
Sample records for rna base pairs

  1. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs.

    Directory of Open Access Journals (Sweden)

    Michael F Sloma


    Full Text Available Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  2. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs. (United States)

    Sloma, Michael F; Mathews, David H


    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package.

  3. Non-Watson Crick base pairs might stabilize RNA structural motifs in ...

    Indian Academy of Sciences (India)

    Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...

  4. Visualizing RNA Secondary Structure Base Pair Binding Probabilities using Nested Concave Hulls


    Sansen , Joris; Bourqui , Romain; Thebault , Patricia; Allali , Julien; Auber , David


    International audience; The challenge 1 of the BIOVIS 2015 design contest consists in designing an intuitive visual depiction of base pairs binding probabilities for secondary structure of ncRNA. Our representation depicts the potential nucleotide pairs binding using nested concave hulls over the computed MFE ncRNA secondary structure. Thus, it allows to identify regions with a high level of uncertainty in the MFE computation and the structures which seem to match to reality.

  5. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit


    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  6. An atlas of RNA base pairs involving modified nucleobases with optimal geometries and accurate energies

    KAUST Repository

    Chawla, Mohit; Oliva, R.; Bujnicki, J. M.; Cavallo, Luigi


    Posttranscriptional modifications greatly enhance the chemical information of RNA molecules, contributing to explain the diversity of their structures and functions. A significant fraction of RNA experimental structures available to date present modified nucleobases, with half of them being involved in H-bonding interactions with other bases, i.e. ‘modified base pairs’. Herein we present a systematic investigation of modified base pairs, in the context of experimental RNA structures. To this end, we first compiled an atlas of experimentally observed modified base pairs, for which we recorded occurrences and structural context. Then, for each base pair, we selected a representative for subsequent quantum mechanics calculations, to find out its optimal geometry and interaction energy. Our structural analyses show that most of the modified base pairs are non Watson–Crick like and are involved in RNA tertiary structure motifs. In addition, quantum mechanics calculations quantify and provide a rationale for the impact of the different modifications on the geometry and stability of the base pairs they participate in.

  7. Base pairing and structural insights into the 5-formylcytosine in RNA duplex (United States)

    Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia


    Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978

  8. Site-Specific Incorporation of Functional Components into RNA by an Unnatural Base Pair Transcription System

    Directory of Open Access Journals (Sweden)

    Rie Kawai


    Full Text Available Toward the expansion of the genetic alphabet, an unnatural base pair between 7-(2-thienylimidazo[4,5-b]pyridine (Ds and pyrrole-2-carbaldehyde (Pa functions as a third base pair in replication and transcription, and provides a useful tool for the site-specific, enzymatic incorporation of functional components into nucleic acids. We have synthesized several modified-Pa substrates, such as alkylamino-, biotin-, TAMRA-, FAM-, and digoxigenin-linked PaTPs, and examined their transcription by T7 RNA polymerase using Ds-containing DNA templates with various sequences. The Pa substrates modified with relatively small functional groups, such as alkylamino and biotin, were efficiently incorporated into RNA transcripts at the internal positions, except for those less than 10 bases from the 3′-terminus. We found that the efficient incorporation into a position close to the 3′-terminus of a transcript depended on the natural base contexts neighboring the unnatural base, and that pyrimidine-Ds-pyrimidine sequences in templates were generally favorable, relative to purine-Ds-purine sequences. The unnatural base pair transcription system provides a method for the site-specific functionalization of large RNA molecules.

  9. Capturing alternative secondary structures of RNA by decomposition of base-pairing probabilities. (United States)

    Hagio, Taichi; Sakuraba, Shun; Iwakiri, Junichi; Mori, Ryota; Asai, Kiyoshi


    It is known that functional RNAs often switch their functions by forming different secondary structures. Popular tools for RNA secondary structures prediction, however, predict the single 'best' structures, and do not produce alternative structures. There are bioinformatics tools to predict suboptimal structures, but it is difficult to detect which alternative secondary structures are essential. We proposed a new computational method to detect essential alternative secondary structures from RNA sequences by decomposing the base-pairing probability matrix. The decomposition is calculated by a newly implemented software tool, RintW, which efficiently computes the base-pairing probability distributions over the Hamming distance from arbitrary reference secondary structures. The proposed approach has been demonstrated on ROSE element RNA thermometer sequence and Lysine RNA ribo-switch, showing that the proposed approach captures conformational changes in secondary structures. We have shown that alternative secondary structures are captured by decomposing base-paring probabilities over Hamming distance. Source code is available from .

  10. Principles of RNA base pairing: Structures and energies of cis and trans-Watson-Crick/Sugar Edge base pairs revealed by quantum chemical calculations

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří


    Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics

  11. Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides. (United States)

    Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu


    A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non

  12. RNA-PAIRS: RNA probabilistic assignment of imino resonance shifts

    International Nuclear Information System (INIS)

    Bahrami, Arash; Clos, Lawrence J.; Markley, John L.; Butcher, Samuel E.; Eghbalnia, Hamid R.


    The significant biological role of RNA has further highlighted the need for improving the accuracy, efficiency and the reach of methods for investigating RNA structure and function. Nuclear magnetic resonance (NMR) spectroscopy is vital to furthering the goals of RNA structural biology because of its distinctive capabilities. However, the dispersion pattern in the NMR spectra of RNA makes automated resonance assignment, a key step in NMR investigation of biomolecules, remarkably challenging. Herein we present RNA Probabilistic Assignment of Imino Resonance Shifts (RNA-PAIRS), a method for the automated assignment of RNA imino resonances with synchronized verification and correction of predicted secondary structure. RNA-PAIRS represents an advance in modeling the assignment paradigm because it seeds the probabilistic network for assignment with experimental NMR data, and predicted RNA secondary structure, simultaneously and from the start. Subsequently, RNA-PAIRS sets in motion a dynamic network that reverberates between predictions and experimental evidence in order to reconcile and rectify resonance assignments and secondary structure information. The procedure is halted when assignments and base-parings are deemed to be most consistent with observed crosspeaks. The current implementation of RNA-PAIRS uses an initial peak list derived from proton-nitrogen heteronuclear multiple quantum correlation ( 1 H– 15 N 2D HMQC) and proton–proton nuclear Overhauser enhancement spectroscopy ( 1 H– 1 H 2D NOESY) experiments. We have evaluated the performance of RNA-PAIRS by using it to analyze NMR datasets from 26 previously studied RNAs, including a 111-nucleotide complex. For moderately sized RNA molecules, and over a range of comparatively complex structural motifs, the average assignment accuracy exceeds 90%, while the average base pair prediction accuracy exceeded 93%. RNA-PAIRS yielded accurate assignments and base pairings consistent with imino resonances for a

  13. RNA-PAIRS: RNA probabilistic assignment of imino resonance shifts

    Energy Technology Data Exchange (ETDEWEB)

    Bahrami, Arash; Clos, Lawrence J.; Markley, John L.; Butcher, Samuel E. [National Magnetic Resonance Facility at Madison (United States); Eghbalnia, Hamid R., E-mail: [University of Cincinnati, Department of Molecular and Cellular Physiology (United States)


    The significant biological role of RNA has further highlighted the need for improving the accuracy, efficiency and the reach of methods for investigating RNA structure and function. Nuclear magnetic resonance (NMR) spectroscopy is vital to furthering the goals of RNA structural biology because of its distinctive capabilities. However, the dispersion pattern in the NMR spectra of RNA makes automated resonance assignment, a key step in NMR investigation of biomolecules, remarkably challenging. Herein we present RNA Probabilistic Assignment of Imino Resonance Shifts (RNA-PAIRS), a method for the automated assignment of RNA imino resonances with synchronized verification and correction of predicted secondary structure. RNA-PAIRS represents an advance in modeling the assignment paradigm because it seeds the probabilistic network for assignment with experimental NMR data, and predicted RNA secondary structure, simultaneously and from the start. Subsequently, RNA-PAIRS sets in motion a dynamic network that reverberates between predictions and experimental evidence in order to reconcile and rectify resonance assignments and secondary structure information. The procedure is halted when assignments and base-parings are deemed to be most consistent with observed crosspeaks. The current implementation of RNA-PAIRS uses an initial peak list derived from proton-nitrogen heteronuclear multiple quantum correlation ({sup 1}H-{sup 15}N 2D HMQC) and proton-proton nuclear Overhauser enhancement spectroscopy ({sup 1}H-{sup 1}H 2D NOESY) experiments. We have evaluated the performance of RNA-PAIRS by using it to analyze NMR datasets from 26 previously studied RNAs, including a 111-nucleotide complex. For moderately sized RNA molecules, and over a range of comparatively complex structural motifs, the average assignment accuracy exceeds 90%, while the average base pair prediction accuracy exceeded 93%. RNA-PAIRS yielded accurate assignments and base pairings consistent with imino

  14. Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

    International Nuclear Information System (INIS)

    Lee, K.M.; Marshall, A.G.


    Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's

  15. On the conformational stability of the smallest RNA kissing complexes maintained through two G·C base pairs

    International Nuclear Information System (INIS)

    Chu, Wally; Weerasekera, Akila; Kim, Chul-Hyun


    Two identical 5′GACG3′ tetra-loop motifs with different stem sequences (called H2 and H3) are found in the 5′ end region of Moloney Murine Leukemia Virus (MMLV) genomic RNA. They play important roles in RNA dimerization and encapsidation through two identical tetra-loops (5′GACG3′) forming a loop-to-loop kissing complex, the smallest RNA kissing complex ever found in nature. We examined the effects of a loop-closing base pair as well as a stem sequence on the conformational stability of the kissing complex. UV melting analysis and gel electrophoresis were performed on eight RNA sequences mimicking the H2 and H3 hairpin tetra-loops with variation in loop-closing base pairs. Our results show that changing the loop-closing base pair from the wildtype (5′A·U3′ for H3, 5′U·A3′ for H2) to 5′G·C3’/5′C·G3′ has significant effect on the stability of the kissing complexes: the substitution to 5′C·G3′ significantly decreases both thermal and mechanical stability, while switching to the 5′G·C3′ significantly increases the mechanical stability only. The kissing complexes with the wildtype loop-closing base pairs (5′A·U3′ for H3 and 5′U·A3′ for H2) show different stability when attached to a different stem sequence (H2 stem vs. H3 stem). This suggests that not only the loop-closing base pair itself, but also the stem sequence, affects the conformational stability of the RNA kissing complex. - Highlights: • Thermodynamic parameters of the smallest RNA kissing interactions were measured. • The effects of loop-closing base pairs on the RNA kissing complex was investigated. • Changing the base pair to 5′CG3′ decreases the stability of the kissing complex. • Changing it to 5′GC3′ increases the mechanical resilience of the kissing complex. • Difference in its stem sequence also affects the stability of the kissing complex.

  16. Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair. (United States)

    Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M


    RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

  17. Recent advances in mechanism-based chemotherapy drug-siRNA pairs in co-delivery systems for cancer: A review. (United States)

    Wang, Mingfang; Wang, Jinyu; Li, Bingcheng; Meng, Lingxin; Tian, Zhaoxing


    Co-delivery of chemotherapy drugs and siRNA for cancer therapy has achieved remarkable results according to synergistic/combined antitumor effects, and is recognized as a promising therapeutic modality. However, little attention has been paid to the extremely complex mechanisms of chemotherapy drug-siRNA pairs during co-delivery process. Proper selection of chemotherapy drug-siRNA pairs is beneficial for achieving desirable cancer therapeutic effects. Exploring the inherent principles during chemotherapy drug-siRNA pair selection for co-delivery would greatly enhanced therapeutic efficiency. To achieve ideal results, this article will systematically review current different mechanism-based chemotherapy drug-siRNA pairs for co-delivery in cancer treatment. Large-scale library screening of recent different chemotherapy drug-siRNA pairs for co-delivery would help to establish the chemotherapy drug-siRNA pair selection principle, which could pave the way for co-delivery of chemotherapy drugs and siRNA for cancer treatment in clinic. Following the inherent principle of chemotherapy drug-siRNA pair, more effective co-delivery vectors can be designed in the future. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. PASSion: a pattern growth algorithm-based pipeline for splice junction detection in paired-end RNA-Seq data. (United States)

    Zhang, Yanju; Lameijer, Eric-Wubbo; 't Hoen, Peter A C; Ning, Zemin; Slagboom, P Eline; Ye, Kai


    RNA-seq is a powerful technology for the study of transcriptome profiles that uses deep-sequencing technologies. Moreover, it may be used for cellular phenotyping and help establishing the etiology of diseases characterized by abnormal splicing patterns. In RNA-Seq, the exact nature of splicing events is buried in the reads that span exon-exon boundaries. The accurate and efficient mapping of these reads to the reference genome is a major challenge. We developed PASSion, a pattern growth algorithm-based pipeline for splice site detection in paired-end RNA-Seq reads. Comparing the performance of PASSion to three existing RNA-Seq analysis pipelines, TopHat, MapSplice and HMMSplicer, revealed that PASSion is competitive with these packages. Moreover, the performance of PASSion is not affected by read length and coverage. It performs better than the other three approaches when detecting junctions in highly abundant transcripts. PASSion has the ability to detect junctions that do not have known splicing motifs, which cannot be found by the other tools. Of the two public RNA-Seq datasets, PASSion predicted ≈ 137,000 and 173,000 splicing events, of which on average 82 are known junctions annotated in the Ensembl transcript database and 18% are novel. In addition, our package can discover differential and shared splicing patterns among multiple samples. The code and utilities can be freely downloaded from and

  19. High-Resolution Crystal Structure of a Silver(I)-RNA Hybrid Duplex Containing Watson-Crick-like C-Silver(I)-C Metallo-Base Pairs. (United States)

    Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira


    Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Spliceosomal small nuclear RNAs of Tetrahymena thermophila and some possible snRNA-snRNA base-pairing interactions

    DEFF Research Database (Denmark)

    Orum, H; Nielsen, Henrik; Engberg, J


    We have identified and characterized the full set of spliceosomal small nuclear RNAs (snRNAs; U1, U2, U4, U5 and U6) from the ciliated protozoan Tetrahymena thermophila. With the exception of U4 snRNA, the sizes of the T. thermophila snRNAs are closely similar to their metazoan homologues. The T....... thermophila snRNAs all have unique 5' ends, which start with an adenine residue. In contrast, with the exception of U6, their 3' ends show some size heterogeneity. The primary sequences of the T. thermophila snRNAs contain the sequence motifs shown, or proposed, to be of functional importance in other...

  1. Reference quantum chemical calculations on RNA base pairs directly involving the 2'-OH group of ribose

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Zgarbová, M.; Jurečka, Petr; Riley, K.E.; Šponer, Judit E.; Hobza, Pavel


    Roč. 5, č. 4 (2009), s. 1166-1179 ISSN 1549-9618 R&D Projects: GA AV ČR(CZ) IAA400040802; GA AV ČR(CZ) IAA400550701; GA MŠk(CZ) LC06030; GA MŠk(CZ) LC512 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702; CEZ:AV0Z40550506 Keywords : RNA * ribose * quantum calculations Subject RIV: BO - Biophysics Impact factor: 4.804, year: 2009

  2. Heterogeneity to Homogeneity: Synthesis, Base Pairing, and Ligation Studies of 4',3'-XyluloNA/RNA and TNA/RNA Chimeric Sequences (United States)

    Bhowmik, S.; Stoop, M.; Krishnamurthy, R.


    Based on the reality of "prebiotic clutter," we herein present an alternate model for pre-RNA to RNA transition, which starts, not with homogeneous-backbone system, but rather with mixtures of heterogeneous-backbone of chimeric "pre-RNA/RNA."

  3. A double base change in alternate base pairs induced by ultraviolet irradiation in a glycine transfer RNA gene

    International Nuclear Information System (INIS)

    Coleman, R.D.; Dunst, R.W.; Hill, C.W.; Pennsylvania State Univ., Hershey


    The glyUsusub(AGA) mutation affects Escherichia coli tRNAsup(Gly)sub(GGG), changing it to an AGA missense suppressor tRNA. Sequence studies have shown that the mutation involves a double base substitution at the first and third positions of the tRNA anticodon, the result being a change in the anticodon from CCC to UCU. A system has been developed to facilitate the detection of this novel mutation, and we have shown that ultraviolet irradiation and N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) are effective in causing the double base change. A single observation of the mutation occuring spontaneously has been made also. The frequency of MNNG-induced glyUsusub(AGA) mutations is compatible with their being caused by two separate mutagenic events. The frequency of UV-induced glyUsusub(AGA) mutations, however, strongly suggests that the occurence of one base substitution strongly enhances the chance of finding the second substitution at the alternate position. In addition to the double change in the anticodon, the glyUsusub(AGA) tRNA differs from tRNAsup(gly)sub(GGG) in that it bears a modification of the A adjacent to the 3' position of the anticodon. Most likely, this modified base is N-[9-(β-D-ribofuranosyl)-purin-6-ylcarbamoyl] threonine. (orig.) 891 AJ/orig. 892 BRE [de

  4. High-Resolution Nuclear Magnetic Resonance Determination of Transfer RNA Tertiary Base Pairs in Solution. 2. Species Containing a Large Variable Loop

    NARCIS (Netherlands)



    The number of base pairs in the solution structure of several class III D3VN tRNA species from E. coli has been determined by analyzing the number of low-field (-15 to -11 ppm) proton resonances in their nuclear magnetic resonance spectra at 360 MHz. Contrary to previous reports indicating the

  5. Electrostatics Explains the Position-Dependent Effect of G⋅U Wobble Base Pairs on the Affinity of RNA Kissing Complexes. (United States)

    Abi-Ghanem, Josephine; Rabin, Clémence; Porrini, Massimiliano; Dausse, Eric; Toulmé, Jean-Jacques; Gabelica, Valérie


    In the RNA realm, non-Watson-Crick base pairs are abundant and can affect both the RNA 3D structure and its function. Here, we investigated the formation of RNA kissing complexes in which the loop-loop interaction is modulated by non-Watson-Crick pairs. Mass spectrometry, surface plasmon resonance, and UV-melting experiments show that the G⋅U wobble base pair favors kissing complex formation only when placed at specific positions. We tried to rationalize this effect by molecular modeling, including molecular mechanics Poisson-Boltzmann surface area (MMPBSA) thermodynamics calculations and PBSA calculations of the electrostatic potential surfaces. Modeling reveals that the G⋅U stabilization is due to a specific electrostatic environment defined by the base pairs of the entire loop-loop region. The loop is not symmetric, and therefore the identity and position of each base pair matters. Predicting and visualizing the electrostatic environment created by a given sequence can help to design specific kissing complexes with high affinity, for potential therapeutic, nanotechnology or analytical applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Evolutionary Transitions of MicroRNA-Target Pairs

    KAUST Repository

    Nozawa, Masafumi; Fujimi, Mai; Iwamoto, Chie; Onizuka, Kanako; Fukuda, Nana; Ikeo, Kazuho; Gojobori, Takashi


    How newly generated microRNA (miRNA) genes are integrated into gene regulatory networks during evolution is fundamental in understanding the molecular and evolutionary bases of robustness and plasticity in gene regulation. A recent model proposed that after the birth of a miRNA, the miRNA is generally integrated into the network by decreasing the number of target genes during evolution. However, this decreasing model remains to be carefully examined by considering in vivo conditions. In this study, we therefore compared the number of target genes among miRNAs with different ages, combining experiments with bioinformatics predictions. First, we focused on three Drosophila miRNAs with different ages. As a result, we found that an older miRNA has a greater number of target genes than a younger miRNA, suggesting the increasing number of targets for each miRNA during evolution (increasing model). To further confirm our results, we also predicted all target genes for all miRNAs in D. melanogaster, considering co-expression of miRNAs and mRNAs in vivo. The results obtained also do not support the decreasing model but are reasonably consistent with the increasing model of miRNA-target pairs. Furthermore, our large-scale analyses of currently available experimental data of miRNA-target pairs also showed a weak but the same trend in humans. These results indicate that the current decreasing model of miRNA-target pairs should be reconsidered and the increasing model may be more appropriate to explain the evolutionary transitions of miRNA-target pairs in many organisms.

  7. Evolutionary Transitions of MicroRNA-Target Pairs

    KAUST Repository

    Nozawa, Masafumi


    How newly generated microRNA (miRNA) genes are integrated into gene regulatory networks during evolution is fundamental in understanding the molecular and evolutionary bases of robustness and plasticity in gene regulation. A recent model proposed that after the birth of a miRNA, the miRNA is generally integrated into the network by decreasing the number of target genes during evolution. However, this decreasing model remains to be carefully examined by considering in vivo conditions. In this study, we therefore compared the number of target genes among miRNAs with different ages, combining experiments with bioinformatics predictions. First, we focused on three Drosophila miRNAs with different ages. As a result, we found that an older miRNA has a greater number of target genes than a younger miRNA, suggesting the increasing number of targets for each miRNA during evolution (increasing model). To further confirm our results, we also predicted all target genes for all miRNAs in D. melanogaster, considering co-expression of miRNAs and mRNAs in vivo. The results obtained also do not support the decreasing model but are reasonably consistent with the increasing model of miRNA-target pairs. Furthermore, our large-scale analyses of currently available experimental data of miRNA-target pairs also showed a weak but the same trend in humans. These results indicate that the current decreasing model of miRNA-target pairs should be reconsidered and the increasing model may be more appropriate to explain the evolutionary transitions of miRNA-target pairs in many organisms.

  8. Novel base-pairing interactions at the tRNA wobble position crucial for accurate reading of the genetic code (United States)

    Rozov, Alexey; Demeshkina, Natalia; Khusainov, Iskander; Westhof, Eric; Yusupov, Marat; Yusupova, Gulnara


    Posttranscriptional modifications at the wobble position of transfer RNAs play a substantial role in deciphering the degenerate genetic code on the ribosome. The number and variety of modifications suggest different mechanisms of action during messenger RNA decoding, of which only a few were described so far. Here, on the basis of several 70S ribosome complex X-ray structures, we demonstrate how Escherichia coli tRNALysUUU with hypermodified 5-methylaminomethyl-2-thiouridine (mnm5s2U) at the wobble position discriminates between cognate codons AAA and AAG, and near-cognate stop codon UAA or isoleucine codon AUA, with which it forms pyrimidine-pyrimidine mismatches. We show that mnm5s2U forms an unusual pair with guanosine at the wobble position that expands general knowledge on the degeneracy of the genetic code and specifies a powerful role of tRNA modifications in translation. Our models consolidate the translational fidelity mechanism proposed previously where the steric complementarity and shape acceptance dominate the decoding mechanism.

  9. How Mg2+ ion and water network affect the stability and structure of non-Watson-Crick base pairs in E. coli loop E of 5S rRNA: a molecular dynamics and reference interaction site model (RISM) study. (United States)

    Shanker, Sudhanshu; Bandyopadhyay, Pradipta


    The non-Watson-Crick (non-WC) base pairs of Escherichia coli loop E of 5S rRNA are stabilized by Mg 2+ ions through water-mediated interaction. It is important to know the synergic role of Mg 2+ and the water network surrounding Mg 2+ in stabilizing the non-WC base pairs of RNA. For this purpose, free energy change of the system is calculated using molecular dynamics (MD) simulation as Mg 2+ is pulled from RNA, which causes disturbance of the water network. It was found that Mg 2+ remains hexahydrated unless it is close to or far from RNA. In the pentahydrated form, Mg 2+ interacts directly with RNA. Water network has been identified by two complimentary methods; MD followed by a density-based clustering algorithm and three-dimensional-reference interaction site model. These two methods gave similar results. Identification of water network around Mg 2+ and non-WC base pairs gives a clue to the strong effect of water network on the stability of this RNA. Based on sequence analysis of all Eubacteria 5s rRNA, we propose that hexahydrated Mg 2+ is an integral part of this RNA and geometry of base pairs surrounding it adjust to accommodate the [Formula: see text]. Overall the findings from this work can help in understanding the basis of the complex structure and stability of RNA with non-WC base pairs.

  10. The base pairing RNA Spot 42 participates in a multi-output feedforward loop to help enact catabolite repression in Escherichia coli (United States)

    Beisel, Chase L.; Storz, Gisela


    SUMMARY Bacteria selectively consume some carbon sources over others through a regulatory mechanism termed catabolite repression. Here, we show that the base pairing RNA Spot 42 plays a broad role in catabolite repression in Escherichia coli by directly repressing genes involved in central and secondary metabolism, redox balancing, and the consumption of diverse non-preferred carbon sources. Many of the genes repressed by Spot 42 are transcriptionally activated by the global regulator CRP. Since CRP represses Spot 42, these regulators participate in a specific regulatory circuit called a multi-output feedforward loop. We found that this loop can reduce leaky expression of target genes in the presence of glucose and can maintain repression of target genes under changing nutrient conditions. Our results suggest that base pairing RNAs in feedforward loops can help shape the steady-state levels and dynamics of gene expression. PMID:21292161

  11. Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA

    International Nuclear Information System (INIS)

    Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.


    3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids

  12. Theoretical analysis of noncanonical base pairing interactions in ...

    Indian Academy of Sciences (India)


    Noncanonical base pairs in RNA have strong structural and functional implications but are currently not considered ..... Full optimizations of the systems were also carried out using ... of the individual bases in the base pair through the equation.

  13. Identification of the base-pairing requirements for repression of hctA translation by the small RNA IhtA leads to the discovery of a new mRNA target in Chlamydia trachomatis.

    Directory of Open Access Journals (Sweden)

    Nicole A Grieshaber

    Full Text Available The non-coding small RNA, IhtA expressed by the obligate intracellular human pathogen Chlamydia trachomatis modulates the translation of HctA, a key protein involved in replicative to infectious cell type differentiation. Using a combination of bioinformatics and mutagenesis we sought to identify the base pairing requirement for functional repression of HctA protein expression, with an eye to applying our findings towards the identification of additional targets. IhtA is predicted to fold into a three stem:loop structure. We found that loop 1 occludes the initiation codon of hctA, while loop 2 and 3 are not required for function. This 7 nucleotide region forms G/C rich interactions surrounding the AUG of hctA. Two additional genes in the chlamydial genome, CTL0322 and CTL0097, contained some elements of the hctA:IhtA recognition sequence. The mRNA of both CTL0322and CTL0097 interacted with IhtA in vitro as measured by biolayer interferometry. However, using a CheZ reporter expression system, IhtA only inhibited the translation of CTL0322. The proposed IhtA recognition site in the CTL0322 message contains significant G/C base pairing on either side of the initiation codon while CTL0097 only contains G/C base pairing 3' to the AUG initiation codon. These data suggest that as the functional interacting region is only 6-7nt in length that full translation repression is dependent on the degree of G/C base pairing. Additionally our results indicate that IhtA may regulate multiple mRNAs involved in the chlamydial infectious cycle.

  14. High-resolution NMR studies of chimeric DNA-RNA-DNA duplexes, heteronomous base pairing, and continuous base stacking at junctions

    International Nuclear Information System (INIS)

    Chou, Shanho; Flynn, P.; Wang, A.; Reid, B.


    Two symmetrical DNA-RNA-DNA duplex chimeras, d(CGCG)r(AAUU)d(CGCG) (designated rAAUU) and d(CGCG)r(UAUA)d(CGCG) (designated rUAUA), and a nonsymmetrical chimeric duplex, d(CGTT)r(AUAA)d(TGCG)/d(CGCA)r(UUAU)d(AACG) (designated rAUAA), as well as their pure DNA analogues, containing dU instead of T, have been synthesized by solid-phase phosphoramidite methods and studied by high-resolution NMR techniques. The 1D imino proton NOE spectra of these d-r-d chimeras indicate normal Watson-Crick hydrogen bonding and base stacking at the junction region. Preliminary qualitative NOESY, COSY, and chemical shift data suggest that the internal RNA segment contains C3'-endo (A-type) sugar conformations except for the first RNA residues (position 5 and 17) following the 3' end of the DNA block, which, unlike the other six ribonucleotides, exhibit detectable H1'-H2' J coupling. The nucleosides of the two flanking DNA segments appear to adopt a fairly normal C2'-endo B-DNA conformation except at the junction with the RNA blocks (residues 4 and 16), where the last DNA residue appears to adopt an intermediate sugar conformation. The data indicate that A-type and B-type conformations can coexist in a single short continuous nucleic acid duplex, but these results differ somewhat from previous theoretical model studies

  15. Influence of nucleotide modifications at the C2' position on the Hoogsteen base-paired parallel-stranded duplex of poly(A) RNA. (United States)

    Copp, William; Denisov, Alexey Y; Xie, Jingwei; Noronha, Anne M; Liczner, Christopher; Safaee, Nozhat; Wilds, Christopher J; Gehring, Kalle


    Polyadenylate (poly(A)) has the ability to form a parallel duplex with Hoogsteen adenine:adenine base pairs at low pH or in the presence of ammonium ions. In order to evaluate the potential of this structural motif for nucleic acid-based nanodevices, we characterized the effects on duplex stability of substitutions of the ribose sugar with 2'-deoxyribose, 2'-O-methyl-ribose, 2'-deoxy-2'-fluoro-ribose, arabinose and 2'-deoxy-2'-fluoro-arabinose. Deoxyribose substitutions destabilized the poly(A) duplex both at low pH and in the presence of ammonium ions: no duplex formation could be detected with poly(A) DNA oligomers. Other sugar C2' modifications gave a variety of effects. Arabinose and 2'-deoxy-2'-fluoro-arabinose nucleotides strongly destabilized poly(A) duplex formation. In contrast, 2'-O-methyl and 2'-deoxy-2'-fluoro-ribo modifications were stabilizing either at pH 4 or in the presence of ammonium ions. The differential effect suggests they could be used to design molecules selectively responsive to pH or ammonium ions. To understand the destabilization by deoxyribose, we determined the structures of poly(A) duplexes with a single DNA residue by nuclear magnetic resonance spectroscopy and X-ray crystallography. The structures revealed minor structural perturbations suggesting that the combination of sugar pucker propensity, hydrogen bonding, pKa shifts and changes in hydration determine duplex stability. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Report on Pairing-based Cryptography. (United States)

    Moody, Dustin; Peralta, Rene; Perlner, Ray; Regenscheid, Andrew; Roginsky, Allen; Chen, Lily


    This report summarizes study results on pairing-based cryptography. The main purpose of the study is to form NIST's position on standardizing and recommending pairing-based cryptography schemes currently published in research literature and standardized in other standard bodies. The report reviews the mathematical background of pairings. This includes topics such as pairing-friendly elliptic curves and how to compute various pairings. It includes a brief introduction to existing identity-based encryption (IBE) schemes and other cryptographic schemes using pairing technology. The report provides a complete study of the current status of standard activities on pairing-based cryptographic schemes. It explores different application scenarios for pairing-based cryptography schemes. As an important aspect of adopting pairing-based schemes, the report also considers the challenges inherent in validation testing of cryptographic algorithms and modules. Based on the study, the report suggests an approach for including pairing-based cryptography schemes in the NIST cryptographic toolkit. The report also outlines several questions that will require further study if this approach is followed.

  17. Modulation of microRNA-mRNA Target Pairs by Human Papillomavirus 16 Oncoproteins

    Directory of Open Access Journals (Sweden)

    Mallory E. Harden


    Full Text Available The E6 and E7 proteins are the major oncogenic drivers encoded by high-risk human papillomaviruses (HPVs. While many aspects of the transforming activities of these proteins have been extensively studied, there are fewer studies that have investigated how HPV E6/E7 expression affects the expression of cellular noncoding RNAs. The goal of our study was to investigate HPV16 E6/E7 modulation of cellular microRNA (miR levels and to determine the potential consequences for cellular gene expression. We performed deep sequencing of small and large cellular RNAs in primary undifferentiated cultures of human foreskin keratinocytes (HFKs with stable expression of HPV16 E6/E7 or a control vector. After integration of the two data sets, we identified 51 differentially expressed cellular miRs associated with the modulation of 1,456 potential target mRNAs in HPV16 E6/E7-expressing HFKs. We discovered that the degree of differential miR expression in HFKs expressing HPV16 E6/E7 was not necessarily predictive of the number of corresponding mRNA targets or the potential impact on gene expression. Additional analyses of the identified miR-mRNA pairs suggest modulation of specific biological activities and biochemical pathways. Overall, our study supports the model that perturbation of cellular miR expression by HPV16 E6/E7 importantly contributes to the rewiring of cellular regulatory circuits by the high-risk HPV E6 and E7 proteins that contribute to oncogenic transformation.

  18. A genomically modified Escherichia coli strain carrying an orthogonal E. coli histidyl-tRNA synthetase•tRNAHis pair. (United States)

    Englert, Markus; Vargas-Rodriguez, Oscar; Reynolds, Noah M; Wang, Yane-Shih; Söll, Dieter; Umehara, Takuya


    Development of new aminoacyl-tRNA synthetase (aaRS)•tRNA pairs is central for incorporation of novel non-canonical amino acids (ncAAs) into proteins via genetic code expansion (GCE). The Escherichia coli and Caulobacter crescentus histidyl-tRNA synthetases (HisRS) evolved divergent mechanisms of tRNA His recognition that prevent their cross-reactivity. Although the E. coli HisRS•tRNA His pair is a good candidate for GCE, its use in C. crescentus is limited by the lack of established genetic selection methods and by the low transformation efficiency of C. crescentus. E. coli was genetically engineered to use a C. crescentus HisRS•tRNA His pair. Super-folder green fluorescent protein (sfGFP) and chloramphenicol acetyltransferase (CAT) were used as reporters for read-through assays. A library of 313 ncAAs coupled with the sfGFP reporter system was employed to investigate the specificity of E. coli HisRS in vivo. A genomically modified E. coli strain (named MEOV1) was created. MEVO1 requires an active C. crescentus HisRS•tRNA His pair for growth, and displays a similar doubling time as the parental E. coli strain. sfGFP- and CAT-based assays showed that the E. coli HisRS•tRNA His pair is orthogonal in MEOV1 cells. A mutation in the anticodon loop of E. coli tRNA His CUA elevated its suppression efficiency by 2-fold. The C. crescentus HisRS•tRNA His pair functionally complements an E. coli ΔhisS strain. The E. coli HisRS•tRNA His is orthogonal in MEOV1 cells. E. coli tRNA His CUA is an efficient amber suppressor in MEOV1. We developed a platform that allows protein engineering of E. coli HisRS that should facilitate GCE in E. coli. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Cytoplasmic Control of Sense-Antisense mRNA Pairs

    Directory of Open Access Journals (Sweden)

    Flore Sinturel


    Full Text Available Transcriptome analyses have revealed that convergent gene transcription can produce many 3′-overlapping mRNAs in diverse organisms. Few studies have examined the fate of 3′-complementary mRNAs in double-stranded RNA-dependent nuclear phenomena, and nothing is known about the cytoplasmic destiny of 3′-overlapping messengers or their impact on gene expression. Here, we demonstrate that the complementary tails of 3′-overlapping mRNAs can interact in the cytoplasm and promote post-transcriptional regulatory events including no-go decay (NGD in Saccharomyces cerevisiae. Genome-wide experiments confirm that these messenger-interacting mRNAs (mimRNAs form RNA duplexes in wild-type cells and thus have potential roles in modulating the mRNA levels of their convergent gene pattern under different growth conditions. We show that the post-transcriptional fate of hundreds of mimRNAs is controlled by Xrn1, revealing the extent to which this conserved 5′-3′ cytoplasmic exoribonuclease plays an unexpected but key role in the post-transcriptional control of convergent gene expression.

  20. Cytoplasmic Control of Sense-Antisense mRNA Pairs. (United States)

    Sinturel, Flore; Navickas, Albertas; Wery, Maxime; Descrimes, Marc; Morillon, Antonin; Torchet, Claire; Benard, Lionel


    Transcriptome analyses have revealed that convergent gene transcription can produce many 3'-overlapping mRNAs in diverse organisms. Few studies have examined the fate of 3'-complementary mRNAs in double-stranded RNA-dependent nuclear phenomena, and nothing is known about the cytoplasmic destiny of 3'-overlapping messengers or their impact on gene expression. Here, we demonstrate that the complementary tails of 3'-overlapping mRNAs can interact in the cytoplasm and promote post-transcriptional regulatory events including no-go decay (NGD) in Saccharomyces cerevisiae. Genome-wide experiments confirm that these messenger-interacting mRNAs (mimRNAs) form RNA duplexes in wild-type cells and thus have potential roles in modulating the mRNA levels of their convergent gene pattern under different growth conditions. We show that the post-transcriptional fate of hundreds of mimRNAs is controlled by Xrn1, revealing the extent to which this conserved 5'-3' cytoplasmic exoribonuclease plays an unexpected but key role in the post-transcriptional control of convergent gene expression. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Radical-pair based avian magnetoreception (United States)

    Procopio, Maria; Ritz, Thorsten


    Behavioural experiments suggest that migratory birds possess a magnetic compass sensor able to detect the direction of the geomagnetic. One hypothesis for the basis of this remarkable sensory ability is that the coherent quantum spin dynamics of photoinduced radical pair reactions transduces directional magnetic information from the geomagnetic field into changes of reaction yields, possibly involving the photoreceptor cryptochrome in the birds retina. The suggested radical-pair based avian magnetoreception has attracted attention in the field of quantum biology as an example of a biological sensor which might exploit quantum coherences for its biological function. Investigations on such a spin-based sensor have focussed on uncovering the design features for the design of a biomimetic magnetic field sensor. We study the effects of slow fluctuations in the nuclear spin environment on the directional signal. We quantitatively evaluate the robustness of signals under fluctuations on a timescale longer than the lifetime of a radical pair, utilizing two models of radical pairs. Our results suggest design principles for building a radical-pair based compass sensor that is both robust and highly directional sensitive.

  2. Unnatural base pair systems toward the expansion of the genetic alphabet in the central dogma. (United States)

    Hirao, Ichiro; Kimoto, Michiko


    Toward the expansion of the genetic alphabet of DNA, several artificial third base pairs (unnatural base pairs) have been created. Synthetic DNAs containing the unnatural base pairs can be amplified faithfully by PCR, along with the natural A-T and G-C pairs, and transcribed into RNA. The unnatural base pair systems now have high potential to open the door to next generation biotechnology. The creation of unnatural base pairs is a consequence of repeating "proof of concept" experiments. In the process, initially designed base pairs were modified to address their weak points. Some of them were artificially evolved to ones with higher efficiency and selectivity in polymerase reactions, while others were eliminated from the analysis. Here, we describe the process of unnatural base pair development, as well as the tests of their applications.

  3. A novel pseudo-complementary PNA G-C base pair

    DEFF Research Database (Denmark)

    Olsen, Anne G.; Dahl, Otto; Petersen, Asger Bjørn


    Pseudo-complementary oligonucleotide analogues and mimics provide novel opportunities for targeting duplex structures in RNA and DNA. Previously, a pseudo-complementary A-T base pair has been introduced. Towards sequence unrestricted targeting, a pseudo-complementary G-C base pair consisting...

  4. Elucidating the 16S rRNA 3' boundaries and defining optimal SD/aSD pairing in Escherichia coli and Bacillus subtilis using RNA-Seq data. (United States)

    Wei, Yulong; Silke, Jordan R; Xia, Xuhua


    Bacterial translation initiation is influenced by base pairing between the Shine-Dalgarno (SD) sequence in the 5' UTR of mRNA and the anti-SD (aSD) sequence at the free 3' end of the 16S rRNA (3' TAIL) due to: 1) the SD/aSD sequence binding location and 2) SD/aSD binding affinity. In order to understand what makes an SD/aSD interaction optimal, we must define: 1) terminus of the 3' TAIL and 2) extent of the core aSD sequence within the 3' TAIL. Our approach to characterize these components in Escherichia coli and Bacillus subtilis involves 1) mapping the 3' boundary of the mature 16S rRNA using high-throughput RNA sequencing (RNA-Seq), and 2) identifying the segment within the 3' TAIL that is strongly preferred in SD/aSD pairing. Using RNA-Seq data, we resolve previous discrepancies in the reported 3' TAIL in B. subtilis and recovered the established 3' TAIL in E. coli. Furthermore, we extend previous studies to suggest that both highly and lowly expressed genes favor SD sequences with intermediate binding affinity, but this trend is exclusive to SD sequences that complement the core aSD sequences defined herein.

  5. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs. (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko


    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  6. Signature scheme based on bilinear pairs (United States)

    Tong, Rui Y.; Geng, Yong J.


    An identity-based signature scheme is proposed by using bilinear pairs technology. The scheme uses user's identity information as public key such as email address, IP address, telephone number so that it erases the cost of forming and managing public key infrastructure and avoids the problem of user private generating center generating forgery signature by using CL-PKC framework to generate user's private key.

  7. DincRNA: a comprehensive web-based bioinformatics toolkit for exploring disease associations and ncRNA function. (United States)

    Cheng, Liang; Hu, Yang; Sun, Jie; Zhou, Meng; Jiang, Qinghua


    DincRNA aims to provide a comprehensive web-based bioinformatics toolkit to elucidate the entangled relationships among diseases and non-coding RNAs (ncRNAs) from the perspective of disease similarity. The quantitative way to illustrate relationships of pair-wise diseases always depends on their molecular mechanisms, and structures of the directed acyclic graph of Disease Ontology (DO). Corresponding methods for calculating similarity of pair-wise diseases involve Resnik's, Lin's, Wang's, PSB and SemFunSim methods. Recently, disease similarity was validated suitable for calculating functional similarities of ncRNAs and prioritizing ncRNA-disease pairs, and it has been widely applied for predicting the ncRNA function due to the limited biological knowledge from wet lab experiments of these RNAs. For this purpose, a large number of algorithms and priori knowledge need to be integrated. e.g. 'pair-wise best, pairs-average' (PBPA) and 'pair-wise all, pairs-maximum' (PAPM) methods for calculating functional similarities of ncRNAs, and random walk with restart (RWR) method for prioritizing ncRNA-disease pairs. To facilitate the exploration of disease associations and ncRNA function, DincRNA implemented all of the above eight algorithms based on DO and disease-related genes. Currently, it provides the function to query disease similarity scores, miRNA and lncRNA functional similarity scores, and the prioritization scores of lncRNA-disease and miRNA-disease pairs. or Supplementary data are available at Bioinformatics online.

  8. Comparison of microarray platforms for measuring differential microRNA expression in paired normal/cancer colon tissues.

    Directory of Open Access Journals (Sweden)

    Maurizio Callari

    Full Text Available BACKGROUND: Microarray technology applied to microRNA (miRNA profiling is a promising tool in many research fields; nevertheless, independent studies characterizing the same pathology have often reported poorly overlapping results. miRNA analysis methods have only recently been systematically compared but only in few cases using clinical samples. METHODOLOGY/PRINCIPAL FINDINGS: We investigated the inter-platform reproducibility of four miRNA microarray platforms (Agilent, Exiqon, Illumina, and Miltenyi, comparing nine paired tumor/normal colon tissues. The most concordant and selected discordant miRNAs were further studied by quantitative RT-PCR. Globally, a poor overlap among differentially expressed miRNAs identified by each platform was found. Nevertheless, for eight miRNAs high agreement in differential expression among the four platforms and comparability to qRT-PCR was observed. Furthermore, most of the miRNA sets identified by each platform are coherently enriched in data from the other platforms and the great majority of colon cancer associated miRNA sets derived from the literature were validated in our data, independently from the platform. Computational integration of miRNA and gene expression profiles suggested that anti-correlated predicted target genes of differentially expressed miRNAs are commonly enriched in cancer-related pathways and in genes involved in glycolysis and nutrient transport. CONCLUSIONS: Technical and analytical challenges in measuring miRNAs still remain and further research is required in order to increase consistency between different microarray-based methodologies. However, a better inter-platform agreement was found by looking at miRNA sets instead of single miRNAs and through a miRNAs - gene expression integration approach.

  9. Inferring microRNA regulation of mRNA with partially ordered samples of paired expression data and exogenous prediction algorithms.

    Directory of Open Access Journals (Sweden)

    Brian Godsey

    Full Text Available MicroRNAs (miRs are known to play an important role in mRNA regulation, often by binding to complementary sequences in "target" mRNAs. Recently, several methods have been developed by which existing sequence-based target predictions can be combined with miR and mRNA expression data to infer true miR-mRNA targeting relationships. It has been shown that the combination of these two approaches gives more reliable results than either by itself. While a few such algorithms give excellent results, none fully addresses expression data sets with a natural ordering of the samples. If the samples in an experiment can be ordered or partially ordered by their expected similarity to one another, such as for time-series or studies of development processes, stages, or types, (e.g. cell type, disease, growth, aging, there are unique opportunities to infer miR-mRNA interactions that may be specific to the underlying processes, and existing methods do not exploit this. We propose an algorithm which specifically addresses [partially] ordered expression data and takes advantage of sample similarities based on the ordering structure. This is done within a Bayesian framework which specifies posterior distributions and therefore statistical significance for each model parameter and latent variable. We apply our model to a previously published expression data set of paired miR and mRNA arrays in five partially ordered conditions, with biological replicates, related to multiple myeloma, and we show how considering potential orderings can improve the inference of miR-mRNA interactions, as measured by existing knowledge about the involved transcripts.

  10. Integration analysis of microRNA and mRNA paired expression profiling identifies deregulated microRNA-transcription factor-gene regulatory networks in ovarian endometriosis. (United States)

    Zhao, Luyang; Gu, Chenglei; Ye, Mingxia; Zhang, Zhe; Li, Li'an; Fan, Wensheng; Meng, Yuanguang


    The etiology and pathophysiology of endometriosis remain unclear. Accumulating evidence suggests that aberrant microRNA (miRNA) and transcription factor (TF) expression may be involved in the pathogenesis and development of endometriosis. This study therefore aims to survey the key miRNAs, TFs and genes and further understand the mechanism of endometriosis. Paired expression profiling of miRNA and mRNA in ectopic endometria compared with eutopic endometria were determined by high-throughput sequencing techniques in eight patients with ovarian endometriosis. Binary interactions and circuits among the miRNAs, TFs, and corresponding genes were identified by the Pearson correlation coefficients. miRNA-TF-gene regulatory networks were constructed using bioinformatic methods. Eleven selected miRNAs and TFs were validated by quantitative reverse transcription-polymerase chain reaction in 22 patients. Overall, 107 differentially expressed miRNAs and 6112 differentially expressed mRNAs were identified by comparing the sequencing of the ectopic endometrium group and the eutopic endometrium group. The miRNA-TF-gene regulatory network consists of 22 miRNAs, 12 TFs and 430 corresponding genes. Specifically, some key regulators from the miR-449 and miR-34b/c cluster, miR-200 family, miR-106a-363 cluster, miR-182/183, FOX family, GATA family, and E2F family as well as CEBPA, SOX9 and HNF4A were suggested to play vital regulatory roles in the pathogenesis of endometriosis. Integration analysis of the miRNA and mRNA expression profiles presents a unique insight into the regulatory network of this enigmatic disorder and possibly provides clues regarding replacement therapy for endometriosis.

  11. Nonsense and sense suppression abilities of original and derivative Methanosarcina mazei pyrrolysyl-tRNA synthetase-tRNA(Pyl pairs in the Escherichia coli BL21(DE3 cell strain.

    Directory of Open Access Journals (Sweden)

    Keturah A Odoi

    Full Text Available Systematic studies of nonsense and sense suppression of the original and three derivative Methanosarcina mazei PylRS-tRNA(Pyl pairs and cross recognition between nonsense codons and various tRNA(Pyl anticodons in the Escherichia coli BL21(DE3 cell strain are reported. tRNA(CUA(Pyl is orthogonal in E. coli and able to induce strong amber suppression when it is co-expressed with pyrrolysyl-tRNA synthetase (PylRS and charged with a PylRS substrate, N(ε-tert-butoxycarbonyl-L-lysine (BocK. Similar to tRNA(CUA(Pyl, tRNA(UUA(Pyl is also orthogonal in E. coli and can be coupled with PylRS to genetically incorporate BocK at an ochre mutation site. Although tRNA(UUA(Pyl is expected to recognize a UAG codon based on the wobble hypothesis, the PylRS-tRNA(UUA(Pyl pair does not give rise to amber suppression that surpasses the basal amber suppression level in E. coli. E. coli itself displays a relatively high opal suppression level and tryptophan (Trp is incorporated at an opal mutation site. Although the PylRS-tRNA(UCA(Pyl pair can be used to encode BocK at an opal codon, the pair fails to suppress the incorporation of Trp at the same site. tRNA(CCU(Pyl fails to deliver BocK at an AGG codon when co-expressed with PylRS in E. coli.

  12. antaRNA: ant colony-based RNA sequence design. (United States)

    Kleinkauf, Robert; Mann, Martin; Backofen, Rolf


    RNA sequence design is studied at least as long as the classical folding problem. Although for the latter the functional fold of an RNA molecule is to be found ,: inverse folding tries to identify RNA sequences that fold into a function-specific target structure. In combination with RNA-based biotechnology and synthetic biology ,: reliable RNA sequence design becomes a crucial step to generate novel biochemical components. In this article ,: the computational tool antaRNA is presented. It is capable of compiling RNA sequences for a given structure that comply in addition with an adjustable full range objective GC-content distribution ,: specific sequence constraints and additional fuzzy structure constraints. antaRNA applies ant colony optimization meta-heuristics and its superior performance is shown on a biological datasets. CONTACT: Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

  13. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark


    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  14. A rule of seven in Watson-Crick base-pairing of mismatched sequences. (United States)

    Cisse, Ibrahim I; Kim, Hajin; Ha, Taekjip


    Sequence recognition through base-pairing is essential for DNA repair and gene regulation, but the basic rules governing this process remain elusive. In particular, the kinetics of annealing between two imperfectly matched strands is not well characterized, despite its potential importance in nucleic acid-based biotechnologies and gene silencing. Here we use single-molecule fluorescence to visualize the multiple annealing and melting reactions of two untethered strands inside a porous vesicle, allowing us to precisely quantify the annealing and melting rates. The data as a function of mismatch position suggest that seven contiguous base pairs are needed for rapid annealing of DNA and RNA. This phenomenological rule of seven may underlie the requirement for seven nucleotides of complementarity to seed gene silencing by small noncoding RNA and may help guide performance improvement in DNA- and RNA-based bio- and nanotechnologies, in which off-target effects can be detrimental.

  15. Feature-Based and String-Based Models for Predicting RNA-Protein Interaction

    Directory of Open Access Journals (Sweden)

    Donald Adjeroh


    Full Text Available In this work, we study two approaches for the problem of RNA-Protein Interaction (RPI. In the first approach, we use a feature-based technique by combining extracted features from both sequences and secondary structures. The feature-based approach enhanced the prediction accuracy as it included much more available information about the RNA-protein pairs. In the second approach, we apply search algorithms and data structures to extract effective string patterns for prediction of RPI, using both sequence information (protein and RNA sequences, and structure information (protein and RNA secondary structures. This led to different string-based models for predicting interacting RNA-protein pairs. We show results that demonstrate the effectiveness of the proposed approaches, including comparative results against leading state-of-the-art methods.

  16. AT Base Pair Anions vs. (9-methyl-A)(1-methyl-T) Base Pair Anions

    International Nuclear Information System (INIS)

    Radisic, Dunja; Bowen, Kit H.; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej S.


    The anionic base pairs of adenine and thymine, (AT)-, and 9-methyladenine and 1-methylthymine, (MAMT)-, have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)- found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration that was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)- was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)- and a resulting (MAMT)- configuration that wa s either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)- occurred at a completely different electron binding energy than had (AT)-. Moreover, the VDE value of (MAMT)- was in agreement with that predicted by theory. The configuration of (MAMT)- and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced damage, BFPT in the WC/HS configurations of (AT)- is not feasible

  17. AT base pair anions versus (9-methyl-A)(1-methyl-T) base pair anions. (United States)

    Radisic, Dunja; Bowen, Kit H; Dabkowska, Iwona; Storoniak, Piotr; Rak, Janusz; Gutowski, Maciej


    The anionic base pairs of adenine and thymine, (AT)(-), and 9-methyladenine and 1-methylthymine, (MAMT)(-), have been investigated both theoretically and experimentally in a complementary, synergistic study. Calculations on (AT)(-) found that it had undergone a barrier-free proton transfer (BFPT) similar to that seen in other dimer anion systems and that its structural configuration was neither Watson-Crick (WC) nor Hoogsteen (HS). The vertical detachment energy (VDE) of (AT)(-) was determined by anion photoelectron spectroscopy and found to be in agreement with the VDE value predicted by theory for the BFPT mechanism. An AT pair in DNA is structurally immobilized into the WC configuration, in part, by being bonded to the sugars of the double helix. This circumstance was mimicked by methylating the sites on both A and T where these sugars would have been tied, viz., 9-methyladenine and 1-methylthymine. Calculations found no BFPT in (MAMT)(-) and a resulting (MAMT)(-) configuration that was either HS or WC, with the configurations differing in stability by ca. 2 kcal/mol. The photoelectron spectrum of (MAMT)(-) occurred at a completely different electron binding energy than had (AT)(-). Moreover, the VDE value of (MAMT)(-) was in agreement with that predicted by theory. The configuration of (MAMT)(-) and its lack of electron-induced proton transfer are inter-related. While there may be other pathways for electron-induced DNA alterations, BFPT in the WC/HS configurations of (AT)(-) is not feasible.

  18. A path-based measurement for human miRNA functional similarities using miRNA-disease associations (United States)

    Ding, Pingjian; Luo, Jiawei; Xiao, Qiu; Chen, Xiangtao


    Compared with the sequence and expression similarity, miRNA functional similarity is so important for biology researches and many applications such as miRNA clustering, miRNA function prediction, miRNA synergism identification and disease miRNA prioritization. However, the existing methods always utilized the predicted miRNA target which has high false positive and false negative to calculate the miRNA functional similarity. Meanwhile, it is difficult to achieve high reliability of miRNA functional similarity with miRNA-disease associations. Therefore, it is increasingly needed to improve the measurement of miRNA functional similarity. In this study, we develop a novel path-based calculation method of miRNA functional similarity based on miRNA-disease associations, called MFSP. Compared with other methods, our method obtains higher average functional similarity of intra-family and intra-cluster selected groups. Meanwhile, the lower average functional similarity of inter-family and inter-cluster miRNA pair is obtained. In addition, the smaller p-value is achieved, while applying Wilcoxon rank-sum test and Kruskal-Wallis test to different miRNA groups. The relationship between miRNA functional similarity and other information sources is exhibited. Furthermore, the constructed miRNA functional network based on MFSP is a scale-free and small-world network. Moreover, the higher AUC for miRNA-disease prediction indicates the ability of MFSP uncovering miRNA functional similarity.

  19. Unveiling clusters of RNA transcript pairs associated with markers of Alzheimer's disease progression.

    Directory of Open Access Journals (Sweden)

    Ahmed Shamsul Arefin

    Full Text Available BACKGROUND: One primary goal of transcriptomic studies is identifying gene expression patterns correlating with disease progression. This is usually achieved by considering transcripts that independently pass an arbitrary threshold (e.g. p<0.05. In diseases involving severe perturbations of multiple molecular systems, such as Alzheimer's disease (AD, this univariate approach often results in a large list of seemingly unrelated transcripts. We utilised a powerful multivariate clustering approach to identify clusters of RNA biomarkers strongly associated with markers of AD progression. We discuss the value of considering pairs of transcripts which, in contrast to individual transcripts, helps avoid natural human transcriptome variation that can overshadow disease-related changes. METHODOLOGY/PRINCIPAL FINDINGS: We re-analysed a dataset of hippocampal transcript levels in nine controls and 22 patients with varying degrees of AD. A large-scale clustering approach determined groups of transcript probe sets that correlate strongly with measures of AD progression, including both clinical and neuropathological measures and quantifiers of the characteristic transcriptome shift from control to severe AD. This enabled identification of restricted groups of highly correlated probe sets from an initial list of 1,372 previously published by our group. We repeated this analysis on an expanded dataset that included all pair-wise combinations of the 1,372 probe sets. As clustering of this massive dataset is unfeasible using standard computational tools, we adapted and re-implemented a clustering algorithm that uses external memory algorithmic approach. This identified various pairs that strongly correlated with markers of AD progression and highlighted important biological pathways potentially involved in AD pathogenesis. CONCLUSIONS/SIGNIFICANCE: Our analyses demonstrate that, although there exists a relatively large molecular signature of AD progression, only

  20. Optimized paired-sgRNA/Cas9 cloning and expression cassette triggers high-efficiency multiplex genome editing in kiwifruit. (United States)

    Wang, Zupeng; Wang, Shuaibin; Li, Dawei; Zhang, Qiong; Li, Li; Zhong, Caihong; Liu, Yifei; Huang, Hongwen


    Kiwifruit is an important fruit crop; however, technologies for its functional genomic and molecular improvement are limited. The clustered regulatory interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) system has been successfully applied to genetic improvement in many crops, but its editing capability is variable depending on the different combinations of the synthetic guide RNA (sgRNA) and Cas9 protein expression devices. Optimizing conditions for its use within a particular species is therefore needed to achieve highly efficient genome editing. In this study, we developed a new cloning strategy for generating paired-sgRNA/Cas9 vectors containing four sgRNAs targeting the kiwifruit phytoene desaturase gene (AcPDS). Comparing to the previous method of paired-sgRNA cloning, our strategy only requires the synthesis of two gRNA-containing primers which largely reduces the cost. We further compared efficiencies of paired-sgRNA/Cas9 vectors containing different sgRNA expression devices, including both the polycistronic tRNA-sgRNA cassette (PTG) and the traditional CRISPR expression cassette. We found the mutagenesis frequency of the PTG/Cas9 system was 10-fold higher than that of the CRISPR/Cas9 system, coinciding with the relative expressions of sgRNAs in two different expression cassettes. In particular, we identified large chromosomal fragment deletions induced by the paired-sgRNAs of the PTG/Cas9 system. Finally, as expected, we found both systems can successfully induce the albino phenotype of kiwifruit plantlets regenerated from the G418-resistance callus lines. We conclude that the PTG/Cas9 system is a more powerful system than the traditional CRISPR/Cas9 system for kiwifruit genome editing, which provides valuable clues for optimizing CRISPR/Cas9 editing system in other plants. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons

  1. Cross disease analysis of co-functional microRNA pairs on a reconstructed network of disease-gene-microRNA tripartite. (United States)

    Peng, Hui; Lan, Chaowang; Zheng, Yi; Hutvagner, Gyorgy; Tao, Dacheng; Li, Jinyan


    MicroRNAs always function cooperatively in their regulation of gene expression. Dysfunctions of these co-functional microRNAs can play significant roles in disease development. We are interested in those multi-disease associated co-functional microRNAs that regulate their common dysfunctional target genes cooperatively in the development of multiple diseases. The research is potentially useful for human disease studies at the transcriptional level and for the study of multi-purpose microRNA therapeutics. We designed a computational method to detect multi-disease associated co-functional microRNA pairs and conducted cross disease analysis on a reconstructed disease-gene-microRNA (DGR) tripartite network. The construction of the DGR tripartite network is by the integration of newly predicted disease-microRNA associations with those relationships of diseases, microRNAs and genes maintained by existing databases. The prediction method uses a set of reliable negative samples of disease-microRNA association and a pre-computed kernel matrix instead of kernel functions. From this reconstructed DGR tripartite network, multi-disease associated co-functional microRNA pairs are detected together with their common dysfunctional target genes and ranked by a novel scoring method. We also conducted proof-of-concept case studies on cancer-related co-functional microRNA pairs as well as on non-cancer disease-related microRNA pairs. With the prioritization of the co-functional microRNAs that relate to a series of diseases, we found that the co-function phenomenon is not unusual. We also confirmed that the regulation of the microRNAs for the development of cancers is more complex and have more unique properties than those of non-cancer diseases.

  2. Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs (United States)

    Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.


    We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

  3. Theoretical study of GC+/GC base pair derivatives

    International Nuclear Information System (INIS)

    Meng Fancui; Wang Huanjie; Xu Weiren; Liu Chengbu


    The geometries of R (R=CH 3 , CH 3 O, F, NO 2 ) substituted GC base pair derivatives and their cations have been optimized at B3LYP/6-31G* level and the substituent effects on the neutral and cationic geometric structures and energies have been discussed. The inner reorganization energies of various base pair derivatives and the native GC base pair have been calculated to discuss the substituent effects on the reorganization energy. NBO (natural bond orbital) analysis has been carried out on both the neutral and the cationic systems to investigate the differences of the charge distributions and the electronic structures. The outcomes indicate that 8-CH 3 O-G:C has the greatest reorganization energy and 8-NO 2 -G:C has the least, while the other substituted base pairs have a reorganization energy close to that of G:C. The one charge is mostly localized on guanine part after ionization and as high as 0.95e. The bond distances of N1-N3'andN2-O2' in the cationic base pair derivatives shortened and that of O6-N4' elongated as compared with the corresponding bond distances of the neutral GC base pair derivatives

  4. Ensemble-based prediction of RNA secondary structures. (United States)

    Aghaeepour, Nima; Hoos, Holger H


    false negative and false positive base pair predictions. Finally, AveRNA can make use of arbitrary sets of secondary structure prediction procedures and can therefore be used to leverage improvements in prediction accuracy offered by algorithms and energy models developed in the future. Our data, MATLAB software and a web-based version of AveRNA are publicly available at

  5. Learning preferences from paired opposite-based semantics

    DEFF Research Database (Denmark)

    Franco de los Ríos, Camilo; Rodríguez, J. Tinguaro; Montero, Javier


    Preference semantics examine the meaning of the preference predicate, according to the way that alternatives can be understood and organized for decision making purposes. Through opposite-based semantics, preference structures can be characterized by their paired decomposition of preference...... on the character of opposition, the compound meaning of preference emerges from the fuzzy reinforcement of paired opposite concepts, searching for significant evidence for affirming dominance among the decision objects. Here we propose a general model for the paired decomposition of preference, examining its...

  6. RNA-based therapies for genodermatoses

    NARCIS (Netherlands)

    Bornert, Olivier; Peking, Patricia; Bremer, Jeroen; Koller, Ulrich; van den Akker, Peter C.; Aartsma-Rus, Annemieke; Pasmooij, Anna M. G.; Murauer, Eva M.; Nystroem, Alexander

    Genetic disorders affecting the skin, genodermatoses, constitute a large and heterogeneous group of diseases, for which treatment is generally limited to management of symptoms. RNA-based therapies are emerging as a powerful tool to treat genodermatoses. In this review, we discuss in detail RNA

  7. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit


    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).

  8. A Comparison of RNA-Seq Results from Paired Formalin-Fixed Paraffin-Embedded and Fresh-Frozen Glioblastoma Tissue Samples.

    Directory of Open Access Journals (Sweden)

    Anna Esteve-Codina

    Full Text Available The molecular classification of glioblastoma (GBM based on gene expression might better explain outcome and response to treatment than clinical factors. Whole transcriptome sequencing using next-generation sequencing platforms is rapidly becoming accepted as a tool for measuring gene expression for both research and clinical use. Fresh frozen (FF tissue specimens of GBM are difficult to obtain since tumor tissue obtained at surgery is often scarce and necrotic and diagnosis is prioritized over freezing. After diagnosis, leftover tissue is usually stored as formalin-fixed paraffin-embedded (FFPE tissue. However, RNA from FFPE tissues is usually degraded, which could hamper gene expression analysis. We compared RNA-Seq data obtained from matched pairs of FF and FFPE GBM specimens. Only three FFPE out of eleven FFPE-FF matched samples yielded informative results. Several quality-control measurements showed that RNA from FFPE samples was highly degraded but maintained transcriptomic similarities to RNA from FF samples. Certain issues regarding mutation analysis and subtype prediction were detected. Nevertheless, our results suggest that RNA-Seq of FFPE GBM specimens provides reliable gene expression data that can be used in molecular studies of GBM if the RNA is sufficiently preserved.

  9. Connecting rules from paired miRNA and mRNA expression data sets of HCV patients to detect both inverse and positive regulatory relationships


    Song, Renhua; Liu, Qian; Liu, Tao; Li, Jinyan


    Background Intensive research based on the inverse expression relationship has been undertaken to discover the miRNA-mRNA regulatory modules involved in the infection of Hepatitis C virus (HCV), the leading cause of chronic liver diseases. However, biological studies in other fields have found that inverse expression relationship is not the only regulatory relationship between miRNAs and their targets, and some miRNAs can positively regulate a mRNA by binding at the 5' UTR of the mRNA. Result...

  10. Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions. (United States)

    Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki


    It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

  11. miRNA-target chimeras reveal miRNA 3'-end pairing as a major determinant of Argonaute target specificity

    DEFF Research Database (Denmark)

    Moore, Michael J; Scheel, Troels K H; Luna, Joseph M


    microRNAs (miRNAs) act as sequence-specific guides for Argonaute (AGO) proteins, which mediate posttranscriptional silencing of target messenger RNAs. Despite their importance in many biological processes, rules governing AGO-miRNA targeting are only partially understood. Here we report a modifie...

  12. Charge transfer in DNA: role of base pairing

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan


    Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009

  13. Ferrocene-based Lewis acids and Lewis pairs: Synthesis and ...

    Indian Academy of Sciences (India)

    The design and synthesis of molecules containing non-interacting Lewis base and Lewis acid groups. [Frustrated Lewis pairs (FLP's)] have received intense attention due to their potential applications in the area of molecular catalysis.1–3. For example,. Stephen's and co-workers have demonstrated that the unquenched ...

  14. Micromechanics of base pair unzipping in the DNA duplex

    International Nuclear Information System (INIS)

    Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V


    All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)

  15. AudioPairBank: Towards A Large-Scale Tag-Pair-Based Audio Content Analysis


    Sager, Sebastian; Elizalde, Benjamin; Borth, Damian; Schulze, Christian; Raj, Bhiksha; Lane, Ian


    Recently, sound recognition has been used to identify sounds, such as car and river. However, sounds have nuances that may be better described by adjective-noun pairs such as slow car, and verb-noun pairs such as flying insects, which are under explored. Therefore, in this work we investigate the relation between audio content and both adjective-noun pairs and verb-noun pairs. Due to the lack of datasets with these kinds of annotations, we collected and processed the AudioPairBank corpus cons...


    Directory of Open Access Journals (Sweden)

    Testiana Deni Wijayatiningsih


    Full Text Available Students had skill to actualize their imagination and interpret their knowledge through writing which could be combined with good writing structure. Moreover, their writing skill still had low motivation and had not reached the standard writing structure. Based on the background above, this research has purpose to know the influence Note Taking Pairs in improving students‘sentence based writing achievement. The subject of this research was the second semester of English Department in Muhammadiyah University of Semarang. It also used statistic non parametric method to analyze the students‘ writing achievement. The result of this research showed that Note Taking Pairs strategy could improve students‘sentence based writing achievement. Hopefully this research is recommended into learning process to improve students‘writing skill especially in sentence-based writing subject.

  17. Prediction of plant promoters based on hexamers and random triplet pair analysis

    Directory of Open Access Journals (Sweden)

    Noman Nasimul


    Full Text Available Abstract Background With an increasing number of plant genome sequences, it has become important to develop a robust computational method for detecting plant promoters. Although a wide variety of programs are currently available, prediction accuracy of these still requires further improvement. The limitations of these methods can be addressed by selecting appropriate features for distinguishing promoters and non-promoters. Methods In this study, we proposed two feature selection approaches based on hexamer sequences: the Frequency Distribution Analyzed Feature Selection Algorithm (FDAFSA and the Random Triplet Pair Feature Selecting Genetic Algorithm (RTPFSGA. In FDAFSA, adjacent triplet-pairs (hexamer sequences were selected based on the difference in the frequency of hexamers between promoters and non-promoters. In RTPFSGA, random triplet-pairs (RTPs were selected by exploiting a genetic algorithm that distinguishes frequencies of non-adjacent triplet pairs between promoters and non-promoters. Then, a support vector machine (SVM, a nonlinear machine-learning algorithm, was used to classify promoters and non-promoters by combining these two feature selection approaches. We referred to this novel algorithm as PromoBot. Results Promoter sequences were collected from the PlantProm database. Non-promoter sequences were collected from plant mRNA, rRNA, and tRNA of PlantGDB and plant miRNA of miRBase. Then, in order to validate the proposed algorithm, we applied a 5-fold cross validation test. Training data sets were used to select features based on FDAFSA and RTPFSGA, and these features were used to train the SVM. We achieved 89% sensitivity and 86% specificity. Conclusions We compared our PromoBot algorithm to five other algorithms. It was found that the sensitivity and specificity of PromoBot performed well (or even better with the algorithms tested. These results show that the two proposed feature selection methods based on hexamer frequencies

  18. rRNA:mRNA pairing alters the length and the symmetry of mRNA-protected fragments in ribosome profiling experiments


    O?Connor, Patrick B. F.; Li, Gene-Wei; Weissman, Jonathan S.; Atkins, John F.; Baranov, Pavel V.


    Motivation: Ribosome profiling is a new technique that allows monitoring locations of translating ribosomes on mRNA at a whole transcriptome level. A recent ribosome profiling study demonstrated that internal Shine?Dalgarno (SD) sequences have a major global effect on translation rates in bacteria: ribosomes pause at SD sites in mRNA. Therefore, it is important to understand how SD sites effect mRNA movement through the ribosome and generation of ribosome footprints. Results: Here, we provide...

  19. DFT study on metal-mediated uracil base pair complexes

    Directory of Open Access Journals (Sweden)

    Ayhan Üngördü


    Full Text Available The most stable of metal-mediated uracil base pair complexes were determined. Method was used density functional theory, B3LYP. The calculations of systems containing C, H, N, O were described by 6-311++G(d,p and cc-PVTZ basis sets and LANL2DZ and SDD basis sets was used for transition metals. Then Egap values of complexes were calculated and the electrical conductivity of the complexes for single nanowires was studied by band theory. Metal-mediated uracil base pair complexes which will be used as conductive wires in nanotechnology were predicted. In nanoworld, this study is expected to show a way for practical applications.

  20. Photochemical selectivity in guanine-cytosine base-pair structures

    Czech Academy of Sciences Publication Activity Database

    Abo-Riziq, A.; Grace, L.; Nir, E.; Kabeláč, Martin; Hobza, Pavel; Vries de, M. S.


    Roč. 102, č. 1 (2005), s. 20-23 ISSN 0027-8424 R&D Projects: GA ČR(CZ) GA203/05/0009 Grant - others:NSF(US) CHE-0244341 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA base pairs * IR-UV spectroscopy * phytochemistry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 10.231, year: 2005

  1. Covariant Evolutionary Event Analysis for Base Interaction Prediction Using a Relational Database Management System for RNA. (United States)

    Xu, Weijia; Ozer, Stuart; Gutell, Robin R


    With an increasingly large amount of sequences properly aligned, comparative sequence analysis can accurately identify not only common structures formed by standard base pairing but also new types of structural elements and constraints. However, traditional methods are too computationally expensive to perform well on large scale alignment and less effective with the sequences from diversified phylogenetic classifications. We propose a new approach that utilizes coevolutional rates among pairs of nucleotide positions using phylogenetic and evolutionary relationships of the organisms of aligned sequences. With a novel data schema to manage relevant information within a relational database, our method, implemented with a Microsoft SQL Server 2005, showed 90% sensitivity in identifying base pair interactions among 16S ribosomal RNA sequences from Bacteria, at a scale 40 times bigger and 50% better sensitivity than a previous study. The results also indicated covariation signals for a few sets of cross-strand base stacking pairs in secondary structure helices, and other subtle constraints in the RNA structure.

  2. A discontinuous RNA platform mediates RNA virus replication: building an integrated model for RNA-based regulation of viral processes.

    Directory of Open Access Journals (Sweden)

    Baodong Wu


    Full Text Available Plus-strand RNA viruses contain RNA elements within their genomes that mediate a variety of fundamental viral processes. The traditional view of these elements is that of local RNA structures. This perspective, however, is changing due to increasing discoveries of functional viral RNA elements that are formed by long-range RNA-RNA interactions, often spanning thousands of nucleotides. The plus-strand RNA genomes of tombusviruses exemplify this concept by possessing different long-range RNA-RNA interactions that regulate both viral translation and transcription. Here we report that a third fundamental tombusvirus process, viral genome replication, requires a long-range RNA-based interaction spanning approximately 3000 nts. In vivo and in vitro analyses suggest that the discontinuous RNA platform formed by the interaction facilitates efficient assembly of the viral RNA replicase. This finding has allowed us to build an integrated model for the role of global RNA structure in regulating the reproduction of a eukaryotic RNA virus, and the insights gained have extended our understanding of the multifunctional nature of viral RNA genomes.

  3. Single base pair mutation analysis by PNA directed PCR clamping

    DEFF Research Database (Denmark)

    Ørum, H.; Nielsen, P.E.; Egholm, M.


    A novel method that allows direct analysis of single base mutation by the polymerase chain reaction (PCR) is described. The method utilizes the finding that PNAs (peptide nucleic acids) recognize and bind to their complementary nucleic acid sequences with higher thermal stability and specificity...... allows selective amplification/suppression of target sequences that differ by only one base pair. Finally we show that PNAs can be designed in such a way that blockage can be accomplished when the PNA target sequence is located between the PCR primers....

  4. Measurement and theory of hydrogen bonding contribution to isosteric DNA base pairs. (United States)

    Khakshoor, Omid; Wheeler, Steven E; Houk, K N; Kool, Eric T


    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions between F and natural bases in nucleic acid duplexes and in a DNA polymerase active site. Since F is widely used to measure electrostatic contributions to pairing and replication, it is important to quantify the impact of this isostere on DNA stability. Here, we studied the pairing stability and selectivity of this compound and a closely related variant, dichlorotoluene deoxyriboside (L), in DNA, using both experimental and computational approaches. We measured the thermodynamics of duplex formation in three sequence contexts and with all possible pairing partners by thermal melting studies using the van't Hoff approach, and for selected cases by isothermal titration calorimetry (ITC). Experimental results showed that internal F-A pairing in DNA is destabilizing by 3.8 kcal/mol (van't Hoff, 37 °C) as compared with T-A pairing. At the end of a duplex, base-base interactions are considerably smaller; however, the net F-A interaction remains repulsive while T-A pairing is attractive. As for selectivity, F is found to be slightly selective for adenine over C, G, T by 0.5 kcal mol, as compared with thymine's selectivity of 2.4 kcal/mol. Interestingly, dichlorotoluene in DNA is slightly less destabilizing and slightly more selective than F, despite the lack of strongly electronegative fluorine atoms. Experimental data were complemented by computational results, evaluated at the M06-2X/6-31+G(d) and MP2/cc-pVTZ levels of theory. These computations suggest that the pairing energy of F to A

  5. Quantifying alternative splicing from paired-end RNA-sequencing data


    Rossell, David; Stephan-Otto Attolini, Camille; Kroiss, Manuel; Stöcker, Almond


    RNA-sequencing has revolutionized biomedical research and, in particular, our ability to study gene alternative splicing. The problem has important implications for human health, as alternative splicing may be involved in malfunctions at the cellular level and multiple diseases. However, the high-dimensional nature of the data and the existence of experimental biases pose serious data analysis challenges. We find that the standard data summaries used to study alternative splicing are severely...

  6. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes. (United States)

    Kondo, Jiro; Westhof, Eric


    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  7. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes (United States)

    Kondo, Jiro; Westhof, Eric


    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  8. Shielding the messenger (RNA): microRNA-based anticancer therapies (United States)

    Sotillo, Elena; Thomas-Tikhonenko, Andrei


    It has been a decade since scientists realized that microRNAs (miRNAs) are not an oddity invented by worms to regulate gene expression at post-transcriptional levels. Rather, many of these 21–22-nucleotide-short RNAs exist in invertebrates and vertebrates alike and some of them are in fact highly conserved. miRNAs are now recognized as an important class of non-coding small RNAs that inhibit gene expression by targeting mRNA stability and translation. In the last ten years, our knowledge of the miRNAs world was expanding at vertiginous speed, propelled by the development of computational engines for miRNA identification and target prediction, biochemical tools and techniques to modulate miRNA activity, and last but not least, the emergence of miRNA-centric animal models. One important conclusion that has emerged from this effort is that many microRNAs and their cognate targets are strongly implicated in cancer, either as oncogenes or tumor and metastasis suppressors. In this review we will discuss the diverse role that miRNAs play in cancer initiation and progression and also the tools with which miRNA expression could be corrected in vivo. While the idea of targeting microRNAs towards therapeutic ends is getting considerable traction, basic, translational, and clinical research done in the next few years will tell whether this promise is well-founded. PMID:21514318

  9. Treatment of pairing correlations based on the equations of motion for zero-coupled pair operators

    International Nuclear Information System (INIS)

    Andreozzi, F.; Covello, A.; Gargano, A.; Ye, L.J.; Porrino, A.


    The pairing problem is treated by means of the equations of motion for zero-coupled pair operators. Exact equations for the seniority-v states of N particles are derived. These equations can be solved by a step-by-step procedure which consists of progressively adding pairs of particles to a core. The theory can be applied at several levels of approximation depending on the number of core states which are taken into account. Some numerical applications to the treatment of v = 0, v = 1, and v = 2 states in the Ni isotopes are performed. The accuracy of various approximations is tested by comparison with exact results. For the seniority-one and seniority-two problems it turns out that the results obtained from the first-order theory are very accurate, while those of higher order calculations are practically exact. Concerning the seniority-zero problem, a fifth-order calculation reproduces quite well the three lowest states

  10. Fragment-based modelling of single stranded RNA bound to RNA recognition motif containing proteins (United States)

    de Beauchene, Isaure Chauvot; de Vries, Sjoerd J.; Zacharias, Martin


    Abstract Protein-RNA complexes are important for many biological processes. However, structural modeling of such complexes is hampered by the high flexibility of RNA. Particularly challenging is the docking of single-stranded RNA (ssRNA). We have developed a fragment-based approach to model the structure of ssRNA bound to a protein, based on only the protein structure, the RNA sequence and conserved contacts. The conformational diversity of each RNA fragment is sampled by an exhaustive library of trinucleotides extracted from all known experimental protein–RNA complexes. The method was applied to ssRNA with up to 12 nucleotides which bind to dimers of the RNA recognition motifs (RRMs), a highly abundant eukaryotic RNA-binding domain. The fragment based docking allows a precise de novo atomic modeling of protein-bound ssRNA chains. On a benchmark of seven experimental ssRNA–RRM complexes, near-native models (with a mean heavy-atom deviation of <3 Å from experiment) were generated for six out of seven bound RNA chains, and even more precise models (deviation < 2 Å) were obtained for five out of seven cases, a significant improvement compared to the state of the art. The method is not restricted to RRMs but was also successfully applied to Pumilio RNA binding proteins. PMID:27131381

  11. Quantitation of base substitutions in eukaryotic 5S rRNA: selection for the maintenance of RNA secondary structure. (United States)

    Curtiss, W C; Vournakis, J N


    Eukaryotic 5S rRNA sequences from 34 diverse species were compared by the following method: (1) The sequences were aligned; (2) the positions of substitutions were located by comparison of all possible pairs of sequences; (3) the substitution sites were mapped to an assumed general base pairing model; and (4) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. An analysis of the sequence and structure variability in each region of the molecule is presented. It was found that the degree of base substitution varies over a wide range, from absolute conservation to occurrence of over 90% of the possible observable substitutions. The substitutions are located primarily in stem regions of the 5S rRNA secondary structure. More than 88% of the substitutions in helical regions maintain base pairing. The disruptive substitutions are primarily located at the edges of helical regions, resulting in shortening of the helical regions and lengthening of the adjacent nonpaired regions. Base stacking patterns determined by the R-Y model are mapped onto the general secondary structure. Intrastrand and interstrand stacking could stabilize alternative coaxial structures and limit the conformational flexibility of nonpaired regions. Two short contiguous regions are 100% conserved in all species. This may reflect evolutionary constraints imposed at the DNA level by the requirement for binding of a 5S gene transcription initiation factor during gene expression.

  12. Hydration sites of unpaired RNA bases: a statistical analysis of the PDB structures

    Directory of Open Access Journals (Sweden)

    Carugo Oliviero


    Full Text Available Abstract Background Hydration is crucial for RNA structure and function. X-ray crystallography is the most commonly used method to determine RNA structures and hydration and, therefore, statistical surveys are based on crystallographic results, the number of which is quickly increasing. Results A statistical analysis of the water molecule distribution in high-resolution X-ray structures of unpaired RNA nucleotides showed that: different bases have the same penchant to be surrounded by water molecules; clusters of water molecules indicate possible hydration sites, which, in some cases, match those of the major and minor grooves of RNA and DNA double helices; complex hydrogen bond networks characterize the solvation of the nucleotides, resulting in a significant rigidity of the base and its surrounding water molecules. Interestingly, the hydration sites around unpaired RNA bases do not match, in general, the positions that are occupied by the second nucleotide when the base-pair is formed. Conclusions The hydration sites around unpaired RNA bases were found. They do not replicate the atom positions of complementary bases in the Watson-Crick pairs.

  13. iDoRNA: An Interacting Domain-based Tool for Designing RNA-RNA Interaction Systems

    Directory of Open Access Journals (Sweden)

    Jittrawan Thaiprasit


    Full Text Available RNA-RNA interactions play a crucial role in gene regulation in living organisms. They have gained increasing interest in the field of synthetic biology because of their potential applications in medicine and biotechnology. However, few novel regulators based on RNA-RNA interactions with desired structures and functions have been developed due to the challenges of developing design tools. Recently, we proposed a novel tool, called iDoDe, for designing RNA-RNA interacting sequences by first decomposing RNA structures into interacting domains and then designing each domain using a stochastic algorithm. However, iDoDe did not provide an optimal solution because it still lacks a mechanism to optimize the design. In this work, we have further developed the tool by incorporating a genetic algorithm (GA to find an RNA solution with maximized structural similarity and minimized hybridized RNA energy, and renamed the tool iDoRNA. A set of suitable parameters for the genetic algorithm were determined and found to be a weighting factor of 0.7, a crossover rate of 0.9, a mutation rate of 0.1, and the number of individuals per population set to 8. We demonstrated the performance of iDoRNA in comparison with iDoDe by using six RNA-RNA interaction models. It was found that iDoRNA could efficiently generate all models of interacting RNAs with far more accuracy and required far less computational time than iDoDe. Moreover, we compared the design performance of our tool against existing design tools using forty-four RNA-RNA interaction models. The results showed that the performance of iDoRNA is better than RiboMaker when considering the ensemble defect, the fitness score and computation time usage. However, it appears that iDoRNA is outperformed by NUPACK and RNAiFold 2.0 when considering the ensemble defect. Nevertheless, iDoRNA can still be an useful alternative tool for designing novel RNA-RNA interactions in synthetic biology research. The source code of iDoRNA

  14. RNA-Based Vaccines in Cancer Immunotherapy

    Directory of Open Access Journals (Sweden)

    Megan A. McNamara


    Full Text Available RNA vaccines traditionally consist of messenger RNA synthesized by in vitro transcription using a bacteriophage RNA polymerase and template DNA that encodes the antigen(s of interest. Once administered and internalized by host cells, the mRNA transcripts are translated directly in the cytoplasm and then the resulting antigens are presented to antigen presenting cells to stimulate an immune response. Alternatively, dendritic cells can be loaded with either tumor associated antigen mRNA or total tumor RNA and delivered to the host to elicit a specific immune response. In this review, we will explain why RNA vaccines represent an attractive platform for cancer immunotherapy, discuss modifications to RNA structure that have been developed to optimize mRNA vaccine stability and translational efficiency, and describe strategies for nonviral delivery of mRNA vaccines, highlighting key preclinical and clinical data related to cancer immunotherapy.

  15. Large scale comparative codon-pair context analysis unveils general rules that fine-tune evolution of mRNA primary structure.

    Directory of Open Access Journals (Sweden)

    Gabriela Moura

    Full Text Available BACKGROUND: Codon usage and codon-pair context are important gene primary structure features that influence mRNA decoding fidelity. In order to identify general rules that shape codon-pair context and minimize mRNA decoding error, we have carried out a large scale comparative codon-pair context analysis of 119 fully sequenced genomes. METHODOLOGIES/PRINCIPAL FINDINGS: We have developed mathematical and software tools for large scale comparative codon-pair context analysis. These methodologies unveiled general and species specific codon-pair context rules that govern evolution of mRNAs in the 3 domains of life. We show that evolution of bacterial and archeal mRNA primary structure is mainly dependent on constraints imposed by the translational machinery, while in eukaryotes DNA methylation and tri-nucleotide repeats impose strong biases on codon-pair context. CONCLUSIONS: The data highlight fundamental differences between prokaryotic and eukaryotic mRNA decoding rules, which are partially independent of codon usage.

  16. Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry. (United States)

    Ishida, Riyoko; Iwahashi, Hideo


    Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).

  17. Type I-E CRISPR-Cas Systems Discriminate Target from Non-Target DNA through Base Pairing-Independent PAM Recognition (United States)

    Datsenko, Kirill A.; Jackson, Ryan N.; Wiedenheft, Blake; Severinov, Konstantin; Brouns, Stan J. J.


    Discriminating self and non-self is a universal requirement of immune systems. Adaptive immune systems in prokaryotes are centered around repetitive loci called CRISPRs (clustered regularly interspaced short palindromic repeat), into which invader DNA fragments are incorporated. CRISPR transcripts are processed into small RNAs that guide CRISPR-associated (Cas) proteins to invading nucleic acids by complementary base pairing. However, to avoid autoimmunity it is essential that these RNA-guides exclusively target invading DNA and not complementary DNA sequences (i.e., self-sequences) located in the host's own CRISPR locus. Previous work on the Type III-A CRISPR system from Staphylococcus epidermidis has demonstrated that a portion of the CRISPR RNA-guide sequence is involved in self versus non-self discrimination. This self-avoidance mechanism relies on sensing base pairing between the RNA-guide and sequences flanking the target DNA. To determine if the RNA-guide participates in self versus non-self discrimination in the Type I-E system from Escherichia coli we altered base pairing potential between the RNA-guide and the flanks of DNA targets. Here we demonstrate that Type I-E systems discriminate self from non-self through a base pairing-independent mechanism that strictly relies on the recognition of four unchangeable PAM sequences. In addition, this work reveals that the first base pair between the guide RNA and the PAM nucleotide immediately flanking the target sequence can be disrupted without affecting the interference phenotype. Remarkably, this indicates that base pairing at this position is not involved in foreign DNA recognition. Results in this paper reveal that the Type I-E mechanism of avoiding self sequences and preventing autoimmunity is fundamentally different from that employed by Type III-A systems. We propose the exclusive targeting of PAM-flanked sequences to be termed a target versus non-target discrimination mechanism. PMID:24039596

  18. RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs. (United States)

    Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju


    Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

  19. siRNA delivery with lipid-based systems

    DEFF Research Database (Denmark)

    Foged, Camilla


    A key hurdle for the further development of RNA interference (RNAi) therapeutics like small interfering RNA (siRNA) is their safe and effective delivery. Lipids are promising and versatile carriers because they are based on Nature's own building blocks and can be provided with properties which......RNA into more hydrophobic lipoplexes, which promote passage of the siRNA across cellular membrane barriers, especially when lipids are added that facilitate membrane fusion. Despite these attractive features, siRNA delivery vehicles are facing a number of challenges such as the limited delivery efficiency...

  20. The structure of an E. coli tRNAfMet A1-U72 variant shows an unusual conformation of the A1-U72 base pair. (United States)

    Monestier, Auriane; Aleksandrov, Alexey; Coureux, Pierre-Damien; Panvert, Michel; Mechulam, Yves; Schmitt, Emmanuelle


    Translation initiation in eukaryotes and archaea involves a methionylated initiator tRNA delivered to the ribosome in a ternary complex with e/aIF2 and GTP. Eukaryotic and archaeal initiator tRNAs contain a highly conserved A 1 -U 72 base pair at the top of the acceptor stem. The importance of this base pair to discriminate initiator tRNAs from elongator tRNAs has been established previously using genetics and biochemistry. However, no structural data illustrating how the A 1 -U 72 base pair participates in the accurate selection of the initiator tRNAs by the translation initiation systems are available. Here, we describe the crystal structure of a mutant E. coli initiator tRNA f Met A 1 -U 72 , aminoacylated with methionine, in which the C 1 :A 72 mismatch at the end of the tRNA acceptor stem has been changed to an A 1 -U 72 base pair. Sequence alignments show that the mutant E. coli tRNA is a good mimic of archaeal initiator tRNAs. The crystal structure, determined at 2.8 Å resolution, shows that the A 1 -U 72 pair adopts an unusual arrangement. A 1 is in a syn conformation and forms a single H-bond interaction with U 72 This interaction requires protonation of the N1 atom of A 1 Moreover, the 5' phosphoryl group folds back into the major groove of the acceptor stem and interacts with the N7 atom of G 2 A possible role of this unusual geometry of the A 1 -U 72 pair in the recognition of the initiator tRNA by its partners during eukaryotic and archaeal translation initiation is discussed. © 2017 Monestier et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  1. The European Regulatory Environment of RNA-Based Vaccines. (United States)

    Hinz, Thomas; Kallen, Kajo; Britten, Cedrik M; Flamion, Bruno; Granzer, Ulrich; Hoos, Axel; Huber, Christoph; Khleif, Samir; Kreiter, Sebastian; Rammensee, Hans-Georg; Sahin, Ugur; Singh-Jasuja, Harpreet; Türeci, Özlem; Kalinke, Ulrich


    A variety of different mRNA-based drugs are currently in development. This became possible, since major breakthroughs in RNA research during the last decades allowed impressive improvements of translation, stability and delivery of mRNA. This article focuses on antigen-encoding RNA-based vaccines that are either directed against tumors or pathogens. mRNA-encoded vaccines are developed both for preventive or therapeutic purposes. Most mRNA-based vaccines are directly administered to patients. Alternatively, primary autologous cells from cancer patients are modified ex vivo by the use of mRNA and then are adoptively transferred to patients. In the EU no regulatory guidelines presently exist that specifically address mRNA-based vaccines. The existing regulatory framework, however, clearly defines that mRNA-based vaccines in most cases have to be centrally approved. Interestingly, depending on whether RNA-based vaccines are directed against tumors or infectious disease, they are formally considered gene therapy products or not, respectively. Besides an overview on the current clinical use of mRNA vaccines in various therapeutic areas a detailed discussion of the current regulatory situation is provided and regulatory perspectives are discussed.

  2. MZ twin pairs or MZ singletons in population family-based GWAS? More power in pairs

    NARCIS (Netherlands)

    Minica, C.C.; Boomsma, D.I.; Vink, J.M.; Dolan, C.V.


    Family-based genome-wide association studies (GWAS) involve testing the genetic association of (many) genetic variants with the phenotype of interest, while taking into account the relatedness among family members. Occasionally in family-based GWAS, including monozygotic (MZ) twins, the data from

  3. Flexibility of short DNA helices with finite-length effect: From base pairs to tens of base pairs

    International Nuclear Information System (INIS)

    Wu, Yuan-Yan; Bao, Lei; Zhang, Xi; Tan, Zhi-Jie


    Flexibility of short DNA helices is important for the biological functions such as nucleosome formation and DNA-protein recognition. Recent experiments suggest that short DNAs of tens of base pairs (bps) may have apparently higher flexibility than those of kilo bps, while there is still the debate on such high flexibility. In the present work, we have studied the flexibility of short DNAs with finite-length of 5–50 bps by the all-atomistic molecular dynamics simulations and Monte Carlo simulations with the worm-like chain model. Our microscopic analyses reveal that short DNAs have apparently high flexibility which is attributed to the significantly strong bending and stretching flexibilities of ∼6 bps at each helix end. Correspondingly, the apparent persistence length l p of short DNAs increases gradually from ∼29 nm to ∼45 nm as DNA length increases from 10 to 50 bps, in accordance with the available experimental data. Our further analyses show that the short DNAs with excluding ∼6 bps at each helix end have the similar flexibility with those of kilo bps and can be described by the worm-like chain model with l p ∼ 50 nm

  4. Paired structures and other opposite-based models

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco, Camilo; Gómez, Daniel


    , that we will assume dependent on a specific negation, previously determined. In this way we can define a paired fuzzy set as a couple of opposite valuation fuzzy sets. Then we shall explore what kind of new valuation fuzzy sets can be generated from the semantic tension between those two poles, leading...... to a more complex valuation structure that still keeps the essence of being paired. In this way several neutral fuzzy sets can appear, in particular indeterminacy, ambivalence and conflict. Two consequences are then presented: on one hand, we will show how Atanassov´s Intuitionistic Fuzzy Sets can be viewed...

  5. Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.


    Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which

  6. Accurate interaction energies of base pairing and base stacking. The final chapter

    Czech Academy of Sciences Publication Activity Database

    Šponer, Jiří; Jurečka, Petr; Hobza, Pavel


    Roč. 22, č. 6 (2005), s. 767 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : base pairing * base stacking * nucleic acids Subject RIV: BO - Biophysics

  7. Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics (United States)

    Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.


    Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

  8. Unstable Hoogsteen base pairs adjacent to echinomycin binding sites within a DNA duplex

    International Nuclear Information System (INIS)

    Gilbert, D.E.; van der Marel, G.A.; van Boom, J.H.; Feigon, J.


    The bisintercalation complex present between the DNA octamer [d(ACGTACGT)] 2 and the cyclic octadepsipeptide antibiotic echinomycin has been studied by one- and two-dimensional proton NMR, and the results obtained have been compared with the crystal structures of related DNA-echinomycin complexes. Two echinomycins are found to bind cooperatively to each DNA duplex at the CpG steps, with the two quinoxaline rings of each echinomycin bisintercalating between the C·G and A·T base pairs. At low temperatures, the A·T base pairs on either side of the intercalation site adopt the Hoogsteen conformation, as observed in the crystal structures. However, as the temperature is raised, the Hoogsteen base pairs in the interior of the duplex are destabilized and are observed to be exchanging between the Hoogsteen base pair and either an open or a Watson-Crick base-paired state. The terminal A·T base pairs, which are not as constrained by the helix as the internal base pairs, remain stably Hoogsteen base-paired up to at least 45 degree C. The implications of these results for the biological role of Hoogsteen base pairs in echinomycin-DNA complexes in vivo are discussed

  9. [Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?]. (United States)

    Brovarets', O O


    At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

  10. Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition

    NARCIS (Netherlands)

    Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.


    DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and

  11. [In silico CRISPR-based sgRNA design]. (United States)

    Wang, Yuanli; Chuai, Guohui; Yan, Jifang; Shi, Lei; Liu, Qi


    CRISPR-based genome editing has been widely implemented in various cell types. In-silico single guide RNA (sgRNA) design is a key step for successful gene editing using CRISPR system. Continuing efforts are made to refine in-silico sgRNA design with high on-target efficacy and reduced off-target effects. In this paper, we summarize the present sgRNA design tools, and show that efficient in-silico models can be built that integrate current heterogeneous genome-editing data to derive unbiased sgRNA design rules and identify key features for improving sgRNA design. Our review shows that systematic comparisons and evaluation of on-target and off-target effects of sgRNA will allow more precise genome editing and gene therapies using the CRISPR system.

  12. A novel knowledge-based potential for RNA 3D structure evaluation (United States)

    Yang, Yi; Gu, Qi; Zhang, Ben-Gong; Shi, Ya-Zhou; Shao, Zhi-Gang


    Ribonucleic acids (RNAs) play a vital role in biology, and knowledge of their three-dimensional (3D) structure is required to understand their biological functions. Recently structural prediction methods have been developed to address this issue, but a series of RNA 3D structures are generally predicted by most existing methods. Therefore, the evaluation of the predicted structures is generally indispensable. Although several methods have been proposed to assess RNA 3D structures, the existing methods are not precise enough. In this work, a new all-atom knowledge-based potential is developed for more accurately evaluating RNA 3D structures. The potential not only includes local and nonlocal interactions but also fully considers the specificity of each RNA by introducing a retraining mechanism. Based on extensive test sets generated from independent methods, the proposed potential correctly distinguished the native state and ranked near-native conformations to effectively select the best. Furthermore, the proposed potential precisely captured RNA structural features such as base-stacking and base-pairing. Comparisons with existing potential methods show that the proposed potential is very reliable and accurate in RNA 3D structure evaluation. Project supported by the National Science Foundation of China (Grants Nos. 11605125, 11105054, 11274124, and 11401448).

  13. Nanoscale protein diffusion by STED-based pair correlation analysis.

    Directory of Open Access Journals (Sweden)

    Paolo Bianchini

    Full Text Available We describe for the first time the combination between cross-pair correlation function analysis (pair correlation analysis or pCF and stimulated emission depletion (STED to obtain diffusion maps at spatial resolution below the optical diffraction limit (super-resolution. Our approach was tested in systems characterized by high and low signal to noise ratio, i.e. Capsid Like Particles (CLPs bearing several (>100 active fluorescent proteins and monomeric fluorescent proteins transiently expressed in living Chinese Hamster Ovary cells, respectively. The latter system represents the usual condition encountered in living cell studies on fluorescent protein chimeras. Spatial resolution of STED-pCF was found to be about 110 nm, with a more than twofold improvement over conventional confocal acquisition. We successfully applied our method to highlight how the proximity to nuclear envelope affects the mobility features of proteins actively imported into the nucleus in living cells. Remarkably, STED-pCF unveiled the existence of local barriers to diffusion as well as the presence of a slow component at distances up to 500-700 nm from either sides of nuclear envelope. The mobility of this component is similar to that previously described for transport complexes. Remarkably, all these features were invisible in conventional confocal mode.

  14. Lewis pair polymerization by classical and frustrated Lewis pairs: Acid, base and monomer scope and polymerization mechanism

    KAUST Repository

    Zhang, Yuetao


    Classical and frustrated Lewis pairs (LPs) of the strong Lewis acid (LA) Al(C 6F 5) 3 with several Lewis base (LB) classes have been found to exhibit exceptional activity in the Lewis pair polymerization (LPP) of conjugated polar alkenes such as methyl methacrylate (MMA) as well as renewable α-methylene-γ-butyrolactone (MBL) and γ-methyl- α-methylene-γ-butyrolactone (γ-MMBL), leading to high molecular weight polymers, often with narrow molecular weight distributions. This study has investigated a large number of LPs, consisting of 11 LAs as well as 10 achiral and 4 chiral LBs, for LPP of 12 monomers of several different types. Although some more common LAs can also be utilized for LPP, Al(C 6F 5) 3-based LPs are far more active and effective than other LA-based LPs. On the other hand, several classes of LBs, when paired with Al(C 6F 5) 3, can render highly active and effective LPP of MMA and γ-MMBL; such LBs include phosphines (e.g., P tBu 3), chiral chelating diphosphines, N-heterocyclic carbenes (NHCs), and phosphazene superbases (e.g., P 4- tBu). The P 4- tBu/Al(C 6F 5) 3 pair exhibits the highest activity of the LP series, with a remarkably high turn-over frequency of 9.6 × 10 4 h -1 (0.125 mol% catalyst, 100% MMA conversion in 30 s, M n = 2.12 × 10 5 g mol -1, PDI = 1.34). The polymers produced by LPs at RT are typically atactic (P γMMBL with ∼47% mr) or syndio-rich (PMMA with ∼70-75% rr), but highly syndiotactic PMMA with rr ∼91% can be produced by chiral or achiral LPs at -78 °C. Mechanistic studies have identified and structurally characterized zwitterionic phosphonium and imidazolium enolaluminates as the active species of the current LPP system, which are formed by the reaction of the monomer·Al(C 6F 5) 3 adduct with P tBu 3 and NHC bases, respectively. Kinetic studies have revealed that the MMA polymerization by the tBu 3P/ Al(C 6F 5) 3 pair is zero-order in monomer concentration after an initial induction period, and the polymerization

  15. Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs. (United States)

    Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A


    DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. The Influence of Square Planar Platinum Complexes on DNA Bases Pairing. An ab initio DFT Study

    Czech Academy of Sciences Publication Activity Database

    Burda, J. V.; Šponer, Jiří; Leszczynski, J.


    Roč. 3, č. 19 (2001), s. 4404-4411 ISSN 1463-9076 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : DNA base pairing * platinated base pairs * ab initio DFT study Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.787, year: 2001

  17. Solvent effects on hydrogen bonds in Watson-Crick, mismatched, and modified DNA base pairs

    NARCIS (Netherlands)

    Poater, Jordi; Swart, Marcel; Guerra, Celia Fonseca; Bickelhaupt, F. Matthias


    We have theoretically analyzed a complete series of Watson–Crick and mismatched DNA base pairs, both in gas phase and in solution. Solvation causes a weakening and lengthening of the hydrogen bonds between the DNA bases because of the stabilization of the lone pairs involved in these bonds. We have

  18. Semiautomated improvement of RNA alignments

    DEFF Research Database (Denmark)

    Andersen, Ebbe Sloth; Lind-Thomsen, Allan; Knudsen, Bjarne


    connects to external tools to provide a flexible semiautomatic editing environment. A new method, Pcluster, is introduced for dividing the sequences of an RNA alignment into subgroups with secondary structure differences. Pcluster was used to evaluate 574 seed alignments obtained from the Rfam database...... and we identified 71 alignments with significant prediction of inconsistent base pairs and 102 alignments with significant prediction of novel base pairs. Four RNA families were used to illustrate how SARSE can be used to manually or automatically correct the inconsistent base pairs detected by Pcluster......: the mir-399 RNA, vertebrate telomase RNA (vert-TR), bacterial transfer-messenger RNA (tmRNA), and the signal recognition particle (SRP) RNA. The general use of the method is illustrated by the ability to accommodate pseudoknots and handle even large and divergent RNA families. The open architecture...

  19. RNA. (United States)

    Darnell, James E., Jr.


    Ribonucleic acid (RNA) converts genetic information into protein and usually must be processed to serve its function. RNA types, chemical structure, protein synthesis, translation, manufacture, and processing are discussed. Concludes that the first genes might have been spliced RNA and that humans might be closer than bacteria to primitive…

  20. Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano


    Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  1. KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry. (United States)

    Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas


    Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.

  2. General enumeration of RNA secondary structures based on new ...

    African Journals Online (AJOL)


    coding, transferring and retrieving genetic information, and in directing cell metabolism. The nucleic acid includes DNA and RNA molecule. RNA molecule is a single-stranded nucleic acid of four different kinds of nucleotides. The four nucleotides only differ by one part, called bases. Hence, one usually identifies nucleotides.

  3. Molecular Beacon-Based MicroRNA Imaging During Neurogenesis. (United States)

    Lee, Jonghwan; Kim, Soonhag


    The fluorescence monitoring system for examining endogenous microRNA (miRNA) activity in cellular level provides crucial information on not only understanding a critical role of miRNA involving a variety of biological processes, but also evaluating miRNA expression patterns in a noninvasive manner. In this protocol, we report the details of a new procedure for a molecular beacon-based miRNA monitoring system, which includes the illustration scheme for miRNA detection strategy, exogenous miRNA detection, and measurement of endogenous miRNA expression level during neurogenesis. The fluorescence signal of miR-124a beacon quenched by BHQ2 was gradually recovered as increasing concentration of the miR-124a in tube. The functional work of miR-124a beacon was examined in intracellular environment, allowing for the internalization of the miR-124a beacon by lipofectamine, which resulted in activated fluorescent signals of the miR-124a beacon in the HeLa cells after the addition of synthetic miR-124a. The endogenous miR-124a expression level was detected by miR-124a beacon system during neurogenesis, showing brighter fluorescence intensity in cytoplasmic area of P19 cells after induction of neuronal differentiation by retinoic acid. The molecular beacon based-miRNA detection technique could be applicable to the simultaneous visualization of a variety of miRNA expression patterns using different fluorescence dyes. For the study of examining endogenous miRNA expression level using miRNA-beacon system, if cellular differentiation step is already prepared, transfection step of miR-124a beacon into P19 cells, and acquisition of activated fluorescence signal measured by confocal microscope can be conducted approximately within 6 h.

  4. Thermodynamic heuristics with case-based reasoning: combined insights for RNA pseudoknot secondary structure. (United States)

    Al-Khatib, Ra'ed M; Rashid, Nur'Aini Abdul; Abdullah, Rosni


    The secondary structure of RNA pseudoknots has been extensively inferred and scrutinized by computational approaches. Experimental methods for determining RNA structure are time consuming and tedious; therefore, predictive computational approaches are required. Predicting the most accurate and energy-stable pseudoknot RNA secondary structure has been proven to be an NP-hard problem. In this paper, a new RNA folding approach, termed MSeeker, is presented; it includes KnotSeeker (a heuristic method) and Mfold (a thermodynamic algorithm). The global optimization of this thermodynamic heuristic approach was further enhanced by using a case-based reasoning technique as a local optimization method. MSeeker is a proposed algorithm for predicting RNA pseudoknot structure from individual sequences, especially long ones. This research demonstrates that MSeeker improves the sensitivity and specificity of existing RNA pseudoknot structure predictions. The performance and structural results from this proposed method were evaluated against seven other state-of-the-art pseudoknot prediction methods. The MSeeker method had better sensitivity than the DotKnot, FlexStem, HotKnots, pknotsRG, ILM, NUPACK and pknotsRE methods, with 79% of the predicted pseudoknot base-pairs being correct.

  5. Covering All the Bases in Genetics: Simple Shorthands and Diagrams for Teaching Base Pairing to Biology Undergraduates

    Directory of Open Access Journals (Sweden)

    Sergei Kuchin


    Full Text Available Explaining base pairing is an important element in teaching undergraduate genetics. I propose a teaching approach that aims to close the gap between the mantra “A pairs with T, and G pairs with C” and the “intimidating” chemical diagrams. The approach offers a set of simple “shorthands” for the key bases that can be used to quickly deduce all canonical and wobble pairs that the students need to know. The approach can be further developed to analyze mutagenic mismatch pairing.

  6. Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA

    International Nuclear Information System (INIS)

    Mendel, D.; Dervan, P.B.


    Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired

  7. A simple and robust vector-based shRNA expression system used for RNA interference. (United States)

    Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi


    RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  8. A simple and robust vector-based shRNA expression system used for RNA interference.

    Directory of Open Access Journals (Sweden)

    Xue-jun Wang

    Full Text Available BACKGROUND: RNA interference (RNAi mediated by small interfering RNAs (siRNAs or short hairpin RNAs (shRNAs has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. RESULTS: In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. CONCLUSION: This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  9. lncRNATargets: A platform for lncRNA target prediction based on nucleic acid thermodynamics. (United States)

    Hu, Ruifeng; Sun, Xiaobo


    Many studies have supported that long noncoding RNAs (lncRNAs) perform various functions in various critical biological processes. Advanced experimental and computational technologies allow access to more information on lncRNAs. Determining the functions and action mechanisms of these RNAs on a large scale is urgently needed. We provided lncRNATargets, which is a web-based platform for lncRNA target prediction based on nucleic acid thermodynamics. The nearest-neighbor (NN) model was used to calculate binging-free energy. The main principle of NN model for nucleic acid assumes that identity and orientation of neighbor base pairs determine stability of a given base pair. lncRNATargets features the following options: setting of a specific temperature that allow use not only for human but also for other animals or plants; processing all lncRNAs in high throughput without RNA size limitation that is superior to any other existing tool; and web-based, user-friendly interface, and colored result displays that allow easy access for nonskilled computer operators and provide better understanding of results. This technique could provide accurate calculation on the binding-free energy of lncRNA-target dimers to predict if these structures are well targeted together. lncRNATargets provides high accuracy calculations, and this user-friendly program is available for free at .

  10. Anomeric 2'-Deoxycytidines and Silver Ions: Hybrid Base Pairs with Greatly Enhanced Stability and Efficient DNA Mismatch Detection with α-dC. (United States)

    Guo, Xiurong; Seela, Frank


    α-d-Nucleosides are rare in nature but can develop fascinating properties when incorporated into DNA. This work reports on the first silver-mediated base pair constructed from two anomeric nucleosides: α-dC and β-dC. The hybrid base pair was integrated into the DNA and DNA/RNA double helix. A 12-mer duplex with α-dC and β-dC pair exhibits a higher thermal stability (T m =43 °C) than that incorporating the β-dC-Ag + -β-dC homo pair (T m =34 °C). Furthermore, α-dC shows excellent mismatch discrimination for DNA single nucleotide polymorphism (SNP). All four SNPs were identified on the basis of large T m value differences measured in the presence of silver ions. High resolution melting was not required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Performance of various density functionals for the hydrogen bonds in DNA base pairs

    NARCIS (Netherlands)

    van der Wijst, T.; Fonseca Guerra, C.; Swart, M.; Bickelhaupt, F.M.


    We have investigated the performance of seven popular density functionals (B3LYP, BLYP, BP86, mPW, OPBE, PBE, PW91) for describing the geometry and stability of the hydrogen bonds in DNA base pairs. For the gas-phase situation, the hydrogen-bond lengths and strengths in the DNA pairs have been

  12. Envisaging quantum transport phenomenon in a muddled base pair of DNA (United States)

    Vohra, Rajan; Sawhney, Ravinder Singh


    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  13. URS DataBase: universe of RNA structures and their motifs. (United States)

    Baulin, Eugene; Yacovlev, Victor; Khachko, Denis; Spirin, Sergei; Roytberg, Mikhail


    The Universe of RNA Structures DataBase (URSDB) stores information obtained from all RNA-containing PDB entries (2935 entries in October 2015). The content of the database is updated regularly. The database consists of 51 tables containing indexed data on various elements of the RNA structures. The database provides a web interface allowing user to select a subset of structures with desired features and to obtain various statistical data for a selected subset of structures or for all structures. In particular, one can easily obtain statistics on geometric parameters of base pairs, on structural motifs (stems, loops, etc.) or on different types of pseudoknots. The user can also view and get information on an individual structure or its selected parts, e.g. RNA-protein hydrogen bonds. URSDB employs a new original definition of loops in RNA structures. That definition fits both pseudoknot-free and pseudoknotted secondary structures and coincides with the classical definition in case of pseudoknot-free structures. To our knowledge, URSDB is the first database supporting searches based on topological classification of pseudoknots and on extended loop classification.Database URL: © The Author(s) 2016. Published by Oxford University Press.

  14. Estimating the Per-Base-Pair Mutation Rate in the Yeast Saccharomyces cerevisiae


    Lang, Gregory I.; Murray, Andrew W.


    Although mutation rates are a key determinant of the rate of evolution they are difficult to measure precisely and global mutations rates (mutations per genome per generation) are often extrapolated from the per-base-pair mutation rate assuming that mutation rate is uniform across the genome. Using budding yeast, we describe an improved method for the accurate calculation of mutation rates based on the fluctuation assay. Our analysis suggests that the per-base-pair mutation rates at two genes...

  15. Cytochrome c oxidase subunit 1-based human RNA quantification to enhance mRNA profiling in forensic biology

    Directory of Open Access Journals (Sweden)

    Dong Zhao


    Full Text Available RNA analysis offers many potential applications in forensic science, and molecular identification of body fluids by analysis of cell-specific RNA markers represents a new technique for use in forensic cases. However, due to the nature of forensic materials that often admixed with nonhuman cellular components, human-specific RNA quantification is required for the forensic RNA assays. Quantification assay for human RNA has been developed in the present study with respect to body fluid samples in forensic biology. The quantitative assay is based on real-time reverse transcription-polymerase chain reaction of mitochondrial RNA cytochrome c oxidase subunit I and capable of RNA quantification with high reproducibility and a wide dynamic range. The human RNA quantification improves the quality of mRNA profiling in the identification of body fluids of saliva and semen because the quantification assay can exclude the influence of nonhuman components and reduce the adverse affection from degraded RNA fragments.

  16. Differential stabilities and sequence-dependent base pair opening dynamics of Watson-Crick base pairs with 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine. (United States)

    Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P


    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.

  17. Differential Stabilities and Sequence-Dependent Base Pair Opening Dynamics of Watson–Crick Base Pairs with 5-Hydroxymethylcytosine, 5-Formylcytosine, or 5-Carboxylcytosine (United States)


    5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson–Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5′-CG-3′ sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5′-T8X9G10-3′ sequence of the DDD, were compared. The presence of 5caC at the X9 base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A5:T8, whereas 5caC did not. At the oxidized base pair G4:X9, 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C3:G10. No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G4:X9; each favored Watson–Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N4 exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes. PMID:25632825

  18. An ID-based Blind Signature Scheme from Bilinear Pairings


    B.Umaprasada Rao; K.A.Ajmath


    Blind signatures, introduced by Chaum, allow a user to obtain a signature on a message without revealing any thing about the message to the signer. Blind signatures play on important role in plenty of applications such as e-voting, e-cash system where anonymity is of great concern. Identity based(ID-based) public key cryptography can be a good alternative for certified based public key setting, especially when efficient key management and moderate security are required. In this paper, we prop...

  19. Entropy-based model for miRNA isoform analysis.

    Directory of Open Access Journals (Sweden)

    Shengqin Wang

    Full Text Available MiRNAs have been widely studied due to their important post-transcriptional regulatory roles in gene expression. Many reports have demonstrated the evidence of miRNA isoform products (isomiRs in high-throughput small RNA sequencing data. However, the biological function involved in these molecules is still not well investigated. Here, we developed a Shannon entropy-based model to estimate isomiR expression profiles of high-throughput small RNA sequencing data extracted from miRBase webserver. By using the Kolmogorov-Smirnov statistical test (KS test, we demonstrated that the 5p and 3p miRNAs present more variants than the single arm miRNAs. We also found that the isomiR variant, except the 3' isomiR variant, is strongly correlated with Minimum Free Energy (MFE of pre-miRNA, suggesting the intrinsic feature of pre-miRNA should be one of the important factors for the miRNA regulation. The functional enrichment analysis showed that the miRNAs with high variation, particularly the 5' end variation, are enriched in a set of critical functions, supporting these molecules should not be randomly produced. Our results provide a probabilistic framework for miRNA isoforms analysis, and give functional insights into pre-miRNA processing.

  20. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.


    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  1. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs. (United States)

    McCoy, A B; Wright, A; Krousel-Wood, M; Thomas, E J; McCoy, J A; Sittig, D F


    Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes.

  2. Validation of a Crowdsourcing Methodology for Developing a Knowledge Base of Related Problem-Medication Pairs (United States)

    Wright, A.; Krousel-Wood, M.; Thomas, E. J.; McCoy, J. A.; Sittig, D. F.


    Summary Background Clinical knowledge bases of problem-medication pairs are necessary for many informatics solutions that improve patient safety, such as clinical summarization. However, developing these knowledge bases can be challenging. Objective We sought to validate a previously developed crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large, non-university health care system with a widely used, commercially available electronic health record. Methods We first retrieved medications and problems entered in the electronic health record by clinicians during routine care during a six month study period. Following the previously published approach, we calculated the link frequency and link ratio for each pair then identified a threshold cutoff for estimated problem-medication pair appropriateness through clinician review; problem-medication pairs meeting the threshold were included in the resulting knowledge base. We selected 50 medications and their gold standard indications to compare the resulting knowledge base to the pilot knowledge base developed previously and determine its recall and precision. Results The resulting knowledge base contained 26,912 pairs, had a recall of 62.3% and a precision of 87.5%, and outperformed the pilot knowledge base containing 11,167 pairs from the previous study, which had a recall of 46.9% and a precision of 83.3%. Conclusions We validated the crowdsourcing approach for generating a knowledge base of problem-medication pairs in a large non-university health care system with a widely used, commercially available electronic health record, indicating that the approach may be generalizable across healthcare settings and clinical systems. Further research is necessary to better evaluate the knowledge, to compare crowdsourcing with other approaches, and to evaluate if incorporating the knowledge into electronic health records improves patient outcomes. PMID:26171079

  3. Vinylimidazole-Based Asymmetric Ion Pair Comonomers: Synthesis, Polymerization Studies and Formation of Ionically Crosslinked PMMA

    NARCIS (Netherlands)

    Jana, S.; Vasantha, V.A.; Stubbs, L.P.; Parthiban, A.; Vancso, Gyula J.


    Vinylimidazole-based asymmetric ion pair comonomers (IPCs) which are free from nonpolymerizable counter ions have been synthesized, characterized and polymerized by free radical polymerization (FRP), atom transfer radical polymerization (ATRP), and reversible addition-fragmentation chain transfer

  4. Reconstruction and analysis of the lncRNA-miRNA-mRNA network based on competitive endogenous RNA reveal functional lncRNAs in rheumatoid arthritis. (United States)

    Jiang, Hui; Ma, Rong; Zou, Shubiao; Wang, Yongzhong; Li, Zhuqing; Li, Weiping


    Rheumatoid arthritis (RA) is an autoimmune disease with an unknown etiology, occurring in approximately 1.0% of general population. More and more studies have suggested that long non-coding RNAs (lncRNAs) could play important roles in various biological processes and be associated with the pathogenesis of different kinds of diseases including RA. Although a large number of lncRNAs have been found, our knowledge of their function and physiological/pathological significance is still in its infancy. In order to reveal functional lncRNAs and identify the key lncRNAs in RA, we reconstructed a global triple network based on the competitive endogenous RNA (ceRNA) theory using the data from National Center for Biotechnology Information Gene Expression Omnibus and our previous paper. Meanwhile, Gene Ontology (GO) and pathway analysis were performed using Cytoscape plug-in BinGO and Database for Annotation, Visualization, and Integration Discovery (DAVID), respectively. We found that the lncRNA-miRNA-mRNA network was composed of 7 lncRNA nodes, 90 mRNA nodes, 24 miRNA nodes, and 301 edges. The functional assay showed that 147 GO terms and 23 pathways were enriched. In addition, three lncRNAs (S5645.1, XR_006437.1, J01878) were highly related to RA, and therefore, were selected as key lncRNAs. This study suggests that specific lncRNAs are associated with the development of RA, and three lncRNAs (S5645.1, XR_006437.1, J01878) could be used as potential diagnostic biomarkers and therapeutic targets.

  5. Identification of the miRNA-mRNA regulatory network of small cell osteosarcoma based on RNA-seq. (United States)

    Xie, Lin; Liao, Yedan; Shen, Lida; Hu, Fengdi; Yu, Sunlin; Zhou, Yonghong; Zhang, Ya; Yang, Yihao; Li, Dongqi; Ren, Minyan; Yuan, Zhongqin; Yang, Zuozhang


    Small cell osteosarcoma (SCO) is a rare subtype of osteosarcoma characterized by highly aggressive progression and a poor prognosis. The miRNA and mRNA expression profiles of peripheral blood mononuclear cells (PBMCs) were obtained in 3 patients with SCO and 10 healthy individuals using high-throughput RNA-sequencing. We identified 37 dysregulated miRNAs and 1636 dysregulated mRNAs in patients with SCO compared to the healthy controls. Specifically, the 37 dysregulated miRNAs consisted of 27 up-regulated miRNAs and 10 down-regulated miRNAs; the 1636 dysregulated mRNAs consisted of 555 up-regulated mRNAs and 1081 down-regulated mRNAs. The target-genes of miRNAs were predicted, and 1334 negative correlations between miRNAs and mRNAs were used to construct an miRNA-mRNA regulatory network. Dysregulated genes were significantly enriched in pathways related to cancer, mTOR signaling and cell cycle signaling. Specifically, hsa-miR-26b-5p, hsa-miR-221-3p and hsa-miR-125b-2-3p were significantly dysregulated miRNAs and exhibited a high degree of connectivity with target genes. Overall, the expression of dysregulated genes in tumor tissues and peripheral blood samples of patients with SCO measured by quantitative real-time polymerase chain reaction corroborated with our bioinformatics analyses based on the expression profiles of PBMCs from patients with SCO. Thus, hsa-miR-26b-5p, hsa-miR-221-3p and hsa-miR-125b-2-3p may be involved in SCO tumorigenesis.

  6. Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion (United States)

    Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.


    The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089

  7. Tunnel conductance of Watson-Crick nucleoside-base pairs from telegraph noise

    International Nuclear Information System (INIS)

    Chang Shuai; He Jin; Lin Lisha; Zhang Peiming; Liang Feng; Huang Shuo; Lindsay, Stuart; Young, Michael


    The use of tunneling signals to sequence DNA is presently hampered by the small tunnel conductance of a junction spanning an entire DNA molecule. The design of a readout system that uses a shorter tunneling path requires knowledge of the absolute conductance across base pairs. We have exploited the stochastic switching of hydrogen-bonded DNA base-nucleoside pairs trapped in a tunnel junction to determine the conductance of individual molecular pairs. This conductance is found to be sensitive to the geometry of the junction, but a subset of the data appears to come from unstrained molecular pairs. The conductances determined from these pairs are within a factor of two of the predictions of density functional calculations. The experimental data reproduces the counterintuitive theoretical prediction that guanine-deoxycytidine pairs (3 H-bonds) have a smaller conductance than adenine-thymine pairs (2 H-bonds). A bimodal distribution of switching lifetimes shows that both H-bonds and molecule-metal contacts break.

  8. Physical implementation of pair-based spike timing dependent plasticity

    International Nuclear Information System (INIS)

    Azghadi, M.R.; Al-Sarawi, S.; Iannella, N.; Abbott, D.


    Full text: Objective Spike-timing-dependent plasticity (STOP) is one of several plasticity rules which leads to learning and memory in the brain. STOP induces synaptic weight changes based on the timing of the pre- and post-synaptic neurons. A neural network which can mimic the adaptive capability of biological brains in the temporal domain, requires the weight of single connections to be altered by spike timing. To physically realise this network into silicon, a large number of interconnected STOP circuits on the same substrate is required. This imposes two significant limitations in terms of power and area. To cover these limitations, very large scale integrated circuit (VLSI) technology provides attractive features in terms of low power and small area requirements. An example is demonstrated by (lndiveli et al. 2006). The objective of this paper is to present a new implementation of the STOP circuit which demonstrates better power and area in comparison to previous implementations. Methods The proposed circuit uses complementary metal oxide semiconductor (CMOS) technology as depicted in Fig. I. The synaptic weight can be stored on a capacitor and charging/discharging current can lead to potentiation and depression. HSpice simulation results demonstrate that the average power, peak power, and area of the proposed circuit have been reduced by 6, 8 and 15%, respectively, in comparison with Indiveri's implementation. These improvements naturally lead to packing more STOP circuits onto the same substrate, when compared to previous proposals. Hence, this new implementation is quite interesting for real-world large neural networks.

  9. Community Mining Method of Label Propagation Based on Dense Pairs

    Directory of Open Access Journals (Sweden)

    WENG Wei


    Full Text Available In recent years, with the popularity of handheld Internet equipments like mobile phones, increasing numbers of people are becoming involved in the virtual social network. Because of its large amount of data and complex structure, the network faces new challenges of community mining. A label propagation algorithm with low time complexity and without prior parameters deals easily with a large networks. This study explored a new method of community mining, based on label propagation with two stages. The first stage involved identifying closely linked nodes according to their local adjacency relations that gave rise to a micro-community. The second stage involved expanding and adjusting this community through a label propagation algorithm (LPA to finally obtain the community structure of the entire social network. This algorithm reduced the number of initial labels and avoided the merging of small communities in general LPAs. Thus, the quality of community discovery was improved, and the linear time complexity of the LPA was maintained.

  10. ‘N-of-1-pathways’ unveils personal deregulated mechanisms from a single pair of RNA-Seq samples: towards precision medicine (United States)

    Gardeux, Vincent; Achour, Ikbel; Li, Jianrong; Maienschein-Cline, Mark; Li, Haiquan; Pesce, Lorenzo; Parinandi, Gurunadh; Bahroos, Neil; Winn, Robert; Foster, Ian; Garcia, Joe G N; Lussier, Yves A


    Background The emergence of precision medicine allowed the incorporation of individual molecular data into patient care. Indeed, DNA sequencing predicts somatic mutations in individual patients. However, these genetic features overlook dynamic epigenetic and phenotypic response to therapy. Meanwhile, accurate personal transcriptome interpretation remains an unmet challenge. Further, N-of-1 (single-subject) efficacy trials are increasingly pursued, but are underpowered for molecular marker discovery. Method ‘N-of-1-pathways’ is a global framework relying on three principles: (i) the statistical universe is a single patient; (ii) significance is derived from geneset/biomodules powered by paired samples from the same patient; and (iii) similarity between genesets/biomodules assesses commonality and differences, within-study and cross-studies. Thus, patient gene-level profiles are transformed into deregulated pathways. From RNA-Seq of 55 lung adenocarcinoma patients, N-of-1-pathways predicts the deregulated pathways of each patient. Results Cross-patient N-of-1-pathways obtains comparable results with conventional genesets enrichment analysis (GSEA) and differentially expressed gene (DEG) enrichment, validated in three external evaluations. Moreover, heatmap and star plots highlight both individual and shared mechanisms ranging from molecular to organ-systems levels (eg, DNA repair, signaling, immune response). Patients were ranked based on the similarity of their deregulated mechanisms to those of an independent gold standard, generating unsupervised clusters of diametric extreme survival phenotypes (p=0.03). Conclusions The N-of-1-pathways framework provides a robust statistical and relevant biological interpretation of individual disease-free survival that is often overlooked in conventional cross-patient studies. It enables mechanism-level classifiers with smaller cohorts as well as N-of-1 studies. Software

  11. ALKBH8-mediated formation of a novel diastereomeric pair of wobble nucleosides in mammalian tRNA

    DEFF Research Database (Denmark)

    van den Born, E.; Vagbo, C. B.; Songe-Moller, L.


    Mammals have nine different homologues (ALKBH1-9) of the Escherichia coli DNA repair demethylase AlkB. ALKBH2 is a genuine DNA repair enzyme, but the in vivo function of the other ALKBH proteins has remained elusive. It was recently shown that ALKBH8 contains an additional transfer RNA ( t...

  12. Sequence-specific inhibition of Dicer measured with a force-based microarray for RNA ligands. (United States)

    Limmer, Katja; Aschenbrenner, Daniela; Gaub, Hermann E


    Malfunction of protein translation causes many severe diseases, and suitable correction strategies may become the basis of effective therapies. One major regulatory element of protein translation is the nuclease Dicer that cuts double-stranded RNA independently of the sequence into pieces of 19-22 base pairs starting the RNA interference pathway and activating miRNAs. Inhibiting Dicer is not desirable owing to its multifunctional influence on the cell's gene regulation. Blocking specific RNA sequences by small-molecule binding, however, is a promising approach to affect the cell's condition in a controlled manner. A label-free assay for the screening of site-specific interference of small molecules with Dicer activity is thus needed. We used the Molecular Force Assay (MFA), recently developed in our lab, to measure the activity of Dicer. As a model system, we used an RNA sequence that forms an aptamer-binding site for paromomycin, a 615-dalton aminoglycoside. We show that Dicer activity is modulated as a function of concentration and incubation time: the addition of paromomycin leads to a decrease of Dicer activity according to the amount of ligand. The measured dissociation constant of paromomycin to its aptamer was found to agree well with literature values. The parallel format of the MFA allows a large-scale search and analysis for ligands for any RNA sequence.

  13. General enumeration of RNA secondary structures based on new ...

    African Journals Online (AJOL)

    Crick base pairs between AU and GC. Based on the new representation, this paper also computes the number of various types of constrained secondary structures taking the minimum stack length 1 and minimum size m for each bonding loop as ...

  14. Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide. (United States)

    Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki


    We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

  15. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone. (United States)

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul


    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. An entropy-based improved k-top scoring pairs (TSP) method for ...

    African Journals Online (AJOL)

    An entropy-based improved k-top scoring pairs (TSP) (Ik-TSP) method was presented in this study for the classification and prediction of human cancers based on gene-expression data. We compared Ik-TSP classifiers with 5 different machine learning methods and the k-TSP method based on 3 different feature selection ...

  17. A statistic to estimate the variance of the histogram-based mutual information estimator based on dependent pairs of observations

    NARCIS (Netherlands)

    Moddemeijer, R

    In the case of two signals with independent pairs of observations (x(n),y(n)) a statistic to estimate the variance of the histogram based mutual information estimator has been derived earlier. We present such a statistic for dependent pairs. To derive this statistic it is necessary to avail of a

  18. SELEX-Based Screening of Exosome-Tropic RNA. (United States)

    Yamashita, Takuma; Shinotsuka, Haruka; Takahashi, Yuki; Kato, Kana; Nishikawa, Makiya; Takakura, Yoshinobu


    Cell-derived nanosized vesicles or exosomes are expected to become delivery carriers for functional RNAs, such as small interfering RNA (siRNA). A method to efficiently load functional RNAs into exosomes is required for the development of exosome-based delivery carriers of functional RNAs. However, there is no method to find exosome-tropic exogenous RNA sequences. In this study, we used a systematic evolution of ligands by exponential enrichment (SELEX) method to screen exosome-tropic RNAs that can be used to load functional RNAs into exosomes by conjugation. Pooled single stranded 80-base RNAs, each of which contains a randomized 40-base sequence, were transfected into B16-BL6 murine melanoma cells and exosomes were collected from the cells. RNAs extracted from the exosomes were subjected to next round of SELEX. Cloning and sequencing of RNAs in SELEX-screened RNA pools showed that 29 of 56 clones had a typical RNA sequence. The sequence found by SELEX was enriched in exosomes after transfection to B16-BL6 cells. The results show that the SELEX-based method can be used for screening of exosome-tropic RNAs.

  19. Generation of arbitrary vector fields based on a pair of orthogonal elliptically polarized base vectors. (United States)

    Xu, Danfeng; Gu, Bing; Rui, Guanghao; Zhan, Qiwen; Cui, Yiping


    We present an arbitrary vector field with hybrid polarization based on the combination of a pair of orthogonal elliptically polarized base vectors on the Poincaré sphere. It is shown that the created vector field is only dependent on the latitude angle 2χ but is independent on the longitude angle 2ψ on the Poincaré sphere. By adjusting the latitude angle 2χ, which is related to two identical waveplates in a common path interferometric arrangement, one could obtain arbitrary type of vector fields. Experimentally, we demonstrate the generation of such kind of vector fields and confirm the distribution of state of polarization by the measurement of Stokes parameters. Besides, we investigate the tight focusing properties of these vector fields. It is found that the additional degree of freedom 2χ provided by arbitrary vector field with hybrid polarization allows one to control the spatial structure of polarization and to engineer the focusing field.

  20. Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate. (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki


    The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

  1. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate (United States)

    Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki


    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson–Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo. PMID:24399194

  2. Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands (United States)

    Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree


    In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.

  3. Size and Base Composition of RNA in Supercoiled Plasmid DNA (United States)

    Williams, Peter H.; Boyer, Herbert W.; Helinski, Donald R.


    The average size and base composition of the covalently integrated RNA segment in supercoiled ColE1 DNA synthesized in Escherichia coli in the presence of chloramphenicol (CM-ColE1 DNA) have been determined by two independent methods. The two approaches yielded similar results, indicating that the RNA segment in CM-ColE1 DNA contains GMP at the 5′ end and comprises on the average 25 to 26 ribonucleotides with a base composition of 10-11 G, 3 A, 5-6 C, and 6-7 U. PMID:4359488


    Ostankova, Yu V; Semenov, A V; Stoyanova, N A; Tokarevich, N K; Lyubimova, N E; Petrova, O A; Ananina, Yu V; Petrov, E M


    Comparative typing of Leptospira spp. strain collection based on analysis of 16S RNA fragment. 2 pairs of primers were used for PCR, that jointly flank 1423b.p. sized fragment. Sequences of Leptospira spp. strain 16S rRNA, presented in the international database, were used for phylogenetic analysis. A high similarity, including interspecies, of the 16S fragment in Leptospira spp. strains was shown independently of the source, serovar and serogroup. Heterogeneity of the primary matrix, spontaneous mutations of hotspots and erroneous nucleotide couplings, characteristic for 16S sequence of pathogenic Leptospira spp. strains, are discussed. Molecular-genetic characteristic of certain reference Leptospira spp. strains by 16S sequence is obtained. Results of the studies give evidence on expedience of introduction into clinical practice of identification of Leptospira spp. by 16S sequence directly from the clinical material, that would allow to significantly reduce identification time, dismiss complex type-specific sera and other labor-intensive methods.

  5. Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

    KAUST Repository

    Chawla, Mohit


    The fluorescent non-natural 4-aminophthalimide (4AP) base, when paired to the complementary 2,4-diaminopyrimidine (DAP) nucleobase, is accommodated in a B-DNA duplex being efficiently recognized and incorporated by DNA polymerases. To complement the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM calculations were initially focused on the geometry and energetics of the 4AP:DAP non-natural pair and of H-bonded base pairs between 4AP and all the natural bases in their classical Watson-Crick geometries. The QM calculations indicate that the 4AP:DAP pair, despite the fact that it can form 3 H-bonds in a classic Watson-Crick geometry, has a stability comparable to the A:T pair. Then, we extended the study to reverse Watson-Crick geometries, characteristic of parallel strands. MD simulations were carried out on two 13-mer DNA duplexes, featuring a central 4AP:DAP or A:T pair, respectively. No major structural deformation of the duplex was observed during the MD simulation. Snapshots from the MD simulations were subjected to QM calculations to investigate the 4AP:DAP interaction energy when embedded into a duplex structure, and to investigate the impact of the two non-natural bases on the stacking interactions with adjacent bases in the DNA duplex. We found a slight increase in stacking interactions involving the 4AP:DAP pair, counterbalanced by a moderate decrease in H-bonding interactions of the 4AP:DAP and of the adjacent base pairs in the duplex. The results of our study are in agreement with experimental data and complement them by providing an insight into which factors contribute positively and which factors contribute negatively to the structural compatibility of the fluorescent 4AP:DAP pair with a B-DNA structure.

  6. Literature-based condition-specific miRNA-mRNA target prediction.

    Directory of Open Access Journals (Sweden)

    Minsik Oh

    Full Text Available miRNAs are small non-coding RNAs that regulate gene expression by binding to the 3'-UTR of genes. Many recent studies have reported that miRNAs play important biological roles by regulating specific mRNAs or genes. Many sequence-based target prediction algorithms have been developed to predict miRNA targets. However, these methods are not designed for condition-specific target predictions and produce many false positives; thus, expression-based target prediction algorithms have been developed for condition-specific target predictions. A typical strategy to utilize expression data is to leverage the negative control roles of miRNAs on genes. To control false positives, a stringent cutoff value is typically set, but in this case, these methods tend to reject many true target relationships, i.e., false negatives. To overcome these limitations, additional information should be utilized. The literature is probably the best resource that we can utilize. Recent literature mining systems compile millions of articles with experiments designed for specific biological questions, and the systems provide a function to search for specific information. To utilize the literature information, we used a literature mining system, BEST, that automatically extracts information from the literature in PubMed and that allows the user to perform searches of the literature with any English words. By integrating omics data analysis methods and BEST, we developed Context-MMIA, a miRNA-mRNA target prediction method that combines expression data analysis results and the literature information extracted based on the user-specified context. In the pathway enrichment analysis using genes included in the top 200 miRNA-targets, Context-MMIA outperformed the four existing target prediction methods that we tested. In another test on whether prediction methods can re-produce experimentally validated target relationships, Context-MMIA outperformed the four existing target prediction

  7. A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs

    International Nuclear Information System (INIS)

    Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.


    Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.

  8. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine. (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O'Neil, Ian A; Iwanejko, Lesley A; Bates, Andrew D; Cosstick, Richard


    8-Nitro-2'-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2'-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2'-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson-Crick pair.

  9. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine† (United States)

    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard


    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesion, which is sufficiently stable to be incorporated into ODNs. Physicochemical studies demonstrated that 8-nitro-2′-O-methylguanosine adopts a syn conformation about the glycosidic bond; thermal melting studies and molecular modelling suggest a relatively stable syn-8-nitroG·anti-G base pair. Interestingly, when this lesion analogue was placed in a primer-template system, extension of the primer by either avian myeloblastosis virus reverse transcriptase (AMV-RT) or human DNA polymerase β (pol β), was significantly impaired, but where incorporation opposite 8-nitroguanine did occur, pol β showed a 2:1 preference to insert dA over dC, while AMV-RT incorporated predominantly dC. The fact that no 8-nitroG·G base pairing is seen in the primer extension products suggests that the polymerases may discriminate against this pairing system on the basis of its poor geometric match to a Watson–Crick pair. PMID:22965127

  10. DNA/RNA-based formulations for treatment of breast cancer. (United States)

    Xie, Zhaolu; Zeng, Xianghui


    To develop a successful formulation for the gene therapy of breast cancer, an effective therapeutic nucleic acid and a proper delivery system are essential. Increased understanding of breast cancer, and developments in biotechnology, material science and nanotechnology have provided a major impetus in the development of effective formulations for the gene therapy of breast cancer. Areas covered: We discuss DNA/RNA-based formulations that can inhibit the growth of breast cancer cells and control the progress of breast cancer. Targets for the gene therapy of breast cancer, DNA/RNA-based therapeutics and delivery systems are summarized. And examples of successful DNA/RNA-based formulations for breast cancer gene therapy are reviewed. Expert opinion: Several challenges remain in developing effective DNA/RNA-based formulations for treatment of breast cancer. Firstly, most of the currently utilized targets are not effective enough as monotherapy for breast cancer. Secondly, the requirements for co-delivery system make the preparation of formulation more complicated. Thirdly, nanoparticles with the modification of tumor-targeting ligands could be more unstable in circulation and normal tissues. Lastly, immune responses against the viral vectors are unfavorable for the gene therapy of breast cancer because of the damage to the host and the impaired therapeutic ability.

  11. Proto-ribosome: a theoretical approach based on RNA relics


    Demongeot, Jacques


    We describe in this paper, based on already published articles, a contribution to the theory postulating the existence of a proto-ribosome, which could have appeared early at the origin of life and we discuss the interest of this notion in an evolutionary perspective, taking into account the existence of possible RNA relics of this proto-ribosome.

  12. MITIE: Simultaneous RNA-Seq-based transcript identification and quantification in multiple samples. (United States)

    Behr, Jonas; Kahles, André; Zhong, Yi; Sreedharan, Vipin T; Drewe, Philipp; Rätsch, Gunnar


    High-throughput sequencing of mRNA (RNA-Seq) has led to tremendous improvements in the detection of expressed genes and reconstruction of RNA transcripts. However, the extensive dynamic range of gene expression, technical limitations and biases, as well as the observed complexity of the transcriptional landscape, pose profound computational challenges for transcriptome reconstruction. We present the novel framework MITIE (Mixed Integer Transcript IdEntification) for simultaneous transcript reconstruction and quantification. We define a likelihood function based on the negative binomial distribution, use a regularization approach to select a few transcripts collectively explaining the observed read data and show how to find the optimal solution using Mixed Integer Programming. MITIE can (i) take advantage of known transcripts, (ii) reconstruct and quantify transcripts simultaneously in multiple samples, and (iii) resolve the location of multi-mapping reads. It is designed for genome- and assembly-based transcriptome reconstruction. We present an extensive study based on realistic simulated RNA-Seq data. When compared with state-of-the-art approaches, MITIE proves to be significantly more sensitive and overall more accurate. Moreover, MITIE yields substantial performance gains when used with multiple samples. We applied our system to 38 Drosophila melanogaster modENCODE RNA-Seq libraries and estimated the sensitivity of reconstructing omitted transcript annotations and the specificity with respect to annotated transcripts. Our results corroborate that a well-motivated objective paired with appropriate optimization techniques lead to significant improvements over the state-of-the-art in transcriptome reconstruction. MITIE is implemented in C++ and is available from under the GPL license.

  13. Triple helical DNA in a duplex context and base pair opening (United States)

    Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra


    It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

  14. RNA-dependent RNA polymerase: Addressing Zika outbreak by a phylogeny-based drug target study. (United States)

    Stephen, Preyesh; Lin, Sheng-Xiang


    Since the first major outbreak of Zika virus (ZIKV) in 2007, ZIKV is spreading explosively through South and Central America, and recent reports in highly populated developing countries alarm the possibility of a more catastrophic outbreak. ZIKV infection in pregnant women leads to embryonic microcephaly and Guillain-Barré syndrome in adults. At present, there is limited understanding of the infectious mechanism, and no approved therapy has been reported. Despite the withdrawal of public health emergency, the WHO still considers the ZIKV as a highly significant and long-term public health challenge that the situation has to be addressed rapidly. Non-structural protein 5 is essential for capping and replication of viral RNA and comprises a methyltransferase and RNA-dependent RNA polymerase (RdRp) domain. We used molecular modeling to obtain the structure of ZIKV RdRp, and by molecular docking and phylogeny analysis, we here demonstrate the potential sites for drug screening. Two metal binding sites and an NS3-interacting region in ZIKV RdRp are demonstrated as potential drug screening sites. The docked structures reveal a remarkable degree of conservation at the substrate binding site and the potential drug screening sites. A phylogeny-based approach is provided for an emergency preparedness, where similar class of ligands could target phylogenetically related proteins. © 2017 John Wiley & Sons A/S.

  15. Determination of an effective scoring function for RNA-RNA interactions with a physics-based double-iterative method. (United States)

    Yan, Yumeng; Wen, Zeyu; Zhang, Di; Huang, Sheng-You


    RNA-RNA interactions play fundamental roles in gene and cell regulation. Therefore, accurate prediction of RNA-RNA interactions is critical to determine their complex structures and understand the molecular mechanism of the interactions. Here, we have developed a physics-based double-iterative strategy to determine the effective potentials for RNA-RNA interactions based on a training set of 97 diverse RNA-RNA complexes. The double-iterative strategy circumvented the reference state problem in knowledge-based scoring functions by updating the potentials through iteration and also overcame the decoy-dependent limitation in previous iterative methods by constructing the decoys iteratively. The derived scoring function, which is referred to as DITScoreRR, was evaluated on an RNA-RNA docking benchmark of 60 test cases and compared with three other scoring functions. It was shown that for bound docking, our scoring function DITScoreRR obtained the excellent success rates of 90% and 98.3% in binding mode predictions when the top 1 and 10 predictions were considered, compared to 63.3% and 71.7% for van der Waals interactions, 45.0% and 65.0% for ITScorePP, and 11.7% and 26.7% for ZDOCK 2.1, respectively. For unbound docking, DITScoreRR achieved the good success rates of 53.3% and 71.7% in binding mode predictions when the top 1 and 10 predictions were considered, compared to 13.3% and 28.3% for van der Waals interactions, 11.7% and 26.7% for our ITScorePP, and 3.3% and 6.7% for ZDOCK 2.1, respectively. DITScoreRR also performed significantly better in ranking decoys and obtained significantly higher score-RMSD correlations than the other three scoring functions. DITScoreRR will be of great value for the prediction and design of RNA structures and RNA-RNA complexes.

  16. Concealed d-wave pairs in the s± condensate of iron-based superconductors. (United States)

    Ong, Tzen; Coleman, Piers; Schmalian, Jörg


    A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.

  17. The Influence of the Thymine C5 Methyl Group on Spontaneous Base Pair Breathing in DNA

    Czech Academy of Sciences Publication Activity Database

    Wärmländer, S.; Šponer, Jiří; Leijon, M.; Šponer, Judit E.


    Roč. 277, č. 32 (2002), s. 28491-28497 ISSN 0021-9258 R&D Projects: GA MŠk LN00A016 Institutional research plan: CEZ:AV0Z4040901 Keywords : thymine * DNA * base pairs Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.696, year: 2002

  18. Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.


    We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a

  19. Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study

    NARCIS (Netherlands)

    Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.


    We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure

  20. Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment

    NARCIS (Netherlands)

    Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.


    Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)

  1. Metalophillic attraction in the consecutive T-HgII-T DNA base pairs

    Czech Academy of Sciences Publication Activity Database

    Benda, Ladislav; Straka, Michal; Bouř, Petr; Tanaka, Y.; Sychrovský, Vladimír


    Roč. 12, č. 1 (2012), s. 50-50 ISSN 1210-8529. [10th Discussions in Structural Molecular Biology. 22.03.2012-24.03.2012, Nové Hrady] Institutional research plan: CEZ:AV0Z40550506 Keywords : T-HgII-T * DNA base pairs Subject RIV: CF - Physical ; Theoretical Chemistry

  2. Time series regression-based pairs trading in the Korean equities market (United States)

    Kim, Saejoon; Heo, Jun


    Pairs trading is an instance of statistical arbitrage that relies on heavy quantitative data analysis to profit by capitalising low-risk trading opportunities provided by anomalies of related assets. A key element in pairs trading is the rule by which open and close trading triggers are defined. This paper investigates the use of time series regression to define the rule which has previously been identified with fixed threshold-based approaches. Empirical results indicate that our approach may yield significantly increased excess returns compared to ones obtained by previous approaches on large capitalisation stocks in the Korean equities market.

  3. Cleavage of influenza RNA by using a human PUF-based artificial RNA-binding protein–staphylococcal nuclease hybrid

    International Nuclear Information System (INIS)

    Mori, Tomoaki; Nakamura, Kento; Masaoka, Keisuke; Fujita, Yusuke; Morisada, Ryosuke; Mori, Koichi; Tobimatsu, Takamasa; Sera, Takashi


    Various viruses infect animals and humans and cause a variety of diseases, including cancer. However, effective methodologies to prevent virus infection have not yet been established. Therefore, development of technologies to inactivate viruses is highly desired. We have already demonstrated that cleavage of a DNA virus genome was effective to prevent its replication. Here, we expanded this methodology to RNA viruses. In the present study, we used staphylococcal nuclease (SNase) instead of the PIN domain (PilT N-terminus) of human SMG6 as an RNA-cleavage domain and fused the SNase to a human Pumilio/fem-3 binding factor (PUF)-based artificial RNA-binding protein to construct an artificial RNA restriction enzyme with enhanced RNA-cleavage rates for influenzavirus. The resulting SNase-fusion nuclease cleaved influenza RNA at rates 120-fold greater than the corresponding PIN-fusion nuclease. The cleaving ability of the PIN-fusion nuclease was not improved even though the linker moiety between the PUF and RNA-cleavage domain was changed. Gel shift assays revealed that the RNA-binding properties of the PUF derivative used was not as good as wild type PUF. Improvement of the binding properties or the design method will allow the SNase-fusion nuclease to cleave an RNA target in mammalian animal cells and/or organisms. - Highlights: • A novel RNA restriction enzyme using SNase was developed tor cleave viral RNA. • Our enzyme cleaved influenza RNA with rates >120-fold higher rates a PIN-fusion one. • Our artificial enzyme with the L5 linker showed the highest RNA cleavage rate. • Our artificial enzyme site-selectively cleaved influenza RNA in vitro.

  4. Co-LncRNA: investigating the lncRNA combinatorial effects in GO annotations and KEGG pathways based on human RNA-Seq data. (United States)

    Zhao, Zheng; Bai, Jing; Wu, Aiwei; Wang, Yuan; Zhang, Jinwen; Wang, Zishan; Li, Yongsheng; Xu, Juan; Li, Xia


    Long non-coding RNAs (lncRNAs) are emerging as key regulators of diverse biological processes and diseases. However, the combinatorial effects of these molecules in a specific biological function are poorly understood. Identifying co-expressed protein-coding genes of lncRNAs would provide ample insight into lncRNA functions. To facilitate such an effort, we have developed Co-LncRNA, which is a web-based computational tool that allows users to identify GO annotations and KEGG pathways that may be affected by co-expressed protein-coding genes of a single or multiple lncRNAs. LncRNA co-expressed protein-coding genes were first identified in publicly available human RNA-Seq datasets, including 241 datasets across 6560 total individuals representing 28 tissue types/cell lines. Then, the lncRNA combinatorial effects in a given GO annotations or KEGG pathways are taken into account by the simultaneous analysis of multiple lncRNAs in user-selected individual or multiple datasets, which is realized by enrichment analysis. In addition, this software provides a graphical overview of pathways that are modulated by lncRNAs, as well as a specific tool to display the relevant networks between lncRNAs and their co-expressed protein-coding genes. Co-LncRNA also supports users in uploading their own lncRNA and protein-coding gene expression profiles to investigate the lncRNA combinatorial effects. It will be continuously updated with more human RNA-Seq datasets on an annual basis. Taken together, Co-LncRNA provides a web-based application for investigating lncRNA combinatorial effects, which could shed light on their biological roles and could be a valuable resource for this community. Database URL: © The Author(s) 2015. Published by Oxford University Press.

  5. Nuclear factor 90 uses an ADAR2-like binding mode to recognize specific bases in dsRNA. (United States)

    Jayachandran, Uma; Grey, Heather; Cook, Atlanta G


    Nuclear factors 90 and 45 (NF90 and NF45) form a protein complex involved in the post-transcriptional control of many genes in vertebrates. NF90 is a member of the dsRNA binding domain (dsRBD) family of proteins. RNA binding partners identified so far include elements in 3' untranslated regions of specific mRNAs and several non-coding RNAs. In NF90, a tandem pair of dsRBDs separated by a natively unstructured segment confers dsRNA binding activity. We determined a crystal structure of the tandem dsRBDs of NF90 in complex with a synthetic dsRNA. This complex shows surprising similarity to the tandem dsRBDs from an adenosine-to-inosine editing enzyme, ADAR2 in complex with a substrate RNA. Residues involved in unusual base-specific recognition in the minor groove of dsRNA are conserved between NF90 and ADAR2. These data suggest that, like ADAR2, underlying sequences in dsRNA may influence how NF90 recognizes its target RNAs. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Aviram–Ratner rectifying mechanism for DNA base-pair sequencing through graphene nanogaps

    International Nuclear Information System (INIS)

    Agapito, Luis A; Gayles, Jacob; Wolowiec, Christian; Kioussis, Nicholas


    We demonstrate that biological molecules such as Watson–Crick DNA base pairs can behave as biological Aviram–Ratner electrical rectifiers because of the spatial separation and weak hydrogen bonding between the nucleobases. We have performed a parallel computational implementation of the ab initio non-equilibrium Green’s function (NEGF) theory to determine the electrical response of graphene—base-pair—graphene junctions. The results show an asymmetric (rectifying) current–voltage response for the cytosine–guanine base pair adsorbed on a graphene nanogap. In sharp contrast we find a symmetric response for the thymine–adenine case. We propose applying the asymmetry of the current–voltage response as a sensing criterion to the technological challenge of rapid DNA sequencing via graphene nanogaps. (paper)

  7. Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA. (United States)

    Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J


    The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.

  8. Watson-Crick base pairing controls excited-state decay in natural DNA. (United States)

    Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang


    Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Improved accuracy of multiple ncRNA alignment by incorporating structural information into a MAFFT-based framework

    Directory of Open Access Journals (Sweden)

    Toh Hiroyuki


    Full Text Available Abstract Background Structural alignment of RNAs is becoming important, since the discovery of functional non-coding RNAs (ncRNAs. Recent studies, mainly based on various approximations of the Sankoff algorithm, have resulted in considerable improvement in the accuracy of pairwise structural alignment. In contrast, for the cases with more than two sequences, the practical merit of structural alignment remains unclear as compared to traditional sequence-based methods, although the importance of multiple structural alignment is widely recognized. Results We took a different approach from a straightforward extension of the Sankoff algorithm to the multiple alignments from the viewpoints of accuracy and time complexity. As a new option of the MAFFT alignment program, we developed a multiple RNA alignment framework, X-INS-i, which builds a multiple alignment with an iterative method incorporating structural information through two components: (1 pairwise structural alignments by an external pairwise alignment method such as SCARNA or LaRA and (2 a new objective function, Four-way Consistency, derived from the base-pairing probability of every sub-aligned group at every multiple alignment stage. Conclusion The BRAliBASE benchmark showed that X-INS-i outperforms other methods currently available in the sum-of-pairs score (SPS criterion. As a basis for predicting common secondary structure, the accuracy of the present method is comparable to or rather higher than those of the current leading methods such as RNA Sampler. The X-INS-i framework can be used for building a multiple RNA alignment from any combination of algorithms for pairwise RNA alignment and base-pairing probability. The source code is available at the webpage found in the Availability and requirements section.

  10. Energy Landscape and Pathways for Transitions between Watson-Crick and Hoogsteen Base Pairing in DNA. (United States)

    Chakraborty, Debayan; Wales, David J


    The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.

  11. Hydrogen bond disruption in DNA base pairs from (14)C transmutation. (United States)

    Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A


    Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.

  12. Enhanced Stability of DNA Nanostructures by Incorporation of Unnatural Base Pairs. (United States)

    Liu, Qing; Liu, Guocheng; Wang, Ting; Fu, Jing; Li, Rujiao; Song, Linlin; Wang, Zhen-Gang; Ding, Baoquan; Chen, Fei


    Self-assembled DNA nanostructures hold great promise in the fields of nanofabrication, biosensing and nanomedicine. However, the inherent low stability of the DNA double helices, formed by weak interactions, largely hinders the assembly and functions of DNA nanostructures. In this study, we redesigned and constructed a six-arm DNA junction by incorporation of the unnatural base pairs 5-Me-isoC/isoG and A/2-thioT into the double helices. They not only retained the structural integrity of the DNA nanostructure, but also showed enhanced thermal stability and resistance to T7 Exonuclease digestion. This research may expand the applications of DNA nanostructures in nanofabrication and biomedical fields, and furthermore, the genetic alphabet expansion with unnatural base pairs may enable us to construct more complicated and diversified self-assembled DNA nanostructures. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs. (United States)

    Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M


    The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

  14. Array based Discovery of Aptamer Pairs (Open Access Publisher’s Version) (United States)


    Array-based Discovery of Aptamer Pairs Minseon Cho,†,‡ Seung Soo Oh,‡ Jeff Nie,§ Ron Stewart,§ Monte J. Radeke,⊥ Michael Eisenstein ,†,‡ Peter J...ac504076k | Anal. Chem. 2015, 87, 821−828827 (24) Cho, M.; Oh, S. S.; Nie, J.; Stewart, R.; Eisenstein , M.; Chambers, J.; Marth, J. D.; Walker, F

  15. DNA electronic circular dichroism on the inter-base pair scale

    DEFF Research Database (Denmark)

    Di Meo, Florent; Nørby, Morten Steen; Rubio-Magnieto, Jenifer


    A successful elucidation of the near-ultraviolet electronic circular dichroism spectrum of a short double-stranded DNA is reported. Time-dependent density functional theory methods are shown to accurately predict spectra and assign bands on the microscopic base-pair scale, a finding that opens...... the field for using circular dichroism spectroscopy as a sensitive nanoscale probe of DNA to reveal its complex interactions with the environment. (Chemical Equation Presented)....

  16. Non-standard base pairing and stacked structures in methyl xanthine clusters

    Czech Academy of Sciences Publication Activity Database

    Callahan, M. P.; Gengeliczki, Z.; Svadlenak, N.; Valdes, Haydee; Hobza, Pavel; de Vries, M. S.


    Roč. 10, č. 19 (2008), s. 2819-2826 ISSN 1463-9076 R&D Projects: GA MŠk LC512 Grant - others:NSF(US) CHE-0615401 Institutional research plan: CEZ:AV0Z40550506 Keywords : non-standard base pairing * stacked structures * in methyl xanthine Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.064, year: 2008

  17. Paired-Associate and Feedback-Based Weather Prediction Tasks Support Multiple Category Learning Systems


    Li, Kaiyun; Fu, Qiufang; Sun, Xunwei; Zhou, Xiaoyan; Fu, Xiaolan


    It remains unclear whether probabilistic category learning in the feedback-based weather prediction task (FB-WPT) can be mediated by a non-declarative or procedural learning system. To address this issue, we compared the effects of training time and verbal working memory, which influence the declarative learning system but not the non-declarative learning system, in the FB and paired-associate (PA) WPTs, as the PA task recruits a declarative learning system. The results of Experiment 1 showed...

  18. Thermodynamic and structural properties of the specific binding between Ag⁺ ion and C:C mismatched base pair in duplex DNA to form C-Ag-C metal-mediated base pair. (United States)

    Torigoe, Hidetaka; Okamoto, Itaru; Dairaku, Takenori; Tanaka, Yoshiyuki; Ono, Akira; Kozasa, Tetsuo


    Metal ion-nucleic acid interactions have attracted considerable interest for their involvement in structure formation and catalytic activity of nucleic acids. Although interactions between metal ion and mismatched base pair duplex are important to understand mechanism of gene mutations related to heavy metal ions, they have not been well-characterized. We recently found that the Ag(+) ion stabilized a C:C mismatched base pair duplex DNA. A C-Ag-C metal-mediated base pair was supposed to be formed by the binding between the Ag(+) ion and the C:C mismatched base pair to stabilize the duplex. Here, we examined specificity, thermodynamics and structure of possible C-Ag-C metal-mediated base pair. UV melting indicated that only the duplex with the C:C mismatched base pair, and not of the duplexes with the perfectly matched and other mismatched base pairs, was specifically stabilized on adding the Ag(+) ion. Isothermal titration calorimetry demonstrated that the Ag(+) ion specifically bound with the C:C base pair at 1:1 molar ratio with a binding constant of 10(6) M(-1), which was significantly larger than those for nonspecific metal ion-DNA interactions. Electrospray ionization mass spectrometry also supported the specific 1:1 binding between the Ag(+) ion and the C:C base pair. Circular dichroism spectroscopy and NMR revealed that the Ag(+) ion may bind with the N3 positions of the C:C base pair without distorting the higher-order structure of the duplex. We conclude that the specific formation of C-Ag-C base pair with large binding affinity would provide a binding mode of metal ion-DNA interactions, similar to that of the previously reported T-Hg-T base pair. The C-Ag-C base pair may be useful not only for understanding of molecular mechanism of gene mutations related to heavy metal ions but also for wide variety of potential applications of metal-mediated base pairs in various fields, such as material, life and environmental sciences. Copyright © 2012 Elsevier

  19. Solid state radiation chemistry of co-crystallized DNA base pairs studied with EPR and ENDOR

    International Nuclear Information System (INIS)

    Nelson, W.H.; Nimmala, S.; Hole, E.O.; Sagstuen, E.; Close, D.M.


    For a number of years, the authors' group has focused on identification of radicals formed from x-irradiation of DNA components by application of EPR and ENDOR spectroscopic techniques to samples in the form of single crystals. With single crystals as samples, it is possible to use the detailed packing and structural information available from x-ray or neutron diffraction reports. This report summarizes results from two crystal systems in which DNA bases are paired by hydrogen bonding. Extensive results are available from one of these, 1-methyl-thymine:9-methyladenine (MTMA), in which the base pairing is the Hoogsteen configuration. Although this configuration is different from that found by Watson-Crick in DNA, nonetheless the hydrogen bond between T(O4) and A(NH 2 ) is present. Although MTMA crystals have been studied previously, the objective was to apply the high-resolution technique of ENDOR to crystals irradiated and studied at temperatures of 10 K or lower in the effort to obtain direct evidence for specific proton transfers. The second system, from which the results are only preliminary, is 9-ethylguanine:1-methyl-5-fluorocytosine (GFC) in which the G:C bases pair is in the Watson Crick configuration. Both crystal systems are anhydrous, so the results include no possible effects from water interactions

  20. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    International Nuclear Information System (INIS)

    Swasey, Steven M; Gwinn, Elisabeth G


    The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)

  1. A stable RNA virus-based vector for citrus trees

    International Nuclear Information System (INIS)

    Folimonov, Alexey S.; Folimonova, Svetlana Y.; Bar-Joseph, Moshe; Dawson, William O.


    Virus-based vectors are important tools in plant molecular biology and plant genomics. A number of vectors based on viruses that infect herbaceous plants are in use for expression or silencing of genes in plants as well as screening unknown sequences for function. Yet there is a need for useful virus-based vectors for woody plants, which demand much greater stability because of the longer time required for systemic infection and analysis. We examined several strategies to develop a Citrus tristeza virus (CTV)-based vector for transient expression of foreign genes in citrus trees using a green fluorescent protein (GFP) as a reporter. These strategies included substitution of the p13 open reading frame (ORF) by the ORF of GFP, construction of a self-processing fusion of GFP in-frame with the major coat protein (CP), or expression of the GFP ORF as an extra gene from a subgenomic (sg) mRNA controlled either by a duplicated CTV CP sgRNA controller element (CE) or an introduced heterologous CE of Beet yellows virus. Engineered vector constructs were examined for replication, encapsidation, GFP expression during multiple passages in protoplasts, and for their ability to infect, move, express GFP, and be maintained in citrus plants. The most successful vectors based on the 'add-a-gene' strategy have been unusually stable, continuing to produce GFP fluorescence after more than 4 years in citrus trees

  2. Measurement and Theory of Hydrogen Bonding Contribution to Isosteric DNA Base Pairs


    Khakshoor, Omid; Wheeler, Steven E.; Houk, K. N.; Kool, Eric T.


    We address the recent debate surrounding the ability of 2,4-difluorotoluene (F), a low-polarity mimic of thymine (T), to form a hydrogen-bonded complex with adenine in DNA. The hydrogen bonding ability of F has been characterized as small to zero in various experimental studies, and moderate to small in computational studies. However, recent X-ray crystallographic studies of difluorotoluene in DNA/RNA have indicated, based on interatomic distances, possible hydrogen bonding interactions betwe...

  3. Base Pair Fraying in Molecular Dynamics Simulations of DNA and RNA

    Czech Academy of Sciences Publication Activity Database

    Zgarbová, M.; Otyepka, Michal; Šponer, Jiří; Lankaš, Filip; Jurečka, P.


    Roč. 10, č. 8 (2014), s. 3177-3189 ISSN 1549-9618 Grant - others:GA ČR(CZ) GP14-29874P Institutional support: RVO:68081707 ; RVO:61388963 Keywords : QUANTUM-CHEMICAL COMPUTATIONS * NUCLEIC-ACID STRUCTURES * AMBER FORCE-FIELD Subject RIV: BO - Biophysics; CC - Organic Chemistry (UOCHB-X) Impact factor: 5.498, year: 2014

  4. Natural RNA circles function as efficient microRNA sponges

    DEFF Research Database (Denmark)

    Hansen, Thomas Birkballe; Jensen, Trine I; Clausen, Bettina Hjelm


    MicroRNAs (miRNAs) are important post-transcriptional regulators of gene expression that act by direct base pairing to target sites within untranslated regions of messenger RNAs. Recently, miRNA activity has been shown to be affected by the presence of miRNA sponge transcripts, the so-called comp......MicroRNAs (miRNAs) are important post-transcriptional regulators of gene expression that act by direct base pairing to target sites within untranslated regions of messenger RNAs. Recently, miRNA activity has been shown to be affected by the presence of miRNA sponge transcripts, the so......-called competing endogenous RNA in humans and target mimicry in plants. We previously identified a highly expressed circular RNA (circRNA) in human and mouse brain. Here we show that this circRNA acts as a miR-7 sponge; we term this circular transcript ciRS-7 (circular RNA sponge for miR-7). ciRS-7 contains more...... sponge, suggesting that miRNA sponge effects achieved by circRNA formation are a general phenomenon. This study serves as the first, to our knowledge, functional analysis of a naturally expressed circRNA....

  5. Enhancement of single guide RNA transcription for efficient CRISPR/Cas-based genomic engineering. (United States)

    Ui-Tei, Kumiko; Maruyama, Shohei; Nakano, Yuko


    Genomic engineering using clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) protein is a promising approach for targeting the genomic DNA of virtually any organism in a sequence-specific manner. Recent remarkable advances in CRISPR/Cas technology have made it a feasible system for use in therapeutic applications and biotechnology. In the CRISPR/Cas system, a guide RNA (gRNA), interacting with the Cas protein, recognizes a genomic region with sequence complementarity, and the double-stranded DNA at the target site is cleaved by the Cas protein. A widely used gRNA is an RNA polymerase III (pol III)-driven single gRNA (sgRNA), which is produced by artificial fusion of CRISPR RNA (crRNA) and trans-activation crRNA (tracrRNA). However, we identified a TTTT stretch, known as a termination signal of RNA pol III, in the scaffold region of the sgRNA. Here, we revealed that sgRNA carrying a TTTT stretch reduces the efficiency of sgRNA transcription due to premature transcriptional termination, and decreases the efficiency of genome editing. Unexpectedly, it was also shown that the premature terminated sgRNA may have an adverse effect of inducing RNA interference. Such disadvantageous effects were avoided by substituting one base in the TTTT stretch.

  6. Signatures of RNA binding proteins globally coupled to effective microRNA target sites

    DEFF Research Database (Denmark)

    Jacobsen, Anders; Wen, Jiayu; Marks, Debora S


    MicroRNAs (miRNAs) and small interfering RNAs (siRNAs), bound to Argonaute proteins (RISC), destabilize mRNAs through base-pairing with the mRNA. However, the gene expression changes after perturbations of these small RNAs are only partially explained by predicted miRNA/siRNA targeting. Targeting...

  7. RNA interference-based therapeutics for human immunodeficiency virus HIV-1 treatment: synthetic siRNA or vector-based shRNA? (United States)

    Subramanya, Sandesh; Kim, Sang-Soo; Manjunath, N; Shankar, Premlata


    Despite the clinical benefits of highly active antiretroviral therapy (HAART), the prospect of life-long antiretroviral treatment poses significant problems, which has spurred interest in developing new drugs and strategies to treat HIV infection and eliminate persistent viral reservoirs. RNAi has emerged as a therapeutic possibility for HIV. We discuss progress in overcoming hurdles to translating transient and stable RNAi enabling technologies to clinical application for HIV; covering the past 2 - 3 years. HIV inhibition can be achieved by transfection of chemically or enzymatically synthesized siRNAs or by DNA-based vector systems expressing short hairpin RNAs (shRNAs) that are processed intracellularly into siRNA. We compare these approaches, focusing on technical and safety issues that will guide the choice of strategy for clinical use. Introduction of synthetic siRNA into cells or its stable endogenous production using vector-driven shRNA have been shown to suppress HIV replication in vitro and, in some instances, in vivo. Each method has advantages and limitations in terms of ease of delivery, duration of silencing, emergence of escape mutants and potential toxicity. Both appear to have potential as future therapeutics for HIV, once the technical and safety issues of each approach are overcome.

  8. The analysis of photon pair source at telecom wavelength based on the BBO crystal (Conference Presentation) (United States)

    Gajewski, Andrzej; Kolenderski, Piotr L.


    There are several problems that must be solved in order to increase the distance of quantum communication protocols based on photons as an information carriers. One of them is the dispersion, whose effects can be minimized by engineering spectral properties of transmitted photons. In particular, it is expected that positively correlated photon pairs can be very useful. We present the full characterization of a source of single photon pairs at a telecom wavelength based on type II spontaneous parametric down conversion (SPDC) process in a beta-barium borate (BBO) crystal. In the type II process, a pump photon, which is polarized extraordinarily, splits in a nonlinear medium into signal and idler photons, which are polarized perpendicularly to each other. In order for the process to be efficient a phase matching condition must be fulfilled. These conditions originate from momentum and energy conservation rules and put severe restrictions on source parameters. Seemingly, these conditions force the photon pair to be negatively correlated in their spectral domain. However, it is possible to achieve positive correlation for pulsed pumping. The experimentally available degrees of freedom of a source are the width of the pumping beam, the collected modes' widths, the length of the nonlinear crystal and the duration of the pumping pulse. In our numerical model we use the following figures of merit: the pair production rate, the efficiency of photon coupling into a single mode fiber, the spectral correlation of the coupled photon pair. The last one is defined as the Pearson correlation parameter for a joint spectral distribution. The aim here is to find the largest positive spectral correlation and the highest coupling efficiency. By resorting to the numerical model Ref. [1] we showed in Ref. [2], that by careful adjustment of the pump's and the collected modes' characteristics, one can optimize any of the source's parameters. Our numerical outcomes conform to the

  9. Efficient and Provable Secure Pairing-Free Security-Mediated Identity-Based Identification Schemes

    Directory of Open Access Journals (Sweden)

    Ji-Jian Chin


    Full Text Available Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user’s secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

  10. Efficient and provable secure pairing-free security-mediated identity-based identification schemes. (United States)

    Chin, Ji-Jian; Tan, Syh-Yuan; Heng, Swee-Huay; Phan, Raphael C-W


    Security-mediated cryptography was first introduced by Boneh et al. in 2001. The main motivation behind security-mediated cryptography was the capability to allow instant revocation of a user's secret key by necessitating the cooperation of a security mediator in any given transaction. Subsequently in 2003, Boneh et al. showed how to convert a RSA-based security-mediated encryption scheme from a traditional public key setting to an identity-based one, where certificates would no longer be required. Following these two pioneering papers, other cryptographic primitives that utilize a security-mediated approach began to surface. However, the security-mediated identity-based identification scheme (SM-IBI) was not introduced until Chin et al. in 2013 with a scheme built on bilinear pairings. In this paper, we improve on the efficiency results for SM-IBI schemes by proposing two schemes that are pairing-free and are based on well-studied complexity assumptions: the RSA and discrete logarithm assumptions.

  11. Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations. (United States)

    Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L


    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

  12. Uncertainty evaluation for three-dimensional scanning electron microscope reconstructions based on the stereo-pair technique

    DEFF Research Database (Denmark)

    Carli, Lorenzo; Genta, G; Cantatore, Angela


    3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to ...

  13. Positive cooperativity of the specific binding between Hg2+ ion and T:T mismatched base pairs in duplex DNA

    International Nuclear Information System (INIS)

    Torigoe, Hidetaka; Miyakawa, Yukako; Ono, Akira; Kozasa, Tetsuo


    Highlights: ► Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio. ► The binding constant between Hg 2+ and the T:T mismatched base pair was 10 6 M −1 . ► The binding constant was larger than those for nonspecific metal–DNA interactions. ► The binding constant for the second Hg 2+ was larger than that for the first Hg 2+ . ► The positive cooperative binding was observed between Hg 2+ and multiple T:T. - Abstract: Metal-mediated base pairs by the interaction between metal ions and artificial bases in oligonucleotides have been developed for their potential applications in nanotechnology. We recently found that a natural T:T mismatched base pair bound with Hg 2+ ion to form a novel T–Hg–T base pair. Here, we examined the thermodynamic properties of the binding between Hg 2+ and each of the single and double T:T mismatched base pair duplex DNAs by isothermal titration calorimetry. Hg 2+ specifically bound with the T:T mismatched base pair at 1:1 molar ratio with 10 6 M −1 binding constant, which was significantly larger than those for nonspecific metal ion–DNA interactions. In the Hg 2+ –double T:T mismatched base pair interaction, the affinity for the second Hg 2+ binding was significantly larger than that for the first Hg 2+ binding. The positively cooperative binding may be favorable to align multiple Hg 2+ in duplex DNA for the application of the metal-mediated base pairs in nanotechnology.

  14. Conformational analysis of a covalently cross-linked Watson-Crick base pair model. (United States)

    Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J


    Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

  15. Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model


    Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.


    Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...

  16. Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects. (United States)

    Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole


    Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

  17. Superior coexistence: systematicALLY regulatING land subsidence BASED on set pair theory

    Directory of Open Access Journals (Sweden)

    Y. Chen


    Full Text Available Anthropogenic land subsidence is an environmental side effect of exploring and using natural resources in the process of economic development. The key points of the system for controlling land subsidence include cooperation and superior coexistence while the economy develops, exploring and using natural resources, and geological environmental safety. Using the theory and method of set pair analysis (SPA, this article anatomises the factors, effects, and transformation of land subsidence. Based on the principle of superior coexistence, this paper promotes a technical approach to the system for controlling land subsidence, in order to improve the prevention and control of geological hazards.

  18. Base-pairing preferences, physicochemical properties and mutational behaviour of the DNA lesion 8-nitroguanine †


    Bhamra, Inder; Compagnone-Post, Patricia; O’Neil, Ian A.; Iwanejko, Lesley A.; Bates, Andrew D.; Cosstick, Richard


    8-Nitro-2′-deoxyguanosine (8-nitrodG) is a relatively unstable, mutagenic lesion of DNA that is increasingly believed to be associated with tissue inflammation. Due to the lability of the glycosidic bond, 8-nitrodG cannot be incorporated into oligodeoxynucleotides (ODNs) by chemical DNA synthesis and thus very little is known about its physicochemical properties and base-pairing preferences. Here we describe the synthesis of 8-nitro-2′-O-methylguanosine, a ribonucleoside analogue of this lesi...

  19. Phylogenetic relationships of Salmonella based on rRNA sequences

    DEFF Research Database (Denmark)

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.


    separated by 16S rRNA analysis and found to be closely related to the Escherichia coli and Shigella complex by both 16S and 23S rRNA analyses. The diphasic serotypes S. enterica subspp. I and VI were separated from the monophasic serotypes subspp. IIIa and IV, including S. bongori, by 23S rRNA sequence...

  20. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters. (United States)

    Kryachko, E S; Remacle, F


    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  1. Easy design of colorimetric logic gates based on nonnatural base pairing and controlled assembly of gold nanoparticles. (United States)

    Zhang, Li; Wang, Zhong-Xia; Liang, Ru-Ping; Qiu, Jian-Ding


    Utilizing the principles of metal-ion-mediated base pairs (C-Ag-C and T-Hg-T), the pH-sensitive conformational transition of C-rich DNA strand, and the ligand-exchange process triggered by DL-dithiothreitol (DTT), a system of colorimetric logic gates (YES, AND, INHIBIT, and XOR) can be rationally constructed based on the aggregation of the DNA-modified Au NPs. The proposed logic operation system is simple, which consists of only T-/C-rich DNA-modified Au NPs, and it is unnecessary to exquisitely design and alter the DNA sequence for different multiple molecular logic operations. The nonnatural base pairing combined with unique optical properties of Au NPs promises great potential in multiplexed ion sensing, molecular-scale computers, and other computational logic devices.

  2. Link-based quantitative methods to identify differentially coexpressed genes and gene Pairs

    Directory of Open Access Journals (Sweden)

    Ye Zhi-Qiang


    Full Text Available Abstract Background Differential coexpression analysis (DCEA is increasingly used for investigating the global transcriptional mechanisms underlying phenotypic changes. Current DCEA methods mostly adopt a gene connectivity-based strategy to estimate differential coexpression, which is characterized by comparing the numbers of gene neighbors in different coexpression networks. Although it simplifies the calculation, this strategy mixes up the identities of different coexpression neighbors of a gene, and fails to differentiate significant differential coexpression changes from those trivial ones. Especially, the correlation-reversal is easily missed although it probably indicates remarkable biological significance. Results We developed two link-based quantitative methods, DCp and DCe, to identify differentially coexpressed genes and gene pairs (links. Bearing the uniqueness of exploiting the quantitative coexpression change of each gene pair in the coexpression networks, both methods proved to be superior to currently popular methods in simulation studies. Re-mining of a publicly available type 2 diabetes (T2D expression dataset from the perspective of differential coexpression analysis led to additional discoveries than those from differential expression analysis. Conclusions This work pointed out the critical weakness of current popular DCEA methods, and proposed two link-based DCEA algorithms that will make contribution to the development of DCEA and help extend it to a broader spectrum.

  3. NMR and molecular modeling evidence for a G·A mismatch base pair in a purine-rich DNA duplex

    International Nuclear Information System (INIS)

    Li, Ying; Wilson, W.D.; Zon, G.


    1 H NMR experiments indicate that the oligomer 5'-d(ATGAGCGAATA) forms an unusual 10-base-pair duplex with 4 G·A base pairs and a 3' unpaired adenosine. NMR results indicate that guanoxine imino protons of the F·A mismatches are not hydrogen bonded but are stacked in the helix. A G→ I substitution in either G·A base pair causes a dramatic decrtease in duplex stability and indicates that hydrogen bonding of the guanosine amino group is critical. Nuclear Overhauser effect spectroscopy (NOESY) and two-dimensional correlated spectroscopy (COSY) results indicate that the overall duplex conformation is in the B-family. Cross-strand NOEs in two-dimensional NOESY spectra between a mismatched AH2 and an AH1' of the other mismatched base pair and between a mismatched GH8 and GNH1 of the other mismatch establish a purine-purine stacking pattern, adenosine over adenosine and guanosine over guanosine, which strongly stabilizes the duplex. A computer graphics molecular model of the ususual duplex was constructed with G·A base pairs containing A-NH 2 to GN3 and G-NH 2 to AN7 hydrogen bonds and B-form base pairs on both sides of the G·A pairs [5'-d(ATGAGC)]. The energy-minimized duplex satisfies all experimental constraints from NOESY and COSY results. A hydrogen bond from G-NH 2 of the mismatch to a phosphate oxygen is predicted

  4. A thermostable messenger RNA based vaccine against rabies. (United States)

    Stitz, Lothar; Vogel, Annette; Schnee, Margit; Voss, Daniel; Rauch, Susanne; Mutzke, Thorsten; Ketterer, Thomas; Kramps, Thomas; Petsch, Benjamin


    Although effective rabies virus vaccines have been existing for decades, each year, rabies virus infections still cause around 50.000 fatalities worldwide. Most of these cases occur in developing countries, where these vaccines are not available. The reasons for this are the prohibitive high costs of cell culture or egg grown rabies virus vaccines and the lack of a functional cold chain in many regions in which rabies virus is endemic. Here, we describe the excellent temperature resistance of a non-replicating mRNA based rabies virus vaccine encoding the rabies virus glycoprotein (RABV-G). Prolonged storage of the vaccine from -80°C to up to +70°C for several months did not impact the protective capacity of the mRNA vaccine. Efficacy after storage was demonstrated by the induction of rabies specific virus neutralizing antibodies and protection in mice against lethal rabies infection. Moreover, storing the vaccine at oscillating temperatures between +4° and +56°C for 20 cycles in order to simulate interruptions of the cold chain during vaccine transport, did not affect the vaccine's immunogenicity and protective characteristics, indicating that maintenance of a cold chain is not essential for this vaccine.

  5. Optimization of Critical Hairpin Features Allows miRNA-based Gene Knockdown Upon Single-copy Transduction

    Directory of Open Access Journals (Sweden)

    Renier Myburgh


    Full Text Available Gene knockdown using micro RNA (miRNA-based vector constructs is likely to become a prominent gene therapy approach. It was the aim of this study to improve the efficiency of gene knockdown through optimizing the structure of miRNA mimics. Knockdown of two target genes was analyzed: CCR5 and green fluorescent protein. We describe here a novel and optimized miRNA mimic design called mirGE comprising a lower stem length of 13 base pairs (bp, positioning of the targeting strand on the 5′ side of the miRNA, together with nucleotide mismatches in upper stem positions 1 and 12 placed on the passenger strand. Our mirGE proved superior to miR-30 in four aspects: yield of targeting strand incorporation into RNA-induced silencing complex (RISC; incorporation into RISC of correct targeting strand; precision of cleavage by Drosha; and ratio of targeting strand over passenger strand. A triple mirGE hairpin cassette targeting CCR5 was constructed. It allowed CCR5 knockdown with an efficiency of over 90% upon single-copy transduction. Importantly, single-copy expression of this construct rendered transduced target cells, including primary human macrophages, resistant to infection with a CCR5-tropic strain of HIV. Our results provide new insights for a better knockdown efficiency of constructs containing miRNA. Our results also provide the proof-of-principle that cells can be rendered HIV resistant through single-copy vector transduction, rendering this approach more compatible with clinical applications.

  6. Matched molecular pair-based data sets for computer-aided medicinal chemistry (United States)

    Bajorath, Jürgen


    Matched molecular pairs (MMPs) are widely used in medicinal chemistry to study changes in compound properties including biological activity, which are associated with well-defined structural modifications. Herein we describe up-to-date versions of three MMP-based data sets that have originated from in-house research projects. These data sets include activity cliffs, structure-activity relationship (SAR) transfer series, and second generation MMPs based upon retrosynthetic rules. The data sets have in common that they have been derived from compounds included in the ChEMBL database (release 17) for which high-confidence activity data are available. Thus, the activity data associated with MMP-based activity cliffs, SAR transfer series, and retrosynthetic MMPs cover the entire spectrum of current pharmaceutical targets. Our data sets are made freely available to the scientific community. PMID:24627802

  7. A QM/MM refinement of an experimental DNA structure with metal-mediated base pairs. (United States)

    Kumbhar, Sadhana; Johannsen, Silke; Sigel, Roland K O; Waller, Mark P; Müller, Jens


    A series of hybrid quantum mechanical/molecular mechanical (QM/MM) calculations was performed on models of a DNA duplex with artificial silver(I)-mediated imidazole base pairs. The optimized structures were compared to the original experimental NMR structure (Nat. Chem. 2 (2010) 229-234). The metal⋯metal distances are significantly shorter (~0.5Å) in the QM/MM model than in the original NMR structure. As a result, argentophilic interactions are feasible between the silver(I) ions of neighboring metal-mediated base pairs. Using the computationally determined metal⋯metal distances, a re-refined NMR solution structure of the DNA duplex was obtained. In this new NMR structure, all experimental constraints remain fulfilled. The new NMR structure shows less deviation from the regular B-type conformation than the original one. This investigation shows that the application of QM/MM models to generate additional constraints to be used during NMR structural refinements represents an elegant approach to obtaining high-resolution NMR structures. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. [Biological and neural bases of partner preferences in rodents: models to understand human pair bonds]. (United States)

    Coria-Avila, G A; Hernández-Aguilar, M E; Toledo-Cárdenas, R; García-Hernández, L I; Manzo, J; Pacheco, P; Miquel, M; Pfaus, J G

    To analyse the biological and neural bases of partner preference formation in rodents as models to understand human pair bonding. Rodents are social individuals, capable of forming short- or long-lasting partner preferences that develop slowly by stimuli like cohabitation, or rapidly by stimuli like sex and stress. Dopamine, corticosteroids, oxytocin, vasopressin, and opioids form the neurochemical substrate for pair bonding in areas like the nucleus accumbens, the prefrontal cortex, the piriform cortex, the medial preoptic area, the ventral tegmental area and the medial amygdala, among others. Additional areas may participate depending on the nature of the conditioned stimuli by which and individual recognizes a preferred partner. Animal models help us understand that the capacity of an individual to display long-lasting and selective preferences depends on neural bases, selected throughout evolution. The challenge in neuroscience is to use this knowledge to create new solutions for mental problems associated with the incapacity of an individual to display a social bond, keep one, or cope with the disruption of a consolidated one.

  9. Dye-sensitized solar cell with a pair of carbon-based electrodes

    International Nuclear Information System (INIS)

    Kyaw, Aung Ko Ko; Demir, Hilmi Volkan; Sun Xiaowei; Tantang, Hosea; Zhang Qichun; Wu Tao; Ke, Lin; Wei Jun


    We have fabricated a dye-sensitized solar cell (DSSC) with a pair of carbon-based electrodes using a transparent, conductive carbon nanotubes (CNTs) film modified with ultra-thin titanium-sub-oxide (TiO x ) as the working electrode and a bilayer of conductive CNTs and carbon black as the counter electrode. Without TiO x modification, the DSSC is almost nonfunctional whereas the power conversion efficiency (PCE) increases significantly when the working electrode is modified with TiO x . The performance of the cell could be further improved when the carbon black film was added on the counter electrode. The improved efficiency can be attributed to the inhibition of the mass recombination at the working electrode/electrolyte interface by TiO x and the acceleration of the electron transfer kinetics at the counter electrode by carbon black. The DSSC with a pair of carbon-based electrodes gives the PCE of 1.37%. (paper)

  10. DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces. (United States)

    Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain


    Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

  11. Analysis of energy-based algorithms for RNA secondary structure prediction

    Directory of Open Access Journals (Sweden)

    Hajiaghayi Monir


    . Second, on our large datasets, the algorithm with best overall accuracy is a pseudo MEA-based algorithm of Hamada et al. that uses a generalized centroid estimator of base pairs. However, between MFE and other MEA-based methods, there is no clear winner in the sense that the relative accuracy of the MFE versus MEA-based algorithms changes depending on the underlying energy parameters. Third, of the four parameter sets we considered, the best accuracy for the MFE-, MEA-based, and pseudo-MEA-based methods is 0.686, 0.680, and 0.711, respectively (on a scale from 0 to 1 with 1 meaning perfect structure predictions and is obtained with a thermodynamic parameter set obtained by Andronescu et al. called BL* (named after the Boltzmann likelihood method by which the parameters were derived. Conclusions Large datasets should be used to obtain reliable measures of the accuracy of RNA structure prediction algorithms, and average accuracies on specific classes (such as Group I introns and Transfer RNAs should be interpreted with caution, considering the relatively small size of currently available datasets for such classes. The accuracy of the MEA-based methods is significantly higher when using the BL* parameter set of Andronescu et al. than when using the parameters of Mathews and Turner, and there is no significant difference between the accuracy of MEA-based methods and MFE when using the BL* parameters. The pseudo-MEA-based method of Hamada et al. with the BL* parameter set significantly outperforms all other MFE and MEA-based algorithms on our large data sets.

  12. Assembling RNA Nanoparticles. (United States)

    Xiao, Shou-Jun


    RNA nanoparticles are designed and self-assembled according to noncanonical interactions of naturally conserved RNA motifs and/or canonical Watson-Crick base-pairing interactions, which have potential applications in gene therapy and nanomedicine. These artificially engineered nanoparticles are mainly synthesized from in vitro transcribed RNAs, purified by denaturing and native polyacrylamide gel electrophoresis (PAGE), and characterized with native PAGE, AFM, and TEM technologies. The protocols of in vitro transcription, denaturing and native PAGE, and RNA nanoparticle self-assembly are described in detail.

  13. Nucleic Acid Base Analog FRET-Pair Facilitating Detailed Structural Measurements in Nucleic Acid Containing Systems

    DEFF Research Database (Denmark)

    Börjesson, Karl; Preus, Søren; El-Sagheer, Afaf


    We present the first nucleobase analog fluorescence resonance energy transfer (FRET)-pair. The pair consists of tCO, 1,3-diaza-2-oxophenoxazine, as an energy donor and the newly developed tC(nitro), 7-nitro-1,3-diaza-2-oxophenothiazine, as an energy acceptor. The FRET-pair successfully monitors d...

  14. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R


    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  15. Design, realization and testing of an adsorption refrigerator based on activated carbon/ethanol working pair

    International Nuclear Information System (INIS)

    Frazzica, A.; Palomba, V.; Dawoud, B.; Gullì, G.; Brancato, V.; Sapienza, A.; Vasta, S.; Freni, A.; Costa, F.; Restuccia, G.


    Highlights: • Development of a lab-scale adsorption refrigerator. • Optimization of working pair and adsorber configuration through experimental activity. • Experimental testing of the prototype under real working boundary conditions. - Abstract: In the present paper design, realization and testing of a novel small scale adsorption refrigerator prototype based on activated carbon/ethanol working pair is described. Firstly, experimental activity has been carried out for identification of the best performing activated carbon available on the market, through the evaluation of the achievable thermodynamic performance both under air conditioning and refrigeration conditions. Once identified the best performing activated carbon, the design of the adsorber was developed by experimental dynamic performance analysis, carried out by means of the Gravimetric-Large Temperature Jump (G-LTJ) apparatus available at CNR ITAE lab. Finally, the whole 0.5 kW refrigerator prototype was designed and built. First experimental results both under reference air conditioning and refrigeration cycles have been reported, to check the achievable performance. High Specific Cooling Powers (SCPs), 95 W/kg and 50 W/kg, for air conditioning and refrigeration respectively, were obtained, while the COP ranged between 0.09 and 0.11, thus showing an improvement of the current state of the art.

  16. RNA Detection Based on Graphene Field-Effect Transistor Biosensor

    Directory of Open Access Journals (Sweden)

    Meng Tian


    Full Text Available Graphene has attracted much attention in biosensing applications due to its unique properties. In this paper, the monolayer graphene was grown by chemical vapor deposition (CVD method. Using the graphene as the electric channel, we have fabricated a graphene field-effect transistor (G-FET biosensor that can be used for label-free detection of RNA. Compared with conventional method, the G-FET RNA biosensor can be run in low cost, be time-saving, and be miniaturized for RNA measurement. The sensors show high performance and achieve the RNA detection sensitivity as low as 0.1 fM, which is two orders of magnitude lower than the previously reports. Moreover, the G-FET biosensor can readily distinguish target RNA from noncomplementary RNA, showing high selectivity for RNA detection. The developed G-FET RNA biosensor with high sensitivity, fast analysis speed, and simple operation may provide a new feasible direction for RNA research and biosensing.

  17. Mechanism of action of mRNA-based vaccines. (United States)

    Iavarone, Carlo; O'hagan, Derek T; Yu, Dong; Delahaye, Nicolas F; Ulmer, Jeffrey B


    The present review summarizes the growing body of work defining the mechanisms of action of this exciting new vaccine technology that should allow rational approaches in the design of next generation mRNA vaccines. Areas covered: Bio-distribution of mRNA, localization of antigen production, role of the innate immunity, priming of the adaptive immune response, route of administration and effects of mRNA delivery systems. Expert commentary: In the last few years, the development of RNA vaccines had a fast growth, the rising number of proof will enable rational approaches to improving the effectiveness and safety of this modern class of medicine.

  18. HuMiTar: A sequence-based method for prediction of human microRNA targets

    Directory of Open Access Journals (Sweden)

    Chen Ke


    Full Text Available Abstract Background MicroRNAs (miRs are small noncoding RNAs that bind to complementary/partially complementary sites in the 3' untranslated regions of target genes to regulate protein production of the target transcript and to induce mRNA degradation or mRNA cleavage. The ability to perform accurate, high-throughput identification of physiologically active miR targets would enable functional characterization of individual miRs. Current target prediction methods include traditional approaches that are based on specific base-pairing rules in the miR's seed region and implementation of cross-species conservation of the target site, and machine learning (ML methods that explore patterns that contrast true and false miR-mRNA duplexes. However, in the case of the traditional methods research shows that some seed region matches that are conserved are false positives and that some of the experimentally validated target sites are not conserved. Results We present HuMiTar, a computational method for identifying common targets of miRs, which is based on a scoring function that considers base-pairing for both seed and non-seed positions for human miR-mRNA duplexes. Our design shows that certain non-seed miR nucleotides, such as 14, 18, 13, 11, and 17, are characterized by a strong bias towards formation of Watson-Crick pairing. We contrasted HuMiTar with several representative competing methods on two sets of human miR targets and a set of ten glioblastoma oncogenes. Comparison with the two best performing traditional methods, PicTar and TargetScanS, and a representative ML method that considers the non-seed positions, NBmiRTar, shows that HuMiTar predictions include majority of the predictions of the other three methods. At the same time, the proposed method is also capable of finding more true positive targets as a trade-off for an increased number of predictions. Genome-wide predictions show that the proposed method is characterized by 1.99 signal

  19. RNA interference-based resistance against a legume mastrevirus

    Directory of Open Access Journals (Sweden)

    Mansoor Shahid


    Full Text Available Abstract Background RNA interference (RNAi is a homology-dependant gene silencing mechanism and has been widely used to engineer resistance in plants against RNA viruses. However, its usefulness in delivering resistance against plant DNA viruses belonging to family Geminiviridae is still being debated. Although the RNAi approach has been shown, using a transient assay, to be useful in countering monocotyledonous plant-infecting geminiviruses of the genus Mastrevirus, it has yet to be investigated as a means of delivering resistance to dicot-infecting mastreviruses. Chickpea chlorotic dwarf Pakistan virus (CpCDPKV is a legume-infecting mastrevirus that affects chickpea and other leguminous crops in Pakistan. Results Here a hairpin (hpRNAi construct containing sequences encompassing part of replication-associated protein gene, intergenic region and part of the movement protein gene of CpCDPKV under the control of the Cauliflower mosaic virus 35S promoter has been produced and stably transformed into Nicotiana benthamiana. Plants harboring the hairpin construct were challenged with CpCDPKV. All non-transgenic N. benthamiana plants developed symptoms of CpCDPKV infection within two weeks post-inoculation. In contrast, none of the inoculated transgenic plants showed symptoms of infection and no viral DNA could be detected by Southern hybridization. A real-time quantitative PCR analysis identified very low-level accumulation of viral DNA in the inoculated transgenic plants. Conclusions The results presented show that the RNAi-based resistance strategy is useful in protecting plants from a dicot-infecting mastrevirus. The very low levels of virus detected in plant tissue of transgenic plants distal to the inoculation site suggest that virus movement and/or viral replication was impaired leading to plants that showed no discernible signs of virus infection.

  20. Fingerprint Identification Using SIFT-Based Minutia Descriptors and Improved All Descriptor-Pair Matching

    Directory of Open Access Journals (Sweden)

    Jiuqiang Han


    Full Text Available The performance of conventional minutiae-based fingerprint authentication algorithms degrades significantly when dealing with low quality fingerprints with lots of cuts or scratches. A similar degradation of the minutiae-based algorithms is observed when small overlapping areas appear because of the quite narrow width of the sensors. Based on the detection of minutiae, Scale Invariant Feature Transformation (SIFT descriptors are employed to fulfill verification tasks in the above difficult scenarios. However, the original SIFT algorithm is not suitable for fingerprint because of: (1 the similar patterns of parallel ridges; and (2 high computational resource consumption. To enhance the efficiency and effectiveness of the algorithm for fingerprint verification, we propose a SIFT-based Minutia Descriptor (SMD to improve the SIFT algorithm through image processing, descriptor extraction and matcher. A two-step fast matcher, named improved All Descriptor-Pair Matching (iADM, is also proposed to implement the 1:N verifications in real-time. Fingerprint Identification using SMD and iADM (FISiA achieved a significant improvement with respect to accuracy in representative databases compared with the conventional minutiae-based method. The speed of FISiA also can meet real-time requirements.

  1. Theoretical studies on the intermolecular interactions of potentially primordial base-pair analogues

    Czech Academy of Sciences Publication Activity Database

    Šponer, Judit E.; Vázquez-Mayagoitia, Á.; Sumpter, B.G.; Leszczynski, J.; Šponer, Jiří; Otyepka, M.; Banáš, P.; Fuentes-Cabrera, M.


    Roč. 16, č. 10 (2010), s. 3057-3065 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06030; GA AV ČR(CZ) 1QS500040581; GA AV ČR(CZ) IAA400040802; GA ČR(CZ) GA203/09/1476 Grant - others:GA MŠk(CZ) LC512; GA AV ČR(CZ) IAA400550701; GA ČR(CZ) GD203/09/H046 Program:LC; IA; GD Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : quantum chemistry * base pairing * origin of life Subject RIV: BO - Biophysics Impact factor: 5.476, year: 2010

  2. High-speed true random number generation based on paired memristors for security electronics (United States)

    Zhang, Teng; Yin, Minghui; Xu, Changmin; Lu, Xiayan; Sun, Xinhao; Yang, Yuchao; Huang, Ru


    True random number generator (TRNG) is a critical component in hardware security that is increasingly important in the era of mobile computing and internet of things. Here we demonstrate a TRNG using intrinsic variation of memristors as a natural source of entropy that is otherwise undesirable in most applications. The random bits were produced by cyclically switching a pair of tantalum oxide based memristors and comparing their resistance values in the off state, taking advantage of the more pronounced resistance variation compared with that in the on state. Using an alternating read scheme in the designed TRNG circuit, the unbiasedness of the random numbers was significantly improved, and the bitstream passed standard randomness tests. The Pt/TaO x /Ta memristors fabricated in this work have fast programming/erasing speeds of ˜30 ns, suggesting a high random number throughput. The approach proposed here thus holds great promise for physically-implemented random number generation.

  3. Atomic-scale Visualization of Electronic Nematicity and Cooper Pairing in Iron-based Superconductors (United States)

    Allan, Milan P.


    The mechanism of high-temperature superconductivity in the relatively novel iron-based high-Tc superconductors is unresolved, both in terms of how the phases evolve with doping, and in terms of the actual Cooper pairing process. To explore these issues, we used spectroscopic-imaging scanning tunneling microscopy to study the electronic structure of CaFe2As2 in the antiferromagnetic-orthorhombic `parent' state from which the superconductivity emerges. We discovered and visualized the now widely studied electronic `nematicity' of this phase, whose suppression is associated with the emergence of superconductivity (Science 327, 181, 2010). As subsequent transport experiments discovered a related anisotropic conductance which increases with dopant concentration, the interplay between the electronic structure surrounding each dopant atom, quasiparticle scattering therefrom, and the transport nematicity has become a pivotal focus of research. We find that substituting Co for Fe atoms in underdoped Ca(Fe1-xCox)2As2 generates a dense population of identical and strongly anisotropic impurity states that are distributed randomly but aligned with the antiferromagnetic a-axis. We also demonstrate, by imaging their surrounding interference patterns, that these impurity states scatter quasiparticles and thus influence transport in a highly anisotropic manner (M.P. Allan et al., 2013). Next, we studied the momentum dependence of the energy gaps of iron-based superconductivity, now focusing on LiFeAs. If strong electron-electron interactions mediate the Cooper pairing, then momentum-space anisotropic superconducting energy gaps Δi (k) were predicted by multiple techniques to appear on the different electronic bands i. We introduced intraband Bogoliubov quasiparticle scattering interference (QPI) techniques for the determination of anisotropic energy gaps to test these hypotheses and discovered the anisotropy, magnitude, and relative orientations of the energy gaps on multiple

  4. Shortcomings of short hairpin RNA-based transgenic RNA interference in mouse oocytes

    Czech Academy of Sciences Publication Activity Database

    Sarnová, Lenka; Malík, Radek; Sedláček, Radislav; Svoboda, Petr


    Roč. 9, č. 8 (2010), s. 1-10 ISSN 1477-5751 R&D Project s: GA MŠk ME09039 Grant - others:EMBO SDIG(DE) project 1483 Institutional research plan: CEZ:AV0Z50520514 Keywords : transgenic RNAi * shRNA * oocyte Subject RIV: EB - Genetics ; Molecular Biology

  5. Shortcomings of short hairpin RNA-based transgenic RNA interference in mouse oocytes

    Czech Academy of Sciences Publication Activity Database

    Sarnová, Lenka; Malík, Radek; Sedláček, Radislav; Svoboda, Petr


    Roč. 9, č. 8 (2010), s. 1-10 ISSN 1477-5751 R&D Projects: GA MŠk ME09039 Grant - others:EMBO SDIG(DE) project 1483 Institutional research plan: CEZ:AV0Z50520514 Keywords : transgenic RNAi * shRNA * oocyte Subject RIV: EB - Genetics ; Molecular Biology

  6. High-Throughput Sequencing Based Methods of RNA Structure Investigation

    DEFF Research Database (Denmark)

    Kielpinski, Lukasz Jan

    In this thesis we describe the development of four related methods for RNA structure probing that utilize massive parallel sequencing. Using them, we were able to gather structural data for multiple, long molecules simultaneously. First, we have established an easy to follow experimental...... and computational protocol for detecting the reverse transcription termination sites (RTTS-Seq). This protocol was subsequently applied to hydroxyl radical footprinting of three dimensional RNA structures to give a probing signal that correlates well with the RNA backbone solvent accessibility. Moreover, we applied...

  7. Small RNA-based feedforward loop with AND-gate logic regulates extrachromosomal DNA transfer in Salmonella. (United States)

    Papenfort, Kai; Espinosa, Elena; Casadesús, Josep; Vogel, Jörg


    Horizontal gene transfer via plasmid conjugation is a major driving force in microbial evolution but constitutes a complex process that requires synchronization with the physiological state of the host bacteria. Although several host transcription factors are known to regulate plasmid-borne transfer genes, RNA-based regulatory circuits for host-plasmid communication remain unknown. We describe a posttranscriptional mechanism whereby the Hfq-dependent small RNA, RprA, inhibits transfer of pSLT, the virulence plasmid of Salmonella enterica. RprA employs two separate seed-pairing domains to activate the mRNAs of both the sigma-factor σ(S) and the RicI protein, a previously uncharacterized membrane protein here shown to inhibit conjugation. Transcription of ricI requires σ(S) and, together, RprA and σ(S) orchestrate a coherent feedforward loop with AND-gate logic to tightly control the activation of RicI synthesis. RicI interacts with the conjugation apparatus protein TraV and limits plasmid transfer under membrane-damaging conditions. To our knowledge, this study reports the first small RNA-controlled feedforward loop relying on posttranscriptional activation of two independent targets and an unexpected role of the conserved RprA small RNA in controlling extrachromosomal DNA transfer.

  8. Current Hormonal Contraceptive Use Predicts Female Extra-Pair and Dyadic Sexual Behavior: Evidence Based on Czech National Survey Data

    Directory of Open Access Journals (Sweden)

    Kateřina Klapilová


    Full Text Available Data from 1155 Czech women (493 using oral contraception, 662 non-users, obtained from the Czech National Survey of Sexual Behavior, were used to investigate evolutionary-based hypotheses concerning the predictive value of current oral contraceptive (OC use on extra-pair and dyadic (in-pair sexual behavior of coupled women. Specifically, the aim was to determine whether current OC use was associated with lower extra-pair and higher in-pair sexual interest and behavior, because OC use suppresses cyclical shifts in mating psychology that occur in normally cycling women. Zero-inflated Poisson (ZIP regression and negative binomial models were used to test associations between OC use and these sexual measures, controlling for other relevant predictors (e.g., age, parity, in-pair sexual satisfaction, relationship length. The overall incidence of having had an extra-pair partner or one-night stand in the previous year was not related to current OC use (the majority of the sample had not. However, among the women who had engaged in extra-pair sexual behavior, OC users had fewer one-night stands than non-users, and tended to have fewer partners, than non-users. OC users also had more frequent dyadic intercourse than non-users, potentially indicating higher commitment to their current relationship. These results suggest that suppression of fertility through OC use may alter important aspects of female sexual behavior, with potential implications for relationship functioning and stability.

  9. A folding algorithm for extended RNA secondary structures. (United States)

    Höner zu Siederdissen, Christian; Bernhart, Stephan H; Stadler, Peter F; Hofacker, Ivo L


    RNA secondary structure contains many non-canonical base pairs of different pair families. Successful prediction of these structural features leads to improved secondary structures with applications in tertiary structure prediction and simultaneous folding and alignment. We present a theoretical model capturing both RNA pair families and extended secondary structure motifs with shared nucleotides using 2-diagrams. We accompany this model with a number of programs for parameter optimization and structure prediction. All sources (optimization routines, RNA folding, RNA evaluation, extended secondary structure visualization) are published under the GPLv3 and available at

  10. Bio-activity of aminosulfonyl ureas in the light of nucleic acid bases and DNA base pair interaction. (United States)

    Mondal Roy, Sutapa


    The quantum chemical descriptors based on density functional theory (DFT) are applied to predict the biological activity (log IC 50 ) of one class of acyl-CoA: cholesterol O-acyltransferase (ACAT) inhibitors, viz. aminosulfonyl ureas. ACAT are very effective agents for reduction of triglyceride and cholesterol levels in human body. Successful two parameter quantitative structure-activity relationship (QSAR) models are developed with a combination of relevant global and local DFT based descriptors for prediction of biological activity of aminosulfonyl ureas. The global descriptors, electron affinity of the ACAT inhibitors (EA) and/or charge transfer (ΔN) between inhibitors and model biosystems (NA bases and DNA base pairs) along with the local group atomic charge on sulfonyl moiety (∑Q Sul ) of the inhibitors reveals more than 90% efficacy of the selected descriptors for predicting the experimental log (IC 50 ) values. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. PseudoBase: a database with RNA pseudoknots. (United States)

    van Batenburg, F H; Gultyaev, A P; Pleij, C W; Ng, J; Oliehoek, J


    PseudoBase is a database containing structural, functional and sequence data related to RNA pseudo-knots. It can be reached at http://wwwbio. Leiden approximately Batenburg/PKB.html. This page will direct the user to a retrieval page from where a particular pseudoknot can be chosen, or to a submission page which enables the user to add pseudoknot information to the database or to an informative page that elaborates on the various aspects of the database. For each pseudoknot, 12 items are stored, e.g. the nucleotides of the region that contains the pseudoknot, the stem positions of the pseudoknot, the EMBL accession number of the sequence that contains this pseudoknot and the support that can be given regarding the reliability of the pseudoknot. Access is via a small number of steps, using 16 different categories. The development process was done by applying the evolutionary methodology for software development rather than by applying the methodology of the classical waterfall model or the more modern spiral model.

  12. The number of preproghrelin mRNA expressing cells is increased in mice with activity-based anorexia. (United States)

    François, Marie; Barde, Swapnali; Achamrah, Najate; Breton, Jonathan; do Rego, Jean-Claude; Coëffier, Moïse; Hökfelt, Tomas; Déchelotte, Pierre; Fetissov, Sergueï O


    Plasma levels of ghrelin, an orexigenic peptide, are increased during conditions of chronic starvation, such as in patients with anorexia nervosa. However, it is not known whether such increase can be related to the number of preproghrelin mRNA-expressing cells in the stomach, and if chronic starvation may activate a tentative central ghrelin production. In this work, in situ hybridization technique was used to analyze the presence and number of preproghrelin mRNA-expressing cells in the stomach and the hypothalamus of mice with activity-based anorexia (ABA) induced by the combination of running wheel activity with progressive, during 10 days, feeding-time restriction (FTR) and compared with sedentary FTR, ABA pair-fed (PF) and ad libitum-fed control mice. All food-restricted mice lost more than 20% of body weight. Body weight loss was similar in ABA and PF mice, but it was more pronounced than in FTR mice. Food intake was also lower in ABA than in FTR mice. Preproghrelin mRNA-expressing cells in the stomach were increased proportionally to the body weight loss in all food-restricted groups with the highest number in ABA mice. No preproghrelin mRNA-producing cells were detectable in the hypothalamus of either control or food-restricted mice. Thus, the increased number of gastric preproghrelin mRNA-producing cells during chronic starvation proportionally to the body weight loss and reduced food intake may underlie increased plasma ghrelin. Hyperactivity-induced anorexia appears to further increase the number of preproghrelin mRNA-producing cells in the stomach. No evidence was found for ghrelin expression in the hypothalamus, not even in any of the present experimental models. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Simulation-based investigation of the paired-gear method in cod-end selectivity studies

    DEFF Research Database (Denmark)

    Herrmann, Bent; Frandsen, Rikke; Holst, René


    In this paper, the paired-gear and covered cod-end methods for estimating the selectivity of trawl cod-ends are compared. A modified version of the cod-end selectivity simulator PRESEMO is used to simulate the data that would be collected from a paired-gear experiment where the test cod-end also ...

  14. Surprising conformers of the biologically important A·T DNA base pairs: QM/QTAIM proofs (United States)

    Brovarets', Ol'ha O.; Tsiupa, Kostiantyn S.; Hovorun, Dmytro M.


    For the first time novel high-energy conformers – A·T(wWC) (5.36), A·T(wrWC) (5.97), A·T(wH) (5.78) and A·T(wrH) (ΔG=5.82 kcal•mol-1) were revealed for each of the four biologically important A·T(WC) DNA base pairs – Watson-Crick A·T(WC), reverse Watson-Crick A·T(rWC), Hoogsteen A·T(H) and reverse Hoogsteen A·T(rH) at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p) level of quantum-mechanical theory in the continuum with ɛ=4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w) structure and is stabilized by the participation of the two anti-parallel N6H/N6H'…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC)↔A·T(wWC), TSA·T(rWC)↔A·T(wrWC), TSA·T(H)↔A·T(wH) and TSA·T(rH)↔A·T(wrH), controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H'…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures (lifetime τ = (1.4-3.9) ps). Their possible biological significance and future perspectives have been briefly discussed.

  15. Surprising Conformers of the Biologically Important A·T DNA Base Pairs: QM/QTAIM Proofs

    Directory of Open Access Journals (Sweden)

    Ol'ha O. Brovarets'


    Full Text Available For the first time novel high-energy conformers–A·T(wWC (5.36, A·T(wrWC (5.97, A·T(wH (5.78, and A·T(wrH (ΔG = 5.82 kcal·mol−1 (See Graphical Abstract were revealed for each of the four biologically important A·T DNA base pairs – Watson-Crick A·T(WC, reverse Watson-Crick A·T(rWC, Hoogsteen A·T(H and reverse Hoogsteen A·T(rH at the MP2/aug-cc-pVDZ//B3LYP/6-311++G(d,p level of quantum-mechanical theory in the continuum with ε = 4 under normal conditions. Each of these conformers possesses substantially non-planar wobble (w structure and is stabilized by the participation of the two anti-parallel N6H/N6H′…O4/O2 and N3H…N6 H-bonds, involving the pyramidalized amino group of the A DNA base as an acceptor and a donor of the H-bonding. The transition states – TSA·T(WC↔A·T(wWC, TSA·T(rWC↔A·T(wrWC, TSA·T(H↔A·T(wH, and TSA·T(rH↔A·T(wrH, controlling the dipole-active transformations of the conformers from the main plane-symmetric state into the high-energy, significantly non-planar state and vice versa, were localized. They also possess wobble structures similarly to the high-energy conformers and are stabilized by the participation of the N6H/N6H′…O4/O2 and N3H…N6 H-bonds. Discovered conformers of the A·T DNA base pairs are dynamically stable short-lived structures [lifetime τ = (1.4–3.9 ps]. Their possible biological significance and future perspectives have been briefly discussed.

  16. Studies of base pair sequence effects on DNA solvation based on all

    Indian Academy of Sciences (India)

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization ...

  17. In Silico Meets In Vivo: Towards Computational CRISPR-Based sgRNA Design. (United States)

    Chuai, Guo-Hui; Wang, Qi-Long; Liu, Qi


    CRISPR-based genome editing has been widely implemented in various cell types. In silico single guide RNA (sgRNA) design is a key step for successful gene editing using the CRISPR system, and continuing efforts are aimed at refining in silico sgRNA design with high on-target efficacy and reduced off-target effects. Many sgRNA design tools are available, but careful assessments of their application scenarios and performance benchmarks across different types of genome-editing data are needed. Efficient in silico models can be built that integrate current heterogeneous genome-editing data to derive unbiased sgRNA design rules and identify key features for improving sgRNA design. Comprehensive evaluation of on-target and off-target effects of sgRNA will allow more precise genome editing and gene therapies using the CRISPR system. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Graph-based surface reconstruction from stereo pairs using image segmentation (United States)

    Bleyer, Michael; Gelautz, Margrit


    This paper describes a novel stereo matching algorithm for epipolar rectified images. The method applies colour segmentation on the reference image. The use of segmentation makes the algorithm capable of handling large untextured regions, estimating precise depth boundaries and propagating disparity information to occluded regions, which are challenging tasks for conventional stereo methods. We model disparity inside a segment by a planar equation. Initial disparity segments are clustered to form a set of disparity layers, which are planar surfaces that are likely to occur in the scene. Assignments of segments to disparity layers are then derived by minimization of a global cost function via a robust optimization technique that employs graph cuts. The cost function is defined on the pixel level, as well as on the segment level. While the pixel level measures the data similarity based on the current disparity map and detects occlusions symmetrically in both views, the segment level propagates the segmentation information and incorporates a smoothness term. New planar models are then generated based on the disparity layers' spatial extents. Results obtained for benchmark and self-recorded image pairs indicate that the proposed method is able to compete with the best-performing state-of-the-art algorithms.

  19. A Novel Clustering Model Based on Set Pair Analysis for the Energy Consumption Forecast in China

    Directory of Open Access Journals (Sweden)

    Mingwu Wang


    Full Text Available The energy consumption forecast is important for the decision-making of national economic and energy policies. But it is a complex and uncertainty system problem affected by the outer environment and various uncertainty factors. Herein, a novel clustering model based on set pair analysis (SPA was introduced to analyze and predict energy consumption. The annual dynamic relative indicator (DRI of historical energy consumption was adopted to conduct a cluster analysis with Fisher’s optimal partition method. Combined with indicator weights, group centroids of DRIs for influence factors were transferred into aggregating connection numbers in order to interpret uncertainty by identity-discrepancy-contrary (IDC analysis. Moreover, a forecasting model based on similarity to group centroid was discussed to forecast energy consumption of a certain year on the basis of measured values of influence factors. Finally, a case study predicting China’s future energy consumption as well as comparison with the grey method was conducted to confirm the reliability and validity of the model. The results indicate that the method presented here is more feasible and easier to use and can interpret certainty and uncertainty of development speed of energy consumption and influence factors as a whole.

  20. Pairing symmetries of several iron-based superconductor families and some similarities with cuprates and heavy-fermions

    Directory of Open Access Journals (Sweden)

    Das Tanmoy


    Full Text Available We show that, by using the unit-cell transformation between 1 Fe per unit cell to 2 Fe per unit cell, one can qualitatively understand the pairing symmetry of several families of iron-based superconductors. In iron-pnictides and iron-chalcogenides, the nodeless s±-pairing and the resulting magnetic resonance mode transform nicely between the two unit cells, while retaining all physical properties unchanged. However, when the electron-pocket disappears from the Fermi surface with complete doping in KFe2As2, we find that the unit-cell invariant requirement prohibits the occurrence of s±-pairing symmetry (caused by inter-hole-pocket nesting. However, the intra-pocket nesting is compatible here, which leads to a nodal d-wave pairing. The corresponding Fermi surface topology and the pairing symmetry are similar to Ce-based heavy-fermion superconductors. Furthermore, when the Fermi surface hosts only electron-pockets in KyFe2-xSe2, the inter-electron-pocket nesting induces a nodeless and isotropic d-wave pairing. This situation is analogous to the electron-doped cuprates, where the strong antiferromagnetic order creates similar disconnected electron-pocket Fermi surface, and hence nodeless d-wave pairing appears. The unit-cell transformation in KyFe2-xSe2 exhibits that the d-wave pairing breaks the translational symmetry of the 2 Fe unit cell, and thus cannot be realized unless a vacancy ordering forms to compensate for it. These results are consistent with the coexistence picture of a competing order and nodeless d-wave superconductivity in both cuprates and KyFe1.6Se2.

  1. Radiation sensitivity of messenger RNA

    International Nuclear Information System (INIS)

    Ponta, H.; Pfennig-Yeh, M.L.; Herrlich, P.; Karlsruhe Univ.; Wagner, E.F.; Schweiger, M.


    Messenger RNA function is inactivated by irradiation with ultraviolet light. A unit length mRNA (in bases) is 2-3 times more sensitive than a unit length of DNA (in base pairs) with respect to the inactivation of template function. These data stem from four experimental systems all of which do not repair DNA: the translation of E. coli mRNA in rifampicin-treated cells, of T7 mRNA in infected E.coli, of f2 phage RNA in vivo, and of stable mRNA in chromosomeless minicells. The comparison of relative sensitivities to UV is relevant to the technique of UV mapping of transcription units which enjoys increasing popularity in pro- and eukaryotic genetic research. (orig.) [de

  2. Radiation sensitivity of messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Ponta, H; Pfennig-Yeh, M L; Herrlich, P [Kernforschungszentrum Karlsruhe G.m.b.H. (Germany, F.R.). Inst. fuer Genetik und Toxikologie von Spaltstoffen; Karlsruhe Univ. (TH) (Germany, F.R.). Inst. fuer Genetik); Wagner, E F; Schweiger, M [Innsbruck Univ. (Austria). Inst. fuer Biochemie


    Messenger RNA function is inactivated by irradiation with ultraviolet light. A unit length mRNA (in bases) is 2-3 times more sensitive than a unit length of DNA (in base pairs) with respect to the inactivation of template function. These data stem from four experimental systems all of which do not repair DNA: the translation of E. coli mRNA in rifampicin-treated cells, of T7 mRNA in infected E.coli, of f2 phage RNA in vivo, and of stable mRNA in chromosomeless minicells. The comparison of relative sensitivities to UV is relevant to the technique of UV mapping of transcription units which enjoys increasing popularity in pro- and eukaryotic genetic research.

  3. Ultrafast deactivation processes in the 2-aminopyridine dimer and the adenine-thymine base pair: Similarities and differences

    International Nuclear Information System (INIS)

    Ai Yuejie; Zhang Feng; Cui Ganglong; Fang Weihai; Luo Yi


    2-aminopyridine dimer has frequently been used as a model system for studying photochemistry of DNA base pairs. We examine here the relevance of 2-aminopyridine dimer for a Watson-Crick adenine-thymine base pair by studying UV-light induced photodynamics along two main hydrogen bridges after the excitation to the localized 1 ππ* excited-state. The respective two-dimensional potential-energy surfaces have been determined by time-dependent density functional theory with Coulomb-attenuated hybrid exchange-correlation functional (CAM-B3LYP). Different mechanistic aspects of the deactivation pathway have been analyzed and compared in detail for both systems, while the related reaction rates have also be obtained from Monte Carlo kinetic simulations. The limitations of the 2-aminopyridine dimer as a model system for the adenine-thymine base pair are discussed.

  4. Tracking fungal community responses to maize plants by DNA- and RNA-based pyrosequencing.

    Directory of Open Access Journals (Sweden)

    Eiko E Kuramae

    Full Text Available We assessed soil fungal diversity and community structure at two sampling times (t1 = 47 days and t2 = 104 days of plant age in pots associated with four maize cultivars, including two genetically modified (GM cultivars by high-throughput pyrosequencing of the 18S rRNA gene using DNA and RNA templates. We detected no significant differences in soil fungal diversity and community structure associated with different plant cultivars. However, DNA-based analyses yielded lower fungal OTU richness as compared to RNA-based analyses. Clear differences in fungal community structure were also observed in relation to sampling time and the nucleic acid pool targeted (DNA versus RNA. The most abundant soil fungi, as recovered by DNA-based methods, did not necessary represent the most "active" fungi (as recovered via RNA. Interestingly, RNA-derived community compositions at t1 were highly similar to DNA-derived communities at t2, based on presence/absence measures of OTUs. We recovered large proportions of fungal sequences belonging to arbuscular mycorrhizal fungi and Basidiomycota, especially at the RNA level, suggesting that these important and potentially beneficial fungi are not affected by the plant cultivars nor by GM traits (Bt toxin production. Our results suggest that even though DNA- and RNA-derived soil fungal communities can be very different at a given time, RNA composition may have a predictive power of fungal community development through time.

  5. Synthetic biology devices and circuits for RNA-based 'smart vaccines': a propositional review. (United States)

    Andries, Oliwia; Kitada, Tasuku; Bodner, Katie; Sanders, Niek N; Weiss, Ron


    Nucleic acid vaccines have been gaining attention as an alternative to the standard attenuated pathogen or protein based vaccine. However, an unrealized advantage of using such DNA or RNA based vaccination modalities is the ability to program within these nucleic acids regulatory devices that would provide an immunologist with the power to control the production of antigens and adjuvants in a desirable manner by administering small molecule drugs as chemical triggers. Advances in synthetic biology have resulted in the creation of highly predictable and modular genetic parts and devices that can be composed into synthetic gene circuits with complex behaviors. With the recent advent of modified RNA gene delivery methods and developments in the RNA replicon platform, we foresee a future in which mammalian synthetic biologists will create genetic circuits encoded exclusively on RNA. Here, we review the current repertoire of devices used in RNA synthetic biology and propose how programmable 'smart vaccines' will revolutionize the field of RNA vaccination.

  6. GARN: Sampling RNA 3D Structure Space with Game Theory and Knowledge-Based Scoring Strategies. (United States)

    Boudard, Mélanie; Bernauer, Julie; Barth, Dominique; Cohen, Johanne; Denise, Alain


    Cellular processes involve large numbers of RNA molecules. The functions of these RNA molecules and their binding to molecular machines are highly dependent on their 3D structures. One of the key challenges in RNA structure prediction and modeling is predicting the spatial arrangement of the various structural elements of RNA. As RNA folding is generally hierarchical, methods involving coarse-grained models hold great promise for this purpose. We present here a novel coarse-grained method for sampling, based on game theory and knowledge-based potentials. This strategy, GARN (Game Algorithm for RNa sampling), is often much faster than previously described techniques and generates large sets of solutions closely resembling the native structure. GARN is thus a suitable starting point for the molecular modeling of large RNAs, particularly those with experimental constraints. GARN is available from:

  7. Doppler Broadening Analysis of Steel Specimens Using Accelerator Based In Situ Pair Production

    International Nuclear Information System (INIS)

    Makarashvili, V.; Wells, D. P.; Roy, A. K.


    Positron Annihilation Spectroscopy (PAS) techniques can be utilized as a sensitive probe of defects in materials. Studying these microscopic defects is very important for a number of industries in order to predict material failure or structural integrity. We have been developing gamma-induced pair-production techniques to produce positrons in thick samples (∼4-40 g/cm 2 , or ∼0.5-5 cm in steel). These techniques are called 'Accelerator-based Gamma-induced Positron Annihilation Spectroscopy'(AG-PAS). We have begun testing the capabilities of this technique for imaging of defect densities in thick structural materials. As a first step, a linear accelerator (LINAC) was employed to produce photon beams by stopping 15 MeV electrons in a 1 mm thick tungsten converter. The accelerator is capable of operating with 30-60 ns pulse width, up to 200 mA peak current at 1 kHz repetition rate. The highly collimated bremsstrahlung beam impinged upon our steel tensile specimens, after traveling through a 1.2 m thick concrete wall. Annihilation radiation was detected by a well-shielded and collimated high-purity germanium detector (HPGe). Conventional Doppler broadening spectrometry (DBS) was performed to determine S, W and T parameters for our samples.

  8. Study of intrinsic anchoring in nematic liquid crystals based on modified Gruhn-Hess pair potential

    International Nuclear Information System (INIS)

    Zhang Zhidong; Zhang Yanjun


    A nematic liquid crystal slab composed of N molecular layers is investigated using a simple cubic lattice model, based upon the molecular pair potential which is spatially anisotropic and dependent on elastic constants of liquid crystals. A perfect nematic order is assumed in the theoretical treatment, which means the orientation of the molecular long axis coincides with the director of liquid crystal and the total free energy equals to the total interaction energy. We present a modified Gruhn-Hess model, which is relative to the splay-bend elastic constant K 13 . Furthermore, we have studied the free nematic interfacial behavior (intrinsic anchoring) by this model in the assumption of the perfect nematic order. We find that the preferred orientation at the free interface and the intrinsic anchoring strength change with the value of modification, and that the director profile can be determined by the competition of the intrinsic anchoring with external forces present in the system. Also we simulate the intrinsic anchoring at different temperatures using Monte Carlo method and the simulation results show that the intrinsic anchoring favors planar alignment and the free interface is more disordered than the bulk

  9. Locations of Joint Physical Activity in Parent-Child Pairs Based on Accelerometer and GPS Monitoring (United States)

    Dunton, Genevieve Fridlund; Liao, Yue; Almanza, Estela; Jerrett, Micheal; Spruijt-Metz, Donna; Pentz, Mary Ann


    Background Parental factors may play an important role in influencing children’s physical activity levels. Purpose This cross-sectional study sought to describe the locations of joint physical activity among parents and children. Methods Parent-child pairs (N = 291) wore an Actigraph GT2M accelerometer and GlobalSat BT-335 Global Positioning Systems (GPS) device over the same 7-day period. Children were ages 8–14 years. Joint behavior was defined by a linear separation distance of less than 50m between parent and child. Land use classifications were assigned to GPS data points. Results Joint physical activity was spread across residential locations (35%), and commercial venues (24%), and open spaces/parks (20%). Obese children and parents performed less joint physical activity in open spaces/parks than under/normal weight children and parents (p’s parent-child physical activity naturally occurs may inform location-based interventions to promote these behaviors. PMID:23011914

  10. Self-Similarity Based Corresponding-Point Extraction from Weakly Textured Stereo Pairs

    Directory of Open Access Journals (Sweden)

    Min Mao


    Full Text Available For the areas of low textured in image pairs, there is nearly no point that can be detected by traditional methods. The information in these areas will not be extracted by classical interest-point detectors. In this paper, a novel weakly textured point detection method is presented. The points with weakly textured characteristic are detected by the symmetry concept. The proposed approach considers the gray variability of the weakly textured local regions. The detection mechanism can be separated into three steps: region-similarity computation, candidate point searching, and refinement of weakly textured point set. The mechanism of radius scale selection and texture strength conception are used in the second step and the third step, respectively. The matching algorithm based on sparse representation (SRM is used for matching the detected points in different images. The results obtained on image sets with different objects show high robustness of the method to background and intraclass variations as well as to different photometric and geometric transformations; the points detected by this method are also the complement of points detected by classical detectors from the literature. And we also verify the efficacy of SRM by comparing with classical algorithms under the occlusion and corruption situations for matching the weakly textured points. Experiments demonstrate the effectiveness of the proposed weakly textured point detection algorithm.

  11. Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality? (United States)

    Brovarets', Ol'ha O; Hovorun, Dmytro M


    The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.

  12. Intercalation of a Zn(II) complex containing ciprofloxacin drug between DNA base pairs. (United States)

    Shahabadi, Nahid; Asadian, Ali Ashraf; Mahdavi, Mryam


    In this study, an attempt has been made to study the interaction of a Zn(II) complex containing an antibiotic drug, ciprofloxacin, with calf thymus DNA using spectroscopic methods. It was found that Zn(II) complex could bind with DNA via intercalation mode as evidenced by: hyperchromism in UV-Vis spectrum; these spectral characteristics suggest that the Zn(II) complex interacts with DNA most likely through a mode that involves a stacking interaction between the aromatic chromophore and the base pairs of DNA. DNA binding constant (K b = 1.4 × 10 4 M -1 ) from spectrophotometric studies of the interaction of Zn(II) complex with DNA is comparable to those of some DNA intercalative polypyridyl Ru(II) complexes 1.0 -4.8 × 10 4 M -1 . CD study showed stabilization of the right-handed B form of DNA in the presence of Zn(II) complex as observed for the classical intercalator methylene blue. Thermodynamic parameters (ΔH DNA-MB, indicating that it binds to DNA in strong competition with MB for the intercalation.

  13. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles.

    Directory of Open Access Journals (Sweden)

    Aleksandra Delplanque

    Full Text Available Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio probes in Förster Resonance Energy Transfer (FRET where trivalent lanthanide ions (La3+ act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5 modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+ and the acceptor (Cy5 with sensitivity at a nanometre scale.

  14. DNA base pair resolution measurements using resonance energy transfer efficiency in lanthanide doped nanoparticles. (United States)

    Delplanque, Aleksandra; Wawrzynczyk, Dominika; Jaworski, Pawel; Matczyszyn, Katarzyna; Pawlik, Krzysztof; Buckle, Malcolm; Nyk, Marcin; Nogues, Claude; Samoc, Marek


    Lanthanide-doped nanoparticles are of considerable interest for biodetection and bioimaging techniques thanks to their unique chemical and optical properties. As a sensitive luminescence material, they can be used as (bio) probes in Förster Resonance Energy Transfer (FRET) where trivalent lanthanide ions (La3+) act as energy donors. In this paper we present an efficient method to transfer ultrasmall (ca. 8 nm) NaYF4 nanoparticles dispersed in organic solvent to an aqueous solution via oxidation of the oleic acid ligand. Nanoparticles were then functionalized with single strand DNA oligomers (ssDNA) by inducing covalent bonds between surface carboxylic groups and a 5' amine modified-ssDNA. Hybridization with the 5' fluorophore (Cy5) modified complementary ssDNA strand demonstrated the specificity of binding and allowed the fine control over the distance between Eu3+ ions doped nanoparticle and the fluorophore by varying the number of the dsDNA base pairs. First, our results confirmed nonradiative resonance energy transfer and demonstrate the dependence of its efficiency on the distance between the donor (Eu3+) and the acceptor (Cy5) with sensitivity at a nanometre scale.

  15. Biomolecule Analogues 2-Hydroxypyridine and 2-Pyridone Base Pairing on Ice Nanoparticles. (United States)

    Rubovič, Peter; Pysanenko, Andriy; Lengyel, Jozef; Nachtigallová, Dana; Fárník, Michal


    Ice nanoparticles (H2O)N, N ≈ 450 generated in a molecular beam experiment pick up individual gas phase molecules of 2-hydroxypyridine and 2-pyridone (HP) evaporated in a pickup cell at temperatures between 298 and 343 K. The mass spectra of the doped nanoparticles show evidence for generation of clusters of adsorbed molecules (HP)n up to n = 8. The clusters are ionized either by 70 eV electrons or by two photons at 315 nm (3.94 eV). The two ionization methods yield different spectra, and their comparison provides an insight into the neutral cluster composition, ionization and intracluster ion-molecule reactions, and cluster fragmentation. Quite a few molecules were reported not to coagulate on ice nanoparticles previously. The (HP)n cluster generation on ice nanoparticles represents the first evidence for coagulating of molecules and cluster formation on free ice nanoparticles. For comparison, we investigate the coagulation of HP molecules picked up on large clusters ArN, N ≈ 205, and also (HP)n clusters generated in supersonic expansions with Ar buffer gas. This comparison points to a propensity for the (HP)2 dimer generation on ice nanoparticles. This shows the feasibility of base pairing for model of biological molecules on free ice nanoparticles. This result is important for hypotheses of the biomolecule synthesis on ice grains in the space. We support our findings by theoretical calculations that show, among others, the HP dimer structures on water clusters.

  16. Paired-Associate and Feedback-Based Weather Prediction Tasks Support Multiple Category Learning Systems. (United States)

    Li, Kaiyun; Fu, Qiufang; Sun, Xunwei; Zhou, Xiaoyan; Fu, Xiaolan


    It remains unclear whether probabilistic category learning in the feedback-based weather prediction task (FB-WPT) can be mediated by a non-declarative or procedural learning system. To address this issue, we compared the effects of training time and verbal working memory, which influence the declarative learning system but not the non-declarative learning system, in the FB and paired-associate (PA) WPTs, as the PA task recruits a declarative learning system. The results of Experiment 1 showed that the optimal accuracy in the PA condition was significantly decreased when the training time was reduced from 7 to 3 s, but this did not occur in the FB condition, although shortened training time impaired the acquisition of explicit knowledge in both conditions. The results of Experiment 2 showed that the concurrent working memory task impaired the optimal accuracy and the acquisition of explicit knowledge in the PA condition but did not influence the optimal accuracy or the acquisition of self-insight knowledge in the FB condition. The apparent dissociation results between the FB and PA conditions suggested that a non-declarative or procedural learning system is involved in the FB-WPT and provided new evidence for the multiple-systems theory of human category learning.

  17. Identification of somatic mutations in cancer through Bayesian-based analysis of sequenced genome pairs. (United States)

    Christoforides, Alexis; Carpten, John D; Weiss, Glen J; Demeure, Michael J; Von Hoff, Daniel D; Craig, David W


    The field of cancer genomics has rapidly adopted next-generation sequencing (NGS) in order to study and characterize malignant tumors with unprecedented resolution. In particular for cancer, one is often trying to identify somatic mutations--changes specific to a tumor and not within an individual's germline. However, false positive and false negative detections often result from lack of sufficient variant evidence, contamination of the biopsy by stromal tissue, sequencing errors, and the erroneous classification of germline variation as tumor-specific. We have developed a generalized Bayesian analysis framework for matched tumor/normal samples with the purpose of identifying tumor-specific alterations such as single nucleotide mutations, small insertions/deletions, and structural variation. We describe our methodology, and discuss its application to other types of paired-tissue analysis such as the detection of loss of heterozygosity as well as allelic imbalance. We also demonstrate the high level of sensitivity and specificity in discovering simulated somatic mutations, for various combinations of a) genomic coverage and b) emulated heterogeneity. We present a Java-based implementation of our methods named Seurat, which is made available for free academic use. We have demonstrated and reported on the discovery of different types of somatic change by applying Seurat to an experimentally-derived cancer dataset using our methods; and have discussed considerations and practices regarding the accurate detection of somatic events in cancer genomes. Seurat is available at

  18. RNA-TVcurve: a Web server for RNA secondary structure comparison based on a multi-scale similarity of its triple vector curve representation. (United States)

    Li, Ying; Shi, Xiaohu; Liang, Yanchun; Xie, Juan; Zhang, Yu; Ma, Qin


    RNAs have been found to carry diverse functionalities in nature. Inferring the similarity between two given RNAs is a fundamental step to understand and interpret their functional relationship. The majority of functional RNAs show conserved secondary structures, rather than sequence conservation. Those algorithms relying on sequence-based features usually have limitations in their prediction performance. Hence, integrating RNA structure features is very critical for RNA analysis. Existing algorithms mainly fall into two categories: alignment-based and alignment-free. The alignment-free algorithms of RNA comparison usually have lower time complexity than alignment-based algorithms. An alignment-free RNA comparison algorithm was proposed, in which novel numerical representations RNA-TVcurve (triple vector curve representation) of RNA sequence and corresponding secondary structure features are provided. Then a multi-scale similarity score of two given RNAs was designed based on wavelet decomposition of their numerical representation. In support of RNA mutation and phylogenetic analysis, a web server (RNA-TVcurve) was designed based on this alignment-free RNA comparison algorithm. It provides three functional modules: 1) visualization of numerical representation of RNA secondary structure; 2) detection of single-point mutation based on secondary structure; and 3) comparison of pairwise and multiple RNA secondary structures. The inputs of the web server require RNA primary sequences, while corresponding secondary structures are optional. For the primary sequences alone, the web server can compute the secondary structures using free energy minimization algorithm in terms of RNAfold tool from Vienna RNA package. RNA-TVcurve is the first integrated web server, based on an alignment-free method, to deliver a suite of RNA analysis functions, including visualization, mutation analysis and multiple RNAs structure comparison. The comparison results with two popular RNA

  19. Universal quantum gates for Single Cooper Pair Box based quantum computing (United States)

    Echternach, P.; Williams, C. P.; Dultz, S. C.; Braunstein, S.; Dowling, J. P.


    We describe a method for achieving arbitrary 1-qubit gates and controlled-NOT gates within the context of the Single Cooper Pair Box (SCB) approach to quantum computing. Such gates are sufficient to support universal quantum computation.

  20. Neutron matter, neutron pairing, and neutron drops based on chiral effective field theory interactions

    Energy Technology Data Exchange (ETDEWEB)

    Krueger, Thomas


    calculate the pairing gaps in neutron matter and provide uncertainty estimates. The formation of heavy elements in the early universe proceeds through the rapid neutron-capture process. This process requires precise knowledge of the properties of very neutron-rich nuclei, which are unstable and at present not accessible in experiments. Thus, one can explore their properties only with theoretical calculations. Currently the only approach to the properties of all nuclei are energy-density functionals (EDFs). All EDFs used today are based on phenomenological models and fits to stable nuclei, which makes their predictive power for unknown (neutron-rich) nuclei unclear. Deriving an ab initio EDF directly from the nuclear forces is an important goal of nuclear theory. A promising approach is the optimised effective potential (OEP) method. We take a step into that direction and calculate neutron drops within the OEP formalism. In addition to the exact-exchange approximation we study for the first time the effect of second-order contributions and compare to quantum Monte Carlo and other results.

  1. 16S rRNA gene-based phylogenetic microarray for simultaneous identification of members of the genus Burkholderia. (United States)

    Schönmann, Susan; Loy, Alexander; Wimmersberger, Céline; Sobek, Jens; Aquino, Catharine; Vandamme, Peter; Frey, Beat; Rehrauer, Hubert; Eberl, Leo


    For cultivation-independent and highly parallel analysis of members of the genus Burkholderia, an oligonucleotide microarray (phylochip) consisting of 131 hierarchically nested 16S rRNA gene-targeted oligonucleotide probes was developed. A novel primer pair was designed for selective amplification of a 1.3 kb 16S rRNA gene fragment of Burkholderia species prior to microarray analysis. The diagnostic performance of the microarray for identification and differentiation of Burkholderia species was tested with 44 reference strains of the genera Burkholderia, Pandoraea, Ralstonia and Limnobacter. Hybridization patterns based on presence/absence of probe signals were interpreted semi-automatically using the novel likelihood-based strategy of the web-tool Phylo- Detect. Eighty-eight per cent of the reference strains were correctly identified at the species level. The evaluated microarray was applied to investigate shifts in the Burkholderia community structure in acidic forest soil upon addition of cadmium, a condition that selected for Burkholderia species. The microarray results were in agreement with those obtained from phylogenetic analysis of Burkholderia 16S rRNA gene sequences recovered from the same cadmiumcontaminated soil, demonstrating the value of the Burkholderia phylochip for determinative and environmental studies.

  2. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair (United States)

    Sinurat, E. N.; Yudiarsah, E.


    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  3. On RNA-RNA interaction structures of fixed topological genus. (United States)

    Fu, Benjamin M M; Han, Hillary S W; Reidys, Christian M


    Interacting RNA complexes are studied via bicellular maps using a filtration via their topological genus. Our main result is a new bijection for RNA-RNA interaction structures and a linear time uniform sampling algorithm for RNA complexes of fixed topological genus. The bijection allows to either reduce the topological genus of a bicellular map directly, or to lose connectivity by decomposing the complex into a pair of single stranded RNA structures. Our main result is proved bijectively. It provides an explicit algorithm of how to rewire the corresponding complexes and an unambiguous decomposition grammar. Using the concept of genus induction, we construct bicellular maps of fixed topological genus g uniformly in linear time. We present various statistics on these topological RNA complexes and compare our findings with biological complexes. Furthermore we show how to construct loop-energy based complexes using our decomposition grammar. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Lipid-Based Liquid Crystalline Nanoparticles Facilitate Cytosolic Delivery of siRNA via Structural Transformation. (United States)

    He, Shufang; Fan, Weiwei; Wu, Na; Zhu, Jingjing; Miao, Yunqiu; Miao, Xiaran; Li, Feifei; Zhang, Xinxin; Gan, Yong


    RNA interference (RNAi) technology has shown great promise for the treatment of cancer and other genetic disorders. Despite the efforts to increase the target tissue distribution, the safe and effective delivery of siRNA to the diseased cells with sufficient cytosolic transport is another critical factor for successful RNAi clinical application. Here, the constructed lipid-based liquid crystalline nanoparticles, called nano-Transformers, can transform thestructure in the intracellular acidic environment and perform high-efficient siRNA delivery for cancer treatment. The developed nano-Transformers have satisfactory siRNA loading efficiency and low cytotoxicity. Different from the traditional cationic nanocarriers, the endosomal membrane fusion induced by the conformational transition of lipids contributes to the easy dissociation of siRNA from nanocarriers and direct release of free siRNA into cytoplasm. We show that transfection with cyclin-dependent kinase 1 (CDK1)-siRNA-loaded nano-Transformers causes up to 95% reduction of relevant mRNA in vitro and greatly inhibits the tumor growth without causing any immunogenic response in vivo. This work highlights that the lipid-based nano-Transformers may become the next generation of siRNA delivery system with higher efficacy and improved safety profiles.

  5. A rhodium(III) complex for high-affinity DNA base-pair mismatch recognition (United States)

    Junicke, Henrik; Hart, Jonathan R.; Kisko, Jennifer; Glebov, Oleg; Kirsch, Ilan R.; Barton, Jacqueline K.


    A rhodium(III) complex, rac-[Rh(bpy)2phzi]3+ (bpy, 2,2′-bipyridine; phzi, benzo[a]phenazine-5,6-quinone diimine) has been designed as a sterically demanding intercalator targeted to destabilized mismatched sites in double-helical DNA. The complex is readily synthesized by condensation of the phenazine quinone with the corresponding diammine complex. Upon photoactivation, the complex promotes direct strand scission at single-base mismatch sites within the DNA duplex. As with the parent mismatch-specific reagent, [Rh(bpy)2(chrysi)]3+ [chrysene-5,6-quinone diimine (chrysi)], mismatch selectivity depends on the helix destabilization associated with mispairing. Unlike the parent chrysi complex, the phzi analogue binds and cleaves with high affinity and efficiency. The specific binding constants for CA, CC, and CT mismatches within a 31-mer oligonucleotide duplex are 0.3, 1, and 6 × 107 M−1, respectively; site-specific photocleavage is evident at nanomolar concentrations. Moreover, the specificity, defined as the ratio in binding affinities for mispaired vs. well paired sites, is maintained. The increase in affinity is attributed to greater stability in the mismatched site associated with stacking by the heterocyclic aromatic ligand. The high-affinity complex is also applied in the differential cleavage of DNA obtained from cell lines deficient in mismatch repair vs. those proficient in mismatch repair. Agreement is found between photocleavage by the mismatch-specific probes and deficiency in mismatch repair. This mismatch-specific targeting, therefore, offers a potential strategy for new chemotherapeutic design. PMID:12610209

  6. Mass renormalization and unconventional pairing in multi-band Fe-based superconductors- a phenomenological approach

    Energy Technology Data Exchange (ETDEWEB)

    Drechsler, S.L.; Efremov, D.; Grinenko, V. [IFW-Dresden (Germany); Johnston, S. [Inst. of Quantum Matter, University of British Coulumbia, Vancouver (Canada); Rosner, H. [MPI-cPfS, Dresden, (Germany); Kikoin, K. [Tel Aviv University (Israel)


    Combining DFT calculations of the density of states and plasma frequencies with experimental thermodynamic, optical, ARPES, and dHvA data taken from the literature, we estimate both the high-energy (Coulomb, Hund's rule coupling) and the low-energy (el-boson coupling) electronic mass renormalization [H(L)EMR] for typical Fe-pnictides with T{sub c}<40 K, focusing on (K,Rb,Cs)Fe{sub 2}As{sub 2}, (Ca,Na)122, (Ba,K)122, LiFeAs, and LaFeO{sub 1-x}F{sub x}As with and without As-vacancies. Using Eliashberg theory we show that these systems can NOT be described by a very strong el-boson coupling constant λ ≥ ∝ 2, being in conflict with the HEMR as seen by DMFT, ARPES and optics. Instead, an intermediate s{sub ±} coupling regime is realized, mainly based on interband spin fluctuations from one predominant pair of bands. For (Ca,Na)122, there is also a non-negligible intraband el-phonon/orbital fluctuation intraband contribution. The coexistence of magnetic As-vacancies and high-T{sub c}=28 K for LaFeO{sub 1-x}F{sub x}As{sub 1-δ} excludes an orbital fluctuation dominated s{sub ++} scenario at least for that system. In contrast, the line nodal BaFe{sub 2}(As,P){sub 2} near the quantum critical point is found as a superstrongly coupled system. The role of a pseudo-gap is briefly discussed for some of these systems.

  7. Comparison of RNA-seq and microarray-based models for clinical endpoint prediction. (United States)

    Zhang, Wenqian; Yu, Ying; Hertwig, Falk; Thierry-Mieg, Jean; Zhang, Wenwei; Thierry-Mieg, Danielle; Wang, Jian; Furlanello, Cesare; Devanarayan, Viswanath; Cheng, Jie; Deng, Youping; Hero, Barbara; Hong, Huixiao; Jia, Meiwen; Li, Li; Lin, Simon M; Nikolsky, Yuri; Oberthuer, André; Qing, Tao; Su, Zhenqiang; Volland, Ruth; Wang, Charles; Wang, May D; Ai, Junmei; Albanese, Davide; Asgharzadeh, Shahab; Avigad, Smadar; Bao, Wenjun; Bessarabova, Marina; Brilliant, Murray H; Brors, Benedikt; Chierici, Marco; Chu, Tzu-Ming; Zhang, Jibin; Grundy, Richard G; He, Min Max; Hebbring, Scott; Kaufman, Howard L; Lababidi, Samir; Lancashire, Lee J; Li, Yan; Lu, Xin X; Luo, Heng; Ma, Xiwen; Ning, Baitang; Noguera, Rosa; Peifer, Martin; Phan, John H; Roels, Frederik; Rosswog, Carolina; Shao, Susan; Shen, Jie; Theissen, Jessica; Tonini, Gian Paolo; Vandesompele, Jo; Wu, Po-Yen; Xiao, Wenzhong; Xu, Joshua; Xu, Weihong; Xuan, Jiekun; Yang, Yong; Ye, Zhan; Dong, Zirui; Zhang, Ke K; Yin, Ye; Zhao, Chen; Zheng, Yuanting; Wolfinger, Russell D; Shi, Tieliu; Malkas, Linda H; Berthold, Frank; Wang, Jun; Tong, Weida; Shi, Leming; Peng, Zhiyu; Fischer, Matthias


    Gene expression profiling is being widely applied in cancer research to identify biomarkers for clinical endpoint prediction. Since RNA-seq provides a powerful tool for transcriptome-based applications beyond the limitations of microarrays, we sought to systematically evaluate the performance of RNA-seq-based and microarray-based classifiers in this MAQC-III/SEQC study for clinical endpoint prediction using neuroblastoma as a model. We generate gene expression profiles from 498 primary neuroblastomas using both RNA-seq and 44 k microarrays. Characterization of the neuroblastoma transcriptome by RNA-seq reveals that more than 48,000 genes and 200,000 transcripts are being expressed in this malignancy. We also find that RNA-seq provides much more detailed information on specific transcript expression patterns in clinico-genetic neuroblastoma subgroups than microarrays. To systematically compare the power of RNA-seq and microarray-based models in predicting clinical endpoints, we divide the cohort randomly into training and validation sets and develop 360 predictive models on six clinical endpoints of varying predictability. Evaluation of factors potentially affecting model performances reveals that prediction accuracies are most strongly influenced by the nature of the clinical endpoint, whereas technological platforms (RNA-seq vs. microarrays), RNA-seq data analysis pipelines, and feature levels (gene vs. transcript vs. exon-junction level) do not significantly affect performances of the models. We demonstrate that RNA-seq outperforms microarrays in determining the transcriptomic characteristics of cancer, while RNA-seq and microarray-based models perform similarly in clinical endpoint prediction. Our findings may be valuable to guide future studies on the development of gene expression-based predictive models and their implementation in clinical practice.

  8. Base pair mismatches and carcinogen-modified bases in DNA: an NMR study of G x T and G x O4meT pairing in dodecanucleotide duplexes

    International Nuclear Information System (INIS)

    Kalnik, M.W.; Kouchakdjian, M.; Li, B.F.L.; Swann, P.F.; Patel, D.J.


    High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G x T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O 4 meT-G-C-G) duplex (designated G x O 4 meT 12-mer) containing G x T and G x O 4 meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G x T 12-mer and G x O 4 meT 12-mer duplexes in H 2 O and D 2 O solution. The guanosine and thymidine imino protons in the G x T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G x T 12-mer duplex. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G x T mismatch or in G x C base pairs indicates that hydrogen bonding to O 4 meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH 3 group of O 4 meT across the pair and NOEs to the imino protons of flanking base pairs. Taken together with data from the NMR of nonexchangeable protons, this shows that both G and O 4 meT have anti-glycosidic torsion angles and are stacked into the duplex. Comparison of the intensity of the NOEs between the guanosine imino proton and the OCH 3 of O 4 meT as well as other protons in its vicinity demonstrates that the OCH 3 group of O 4 meT adopts the syn orientation with respect to N3 of the methylated thymidine. The authors propose an alternate base pairing mode stabilized by one short hydrogen bond between the 2-amino group of guanosine and the 2-carbonyl group of O 4 met

  9. Supramolecular Switches Based on the Guanine–Cytosine (GC) Watson–Crick Pair: Effect of Neutral and Ionic Substituents

    NARCIS (Netherlands)

    Guerra, C.F.; van der Wijst, T.; Bickelhaupt, F.M.


    We have theoretically analyzed Watson–Crick guanine–cytosine (GC) base pairs in which purine-C8 and/or pyrimidine-C6 positions carry a substituent X = NH−, NH2, NH3+ (N series), O−, OH, or OH2+ (O series), using the generalized gradient approximation (GGA) of density functional theory at the

  10. Higher order structural effects stabilizing the reverse watson-crick guanine-cytosine base pair in functional RNAs

    KAUST Repository

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi


    of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G

  11. A 3-base pair deletion, c.9711_9713del, in DMD results in intellectual disability without muscular dystrophy

    NARCIS (Netherlands)

    Brouwer, A.P.M. de; Nabuurs, S.B.; Verhaart, I.E.; Oudakker, A.R.; Hordijk, R.; Yntema, H.G.; Hordijk-Hos, J.M.; Voesenek, K.E.; Vries, B. de; Essen, T. van; Chen, W.; Hu, H; Chelly, J.; Dunnen, J.T. den; Kalscheuer, V.M.M.; Aartsma-Rus, A.M.; Hamel, B.C.J.; Bokhoven, H. van; Kleefstra, T.


    We have identified a deletion of 3 base pairs in the dystrophin gene (DMD), c.9711_9713del, in a family with nonspecific X-linked intellectual disability (ID) by sequencing of the exons of 86 known X-linked ID genes. This in-frame deletion results in the deletion of a single-amino-acid residue,

  12. Geminal phosphorus/aluminum-based frustrated Lewis pairs: C-H versus C≡C activation and CO2 fixation

    NARCIS (Netherlands)

    Appelt, C.; Westenberg, H.; Bertini, F.; Ehlers, A.W.; Slootweg, J.C.; Lammertsma, K.; Uhl, W.


    Catch it! Geminal phosphorus/aluminum-based frustrated Lewis pairs (FLPs) are easily obtained by hydroalumination of alkynylphosphines. These FLPs can activate terminal acetylenes by two competitive pathways, which were analyzed by DFT calculations, and they can bind carbon dioxide reversibly.

  13. Photoinduced electron transfer in a Watson-Crick base-paired, 2-aminopurine:uracil-C60 hydrogen bonding conjugate. (United States)

    D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu


    A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.

  14. Identification of a two base pair deletion in five unrelated families with adrenoleukodystrophy: a possible hot spot for mutations

    NARCIS (Netherlands)

    Kemp, S.; Ligtenberg, M. J.; van Geel, B. M.; Barth, P. G.; Wolterman, R. A.; Schoute, F.; Sarde, C. O.; Mandel, J. L.; van Oost, B. A.; Bolhuis, P. A.


    The gene for X-linked adrenoleukodystrophy (ALD) was recently identified. Intragenic deletions of several kilobases were found in about 7% of patients. Point mutations, expected to be very heterogeneous, were identified so far in only two patients. We report the identification of a two base pair

  15. RNA-SSPT: RNA Secondary Structure Prediction Tools. (United States)

    Ahmad, Freed; Mahboob, Shahid; Gulzar, Tahsin; Din, Salah U; Hanif, Tanzeela; Ahmad, Hifza; Afzal, Muhammad


    The prediction of RNA structure is useful for understanding evolution for both in silico and in vitro studies. Physical methods like NMR studies to predict RNA secondary structure are expensive and difficult. Computational RNA secondary structure prediction is easier. Comparative sequence analysis provides the best solution. But secondary structure prediction of a single RNA sequence is challenging. RNA-SSPT is a tool that computationally predicts secondary structure of a single RNA sequence. Most of the RNA secondary structure prediction tools do not allow pseudoknots in the structure or are unable to locate them. Nussinov dynamic programming algorithm has been implemented in RNA-SSPT. The current studies shows only energetically most favorable secondary structure is required and the algorithm modification is also available that produces base pairs to lower the total free energy of the secondary structure. For visualization of RNA secondary structure, NAVIEW in C language is used and modified in C# for tool requirement. RNA-SSPT is built in C# using Dot Net 2.0 in Microsoft Visual Studio 2005 Professional edition. The accuracy of RNA-SSPT is tested in terms of Sensitivity and Positive Predicted Value. It is a tool which serves both secondary structure prediction and secondary structure visualization purposes.

  16. Investigation of RNA Structure by High-Throughput SHAPE-Based Probing Methods

    DEFF Research Database (Denmark)

    Poulsen, Line Dahl

    of highthroughput SHAPE-based approaches to investigate RNA structure based on novel SHAPE reagents that permit selection of full-length cDNAs. The SHAPE Selection (SHAPES) method is applied to the foot-and-mouth disease virus (FMDV) plus strand RNA genome, and the data is used to construct a genome-wide structural...... that they are functional. The SHAPES method is further applied to the hepatitis C virus (HCV), where the data is used to refine known and predicted structures. Over the past years, the interest of studying RNA structure in their native environment has been increased, and to allow studying RNA structure inside living cells...... using the SHAPE Selection approach, I introduce a biotinylated probing reagent. This chemical can cross cell membranes and reacts with RNA inside the cells, allowing the structural conformations to be studied in the context of physiological relevant conditions in living cells. The methods and results...

  17. Smart Inulin-Based Polycationic Nanodevices for siRNA Delivery. (United States)

    Cavallaro, G; Sardo, C; Scialabba, C; Licciardi, M; Giammona, G


    The advances of short interfering RNA (siRNA) mediated therapy provide a powerful option for the treatment of many diseases by silencing the expression of targeted genes including cancer development and progression. Inulin is a very simple and biocompatible polysaccharide proposed by our groups to produce interesting delivery systems for Nucleic Acid Based Drugs (NABDs), such as siRNA, either as polycations able to give polyplexes and polymeric coatings for nanosystems having a metallic core. In this research field, different functionalizing groups were linked to the inulin backbone with specific aims including oligoamine such as Ethylendiammine (EDA), Diethylediamine (DETA), Spermine, (SPM) etc. In this contribution the main Inulin-based nanodevices for the delivery of siRNA have been reported, analysed and compared with particular reference to their chemical design and structure, biocompatibility, siRNA complexing ability, silencing ability. Copyright© Bentham Science Publishers; For any queries, please email at

  18. Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution. (United States)

    Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M


    Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Adjusted Wald Confidence Interval for a Difference of Binomial Proportions Based on Paired Data (United States)

    Bonett, Douglas G.; Price, Robert M.


    Adjusted Wald intervals for binomial proportions in one-sample and two-sample designs have been shown to perform about as well as the best available methods. The adjusted Wald intervals are easy to compute and have been incorporated into introductory statistics courses. An adjusted Wald interval for paired binomial proportions is proposed here and…

  20. Predicting and Modeling RNA Architecture (United States)

    Westhof, Eric; Masquida, Benoît; Jossinet, Fabrice


    SUMMARY A general approach for modeling the architecture of large and structured RNA molecules is described. The method exploits the modularity and the hierarchical folding of RNA architecture that is viewed as the assembly of preformed double-stranded helices defined by Watson-Crick base pairs and RNA modules maintained by non-Watson-Crick base pairs. Despite the extensive molecular neutrality observed in RNA structures, specificity in RNA folding is achieved through global constraints like lengths of helices, coaxiality of helical stacks, and structures adopted at the junctions of helices. The Assemble integrated suite of computer tools allows for sequence and structure analysis as well as interactive modeling by homology or ab initio assembly with possibilities for fitting within electronic density maps. The local key role of non-Watson-Crick pairs guides RNA architecture formation and offers metrics for assessing the accuracy of three-dimensional models in a more useful way than usual root mean square deviation (RMSD) values. PMID:20504963

  1. Classification between normal and tumor tissues based on the pair-wise gene expression ratio

    International Nuclear Information System (INIS)

    Yap, YeeLeng; Zhang, XueWu; Ling, MT; Wang, XiangHong; Wong, YC; Danchin, Antoine


    Precise classification of cancer types is critically important for early cancer diagnosis and treatment. Numerous efforts have been made to use gene expression profiles to improve precision of tumor classification. However, reliable cancer-related signals are generally lacking. Using recent datasets on colon and prostate cancer, a data transformation procedure from single gene expression to pair-wise gene expression ratio is proposed. Making use of the internal consistency of each expression profiling dataset this transformation improves the signal to noise ratio of the dataset and uncovers new relevant cancer-related signals (features). The efficiency in using the transformed dataset to perform normal/tumor classification was investigated using feature partitioning with informative features (gene annotation) as discriminating axes (single gene expression or pair-wise gene expression ratio). Classification results were compared to the original datasets for up to 10-feature model classifiers. 82 and 262 genes that have high correlation to tissue phenotype were selected from the colon and prostate datasets respectively. Remarkably, data transformation of the highly noisy expression data successfully led to lower the coefficient of variation (CV) for the within-class samples as well as improved the correlation with tissue phenotypes. The transformed dataset exhibited lower CV when compared to that of single gene expression. In the colon cancer set, the minimum CV decreased from 45.3% to 16.5%. In prostate cancer, comparable CV was achieved with and without transformation. This improvement in CV, coupled with the improved correlation between the pair-wise gene expression ratio and tissue phenotypes, yielded higher classification efficiency, especially with the colon dataset – from 87.1% to 93.5%. Over 90% of the top ten discriminating axes in both datasets showed significant improvement after data transformation. The high classification efficiency achieved suggested

  2. Genome-Wide Development of MicroRNA-Based SSR Markers in Medicago truncatula with Their Transferability Analysis and Utilization in Related Legume Species. (United States)

    Min, Xueyang; Zhang, Zhengshe; Liu, Yisong; Wei, Xingyi; Liu, Zhipeng; Wang, Yanrong; Liu, Wenxian


    Microsatellite (simple sequence repeats, SSRs) marker is one of the most widely used markers in marker-assisted breeding. As one type of functional markers, MicroRNA-based SSR (miRNA-SSR) markers have been exploited mainly in animals, but the development and characterization of miRNA-SSR markers in plants are still limited. In the present study, miRNA-SSR markers for Medicago truncatula ( M. truncatula ) were developed and their cross-species transferability in six leguminous species was evaluated. A total of 169 primer pairs were successfully designed from 130 M. truncatula miRNA genes, the majority of which were mononucleotide repeats (70.41%), followed by dinucleotide repeats (14.20%), compound repeats (11.24%) and trinucleotide repeats (4.14%). Functional classification of SSR-containing miRNA genes showed that all targets could be grouped into three Gene Ontology (GO) categories: 17 in biological process, 11 in molecular function, and 14 in cellular component. The miRNA-SSR markers showed high transferability in other six leguminous species, ranged from 74.56% to 90.53%. Furthermore, 25 Mt - miRNA-SSR markers were used to evaluate polymorphisms in 20 alfalfa accessions, and the polymorphism information content (PIC) values ranged from 0.39 to 0.89 with an average of 0.71, the allele number per marker varied from 3 to 18 with an average of 7.88, indicating a high level of informativeness. The present study is the first time developed and characterized of M. truncatula miRNA-SSRs and demonstrated their utility in transferability, these novel markers will be valuable for genetic diversity analysis, marker-assisted selection and genotyping in leguminous species.

  3. Investigations on therapeutic glucocerebrosidases through paired detection with fluorescent activity-based probes.

    Directory of Open Access Journals (Sweden)

    Wouter W Kallemeijn

    Full Text Available Deficiency of glucocerebrosidase (GBA causes Gaucher disease (GD. In the common non-neuronopathic GD type I variant, glucosylceramide accumulates primarily in the lysosomes of visceral macrophages. Supplementing storage cells with lacking enzyme is accomplished via chronic intravenous administration of recombinant GBA containing mannose-terminated N-linked glycans, mediating the selective uptake by macrophages expressing mannose-binding lectin(s. Two recombinant GBA preparations with distinct N-linked glycans are registered in Europe for treatment of type I GD: imiglucerase (Genzyme, contains predominantly Man(3 glycans, and velaglucerase (Shire PLC Man(9 glycans. Activity-based probes (ABPs enable fluorescent labeling of recombinant GBA preparations through their covalent attachment to the catalytic nucleophile E340 of GBA. We comparatively studied binding and uptake of ABP-labeled imiglucerase and velaglucerase in isolated dendritic cells, cultured human macrophages and living mice, through simultaneous detection of different GBAs by paired measurements. Uptake of ABP-labeled rGBAs by dendritic cells was comparable, as well as the bio-distribution following equimolar intravenous administration to mice. ABP-labeled rGBAs were recovered largely in liver, white-blood cells, bone marrow and spleen. Lungs, brain and skin, affected tissues in severe GD types II and III, were only poorly supplemented. Small, but significant differences were noted in binding and uptake of rGBAs in cultured human macrophages, in the absence and presence of mannan. Mannan-competed binding and uptake were largest for velaglucerase, when determined with single enzymes or as equimolar mixtures of both enzymes. Vice versa, imiglucerase showed more prominent binding and uptake not competed by mannan. Uptake of recombinant GBAs by cultured macrophages seems to involve multiple receptors, including several mannose-binding lectins. Differences among cells from different donors

  4. Web Camera Based Eye Tracking to Assess Visual Memory on a Visual Paired Comparison Task

    Directory of Open Access Journals (Sweden)

    Nicholas T. Bott


    Full Text Available Background: Web cameras are increasingly part of the standard hardware of most smart devices. Eye movements can often provide a noninvasive “window on the brain,” and the recording of eye movements using web cameras is a burgeoning area of research.Objective: This study investigated a novel methodology for administering a visual paired comparison (VPC decisional task using a web camera.To further assess this method, we examined the correlation between a standard eye-tracking camera automated scoring procedure [obtaining images at 60 frames per second (FPS] and a manually scored procedure using a built-in laptop web camera (obtaining images at 3 FPS.Methods: This was an observational study of 54 clinically normal older adults.Subjects completed three in-clinic visits with simultaneous recording of eye movements on a VPC decision task by a standard eye tracker camera and a built-in laptop-based web camera. Inter-rater reliability was analyzed using Siegel and Castellan's kappa formula. Pearson correlations were used to investigate the correlation between VPC performance using a standard eye tracker camera and a built-in web camera.Results: Strong associations were observed on VPC mean novelty preference score between the 60 FPS eye tracker and 3 FPS built-in web camera at each of the three visits (r = 0.88–0.92. Inter-rater agreement of web camera scoring at each time point was high (κ = 0.81–0.88. There were strong relationships on VPC mean novelty preference score between 10, 5, and 3 FPS training sets (r = 0.88–0.94. Significantly fewer data quality issues were encountered using the built-in web camera.Conclusions: Human scoring of a VPC decisional task using a built-in laptop web camera correlated strongly with automated scoring of the same task using a standard high frame rate eye tracker camera.While this method is not suitable for eye tracking paradigms requiring the collection and analysis of fine-grained metrics, such as

  5. Chess games: a model for RNA based computation. (United States)

    Cukras, A R; Faulhammer, D; Lipton, R J; Landweber, L F


    Here we develop the theory of RNA computing and a method for solving the 'knight problem' as an instance of a satisfiability (SAT) problem. Using only biological molecules and enzymes as tools, we developed an algorithm for solving the knight problem (3 x 3 chess board) using a 10-bit combinatorial pool and sequential RNase H digestions. The results of preliminary experiments presented here reveal that the protocol recovers far more correct solutions than expected at random, but the persistence of errors still presents the greatest challenge.

  6. New Kids on the Block: RNA-Based Influenza Virus Vaccines. (United States)

    Scorza, Francesco Berlanda; Pardi, Norbert


    RNA-based immunization strategies have emerged as promising alternatives to conventional vaccine approaches. A substantial body of published work demonstrates that RNA vaccines can elicit potent, protective immune responses against various pathogens. Consonant with its huge impact on public health, influenza virus is one of the best studied targets of RNA vaccine research. Currently licensed influenza vaccines show variable levels of protection against seasonal influenza virus strains but are inadequate against drifted and pandemic viruses. In recent years, several types of RNA vaccines demonstrated efficacy against influenza virus infections in preclinical models. Additionally, comparative studies demonstrated the superiority of some RNA vaccines over the currently used inactivated influenza virus vaccines in animal models. Based on these promising preclinical results, clinical trials have been initiated and should provide valuable information about the translatability of the impressive preclinical data to humans. This review briefly describes RNA-based vaccination strategies, summarizes published preclinical and clinical data, highlights the roadblocks that need to be overcome for clinical applications, discusses the landscape of industrial development, and shares the authors' personal perspectives about the future of RNA-based influenza virus vaccines.

  7. Contact ion pair formation between hard acids and soft bases in aqueous solutions observed with 2DIR spectroscopy. (United States)

    Sun, Zheng; Zhang, Wenkai; Ji, Minbiao; Hartsock, Robert; Gaffney, Kelly J


    The interaction of charged species in aqueous solution has important implications for chemical, biological, and environmental processes. We have used 2DIR spectroscopy to study the equilibrium dynamics of thiocyanate chemical exchange between free ion (NCS(-)) and contact ion pair configurations (MNCS(+)), where M(2+) = Mg(2+) or Ca(2+). Detailed studies of the influence of anion concentration and anion speciation show that the chemical exchange observed with the 2DIR measurements results from NCS(-) exchanging with other anion species in the first solvation shell surrounding Mg(2+) or Ca(2+). The presence of chemical exchange in the 2DIR spectra provides an indirect, but robust, determinant of contact ion pair formation. We observe preferential contact ion pair formation between soft Lewis base anions and hard Lewis acid cations. This observation cannot be easily reconciled with Pearson's acid-base concept or Collins' Law of Matching Water Affinities. The anions that form contact ion pairs also correspond to the ions with an affinity for water and protein surfaces, so similar physical and chemical properties may control these distinct phenomena.

  8. In vitro base modification of Escherichia coli glutamate 2 transfer-RNA and phenylalanine transfer-RNA gene transcripts

    International Nuclear Information System (INIS)

    Shahan, M.N.


    Plasmids were constructed that contain an E. Coli tRNA 2 Glu or tRNA Phe gene in a system transcribable by T7 or SP6 RNA polymerase. Selectively 32 P-labeled transcripts of these plasmids were used to study tRNA base modification in vitro in crude extracts by nearest neighbor analysis. The synthesis of 5-methyl-aminomethyl-2-thiouridine (mnm 5 s 2 U) was studied. Complete synthesis of mnm 5 s 2 2U is not observed. Instead, 2-thiouridine (s 2 U) is synthesized. Synthesis requires ATP, cysteine, Mg + , and monovalent cation concentrations below 50 mM. The reaction has a pH optimum above 7.0. Sulfide ion will substitute for cysteine in the reaction but sulfate, sulfite, methionine, homocysteine, and β-mercaptopyruvate will not. Extracts from E. coli strains carrying either the asuE or asuF mutations have reduced s 2 U synthetic activity which supports in vivo evidence that the wild type genes are involved in 2-thiolation of uridine. The enzyme is shown to be unstable both upon storage at -80 degree C and during the modification reaction. A method was developed to study the synthesis of any one of four pseudouridines ψ found at different positions of the tRNA cloverleaf. Synthesis of ψ is observed at three of the four positions-positions 32, 39, and 55. The asuC mutation is shown to affect ψ synthesis only at position 39 confirming that it is an allele of hisT and that the hisT mutations do not affect ψ synthesis at position 32 in E. coli. Synthesis of ψ32, ψ39, and ψ55 does not require any prior modification. Synthesis of dihydrouridine, 7-methylguanosine, and 3(3-amino-3-carboxypropyl)uridine is also observed. Synthesis of 2-methyladenosine and ψ 13 is not seen. Removal of part of the aminoacyl stem reduces synthesis of all modifications examined by 3' fold or more

  9. Understanding the effect of locked nucleic acid and 2'-O-methyl modification on the hybridization thermodynamics of a miRNA-mRNA pair in the presence and absence of AfPiwi protein. (United States)

    Kumar, Santosh; Mapa, Koyeli; Maiti, Souvik


    miRNAs are some of the key epigenetic regulators of gene expression. They act through hybridization with their target mRNA and modulate the level of respective proteins via different mechanisms. Various cancer conditions are known to be associated with up- and downregulation of the oncogenic and tumor suppressor miRNAs, respectively. The levels of aberrantly expressed oncogenic miRNAs can be downregulated in different ways. Similarly, restoration of tumor suppressor miRNAs to their normal levels can be achieved using miRNA mimics. However, the use of miRNA mimics is limited by their reduced biostability and function. We have studied the hybridization thermodynamics of the miRNA 26a (11-mer, including the seed sequence) guide strand with the mRNA (11-mer) target strand in the absence and presence of AfPiwi protein. We have also inserted locked nucleic acids (LNAs) and 2'-O-methyl-modified nucleotides into the guide strand, in a walk-through manner, to assess their effect on the binding efficiency between guide and target RNA. Insertion of LNA and 2'-O-methyl-modified nucleotides into the guide strand helped to strengthen the binding affinity irrespective of the position of insertion. However, in the presence of AfPiwi protein, these modifications reduced the binding affinity to different extents depending on the position of insertion. Insertion of a modification leads to an increase in the enthalpic contribution with an increased unfavorable entropic contribution, which negatively compensates for the higher favorable enthalpy.

  10. RNA-ID, a highly sensitive and robust method to identify cis-regulatory sequences using superfolder GFP and a fluorescence-based assay. (United States)

    Dean, Kimberly M; Grayhack, Elizabeth J


    We have developed a robust and sensitive method, called RNA-ID, to screen for cis-regulatory sequences in RNA using fluorescence-activated cell sorting (FACS) of yeast cells bearing a reporter in which expression of both superfolder green fluorescent protein (GFP) and yeast codon-optimized mCherry red fluorescent protein (RFP) is driven by the bidirectional GAL1,10 promoter. This method recapitulates previously reported progressive inhibition of translation mediated by increasing numbers of CGA codon pairs, and restoration of expression by introduction of a tRNA with an anticodon that base pairs exactly with the CGA codon. This method also reproduces effects of paromomycin and context on stop codon read-through. Five key features of this method contribute to its effectiveness as a selection for regulatory sequences: The system exhibits greater than a 250-fold dynamic range, a quantitative and dose-dependent response to known inhibitory sequences, exquisite resolution that allows nearly complete physical separation of distinct populations, and a reproducible signal between different cells transformed with the identical reporter, all of which are coupled with simple methods involving ligation-independent cloning, to create large libraries. Moreover, we provide evidence that there are sequences within a 9-nt library that cause reduced GFP fluorescence, suggesting that there are novel cis-regulatory sequences to be found even in this short sequence space. This method is widely applicable to the study of both RNA-mediated and codon-mediated effects on expression.

  11. Intense charge transfer surface based on graphene and thymine-Hg(II)-thymine base pairs for detection of Hg(2.). (United States)

    Li, Jiao; Lu, Liping; Kang, Tianfang; Cheng, Shuiyuan


    In this article, we developed an electrochemiluminescence (ECL) sensor with a high-intensity charge transfer interface for Hg(2+) detection based on Hg(II)-induced DNA hybridization. The sensor was fabricated by the following simple method. First, graphene oxide (GO) was electrochemically reduced onto a glassy carbon electrode through cyclic voltammetry. Then, amino-labeled double-stranded (ds)DNA was assembled on the electrode surface using 1-pyrenebutyric acid N-hydroxysuccinimide as a linker between GO and DNA. The other terminal of dsDNA, which was labeled with biotin, was linked to CdSe quantum dots via biotin-avidin interactions. Reduced graphene oxide has excellent electrical conductivity. dsDNA with T-Hg(II)-T base pairs exhibited more facile charge transfer. They both accelerate the electron transfer performance and sensitivity of the sensor. The increased ECL signals were logarithmically linear with the concentration of Hg(II) when Hg(2+) was present in the detection solution. The linear range of the sensor was 10(-11) to 10(-8)mol/L (R=0.9819) with a detection limit of 10(-11)mol/L. This biosensor exhibited satisfactory results when it was used to detect Hg(II) in real water samples. The biosensor with high-intense charge transfer performance is a prospect avenue to pursue more and more sensitive detection method. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. RNACompress: Grammar-based compression and informational complexity measurement of RNA secondary structure

    Directory of Open Access Journals (Sweden)

    Chen Chun


    Full Text Available Abstract Background With the rapid emergence of RNA databases and newly identified non-coding RNAs, an efficient compression algorithm for RNA sequence and structural information is needed for the storage and analysis of such data. Although several algorithms for compressing DNA sequences have been proposed, none of them are suitable for the compression of RNA sequences with their secondary structures simultaneously. This kind of compression not only facilitates the maintenance of RNA data, but also supplies a novel way to measure the informational complexity of RNA structural data, raising the possibility of studying the relationship between the functional activities of RNA structures and their complexities, as well as various structural properties of RNA based on compression. Results RNACompress employs an efficient grammar-based model to compress RNA sequences and their secondary structures. The main goals of this algorithm are two fold: (1 present a robust and effective way for RNA structural data compression; (2 design a suitable model to represent RNA secondary structure as well as derive the informational complexity of the structural data based on compression. Our extensive tests have shown that RNACompress achieves a universally better compression ratio compared with other sequence-specific or common text-specific compression algorithms, such as Gencompress, winrar and gzip. Moreover, a test of the activities of distinct GTP-binding RNAs (aptamers compared with their structural complexity shows that our defined informational complexity can be used to describe how complexity varies with activity. These results lead to an objective means of comparing the functional properties of heteropolymers from the information perspective. Conclusion A universal algorithm for the compression of RNA secondary structure as well as the evaluation of its informational complexity is discussed in this paper. We have developed RNACompress, as a useful tool

  13. 1,8-Naphthyridine-2,7-diamine: a potential universal reader of Watson-Crick base pairs for DNA sequencing by electron tunneling. (United States)

    Liang, Feng; Lindsay, Stuart; Zhang, Peiming


    With the aid of Density Functional Theory (DFT), we designed 1,8-naphthyridine-2,7-diamine as a recognition molecule to read DNA base pairs for genomic sequencing by electron tunneling. NMR studies show that it can form stable triplets with both A : T and G : C base pairs through hydrogen bonding. Our results suggest that the naphthyridine molecule should be able to function as a universal base pair reader in a tunneling gap, generating distinguishable signatures under electrical bias for each of DNA base pairs.

  14. Preclinical and clinical development of siRNA-based therapeutics. (United States)

    Ozcan, Gulnihal; Ozpolat, Bulent; Coleman, Robert L; Sood, Anil K; Lopez-Berestein, Gabriel


    The discovery of RNA interference, first in plants and Caenorhabditis elegans and later in mammalian cells, led to the emergence of a transformative view in biomedical research. Knowledge of the multiple actions of non-coding RNAs has truly allowed viewing DNA, RNA and proteins in novel ways. Small interfering RNAs (siRNAs) can be used as tools to study single gene function both in vitro and in vivo and are an attractive new class of therapeutics, especially against undruggable targets for the treatment of cancer and other diseases. Despite the potential of siRNAs in cancer therapy, many challenges remain, including rapid degradation, poor cellular uptake and off-target effects. Rational design strategies, selection algorithms, chemical modifications and nanocarriers offer significant opportunities to overcome these challenges. Here, we review the development of siRNAs as therapeutic agents from early design to clinical trial, with special emphasis on the development of EphA2-targeting siRNAs for ovarian cancer treatment. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant. (United States)

    Xia, Shuangluo; Konigsberg, William H


    Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

  16. Photon-Pair Sources Based on Intermodal Four-Wave Mixing in Few-Mode Fibers

    Directory of Open Access Journals (Sweden)

    Karsten Rottwitt


    Full Text Available Four-wave mixing in optical fibers has been proven to have many applications within processing of classical optical signals. In addition, recent developments in multimode fibers have made it possible to achieve the necessary phase-matching for efficient four-wave mixing over a very wide bandwidth. Thus, the combination of multimode fiber optics and four-wave mixing is very attractive for various applications. This is especially the case for applications in quantum communication, for example in photon-pair generation. This is the subject of this work, where we discuss the impact of fluctuations in core radius on the quality of the heralded single-photon states and demonstrate experimental results of intermodal spontaneous four-wave mixing for photon-pair generation.

  17. Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang


    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

  18. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA. (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang


    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. 4D Flexible Atom-Pairs: An efficient probabilistic conformational space comparison for ligand-based virtual screening (United States)


    Background The performance of 3D-based virtual screening similarity functions is affected by the applied conformations of compounds. Therefore, the results of 3D approaches are often less robust than 2D approaches. The application of 3D methods on multiple conformer data sets normally reduces this weakness, but entails a significant computational overhead. Therefore, we developed a special conformational space encoding by means of Gaussian mixture models and a similarity function that operates on these models. The application of a model-based encoding allows an efficient comparison of the conformational space of compounds. Results Comparisons of our 4D flexible atom-pair approach with over 15 state-of-the-art 2D- and 3D-based virtual screening similarity functions on the 40 data sets of the Directory of Useful Decoys show a robust performance of our approach. Even 3D-based approaches that operate on multiple conformers yield inferior results. The 4D flexible atom-pair method achieves an averaged AUC value of 0.78 on the filtered Directory of Useful Decoys data sets. The best 2D- and 3D-based approaches of this study yield an AUC value of 0.74 and 0.72, respectively. As a result, the 4D flexible atom-pair approach achieves an average rank of 1.25 with respect to 15 other state-of-the-art similarity functions and four different evaluation metrics. Conclusions Our 4D method yields a robust performance on 40 pharmaceutically relevant targets. The conformational space encoding enables an efficient comparison of the conformational space. Therefore, the weakness of the 3D-based approaches on single conformations is circumvented. With over 100,000 similarity calculations on a single desktop CPU, the utilization of the 4D flexible atom-pair in real-world applications is feasible. PMID:21733172

  20. nRC: non-coding RNA Classifier based on structural features. (United States)

    Fiannaca, Antonino; La Rosa, Massimo; La Paglia, Laura; Rizzo, Riccardo; Urso, Alfonso


    Non-coding RNA (ncRNA) are small non-coding sequences involved in gene expression regulation of many biological processes and diseases. The recent discovery of a large set of different ncRNAs with biologically relevant roles has opened the way to develop methods able to discriminate between the different ncRNA classes. Moreover, the lack of knowledge about the complete mechanisms in regulative processes, together with the development of high-throughput technologies, has required the help of bioinformatics tools in addressing biologists and clinicians with a deeper comprehension of the functional roles of ncRNAs. In this work, we introduce a new ncRNA classification tool, nRC (non-coding RNA Classifier). Our approach is based on features extraction from the ncRNA secondary structure together with a supervised classification algorithm implementing a deep learning architecture based on convolutional neural networks. We tested our approach for the classification of 13 different ncRNA classes. We obtained classification scores, using the most common statistical measures. In particular, we reach an accuracy and sensitivity score of about 74%. The proposed method outperforms other similar classification methods based on secondary structure features and machine learning algorithms, including the RNAcon tool that, to date, is the reference classifier. nRC tool is freely available as a docker image at The source code of nRC tool is also available at

  1. Identifying and characterizing Hfq-RNA interactions. (United States)

    Faner, M A; Feig, A L


    To regulate stress responses and virulence, bacteria use small regulatory RNAs (sRNAs). These RNAs can up or down regulate target mRNAs through base pairing by influencing ribosomal access and RNA decay. A large class of these sRNAs, called trans-encoded sRNAs, requires the RNA binding protein Hfq to facilitate base pairing between the regulatory RNA and its target mRNA. The resulting network of regulation is best characterized in Escherichia coli and Salmonella typhimurium, but the importance of Hfq dependent sRNA regulation is recognized in a diverse population of bacteria. In this review we present the approaches and methods used to discover Hfq binding RNAs, characterize their interactions and elucidate their functions. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Development of a clinician reputation metric to identify appropriate problem-medication pairs in a crowdsourced knowledge base. (United States)

    McCoy, Allison B; Wright, Adam; Rogith, Deevakar; Fathiamini, Safa; Ottenbacher, Allison J; Sittig, Dean F


    Correlation of data within electronic health records is necessary for implementation of various clinical decision support functions, including patient summarization. A key type of correlation is linking medications to clinical problems; while some databases of problem-medication links are available, they are not robust and depend on problems and medications being encoded in particular terminologies. Crowdsourcing represents one approach to generating robust knowledge bases across a variety of terminologies, but more sophisticated approaches are necessary to improve accuracy and reduce manual data review requirements. We sought to develop and evaluate a clinician reputation metric to facilitate the identification of appropriate problem-medication pairs through crowdsourcing without requiring extensive manual review. We retrieved medications from our clinical data warehouse that had been prescribed and manually linked to one or more problems by clinicians during e-prescribing between June 1, 2010 and May 31, 2011. We identified measures likely to be associated with the percentage of accurate problem-medication links made by clinicians. Using logistic regression, we created a metric for identifying clinicians who had made greater than or equal to 95% appropriate links. We evaluated the accuracy of the approach by comparing links made by those physicians identified as having appropriate links to a previously manually validated subset of problem-medication pairs. Of 867 clinicians who asserted a total of 237,748 problem-medication links during the study period, 125 had a reputation metric that predicted the percentage of appropriate links greater than or equal to 95%. These clinicians asserted a total of 2464 linked problem-medication pairs (983 distinct pairs). Compared to a previously validated set of problem-medication pairs, the reputation metric achieved a specificity of 99.5% and marginally improved the sensitivity of previously described knowledge bases. A

  3. A collaborative European exercise on mRNA-based body fluid/skin typing and interpretation of DNA and RNA results

    DEFF Research Database (Denmark)

    van den Berge, M; Carracedo, A; Gomes, I


    The European Forensic Genetics Network of Excellence (EUROFORGEN-NoE) undertook a collaborative project on mRNA-based body fluid/skin typing and the interpretation of the resulting RNA and DNA data. Although both body fluids and skin are composed of a variety of cell types with different function...

  4. Crystal structure of metallo DNA duplex containing consecutive Watson-Crick-like T-Hg(II)-T base pairs. (United States)

    Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira


    The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit


    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  6. Watson-Crick Base Pairing, Electronic and Photophysical Properties of Triazole Modified Adenine Analogues: A Computational Study

    KAUST Repository

    Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan


    We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.

  7. Hidden in Plain Sight: Subtle Effects of the 8-Oxoguanine Lesion on the Structure, Dynamics, and Thermodynamics of a 15-Base-Pair Oligodeoxynucleotide Duplex† (United States)

    Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.


    The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242

  8. A Subcarrier-Pair Based Resource Allocation Scheme Using Proportional Fairness for Cooperative OFDM-Based Cognitive Radio Networks (United States)

    Ma, Yongtao; Zhou, Liuji; Liu, Kaihua


    The paper presents a joint subcarrier-pair based resource allocation algorithm in order to improve the efficiency and fairness of cooperative multiuser orthogonal frequency division multiplexing (MU-OFDM) cognitive radio (CR) systems. A communication model where one source node communicates with one destination node assisted by one half-duplex decode-and-forward (DF) relay is considered in the paper. An interference-limited environment is considered, with the constraint of transmitted sum-power over all channels and aggregate average interference towards multiple primary users (PUs). The proposed resource allocation algorithm is capable of maximizing both the system transmission efficiency and fairness among secondary users (SUs). Besides, the proposed algorithm can also keep the interference introduced to the PU bands below a threshold. A proportional fairness constraint is used to assure that each SU can achieve a required data rate, with quality of service guarantees. Moreover, we extend the analysis to the scenario where each cooperative SU has no channel state information (CSI) about non-adjacent links. We analyzed the throughput and fairness tradeoff in CR system. A detailed analysis of the performance of the proposed algorithm is presented with the simulation results. PMID:23939586

  9. Mahonian pairs


    Sagan, Bruce E.; Savage, Carla D.


    We introduce the notion of a Mahonian pair. Consider the set, P^*, of all words having the positive integers as alphabet. Given finite subsets S,T of P^*, we say that (S,T) is a Mahonian pair if the distribution of the major index, maj, over S is the same as the distribution of the inversion number, inv, over T. So the well-known fact that maj and inv are equidistributed over the symmetric group, S_n, can be expressed by saying that (S_n,S_n) is a Mahonian pair. We investigate various Mahonia...

  10. DNA sequence of 15 base pairs is sufficient to mediate both glucocorticoid and progesterone induction of gene expression

    International Nuclear Information System (INIS)

    Straehle, U.; Klock, G.; Schuetz, G.


    To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same

  11. Analysis of current and alternative phenol based RNA extraction methodologies for cyanobacteria

    Directory of Open Access Journals (Sweden)

    Lindblad Peter


    Full Text Available Abstract Background The validity and reproducibility of gene expression studies depend on the quality of extracted RNA and the degree of genomic DNA contamination. Cyanobacteria are gram-negative prokaryotes that synthesize chlorophyll a and carry out photosynthetic water oxidation. These organisms possess an extended array of secondary metabolites that impair cell lysis, presenting particular challenges when it comes to nucleic acid isolation. Therefore, we used the NHM5 strain of Nostoc punctiforme ATCC 29133 to compare and improve existing phenol based chemistry and procedures for RNA extraction. Results With this work we identify and explore strategies for improved and lower cost high quality RNA isolation from cyanobacteria. All the methods studied are suitable for RNA isolation and its use for downstream applications. We analyse different Trizol based protocols, introduce procedural changes and describe an alternative RNA extraction solution. Conclusion It was possible to improve purity of isolated RNA by modifying protocol procedures. Further improvements, both in RNA purity and experimental cost, were achieved by using a new extraction solution, PGTX.

  12. Mapping Optimal Charge Density and Length of ROMP-Based PTDMs for siRNA Internalization. (United States)

    Caffrey, Leah M; deRonde, Brittany M; Minter, Lisa M; Tew, Gregory N


    A fundamental understanding of how polymer structure impacts internalization and delivery of biologically relevant cargoes, particularly small interfering ribonucleic acid (siRNA), is of critical importance to the successful design of improved delivery reagents. Herein we report the use of ring-opening metathesis polymerization (ROMP) methods to synthesize two series of guanidinium-rich protein transduction domain mimics (PTDMs): one based on an imide scaffold that contains one guanidinium moiety per repeat unit, and another based on a diester scaffold that contains two guanidinium moieties per repeat unit. By varying both the degree of polymerization and, in effect, the relative number of cationic charges in each PTDM, the performances of the two ROMP backbones for siRNA internalization were evaluated and compared. Internalization of fluorescently labeled siRNA into Jurkat T cells demonstrated that fluorescein isothiocyanate (FITC)-siRNA internalization had a charge content dependence, with PTDMs containing approximately 40 to 60 cationic charges facilitating the most internalization. Despite this charge content dependence, the imide scaffold yielded much lower viabilities in Jurkat T cells than the corresponding diester PTDMs with similar numbers of cationic charges, suggesting that the diester scaffold is preferred for siRNA internalization and delivery applications. These developments will not only improve our understanding of the structural factors necessary for optimal siRNA internalization, but will also guide the future development of optimized PTDMs for siRNA internalization and delivery.

  13. Optimal consistency in microRNA expression analysis using reference-gene-based normalization. (United States)

    Wang, Xi; Gardiner, Erin J; Cairns, Murray J


    Normalization of high-throughput molecular expression profiles secures differential expression analysis between samples of different phenotypes or biological conditions, and facilitates comparison between experimental batches. While the same general principles apply to microRNA (miRNA) normalization, there is mounting evidence that global shifts in their expression patterns occur in specific circumstances, which pose a challenge for normalizing miRNA expression data. As an alternative to global normalization, which has the propensity to flatten large trends, normalization against constitutively expressed reference genes presents an advantage through their relative independence. Here we investigated the performance of reference-gene-based (RGB) normalization for differential miRNA expression analysis of microarray expression data, and compared the results with other normalization methods, including: quantile, variance stabilization, robust spline, simple scaling, rank invariant, and Loess regression. The comparative analyses were executed using miRNA expression in tissue samples derived from subjects with schizophrenia and non-psychiatric controls. We proposed a consistency criterion for evaluating methods by examining the overlapping of differentially expressed miRNAs detected using different partitions of the whole data. Based on this criterion, we found that RGB normalization generally outperformed global normalization methods. Thus we recommend the application of RGB normalization for miRNA expression data sets, and believe that this will yield a more consistent and useful readout of differentially expressed miRNAs, particularly in biological conditions characterized by large shifts in miRNA expression.

  14. A new image reconstruction method for 3-D PET based upon pairs of near-missing lines of response

    Energy Technology Data Exchange (ETDEWEB)

    Kawatsu, Shoji [Department of Radiology, Kyoritu General Hospital, 4-33 Go-bancho, Atsuta-ku, Nagoya-shi, Aichi 456-8611 (Japan) and Department of Brain Science and Molecular Imaging, National Institute for Longevity Sciences, National Center for Geriatrics and Gerontology, 36-3, Gengo Moriaka-cho, Obu-shi, Aichi 474-8522 (Japan)]. E-mail:; Ushiroya, Noboru [Department of General Education, Wakayama National College of Technology, 77 Noshima, Nada-cho, Gobo-shi, Wakayama 644-0023 (Japan)


    We formerly introduced a new image reconstruction method for three-dimensional positron emission tomography, which is based upon pairs of near-missing lines of response. This method uses an elementary geometric property of lines of response, namely that two lines of response which originate from radioactive isotopes located within a sufficiently small voxel, will lie within a few millimeters of each other. The effectiveness of this method was verified by performing a simulation using GATE software and a digital Hoffman phantom.

  15. Drawbacks of the ancient RNA-based life-like system under primitive earth conditions. (United States)

    Kawamura, Kunio


    Following the discovery of ribozymes, the "RNA world" hypothesis has become the most accepted hypothesis concerning the origin of life and genetic information. However, this hypothesis has several drawbacks. Verification of the hypothesis from different viewpoints led us to proposals from the viewpoint of the hydrothermal origin of life, solubility of RNA and related biopolymers, and the possibility of creating an evolutionary system comparable to the in vitro selection technique for functional RNA molecules based on molecular biology. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  16. Biosensor-based microRNA detection: techniques, design, performance, and challenges. (United States)

    Johnson, Blake N; Mutharasan, Raj


    The current state of biosensor-based techniques for amplification-free microRNA (miRNA) detection is critically reviewed. Comparison with non-sensor and amplification-based molecular techniques (MTs), such as polymerase-based methods, is made in terms of transduction mechanism, associated protocol, and sensitivity. Challenges associated with miRNA hybridization thermodynamics which affect assay selectivity and amplification bias are briefly discussed. Electrochemical, electromechanical, and optical classes of miRNA biosensors are reviewed in terms of transduction mechanism, limit of detection (LOD), time-to-results (TTR), multiplexing potential, and measurement robustness. Current trends suggest that biosensor-based techniques (BTs) for miRNA assay will complement MTs due to the advantages of amplification-free detection, LOD being femtomolar (fM)-attomolar (aM), short TTR, multiplexing capability, and minimal sample preparation requirement. Areas of future importance in miRNA BT development are presented which include focus on achieving high measurement confidence and multiplexing capabilities.

  17. [Quantum-chemical investigation of tautomerization ways of Watson-Crick DNA base pair guanine-cytosine]. (United States)

    Brovarets', O O; Hovorun, D M


    A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.

  18. eRNA: a graphic user interface-based tool optimized for large data analysis from high-throughput RNA sequencing. (United States)

    Yuan, Tiezheng; Huang, Xiaoyi; Dittmar, Rachel L; Du, Meijun; Kohli, Manish; Boardman, Lisa; Thibodeau, Stephen N; Wang, Liang


    RNA sequencing (RNA-seq) is emerging as a critical approach in biological research. However, its high-throughput advantage is significantly limited by the capacity of bioinformatics tools. The research community urgently needs user-friendly tools to efficiently analyze the complicated data generated by high throughput sequencers. We developed a standalone tool with graphic user interface (GUI)-based analytic modules, known as eRNA. The capacity of performing parallel processing and sample management facilitates large data analyses by maximizing hardware usage and freeing users from tediously handling sequencing data. The module miRNA identification" includes GUIs for raw data reading, adapter removal, sequence alignment, and read counting. The module "mRNA identification" includes GUIs for reference sequences, genome mapping, transcript assembling, and differential expression. The module "Target screening" provides expression profiling analyses and graphic visualization. The module "Self-testing" offers the directory setups, sample management, and a check for third-party package dependency. Integration of other GUIs including Bowtie, miRDeep2, and miRspring extend the program's functionality. eRNA focuses on the common tools required for the mapping and quantification analysis of miRNA-seq and mRNA-seq data. The software package provides an additional choice for scientists who require a user-friendly computing environment and high-throughput capacity for large data analysis. eRNA is available for free download at

  19. Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs. (United States)

    Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J


    Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.

  20. Determination of redox potentials for the Watson-Crick base pairs, DNA nucleosides, and relevant nucleoside analogues. (United States)

    Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy


    Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.

  1. A Meta-Path-Based Prediction Method for Human miRNA-Target Association

    Directory of Open Access Journals (Sweden)

    Jiawei Luo


    Full Text Available MicroRNAs (miRNAs are short noncoding RNAs that play important roles in regulating gene expressing, and the perturbed miRNAs are often associated with development and tumorigenesis as they have effects on their target mRNA. Predicting potential miRNA-target associations from multiple types of genomic data is a considerable problem in the bioinformatics research. However, most of the existing methods did not fully use the experimentally validated miRNA-mRNA interactions. Here, we developed RMLM and RMLMSe to predict the relationship between miRNAs and their targets. RMLM and RMLMSe are global approaches as they can reconstruct the missing associations for all the miRNA-target simultaneously and RMLMSe demonstrates that the integration of sequence information can improve the performance of RMLM. In RMLM, we use RM measure to evaluate different relatedness between miRNA and its target based on different meta-paths; logistic regression and MLE method are employed to estimate the weight of different meta-paths. In RMLMSe, sequence information is utilized to improve the performance of RMLM. Here, we carry on fivefold cross validation and pathway enrichment analysis to prove the performance of our methods. The fivefold experiments show that our methods have higher AUC scores compared with other methods and the integration of sequence information can improve the performance of miRNA-target association prediction.

  2. Weighted profile likelihood-based confidence interval for the difference between two proportions with paired binomial data. (United States)

    Pradhan, Vivek; Saha, Krishna K; Banerjee, Tathagata; Evans, John C


    Inference on the difference between two binomial proportions in the paired binomial setting is often an important problem in many biomedical investigations. Tang et al. (2010, Statistics in Medicine) discussed six methods to construct confidence intervals (henceforth, we abbreviate it as CI) for the difference between two proportions in paired binomial setting using method of variance estimates recovery. In this article, we propose weighted profile likelihood-based CIs for the difference between proportions of a paired binomial distribution. However, instead of the usual likelihood, we use weighted likelihood that is essentially making adjustments to the cell frequencies of a 2 × 2 table in the spirit of Agresti and Min (2005, Statistics in Medicine). We then conduct numerical studies to compare the performances of the proposed CIs with that of Tang et al. and Agresti and Min in terms of coverage probabilities and expected lengths. Our numerical study clearly indicates that the weighted profile likelihood-based intervals and Jeffreys interval (cf. Tang et al.) are superior in terms of achieving the nominal level, and in terms of expected lengths, they are competitive. Finally, we illustrate the use of the proposed CIs with real-life examples. Copyright © 2014 John Wiley & Sons, Ltd.

  3. Uncertainty evaluation for three-dimensional scanning electron microscope reconstructions based on the stereo-pair technique

    International Nuclear Information System (INIS)

    Carli, L; Cantatore, A; De Chiffre, L; Genta, G; Barbato, G; Levi, R


    3D-SEM is a method, based on the stereophotogrammetry technique, which obtains three-dimensional topographic reconstructions starting typically from two SEM images, called the stereo-pair. In this work, a theoretical uncertainty evaluation of the stereo-pair technique, according to GUM (Guide to the Expression of Uncertainty in Measurement), was carried out, considering 3D-SEM reconstructions of a wire gauge with a reference diameter of 250 µm. Starting from the more commonly used tilting strategy, one based on the item rotation inside the SEM chamber was also adopted. The latter enables multiple-view reconstructions of the cylindrical item under consideration. Uncertainty evaluation was performed starting from a modified version of the Piazzesi equation, enabling the calculation of the z-coordinate from a given stereo-pair. The metrological characteristics of each input variable have been taken into account and a SEM stage calibration has been performed. Uncertainty tables for the cases of tilt and rotation were then produced, leading to the calculation of expanded uncertainty. For the case of rotation, the largest uncertainty contribution resulted to be the rotational angle; however, for the case of tilt it resulted to be the pixel size. A relative expanded uncertainty equal to 5% and 4% was obtained for the case of rotation and tilt, respectively

  4. A Method to Predict the Structure and Stability of RNA/RNA Complexes. (United States)

    Xu, Xiaojun; Chen, Shi-Jie


    RNA/RNA interactions are essential for genomic RNA dimerization and regulation of gene expression. Intermolecular loop-loop base pairing is a widespread and functionally important tertiary structure motif in RNA machinery. However, computational prediction of intermolecular loop-loop base pairing is challenged by the entropy and free energy calculation due to the conformational constraint and the intermolecular interactions. In this chapter, we describe a recently developed statistical mechanics-based method for the prediction of RNA/RNA complex structures and stabilities. The method is based on the virtual bond RNA folding model (Vfold). The main emphasis in the method is placed on the evaluation of the entropy and free energy for the loops, especially tertiary kissing loops. The method also uses recursive partition function calculations and two-step screening algorithm for large, complicated structures of RNA/RNA complexes. As case studies, we use the HIV-1 Mal dimer and the siRNA/HIV-1 mutant (T4) to illustrate the method.

  5. A Circulating microRNA Signature Predicts Age-Based Development of Lymphoma.

    Directory of Open Access Journals (Sweden)

    Afshin Beheshti

    Full Text Available Extensive epidemiological data have demonstrated an exponential rise in the incidence of non-Hodgkin lymphoma (NHL that is associated with increasing age. The molecular etiology of this remains largely unknown, which impacts the effectiveness of treatment for patients. We proposed that age-dependent circulating microRNA (miRNA signatures in the host influence diffuse large B cell lymphoma (DLBCL development. Our objective was to examine tumor development in an age-based DLBCL system using an inventive systems biology approach. We harnessed a novel murine model of spontaneous DLBCL initiation (Smurf2-deficient at two age groups: 3 and 15 months old. All Smurf2-deficient mice develop visible DLBCL tumor starting at 15 months of age. Total miRNA was isolated from serum, bone marrow and spleen and were collected for all age groups for Smurf2-deficient mice and age-matched wild-type C57BL/6 mice. Using systems biology techniques, we identified a list of 10 circulating miRNAs being regulated in both the spleen and bone marrow that were present in DLBCL forming mice starting at 3 months of age that were not present in the control mice. Furthermore, this miRNA signature was found to occur circulating in the blood and it strongly impacted JUN and MYC oncogenic signaling. In addition, quantification of the miRNA signature was performed via Droplet Digital PCR technology. It was discovered that a key miRNA signature circulates throughout a host prior to the formation of a tumor starting at 3 months old, which becomes further modulated by age and yielded calculation of a 'carcinogenic risk score'. This novel age-based circulating miRNA signature may potentially be leveraged as a DLBCL risk profile at a young age to predict future lymphoma development or disease progression as well as for potential innovative miRNA-based targeted therapeutic strategies in lymphoma.

  6. Alpha–beta monitoring system based on pair of simultaneous Multi-Wire Proportional Counters

    Energy Technology Data Exchange (ETDEWEB)

    Wengrowicz, U.; Amidan, D. [Department of Nuclear Engineering, Ben Gurion University of the Negev, Beer-Sheva 84105 (Israel); NRC-Negev, P.O. Box 9001, Beer-Sheva 84190 (Israel); Orion, I. [Department of Nuclear Engineering, Ben Gurion University of the Negev, Beer-Sheva 84105 (Israel)


    A new approach for a simultaneous alpha–beta Multi-wire Proportional Counter (MWPC) is presented. The popular approach for alpha–beta monitoring systems consists of a large area MWPC using noble gas flow such as Argon Methane. This method of measurement is effective but requires large-scale and expensive maintenance due to the needs of gas flow control and periodic replacements. In this work, a pair of simultaneous MWPCs for alpha–beta measuring is presented. The developed detector consists of a sealed gas MWPC sensor for beta particles, behind a free air alpha sensor. This approach allows effective simultaneous detection and discrimination of both alpha and beta radiation without the maintenance cost noble gas flow required for unsealed detectors.

  7. Application of TALE-Based Approach for Dissecting Functional MicroRNA-302/367 in Cellular Reprogramming. (United States)

    Zhang, Zhonghui; Wu, Wen-Shu


    MicroRNAs are small 18-24 nt single-stranded noncoding RNA molecules involved in many biological processes, including stemness maintenance and cellular reprogramming. Current methods used in loss-of-function studies of microRNAs have several limitations. Here, we describe a new approach for dissecting miR-302/367 functions by transcription activator-like effectors (TALEs), which are natural effector proteins secreted by Xanthomonas and Ralstonia bacteria. Knockdown of the miR-302/367 cluster uses the Kruppel-associated box repressor domain fused with specific TALEs designed to bind the miR-302/367 cluster promoter. Knockout of the miR-302/367 cluster uses two pairs of TALE nucleases (TALENs) to delete the miR-302/367 cluster in human primary cells. Together, both TALE-based transcriptional repressor and TALENs are two promising approaches for loss-of-function studies of microRNA cluster in human primary cells.

  8. A Thiazole Coumarin (TC) Turn-On Fluorescence Probe for AT-Base Pair Detection and Multipurpose Applications in Different Biological Systems (United States)

    Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.


    Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology. PMID:25252596

  9. Biomarker MicroRNAs for Diagnosis of Oral Squamous Cell Carcinoma Identified Based on Gene Expression Data and MicroRNA-mRNA Network Analysis (United States)

    Zhang, Hui; Li, Tangxin; Zheng, Linqing


    Oral squamous cell carcinoma is one of the most malignant tumors with high mortality rate worldwide. Biomarker discovery is critical for early diagnosis and precision treatment of this disease. MicroRNAs are small noncoding RNA molecules which often regulate essential biological processes and are good candidates for biomarkers. By integrative analysis of both the cancer-associated gene expression data and microRNA-mRNA network, miR-148b-3p, miR-629-3p, miR-27a-3p, and miR-142-3p were screened as novel diagnostic biomarkers for oral squamous cell carcinoma based on their unique regulatory abilities in the network structure of the conditional microRNA-mRNA network and their important functions. These findings were confirmed by literature verification and functional enrichment analysis. Future experimental validation is expected for the further investigation of their molecular mechanisms. PMID:29098014

  10. Biofilm formation on the Provox ActiValve: Composition and ingrowth analyzed by Illumina paired-end RNA sequencing, fluorescence in situ hybridization, and confocal laser scanning microscopy. (United States)

    Timmermans, Adriana J; Harmsen, Hermie J M; Bus-Spoor, Carien; Buijssen, Kevin J D A; van As-Brooks, Corina; de Goffau, Marcus C; Tonk, Rudi H; van den Brekel, Michiel W M; Hilgers, Frans J M; van der Laan, Bernard F A M


    The most frequent cause of voice prosthesis failure is microbial biofilm formation on the silicone valve, leading to destruction of the material and transprosthetic leakage. The Provox ActiValve valve is made of fluoroplastic, which should be insusceptible to destruction. The purpose of this study was to determine if fluoroplastic is insusceptible to destruction by Candida species. Thirty-three dysfunctional Provox ActiValves (collected 2011-2013). Biofilm analysis was performed with Illumina paired-end sequencing (IPES), assessment of biofilm-material interaction with fluorescence in situ hybridization (FISH), and confocal laser scanning microscopy (CLSM). IPES (n = 10) showed that Candida albicans and Candida tropicalis are dominant populations on fluoroplastic and silicone. Microbial diversity is significantly lower on fluoroplastic. Lactobacillus gasseri is the prevalent bacterial strain on most voice prostheses. FISH and CLSM (n = 23): in none of the cases was ingrowth of Candida species present in the fluoroplastic. Fluoroplastic material of Provox ActiValve seems insusceptible to destruction by Candida species, which could help improve durability of voice prostheses. © 2015 Wiley Periodicals, Inc. Head Neck 38: E432-E440, 2016. © 2015 Wiley Periodicals, Inc.

  11. Sequence-based heuristics for faster annotation of non-coding RNA families. (United States)

    Weinberg, Zasha; Ruzzo, Walter L


    Non-coding RNAs (ncRNAs) are functional RNA molecules that do not code for proteins. Covariance Models (CMs) are a useful statistical tool to find new members of an ncRNA gene family in a large genome database, using both sequence and, importantly, RNA secondary structure information. Unfortunately, CM searches are extremely slow. Previously, we created rigorous filters, which provably sacrifice none of a CM's accuracy, while making searches significantly faster for virtually all ncRNA families. However, these rigorous filters make searches slower than heuristics could be. In this paper we introduce profile HMM-based heuristic filters. We show that their accuracy is usually superior to heuristics based on BLAST. Moreover, we compared our heuristics with those used in tRNAscan-SE, whose heuristics incorporate a significant amount of work specific to tRNAs, where our heuristics are generic to any ncRNA. Performance was roughly comparable, so we expect that our heuristics provide a high-quality solution that--unlike family-specific solutions--can scale to hundreds of ncRNA families. The source code is available under GNU Public License at the supplementary web site.

  12. An sRNA and Cold Shock Protein Homolog-Based Feedforward Loop Post-transcriptionally Controls Cell Cycle Master Regulator CtrA. (United States)

    Robledo, Marta; Schlüter, Jan-Philip; Loehr, Lars O; Linne, Uwe; Albaum, Stefan P; Jiménez-Zurdo, José I; Becker, Anke


    Adjustment of cell cycle progression is crucial for bacterial survival and adaptation under adverse conditions. However, the understanding of modulation of cell cycle control in response to environmental changes is rather incomplete. In α-proteobacteria, the broadly conserved cell cycle master regulator CtrA underlies multiple levels of control, including coupling of cell cycle and cell differentiation. CtrA levels are known to be tightly controlled through diverse transcriptional and post-translational mechanisms. Here, small RNA (sRNA)-mediated post-transcriptional regulation is uncovered as an additional level of CtrA fine-tuning. Computational predictions as well as transcriptome and proteome studies consistently suggested targeting of ctrA and the putative cold shock chaperone cspA5 mRNAs by the trans- encoded sRNA ( trans- sRNA) GspR (formerly SmelC775) in several Sinorhizobium species. GspR strongly accumulated in the stationary growth phase, especially in minimal medium (MM) cultures. Lack of the gspR locus confers a fitness disadvantage in competition with the wild type, while its overproduction hampers cell growth, suggesting that this riboregulator interferes with cell cycle progression. An eGFP-based reporter in vivo assay, involving wild-type and mutant sRNA and mRNA pairs, experimentally confirmed GspR-dependent post-transcriptional down-regulation of ctrA and cspA5 expression, which most likely occurs through base-pairing to the respective mRNA. The energetically favored secondary structure of GspR is predicted to comprise three stem-loop domains, with stem-loop 1 and stem-loop 3 targeting ctrA and cspA5 mRNA, respectively. Moreover, this work reports evidence for post-transcriptional control of ctrA by CspA5. Thus, this regulation and GspR-mediated post-transcriptional repression of ctrA and cspA5 expression constitute a coherent feed-forward loop, which may enhance the negative effect of GspR on CtrA levels. This novel regulatory circuit involving

  13. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts. (United States)

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D


    Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which

  14. Growth inhibition of head and neck squamous cell carcinoma cells by sgRNA targeting the cyclin D1 mRNA based on TRUE gene silencing.

    Directory of Open Access Journals (Sweden)

    Satoshi Iizuka

    Full Text Available Head and neck squamous cell carcinoma (HNSCC exhibits increased expression of cyclin D1 (CCND1. Previous studies have shown a correlation between poor prognosis of HNSCC and cyclin D1 overexpression. tRNase ZL-utilizing efficacious gene silencing (TRUE gene silencing is one of the RNA-mediated gene expression control technologies that have therapeutic potential. This technology is based on a unique enzymatic property of mammalian tRNase ZL, which is that it can cleave any target RNA at any desired site by recognizing a pre-tRNA-like complex formed between the target RNA and an artificial small guide RNA (sgRNA. In this study, we designed several sgRNAs targeting human cyclin D1 mRNA to examine growth inhibition of HNSCC cells. Transfection of certain sgRNAs decreased levels of cyclin D1 mRNA and protein in HSC-2 and HSC-3 cells, and also inhibited their proliferation. The combination of these sgRNAs and cisplatin showed more than additive inhibition of cancer cell growth. These findings demonstrate that TRUE gene silencing of cyclin D1 leads to inhibition of the growth of HNSCC cells and suggest that these sgRNAs alone or combined with cisplatin may be a useful new therapy for HNSCCs.

  15. A fully synthetic human Fab antibody library based on fixed VH/VL framework pairings with favorable biophysical properties (United States)

    Tiller, Thomas; Schuster, Ingrid; Deppe, Dorothée; Siegers, Katja; Strohner, Ralf; Herrmann, Tanja; Berenguer, Marion; Poujol, Dominique; Stehle, Jennifer; Stark, Yvonne; Heßling, Martin; Daubert, Daniela; Felderer, Karin; Kaden, Stefan; Kölln, Johanna; Enzelberger, Markus; Urlinger, Stefanie


    This report describes the design, generation and testing of Ylanthia, a fully synthetic human Fab antibody library with 1.3E+11 clones. Ylanthia comprises 36 fixed immunoglobulin (Ig) variable heavy (VH)/variable light (VL) chain pairs, which cover a broad range of canonical complementarity-determining region (CDR) structures. The variable Ig heavy and Ig light (VH/VL) chain pairs were selected for biophysical characteristics favorable to manufacturing and development. The selection process included multiple parameters, e.g., assessment of protein expression yield, thermal stability and aggregation propensity in fragment antigen binding (Fab) and IgG1 formats, and relative Fab display rate on phage. The framework regions are fixed and the diversified CDRs were designed based on a systematic analysis of a large set of rearranged human antibody sequences. Care was taken to minimize the occurrence of potential posttranslational modification sites within the CDRs. Phage selection was performed against various antigens and unique antibodies with excellent biophysical properties were isolated. Our results confirm that quality can be built into an antibody library by prudent selection of unmodified, fully human VH/VL pairs as scaffolds. PMID:23571156

  16. Return and Risk of Pairs Trading Using a Simulation-Based Bayesian Procedure for Predicting Stable Ratios of Stock Prices

    Directory of Open Access Journals (Sweden)

    David Ardia


    Full Text Available We investigate the direct connection between the uncertainty related to estimated stable ratios of stock prices and risk and return of two pairs trading strategies: a conditional statistical arbitrage method and an implicit arbitrage one. A simulation-based Bayesian procedure is introduced for predicting stable stock price ratios, defined in a cointegration model. Using this class of models and the proposed inferential technique, we are able to connect estimation and model uncertainty with risk and return of stock trading. In terms of methodology, we show the effect that using an encompassing prior, which is shown to be equivalent to a Jeffreys’ prior, has under an orthogonal normalization for the selection of pairs of cointegrated stock prices and further, its effect for the estimation and prediction of the spread between cointegrated stock prices. We distinguish between models with a normal and Student t distribution since the latter typically provides a better description of daily changes of prices on financial markets. As an empirical application, stocks are used that are ingredients of the Dow Jones Composite Average index. The results show that normalization has little effect on the selection of pairs of cointegrated stocks on the basis of Bayes factors. However, the results stress the importance of the orthogonal normalization for the estimation and prediction of the spread—the deviation from the equilibrium relationship—which leads to better results in terms of profit per capital engagement and risk than using a standard linear normalization.

  17. Splitting efficiency and interference effects in a Cooper pair splitter based on a triple quantum dot with ferromagnetic contacts (United States)

    Bocian, Kacper; Rudziński, Wojciech; Weymann, Ireneusz


    We theoretically study the spin-resolved subgap transport properties of a Cooper pair splitter based on a triple quantum dot attached to superconducting and ferromagnetic leads. Using the Keldysh Green's function formalism, we analyze the dependence of the Andreev conductance, Cooper pair splitting efficiency, and tunnel magnetoresistance on the gate and bias voltages applied to the system. We show that the system's transport properties are strongly affected by spin dependence of tunneling processes and quantum interference between different local and nonlocal Andreev reflections. We also study the effects of finite hopping between the side quantum dots on the Andreev current. This allows for identifying the optimal conditions for enhancing the Cooper pair splitting efficiency of the device. We find that the splitting efficiency exhibits a nonmonotonic dependence on the degree of spin polarization of the leads and the magnitude and type of hopping between the dots. An almost perfect splitting efficiency is predicted in the nonlinear response regime when the energies of the side quantum dots are tuned to the energies of the corresponding Andreev bound states. In addition, we analyzed features of the tunnel magnetoresistance (TMR) for a wide range of the gate and bias voltages, as well as for different model parameters, finding the corresponding sign changes of the TMR in certain transport regimes. The mechanisms leading to these effects are thoroughly discussed.

  18. Stability of RNA silencing-based traits after virus infection

    DEFF Research Database (Denmark)

    Jørgensen, Bodil; Albrechtsen, Merete


    with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...

  19. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    Energy Technology Data Exchange (ETDEWEB)

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N., E-mail: [Department of Computer Science and Engineering, Toyohashi University of Technology, Toyohashi, Aichi, 441-8580 (Japan); Shulga, S. [Institute for Food Biotechnology and Genomics, National Academy of Sciences of Ukraine, Kyiv (Ukraine); Danilov, V. I. [Institute of Molecular Biology and Genetics, National Academy of Sciences of Ukraine, Kyiv (Ukraine)


    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH{sub 2} group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH{sub 2} group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes.

  20. DFT study on the attacking mechanisms of H and OH radicals to G-C and A-T base pairs in water

    International Nuclear Information System (INIS)

    Okutsu, N.; Shimamura, K.; Shimizu, E.; Kurita, N.; Shulga, S.; Danilov, V. I.


    To elucidate the effect of radicals on DNA base pairs, we investigated the attacking mechanism of OH and H radicals to the G-C and A-T base pairs, using the density functional theory (DFT) calculations in water approximated by the continuum solvation model. The DFT calculations revealed that the OH radical abstracts the hydrogen atom of a NH 2 group of G or A base and induces a tautomeric reaction for an A-T base pair more significantly than for a G-C base pair. On the other hand, the H radical prefers to bind to the Cytosine NH 2 group of G-C base pair and induce a tautomeric reaction from G-C to G*-C*, whose activation free energy is considerably small (−0.1 kcal/mol) in comparison with that (42.9 kcal/mol) for the reaction of an A-T base pair. Accordingly, our DFT calculations elucidated that OH and H radicals have a significant effect on A-T and G-C base pairs, respectively. This finding will be useful for predicting the effect of radiation on the genetic information recorded in the base sequences of DNA duplexes

  1. Hydroxylamine and methoxyamine mutagenesis: displacement of the tautomeric equilibrium of the promutagen N6-methoxyadenosine by complementary base pairing. (United States)

    Stolarski, R; Kierdaszuk, B; Hagberg, C E; Shugar, D


    The imino-amino tautomeric equilibrium of the promutagenic adenosine analogue N6-methoxy-2',3',5'-tri-O-methyladenosine [OMe6A(Me)3], in solvents of various polarities, has been studied with the aid of 1H and 13C NMR spectroscopy. The high energy barrier (free enthalpy delta G = 80 +/- 5 kJ X mol-1) between the two tautomeric species renders possible direct observation of the independent sets of all 1H and 13C signals from each of them. The equilibrium ranges from 10% imino in CCl4 to 90% in aqueous medium. Thermodynamic parameters, including energy barriers and lifetimes, were calculated from the temperature dependence of the equilibrium. Essentially similar results prevail for the promutagenic N6-hydroxy analogue. The conformations of the sugar moieties, and of the base about the glycosidic bond, for both tautomers are similar to those for adenosine. The conformation of the exocyclic N6-OCH3 group, which determines the ability of each species to form planar associates (hydrogen-bonded base pairs), has also been evaluated. Formation of autoassociates of OMe6A(Me)3 and of heteroassociates with the potentially complementary 2',3',5'-tri-O-methyluridine and -cytidine, in chloroform solution, was also investigated. The amino form base pairs with uridine and the imino form with cytidine. Formation of a complementary base pair by a given tautomeric species was accompanied by an increase of up to 10% in the population of this species and a concomitant decrease in population of the other species.(ABSTRACT TRUNCATED AT 250 WORDS)

  2. Structural variability and the nature of intermolecular interactions in Watson-Crick B-DNA base pairs. (United States)

    Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J


    A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the


    Directory of Open Access Journals (Sweden)

    Mudasir Mudasir


    Full Text Available A research about base-pair specificity of the DNA binding of [Fe(phen3]2+, [Fe(phen2(dip]2+ and [Fe(phen(dip2]2+ complexes and the effect of calf-thymus DNA (ct-DNA binding of these metal complexes on thermal denaturation of ct-DNA has been carried out. This research is intended to evaluate the preferential binding of the complexes to the sequence of DNA (A-T or G-C sequence and to investigate the binding strength and mode upon their interaction with DNA. Base-pair specificity of the DNA binding of the complexes was determined by comparing the equilibrium binding constant (Kb of each complex to polysynthetic DNA that contain only A-T or G-C sequence. The Kb value of the interaction was determined by spectrophotometric titration and thermal denaturation temperature (Tm was determined by monitoring the absorbance of the mixture solution of each complex and ct-DNA at λ =260 nm as temperature was elevated in the range of 25 - 100 oC. Results of the study show that in general all iron(II complexes studied exhibit a base-pair specificity in their DNA binding to prefer the relatively facile A-T sequence as compared to the G-C one. The thermal denaturation experiments have demonstrated that Fe(phen3]2+ and [Fe(phen2(dip]2+ interact weakly with double helical DNA via electrostatic interaction as indicated by insignificant changes in melting temperature, whereas [Fe(phen2(dip]2+  most probably binds to DNA in mixed modes of interaction, i.e.: intercalation and electrostatic interaction. This conclusion is based on the fact that the binding of [Fe(phen2(dip]2+ to ct-DNA moderately increase the Tm value of ct- DNA   Keywords: DNA Binding, mixed-ligand complexes

  4. Probing electronic coupling between adenine bases in RNA strands from synchrotron radiation circular dichroism experiments

    DEFF Research Database (Denmark)

    Nielsen, Lisbeth Munksgård; Hoffmann, Søren Vrønning; Nielsen, Steen Brøndsted


    Circular dichroism spectra (176–330 nm) of RNA adenine oligomers, (rA)n (n = 1–10, 12, 15, and 20), reveal electronic coupling between two bases in short strands. The number of interacting bases in long strands is more and larger than that reported previously for the corresponding DNA strands....

  5. A dynamically tunable plasmonic multi-functional device based on graphene nano-sheet pair arrays (United States)

    Wang, Wei; Meng, Zhao; Liang, Ruisheng; Chen, Shijie; Ding, Li; Wang, Faqiang; Liu, Hongzhan; Meng, Hongyun; Wei, Zhongchao


    Dynamically tunable plasmonic multi-functional is particularly desirable for various nanotechnological applications. In this paper, graphene nano-sheet pair arrays separated by a substrate, which can act as a dynamically tunable plasmonic band stop filter with transmission at resonance wavelength lower than 1%, a high sensitivity refractive index sensor with sensitivity up to 4879 nm/RIU, figure of merit of 40.66 and a two circuit optical switch with the modulation depth up to 0.998, are proposed and numerically investigated. These excellent optical performances are calculated by using FDTD numerical modeling and theoretical deduction. Simulation results show that a slight variation of chemical potential of the graphene nano-sheet can achieve significant resonance wavelength shifts. In additional, the resonance wavelength and transmission of this plasmonic device can be tuned easily by two voltages owing to the simple patterned graphene. These studies may have great potential in fabrication of multi-functional and dynamically tunable optoelectronic integrated devices.

  6. Knowledge-based errors in anesthesia: a paired, controlled trial of learning and retention. (United States)

    Goldhaber-Fiebert, Sara N; Goldhaber-Fiebert, Jeremy D; Rosow, Carl E


    Optimizing patient safety by improving the training of physicians is a major challenge of medical education. In this pilot study, we hypothesized that a brief lecture, targeted to rare but potentially dangerous situations, could improve anesthesia practitioners' knowledge levels with significant retention of learning at six months. In this paired controlled trial, anesthesia residents and attending physicians at Massachusetts General Hospital took the same 14-question multiple choice examination three times: at baseline, immediately after a brief lecture, and six months later. The lecture covered material on seven "intervention" questions; the remaining seven were "control" questions. The authors measured immediate knowledge acquisition, defined as the change in percentage of correct answers on intervention questions between baseline and post-lecture, and measured learning retention as the difference between baseline and six months. Both measurements were corrected for change in performance on control questions. Fifty of the 89 subjects completed all three examinations. The post-lecture increase in percentage of questions answered correctly, adjusted for control, was 22.2% [95% confidence interval (CI) 16.0-28.4%; P learning at six months. Exposing residents or other practitioners to this type of inexpensive teaching intervention may help them to avoid preventable uncommon errors that are rooted in unfamiliarity with the situation or the equipment. The methods used for this study may also be applied to compare the effect of various other teaching modalities while, at the same time, preserving participant anonymity and making adjustments for ongoing learning.

  7. Network-Based Isoform Quantification with RNA-Seq Data for Cancer Transcriptome Analysis.

    Directory of Open Access Journals (Sweden)

    Wei Zhang


    Full Text Available High-throughput mRNA sequencing (RNA-Seq is widely used for transcript quantification of gene isoforms. Since RNA-Seq data alone is often not sufficient to accurately identify the read origins from the isoforms for quantification, we propose to explore protein domain-domain interactions as prior knowledge for integrative analysis with RNA-Seq data. We introduce a Network-based method for RNA-Seq-based Transcript Quantification (Net-RSTQ to integrate protein domain-domain interaction network with short read alignments for transcript abundance estimation. Based on our observation that the abundances of the neighboring isoforms by domain-domain interactions in the network are positively correlated, Net-RSTQ models the expression of the neighboring transcripts as Dirichlet priors on the likelihood of the observed read alignments against the transcripts in one gene. The transcript abundances of all the genes are then jointly estimated with alternating optimization of multiple EM problems. In simulation Net-RSTQ effectively improved isoform transcript quantifications when isoform co-expressions correlate with their interactions. qRT-PCR results on 25 multi-isoform genes in a stem cell line, an ovarian cancer cell line, and a breast cancer cell line also showed that Net-RSTQ estimated more consistent isoform proportions with RNA-Seq data. In the experiments on the RNA-Seq data in The Cancer Genome Atlas (TCGA, the transcript abundances estimated by Net-RSTQ are more informative for patient sample classification of ovarian cancer, breast cancer and lung cancer. All experimental results collectively support that Net-RSTQ is a promising approach for isoform quantification. Net-RSTQ toolbox is available at

  8. Tree decomposition based fast search of RNA structures including pseudoknots in genomes. (United States)

    Song, Yinglei; Liu, Chunmei; Malmberg, Russell; Pan, Fangfang; Cai, Liming


    Searching genomes for RNA secondary structure with computational methods has become an important approach to the annotation of non-coding RNAs. However, due to the lack of efficient algorithms for accurate RNA structure-sequence alignment, computer programs capable of fast and effectively searching genomes for RNA secondary structures have not been available. In this paper, a novel RNA structure profiling model is introduced based on the notion of a conformational graph to specify the consensus structure of an RNA family. Tree decomposition yields a small tree width t for such conformation graphs (e.g., t = 2 for stem loops and only a slight increase for pseudo-knots). Within this modelling framework, the optimal alignment of a sequence to the structure model corresponds to finding a maximum valued isomorphic subgraph and consequently can be accomplished through dynamic programming on the tree decomposition of the conformational graph in time O(k(t)N(2)), where k is a small parameter; and N is the size of the projiled RNA structure. Experiments show that the application of the alignment algorithm to search in genomes yields the same search accuracy as methods based on a Covariance model with a significant reduction in computation time. In particular; very accurate searches of tmRNAs in bacteria genomes and of telomerase RNAs in yeast genomes can be accomplished in days, as opposed to months required by other methods. The tree decomposition based searching tool is free upon request and can be downloaded at our site h t t p ://

  9. RNA2DMut: a web tool for the design and analysis of RNA structure mutations. (United States)

    Moss, Walter N


    With the widespread application of high-throughput sequencing, novel RNA sequences are being discovered at an astonishing rate. The analysis of function, however, lags behind. In both the cis - and trans -regulatory functions of RNA, secondary structure (2D base-pairing) plays essential regulatory roles. In order to test RNA function, it is essential to be able to design and analyze mutations that can affect structure. This was the motivation for the creation of the RNA2DMut web tool. With RNA2DMut, users can enter in RNA sequences to analyze, constrain mutations to specific residues, or limit changes to purines/pyrimidines. The sequence is analyzed at each base to determine the effect of every possible point mutation on 2D structure. The metrics used in RNA2DMut rely on the calculation of the Boltzmann structure ensemble and do not require a robust 2D model of RNA structure for designing mutations. This tool can facilitate a wide array of uses involving RNA: for example, in designing and evaluating mutants for biological assays, interrogating RNA-protein interactions, identifying key regions to alter in SELEX experiments, and improving RNA folding and crystallization properties for structural biology. Additional tools are available to help users introduce other mutations (e.g., indels and substitutions) and evaluate their effects on RNA structure. Example calculations are shown for five RNAs that require 2D structure for their function: the MALAT1 mascRNA, an influenza virus splicing regulatory motif, the EBER2 viral noncoding RNA, the Xist lncRNA repA region, and human Y RNA 5. RNA2DMut can be accessed at © 2018 Moss; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  10. RNA-based, transient modulation of gene expression in human haematopoietic stem and progenitor cells (United States)

    Diener, Yvonne; Jurk, Marion; Kandil, Britta; Choi, Yeong-Hoon; Wild, Stefan; Bissels, Ute; Bosio, Andreas


    Modulation of gene expression is a useful tool to study the biology of haematopoietic stem and progenitor cells (HSPCs) and might also be instrumental to expand these cells for therapeutic approaches. Most of the studies so far have employed stable gene modification by viral vectors that are burdensome when translating protocols into clinical settings. Our study aimed at exploring new ways to transiently modify HSPC gene expression using non-integrating, RNA-based molecules. First, we tested different methods to deliver these molecules into HSPCs. The delivery of siRNAs with chemical transfection methods such as lipofection or cationic polymers did not lead to target knockdown, although we observed more than 90% fluorescent cells using a fluorochrome-coupled siRNA. Confocal microscopic analysis revealed that despite extensive washing, siRNA stuck to or in the cell surface, thereby mimicking a transfection event. In contrast, electroporation resulted in efficient, siRNA-mediated protein knockdown. For transient overexpression of proteins, we used optimised mRNA molecules with modified 5′- and 3′-UTRs. Electroporation of mRNA encoding GFP resulted in fast, efficient and persistent protein expression for at least seven days. Our data provide a broad-ranging comparison of transfection methods for hard-to-transfect cells and offer new opportunities for DNA-free, non-integrating gene modulation in HSPCs. PMID:26599627

  11. Nanosystems based on siRNA silencing HuR expression counteract diabetic retinopathy in rat. (United States)

    Amadio, Marialaura; Pascale, Alessia; Cupri, Sarha; Pignatello, Rosario; Osera, Cecilia; D Agata, Velia; D Amico, Agata Grazia; Leggio, Gian Marco; Ruozi, Barbara; Govoni, Stefano; Drago, Filippo; Bucolo, Claudio


    We evaluated whether specifically and directly targeting human antigen R (HuR), a member of embryonic lethal abnormal vision (ELAV) proteins family, may represent a new potential therapeutic strategy to manage diabetic retinopathy. Nanosystems loaded with siRNA silencing HuR expression (lipoplexes), consisting of solid lipid nanoparticles (SLN) and liposomes (SUV) were prepared. Photon correlation spectroscopy analysis, Zeta potential measurement and atomic force microscopy (AFM) studies were carried out to characterize the complexation of siRNA with the lipid nanocarriers. Nanosystems were evaluated by using AFM and scanning electron microscopy. The lipoplexes were injected into the eye of streptozotocin (STZ)-induced diabetic rats. Retinal HuR and VEGF levels were detected by Western blot and ELISA, respectively. Retinal histology was also carried out. The results demonstrated that retinal HuR and VEGF are significantly increased in STZ-rats and are blunted by HuR siRNA treatment. Lipoplexes with a weak positive surface charge and with a 4:1 N/P (cationic lipid nitrogen to siRNA phosphate) ratio exert a better transfection efficiency, significantly dumping retinal HuR and VEGF levels. In conclusion, we demonstrated that siRNA can be efficiently delivered into the rat retina using lipid-based nanocarriers, and some of the lipoplexes loaded with siRNA silencing HuR expression are potential candidates to manage retinal diseases. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Sensitive voltammetric detection of yeast RNA based on its interaction with Victoria Blue B

    Directory of Open Access Journals (Sweden)



    Full Text Available Voltammetric studies of the interaction of yeast RNA (y-RNA with Victoria Blue B (VBB are described in this paper. Furthermore, a linear sweep voltammetric method for the detection of y-RNA was established. The reaction conditions, such as acidity and amount of buffer solution, the concentration of VBB, the reaction time and temperature, etc., were carefully investigated by second order derivative linear sweep voltammetry. Under the optimal conditions, the reduction peak current of VBB at –0.75 V decreased greatly after the addition of y-RNA to the solution without any shift of the reduction peak potential. Based on the decrease of the peak current, a new quantitative method for the determination of y-RNA was developed. The effects of co-existing substances on the determination were carefully investigated and three synthetic samples were determined with satisfactory results. The stoichiometry of the VBB–y-RNA complex was calculated by linear sweep voltammetry and the interaction mechanism is discussed.

  13. tRNA acceptor-stem and anticodon bases embed separate features of amino acid chemistry (United States)

    Carter, Charles W.; Wolfenden, Richard


    abstract The universal genetic code is a translation table by which nucleic acid sequences can be interpreted as polypeptides with a wide range of biological functions. That information is used by aminoacyl-tRNA synthetases to translate the code. Moreover, amino acid properties dictate protein folding. We recently reported that digital correlation techniques could identify patterns in tRNA identity elements that govern recognition by synthetases. Our analysis, and the functionality of truncated synthetases that cannot recognize the tRNA anticodon, support the conclusion that the tRNA acceptor stem houses an independent code for the same 20 amino acids that likely functioned earlier in the emergence of genetics. The acceptor-stem code, related to amino acid size, is distinct from a code in the anticodon that is related to amino acid polarity. Details of the acceptor-stem code suggest that it was useful in preserving key properties of stereochemically-encoded peptides that had developed the capacity to interact catalytically with RNA. The quantitative embedding of the chemical properties of amino acids into tRNA bases has implications for the origins of molecular biology. PMID:26595350

  14. The effect of chemical modification of DNA base on binding of Hg-II and Ag-I in metal-mediated base pairs

    Czech Academy of Sciences Publication Activity Database

    Šebera, Jakub; Tanaka, Y.; Ono, A.; Sychrovský, Vladimír


    Roč. 452, Oct 1 (2016), s. 199-204 ISSN 0020-1693 R&D Projects: GA ČR GA13-27676S Institutional support: RVO:61388963 Keywords : DFT * metal-mediated base pairs * Hg * Ag Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.002, year: 2016

  15. Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing. (United States)

    Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon


    It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

  16. Design of a rotary dielectric elastomer actuator using a topology optimization method based on pairs of curves (United States)

    Wang, Nianfeng; Guo, Hao; Chen, Bicheng; Cui, Chaoyu; Zhang, Xianmin


    Dielectric elastomers (DE), known as electromechanical transducers, have been widely used in the field of sensors, generators, actuators and energy harvesting for decades. A large number of DE actuators including bending actuators, linear actuators and rotational actuators have been designed utilizing an experience design method. This paper proposes a new method for the design of DE actuators by using a topology optimization method based on pairs of curves. First, theoretical modeling and optimization design are discussed, after which a rotary dielectric elastomer actuator has been designed using this optimization method. Finally, experiments and comparisons between several DE actuators have been made to verify the optimized result.

  17. Optimization of the Municipal Waste Collection Route Based on the Method of the Minimum Pairing

    Directory of Open Access Journals (Sweden)

    Michal Petřík


    Full Text Available In the present article is shown the use of Maple program for processing of data describing the position of municipal waste sources and topology of collecting area. The data are further processed through the use of graph theory algorithms, which enable creation of collection round proposal. In this case study is described method of waste pick-up solution in a certain village of approx. 1,600 inhabitants and built-up area of approx. 30 hectares. Village has approx. 11.5 kilometers of ride able routes, with approx. 1 kilometer without waste source. The first part shows topology of the village in light of location of waste sources and capacity of the routes. In the second part are topological data converted into data that can be processed by use of the Graph Theory and the correspondent graph is shown. Optimizing collection route in a certain graph means to find the Euler circle. However, this circle can be constructed only on condition that all the vertices of the graph are of an even degree. Practically this means that is necessary to introduce auxiliary edges – paths that will be passed twice. These paths will connect vertices with odd values. The optimal solution then requires that the total length of the inserted edges was minimal possible, which corresponds to the minimum pairing method. As it is a problem of exponential complexity, it is necessary to make some simplifications. These simplifications are depicted graphically and the results are displayed in the conclusion. The resulting graph with embedded auxiliary edges can be used as a basic decision making material for creation of real collection round that respects local limitations such as one way streets or streets where is the waste collection is not possible from both sides at the same time.

  18. Effect of single interstitial impurity in iron-based superconductors with sign-changed s-wave pairing symmetry

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Xiang-Long, E-mail: [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Liu, Da-Yong; Quan, Ya-Min; Zheng, Xiao-Jun [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Zou, Liang-Jian, E-mail: [Key Laboratory of Materials Physics, Institute of Solid State Physics, Chinese Academy of Sciences, P. O. Box 1129, Hefei 230031 (China); Department of Physics, University of Science and Technology of China, Hefei 230026 (China)


    Highlights: • Effects of single interstitial impurity are studied in iron-based superconductors. • Bound states within the superconducting gap can be induced. • The interstitial impurity can induce a π phase shift of pairing order parameter. • For strong magnetic scattering the bound-state peak can appear at the Fermi level. - Abstract: We employ the self-consistent Bogoliubov-de Gennes (BdG) formulation to investigate the effect of single interstitial nonmagnetic/magnetic impurity in iron-based superconductors with s ± -wave pairing symmetry. We find that both the nonmagnetic and magnetic impurities can induce bound states within the superconducting (SC) gap and a π phase shift of SC order parameter at the impurity site. However, different from the interstitial-nonmagnetic-impurity case characterized by two symmetric peaks with respect to zero energy, the interstitial magnetic one only induces single bound-state peak. In the strong scattering regime this peak can appear at the Fermi level, which has been observed in the recent scanning tunneling microscope (STM) experiment of Fe(Te,Se) superconductor with interstitial Fe impurities (Yin et al. 2015 [44]). This novel single in-gap peak feature also distinguishes the interstitial case from the substitutional one with two peaks. These results provide important information for comparing the different impurity effects in the iron-based superconductors.

  19. Accurate classification of brain gliomas by discriminate dictionary learning based on projective dictionary pair learning of proton magnetic resonance spectra. (United States)

    Adebileje, Sikiru Afolabi; Ghasemi, Keyvan; Aiyelabegan, Hammed Tanimowo; Saligheh Rad, Hamidreza


    Proton magnetic resonance spectroscopy is a powerful noninvasive technique that complements the structural images of cMRI, which aids biomedical and clinical researches, by identifying and visualizing the compositions of various metabolites within the tissues of interest. However, accurate classification of proton magnetic resonance spectroscopy is still a challenging issue in clinics due to low signal-to-noise ratio, overlapping peaks of metabolites, and the presence of background macromolecules. This paper evaluates the performance of a discriminate dictionary learning classifiers based on projective dictionary pair learning method for brain gliomas proton magnetic resonance spectroscopy spectra classification task, and the result were compared with the sub-dictionary learning methods. The proton magnetic resonance spectroscopy data contain a total of 150 spectra (74 healthy, 23 grade II, 23 grade III, and 30 grade IV) from two databases. The datasets from both databases were first coupled together, followed by column normalization. The Kennard-Stone algorithm was used to split the datasets into its training and test sets. Performance comparison based on the overall accuracy, sensitivity, specificity, and precision was conducted. Based on the overall accuracy of our classification scheme, the dictionary pair learning method was found to outperform the sub-dictionary learning methods 97.78% compared with 68.89%, respectively. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  20. A small RNA activates CFA synthase by isoform-specific mRNA stabilization. (United States)

    Fröhlich, Kathrin Sophie; Papenfort, Kai; Fekete, Agnes; Vogel, Jörg


    Small RNAs use a diversity of well-characterized mechanisms to repress mRNAs, but how they activate gene expression at the mRNA level remains not well understood. The predominant activation mechanism of Hfq-associated small RNAs has been translational control whereby base pairing with the target prevents the formation of an intrinsic inhibitory structure in the mRNA and promotes translation initiation. Here, we report a translation-independent mechanism whereby the small RNA RydC selectively activates the longer of two isoforms of cfa mRNA (encoding cyclopropane fatty acid synthase) in Salmonella enterica. Target activation is achieved through seed pairing of the pseudoknot-exposed, conserved 5' end of RydC to an upstream region of the cfa mRNA. The seed pairing stabilizes the messenger, likely by interfering directly with RNase E-mediated decay in the 5' untranslated region. Intriguingly, this mechanism is generic such that the activation is equally achieved by seed pairing of unrelated small RNAs, suggesting that this mechanism may be utilized in the design of RNA-controlled synthetic circuits. Physiologically, RydC is the first small RNA known to regulate membrane stability.

  1. Nanotechnology based approaches for detection and delivery of microRNA in healthcare and crop protection. (United States)

    Chaudhary, Vrantika; Jangra, Sumit; Yadav, Neelam R


    Nanobiotechnology has the potential to revolutionize diverse sectors including medicine, agriculture, food, textile and pharmaceuticals. Disease diagnostics, therapeutics and crop protection strategies are fast emerging using nanomaterials preferably nanobiomaterials. It has potential for development of novel nanobiomolecules which offer several advantages over conventional treatment methods. RNA nanoparticles with many unique features are promising candidates in disease treatment. The miRNAs are involved in many biochemical and developmental pathways and their regulation in plants and animals. These appear to be a powerful tool for controlling various pathological diseases in human, plants and animals, however there are challenges associated with miRNA based nanotechnology. Several advancements made in the field of miRNA therapeutics make it an attractive approach, but a lot more has to be explored in nanotechnology assisted miRNA therapy. The miRNA based technologies can be employed for detection and combating crop diseases as well. Despite these potential advantages, nanobiotechnology applications in the agricultural sector are still in its infancy and have not yet made its mark in comparison with healthcare sector. The review provides a platform to discuss nature, role and use of miRNAs in nanobiotechnology applications.

  2. incaRNAfbinv: a web server for the fragment-based design of RNA sequences (United States)

    Drory Retwitzer, Matan; Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme; Barash, Danny


    Abstract In recent years, new methods for computational RNA design have been developed and applied to various problems in synthetic biology and nanotechnology. Lately, there is considerable interest in incorporating essential biological information when solving the inverse RNA folding problem. Correspondingly, RNAfbinv aims at including biologically meaningful constraints and is the only program to-date that performs a fragment-based design of RNA sequences. In doing so it allows the design of sequences that do not necessarily exactly fold into the target, as long as the overall coarse-grained tree graph shape is preserved. Augmented by the weighted sampling algorithm of incaRNAtion, our web server called incaRNAfbinv implements the method devised in RNAfbinv and offers an interactive environment for the inverse folding of RNA using a fragment-based design approach. It takes as input: a target RNA secondary structure; optional sequence and motif constraints; optional target minimum free energy, neutrality and GC content. In addition to the design of synthetic regulatory sequences, it can be used as a pre-processing step for the detection of novel natural occurring RNAs. The two complementary methodologies RNAfbinv and incaRNAtion are merged together and fully implemented in our web server incaRNAfbinv, available at PMID:27185893

  3. RNA-Based TWIST1 Inhibition via Dendrimer Complex to Reduce Breast Cancer Cell Metastasis

    Directory of Open Access Journals (Sweden)

    James Finlay


    Full Text Available Breast cancer is the leading cause of cancer-related deaths among women in the United States, and survival rates are lower for patients with metastases and/or triple-negative breast cancer (TNBC; ER, PR, and Her2 negative. Understanding the mechanisms of cancer metastasis is therefore crucial to identify new therapeutic targets and develop novel treatments to improve patient outcomes. A potential target is the TWIST1 transcription factor, which is often overexpressed in aggressive breast cancers and is a master regulator of cellular migration through epithelial-mesenchymal transition (EMT. Here, we demonstrate an siRNA-based TWIST1 silencing approach with delivery using a modified poly(amidoamine (PAMAM dendrimer. Our results demonstrate that SUM1315 TNBC cells efficiently take up PAMAM-siRNA complexes, leading to significant knockdown of TWIST1 and EMT-related target genes. Knockdown lasts up to one week after transfection and leads to a reduction in migration and invasion, as determined by wound healing and transwell assays. Furthermore, we demonstrate that PAMAM dendrimers can deliver siRNA to xenograft orthotopic tumors and siRNA remains in the tumor for at least four hours after treatment. These results suggest that further development of dendrimer-based delivery of siRNA for TWIST1 silencing may lead to a valuable adjunctive therapy for patients with TNBC.

  4. RNA-Based Assessment of Diversity and Composition of Active Archaeal Communities in the German Bight

    Directory of Open Access Journals (Sweden)

    Bernd Wemheuer


    Full Text Available Archaea play an important role in various biogeochemical cycles. They are known extremophiles inhabiting environments such as thermal springs or hydrothermal vents. Recent studies have revealed a significant abundance of Archaea in moderate environments, for example, temperate sea water. Nevertheless, the composition and ecosystem function of these marine archaeal communities is largely unknown. To assess diversity and composition of active archaeal communities in the German Bight, seven marine water samples were taken and studied by RNA-based analysis of ribosomal 16S rRNA. For this purpose, total RNA was extracted from the samples and converted to cDNA. Archaeal community structures were investigated by pyrosequencing-based analysis of 16S rRNA amplicons generated from cDNA. To our knowledge, this is the first study combining next-generation sequencing and metatranscriptomics to study archaeal communities in marine habitats. The pyrosequencing-derived dataset comprised 62,045 archaeal 16S rRNA sequences. We identified Halobacteria as the predominant archaeal group across all samples with increased abundance in algal blooms. Thermoplasmatales (Euryarchaeota and the Marine Group I (Thaumarchaeota were identified in minor abundances. It is indicated that archaeal community patterns were influenced by environmental conditions.

  5. Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence. (United States)

    Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen


    The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Milestones and Millennials: A Perfect Pairing-Competency-Based Medical Education and the Learning Preferences of Generation Y. (United States)

    Desy, Janeve R; Reed, Darcy A; Wolanskyj, Alexandra P


    Millennials are quickly becoming the most prevalent generation of medical learners. These individuals have a unique outlook on education and have different preferences and expectations than their predecessors. As evidenced by its implementation by the Accreditation Council for Graduate Medical Education in the United States and the Royal College of Physicians and Surgeons in Canada, competency based medical education is rapidly gaining international acceptance. Characteristics of competency based medical education can be perfectly paired with Millennial educational needs in several dimensions including educational expectations, the educational process, attention to emotional quotient and professionalism, assessment, feedback, and intended outcomes. We propose that with its attention to transparency, personalized learning, and frequent formative assessment, competency based medical education is an ideal fit for the Millennial generation as it realigns education and assessment with the needs of these 21st century learners. Copyright © 2016 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

  7. Structural context effects in the oxidation of 8-oxo-7,8-dihydro-2'-deoxyguanosine to hydantoin products: electrostatics, base stacking, and base pairing. (United States)

    Fleming, Aaron M; Muller, James G; Dlouhy, Adrienne C; Burrows, Cynthia J


    8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in cells, where it resides in many structural contexts, including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and duplex DNA base-paired with either adenine (A) or cytosine (C). OG is prone to further oxidation to the highly mutagenic hydantoin products spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen-bond modulators (2,6-diaminopurine, N(4)-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics, and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base-pairing effects. Moreover, these structural effects cause an increase in the effective pK(a) of 5-HO-OG, following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG·C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation, for which the OG·A base pair is ~2.5-fold more reactive than an OG·C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG·C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome.

  8. Structural Context Effects in the Oxidation of 8-Oxo-7,8-dihydro-2’-deoxyguanosine to Hydantoin Products: Electrostatics, Base Stacking, and Base Pairing (United States)

    Fleming, Aaron M.; Muller, James G.; Dlouhy, Adrienne C.; Burrows, Cynthia J.


    8-Oxo-7,8-dihydroguanine (OG) is the most common base damage found in the cell where it resides in many structural contexts including the nucleotide pool, single-stranded DNA at transcription forks and replication bubbles, and in duplex DNA base paired with either A or C. OG is prone to further oxidation to the highly mutagenic hydantoin products, spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) in a sharply pH-dependent fashion within nucleosides. In the present work, studies were conducted to determine how the structural context affects OG oxidation to the hydantoins. These studies revealed a trend in which the Sp yield was greatest in unencumbered contexts, such as nucleosides, while the Gh yield increased in oligodeoxynucleotide (ODN) contexts or at reduced pH. Oxidation of oligomers containing hydrogen bond modulators (2,6-diaminopurine, N4-ethylcytidine) or alteration of the reaction conditions (pH, temperature, and salt) identify base stacking, electrostatics and base pairing as the drivers of the key intermediate 5-hydroxy-8-oxo-7,8-dihydroguanine (5-HO-OG) partitioning along the two hydantoin pathways, allowing us to propose a mechanism for the observed base pairing effects. Moreover, these structural effects cause an increase in the effective pKa of 5-HO-OG following an increasing trend from 5.7 in nucleosides to 7.7 in a duplex bearing an OG•C base pair, which supports the context-dependent product yields. The high yield of Gh in ODNs underscores the importance of further study on this lesion. The structural context of OG also determined its relative reactivity toward oxidation for which the OG•A base pair is ~2.5-fold more reactive than an OG•C base pair, and with the weak one-electron oxidant ferricyanide, the OG nucleoside reactivity is >6000-fold greater than that of OG•C in a duplex, leading to the conclusion that OG in the nucleoside pool should act as a protective agent for OG in the genome. PMID:22880947

  9. Deuterium isotope effects and fractionation factors of hydrogen-bonded A:T base pairs of DNA

    International Nuclear Information System (INIS)

    Vakonakis, Ioannis; Salazar, Miguel; Kang, Mijeong; Dunbar, Kim R.; Li Wang, Andy C.


    Deuterium isotope effects and fractionation factors of N1...H3-N3 hydrogen bonded Watson-Crick A:T base pairs of two DNA dodecamers are presented here. Specifically, two-bond deuterium isotope effects on the chemical shifts of 13 C2 and 13 C4, 2 Δ 13 C2 and 2 Δ 13 C4, and equilibrium deuterium/protium fractionation factors of H3, Φ, were measured and seen to correlate with the chemical shift of the corresponding imino proton, δ H3 . Downfield-shifted imino protons associated with larger values of 2 Δ 13 C2 and 2 Δ 13 C4 and smaller Φ values, which together suggested that the effective H3-N3 vibrational potentials were more anharmonic in the stronger hydrogen bonds of these DNA molecules. We anticipate that 2 Δ 13 C2, 2 Δ 13 C4 and Φ values can be useful gauges of hydrogen bond strength of A:T base pairs

  10. NMR scalar couplings across Watson–Crick base pair hydrogen bonds in DNA observed by transverse relaxation-optimized spectroscopy (United States)

    Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt


    This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668

  11. Light-emitting self-assembled peptide nucleic acids exhibit both stacking interactions and Watson-Crick base pairing. (United States)

    Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud


    The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.


    Directory of Open Access Journals (Sweden)

    Abu Husen


    Full Text Available This study aims to implement of Problem Based Learning combined Think Pair Share in order to improve critical thinking and science process skills of students at XI IPA SMA. This research was classroom action research. The subjects were 28 students of classroom XI IPA 1 SMAN 1 Kasiman Bojonegoro 2016/2017. This research was conducted in two cycles. The research data consists of the learning realized by observation, the results of the critical thinking paper and pencil tests, and the science process skills by observation. Data were analyzed by descriptive qualitative technique. The results showed that the combined PBL and TPS learning model can improve the ability of critical thinking, and science process skills students of classroom XI IPA 1 SMAN 1 Kasiman Bojonegoro. Penelitian ini bertujuan untuk menerapkan Problem Based Learning dipadu Think Pair Share dalam rangka meningkatkan kemampuan berpikir kritis dan keterampilan proses sains siswa kelas XI IPA SMA. Penelitian ini merupakan penelitian tindakan kelas. Subjek penelitian adalah siswa kelas XI IPA 1 SMAN 1 Kasiman Bojonegoro tahun pelajaran 2016/2017 dengan jumlah 28 siswa. Penelitian dilaksanakan selama dua siklus. Data penelitian terdiri atas hasil observasi keterlaksanaan pembelajaran, hasil tes tulis kemampuan berpikir kritis, dan hasil observasi keterampilan proses sains. Data dianalisis secara deskriptif kualitatif. Hasil penelitian menunjukkan bahwa model pembelajaran PBL dipadu TPS dapat meningkatkan kemampuan berpikir kritis dan keterampilan proses sains siswa kelas XI IPA 1 SMAN 1 Kasiman Bojonegoro.

  13. Energetics and dynamics of the non-natural fluorescent 4AP:DAP base pair

    KAUST Repository

    Chawla, Mohit; Autiero, Ida; Oliva, Romina; Cavallo, Luigi


    the experimental studies and rationalize the impact of the above non-natural bases on the structure, stability and dynamics of nucleic acid structures, we performed quantum mechanics (QM) calculations along with classical molecular dynamics (MD) simulations. QM

  14. A mRNA-Responsive G-Quadruplex-Based Drug Release System

    Directory of Open Access Journals (Sweden)

    Hidenobu Yaku


    Full Text Available G-quadruplex-based drug delivery carriers (GDDCs were designed to capture and release a telomerase inhibitor in response to a target mRNA. Hybridization between a loop on the GDDC structure and the mRNA should cause the G-quadruplex structure of the GDDC to unfold and release the bound inhibitor, anionic copper(II phthalocyanine (CuAPC. As a proof of concept, GDDCs were designed with a 10-30-mer loop, which can hybridize with a target sequence in epidermal growth factor receptor (EGFR mRNA. Structural analysis using circular dichroism (CD spectroscopy showed that the GDDCs form a (3 + 1 type G-quadruplex structure in 100 mM KCl and 10 mM MgCl2 in the absence of the target RNA. Visible absorbance titration experiments showed that the GDDCs bind to CuAPC with Ka values of 1.5 × 105 to 5.9 × 105 M−1 (Kd values of 6.7 to 1.7 μM at 25 °C, depending on the loop length. Fluorescence titration further showed that the G-quadruplex structure unfolds upon binding to the target RNA with Ka values above 1.0 × 108 M−1 (Kd values below 0.01 μM at 25 °C. These results suggest the carrier can sense and bind to the target RNA, which should result in release of the bound drug. Finally, visible absorbance titration experiments demonstrated that the GDDC release CuAPC in response to the target RNA.

  15. Construction of permanently inducible miRNA-based expression vectors using site-specific recombinases

    Directory of Open Access Journals (Sweden)

    Garwick-Coppens Sara E


    Full Text Available Abstract Background RNA interference (RNAi is a conserved gene silencing mechanism mediated by small inhibitory microRNAs (miRNAs. Promoter-driven miRNA expression vectors have emerged as important tools for delivering natural or artificially designed miRNAs to eukaryotic cells and organisms. Such systems can be used to query the normal or pathogenic functions of natural miRNAs or messenger RNAs, or to therapeutically silence disease genes. Results As with any molecular cloning procedure, building miRNA-based expression constructs requires a time investment and some molecular biology skills. To improve efficiency and accelerate the construction process, we developed a method to rapidly generate miRNA expression vectors using recombinases instead of more traditional cut-and-paste molecular cloning techniques. In addition to streamlining the construction process, our cloning strategy provides vectors with added versatility. In our system, miRNAs can be constitutively expressed from the U6 promoter, or inducibly expressed by Cre recombinase. We also engineered a built-in mechanism to destroy the vector with Flp recombinase, if desired. Finally, to further simplify the construction process, we developed a software package that automates the prediction and design of optimal miRNA sequences using our system. Conclusions We designed and tested a modular system to rapidly clone miRNA expression cassettes. Our strategy reduces the hands-on time required to successfully generate effective constructs, and can be implemented in labs with minimal molecular cloning expertise. This versatile system provides options that permit constitutive or inducible miRNA expression, depending upon the needs of the end user. As such, it has utility for basic or translational applications.

  16. Targeting miRNA-based medicines to cystic fibrosis airway epithelial cells using nanotechnology

    Directory of Open Access Journals (Sweden)

    McKiernan PJ


    Full Text Available Paul J McKiernan,2 Orla Cunninghamm,1,2 Catherine M Greenem,2 Sally-Ann Cryan1,31School of Pharmacy, Royal College of Surgeons in Ireland, 2Respiratory Research Division, Department of Medicine, Royal College of Surgeons in Ireland Education and Research Centre, Beaumont Hospital, 3Trinity Centre for Bioengineering, Trinity College Dublin, Dublin, IrelandAbstract: Cystic fibrosis (CF is an inherited disorder characterized by chronic airway inflammation. microRNAs (miRNAs are endogenous small RNAs which act on messenger (mRNA at a post transcriptional level, and there is a growing understanding that altered expression of miRNA is involved in the CF phenotype. Modulation of miRNA by replacement using miRNA mimics (premiRs presents a new therapeutic paradigm for CF, but effective and safe methods of delivery to the CF epithelium are limiting clinical translation. Herein, polymeric nanoparticles are investigated for delivery of miRNA mimics into CF airway epithelial cells, using miR-126 as a proof-of-concept premiR cargo to determine efficiency. Two polymers, polyethyleneimine (PEI and chitosan, were used to prepare miRNA nanomedicines, characterized for their size, surface (zeta potential, and RNA complexation efficiency, and screened for delivery and cytotoxicity in CFBE41o- (human F508del cystic fibrosis transmembrane conductance regulator bronchial epithelial cells using a novel high content analysis method. RNA extraction was carried out 24 hours post transfection, and miR-126 and TOM1 (target of Myb1 expression (a validated miR-126 target was assessed. Manufacture was optimized to produce small nanoparticles that effectively complexed miRNA. Using high content analysis, PEI-based nanoparticles were more effective than chitosan-based nanoparticles in facilitating uptake of miRNA into CFBE41o- cells and this was confirmed in miR-126 assays. PEI-premiR-126 nanoparticles at low nitrogen/phosphate (N/P ratios resulted in significant knockdown of

  17. Chain propagation and termination mechanisms for polymerization of conjugated polar alkenes by [Al]-based frustrated Lewis pairs

    KAUST Repository

    He, Jianghua


    A combined experimental and theoretical study on mechanistic aspects of polymerization of conjugated polar alkenes by frustrated Lewis pairs (FLPs) based on N-heterocyclic carbene (NHC) and Al(C6F5)3 pairs is reported. This study consists of three key parts: structural characterization of active propagating intermediates, propagation kinetics, and chain-termination pathways. Zwitterionic intermediates that simulate the active propagating species in such polymerization have been generated or isolated from the FLP activation of monomers such as 2-vinylpyridine and 2-isopropenyl-2-oxazoline-one of which, IMes+-CH2C(Me)=(C3H2NO)Al(C6F5)3 - (2), has been structurally characterized. Kinetics performed on the polymerization of 2-vinylpyridine by ItBu/Al(C6F5)3 revealed that the polymerization follows a zero-order dependence on monomer concentration and a first-order dependence on initiator (ItBu) and activator [Al(C6F5)3] concentrations, indicating a bimolecular, activated monomer propagation mechanism. The Lewis pair polymerization of conjugate polar alkenes such as methacrylates is accompanied by competing chain-termination side reactions; between the two possible chain-termination pathways, the one that proceeds via intramolecular backbiting cyclization involving nucleophilic attack of the activated ester group of the growing polymer chain by the O-ester enolate active chain end to generate a six-membered lactone (δ-valerolactone)-terminated polymer chain is kinetically favored, but thermodynamically disfavored, over the pathway leading to the -ketoester-terminated chain, as revealed by computational studies.

  18. Nanoparticle-based delivery of small interfering RNA: challenges for cancer therapy

    Directory of Open Access Journals (Sweden)

    Miele E


    Full Text Available Evelina Miele,1,* Gian Paolo Spinelli,2,* Ermanno Miele,3 Enzo Di Fabrizio,3,6 Elisabetta Ferretti,4 Silverio Tomao,2 Alberto Gulino,1,5 1Department of Molecular Medicine, 2Department of Medico-Surgical Sciences and Biotechnologies, Sapienza University of Rome, Rome, 3Nanostructures, Istituto Italiano di Tecnologia, via Morego, 30, 16163 Genova, 4Department of Experimental Medicine, Sapienza University of Rome, Rome, 5Center for Life Nanoscience, Istituto Italiano di Tecnologia, Rome, Italy, 6BIONEM lab, University of Magna Graecia, Campus S. Venuta, Viale Europa 88100 Catanzaro, Italy *These authors contributed equally to this workAbstract: During recent decades there have been remarkable advances and profound changes in cancer therapy. Many therapeutic strategies learned at the bench, including monoclonal antibodies and small molecule inhibitors, have been used at the bedside, leading to important successes. One of the most important advances in biology has been the discovery that small interfering RNA (siRNA is able to regulate the expression of genes, by a phenomenon known as RNA interference (RNAi. RNAi is one of the most rapidly growing fields of research in biology and therapeutics. Much research effort has gone into the application of this new discovery in the treatment of various diseases, including cancer. However, even though these molecules may have potential and strong utility, some limitations make their clinical application difficult, including delivery problems, side effects due to off-target actions, disturbance of physiological functions of the cellular machinery involved in gene silencing, and induction of the innate immune response. Many researchers have attempted to overcome these limitations and to improve the safety of potential RNAi-based therapeutics. Nanoparticles, which are nanostructured entities with tunable size, shape, and surface, as well as biological behavior, provide an ideal opportunity to modify current

  19. Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations. (United States)

    Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise


    Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.

  20. Emerging RNA-based drugs: siRNAs, microRNAs and derivates. (United States)

    Pereira, Tiago Campos; Lopes-Cendes, Iscia


    An emerging new category of therapeutic agents based on ribonucleic acid has emerged and shown very promising in vitro, animal and pre-clinical results, known as small interfering RNAs (siRNAs), microRNAs mimics (miRNA mimics) and their derivates. siRNAs are small RNA molecules that promote potent and specific silencing of mutant, exogenous or aberrant genes through a mechanism known as RNA interference. These agents have called special attention to medicine since they have been used to experimentally treat a series of neurological conditions with distinct etiologies such as prion, viral, bacterial, fungal, genetic disorders and others. siRNAs have also been tested in other scenarios such as: control of anxiety, alcohol consumption, drug-receptor blockage and inhibition of pain signaling. Although in a much earlier stage, miRNAs mimics, anti-miRs and small activating RNAs (saRNAs) also promise novel therapeutic approaches to control gene expression. In this review we intend to introduce clinicians and medical researchers to the most recent advances in the world of siRNA- and miRNA-mediated gene control, its history, applications in cells, animals and humans, delivery methods (an yet unsolved hurdle), current status and possible applications in future clinical practice.

  1. A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction (United States)

    Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng


    In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples.

  2. Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components (United States)

    Gerling, Thomas; Wagenbauer, Klaus F.; Neuner, Andrea M.; Dietz, Hendrik


    We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components’ interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.

  3. Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA. (United States)

    Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T


    Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.

  4. Synchronized Pair Configuration in Virtualization-Based Lab for Learning Computer Networks (United States)

    Kongcharoen, Chaknarin; Hwang, Wu-Yuin; Ghinea, Gheorghita


    More studies are concentrating on using virtualization-based labs to facilitate computer or network learning concepts. Some benefits are lower hardware costs and greater flexibility in reconfiguring computer and network environments. However, few studies have investigated effective mechanisms for using virtualization fully for collaboration.…

  5. Pairing based threshold cryptography improving on Libert-Quisquater and Baek-Zheng

    DEFF Research Database (Denmark)

    Desmedt, Yvo; Lange, Tanja


    In this paper we apply techniques from secret sharing and threshold decryption to show how to properly design an ID-based threshold system in which one assumes no trust in any party. In our scheme: We avoid that any single machine ever knew the master secret s of the trusted authority (TA). Inste...

  6. New miRNA labeling method for bead-based quantification

    Directory of Open Access Journals (Sweden)

    Lanfranchi Gerolamo


    Full Text Available Abstract Background microRNAs (miRNAs are small single-stranded non-coding RNAs that act as crucial regulators of gene expression. Different methods have been developed for miRNA expression profiling in order to better understand gene regulation in normal and pathological conditions. miRNAs expression values obtained from large scale methodologies such as microarrays still need a validation step with alternative technologies. Results Here we have applied with an innovative approach, the Luminex® xMAP™ technology validate expression data of differentially expressed miRNAs obtained from high throughput arrays. We have developed a novel labeling system of small RNA molecules (below 200 nt, optimizing the sensitive cloning method for miRNAs, termed miRNA amplification profiling (mRAP. The Luminex expression patterns of three miRNAs (miR-23a, miR-27a and miR-199a in seven different cell lines have been validated by TaqMan miRNA assay. In all cases, bead-based meas were confirmed by the data obtained by TaqMan and microarray technologies. Conclusions We demonstrate that the measure of individual miRNA by the bead-based method is feasible, high speed, sensitive and low cost. The Luminex® xMAP™ technology also provides flexibility, since the central reaction can be scaled up with additional miRNA capturing beads, allowing validation of many differentially expressed miRNAs obtained from microarrays in a single experiment. We propose this technology as an alternative method to qRT-PCR for validating miRNAs expression data obtained with high-throughput technologies.

  7. Base substitutions at scissile bond sites are sufficient to alter RNA-binding and cleavage activity of RNase III. (United States)

    Kim, Kyungsub; Sim, Se-Hoon; Jeon, Che Ok; Lee, Younghoon; Lee, Kangseok


    RNase III, a double-stranded RNA-specific endoribonuclease, degrades bdm mRNA via cleavage at specific sites. To better understand the mechanism of cleavage site selection by RNase III, we performed a genetic screen for sequences containing mutations at the bdm RNA cleavage sites that resulted in altered mRNA stability using a transcriptional bdm'-'cat fusion construct. While most of the isolated mutants showed the increased bdm'-'cat mRNA stability that resulted from the inability of RNase III to cleave the mutated sequences, one mutant sequence (wt-L) displayed in vivo RNA stability similar to that of the wild-type sequence. In vivo and in vitro analyses of the wt-L RNA substrate showed that it was cut only once on the RNA strand to the 5'-terminus by RNase III, while the binding constant of RNase III to this mutant substrate was moderately increased. A base substitution at the uncleaved RNase III cleavage site in wt-L mutant RNA found in another mutant lowered the RNA-binding affinity by 11-fold and abolished the hydrolysis of scissile bonds by RNase III. Our results show that base substitutions at sites forming the scissile bonds are sufficient to alter RNA cleavage as well as the binding activity of RNase III. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  8. Paper-Based MicroRNA Expression Profiling from Plasma and Circulating Tumor Cells. (United States)

    Leong, Sai Mun; Tan, Karen Mei-Ling; Chua, Hui Wen; Huang, Mo-Chao; Cheong, Wai Chye; Li, Mo-Huang; Tucker, Steven; Koay, Evelyn Siew-Chuan


    Molecular characterization of circulating tumor cells (CTCs) holds great promise for monitoring metastatic progression and characterizing metastatic disease. However, leukocyte and red blood cell contamination of routinely isolated CTCs makes CTC-specific molecular characterization extremely challenging. Here we report the use of a paper-based medium for efficient extraction of microRNAs (miRNAs) from limited amounts of biological samples such as rare CTCs harvested from cancer patient blood. Specifically, we devised a workflow involving the use of Flinders Technology Associates (FTA) ® Elute Card with a digital PCR-inspired "partitioning" method to extract and purify miRNAs from plasma and CTCs. We demonstrated the sensitivity of this method to detect miRNA expression from as few as 3 cancer cells spiked into human blood. Using this method, background miRNA expression was excluded from contaminating blood cells, and CTC-specific miRNA expression profiles were derived from breast and colorectal cancer patients. Plasma separated out during purification of CTCs could likewise be processed using the same paper-based method for miRNA detection, thereby maximizing the amount of patient-specific information that can be derived from a single blood draw. Overall, this paper-based extraction method enables an efficient, cost-effective workflow for maximized recovery of small RNAs from limited biological samples for downstream molecular analyses. © 2016 American Association for Clinical Chemistry.

  9. Optimization of polymeric triiodide membrane electrode based on clozapine-triiodide ion-pair using experimental design. (United States)

    Farhadi, Khalil; Bahram, Morteza; Shokatynia, Donya; Salehiyan, Floria


    Central composite design (CCD) and response surface methodology (RSM) were developed as experimental strategies for modeling and optimization of the influence of some variables on the performance of a new PVC membrane triiodide ion-selective electrode. This triiodide sensor is based on triiodide-clozapine ion-pair complexation. PVC, plasticizers, ion-pair amounts and pH were investigated as four variables to build a model to achieve the best Nernstian slope (59.9 mV) as response. The electrode is prepared by incorporating the ion-exchanger in PVC matrix plasticized with 2-nitrophenyl octal ether, which is directly coated on the surface of a graphite electrode. The influence of foreign ions on the electrode performance was also investigated. The optimized membranes demonstrate Nernstian response for triiodide ions over a wide linear range from 5.0 x 10(-6) to 1.0 x 10(-2)mol L(-1) with a limit of detection 2.0 x 10(-6) mol L(-1) at 25 degrees C. The electrodes could be used over a wide pH range 4-8, and have the advantages of easy to prepare, good selectivity and fast response time, long lifetime (over 3 months) and small interferences from hydrogen ion. The proposed electrode was successfully used as indicator electrode in potentiometric titration of triiodide ions and ascorbic acid.

  10. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems

    Directory of Open Access Journals (Sweden)

    Camila Ximenes


    Full Text Available The Global Program for the Elimination of Lymphatic Filariasis (GPELF aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2 and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2, which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

  11. Non-linguistic learning and aphasia: Evidence from a paired associate and feedback-based task (United States)

    Vallila-Rohter, Sofia; Kiran, Swathi


    Though aphasia is primarily characterized by impairments in the comprehension and/or expression of language, research has shown that patients with aphasia also show deficits in cognitive-linguistic domains such as attention, executive function, concept knowledge and memory (Helm-Estabrooks, 2002 for review). Research in aphasia suggests that cognitive impairments can impact the online construction of language, new verbal learning, and transactional success (Freedman & Martin, 2001; Hula & McNeil, 2008; Ramsberger, 2005). In our research, we extend this hypothesis to suggest that general cognitive deficits influence progress with therapy. The aim of our study is to explore learning, a cognitive process that is integral to relearning language, yet underexplored in the field of aphasia rehabilitation. We examine non-linguistic category learning in patients with aphasia (n=19) and in healthy controls (n=12), comparing feedback and non-feedback based instruction. Participants complete two computer-based learning tasks that require them to categorize novel animals based on the percentage of features shared with one of two prototypes. As hypothesized, healthy controls showed successful category learning following both methods of instruction. In contrast, only 60% of our patient population demonstrated successful non-linguistic category learning. Patient performance was not predictable by standardized measures of cognitive ability. Results suggest that general learning is affected in aphasia and is a unique, important factor to consider in the field of aphasia rehabilitation. PMID:23127795

  12. Facilitating RNA structure prediction with microarrays. (United States)

    Kierzek, Elzbieta; Kierzek, Ryszard; Turner, Douglas H; Catrina, Irina E


    Determining RNA secondary structure is important for understanding structure-function relationships and identifying potential drug targets. This paper reports the use of microarrays with heptamer 2'-O-methyl oligoribonucleotides to probe the secondary structure of an RNA and thereby improve the prediction of that secondary structure. When experimental constraints from hybridization results are added to a free-energy minimization algorithm, the prediction of the secondary structure of Escherichia coli 5S rRNA improves from 27 to 92% of the known canonical base pairs. Optimization of buffer conditions for hybridization and application of 2'-O-methyl-2-thiouridine to enhance binding and improve discrimination between AU and GU pairs are also described. The results suggest that probing RNA with oligonucleotide microarrays can facilitate determination of secondary structure.

  13. SPIDIA-RNA: second external quality assessment for the pre-analytical phase of blood samples used for RNA based analyses.

    Directory of Open Access Journals (Sweden)

    Francesca Malentacchi

    Full Text Available One purpose of the EC funded project, SPIDIA, is to develop evidence-based quality guidelines for the pre-analytical handling of blood samples for RNA molecular testing. To this end, two pan-European External Quality Assessments (EQAs were implemented. Here we report the results of the second SPIDIA-RNA EQA. This second study included modifications in the protocol related to the blood collection process, the shipping conditions and pre-analytical specimen handling for participants. Participating laboratories received two identical proficiency blood specimens collected in tubes with or without an RNA stabilizer. For pre-defined specimen storage times and temperatures, laboratories were asked to perform RNA extraction from whole blood according to their usual procedure and to return extracted RNA to the SPIDIA facility for further analysis. These RNA samples were evaluated for purity, yield, integrity, stability, presence of interfering substances, and gene expression levels for the validated markers of RNA stability: FOS, IL1B, IL8, GAPDH, FOSB and TNFRSF10c. Analysis of the gene expression results of FOS, IL8, FOSB, and TNFRSF10c, however, indicated that the levels of these transcripts were significantly affected by blood collection tube type and storage temperature. These results demonstrated that only blood collection tubes containing a cellular RNA stabilizer allowed reliable gene expression analysis within 48 h from blood collection for all the genes investigated. The results of these two EQAs have been proposed for use in the development of a Technical Specification by the European Committee for Standardization.

  14. Inverse folding of RNA pseudoknot structures

    Directory of Open Access Journals (Sweden)

    Li Linda YM


    Full Text Available Abstract Background RNA exhibits a variety of structural configurations. Here we consider a structure to be tantamount to the noncrossing Watson-Crick and G-U-base pairings (secondary structure and additional cross-serial base pairs. These interactions are called pseudoknots and are observed across the whole spectrum of RNA functionalities. In the context of studying natural RNA structures, searching for new ribozymes and designing artificial RNA, it is of interest to find RNA sequences folding into a specific structure and to analyze their induced neutral networks. Since the established inverse folding algorithms, RNAinverse, RNA-SSD as well as INFO-RNA are limited to RNA secondary structures, we present in this paper the inverse folding algorithm Inv which can deal with 3-noncrossing, canonical pseudoknot structures. Results In this paper we present the inverse folding algorithm Inv. We give a detailed analysis of Inv, including pseudocodes. We show that Inv allows to design in particular 3-noncrossing nonplanar RNA pseudoknot 3-noncrossing RNA structures-a class which is difficult to construct via dynamic programming routines. Inv is freely available at Conclusions The algorithm Inv extends inverse folding capabilities to RNA pseudoknot structures. In comparison with RNAinverse it uses new ideas, for instance by considering sets of competing structures. As a result, Inv is not only able to find novel sequences even for RNA secondary structures, it does so in the context of competing structures that potentially exhibit cross-serial interactions.

  15. A quantitative analysis of secondary RNA structure using domination based parameters on trees

    Directory of Open Access Journals (Sweden)

    Zou Yue


    Full Text Available Abstract Background It has become increasingly apparent that a comprehensive database of RNA motifs is essential in order to achieve new goals in genomic and proteomic research. Secondary RNA structures have frequently been represented by various modeling methods as graph-theoretic trees. Using graph theory as a modeling tool allows the vast resources of graphical invariants to be utilized to numerically identify secondary RNA motifs. The domination number of a graph is a graphical invariant that is sensitive to even a slight change in the structure of a tree. The invariants selected in this study are variations of the domination number of a graph. These graphical invariants are partitioned into two classes, and we define two parameters based on each of these classes. These parameters are calculated for all small order trees and a statistical analysis of the resulting data is conducted to determine if the values of these parameters can be utilized to identify which trees of orders seven and eight are RNA-like in structure. Results The statistical analysis shows that the domination based parameters correctly distinguish between the trees that represent native structures and those that are not likely candidates to represent RNA. Some of the trees previously identified as candidate structures are found to be "very" RNA like, while others are not, thereby refining the space of structures likely to be found as representing secondary RNA structure. Conclusion Search algorithms are available that mine nucleotide sequence databases. However, the number of motifs identified can be quite large, making a further search for similar motif computationally difficult. Much of the work in the bioinformatics arena is toward the development of better algorithms to address the computational problem. This work, on the other hand, uses mathematical descriptors to more clearly characterize the RNA motifs and thereby reduce the corresponding search space. These

  16. Matrix factorization-based data fusion for the prediction of lncRNA-disease associations. (United States)

    Fu, Guangyuan; Wang, Jun; Domeniconi, Carlotta; Yu, Guoxian


    Long non-coding RNAs (lncRNAs) play crucial roles in complex disease diagnosis, prognosis, prevention and treatment, but only a small portion of lncRNA-disease associations have been experimentally verified. Various computational models have been proposed to identify lncRNA-disease associations by integrating heterogeneous data sources. However, existing models generally ignore the intrinsic structure of data sources or treat them as equally relevant, while they may not be. To accurately identify lncRNA-disease associations, we propose a Matrix Factorization based LncRNA-Disease Association prediction model (MFLDA in short). MFLDA decomposes data matrices of heterogeneous data sources into low-rank matrices via matrix tri-factorization to explore and exploit their intrinsic and shared structure. MFLDA can select and integrate the data sources by assigning different weights to them. An iterative solution is further introduced to simultaneously optimize the weights and low-rank matrices. Next, MFLDA uses the optimized low-rank matrices to reconstruct the lncRNA-disease association matrix and thus to identify potential associations. In 5-fold cross validation experiments to identify verified lncRNA-disease associations, MFLDA achieves an area under the receiver operating characteristic curve (AUC) of 0.7408, at least 3% higher than those given by state-of-the-art data fusion based computational models. An empirical study on identifying masked lncRNA-disease associations again shows that MFLDA can identify potential associations more accurately than competing models. A case study on identifying lncRNAs associated with breast, lung and stomach cancers show that 38 out of 45 (84%) associations predicted by MFLDA are supported by recent biomedical literature and further proves the capability of MFLDA in identifying novel lncRNA-disease associations. MFLDA is a general data fusion framework, and as such it can be adopted to predict associations between other biological

  17. Nematic fluctuations, fermiology and the pairing potential in iron-based superconductors

    Energy Technology Data Exchange (ETDEWEB)

    Kretzschmar, Florian


    The thesis comprises a systematic study on the doping, temperature and momentum dependent electron dynamics in iron-based superconductors using inelastic light scattering. The observation of Bardasis-Schrieffer modes in the excitation spectrum of superconducting Ba{sub 0.6}K{sub 0.4}Fe{sub 2}As{sub 2} is reported and the energy and symmetry dependence of the modes are analyzed. The analysis yields the identification of a strong subdominant component of the interaction potential V(k,k{sup '}). Strong nematic fluctuations are investigated in Ba(Fe{sub 1-x}Co{sub x}){sub 2}As{sub 2}. The nature of the fluctuations and the origin of nematicity in Ba(Fe{sub 1-x}Co{sub x}){sub 2}As{sub 2} are identified.

  18. Cyanine-based probe\\tag-peptide pair fluorescence protein imaging and fluorescence protein imaging methods (United States)

    Mayer-Cumblidge, M. Uljana; Cao, Haishi


    A molecular probe comprises two arsenic atoms and at least one cyanine based moiety. A method of producing a molecular probe includes providing a molecule having a first formula, treating the molecule with HgOAc, and subsequently transmetallizing with AsCl.sub.3. The As is liganded to ethanedithiol to produce a probe having a second formula. A method of labeling a peptide includes providing a peptide comprising a tag sequence and contacting the peptide with a biarsenical molecular probe. A complex is formed comprising the tag sequence and the molecular probe. A method of studying a peptide includes providing a mixture containing a peptide comprising a peptide tag sequence, adding a biarsenical probe to the mixture, and monitoring the fluorescence of the mixture.

  19. The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure. (United States)

    Leontis, N B; Westhof, E


    A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings

  20. Study design requirements for RNA sequencing-based breast cancer diagnostics. (United States)

    Mer, Arvind Singh; Klevebring, Daniel; Grönberg, Henrik; Rantalainen, Mattias


    Sequencing-based molecular characterization of tumors provides information required for individualized cancer treatment. There are well-defined molecular subtypes of breast cancer that provide improved prognostication compared to routine biomarkers. However, molecular subtyping is not yet implemented in routine breast cancer care. Clinical translation is dependent on subtype prediction models providing high sensitivity and specificity. In this study we evaluate sample size and RNA-sequencing read requirements for breast cancer subtyping to facilitate rational design of translational studies. We applied subsampling to ascertain the effect of training sample size and the number of RNA sequencing reads on classification accuracy of molecular subtype and routine biomarker prediction models (unsupervised and supervised). Subtype classification accuracy improved with increasing sample size up to N = 750 (accuracy = 0.93), although with a modest improvement beyond N = 350 (accuracy = 0.92). Prediction of routine biomarkers achieved accuracy of 0.94 (ER) and 0.92 (Her2) at N = 200. Subtype classification improved with RNA-sequencing library size up to 5 million reads. Development of molecular subtyping models for cancer diagnostics requires well-designed studies. Sample size and the number of RNA sequencing reads directly influence accuracy of molecular subtyping. Results in this study provide key information for rational design of translational studies aiming to bring sequencing-based diagnostics to the clinic.

  1. BRAKER1: Unsupervised RNA-Seq-Based Genome Annotation with GeneMark-ET and AUGUSTUS. (United States)

    Hoff, Katharina J; Lange, Simone; Lomsadze, Alexandre; Borodovsky, Mark; Stanke, Mario


    Gene finding in eukaryotic genomes is notoriously difficult to automate. The task is to design a work flow with a minimal set of tools that would reach state-of-the-art performance across a wide range of species. GeneMark-ET is a gene prediction tool that incorporates RNA-Seq data into unsupervised training and subsequently generates ab initio gene predictions. AUGUSTUS is a gene finder that usually requires supervised training and uses information from RNA-Seq reads in the prediction step. Complementary strengths of GeneMark-ET and AUGUSTUS provided motivation for designing a new combined tool for automatic gene prediction. We present BRAKER1, a pipeline for unsupervised RNA-Seq-based genome annotation that combines the advantages of GeneMark-ET and AUGUSTUS. As input, BRAKER1 requires a genome assembly file and a file in bam-format with spliced alignments of RNA-Seq reads to the genome. First, GeneMark-ET performs iterative training and generates initial gene structures. Second, AUGUSTUS uses predicted genes for training and then integrates RNA-Seq read information into final gene predictions. In our experiments, we observed that BRAKER1 was more accurate than MAKER2 when it is using RNA-Seq as sole source for training and prediction. BRAKER1 does not require pre-trained parameters or a separate expert-prepared training step. BRAKER1 is available for download at and or Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail:

  2. Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.

    Directory of Open Access Journals (Sweden)

    Shu Wu

    Full Text Available Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9 within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%; and could aid in species-level analyses, but with some limitations; 2 nearly-whole-length sequences and some partial regions (around V2, V4, and V9 of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%; 3 compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%; and 4 V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.

  3. Spectroelectrochemical detection of microRNA-155 based on functional RNA immobilization onto ITO/GNP nanopattern. (United States)

    Mohammadniaei, Mohsen; Yoon, Jinho; Lee, Taek; Choi, Jeong-Woo


    We fabricated a microRNA biosensor using the combination of surface enhanced Raman spectroscopy (SERS) and electrochemical (EC) techniques. For the first time, the weaknesses of each techniques for microRNA detection was compensated by the other ones to give rise to the specific and wide-range detection of miR-155. A single stranded 3' methylene blue (MB) and 5' thiol-modified RNA (MB-ssRNA-SH) was designed to detect the target miR-155 and immobilized onto the gold nanoparticle-modified ITO (ITO/GNP). Upon the invasion of target strand, the double-stranded RNA transformed rapidly to an upright structure resulting in a notable decrease in SERS and redox signals of the MB. For the first time, by combination of SERS and EC techniques in a single platform we extended the dynamic range of both techniques from 10 pM to 450 nM (SERS: 10 pM-5 nM and EC: 5 nM-450 nM). As well, the SERS technique improved the detection limit of the EC method from 100 pM to 100 fM, while the EC method covered single-mismatch detection which was the SERS deficiency. The fabricated single-step biosensor possessing a good capability of miRNA detection in human serum, could be employed throughout the broad ranges of biomedical and bioelectronics applications. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. Atomistic details of the molecular recognition of DNA-RNA hybrid ...

    Indian Academy of Sciences (India)

    conformations corresponding to typical A- and B-type nucleic acids and the .... protein chains and five base pairs in DNA-RNA hybrid ... employed to treat the long range electrostatic interac- .... The solvent accessible surface areas (SASA) of.

  5. A Novel 3670-Base Pair Mitochondrial DNA Deletion Resulting in Multi-systemic Manifestations in a Child

    Directory of Open Access Journals (Sweden)

    Hsin-Ming Liu


    Full Text Available Mitochondrial DNA (mtDNA deletion is a rare occurrence that results in defects to oxidative phosphorylation. The common clinical presentations of mtDNA deletion vary but include mitochondrial myopathy, Pearson syndrome, Kearns-Sayre syndrome, and progressive external ophthalmoplegia. Here, we report the case of a 10-year-old boy who presented with progressive deterioration of his clinical status (which included hypoglycemia, short stature, sensorineural hearing loss, retinitis pigmentosa, and chronic gastrointestinal dysmotility that progressed to acute deterioration with pancreatitis, Fanconi syndrome, lactic acidosis, and acute encephalopathy. Following treatment, the patient was stabilized and his neurological condition improved. Through a combination of histological examinations and biochemical and molecular analyses, mitochondrial disease was confirmed. A novel 3670-base pair deletion (deletion of mtDNA nt 7,628-11,297 was identified in the muscle tissue. A direct repeat of CTACT at the breakpoints was also detected.

  6. Stereo Vision-Based High Dynamic Range Imaging Using Differently-Exposed Image Pair

    Directory of Open Access Journals (Sweden)

    Won-Jae Park


    Full Text Available In this paper, a high dynamic range (HDR imaging method based on the stereo vision system is presented. The proposed method uses differently exposed low dynamic range (LDR images captured from a stereo camera. The stereo LDR images are first converted to initial stereo HDR images using the inverse camera response function estimated from the LDR images. However, due to the limited dynamic range of the stereo LDR camera, the radiance values in under/over-exposed regions of the initial main-view (MV HDR image can be lost. To restore these radiance values, the proposed stereo matching and hole-filling algorithms are applied to the stereo HDR images. Specifically, the auxiliary-view (AV HDR image is warped by using the estimated disparity between initial the stereo HDR images and then effective hole-filling is applied to the warped AV HDR image. To reconstruct the final MV HDR, the warped and hole-filled AV HDR image is fused with the initial MV HDR image using the weight map. The experimental results demonstrate objectively and subjectively that the proposed stereo HDR imaging method provides better performance compared to the conventional method.

  7. Ionization and fragmentation of DNA-RNA bases: a density functional theory study

    International Nuclear Information System (INIS)

    Sadr-Arani, Leila


    Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)

  8. Investigations into nuclear pairing

    International Nuclear Information System (INIS)

    Clark, R.M.


    This paper is divided in two main sections focusing on different aspects of collective nuclear behavior. In the first section, solutions are considered for the collective pairing Hamiltonian. In particular, an approximate solution at the critical point of the pairing transition from harmonic vibration (normal nuclear behavior) to deformed rotation (superconducting behavior) in gauge space is found by analytic solution of the Hamiltonian. The eigenvalues are expressed in terms of the zeros of Bessel functions of integer order. The results are compared to the pairing bands based on the Pb isotopes. The second section focuses on the experimental search for the Giant Pairing Vibration (GPV) in nuclei. After briefly describing the origin of the GPV, and the reasons that the state has remained unidentified, a novel idea for populating this state is presented. A recent experiment has been performed using the LIBERACE+STARS detector system at the 88-Inch Cyclotron of LBNL to test the idea. (Author)

  9. Sets of RNA repeated tags and hybridization-sensitive fluorescent probes for distinct images of RNA in a living cell.

    Directory of Open Access Journals (Sweden)

    Takeshi Kubota

    Full Text Available BACKGROUND: Imaging the behavior of RNA in a living cell is a powerful means for understanding RNA functions and acquiring spatiotemporal information in a single cell. For more distinct RNA imaging in a living cell, a more effective chemical method to fluorescently label RNA is now required. In addition, development of the technology labeling with different colors for different RNA would make it easier to analyze plural RNA strands expressing in a cell. METHODOLOGY/PRINCIPAL FINDINGS: Tag technology for RNA imaging in a living cell has been developed based on the unique chemical functions of exciton-controlled hybridization-sensitive oligonucleotide (ECHO probes. Repetitions of selected 18-nucleotide RNA tags were incorporated into the mRNA 3'-UTR. Pairs with complementary ECHO probes exhibited hybridization-sensitive fluorescence emission for the mRNA expressed in a living cell. The mRNA in a nucleus was detected clearly as fluorescent puncta, and the images of the expression of two mRNAs were obtained independently and simultaneously with two orthogonal tag-probe pairs. CONCLUSIONS/SIGNIFICANCE: A compact and repeated label has been developed for RNA imaging in a living cell, based on the photochemistry of ECHO probes. The pairs of an 18-nt RNA tag and the complementary ECHO probes are highly thermostable, sequence-specifically emissive, and orthogonal to each other. The nucleotide length necessary for one tag sequence is much shorter compared with conventional tag technologies, resulting in easy preparation of the tag sequences with a larger number of repeats for more distinct RNA imaging.

  10. Methylated nucleosides in tRNA and tRNA methyltransferases

    Directory of Open Access Journals (Sweden)

    Hiroyuki eHori


    Full Text Available To date, more than 90 modified nucleosides have been found in tRNA and the biosynthetic pathways of the majority of tRNA modifications include a methylation step(s. Recent studies of the biosynthetic pathways have demonstrated that the availability of methyl group donors for the methylation in tRNA is important for correct and efficient protein synthesis. In this review, I focus on the methylated nucleosides and tRNA methyltransferases. The primary functions of tRNA methylations are linked to the different steps of protein synthesis, such as the stabilization of tRNA structure, reinforcement of the codon–anticodon interaction, regulation of wobble base pairing, and prevention of frameshift errors. However, beyond these basic functions, recent studies have demonstrated that tRNA methylations are also involved in the RNA quality control system and regulation of tRNA localization in the cell. In a thermophilic eubacterium, tRNA modifications and the modification enzymes form a network that responses to temperature changes. Furthermore, several modifications are involved in genetic diseases, infections, and the immune response. Moreover, structural, biochemical, and bioinformatics studies of tRNA methyltransferases have been clarifying the details of tRNA methyltransferases and have enabled these enzymes to be classified. In the final section, the evolution of modification enzymes is discussed.

  11. [Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence (United States)

    Ortega, Maya


    My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

  12. Orotidine-Containing RNA: Implications for the Hierarchical Selection (Systems Chemistry Emergence) of RNA. (United States)

    Kim, Eun-Kyong; Martin, Vincent; Krishnamurthy, Ramanarayanan


    The prebiotic synthesis of canonical nucleobases from HCN is a cornerstone for the RNA world hypothesis. However, their role in the primordial pathways to RNA is still debated. The very same process starting from HCN also gives rise to orotic acid, which (via orotidine) plays a crucial role in extant biology in the de novo synthesis of uridine and cytidine, the informational base-pairs in RNA. However, orotidine itself is absent in RNA. Given the prebiotic and biological relevance of orotic acid vis-à-vis uracil, we investigated orotidine-containing RNA oligonucleotides and show that they have severely compromised base-pairing properties. While not unexpected, these results suggest that the emergence of extant RNA cannot just be a consequence of the plausible prebiotic formation of its chemical constituents/building blocks. In combination with other investigations on alternative prebiotic nucleobases, sugars, and linkers, these findings imply that the selection of the components of extant RNA occurred at a higher hierarchical level of an oligomer/polymer based on its functional properties-pointing to a systems chemistry emergence of RNA from a library of precursors. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Fine-grained parallelism accelerating for RNA secondary structure prediction with pseudoknots based on FPGA. (United States)

    Xia, Fei; Jin, Guoqing


    PKNOTS is a most famous benchmark program and has been widely used to predict RNA secondary structure including pseudoknots. It adopts the standard four-dimensional (4D) dynamic programming (DP) method and is the basis of many variants and improved algorithms. Unfortunately, the O(N(6)) computing requirements and complicated data dependency greatly limits the usefulness of PKNOTS package with the explosion in gene database size. In this paper, we present a fine-grained parallel PKNOTS package and prototype system for accelerating RNA folding application based on FPGA chip. We adopted a series of storage optimization strategies to resolve the "Memory Wall" problem. We aggressively exploit parallel computing strategies to improve computational efficiency. We also propose several methods that collectively reduce the storage requirements for FPGA on-chip memory. To the best of our knowledge, our design is the first FPGA implementation for accelerating 4D DP problem for RNA folding application including pseudoknots. The experimental results show a factor of more than 50x average speedup over the PKNOTS-1.08 software running on a PC platform with Intel Core2 Q9400 Quad CPU for input RNA sequences. However, the power consumption of our FPGA accelerator is only about 50% of the general-purpose micro-processors.

  14. Rank-Based miRNA Signatures for Early Cancer Detection

    Directory of Open Access Journals (Sweden)

    Mario Lauria


    Full Text Available We describe a new signature definition and analysis method to be used as biomarker for early cancer detection. Our new approach is based on the construction of a reference map of transcriptional signatures of both healthy and cancer affected individuals using circulating miRNA from a large number of subjects. Once such a map is available, the diagnosis for a new patient can be performed by observing the relative position on the map of his/her transcriptional signature. To demonstrate its efficacy for this specific application we report the results of the application of our method to published datasets of circulating miRNA, and we quantify its performance compared to current state-of-the-art methods. A number of additional features make this method an ideal candidate for large-scale use, for example, as a mass screening tool for early cancer detection or for at-home diagnostics. Specifically, our method is minimally invasive (because it works well with circulating miRNA, it is robust with respect to lab-to-lab protocol variability and batch effects (it requires that only the relative ranking of expression value of miRNA in a profile be accurate not their absolute values, and it is scalable to a large number of subjects. Finally we discuss the need for HPC capability in a widespread application of our or similar methods.

  15. A DNA sequence obtained by replacement of the dopamine RNA aptamer bases is not an aptamer. (United States)

    Álvarez-Martos, Isabel; Ferapontova, Elena E


    A unique specificity of the aptamer-ligand biorecognition and binding facilitates bioanalysis and biosensor development, contributing to discrimination of structurally related molecules, such as dopamine and other catecholamine neurotransmitters. The aptamer sequence capable of specific binding of dopamine is a 57 nucleotides long RNA sequence reported in 1997 (Biochemistry, 1997, 36, 9726). Later, it was suggested that the DNA homologue of the RNA aptamer retains the specificity of dopamine binding (Biochem. Biophys. Res. Commun., 2009, 388, 732). Here, we show that the DNA sequence obtained by the replacement of the RNA aptamer bases for their DNA analogues is not able of specific biorecognition of dopamine, in contrast to the original RNA aptamer sequence. This DNA sequence binds dopamine and structurally related catecholamine neurotransmitters non-specifically, as any DNA sequence, and, thus, is not an aptamer and cannot be used neither for in vivo nor in situ analysis of dopamine in the presence of structurally related neurotransmitters. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. A configuration space of homologous proteins conserving mutual information and allowing a phylogeny inference based on pair-wise Z-score probabilities


    Maréchal Eric; Ortet Philippe; Roy Sylvaine; Bastien Olivier


    Abstract Background Popular methods to reconstruct molecular phylogenies are based on multiple sequence alignments, in which addition or removal of data may change the resulting tree topology. We have sought a representation of homologous proteins that would conserve the information of pair-wise sequence alignments, respect probabilistic properties of Z-scores (Monte Carlo methods applied to pair-wise comparisons) and be the basis for a novel method of consistent and stable phylogenetic recon...

  17. Evolutionary rate variation and RNA secondary structure prediction

    DEFF Research Database (Denmark)

    Knudsen, B.; Andersen, E.S.; Damgaard, C.


    Predicting RNA secondary structure using evolutionary history can be carried out by using an alignment of related RNA sequences with conserved structure. Accurately determining evolutionary substitution rates for base pairs and single stranded nucleotides is a concern for methods based on this type...... by applying rates derived from tRNA and rRNA to the prediction of the much more rapidly evolving 5'-region of HIV-1. We find that the HIV-1 prediction is in agreement with experimental data, even though the relative evolutionary rate between A and G is significantly increased, both in stem and loop regions...

  18. Bioinformatical approaches to RNA structure prediction & Sequencing of an ancient human genome

    DEFF Research Database (Denmark)

    Lindgreen, Stinus

    Stinus Lindgreen has been working in two different fields during his Ph.D. The first part has been focused on computational approaches to predict the structure of non-coding RNA molecules at the base pairing level. This has resulted in the analysis of various measures of the base pairing potentia...

  19. Structural and energetic characterization of the emissive RNA alphabet based on the isothiazolo[4,3-d]pyrimidine heterocycle core

    KAUST Repository

    Chawla, Mohit; Poater, Albert; Oliva, Romina; Cavallo, Luigi


    We present theoretical characterization of fluorescent non-natural nucleobases, tzA, tzG, tzC, and tzU, derived from the isothiazolo[4,3-d]pyrimidine heterocycle. Consistent with the experimental evidence, our calculations show that the non-natural bases have minimal impact on the geometry and stability of the classical Watson-Crick base pairs, allowing them to accurately mimic natural bases in a RNA duplex, in terms of H-bonding. In contrast, our calculations indicate that H-bonded base pairs involving the Hoogsteen edge are destabilized relative to their natural counterparts. Analysis of the photophysical properties of the non-natural bases allowed us to correlate their absorption/emission peaks to the strong impact of the modification on the energy of the lowest unoccupied molecular orbital, LUMO, which is stabilized by roughly 1.0-1.2 eV relative to the natural analogues, while the highest occupied molecular orbital, HOMO, is not substantially affected. As a result, the HOMO-LUMO gap is reduced from 5.3-5.5 eV in the natural bases to 4.0-4.4 eV in the modified ones, with a consequent bathochromic shift in the absorption and emission spectra. © 2016 the Owner Societies.

  20. Structural and energetic characterization of the emissive RNA alphabet based on the isothiazolo[4,3-d]pyrimidine heterocycle core

    KAUST Repository

    Chawla, Mohit


    We present theoretical characterization of fluorescent non-natural nucleobases, tzA, tzG, tzC, and tzU, derived from the isothiazolo[4,3-d]pyrimidine heterocycle. Consistent with the experimental evidence, our calculations show that the non-natural bases have minimal impact on the geometry and stability of the classical Watson-Crick base pairs, allowing them to accurately mimic natural bases in a RNA duplex, in terms of H-bonding. In contrast, our calculations indicate that H-bonded base pairs involving the Hoogsteen edge are destabilized relative to their natural counterparts. Analysis of the photophysical properties of the non-natural bases allowed us to correlate their absorption/emission peaks to the strong impact of the modification on the energy of the lowest unoccupied molecular orbital, LUMO, which is stabilized by roughly 1.0-1.2 eV relative to the natural analogues, while the highest occupied molecular orbital, HOMO, is not substantially affected. As a result, the HOMO-LUMO gap is reduced from 5.3-5.5 eV in the natural bases to 4.0-4.4 eV in the modified ones, with a consequent bathochromic shift in the absorption and emission spectra. © 2016 the Owner Societies.

  1. The use of carrier RNA to enhance DNA extraction from microfluidic-based silica monoliths. (United States)

    Shaw, Kirsty J; Thain, Lauren; Docker, Peter T; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J


    DNA extraction was carried out on silica-based monoliths within a microfluidic device. Solid-phase DNA extraction methodology was applied in which the DNA binds to silica in the presence of a chaotropic salt, such as guanidine hydrochloride, and is eluted in a low ionic strength solution, such as water. The addition of poly-A carrier RNA to the chaotropic salt solution resulted in a marked increase in the effective amount of DNA that could be recovered (25ng) compared to the absence of RNA (5ng) using the silica-based monolith. These findings confirm that techniques utilising nucleic acid carrier molecules can enhance DNA extraction methodologies in microfluidic applications.

  2. Associations between HIV-RNA-based indicators and virological and clinical outcomes

    DEFF Research Database (Denmark)

    Laut, Kamilla G; Shepherd, Leah C; Pedersen, Court


    OBJECTIVES: To evaluate and compare the performance of six HIV-RNA-based quality of care indicators for predicting short-term and long-term outcomes. DESIGN: Multinational cohort study. METHODS: We included EuroSIDA patients on antiretroviral therapy (ART) with at least three viral load measureme......OBJECTIVES: To evaluate and compare the performance of six HIV-RNA-based quality of care indicators for predicting short-term and long-term outcomes. DESIGN: Multinational cohort study. METHODS: We included EuroSIDA patients on antiretroviral therapy (ART) with at least three viral load...... measurements after baseline (the latest of 01/01/2001 or entry into EuroSIDA). Using multivariate Poisson regression, we modelled the association between short-term (resistance, triple-class failure) and long-term (all-cause mortality, any AIDS/non-AIDS clinical event) outcomes and the indicators: viraemia...

  3. Multi-objective optimization of Stirling engine systems using Front-based Yin-Yang-Pair Optimization

    International Nuclear Information System (INIS)

    Punnathanam, Varun; Kotecha, Prakash


    Highlights: • Efficient multi-objective optimization algorithm F-YYPO demonstrated. • Three Stirling engine applications with a total of eight cases. • Improvements in the objective function values of up to 30%. • Superior to the popularly used gamultiobj of MATLAB. • F-YYPO has extremely low time complexity. - Abstract: In this work, we demonstrate the performance of Front-based Yin-Yang-Pair Optimization (F-YYPO) to solve multi-objective problems related to Stirling engine systems. The performance of F-YYPO is compared with that of (i) a recently proposed multi-objective optimization algorithm (Multi-Objective Grey Wolf Optimizer) and (ii) an algorithm popularly employed in literature due to its easy accessibility (MATLAB’s inbuilt multi-objective Genetic Algorithm function: gamultiobj). We consider three Stirling engine based optimization problems: (i) the solar-dish Stirling engine system which considers objectives of output power, thermal efficiency and rate of entropy generation; (ii) Stirling engine thermal model which considers the associated irreversibility of the cycle with objectives of output power, thermal efficiency and pressure drop; and finally (iii) an experimentally validated polytropic finite speed thermodynamics based Stirling engine model also with objectives of output power and pressure drop. We observe F-YYPO to be significantly more effective as compared to its competitors in solving the problems, while requiring only a fraction of the computational time required by the other algorithms.

  4. Dissection of functional lncRNAs in Alzheimer's disease by construction and analysis of lncRNA-mRNA networks based on competitive endogenous RNAs. (United States)

    Wang, Lian-Kun; Chen, Xiao-Feng; He, Dan-Dan; Li, You; Fu, Jin


    Alzheimer's disease (AD) is a neurodegenerative disorder that is the most common cause of dementia in the elderly, and intracellular neurofibrillary tangles (NFTs) are one of the pathological features of AD. Recent studies have suggested long noncoding RNAs (lncRNAs) play important roles in AD. Competing endogenous RNAs (ceRNAs) is a mechanism that has recently been proposed, in which lncRNAs compete for common miRNA-binding sites with mRNAs. However, the roles of lncRNAs and ceRNA in AD NFTs is limited. In this study, we constructed a global triple network based on ceRNA theory, then an AD NFT lncRNA-mRNA network (NFTLMN) was generated. By analyzing the NFTLMN, three lncRNAs (AP000265.1, KB-1460A1.5 and RP11-145M9.4), which are highly related with AD NFTs were identified. To further explore the cross-talk between mRNAs and lncRNAs, a clustering module analysis was performed on the NFTLMN and two AD NFT related modules were identified. Our study provides a better understanding of the molecular basis of AD NFTs and may offer novel treatment strategies for AD. Copyright © 2016. Published by Elsevier Inc.

  5. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing? (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse


    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  6. Evolutionary patterns of RNA-based duplication in non-mammalian chordates.

    Directory of Open Access Journals (Sweden)

    Ming Chen

    Full Text Available The role of RNA-based duplication, or retroposition, in the evolution of new gene functions in mammals, plants, and Drosophila has been widely reported. However, little is known about RNA-based duplication in non-mammalian chordates. In this study, we screened ten non-mammalian chordate genomes for retrocopies and investigated their evolutionary patterns. We identified numerous retrocopies in these species. Examination of the age distribution of these retrocopies revealed no burst of young retrocopies in ancient chordate species. Upon comparing these non-mammalian chordate species to the mammalian species, we observed that a larger fraction of the non-mammalian retrocopies was under strong evolutionary constraints than mammalian retrocopies are, as evidenced by signals of purifying selection and expression profiles. For the Western clawed frog, Medaka, and Sea squirt, many retrogenes have evolved gonad and brain expression patterns, similar to what was observed in human. Testing of retrogene movement in the Medaka genome, where the nascent sex chrosomes have been well assembled, did not reveal any significant gene movement. Taken together, our analyses demonstrate that RNA-based duplication generates many functional genes and can make a significant contribution to the evolution of non-mammalian genomes.

  7. GIMDA: Graphlet interaction-based MiRNA-disease association prediction. (United States)

    Chen, Xing; Guan, Na-Na; Li, Jian-Qiang; Yan, Gui-Ying


    MicroRNAs (miRNAs) have been confirmed to be closely related to various human complex diseases by many experimental studies. It is necessary and valuable to develop powerful and effective computational models to predict potential associations between miRNAs and diseases. In this work, we presented a prediction model of Graphlet Interaction for MiRNA-Disease Association prediction (GIMDA) by integrating the disease semantic similarity, miRNA functional similarity, Gaussian interaction profile kernel similarity and the experimentally confirmed miRNA-disease associations. The related score of a miRNA to a disease was calculated by measuring the graphlet interactions between two miRNAs or two diseases. The novelty of GIMDA lies in that we used graphlet interaction to analyse the complex relationships between two nodes in a graph. The AUCs of GIMDA in global and local leave-one-out cross-validation (LOOCV) turned out to be 0.9006 and 0.8455, respectively. The average result of five-fold cross-validation reached to 0.8927 ± 0.0012. In case study for colon neoplasms, kidney neoplasms and prostate neoplasms based on the database of HMDD V2.0, 45, 45, 41 of the top 50 potential miRNAs predicted by GIMDA were validated by dbDEMC and miR2Disease. Additionally, in the case study of new diseases without any known associated miRNAs and the case study of predicting potential miRNA-disease associations using HMDD V1.0, there were also high percentages of top 50 miRNAs verified by the experimental literatures. © 2017 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  8. mRNA-based vaccines synergize with radiation therapy to eradicate established tumors

    International Nuclear Information System (INIS)

    Fotin-Mleczek, Mariola; Zanzinger, Kai; Heidenreich, Regina; Lorenz, Christina; Kowalczyk, Aleksandra; Kallen, Karl-Josef; Huber, Stephan M


    The eradication of large, established tumors by active immunotherapy is a major challenge because of the numerous cancer evasion mechanisms that exist. This study aimed to establish a novel combination therapy consisting of messenger RNA (mRNA)-based cancer vaccines and radiation, which would facilitate the effective treatment of established tumors with aggressive growth kinetics. The combination of a tumor-specific mRNA-based vaccination with radiation was tested in two syngeneic tumor models, a highly immunogenic E.G7-OVA and a low immunogenic Lewis lung cancer (LLC). The molecular mechanism induced by the combination therapy was evaluated via gene expression arrays as well as flow cytometry analyses of tumor infiltrating cells. In both tumor models we demonstrated that a combination of mRNA-based immunotherapy with radiation results in a strong synergistic anti-tumor effect. This was manifested as either complete tumor eradication or delay in tumor growth. Gene expression analysis of mouse tumors revealed a variety of substantial changes at the tumor site following radiation. Genes associated with antigen presentation, infiltration of immune cells, adhesion, and activation of the innate immune system were upregulated. A combination of radiation and immunotherapy induced significant downregulation of tumor associated factors and upregulation of tumor suppressors. Moreover, combination therapy significantly increased CD4 + , CD8 + and NKT cell infiltration of mouse tumors. Our data provide a scientific rationale for combining immunotherapy with radiation and provide a basis for the development of more potent anti-cancer therapies. The online version of this article (doi:10.1186/1748-717X-9-180) contains supplementary material, which is available to authorized users

  9. Combinatorics of RNA-RNA interaction

    DEFF Research Database (Denmark)

    Li, Thomas J X; Reidys, Christian


    RNA-RNA binding is an important phenomenon observed for many classes of non-coding RNAs and plays a crucial role in a number of regulatory processes. Recently several MFE folding algorithms for predicting the joint structure of two interacting RNA molecules have been proposed. Here joint structure...... means that in a diagram representation the intramolecular bonds of each partner are pseudoknot-free, that the intermolecular binding pairs are noncrossing, and that there is no so-called "zigzag" configuration. This paper presents the combinatorics of RNA interaction structures including...

  10. Cigarette smoke exposure-associated alterations to noncoding RNA

    Directory of Open Access Journals (Sweden)

    Matthew Alan Maccani


    Full Text Available Environmental exposures vary by timing, severity, and frequency and may have a number of deleterious effects throughout the life course. The period of in utero development, for example, is one of the most crucial stages of development during which adverse environmental exposures can both alter the growth and development of the fetus as well as lead to aberrant fetal programming, increasing disease risk. During fetal development and beyond, the plethora of exposures, including nutrients, drugs, stress, and trauma, influence health, development, and survival. Recent research in environmental epigenetics has investigated the roles of environmental exposures in influencing epigenetic modes of gene regulation during pregnancy and at various stages of life. Many relatively common environmental exposures, such as cigarette smoking, alcohol consumption, and drug use, may have consequences for the expression and function of noncoding RNA (ncRNA, important post-transcriptional regulators of gene expression. A number of ncRNA have been discovered, including microRNA (miRNA, Piwi-interacting RNA (piRNA, and long noncoding RNA (long ncRNA. The best-characterized species of ncRNA are miRNA, the mature forms of which are ~22 nucleotides in length and capable of post-transcriptionally regulating target mRNA utilizing mechanisms based largely on the degree of complementarity between miRNA and target mRNA. Because miRNA can still negatively regulate gene expression when imperfectly base-paired with a target mRNA, a single miRNA can have a large number of potential mRNA targets and can regulate many different biological processes critical for health and development. The following review analyzes the current literature detailing links between cigarette smoke exposure and aberrant expression and function of noncoding RNA, assesses how such alterations may have consequences throughout the life course, and proposes future directions for this intriguing field of

  11. 2-Methoxypyridine as a Thymidine Mimic in Watson-Crick Base Pairs of DNA and PNA: Synthesis, Thermal Stability, and NMR Structural Studies. (United States)

    Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks


    The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. A process-based approach to characterizing the effect of acute alprazolam challenge on visual paired associate learning and memory in healthy older adults. (United States)

    Pietrzak, Robert H; Scott, James Cobb; Harel, Brian T; Lim, Yen Ying; Snyder, Peter J; Maruff, Paul


    Alprazolam is a benzodiazepine that, when administered acutely, results in impairments in several aspects of cognition, including attention, learning, and memory. However, the profile (i.e., component processes) that underlie alprazolam-related decrements in visual paired associate learning has not been fully explored. In this double-blind, placebo-controlled, randomized cross-over study of healthy older adults, we used a novel, "process-based" computerized measure of visual paired associate learning to examine the effect of a single, acute 1-mg dose of alprazolam on component processes of visual paired associate learning and memory. Acute alprazolam challenge was associated with a large magnitude reduction in visual paired associate learning and memory performance (d = 1.05). Process-based analyses revealed significant increases in distractor, exploratory, between-search, and within-search error types. Analyses of percentages of each error type suggested that, relative to placebo, alprazolam challenge resulted in a decrease in the percentage of exploratory errors and an increase in the percentage of distractor errors, both of which reflect memory processes. Results of this study suggest that acute alprazolam challenge decreases visual paired associate learning and memory performance by reducing the strength of the association between pattern and location, which may reflect a general breakdown in memory consolidation, with less evidence of reductions in executive processes (e.g., working memory) that facilitate visual paired associate learning and memory. Copyright © 2012 John Wiley & Sons, Ltd.

  13. Fluorescence-based codetection with protein markers reveals distinct cellular compartments for altered MicroRNA expression in solid tumors

    DEFF Research Database (Denmark)

    Sempere, Lorenzo F; Preis, Meir; Yezefski, Todd


    of altered miRNA expression in solid tumors, we developed a sensitive fluorescence-based in situ hybridization (ISH) method to visualize miRNA accumulation within individual cells in formalin-fixed, paraffin-embedded tissue specimens. This ISH method was implemented to be compatible with routine clinical...

  14. Movement of regulatory RNA between animal cells. (United States)

    Jose, Antony M


    Recent studies suggest that RNA can move from one cell to another and regulate genes through specific base-pairing. Mechanisms that modify or select RNA for secretion from a cell are unclear. Secreted RNA can be stable enough to be detected in the extracellular environment and can enter the cytosol of distant cells to regulate genes. Mechanisms that import RNA into the cytosol of an animal cell can enable uptake of RNA from many sources including other organisms. This role of RNA is akin to that of steroid hormones, which cross cell membranes to regulate genes. The potential diagnostic use of RNA in human extracellular fluids has ignited interest in understanding mechanisms that enable the movement of RNA between animal cells. Genetic model systems will be essential to gain more confidence in proposed mechanisms of RNA transport and to connect an extracellular RNA with a specific biological function. Studies in the worm C. elegans and in other animals have begun to reveal parts of this novel mechanism of cell-to-cell communication. Here, I summarize the current state of this nascent field, highlight the many unknowns, and suggest future directions. © 2015 Wiley Periodicals, Inc.

  15. Novel transmission pricing scheme based on point-to-point tariff and transaction pair matching for pool market

    International Nuclear Information System (INIS)

    Chen, Qixin; Xia, Qing; Kang, Chongqing


    Transmission pricing scheme is a key component in the infrastructure of power market, and pool is an indispensable pattern of market organization; meanwhile, pay-as-bid (PAB) serves as a main option to determine market prices in pool. In this paper, a novel transmission pricing scheme is proposed for pool power market based on PAB. The new scheme is developed by utilizing point-to-point (PTP) tariff and introducing an approach of transaction pair matching (TPM). The model and procedure of the new scheme are presented in detail. Apart from the advantages of existing transmission pricing schemes, such as ensuing open, fair and non-discriminatory access, proper recovery for investment as well as transparency, the new scheme provides economic signals to promote the maximum use of the existing transmission network, encourages appropriate bidding behaviors in pool, and helps to reduce the possibility of the enforcement of market power and the appearing of price spikes; thus improves market operation efficiency and trading effects. In order to testify the effectiveness of the proposed scheme, a case based on IEEE 30-bus system is studied. (author)

  16. Computational Identification of Protein Pupylation Sites by Using Profile-Based Composition of k-Spaced Amino Acid Pairs.

    Directory of Open Access Journals (Sweden)

    Md Mehedi Hasan

    Full Text Available Prokaryotic proteins are regulated by pupylation, a type of post-translational modification that contributes to cellular function in bacterial organisms. In pupylation process, the prokaryotic ubiquitin-like protein (Pup tagging is functionally analogous to ubiquitination in order to tag target proteins for proteasomal degradation. To date, several experimental methods have been developed to identify pupylated proteins and their pupylation sites, but these experimental methods are generally laborious and costly. Therefore, computational methods that can accurately predict potential pupylation sites based on protein sequence information are highly desirable. In this paper, a novel predictor termed as pbPUP has been developed for accurate prediction of pupylation sites. In particular, a sophisticated sequence encoding scheme [i.e. the profile-based composition of k-spaced amino acid pairs (pbCKSAAP] is used to represent the sequence patterns and evolutionary information of the sequence fragments surrounding pupylation sites. Then, a Support Vector Machine (SVM classifier is trained using the pbCKSAAP encoding scheme. The final pbPUP predictor achieves an AUC value of 0.849 in 10-fold cross-validation tests and outperforms other existing predictors on a comprehensive independent test dataset. The proposed method is anticipated to be a helpful computational resource for the prediction of pupylation sites. The web server and curated datasets in this study are freely available at

  17. Novel transmission pricing scheme based on point-to-point tariff and transaction pair matching for pool market

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Qixin; Xia, Qing; Kang, Chongqing [State Key Lab. of Power System, Dept. of Electrical Engineering, Tsinghua University, Beijing 100084 (China)


    Transmission pricing scheme is a key component in the infrastructure of power market, and pool is an indispensable pattern of market organization; meanwhile, pay-as-bid (PAB) serves as a main option to determine market prices in pool. In this paper, a novel transmission pricing scheme is proposed for pool power market based on PAB. The new scheme is developed by utilizing point-to-point (PTP) tariff and introducing an approach of transaction pair matching (TPM). The model and procedure of the new scheme are presented in detail. Apart from the advantages of existing transmission pricing schemes, such as ensuing open, fair and non-discriminatory access, proper recovery for investment as well as transparency, the new scheme provides economic signals to promote the maximum use of the existing transmission network, encourages appropriate bidding behaviors in pool, and helps to reduce the possibility of the enforcement of market power and the appearing of price spikes; thus improves market operation efficiency and trading effects. In order to testify the effectiveness of the proposed scheme, a case based on IEEE 30-bus system is studied. (author)

  18. Whole Blood mRNA Expression-Based Prognosis of Metastatic Renal Cell Carcinoma. (United States)

    Giridhar, Karthik V; Sosa, Carlos P; Hillman, David W; Sanhueza, Cristobal; Dalpiaz, Candace L; Costello, Brian A; Quevedo, Fernando J; Pitot, Henry C; Dronca, Roxana S; Ertz, Donna; Cheville, John C; Donkena, Krishna Vanaja; Kohli, Manish


    The Memorial Sloan Kettering Cancer Center (MSKCC) prognostic score is based on clinical parameters. We analyzed whole blood mRNA expression in metastatic clear cell renal cell carcinoma (mCCRCC) patients and compared it to the MSKCC score for predicting overall survival. In a discovery set of 19 patients with mRCC, we performed whole transcriptome RNA sequencing and selected eighteen candidate genes for further evaluation based on associations with overall survival and statistical significance. In an independent validation of set of 47 patients with mCCRCC, transcript expression of the 18 candidate genes were quantified using a customized NanoString probeset. Cox regression multivariate analysis confirmed that two of the candidate genes were significantly associated with overall survival. Higher expression of BAG1 [hazard ratio (HR) of 0.14, p < 0.0001, 95% confidence interval (CI) 0.04-0.36] and NOP56 (HR 0.13, p < 0.0001, 95% CI 0.05-0.34) were associated with better prognosis. A prognostic model incorporating expression of BAG1 and NOP56 into the MSKCC score improved prognostication significantly over a model using the MSKCC prognostic score only ( p < 0.0001). Prognostic value of using whole blood mRNA gene profiling in mCCRCC is feasible and should be prospectively confirmed in larger studies.

  19. Whole Blood mRNA Expression-Based Prognosis of Metastatic Renal Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Karthik V. Giridhar


    Full Text Available The Memorial Sloan Kettering Cancer Center (MSKCC prognostic score is based on clinical parameters. We analyzed whole blood mRNA expression in metastatic clear cell renal cell carcinoma (mCCRCC patients and compared it to the MSKCC score for predicting overall survival. In a discovery set of 19 patients with mRCC, we performed whole transcriptome RNA sequencing and selected eighteen candidate genes for further evaluation based on associations with overall survival and statistical significance. In an independent validation of set of 47 patients with mCCRCC, transcript expression of the 18 candidate genes were quantified using a customized NanoString probeset. Cox regression multivariate analysis confirmed that two of the candidate genes were significantly associated with overall survival. Higher expression of BAG1 [hazard ratio (HR of 0.14, p < 0.0001, 95% confidence interval (CI 0.04–0.36] and NOP56 (HR 0.13, p < 0.0001, 95% CI 0.05–0.34 were associated with better prognosis. A prognostic model incorporating expression of BAG1 and NOP56 into the MSKCC score improved prognostication significantly over a model using the MSKCC prognostic score only (p < 0.0001. Prognostic value of using whole blood mRNA gene profiling in mCCRCC is feasible and should be prospectively confirmed in larger studies.

  20. MicroRNA-based Therapy in Animal Models of Selected Gastrointestinal Cancers

    Directory of Open Access Journals (Sweden)

    Jana Merhautova


    Full Text Available Gastrointestinal cancer accounts for the 20 most frequent cancer diseases worldwide and there is a constant urge to bring new therapeutics with new mechanism of action into the clinical practice. Quantity of in vitro and in vivo evidences indicate, that exogenous change in pathologically imbalanced microRNAs (miRNAs is capable of transforming the cancer cell phenotype. This review analyzed preclinical miRNA-based therapy attempts in animal models of gastric, pancreatic, gallbladder, and colorectal cancer. From more than 400 original articles, 26 was found to assess the effect of miRNA mimics, precursors, expression vectors, or inhibitors administered locally or systemically being an approach with relatively high translational potential. We have focused on mapping available information on animal model used (animal strain, cell line, xenograft method, pharmacological aspects (oligonucleotide chemistry, delivery system, posology, route of administration and toxicology assessments. We also summarize findings in the field pharmacokinetics and toxicity of miRNA-based therapy.□

  1. Double-stranded RNA transcribed from vector-based oligodeoxynucleotide acts as transcription factor decoy

    International Nuclear Information System (INIS)

    Xiao, Xiao; Gang, Yi; Wang, Honghong; Wang, Jiayin; Zhao, Lina; Xu, Li; Liu, Zhiguo


    Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself. The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity

  2. Predicting microRNA-disease associations using label propagation based on linear neighborhood similarity. (United States)

    Li, Guanghui; Luo, Jiawei; Xiao, Qiu; Liang, Cheng; Ding, Pingjian


    Interactions between microRNAs (miRNAs) and diseases can yield important information for uncovering novel prognostic markers. Since experimental determination of disease-miRNA associations is time-consuming and costly, attention has been given to designing efficient and robust computational techniques for identifying undiscovered interactions. In this study, we present a label propagation model with linear neighborhood similarity, called LPLNS, to predict unobserved miRNA-disease associations. Additionally, a preprocessing step is performed to derive new interaction likelihood profiles that will contribute to the prediction since new miRNAs and diseases lack known associations. Our results demonstrate that the LPLNS model based on the known disease-miRNA associations could achieve impressive performance with an AUC of 0.9034. Furthermore, we observed that the LPLNS model based on new interaction likelihood profiles could improve the performance to an AUC of 0.9127. This was better than other comparable methods. In addition, case studies also demonstrated our method's outstanding performance for inferring undiscovered interactions between miRNAs and diseases, especially for novel diseases. Copyright © 2018. Published by Elsevier Inc.

  3. Double-stranded RNA transcribed from vector-based oligodeoxynucleotide acts as transcription factor decoy

    Energy Technology Data Exchange (ETDEWEB)

    Xiao, Xiao [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Gang, Yi [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Department of Infectious Diseases, Tangdu Hospital, Fourth Military Medical University, Xi’an 710038, Shaanxi Province (China); Wang, Honghong [No. 518 Hospital of Chinese People’s Liberation Army, Xi’an 710043, Shaanxi Province (China); Wang, Jiayin [The Genome Institute, Washington University in St. Louis, St. Louis, MO 63108 (United States); Zhao, Lina [Department of Radiation Oncology, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Xu, Li, E-mail: [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Liu, Zhiguo, E-mail: [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China)


    Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself. The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity.

  4. A compilation of Web-based research tools for miRNA analysis. (United States)

    Shukla, Vaibhav; Varghese, Vinay Koshy; Kabekkodu, Shama Prasada; Mallya, Sandeep; Satyamoorthy, Kapaettu


    Since the discovery of microRNAs (miRNAs), a class of noncoding RNAs that regulate the gene expression posttranscriptionally in sequence-specific manner, there has been a release of number of tools useful for both basic and advanced applications. This is because of the significance of miRNAs in many pathophysiological conditions including cancer. Numerous bioinformatics tools that have been developed for miRNA analysis have their utility for detection, expression, function, target prediction and many other related features. This review provides a comprehensive assessment of web-based tools for the miRNA analysis that does not require prior knowledge of any computing languages. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please email:

  5. Ratiometric FRET-based detection of DNA and micro-RNA in solution

    International Nuclear Information System (INIS)

    Matveeva, Evgenia G.; Gryczynski, Zygmunt; Stewart, Donald R.; Gryczynski, Ignacy


    A ratiometric method for detecting DNA oligomers in bulk solution based on Foerster resonance energy transfer (FRET) is described. The two fluorescence signals (green and red), originating from Cy3 (donor, green) and Cy5 (acceptor, red) labels, are simultaneously detected from the pre-hybridized Cy3oligomerY:Cy5oligomerX system. The ratio of red to green intensities is sensitive to the presence of the single-stranded complimentary oligomer, which replaces single-stranded Cy3oligomerY in the donor:acceptor complex and perturbs the FRET. The detection scheme is generally applicable to the detection of DNA and RNA, and particularly micro-RNA. The proposed method is applicable to various double-stranded various lengths targets (manipulation of the sample preparation conditions, such as temperature, incubation time, denaturizing agent, may be needed).

  6. RNA aptamer-based electrochemical biosensor for selective and label-free analysis of dopamine

    DEFF Research Database (Denmark)

    Farjami, Elahe; Campos, Rui; Nielsen, Jesper Sejrup


    , including dopamine precursors and metabolites and other neurotransmitters (NT). Here we report an electrochemical RNA aptamer-based biosensor for analysis of dopamine in the presence of other NT. The biosensor exploits a specific binding of dopamine by the RNA aptamer, immobilized at a cysteamine......, norepinephrine, 3,4-dihydroxy-phenylalanine (l-DOPA), 3,4-dihydroxyphenylacetic acid (DOPAC), methyldopamine, and tyramine, which gave negligible signals under conditions of experiments (electroanalysis at 0.185 V vs Ag/AgCl). The interference from ascorbic and uric acids was eliminated by application...... as a general strategy not to restrict the conformational freedom and binding properties of surface-bound aptamers and, thus, be applicable for the development of other aptasensors...

  7. Investigation on the ion pair amphiphiles and their in vitro release of amantadine drug based on PLGA–PEG–PLGA gel

    International Nuclear Information System (INIS)

    Yang, Xiaoxia; Ji, Xiaoqing; Shi, Chunhuan; Liu, Jing; Wang, Haiyang; Luan, Yuxia


    The amantadine drug and oleic acid surfactant are used to form amantadine-based ion pair amphiphiles based on proton transfer reaction between the drug and the surfactant molecules. The ion pair amphiphiles are characterized by 1 H-nuclear magnetic resonance, Fourier transform infrared spectroscopy, and X-ray diffraction. Self-assembly properties of amantadine-based ion pair amphiphiles are studied by surface tension determination, transmission electron microscopy, zeta potential, and dynamic light scattering. The aggregation behavior studies indicate that the as-prepared ion pair amphiphiles can self-assemble into vesicles with the size of 200–300 nm in aqueous solution. The drug release results show that the amantadine release rate could be well controlled by incorporating the amantadine-based ion pair vesicles in poly (lactic-co-glycolic acid)-poly (ethylene glycol)-poly (lactic-co-glycolic acid) (PLGA–PEG–PLGA) copolymer hydrogel. The drug release from the AT–OA vesicle-loaded PLGA–PEG–PLGA hydrogel is significantly inhibited in comparison with the AT-loaded PLGA–PEG–PLGA hydrogel. The present work thus demonstrates that the vesicle-loaded hydrogel is a good candidate for the drug delivery system with long-term controlled drug release behavior

  8. A probabilistic model of RNA conformational space

    DEFF Research Database (Denmark)

    Frellsen, Jes; Moltke, Ida; Thiim, Martin


    , the discrete nature of the fragments necessitates the use of carefully tuned, unphysical energy functions, and their non-probabilistic nature impairs unbiased sampling. We offer a solution to the sampling problem that removes these important limitations: a probabilistic model of RNA structure that allows...... conformations for 9 out of 10 test structures, solely using coarse-grained base-pairing information. In conclusion, the method provides a theoretical and practical solution for a major bottleneck on the way to routine prediction and simulation of RNA structure and dynamics in atomic detail.......The increasing importance of non-coding RNA in biology and medicine has led to a growing interest in the problem of RNA 3-D structure prediction. As is the case for proteins, RNA 3-D structure prediction methods require two key ingredients: an accurate energy function and a conformational sampling...

  9. Accelerated probabilistic inference of RNA structure evolution

    Directory of Open Access Journals (Sweden)

    Holmes Ian


    Full Text Available Abstract Background Pairwise stochastic context-free grammars (Pair SCFGs are powerful tools for evolutionary analysis of RNA, including simultaneous RNA sequence alignment and secondary structure prediction, but the associated algorithms are intensive in both CPU and memory usage. The same problem is faced by other RNA alignment-and-folding algorithms based on Sankoff's 1985 algorithm. It is therefore desirable to constrain such algorithms, by pre-processing the sequences and using this first pass to limit the range of structures and/or alignments that can be considered. Results We demonstrate how flexible classes of constraint can be imposed, greatly reducing the computational costs while maintaining a high quality of structural homology prediction. Any score-attributed context-free grammar (e.g. energy-based scoring schemes, or conditionally normalized Pair SCFGs is amenable to this treatment. It is now possible to combine independent structural and alignment constraints of unprecedented general flexibility in Pair SCFG alignment algorithms. We outline several applications to the bioinformatics of RNA sequence and structure, including Waterman-Eggert N-best alignments and progressive multiple alignment. We evaluate the performance of the algorithm on test examples from the RFAM database. Conclusion A program, Stemloc, that implements these algorithms for efficient RNA sequence alignment and structure prediction is available under the GNU General Public License.

  10. Lentiviral transgenic microRNA-based shRNA suppressed mouse cytochromosome P450 3A (CYP3A expression in a dose-dependent and inheritable manner.

    Directory of Open Access Journals (Sweden)

    Yong Wang

    Full Text Available Cytochomosome P450 enzymes (CYP are heme-containing monooxygenases responsible for oxidative metabolism of many exogenous and endogenous compounds including drugs. The species difference of CYP limits the extent to which data obtained from animals can be translated to humans in pharmacodynamics or pharmacokinetics studies. Transgenic expression of human CYP in animals lacking or with largely reduced endogenous CYP counterparts is recognized as an ideal strategy to correct CYP species difference. CYP3A is the most abundant CYP subfamily both in human and mammals. In this study, we designed a microRNA-based shRNA (miR-shRNA simultaneously targeting four members of mouse CYP3A subfamily (CYP3A11, CYP3A16, CYP3A41 and CYP3A44, and transgenic mice expressing the designed miR-shRNA were generated by lentiviral transgenesis. Results showed that the CYP3A expression level in transgenic mice was markedly reduced compared to that in wild type or unrelated miR-shRNA transgenic mice, and was inversely correlated to the miR-shRNA expression level. The CYP3A expression levels in transgenic offspring of different generations were also remarkably lower compared to those of controls, and moreover the inhibition rate of CYP3A expression remained comparable over generations. The ratio of the targeted CYP3A transcriptional levels was comparable between knockdown and control mice of the same gender as detected by RT-PCR DGGE analysis. These data suggested that transgenic miR-shRNA suppressed CYP3A expression in a dose-dependent and inheritable manner, and transcriptional levels of the targeted CYP3As were suppressed to a similar extent. The observed knockdown efficacy was further confirmed by enzymatic activity analysis, and data showed that CYP3A activities in transgenic mice were markedly reduced compared to those in wild-type or unrelated miR-shRNA transgenic controls (1.11±0.71 vs 5.85±1.74, 5.9±2.4; P<0.01. This work laid down a foundation to further knock

  11. Evaluation of the comprehensive palatability of Japanese sake paired with dishes by multiple regression analysis based on subdomains. (United States)

    Nakamura, Ryo; Nakano, Kumiko; Tamura, Hiroyasu; Mizunuma, Masaki; Fushiki, Tohru; Hirata, Dai


    Many factors contribute to palatability. In order to evaluate the palatability of Japanese alcohol sake paired with certain dishes by integrating multiple factors, here we applied an evaluation method previously reported for palatability of cheese by multiple regression analysis based on 3 subdomain factors (rewarding, cultural, and informational). We asked 94 Japanese participants/subjects to evaluate the palatability of sake (1st evaluation/E1 for the first cup, 2nd/E2 and 3rd/E3 for the palatability with aftertaste/afterglow of certain dishes) and to respond to a questionnaire related to 3 subdomains. In E1, 3 factors were extracted by a factor analysis, and the subsequent multiple regression analyses indicated that the palatability of sake was interpreted by mainly the rewarding. Further, the results of attribution-dissections in E1 indicated that 2 factors (rewarding and informational) contributed to the palatability. Finally, our results indicated that the palatability of sake was influenced by the dish eaten just before drinking.

  12. Controlled and Efficient Polymerization of Conjugated Polar Alkenes by Lewis Pairs Based on Sterically Hindered Aryloxide-Substituted Alkylaluminum

    Directory of Open Access Journals (Sweden)

    Xiaojun Wang


    Full Text Available Reported herein is the development of an effective strategy for controlled and efficient Lewis pair polymerization of conjugated polar alkenes, including methyl methacrylate (MMA, n-butyl methacrylate (nBuMA, and γ-methyl-α-methylene-γ-butyrolactone (γMMBL, by the utilization of sterically encumbered Al(BHT2Me (BHT: 2,6-di-tert-butyl-4-methylphenol as a Lewis acid that shuts down intramolecular backbiting termination. In combination with a selected N-heterocyclic carbene (NHC as a Lewis base, the polymerization of MMA exhibited activity up to 3000 h−1 TOF and an acceptable initiation efficiency of 60.6%, producing polymers with high molecular weight (Mn up to 130 kg/mol and extremely narrow dispersity (Đ = 1.06~1.13. This controlled polymerization with a living characteristic has been evidenced by chain-extension experiments and chain-end analysis, and enabled the synthesis of well-defined diblock copolymers.

  13. Perturbative triples correction for local pair natural orbital based explicitly correlated CCSD(F12*) using Laplace transformation techniques. (United States)

    Schmitz, Gunnar; Hättig, Christof


    We present an implementation of pair natural orbital coupled cluster singles and doubles with perturbative triples, PNO-CCSD(T), which avoids the quasi-canonical triples approximation (T0) where couplings due to off-diagonal Fock matrix elements are neglected. A numerical Laplace transformation of the canonical expression for the perturbative (T) triples correction is used to avoid an I/O and storage bottleneck for the triples amplitudes. Results for a test set of reaction energies show that only very few Laplace grid points are needed to obtain converged energy differences and that PNO-CCSD(T) is a more robust approximation than PNO-CCSD(T0) with a reduced mean absolute deviation from canonical CCSD(T) results. We combine the PNO-based (T) triples correction with the explicitly correlated PNO-CCSD(F12*) method and investigate the use of specialized F12-PNOs in the conventional triples correction. We find that no significant additional errors are introduced and that PNO-CCSD(F12*)(T) can be applied in a black box manner.

  14. A pair natural orbital based implementation of CCSD excitation energies within the framework of linear response theory (United States)

    Frank, Marius S.; Hättig, Christof


    We present a pair natural orbital (PNO)-based implementation of coupled cluster singles and doubles (CCSD) excitation energies that builds upon the previously proposed state-specific PNO approach to the excited state eigenvalue problem. We construct the excited state PNOs for each state separately in a truncated orbital specific virtual basis and use a local density-fitting approximation to achieve an at most quadratic scaling of the computational costs for the PNO construction. The earlier reported excited state PNO construction is generalized such that a smooth convergence of the results for charge transfer states is ensured for general coupled cluster methods. We investigate the accuracy of our implementation by applying it to a large and diverse test set comprising 153 singlet excitations in organic molecules. Already moderate PNO thresholds yield mean absolute errors below 0.01 eV. The performance of the implementation is investigated through the calculations on alkene chains and reveals an at most cubic cost-scaling for the CCSD iterations with the system size.

  15. Paired fuzzy sets

    DEFF Research Database (Denmark)

    Rodríguez, J. Tinguaro; Franco de los Ríos, Camilo; Gómez, Daniel


    In this paper we want to stress the relevance of paired fuzzy sets, as already proposed in previous works of the authors, as a family of fuzzy sets that offers a unifying view for different models based upon the opposition of two fuzzy sets, simply allowing the existence of different types...

  16. Affine pairings on ARM

    NARCIS (Netherlands)

    Acar, T.; Lauter, K.; Naehrig, M.; Shumow, D.; Abdalla, M.; Lange, T.


    We report on relative performance numbers for affine and projective pairings on a dual-core Cortex A9 ARM processor. Using a fast inversion in the base field and doing inversion in extension fields by using the norm map to reduce to inversions in smaller fields, we find a very low ratio of

  17. Design of two and three input molecular logic gates using non-Watson-Crick base pairing-based molecular beacons. (United States)

    Lin, Jia-Hui; Tseng, Wei-Lung


    This study presents a single, resettable, and sensitive molecular beacon (MB) used to operate molecular-scale logic gates. The MB consists of a random DNA sequence, a fluorophore at the 5'-end, and a quencher at the 3'-end. The presence of Hg(2+), Ag(+), and coralyne promoted the formation of stable T-Hg(2+)-T, C-Ag(+)-C, and A2-coralyne-A2 coordination in the MB probe, respectively, thereby driving its conformational change. The metal ion or small molecule-mediated coordination of mismatched DNA brought the fluorophore and the quencher into close proximity, resulting in collisional quenching of fluorescence between the two organic dyes. Because thiol can bind Hg(2+) and remove it from the T-Hg(2+)-T-based MB, adding thiol to a solution of the T-Hg(2+)-T-based MB allowed the fluorophore and the quencher to be widely separated. A similar phenomenon was observed when replacing Hg(2+) with Ag(+). Because Ag(+) strongly binds to iodide, cyanide, and cysteine, they were capable of removing Ag(+) from the C-Ag(+)-C-based MB, restoring the fluorescence of the MB. Moreover, the fluorescence of the A2-coralyne-A2-based MB could be switched on by adding polyadenosine. Using these analytes as inputs and the MB as a signal transducer, we successfully developed a series of two-input, three-input, and set-reset logic gates at the molecular level.

  18. Analytical Performances of Human Immunodeficiency Virus Type 1 RNA-Based Amplix® Real-Time PCR Platform for HIV-1 RNA Quantification

    Directory of Open Access Journals (Sweden)

    Christian Diamant Mossoro-Kpinde


    Full Text Available Objectives. We evaluated the performances of Amplix real-time PCR platform developed by Biosynex (Strasbourg, France, combining automated station extraction (Amplix station 16 Dx and real-time PCR (Amplix NG, for quantifying plasma HIV-1 RNA by lyophilized HIV-1 RNA-based Amplix reagents targeting gag and LTR, using samples from HIV-1-infected adults from Central African Republic. Results. Amplix real-time PCR assay showed low limit of detection (28 copies/mL, across wide dynamic range (1.4–10 log copies/mL, 100% sensitivity and 99% specificity, high reproducibility, and accuracy with mean bias < 5%. The assay showed excellent correlations and concordance of 95.3% with the reference HIV-1 RNA load assay (Roche, with mean absolute bias of +0.097 log copies/mL by Bland-Altman analysis. The assay was able to detect and quantify the most prevalent HIV-1 subtype strains and the majority of non-B subtypes, CRFs of HIV-1 group M, and HIV-1 groups N and O circulating in Central Africa. The Amplix assay showed 100% sensitivity and 99.6% specificity to diagnose virological failure in clinical samples from antiretroviral drug-experienced patients. Conclusions. The HIV-1 RNA-based Amplix real-time PCR platform constitutes sensitive and reliable system for clinical monitoring of HIV-1 RNA load in HIV-1-infected children and adults, particularly adapted to intermediate laboratory facilities in sub-Saharan Africa.

  19. Towards Antiviral shRNAs Based on the AgoshRNA Design.

    Directory of Open Access Journals (Sweden)

    Ying Poi Liu

    Full Text Available RNA interference (RNAi can be induced by intracellular expression of a short hairpin RNA (shRNA. Processing of the shRNA requires the RNaseIII-like Dicer enzyme to remove the loop and to release the biologically active small interfering RNA (siRNA. Dicer is also involved in microRNA (miRNA processing to liberate the mature miRNA duplex, but recent studies indicate that miR-451 is not processed by Dicer. Instead, this miRNA is processed by the Argonaute 2 (Ago2 protein, which also executes the subsequent cleavage of a complementary mRNA target. Interestingly, shRNAs that structurally resemble miR-451 can also be processed by Ago2 instead of Dicer. The key determinant of these "AgoshRNA" molecules is a relatively short basepaired stem, which avoids Dicer recognition and consequently allows alternative processing by Ago2. AgoshRNA processing yields a single active RNA strand, whereas standard shRNAs produce a duplex with guide and passenger strands and the latter may cause adverse off-target effects. In this study, we converted previously tested active anti-HIV-1 shRNA molecules into AgoshRNA. We tested several designs that could potentially improve AgoshRNA activity, including extension of the complementarity between the guide strand and the mRNA target and reduction of the thermodynamic stability of the hairpins. We demonstrate that active AgoshRNAs can be generated. However, the RNAi activity is reduced compared to the matching shRNAs. Despite reduced RNAi activity, comparison of an active AgoshRNA and the matching shRNA in a sensitive cell toxicity assay revealed that the AgoshRNA is much less toxic.

  20. Predicting microRNA precursors with a generalized Gaussian components based density estimation algorithm

    Directory of Open Access Journals (Sweden)

    Wu Chi-Yeh


    Full Text Available Abstract Background MicroRNAs (miRNAs are short non-coding RNA molecules, which play an important role in post-transcriptional regulation of gene expression. There have been many efforts to discover miRNA precursors (pre-miRNAs over the years. Recently, ab initio approaches have attracted more attention because they do not depend on homology information and provide broader applications than comparative approaches. Kernel based classifiers such as support vector machine (SVM are extensively adopted in these ab initio approaches due to the prediction performance they achieved. On the other hand, logic based classifiers such as decision tree, of which the constructed model is interpretable, have attracted less attention. Results This article reports the design of a predictor of pre-miRNAs with a novel kernel based classifier named the generalized Gaussian density estimator (G2DE based classifier. The G2DE is a kernel based algorithm designed to provide interpretability by utilizing a few but representative kernels for constructing the classification model. The performance of the proposed predictor has been evaluated with 692 human pre-miRNAs and has been compared with two kernel based and two logic based classifiers. The experimental results show that the proposed predictor is capable of achieving prediction performance comparable to those delivered by the prevailing kernel based classification algorithms, while providing the user with an overall picture of the distribution of the data set. Conclusion Software predictors that identify pre-miRNAs in genomic sequences have been exploited by biologists to facilitate molecular biology research in recent years. The G2DE employed in this study can deliver prediction accuracy comparable with the state-of-the-art kernel based machine learning algorithms. Furthermore, biologists can obtain valuable insights about the different characteristics of the sequences of pre-miRNAs with the models generated by the G

  1. Stormbow: A Cloud-Based Tool for Reads Mapping and Expression Quantification in Large-Scale RNA-Seq Studies. (United States)

    Zhao, Shanrong; Prenger, Kurt; Smith, Lance


    RNA-Seq is becoming a promising replacement to microarrays in transcriptome profiling and differential gene expression study. Technical improvements have decreased sequencing costs and, as a result, the size and number of RNA-Seq datasets have increased rapidly. However, the increasing volume of data from large-scale RNA-Seq studies poses a practical challenge for data analysis in a local environment. To meet this challenge, we developed Stormbow, a cloud-based software package, to process large volumes of RNA-Seq data in parallel. The performance of Stormbow has been tested by practically applying it to analyse 178 RNA-Seq samples in the cloud. In our test, it took 6 to 8 hours to process an RNA-Seq sample with 100 million reads, and the average cost was $3.50 per sample. Utilizing Amazon Web Services as the infrastructure for Stormbow allows us to easily scale up to handle large datasets with on-demand computational resources. Stormbow is a scalable, cost effective, and open-source based tool for large-scale RNA-Seq data analysis. Stormbow can be freely downloaded and can be used out of box to process Illumina RNA-Seq datasets.

  2. Protocol: high throughput silica-based purification of RNA from Arabidopsis seedlings in a 96-well format. (United States)

    Salvo-Chirnside, Eliane; Kane, Steven; Kerr, Lorraine E


    The increasing popularity of systems-based approaches to plant research has resulted in a demand for high throughput (HTP) methods to be developed. RNA extraction from multiple samples in an experiment is a significant bottleneck in performing systems-level genomic studies. Therefore we have established a high throughput method of RNA extraction from Arabidopsis thaliana to facilitate gene expression studies in this widely used plant model. We present optimised manual and automated protocols for the extraction of total RNA from 9-day-old Arabidopsis seedlings in a 96 well plate format using silica membrane-based methodology. Consistent and reproducible yields of high quality RNA are isolated averaging 8.9 μg total RNA per sample (~20 mg plant tissue). The purified RNA is suitable for subsequent qPCR analysis of the expression of over 500 genes in triplicate from each sample. Using the automated procedure, 192 samples (2 × 96 well plates) can easily be fully processed (samples homogenised, RNA purified and quantified) in less than half a day. Additionally we demonstrate that plant samples can be stored in RNAlater at -20°C (but not 4°C) for 10 months prior to extraction with no significant effect on RNA yield or quality. Additionally, disrupted samples can be stored in the lysis buffer at -20°C for at least 6 months prior to completion of the extraction procedure providing a flexible sampling and storage scheme to facilitate complex time series experiments.

  3. Automated identification of RNA 3D modules with discriminative power in RNA structural alignments

    DEFF Research Database (Denmark)

    Theis, Corinna; Höner zu Siederdissen, Christian; Hofacker, Ivo L.


    Recent progress in predicting RNA structure is moving towards filling the 'gap' in 2D RNA structure prediction where, for example, predicted internal loops often form non-canonical base pairs. This is increasingly recognized with the steady increase of known RNA 3D modules. There is a general...... comparative evidence. Subsequently, the modules, initially represented by a graph, are turned into models for the RMDetect program, which allows to test their discriminative power using real and randomized Rfam alignments. An initial extraction of 22495 3D modules in all PDB files results in 977 internal loop...

  4. ACL2 Meets the GPU: Formalizing a CUDA-based Parallelizable All-Pairs Shortest Path Algorithm in ACL2

    Directory of Open Access Journals (Sweden)

    David S. Hardin


    Full Text Available As Graphics Processing Units (GPUs have gained in capability and GPU development environments have matured, developers are increasingly turning to the GPU to off-load the main host CPU of numerically-intensive, parallelizable computations. Modern GPUs feature hundreds of cores, and offer programming niceties such as double-precision floating point, and even limited recursion. This shift from CPU to GPU, however, raises the question: how do we know that these new GPU-based algorithms are correct? In order to explore this new verification frontier, we formalized a parallelizable all-pairs shortest path (APSP algorithm for weighted graphs, originally coded in NVIDIA's CUDA language, in ACL2. The ACL2 specification is written using a single-threaded object (stobj and tail recursion, as the stobj/tail recursion combination yields the most straightforward translation from imperative programming languages, as well as efficient, scalable executable specifications within ACL2 itself. The ACL2 version of the APSP algorithm can process millions of vertices and edges with little to no garbage generation, and executes at one-sixth the speed of a host-based version of APSP coded in C – a very respectable result for a theorem prover. In addition to formalizing the APSP algorithm (which uses Dijkstra's shortest path algorithm at its core, we have also provided capability that the original APSP code lacked, namely shortest path recovery. Path recovery is accomplished using a secondary ACL2 stobj implementing a LIFO stack, which is proven correct. To conclude the experiment, we ported the ACL2 version of the APSP kernels back to C, resulting in a less than 5% slowdown, and also performed a partial back-port to CUDA, which, surprisingly, yielded a slight performance increase.

  5. Can tautomerization of the A·T Watson-Crick base pair via double proton transfer provoke point mutations during DNA replication? A comprehensive QM and QTAIM analysis. (United States)

    Brovarets, Ol'ha O; Hovorun, Dmytro M


    Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H

  6. An albumin-mediated cholesterol design-based strategy for tuning siRNA pharmacokinetics and gene silencing. (United States)

    Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria; Dagnæs-Hansen, Frederik; Wengel, Jesper; Malle, Birgitte Mølholm; Kragh-Hansen, Ulrich; Cameron, Jason; Bukrinski, Jens Thostrup; Howard, Kenneth A


    Major challenges for the clinical translation of small interfering RNA (siRNA) include overcoming the poor plasma half-life, site-specific delivery and modulation of gene silencing. In this work, we exploit the intrinsic transport properties of human serum albumin to tune the blood circulatory half-life, hepatic accumulation and gene silencing; based on the number of siRNA cholesteryl modifications. We demonstrate by a gel shift assay a strong and specific affinity of recombinant human serum albumin (rHSA) towards cholesteryl-modified siRNA (Kd>1×10(-7)M) dependent on number of modifications. The rHSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies using multiple cholesteryl modifications. A structural-activity-based screen of in vitro EGFP-silencing was used to select optimal siRNA designs containing cholesteryl modifications within the sense strand that were used for in vivo studies. We demonstrate plasma half-life extension in NMRI mice from t1/2 12min (naked) to t1/2 45min (single cholesteryl) and t1/2 71min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing of 28% (rHSA/siRNA) compared to 4% (naked siRNA) 6days post-injection. This work presents a novel albumin-mediated cholesteryl design-based strategy for tuning pharmacokinetics and systemic gene silencing. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Attenuation-based kV pair selection in dual source dual energy computed tomography angiography of the chest: impact on radiation dose and image quality

    Energy Technology Data Exchange (ETDEWEB)

    Renapurkar, Rahul D.; Azok, Joseph; Lempel, Jason; Karim, Wadih; Graham, Ruffin [Thoracic Imaging, L10, Imaging Institute, Cleveland Clinic, Cleveland, OH (United States); Primak, Andrew [Siemens Medical Solutions, Malvern, PA (United States); Tandon, Yasmeen [Case Western Reserve University-Metro Health Medical Center, Department of Radiology, Cleveland, OH (United States); Bullen, Jennifer [Quantitative Health Sciences, Cleveland Clinic, Cleveland, OH (United States); Dong, Frank [Section of Medical Physics, Cleveland Clinic, Cleveland, OH (United States)


    The purpose of this study was to evaluate the impact of attenuation-based kilovoltage (kV) pair selection in dual source dual energy (DSDE)-pulmonary embolism (PE) protocol examinations on radiation dose savings and image quality. A prospective study was carried out on 118 patients with suspected PE. In patients in whom attenuation-based kV pair selection selected the 80/140Sn kV pair, the pre-scan 100/140Sn CTDIvol (computed tomography dose index volume) values were compared with the pre-scan 80/140Sn CTDIvol values. Subjective and objective image quality parameters were assessed. Attenuation-based kV pair selection switched to the 80/140Sn kV pair (''switched'' cohort) in 63 out of 118 patients (53%). The mean 100/140Sn pre-scan CTDIvol was 8.8 mGy, while the mean 80/140Sn pre-scan CTDIvol was 7.5 mGy. The average estimated dose reduction for the ''switched'' cohort was 1.3 mGy (95% CI 1.2, 1.4; p < 0.001), representing a 15% reduction in dose. After adjusting for patient weight, mean attenuation was significantly higher in the ''switched'' vs. ''non-switched'' cohorts in all five pulmonary arteries and in all lobes on iodine maps. This study demonstrates that attenuation-based kV pair selection in DSDE examination is feasible and can offer radiation dose reduction without compromising image quality. (orig.)

  8. Secondary structure of 5S RNA: NMR experiments on RNA molecules partially labeled with Nitrogen-15

    International Nuclear Information System (INIS)

    Gewirth, D.T.; Abo, S.R.; Leontis, N.B.; Moore, P.B.


    A method has been found for reassembling fragment 1 of Escherichia coli 5S RNA from mixtures containing strand III (bases 69-87) and the complex consisting of strand II (bases 89-120) and strand IV (bases 1-11). The reassembled molecule is identical with unreconstituted fragment 1. With this technique, fragment 1 molecules have been constructed 15 N-labeled either in strand III or in the strand II-strand IV complex. Spectroscopic data obtained with these partially labeled molecules show that the terminal helix of 5S RNA includes the GU and GC base pairs at positions 9 and 10 which the standard model for 5S secondary structure predicts but that these base pairs are unstable both in the fragment and in native 5S RNA. The data also assign three resonances to the helix V region of the molecule (bases 70-77 and 99-106). None of these resonances has a normal chemical shift even though two of them correspond to AU or GU base pairs in the standard model. The implications of these findings for the authors understanding of the structure of 5S RNA and its complex with ribosomal protein L25 are discussed

  9. Classification and energetics of the base-phosphate interactions in RNA

    Czech Academy of Sciences Publication Activity Database

    Zirbel, C.L.; Šponer, Judit E.; Šponer, Jiří; Stombaugh, J.; Leontis, N.B.


    Roč. 37, č. 15 (2009), s. 4898-4918 ISSN 0305-1048 R&D Projects: GA AV ČR(CZ) IAA400550701; GA AV ČR(CZ) IAA400040802; GA AV ČR(CZ) 1QS500040581; GA MŠk(CZ) LC06030 Grant - others:GA ČR(CZ) GA203/09/1476 Program:GA Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : RNA * base * phosphate Subject RIV: BO - Biophysics Impact factor: 7.479, year: 2009

  10. Human disease MiRNA inference by combining target information based on heterogeneous manifolds. (United States)

    Ding, Pingjian; Luo, Jiawei; Liang, Cheng; Xiao, Qiu; Cao, Buwen


    The emergence of network medicine has provided great insight into the identification of disease-related molecules, which could help with the development of personalized medicine. However, the state-of-the-art methods could neither simultaneously consider target information and the known miRNA-disease associations nor effectively explore novel gene-disease associations as a by-product during the process of inferring disease-related miRNAs. Computational methods incorporating multiple sources of information offer more opportunities to infer disease-related molecules, including miRNAs and genes in heterogeneous networks at a system level. In this study, we developed a novel algorithm, named inference of Disease-related MiRNAs based on Heterogeneous Manifold (DMHM), to accurately and efficiently identify miRNA-disease associations by integrating multi-omics data. Graph-based regularization was utilized to obtain a smooth function on the data manifold, which constitutes the main principle of DMHM. The novelty of this framework lies in the relatedness between diseases and miRNAs, which are measured via heterogeneous manifolds on heterogeneous networks integrating target information. To demonstrate the effectiveness of DMHM, we conducted comprehensive experiments based on HMDD datasets and compared DMHM with six state-of-the-art methods. Experimental results indicated that DMHM significantly outperformed the other six methods under fivefold cross validation and de novo prediction tests. Case studies have further confirmed the practical usefulness of DMHM. Copyright © 2018 Elsevier Inc. All rights reserved.

  11. Tuning iteration space slicing based tiled multi-core code implementing Nussinov's RNA folding.