent to its ATP-binding site. We show here that this CTD is important for the DNA replication activity of HPV11 E1 in vivo and that it can be divided into three functional subdomains that roughly correspond to the three conserved regions of the CTD: an alpha helix, needed
Anosova, Irina; Melnik, Svitlana; Tripsianes, Konstantinos; Kateb, Fatiha; Grummt, Ingrid; Sattler, Michael
2015-05-26
The chromatin remodeling complex NoRC, comprising the subunits SNF2h and TIP5/BAZ2A, mediates heterochromatin formation at major clusters of repetitive elements, including rRNA genes, centromeres and telomeres. Association with chromatin requires the interaction of the TAM (TIP5/ARBP/MBD) domain of TIP5 with noncoding RNA, which targets NoRC to specific genomic loci. Here, we show that the NMR structure of the TAM domain of TIP5 resembles the fold of the MBD domain, found in methyl-CpG binding proteins. However, the TAM domain exhibits an extended MBD fold with unique C-terminal extensions that constitute a novel surface for RNA binding. Mutation of critical amino acids within this surface abolishes RNA binding in vitro and in vivo. Our results explain the distinct binding specificities of TAM and MBD domains to RNA and methylated DNA, respectively, and reveal structural features for the interaction of NoRC with non-coding RNA. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA
Ciganda, Martin; Williams, Noreen
2012-01-01
P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864
Characterization of the ptr5{sup +} gene involved in nuclear mRNA export in fission yeast
Energy Technology Data Exchange (ETDEWEB)
Watanabe, Nobuyoshi; Ikeda, Terumasa; Mizuki, Fumitaka [Department of Biological Sciences, Graduate School of Science and Technology, Kumamoto University, Kurokami, Kumamoto 860-8555 (Japan); Tani, Tokio, E-mail: ttani@sci.kumamoto-u.ac.jp [Department of Biological Sciences, Graduate School of Science and Technology, Kumamoto University, Kurokami, Kumamoto 860-8555 (Japan)
2012-02-03
Highlights: Black-Right-Pointing-Pointer We cloned the ptr5{sup +} gene involved in nuclear mRNA export in fission yeast. Black-Right-Pointing-Pointer The ptr5{sup +} gene was found to encode nucleoporin 85 (Nup85). Black-Right-Pointing-Pointer Seh1p and Mlo3p are multi-copy suppressors for the ptr5 mutation. Black-Right-Pointing-Pointer Ptr5p/Nup85p functions in nuclear mRNA export through the mRNA export factor Rae1p. Black-Right-Pointing-Pointer Ptr5p/Nup85p interacts genetically with pre-mRNA splicing factors. -- Abstract: To analyze the mechanisms of mRNA export from the nucleus to the cytoplasm, we have isolated eleven mutants, ptr [poly(A){sup +} RNA transport] 1 to 11, which accumulate poly(A){sup +} RNA in the nucleus at a nonpermissive temperature in Schizosaccharomyces pombe. Of those, the ptr5-1 mutant shows dots- or a ring-like accumulation of poly(A){sup +} RNA at the nuclear periphery after shifting to the nonpermissive temperature. We cloned the ptr5{sup +} gene and found that it encodes a component of the nuclear pore complex (NPC), nucleoporin 85 (Nup85). The ptr5-1 mutant shows no defects in protein transport, suggesting the specific involvement of Ptr5p/Nup85p in nuclear mRNA export in S. pombe. We identified Seh1p, a nucleoporin interacting with Nup85p, an mRNA-binding protein Mlo3p, and Sac3p, a component of the TREX-2 complex involved in coupling of nuclear mRNA export with transcription, as multi-copy suppressors for the ptr5-1 mutation. In addition, we found that the ptr5-1 mutation is synthetically lethal with a mutation of the mRNA export factor Rae1p, and that the double mutant exaggerates defective nuclear mRNA export, suggesting that Ptr5p/Nup85p is involved in nuclear mRNA export through Rae1p. Interestingly, the ptr5-1 mutation also showed synthetic effects with several prp pre-mRNA splicing mutations, suggesting a functional linkage between the NPCs and the splicing apparatus in the yeast nucleus.
Essential and distinct roles of the F-box and helicase domains of Fbh1 in DNA damage repair
Directory of Open Access Journals (Sweden)
Shinagawa Hideo
2008-03-01
Full Text Available Abstract Background DNA double-strand breaks (DSBs are induced by exogenous insults such as ionizing radiation and chemical exposure, and they can also arise as a consequence of stalled or collapsed DNA replication forks. Failure to repair DSBs can lead to genomic instability or cell death and cancer in higher eukaryotes. The Schizosaccharomyces pombe fbh1 gene encodes an F-box DNA helicase previously described to play a role in the Rhp51 (an orthologue of S. cerevisiae RAD51-dependent recombinational repair of DSBs. Fbh1 fused to GFP localizes to discrete nuclear foci following DNA damage. Results To determine the functional roles of the highly conserved F-box and helicase domains, we have characterized fbh1 mutants carrying specific mutations in these domains. We show that the F-box mutation fbh1-fb disturbs the nuclear localization of Fbh1, conferring an fbh1 null-like phenotype. Moreover, nuclear foci do not form in fbh1-fb cells with DNA damage even if Fbh1-fb is targeted to the nucleus by fusion to a nuclear localization signal sequence. In contrast, the helicase mutation fbh1-hl causes the accumulation of Fbh1 foci irrespective of the presence of DNA damage and confers damage sensitivity greater than that conferred by the null allele. Additional mutation of the F-box alleviates the hypermorphic phenotype of the fbh1-hl mutant. Conclusion These results suggest that the F-box and DNA helicase domains play indispensable but distinct roles in Fbh1 function. Assembly of the SCFFbh1 complex is required for both the nuclear localization and DNA damage-induced focus formation of Fbh1 and is therefore prerequisite for the Fbh1 recombination function.
I prokaryota si chrání svoji RNA – nové typy 5'-RNA čepiček
Czech Academy of Sciences Publication Activity Database
Cahová, Hana
2017-01-01
Roč. 111, č. 7 (2017), s. 414-423 ISSN 0009-2770 R&D Projects: GA ČR(CZ) GJ16-16358Y Institutional support: RVO:61388963 Keywords : 5'-RNA cap * NAD-RNA * RNA chemical modification Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 0.387, year: 2016 http://www.chemicke-listy.cz/docs/full/2017_07_414-423.pdf
Directory of Open Access Journals (Sweden)
Sarit Edelheit
2013-06-01
Full Text Available The presence of 5-methylcytidine (m(5C in tRNA and rRNA molecules of a wide variety of organisms was first observed more than 40 years ago. However, detection of this modification was limited to specific, abundant, RNA species, due to the usage of low-throughput methods. To obtain a high resolution, systematic, and comprehensive transcriptome-wide overview of m(5C across the three domains of life, we used bisulfite treatment on total RNA from both gram positive (B. subtilis and gram negative (E. coli bacteria, an archaeon (S. solfataricus and a eukaryote (S. cerevisiae, followed by massively parallel sequencing. We were able to recover most previously documented m(5C sites on rRNA in the four organisms, and identified several novel sites in yeast and archaeal rRNAs. Our analyses also allowed quantification of methylated m(5C positions in 64 tRNAs in yeast and archaea, revealing stoichiometric differences between the methylation patterns of these organisms. Molecules of tRNAs in which m(5C was absent were also discovered. Intriguingly, we detected m(5C sites within archaeal mRNAs, and identified a consensus motif of AUCGANGU that directs methylation in S. solfataricus. Our results, which were validated using m(5C-specific RNA immunoprecipitation, provide the first evidence for mRNA modifications in archaea, suggesting that this mode of post-transcriptional regulation extends beyond the eukaryotic domain.
Recker, Julia; Knoll, Alexander; Puchta, Holger
2014-12-01
In humans, mutations in the DNA helicase Regulator of Telomere Elongation Helicase1 (RTEL1) lead to Hoyeraal-Hreidarsson syndrome, a severe, multisystem disorder. Here, we demonstrate that the RTEL1 homolog in Arabidopsis thaliana plays multiple roles in preserving genome stability. RTEL1 suppresses homologous recombination in a pathway parallel to that of the DNA translocase FANCM. Cytological analyses of root meristems indicate that RTEL1 is involved in processing DNA replication intermediates independently from FANCM and the nuclease MUS81. Moreover, RTEL1 is involved in interstrand and intrastrand DNA cross-link repair independently from FANCM and (in intrastrand cross-link repair) parallel to MUS81. RTEL1 contributes to telomere homeostasis; the concurrent loss of RTEL1 and the telomerase TERT leads to rapid, severe telomere shortening, which occurs much more rapidly than it does in the single-mutant line tert, resulting in developmental arrest after four generations. The double mutant rtel1-1 recq4A-4 exhibits massive growth defects, indicating that this RecQ family helicase, which is also involved in the suppression of homologous recombination and the repair of DNA lesions, can partially replace RTEL1 in the processing of DNA intermediates. The requirement for RTEL1 in multiple pathways to preserve genome stability in plants can be explained by its putative role in the destabilization of DNA loop structures, such as D-loops and T-loops. © 2014 American Society of Plant Biologists. All rights reserved.
A critical role for noncoding 5S rRNA in regulating Mdmx stability.
Li, Muyang; Gu, Wei
2011-09-16
Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis. Copyright © 2011 Elsevier Inc. All rights reserved.
Terminal structures of West Nile virus genomic RNA and their interactions with viral NS5 protein
International Nuclear Information System (INIS)
Dong Hongping; Zhang Bo; Shi Peiyong
2008-01-01
Genome cyclization is essential for flavivirus replication. We used RNases to probe the structures formed by the 5'-terminal 190 nucleotides and the 3'-terminal 111 nucleotides of the West Nile virus (WNV) genomic RNA. When analyzed individually, the two RNAs adopt stem-loop structures as predicted by the thermodynamic-folding program. However, when mixed together, the two RNAs form a duplex that is mediated through base-pairings of two sets of RNA elements (5'CS/3'CSI and 5'UAR/3'UAR). Formation of the RNA duplex facilitates a conformational change that leaves the 3'-terminal nucleotides of the genome (position - 8 to - 16) to be single-stranded. Viral NS5 binds specifically to the 5'-terminal stem-loop (SL1) of the genomic RNA. The 5'SL1 RNA structure is essential for WNV replication. The study has provided further evidence to suggest that flavivirus genome cyclization and NS5/5'SL1 RNA interaction facilitate NS5 binding to the 3' end of the genome for the initiation of viral minus-strand RNA synthesis
PAX5α and PAX5β mRNA expression in breast Cancer: Relation to ...
African Journals Online (AJOL)
Background: Many studies evaluated the role of paired box gene 5 (PAX5) in breast cancer. However, few investigated PAX5α and PAX5β isoforms individually. Objective: The aim of the present study is to evaluate mRNA expression of PAX5α and PAX5β in breast cancer and assessing their underlying pathological roles ...
Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA
International Nuclear Information System (INIS)
Hirose, Yutaka; Harada, Fumio
2008-01-01
4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus
RNA-Guided DNA Rearrangements in Breast Cancer
2012-09-01
splicing endonuclease positive effector-related protein ; helicase sen1 AAA_12 Search table of mass spectrometry raw data for the ~90kD protein ...Transfer Cell (Bio-Rad) following manufacturer’s instructions. The membrane was blocked with 5% non- fat milk at room temperature for 30 min...incubated with Otiwi1 antibody (1:1000 dilution in 5% non- fat milk ) overnight at 4 C. The membrane was washed with TBST for 15 min four times, and
Branscheid, Anja; Marchais, Antonin; Schott, Gregory; Lange, Heike; Gagliardi, Dominique; Andersen, Stig Uggerhøj; Voinnet, Olivier; Brodersen, Peter
2015-01-01
Small regulatory RNAs are fundamental in eukaryotic and prokaryotic gene regulation. In plants, an important element of post-transcriptional control is effected by 20–24 nt microRNAs (miRNAs) and short interfering RNAs (siRNAs) bound to the ARGONAUTE1 (AGO1) protein in an RNA induced silencing complex (RISC). AGO1 may cleave target mRNAs with small RNA complementarity, but the fate of the resulting cleavage fragments remains incompletely understood. Here, we show that SKI2, SKI3 and SKI8, subunits of a cytoplasmic cofactor of the RNA exosome, are required for degradation of RISC 5′, but not 3′-cleavage fragments in Arabidopsis. In the absence of SKI2 activity, many miRNA targets produce siRNAs via the RNA-dependent RNA polymerase 6 (RDR6) pathway. These siRNAs are low-abundant, and map close to the cleavage site. In most cases, siRNAs were produced 5′ to the cleavage site, but several examples of 3′-spreading were also identified. These observations suggest that siRNAs do not simply derive from RDR6 action on stable 5′-cleavage fragments and hence that SKI2 has a direct role in limiting secondary siRNA production in addition to its function in mediating degradation of 5′-cleavage fragments. PMID:26464441
Simon, Lauriane; Rabanal, Fernando A; Dubos, Tristan; Oliver, Cecilia; Lauber, Damien; Poulet, Axel; Vogt, Alexander; Mandlbauer, Ariane; Le Goff, Samuel; Sommer, Andreas; Duborjal, Hervé; Tatout, Christophe; Probst, Aline V
2018-04-06
Organized in tandem repeat arrays in most eukaryotes and transcribed by RNA polymerase III, expression of 5S rRNA genes is under epigenetic control. To unveil mechanisms of transcriptional regulation, we obtained here in depth sequence information on 5S rRNA genes from the Arabidopsis thaliana genome and identified differential enrichment in epigenetic marks between the three 5S rDNA loci situated on chromosomes 3, 4 and 5. We reveal the chromosome 5 locus as the major source of an atypical, long 5S rRNA transcript characteristic of an open chromatin structure. 5S rRNA genes from this locus translocated in the Landsberg erecta ecotype as shown by linkage mapping and chromosome-specific FISH analysis. These variations in 5S rDNA locus organization cause changes in the spatial arrangement of chromosomes in the nucleus. Furthermore, 5S rRNA gene arrangements are highly dynamic with alterations in chromosomal positions through translocations in certain mutants of the RNA-directed DNA methylation pathway and important copy number variations among ecotypes. Finally, variations in 5S rRNA gene sequence, chromatin organization and transcripts indicate differential usage of 5S rDNA loci in distinct ecotypes. We suggest that both the usage of existing and new 5S rDNA loci resulting from translocations may impact neighboring chromatin organization.
Petojevic, Tatjana; Pesavento, James J.; Costa, Alessandro; Liang, Jingdan; Wang, Zhijun; Berger, James M.; Botchan, Michael R.
2015-01-01
DNA replication licensing is now understood to be the pathway that leads to the assembly of double hexamers of minichromosome maintenance (Mcm2–7) at origin sites. Cell division control protein 45 (Cdc45) and GINS proteins activate the latent Mcm2–7 helicase by inducing allosteric changes through binding, forming a Cdc45/Mcm2-7/GINS (CMG) complex that is competent to unwind duplex DNA. The CMG has an active gate between subunits Mcm2 and Mcm5 that opens and closes in response to nucleotide binding. The consequences of inappropriate Mcm2/5 gate actuation and the role of a side channel formed between GINS/Cdc45 and the outer edge of the Mcm2–7 ring for unwinding have remained unexplored. Here we uncover a novel function for Cdc45. Cross-linking studies trace the path of the DNA with the CMG complex at a fork junction between duplex and single strands with the bound CMG in an open or closed gate conformation. In the closed state, the lagging strand does not pass through the side channel, but in the open state, the leading strand surprisingly interacts with Cdc45. Mutations in the recombination protein J fold of Cdc45 that ablate this interaction diminish helicase activity. These data indicate that Cdc45 serves as a shield to guard against occasional slippage of the leading strand from the core channel. PMID:25561522
LncRNA GAS5 Represses Osteosarcoma Cells Growth and Metastasis via Sponging MiR-203a
Directory of Open Access Journals (Sweden)
Yang Wang
2018-01-01
Full Text Available Background/Aims: LncRNA GAS5, a growth suppressor, has been reported to exert anti-tumor actions in various cancers, whereas the exact mechanism underling the anti-tumor action is still unclear. This study was aimed to investigate the effect of lncRNA GAS5 on osteosarcoma and tried to decode the underling mechanisms. Methods: Expressions of lncRNA GAS5 in MG-63 cells were silenced by shRNA transfection, while were overexpressed by vector transfection. Cell viability, migration, invasion and apoptosis were respectively assessed by MTT, Transwell assay and flow cytometry. Regulations between lncRNA GAS5 and miR-203a, as well as between miR-203a and TIMP2 were detected by qPCR, western blot and dual luciferase activity assay. Results: LncRNA GAS5 was down-regulated in MG-63 and OS-732 cells compared to hFOB1.19 cells. Silence of lncRNA GAS5 significantly promoted MG-63 cells viability, migration and invasion, and up-regulated Cyclin D1, Cyclin B1, CDK1 and CDK4 expressions. miR-203a was negatively regulated by lncRNA GAS5. The promoting activities of lncRNA GAS5 silence on MG-63 cells growth and metastasis were reversed by miR-203a suppression. TIMP2 was a target of miR-203a and the anti-growth and anti-metastasis actions of miR-203a suppression were reversed by TIMP2 silence. Further, lncRNA GAS5 silence, miR-203a overexpression, and TIMP2 silence could activate PI3K/AKT/GSK3β signaling while block NF-κB signaling. Conclusion: LncRNA GAS5 might be a tumor suppressor in osteosarcoma via sponging miR-203a, sequestering miR-203a away from TIMP2.
Kivlehan, Francine; Mavré, François; Talini, Luc; Limoges, Benoît; Marchal, Damien
2011-09-21
We described an electrochemical method to monitor in real-time the isothermal helicase-dependent amplification of nucleic acids. The principle of detection is simple and well-adapted to the development of portable, easy-to-use and inexpensive nucleic acids detection technologies. It consists of monitoring a decrease in the electrochemical current response of a reporter DNA intercalating redox probe during the isothermal DNA amplification. The method offers the possibility to quantitatively analyze target nucleic acids in less than one hour at a single constant temperature, and to perform at the end of the isothermal amplification a DNA melt curve analysis for differentiating between specific and non-specific amplifications. To illustrate the potentialities of this approach for the development of a simple, robust and low-cost instrument with high throughput capability, the method was validated with an electrochemical system capable of monitoring up to 48 real-time isothermal HDA reactions simultaneously in a disposable microplate consisting of 48-electrochemical microwells. Results obtained with this approach are comparable to that obtained with a well-established but more sophisticated and expensive fluorescence-based method. This makes for a promising alternative detection method not only for real-time isothermal helicase-dependent amplification of nucleic acid, but also for other isothermal DNA amplification strategies.
Mcm10 regulates DNA replication elongation by stimulating the CMG replicative helicase.
Lõoke, Marko; Maloney, Michael F; Bell, Stephen P
2017-02-01
Activation of the Mcm2-7 replicative DNA helicase is the committed step in eukaryotic DNA replication initiation. Although Mcm2-7 activation requires binding of the helicase-activating proteins Cdc45 and GINS (forming the CMG complex), an additional protein, Mcm10, drives initial origin DNA unwinding by an unknown mechanism. We show that Mcm10 binds a conserved motif located between the oligonucleotide/oligosaccharide fold (OB-fold) and A subdomain of Mcm2. Although buried in the interface between these domains in Mcm2-7 structures, mutations predicted to separate the domains and expose this motif restore growth to conditional-lethal MCM10 mutant cells. We found that, in addition to stimulating initial DNA unwinding, Mcm10 stabilizes Cdc45 and GINS association with Mcm2-7 and stimulates replication elongation in vivo and in vitro. Furthermore, we identified a lethal allele of MCM10 that stimulates initial DNA unwinding but is defective in replication elongation and CMG binding. Our findings expand the roles of Mcm10 during DNA replication and suggest a new model for Mcm10 function as an activator of the CMG complex throughout DNA replication. © 2017 Lõoke et al.; Published by Cold Spring Harbor Laboratory Press.
Common 5S rRNA variants are likely to be accepted in many sequence contexts
Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.
2003-01-01
Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The
Bloom syndrome helicase in meiosis: Pro-crossover functions of an anti-crossover protein.
Hatkevich, Talia; Sekelsky, Jeff
2017-09-01
The functions of the Bloom syndrome helicase (BLM) and its orthologs are well characterized in mitotic DNA damage repair, but their roles within the context of meiotic recombination are less clear. In meiotic recombination, multiple repair pathways are used to repair meiotic DSBs, and current studies suggest that BLM may regulate the use of these pathways. Based on literature from Saccharomyces cerevisiae, Arabidopsis thaliana, Mus musculus, Drosophila melanogaster, and Caenorhabditis elegans, we present a unified model for a critical meiotic role of BLM and its orthologs. In this model, BLM and its orthologs utilize helicase activity to regulate the use of various pathways in meiotic recombination by continuously disassembling recombination intermediates. This unwinding activity provides the meiotic program with a steady pool of early recombination substrates, increasing the probability for a DSB to be processed by the appropriate pathway. As a result of BLM activity, crossovers are properly placed throughout the genome, promoting proper chromosomal disjunction at the end of meiosis. This unified model can be used to further refine the complex role of BLM and its orthologs in meiotic recombination. © 2017 WILEY Periodicals, Inc.
PML tumor suppressor protein is required for HCV production
Energy Technology Data Exchange (ETDEWEB)
Kuroki, Misao [Department of Tumor Virology, Okayama University Graduate School of Medicine, Dentistry, and Pharmaceutical Sciences, 2-5-1, Shikata-cho, Okayama 700-8558 (Japan); Research Fellow of the Japan Society for the Promotion of Science (Japan); Center for AIDS Research, Kumamoto University, Kumamoto 860-0811 (Japan); Ariumi, Yasuo, E-mail: ariumi@kumamoto-u.ac.jp [Department of Tumor Virology, Okayama University Graduate School of Medicine, Dentistry, and Pharmaceutical Sciences, 2-5-1, Shikata-cho, Okayama 700-8558 (Japan); Center for AIDS Research, Kumamoto University, Kumamoto 860-0811 (Japan); Hijikata, Makoto [Department of Viral Oncology, Institute for Virus Research, Kyoto University, Kyoto 606-8507 (Japan); Ikeda, Masanori; Dansako, Hiromichi [Department of Tumor Virology, Okayama University Graduate School of Medicine, Dentistry, and Pharmaceutical Sciences, 2-5-1, Shikata-cho, Okayama 700-8558 (Japan); Wakita, Takaji [Department of Virology II, National Institute of Infectious Diseases, Tokyo 162-8640 (Japan); Shimotohno, Kunitada [Research Center for Hepatitis and Immunology, National Center for Global Health and Medicine, Ichikawa, Chiba 272-8516 (Japan); Kato, Nobuyuki [Department of Tumor Virology, Okayama University Graduate School of Medicine, Dentistry, and Pharmaceutical Sciences, 2-5-1, Shikata-cho, Okayama 700-8558 (Japan)
2013-01-11
Highlights: Black-Right-Pointing-Pointer PML tumor suppressor protein is required for HCV production. Black-Right-Pointing-Pointer PML is dispensable for HCV RNA replication. Black-Right-Pointing-Pointer HCV could not alter formation of PML-NBs. Black-Right-Pointing-Pointer INI1 and DDX5, PML-related proteins, are involved in HCV life cycle. -- Abstract: PML tumor suppressor protein, which forms discrete nuclear structures termed PML-nuclear bodies, has been associated with several cellular functions, including cell proliferation, apoptosis and antiviral defense. Recently, it was reported that the HCV core protein colocalizes with PML in PML-NBs and abrogates the PML function through interaction with PML. However, role(s) of PML in HCV life cycle is unknown. To test whether or not PML affects HCV life cycle, we examined the level of secreted HCV core and the infectivity of HCV in the culture supernatants as well as the level of HCV RNA in HuH-7-derived RSc cells, in which HCV-JFH1 can infect and efficiently replicate, stably expressing short hairpin RNA targeted to PML. In this context, the level of secreted HCV core and the infectivity in the supernatants from PML knockdown cells was remarkably reduced, whereas the level of HCV RNA in the PML knockdown cells was not significantly affected in spite of very effective knockdown of PML. In fact, we showed that PML is unrelated to HCV RNA replication using the subgenomic HCV-JFH1 replicon RNA, JRN/3-5B. Furthermore, the infectivity of HCV-like particle in the culture supernatants was significantly reduced in PML knockdown JRN/3-5B cells expressing core to NS2 coding region of HCV-JFH1 genome using the trans-packaging system. Finally, we also demonstrated that INI1 and DDX5, the PML-related proteins, are involved in HCV production. Taken together, these findings suggest that PML is required for HCV production.
RTEL1: functions of a disease-associated helicase.
Vannier, Jean-Baptiste; Sarek, Grzegorz; Boulton, Simon J
2014-07-01
DNA secondary structures that arise during DNA replication, repair, and recombination (3R) must be processed correctly to prevent genetic instability. Regulator of telomere length 1 (RTEL1) is an essential DNA helicase that disassembles a variety of DNA secondary structures to facilitate 3R processes and to maintain telomere integrity. The past few years have witnessed the emergence of RTEL1 variants that confer increased susceptibility to high-grade glioma, astrocytomas, and glioblastomas. Mutations in RTEL1 have also been implicated in Hoyeraal-Hreidarsson syndrome, a severe form of the bone-marrow failure and cancer predisposition disorder, dyskeratosis congenita. We review these recent findings and highlight its crucial link between DNA secondary-structure metabolism and human disease. Copyright © 2014 Elsevier Ltd. All rights reserved.
The Argonaute CSR-1 and its 22G-RNA cofactors are required for holocentric chromosome segregation.
Claycomb, Julie M; Batista, Pedro J; Pang, Ka Ming; Gu, Weifeng; Vasale, Jessica J; van Wolfswinkel, Josien C; Chaves, Daniel A; Shirayama, Masaki; Mitani, Shohei; Ketting, René F; Conte, Darryl; Mello, Craig C
2009-10-02
RNAi-related pathways regulate diverse processes, from developmental timing to transposon silencing. Here, we show that in C. elegans the Argonaute CSR-1, the RNA-dependent RNA polymerase EGO-1, the Dicer-related helicase DRH-3, and the Tudor-domain protein EKL-1 localize to chromosomes and are required for proper chromosome segregation. In the absence of these factors chromosomes fail to align at the metaphase plate and kinetochores do not orient to opposing spindle poles. Surprisingly, the CSR-1-interacting small RNAs (22G-RNAs) are antisense to thousands of germline-expressed protein-coding genes. Nematodes assemble holocentric chromosomes in which continuous kinetochores must span the expressed domains of the genome. We show that CSR-1 interacts with chromatin at target loci but does not downregulate target mRNA or protein levels. Instead, our findings support a model in which CSR-1 complexes target protein-coding domains to promote their proper organization within the holocentric chromosomes of C. elegans.
Time-course of 5-HT(6) receptor mRNA expression during memory consolidation and amnesia.
Huerta-Rivas, A; Pérez-García, G; González-Espinosa, C; Meneses, A
2010-01-01
Growing evidence indicates that antagonists of the 5-hydroxytryptamine (serotonin) receptor(6) (5-HT(6)) improve memory and reverse amnesia although the mechanisms involved are poorly understood. Hence, in this paper RT-PCR was used to evaluate changes in mRNA expression of 5-HT(6) receptor in trained and untrained rats treated with the 5-HT(6) receptor antagonist SB-399885 and amnesic drugs scopolamine or dizocilpine. Changes in mRNA expression of 5-HT(6) receptor were investigated at different times in prefrontal cortex, hippocampus and striatum. Data indicated that memory in the Pavlovian/instrumental autoshaping task was a progressive process associated to reduced mRNA expression of 5-HT(6) receptor in the three structures examined. SB-399885 improved long-term memory at 48h, while the muscarinic receptor antagonist scopolamine or the non-competitive NMDA receptor antagonist dizocilpine impaired it at 24h. Autoshaping training and treatment with SB-399885 increased 5-HT(6) receptor mRNA expression in (maximum increase) prefrontal cortex and striatum, 24 or 48h. The scopolamine-induced amnesia suppressed 5-HT(6) receptor mRNA expression while the dizocilpine-induced amnesia did not modify 5-HT(6) receptor mRNA expression. SB-399885 and scopolamine or dizocilpine were able to reestablish memory and 5-HT(6) receptor mRNA expression. These data confirmed previous memory evidence and of more interest is the observation that training, SB-399885 and amnesic drugs modulated 5-HT(6) receptor mRNA expression in prefrontal cortex, hippocampus and striatum. Further investigation in different memory tasks, times and amnesia models together with more complex control groups might provide further clues. Copyright 2009 Elsevier Inc. All rights reserved.
Coutard, Bruno; Decroly, Etienne; Li, Changqing; Sharff, Andrew; Lescar, Julien; Bricogne, Gérard; Barral, Karine
2014-06-01
Seasonal and pandemic flaviviruses continue to be leading global health concerns. With the view to help drug discovery against Dengue virus (DENV), a fragment-based experimental approach was applied to identify small molecule ligands targeting two main components of the flavivirus replication complex: the NS3 helicase (Hel) and the NS5 mRNA methyltransferase (MTase) domains. A library of 500 drug-like fragments was first screened by thermal-shift assay (TSA) leading to the identification of 36 and 32 fragment hits binding Hel and MTase from DENV, respectively. In a second stage, we set up a fragment-based X-ray crystallographic screening (FBS-X) in order to provide both validated fragment hits and structural binding information. No fragment hit was confirmed for DENV Hel. In contrast, a total of seven fragments were identified as DENV MTase binders and structures of MTase-fragment hit complexes were solved at resolution at least 2.0Å or better. All fragment hits identified contain either a five- or six-membered aromatic ring or both, and three novel binding sites were located on the MTase. To further characterize the fragment hits identified by TSA and FBS-X, we performed enzymatic assays to assess their inhibition effect on the N7- and 2'-O-MTase enzymatic activities: five of these fragment hits inhibit at least one of the two activities with IC50 ranging from 180μM to 9mM. This work validates the FBS-X strategy for identifying new anti-flaviviral hits targeting MTase, while Hel might not be an amenable target for fragment-based drug discovery (FBDD). This approach proved to be a fast and efficient screening method for FBDD target validation and discovery of starting hits for the development of higher affinity molecules that bind to novel allosteric sites. Copyright © 2014 Elsevier B.V. All rights reserved.
Relocalization of nuclear DNA helicase II during the growth period of bovine oocytes
Czech Academy of Sciences Publication Activity Database
Baran, V.; Kovářová, Hana; Klíma, Jiří; Hozák, Pavel; Motlík, Jan
2006-01-01
Roč. 125, 1-2 (2006), s. 155-164 ISSN 0948-6143 R&D Projects: GA ČR GA523/03/0857 Grant - others:Slovenská Akademie věd(SK) VEGA 2/3065/23 Institutional research plan: CEZ:AV0Z50450515; CEZ:AV0Z50390512 Keywords : DNA helicase II * fibroblasts * oocytes Subject RIV: EB - Genetics ; Molecular Biology Impact factor : 3.220, year: 2006
New roles of the human Suv3 helicase in genome maintenance
DEFF Research Database (Denmark)
Venø, Susanne Trillingsgaard
During her PhD studies, Susanne Trillingsgaard Venø carried out research into the role of the human Suv3 protein in stabilising the human genome – DNA. Suv3 is a helicase that separates the two strands of the DNA’s double helix. Throughout our lives, the DNA in our cells is constantly exposed...... maintenance. Based on these new research results, the Suv3 protein could be a valuable model for genome stability as an important factor in our understanding of why we get old....
DEFF Research Database (Denmark)
Natsume, Toyoaki; Nishimura, Kohei; Minocherhomji, Sheroy
2017-01-01
stemming from replisome dissociation during DNA replication perturbation, we used a degron-based system for inducible proteolysis of a subunit of the replicative helicase. We show that MCM2-depleted cells activate a DNA damage response pathway and generate replication-associated DNA double-strand breaks...
Molecular architecture of the recombinant human MCM2-7 helicase in complex with nucleotides and DNA
DEFF Research Database (Denmark)
Boskovic, Jasminka; Bragado-Nilsson, Elisabeth; Saligram Prabhakar, Bhargav
2016-01-01
DNA replication is a key biological process that involves different protein complexes whose assembly is rigorously regulated in a successive order. One of these complexes is a replicative hexameric helicase, the MCM complex, which is essential for the initiation and elongation phases of replicati...
Visual Display of 5p-arm and 3p-arm miRNA Expression with a Mobile Application.
Pan, Chao-Yu; Kuo, Wei-Ting; Chiu, Chien-Yuan; Lin, Wen-Chang
2017-01-01
MicroRNAs (miRNAs) play important roles in human cancers. In previous studies, we have demonstrated that both 5p-arm and 3p-arm of mature miRNAs could be expressed from the same precursor and we further interrogated the 5p-arm and 3p-arm miRNA expression with a comprehensive arm feature annotation list. To assist biologists to visualize the differential 5p-arm and 3p-arm miRNA expression patterns, we utilized a user-friendly mobile App to display. The Cancer Genome Atlas (TCGA) miRNA-Seq expression information. We have collected over 4,500 miRNA-Seq datasets from 15 TCGA cancer types and further processed them with the 5p-arm and 3p-arm annotation analysis pipeline. In order to be displayed with the RNA-Seq Viewer App, annotated 5p-arm and 3p-arm miRNA expression information and miRNA gene loci information were converted into SQLite tables. In this distinct application, for any given miRNA gene, 5p-arm miRNA is illustrated on the top of chromosome ideogram and 3p-arm miRNA is illustrated on the bottom of chromosome ideogram. Users can then easily interrogate the differentially 5p-arm/3p-arm expressed miRNAs with their mobile devices. This study demonstrates the feasibility and utility of RNA-Seq Viewer App in addition to mRNA-Seq data visualization.
Visual Display of 5p-arm and 3p-arm miRNA Expression with a Mobile Application
Directory of Open Access Journals (Sweden)
Chao-Yu Pan
2017-01-01
Full Text Available MicroRNAs (miRNAs play important roles in human cancers. In previous studies, we have demonstrated that both 5p-arm and 3p-arm of mature miRNAs could be expressed from the same precursor and we further interrogated the 5p-arm and 3p-arm miRNA expression with a comprehensive arm feature annotation list. To assist biologists to visualize the differential 5p-arm and 3p-arm miRNA expression patterns, we utilized a user-friendly mobile App to display. The Cancer Genome Atlas (TCGA miRNA-Seq expression information. We have collected over 4,500 miRNA-Seq datasets from 15 TCGA cancer types and further processed them with the 5p-arm and 3p-arm annotation analysis pipeline. In order to be displayed with the RNA-Seq Viewer App, annotated 5p-arm and 3p-arm miRNA expression information and miRNA gene loci information were converted into SQLite tables. In this distinct application, for any given miRNA gene, 5p-arm miRNA is illustrated on the top of chromosome ideogram and 3p-arm miRNA is illustrated on the bottom of chromosome ideogram. Users can then easily interrogate the differentially 5p-arm/3p-arm expressed miRNAs with their mobile devices. This study demonstrates the feasibility and utility of RNA-Seq Viewer App in addition to mRNA-Seq data visualization.
Fabian, Marc R; White, K Andrew
2004-07-09
Tomato bushy stunt virus (TBSV) is the prototypical member of the genus Tombusvirus in the family Tombusviridae. The (+)-strand RNA genome of TBSV lacks both a 5' cap and a 3' poly(A) tail and instead contains a 3'-terminal RNA sequence that acts as a cap-independent translational enhancer (3' CITE). In this study, we have determined the RNA secondary structure of the translation-specific central segment of the 3' CITE, termed region 3.5 (R3.5). MFOLD structural modeling combined with solution structure mapping and comparative sequence analysis indicate that R3.5 adopts a branched structure that contains three major helices. Deletion and substitution studies revealed that two of these extended stem-loop (SL) structures are essential for 3' CITE activity in vivo. In particular, the terminal loop of one of these SLs, SL-B, was found to be critical for translation. Compensatory mutational analysis showed that SL-B functions by base pairing with another SL, SL3, in the 5' untranslated region of the TBSV genome. Thus, efficient translation of TBSV mRNA in vivo requires a 5'-3' RNA-RNA interaction that effectively circularizes the message. Similar types of interactions are also predicted to occur in TBSV subgenomic mRNAs between their 5' untranslated regions and the 3' CITE, and both genomic and subgenomic 5'-3' interactions are well conserved in all members of the genus Tombusvirus. In addition, a survey of other genera in Tombusviridae revealed the potential for similar 5'-3' RNA-RNA-based interactions in their viral mRNAs, suggesting that this mechanism extends throughout this large virus family.
The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine
International Nuclear Information System (INIS)
Nuc, K.; Nuc, P.; Pawelkiewicz, J.
1993-01-01
We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs
Zheng, Xiaomei; Zheng, Ping; Zhang, Kun; Cairns, Timothy C; Meyer, Vera; Sun, Jibin; Ma, Yanhe
2018-04-30
The CRISPR/Cas9 system is a revolutionary genome editing tool. However, in eukaryotes, search and optimization of a suitable promoter for guide RNA expression is a significant technical challenge. Here we used the industrially important fungus, Aspergillus niger, to demonstrate that the 5S rRNA gene, which is both highly conserved and efficiently expressed in eukaryotes, can be used as a guide RNA promoter. The gene editing system was established with 100% rates of precision gene modifications among dozens of transformants using short (40-bp) homologous donor DNA. This system was also applicable for generation of designer chromosomes, as evidenced by deletion of a 48 kb gene cluster required for biosynthesis of the mycotoxin fumonisin B1. Moreover, this system also facilitated simultaneous mutagenesis of multiple genes in A. niger. We anticipate that the use of the 5S rRNA gene as guide RNA promoter can broadly be applied for engineering highly efficient eukaryotic CRISPR/Cas9 toolkits. Additionally, the system reported here will enable development of designer chromosomes in model and industrially important fungi.
Collaborating functions of BLM and DNA topoisomerase I in regulating human rDNA transcription
Energy Technology Data Exchange (ETDEWEB)
Grierson, Patrick M. [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States); Acharya, Samir, E-mail: samir.acharya@osumc.edu [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States); Groden, Joanna [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States)
2013-03-15
Bloom's syndrome (BS) is an inherited disorder caused by loss of function of the recQ-like BLM helicase. It is characterized clinically by severe growth retardation and cancer predisposition. BLM localizes to PML nuclear bodies and to the nucleolus; its deficiency results in increased intra- and inter-chromosomal recombination, including hyper-recombination of rDNA repeats. Our previous work has shown that BLM facilitates RNA polymerase I-mediated rRNA transcription in the nucleolus (Grierson et al., 2012 [18]). This study uses protein co-immunoprecipitation and in vitro transcription/translation (IVTT) to identify a direct interaction of DNA topoisomerase I with the C-terminus of BLM in the nucleolus. In vitro helicase assays demonstrate that DNA topoisomerase I stimulates BLM helicase activity on a nucleolar-relevant RNA:DNA hybrid, but has an insignificant effect on BLM helicase activity on a control DNA:DNA duplex substrate. Reciprocally, BLM enhances the DNA relaxation activity of DNA topoisomerase I on supercoiled DNA substrates. Our study suggests that BLM and DNA topoisomerase I function coordinately to modulate RNA:DNA hybrid formation as well as relaxation of DNA supercoils in the context of nucleolar transcription.
Collaborating functions of BLM and DNA topoisomerase I in regulating human rDNA transcription
International Nuclear Information System (INIS)
Grierson, Patrick M.; Acharya, Samir; Groden, Joanna
2013-01-01
Bloom's syndrome (BS) is an inherited disorder caused by loss of function of the recQ-like BLM helicase. It is characterized clinically by severe growth retardation and cancer predisposition. BLM localizes to PML nuclear bodies and to the nucleolus; its deficiency results in increased intra- and inter-chromosomal recombination, including hyper-recombination of rDNA repeats. Our previous work has shown that BLM facilitates RNA polymerase I-mediated rRNA transcription in the nucleolus (Grierson et al., 2012 [18]). This study uses protein co-immunoprecipitation and in vitro transcription/translation (IVTT) to identify a direct interaction of DNA topoisomerase I with the C-terminus of BLM in the nucleolus. In vitro helicase assays demonstrate that DNA topoisomerase I stimulates BLM helicase activity on a nucleolar-relevant RNA:DNA hybrid, but has an insignificant effect on BLM helicase activity on a control DNA:DNA duplex substrate. Reciprocally, BLM enhances the DNA relaxation activity of DNA topoisomerase I on supercoiled DNA substrates. Our study suggests that BLM and DNA topoisomerase I function coordinately to modulate RNA:DNA hybrid formation as well as relaxation of DNA supercoils in the context of nucleolar transcription
G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*
Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang
2015-01-01
The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683
Gemin5: A Multitasking RNA-Binding Protein Involved in Translation Control
Directory of Open Access Journals (Sweden)
David Piñeiro
2015-04-01
Full Text Available Gemin5 is a RNA-binding protein (RBP that was first identified as a peripheral component of the survival of motor neurons (SMN complex. This predominantly cytoplasmic protein recognises the small nuclear RNAs (snRNAs through its WD repeat domains, allowing assembly of the SMN complex into small nuclear ribonucleoproteins (snRNPs. Additionally, the amino-terminal end of the protein has been reported to possess cap-binding capacity and to interact with the eukaryotic initiation factor 4E (eIF4E. Gemin5 was also shown to downregulate translation, to be a substrate of the picornavirus L protease and to interact with viral internal ribosome entry site (IRES elements via a bipartite non-canonical RNA-binding site located at its carboxy-terminal end. These features link Gemin5 with translation control events. Thus, beyond its role in snRNPs biogenesis, Gemin5 appears to be a multitasking protein cooperating in various RNA-guided processes. In this review, we will summarise current knowledge of Gemin5 functions. We will discuss the involvement of the protein on translation control and propose a model to explain how the proteolysis fragments of this RBP in picornavirus-infected cells could modulate protein synthesis.
Assembly of proteins and 5 S rRNA to transcripts of the major structural domains of 23 S rRNA
DEFF Research Database (Denmark)
Ostergaard, P; Phan, H; Johansen, L B
1998-01-01
The six major structural domains of 23 S rRNA from Escherichia coli, and all combinations thereof, were synthesized as separate T7 transcripts and reconstituted with total 50 S subunit proteins. Analysis by one and two-dimensional gel electrophoresis demonstrated the presence of at least one prim...... approach was used to map the putative binding regions on domain V of protein L9 and the 5 S RNA-L5-L18 complex....
Directory of Open Access Journals (Sweden)
Katrina Mitchel
Full Text Available The contributions of the Sgs1, Mph1, and Srs2 DNA helicases during mitotic double-strand break (DSB repair in yeast were investigated using a gap-repair assay. A diverged chromosomal substrate was used as a repair template for the gapped plasmid, allowing mismatch-containing heteroduplex DNA (hDNA formed during recombination to be monitored. Overall DSB repair efficiencies and the proportions of crossovers (COs versus noncrossovers (NCOs were determined in wild-type and helicase-defective strains, allowing the efficiency of CO and NCO production in each background to be calculated. In addition, the products of individual NCO events were sequenced to determine the location of hDNA. Because hDNA position is expected to differ depending on whether a NCO is produced by synthesis-dependent-strand-annealing (SDSA or through a Holliday junction (HJ-containing intermediate, its position allows the underlying molecular mechanism to be inferred. Results demonstrate that each helicase reduces the proportion of CO recombinants, but that each does so in a fundamentally different way. Mph1 does not affect the overall efficiency of gap repair, and its loss alters the CO-NCO by promoting SDSA at the expense of HJ-containing intermediates. By contrast, Sgs1 and Srs2 are each required for efficient gap repair, strongly promoting NCO formation and having little effect on CO efficiency. hDNA analyses suggest that all three helicases promote SDSA, and that Sgs1 and Srs2 additionally dismantle HJ-containing intermediates. The hDNA data are consistent with the proposed role of Sgs1 in the dissolution of double HJs, and we propose that Srs2 dismantles nicked HJs.
Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M
2017-04-01
5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Directory of Open Access Journals (Sweden)
Ling Liu
2009-03-01
Full Text Available Brome mosaic virus (BMV protein 1a has multiple key roles in viral RNA replication. 1a localizes to perinuclear endoplasmic reticulum (ER membranes as a peripheral membrane protein, induces ER membrane invaginations in which RNA replication complexes form, and recruits and stabilizes BMV 2a polymerase (2a(Pol and RNA replication templates at these sites to establish active replication complexes. During replication, 1a provides RNA capping, NTPase and possibly RNA helicase functions. Here we identify in BMV 1a an amphipathic alpha-helix, helix A, and use NMR analysis to define its structure and propensity to insert in hydrophobic membrane-mimicking micelles. We show that helix A is essential for efficient 1a-ER membrane association and normal perinuclear ER localization, and that deletion or mutation of helix A abolishes RNA replication. Strikingly, mutations in helix A give rise to two dramatically opposite 1a function phenotypes, implying that helix A acts as a molecular switch regulating the intricate balance between separable 1a functions. One class of helix A deletions and amino acid substitutions markedly inhibits 1a-membrane association and abolishes ER membrane invagination, viral RNA template recruitment, and replication, but doubles the 1a-mediated increase in 2a(Pol accumulation. The second class of helix A mutations not only maintains efficient 1a-membrane association but also amplifies the number of 1a-induced membrane invaginations 5- to 8-fold and enhances viral RNA template recruitment, while failing to stimulate 2a(Pol accumulation. The results provide new insights into the pathways of RNA replication complex assembly and show that helix A is critical for assembly and function of the viral RNA replication complex, including its central role in targeting replication components and controlling modes of 1a action.
International Nuclear Information System (INIS)
Eki, T.
2004-01-01
Gene function suppression nematodes were produced by systematic RNA interference process (RNAi) of genes which included helicase gene group. Some of high sensitivity genes were identified by the result of function screening for X-ray sensitivity of the function suppression nematode. A complete length of cDNA was separated from the two novel genes, and all the base sequences were determined. It was cleared that one of the novel genes encodes RNA helicases protein which consists of 1,119 amino acids, and the other one encodes chromatin modeling ATPase protein which consists of 3,035 and 3,201 amino acids. Candidacy genes of about 14 pieces for the RNA helicase protein were identified by yeast two-hybrid process as the results of research for nematode protein which showed protein interaction. (M. Suetake)
Czech Academy of Sciences Publication Activity Database
Šimandlová, Jitka; Zagelbaum, J.; Payne, M.J.; Chu, W.K.; Shevelev, Igor; Hanada, K.; Chatterjee, S.; Reid, D.A.; Liu, Y.; Janščák, Pavel; Rothenberg, E.; Hickson, I.D.
2013-01-01
Roč. 288, č. 47 (2013), s. 34168-34180 ISSN 0021-9258 R&D Projects: GA ČR GAP305/10/0281 Institutional support: RVO:68378050 Keywords : DNA damage * DNA helicase * DNA recombination * DNA repair * DNA replication Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.600, year: 2013
Kamina, Anyango D; Williams, Noreen
2017-01-01
RNA binding proteins are involved in many aspects of RNA metabolism. In Trypanosoma brucei, our laboratory has identified two trypanosome-specific RNA binding proteins P34 and P37 that are involved in the maturation of the 60S subunit during ribosome biogenesis. These proteins are part of the T. brucei 5S ribonucleoprotein particle (5S RNP) and P34 binds to 5S ribosomal RNA (rRNA) and ribosomal protein L5 through its N-terminus and its RNA recognition motif (RRM) domains. We generated truncated P34 proteins to determine these domains' interactions with 5S rRNA and L5. Our analyses demonstrate that RRM1 of P34 mediates the majority of binding with 5S rRNA and the N-terminus together with RRM1 contribute the most to binding with L5. We determined that the consensus ribonucleoprotein (RNP) 1 and 2 sequences, characteristic of canonical RRM domains, are not fully conserved in the RRM domains of P34. However, the aromatic amino acids previously described to mediate base stacking interactions with their RNA target are conserved in both of the RRM domains of P34. Surprisingly, mutation of these aromatic residues did not disrupt but instead enhanced 5S rRNA binding. However, we identified four arginine residues located in RRM1 of P34 that strongly impact L5 binding. These mutational analyses of P34 suggest that the binding site for 5S rRNA and L5 are near each other and specific residues within P34 regulate the formation of the 5S RNP. These studies show the unique way that the domains of P34 mediate binding with the T. brucei 5S RNP.
DEFF Research Database (Denmark)
Nguyen, Giang Huong; Tang, Weiliang; Robles, Ana I
2014-01-01
Bloom syndrome is a rare autosomal recessive disorder characterized by genetic instability and cancer predisposition, and caused by mutations in the gene encoding the Bloom syndrome, RecQ helicase-like (BLM) protein. To determine whether altered gene expression might be responsible for pathologic...
Hauler, Aron; Jonietz, Christian; Stoll, Birgit; Stoll, Katrin; Braun, Hans-Peter; Binder, Stefan
2013-05-01
The 5' ends of many mitochondrial transcripts are generated post-transcriptionally. Recently, we identified three RNA PROCESSING FACTORs required for 5' end maturation of different mitochondrial mRNAs in Arabidopsis thaliana. All of these factors are pentatricopeptide repeat proteins (PPRPs), highly similar to RESTORERs OF FERTILTY (RF), that rescue male fertility in cytoplasmic male-sterile lines from different species. Therefore, we suggested a general role of these RF-like PPRPs in mitochondrial 5' processing. We now identified RNA PROCESSING FACTOR 5, a PPRP not classified as an RF-like protein, required for the efficient 5' maturation of the nad6 and atp9 mRNAs as well as 26S rRNA. The precursor molecules of these RNAs share conserved sequence elements, approximately ranging from positions -50 to +9 relative to mature 5' mRNA termini, suggesting these sequences to be at least part of the cis elements required for processing. The knockout of RPF5 has only a moderate influence on 5' processing of atp9 mRNA, whereas the generation of the mature nad6 mRNA and 26S rRNA is almost completely abolished in the mutant. The latter leads to a 50% decrease of total 26S rRNA species, resulting in an imbalance between the large rRNA and 18S rRNA. Despite these severe changes in RNA levels and in the proportion between the 26S and 18S rRNAs, mitochondrial protein levels appear to be unaltered in the mutant, whereas seed germination capacity is markedly reduced. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.
hSSB1 associates with and promotes stability of the BLM helicase
O'BYRNE, KEN
2017-01-01
Background Maintenance of genome stability is critical in human cells. Mutations in or loss of genome stability pathways can lead to a number of pathologies including cancer. hSSB1 is a critical DNA repair protein functioning in the repair and signalling of stalled DNA replication forks, double strand DNA breaks and oxidised DNA lesions. The BLM helicase is central to the repair of both collapsed DNA replication forks and double strand DNA breaks by homologous recombination. Results In this s...
Recker, Julia; Knoll, Alexander; Puchta, Holger
2014-01-01
In humans, mutations in the DNA helicase Regulator of Telomere Elongation Helicase1 (RTEL1) lead to Hoyeraal-Hreidarsson syndrome, a severe, multisystem disorder. Here, we demonstrate that the RTEL1 homolog in Arabidopsis thaliana plays multiple roles in preserving genome stability. RTEL1 suppresses homologous recombination in a pathway parallel to that of the DNA translocase FANCM. Cytological analyses of root meristems indicate that RTEL1 is involved in processing DNA replication intermediates independently from FANCM and the nuclease MUS81. Moreover, RTEL1 is involved in interstrand and intrastrand DNA cross-link repair independently from FANCM and (in intrastrand cross-link repair) parallel to MUS81. RTEL1 contributes to telomere homeostasis; the concurrent loss of RTEL1 and the telomerase TERT leads to rapid, severe telomere shortening, which occurs much more rapidly than it does in the single-mutant line tert, resulting in developmental arrest after four generations. The double mutant rtel1-1 recq4A-4 exhibits massive growth defects, indicating that this RecQ family helicase, which is also involved in the suppression of homologous recombination and the repair of DNA lesions, can partially replace RTEL1 in the processing of DNA intermediates. The requirement for RTEL1 in multiple pathways to preserve genome stability in plants can be explained by its putative role in the destabilization of DNA loop structures, such as D-loops and T-loops. PMID:25516598
Tan, Cheng; Li, Wenfei; Wang, Wei
2013-12-19
Protein TFIIIA is composed of nine tandemly arranged Cys2His2 zinc fingers. It can bind either to the 5S RNA gene as a transcription factor or to the 5S RNA transcript as a chaperone. Although structural and biochemical data provided valuable information on the recognition between the TFIIIIA and the 5S DNA/RNA, the involved conformational motions and energetic factors contributing to the binding affinity and specificity remain unclear. In this work, we conducted MD simulations and MM/GBSA calculations to investigate the binding-induced conformational changes in the recognition of the 5S RNA by the central three zinc fingers of TFIIIA and the energetic factors that influence the binding affinity and specificity at an atomistic level. Our results revealed drastic interdomain conformational changes between these three zinc fingers, involving the exposure/burial of several crucial DNA/RNA binding residues, which can be related to the competition between DNA and RNA for the binding of TFIIIA. We also showed that the specific recognition between finger 4/finger 6 and the 5S RNA introduces frustrations to the nonspecific interactions between finger 5 and the 5S RNA, which may be important to achieve optimal binding affinity and specificity.
Thakur, Manoj; Kumar, Mohan B J; Muniyappa, K
2016-10-18
Much is known about the Escherichia coli nucleotide excision repair (NER) pathway; however, very little is understood about the proteins involved and the molecular mechanism of NER in mycobacteria. In this study, we show that Mycobacterium tuberculosis UvrB (MtUvrB), which exists in solution as a monomer, binds to DNA in a structure-dependent manner. A systematic examination of MtUvrB substrate specificity reveals that it associates preferentially with single-stranded DNA, duplexes with 3' or 5' overhangs, and linear duplex DNA with splayed arms. Whereas E. coli UvrB (EcUvrB) binds weakly to undamaged DNA and has no ATPase activity, MtUvrB possesses intrinsic ATPase activity that is greatly stimulated by both single- and double-stranded DNA. Strikingly, we found that MtUvrB, but not EcUvrB, possesses the DNA unwinding activity characteristic of an ATP-dependent DNA helicase. The helicase activity of MtUvrB proceeds in the 3' to 5' direction and is strongly modulated by a nontranslocating 5' single-stranded tail, indicating that in addition to the translocating strand it also interacts with the 5' end of the substrate. The fraction of DNA unwound by MtUvrB decreases significantly as the length of the duplex increases: it fails to unwind duplexes longer than 70 bp. These results, on one hand, reveal significant mechanistic differences between MtUvrB and EcUvrB and, on the other, support an alternative role for UvrB in the processing of key DNA replication intermediates. Altogether, our findings provide insights into the catalytic functions of UvrB and lay the foundation for further understanding of the NER pathway in M. tuberculosis.
International Nuclear Information System (INIS)
Vakhitov, V.A.; Gimalov, F.R.; Nikonorov, Yu.M.
1986-01-01
The number of 5s-rRNA and tRNA genes has been studied in 43 species of wheat and Aegilops differing in ploidy level, genomic composition and origin. It has been demonstrated that the repeatability of the 5s-rRNA and tRNA genes increases in wheat with increasing ploidy level, but not in proportion to the genome size. In Aegilops, in distinction from wheat, the relative as well as absolute number of 5s-RNA genes increases with increasing ploidy level. The proportion of the sequences coding for tRNA in the dipoloid and polyploid Aegilops species is practically similar, while the number of tRNA genes increases almost 2-3 times with increasing ploidy level. Large variability has been recorded between the species with similar genomic composition and ploidy level in respect of the number of the 5s-rRNA and tRNA genes. It has been demonstrated that integration of the initial genomes of the amphidiploids is accompanied by elimination of a particular part of these genomes. It has been concluded that the mechanisms of establishment and evolution of genomes in the intra- and intergeneric allopolyploids are not identical
The human RecQ helicases BLM and RECQL4 cooperate to preserve genome stability
Czech Academy of Sciences Publication Activity Database
Singh, D.K.; Popuri, V.; Kulikowicz, T.; Shevelev, Igor; Ghosh, A.K.; Ramamoorthy, M.; Rossi, M.L.; Janščák, Pavel; Croteau, D.L.; Bohr, V.A.
2012-01-01
Roč. 40, č. 14 (2012), s. 6632-6648 ISSN 0305-1048 R&D Projects: GA ČR GAP305/10/0281 Grant - others:NIH(US) Z01-AG000726-17 Institutional research plan: CEZ:AV0Z50520514 Institutional support: RVO:68378050 Keywords : RecQ helicase * genome stability * BLM * RECQL4 Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 8.278, year: 2012
SNHG5 promotes colorectal cancer cell survival by counteracting STAU1-mediated mRNA destabilization
DEFF Research Database (Denmark)
Damas, Nkerorema Djodji; Marcatti, Michela; Côme, Christophe
2016-01-01
We currently have limited knowledge of the involvement of long non-coding RNAs (lncRNAs) in normal cellular processes and pathologies. Here, we identify and characterize SNHG5 as a stable cytoplasmic lncRNA with up-regulated expression in colorectal cancer. Depletion of SNHG5 induces cell cycle...... characterize SNHG5 as a lncRNA promoting tumour cell survival in colorectal cancer and delineate a novel mechanism in which a cytoplasmic lncRNA functions through blocking the action of STAU1....
Beauparlant, Marc A; Drouin, Guy
2014-02-01
Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.
Directory of Open Access Journals (Sweden)
Joseph M Dhahbi
2018-02-01
Full Text Available Extracellular RNAs are gaining clinical interest as biofluid-based noninvasive markers for diseases, especially cancer. In particular, derivatives of transfer RNA (tRNA are emerging as a new class of small-noncoding RNAs with high biomarker potential. We and others previously reported alterations in serum levels of specific tRNA halves in disease states including cancer. Here, we explored seminal fluid for tRNA halves as potential markers of prostate cancer. We found that 5′ tRNA halves are abundant in seminal fluid and are elevated in prostate cancer relative to noncancer patients. Importantly, most of these tRNA halves are also detectable in prostatic tissues, and a subset were increased in malignant relative to adjacent normal tissue. These findings emphasize the potential of 5′ tRNA halves as noninvasive markers for prostate cancer screening and diagnosis and provide leads for future work to elucidate a putative role of the 5′ tRNA halves in carcinogenesis.
Dissection of the functional domains of an archaeal holliday junction helicase
DEFF Research Database (Denmark)
Hong, Ye; Chu, Mingzhu; Li, Yansheng
2012-01-01
Helicases and nucleases form complexes that play very important roles in DNA repair pathways some of which interact with each other at Holliday junctions. In this study, we present in vitro and in vivo analysis of Hjm and its interaction with Hjc in Sulfolobus. In vitro studies employed Hjm from...... conformation change of the enzyme. Furthermore, StoHjm is able to prevent the formation of Hjc/HJ high complex, suggesting a regulation mechanism of Hjm to the activity of Hjc. We show that Hjm is essential for cell viability using recently developed genetic system and mutant propagation assay, suggesting...
Yeast as a model system to study RecQ helicase function
DEFF Research Database (Denmark)
Ashton, Thomas M; Hickson, Ian David
2010-01-01
Mutations in the highly conserved RecQ helicase, BLM, cause the rare cancer predisposition disorder, Bloom's syndrome. The orthologues of BLM in Saccharomyces cerevisiae and Schizosaccharomyces pombe are SGS1 and rqh1(+), respectively. Studies in these yeast species have revealed a plethora...... of roles for the Sgs1 and Rqh1 proteins in repair of double strand breaks, restart of stalled replication forks, processing of aberrant intermediates that arise during meiotic recombination, and maintenance of telomeres. In this review, we focus on the known roles of Sgs1 and Rqh1 and how studies in yeast...
PAX5О± and PAX5ОІ mRNA expression in breast Cancer: Relation ...
African Journals Online (AJOL)
Manal Basyouni Ahmed
mRNA expression of PAX5a and PAX5b in breast cancer and assessing their underlying pathological roles through ... the molecular alterations that contribute to disease initiation and ... ring growth and survival of cancer cells [3]. PAX5 is ..... and CA15-3 are prognostic parameters for different molecular subtypes of · breast ...
Energy Technology Data Exchange (ETDEWEB)
Yoshikatsu, Yuki [Department of Life Systems, Institute of Technology and Science, The University of Tokushima Graduate School, Tokushima 770-8506 (Japan); Ishida, Yo-ichi; Sudo, Haruka [Department of Molecular and Cellular Biochemistry, Meiji Pharmaceutical University, Kiyose, Tokyo 204-8588 (Japan); Yuasa, Keizo; Tsuji, Akihiko [Department of Life Systems, Institute of Technology and Science, The University of Tokushima Graduate School, Tokushima 770-8506 (Japan); Nagahama, Masami, E-mail: nagahama@my-pharm.ac.jp [Department of Molecular and Cellular Biochemistry, Meiji Pharmaceutical University, Kiyose, Tokyo 204-8588 (Japan)
2015-08-28
Nuclear VCP-like 2 (NVL2) is a member of the chaperone-like AAA-ATPase family and is involved in the biosynthesis of 60S ribosomal subunits in mammalian cells. We previously showed the interaction of NVL2 with a DExD/H-box RNA helicase MTR4/DOB1, which is a known cofactor for an exoribonuclease complex, the exosome. This finding implicated NVL2 in RNA metabolic processes during ribosome biogenesis. In the present study, we found that a series of mutations within the ATPase domain of NVL2 causes a defect in pre-rRNA processing into mature 28S and 5.8S rRNAs. Co-immunoprecipitation analysis showed that NVL2 was associated with the nuclear exosome complex, which includes RRP6 as a nucleus-specific catalytic subunit. This interaction was prevented by depleting either MTR4 or RRP6, indicating their essential role in mediating this interaction with NVL2. Additionally, knockdown of MPP6, another cofactor for the nuclear exosome, also prevented the interaction by causing MTR4 to dissociate from the nuclear exosome. These results suggest that NVL2 is involved in pre-rRNA processing by associating with the nuclear exosome complex and that MPP6 is required for maintaining the integrity of this rRNA processing complex. - Highlights: • ATPase-deficient mutants of NVL2 have decreased pre-rRNA processing. • NVL2 associates with the nuclear exosome through interactions with MTR4 and RRP6. • MPP6 stabilizes MTR4-RRP6 interaction and allows NVL2 to interact with the complex.
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
The Human Splicing Factor ASF/SF2 can Specifically Recognize Pre-mRNA 5' Splice Sites
Zuo, Ping; Manley, James L.
1994-04-01
ASF/SF2 is a human protein previously shown to function in in vitro pre-mRNA splicing as an essential factor necessary for all splices and also as an alternative splicing factor, capable of switching selection of 5' splice sites. To begin to study the protein's mechanism of action, we have investigated the RNA binding properties of purified recombinant ASF/SF2. Using UV crosslinking and gel shift assays, we demonstrate that the RNA binding region of ASF/SF2 can interact with RNA in a sequence-specific manner, recognizing the 5' splice site in each of two different pre-mRNAs. Point mutations in the 5' splice site consensus can reduce binding by as much as a factor of 100, with the largest effects observed in competition assays. These findings support a model in which ASF/SF2 aids in the recognition of pre-mRNA 5' splice sites.
Langston, Lance D; Zhang, Dan; Yurieva, Olga; Georgescu, Roxana E; Finkelstein, Jeff; Yao, Nina Y; Indiani, Chiara; O'Donnell, Mike E
2014-10-28
DNA replication in eukaryotes is asymmetric, with separate DNA polymerases (Pol) dedicated to bulk synthesis of the leading and lagging strands. Pol α/primase initiates primers on both strands that are extended by Pol ε on the leading strand and by Pol δ on the lagging strand. The CMG (Cdc45-MCM-GINS) helicase surrounds the leading strand and is proposed to recruit Pol ε for leading-strand synthesis, but to date a direct interaction between CMG and Pol ε has not been demonstrated. While purifying CMG helicase overexpressed in yeast, we detected a functional complex between CMG and native Pol ε. Using pure CMG and Pol ε, we reconstituted a stable 15-subunit CMG-Pol ε complex and showed that it is a functional polymerase-helicase on a model replication fork in vitro. On its own, the Pol2 catalytic subunit of Pol ε is inefficient in CMG-dependent replication, but addition of the Dpb2 protein subunit of Pol ε, known to bind the Psf1 protein subunit of CMG, allows stable synthesis with CMG. Dpb2 does not affect Pol δ function with CMG, and thus we propose that the connection between Dpb2 and CMG helps to stabilize Pol ε on the leading strand as part of a 15-subunit leading-strand holoenzyme we refer to as CMGE. Direct binding between Pol ε and CMG provides an explanation for specific targeting of Pol ε to the leading strand and provides clear mechanistic evidence for how strand asymmetry is maintained in eukaryotes.
The adnAB Locus, Encoding a Putative Helicase-Nuclease Activity, Is Essential in Streptomyces
Zhang, Lingli; Nguyen, Hoang Chuong; Chipot, Ludovic; Piotrowski, Emilie; Bertrand, Claire
2014-01-01
Homologous recombination is a crucial mechanism that repairs a wide range of DNA lesions, including the most deleterious ones, double-strand breaks (DSBs). This multistep process is initiated by the resection of the broken DNA ends by a multisubunit helicase-nuclease complex exemplified by Escherichia coli RecBCD, Bacillus subtilis AddAB, and newly discovered Mycobacterium tuberculosis AdnAB. Here we show that in Streptomyces, neither recBCD nor addAB homologues could be detected. The only putative helicase-nuclease-encoding genes identified were homologous to M. tuberculosis adnAB genes. These genes are conserved as a single copy in all sequenced genomes of Streptomyces. The disruption of adnAB in Streptomyces ambofaciens and Streptomyces coelicolor could not be achieved unless an ectopic copy was provided, indicating that adnAB is essential for growth. Both adnA and adnB genes were shown to be inducible in response to DNA damage (mitomycin C) and to be independently transcribed. Introduction of S. ambofaciens adnAB genes in an E. coli recB mutant restored viability and resistance to UV light, suggesting that Streptomyces AdnAB could be a functional homologue of RecBCD and be involved in DNA damage resistance. PMID:24837284
Zelenka, Jaroslav; Alán, Lukáš; Jabůrek, Martin; Ježek, Petr
2014-04-01
Based on the matrix-addressing sequence of mitochondrial ribosomal 5S-rRNA (termed MAM), which is naturally imported into mitochondria, we have constructed an import system for in vivo targeting of mitochondrial DNA (mtDNA) or mt-mRNA, in order to provide fluorescence hybridization of the desired sequences. Thus DNA oligonucleotides were constructed, containing the 5'-flanked T7 RNA polymerase promoter. After in vitro transcription and fluorescent labeling with Alexa Fluor(®) 488 or 647 dye, we obtained the fluorescent "L-ND5 probe" containing MAM and exemplar cargo, i.e., annealing sequence to a short portion of ND5 mRNA and to the light-strand mtDNA complementary to the heavy strand nd5 mt gene (5'-end 21 base pair sequence). For mitochondrial in vivo fluorescent hybridization, HepG2 cells were treated with dequalinium micelles, containing the fluorescent probes, bringing the probes proximally to the mitochondrial outer membrane and to the natural import system. A verification of import into the mitochondrial matrix of cultured HepG2 cells was provided by confocal microscopy colocalizations. Transfections using lipofectamine or probes without 5S-rRNA addressing MAM sequence or with MAM only were ineffective. Alternatively, the same DNA oligonucleotides with 5'-CACC overhang (substituting T7 promoter) were transcribed from the tetracycline-inducible pENTRH1/TO vector in human embryonic kidney T-REx®-293 cells, while mitochondrial matrix localization after import of the resulting unlabeled RNA was detected by PCR. The MAM-containing probe was then enriched by three-order of magnitude over the natural ND5 mRNA in the mitochondrial matrix. In conclusion, we present a proof-of-principle for mitochondrial in vivo hybridization and mitochondrial nucleic acid import.
Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18
Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan
2011-01-01
5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364
Hishiki, Asami; Hara, Kodai; Ikegaya, Yuzu; Yokoyama, Hideshi; Shimizu, Toshiyuki; Sato, Mamoru; Hashimoto, Hiroshi
2015-05-22
HLTF (helicase-like transcription factor) is a yeast RAD5 homolog found in mammals. HLTF has E3 ubiquitin ligase and DNA helicase activities, and plays a pivotal role in the template-switching pathway of DNA damage tolerance. HLTF has an N-terminal domain that has been designated the HIRAN (HIP116 and RAD5 N-terminal) domain. The HIRAN domain has been hypothesized to play a role in DNA binding; however, the structural basis of, and functional evidence for, the HIRAN domain in DNA binding has remained unclear. Here we show for the first time the crystal structure of the HIRAN domain of human HLTF in complex with DNA. The HIRAN domain is composed of six β-strands and two α-helices, forming an OB-fold structure frequently found in ssDNA-binding proteins, including in replication factor A (RPA). Interestingly, this study reveals that the HIRAN domain interacts with not only with a single-stranded DNA but also with a duplex DNA. Furthermore, the structure unexpectedly clarifies that the HIRAN domain specifically recognizes the 3'-end of DNA. These results suggest that the HIRAN domain functions as a sensor to the 3'-end of the primer strand at the stalled replication fork and that the domain facilitates fork regression. HLTF is recruited to a damaged site through the HIRAN domain at the stalled replication fork. Furthermore, our results have implications for the mechanism of template switching. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Guangzhen Hu
Full Text Available Long noncoding RNAs (lncRNAs are important regulators of transcription; however, their involvement in protein translation is not well known. Here we explored whether the lncRNA GAS5 is associated with translation initiation machinery and regulates translation. GAS5 was enriched with eukaryotic translation initiation factor-4E (eIF4E in an RNA-immunoprecipitation assay using lymphoma cell lines. We identified two RNA binding motifs within eIF4E protein and the deletion of each motif inhibited the binding of GAS5 with eIF4E. To confirm the role of GAS5 in translation regulation, GAS5 siRNA and in vitro transcribed GAS5 RNA were used to knock down or overexpress GAS5, respectively. GAS5 siRNA had no effect on global protein translation but did specifically increase c-Myc protein level without an effect on c-Myc mRNA. The mechanism of this increase in c-Myc protein was enhanced association of c-Myc mRNA with the polysome without any effect on protein stability. In contrast, overexpression of in vitro transcribed GAS5 RNA suppressed c-Myc protein without affecting c-Myc mRNA. Interestingly, GAS5 was found to be bound with c-Myc mRNA, suggesting that GAS5 regulates c-Myc translation through lncRNA-mRNA interaction. Our findings have uncovered a role of GAS5 lncRNA in translation regulation through its interactions with eIF4E and c-Myc mRNA.
Wang, Yong; Yang, Tao; Zhang, Zhen; Lu, Ming; Zhao, Wei; Zeng, Xiandong; Zhang, Weiguo
2017-05-01
Long non-coding RNA (lncRNA) have been the focus of increasing attention due to the role they play in many diseases, including osteosarcoma. The function of taurine upregulated gene 1 (TUG1) and its mechanism in osteosarcoma remain unclear. In our research, we found that TUG1 was elevated and correlated with a poor prognosis in osteosarcoma patients. In addition, the following functional experiment showed that decreased TUG1 could remarkably inhibit osteosarcoma cell migration and invasion, indicating that TUG1 functioned as an oncogene in osteosarcoma. Moreover, we revealed that TUG1 and Rho-associated coiled-coil-containing protein kinase 1 (ROCK1), a metastasis-related gene targeted by microRNA-335-5p (miR-335-5p), had the same miR-335-5p combining site. The subsequent luciferase assay verified TUG1 was a target of miR-335-5p. Furthermore, the results of a real-time quantitative PCR showed that TUG1 and miR-335-5p could affect each other's expression. respectively. Finally, we affirmed that TUG1 affected ROCK1 expression and ROCK1-mediated migration/invasion by working as a competitive endogenous RNA (ceRNA) via miR-335-5p. In summary, the findings of this study, based on ceRNA theory, combining the research foundation of miR-335-5p and ROCK1, and taking TUG1 as a new study point, provide new insight into molecular-level reversing migration and invasion of osteosarcoma. © 2017 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.
Deore, R R; Chern, J-W
2010-01-01
Hepatitis C virus (HCV), a causative agent for non-A and non-B hepatitis, has infected approximately 3% of world's population. The current treatment option of ribavirin in combination with pegylated interferon possesses lower sustained virological response rates, and has serious disadvantages. Unfortunately, no prophylactic vaccine has been approved yet. Therefore, there is an unmet clinical need for more effective and safe anti-HCV drugs. HCV NS5B RNA dependent RNA polymerase is currently pursued as the most popular target to develop safe anti-HCV agents, as it is not expressed in uninfected cells. More than 25 pharmaceutical companies and some research groups have developed ≈50 structurally diverse scaffolds to inhibit NS5B. Here we provide comprehensive account of the drug development process of these scaffolds. NS5B polymerase inhibitors have been broadly classified in nucleoside and non nucleoside inhibitors and are sub classified according to their mechanism of action and structural diversities. With some additional considerations about the inhibitor bound NS5B enzyme X-ray crystal structure information and pharmacological aspects of the inhibitors, this review summarizes the lead identification, structure activity relationship (SAR) studies leading to the most potent NS5B inhibitors with subgenomic replicon activity.
Diverse evolutionary trajectories for small RNA biogenesis genes in the oomycete genus Phytophthora
Directory of Open Access Journals (Sweden)
Stephanie eBollmann
2016-03-01
Full Text Available Gene regulation by small RNA pathways is ubiquitous among eukaryotes, but little is known about small RNA pathways in the Stramenopile kingdom. Phytophthora, a genus of filamentous oomycetes, contains many devastating plant pathogens, causing multibillion-dollar damage to crops, ornamental plants, and natural environments. The genomes of several oomycetes including Phytophthora species such as the soybean pathogen P. sojae, have been sequenced, allowing evolutionary analysis of small RNA-processing enzymes. This study examined the evolutionary origins of the oomycete small RNA-related genes Dicer-like (DCL, and RNA-dependent RNA polymerase (RDR through broad phylogenetic analyses of the key domains. Two Dicer gene homologs, DCL1 and DCL2, and one RDR homolog were cloned and analyzed from P. sojae. Gene expression analysis revealed only minor changes in transcript levels among different life stages. Oomycete DCL1 homologs clustered with animal and plant Dicer homologs in evolutionary trees, whereas oomycete DCL2 homologs clustered basally to the tree along with Drosha homologs. Phylogenetic analysis of the RDR homologs confirmed a previous study that suggested the last common eukaryote ancestor possessed three RDR homologs, which were selectively retained or lost in later lineages. Our analysis clarifies the position of some Unikont and Chromalveolate RDR lineages within the tree, including oomycete homologs. Finally, we analyzed alterations in the domain structure of oomycete Dicer and RDR homologs, specifically focusing on the proposed domain transfer of the DEAD-box helicase domain from Dicer to RDR. Implications of the oomycete domain structure are discussed, and possible roles of the two oomycete Dicer homologs are proposed.
Cinek, Ondrej; Tapia, German; Witsø, Elisabet; Kramna, Lenka; Holkova, Katerina; Rasmussen, Trond; Stene, Lars C.; Rønningen, Kjersti S.
2012-01-01
Objective Polymorphisms in the IFIH1 (common rs1990760 and four rare rs35667974, rs35337543, rs35744605, rs35732034) have been convincingly associated with type 1 diabetes. The encoded protein (interferon-induced helicase C domain-containing protein 1) senses double-stranded RNA during replication of Picornavirales, including Enterovirus, a genus suspected in the etiology of type 1 diabetes. We therefore investigated whether the polymorphisms are associated with differences in the frequency of enterovirus RNA in blood. Research Design and Methods The study included 1001 blood samples, each from a child participating in the Norwegian ‘Environmental Triggers of Type 1 Diabetes: the MIDIA study’. The enterovirus RNA was tested using qualitative semi-nested real-time reverse transcriptase PCR on RNA extracted from frozen cell packs after removal of plasma. Stool samples previously analyzed for enterovirus RNA were available in 417 children. Results The genotypes of IFIH1 rs1990760 were associated with different frequencies of enterovirus RNA in blood (7.0%, 14.4% and 9.5% bloods were enterovirus positive among children carrying the Ala/Ala, Ala/Thr and Thr/Thr genotypes, respectively, p = 0.012). This association remained essentially unchanged after adjustment for age and calendar year. The presence of enterovirus in the concomitantly sampled stool further increased the likelihood of enterovirus RNA in blood (odds ratio 2.40, CI 95% 1.13–4.70), but did not affect the association with IFIH1 rs1990760. The rare polymorphisms (individually, or pooled) were not significantly associated with enterovirus RNA in blood. Conclusions The common IFIH1 SNP may modify the frequency of enterovirus RNA in blood of healthy children. This effect can help explain the association of IFIH1 with type 1 diabetes. PMID:23144876
Directory of Open Access Journals (Sweden)
Marie-Jo Halaby
2015-01-01
Full Text Available Synthesis of the p53 tumor suppressor increases following DNA damage. This increase and subsequent activation of p53 are essential for the protection of normal cells against tumorigenesis. We previously discovered an internal ribosome entry site (IRES that is located at the 5′-untranslated region (UTR of p53 mRNA and found that the IRES activity increases following DNA damage. However, the mechanism underlying IRES-mediated p53 translation in response to DNA damage is still poorly understood. In this study, we discovered that translational control protein 80 (TCP80 has increased binding to the p53 mRNA in vivo following DNA damage. Overexpression of TCP80 also leads to increased p53 IRES activity in response to DNA damage. TCP80 has increased association with RNA helicase A (RHA following DNA damage and overexpression of TCP80, along with RHA, leads to enhanced expression of p53. Moreover, we found that MCF-7 breast cancer cells with decreased expression of TCP80 and RHA exhibit defective p53 induction following DNA damage and diminished expression of its downstream target PUMA, a proapoptotic protein. Taken together, our discovery of the function of TCP80 and RHA in regulating p53 IRES and p53 induction following DNA damage provides a better understanding of the mechanisms that regulate IRES-mediated p53 translation in response to genotoxic stress.
Energy Technology Data Exchange (ETDEWEB)
Harris, T.J.R.; Dunn, J.J.; Wimmer, E.
1978-11-01
The small protein (VPg) covalently linked to the 5' end of the poliovirus Type 1 (PV-1) RNA has been labeled in vitro with /sup 125/I usingthe Bolton and Hunter reagent. The RNA is not degraded under the conditions used and nearly all the label enters VPg and not the polynucleotide chain. When this /sup 125/I-labeled RNA is cleaved with RNase III at low monovalent salt concentrations, one major /sup 125/I-labeled fragment, approximately 100 nucleotides long, is produced. The corresponding fragment from similar digests of /sup 32/P-labeled RNA has also been identified. The /sup 32/P-labeled fragment changes electrophoretic mobility after protease treatment indicating that it contains VPg. Furthermore, the RNase T1 oligonucleotide known to be at the 5' terminus of poliovirus RNA is found in T1 digests of the purified fragment. These results confirm that the fragment is derived from the 5' end of the RNA. This fragment will be useful in studies concerning the initiation of protein synthesis during poliovirus infection.
Raikwar, Shailendra; Srivastava, Vineet K; Gill, Sarvajeet S; Tuteja, Renu; Tuteja, Narendra
2015-01-01
Genetic material always remains at the risk of spontaneous or induced damage which challenges the normal functioning of DNA molecule, thus, DNA repair is vital to protect the organisms against genetic damage. Helicases, the unique molecular motors, are emerged as prospective molecules to engineer stress tolerance in plants and are involved in nucleic acid metabolism including DNA repair. The repair helicase, XPB is an evolutionary conserved protein present in different organisms, including plants. Availability of few efficient promoters for gene expression in plants provoked us to study the promoter of XPB for better understanding of gene regulation under stress conditions. Here, we report the in silico analysis of novel stress inducible promoter of Oryza sativa XPB2 (OsXPB2). The in vivo validation of functionality/activity of OsXPB2 promoter under abiotic and hormonal stress conditions was performed by Agrobacterium-mediated transient assay in tobacco leaves using OsXPB2::GUS chimeric construct. The present research revealed that OsXPB2 promoter contains cis-elements accounting for various abiotic stresses (salt, dehydration, or cold) and hormone (Auxin, ABA, or MeJA) induced GUS expression/activity in the promoter-reporter assay. The promoter region of OsXPB2 contains CACG, GTAACG, CACGTG, CGTCA CCGCCGCGCT cis acting-elements which are reported to be salt, dehydration, cold, MeJA, or ABA responsive, respectively. Functional analysis was done by Agrobacterium-mediated transient assay using agroinfiltration in tobacco leaves, followed by GUS staining and fluorescence quantitative analyses. The results revealed high induction of GUS activity under multiple abiotic stresses as compared to mock treated control. The present findings suggest that OsXPB2 promoter is a multi-stress inducible promoter and has potential applications in sustainable crop production under abiotic stresses by regulating desirable pattern of gene expression.
The 4.5 S RNA gene of Escherichia coli is essential for cell growth
DEFF Research Database (Denmark)
Brown, S; Fournier, M J
1984-01-01
The Escherichia coli gene coding for the metabolically stable 4.5 S RNA (ffs) has been shown to be required for cell viability. Essentiality was demonstrated by examining the recombination behavior of substitution mutations of ffs generated in vitro. Substitution mutants of ffs are able to replace...... the chromosomal allele only in the presence of a second, intact copy of ffs. Independent evidence of essentiality and the finding that 4.5 S RNA is important for protein synthetic activity came from characterization of cells dependent on the lac operon inducer isopropyl-beta-D-thiogalactoside for ffs gene...... expression. Here, a strain dependent on isopropyl-beta-D-thiogalactoside for 4.5 S RNA synthesis was developed by inactivation of the chromosomal ffs allele and lysogenization by a lambda phage containing 4.5 S DNA fused to a hybrid trp-lac promoter. Withdrawal of the thiogalactoside leads to a deficiency...
RTEL1: an essential helicase for telomere maintenance and the regulation of homologous recombination
Uringa, Evert-Jan; Youds, Jillian L.; Lisaingo, Kathleen; Lansdorp, Peter M.; Boulton, Simon J.
2010-01-01
Telomere maintenance and DNA repair are crucial processes that protect the genome against instability. RTEL1, an essential iron–sulfur cluster-containing helicase, is a dominant factor that controls telomere length in mice and is required for telomere integrity. In addition, RTEL1 promotes synthesis-dependent strand annealing to direct DNA double-strand breaks into non-crossover outcomes during mitotic repair and in meiosis. Here, we review the role of RTEL1 in telomere maintenance and homolo...
The N-terminal domain of human DNA helicase Rtel1 contains a redox active iron-sulfur cluster.
Landry, Aaron P; Ding, Huangen
2014-01-01
Human telomere length regulator Rtel1 is a superfamily II DNA helicase and is essential for maintaining proper length of telomeres in chromosomes. Here we report that the N-terminal domain of human Rtel1 (RtelN) expressed in Escherichia coli cells produces a protein that contains a redox active iron-sulfur cluster with the redox midpoint potential of -248 ± 10 mV (pH 8.0). The iron-sulfur cluster in RtelN is sensitive to hydrogen peroxide and nitric oxide, indicating that reactive oxygen/nitrogen species may modulate the DNA helicase activity of Rtel1 via modification of its iron-sulfur cluster. Purified RtelN retains a weak binding affinity for the single-stranded (ss) and double-stranded (ds) DNA in vitro. However, modification of the iron-sulfur cluster by hydrogen peroxide or nitric oxide does not significantly affect the DNA binding activity of RtelN, suggesting that the iron-sulfur cluster is not directly involved in the DNA interaction in the N-terminal domain of Rtel1.
The N-Terminal Domain of Human DNA Helicase Rtel1 Contains a Redox Active Iron-Sulfur Cluster
Directory of Open Access Journals (Sweden)
Aaron P. Landry
2014-01-01
Full Text Available Human telomere length regulator Rtel1 is a superfamily II DNA helicase and is essential for maintaining proper length of telomeres in chromosomes. Here we report that the N-terminal domain of human Rtel1 (RtelN expressed in Escherichia coli cells produces a protein that contains a redox active iron-sulfur cluster with the redox midpoint potential of −248 ± 10 mV (pH 8.0. The iron-sulfur cluster in RtelN is sensitive to hydrogen peroxide and nitric oxide, indicating that reactive oxygen/nitrogen species may modulate the DNA helicase activity of Rtel1 via modification of its iron-sulfur cluster. Purified RtelN retains a weak binding affinity for the single-stranded (ss and double-stranded (ds DNA in vitro. However, modification of the iron-sulfur cluster by hydrogen peroxide or nitric oxide does not significantly affect the DNA binding activity of RtelN, suggesting that the iron-sulfur cluster is not directly involved in the DNA interaction in the N-terminal domain of Rtel1.
Cui, J G; Zhao, Y; Sethi, P; Li, Y Y; Mahta, A; Culicchia, F; Lukiw, W J
2010-07-01
High density micro-RNA (miRNA) arrays, fluorescent-reporter miRNA assay and Northern miRNA dot-blot analysis show that a brain-enriched miRNA-128 is significantly down-regulated in glioblastoma multiforme (GBM) and in GBM cell lines when compared to age-matched controls. The down-regulation of miRNA-128 was found to inversely correlate with WHO tumor grade. Three bioinformatics-verified miRNA-128 targets, angiopoietin-related growth factor protein 5 (ARP5; ANGPTL6), a transcription suppressor that promotes stem cell renewal and inhibits the expression of known tumor suppressor genes involved in senescence and differentiation, Bmi-1, and a transcription factor critical for the control of cell-cycle progression, E2F-3a, were found to be up-regulated. Addition of exogenous miRNA-128 to CRL-1690 and CRL-2610 GBM cell lines (a) restored 'homeostatic' ARP5 (ANGPTL6), Bmi-1 and E2F-3a expression, and (b) significantly decreased the proliferation of CRL-1690 and CRL-2610 cell lines. Our data suggests that down-regulation of miRNA-128 may contribute to glioma and GBM, in part, by coordinately up-regulating ARP5 (ANGPTL6), Bmi-1 and E2F-3a, resulting in the proliferation of undifferentiated GBM cells.
DEFF Research Database (Denmark)
Hallberg, B. Martin; Ericsson, Ulrika B.; Johnson, Kenneth A
2006-01-01
potential that differ from other RNA-MTase structures, suggesting that YebU interacts with its RNA target in a different manner. Docking of YebU onto the 30 S subunit indicates that the PUA and MTase domains make several contacts with 16 S rRNA as well as with the ribosomal protein S12. The ribosomal...... protein interactions would explain why the assembled 30 S subunit, and not naked 16 S rRNA, is the preferred substrate for YebU....... by X-ray crystallography, and we present a molecular model for how YebU specifically recognizes, binds and methylates its ribosomal substrate. The YebU protein has an N-terminal SAM-binding catalytic domain with structural similarity to the equivalent domains in several other m(5)C RNA MTases including...
Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette
2012-07-01
Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.
Liang, Xue-Hai; Sun, Hong; Shen, Wen; Wang, Shiyu; Yao, Joyee; Migawa, Michael T; Bui, Huynh-Hoa; Damle, Sagar S; Riney, Stan; Graham, Mark J; Crooke, Rosanne M; Crooke, Stanley T
2017-09-19
A variety of diseases are caused by deficiencies in amounts or activity of key proteins. An approach that increases the amount of a specific protein might be of therapeutic benefit. We reasoned that translation could be specifically enhanced using trans-acting agents that counter the function of negative regulatory elements present in the 5' UTRs of some mRNAs. We recently showed that translation can be enhanced by antisense oligonucleotides (ASOs) that target upstream open reading frames. Here we report the amount of a protein can also be selectively increased using ASOs designed to hybridize to other translation inhibitory elements in 5' UTRs. Levels of human RNASEH1, LDLR, and ACP1 and of mouse ACP1 and ARF1 were increased up to 2.7-fold in different cell types and species upon treatment with chemically modified ASOs targeting 5' UTR inhibitory regions in the mRNAs encoding these proteins. The activities of ASOs in enhancing translation were sequence and position dependent and required helicase activity. The ASOs appear to improve the recruitment of translation initiation factors to the target mRNA. Importantly, ASOs targeting ACP1 mRNA significantly increased the level of ACP1 protein in mice, suggesting that this approach has therapeutic and research potentials. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
RNA interactions in the 5' region of the HIV-1 genome
DEFF Research Database (Denmark)
Damgaard, Christian Kroun; Andersen, Ebbe Sloth; Knudsen, Bjarne
2004-01-01
The untranslated leader of the dimeric HIV-1 RNA genome is folded into a complex structure that plays multiple and essential roles in the viral replication cycle. Here, we have investigated secondary and tertiary structural elements within the 5' 744 nucleotides of the HIV-1 genome using...... a combination of bioinformatics, enzymatic probing, native gel electrophoresis, and UV-crosslinking experiments. We used a recently developed RNA folding algorithm (Pfold) to predict the common secondary structure of an alignment of 20 divergent HIV-1 sequences. Combining this analysis with biochemical data, we...
Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard
2015-04-07
During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.
Jullien, Laurent; Kannengiesser, Caroline; Kermasson, Laetitia; Cormier-Daire, Valérie; Leblanc, Thierry; Soulier, Jean; Londono-Vallejo, Arturo; de Villartay, Jean-Pierre; Callebaut, Isabelle; Revy, Patrick
2016-05-01
The DNA helicase RTEL1 participates in telomere maintenance and genome stability. Biallelic mutations in the RTEL1 gene account for the severe telomere biology disorder characteristic of the Hoyeraal-Hreidarsson syndrome (HH). Here, we report a HH patient (P4) carrying two novel compound heterozygous mutations in RTEL1: a premature stop codon (c.949A>T, p.Lys317*) and an intronic deletion leading to an exon skipping and an in-frame deletion of 25 amino-acids (p.Ile398_Lys422). P4's cells exhibit short and dysfunctional telomeres similarly to other RTEL1-deficient patients. 3D structure predictions indicated that the p.Ile398_Lys422 deletion affects a part of the helicase ARCH domain, which lines the pore formed with the core HD and the iron-sulfur cluster domains and is highly specific of sequences from the eukaryotic XPD family members. © 2016 WILEY PERIODICALS, INC.
CCL5 promotes proliferation of MCF-7 cells through mTOR-dependent mRNA translation
International Nuclear Information System (INIS)
Murooka, Thomas T.; Rahbar, Ramtin; Fish, Eleanor N.
2009-01-01
The proliferative capacity of cancer cells is regulated by factors intrinsic to cancer cells and by secreted factors in the microenvironment. Here, we investigated the proto-oncogenic potential of the chemokine receptor, CCR5, in MCF-7 breast cancer cell lines. At physiological levels, CCL5, a ligand for CCR5, enhanced MCF-7.CCR5 proliferation. Treatment with the mTOR inhibitor, rapamycin, inhibited this CCL5-inducible proliferation. Because mTOR directly modulates mRNA translation, we investigated whether CCL5 activation of CCR5 leads to increased translation. CCL5 induced the formation of the eIF4F translation initiation complex through an mTOR-dependent process. Indeed, CCL5 initiated mRNA translation, shown by an increase in high-molecular-weight polysomes. Specifically, we show that CCL5 mediated a rapid up-regulation of protein expression for cyclin D1, c-Myc and Dad-1, without affecting their mRNA levels. Taken together, we describe a mechanism by which CCL5 influences translation of rapamycin-sensitive mRNAs, thereby providing CCR5-positive breast cancer cells with a proliferative advantage.
An essential nuclear protein in trypanosomes is a component of mRNA transcription/export pathway.
Directory of Open Access Journals (Sweden)
Mariana Serpeloni
Full Text Available In eukaryotic cells, different RNA species are exported from the nucleus via specialized pathways. The mRNA export machinery is highly integrated with mRNA processing, and includes a different set of nuclear transport adaptors as well as other mRNA binding proteins, RNA helicases, and NPC-associated proteins. The protozoan parasite Trypanosoma cruzi is the causative agent of Chagas disease, a widespread and neglected human disease which is endemic to Latin America. Gene expression in Trypanosoma has unique characteristics, such as constitutive polycistronic transcription of protein-encoding genes and mRNA processing by trans-splicing. In general, post-transcriptional events are the major points for regulation of gene expression in these parasites. However, the export pathway of mRNA from the nucleus is poorly understood. The present study investigated the function of TcSub2, which is a highly conserved protein ortholog to Sub2/ UAP56, a component of the Transcription/Export (TREX multiprotein complex connecting transcription with mRNA export in yeast/human. Similar to its orthologs, TcSub2 is a nuclear protein, localized in dispersed foci all over the nuclei -except the fibrillar center of nucleolus- and at the interface between dense and non-dense chromatin areas, proposing the association of TcSub2 with transcription/processing sites. These findings were analyzed further by BrUTP incorporation assays and confirmed that TcSub2 is physically associated with active RNA polymerase II (RNA pol II, but not RNA polymerase I (RNA pol I or Spliced Leader (SL transcription, demonstrating participation particularly in nuclear mRNA metabolism in T. cruzi. The double knockout of the TcSub2 gene is lethal in T. cruzi, suggesting it has an essential function. Alternatively, RNA interference assays were performed in Trypanosoma brucei. It allowed demonstrating that besides being an essential protein, its knockdown causes mRNA accumulation in the nucleus and
Membrane recognition and dynamics of the RNA degradosome.
Directory of Open Access Journals (Sweden)
Henrik Strahl
2015-02-01
Full Text Available RNase E, which is the central component of the multienzyme RNA degradosome, serves as a scaffold for interaction with other enzymes involved in mRNA degradation including the DEAD-box RNA helicase RhlB. Epifluorescence microscopy under live cell conditions shows that RNase E and RhlB are membrane associated, but neither protein forms cytoskeletal-like structures as reported earlier by Taghbalout and Rothfield. We show that association of RhlB with the membrane depends on a direct protein interaction with RNase E, which is anchored to the inner cytoplasmic membrane through an MTS (Membrane Targeting Sequence. Molecular dynamics simulations show that the MTS interacts with the phospholipid bilayer by forming a stabilized amphipathic α-helix with the helical axis oriented parallel to the plane of the bilayer and hydrophobic side chains buried deep in the acyl core of the membrane. Based on the molecular dynamics simulations, we propose that the MTS freely diffuses in the membrane by a novel mechanism in which a large number of weak contacts are rapidly broken and reformed. TIRFm (Total Internal Reflection microscopy shows that RNase E in live cells rapidly diffuses over the entire inner membrane forming short-lived foci. Diffusion could be part of a scanning mechanism facilitating substrate recognition and cooperativity. Remarkably, RNase E foci disappear and the rate of RNase E diffusion increases with rifampicin treatment. Control experiments show that the effect of rifampicin is specific to RNase E and that the effect is not a secondary consequence of the shut off of E. coli transcription. We therefore interpret the effect of rifampicin as being due to the depletion of RNA substrates for degradation. We propose a model in which formation of foci and constraints on diffusion arise from the transient clustering of RNase E into cooperative degradation bodies.
Nakashima, T; Yao, M; Kawamura, S; Iwasaki, K; Kimura, M; Tanaka, I
2001-05-01
Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.
Pickard, Mark R.; Williams, Gwyn T.
2016-01-01
Growth arrest-specific 5 (GAS5) lncRNA promotes apoptosis, and its expression is down-regulated in breast cancer. GAS5 lncRNA is a decoy of glucocorticoid/related receptors; a stem-loop sequence constitutes the GAS5 hormone response element mimic (HREM), which is essential for the regulation of breast cancer cell apoptosis. This preclinical study aimed to determine if the GAS5 HREM sequence alone promotes the apoptosis of breast cancer cells. Nucleofection of hormone-sensitive and –insensitive breast cancer cell lines with a GAS5 HREM DNA oligonucleotide increased both basal and ultraviolet-C-induced apoptosis, and decreased culture viability and clonogenic growth, similar to GAS5 lncRNA. The HREM oligonucleotide demonstrated similar sequence specificity to the native HREM for its functional activity and had no effect on endogenous GAS5 lncRNA levels. Certain chemically modified HREM oligonucleotides, notably DNA and RNA phosphorothioates, retained pro-apoptotic. activity. Crucially the HREM oligonucleotide could overcome apoptosis resistance secondary to deficient endogenous GAS5 lncRNA levels. Thus, the GAS5 lncRNA HREM sequence alone is sufficient to induce apoptosis in breast cancer cells, including triple-negative breast cancer cells. These findings further suggest that emerging knowledge of structure/function relationships in the field of lncRNA biology can be exploited for the development of entirely novel, oligonucleotide mimic-based, cancer therapies. PMID:26862727
Linking Maternal and Somatic 5S rRNA types with Different Sequence-Specific Non-LTR Retrotransposons
Locati, M.D.; Pagano, J.F.B.; Ensink, W.A.; van Olst, M.; van Leeuwen, S.; Nehrdich, U.; Zhu, K.; Spaink, H.P.; Girard, G.; Rauwerda, H.; Jonker, M.J.; Dekker, R.J.; Breit, T.M.
5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo and adult tissue,
Phytophthora effector targets a novel component of small RNA pathway in plants to promote infection.
Qiao, Yongli; Shi, Jinxia; Zhai, Yi; Hou, Yingnan; Ma, Wenbo
2015-05-05
A broad range of parasites rely on the functions of effector proteins to subvert host immune response and facilitate disease development. The notorious Phytophthora pathogens evolved effectors with RNA silencing suppression activity to promote infection in plant hosts. Here we report that the Phytophthora Suppressor of RNA Silencing 1 (PSR1) can bind to an evolutionarily conserved nuclear protein containing the aspartate-glutamate-alanine-histidine-box RNA helicase domain in plants. This protein, designated PSR1-Interacting Protein 1 (PINP1), regulates the accumulation of both microRNAs and endogenous small interfering RNAs in Arabidopsis. A null mutation of PINP1 causes embryonic lethality, and silencing of PINP1 leads to developmental defects and hypersusceptibility to Phytophthora infection. These phenotypes are reminiscent of transgenic plants expressing PSR1, supporting PINP1 as a direct virulence target of PSR1. We further demonstrate that the localization of the Dicer-like 1 protein complex is impaired in the nucleus of PINP1-silenced or PSR1-expressing cells, indicating that PINP1 may facilitate small RNA processing by affecting the assembly of dicing complexes. A similar function of PINP1 homologous genes in development and immunity was also observed in Nicotiana benthamiana. These findings highlight PINP1 as a previously unidentified component of RNA silencing that regulates distinct classes of small RNAs in plants. Importantly, Phytophthora has evolved effectors to target PINP1 in order to promote infection.
tRNA modifying enzymes, NSUN2 and METTL1, determine sensitivity to 5-fluorouracil in HeLa cells.
Directory of Open Access Journals (Sweden)
Mayumi Okamoto
2014-09-01
Full Text Available Nonessential tRNA modifications by methyltransferases are evolutionarily conserved and have been reported to stabilize mature tRNA molecules and prevent rapid tRNA decay (RTD. The tRNA modifying enzymes, NSUN2 and METTL1, are mammalian orthologs of yeast Trm4 and Trm8, which are required for protecting tRNA against RTD. A simultaneous overexpression of NSUN2 and METTL1 is widely observed among human cancers suggesting that targeting of both proteins provides a novel powerful strategy for cancer chemotherapy. Here, we show that combined knockdown of NSUN2 and METTL1 in HeLa cells drastically potentiate sensitivity of cells to 5-fluorouracil (5-FU whereas heat stress of cells revealed no effects. Since NSUN2 and METTL1 are phosphorylated by Aurora-B and Akt, respectively, and their tRNA modifying activities are suppressed by phosphorylation, overexpression of constitutively dephosphorylated forms of both methyltransferases is able to suppress 5-FU sensitivity. Thus, NSUN2 and METTL1 are implicated in 5-FU sensitivity in HeLa cells. Interfering with methylation of tRNAs might provide a promising rationale to improve 5-FU chemotherapy of cancer.
Tóth, Júlia; van Aelst, Kara; Salmons, Hannah; Szczelkun, Mark D.
2012-01-01
DNA cleavage by the Type III Restriction–Modification (RM) enzymes requires the binding of a pair of RM enzymes at two distant, inversely orientated recognition sequences followed by helicase-catalysed ATP hydrolysis and long-range communication. Here we addressed the dissociation from DNA of these enzymes at two stages: during long-range communication and following DNA cleavage. First, we demonstrated that a communicating species can be trapped in a DNA domain without a recognition site, with a non-specific DNA association lifetime of ∼200 s. If free DNA ends were present the lifetime became too short to measure, confirming that ends accelerate dissociation. Secondly, we observed that Type III RM enzymes can dissociate upon DNA cleavage and go on to cleave further DNA molecules (they can ‘turnover’, albeit inefficiently). The relationship between the observed cleavage rate and enzyme concentration indicated independent binding of each site and a requirement for simultaneous interaction of at least two enzymes per DNA to achieve cleavage. In light of various mechanisms for helicase-driven motion on DNA, we suggest these results are most consistent with a thermally driven random 1D search model (i.e. ‘DNA sliding’). PMID:22523084
Cytosolic DNA Sensor Upregulation Accompanies DNA Electrotransfer in B16.F10 Melanoma Cells
Directory of Open Access Journals (Sweden)
Katarina Znidar
2016-01-01
Full Text Available In several preclinical tumor models, antitumor effects occur after intratumoral electroporation, also known as electrotransfer, of plasmid DNA devoid of a therapeutic gene. In mouse melanomas, these effects are preceded by significant elevation of several proinflammatory cytokines. These observations implicate the binding and activation of intracellular DNA-specific pattern recognition receptors or DNA sensors in response to DNA electrotransfer. In tumors, IFNβ mRNA and protein levels significantly increased. The mRNAs of several DNA sensors were detected, and DAI, DDX60, and p204 tended to be upregulated. These effects were accompanied with reduced tumor growth and increased tumor necrosis. In B16.F10 cells in culture, IFNβ mRNA and protein levels were significantly upregulated. The mRNAs for several DNA sensors were present in these cells; DNA-dependent activator of interferon regulatory factor (DAI, DEAD (Asp-Glu-Ala-Asp box polypeptide 60 (DDX60, and p204 were significantly upregulated while DDX60 protein levels were coordinately upregulated. Upregulation of DNA sensors in tumors could be masked by the lower transfection efficiency compared to in vitro or to dilution by other tumor cell types. Mirroring the observation of tumor necrosis, cells underwent a significant DNA concentration-dependent decrease in proliferation and survival. Taken together, these results indicate that DNA electrotransfer may cause the upregulation of several intracellular DNA sensors in B16.F10 cells, inducing effects in vitro and potentially in vivo.
The flavoprotein Mcap0476 (RlmFO) catalyzes m5U1939 modification in Mycoplasma capricolum 23S rRNA
DEFF Research Database (Denmark)
Lartigue, Carole; Lebaudy, Anne; Blanchard, Alain
2014-01-01
Efficient protein synthesis in all organisms requires the post-transcriptional methylation of specific ribosomal ribonucleic acid (rRNA) and transfer RNA (tRNA) nucleotides. The methylation reactions are almost invariably catalyzed by enzymes that use S-adenosylmethionine (AdoMet) as the methyl g...... specifically modifies m5U1939 in 23S rRNA, a conserved methylation catalyzed by AdoMet-dependent enzymes in all other characterized bacteria. The Mcap0476 methyltransferase (renamed RlmFO) represents the first folate-dependent flavoprotein seen to modify ribosomal RNA.......Efficient protein synthesis in all organisms requires the post-transcriptional methylation of specific ribosomal ribonucleic acid (rRNA) and transfer RNA (tRNA) nucleotides. The methylation reactions are almost invariably catalyzed by enzymes that use S-adenosylmethionine (AdoMet) as the methyl...... group donor. One noteworthy exception is seen in some bacteria, where the conserved tRNA methylation at m5U54 is added by the enzyme TrmFO using flavin adenine dinucleotide together with N5,N10-methylenetetrahydrofolate as the one-carbon donor. The minimalist bacterium Mycoplasma capricolum possesses...
DEFF Research Database (Denmark)
Enevold, C; Kjaer, Lasse; Nielsen, Claus Henrik
2014-01-01
This study aimed to demonstrate possible associations between genetic polymorphisms in Toll-like receptor 3, interferon induced with helicase C domain 1 (IFIH1) and DEAD (Asp-Glu-Ala-Asp) box polypeptide 58 and systemic lupus erythematosus (SLE), including the phenotypes lupus nephritis and malar...
Pasion, S G; Hines, J C; Ou, X; Mahmood, R; Ray, D S
1996-12-01
Gene expression in trypanosomatids appears to be regulated largely at the posttranscriptional level and involves maturation of mRNA precursors by trans splicing of a 39-nucleotide miniexon sequence to the 5' end of the mRNA and cleavage and polyadenylation at the 3' end of the mRNA. To initiate the identification of sequences involved in the periodic expression of DNA replication genes in trypanosomatids, we have mapped splice acceptor sites in the 5' flanking region of the TOP2 gene, which encodes the kinetoplast DNA topoisomerase, and have carried out deletion analysis of this region on a plasmid-encoded TOP2 gene. Block deletions within the 5' untranslated region (UTR) identified two regions (-608 to -388 and -387 to -186) responsible for periodic accumulation of the mRNA. Deletion of one or the other of these sequences had no effect on periodic expression of the mRNA, while deletion of both regions resulted in constitutive expression of the mRNA throughout the cell cycle. Subcloning of these sequences into the 5' UTR of a construct lacking both regions of the TOP2 5' UTR has shown that an octamer consensus sequence present in the 5' UTR of the TOP2, RPA1, and DHFR-TS mRNAs is required for normal cycling of the TOP2 mRNA. Mutation of the consensus octamer sequence in the TOP2 5' UTR in a plasmid construct containing only a single consensus octamer and that shows normal cycling of the plasmid-encoded TOP2 mRNA resulted in substantial reduction of the cycling of the mRNA level. These results imply a negative regulation of TOP2 mRNA during the cell cycle by a mechanism involving redundant elements containing one or more copies of a conserved octamer sequence within the 5' UTR of TOP2 mRNA.
Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo
2017-01-17
Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.
Directory of Open Access Journals (Sweden)
Riñón Marta
2007-11-01
Full Text Available Abstract Background Pathogen-associated molecular patterns (PAMP receptors play a key role in the early host response to viruses. In this work, we determined mRNA levels of two members of the Toll-like Receptors family, (TLR3 and TLR7 and the helicase RIG-I, all of three recognizing viral RNA products, in peripheral blood of healthy donors and hepatitis C virus (HCV patients, to observe if their transcripts are altered in this disease. Methods IFN-α, TLR3, TLR7 and RIG-I levels in peripheral blood from healthy controls (n = 18 and chronic HCV patients (n = 18 were quantified by real-time polymerase chain reaction. Results Our results show that IFN-α, TLR3, TLR7 and RIG-I mRNA levels are significantly down-regulated in patients with chronic HCV infection when compared with healthy controls. We also found that the measured levels of TLR3 and TLR7, but not RIG-I, correlated significantly with those of IFN-α Conclusion Monitoring the expression of RNA-sensing receptors like TLR3, TLR7 and RIG-I during the different clinical stages of infection could bring a new source of data about the prognosis of disease.
Cyclophilin B stimulates RNA synthesis by the HCV RNA dependent RNA polymerase.
Heck, Julie A; Meng, Xiao; Frick, David N
2009-04-01
Cyclophilins are cellular peptidyl isomerases that have been implicated in regulating hepatitis C virus (HCV) replication. Cyclophilin B (CypB) is a target of cyclosporin A (CsA), an immunosuppressive drug recently shown to suppress HCV replication in cell culture. Watashi et al. recently demonstrated that CypB is important for efficient HCV replication, and proposed that it mediates the anti-HCV effects of CsA through an interaction with NS5B [Watashi K, Ishii N, Hijikata M, Inoue D, Murata T, Miyanari Y, et al. Cyclophilin B is a functional regulator of hepatitis C virus RNA polymerase. Mol Cell 2005;19:111-22]. We examined the effects of purified CypB proteins on the enzymatic activity of NS5B. Recombinant CypB purified from insect cells directly stimulated NS5B-catalyzed RNA synthesis. CypB increased RNA synthesis by NS5B derived from genotype 1a, 1b, and 2a HCV strains. Stimulation appears to arise from an increase in productive RNA binding. NS5B residue Pro540, a previously proposed target of CypB peptidyl-prolyl isomerase activity, is not required for stimulation of RNA synthesis.
Drosophila SMN complex proteins Gemin2, Gemin3, and Gemin5 are components of U bodies
International Nuclear Information System (INIS)
Cauchi, Ruben J.; Sanchez-Pulido, Luis; Liu, Ji-Long
2010-01-01
Uridine-rich small nuclear ribonucleoproteins (U snRNPs) play key roles in pre-mRNA processing in the nucleus. The assembly of most U snRNPs takes place in the cytoplasm and is facilitated by the survival motor neuron (SMN) complex. Discrete cytoplasmic RNA granules called U bodies have been proposed to be specific sites for snRNP assembly because they contain U snRNPs and SMN. U bodies invariably associate with P bodies, which are involved in mRNA decay and translational control. However, it remains unknown whether other SMN complex proteins also localise to U bodies. In Drosophila there are four SMN complex proteins, namely SMN, Gemin2/CG10419, Gemin3 and Gemin5/Rigor mortis. Drosophila Gemin3 was originally identified as the Drosophila orthologue of human and yeast Dhh1, a component of P bodies. Through an in silico analysis of the DEAD-box RNA helicases we confirmed that Gemin3 is the bona fide Drosophila orthologue of vertebrate Gemin3 whereas the Drosophila orthologue of Dhh1 is Me31B. We then made use of the Drosophila egg chamber as a model system to study the subcellular distribution of the Gemin proteins as well as Me31B. Our cytological investigations show that Gemin2, Gemin3 and Gemin5 colocalise with SMN in U bodies. Although they are excluded from P bodies, as components of U bodies, Gemin2, Gemin3 and Gemin5 are consistently found associated with P bodies, wherein Me31B resides. In addition to a role in snRNP biogenesis, SMN complexes residing in U bodies may also be involved in mRNP assembly and/or transport.
Drosophila SMN complex proteins Gemin2, Gemin3, and Gemin5 are components of U bodies
Energy Technology Data Exchange (ETDEWEB)
Cauchi, Ruben J.; Sanchez-Pulido, Luis [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3QX (United Kingdom); Liu, Ji-Long, E-mail: jilong.liu@dpag.ox.ac.uk [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3QX (United Kingdom)
2010-08-15
Uridine-rich small nuclear ribonucleoproteins (U snRNPs) play key roles in pre-mRNA processing in the nucleus. The assembly of most U snRNPs takes place in the cytoplasm and is facilitated by the survival motor neuron (SMN) complex. Discrete cytoplasmic RNA granules called U bodies have been proposed to be specific sites for snRNP assembly because they contain U snRNPs and SMN. U bodies invariably associate with P bodies, which are involved in mRNA decay and translational control. However, it remains unknown whether other SMN complex proteins also localise to U bodies. In Drosophila there are four SMN complex proteins, namely SMN, Gemin2/CG10419, Gemin3 and Gemin5/Rigor mortis. Drosophila Gemin3 was originally identified as the Drosophila orthologue of human and yeast Dhh1, a component of P bodies. Through an in silico analysis of the DEAD-box RNA helicases we confirmed that Gemin3 is the bona fide Drosophila orthologue of vertebrate Gemin3 whereas the Drosophila orthologue of Dhh1 is Me31B. We then made use of the Drosophila egg chamber as a model system to study the subcellular distribution of the Gemin proteins as well as Me31B. Our cytological investigations show that Gemin2, Gemin3 and Gemin5 colocalise with SMN in U bodies. Although they are excluded from P bodies, as components of U bodies, Gemin2, Gemin3 and Gemin5 are consistently found associated with P bodies, wherein Me31B resides. In addition to a role in snRNP biogenesis, SMN complexes residing in U bodies may also be involved in mRNP assembly and/or transport.
Energy Technology Data Exchange (ETDEWEB)
Matsuo, Eiko [Microbiology and Immunology, Division of Animal Science, Department of Bioresource Science, Graduate School of Agricultural Science, Kobe University, 1-1, Rokkodai, Nada-ku, Kobe-City 657-8501 (Japan); Faculty of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, Keppel Street, London WC1E 7HT (United Kingdom); Leon, Esther; Matthews, Steve J. [Division of Molecular Biosciences, Centre for Structural Biology, Imperial College London, South Kensington, London SW7 2AZ (United Kingdom); Roy, Polly, E-mail: polly.roy@lshtm.ac.uk [Faculty of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, Keppel Street, London WC1E 7HT (United Kingdom)
2014-09-05
Highlights: • NMR analysis on BTV VP6 reveals two large loop regions. • The loss of a loop (aa 34–130) does not affect the overall fold of the protein. • A region of VP6 (aa 34–92) is not required for BTV replication. • A region of VP6 (aa 93–130) plays an essential role in the virus replication. - Abstract: Bluetongue virus core protein VP6 is an ATP hydrolysis dependent RNA helicase. However, despite much study, the precise role of VP6 within the viral capsid and its structure remain unclear. To investigate the requirement of VP6 in BTV replication, we initiated a structural and biological study. Multinuclear nuclear magnetic resonance spectra were assigned on his-tagged full-length VP6 (329 amino acid residues) as well as several truncated VP6 variants. The analysis revealed a large structured domain with two large loop regions that exhibit significant conformational exchange. One of the loops (amino acid position 34–130) could be removed without affecting the overall fold of the protein. Moreover, using a BTV reverse genetics system, it was possible to demonstrate that the VP6-truncated BTV was viable in BHK cells in the absence of any helper VP6 protein, suggesting that a large portion of this loop region is not absolutely required for BTV replication.
Tackett, Alan J.; Corey, David R.; Raney, Kevin D.
2002-01-01
Peptide nucleic acid (PNA) is a DNA mimic in which the nucleobases are linked by an N-(2-aminoethyl) glycine backbone. Here we report that PNA can interact with single-stranded DNA (ssDNA) in a non-sequence-specific fashion. We observed that a 15mer PNA inhibited the ssDNA-stimulated ATPase activity of a bacteriophage T4 helicase, Dda. Surprisingly, when a fluorescein-labeled 15mer PNA was used in binding studies no interaction was observed between PNA and Dda. However, fluorescence polarization did reveal non-sequence-specific interactions between PNA and ssDNA. Thus, the inhibition of ATPase activity of Dda appears to result from depletion of the available ssDNA due to non-Watson–Crick binding of PNA to ssDNA. Inhibition of the ssDNA-stimulated ATPase activity was observed for several PNAs of varying length and sequence. To study the basis for this phenomenon, we examined self-aggregation by PNAs. The 15mer PNA readily self-aggregates to the point of precipitation. Since PNAs are hydrophobic, they aggregate more than DNA or RNA, making the study of this phenomenon essential for understanding the properties of PNA. Non-sequence-specific interactions between PNA and ssDNA were observed at moderate concentrations of PNA, suggesting that such interactions should be considered for antisense and antigene applications. PMID:11842106
International Nuclear Information System (INIS)
Lee, K.M.; Marshall, A.G.
1987-01-01
Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's
Directory of Open Access Journals (Sweden)
Willson Richard C
2010-12-01
Full Text Available Abstract Background Manufacturing large quantities of recombinant RNAs by overexpression in a bacterial host is hampered by their instability in intracellular environment. To overcome this problem, an RNA of interest can be fused into a stable bacterial RNA for the resulting chimeric construct to accumulate in the cytoplasm to a sufficiently high level. Being supplemented with cost-effective procedures for isolation of the chimera from cells and recovery of the recombinant RNA from stabilizing scaffold, this strategy might become a viable alternative to the existing methods of chemical or enzymatic RNA synthesis. Results Sequence encoding a 71-nucleotide recombinant RNA was inserted into a plasmid-borne deletion mutant of the Vibrio proteolyticus 5S rRNA gene in place of helix III - loop C segment of the original 5S rRNA. After transformation into Escherichia coli, the chimeric RNA (3×pen aRNA was expressed constitutively from E. coli rrnB P1 and P2 promoters. The RNA chimera accumulated to levels that exceeded those of the host's 5S rRNA. A novel method relying on liquid-solid partitioning of cellular constituents was developed for isolation of total RNA from bacterial cells. This protocol avoids toxic chemicals, and is therefore more suitable for large scale RNA purification than traditional methods. A pair of biotinylated 8-17 DNAzymes was used to bring about the quantitative excision of the 71-nt recombinant RNA from the chimera. The recombinant RNA was isolated by sequence-specific capture on beads with immobilized complementary deoxyoligonucleotide, while DNAzymes were recovered by biotin affinity chromatography for reuse. Conclusions The feasibility of a fermentation-based approach for manufacturing large quantities of small RNAs in vivo using a "5S rRNA scaffold" strategy is demonstrated. The approach provides a route towards an economical method for the large-scale production of small RNAs including shRNAs, siRNAs and aptamers for use
Directory of Open Access Journals (Sweden)
Shailendra eRaikwar
2015-12-01
Full Text Available Genetic material always remains at the risk of spontaneous or induced damage which challenges the normal functioning of DNA molecule, thus, DNA repair is vital to protect the organisms against genetic damage. DNA hHelicases, the unique molecular motors, are emerged as potentialprospective molecules to engineer stress tolerance in plants and are involved in a variety of DNA nucleic acid metabolismc processes including DNA repair. The DNA repair helicase, OsXPB2 is an evolutionary conserved protein present in different organisms, including plants. Availability of few efficient promoters for gene expression in plants provoked us to study the promoter of XPB for better understanding of gene regulation under stress The analysis of promoter sequence from plant genome is important in understanding the gene regulation. Hereconditions. Here, we report the in silico analysis of novel stress inducible promoter of rice Oryza sativa OsXPB2 (OsXPB2. gene is reported. The in vivo validation of functionality/activity of novel stress inducible promoter of rice OsXPB2 gene promoter under abiotic and hormonal stress conditions was performed by Agrobacterium-mediated transient assay in tobacco leaves using OsXPB2::GUS chimeric construct. Our resultsThe present research revealed that OsXPB2 promoter contains cis-elements accounting for various abiotic stresses (salt, dehydration or cold and hormone (Auxin, ABA or MeJA induced GUS expression/activity in the promoter-reporter assay. The promoter region of OsXPB2 contains CACG, GTAACG, CACGTG, CGTCA CCGCCGCGCT cis acting-elements which are reported to be salt, dehydration, cold, MeJA or ABA responsive, respectively. Functional analysis was done by Agrobacterium-transient assays using agroinfiltration in tobacco leaves, followed by GUS staining and fluorescence quantitative analyses. The results revealed high induction of GUS activity under multiple abiotic stresses as compared to mock treated control. The present
Maeda, Tomoya; Tanaka, Yuya; Wachi, Masaaki; Inui, Masayuki
2017-03-01
Corynebacterium glutamicum has been applied for the industrial production of various metabolites, such as amino acids. To understand the biosynthesis of the membrane protein in this bacterium, we investigated the process of signal recognition particle (SRP) assembly. SRP is found in all three domains of life and plays an important role in the membrane insertion of proteins. SRP RNA is initially transcribed as precursor molecules; however, relatively little is known about its maturation. In C. glutamicum , SRP consists of the Ffh protein and 4.5S RNA lacking an Alu domain. In this study, we found that 3'-to-5' exoribonuclease, polynucleotide phosphorylase (PNPase), and two endo-type RNases, RNase E/G and YbeY, are involved in the 3' maturation of 4.5S RNA in C. glutamicum The mature form of 4.5S RNA was inefficiently formed in Δ rneG Δ pnp mutant cells, suggesting the existence of an alternative pathway for the 3' maturation of 4.5S RNA. Primer extension analysis also revealed that the 5' mature end of 4.5S RNA corresponds to that of the transcriptional start site. Immunoprecipitated Ffh protein contained immature 4.5S RNA in Δ pnp , Δ rneG , and Δ ybeY mutants, suggesting that 4.5S RNA precursors can interact with Ffh. These results imply that the maturation of 4.5S RNA can be performed in the 4.5S RNA-Ffh complex. IMPORTANCE Overproduction of a membrane protein, such as a transporter, is useful for engineering of strains of Corynebacterium glutamicum , which is a workhorse of amino acid production. To understand membrane protein biogenesis in this bacterium, we investigated the process of signal recognition particle (SRP) assembly. SRP contains the Ffh protein and SRP RNA and plays an important role in the membrane insertion of proteins. Although SRP RNA is highly conserved among the three domains of life, relatively little is known about its maturation. We show that PNPase, RNase E/G, and YbeY are involved in the 3' maturation of the SRP RNA (4.5S RNA) in
Dicty_cDB: Contig-U12068-1 [Dicty_cDB
Lifescience Database Archive (English)
Full Text Available e-11 1 ( EX440985 ) GQ04101.B7_M01 GQ041 - Shoot tip - Dormant (Norma... 82 7e-11 1 ( AF120269 ) Caenorhabditis elegans sex determ...AC0283 ) ATP-dependent helicase [imported] - Yersinia pest... 87 2e-15 CP000058_1...robable ATP-dependent RNA helicase A [imported] -... 83 3e-14 CP000462_2159( CP000462 |pid:none) Aeromonas h...ingitidis serogrou... 73 3e-11 A81960( A81960 ) probable DNA helicase NMA0430 [imported] - Neisse... 73 3e-1...keilllllhhh midemigaviemiieemievviemiieemievvvvigemiiegmikvvvvvvigmiiegm ievaiekiikemtevhhigevriliktlklhkedim
Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.
Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L
2017-11-01
Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or
International Nuclear Information System (INIS)
Lockard, R.E.; Rieser, L.; Vournakis, J.N.
1981-01-01
In recent years, there has been a growing appreciation of the potential applications of 5'- 32 P-end-labeled mRNA, not only for screening recombinant clones and mapping gene structure, but also for revealing possible nucleotide sequence and structural signals within mRNA molecules themselves, which may be important for eukaryotic mRNA processing and turnover and for controlling differential rates of translational initiation. Three major problems, however, have retarded progress in this area, lack of methods for efficient and reproducible removal of m7G5ppp5'-cap structures, which maintain the integrity of an RNA molecule; inability to generate a sufficient amount of labeled mRNA, owing to the limited availability of most pure mRNA species; and the frequent problem of RNA degradation during in vitro end-labeling owing to RNAse contamination. The procedures presented here permit one to decap and label minute quantities of mRNA, effectively. Tobacco acid pyrophosphatase is relatively efficient in removing cap structures from even nanogram quantities of available mRNA, and enough radioactivity can be easily generated from minute amounts ofintact mRNA with very high-specific-activity [gamma- 32 P]ATP and the inhibition of ribonuclease contamination with diethylpyrocarbonate. These procedures can be modified and applied to almost any other type of RNA molecule as well. In Section III of this volume, we explore in detail how effectively 5'-end-labeled mRNA can be used not only for nucleotide sequence analysis, but also for mapping mRNA secondary structure
Cubillos-Ruiz, Juan R; Engle, Xavier; Scarlett, Uciane K; Martinez, Diana; Barber, Amorette; Elgueta, Raul; Wang, Li; Nesbeth, Yolanda; Durant, Yvon; Gewirtz, Andrew T; Sentman, Charles L; Kedl, Ross; Conejo-Garcia, Jose R
2009-08-01
The success of clinically relevant immunotherapies requires reversing tumor-induced immunosuppression. Here we demonstrated that linear polyethylenimine-based (PEI-based) nanoparticles encapsulating siRNA were preferentially and avidly engulfed by regulatory DCs expressing CD11c and programmed cell death 1-ligand 1 (PD-L1) at ovarian cancer locations in mice. PEI-siRNA uptake transformed these DCs from immunosuppressive cells to efficient antigen-presenting cells that activated tumor-reactive lymphocytes and exerted direct tumoricidal activity, both in vivo and in situ. PEI triggered robust and selective TLR5 activation in vitro and elicited the production of hallmark TLR5-inducible cytokines in WT mice, but not in Tlr5-/- littermates. Thus, PEI is a TLR5 agonist that, to our knowledge, was not previously recognized. In addition, PEI-complexed nontargeting siRNA oligonucleotides stimulated TLR3 and TLR7. The nonspecific activation of multiple TLRs (specifically, TLR5 and TLR7) reversed the tolerogenic phenotype of human and mouse ovarian tumor-associated DCs. In ovarian carcinoma-bearing mice, this induced T cell-mediated tumor regression and prolonged survival in a manner dependent upon myeloid differentiation primary response gene 88 (MyD88; i.e., independent of TLR3). Furthermore, gene-specific siRNA-PEI nanocomplexes that silenced immunosuppressive molecules on mouse tumor-associated DCs elicited discernibly superior antitumor immunity and enhanced therapeutic effects compared with nontargeting siRNA-PEI nanocomplexes. Our results demonstrate that the intrinsic TLR5 and TLR7 stimulation of siRNA-PEI nanoparticles synergizes with the gene-specific silencing activity of siRNA to transform tumor-infiltrating regulatory DCs into DCs capable of promoting therapeutic antitumor immunity.
Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon
2012-07-17
In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.
Energy Technology Data Exchange (ETDEWEB)
Zhang, L.; Liang, H. [Department of Pediatrics, Qilu Hospital, Shandong University, Jinan (China); Cao, W. [Department of Obstetrics, Qingdao Central Hospital, Qingdao (China); Xu, R.; Ju, X.L. [Department of Pediatrics, Qilu Hospital, Shandong University, Jinan (China)
2014-05-23
Neuroblastoma is a solid tumor that occurs mainly in children. Malignant neuroblastomas have a poor prognosis because conventional chemotherapeutic agents are not very effective. Survivin, a member of the inhibitor of the apoptosis protein family, plays a significant role in cell division, inhibition of apoptosis, and promotion of cell proliferation and invasion. Previous studies found that survivin is highly expressed in some malignant neuroblastomas and is correlated with poor prognosis. The aim of this study was to investigate whether survivin could serve as a potential therapeutic target of human neuroblastoma. We employed RNA interference to reduce survivin expression in the human neuroblastoma SH-SY5Y cell line and analyzed the effect of RNA interference on cell proliferation and invasion in vitro and in vivo. RNA interference of survivin led to a significant decrease in invasiveness and proliferation and increased apoptosis in SH-SY5Y cells in vitro. RNA interference of survivin inhibited tumor growth in vivo by 68±13% (P=0.002) and increased the number of apoptotic cells by 9.8±1.2% (P=0.001) compared with negative small interfering RNA (siRNA) treatment controls. Moreover, RNA interference of survivin inhibited the formation of lung metastases by 92% (P=0.002) and reduced microvascular density by 60% (P=0.0003). Survivin siRNA resulted in significant downregulation of survivin mRNA and protein expression both in vitro and in vivo compared with negative siRNA treatment controls. RNA interference of survivin was found to be a potent inhibitor of SH-SY5Y tumor growth and metastasis formation. These results support further clinical development of RNA interference of survivin as a treatment of neuroblastoma and other cancer types.
An In-Silico Investigation of Phytochemicals as Antiviral Agents Against Dengue Fever.
Powers, Chelsea N; Setzer, William N
2016-01-01
A virtual screening analysis of our library of phytochemical structures with dengue virus protein targets has been carried out using a molecular docking approach. A total of 2194 plant-derived secondary metabolites have been docked. This molecule set comprised of 290 alkaloids (68 indole alkaloids, 153 isoquinoline alkaloids, 5 quinoline alkaloids, 13 piperidine alkaloids, 14 steroidal alkaloids, and 37 miscellaneous alkaloids), 678 terpenoids (47 monoterpenoids, 169 sesquiterpenoids, 265 diterpenoids, 81 steroids, and 96 triterpenoids), 20 aurones, 81 chalcones, 349 flavonoids, 120 isoflavonoids, 74 lignans, 58 stilbenoids, 169 miscellaneous polyphenolic compounds, 100 coumarins, 28 xanthones, 67 quinones, and 160 miscellaneous phytochemicals. Dengue virus protein targets examined included dengue virus protease (NS2B-NS3pro), helicase (NS3 helicase), methyltransferase (MTase), RNA-dependent RNA polymerase (RdRp), and the dengue virus envelope protein. Polyphenolic compounds, flavonoids, chalcones, and other phenolics were the most numerous of the strongly docking ligands for dengue virus protein targets.
Directory of Open Access Journals (Sweden)
Alyssa Flobinus
2018-03-01
Full Text Available The RNA3 species of the beet necrotic yellow vein virus (BNYVV, a multipartite positive-stranded RNA phytovirus, contains the ‘core’ nucleotide sequence required for its systemic movement in Beta macrocarpa. Within this ‘core’ sequence resides a conserved “coremin” motif of 20 nucleotides that is absolutely essential for long-distance movement. RNA3 undergoes processing steps to yield a noncoding RNA3 (ncRNA3 possessing “coremin” at its 5′ end, a mandatory element for ncRNA3 accumulation. Expression of wild-type (wt or mutated RNA3 in Saccharomyces cerevisiae allows for the accumulation of ncRNA3 species. Screening of S. cerevisiae ribonuclease mutants identified the 5′-to-3′ exoribonuclease Xrn1 as a key enzyme in RNA3 processing that was recapitulated both in vitro and in insect cell extracts. Xrn1 stalled on ncRNA3-containing RNA substrates in these decay assays in a similar fashion as the flavivirus Xrn1-resistant structure (sfRNA. Substitution of the BNYVV-RNA3 ‘core’ sequence by the sfRNA sequence led to the accumulation of an ncRNA species in yeast in vitro but not in planta and no viral long distance occurred. Interestingly, XRN4 knockdown reduced BNYVV RNA accumulation suggesting a dual role for the ribonuclease in the viral cycle.
Jain, Aklank; Bacolla, Albino; Del Mundo, Imee M; Zhao, Junhua; Wang, Guliang; Vasquez, Karen M
2013-12-01
Sequences that have the capacity to adopt alternative (i.e. non-B) DNA structures in the human genome have been implicated in stimulating genomic instability. Previously, we found that a naturally occurring intra-molecular triplex (H-DNA) caused genetic instability in mammals largely in the form of DNA double-strand breaks. Thus, it is of interest to determine the mechanism(s) involved in processing H-DNA. Recently, we demonstrated that human DHX9 helicase preferentially unwinds inter-molecular triplex DNA in vitro. Herein, we used a mutation-reporter system containing H-DNA to examine the relevance of DHX9 activity on naturally occurring H-DNA structures in human cells. We found that H-DNA significantly increased mutagenesis in small-interfering siRNA-treated, DHX9-depleted cells, affecting mostly deletions. Moreover, DHX9 associated with H-DNA in the context of supercoiled plasmids. To further investigate the role of DHX9 in the recognition/processing of H-DNA, we performed binding assays in vitro and chromatin immunoprecipitation assays in U2OS cells. DHX9 recognized H-DNA, as evidenced by its binding to the H-DNA structure and enrichment at the H-DNA region compared with a control region in human cells. These composite data implicate DHX9 in processing H-DNA structures in vivo and support its role in the overall maintenance of genomic stability at sites of alternatively structured DNA.
CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.
Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A
2014-05-06
In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.
Directory of Open Access Journals (Sweden)
Thomas Spaller
Full Text Available The amoeba Dictyostelium discoideum has a haploid genome in which two thirds of the DNA encodes proteins. Consequently, the space available for selfish mobile elements to expand without excess damage to the host genome is limited. The non-long terminal repeat retrotransposon TRE5-A maintains an active population in the D. discoideum genome and apparently adapted to this gene-dense environment by targeting positions ~47 bp upstream of tRNA genes that are devoid of protein-coding regions. Because only ~24% of tRNA genes are associated with a TRE5-A element in the reference genome, we evaluated whether TRE5-A retrotransposition is limited to this subset of tRNA genes. We determined that a tagged TRE5-A element (TRE5-Absr integrated at 384 of 405 tRNA genes, suggesting that expansion of the current natural TRE5-A population is not limited by the availability of targets. We further observed that TRE5-Absr targets the ribosomal 5S gene on the multicopy extrachromosomal DNA element that carries the ribosomal RNA genes, indicating that TRE5-A integration may extend to the entire RNA polymerase III (Pol III transcriptome. We determined that both natural TRE5-A and cloned TRE5-Absr retrotranspose to locations on the extrachromosomal rDNA element that contain tRNA gene-typical A/B box promoter motifs without displaying any other tRNA gene context. Based on previous data suggesting that TRE5-A targets tRNA genes by locating Pol III transcription complexes, we propose that A/B box loci reflect Pol III transcription complex assembly sites that possess a function in the biology of the extrachromosomal rDNA element.
YebU is a m5C methyltransferase specific for 16 S rRNA nucleotide 1407
DEFF Research Database (Denmark)
Andersen, Niels Møller; Douthwaite, Stephen
2006-01-01
generally require specific enzymes, and only one m5C rRNA methyltransferase, RsmB (formerly Fmu) that methylates nucleotide C967, has previously been identified. BLAST searches of the E.coli genome revealed a single gene, yebU, with sufficient similarity to rsmB to encode a putative m5C RNA...... methyltransferase. This suggested that the yebU gene product modifies C1407 and/or C1962. Here, we analysed the E.coli rRNAs by matrix assisted laser desorption/ionization mass spectrometry and show that inactivation of the yebU gene leads to loss of methylation at C1407 in 16 S rRNA, but does not interfere...
Germline mutations of regulator of telomere elongation helicase 1, RTEL1, in Dyskeratosis congenita.
Ballew, Bari J; Yeager, Meredith; Jacobs, Kevin; Giri, Neelam; Boland, Joseph; Burdett, Laurie; Alter, Blanche P; Savage, Sharon A
2013-04-01
Dyskeratosis congenita (DC) is an inherited bone marrow failure and cancer predisposition syndrome caused by aberrant telomere biology. The classic triad of dysplastic nails, abnormal skin pigmentation, and oral leukoplakia is diagnostic of DC, but substantial clinical heterogeneity exists; the clinically severe variant Hoyeraal Hreidarsson syndrome (HH) also includes cerebellar hypoplasia, severe immunodeficiency, enteropathy, and intrauterine growth retardation. Germline mutations in telomere biology genes account for approximately one-half of known DC families. Using exome sequencing, we identified mutations in RTEL1, a helicase with critical telomeric functions, in two families with HH. In the first family, two siblings with HH and very short telomeres inherited a premature stop codon from their mother who has short telomeres. The proband from the second family has HH and inherited a premature stop codon in RTEL1 from his father and a missense mutation from his mother, who also has short telomeres. In addition, inheritance of only the missense mutation led to very short telomeres in the proband's brother. Targeted sequencing identified a different RTEL1 missense mutation in one additional DC proband who has bone marrow failure and short telomeres. Both missense mutations affect the helicase domain of RTEL1, and three in silico prediction algorithms suggest that they are likely deleterious. The nonsense mutations both cause truncation of the RTEL1 protein, resulting in loss of the PIP box; this may abrogate an important protein-protein interaction. These findings implicate a new telomere biology gene, RTEL1, in the etiology of DC.
International Nuclear Information System (INIS)
Chen, I-H.; Meng Hsiao; Hsu, Y.-H.; Tsai, C.-H.
2003-01-01
The 3' untranslated region (UTR) of bamboo mosaic potexvirus (BaMV) RNA was identified to fold into a tertiary structure comprising a cloverleaf-like structure designated ABC domain followed by a major stem-loop D, which in turn is followed by a pseudoknot E and a poly(A) tail. The coat protein accumulation level of the mutant, BaMV40A/ΔABC, lacking ABC domain was just 15% that of wild-type when inoculated into protoplasts of Nicotiana benthamiana. This suggested that ABC domain might play an important role in BaMV RNA replication. To define the precise role of each of the three stem-loops of ABC domain in RNA replication, three mutants BaMV40B and C each lacking stem-loop A, B, and C, respectively, were created. Our results showed that accumulation of viral products of mutants BaMV40B and C were not as efficient as wild-type. On the contrary, level of accumulation of viral products of BaMVA was similar to that of wild-type in protoplasts and inoculated leaves. Interestingly, the accumulation of viral products was not as efficient as that of wild-type in systemic leaves, implying that stem-loop A is dispensable for replication, but signifies a role in systemic accumulation. Using UV cross-linking and competition experiments, it was demonstrated that the E. coli expressed helicase domain of BaMV ORF1 can preferentially interact with the ABC domain
Identification of Host Cell Factors Associated with Astrovirus Replication in Caco-2 Cells.
Murillo, Andrea; Vera-Estrella, Rosario; Barkla, Bronwyn J; Méndez, Ernesto; Arias, Carlos F
2015-10-01
Astroviruses are small, nonenveloped viruses with a single-stranded positive-sense RNA genome causing acute gastroenteritis in children and immunocompromised patients. Since positive-sense RNA viruses have frequently been found to replicate in association with membranous structures, in this work we characterized the replication of the human astrovirus serotype 8 strain Yuc8 in Caco-2 cells, using density gradient centrifugation and free-flow zonal electrophoresis (FFZE) to fractionate cellular membranes. Structural and nonstructural viral proteins, positive- and negative-sense viral RNA, and infectious virus particles were found to be associated with a distinct population of membranes separated by FFZE. The cellular proteins associated with this membrane population in infected and mock-infected cells were identified by tandem mass spectrometry. The results indicated that membranes derived from multiple cell organelles were present in the population. Gene ontology and protein-protein interaction network analysis showed that groups of proteins with roles in fatty acid synthesis and ATP biosynthesis were highly enriched in the fractions of this population in infected cells. Based on this information, we investigated by RNA interference the role that some of the identified proteins might have in the replication cycle of the virus. Silencing of the expression of genes involved in cholesterol (DHCR7, CYP51A1) and fatty acid (FASN) synthesis, phosphatidylinositol (PI4KIIIβ) and inositol phosphate (ITPR3) metabolism, and RNA helicase activity (DDX23) significantly decreased the amounts of Yuc8 genomic and antigenomic RNA, synthesis of the structural protein VP90, and virus yield. These results strongly suggest that astrovirus RNA replication and particle assembly take place in association with modified membranes potentially derived from multiple cell organelles. Astroviruses are common etiological agents of acute gastroenteritis in children and immunocompromised patients
Identification of Host Cell Factors Associated with Astrovirus Replication in Caco-2 Cells
Murillo, Andrea; Vera-Estrella, Rosario; Barkla, Bronwyn J.; Méndez, Ernesto
2015-01-01
ABSTRACT Astroviruses are small, nonenveloped viruses with a single-stranded positive-sense RNA genome causing acute gastroenteritis in children and immunocompromised patients. Since positive-sense RNA viruses have frequently been found to replicate in association with membranous structures, in this work we characterized the replication of the human astrovirus serotype 8 strain Yuc8 in Caco-2 cells, using density gradient centrifugation and free-flow zonal electrophoresis (FFZE) to fractionate cellular membranes. Structural and nonstructural viral proteins, positive- and negative-sense viral RNA, and infectious virus particles were found to be associated with a distinct population of membranes separated by FFZE. The cellular proteins associated with this membrane population in infected and mock-infected cells were identified by tandem mass spectrometry. The results indicated that membranes derived from multiple cell organelles were present in the population. Gene ontology and protein-protein interaction network analysis showed that groups of proteins with roles in fatty acid synthesis and ATP biosynthesis were highly enriched in the fractions of this population in infected cells. Based on this information, we investigated by RNA interference the role that some of the identified proteins might have in the replication cycle of the virus. Silencing of the expression of genes involved in cholesterol (DHCR7, CYP51A1) and fatty acid (FASN) synthesis, phosphatidylinositol (PI4KIIIβ) and inositol phosphate (ITPR3) metabolism, and RNA helicase activity (DDX23) significantly decreased the amounts of Yuc8 genomic and antigenomic RNA, synthesis of the structural protein VP90, and virus yield. These results strongly suggest that astrovirus RNA replication and particle assembly take place in association with modified membranes potentially derived from multiple cell organelles. IMPORTANCE Astroviruses are common etiological agents of acute gastroenteritis in children and
International Nuclear Information System (INIS)
Valles, Steven M.; Hashimoto, Yoshifumi
2009-01-01
We report the discovery of a new virus from the red imported fire ant, Solenopsis invicta. Solenopsis invicta virus 3 (SINV-3) represents the third virus discovered from this ant species using the metagenomics approach. The single (positive)-strand RNA, monopartite, bicistronic genome of SINV-3 was sequenced in entirety (GenBank accession number (FJ528584)), comprised of 10,386 nucleotides, and polyadenylated at the 3' terminus. This genome size was confirmed by Northern analysis. The genome revealed 2 large open reading frames (ORFs) in the sense orientation with an untranslated region (UTR) at each end and between the two ORFs. The 5' proximal ORF (ORF 1) encoded a predicted protein of 299.1 kDa (2580 amino acids). The 3' proximal ORF (ORF 2) encoded a predicted protein of 73.2 kDa (651 amino acids). RNA-dependent RNA polymerase (RdRp), helicase, and protease domains were recognized in ORF 1. SDS-PAGE separation of purified SINV-3 particles yielded 2 bands (ostensibly capsid proteins) with a combined molecular mass of 77.3 kDa which was similar to the mass predicted by ORF 2 (73.2 kDa). Phylogenetic analysis of the conserved amino acid sequences containing domains I to VIII of the RdRp from dicistroviruses, iflaviruses, plant small RNA viruses, picornaviruses, and 4 unassigned positive-strand RNA viruses revealed a trichotomous phenogram with SINV-3 and Kelp fly virus comprising a unique cluster. Electron microscopic examination of negatively stained samples of SINV-3 revealed isometric particles with apparent projections and a diameter of 27.3 ± 1.3 nm. SINV-3 was successfully transmitted to uninfected workers by feeding. The minus (replicative) strand of SINV-3 was detected in worker ants indicating replication of the virus. The possibility of using SINV-3 as a microbial control agent for fire ants is discussed.
Uringa, Evert-Jan; Youds, Jillian L; Lisaingo, Kathleen; Lansdorp, Peter M; Boulton, Simon J
2011-03-01
Telomere maintenance and DNA repair are crucial processes that protect the genome against instability. RTEL1, an essential iron-sulfur cluster-containing helicase, is a dominant factor that controls telomere length in mice and is required for telomere integrity. In addition, RTEL1 promotes synthesis-dependent strand annealing to direct DNA double-strand breaks into non-crossover outcomes during mitotic repair and in meiosis. Here, we review the role of RTEL1 in telomere maintenance and homologous recombination and discuss models linking RTEL1's enzymatic activity to its function in telomere maintenance and DNA repair.
RECQ5 helicase promotes resolution of conflicts between replication and transcription in human cells
Czech Academy of Sciences Publication Activity Database
Urban, Václav; Dobrovolná, Jana; Hühn, D.; Fryzelkova, Jana; Bartek, Jiří; Janščák, Pavel
2016-01-01
Roč. 214, č. 4 (2016), s. 401-415 ISSN 0021-9525 R&D Projects: GA ČR(CZ) GA14-05743S; GA MŠk LH14037 Institutional support: RVO:68378050 Keywords : rna-polymerase-ii * fragile sites * homologous recombination * genome instability * dna-replication * genes * fork * protein * stress * brca1 Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 7.955, year: 2016
Sun, Yan-Lin; Kang, Ho-Min; Kim, Young-Sik; Baek, Jun-Pill; Zheng, Shi-Lin; Xiang, Jin-Jun; Hong, Soon-Kwan
2014-05-04
The tomato ( Solanum lycopersicum ) is a major vegetable crop worldwide. To satisfy popular demand, more than 500 tomato varieties have been bred. However, a clear variety identification has not been found. Thorough understanding of the phylogenetic relationship and hybridization information of tomato varieties is very important for further variety breeding. Thus, in this study, we collected 26 tomato varieties and attempted to distinguish them based on the 5S rRNA region, which is widely used in the determination of phylogenetic relations. Sequence analysis of the 5S rRNA region suggested that a large number of nucleotide variations exist among tomato varieties. These variable nucleotide sites were also informative regarding hybridization. Chromas sequencing of Yellow Mountain View and Seuwiteuking varieties indicated three and one variable nucleotide sites in the non-transcribed spacer (NTS) of the 5S rRNA region showing hybridization, respectively. Based on a phylogenetic tree constructed using the 5S rRNA sequences, we observed that 16 tomato varieties were divided into three groups at 95% similarity. Rubiking and Sseommeoking, Lang Selection Procedure and Seuwiteuking, and Acorn Gold and Yellow Mountain View exhibited very high identity with their partners. This work will aid variety authentication and provides a basis for further tomato variety breeding.
Ren, Kewei; Li, Zhen; Li, Yahua; Zhang, Wenzhe; Han, Xinwei
2017-05-24
Long noncoding RNA (lncRNA) taurine-upregulated gene 1 (TUG1) is involved in the development and carcinogenesis of various tumors, suggesting the diagnostic potential of TUG1 in these cancers. However, the exact role of TUG1 and its underlying mechanism in gastric cancer (GC) remain unknown. In this study, the expression of TUG1 and miR-145-5p in GC cell lines and nonmalignant gastric epithelial cell lines was detected by qRT-PCR. BGC-823 and SGC-7901 cells were transfected with si-TUG1, pcDNA 3.1-TUG1, miR-145-5p mimics, or matched controls. The biological function of TUG1 and miR-145-5p in GC cell proliferation and invasion in vitro and tumor growth in vivo was investigated by MTT assay, Transwell invasion assay, and tumor xenograft experiments. The regulating relationship between TUG1 and miR-145-5 was confirmed by luciferase reporter assay. The results showed that TUG1 was significantly overexpressed and miR-145-5p was dramatically downregulated in GC cell lines. TUG1 knockdown strikingly inhibited cell proliferation and invasion in vitro and markedly suppressed tumor growth in vivo. Furthermore, TUG1 could directly bind to miR-145-5p and repress miR-145-5p expression. TUG1 overexpression significantly relieved the inhibition on GC cell proliferation and invasion in vitro and tumor growth in vivo, mediated by miR-145-5p overexpression. In conclusion, TUG1 promotes cell proliferation and invasion in GC via negatively modulating miRNA-145-5p, which undoubtedly contributes to understanding the mechanism of GC occurrence and development.
In situ hybridization of iodinated 5S and 18/25S RNA to Vicia faba metaphase chromosomes
International Nuclear Information System (INIS)
Schubert, I.; Baeumlein, H.; Wobus, U.
1978-01-01
In vitro labelled 125 I ribosomal RNA fractions (18/25S and 5S) were in situ hybridized to metaphase chromosomes of a reconstructed karyotype of Vicia faba (characterized by two translocations and one pericentric inversion, each being present homozygously). The sites of 18S and 25S RNA were found to be confined to the nucleolus organizing secondary constriction. Two loci of 5S RNA were recognized on the satellite of nucleolus bearing chromosome. Possible correlations between the location of ribosomal genes, heterochromatic G-bands and clusters of mutagen induced chromatid aberrations are discussed. (author)
Characterization of the TRBP domain required for Dicer interaction and function in RNA interference
Directory of Open Access Journals (Sweden)
El Far Mohamed
2009-05-01
Full Text Available Abstract Background Dicer, Ago2 and TRBP are the minimum components of the human RNA-induced silencing complex (RISC. While Dicer and Ago2 are RNases, TRBP is the double-stranded RNA binding protein (dsRBP that loads small interfering RNA into the RISC. TRBP binds directly to Dicer through its C-terminal domain. Results We show that the TRBP binding site in Dicer is a 165 amino acid (aa region located between the ATPase and the helicase domains. The binding site in TRBP is a 69 aa domain, called C4, located at the C-terminal end of TRBP. The TRBP1 and TRBP2 isoforms, but not TRBPs lacking the C4 site (TRBPsΔC4, co-immunoprecipitated with Dicer. The C4 domain is therefore necessary to bind Dicer, irrespective of the presence of RNA. Immunofluorescence shows that while full-length TRBPs colocalize with Dicer, TRBPsΔC4 do not. tarbp2-/- cells, which do not express TRBP, do not support RNA interference (RNAi mediated by short hairpin or micro RNAs against EGFP. Both TRBPs, but not TRBPsΔC4, were able to rescue RNAi function. In human cells with low RNAi activity, addition of TRBP1 or 2, but not TRBPsΔC4, rescued RNAi function. Conclusion The mapping of the interaction sites between TRBP and Dicer show unique domains that are required for their binding. Since TRBPsΔC4 do not interact or colocalize with Dicer, we suggest that TRBP and Dicer, both dsRBPs, do not interact through bound dsRNA. TRBPs, but not TRBPsΔC4, rescue RNAi activity in RNAi-compromised cells, indicating that the binding of Dicer to TRBP is critical for RNAi function.
Directory of Open Access Journals (Sweden)
Kim Chan-Mi
2007-07-01
Full Text Available Abstract Background Japanese encephalitis virus (JEV NS5 is a viral nonstructural protein that carries both methyltransferase and RNA-dependent RNA polymerase (RdRp domains. It is a key component of the viral RNA replicase complex that presumably includes other viral nonstructural and cellular proteins. The biochemical properties of JEV NS5 have not been characterized due to the lack of a robust in vitro RdRp assay system, and the molecular mechanisms for the initiation of RNA synthesis by JEV NS5 remain to be elucidated. Results To characterize the biochemical properties of JEV RdRp, we expressed in Escherichia coli and purified an enzymatically active full-length recombinant JEV NS5 protein with a hexahistidine tag at the N-terminus. The purified NS5 protein, but not the mutant NS5 protein with an Ala substitution at the first Asp of the RdRp-conserved GDD motif, exhibited template- and primer-dependent RNA synthesis activity using a poly(A RNA template. The NS5 protein was able to use both plus- and minus-strand 3'-untranslated regions of the JEV genome as templates in the absence of a primer, with the latter RNA being a better template. Analysis of the RNA synthesis initiation site using the 3'-end 83 nucleotides of the JEV genome as a minimal RNA template revealed that the NS5 protein specifically initiates RNA synthesis from an internal site, U81, at the two nucleotides upstream of the 3'-end of the template. Conclusion As a first step toward the understanding of the molecular mechanisms for JEV RNA replication and ultimately for the in vitro reconstitution of viral RNA replicase complex, we for the first time established an in vitro JEV RdRp assay system with a functional full-length recombinant JEV NS5 protein and characterized the mechanisms of RNA synthesis from nonviral and viral RNA templates. The full-length recombinant JEV NS5 will be useful for the elucidation of the structure-function relationship of this enzyme and for the
DIANA-microT web server v5.0: service integration into miRNA functional analysis workflows.
Paraskevopoulou, Maria D; Georgakilas, Georgios; Kostoulas, Nikos; Vlachos, Ioannis S; Vergoulis, Thanasis; Reczko, Martin; Filippidis, Christos; Dalamagas, Theodore; Hatzigeorgiou, A G
2013-07-01
MicroRNAs (miRNAs) are small endogenous RNA molecules that regulate gene expression through mRNA degradation and/or translation repression, affecting many biological processes. DIANA-microT web server (http://www.microrna.gr/webServer) is dedicated to miRNA target prediction/functional analysis, and it is being widely used from the scientific community, since its initial launch in 2009. DIANA-microT v5.0, the new version of the microT server, has been significantly enhanced with an improved target prediction algorithm, DIANA-microT-CDS. It has been updated to incorporate miRBase version 18 and Ensembl version 69. The in silico-predicted miRNA-gene interactions in Homo sapiens, Mus musculus, Drosophila melanogaster and Caenorhabditis elegans exceed 11 million in total. The web server was completely redesigned, to host a series of sophisticated workflows, which can be used directly from the on-line web interface, enabling users without the necessary bioinformatics infrastructure to perform advanced multi-step functional miRNA analyses. For instance, one available pipeline performs miRNA target prediction using different thresholds and meta-analysis statistics, followed by pathway enrichment analysis. DIANA-microT web server v5.0 also supports a complete integration with the Taverna Workflow Management System (WMS), using the in-house developed DIANA-Taverna Plug-in. This plug-in provides ready-to-use modules for miRNA target prediction and functional analysis, which can be used to form advanced high-throughput analysis pipelines.
Barreda-García, Susana; Miranda-Castro, Rebeca; de-Los-Santos-Álvarez, Noemí; Miranda-Ordieres, Arturo J; Lobo-Castañón, María Jesús
2018-01-01
Highly sensitive testing of nucleic acids is essential to improve the detection of pathogens, which pose a major threat for public health worldwide. Currently available molecular assays, mainly based on PCR, have a limited utility in point-of-need control or resource-limited settings. Consequently, there is a strong interest in developing cost-effective, robust, and portable platforms for early detection of these harmful microorganisms. Since its description in 2004, isothermal helicase-dependent amplification (HDA) has been successfully applied in the development of novel molecular-based technologies for rapid, sensitive, and selective detection of viruses and bacteria. In this review, we highlight relevant analytical systems using this simple nucleic acid amplification methodology that takes place at a constant temperature and that is readily compatible with microfluidic technologies. Different strategies for monitoring HDA amplification products are described. In addition, we present technological advances for integrating sample preparation, HDA amplification, and detection. Future perspectives and challenges toward point-of-need use not only for clinical diagnosis but also in food safety testing and environmental monitoring are also discussed. Graphical Abstract Expanding the analytical toolbox for the detection of DNA sequences specific of pathogens with isothermal helicase dependent amplification (HDA).
Directory of Open Access Journals (Sweden)
Shobbir Hussain
2013-07-01
Full Text Available Autosomal-recessive loss of the NSUN2 gene has been identified as a causative link to intellectual disability disorders in humans. NSun2 is an RNA methyltransferase modifying cytosine-5 in transfer RNAs (tRNAs, yet the identification of cytosine methylation in other RNA species has been hampered by the lack of sensitive and reliable molecular techniques. Here, we describe miCLIP as an additional approach for identifying RNA methylation sites in transcriptomes. miCLIP is a customized version of the individual-nucleotide-resolution crosslinking and immunoprecipitation (iCLIP method. We confirm site-specific methylation in tRNAs and additional messenger and noncoding RNAs (ncRNAs. Among these, vault ncRNAs contained six NSun2-methylated cytosines, three of which were confirmed by RNA bisulfite sequencing. Using patient cells lacking the NSun2 protein, we further show that loss of cytosine-5 methylation in vault RNAs causes aberrant processing into Argonaute-associated small RNA fragments that can function as microRNAs. Thus, impaired processing of vault ncRNA may contribute to the etiology of NSun2-deficiency human disorders.
International Nuclear Information System (INIS)
Annamalai, Padmanaban; Hsu, Y.-H.; Liu, Y.-P.; Tsai, C.-H.; Lin, N.-S.
2003-01-01
The satellite RNA of Bamboo mosaic virus (satBaMV) contains on open reading frame for a 20-kDa protein that is flanked by a 5'-untranslated region (UTR) of 159 nucleotides (nt) and a 3'-UTR of 129 nt. A secondary structure was predicted for the 5'-UTR of satBaMV RNA, which folds into a large stem-loop (LSL) and a small stem-loop. Enzymatic probing confirmed the existence of LSL (nt 8-138) in the 5'-UTR. The essential cis-acting sequences in the 5'-UTR required for satBaMV RNA replication were determined by deletion and substitution mutagenesis. Their replication efficiencies were analyzed in Nicotiana benthamiana protoplasts and Chenopodium quinoa plants coinoculated with helper BaMV RNA. All deletion mutants abolished the replication of satBaMV RNA, whereas mutations introduced in most of the loop regions and stems showed either no replication or a decreased replication efficiency. Mutations that affected the positive-strand satBaMV RNA accumulation also affected the accumulation of negative-strand RNA; however, the accumulation of genomic and subgenomic RNAs of BaMV were not affected. Moreover, covariation analyses of natural satBaMV variants provide substantial evidence that the secondary structure in the 5'-UTR of satBaMV is necessary for efficient replication
The novel HSV-1 US5-1 RNA is transcribed off a domain encoding US 5, US 4, US 3, US 2 and α22
Directory of Open Access Journals (Sweden)
Roizman Bernard
2010-05-01
Full Text Available Abstract Background The genome of herpes simplex virus 1 encodes at least 84 transcripts from which proteins are translated and several additional RNAs whose status as mRNAs is unknown. These RNAs include latency-associated transcript, OriS1 and OriS2 RNAs and in case of α4 null mutant additional transcript that spans the junction between L and S component of the HSV-1 genome. Current data do not suggest that a peptide is translated from these RNAs. Results We describe here a novel RNA designated US5-1 that spans 4.5 kb of the unique-short (US region. The RNA initiates in US5 and terminates in the α22 open reading frame. It is expressed antisense to US5, US4, US3 and ICP22 mRNAs. This transcript is expressed with γ2 kinetics and has a half-life of 80 minutes. Conclusion These results identify a novel transcript encoded within HSV-1 genome. Since no major hypothetical open-reading frames are present in this transcript it is feasible that this RNA exerts its function as a non-coding RNA.
Directory of Open Access Journals (Sweden)
Qian Feng
Full Text Available Upon viral infections, pattern recognition receptors (PRRs recognize pathogen-associated molecular patterns (PAMPs and stimulate an antiviral state associated with the production of type I interferons (IFNs and inflammatory markers. Type I IFNs play crucial roles in innate antiviral responses by inducing expression of interferon-stimulated genes and by activating components of the adaptive immune system. Although pegylated IFNs have been used to treat hepatitis B and C virus infections for decades, they exert substantial side effects that limit their use. Current efforts are directed toward the use of PRR agonists as an alternative approach to elicit host antiviral responses in a manner similar to that achieved in a natural infection. RIG-I is a cytosolic PRR that recognizes 5' triphosphate (5'ppp-containing RNA ligands. Due to its ubiquitous expression profile, induction of the RIG-I pathway provides a promising platform for the development of novel antiviral agents and vaccine adjuvants. In this study, we investigated whether structured RNA elements in the genome of coxsackievirus B3 (CVB3, a picornavirus that is recognized by MDA5 during infection, could activate RIG-I when supplied with 5'ppp. We show here that a 5'ppp-containing cloverleaf (CL RNA structure is a potent RIG-I inducer that elicits an extensive antiviral response that includes induction of classical interferon-stimulated genes, as well as type III IFNs and proinflammatory cytokines and chemokines. In addition, we show that prophylactic treatment with CVB3 CL provides protection against various viral infections including dengue virus, vesicular stomatitis virus and enterovirus 71, demonstrating the antiviral efficacy of this RNA ligand.
Energy Technology Data Exchange (ETDEWEB)
Zheng, Rong [Department of Radiation Oncology, Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong (China); Department of Radiation Oncology, Fujian Medical University Union Hospital, Fuzhou, Fujian (China); Yao, Qiwei [Department of Radiation Oncology, Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong (China); Department of Radiation Oncology, Teaching Hospital of Fujian Medical University, Fujian Provincial Cancer Hospital, Fuzhou, Fujian (China); Ren, Chen; Liu, Ying; Yang, Hongli; Xie, Guozhu; Du, Shasha [Department of Radiation Oncology, Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong (China); Yang, Kaijun [Department of Neurosurgery, Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong (China); Yuan, Yawei, E-mail: yuanyawei2015@outlook.com [Department of Radiation Oncology, Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong (China); Department of Radiation Oncology, Cancer Hospital Center of Guangzhou Medical University, Guangzhou, Guangdong (China)
2016-11-15
Purpose: Although increasing evidence has shown that long noncoding RNAs play an important regulatory role in carcinogenesis and tumor progression, little is known about the role of small nucleolar RNA host gene 18 (SNHG18) in cancer. The goal of this study was to investigate the expression of SNHG18 and its clinical significance in glioma. Methods and Materials: Differences in the lncRNA expression profile between M059K and M059J cells were assessed by lncRNA expression microarray analysis. The expression and localization of SNHG18 in glioma cells or tissues was evaluated by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) and in situ hybridization (ISH), respectively. the clinical associations of SNHG18 in glioma was evaluated by qRT-PCR, ISH and immunohistochemistry. The role of SNHG18 in glioma radiosensitivity was evaluated by colony formation assays, immunofluorescence, Western blot and tumor growth inhibition study. Results: The present study investigated the clinical associations of SNHG18 and its role in glioma. Our results showed that the expression of SNHG18 was remarkably upregulated in clinical glioma tissues compared with normal brain tissues. SNHG18 expression was associated with the clinical tumor grade and correlated negatively with isocitrate dehydrogenase 1 mutation. In addition, knockdown of SNHG18 with short hairpin RNA suppressed the radioresistance of glioma cells, and transgenic expression of SNHG18 had the opposite effect. Furthermore, xenograft tumors grown from cells with SNHG18 deletion were more radiosensitive than tumors grown from control cells. Further studies revealed that SNHG18 promotes radioresistance by inhibiting semaphorin 5A and that inhibition of semaphorin 5A expression abrogated the radiosensitizing effect caused by SNHG18 deletion. Conclusions: Our findings provide new insights into the role of SNHG18 in glioma and suggest its potential as a target for glioma therapy.
International Nuclear Information System (INIS)
Zheng, Rong; Yao, Qiwei; Ren, Chen; Liu, Ying; Yang, Hongli; Xie, Guozhu; Du, Shasha; Yang, Kaijun; Yuan, Yawei
2016-01-01
Purpose: Although increasing evidence has shown that long noncoding RNAs play an important regulatory role in carcinogenesis and tumor progression, little is known about the role of small nucleolar RNA host gene 18 (SNHG18) in cancer. The goal of this study was to investigate the expression of SNHG18 and its clinical significance in glioma. Methods and Materials: Differences in the lncRNA expression profile between M059K and M059J cells were assessed by lncRNA expression microarray analysis. The expression and localization of SNHG18 in glioma cells or tissues was evaluated by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) and in situ hybridization (ISH), respectively. the clinical associations of SNHG18 in glioma was evaluated by qRT-PCR, ISH and immunohistochemistry. The role of SNHG18 in glioma radiosensitivity was evaluated by colony formation assays, immunofluorescence, Western blot and tumor growth inhibition study. Results: The present study investigated the clinical associations of SNHG18 and its role in glioma. Our results showed that the expression of SNHG18 was remarkably upregulated in clinical glioma tissues compared with normal brain tissues. SNHG18 expression was associated with the clinical tumor grade and correlated negatively with isocitrate dehydrogenase 1 mutation. In addition, knockdown of SNHG18 with short hairpin RNA suppressed the radioresistance of glioma cells, and transgenic expression of SNHG18 had the opposite effect. Furthermore, xenograft tumors grown from cells with SNHG18 deletion were more radiosensitive than tumors grown from control cells. Further studies revealed that SNHG18 promotes radioresistance by inhibiting semaphorin 5A and that inhibition of semaphorin 5A expression abrogated the radiosensitizing effect caused by SNHG18 deletion. Conclusions: Our findings provide new insights into the role of SNHG18 in glioma and suggest its potential as a target for glioma therapy.
Directory of Open Access Journals (Sweden)
Giulio Donati
2013-07-01
Full Text Available Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted.
Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George
2013-07-11
Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Li, Longhu; Haider, Husnain Kh.; Wang, Linlin; Lu, Gang
2012-01-01
We previously showed that treatment with tadalafil, a long-acting phosphodiesterase-5a (PDE5a) inhibitor, effectively prevented adverse left ventricular (LV) remodeling of the infarcted heart. We hypothesized that short-hairpin RNA (shRNA) therapy targeting PDE5a would simulate the effects of pharmacological intervention for treatment of postinfarction LV remodeling and dysfunction. Experimental model of myocardial infarction was developed in female mice by permanent ligation of left coronary artery. Immediately after that, an adenoviral vector encoding for shRNA sequence targeting PDE5a (Ad-shPDE5a) was injected intramyocardially, which specifically inhibited PDE5a in the heart. Four weeks later, Ad-shPDE5a treated mice showed significant mitigation of the left ventricle (LV) dilatation and dysfunction as indicated by smaller LV cavity and more preserved ejection fraction and fractional shortening. Infarction size and fibrosis were significantly reduced in Ad-shPDE5a-treated mice. Additionally, more salvaged cardiomyocytes, significantly reduced collagen contents, and higher blood vessel density were observed in Ad-shPDE5a-treated mice. The cytoprotective effects of Ad-shPDE5a were demonstrated in vitro in Ad-shPDE5a transfected cardiomyocytes cultured under oxygen glucose deprivation. Among downstream mediators of PDE5a signaling, cyclic GMP (cGMP) and cGMP-dependent protein kinase G (PKG) were activated with concomitant reduction in caspase-3 activity. However, no significant change in PKA and cAMP activities were observed in Ad-shPDE5a-treated hearts. Inhibition with shRNA improved cardiac remodeling and dysfunction by reducing infarction size and cardiac fibrosis and increased cGMP and PKG activity. These findings suggest that PDE5 inhibition with Ad-shPDE5a is a novel approach for treatment of myocardial infarction. PMID:22447941
Importance of a 5′ Stem-Loop for Longevity of papA mRNA in Escherichia coli
Bricker, Angela L.; Belasco, Joel G.
1999-01-01
High-level expression of the major pilus subunit (PapA) of uropathogenic strains of Escherichia coli results in part from the unusually long lifetime of the mRNA that encodes this protein. Here we report that the longevity of papA mRNA derives in large measure from the protection afforded by its 5′ untranslated region. This papA RNA segment can prolong the lifetime of an otherwise short-lived mRNA to which it is fused. In vivo alkylation studies indicate that, in its natural milieu, the papA ...
DEFF Research Database (Denmark)
Lubas, Michal Szymon; Damgaard, Christian Kroun; Tomecki, Rafal
2013-01-01
Turnover of mRNA in the cytoplasm of human cells is thought to be redundantly conducted by the monomeric 5'-3' exoribonuclease hXRN1 and the 3'-5' exoribonucleolytic RNA exosome complex. However, in addition to the exosome-associated 3'-5' exonucleases hDIS3 and hDIS3L, the human genome encodes...
Directory of Open Access Journals (Sweden)
Jonathan Krell
Full Text Available The growth arrest-specific transcript 5 gene (GAS5 encodes a long noncoding RNA (lncRNA and hosts a number of small nucleolar RNAs (snoRNAs that have recently been implicated in multiple cellular processes and cancer. Here, we investigate the relationship between DNA damage, p53, and the GAS5 snoRNAs to gain further insight into the potential role of this locus in cell survival and oncogenesis both in vivo and in vitro.We used quantitative techniques to analyse the effect of DNA damage on GAS5 snoRNA expression and to assess the relationship between p53 and the GAS5 snoRNAs in cancer cell lines and in normal, pre-malignant, and malignant human colorectal tissue and used biological techniques to suggest potential roles for these snoRNAs in the DNA damage response.GAS5-derived snoRNA expression was induced by DNA damage in a p53-dependent manner in colorectal cancer cell lines and their levels were not affected by DICER. Furthermore, p53 levels strongly correlated with GAS5-derived snoRNA expression in colorectal tissue.In aggregate, these data suggest that the GAS5-derived snoRNAs are under control of p53 and that they have an important role in mediating the p53 response to DNA damage, which may not relate to their function in the ribosome. We suggest that these snoRNAs are not processed by DICER to form smaller snoRNA-derived RNAs with microRNA (miRNA-like functions, but their precise role requires further evaluation. Furthermore, since GAS5 host snoRNAs are often used as endogenous controls in qPCR quantifications we show that their use as housekeeping genes in DNA damage experiments can lead to inaccurate results.
Directory of Open Access Journals (Sweden)
A Arshi
2016-06-01
Full Text Available Background & aim: Breast cancer entails 10% of all cancers in the world. Among all types of cancers, 30 percent of women are infected with breast cancer. Non-coding of long RNA (lncRNA is a new group of known genes in the human genome transcribed from large parts of the genome of eukaryotes and play an important role in the regulation of different biological processes. The aim of the present study was to compare the expression level of GAS5 lncRNA and NEAT1 in normal and neoplastic samples from breast cancer patients by RT-qPCR. Methods: In the present case-control study, 40 samples from patients with breast cancer tumor and 40 patients from non-tumor under the direct supervision of a pathologist specialist due to clinical presentation and laboratory findings were collected. After extracting DNA from normal and tumor tissues, cDNA synthesis method according to the protocol and RT-qPCR was performed by SYBR®Premix Ex TaqTM II kit. LncRNA expression levels of genes GAS5 and NEAT1 was calculated using ΔΔCT. Data were analyzed using t-test. Results: The results of Real Time Reverse transcription-PCR indicated that partial expression levels of GAS5 lncRNA gene in tumor samples compared to normal GAS5 lncRNA of the gene, decreasing the expression, and the mean relative expression levels of lncRNA and NEAT1 gene in tumor samples compared to normal was overexpressed. These variation gene expression of LncRNA related to GAS5 about 1.5 times and 2 times to lncRNA from NEAT1 gene was observed respectively. Conclusion: Due to the previous reports, these lncRNAs act as tumor suppressor in breast cancer and had differential expression in tumor and normal tissues, which could be used as biomarker for cancer diagnosis. Moreover, expression of these lncRNAs in different breast cancer subtypes and patient with other blood raises the importance of this molecules as a biomarker for cancer diagnosis and prognosis.
Does unpaired adenosine-66 from helix II of Escherichia coli 5S RNA bind to protein L18?
DEFF Research Database (Denmark)
Christiansen, J; Douthwaite, S R; Christensen, A
1985-01-01
Adenosine-66 is unpaired within helix II of Escherichia coli 5S RNA and lies in the binding site of ribosomal protein L18. It has been proposed as a recognition site for protein L18. We have investigated further the structural importance of this nucleotide by deleting it. The 5S RNA gene of the rrn...... plasmid derived from pKK3535. Binding studies with protein L18 revealed that the protein bound much more weakly to the mutated 5S RNA. We consider the most likely explanation of this result is that L18 interacts with adenosine-66, and we present a tentative model for an interaction between the unpaired...
Directory of Open Access Journals (Sweden)
Dorothee A Vogt
Full Text Available The nonstructural protein NS5A has emerged as a new drug target in antiviral therapies for Hepatitis C Virus (HCV infection. NS5A is critically involved in viral RNA replication that takes place at newly formed membranes within the endoplasmic reticulum (membranous web and assists viral assembly in the close vicinity of lipid droplets (LDs. To identify host proteins that interact with NS5A, we performed a yeast two-hybrid screen with the N-terminus of NS5A (amino acids 1-31, a well-studied α-helical domain important for the membrane tethering of NS5A. Our studies identified the LD-associated host protein, Tail-Interacting Protein 47 (TIP47 as a novel NS5A interaction partner. Coimmunoprecipitation experiments in Huh7 hepatoma cells confirmed the interaction of TIP47 with full-length NS5A. shRNA-mediated knockdown of TIP47 caused a more than 10-fold decrease in the propagation of full-length infectious HCV in Huh7.5 hepatoma cells. A similar reduction was observed when TIP47 was knocked down in cells harboring an autonomously replicating HCV RNA (subgenomic replicon, indicating that TIP47 is required for efficient HCV RNA replication. A single point mutation (W9A in NS5A that disrupts the interaction with TIP47 but preserves proper subcellular localization severely decreased HCV RNA replication. In biochemical membrane flotation assays, TIP47 cofractionated with HCV NS3, NS5A, NS5B proteins, and viral RNA, and together with nonstructural viral proteins was uniquely distributed to lower-density LD-rich membrane fractions in cells actively replicating HCV RNA. Collectively, our data support a model where TIP47--via its interaction with NS5A--serves as a novel cofactor for HCV infection possibly by integrating LD membranes into the membranous web.
Directory of Open Access Journals (Sweden)
Nathalie Taquet
2009-01-01
Full Text Available Crohn's disease (CD is a multifactorial chronic inflammatory bowel disease of unknown cause. The aim of the present study was to explore if mRNA over-expression of SSTR5 and CCR7 found in CD patients could be correlated to respective protein expression. When compared to healthy donors, SSTR5 was over-expressed 417 ± 71 times in CD peripheral blood mononuclear cells (PBMCs. Flow cytometry experiments showed no correlation between mRNA and protein expression for SSTR5 in PBMCs. In an attempt to find a reason of such a high mRNA expression, SSTR5 present on CD PBMCs were tested and found as biologically active as on healthy cells. In biopsies of CD intestinal tissue, SSTR5 was not over-expressed but CCR7, unchanged in PBMCs, was over-expressed by 10 ± 3 times in the lamina propria. Confocal microscopy showed a good correlation of CCR7 mRNA and protein expression in CD intestinal biopsies. Our data emphasize flow and image cytometry as impossible to circumvent in complement to molecular biology so to avoid false interpretation on receptor expressions. Once confirmed by further large-scale studies, our preliminary results suggest a role for SSTR5 and CCR7 in CD pathogenesis.
MicroRNA-1 promotes apoptosis of hepatocarcinoma cells by targeting apoptosis inhibitor-5 (API-5).
Li, Dong; Liu, Yu; Li, Hua; Peng, Jing-Jing; Tan, Yan; Zou, Qiang; Song, Xiao-Feng; Du, Min; Yang, Zheng-Hui; Tan, Yong; Zhou, Jin-Jun; Xu, Tao; Fu, Zeng-Qiang; Feng, Jian-Qiong; Cheng, Peng; chen, Tao; Wei, Dong; Su, Xiao-Mei; Liu, Huan-Yi; Qi, Zhong-Chun; Tang, Li-Jun; Wang, Tao; Guo, Xin; Hu, Yong-He; Zhang, Tao
2015-01-02
Although microRNA-1 (miR-1) is a known liver cancer suppressor, the role of miR-1 in apoptosis of hepatoma cells has remained largely unknown. Our study shows that ectopic miR-1 overexpression induced apoptosis of liver hepatocellular carcinoma (HepG2) cells. Apoptosis inhibitor 5 (API-5) was found to be a potential regulator of miR-1 induced apoptosis, using a bioinformatics approach. Furthermore, an inverse relationship between miR-1 and API-5 expression was observed in human liver cancer tissues and adjacent normal liver tissues. Negative regulation of API-5 expression by miR-1 was demonstrated to promote apoptosis of HepG2 cells. Our study provides a novel regulatory mechanism of miR-1 in the apoptosis of hepatoma cells. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Dmitry Bogolyubov
2007-06-01
Full Text Available In the present study we used 5-bromouridine 5'-triphosphate (BrUTP microinjections to localize the transcription sites in oocytes of insects with different types of the ovarium structure: panoistic, meroistic polytrophic, and meroistic telotrophic. We found that in an insect with panoistic ovaries (Acheta domesticus, oocyte nuclei maintain their transcription activity during the long period of oocyte growth. In insects with meroistic ovaries (Tenebrio molitor and Panorpa communis, early oocyte chromosomes were found to be transcriptionally active, and some transcription activity still persist while the karyosphere, a compact structure formed by all condensed oocyte chromosomes, begins to develop. At the latest stages of karyosphere development, no anti-Br-RNA signal was registered in the karyosphere.
Song, Jie; Li, Na; Xia, Yang; Gao, Zhong; Zou, Sa-Feng; Yan, Yu-Hui; Li, Shao-Heng; Wang, Yue; Meng, Ya-Kun; Yang, Jing-Xian; Kang, Ting-Guo
2016-09-01
Mechanical trauma injury is a severe insult to neural cells. Subsequent secondary injury involves the release of inflammatory factors that have dramatic consequences for undamaged cells, leading to normal cell death after the initial injury. The present study investigated the capacity for arctigenin (ARC) to prevent secondary effects and evaluated the mechanism underlying the action of microRNA (miRNA)-199a and miRNA-16 in a mechanical trauma injury (MTI) model using SH-SY5Y cells in vitro. SH-SY5Y cells are often applied to in vitro models of neuronal function and differentiation. Recently, miRNAs have been demonstrated to play a crucial role in NF-κB and cholinergic signaling, which can regulate inflammation. The cell model was established by scratch-induced injury of human SH-SY5Y cells, which mimics the characteristics of MTI. A cell counting kit-8 (CCK-8), terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL), and immunocytochemistry were used to measure cell viability. Enzyme-linked immunosorbent assay (ELISA) was used to evaluate the inflammatory cytokine and cholinesterase (CHE) content. The lactate dehydrogenase (LDH) content was measured to assess the degree of cell injury. The mRNA levels were measured by RT-PCR to analyze ARC's mechanism of action. miRNA inhibitors and mimics were used to inhibit and strengthen the expression of miRNAs. Protein expression was detected by western blotting analysis. ARC treatment reduced the TNF-α and IL-6 levels as well as the number of TUNEL+ apoptotic SH-SY5Y cells surrounding the scratch and increased the IL-10 level compared to the controls. ARC attenuated the increase of the cell damage degree and LDH content induced by scratching, indicating increased cell survival. Mechanistic studies showed that ARC upregulated the miRNA-16 and miRNA-199a levels to reduce upstream protein (IKKα and IKKβ) expression and inhibit NF-κB signaling pathway activity; moreover, the increased miRNA-199a suppresses