WorldWideScience

Sample records for risc rna induced

  1. Development of Novel Antisense Oligonucleotides for the Functional Regulation of RNA-Induced Silencing Complex (RISC) by Promoting the Release of microRNA from RISC.

    Science.gov (United States)

    Ariyoshi, Jumpei; Momokawa, Daiki; Eimori, Nao; Kobori, Akio; Murakami, Akira; Yamayoshi, Asako

    2015-12-16

    MicroRNAs (miRNAs) are known to be important post-transcription regulators of gene expression. Aberrant miRNA expression is associated with pathological disease processes, including carcinogenesis. Therefore, miRNAs are considered significant therapeutic targets for cancer therapy. MiRNAs do not act alone, but exhibit their functions by forming RNA-induced silencing complex (RISC). Thus, the regulation of RISC activity is a promising approach for cancer therapy. MiRNA is a core component of RISC and is an essential to RISC for recognizing target mRNA. Thereby, it is expected that development of the method to promote the release of miRNA from RISC would be an effective approach for inhibition of RISC activity. In this study, we synthesized novel peptide-conjugated oligonucleotides (RINDA-as) to promote the release of miRNA from RISC. RINDA-as showed a high rate of miRNA release from RISC and high level of inhibitory effect on RISC activity.

  2. Increased RNA-induced silencing complex (RISC) activity contributes to hepatocellular carcinoma.

    Science.gov (United States)

    Yoo, Byoung Kwon; Santhekadur, Prasanna K; Gredler, Rachel; Chen, Dong; Emdad, Luni; Bhutia, Sujit; Pannell, Lewis; Fisher, Paul B; Sarkar, Devanand

    2011-05-01

    There is virtually no effective treatment for advanced hepatocellular carcinoma (HCC) and novel targets need to be identified to develop effective treatment. We recently documented that the oncogene Astrocyte elevated gene-1 (AEG-1) plays a seminal role in hepatocarcinogenesis. Employing yeast two-hybrid assay and coimmunoprecipitation followed by mass spectrometry, we identified staphylococcal nuclease domain containing 1 (SND1), a nuclease in the RNA-induced silencing complex (RISC) facilitating RNAi-mediated gene silencing, as an AEG-1 interacting protein. Coimmunoprecipitation and colocalization studies confirmed that AEG-1 is also a component of RISC and both AEG-1 and SND1 are required for optimum RISC activity facilitating small interfering RNA (siRNA) and micro RNA (miRNA)-mediated silencing of luciferase reporter gene. In 109 human HCC samples SND1 was overexpressed in ≈74% cases compared to normal liver. Correspondingly, significantly higher RISC activity was observed in human HCC cells compared to immortal normal hepatocytes. Increased RISC activity, conferred by AEG-1 or SND1, resulted in increased degradation of tumor suppressor messenger RNAs (mRNAs) that are target of oncomiRs. Inhibition of enzymatic activity of SND1 significantly inhibited proliferation of human HCC cells. As a corollary, stable overexpression of SND1 augmented and siRNA-mediated inhibition of SND1 abrogated growth of human HCC cells in vitro and in vivo, thus revealing a potential role of SND1 in hepatocarcinogenesis. We unravel a novel mechanism that overexpression of AEG-1 and SND1 leading to increased RISC activity might contribute to hepatocarcinogenesis. Targeted inhibition of SND1 enzymatic activity might be developed as an effective therapy for HCC. Copyright © 2011 American Association for the Study of Liver Diseases.

  3. Capturing microRNA targets using an RNA-induced silencing complex (RISC)-trap approach.

    Science.gov (United States)

    Cambronne, Xiaolu A; Shen, Rongkun; Auer, Paul L; Goodman, Richard H

    2012-12-11

    Identifying targets is critical for understanding the biological effects of microRNA (miRNA) expression. The challenge lies in characterizing the cohort of targets for a specific miRNA, especially when targets are being actively down-regulated in miRNA- RNA-induced silencing complex (RISC)-messengerRNA (mRNA) complexes. We have developed a robust and versatile strategy called RISCtrap to stabilize and purify targets from this transient interaction. Its utility was demonstrated by determining specific high-confidence target datasets for miR-124, miR-132, and miR-181 that contained known and previously unknown transcripts. Two previously unknown miR-132 targets identified with RISCtrap, adaptor protein CT10 regulator of kinase 1 (CRK1) and tight junction-associated protein 1 (TJAP1), were shown to be endogenously regulated by miR-132 in adult mouse forebrain. The datasets, moreover, differed in the number of targets and in the types and frequency of microRNA recognition element (MRE) motifs, thus revealing a previously underappreciated level of specificity in the target sets regulated by individual miRNAs.

  4. Dysregulated RNA-Induced Silencing Complex (RISC) Assembly within CNS Corresponds with Abnormal miRNA Expression during Autoimmune Demyelination.

    Science.gov (United States)

    Lewkowicz, Przemysław; Cwiklińska, Hanna; Mycko, Marcin P; Cichalewska, Maria; Domowicz, Małgorzata; Lewkowicz, Natalia; Jurewicz, Anna; Selmaj, Krzysztof W

    2015-05-13

    MicroRNAs (miRNAs) associate with Argonaute (Ago), GW182, and FXR1 proteins to form RNA-induced silencing complexes (RISCs). RISCs represent a critical checkpoint in the regulation and bioavailability of miRNAs. Recent studies have revealed dysregulation of miRNAs in multiple sclerosis (MS) and its animal model, experimental autoimmune encephalomyelitis (EAE); however, the function of RISCs in EAE and MS is largely unknown. Here, we examined the expression of Ago, GW182, and FXR1 in CNS tissue, oligodendrocytes (OLs), brain-infiltrating T lymphocytes, and CD3(+)splenocytes (SCs) of EAE mic, and found that global RISC protein levels were significantly dysregulated. Specifically, Ago2 and FXR1 levels were decreased in OLs and brain-infiltrating T cells in EAE mice. Accordingly, assembly of Ago2/GW182/FXR1 complexes in EAE brain tissues was disrupted, as confirmed by immunoprecipitation experiments. In parallel with alterations in RISC complex content in OLs, we found downregulation of miRNAs essential for differentiation and survival of OLs and myelin synthesis. In brain-infiltrating T lymphocytes, aberrant RISC formation contributed to miRNA-dependent proinflammatory helper T-cell polarization. In CD3(+) SCs, we found increased expression of both Ago2 and FXR1 in EAE compared with nonimmunized mice. Therefore, our results demonstrate a gradient in expression of miRNA between primary activated T cells in the periphery and polarized CNS-infiltrating T cells. These results suggest that, in polarized autoreactive effector T cells, miRNA synthesis is inhibited in response to dysregulated RISC assembly, allowing these cells to maintain a highly specific proinflammatory program. Therefore, our findings may provide a mechanism that leads to miRNA dysregulation in EAE/MS. Copyright © 2015 the authors 0270-6474/15/357521-17$15.00/0.

  5. RNA-induced silencing complex (RISC) Proteins PACT, TRBP, and Dicer are SRA binding nuclear receptor coregulators.

    Science.gov (United States)

    Redfern, Andrew D; Colley, Shane M; Beveridge, Dianne J; Ikeda, Naoya; Epis, Michael R; Li, Xia; Foulds, Charles E; Stuart, Lisa M; Barker, Andrew; Russell, Victoria J; Ramsay, Kerry; Kobelke, Simon J; Li, Xiaotao; Hatchell, Esme C; Payne, Christine; Giles, Keith M; Messineo, Adriana; Gatignol, Anne; Lanz, Rainer B; O'Malley, Bert W; Leedman, Peter J

    2013-04-16

    The cytoplasmic RNA-induced silencing complex (RISC) contains dsRNA binding proteins, including protein kinase RNA activator (PACT), transactivation response RNA binding protein (TRBP), and Dicer, that process pre-microRNAs into mature microRNAs (miRNAs) that target specific mRNA species for regulation. There is increasing evidence for important functional interactions between the miRNA and nuclear receptor (NR) signaling networks, with recent data showing that estrogen, acting through the estrogen receptor, can modulate initial aspects of nuclear miRNA processing. Here, we show that the cytoplasmic RISC proteins PACT, TRBP, and Dicer are steroid receptor RNA activator (SRA) binding NR coregulators that target steroid-responsive promoters and regulate NR activity and downstream gene expression. Furthermore, each of the RISC proteins, together with Argonaute 2, associates with SRA and specific pre-microRNAs in both the nucleus and cytoplasm, providing evidence for links between NR-mediated transcription and some of the factors involved in miRNA processing.

  6. Multilayer checkpoints for microRNA authenticity during RISC assembly.

    Science.gov (United States)

    Kawamata, Tomoko; Yoda, Mayuko; Tomari, Yukihide

    2011-09-01

    MicroRNAs (miRNAs) function through the RNA-induced silencing complex (RISC), which contains an Argonaute (Ago) protein at the core. RISC assembly follows a two-step pathway: miRNA/miRNA* duplex loading into Ago, and separation of the two strands within Ago. Here we show that the 5' phosphate of the miRNA strand is essential for duplex loading into Ago, whereas the preferred 5' nucleotide of the miRNA strand and the base-pairing status in the seed region and the middle of the 3' region function as additive anchors to Ago. Consequently, the miRNA authenticity is inspected at multiple steps during RISC assembly.

  7. Synaptotagmin 11 interacts with components of the RNA-induced silencing complex RISC in clonal pancreatic β-cells.

    Science.gov (United States)

    Milochau, Alexandra; Lagrée, Valérie; Benassy, Marie-Noëlle; Chaignepain, Stéphane; Papin, Julien; Garcia-Arcos, Itsaso; Lajoix, Anne; Monterrat, Carole; Coudert, Laetitia; Schmitter, Jean-Marie; Ochoa, Begoña; Lang, Jochen

    2014-06-27

    Synaptotagmins are two C2 domain-containing transmembrane proteins. The function of calcium-sensitive members in the regulation of post-Golgi traffic has been well established whereas little is known about the calcium-insensitive isoforms constituting half of the protein family. Novel binding partners of synaptotagmin 11 were identified in β-cells. A number of them had been assigned previously to ER/Golgi derived-vesicles or linked to RNA synthesis, translation and processing. Whereas the C2A domain interacted with the Q-SNARE Vti1a, the C2B domain of syt11 interacted with the SND1, Ago2 and FMRP, components of the RNA-induced silencing complex (RISC). Binding to SND was direct via its N-terminal tandem repeats. Our data indicate that syt11 may provide a link between gene regulation by microRNAs and membrane traffic. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  8. AGO/RISC-mediated antiviral RNA silencing in a plant in vitro system.

    Science.gov (United States)

    Schuck, Jana; Gursinsky, Torsten; Pantaleo, Vitantonio; Burgyán, Jozsef; Behrens, Sven-Erik

    2013-05-01

    AGO/RISC-mediated antiviral RNA silencing, an important component of the plant's immune response against RNA virus infections, was recapitulated in vitro. Cytoplasmic extracts of tobacco protoplasts were applied that supported Tombusvirus RNA replication, as well as the formation of RNA-induced silencing complexes (RISC) that could be functionally reconstituted with various plant ARGONAUTE (AGO) proteins. For example, when RISC containing AGO1, 2, 3 or 5 were programmed with exogenous siRNAs that specifically targeted the viral RNA, endonucleolytic cleavages occurred and viral replication was inhibited. Antiviral RNA silencing was disabled by the viral silencing suppressor p19 when this was present early during RISC formation. Notably, with replicating viral RNA, only (+)RNA molecules were accessible to RISC, whereas (-)RNA replication intermediates were not. The vulnerability of viral RNAs to RISC activity also depended on the RNA structure of the target sequence. This was most evident when we characterized viral siRNAs (vsiRNAs) that were particularly effective in silencing with AGO1- or AGO2/RISC. These vsiRNAs targeted similar sites, suggesting that accessible parts of the viral (+)RNA may be collectively attacked by different AGO/RISC. The in vitro system was, hence, established as a valuable tool to define and characterize individual molecular determinants of antiviral RNA silencing.

  9. RISC RNA sequencing for context-specific identification of in vivo microRNA targets.

    Science.gov (United States)

    Matkovich, Scot J; Van Booven, Derek J; Eschenbacher, William H; Dorn, Gerald W

    2011-01-07

    MicroRNAs (miRs) are expanding our understanding of cardiac disease and have the potential to transform cardiovascular therapeutics. One miR can target hundreds of individual mRNAs, but existing methodologies are not sufficient to accurately and comprehensively identify these mRNA targets in vivo. To develop methods permitting identification of in vivo miR targets in an unbiased manner, using massively parallel sequencing of mouse cardiac transcriptomes in combination with sequencing of mRNA associated with mouse cardiac RNA-induced silencing complexes (RISCs). We optimized techniques for expression profiling small amounts of RNA without introducing amplification bias and applied this to anti-Argonaute 2 immunoprecipitated RISCs (RISC-Seq) from mouse hearts. By comparing RNA-sequencing results of cardiac RISC and transcriptome from the same individual hearts, we defined 1645 mRNAs consistently targeted to mouse cardiac RISCs. We used this approach in hearts overexpressing miRs from Myh6 promoter-driven precursors (programmed RISC-Seq) to identify 209 in vivo targets of miR-133a and 81 in vivo targets of miR-499. Consistent with the fact that miR-133a and miR-499 have widely differing "seed" sequences and belong to different miR families, only 6 targets were common to miR-133a- and miR-499-programmed hearts. RISC-sequencing is a highly sensitive method for general RISC profiling and individual miR target identification in biological context and is applicable to any tissue and any disease state.

  10. Detection of the argonaute protein Ago2 and microRNAs in the RNA induced silencing complex (RISC) using a monoclonal antibody.

    Science.gov (United States)

    Ikeda, Keigo; Satoh, Minoru; Pauley, Kaleb M; Fritzler, Marvin J; Reeves, Westley H; Chan, Edward K L

    2006-12-20

    MicroRNAs (miRNAs) are short RNA molecules responsible for post-transcriptional gene silencing by the degradation or translational inhibition of their target messenger RNAs (mRNAs). This process of gene silencing, known as RNA interference (RNAi), is mediated by highly conserved Argonaute (Ago) proteins which are the key components of the RNA induced silencing complex (RISC). In humans, Ago2 is responsible for the endonuclease cleavage of targeted mRNA and it interacts with the mRNA-binding protein GW182, which is a marker for cytoplasmic foci referred to as GW bodies (GWBs). We demonstrated that the anti-Ago2 monoclonal antibody 4F9 recognized GWBs in a cell cycle dependent manner and was capable of capturing miRNAs associated with Ago2. Since Ago2 protein is the effector protein of RNAi, anti-Ago2 monoclonal antibody may be useful in capturing functional miRNAs.

  11. 3' fragment of miR173-programmed RISC-cleaved RNA is protected from degradation in a complex with RISC and SGS3.

    Science.gov (United States)

    Yoshikawa, Manabu; Iki, Taichiro; Tsutsui, Yasuhiro; Miyashita, Kyoko; Poethig, R Scott; Habu, Yoshiki; Ishikawa, Masayuki

    2013-03-05

    trans-acting small interfering RNAs (tasiRNAs) are plant-specific endogenous siRNAs produced via a unique pathway whose first step is the microRNA (miRNA)-programmed RNA-induced silencing complex (RISC)-mediated cleavage of tasiRNA gene (TAS) transcripts. One of the products is subsequently transformed into tasiRNAs by a pathway that requires several factors including SUPPRESSOR OF GENE SILENCING3 (SGS3) and RNA-DEPENDENT RNA POLYMERASE6. Here, using in vitro assembled ARGONAUTE (AGO)1-RISCs, we show that SGS3 is recruited onto RISCs only when they bind target RNA. Following cleavage by miRNA173 (miR173)-programmed RISC, SGS3 was found in complexes containing cleaved TAS2 RNA and RISC. The 3' cleavage fragment (the source of tasiRNAs) was protected from degradation in this complex. Depletion of SGS3 did not affect TAS2 RNA cleavage by miR173-programmed RISC, but did affect the stability of the 3' cleavage fragment. When the 3' nucleotide of 22-nt miR173 was deleted or the corresponding nucleotide in TAS2 RNA was mutated, the complex was not observed and the 3' cleavage fragment was degraded. Importantly, these changes in miR173 or TAS2 RNA are known to lead to a loss of tasiRNA production in vivo. These results suggest that (i) SGS3 associates with AGO1-RISC via the double-stranded RNA formed by the 3'-terminal nucleotides of 22-nt miR173 and corresponding target RNA, which probably protrudes from the AGO1-RISC molecular surface, (ii) SGS3 protects the 3' cleavage fragment of TAS2 RNA from degradation, and (iii) the observed SGS3-dependent stabilization of the 3' fragment of TAS2 RNA is key to tasiRNA production.

  12. Native gel analysis for RISC assembly.

    Science.gov (United States)

    Kawamata, Tomoko; Tomari, Yukihide

    2011-01-01

    Small-interfering RNAs (siRNAs) and microRNAs (miRNAs) regulate expression of their target mRNAs via the RNA-induced silencing complex (RISC). A core component of RISC is the Argonaute (Ago) protein, which dictates the RISC function. In Drosophila, miRNAs and siRNAs are generally loaded into Ago1-containing RISC (Ago1-RISC) and Ago2-containing RISC (Ago2-RISC), respectively. We developed a native agarose gel system to directly detect Ago1-RISC, Ago2-RISC, and their precursor complexes. Methods presented here will provide powerful tools to biochemically dissect the RISC assembly pathways.

  13. Slicer-independent mechanism drives small-RNA strand separation during human RISC assembly.

    Science.gov (United States)

    Park, June Hyun; Shin, Chanseok

    2015-10-30

    Small RNA silencing is mediated by the effector RNA-induced silencing complex (RISC) that consists of an Argonaute protein (AGOs 1-4 in humans). A fundamental step during RISC assembly involves the separation of two strands of a small RNA duplex, whereby only the guide strand is retained to form the mature RISC, a process not well understood. Despite the widely accepted view that 'slicer-dependent unwinding' via passenger-strand cleavage is a prerequisite for the assembly of a highly complementary siRNA into the AGO2-RISC, here we show by careful re-examination that 'slicer-independent unwinding' plays a more significant role in human RISC maturation than previously appreciated, not only for a miRNA duplex, but, unexpectedly, for a highly complementary siRNA as well. We discovered that 'slicer-dependency' for the unwinding was affected primarily by certain parameters such as temperature and Mg(2+). We further validate these observations in non-slicer AGOs (1, 3 and 4) that can be programmed with siRNAs at the physiological temperature of humans, suggesting that slicer-independent mechanism is likely a common feature of human AGOs. Our results now clearly explain why both miRNA and siRNA are found in all four human AGOs, which is in striking contrast to the strict small-RNA sorting system in Drosophila. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Hsc70/Hsp90 chaperone machinery mediates ATP-dependent RISC loading of small RNA duplexes.

    Science.gov (United States)

    Iwasaki, Shintaro; Kobayashi, Maki; Yoda, Mayuko; Sakaguchi, Yuriko; Katsuma, Susumu; Suzuki, Tsutomu; Tomari, Yukihide

    2010-07-30

    Small silencing RNAs--small interfering RNAs (siRNAs) or microRNAs (miRNAs)--direct posttranscriptional gene silencing of their mRNA targets as guides for the RNA-induced silencing complex (RISC). Both siRNAs and miRNAs are born double stranded. Surprisingly, loading these small RNA duplexes into Argonaute proteins, the core components of RISC, requires ATP, whereas separating the two small RNA strands within Argonaute does not. Here we show that the Hsc70/Hsp90 chaperone machinery is required to load small RNA duplexes into Argonaute proteins, but not for subsequent strand separation or target cleavage. We envision that the chaperone machinery uses ATP and mediates a conformational opening of Ago proteins so that they can receive bulky small RNA duplexes. Our data suggest that the chaperone machinery may serve as the driving force for the RISC assembly pathway. Copyright 2010 Elsevier Inc. All rights reserved.

  15. RNA helicase A is not required for RISC activity.

    Science.gov (United States)

    Liang, Xue-Hai; Crooke, Stanley T

    2013-10-01

    It has been shown that siRNAs can compete with each other or with endogenous miRNAs for RISC components. This competition may complicate the interpretations of phenotypes observed through siRNA-mediated knockdown of genes, especially those genes implicated in the RISC pathway. In this study, we re-examined the function of RNA helicase A (RHA), which has been previously proposed to function in RISC loading based on siRNA-mediated knockdown studies. Here we show that reduced RISC activity or loading of siRNAs was observed only in cells depleted of RHA using siRNA, but not using RNaseH-dependent antisense oligonucleotides (ASOs), suggesting that the impaired RISC function stems from the competition between pre-existing and newly transfected siRNAs, but not from reduction of the RHA protein. This view is further supported by the findings that cells depleted of a control protein, NCL1, using siRNA, but not ASO, exhibited similar defects on the loading and activity of a subsequently transfected siRNA. Transfection of RHA or NCL1 siRNAs, but not ASOs, reduced the levels of endogenous miRNAs, suggesting a competition mechanism. As a positive control, we showed that reduction of MOV10 by either siRNA or ASO decreased siRNA activity, confirming its role in RISC function. Together, our results indicate that RHA is not required for RISC activity or loading, and suggest that proper controls are required when using siRNAs to functionalize genes to avoid competition effects. © 2013. Published by Elsevier B.V. All rights reserved.

  16. Making RISC.

    Science.gov (United States)

    Kawamata, Tomoko; Tomari, Yukihide

    2010-07-01

    It is well established that 20- to 30-nt small RNAs, including small interfering RNAs, microRNAs and Piwi-interacting RNAs, play crucial roles in regulating gene expression and control a surprisingly diverse array of biological processes. These small RNAs cannot work alone: they must form effector ribonucleoprotein complexes - RNA-induced silencing complexes (RISCs) - to exert their function. Thus, RISC assembly is a key process in small RNA-mediated silencing. Recent biochemical analyses of RISC assembly, together with new structural studies of Argonaute, the core protein component of RISC, suggest a revised view of how mature RISC, which contains single-stranded guide RNA, is built from small RNAs that are born double-stranded. Copyright 2010 Elsevier Ltd. All rights reserved.

  17. Expression levels of the microRNA maturing microprocessor complex component DGCR8 and the RNA-induced silencing complex (RISC) components argonaute-1, argonaute-2, PACT, TARBP1, and TARBP2 in epithelial skin cancer.

    Science.gov (United States)

    Sand, Michael; Skrygan, Marina; Georgas, Dimitrios; Arenz, Christoph; Gambichler, Thilo; Sand, Daniel; Altmeyer, Peter; Bechara, Falk G

    2012-11-01

    The microprocessor complex mediates intranuclear biogenesis of precursor microRNAs from the primary microRNA transcript. Extranuclear, mature microRNAs are incorporated into the RNA-induced silencing complex (RISC) before interaction with complementary target mRNA leads to transcriptional repression or cleavage. In this study, we investigated the expression profiles of the microprocessor complex subunit DiGeorge syndrome critical region gene 8 (DGCR8) and the RISC components argonaute-1 (AGO1), argonaute-2 (AGO2), as well as double-stranded RNA-binding proteins PACT, TARBP1, and TARBP2 in epithelial skin cancer and its premalignant stage. Patients with premalignant actinic keratoses (AK, n = 6), basal cell carcinomas (BCC, n = 15), and squamous cell carcinomas (SCC, n = 7) were included in the study. Punch biopsies were harvested from the center of the tumors (lesional), from healthy skin sites (intraindividual controls), and from healthy skin sites in a healthy control group (n = 16; interindividual control). The DGCR8, AGO1, AGO2, PACT, TARBP1, and TARBP2 mRNA expression levels were detected by quantitative real-time reverse transcriptase polymerase chain reaction. The DGCR8, AGO1, AGO2, PACT, and TARBP1 expression levels were significantly higher in the AK, BCC, and SCC groups than the healthy controls (P  0.05). This study indicates that major components of the miRNA pathway, such as the microprocessor complex and RISC, are dysregulated in epithelial skin cancer. Copyright © 2011 Wiley Periodicals, Inc.

  18. Structural insights into RISC assembly facilitated by dsRNA-binding domains of human RNA helicase A (DHX9).

    Science.gov (United States)

    Fu, Qinqin; Yuan, Y Adam

    2013-03-01

    Intensive research interest has focused on small RNA-processing machinery and the RNA-induced silencing complex (RISC), key cellular machines in RNAi pathways. However, the structural mechanism regarding RISC assembly, the primary step linking small RNA processing and RNA-mediated gene silencing, is largely unknown. Human RNA helicase A (DHX9) was reported to function as an RISC-loading factor, and such function is mediated mainly by its dsRNA-binding domains (dsRBDs). Here, we report the crystal structures of human RNA helicase A (RHA) dsRBD1 and dsRBD2 domains in complex with dsRNAs, respectively. Structural analysis not only reveals higher siRNA duplex-binding affinity displayed by dsRBD1, but also identifies a crystallographic dsRBD1 pair of physiological significance in cooperatively recognizing dsRNAs. Structural observations are further validated by isothermal titration calorimetric (ITC) assay. Moreover, co-immunoprecipitation (co-IP) assay coupled with mutagenesis demonstrated that both dsRBDs are required for RISC association, and such association is mediated by dsRNA. Hence, our structural and functional efforts have revealed a potential working model for siRNA recognition by RHA tandem dsRBDs, and together they provide direct structural insights into RISC assembly facilitated by RHA.

  19. 3′ fragment of miR173-programmed RISC-cleaved RNA is protected from degradation in a complex with RISC and SGS3

    Science.gov (United States)

    Yoshikawa, Manabu; Iki, Taichiro; Tsutsui, Yasuhiro; Miyashita, Kyoko; Poethig, R. Scott; Habu, Yoshiki; Ishikawa, Masayuki

    2013-01-01

    trans-acting small interfering RNAs (tasiRNAs) are plant-specific endogenous siRNAs produced via a unique pathway whose first step is the microRNA (miRNA)-programmed RNA-induced silencing complex (RISC)–mediated cleavage of tasiRNA gene (TAS) transcripts. One of the products is subsequently transformed into tasiRNAs by a pathway that requires several factors including SUPPRESSOR OF GENE SILENCING3 (SGS3) and RNA-DEPENDENT RNA POLYMERASE6. Here, using in vitro assembled ARGONAUTE (AGO)1–RISCs, we show that SGS3 is recruited onto RISCs only when they bind target RNA. Following cleavage by miRNA173 (miR173)-programmed RISC, SGS3 was found in complexes containing cleaved TAS2 RNA and RISC. The 3′ cleavage fragment (the source of tasiRNAs) was protected from degradation in this complex. Depletion of SGS3 did not affect TAS2 RNA cleavage by miR173-programmed RISC, but did affect the stability of the 3′ cleavage fragment. When the 3′ nucleotide of 22-nt miR173 was deleted or the corresponding nucleotide in TAS2 RNA was mutated, the complex was not observed and the 3′ cleavage fragment was degraded. Importantly, these changes in miR173 or TAS2 RNA are known to lead to a loss of tasiRNA production in vivo. These results suggest that (i) SGS3 associates with AGO1–RISC via the double-stranded RNA formed by the 3′-terminal nucleotides of 22-nt miR173 and corresponding target RNA, which probably protrudes from the AGO1–RISC molecular surface, (ii) SGS3 protects the 3′ cleavage fragment of TAS2 RNA from degradation, and (iii) the observed SGS3-dependent stabilization of the 3′ fragment of TAS2 RNA is key to tasiRNA production. PMID:23417299

  20. Steric restrictions of RISC in RNA interference identified with size-expanded RNA nucleobases.

    Science.gov (United States)

    Hernández, Armando R; Peterson, Larryn W; Kool, Eric T

    2012-08-17

    Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC), the key protein complex of RNA interference (RNAi), is of great importance to the development of siRNAs with improved biological and potentially therapeutic function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to -5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3'-end increased activity over that of wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation.

  1. Structural insights into RNA processing by the human RISC-loading complex.

    Science.gov (United States)

    Wang, Hong-Wei; Noland, Cameron; Siridechadilok, Bunpote; Taylor, David W; Ma, Enbo; Felderer, Karin; Doudna, Jennifer A; Nogales, Eva

    2009-11-01

    Targeted gene silencing by RNA interference (RNAi) requires loading of a short guide RNA (small interfering RNA (siRNA) or microRNA (miRNA)) onto an Argonaute protein to form the functional center of an RNA-induced silencing complex (RISC). In humans, Argonaute2 (AGO2) assembles with the guide RNA-generating enzyme Dicer and the RNA-binding protein TRBP to form a RISC-loading complex (RLC), which is necessary for efficient transfer of nascent siRNAs and miRNAs from Dicer to AGO2. Here, using single-particle EM analysis, we show that human Dicer has an L-shaped structure. The RLC Dicer's N-terminal DExH/D domain, located in a short 'base branch', interacts with TRBP, whereas its C-terminal catalytic domains in the main body are proximal to AGO2. A model generated by docking the available atomic structures of Dicer and Argonaute homologs into the RLC reconstruction suggests a mechanism for siRNA transfer from Dicer to AGO2.

  2. Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple turnover.

    Science.gov (United States)

    Rawlings, Renata A; Krishnan, Vishalakshi; Walter, Nils G

    2011-04-29

    RNA interference is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response to viruses and retrotransposons. During viral infection, the RNase-III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs) 21-24 nucleotides in length and helps load them into the RNA-induced silencing complex (RISC) to guide the cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressors (RSS) that tightly, and presumably quantitatively, bind siRNAs to thwart RNA-interference-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus, as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding [(1.69 ± 0.07) × 10(8) M(-)(1) s(-1)] and marked dissociation (k(off)=0.062 ± 0.002 s(-1)). We also observe that p19 efficiently competes with recombinant Dicer and inhibits the formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. Depletion of key protein components of the RISC pathway impairs pre-ribosomal RNA processing.

    Science.gov (United States)

    Liang, Xue-Hai; Crooke, Stanley T

    2011-06-01

    Little is known about whether components of the RNA-induced silencing complex (RISC) mediate the biogenesis of RNAs other than miRNA. Here, we show that depletion of key proteins of the RISC pathway by antisense oligonucleotides significantly impairs pre-rRNA processing in human cells. In cells depleted of Drosha or Dicer, different precursors to 5.8S rRNA strongly accumulated, without affecting normal endonucleolytic cleavages. Moderate yet distinct processing defects were also observed in Ago2-depleted cells. Physical links between pre-rRNA and these proteins were identified by co-immunoprecipitation analyses. Interestingly, simultaneous depletion of Dicer and Drosha led to a different processing defect, causing slower production of 28S rRNA and its precursor. Both Dicer and Ago2 were detected in the nuclear fraction, and reduction of Dicer altered the structure of the nucleolus, where pre-rRNA processing occurs. Together, these results suggest that Drosha and Dicer are implicated in rRNA biogenesis.

  4. Single-molecule fluorescence measurements reveal the reaction mechanisms of the core RISC, composed of human Argonaute 2 and a guide RNA.

    Science.gov (United States)

    Jo, Myung Hyun; Song, Ji-Joon; Hohng, Sungchul

    2015-12-01

    In eukaryotes, small RNAs play important roles in both gene regulation and resistance to viral infection. Argonaute proteins have been identified as a key component of the effector complexes of various RNA-silencing pathways, but the mechanistic roles of Argonaute proteins in these pathways are not clearly understood. To address this question, we performed single-molecule fluorescence experiments using an RNA-induced silencing complex (core-RISC) composed of a small RNA and human Argonaute 2. We found that target binding of core-RISC starts at the seed region of the guide RNA. After target binding, four distinct reactions followed: target cleavage, transient binding, stable binding, and Argonaute unloading. Target cleavage required extensive sequence complementarity and accelerated core-RISC dissociation for recycling. In contrast, the stable binding of core-RISC to target RNAs required seed-match only, suggesting a potential explanation for the seed-match rule of microRNA (miRNA) target selection.

  5. Statistical Use of Argonaute Expression and RISC Assembly in microRNA Target Identification

    Science.gov (United States)

    Stanhope, Stephen A.; Sengupta, Srikumar; den Boon, Johan; Ahlquist, Paul; Newton, Michael A.

    2009-01-01

    MicroRNAs (miRNAs) posttranscriptionally regulate targeted messenger RNAs (mRNAs) by inducing cleavage or otherwise repressing their translation. We address the problem of detecting m/miRNA targeting relationships in homo sapiens from microarray data by developing statistical models that are motivated by the biological mechanisms used by miRNAs. The focus of our modeling is the construction, activity, and mediation of RNA-induced silencing complexes (RISCs) competent for targeted mRNA cleavage. We demonstrate that regression models accommodating RISC abundance and controlling for other mediating factors fit the expression profiles of known target pairs substantially better than models based on m/miRNA expressions alone, and lead to verifications of computational target pair predictions that are more sensitive than those based on marginal expression levels. Because our models are fully independent of exogenous results from sequence-based computational methods, they are appropriate for use as either a primary or secondary source of information regarding m/miRNA target pair relationships, especially in conjunction with high-throughput expression studies. PMID:19779550

  6. A viral suppressor of RNA silencing inhibits ARGONAUTE 1 function by precluding target RNA binding to pre-assembled RISC.

    Science.gov (United States)

    Kenesi, Erzsébet; Carbonell, Alberto; Lózsa, Rita; Vértessy, Beáta; Lakatos, Lóránt

    2017-07-27

    In most eukaryotes, RNA silencing is an adaptive immune system regulating key biological processes including antiviral defense. To evade this response, viruses of plants, worms and insects have evolved viral suppressors of RNA silencing proteins (VSRs). Various VSRs, such as P1 from Sweet potato mild mottle virus (SPMMV), inhibit the activity of RNA-induced silencing complexes (RISCs) including an ARGONAUTE (AGO) protein loaded with a small RNA. However, the specific mechanisms explaining this class of inhibition are unknown. Here, we show that SPMMV P1 interacts with AGO1 and AGO2 from Arabidopsis thaliana, but solely interferes with AGO1 function. Moreover, a mutational analysis of a newly identified zinc finger domain in P1 revealed that this domain could represent an effector domain as it is required for P1 suppressor activity but not for AGO1 binding. Finally, a comparative analysis of the target RNA binding capacity of AGO1 in the presence of wild-type or suppressor-defective P1 forms revealed that P1 blocks target RNA binding to AGO1. Our results describe the negative regulation of RISC, the small RNA containing molecular machine. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. ATP-dependent human RISC assembly pathways.

    Science.gov (United States)

    Yoda, Mayuko; Kawamata, Tomoko; Paroo, Zain; Ye, Xuecheng; Iwasaki, Shintaro; Liu, Qinghua; Tomari, Yukihide

    2010-01-01

    The assembly of RNA-induced silencing complex (RISC) is a key process in small RNA-mediated gene silencing. In humans, small interfering RNAs (siRNAs) and microRNAs (miRNAs) are incorporated into RISCs containing the Argonaute (AGO) subfamily proteins Ago1-4. Previous studies have proposed that, unlike Drosophila melanogaster RISC assembly pathways, human RISC assembly is coupled with dicing and is independent of ATP. Here we show by careful reexamination that, in humans, RISC assembly and dicing are uncoupled, and ATP greatly facilitates RISC loading of small-RNA duplexes. Moreover, all four human AGO proteins show remarkably similar structural preferences for small-RNA duplexes: central mismatches promote RISC loading, and seed or 3'-mid (guide position 12-15) mismatches facilitate unwinding. All these features of human AGO proteins are highly reminiscent of fly Ago1 but not fly Ago2.

  8. Dicer is dispensable for asymmetric RISC loading in mammals.

    Science.gov (United States)

    Betancur, Juan G; Tomari, Yukihide

    2012-01-01

    In flies, asymmetric loading of small RNA duplexes into Argonaute2-containing RNA-induced silencing complex (Ago2-RISC) requires Dicer-2/R2D2 heterodimer, which acts as a protein sensor for the thermodynamic stabilities of the ends of small RNA duplexes. However, the mechanism of small RNA asymmetry sensing in mammalian RISC assembly remains obscure. Here, we quantitatively examined RISC assembly and target silencing activity in the presence or absence of Dicer in mammals. Our data show that, unlike the well-characterized fly Ago2-RISC assembly pathway, mammalian Dicer is dispensable for asymmetric RISC loading in vivo and in vitro.

  9. Wig1 prevents cellular senescence by regulating p21 mRNA decay through control of RISC recruitment.

    Science.gov (United States)

    Kim, Bong Cho; Lee, Hyung Chul; Lee, Je-Jung; Choi, Chang-Min; Kim, Dong-Kwan; Lee, Jae Cheol; Ko, Young-Gyu; Lee, Jae-Seon

    2012-11-14

    Premature senescence, a key strategy used to suppress carcinogenesis, can be driven by p53/p21 proteins in response to various stresses. Here, we demonstrate that Wig1 plays a critical role in this process through regulation of p21 mRNA stability. Wig1 controls the association of Argonaute2 (Ago2), a central component of the RNA-induced silencing complex (RISC), with target p21 mRNA via binding of the stem-loop structure near the microRNA (miRNA) target site. Depletion of Wig1 prohibited miRNA-mediated p21 mRNA decay and resulted in premature senescence. Wig1 plays an essential role in cell proliferation, as demonstrated in tumour xenografts in mice, and Wig1 and p21 mRNA levels are inversely correlated in human normal and cancer tissues. Together, our data indicate a novel role of Wig1 in RISC target accessibility, which is a key step in RNA-mediated gene silencing. In addition, these findings indicate that fine-tuning of p21 levels by Wig1 is essential for the prevention of cellular senescence.

  10. Effective Anti-miRNA Oligonucleotides Show High Releasing Rate of MicroRNA from RNA-Induced Silencing Complex.

    Science.gov (United States)

    Ariyoshi, Jumpei; Matsuyama, Yohei; Kobori, Akio; Murakami, Akira; Sugiyama, Hiroshi; Yamayoshi, Asako

    2017-10-01

    MicroRNAs (miRNAs) regulate gene expression by forming RNA-induced silencing complexes (RISCs) and have been considered as promising therapeutic targets. MiRNA is an essential component of RISC for the modulation of gene expression. Therefore, the release of miRNA from RISC is considered as an effective method for the inhibition of miRNA functions. In our previous study, we reported that anti-miRNA oligonucleotides (AMOs), which are composed of the 2'-O-methyl (2'-OMe) RNA, could induce the release of miRNA from RISC. However, the mechanisms underlying the miRNA-releasing effects of chemically modified AMOs, which are conventionally used as anti-cancer drugs, are still unclear. In this study, we investigated the relationship between the miRNA releasing rate from RISC and the inhibitory effect on RISC activity (IC 50 ) using conventional chemically modified AMOs. We demonstrated that the miRNA-releasing effects of AMOs are directly proportional to the IC 50 values, and AMOs, which have an ability to promote the release of miRNA from RISC, can effectively inhibit RISC activity in living cells.

  11. Polerovirus protein P0 prevents the assembly of small RNA-containing RISC complexes and leads to degradation of ARGONAUTE1.

    Science.gov (United States)

    Csorba, Tibor; Lózsa, Rita; Hutvágner, György; Burgyán, József

    2010-05-01

    RNA silencing plays an important role in plants in defence against viruses. To overcome this defence, plant viruses encode suppressors of RNA silencing. The most common mode of silencing suppression is sequestration of double-stranded RNAs involved in the antiviral silencing pathways. Viral suppressors can also overcome silencing responses through protein-protein interaction. The poleroviral P0 silencing suppressor protein targets ARGONAUTE (AGO) proteins for degradation. AGO proteins are the core component of the RNA-induced silencing complex (RISC). We found that P0 does not interfere with the slicer activity of pre-programmed siRNA/miRNA containing AGO1, but prevents de novo formation of siRNA/miRNA containing AGO1. We show that the AGO1 protein is part of a high-molecular-weight complex, suggesting the existence of a multi-protein RISC in plants. We propose that P0 prevents RISC assembly by interacting with one of its protein components, thus inhibiting formation of siRNA/miRNA-RISC, and ultimately leading to AGO1 degradation. Our findings also suggest that siRNAs enhance the stability of co-expressed AGO1 in both the presence and absence of P0.

  12. Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple-turnover

    Science.gov (United States)

    Rawlings, Renata A.; Krishnan, Vishalakshi; Walter, Nils G.

    2011-01-01

    RNA interference (RNAi) is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response against viruses and retrotransposons. During viral infection, the RNase III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs), 21–24 nucleotides in length, and helps load them into the RNA-induced silencing complex (RISC) to guide cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressor (RSS) proteins that tightly, and presumably quantitatively, bind siRNAs to thwart RNAi-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus (CIRV), as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding ((1.69 ± 0.07)×108 M−1s−1) and marked dissociation (koff = 0.062 ± 0.002 s−1). We also observe that p19 efficiently competes with recombinant Dicer and inhibits formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple-turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. PMID:21354178

  13. SKI2 mediates degradation of RISC 5′-cleavage fragments and prevents secondary siRNA production from miRNA targets in Arabidopsis

    Science.gov (United States)

    Branscheid, Anja; Marchais, Antonin; Schott, Gregory; Lange, Heike; Gagliardi, Dominique; Andersen, Stig Uggerhøj; Voinnet, Olivier; Brodersen, Peter

    2015-01-01

    Small regulatory RNAs are fundamental in eukaryotic and prokaryotic gene regulation. In plants, an important element of post-transcriptional control is effected by 20–24 nt microRNAs (miRNAs) and short interfering RNAs (siRNAs) bound to the ARGONAUTE1 (AGO1) protein in an RNA induced silencing complex (RISC). AGO1 may cleave target mRNAs with small RNA complementarity, but the fate of the resulting cleavage fragments remains incompletely understood. Here, we show that SKI2, SKI3 and SKI8, subunits of a cytoplasmic cofactor of the RNA exosome, are required for degradation of RISC 5′, but not 3′-cleavage fragments in Arabidopsis. In the absence of SKI2 activity, many miRNA targets produce siRNAs via the RNA-dependent RNA polymerase 6 (RDR6) pathway. These siRNAs are low-abundant, and map close to the cleavage site. In most cases, siRNAs were produced 5′ to the cleavage site, but several examples of 3′-spreading were also identified. These observations suggest that siRNAs do not simply derive from RDR6 action on stable 5′-cleavage fragments and hence that SKI2 has a direct role in limiting secondary siRNA production in addition to its function in mediating degradation of 5′-cleavage fragments. PMID:26464441

  14. SKI2 mediates degradation of RISC 5'-cleavage fragments and prevents secondary siRNA production from miRNA targets in Arabidopsis.

    Science.gov (United States)

    Branscheid, Anja; Marchais, Antonin; Schott, Gregory; Lange, Heike; Gagliardi, Dominique; Andersen, Stig Uggerhøj; Voinnet, Olivier; Brodersen, Peter

    2015-12-15

    Small regulatory RNAs are fundamental in eukaryotic and prokaryotic gene regulation. In plants, an important element of post-transcriptional control is effected by 20-24 nt microRNAs (miRNAs) and short interfering RNAs (siRNAs) bound to the ARGONAUTE1 (AGO1) protein in an RNA induced silencing complex (RISC). AGO1 may cleave target mRNAs with small RNA complementarity, but the fate of the resulting cleavage fragments remains incompletely understood. Here, we show that SKI2, SKI3 and SKI8, subunits of a cytoplasmic cofactor of the RNA exosome, are required for degradation of RISC 5', but not 3'-cleavage fragments in Arabidopsis. In the absence of SKI2 activity, many miRNA targets produce siRNAs via the RNA-dependent RNA polymerase 6 (RDR6) pathway. These siRNAs are low-abundant, and map close to the cleavage site. In most cases, siRNAs were produced 5' to the cleavage site, but several examples of 3'-spreading were also identified. These observations suggest that siRNAs do not simply derive from RDR6 action on stable 5'-cleavage fragments and hence that SKI2 has a direct role in limiting secondary siRNA production in addition to its function in mediating degradation of 5'-cleavage fragments. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Sensing miRNA: Signal Amplification by Cognate RISC for Intracellular Detection of miRNA in Live Cells.

    Science.gov (United States)

    Kavishwar, Amol; Medarova, Zdravka

    2016-01-01

    The ability to detect miRNA expression in live cells would leave these cells available for further manipulation or culture. Here, we describe the design of a miRNA sensor oligonucleotide whose sequence mimics the target mRNA. The sensor has a fluorescent label on one end of the oligo and a quencher on the other. When inside the cell, the sensor is recognized by its cognate miRNA-RISC and gets cleaved, setting the fluorophore free from its quencher. This results in fluorescence "turn on." Since cleavage by the RISC complex is an enzymatic process, the described approach has a very high level of sensitivity (nM). The rate of nonspecific cleavage of the sensor is very slow permitting the collection of meaningful signal over a long period of time.

  16. The microRNA and messengerRNA profile of the RNA-induced silencing complex in human primary astrocyte and astrocytoma cells.

    Science.gov (United States)

    Moser, Joanna J; Fritzler, Marvin J

    2010-10-18

    GW/P bodies are cytoplasmic ribonucleoprotein-rich foci involved in microRNA (miRNA)-mediated messenger RNA (mRNA) silencing and degradation. The mRNA regulatory functions within GW/P bodies are mediated by GW182 and its binding partner hAgo2 that bind miRNA in the RNA-induced silencing complex (RISC). To date there are no published reports of the profile of miRNA and mRNA targeted to the RISC or a comparison of the RISC-specific miRNA/mRNA profile differences in malignant and non-malignant cells. RISC mRNA and miRNA components were profiled by microarray analysis of malignant human U-87 astrocytoma cells and its non-malignant counterpart, primary human astrocytes. Total cell RNA as well as RNA from immunoprecipitated RISC was analyzed. The novel findings were fourfold: (1) miRNAs were highly enriched in astrocyte RISC compared to U-87 astrocytoma RISC, (2) astrocytoma and primary astrocyte cells each contained unique RISC miRNA profiles as compared to their respective cellular miRNA profiles, (3) miR-195, 10b, 29b, 19b, 34a and 455-3p levels were increased and the miR-181b level was decreased in U-87 astrocytoma RISC as compared to astrocyte RISC, and (4) the RISC contained decreased levels of mRNAs in primary astrocyte and U-87 astrocytoma cells. The observation that miR-34a and miR-195 levels were increased in the RISC of U-87 astrocytoma cells suggests an oncogenic role for these miRNAs. Differential regulation of mRNAs by specific miRNAs is evidenced by the observation that three miR34a-targeted mRNAs and two miR-195-targeted mRNAs were downregulated while one miR-195-targeted mRNA was upregulated. Biological pathway analysis of RISC mRNA components suggests that the RISC plays a pivotal role in malignancy and other conditions. This study points to the importance of the RISC and ultimately GW/P body composition and function in miRNA and mRNA deregulation in astrocytoma cells and possibly in other malignancies.

  17. The microRNA and messengerRNA profile of the RNA-induced silencing complex in human primary astrocyte and astrocytoma cells.

    Directory of Open Access Journals (Sweden)

    Joanna J Moser

    2010-10-01

    Full Text Available GW/P bodies are cytoplasmic ribonucleoprotein-rich foci involved in microRNA (miRNA-mediated messenger RNA (mRNA silencing and degradation. The mRNA regulatory functions within GW/P bodies are mediated by GW182 and its binding partner hAgo2 that bind miRNA in the RNA-induced silencing complex (RISC. To date there are no published reports of the profile of miRNA and mRNA targeted to the RISC or a comparison of the RISC-specific miRNA/mRNA profile differences in malignant and non-malignant cells.RISC mRNA and miRNA components were profiled by microarray analysis of malignant human U-87 astrocytoma cells and its non-malignant counterpart, primary human astrocytes. Total cell RNA as well as RNA from immunoprecipitated RISC was analyzed. The novel findings were fourfold: (1 miRNAs were highly enriched in astrocyte RISC compared to U-87 astrocytoma RISC, (2 astrocytoma and primary astrocyte cells each contained unique RISC miRNA profiles as compared to their respective cellular miRNA profiles, (3 miR-195, 10b, 29b, 19b, 34a and 455-3p levels were increased and the miR-181b level was decreased in U-87 astrocytoma RISC as compared to astrocyte RISC, and (4 the RISC contained decreased levels of mRNAs in primary astrocyte and U-87 astrocytoma cells.The observation that miR-34a and miR-195 levels were increased in the RISC of U-87 astrocytoma cells suggests an oncogenic role for these miRNAs. Differential regulation of mRNAs by specific miRNAs is evidenced by the observation that three miR34a-targeted mRNAs and two miR-195-targeted mRNAs were downregulated while one miR-195-targeted mRNA was upregulated. Biological pathway analysis of RISC mRNA components suggests that the RISC plays a pivotal role in malignancy and other conditions. This study points to the importance of the RISC and ultimately GW/P body composition and function in miRNA and mRNA deregulation in astrocytoma cells and possibly in other malignancies.

  18. Conversion of pre-RISC to holo-RISC by Ago2 during assembly of RNAi complexes

    Science.gov (United States)

    Kim, Kevin; Lee, Young Sik; Carthew, Richard W.

    2007-01-01

    In the Drosophila RNA interference (RNAi) pathway, small interfering RNAs (siRNAs) direct Argonaute2 (Ago2), an endonuclease, within the RNA-induced silencing complex (RISC) to cleave complementary mRNA targets. In vitro studies have shown that, for each siRNA duplex, RISC retains only one strand, the guide, and releases the other, the passenger, to form a holo-RISC complex. Here, we have isolated a new Ago2 mutant allele and provide, for the first time, in vivo evidence that endogenous Ago2 slicer activity is important to mount an RNAi response in Drosophila. We demonstrate in vivo that efficient removal of the passenger strand from RISC requires the cleavage activity of Ago2. We have also identified a new intermediate complex in the RISC assembly pathway, pre-RISC, in which Ago2 is stably bound to double-stranded siRNA. PMID:17123955

  19. Microbial Disruption of Autophagy Alters Expression of the RISC Component AGO2, a Critical Regulator of the miRNA Silencing Pathway.

    Science.gov (United States)

    Sibony, Michal; Abdullah, Majd; Greenfield, Laura; Raju, Deepa; Wu, Ted; Rodrigues, David M; Galindo-Mata, Esther; Mascarenhas, Heidi; Philpott, Dana J; Silverberg, Mark S; Jones, Nicola L

    2015-12-01

    Autophagy is implicated in Crohn's disease (CD) pathogenesis. Recent evidence suggests autophagy regulates the microRNA (miRNA)-induced silencing complex (miRISC). Therefore, autophagy may play a novel role in CD by regulating expression of miRISC, thereby altering miRNA silencing. As microbes associated with CD can alter autophagy, we hypothesized that microbial disruption of autophagy affects the critical miRISC component AGO2. AGO2 expression was assessed in epithelial and immune cells, and intestinal organoids with disrupted autophagy. Microarray technology was used to determine the expression of downstream miRNAs in cells with defective autophagy. Increased AGO2 was detected in autophagy-deficient ATG5-/- and ATG16-/- mouse embryonic fibroblast cells (MEFs) in comparison with wild-type MEFs. Chemical agents and VacA toxin, which disrupt autophagy, increased AGO2 expression in MEFs, epithelial cells lines, and human monocytes, respectively. Increased AGO2 was also detected in ATG7-/- intestinal organoids, in comparison with wild-type organoids. Five miRNAs were differentially expressed in autophagy-deficient MEFs. Pathway enrichment analysis of the differentially expressed miRNAs implicated signaling pathways previously associated with CD. Taken together, our results suggest that autophagy is involved in the regulation of the critical miRISC component AGO2 in epithelial and immune cells and primary intestinal epithelial cells. We propose a mechanism by which autophagy alters miRNA expression, which likely impacts the regulation of CD-associated pathways. Furthermore, as enteric microbial products can manipulate autophagy and AGO2, our findings suggest a novel mechanism by which enteric microbes could influence miRNA to promote disease.

  20. Focusing on RISC assembly in mammalian cells.

    Science.gov (United States)

    Hong, Junmei; Wei, Na; Chalk, Alistair; Wang, Jue; Song, Yutong; Yi, Fan; Qiao, Ren-Ping; Sonnhammer, Erik L L; Wahlestedt, Claes; Liang, Zicai; Du, Quan

    2008-04-11

    RISC (RNA-induced silencing complex) is a central protein complex in RNAi, into which a siRNA strand is assembled to become effective in gene silencing. By using an in vitro RNAi reaction based on Drosophila embryo extract, an asymmetric model was recently proposed for RISC assembly of siRNA strands, suggesting that the strand that is more loosely paired at its 5' end is selectively assembled into RISC and results in target gene silencing. However, in the present study, we were unable to establish such a correlation in cell-based RNAi assays, as well as in large-scale RNAi data analyses. This suggests that the thermodynamic stability of siRNA is not a major determinant of gene silencing in mammalian cells. Further studies on fork siRNAs showed that mismatch at the 5' end of the siRNA sense strand decreased RISC assembly of the antisense strand, but surprisingly did not increase RISC assembly of the sense strand. More interestingly, measurements of melting temperature showed that the terminal stability of fork siRNAs correlated with the positions of the mismatches, but not gene silencing efficacy. In summary, our data demonstrate that there is no definite correlation between siRNA stability and gene silencing in mammalian cells, which suggests that instead of thermodynamic stability, other features of the siRNA duplex contribute to RISC assembly in RNAi.

  1. Focusing on RISC assembly in mammalian cells

    International Nuclear Information System (INIS)

    Hong Junmei; Wei Na; Chalk, Alistair; Wang Jue; Song, Yutong; Yi Fan; Qiao Renping; Sonnhammer, Erik L.L.; Wahlestedt, Claes; Liang Zicai; Du, Quan

    2008-01-01

    RISC (RNA-induced silencing complex) is a central protein complex in RNAi, into which a siRNA strand is assembled to become effective in gene silencing. By using an in vitro RNAi reaction based on Drosophila embryo extract, an asymmetric model was recently proposed for RISC assembly of siRNA strands, suggesting that the strand that is more loosely paired at its 5' end is selectively assembled into RISC and results in target gene silencing. However, in the present study, we were unable to establish such a correlation in cell-based RNAi assays, as well as in large-scale RNAi data analyses. This suggests that the thermodynamic stability of siRNA is not a major determinant of gene silencing in mammalian cells. Further studies on fork siRNAs showed that mismatch at the 5' end of the siRNA sense strand decreased RISC assembly of the antisense strand, but surprisingly did not increase RISC assembly of the sense strand. More interestingly, measurements of melting temperature showed that the terminal stability of fork siRNAs correlated with the positions of the mismatches, but not gene silencing efficacy. In summary, our data demonstrate that there is no definite correlation between siRNA stability and gene silencing in mammalian cells, which suggests that instead of thermodynamic stability, other features of the siRNA duplex contribute to RISC assembly in RNAi

  2. The nuclear receptor ERβ engages AGO2 in regulation of gene transcription, RNA splicing and RISC loading.

    Science.gov (United States)

    Tarallo, Roberta; Giurato, Giorgio; Bruno, Giuseppina; Ravo, Maria; Rizzo, Francesca; Salvati, Annamaria; Ricciardi, Luca; Marchese, Giovanna; Cordella, Angela; Rocco, Teresa; Gigantino, Valerio; Pierri, Biancamaria; Cimmino, Giovanni; Milanesi, Luciano; Ambrosino, Concetta; Nyman, Tuula A; Nassa, Giovanni; Weisz, Alessandro

    2017-10-06

    The RNA-binding protein Argonaute 2 (AGO2) is a key effector of RNA-silencing pathways It exerts a pivotal role in microRNA maturation and activity and can modulate chromatin remodeling, transcriptional gene regulation and RNA splicing. Estrogen receptor beta (ERβ) is endowed with oncosuppressive activities, antagonizing hormone-induced carcinogenesis and inhibiting growth and oncogenic functions in luminal-like breast cancers (BCs), where its expression correlates with a better prognosis of the disease. Applying interaction proteomics coupled to mass spectrometry to characterize nuclear factors cooperating with ERβ in gene regulation, we identify AGO2 as a novel partner of ERβ in human BC cells. ERβ-AGO2 association was confirmed in vitro and in vivo in both the nucleus and cytoplasm and is shown to be RNA-mediated. ChIP-Seq demonstrates AGO2 association with a large number of ERβ binding sites, and total and nascent RNA-Seq in ERβ + vs ERβ - cells, and before and after AGO2 knock-down in ERβ + cells, reveals a widespread involvement of this factor in ERβ-mediated regulation of gene transcription rate and RNA splicing. Moreover, isolation and sequencing by RIP-Seq of ERβ-associated long and small RNAs in the cytoplasm suggests involvement of the nuclear receptor in RISC loading, indicating that it may also be able to directly control mRNA translation efficiency and stability. These results demonstrate that AGO2 can act as a pleiotropic functional partner of ERβ, indicating that both factors are endowed with multiple roles in the control of key cellular functions.

  3. In vitro reconstitution of chaperone-mediated human RISC assembly.

    Science.gov (United States)

    Naruse, Ken; Matsuura-Suzuki, Eriko; Watanabe, Mariko; Iwasaki, Shintaro; Tomari, Yukihide

    2018-01-01

    To silence target mRNAs, small RNAs and Argonaute (Ago) proteins need to be assembled into RNA-induced silencing complexes (RISCs). Although the assembly of Drosophila melanogaster RISC was recently reconstituted by Ago2, the Dicer-2/R2D2 heterodimer, and five chaperone proteins, the absence of a reconstitution system for mammalian RISC assembly has posed analytical challenges. Here we describe reconstitution of human RISC assembly using Ago2 and five recombinant chaperone proteins: Hsp90β, Hsc70, Hop, Dnaja2, and p23. Our data show that ATP hydrolysis by both Hsp90β and Hsc70 is required for RISC assembly of small RNA duplexes but not for that of single-stranded RNAs. The reconstitution system lays the groundwork for further studies of small RNA-mediated gene silencing in mammals. © 2018 Naruse et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  4. Single-Molecule Analysis for RISC Assembly and Target Cleavage.

    Science.gov (United States)

    Sasaki, Hiroshi M; Tadakuma, Hisashi; Tomari, Yukihide

    2018-01-01

    RNA-induced silencing complex (RISC) is a small RNA-protein complex that mediates silencing of complementary target RNAs. Biochemistry has been successfully used to characterize the molecular mechanism of RISC assembly and function for nearly two decades. However, further dissection of intermediate states during the reactions has been warranted to fill in the gaps in our understanding of RNA silencing mechanisms. Single-molecule analysis with total internal reflection fluorescence (TIRF) microscopy is a powerful imaging-based approach to interrogate complex formation and dynamics at the individual molecule level with high sensitivity. Combining this technique with our recently established in vitro reconstitution system of fly Ago2-RISC, we have developed a single-molecule observation system for RISC assembly. In this chapter, we summarize the detailed protocol for single-molecule analysis of chaperone-assisted assembly of fly Ago2-RISC as well as its target cleavage reaction.

  5. Slicing-independent RISC activation requires the argonaute PAZ domain.

    Science.gov (United States)

    Gu, Shuo; Jin, Lan; Huang, Yong; Zhang, Feijie; Kay, Mark A

    2012-08-21

    Small RNAs regulate genetic networks through a ribonucleoprotein complex called the RNA-induced silencing complex (RISC), which, in mammals, contains at its center one of four Argonaute proteins (Ago1-Ago4). A key regulatory event in the RNA interference (RNAi) and microRNA (miRNA) pathways is Ago loading, wherein double-stranded small-RNA duplexes are incorporated into RISC (pre-RISC) and then become single-stranded (mature RISC), a process that is not well understood. The Agos contain an evolutionarily conserved PAZ (Piwi/Argonaute/Zwille) domain whose primary function is to bind the 3' end of small RNAs. We created multiple PAZ-domain-disrupted mutant Ago proteins and studied their biochemical properties and biological functionality in cells. We found that the PAZ domain is dispensable for Ago loading of slicing-competent RISC. In contrast, in the absence of slicer activity or slicer-substrate duplex RNAs, PAZ-disrupted Agos bound duplex small interfering RNAs, but were unable to unwind or eject the passenger strand and form functional RISC complexes. We have discovered that the highly conserved PAZ domain plays an important role in RISC activation, providing new mechanistic insights into how miRNAs regulate genes, as well as new insights for future design of miRNA- and RNAi-based therapeutics. Copyright © 2012 Elsevier Ltd. All rights reserved.

  6. Clarifying mammalian RISC assembly in vitro

    Directory of Open Access Journals (Sweden)

    Metzler David

    2011-04-01

    Full Text Available Abstract Background Argonaute, the core component of the RNA induced silencing complex (RISC, binds to mature miRNAs and regulates gene expression at transcriptional or post-transcriptional level. We recently reported that Argonaute 2 (Ago2 also assembles into complexes with miRNA precursors (pre-miRNAs. These Ago2:pre-miRNA complexes are catalytically active in vitro and constitute non-canonical RISCs. Results The use of pre-miRNAs as guides by Ago2 bypasses Dicer activity and complicates in vitro RISC reconstitution. In this work, we characterized Ago2:pre-miRNA complexes and identified RNAs that are targeted by miRNAs but not their corresponding pre-miRNAs. Using these target RNAs we were able to recapitulate in vitro pre-miRNA processing and canonical RISC loading, and define the minimal factors required for these processes. Conclusions Our results indicate that Ago2 and Dicer are sufficient for processing and loading of miRNAs into RISC. Furthermore, our studies suggest that Ago2 binds primarily to the 5'- and alternatively, to the 3'-end of select pre-miRNAs.

  7. C3PO, an endoribonuclease that promotes RNAi by facilitating RISC activation.

    Science.gov (United States)

    Liu, Ying; Ye, Xuecheng; Jiang, Feng; Liang, Chunyang; Chen, Dongmei; Peng, Junmin; Kinch, Lisa N; Grishin, Nick V; Liu, Qinghua

    2009-08-07

    The catalytic engine of RNA interference (RNAi) is the RNA-induced silencing complex (RISC), wherein the endoribonuclease Argonaute and single-stranded small interfering RNA (siRNA) direct target mRNA cleavage. We reconstituted long double-stranded RNA- and duplex siRNA-initiated RISC activities with the use of recombinant Drosophila Dicer-2, R2D2, and Ago2 proteins. We used this core reconstitution system to purify an RNAi regulator that we term C3PO (component 3 promoter of RISC), a complex of Translin and Trax. C3PO is a Mg2+-dependent endoribonuclease that promotes RISC activation by removing siRNA passenger strand cleavage products. These studies establish an in vitro RNAi reconstitution system and identify C3PO as a key activator of the core RNAi machinery.

  8. RISC assembly: Coordination between small RNAs and Argonaute proteins.

    Science.gov (United States)

    Kobayashi, Hotaka; Tomari, Yukihide

    2016-01-01

    Non-coding RNAs generally form ribonucleoprotein (RNP) complexes with their partner proteins to exert their functions. Small RNAs, including microRNAs, small interfering RNAs, and PIWI-interacting RNAs, assemble with Argonaute (Ago) family proteins into the effector complex called RNA-induced silencing complex (RISC), which mediates sequence-specific target gene silencing. RISC assembly is not a simple binding between a small RNA and Ago; rather, it follows an ordered multi-step pathway that requires specific accessory factors. Some steps of RISC assembly and RISC-mediated gene silencing are dependent on or facilitated by particular intracellular platforms, suggesting their spatial regulation. In this review, we summarize the currently known mechanisms for RISC assembly of each small RNA class and propose a revised model for the role of the chaperone machinery in the duplex-initiated RISC assembly pathway. This article is part of a Special Issue entitled: Clues to long noncoding RNA taxonomy1, edited by Dr. Tetsuro Hirose and Dr. Shinichi Nakagawa. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Cyclophilin 40 facilitates HSP90-mediated RISC assembly in plants.

    Science.gov (United States)

    Iki, Taichiro; Yoshikawa, Manabu; Meshi, Tetsuo; Ishikawa, Masayuki

    2012-01-18

    Posttranscriptional gene silencing is mediated by RNA-induced silencing complexes (RISCs) that contain AGO proteins and single-stranded small RNAs. The assembly of plant AGO1-containing RISCs depends on the molecular chaperone HSP90. Here, we demonstrate that cyclophilin 40 (CYP40), protein phosphatase 5 (PP5), and several other proteins with the tetratricopeptide repeat (TPR) domain associates with AGO1 in an HSP90-dependent manner in extracts of evacuolated tobacco protoplasts (BYL). Intriguingly, CYP40, but not the other TPR proteins, could form a complex with small RNA duplex-bound AGO1. Moreover, CYP40 that was synthesized by in-vitro translation using BYL uniquely facilitated binding of small RNA duplexes to AGO1, and as a result, increased the amount of mature RISCs that could cleave target RNAs. CYP40 was not contained in mature RISCs, indicating that the association is transient. Addition of PP5 or cyclophilin-binding drug cyclosporine A prevented the association of endogenous CYP40 with HSP90-AGO1 complex and inhibited RISC assembly. These results suggest that a complex of AGO1, HSP90, CYP40, and a small RNA duplex is a key intermediate of RISC assembly in plants.

  10. Structural determinants of miRNAs for RISC loading and slicer-independent unwinding.

    Science.gov (United States)

    Kawamata, Tomoko; Seitz, Hervé; Tomari, Yukihide

    2009-09-01

    MicroRNAs (miRNAs) regulate expression of their target mRNAs through the RNA-induced silencing complex (RISC), which contains an Argonaute (Ago) family protein as a core component. In Drosophila melanogaster, miRNAs are generally sorted into Ago1-containing RISC (Ago1-RISC). We established a native gel system that can biochemically dissect the Ago1-RISC assembly pathway. We found that miRNA-miRNA* duplexes are loaded into Ago1 as double-stranded RNAs in an ATP-dependent fashion. In contrast, unexpectedly, unwinding of miRNA-miRNA* duplexes is a passive process that does not require ATP or slicer activity of Ago1. Central mismatches direct miRNA-miRNA* duplexes into pre-Ago1-RISC, whereas mismatches in the seed or guide strand positions 12-15 promote conversion of pre-Ago1-RISC into mature Ago1-RISC. Our findings show that unwinding of miRNAs is a precise mirror-image process of target recognition, and both processes reflect the unique geometry of RNAs in Ago proteins.

  11. Autoantigen La promotes efficient RNAi, antiviral response, and transposon silencing by facilitating multiple-turnover RISC catalysis.

    Science.gov (United States)

    Liu, Ying; Tan, Huiling; Tian, Hui; Liang, Chunyang; Chen, She; Liu, Qinghua

    2011-11-04

    The effector of RNA interference (RNAi) is the RNA-induced silencing complex (RISC). C3PO promotes the activation of RISC by degrading the Argonaute2 (Ago2)-nicked passenger strand of duplex siRNA. Active RISC is a multiple-turnover enzyme that uses the guide strand of siRNA to direct the Ago2-mediated sequence-specific cleavage of complementary mRNA. How this effector step of RNAi is regulated is currently unknown. Here, we used the human Ago2 minimal RISC system to purify Sjögren's syndrome antigen B (SSB)/autoantigen La as an activator of the RISC-mediated mRNA cleavage activity. Our reconstitution studies showed that La could promote multiple-turnover RISC catalysis by facilitating the release of cleaved mRNA from RISC. Moreover, we demonstrated that La was required for efficient RNAi, antiviral defense, and transposon silencing in vivo. Taken together, the findings of C3PO and La reveal a general concept that regulatory factors are required to remove Ago2-cleaved products to assemble or restore active RISC. Copyright © 2011 Elsevier Inc. All rights reserved.

  12. RISC-Target Interaction: Cleavage and Translational Suppression

    Science.gov (United States)

    van den Berg, Arjen; Mols, Johann; Han, Jiahuai

    2008-01-01

    Summary Small RNA molecules have been known and utilized to suppress gene expression for more than a decade. The discovery that these small RNA molecules are endogenously expressed in many organisms and have a critical role in controlling gene expression have led to the arising of a whole new field of research. Termed small interfering RNA (siRNA) or microRNA (miRNA) these ~22 nt RNA molecules have the capability to suppress gene expression through various mechanisms once they are incorporated in the multi-protein RNA-Induced Silencing Complex (RISC) and interact with their target mRNA. This review introduces siRNAs and microRNAs in a historical perspective and focuses on the key molecules in RISC, structural properties and mechanisms underlying the process of small RNA regulated post-transcriptional suppression of gene expression. PMID:18692607

  13. RISC-interacting clearing 3'- 5' exoribonucleases (RICEs) degrade uridylated cleavage fragments to maintain functional RISC in Arabidopsis thaliana.

    Science.gov (United States)

    Zhang, Zhonghui; Hu, Fuqu; Sung, Min Woo; Shu, Chang; Castillo-González, Claudia; Koiwa, Hisashi; Tang, Guiliang; Dickman, Martin; Li, Pingwei; Zhang, Xiuren

    2017-05-02

    RNA-induced silencing complex (RISC) is composed of miRNAs and AGO proteins. AGOs use miRNAs as guides to slice target mRNAs to produce truncated 5' and 3' RNA fragments. The 5' cleaved RNA fragments are marked with uridylation for degradation. Here, we identified novel cofactors of Arabidopsis AGOs, named RICE1 and RICE2. RICE proteins specifically degraded single-strand (ss) RNAs in vitro; but neither miRNAs nor miRNA*s in vivo. RICE1 exhibited a DnaQ-like exonuclease fold and formed a homohexamer with the active sites located at the interfaces between RICE1 subunits. Notably, ectopic expression of catalytically-inactive RICE1 not only significantly reduced miRNA levels; but also increased 5' cleavage RISC fragments with extended uridine tails. We conclude that RICEs act to degrade uridylated 5' products of AGO cleavage to maintain functional RISC. Our study also suggests a possible link between decay of cleaved target mRNAs and miRNA stability in RISC.

  14. siRNAs targeted to certain polyadenylation sites promote specific, RISC-independent degradation of messenger RNAs.

    Science.gov (United States)

    Vickers, Timothy A; Crooke, Stanley T

    2012-07-01

    While most siRNAs induce sequence-specific target mRNA cleavage and degradation in a process mediated by Ago2/RNA-induced silencing complex (RISC), certain siRNAs have also been demonstrated to direct target RNA reduction through deadenylation and subsequent degradation of target transcripts in a process which involves Ago1/RISC and P-bodies. In the current study, we present data suggesting that a third class of siRNA exist, which are capable of promoting target RNA reduction that is independent of both Ago and RISC. These siRNAs bind the target messenger RNA at the polyA signal and are capable of redirecting a small amount of polyadenylation to downstream polyA sites when present, however, the majority of the activity appears to be due to inhibition of polyadenylation or deadenylation of the transcript, followed by exosomal degradation of the immature mRNA.

  15. The microRNA effector RNA-induced silencing complex in hidradenitis suppurativa: a significant dysregulation within active inflammatory lesions.

    Science.gov (United States)

    Hessam, S; Sand, M; Skrygan, M; Bechara, Falk G

    2017-09-01

    Recently, we could show that the expression levels of the key regulators of the microRNA (miRNA) maturation and transport were dysregulated in inflamed hidradenitis suppurativa (HS) tissue (Heyam et al. in Wiley Interdiscip Rev RNA 6:271-289, 2015). The RNA-induced silencing complex (RISC) is the central element of the miRNA pathway and regulates miRNA formation and function. We investigated the expression of the RISC components, namely transactivation-responsive RNA-binding protein-1 (TRBP1), TRBP2, protein activator (PACT) of the interferon-induced protein kinase R, Argonaute RISC Catalytic Component-1 (AGO1) and Component-2 (AGO2), metadherin, and staphylococcal nuclease and Tudor domain-containing-1 (SND1) in inflamed HS tissue compared to healthy and psoriatic controls by real-time reverse transcription polymerase chain reaction. Expression levels of all investigated components were significantly lower in lesional HS skin (n = 18) compared to healthy controls (n = 10). TRBP1, PACT, AGO1, AGO2, and SND1 expression levels were significantly down-regulated in lesional HS skin compared to healthy-appearing perilesional skin (n = 7). TRBP2 and SND1 expression levels were significantly lower in healthy-appearing perilesional skin compared to healthy controls. In lesional HS skin, expression levels of PACT, AGO1, and AGO2 were significantly lower compared to psoriatic skin (n = 10). In summary, our data showed that all investigated components of RISC are dysregulated in the skin of HS patients, providing support for the hypothesis that miRNAs may have a pathological role in the inflammatory pathogenesis of HS.

  16. The co-chaperones Fkbp4/5 control Argonaute2 expression and facilitate RISC assembly.

    Science.gov (United States)

    Martinez, Natalia J; Chang, Hao-Ming; Borrajo, Jacob de Riba; Gregory, Richard I

    2013-11-01

    Argonaute2 (Ago2) protein and associated microRNAs (miRNAs) or small interfering RNAs (siRNAs) form the RNA-induced silencing complex (RISC) for target messenger RNA cleavage and post-transcriptional gene silencing. Although Ago2 is essential for RISC activity, the mechanism of RISC assembly is not well understood, and factors controlling Ago2 protein expression are largely unknown. A role for the Hsc70/Hsp90 chaperone complex in loading small RNA duplexes into the RISC has been demonstrated in cell extracts, and unloaded Ago2 is unstable and degraded by the lysosome in mammalian cells. Here we identify the co-chaperones Fkbp4 and Fkbp5 as Ago2-associated proteins in mouse embryonic stem cells. Pharmacological inhibition of this interaction using FK506 or siRNA-mediated Fkbp4/5 depletion leads to decreased Ago2 protein levels. We find FK506 treatment inhibits, whereas Fkbp4/5 overexpression promotes, miRNA-mediated stabilization of Ago2 expression. Simultaneous treatment with a lysosome inhibitor revealed the accumulation of unloaded Ago2 complexes in FK506-treated cells. We find that, consistent with unloaded miRNAs being unstable, FK506 treatment also affects miRNA abundance, particularly nascent miRNAs. Our results support a role for Fkbp4/5 in RISC assembly.

  17. Argonaute pull-down and RISC analysis using 2'-O-methylated oligonucleotides affinity matrices.

    Science.gov (United States)

    Jannot, Guillaume; Vasquez-Rifo, Alejandro; Simard, Martin J

    2011-01-01

    During the last decade, several novel small non-coding RNA pathways have been unveiled, which reach out to many biological processes. Common to all these pathways is the binding of a small RNA molecule to a protein member of the Argonaute family, which forms a minimal core complex called the RNA-induced silencing complex or RISC. The RISC targets mRNAs in a sequence-specific manner, either to induce mRNA cleavage through the intrinsic activity of the Argonaute protein or to abrogate protein synthesis by a mechanism that is still under investigation. We describe here, in details, a method for the affinity chromatography of the let-7 RISC starting from extracts of the nematode Caenorhabditis elegans. Our method exploits the sequence specificity of the RISC and makes use of biotinylated and 2'-O-methylated oligonucleotides to trap and pull-down small RNAs and their associated proteins. Importantly, this technique may easily be adapted to target other small RNAs expressed in different cell types or model organisms. This method provides a useful strategy to identify the proteins associated with the RISC, and hence gain insight in the functions of small RNAs.

  18. Differential RISC association of endogenous human microRNAs predicts their inhibitory potential.

    Science.gov (United States)

    Flores, Omar; Kennedy, Edward M; Skalsky, Rebecca L; Cullen, Bryan R

    2014-04-01

    It has previously been assumed that the generally high stability of microRNAs (miRNAs) reflects their tight association with Argonaute (Ago) proteins, essential components of the RNA-induced silencing complex (RISC). However, recent data have suggested that the majority of mature miRNAs are not, in fact, Ago associated. Here, we demonstrate that endogenous human miRNAs vary widely, by >100-fold, in their level of RISC association and show that the level of Ago binding is a better indicator of inhibitory potential than is the total level of miRNA expression. While miRNAs of closely similar sequence showed comparable levels of RISC association in the same cell line, these varied between different cell types. Moreover, the level of RISC association could be modulated by overexpression of complementary target mRNAs. Together, these data indicate that the level of RISC association of a given endogenous miRNA is regulated by the available RNA targetome and predicts miRNA function.

  19. An antiviral RISC isolated from Tobacco rattle virus-infected plants.

    Science.gov (United States)

    Ciomperlik, Jessica J; Omarov, Rustem T; Scholthof, Herman B

    2011-03-30

    The RNAi model predicts that during antiviral defense a RNA-induced silencing complex (RISC) is programmed with viral short-interfering RNAs (siRNAs) to target the cognate viral RNA for degradation. We show that infection of Nicotiana benthamiana with Tobacco rattle virus (TRV) activates an antiviral nuclease that specifically cleaves TRV RNA in vitro. In agreement with known RISC properties, the nuclease activity was inhibited by NaCl and EDTA and stimulated by divalent metal cations; a novel property was its preferential targeting of elongated RNA molecules. Intriguingly, the specificity of the TRV RISC could be reprogrammed by exogenous addition of RNA (containing siRNAs) from plants infected with an unrelated virus, resulting in a newly acquired ability of RISC to target this heterologous genome in vitro. Evidently the virus-specific nuclease complex from N. benthamiana represents a genuine RISC that functions as a readily employable and reprogrammable antiviral defense unit. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. An in vitro reprogrammable antiviral RISC with size-preferential ribonuclease activity.

    Science.gov (United States)

    Omarov, Rustem T; Ciomperlik, Jessica; Scholthof, Herman B

    2016-03-01

    Infection of Nicotiana benthamiana plants with Tomato bushy stunt virus (TBSV) mutants compromised for silencing suppression induces formation of an antiviral RISC (vRISC) that can be isolated using chromatography procedures. The isolated vRISC sequence-specifically degrades TBSV RNA in vitro, its activity can be down-regulated by removing siRNAs, and re-stimulated by exogenous supply of siRNAs. vRISC is most effective at hydrolyzing the ~4.8kb genomic RNA, but less so for a ~2.2kb TBSV subgenomic mRNA (sgRNA1), while the 3' co-terminal sgRNA2 of ~0.9kb appears insensitive to vRISC cleavage. Moreover, experiments with in vitro generated 5' co-terminal viral transcripts show that RNAs of ~2.7kb are efficiently cleaved while those of ~1.1kb or shorter are unaffected. The isolated antiviral ribonuclease complex fails to degrade ~0.4kb defective interfering RNAs (DIs) in vitro, agreeing with findings that in plants DIs are not targeted by silencing. Copyright © 2016. Published by Elsevier Inc.

  1. Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates.

    Science.gov (United States)

    Flores-Jasso, C Fabián; Salomon, William E; Zamore, Phillip D

    2013-02-01

    Small interfering RNAs (siRNAs) direct Argonaute proteins, the core components of the RNA-induced silencing complex (RISC), to cleave complementary target RNAs. Here, we describe a method to purify active RISC containing a single, unique small RNA guide sequence. We begin by capturing RISC using a complementary 2'-O-methyl oligonucleotide tethered to beads. Unlike other methods that capture RISC but do not allow its recovery, our strategy purifies active, soluble RISC in good yield. The method takes advantage of the finding that RISC partially paired to a target through its siRNA guide dissociates more than 300 times faster than a fully paired siRNA in RISC. We use this strategy to purify fly Ago1- and Ago2-RISC, as well as mouse AGO2-RISC. The method can discriminate among RISCs programmed with different guide strands, making it possible to deplete and recover specific RISC populations. Endogenous microRNA:Argonaute complexes can also be purified from cell lysates. Our method scales readily and takes less than a day to complete.

  2. RISC-interacting clearing 3’- 5’ exoribonucleases (RICEs) degrade uridylated cleavage fragments to maintain functional RISC in Arabidopsis thaliana

    Science.gov (United States)

    Zhang, Zhonghui; Hu, Fuqu; Sung, Min Woo; Shu, Chang; Castillo-González, Claudia; Koiwa, Hisashi; Tang, Guiliang; Dickman, Martin; Li, Pingwei; Zhang, Xiuren

    2017-01-01

    RNA-induced silencing complex (RISC) is composed of miRNAs and AGO proteins. AGOs use miRNAs as guides to slice target mRNAs to produce truncated 5' and 3' RNA fragments. The 5' cleaved RNA fragments are marked with uridylation for degradation. Here, we identified novel cofactors of Arabidopsis AGOs, named RICE1 and RICE2. RICE proteins specifically degraded single-strand (ss) RNAs in vitro; but neither miRNAs nor miRNA*s in vivo. RICE1 exhibited a DnaQ-like exonuclease fold and formed a homohexamer with the active sites located at the interfaces between RICE1 subunits. Notably, ectopic expression of catalytically-inactive RICE1 not only significantly reduced miRNA levels; but also increased 5' cleavage RISC fragments with extended uridine tails. We conclude that RICEs act to degrade uridylated 5’ products of AGO cleavage to maintain functional RISC. Our study also suggests a possible link between decay of cleaved target mRNAs and miRNA stability in RISC. DOI: http://dx.doi.org/10.7554/eLife.24466.001 PMID:28463111

  3. Alfalfa dwarf cytorhabdovirus P protein is a local and systemic RNA silencing supressor which inhibits programmed RISC activity and prevents transitive amplification of RNA silencing.

    Science.gov (United States)

    Bejerman, Nicolás; Mann, Krin S; Dietzgen, Ralf G

    2016-09-15

    Plants employ RNA silencing as an innate defense mechanism against viruses. As a counter-defense, plant viruses have evolved to express RNA silencing suppressor proteins (RSS), which target one or more steps of the silencing pathway. In this study, we show that the phosphoprotein (P) encoded by the negative-sense RNA virus alfalfa dwarf virus (ADV), a species of the genus Cytorhabdovirus, family Rhabdoviridae, is a suppressor of RNA silencing. ADV P has a relatively weak local RSS activity, and does not prevent siRNA accumulation. On the other hand, ADV P strongly suppresses systemic RNA silencing, but does not interfere with the short-distance spread of silencing, which is consistent with its lack of inhibition of siRNA accumulation. The mechanism of suppression appears to involve ADV P binding to RNA-induced silencing complex proteins AGO1 and AGO4 as shown in protein-protein interaction assays when ectopically expressed. In planta, we demonstrate that ADV P likely functions by inhibiting miRNA-guided AGO1 cleavage and prevents transitive amplification by repressing the production of secondary siRNAs. As recently described for lettuce necrotic yellows cytorhabdovirus P, but in contrast to other viral RSS known to disrupt AGO activity, ADV P sequence does not contain any recognizable GW/WG or F-box motifs, which suggests that cytorhabdovirus P proteins may use alternative motifs to bind to AGO proteins. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

  4. TAF11 assembles RISC loading complex to enhance RNAi efficiency

    Science.gov (United States)

    Liang, Chunyang; Wang, Yibing; Murota, Yukiko; Liu, Xiang; Smith, Dean; Siomi, Mikiko C.; Liu, Qinghua

    2015-01-01

    SUMMARY Assembly of the RNA-induced silencing complex (RISC) requires formation of the RISC loading complex (RLC), which contains Dicer-2(Dcr-2)-R2D2 complex and recruits duplex siRNA to Ago2 in Drosophila melanogaster. However, the precise composition and action mechanism of Drosophila RLC remain unclear. Here, we identified the missing factor of RLC as TATA-binding protein associated factor 11 (TAF11) by genetic screen. Although an annotated nuclear transcription factor, we found that TAF11 also associated with Dcr-2/R2D2 and localized to cytoplasmic D2 bodies. Consistent with defective RLC assembly in taf11−/− ovary extract, we reconstituted the RLC in vitro using recombinant Dcr-2-R2D2 complex, TAF11, and duplex siRNA. Furthermore, we showed that TAF11 tetramer facilitates Dcr-2-R2D2 tetramerization to enhance siRNA binding and RISC loading activities. Together, our genetic and biochemical studies define the molecular nature of Drosophila RLC and elucidate a novel cytoplasmic function of TAF11 in organizing RLC assembly to enhance RNAi efficiency. PMID:26257286

  5. Anatomy of RISC: how do small RNAs and chaperones activate Argonaute proteins?

    Science.gov (United States)

    Nakanishi, Kotaro

    2016-09-01

    RNA silencing is a eukaryote-specific phenomenon in which microRNAs and small interfering RNAs degrade messenger RNAs containing a complementary sequence. To this end, these small RNAs need to be loaded onto an Argonaute protein (AGO protein) to form the effector complex referred to as RNA-induced silencing complex (RISC). RISC assembly undergoes multiple and sequential steps with the aid of Hsc70/Hsp90 chaperone machinery. The molecular mechanisms for this assembly process remain unclear, despite their significance for the development of gene silencing techniques and RNA interference-based therapeutics. This review dissects the currently available structures of AGO proteins and proposes models and hypotheses for RISC assembly, covering the conformation of unloaded AGO proteins, the chaperone-assisted duplex loading, and the slicer-dependent and slicer-independent duplex separation. The differences in the properties of RISC between prokaryotes and eukaryotes will also be clarified. WIREs RNA 2016, 7:637-660. doi: 10.1002/wrna.1356 For further resources related to this article, please visit the WIREs website. © 2016 The Authors. WIREs RNA published by Wiley Periodicals, Inc.

  6. Fluorescence correlation spectroscopy and fluorescence cross-correlation spectroscopy reveal the cytoplasmic origination of loaded nuclear RISC in vivo in human cells.

    Science.gov (United States)

    Ohrt, Thomas; Mütze, Jörg; Staroske, Wolfgang; Weinmann, Lasse; Höck, Julia; Crell, Karin; Meister, Gunter; Schwille, Petra

    2008-11-01

    Studies of RNA interference (RNAi) provide evidence that in addition to the well-characterized cytoplasmic mechanisms, nuclear mechanisms also exist. The mechanism by which the nuclear RNA-induced silencing complex (RISC) is formed in mammalian cells, as well as the relationship between the RNA silencing pathways in nuclear and cytoplasmic compartments is still unknown. Here we show by applying fluorescence correlation and cross-correlation spectroscopy (FCS/FCCS) in vivo that two distinct RISC exist: a large approximately 3 MDa complex in the cytoplasm and a 20-fold smaller complex of approximately 158 kDa in the nucleus. We further show that nuclear RISC, consisting only of Ago2 and a short RNA, is loaded in the cytoplasm and imported into the nucleus. The loaded RISC accumulates in the nucleus depending on the presence of a target, based on an miRNA-like interaction with impaired cleavage of the cognate RNA. Together, these results suggest a new RISC shuttling mechanism between nucleus and cytoplasm ensuring concomitant gene regulation by small RNAs in both compartments.

  7. Aberrant brain microRNA target and miRISC gene expression in the anx/anx anorexia mouse model

    DEFF Research Database (Denmark)

    Mercader, Josep M; González, Juan R; Lozano, Juan José

    2012-01-01

    The anorexia mouse model, anx/anx, carries a spontaneous mutation not yet identified and homozygous mutants are characterized by anorexia-cachexia, hyperactivity, and ataxia. In order to test if the microRNA function was altered in these mice, hypothalamus and cortex transcriptomes were evaluated...

  8. Arabidopsis ARGONAUTE7 selects miR390 through multiple checkpoints during RISC assembly.

    Science.gov (United States)

    Endo, Yayoi; Iwakawa, Hiro-oki; Tomari, Yukihide

    2013-07-01

    Plant ARGONAUTE7 (AGO7) assembles RNA-induced silencing complex (RISC) specifically with miR390 and regulates the auxin-signalling pathway via production of TAS3 trans-acting siRNAs (tasiRNAs). However, how AGO7 discerns miR390 among other miRNAs remains unclear. Here, we show that the 5' adenosine of miR390 and the central region of miR390/miR390* duplex are critical for the specific interaction with AGO7. Furthermore, despite the existence of mismatches in the seed and central regions of the duplex, cleavage of the miR390* strand is required for maturation of AGO7-RISC. These findings suggest that AGO7 uses multiple checkpoints to select miR390, thereby circumventing promiscuous tasiRNA production.

  9. TAF11 Assembles the RISC Loading Complex to Enhance RNAi Efficiency.

    Science.gov (United States)

    Liang, Chunyang; Wang, Yibing; Murota, Yukiko; Liu, Xiang; Smith, Dean; Siomi, Mikiko C; Liu, Qinghua

    2015-09-03

    Assembly of the RNA-induced silencing complex (RISC) requires formation of the RISC loading complex (RLC), which contains the Dicer-2 (Dcr-2)-R2D2 complex and recruits duplex siRNA to Ago2 in Drosophila melanogaster. However, the precise composition and action mechanism of Drosophila RLC remain unclear. Here we identified the missing factor of RLC as TATA-binding protein-associated factor 11 (TAF11) by genetic screen. Although it is an annotated nuclear transcription factor, we found that TAF11 also associated with Dcr-2/R2D2 and localized to cytoplasmic D2 bodies. Consistent with defective RLC assembly in taf11(-/-) ovary extract, we reconstituted the RLC in vitro using the recombinant Dcr-2-R2D2 complex, TAF11, and duplex siRNA. Furthermore, we showed that TAF11 tetramer facilitates Dcr-2-R2D2 tetramerization to enhance siRNA binding and RISC loading activities. Together, our genetic and biochemical studies define the molecular nature of the Drosophila RLC and elucidate a cytoplasmic function of TAF11 in organizing RLC assembly to enhance RNAi efficiency. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. RNAi and retroviruses: are they in RISC?

    Science.gov (United States)

    Vasselon, Thierry; Bouttier, Manuella; Saumet, Anne; Lecellier, Charles-Henri

    2013-02-01

    RNA interference (RNAi) is a potent cellular system against viruses in various organisms. Although common traits are observed in plants, insects, and nematodes, the situation observed in mammals appears more complex. In mammalian somatic cells, RNAi is implicated in endonucleolytic cleavage mediated by artificially delivered small interfering RNAs (siRNAs) as well as in translation repression mediated by microRNAs (miRNAs). Because siRNAs and miRNAs recognize viral mRNAs, RNAi inherently limits virus production and participates in antiviral defense. However, several observations made in the cases of hepatitis C virus and retroviruses (including the human immunodeficiency virus and the primate foamy virus) bring evidence that this relationship is much more complex and that certain components of the RNAi effector complex [called the RNA-induced silencing complex (RISC)], such as AGO2, are also required for viral replication. Here, we summarize recent discoveries that have revealed this dual implication in virus biology. We further discuss their potential implications for the functions of RNAi-related proteins, with special emphasis on retrotransposition and genome stability.

  11. Functional regulation of RNA-induced silencing complex by photoreactive oligonucleotides.

    Science.gov (United States)

    Matsuyama, Yohei; Yamayoshi, Asako; Kobori, Akio; Murakami, Akira

    2014-02-01

    We developed a novel method for regulation of RISC function by photoreactive oligonucleotides (Ps-Oligo) containing 2'-O-psoralenylmethoxyethyl adenosine (Aps). We observed that inhibitory effects of Ps-Oligos on RISC function were enhanced by UV-irradiation compared with 2'-O-methyl-oligonucleotide without Aps. These results suggest Ps-Oligo inhibited RISC function by cross-linking effect, and we propose that the concept described in this report may be promising and applicable one to regulate the small RNA-mediated post-transcriptional regulation. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  12. The microRNA machinery regulates fasting-induced changes in gene expression and longevity in Caenorhabditis elegans.

    Science.gov (United States)

    Kogure, Akiko; Uno, Masaharu; Ikeda, Takako; Nishida, Eisuke

    2017-07-07

    Intermittent fasting (IF) is a dietary restriction regimen that extends the lifespans of Caenorhabditis elegans and mammals by inducing changes in gene expression. However, how IF induces these changes and promotes longevity remains unclear. One proposed mechanism involves gene regulation by microRNAs (miRNAs), small non-coding RNAs (∼22 nucleotides) that repress gene expression and whose expression can be altered by fasting. To test this proposition, we examined the role of the miRNA machinery in fasting-induced transcriptional changes and longevity in C. elegans We revealed that fasting up-regulated the expression of the miRNA-induced silencing complex (miRISC) components, including Argonaute and GW182, and the miRNA-processing enzyme DRSH-1 (the ortholog of the Drosophila Drosha enzyme). Our lifespan measurements demonstrated that IF-induced longevity was suppressed by knock-out or knockdown of miRISC components and was completely inhibited by drsh-1 ablation. Remarkably, drsh-1 ablation inhibited the fasting-induced changes in the expression of the target genes of DAF-16, the insulin/IGF-1 signaling effector in C. elegans Fasting-induced transcriptome alterations were substantially and modestly suppressed in the drsh-1 null mutant and the null mutant of ain-1 , a gene encoding GW182, respectively. Moreover, miRNA array analyses revealed that the expression levels of numerous miRNAs changed after 2 days of fasting. These results indicate that components of the miRNA machinery, especially the miRNA-processing enzyme DRSH-1, play an important role in mediating IF-induced longevity via the regulation of fasting-induced changes in gene expression. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. AVR RISC microcontroller handbook

    CERN Document Server

    Kuhnel, Claus

    1998-01-01

    The AVR RISC Microcontroller Handbook is a comprehensive guide to designing with Atmel's new controller family, which is designed to offer high speed and low power consumption at a lower cost. The main text is divided into three sections: hardware, which covers all internal peripherals; software, which covers programming and the instruction set; and tools, which explains using Atmel's Assembler and Simulator (available on the Web) as well as IAR's C compiler.Practical guide for advanced hobbyists or design professionalsDevelopment tools and code available on the Web

  14. RISC processing in Fastbus

    International Nuclear Information System (INIS)

    Atiya, M.; Haggerty, J.; Ng, C.; Sambamurti, A.; Strzelinski, R.

    1990-01-01

    This paper reports on the designed, construction and testing microprocessor based controller for data acquisition and analysis conforming to the IEEE-960 Fastbus standard. The controller uses the RISC AM29000 processor and the Am29027 floating point co-processor. The module functions as a Fastbus slave and is used for analysis and filtering of digitially sampled waveforms acquired in a large system of high performance transient digitizers (over 200 channels, each sampling at 500 MHz. with 8 bits of dynamic range). With modifications the module can operate as a Fastbus master

  15. Optical RISC computer

    Science.gov (United States)

    Guilfoyle, Peter S.; Stone, Richard V.; Hessenbruch, John M.; Zeise, Frederick F.

    1993-07-01

    A second generation digital optical computer (DOC II) has been developed which utilizes a RISC based operating system as its host. This 32 bit, high performance (12.8 GByte/sec), computing platform demonstrates a number of basic principals that are inherent to parallel free space optical interconnects such as speed (up to 1012 bit operations per second) and low power 1.2 fJ per bit). Although DOC II is a general purpose machine, special purpose applications have been developed and are currently being evaluated on the optical platform.

  16. Correlation of mRNA Profiles, miRNA Profiles, and Functional Immune Response in Rainbow Trout (Oncorrhynkus Mykiss) Infected With Viral Hemorrhagic Septicemia Virus (VHSV) and in Fish Vaccinated With a DNA Vaccine Against VHSV

    DEFF Research Database (Denmark)

    Bela-Ong, Dennis; Schyth, Brian Dall; Jørgensen, Hanne

    2011-01-01

    and are incorporated into the RNA-Induced Silencing Complex (RISC), which target specific mRNA sequences, causing either mRNA degradation or translation repression. This results in altered mRNA and protein profiles characteristic of a particular cellular phenotype or physiological state. By targeting immune relevant m...

  17. A Regulatory RNA Inducing Transgenerationally Inherited Phenotypes

    DEFF Research Database (Denmark)

    Jensen, Lea Møller

    . The variation in Arabidopsis enables different regulatory networks and mechanisms to shape the phenotypic characteristics. The thesis describes the identification of regulatory RNA encoded by an enzyme encoding gene. The RNA regulates by inducing transgenerationally inherited phenotypes. The function of the RNA...... is dependent on the genetic background illustrating that polymorphisms are found in either interactors or target genes of the RNA. Furthermore, the RNA provides a mechanistic link between accumulation of glucosinolate and onset of flowering....

  18. RISC vs. Non-RISC Schools: A Comparison of Student Proficiencies for Reading, Writing, and Mathematics

    Science.gov (United States)

    Haystead, Mark W.

    2010-01-01

    This report describes the findings for an analysis of data provided by the Re-Inventing Schools Coalition (RISC). A comparison was made between schools at seven districts that employ the RISC model and eight non-RISC districts (hereinafter referred to as RISC and non-RISC schools) on the percentages of students who scored proficient or above on…

  19. RISC-mediated control of selected chromatin regulators stabilizes ground state pluripotency of mouse embryonic stem cells.

    Science.gov (United States)

    Pandolfini, Luca; Luzi, Ettore; Bressan, Dario; Ucciferri, Nadia; Bertacchi, Michele; Brandi, Rossella; Rocchiccioli, Silvia; D'Onofrio, Mara; Cremisi, Federico

    2016-05-06

    Embryonic stem cells are intrinsically unstable and differentiate spontaneously if they are not shielded from external stimuli. Although the nature of such instability is still controversial, growing evidence suggests that protein translation control may play a crucial role. We performed an integrated analysis of RNA and proteins at the transition between naïve embryonic stem cells and cells primed to differentiate. During this transition, mRNAs coding for chromatin regulators are specifically released from translational inhibition mediated by RNA-induced silencing complex (RISC). This suggests that, prior to differentiation, the propensity of embryonic stem cells to change their epigenetic status is hampered by RNA interference. The expression of these chromatin regulators is reinstated following acute inactivation of RISC and it correlates with loss of stemness markers and activation of early cell differentiation markers in treated embryonic stem cells. We propose that RISC-mediated inhibition of specific sets of chromatin regulators is a primary mechanism for preserving embryonic stem cell pluripotency while inhibiting the onset of embryonic developmental programs.

  20. SiRNAs conjugated with aromatic compounds induce RISC-mediated antisense strand selection and strong gene-silencing activity

    Energy Technology Data Exchange (ETDEWEB)

    Kubo, Takanori, E-mail: kubo-t@yasuda-u.ac.jp [Faculty of Pharmacy, Yasuda Women' s University, 6-13-1 Yasuhigashi, Asaminami-ku, Hiroshima 731-0153 (Japan); Yanagihara, Kazuyoshi [Faculty of Pharmacy, Yasuda Women' s University, 6-13-1 Yasuhigashi, Asaminami-ku, Hiroshima 731-0153 (Japan); Division of Genetics, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045 (Japan); Takei, Yoshifumi [Department of Biochemistry, Nagoya University Graduate School of Medicine, 65 Tsurumi-cho, Showa-ku, Nagoya 466-8550 (Japan); Mihara, Keichiro [Department of Hematology and Oncology, Research Institute for Radiation Biology and Medicine, Hiroshima University, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8553 (Japan); Sato, Yuichiro; Seyama, Toshio [Faculty of Pharmacy, Yasuda Women' s University, 6-13-1 Yasuhigashi, Asaminami-ku, Hiroshima 731-0153 (Japan)

    2012-10-05

    Highlights: Black-Right-Pointing-Pointer SiRNAs conjugated with aromatic compounds (Ar-siRNAs) at 5 Prime -sense strand were synthesized. Black-Right-Pointing-Pointer Ar-siRNAs increased resistance against nuclease degradation. Black-Right-Pointing-Pointer Ar-siRNAs were thermodynamically stable compared with the unmodified siRNA. Black-Right-Pointing-Pointer High levels of cellular uptake and cytoplasmic localization were found. Black-Right-Pointing-Pointer Strong gene-silencing efficacy was exhibited in the Ar-siRNAs. -- Abstract: Short interference RNA (siRNA) is a powerful tool for suppressing gene expression in mammalian cells. In this study, we focused on the development of siRNAs conjugated with aromatic compounds in order to improve the potency of RNAi and thus to overcome several problems with siRNAs, such as cellular delivery and nuclease stability. The siRNAs conjugated with phenyl, hydroxyphenyl, naphthyl, and pyrenyl derivatives showed strong resistance to nuclease degradation, and were thermodynamically stable compared with unmodified siRNA. A high level of membrane permeability in HeLa cells was also observed. Moreover, these siRNAs exhibited enhanced RNAi efficacy, which exceeded that of locked nucleic acid (LNA)-modified siRNAs, against exogenous Renilla luciferase in HeLa cells. In particular, abundant cytoplasmic localization and strong gene-silencing efficacy were found in the siRNAs conjugated with phenyl and hydroxyphenyl derivatives. The novel siRNAs conjugated with aromatic compounds are promising candidates for a new generation of modified siRNAs that can solve many of the problems associated with RNAi technology.

  1. Radiation-Induced Short Channel (RISCE) and Narrow Channel (RINCE) Effects in 65 and 130 nm MOSFETs

    CERN Document Server

    Faccio, F; Cornale, D; Paccagnella, A; Gerardin, S

    2015-01-01

    The behavior of transistors in commercial-grade complementary metal-oxide semiconductor technologies in the 65 and 130 nm nodes has been explored up to a total ionizing dose of 1 Grad. The large dose tolerance of the thin gate oxide is confirmed, but defects in the spacer and STI oxides have a strong effect on the performance of the transistors. A radiation-induced short channel effect is traced to charge trapping in the spacers used for drain engineering, while a radiation-induced narrow channel effect is due to defect generation in the lateral isolation oxide (STI). These strongly degrade the electrical characteristics of short and narrow channel transistors at high doses, and their magnitude depends on the applied bias and temperature during irradiation in a complex way.

  2. The 5'-end heterogeneity of adenovirus virus-associated RNAI contributes to the asymmetric guide strand incorporation into the RNA-induced silencing complex.

    Science.gov (United States)

    Xu, Ning; Gkountela, Sofia; Saeed, Khalid; Akusjärvi, Göran

    2009-11-01

    Human Adenovirus type 5 encodes two short RNA polymerase III transcripts, the virus-associated (VA) RNAI and VA RNAII, which can adopt stable hairpin structures that resemble micro-RNA precursors. The terminal stems of the VA RNAs are processed into small RNAs (mivaRNAs) that are incorporated into RISC. It has been reported that VA RNAI has two transcription initiation sites, which produce two VA RNAI species; a major species, VA RNAI(G), which accounts for 75% of the VA RNAI pool, and a minor species, VA RNAI(A), which initiates transcription three nucleotides upstream compared to VA RNAI(G). We show that this 5'-heterogeneity results in a dramatic difference in RISC assembly. Thus, both VA RNAI(G) and VA RNAI(A) are processed by Dicer at the same position in the terminal stem generating the same 3'-strand mivaRNA. This mivaRNA is incorporated into RISC with 200-fold higher efficiency compared to the 5'-strand of mivaRNAI. Of the small number of 5'-strands used in RISC assembly only VA RNAI(A) generated active RISC complexes. We also show that the 3'-strand of mivaRNAI, although being the preferred substrate for RISC assembly, generates unstable RISC complexes with a low in vitro cleavage activity, only around 2% compared to RISC assembled on the VA RNAI(A) 5'-strand.

  3. IGF2BP3 Modulates the Interaction of Invasion-Associated Transcripts with RISC

    Directory of Open Access Journals (Sweden)

    Hanane Ennajdaoui

    2016-05-01

    Full Text Available Insulin-like growth factor 2 mRNA binding protein 3 (IGF2BP3 expression correlates with malignancy, but its role(s in pathogenesis remains enigmatic. We interrogated the IGF2BP3-RNA interaction network in pancreatic ductal adenocarcinoma (PDAC cells. Using a combination of genome-wide approaches, we have identified 164 direct mRNA targets of IGF2BP3. These transcripts encode proteins enriched for functions such as cell migration, proliferation, and adhesion. Loss of IGF2BP3 reduced PDAC cell invasiveness and remodeled focal adhesion junctions. Individual nucleotide resolution crosslinking immunoprecipitation (iCLIP revealed significant overlap of IGF2BP3 and microRNA (miRNA binding sites. IGF2BP3 promotes association of the RNA-induced silencing complex (RISC with specific transcripts. Our results show that IGF2BP3 influences a malignancy-associated RNA regulon by modulating miRNA-mRNA interactions.

  4. IGF2BP3 Modulates the Interaction of Invasion-Associated Transcripts with RISC.

    Science.gov (United States)

    Ennajdaoui, Hanane; Howard, Jonathan M; Sterne-Weiler, Timothy; Jahanbani, Fereshteh; Coyne, Doyle J; Uren, Philip J; Dargyte, Marija; Katzman, Sol; Draper, Jolene M; Wallace, Andrew; Cazarez, Oscar; Burns, Suzanne C; Qiao, Mei; Hinck, Lindsay; Smith, Andrew D; Toloue, Masoud M; Blencowe, Benjamin J; Penalva, Luiz O F; Sanford, Jeremy R

    2016-05-31

    Insulin-like growth factor 2 mRNA binding protein 3 (IGF2BP3) expression correlates with malignancy, but its role(s) in pathogenesis remains enigmatic. We interrogated the IGF2BP3-RNA interaction network in pancreatic ductal adenocarcinoma (PDAC) cells. Using a combination of genome-wide approaches, we have identified 164 direct mRNA targets of IGF2BP3. These transcripts encode proteins enriched for functions such as cell migration, proliferation, and adhesion. Loss of IGF2BP3 reduced PDAC cell invasiveness and remodeled focal adhesion junctions. Individual nucleotide resolution crosslinking immunoprecipitation (iCLIP) revealed significant overlap of IGF2BP3 and microRNA (miRNA) binding sites. IGF2BP3 promotes association of the RNA-induced silencing complex (RISC) with specific transcripts. Our results show that IGF2BP3 influences a malignancy-associated RNA regulon by modulating miRNA-mRNA interactions. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  5. The RISC-spectrometer experiment

    International Nuclear Information System (INIS)

    Pinter, Gy.

    1981-01-01

    The RISC (Relativistic Ionising Streamer Chamber) spectrometer (situated at Protvino, joining the accelerator) is discussed, and the experiment carried out in international cooperation is presented. The beam monitor, the trigger system and the control and data recording system as well as the streamer spark chamber are detailed (the latter is the largest of our time). Examples of the main experiments as well as the work carried out in Budapest are discussed briefly. (Sz.J.)

  6. Combinatorial delivery of small interfering RNAs reduces RNAi efficacy by selective incorporation into RISC

    Science.gov (United States)

    Castanotto, Daniela; Sakurai, Kumi; Lingeman, Robert; Li, Haitang; Shively, Louise; Aagaard, Lars; Soifer, Harris; Gatignol, Anne; Riggs, Arthur; Rossi, John J.

    2007-01-01

    Despite the great potential of RNAi, ectopic expression of shRNA or siRNAs holds the inherent risk of competition for critical RNAi components, thus altering the regulatory functions of some cellular microRNAs. In addition, specific siRNA sequences can potentially hinder incorporation of other siRNAs when used in a combinatorial approach. We show that both synthetic siRNAs and expressed shRNAs compete against each other and with the endogenous microRNAs for transport and for incorporation into the RNA induced silencing complex (RISC). The same siRNA sequences do not display competition when expressed from a microRNA backbone. We also show that TAR RNA binding protein (TRBP) is one of the sensors for selection and incorporation of the guide sequence of interfering RNAs. These findings reveal that combinatorial siRNA approaches can be problematic and have important implications for the methodology of expression and use of therapeutic interfering RNAs. PMID:17660190

  7. Functional analysis of neuronal microRNAs in Caenorhabditis elegans dauer formation by combinational genetics and Neuronal miRISC immunoprecipitation.

    Directory of Open Access Journals (Sweden)

    Minh T Than

    2013-06-01

    Full Text Available Identifying the physiological functions of microRNAs (miRNAs is often challenging because miRNAs commonly impact gene expression under specific physiological conditions through complex miRNA::mRNA interaction networks and in coordination with other means of gene regulation, such as transcriptional regulation and protein degradation. Such complexity creates difficulties in dissecting miRNA functions through traditional genetic methods using individual miRNA mutations. To investigate the physiological functions of miRNAs in neurons, we combined a genetic "enhancer" approach complemented by biochemical analysis of neuronal miRNA-induced silencing complexes (miRISCs in C. elegans. Total miRNA function can be compromised by mutating one of the two GW182 proteins (AIN-1, an important component of miRISC. We found that combining an ain-1 mutation with a mutation in unc-3, a neuronal transcription factor, resulted in an inappropriate entrance into the stress-induced, alternative larval stage known as dauer, indicating a role of miRNAs in preventing aberrant dauer formation. Analysis of this genetic interaction suggests that neuronal miRNAs perform such a role partly by regulating endogenous cyclic guanosine monophosphate (cGMP signaling, potentially influencing two other dauer-regulating pathways. Through tissue-specific immunoprecipitations of miRISC, we identified miRNAs and their likely target mRNAs within neuronal tissue. We verified the biological relevance of several of these miRNAs and found that many miRNAs likely regulate dauer formation through multiple dauer-related targets. Further analysis of target mRNAs suggests potential miRNA involvement in various neuronal processes, but the importance of these miRNA::mRNA interactions remains unclear. Finally, we found that neuronal genes may be more highly regulated by miRNAs than intestinal genes. Overall, our study identifies miRNAs and their targets, and a physiological function of these miRNAs in

  8. Cadherin complexes recruit mRNAs and RISC to regulate epithelial cell signaling.

    Science.gov (United States)

    Kourtidis, Antonis; Necela, Brian; Lin, Wan-Hsin; Lu, Ruifeng; Feathers, Ryan W; Asmann, Yan W; Thompson, E Aubrey; Anastasiadis, Panos Z

    2017-10-02

    Cumulative evidence demonstrates that most RNAs exhibit specific subcellular distribution. However, the mechanisms regulating this phenomenon and its functional consequences are still under investigation. Here, we reveal that cadherin complexes at the apical zonula adherens (ZA) of epithelial adherens junctions recruit the core components of the RNA-induced silencing complex (RISC) Ago2, GW182, and PABPC1, as well as a set of 522 messenger RNAs (mRNAs) and 28 mature microRNAs (miRNAs or miRs), via PLEKHA7. Top canonical pathways represented by these mRNAs include Wnt/β-catenin, TGF-β, and stem cell signaling. We specifically demonstrate the presence and silencing of MYC, JUN, and SOX2 mRNAs by miR-24 and miR-200c at the ZA. PLEKHA7 knockdown dissociates RISC from the ZA, decreases loading of the ZA-associated mRNAs and miRNAs to Ago2, and results in a corresponding increase of MYC, JUN, and SOX2 protein expression. The present work reveals a mechanism that directly links junction integrity to the silencing of a set of mRNAs that critically affect epithelial homeostasis. © 2017 Kourtidis et al.

  9. Regulation of the activity of the promoter of RNA-induced silencing, C3PO.

    Science.gov (United States)

    Sahu, Shriya; Williams, Leo; Perez, Alberto; Philip, Finly; Caso, Giuseppe; Zurawsky, Walter; Scarlata, Suzanne

    2017-09-01

    RNA-induced silencing is a process which allows cells to regulate the synthesis of specific proteins. RNA silencing is promoted by the protein C3PO (component 3 of RISC). We have previously found that phospholipase Cβ, which increases intracellular calcium levels in response to specific G protein signals, inhibits C3PO activity towards certain genes. Understanding the parameters that control C3PO activity and which genes are impacted by G protein activation would help predict which genes are more vulnerable to downregulation. Here, using a library of 10 18 oligonucleotides, we show that C3PO binds oligonucleotides with structural specificity but little sequence specificity. Alternately, C3PO hydrolyzes oligonucleotides with a rate that is sensitive to substrate stability. Importantly, we find that oligonucleotides with higher Tm values are inhibited by bound PLCβ. This finding is supported by microarray analysis in cells over-expressing PLCβ1. Taken together, this study allows predictions of the genes whose post-transcriptional regulation is responsive to the G protein/phospholipase Cβ/calcium signaling pathway. © 2017 The Protein Society.

  10. Characterization of RNA interference in rat PC12 cells

    DEFF Research Database (Denmark)

    Thonberg, Håkan; Schéele, Camilla C; Dahlgren, Cecilia

    2004-01-01

    strand of the siRNA guides a multi-protein complex, RNA-induced silencing complex (RISC), to cleave target mRNA. Although the exact function and composition of RISC is still unclear, it has been shown to include several proteins of the Argonaute protein family. Here we report of a robust system...... of the rat Golgi-ER protein 95 kDa (GERp95), an Argonaute family protein, by siRNA methodology. After GERp95-ablation, sequential knockdown of NPY by siRNA was shown to be impaired. Thus, we report that the GERp95 protein is functionally required for RNAi targeting NPY in rat PC12 cells....

  11. Functional Verification of Enhanced RISC Processor

    OpenAIRE

    SHANKER NILANGI; SOWMYA L

    2013-01-01

    This paper presents design and verification of a 32-bit enhanced RISC processor core having floating point computations integrated within the core, has been designed to reduce the cost and complexity. The designed 3 stage pipelined 32-bit RISC processor is based on the ARM7 processor architecture with single precision floating point multiplier, floating point adder/subtractor for floating point operations and 32 x 32 booths multiplier added to the integer core of ARM7. The binary representati...

  12. A proteomic study of TAR-RNA binding protein (TRBP-associated factors

    Directory of Open Access Journals (Sweden)

    Chi Ya-Hui

    2011-02-01

    Full Text Available Abstract Background The human TAR RNA-binding protein, TRBP, was first identified and cloned based on its high affinity binding to the small hairpin trans-activation responsive (TAR RNA of HIV-1. TRBP has more recently been found to be a constituent of the RNA-induced silencing complex (RISC serving as a Dicer co-factor in the processing of the ~70 nucleotide pre-microRNAs(miRNAs to 21-25 nucleotide mature miRNAs. Findings Using co-immunoprecipitation and protein-identification by mass spectrometry, we characterized intracellular proteins that complex with TRBP. These interacting proteins include those that have been described to act in protein synthesis, RNA modifications and processing, DNA transcription, and cell proliferation. Conclusions Our findings provide a proteome of factors that may cooperate with TRBP in activities such as miRNA processing and in RNA interference by the RISC complex.

  13. Intervention of radiation‐induced skin fibrosis by RNA interference

    DEFF Research Database (Denmark)

    Nawroth, Isabel

    ‐α (TNFα) production by macrophages might promote RIF. RNA interference (RNAi) is an evolutionary conserved gene‐silencing mechanism capable of degrading mRNA containing a homologous sequence to an exogenously introduced double stranded small interfering RNA (siRNA). These siRNAs can induce RNAi...... and inhibit the expression of target proteins. Therefore, siRNAs are considered as promising therapeutics for treatment of various diseases including genetic and viral diseases, and cancer. In this study, the therapeutic potential of RNA interference was investigated as an intervention strategy for radiation......‐induced skin fibrosis. Chitosan‐based nanoparticles (or polyplexes) formed by self‐assembly with siRNA were applied to overcome extracellular and intracellular barriers and deliver siRNA site‐specific. In this work we show that intraperitoneal administration of chitosan/DsiRNA nanoparticles targeting TNFα...

  14. Deep sequencing of cardiac microRNA-mRNA interactomes in clinical and experimental cardiomyopathy.

    Science.gov (United States)

    Matkovich, Scot J; Dorn, Gerald W

    2015-01-01

    MicroRNAs are a family of short (~21 nucleotide) noncoding RNAs that serve key roles in cellular growth and differentiation and the response of the heart to stress stimuli. As the sequence-specific recognition element of RNA-induced silencing complexes (RISCs), microRNAs bind mRNAs and prevent their translation via mechanisms that may include transcript degradation and/or prevention of ribosome binding. Short microRNA sequences and the ability of microRNAs to bind to mRNA sites having only partial/imperfect sequence complementarity complicate purely computational analyses of microRNA-mRNA interactomes. Furthermore, computational microRNA target prediction programs typically ignore biological context, and therefore the principal determinants of microRNA-mRNA binding: the presence and quantity of each. To address these deficiencies we describe an empirical method, developed via studies of stressed and failing hearts, to determine disease-induced changes in microRNAs, mRNAs, and the mRNAs targeted to the RISC, without cross-linking mRNAs to RISC proteins. Deep sequencing methods are used to determine RNA abundances, delivering unbiased, quantitative RNA data limited only by their annotation in the genome of interest. We describe the laboratory bench steps required to perform these experiments, experimental design strategies to achieve an appropriate number of sequencing reads per biological replicate, and computer-based processing tools and procedures to convert large raw sequencing data files into gene expression measures useful for differential expression analyses.

  15. Conformational Selection and Induced Fit for RNA Polymerase and RNA/DNA Hybrid Backtracked Recognition

    Directory of Open Access Journals (Sweden)

    Haifeng eChen

    2015-11-01

    Full Text Available RNA polymerase catalyzes transcription with a high fidelity. If DNA/RNA mismatch or DNA damage occurs downstream, a backtracked RNA polymerase can proofread this situation. However, the backtracked mechanism is still poorly understood. Here we have performed multiple explicit-solvent molecular dynamics (MD simulations on bound and apo DNA/RNA hybrid to study backtracked recognition. MD simulations at room temperature suggest that specific electrostatic interactions play key roles in the backtracked recognition between the polymerase and DNA/RNA hybrid. Kinetics analysis at high temperature shows that bound and apo DNA/RNA hybrid unfold via a two-state process. Both kinetics and free energy landscape analyses indicate that bound DNA/RNA hybrid folds in the order of DNA/RNA contracting, the tertiary folding and polymerase binding. The predicted Φ-values suggest that C7, G9, dC12, dC15 and dT16 are key bases for the backtracked recognition of DNA/RNA hybrid. The average RMSD values between the bound structures and the corresponding apo ones and Kolmogorov-Smirnov (KS P test analyses indicate that the recognition between DNA/RNA hybrid and polymerase might follow an induced fit mechanism for DNA/RNA hybrid and conformation selection for polymerase. Furthermore, this method could be used to relative studies of specific recognition between nucleic acid and protein.

  16. RNA interference prevents lipopolysaccharide-induced preprotachykinin gene expression

    International Nuclear Information System (INIS)

    Lai, Y.-L.; Yu, S.C.; Chen, M.-J.

    2003-01-01

    We showed previously that lipopolysaccharide (LPS) induces noncholinergic airway hyperreactivity to capsaicin via an upregulation of tachykinin synthesis. This study was designed to test whether double-stranded preprotachykinin (ds PPT) RNA, RNA interference (RNAi), prevents the LPS-induced alterations. First, cultured primary nodose ganglial cells of newborn Brown-Norway rats were divided into four groups: control; LPS; LPS+RNAi; and LPS+RNAi+liposome. Second, young Brown-Norway rats for the in vivo study were divided into three groups (control; LPS; and LPS+RNAi), and ds PPT RNA was microinjected bilaterally into the nodose ganglia in the LPS+RNAi group. Then, ganglial cells were collected from the culture whereas the nodose ganglia and lungs were sampled from the animals, and PPT mRNA and substance P (SP) levels were analyzed. Also, airway reactivity to capsaicin was performed in vivo. LPS induced significant increases in PPT mRNA and SP levels in vitro and in vivo and an increase in airway reactivity to capsaicin in vivo. However, ds PPT RNA, but not scrambled RNA, prevented all LPS-induced alterations. The effect of ds PPT RNA was not enhanced by liposome in vitro. Therefore, we demonstrated that the local application of RNAi prevents effectively the activation of the noncholinergic system modulating the lungs/airways

  17. The origin and effect of small RNA signaling in plants

    Directory of Open Access Journals (Sweden)

    Jean-Sébastien eParent

    2012-08-01

    Full Text Available Given their sessile condition, land plants need to integrate environmental cues rapidly and send signal throughout the organism to modify their metabolism accordingly. Small RNA (sRNA molecules are among the messengers that plant cells use to carry such signals. These molecules originate from fold-back stem-loops transcribed from endogenous loci or from perfect double-stranded RNA produced through the action of RNA-dependent RNA polymerases. Once produced, sRNAs associate with Argonaute and other proteins to form the RNA-induced silencing complex (RISC that executes silencing of complementary RNA molecules. Depending on the nature of the RNA target and the Argonaute protein involved, RISC triggers either DNA methylation and chromatin modification (leading to transcriptional gene silencing, TGS or RNA cleavage or translational inhibition (leading to post-transcriptional gene silencing, PTGS. In some cases, sRNAs move to neighboring cells and/or to the vascular tissues for long-distance trafficking. Many genes are involved in the biogenesis of sRNAs and recent studies have shown that both their origin and their protein partners have great influence on their activity and range. Here we summarize the work done to uncover the mode of action of the different classes of small RNA with special emphasis on their movement and how plants can take advantage of their mobility. We also review the various genetic requirements needed for production, movement and perception of the silencing signal.

  18. RISC & DSP System Application Design using VHDL

    OpenAIRE

    Rachana Solanki; Vinay Gupta

    2014-01-01

    The Reduced Instruction Set Computer (RISC) processor use fewer instructions with simple constructs, therefore they can be executed much faster within the CPU without having to use memory as often. It reduce execution time by simplifying the instruction set of the computer. The DSP processors are perform the operation such as Discrete Cosine transform (DCT), Inverse DCT, Discrete Fourier Transform (DFT) and Fast Fourier Transform (FFT) are performed by DSP system. This paper represent the des...

  19. SmD1 Modulates the miRNA Pathway Independently of Its Pre-mRNA Splicing Function.

    Directory of Open Access Journals (Sweden)

    Xiao-Peng Xiong

    2015-08-01

    Full Text Available microRNAs (miRNAs are a class of endogenous regulatory RNAs that play a key role in myriad biological processes. Upon transcription, primary miRNA transcripts are sequentially processed by Drosha and Dicer ribonucleases into ~22-24 nt miRNAs. Subsequently, miRNAs are incorporated into the RNA-induced silencing complexes (RISCs that contain Argonaute (AGO family proteins and guide RISC to target RNAs via complementary base pairing, leading to post-transcriptional gene silencing by a combination of translation inhibition and mRNA destabilization. Select pre-mRNA splicing factors have been implicated in small RNA-mediated gene silencing pathways in fission yeast, worms, flies and mammals, but the underlying molecular mechanisms are not well understood. Here, we show that SmD1, a core component of the Drosophila small nuclear ribonucleoprotein particle (snRNP implicated in splicing, is required for miRNA biogenesis and function. SmD1 interacts with both the microprocessor component Pasha and pri-miRNAs, and is indispensable for optimal miRNA biogenesis. Depletion of SmD1 impairs the assembly and function of the miRISC without significantly affecting the expression of major canonical miRNA pathway components. Moreover, SmD1 physically and functionally associates with components of the miRISC, including AGO1 and GW182. Notably, miRNA defects resulting from SmD1 silencing can be uncoupled from defects in pre-mRNA splicing, and the miRNA and splicing machineries are physically and functionally distinct entities. Finally, photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (PAR-CLIP analysis identifies numerous SmD1-binding events across the transcriptome and reveals direct SmD1-miRNA interactions. Our study suggests that SmD1 plays a direct role in miRNA-mediated gene silencing independently of its pre-mRNA splicing activity and indicates that the dual roles of splicing factors in post-transcriptional gene regulation may be

  20. The RNA silencing pathway: the bits and pieces that matter.

    Directory of Open Access Journals (Sweden)

    2005-07-01

    Full Text Available Cellular pathways are generally proposed on the basis of available experimental knowledge. The proposed pathways, however, may be inadequate to describe the phenomena they are supposed to explain. For instance, by means of concise mathematical models we are able to reveal shortcomings in the current description of the pathway of RNA silencing. The silencing pathway operates by cleaving siRNAs from dsRNA. siRNAs can associate with RISC, leading to the degradation of the target mRNA. We propose and analyze a few small extensions to the pathway: a siRNA degrading RNase, primed amplification of aberrant RNA pieces, and cooperation between aberrant RNA to trigger amplification. These extensions allow for a consistent explanation for various types of silencing phenomena, such as virus induced silencing, transgene and transposon induced silencing, and avoidance of self-reactivity, as well as for differences found between species groups.

  1. A novel rotometer based on a RISC microcontroller.

    Science.gov (United States)

    Heredia-López, F J; Bata-García, J L; Alvarez-Cervera, F J; Góngora-Alfaro, J L

    2002-08-01

    A new, low-cost rotometer, based on a reduced instruction set computer (RISC) microcontroller, is presented. Like earlier devices, it counts the number and direction of full turns for predetermined time periods during the evaluation of turning behavior induced by drug administration in rats. The present stand-alone system includes a nonvolatile memory for long-term data storage and a serial port for data transmission. It also contains a display for monitoring the experiments and has battery backup to avoid interruptions owing to power failures. A high correlation was found (r > .988, p < 2 x 10(-14)) between the counts of the rotometer and those of two trained observers. The system reflects quantitative differences in turning behavior owing to pharmacological manipulations. It provides the most common counting parameters and is inexpensive, flexible, highly reliable, and completely portable (weight including batteries, 159 g).

  2. The Resilient Schools Consortium (RiSC): Linking Climate Literacy, Resilience Thinking and Service Learning

    Science.gov (United States)

    Branco, B. F.; Fano, E.; Adams, J.; Shon, L.; Zimmermann, A.; Sioux, H.; Gillis, A.

    2017-12-01

    Public schools and youth voices are largely absent from climate resilience planning and projects in New York City. Additionally, research shows that U.S. science teachers' understanding of climate science is lacking, hence there is not only an urgent need to train and support teachers on both the science and pedagogy of climate change, but to link climate literacy, resilience thinking and service learning in K-12 education. However, research on participation of students and teachers in authentic, civic-oriented experiences points to increased engagement and learning outcomes in science. The Resilient Schools Consortium (RiSC) Project will address all these needs through an afterschool program in six coastal Brooklyn schools that engages teachers and urban youth (grades 6-12), in school and community climate resilience assessment and project design. The RiSC climate curriculum, co-designed by New York City school teachers with Brooklyn College, the National Wildlife Federation, New York Sea Grant and the Science and Resilience Institute at Jamaica Bay, will begin by helping students to understand the difference between climate and weather. The curriculum makes extensive use of existing resources such as NOAA's Digital Coast and the Coastal Resilience Mapping Portal. Through a series of four modules over two school years, the six RiSC teams will; 1. explore and understand the human-induced drivers of climate change and, particularly, the significant climate and extreme weather related risks to their schools and surrounding communities; 2. complete a climate vulnerability assessment within the school and the community that is aligned to OneNYC - the city's resilience planning document; 3. design and execute a school-based resilience project; and 4. propose resilience guidelines for NYC Department of Education schools. At the end of each school year, the six RiSC teams will convene a RiSC summit with city officials and resilience practitioners to share ideas and

  3. De predictieve validiteit van de Recidive Inschattingsschalen (RISc)

    NARCIS (Netherlands)

    Knaap, L.M. van der; Alberda, D.L.

    2009-01-01

    Om inzichten te krijgen in criminogene factoren van delinquenten is het screeningsinstrument 'Recidive Inschattingsschalen' (RISc) ontwikkeld. De betrouwbaarheid en validiteit van dit instrument zijn al onderzocht en positief bevonden. Dit onderzoek gaat na of de RISc geschikt is als

  4. RNA Interference and its therapeutic applications

    Directory of Open Access Journals (Sweden)

    Srinivasa Rao T

    2011-10-01

    Full Text Available RNAi is a potent method, requiring only a few molecules of dsRNA per cell to silence the expression. Long molecules of double stranded RNA (dsRNA trigger the process. The dsRNA comes from virus and transposon activity in natural RNAi process, while it can be injected in the cells in experimental processes. The strand of the dsRNA that is identical in sequence to a region in target mRNA molecule is called the sense strand, and the other strand which is complimentary is termed the antisense strand. An enzyme complex called DICER thought to be similar to RNAase III then recognizes dsRNA, and cuts it into roughly 22- nucleotide long fragments. These fragments termed siRNAs for “small interfering RNAs” remain in double stranded duplexes with very short 3' overhangs. However, only one of the two strands, known as the guide strand or antisense strand binds the argonaute protein of RNA-induced silencing complex (RISC and target the complementary mRNA resulting gene silencing. The other anti-guide strand or passenger strand is degraded as a RISC substrate during the process of RISC activation. This form of RNAi is termed as post transcriptional gene silencing (PTGS; other forms are also thought to operate at the genomic or transcriptional level in some organisms. In mammals dsRNA longer than 30 base pairs induces a nonspecific antiviral response. This so-called interferon response results in a nonspecific arrest in translation and induction of apoptosis. This cascade induces a global non-specific suppression of translation, which in turn triggers apoptosis. Interestingly, dsRNAs less than 30 nt in length do not activate the antiviral response and specifically switched off genes in human cells without initiating the acute phase response. Thus these siRNAs are suitable for gene target validation and therapeutic applications in many species, including humans. [Vet. World 2011; 4(5.000: 225-229

  5. Deep Sequencing Insights in Therapeutic shRNA Processing and siRNA Target Cleavage Precision.

    Science.gov (United States)

    Denise, Hubert; Moschos, Sterghios A; Sidders, Benjamin; Burden, Frances; Perkins, Hannah; Carter, Nikki; Stroud, Tim; Kennedy, Michael; Fancy, Sally-Ann; Lapthorn, Cris; Lavender, Helen; Kinloch, Ross; Suhy, David; Corbau, Romu

    2014-02-04

    TT-034 (PF-05095808) is a recombinant adeno-associated virus serotype 8 (AAV8) agent expressing three short hairpin RNA (shRNA) pro-drugs that target the hepatitis C virus (HCV) RNA genome. The cytosolic enzyme Dicer cleaves each shRNA into multiple, potentially active small interfering RNA (siRNA) drugs. Using next-generation sequencing (NGS) to identify and characterize active shRNAs maturation products, we observed that each TT-034-encoded shRNA could be processed into as many as 95 separate siRNA strands. Few of these appeared active as determined by Sanger 5' RNA Ligase-Mediated Rapid Amplification of cDNA Ends (5-RACE) and through synthetic shRNA and siRNA analogue studies. Moreover, NGS scrutiny applied on 5-RACE products (RACE-seq) suggested that synthetic siRNAs could direct cleavage in not one, but up to five separate positions on targeted RNA, in a sequence-dependent manner. These data support an on-target mechanism of action for TT-034 without cytotoxicity and question the accepted precision of substrate processing by the key RNA interference (RNAi) enzymes Dicer and siRNA-induced silencing complex (siRISC).Molecular Therapy-Nucleic Acids (2014) 3, e145; doi:10.1038/mtna.2013.73; published online 4 February 2014.

  6. Kinetic analysis of the effects of target structure on siRNA efficiency

    Science.gov (United States)

    Chen, Jiawen; Zhang, Wenbing

    2012-12-01

    RNAi efficiency for target cleavage and protein expression is related to the target structure. Considering the RNA-induced silencing complex (RISC) as a multiple turnover enzyme, we investigated the effect of target mRNA structure on siRNA efficiency with kinetic analysis. The 4-step model was used to study the target cleavage kinetic process: hybridization nucleation at an accessible target site, RISC-mRNA hybrid elongation along with mRNA target structure melting, target cleavage, and enzyme reactivation. At this model, the terms accounting for the target accessibility, stability, and the seed and the nucleation site effects are all included. The results are in good agreement with that of experiments which show different arguments about the structure effects on siRNA efficiency. It shows that the siRNA efficiency is influenced by the integrated factors of target's accessibility, stability, and the seed effects. To study the off-target effects, a simple model of one siRNA binding to two mRNA targets was designed. By using this model, the possibility for diminishing the off-target effects by the concentration of siRNA was discussed.

  7. The Polerovirus F box protein P0 targets ARGONAUTE1 to suppress RNA silencing.

    Science.gov (United States)

    Bortolamiol, Diane; Pazhouhandeh, Maghsoud; Marrocco, Katia; Genschik, Pascal; Ziegler-Graff, Véronique

    2007-09-18

    Plants employ post-transcriptional gene silencing (PTGS) as an antiviral defense response. In this mechanism, viral-derived small RNAs are incorporated into the RNA-induced silencing complex (RISC) to guide degradation of the corresponding viral RNAs. ARGONAUTE1 (AGO1) is a key component of RISC: it carries the RNA slicer activity. As a counter-defense, viruses have evolved various proteins that suppress PTGS. Recently, we showed that the Polerovirus P0 protein carries an F box motif required to form an SCF-like complex, which is also essential for P0's silencing suppressor function. Here, we investigate the molecular mechanism by which P0 impairs PTGS. First we show that P0's expression does not affect the biogenesis of primary siRNAs in an inverted repeat-PTGS assay, but it does affect their activity. Moreover, P0's expression in transformed Arabidopsis plants leads to various developmental abnormalities reminiscent of mutants affected in miRNA pathways, which is accompanied by enhanced levels of several miRNA-target transcripts, suggesting that P0 acts at the level of RISC. Interestingly, ectopic expression of P0 triggered AGO1 protein decay in planta. Finally, we provide evidence that P0 physically interacts with AGO1. Based on these results, we propose that P0 hijacks the host SCF machinery to modulate gene silencing by destabilizing AGO1.

  8. Argonaute Utilization for miRNA Silencing Is Determined by Phosphorylation-Dependent Recruitment of LIM-Domain-Containing Proteins

    Directory of Open Access Journals (Sweden)

    Katherine S. Bridge

    2017-07-01

    Full Text Available As core components of the microRNA-induced silencing complex (miRISC, Argonaute (AGO proteins interact with TNRC6 proteins, recruiting other effectors of translational repression/mRNA destabilization. Here, we show that LIMD1 coordinates the assembly of an AGO-TNRC6 containing miRISC complex by binding both proteins simultaneously at distinct interfaces. Phosphorylation of AGO2 at Ser 387 by Akt3 induces LIMD1 binding, which in turn enables AGO2 to interact with TNRC6A and downstream effector DDX6. Conservation of this serine in AGO1 and 4 indicates this mechanism may be a fundamental requirement for AGO function and miRISC assembly. Upon CRISPR-Cas9-mediated knockout of LIMD1, AGO2 miRNA-silencing function is lost and miRNA silencing becomes dependent on a complex formed by AGO3 and the LIMD1 family member WTIP. The switch to AGO3 utilization occurs due to the presence of a glutamic acid residue (E390 on the interaction interface, which allows AGO3 to bind to LIMD1, AJUBA, and WTIP irrespective of Akt signaling.

  9. The Radiation, Interplanetary Shocks, and Coronal Sources (RISCS) Toolset

    Science.gov (United States)

    Zank, G. P.; Spann, James F.

    2014-01-01

    The goal of this project is to serve the needs of space system designers and operators by developing an interplanetary radiation environment model within 10 AU:Radiation, Interplanetary Shocks, and Coronal Sources (RISCS) toolset: (1) The RISCS toolset will provide specific reference environments for space system designers and nowcasting and forecasting capabilities for space system operators; (2) We envision the RISCS toolset providing the spatial and temporal radiation environment external to the Earth's (and other planets') magnetosphere, as well as possessing the modularity to integrate separate applications (apps) that can map to specific magnetosphere locations and/or perform the subsequent radiation transport and dosimetry for a specific target.

  10. RISC Processors and High Performance Computing

    Science.gov (United States)

    Bailey, David H.; Saini, Subhash; Craw, James M. (Technical Monitor)

    1995-01-01

    This tutorial will discuss the top five RISC microprocessors and the parallel systems in which they are used. It will provide a unique cross-machine comparison not available elsewhere. The effective performance of these processors will be compared by citing standard benchmarks in the context of real applications. The latest NAS Parallel Benchmarks, both absolute performance and performance per dollar, will be listed. The next generation of the NPB will be described. The tutorial will conclude with a discussion of future directions in the field. Technology Transfer Considerations: All of these computer systems are commercially available internationally. Information about these processors is available in the public domain, mostly from the vendors themselves. The NAS Parallel Benchmarks and their results have been previously approved numerous times for public release, beginning back in 1991.

  11. Gender-specific hierarchy in nuage localization of PIWI-interacting RNA factors in Drosophila

    Directory of Open Access Journals (Sweden)

    Mikiko C Siomi

    2011-08-01

    Full Text Available PIWI-interacting RNAs (piRNAs are germline-specific small non-coding RNAs that form piRNA-induced silencing complexes (piRISCs by associating with PIWI proteins, a subclade of the Argonaute proteins predominantly expressed in the germline. piRISCs protect the integrity of the germline genome from invasive transposable DNA elements by silencing them. Multiple piRNA biogenesis factors have been identified in Drosophila. The majority of piRNA factors are localized in the nuage, electron-dense non-membranous cytoplasmic structures located in the perinuclear regions of germ cells. Thus, piRNA biogenesis is thought to occur in the nuage in germ cells. Immunofluorescence analyses of ovaries from piRNA factor mutants have revealed a localization hierarchy of piRNA factors in female nuage. However, whether this hierarchy is female-specific or can also be applied in male gonads remains undetermined. Here, we show by immunostaining of both ovaries and testes from piRNA factor mutants that the molecular hierarchy of piRNA factors shows gender-specificity, especially for Krimper (Krimp, a Tudor-domain containing protein of unknown function(s: Krimp is dispensable for PIWI protein Aubergine (Aub nuage localization in ovaries but Krimp and Aub require each other for their proper nuage localization in testes. This suggests that the functional requirement of Krimp in piRNA biogenesis may be different in male and female gonads.

  12. A Fault-tolerant RISC Microprocessor for Spacecraft Applications

    Science.gov (United States)

    Timoc, Constantin; Benz, Harry

    1990-01-01

    Viewgraphs on a fault-tolerant RISC microprocessor for spacecraft applications are presented. Topics covered include: reduced instruction set computer; fault tolerant registers; fault tolerant ALU; and double rail CMOS logic.

  13. Efficient construction of an inverted minimal H1 promoter driven siRNA expression cassette: facilitation of promoter and siRNA sequence exchange.

    Directory of Open Access Journals (Sweden)

    Hoorig Nassanian

    2007-08-01

    Full Text Available RNA interference (RNAi, mediated by small interfering RNA (siRNA, is an effective method used to silence gene expression at the post-transcriptional level. Upon introduction into target cells, siRNAs incorporate into the RNA-induced silencing complex (RISC. The antisense strand of the siRNA duplex then "guides" the RISC to the homologous mRNA, leading to target degradation and gene silencing. In recent years, various vector-based siRNA expression systems have been developed which utilize opposing polymerase III promoters to independently drive expression of the sense and antisense strands of the siRNA duplex from the same template.We show here the use of a ligase chain reaction (LCR to develop a new vector system called pInv-H1 in which a DNA sequence encoding a specific siRNA is placed between two inverted minimal human H1 promoters (approximately 100 bp each. Expression of functional siRNAs from this construct has led to efficient silencing of both reporter and endogenous genes. Furthermore, the inverted H1 promoter-siRNA expression cassette was used to generate a retrovirus vector capable of transducing and silencing expression of the targeted protein by>80% in target cells.The unique design of this construct allows for the efficient exchange of siRNA sequences by the directional cloning of short oligonucleotides via asymmetric restriction sites. This provides a convenient way to test the functionality of different siRNA sequences. Delivery of the siRNA cassette by retroviral transduction suggests that a single copy of the siRNA expression cassette efficiently knocks down gene expression at the protein level. We note that this vector system can potentially be used to generate a random siRNA library. The flexibility of the ligase chain reaction suggests that additional control elements can easily be introduced into this siRNA expression cassette.

  14. 16-Bit RISC Processor Design for Convolution Application

    OpenAIRE

    Anand Nandakumar Shardul

    2013-01-01

    In this project, we propose a 16-bit non-pipelined RISC processor, which is used for signal processing applications. The processor consists of the blocks, namely, program counter, clock control unit, ALU, IDU and registers. Advantageous architectural modifications have been made in the incremented circuit used in program counter and carry select adder unit of the ALU in the RISC CPU core. Furthermore, a high speed and low power modified modifies multiplier has been designed and introduced in ...

  15. Hydroxychloroquine-conjugated gold nanoparticles for improved siRNA activity.

    Science.gov (United States)

    Perche, F; Yi, Y; Hespel, L; Mi, P; Dirisala, A; Cabral, H; Miyata, K; Kataoka, K

    2016-06-01

    Current technology of siRNA delivery relies on pharmaceutical dosage forms to route maximal doses of siRNA to the tumor. However, this rationale does not address intracellular bottlenecks governing silencing activity. Here, we tested the impact of hydroxychloroquine conjugation on the intracellular fate and silencing activity of siRNA conjugated PEGylated gold nanoparticles. Addition of hydroxychloroquine improved endosomal escape and increased siRNA guide strand distribution to the RNA induced silencing complex (RISC), both crucial obstacles to the potency of siRNA. This modification significantly improved gene downregulation in cellulo. Altogether, our data suggest the benefit of this modification for the design of improved siRNA delivery systems. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. miRNA-like duplexes as RNAi triggers with improved specificity

    Directory of Open Access Journals (Sweden)

    Juan G. Betancur

    2012-07-01

    Full Text Available siRNA duplexes, the most common triggers of RNA interference, are first loaded into an Argonaute (Ago protein and then undergo unwinding via passenger strand cleavage, which requires the slicer activity of the Ago protein. In mammals, only Ago2 out of the four Ago proteins possesses such slicer activity. In contrast, miRNA/miRNA* duplexes often contain central mismatches that prevent slicer-dependent unwinding. Instead, mismatches in specific regions (seed and 3´-mid regions promote efficient slicer-independent unwinding by any of the four mammalian Ago proteins. Both slicer-dependent and slicer-independent unwinding mechanisms produce guide-containing RNA-induced silencing complex (RISC, which silences target mRNAs by cleavage, translational repression, and/or deadenylation that leads to mRNA decay. In this review, we summarize our current knowledge of the RISC assembly pathways, and describe a simple method to rationally design artificial miRNA/miRNA*-like duplexes and highlight its benefits to reduce the unwanted off-target effects without compromising the specific target silencing activity.

  17. Thermodynamic control of small RNA-mediated gene silencing

    Directory of Open Access Journals (Sweden)

    Kumiko eUi-Tei

    2012-06-01

    Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.

  18. MicroRNA, SND1, and alterations in translational regulation in colon carcinogenesis

    International Nuclear Information System (INIS)

    Tsuchiya, Naoto; Nakagama, Hitoshi

    2010-01-01

    Post-transcriptional regulation of gene expression by microRNA (miRNA) has recently attracted major interest in relation to its involvement in cancer development. miRNA is a member of small non-coding RNA, consists of 22-24 nucleotides and regulates expression of target mRNA species in a post-transcriptional manner by being incorporated with RNA-induced silencing complex (RISC). Staphylococcal nuclease homology domain containing 1 (SND1), a component of RISC, is frequently up-regulated in human colon cancers and also chemically induced colon cancers in animals. We here showed that SDN1 is involved in miRNA-mediated gene suppression and overexpression of SND1 in colon cancer cells causes down-regulation of APC without altering APC mRNA levels. As for the miRNA expression profile in human colon cancer, miR-34a was among the list of down-regulated miRNA. Expression of miR-34a is tightly regulated by p53, and ectopic expression of miR-34a in colon cancer cells causes remarkable reduction of cell proliferation and induces senescence-like phenotypes. MiR-34a also participates in the positive feedback loop of the p53 tumor suppressor network. This circuitry mechanism for p53 activation is of interest in understanding the tumor suppressive function of miR-34a in colon carcinogenesis. miRNA should also be considered as novel anti-cancer agents in tumor suppressive therapeutic applications.

  19. Integrating microRNA and mRNA expression profiles in response to radiation-induced injury in rat lung

    International Nuclear Information System (INIS)

    Xie, Ling; Zhou, Jundong; Zhang, Shuyu; Chen, Qing; Lai, Rensheng; Ding, Weiqun; Song, ChuanJun; Meng, XingJun; Wu, Jinchang

    2014-01-01

    Exposure to radiation provokes cellular responses, which are likely regulated by gene expression networks. MicroRNAs are small non-coding RNAs, which regulate gene expression by promoting mRNA degradation or inhibiting protein translation. The expression patterns of both mRNA and miRNA during the radiation-induced lung injury (RILI) remain less characterized and the role of miRNAs in the regulation of this process has not been studied. The present study sought to evaluate miRNA and mRNA expression profiles in the rat lung after irradiation. Male Wistar rats were subjected to single dose irradiation with 20 Gy using 6 MV x-rays to the right lung. (A dose rate of 5 Gy/min was applied). Rats were sacrificed at 3, 12 and 26 weeks after irradiation, and morphological changes in the lung were examined by haematoxylin and eosin. The miRNA and mRNA expression profiles were evaluated by microarrays and followed by quantitative RT-PCR analysis. A cDNA microarray analysis found 2183 transcripts being up-regulated and 2917 transcripts down-regulated (P ≤ 0.05, ≥2.0 fold change) in the lung tissues after irradiation. Likewise, a miRNAs microarray analysis indicated 15 miRNA species being up-regulated and 8 down-regulated (P ≤ 0.05). Subsequent bioinformatics anal -yses of the differentially expressed mRNA and miRNAs revealed that alterations in mRNA expression following irradiation were negatively correlated with miRNAs expression. Our results provide evidence indicating that irradiation induces alterations of mRNA and miRNA expression in rat lung and that there is a negative correlation of mRNA and miRNA expression levels after irradiation. These findings significantly advance our understanding of the regulatory mechanisms underlying the pathophysiology of radiation-induced lung injury. In summary, RILI does not develop gradually in a linear process. In fact, different cell types interact via cytokines in a very complex network. Furthermore, this study suggests that

  20. RNA.

    Science.gov (United States)

    Darnell, James E., Jr.

    1985-01-01

    Ribonucleic acid (RNA) converts genetic information into protein and usually must be processed to serve its function. RNA types, chemical structure, protein synthesis, translation, manufacture, and processing are discussed. Concludes that the first genes might have been spliced RNA and that humans might be closer than bacteria to primitive…

  1. Signatures of RNA binding proteins globally coupled to effective microRNA target sites

    DEFF Research Database (Denmark)

    Jacobsen, Anders; Wen, Jiayu; Marks, Debora S

    2010-01-01

    MicroRNAs (miRNAs) and small interfering RNAs (siRNAs), bound to Argonaute proteins (RISC), destabilize mRNAs through base-pairing with the mRNA. However, the gene expression changes after perturbations of these small RNAs are only partially explained by predicted miRNA/siRNA targeting. Targeting...

  2. A comprehensive survey of 3' animal miRNA modification events and a possible role for 3' adenylation in modulating miRNA targeting effectiveness.

    Science.gov (United States)

    Burroughs, A Maxwell; Ando, Yoshinari; de Hoon, Michiel J L; Tomaru, Yasuhiro; Nishibu, Takahiro; Ukekawa, Ryo; Funakoshi, Taku; Kurokawa, Tsutomu; Suzuki, Harukazu; Hayashizaki, Yoshihide; Daub, Carsten O

    2010-10-01

    Animal microRNA sequences are subject to 3' nucleotide addition. Through detailed analysis of deep-sequenced short RNA data sets, we show adenylation and uridylation of miRNA is globally present and conserved across Drosophila and vertebrates. To better understand 3' adenylation function, we deep-sequenced RNA after knockdown of nucleotidyltransferase enzymes. The PAPD4 nucleotidyltransferase adenylates a wide range of miRNA loci, but adenylation does not appear to affect miRNA stability on a genome-wide scale. Adenine addition appears to reduce effectiveness of miRNA targeting of mRNA transcripts while deep-sequencing of RNA bound to immunoprecipitated Argonaute (AGO) subfamily proteins EIF2C1-EIF2C3 revealed substantial reduction of adenine addition in miRNA associated with EIF2C2 and EIF2C3. Our findings show 3' addition events are widespread and conserved across animals, PAPD4 is a primary miRNA adenylating enzyme, and suggest a role for 3' adenine addition in modulating miRNA effectiveness, possibly through interfering with incorporation into the RNA-induced silencing complex (RISC), a regulatory role that would complement the role of miRNA uridylation in blocking DICER1 uptake.

  3. A comprehensive survey of 3′ animal miRNA modification events and a possible role for 3′ adenylation in modulating miRNA targeting effectiveness

    Science.gov (United States)

    Burroughs, A. Maxwell; Ando, Yoshinari; de Hoon, Michiel J.L.; Tomaru, Yasuhiro; Nishibu, Takahiro; Ukekawa, Ryo; Funakoshi, Taku; Kurokawa, Tsutomu; Suzuki, Harukazu; Hayashizaki, Yoshihide; Daub, Carsten O.

    2010-01-01

    Animal microRNA sequences are subject to 3′ nucleotide addition. Through detailed analysis of deep-sequenced short RNA data sets, we show adenylation and uridylation of miRNA is globally present and conserved across Drosophila and vertebrates. To better understand 3′ adenylation function, we deep-sequenced RNA after knockdown of nucleotidyltransferase enzymes. The PAPD4 nucleotidyltransferase adenylates a wide range of miRNA loci, but adenylation does not appear to affect miRNA stability on a genome-wide scale. Adenine addition appears to reduce effectiveness of miRNA targeting of mRNA transcripts while deep-sequencing of RNA bound to immunoprecipitated Argonaute (AGO) subfamily proteins EIF2C1–EIF2C3 revealed substantial reduction of adenine addition in miRNA associated with EIF2C2 and EIF2C3. Our findings show 3′ addition events are widespread and conserved across animals, PAPD4 is a primary miRNA adenylating enzyme, and suggest a role for 3′ adenine addition in modulating miRNA effectiveness, possibly through interfering with incorporation into the RNA-induced silencing complex (RISC), a regulatory role that would complement the role of miRNA uridylation in blocking DICER1 uptake. PMID:20719920

  4. RNA İNTERFERANS (RNAİ)

    OpenAIRE

    GÜNDOĞDU, Ramazan; ÇELİK, Venhar

    2009-01-01

    RNA interferans, uygun çift zincirli RNA’nın hücreye girdiği zaman, endojenik komplementer mRNA dizisinin parçalanmasına yol açan, transkripsiyon sonrası gen susturma mekanizmasıdır. RNA interferans, Dicer adı verilen bir RNase III enzimi tarafından çift zincirli RNA’nın küçük engelleyici RNA’lara (siRNA) kesilmesi ile başlamaktadır. Bu siRNA’lar daha sonra, bir multiprotein-RNA nükleaz kompleksi olan, RNA- indükleyici baskılama kompleksine (RISC) bağlanır. RISC, siRNA’ları komplementer mRNA’...

  5. Schizotypal Estimators in Adolescence: The Concurrent Validity of the RISC.

    Science.gov (United States)

    Rust, John; Chiu, Herbert

    1988-01-01

    Administered Minnesota Counseling Inventory and Rust Inventory of Schizotypal Cognition (RISC) to 174 adolescents in Hong Kong. Results showed that negative schizophrenic symptoms of social dysfunction and emotional instability as measured by Minnesota Counseling Inventory were positively and significantly correlated with positive schizotypal…

  6. Optimization of Particle-in-Cell Codes on RISC Processors

    Science.gov (United States)

    Decyk, Viktor K.; Karmesin, Steve Roy; Boer, Aeint de; Liewer, Paulette C.

    1996-01-01

    General strategies are developed to optimize particle-cell-codes written in Fortran for RISC processors which are commonly used on massively parallel computers. These strategies include data reorganization to improve cache utilization and code reorganization to improve efficiency of arithmetic pipelines.

  7. DICER-ARGONAUTE2 complex in continuous fluorogenic assays of RNA interference enzymes.

    Directory of Open Access Journals (Sweden)

    Mark A Bernard

    Full Text Available Mechanistic studies of RNA processing in the RNA-Induced Silencing Complex (RISC have been hindered by lack of methods for continuous monitoring of enzymatic activity. "Quencherless" fluorogenic substrates of RNAi enzymes enable continuous monitoring of enzymatic reactions for detailed kinetics studies. Recombinant RISC enzymes cleave the fluorogenic substrates targeting human thymidylate synthase (TYMS and hypoxia-inducible factor 1-α subunit (HIF1A. Using fluorogenic dsRNA DICER substrates and fluorogenic siRNA, DICER+ARGONAUTE2 mixtures exhibit synergistic enzymatic activity relative to either enzyme alone, and addition of TRBP does not enhance the apparent activity. Titration of AGO2 and DICER in enzyme assays suggests that AGO2 and DICER form a functional high-affinity complex in equimolar ratio. DICER and DICER+AGO2 exhibit Michaelis-Menten kinetics with DICER substrates. However, AGO2 cannot process the fluorogenic siRNA without DICER enzyme, suggesting that AGO2 cannot self-load siRNA into its active site. The DICER+AGO2 combination processes the fluorogenic siRNA substrate (Km=74 nM with substrate inhibition kinetics (Ki=105 nM, demonstrating experimentally that siRNA binds two different sites that affect Dicing and AGO2-loading reactions in RISC. This result suggests that siRNA (product of DICER bound in the active site of DICER may undergo direct transfer (as AGO2 substrate to the active site of AGO2 in the DICER+AGO2 complex. Competitive substrate assays indicate that DICER+AGO2 cleavage of fluorogenic siRNA is specific, since unlabeled siRNA and DICER substrates serve as competing substrates that cause a concentration-dependent decrease in fluorescent rates. Competitive substrate assays of a series of DICER substrates in vitro were correlated with cell-based assays of HIF1A mRNA knockdown (log-log slope=0.29, suggesting that improved DICER substrate designs with 10-fold greater processing by the DICER+AGO2 complex can provide a

  8. GW182-Free microRNA Silencing Complex Controls Post-transcriptional Gene Expression during Caenorhabditis elegans Embryogenesis.

    Directory of Open Access Journals (Sweden)

    Guillaume Jannot

    2016-12-01

    Full Text Available MicroRNAs and Argonaute form the microRNA induced silencing complex or miRISC that recruits GW182, causing mRNA degradation and/or translational repression. Despite the clear conservation and molecular significance, it is unknown if miRISC-GW182 interaction is essential for gene silencing during animal development. Using Caenorhabditis elegans to explore this question, we examined the relationship and effect on gene silencing between the GW182 orthologs, AIN-1 and AIN-2, and the microRNA-specific Argonaute, ALG-1. Homology modeling based on human Argonaute structures indicated that ALG-1 possesses conserved Tryptophan-binding Pockets required for GW182 binding. We show in vitro and in vivo that their mutations severely altered the association with AIN-1 and AIN-2. ALG-1 tryptophan-binding pockets mutant animals retained microRNA-binding and processing ability, but were deficient in reporter silencing activity. Interestingly, the ALG-1 tryptophan-binding pockets mutant phenocopied the loss of alg-1 in worms during larval stages, yet was sufficient to rescue embryonic lethality, indicating the dispensability of AINs association with the miRISC at this developmental stage. The dispensability of AINs in miRNA regulation is further demonstrated by the capacity of ALG-1 tryptophan-binding pockets mutant to regulate a target of the embryonic mir-35 microRNA family. Thus, our results demonstrate that the microRNA pathway can act independently of GW182 proteins during C. elegans embryogenesis.

  9. Biochemical and single-molecule analyses of the RNA silencing suppressing activity of CrPV-1A.

    Science.gov (United States)

    Watanabe, Mariko; Iwakawa, Hiro-Oki; Tadakuma, Hisashi; Tomari, Yukihide

    2017-10-13

    Viruses often encode viral silencing suppressors (VSSs) to counteract the hosts' RNA silencing activity. The cricket paralysis virus 1A protein (CrPV-1A) is a unique VSS that binds to a specific Argonaute protein (Ago)-the core of the RNA-induced silencing complex (RISC)-in insects to suppress its target cleavage reaction. However, the precise molecular mechanism of CrPV-1A action remains unclear. Here we utilized biochemical and single-molecule imaging approaches to analyze the effect of CrPV-1A during target recognition and cleavage by Drosophila Ago2-RISC. Our results suggest that CrPV-1A obstructs the initial target searching by Ago2-RISC via base pairing in the seed region. The combination of biochemistry and single-molecule imaging may help to pave the way for mechanistic understanding of VSSs with diverse functions. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. SiRNA Crosslinked Nanoparticles for the Treatment of Inflammation-induced Liver Injury.

    Science.gov (United States)

    Tang, Yaqin; Zeng, Ziying; He, Xiao; Wang, Tingting; Ning, Xinghai; Feng, Xuli

    2017-02-01

    RNA interference mediated by small interfering RNA (siRNA) provides a powerful tool for gene regulation, and has a broad potential as a promising therapeutic strategy. However, therapeutics based on siRNA have had limited clinical success due to their undesirable pharmacokinetic properties. This study presents pH-sensitive nanoparticles-based siRNA delivery systems (PNSDS), which are positive-charge-free nanocarriers, composed of siRNA chemically crosslinked with multi-armed poly(ethylene glycol) carriers via acid-labile acetal linkers. The unique siRNA crosslinked structure of PNSDS allows it to have minimal cytotoxicity, high siRNA loading efficiency, and a stimulus-responsive property that enables the selective intracellular release of siRNA in response to pH conditions. This study demonstrates that PNSDS can deliver tumor necrosis factor alpha (TNF-α) siRNA into macrophages and induce the efficient down regulation of the targeted gene in complete cell culture media. Moreover, PNSDS with mannose targeting moieties can selectively accumulate in mice liver, induce specific inhibition of macrophage TNF-α expression in vivo, and consequently protect mice from inflammation-induced liver damages. Therefore, this novel siRNA delivering platform would greatly improve the therapeutic potential of RNAi based therapies.

  11. rRNA fragmentation induced by a yeast killer toxin.

    Science.gov (United States)

    Kast, Alene; Klassen, Roland; Meinhardt, Friedhelm

    2014-02-01

    Virus like dsDNA elements (VLE) in yeast were previously shown to encode the killer toxins PaT and zymocin, which target distinct tRNA species via specific anticodon nuclease (ACNase) activities. Here, we characterize a third member of the VLE-encoded toxins, PiT from Pichia inositovora, and identify PiOrf4 as the cytotoxic subunit by conditional expression in Saccharomyces cerevisiae. In contrast to the tRNA targeting toxins, however, neither a change of the wobble uridine modification status by introduction of elp3 or trm9 mutations nor tRNA overexpression rescued from PiOrf4 toxicity. Consistent with a distinct RNA target, expression of PiOrf4 causes specific fragmentation of the 25S and 18S rRNA. A stable cleavage product comprising the first ∼ 130 nucleotides of the 18S rRNA was purified and characterized by linker ligation and subsequent reverse transcription; 3'-termini were mapped to nucleotide 131 and 132 of the 18S rRNA sequence, a region showing some similarity to the anticodon loop of tRNA(Glu)(UUC), the zymocin target. PiOrf4 residues Glu9 and His214, corresponding to catalytic sites Glu9 and His209 in the ACNase subunit of zymocin are essential for in vivo toxicity and rRNA fragmentation, raising the possibility of functionally conserved RNase modules in both proteins. © 2013 John Wiley & Sons Ltd.

  12. Bacterial RNA induces myocyte cellular dysfunction through the activation of PKR

    Science.gov (United States)

    Bleiblo, Farag; Michael, Paul; Brabant, Danielle; Ramana, Chilakamarti V.; Tai, TC; Saleh, Mazen; Parrillo, Joseph E.; Kumar, Anand

    2012-01-01

    Severe sepsis and the ensuing septic shock are serious life threatening conditions. These diseases are triggered by the host's over exuberant systemic response to the infecting pathogen. Several surveillance mechanisms have evolved to discriminate self from foreign RNA and accordingly trigger effective cellular responses to target the pathogenic threats. The RNA-dependent protein kinase (PKR) is a key component of the cytoplasmic RNA sensors involved in the recognition of viral double-stranded RNA (dsRNA). Here, we identify bacterial RNA as a distinct pathogenic pattern recognized by PKR. Our results indicate that natural RNA derived from bacteria directly binds to and activates PKR. We further show that bacterial RNA induces human cardiac myocyte apoptosis and identify the requirement for PKR in mediating this response. In addition to bacterial immunity, the results presented here may also have implications in cardiac pathophysiology. PMID:22833816

  13. Interactions between the HIV-1 Unspliced mRNA and Host mRNA Decay Machineries

    Directory of Open Access Journals (Sweden)

    Daniela Toro-Ascuy

    2016-11-01

    Full Text Available The human immunodeficiency virus type-1 (HIV-1 unspliced transcript is used both as mRNA for the synthesis of structural proteins and as the packaged genome. Given the presence of retained introns and instability AU-rich sequences, this viral transcript is normally retained and degraded in the nucleus of host cells unless the viral protein REV is present. As such, the stability of the HIV-1 unspliced mRNA must be particularly controlled in the nucleus and the cytoplasm in order to ensure proper levels of this viral mRNA for translation and viral particle formation. During its journey, the HIV-1 unspliced mRNA assembles into highly specific messenger ribonucleoproteins (mRNPs containing many different host proteins, amongst which are well-known regulators of cytoplasmic mRNA decay pathways such as up-frameshift suppressor 1 homolog (UPF1, Staufen double-stranded RNA binding protein 1/2 (STAU1/2, or components of miRNA-induced silencing complex (miRISC and processing bodies (PBs. More recently, the HIV-1 unspliced mRNA was shown to contain N6-methyladenosine (m6A, allowing the recruitment of YTH N6-methyladenosine RNA binding protein 2 (YTHDF2, an m6A reader host protein involved in mRNA decay. Interestingly, these host proteins involved in mRNA decay were shown to play positive roles in viral gene expression and viral particle assembly, suggesting that HIV-1 interacts with mRNA decay components to successfully accomplish viral replication. This review summarizes the state of the art in terms of the interactions between HIV-1 unspliced mRNA and components of different host mRNA decay machineries.

  14. Radiation-induced alternative transcripts as detected in total and polysome-bound mRNA.

    Science.gov (United States)

    Wahba, Amy; Ryan, Michael C; Shankavaram, Uma T; Camphausen, Kevin; Tofilon, Philip J

    2018-01-02

    Alternative splicing is a critical event in the posttranscriptional regulation of gene expression. To investigate whether this process influences radiation-induced gene expression we defined the effects of ionizing radiation on the generation of alternative transcripts in total cellular mRNA (the transcriptome) and polysome-bound mRNA (the translatome) of the human glioblastoma stem-like cell line NSC11. For these studies, RNA-Seq profiles from control and irradiated cells were compared using the program SpliceSeq to identify transcripts and splice variations induced by radiation. As compared to the transcriptome (total RNA) of untreated cells, the radiation-induced transcriptome contained 92 splice events suggesting that radiation induced alternative splicing. As compared to the translatome (polysome-bound RNA) of untreated cells, the radiation-induced translatome contained 280 splice events of which only 24 were overlapping with the radiation-induced transcriptome. These results suggest that radiation not only modifies alternative splicing of precursor mRNA, but also results in the selective association of existing mRNA isoforms with polysomes. Comparison of radiation-induced alternative transcripts to radiation-induced gene expression in total RNA revealed little overlap (about 3%). In contrast, in the radiation-induced translatome, about 38% of the induced alternative transcripts corresponded to genes whose expression level was affected in the translatome. This study suggests that whereas radiation induces alternate splicing, the alternative transcripts present at the time of irradiation may play a role in the radiation-induced translational control of gene expression and thus cellular radioresponse.

  15. Double-stranded RNA interferes in a sequence-specific manner with the infection of representative members of the two viroid families

    International Nuclear Information System (INIS)

    Carbonell, Alberto; Martinez de Alba, Angel-Emilio; Flores, Ricardo; Gago, Selma

    2008-01-01

    Infection by viroids, non-protein-coding circular RNAs, occurs with the accumulation of 21-24 nt viroid-derived small RNAs (vd-sRNAs) with characteristic properties of small interfering RNAs (siRNAs) associated to RNA silencing. The vd-sRNAs most likely derive from dicer-like (DCL) enzymes acting on viroid-specific dsRNA, the key elicitor of RNA silencing, or on the highly structured genomic RNA. Previously, viral dsRNAs delivered mechanically or agroinoculated have been shown to interfere with virus infection in a sequence-specific manner. Here, we report similar results with members of the two families of nuclear- and chloroplast-replicating viroids. Moreover, homologous vd-sRNAs co-delivered mechanically also interfered with one of the viroids examined. The interference was sequence-specific, temperature-dependent and, in some cases, also dependent on the dose of the co-inoculated dsRNA or vd-sRNAs. The sequence-specific nature of these effects suggests the involvement of the RNA induced silencing complex (RISC), which provides sequence specificity to RNA silencing machinery. Therefore, viroid titer in natural infections might be regulated by the concerted action of DCL and RISC. Viroids could have evolved their secondary structure as a compromise between resistance to DCL and RISC, which act preferentially against RNAs with compact and relaxed secondary structures, respectively. In addition, compartmentation, association with proteins or active replication might also help viroids to elude their host RNA silencing machinery

  16. Strategies for Improving siRNA-Induced Gene Silencing Efficiency.

    Science.gov (United States)

    Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad

    2017-12-01

    Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.

  17. A RISC/UNIX workstation second stage trigger

    International Nuclear Information System (INIS)

    Foreman, W.M.; Amann, J.F.; Fu, S.; Kozlowski, T.; Naivar, F.J.; Oothoudt, M.A.; Shelley, F.

    1992-01-01

    Recent advances in Reduced Instruction Set Computer (RISC) workstations have greatly altered the economics of processing power available for experiments. In addition VME interfaces available for many of these workstations make it possible to use them in experiment frontends for filtering and compressing data. Such a second stage trigger has been implemented at LAMPF using a commercially available workstation and VME interface. The implementation is described and measurements of data transfer speeds are presented in this paper

  18. Simty: generalized SIMT execution on RISC-V

    OpenAIRE

    Collange , Sylvain

    2017-01-01

    International audience; We present Simty, a massively multi-threaded RISC-V processor core that acts as a proof of concept for dynamic inter-thread vector-ization at the micro-architecture level. Simty runs groups of scalar threads executing SPMD code in lockstep, and assembles SIMD instructions dynamically across threads. Unlike existing SIMD or SIMT processors like GPUs or vector processors, Simty vector-izes scalar general-purpose binaries. It does not involve any instruction set extension...

  19. HCV-induced autophagosomes are generated via homotypic fusion of phagophores that mediate HCV RNA replication.

    Directory of Open Access Journals (Sweden)

    Linya Wang

    2017-09-01

    Full Text Available Hepatitis C virus (HCV induces autophagy to promote its replication, including its RNA replication, which can take place on double-membrane vesicles known as autophagosomes. However, how HCV induces the biogenesis of autophagosomes and how HCV RNA replication complex may be assembled on autophagosomes were largely unknown. During autophagy, crescent membrane structures known as phagophores first appear in the cytoplasm, which then progress to become autophagosomes. By conducting electron microscopy and in vitro membrane fusion assay, we found that phagophores induced by HCV underwent homotypic fusion to generate autophagosomes in a process dependent on the SNARE protein syntaxin 7 (STX7. Further analyses by live-cell imaging and fluorescence microscopy indicated that HCV-induced phagophores originated from the endoplasmic reticulum (ER. Interestingly, comparing with autophagy induced by nutrient starvation, the progression of phagophores to autophagosomes induced by HCV took significantly longer time, indicating fundamental differences in the biogenesis of autophagosomes induced by these two different stimuli. As the knockdown of STX7 to inhibit the formation of autophagosomes did not affect HCV RNA replication, and purified phagophores could mediate HCV RNA replication, the assembly of the HCV RNA replication complex on autophagosomes apparently took place during the formative stage of phagophores. These findings provided important information for understanding how HCV controlled and modified this important cellular pathway for its own replication.

  20. MicroRNA-197 induces epithelial-mesenchymal transition and ...

    Indian Academy of Sciences (India)

    微软用户

    Background: The major cause of cancer-related deaths in patients with lung ... These observations suggest that miR-197 could be a therapeutic target for preventing ..... Ng C, et al. MicroRNA-antagonism regulates breast cancer stemness and ...

  1. HIV-1 RNAs are Not Part of the Argonaute 2 Associated RNA Interference Pathway in Macrophages.

    Directory of Open Access Journals (Sweden)

    Valentina Vongrad

    Full Text Available MiRNAs and other small noncoding RNAs (sncRNAs are key players in post-transcriptional gene regulation. HIV-1 derived small noncoding RNAs (sncRNAs have been described in HIV-1 infected cells, but their biological functions still remain to be elucidated. Here, we approached the question whether viral sncRNAs may play a role in the RNA interference (RNAi pathway or whether viral mRNAs are targeted by cellular miRNAs in human monocyte derived macrophages (MDM.The incorporation of viral sncRNAs and/or their target RNAs into RNA-induced silencing complex was investigated using photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP as well as high-throughput sequencing of RNA isolated by cross-linking immunoprecipitation (HITS-CLIP, which capture Argonaute2-bound miRNAs and their target RNAs. HIV-1 infected monocyte-derived macrophages (MDM were chosen as target cells, as they have previously been shown to express HIV-1 sncRNAs. In addition, we applied small RNA deep sequencing to study differential cellular miRNA expression in HIV-1 infected versus non-infected MDMs.PAR-CLIP and HITS-CLIP data demonstrated the absence of HIV-1 RNAs in Ago2-RISC, although the presence of a multitude of HIV-1 sncRNAs in HIV-1 infected MDMs was confirmed by small RNA sequencing. Small RNA sequencing revealed that 1.4% of all sncRNAs were of HIV-1 origin. However, neither HIV-1 derived sncRNAs nor putative HIV-1 target sequences incorporated into Ago2-RISC were identified suggesting that HIV-1 sncRNAs are not involved in the canonical RNAi pathway nor is HIV-1 targeted by this pathway in HIV-1 infected macrophages.

  2. p38-MK2 signaling axis regulates RNA metabolism after UV-light-induced DNA damage

    DEFF Research Database (Denmark)

    Borisova, Marina E; Voigt, Andrea; Tollenaere, Maxim A X

    2018-01-01

    quantitative phosphoproteomics and protein kinase inhibition to provide a systems view on protein phosphorylation patterns induced by UV light and uncover the dependencies of phosphorylation events on the canonical DNA damage signaling by ATM/ATR and the p38 MAP kinase pathway. We identify RNA-binding proteins......Ultraviolet (UV) light radiation induces the formation of bulky photoproducts in the DNA that globally affect transcription and splicing. However, the signaling pathways and mechanisms that link UV-light-induced DNA damage to changes in RNA metabolism remain poorly understood. Here we employ...

  3. RISC-RAD. A European integrated approach to the problem of low doses

    International Nuclear Information System (INIS)

    Meunier, A.; Sabatier, L.; Atkinson, M.; Paretzke, H.; Bouffler, S.; Mullenders, L.

    2007-01-01

    experience gained within RISC-RAD, and the results of the project will give the low dose community an interesting perspective on interdisciplinary research issues. The acronym stands for Radiosensitivity of Individuals and Susceptibility to Cancer induced by Ionizing Radiations.

  4. Psychometrische kwaliteiten van de Recidive Inschattingsschalen (RISc) : Interbeoordelaarsbetrouwbaarheid, interne consistentie en congruente validiteit

    NARCIS (Netherlands)

    Knaap, L.M. van der; Leenarts, L.E.W.; Nijssen, L.T.J.

    2007-01-01

    Het instrument Recidive Inschattings Schalen (RISc) is gebaseerd op een Engelstalig instrument (OASys). Tijdens de ontwikkeling van de RISc is aandacht besteed aan de vertaling van het instrument, aan de kwaliteit van de items en aan de interne consistentie van de schalen van het instrument. Verder

  5. Psychometric Evaluation of the Connor-Davidson Resilience Scale (CD-RISC) Using Iranian Students

    Science.gov (United States)

    Khoshouei, Mahdieh Sadat

    2009-01-01

    The purpose of this study was to evaluate the psychometric properties of the Persian version of the Connor-Davidson Resilience Scale (CD-RISC). The CD-RISC was completed by a sample of 323 Isfahan university students (168 females, 155 males) aged 19-34 years. A maximum likelihood method with an oblique solution resulted in four factors…

  6. Efficient Multiple Genome Modifications Induced by the crRNAs, tracrRNA and Cas9 Protein Complex in Zebrafish

    Science.gov (United States)

    Ohga, Rie; Ota, Satoshi; Kawahara, Atsuo

    2015-01-01

    The type II clustered regularly interspaced short palindromic repeats (CRISPR) associated with Cas9 endonuclease (CRISPR/Cas9) has become a powerful genetic tool for understanding the function of a gene of interest. In zebrafish, the injection of Cas9 mRNA and guide-RNA (gRNA), which are prepared using an in vitro transcription system, efficiently induce DNA double-strand breaks (DSBs) at the targeted genomic locus. Because gRNA was originally constructed by fusing two short RNAs CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA), we examined the effect of synthetic crRNAs and tracrRNA with Cas9 mRNA or Cas9 protein on the genome editing activity. We previously reported that the disruption of tyrosinase (tyr) by tyr-gRNA/Cas9 mRNA causes a retinal pigment defect, whereas the disruption of spns2 by spns2-gRNA1/Cas9 mRNA leads to a cardiac progenitor migration defect in zebrafish. Here, we found that the injection of spns2-crRNA1, tyr-crRNA and tracrRNA with Cas9 mRNA or Cas9 protein simultaneously caused a migration defect in cardiac progenitors and a pigment defect in retinal epithelial cells. A time course analysis demonstrated that the injection of crRNAs and tracrRNA with Cas9 protein rapidly induced genome modifications compared with the injection of crRNAs and tracrRNA with Cas9 mRNA. We further show that the crRNA-tracrRNA-Cas9 protein complex is functional for the visualization of endogenous gene expression; therefore, this is a very powerful, ready-to-use system in zebrafish. PMID:26010089

  7. RISC. A new style in the design of architectures

    International Nuclear Information System (INIS)

    Cortadella, J.; Gonzalez, A.; Llaberia, J.M.

    1988-01-01

    In the 80's a new architecture design and implementation style has appeared: the RISC style. It proposes an overall view of the system were the processor is included. For each function, an extensive analysis has to be performed in order to evaluate the advantages and disadvantages that hardware and software introduce in the design. An optimum design involved an agreement between both levels and has to take into account cost, performance, and technological factors. In this paper, the main features of this new architecture design style are presented. (Author)

  8. A fastbus master based on a risc microprocessor

    International Nuclear Information System (INIS)

    Cerrito, L.; Chorowicz, V.; Lebbolo, H.; Vallereau, A.

    1990-01-01

    SISIFUS is a general purpose Fastbus Master and Slave able to perform any operation on both Fastbus segments. Master operations are directed either by the processor or by two fast sequencers. A Block Mover function is implemented allowing direct data block transfers between two Slaves. SISIFUS uses the AM 29000 RISC microprocessor which can execute every assembler instruction in 40ns. The on-board monitor/debugger allows programs to be written in assembler from a terminal connected to the module or written in C and cross compiled on a host computer (PC)

  9. Efficient Inhibition of wear debris-induced inflammation by locally delivered siRNA

    International Nuclear Information System (INIS)

    Peng Xiaochun; Tao Kun; Cheng Tao; Zhu Junfeng; Zhang Xianlong

    2008-01-01

    Aseptic loosening is the most common long-term complication of total joint replacement, which is associated with the generation of wear debris. The purpose of this study was to investigate the inhibitory effect of small interfering RNA (siRNA) targeting tumor necrosis factor-α (TNF-α) on wear debris-induced inflammation. A local delivery of lentivirus-mediated TNF-α siRNA into the modified murine air pouch, which was stimulated by polymethylmethacrylate (PMMA) particles, resulted in significant blockage of TNF-α both in mRNA and protein levels for up to 4 weeks. In addition, significant down-regulation of interleukin-1 (IL-1) and interleukin-6 (IL-6) was observed in TNF-α siRNA-treated pouches. The safety profile of gene therapy was proven by Bioluminescent assay and quantitative fluorescent flux. Histological analysis revealed less inflammatory responses (thinner pouch membrane and decreased cellular infiltration) in TNF-α siRNA-treated pouches. These findings suggest that local delivery of TNF-α siRNA might be an excellent therapeutic candidate to inhibit particle-induced inflammation.

  10. Perivascular delivery of Notch 1 siRNA inhibits injury-induced arterial remodeling.

    Directory of Open Access Journals (Sweden)

    Eileen M Redmond

    Full Text Available To determine the efficacy of perivascular delivery of Notch 1 siRNA in preventing injury-induced arterial remodeling.Carotid artery ligation was performed to induce arterial remodeling. After 14 days, morphometric analysis confirmed increased vSMC growth and subsequent media thickening and neointimal formation. Laser capture microdissection, quantitative qRT-PCR and immunoblot analysis of medial tissue revealed a significant increase in Notch1 receptor and notch target gene, Hrt 1 and 2 expression in the injured vessels. Perivascular delivery of Notch 1 siRNA by pluronic gel inhibited the injury-induced increase in Notch 1 receptor and target gene expression when compared to scrambled siRNA controls while concomitantly reducing media thickening and neointimal formation to pre-injury, sham-operated levels. Selective Notch 1 knockdown also reversed the injury-induced inhibition of pro-apoptotic Bax expression while decreasing injury-induced anti-apoptotic Bcl-XL expression to sham-operated control levels. In parallel experiments, proliferative cyclin levels, as measured by PCNA expression, were reversed to sham-operated control levels following selective Notch 1 knockdown.These results suggest that injury-induced arterial remodeling can be successfully inhibited by localized perivascular delivery of Notch 1 siRNA.

  11. Design of RISC Processor Using VHDL and Cadence

    Science.gov (United States)

    Moslehpour, Saeid; Puliroju, Chandrasekhar; Abu-Aisheh, Akram

    The project deals about development of a basic RISC processor. The processor is designed with basic architecture consisting of internal modules like clock generator, memory, program counter, instruction register, accumulator, arithmetic and logic unit and decoder. This processor is mainly used for simple general purpose like arithmetic operations and which can be further developed for general purpose processor by increasing the size of the instruction register. The processor is designed in VHDL by using Xilinx 8.1i version. The present project also serves as an application of the knowledge gained from past studies of the PSPICE program. The study will show how PSPICE can be used to simplify massive complex circuits designed in VHDL Synthesis. The purpose of the project is to explore the designed RISC model piece by piece, examine and understand the Input/ Output pins, and to show how the VHDL synthesis code can be converted to a simplified PSPICE model. The project will also serve as a collection of various research materials about the pieces of the circuit.

  12. A study on the effectiveness of lockup-free caches for a Reduced Instruction Set Computer (RISC) processor

    OpenAIRE

    Tharpe, Leonard.

    1992-01-01

    Approved for public release; distribution is unlimited This thesis presents a simulation and analysis of the Reduced Instruction Set Computer (RISC) architecture and the effects on RISC performance of a lockup-free cache interface. RISC architectures achieve high performance by having a small, but sufficient, instruction set with most instructions executing in one clock cycle. Current RISC performance range from 1.5 to 2.0 CPI. The goal of RISC is to attain a CPI of 1.0. The major hind...

  13. Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

    Science.gov (United States)

    Travella, Silvia; Keller, Beat

    Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

  14. Formation of tRNA granules in the nucleus of heat-induced human cells

    International Nuclear Information System (INIS)

    Miyagawa, Ryu; Mizuno, Rie; Watanabe, Kazunori; Ijiri, Kenichi

    2012-01-01

    Highlights: ► tRNAs are tranlocated into the nucleus in heat-induced HeLa cells. ► tRNAs form the unique granules in the nucleus. ► tRNA ganules overlap with nuclear stress granules. -- Abstract: The stress response, which can trigger various physiological phenomena, is important for living organisms. For instance, a number of stress-induced granules such as P-body and stress granule have been identified. These granules are formed in the cytoplasm under stress conditions and are associated with translational inhibition and mRNA decay. In the nucleus, there is a focus named nuclear stress body (nSB) that distinguishes these structures from cytoplasmic stress granules. Many splicing factors and long non-coding RNA species localize in nSBs as a result of stress. Indeed, tRNAs respond to several kinds of stress such as heat, oxidation or starvation. Although nuclear accumulation of tRNAs occurs in starved Saccharomyces cerevisiae, this phenomenon is not found in mammalian cells. We observed that initiator tRNA Met (Meti) is actively translocated into the nucleus of human cells under heat stress. During this study, we identified unique granules of Meti that overlapped with nSBs. Similarly, elongator tRNA Met was translocated into the nucleus and formed granules during heat stress. Formation of tRNA granules is closely related to the translocation ratio. Then, all tRNAs may form the specific granules.

  15. Random small interfering RNA library screen identifies siRNAs that induce human erythroleukemia cell differentiation.

    Science.gov (United States)

    Fan, Cuiqing; Xiong, Yuan; Zhu, Ning; Lu, Yabin; Zhang, Jiewen; Wang, Song; Liang, Zicai; Shen, Yan; Chen, Meihong

    2011-03-01

    Cancers are characterized by poor differentiation. Differentiation therapy is a strategy to alleviate malignant phenotypes by inducing cancer cell differentiation. Here we carried out a combinatorial high-throughput screen with a random siRNA library on human erythroleukemia K-562 cell differentiation. Two siRNAs screened from the library were validated to be able to induce erythroid differentiation to varying degrees, determined by CD235 and globin up-regulation, GATA-2 down-regulation, and cell growth inhibition. The screen we performed here is the first trial of screening cancer differentiation-inducing agents from a random siRNA library, demonstrating that a random siRNA library can be considered as a new resource in efforts to seek new therapeutic agents for cancers. As a random siRNA library has a broad coverage for the entire genome, including known/unknown genes and protein coding/non-coding sequences, screening using a random siRNA library can be expected to greatly augment the repertoire of therapeutic siRNAs for cancers.

  16. Low dose radiation effects: an integrative european approach (Risc-Rad Project) coordinated by the Cea

    International Nuclear Information System (INIS)

    Sabatier, L.

    2006-01-01

    RISC-RAD (Radiosensitivity of Individuals and Susceptibility to Cancer induced by ionizing Radiations) is an Integrated Project funded by the European Commission under 6. Framework Programme / EURATOM. RISC-RAD started on 1. January 2004 for a duration of four years. Coordinated by Cea (Dr Laure Sabatier), it involves 11 European countries (Austria, Denmark, Finland, France, Germany, Ireland, Italy, the Netherlands, Spain, Sweden and the United Kingdom) and 29 research institutions. Objectives: Exposures to low and protracted doses of ionizing radiation are very frequent in normal living environment, at work places, in industry and in medicine. Effects of these exposures on human health cannot be reliably assessed by epidemiological methods, nor is thoroughly understood by biologists. RISC-RAD project proposes to help bridging the gap of scientific knowledge about these effects. To achieve this goal, a necessary key step is to understand the basic mechanisms by which radiation induces cancer. Studying this multistage process in an integrated way, the project offers a new biological approach characterised by and clear-cut and objective-driven scientific policy: the project is focused on the effects of low doses (less than 100 mSv) and protracted doses of radiation. It aims at identifying new parameters that take into account the differences in radiation responses between individuals. A group of modelers works closely with the experimental teams in order to better quantify the risks associated with low and protracted doses. Research work is divided into five work packages interacting closely with each other. WP1 is dedicated to DNA damage. Ionizing Radiation (IR) produce a broad spectrum of base modifications and DNA strand breaks of different kinds, among which double-strand breaks and 'clustered damage' which is thought to be a major feature in biological effectiveness of IR. The aim of Work Package 1 is to improve understanding of the initial DNA damage induced by

  17. RNA editing is induced by type I interferon in esophageal squamous cell carcinoma.

    Science.gov (United States)

    Zhang, Jinyao; Chen, Zhaoli; Tang, Zefang; Huang, Jianbing; Hu, Xueda; He, Jie

    2017-07-01

    In recent years, abnormal RNA editing has been shown to play an important role in the development of esophageal squamous cell carcinoma, as such abnormal editing is catalyzed by ADAR (adenosine deaminases acting on RNA). However, the regulatory mechanism of ADAR1 in esophageal squamous cell carcinomas remains largely unknown. In this study, we investigated ADAR1 expression and its association with RNA editing in esophageal squamous cell carcinomas. RNA sequencing applied to esophageal squamous cell carcinoma clinical samples showed that ADAR1 expression was correlated with the expression of STAT1, STAT2, and IRF9. In vitro experiments showed that the abundance of ADAR1 protein was associated with the induced activation of the JAK/STAT pathway by type I interferon. RNA sequencing results showed that treatment with type I interferon caused an increase in the number and degree of RNA editing in esophageal squamous cell carcinoma cell lines. In conclusion, the activation of the JAK/STAT pathway is a regulatory mechanism of ADAR1 expression and causes abnormal RNA editing profile in esophageal squamous cell carcinoma. This mechanism may serve as a new target for esophageal squamous cell carcinoma therapy.

  18. Expression of miRNA-122 Induced by Liver Toxicants in Zebrafish

    Directory of Open Access Journals (Sweden)

    Hyun-Sik Nam

    2016-01-01

    Full Text Available MicroRNA-122 (miRNA-122, also known as liver-specific miRNA, has recently been shown to be a potent biomarker in response to liver injury in mammals. The objective of this study was to examine its expression in response to toxicant treatment and acute liver damage, using the zebrafish system as an alternative model organism. For the hepatotoxicity assay, larval zebrafish were arrayed in 24-well plates. Adult zebrafish were also tested and arrayed in 200 mL cages. Animals were exposed to liver toxicants (tamoxifen or acetaminophen at various doses, and miRNA-122 expression levels were analyzed using qRT-PCR in dissected liver, brain, heart, and intestine, separately. Our results showed no significant changes in miRNA-122 expression level in tamoxifen-treated larvae; however, miRNA-122 expression was highly induced in tamoxifen-treated adults in a tissue-specific manner. In addition, we observed a histological change in adult liver (0.5 μM and cell death in larval liver (5 μM at different doses of tamoxifen. These results indicated that miRNA-122 may be utilized as a liver-specific biomarker for acute liver toxicity in zebrafish.

  19. Small regulatory RNA-induced growth rate heterogeneity of Bacillus subtilis.

    Science.gov (United States)

    Mars, Ruben A T; Nicolas, Pierre; Ciccolini, Mariano; Reilman, Ewoud; Reder, Alexander; Schaffer, Marc; Mäder, Ulrike; Völker, Uwe; van Dijl, Jan Maarten; Denham, Emma L

    2015-03-01

    Isogenic bacterial populations can consist of cells displaying heterogeneous physiological traits. Small regulatory RNAs (sRNAs) could affect this heterogeneity since they act by fine-tuning mRNA or protein levels to coordinate the appropriate cellular behavior. Here we show that the sRNA RnaC/S1022 from the Gram-positive bacterium Bacillus subtilis can suppress exponential growth by modulation of the transcriptional regulator AbrB. Specifically, the post-transcriptional abrB-RnaC/S1022 interaction allows B. subtilis to increase the cell-to-cell variation in AbrB protein levels, despite strong negative autoregulation of the abrB promoter. This behavior is consistent with existing mathematical models of sRNA action, thus suggesting that induction of protein expression noise could be a new general aspect of sRNA regulation. Importantly, we show that the sRNA-induced diversity in AbrB levels generates heterogeneity in growth rates during the exponential growth phase. Based on these findings, we hypothesize that the resulting subpopulations of fast- and slow-growing B. subtilis cells reflect a bet-hedging strategy for enhanced survival of unfavorable conditions.

  20. MicroRNA Regulation of Ionizing Radiation-Induced Premature Senescence

    International Nuclear Information System (INIS)

    Wang Yong; Scheiber, Melissa N.; Neumann, Carola; Calin, George A.; Zhou Daohong

    2011-01-01

    Purpose: MicroRNAs (miRNAs) have emerged as critical regulators of many cellular pathways. Ionizing radiation (IR) exposure causes DNA damage and induces premature senescence. However, the role of miRNAs in IR-induced senescence has not been well defined. Thus, the purpose of this study was to identify and characterize senescence-associated miRNAs (SA-miRNAs) and to investigate the role of SA-miRNAs in IR-induced senescence. Methods and Materials: In human lung (WI-38) fibroblasts, premature senescence was induced either by IR or busulfan (BU) treatment, and replicative senescence was accomplished by serial passaging. MiRNA microarray were used to identify SA-miRNAs, and real-time reverse transcription (RT)-PCR validated the expression profiles of SA-miRNAs in various senescent cells. The role of SA-miRNAs in IR-induced senescence was characterized by knockdown of miRNA expression, using anti-miRNA oligonucleotides or by miRNA overexpression through the transfection of pre-miRNA mimics. Results: We identified eight SA-miRNAs, four of which were up-regulated (miR-152, -410, -431, and -493) and four which were down-regulated (miR-155, -20a, -25, and -15a), that are differentially expressed in both prematurely senescent (induced by IR or BU) and replicatively senescent WI-38 cells. Validation of the expression of these SA-miRNAs indicated that down-regulation of miR-155, -20a, -25, and -15a is a characteristic miRNA expression signature of cellular senescence. Functional analyses revealed that knockdown of miR-155 or miR-20a, but not miR-25 or miR-15a, markedly enhanced IR-induced senescence, whereas ectopic overexpression of miR-155 or miR-20a significantly inhibited senescence induction. Furthermore, our studies indicate that miR-155 modulates IR-induced senescence by acting downstream of the p53 and p38 mitogen-activated protein kinase (MAPK) pathways and in part via regulating tumor protein 53-induced nuclear protein 1 (TP53INP1) expression. Conclusion: Our

  1. Elucidating Mechanisms of Molecular Recognition Between Human Argonaute and miRNA Using Computational Approaches

    KAUST Repository

    Jiang, Hanlun

    2016-12-06

    MicroRNA (miRNA) and Argonaute (AGO) protein together form the RNA-induced silencing complex (RISC) that plays an essential role in the regulation of gene expression. Elucidating the underlying mechanism of AGO-miRNA recognition is thus of great importance not only for the in-depth understanding of miRNA function but also for inspiring new drugs targeting miRNAs. In this chapter we introduce a combined computational approach of molecular dynamics (MD) simulations, Markov state models (MSMs), and protein-RNA docking to investigate AGO-miRNA recognition. Constructed from MD simulations, MSMs can elucidate the conformational dynamics of AGO at biologically relevant timescales. Protein-RNA docking can then efficiently identify the AGO conformations that are geometrically accessible to miRNA. Using our recent work on human AGO2 as an example, we explain the rationale and the workflow of our method in details. This combined approach holds great promise to complement experiments in unraveling the mechanisms of molecular recognition between large, flexible, and complex biomolecules.

  2. Elucidating Mechanisms of Molecular Recognition Between Human Argonaute and miRNA Using Computational Approaches.

    Science.gov (United States)

    Jiang, Hanlun; Zhu, Lizhe; Héliou, Amélie; Gao, Xin; Bernauer, Julie; Huang, Xuhui

    2017-01-01

    MicroRNA (miRNA) and Argonaute (AGO) protein together form the RNA-induced silencing complex (RISC) that plays an essential role in the regulation of gene expression. Elucidating the underlying mechanism of AGO-miRNA recognition is thus of great importance not only for the in-depth understanding of miRNA function but also for inspiring new drugs targeting miRNAs. In this chapter we introduce a combined computational approach of molecular dynamics (MD) simulations, Markov state models (MSMs), and protein-RNA docking to investigate AGO-miRNA recognition. Constructed from MD simulations, MSMs can elucidate the conformational dynamics of AGO at biologically relevant timescales. Protein-RNA docking can then efficiently identify the AGO conformations that are geometrically accessible to miRNA. Using our recent work on human AGO2 as an example, we explain the rationale and the workflow of our method in details. This combined approach holds great promise to complement experiments in unraveling the mechanisms of molecular recognition between large, flexible, and complex biomolecules.

  3. Foot-and-mouth disease virus-induced RNA polymerase is associated with Golgi apparatus.

    OpenAIRE

    Polatnick, J; Wool, S H

    1985-01-01

    Electrophoretic analysis of the Golgi apparatus isolated by differential centrifugation from radiolabeled cells infected with foot-and-mouth disease virus showed about 10 protein bands. The virus-induced RNA polymerase was identified by immunoprecipitation and electron microscope staining procedures. Pulse-chase experiments indicated that the polymerase passed through the Golgi apparatus in less than 1 h.

  4. Proposta e simulação de uma arquitetura RISC

    OpenAIRE

    Fredy Joao Valente

    1991-01-01

    RISC - Uma nova tendência em arquitetura de computadores. Este trabalho apresenta um estudo de como surgiu esta nova arquitetura, e suas características básicas, que a diferencia das arquiteturas convencionais. Uma proposta de microprocessador RISC é apresentada, com sua rota de dados completamente detalhada. Um simulador para arquitetura RISC foi então construído, para se testar este microprocessador. Para validar o simulador, que é a idéia principal deste trabalho, e para se avaliar a arqui...

  5. FcepsilonRI-alpha siRNA inhibits the antigen-induced activation of mast cells.

    Science.gov (United States)

    Safaralizadeh, Reza; Soheili, Zahra-Soheila; Deezagi, Abdolkhaleg; Pourpak, Zahra; Samiei, Shahram; Moin, Mostafa

    2009-12-01

    FcepsilonRI, The high affinity receptor for IgE plays a critical role in triggering the allergic reactions. It is responsible for inducing mast cell degranulation and deliberation of allergy mediators when it is aggregated by allergen and IgE complexes. FcepsilonRI on the mast cells consists of three subunits; alpha chain directly binds IgE, beta chain and dimmer of gamma chains together mediate intracellular signaling. Cross-linking of IgE-bound FcepsilonRI on the surface of mast cells and basophils by the multivalent antigen induces release of chemical mediators. The present in vitro study was designed to investigate the effect of synthetic FcepsilonRI-alpha siRNA on the antigen-induced activation of MC/9 cells. MC/9 cells which are murine mast cells were transfected by FcepsilonRI-alpha siRNA and negative control siRNA. After 6 h, anti-DNP (Dinitrophenyl) IgE was used for the cells sensitization. Then the cells were challenged with Dinitrophenyl-Human Serum Albumin (DNP-HSA) for mast cell degranulation induction before collection of supernatants. The amount of mRNA and protein expression was measured by Real Time PCR and western blot analysis, respectively. Determination of the expression rate of FcepsilonRI-alpha on cell surface was achieved by flow cytometry. ELISA and spectrophotometry methods were used subsequently for measuring the effects of FcepsilonRI-alpha siRNA on antigen-induced histamine and beta-hexosaminidase release. FcepsilonRI-alpha siRNA treated cells showed significant decrease in FcepsilonRI-alpha mRNA and protein expression in comparison to control cells. FcepsilonRI-mediated mast cell release of beta-hexosaminidase and histamine were also inhibited. In this study it was shown that FcepsilonRI-alpha siRNA could suppress FcepsilonRI-alpha expression and inhibited degranulation and histamine release in antigen-stimulated MC/9 cells. In conclusion, knock-down of FcepsilonRI-alpha by siRNA could be a promising method for inhibition of the mast

  6. Characterization of the TRBP domain required for Dicer interaction and function in RNA interference

    Directory of Open Access Journals (Sweden)

    El Far Mohamed

    2009-05-01

    Full Text Available Abstract Background Dicer, Ago2 and TRBP are the minimum components of the human RNA-induced silencing complex (RISC. While Dicer and Ago2 are RNases, TRBP is the double-stranded RNA binding protein (dsRBP that loads small interfering RNA into the RISC. TRBP binds directly to Dicer through its C-terminal domain. Results We show that the TRBP binding site in Dicer is a 165 amino acid (aa region located between the ATPase and the helicase domains. The binding site in TRBP is a 69 aa domain, called C4, located at the C-terminal end of TRBP. The TRBP1 and TRBP2 isoforms, but not TRBPs lacking the C4 site (TRBPsΔC4, co-immunoprecipitated with Dicer. The C4 domain is therefore necessary to bind Dicer, irrespective of the presence of RNA. Immunofluorescence shows that while full-length TRBPs colocalize with Dicer, TRBPsΔC4 do not. tarbp2-/- cells, which do not express TRBP, do not support RNA interference (RNAi mediated by short hairpin or micro RNAs against EGFP. Both TRBPs, but not TRBPsΔC4, were able to rescue RNAi function. In human cells with low RNAi activity, addition of TRBP1 or 2, but not TRBPsΔC4, rescued RNAi function. Conclusion The mapping of the interaction sites between TRBP and Dicer show unique domains that are required for their binding. Since TRBPsΔC4 do not interact or colocalize with Dicer, we suggest that TRBP and Dicer, both dsRBPs, do not interact through bound dsRNA. TRBPs, but not TRBPsΔC4, rescue RNAi activity in RNAi-compromised cells, indicating that the binding of Dicer to TRBP is critical for RNAi function.

  7. Context Switching with Multiple Register Windows: A RISC Performance Study

    Science.gov (United States)

    Konsek, Marion B.; Reed, Daniel A.; Watcharawittayakul, Wittaya

    1987-01-01

    Although previous studies have shown that a large file of overlapping register windows can greatly reduce procedure call/return overhead, the effects of register windows in a multiprogramming environment are poorly understood. This paper investigates the performance of multiprogrammed, reduced instruction set computers (RISCs) as a function of window management strategy. Using an analytic model that reflects context switch and procedure call overheads, we analyze the performance of simple, linearly self-recursive programs. For more complex programs, we present the results of a simulation study. These studies show that a simple strategy that saves all windows prior to a context switch, but restores only a single window following a context switch, performs near optimally.

  8. RISC-type microprocessors may revolutionize aerospace simulation

    Science.gov (United States)

    Jackson, Albert S.

    The author explores the application of RISC (reduced instruction set computer) processors in massively parallel computer (MPC) designs for aerospace simulation. The MPC approach is shown to be well adapted to the needs of aerospace simulation. It is shown that any of the three common types of interconnection schemes used with MPCs are effective for general-purpose simulation, although the bus-or switch-oriented machines are somewhat easier to use. For partial differential equation models, the hypercube approach at first glance appears more efficient because the nearest-neighbor connections required for three-dimensional models are hardwired in a hypercube machine. However, the data broadcast ability of a bus system, combined with the fact that data can be transmitted over a bus as soon as it has been updated, makes the bus approach very competitive with the hypercube approach even for these types of models.

  9. Introducing RISC: A New Video Inventory for Testing Social Perception.

    Directory of Open Access Journals (Sweden)

    Kathrin Rothermich

    Full Text Available Indirect forms of speech, such as sarcasm, jocularity (joking, and 'white lies' told to spare another's feelings, occur frequently in daily life and are a problem for many clinical populations. During social interactions, information about the literal or nonliteral meaning of a speaker unfolds simultaneously in several communication channels (e.g., linguistic, facial, vocal, and body cues; however, to date many studies have employed uni-modal stimuli, for example focusing only on the visual modality, limiting the generalizability of these results to everyday communication. Much of this research also neglects key factors for interpreting speaker intentions, such as verbal context and the relationship of social partners. Relational Inference in Social Communication (RISC is a newly developed (English-language database composed of short video vignettes depicting sincere, jocular, sarcastic, and white lie social exchanges between two people. Stimuli carefully manipulated the social relationship between communication partners (e.g., boss/employee, couple and the availability of contextual cues (e.g. preceding conversations, physical objects while controlling for major differences in the linguistic content of matched items. Here, we present initial perceptual validation data (N = 31 on a corpus of 920 items. Overall accuracy for identifying speaker intentions was above 80% correct and our results show that both relationship type and verbal context influence the categorization of literal and nonliteral interactions, underscoring the importance of these factors in research on speaker intentions. We believe that RISC will prove highly constructive as a tool in future research on social cognition, inter-personal communication, and the interpretation of speaker intentions in both healthy adults and clinical populations.

  10. Introducing RISC: A New Video Inventory for Testing Social Perception.

    Science.gov (United States)

    Rothermich, Kathrin; Pell, Marc D

    2015-01-01

    Indirect forms of speech, such as sarcasm, jocularity (joking), and 'white lies' told to spare another's feelings, occur frequently in daily life and are a problem for many clinical populations. During social interactions, information about the literal or nonliteral meaning of a speaker unfolds simultaneously in several communication channels (e.g., linguistic, facial, vocal, and body cues); however, to date many studies have employed uni-modal stimuli, for example focusing only on the visual modality, limiting the generalizability of these results to everyday communication. Much of this research also neglects key factors for interpreting speaker intentions, such as verbal context and the relationship of social partners. Relational Inference in Social Communication (RISC) is a newly developed (English-language) database composed of short video vignettes depicting sincere, jocular, sarcastic, and white lie social exchanges between two people. Stimuli carefully manipulated the social relationship between communication partners (e.g., boss/employee, couple) and the availability of contextual cues (e.g. preceding conversations, physical objects) while controlling for major differences in the linguistic content of matched items. Here, we present initial perceptual validation data (N = 31) on a corpus of 920 items. Overall accuracy for identifying speaker intentions was above 80% correct and our results show that both relationship type and verbal context influence the categorization of literal and nonliteral interactions, underscoring the importance of these factors in research on speaker intentions. We believe that RISC will prove highly constructive as a tool in future research on social cognition, inter-personal communication, and the interpretation of speaker intentions in both healthy adults and clinical populations.

  11. Construction of permanently inducible miRNA-based expression vectors using site-specific recombinases

    Directory of Open Access Journals (Sweden)

    Garwick-Coppens Sara E

    2011-11-01

    Full Text Available Abstract Background RNA interference (RNAi is a conserved gene silencing mechanism mediated by small inhibitory microRNAs (miRNAs. Promoter-driven miRNA expression vectors have emerged as important tools for delivering natural or artificially designed miRNAs to eukaryotic cells and organisms. Such systems can be used to query the normal or pathogenic functions of natural miRNAs or messenger RNAs, or to therapeutically silence disease genes. Results As with any molecular cloning procedure, building miRNA-based expression constructs requires a time investment and some molecular biology skills. To improve efficiency and accelerate the construction process, we developed a method to rapidly generate miRNA expression vectors using recombinases instead of more traditional cut-and-paste molecular cloning techniques. In addition to streamlining the construction process, our cloning strategy provides vectors with added versatility. In our system, miRNAs can be constitutively expressed from the U6 promoter, or inducibly expressed by Cre recombinase. We also engineered a built-in mechanism to destroy the vector with Flp recombinase, if desired. Finally, to further simplify the construction process, we developed a software package that automates the prediction and design of optimal miRNA sequences using our system. Conclusions We designed and tested a modular system to rapidly clone miRNA expression cassettes. Our strategy reduces the hands-on time required to successfully generate effective constructs, and can be implemented in labs with minimal molecular cloning expertise. This versatile system provides options that permit constitutive or inducible miRNA expression, depending upon the needs of the end user. As such, it has utility for basic or translational applications.

  12. Exosome-mediated microRNA transfer plays a role in radiation-induced bystander effect.

    Science.gov (United States)

    Xu, Shuai; Wang, Jufang; Ding, Nan; Hu, Wentao; Zhang, Xurui; Wang, Bing; Hua, Junrui; Wei, Wenjun; Zhu, Qiyun

    2015-01-01

    Bystander effects can be induced through cellular communication between irradiated cells and non-irradiated cells. The signals that mediate this cellular communication, such as cytokines, reactive oxygen species, nitric oxide and even microRNAs, can be transferred between cells via gap junctions or extracellular medium. We have previously reported that miR-21, a well described DDR (DNA damage response) microRNA, is involved in radiation-induced bystander effects through a medium-mediated way. However, the mechanisms of the microRNA transfer have not been elucidated in details. In the present study, it was found that exosomes isolated from irradiated conditioned medium could induce bystander effects. Furthermore, we demonstrated plenty of evidences that miR-21, which is up-regulated as a result of mimic transfection or irradiation, can be transferred from donor or irradiated cells into extracellular medium and subsequently get access to the recipient or bystander cells through exosomes to induce bystander effects. Inhibiting the miR-21 expression in advance can offset the bystander effects to some extent. From all of these results, it can be concluded that the exosome-mediated microRNA transfer plays an important role in the radiation-induced bystander effects. These findings provide new insights into the functions of microRNAs and the cellular communication between the directly irradiated cells and the non-irradiated cells.

  13. Temperature regulates splicing efficiency of the cold-inducible RNA-binding protein gene Cirbp

    Science.gov (United States)

    Gotic, Ivana; Omidi, Saeed; Fleury-Olela, Fabienne; Molina, Nacho; Naef, Felix; Schibler, Ueli

    2016-01-01

    In mammals, body temperature fluctuates diurnally around a mean value of 36°C–37°C. Despite the small differences between minimal and maximal values, body temperature rhythms can drive robust cycles in gene expression in cultured cells and, likely, animals. Here we studied the mechanisms responsible for the temperature-dependent expression of cold-inducible RNA-binding protein (CIRBP). In NIH3T3 fibroblasts exposed to simulated mouse body temperature cycles, Cirbp mRNA oscillates about threefold in abundance, as it does in mouse livers. This daily mRNA accumulation cycle is directly controlled by temperature oscillations and does not depend on the cells’ circadian clocks. Here we show that the temperature-dependent accumulation of Cirbp mRNA is controlled primarily by the regulation of splicing efficiency, defined as the fraction of Cirbp pre-mRNA processed into mature mRNA. As revealed by genome-wide “approach to steady-state” kinetics, this post-transcriptional mechanism is widespread in the temperature-dependent control of gene expression. PMID:27633015

  14. HPV-16 L1 genes with inactivated negative RNA elements induce potent immune responses

    International Nuclear Information System (INIS)

    Rollman, Erik; Arnheim, Lisen; Collier, Brian; Oeberg, Daniel; Hall, Haakan; Klingstroem, Jonas; Dillner, Joakim; Pastrana, Diana V.; Buck, Chris B.; Hinkula, Jorma; Wahren, Britta; Schwartz, Stefan

    2004-01-01

    Introduction of point mutations in the 5' end of the human papillomavirus type 16 (HPV-16) L1 gene specifically inactivates negative regulatory RNA processing elements. DNA vaccination of C57Bl/6 mice with the mutated L1 gene resulted in improved immunogenicity for both neutralizing antibodies as well as for broad cellular immune responses. Previous reports on the activation of L1 by codon optimization may be explained by inactivation of the regulatory RNA elements. The modified HPV-16 L1 DNA that induced anti-HPV-16 immunity may be seen as a complementary approach to protein subunit immunization against papillomavirus

  15. JAK kinases are required for the bacterial RNA and poly I:C induced tyrosine phosphorylation of PKR

    Science.gov (United States)

    Bleiblo, Farag; Michael, Paul; Brabant, Danielle; Ramana, Chilakamarti V; Tai, TC; Saleh, Mazen; Parrillo, Joseph E; Kumar, Anand; Kumar, Aseem

    2013-01-01

    Discriminating the molecular patterns associated with RNA is central to innate immunity. The protein kinase PKR is a cytosolic sensor involved in the recognition of viral dsRNA and triggering interferon-induced signaling. Here, we identified bacterial RNA as a novel distinct pattern recognized by PKR. We show that the tyrosine phosphorylation of PKR induced by either bacterial RNA or poly I:C is impaired in mutant cells lacking TYK2, JAK1, or JAK2 kinases. PKR was found to be a direct substrate for the activated JAKs. Our results indicated that the double-stranded structures of bacterial RNA are required to fully activate PKR. These results suggest that bacterial RNA signaling is analogous in some respects to that of viral RNA and interferons and may have implications in bacterial immunity. PMID:23236554

  16. Effective gene silencing activity of prodrug-type 2'-O-methyldithiomethyl siRNA compared with non-prodrug-type 2'-O-methyl siRNA.

    Science.gov (United States)

    Hayashi, Junsuke; Nishigaki, Misa; Ochi, Yosuke; Wada, Shun-Ichi; Wada, Fumito; Nakagawa, Osamu; Obika, Satoshi; Harada-Shiba, Mariko; Urata, Hidehito

    2018-07-01

    Small interfering RNAs (siRNAs) are an active agent to induce gene silencing and they have been studied for becoming a biological and therapeutic tool. Various 2'-O-modified RNAs have been extensively studied to improve the nuclease resistance. However, the 2'-O-modified siRNA activities were often decreased by modification, since the bulky 2'-O-modifications inhibit to form a RNA-induced silencing complex (RISC). We developed novel prodrug-type 2'-O-methyldithiomethyl (MDTM) siRNA, which is converted into natural siRNA in an intracellular reducing environment. Prodrug-type 2'-O-MDTM siRNAs modified at the 5'-end side including 5'-end nucleotide and the seed region of the antisense strand exhibited much stronger gene silencing effect than non-prodrug-type 2'-O-methyl (2'-O-Me) siRNAs. Furthermore, the resistances for nuclease digestion of siRNAs were actually enhanced by 2'-O-MDTM modifications. Our results indicate that 2'-O-MDTM modifications improve the stability of siRNA in serum and they are able to be introduced at any positions of siRNA. Copyright © 2018 Elsevier Ltd. All rights reserved.

  17. Optimization of Critical Hairpin Features Allows miRNA-based Gene Knockdown Upon Single-copy Transduction

    Directory of Open Access Journals (Sweden)

    Renier Myburgh

    2014-01-01

    Full Text Available Gene knockdown using micro RNA (miRNA-based vector constructs is likely to become a prominent gene therapy approach. It was the aim of this study to improve the efficiency of gene knockdown through optimizing the structure of miRNA mimics. Knockdown of two target genes was analyzed: CCR5 and green fluorescent protein. We describe here a novel and optimized miRNA mimic design called mirGE comprising a lower stem length of 13 base pairs (bp, positioning of the targeting strand on the 5′ side of the miRNA, together with nucleotide mismatches in upper stem positions 1 and 12 placed on the passenger strand. Our mirGE proved superior to miR-30 in four aspects: yield of targeting strand incorporation into RNA-induced silencing complex (RISC; incorporation into RISC of correct targeting strand; precision of cleavage by Drosha; and ratio of targeting strand over passenger strand. A triple mirGE hairpin cassette targeting CCR5 was constructed. It allowed CCR5 knockdown with an efficiency of over 90% upon single-copy transduction. Importantly, single-copy expression of this construct rendered transduced target cells, including primary human macrophages, resistant to infection with a CCR5-tropic strain of HIV. Our results provide new insights for a better knockdown efficiency of constructs containing miRNA. Our results also provide the proof-of-principle that cells can be rendered HIV resistant through single-copy vector transduction, rendering this approach more compatible with clinical applications.

  18. Tentative mapping of transcription-induced interchromosomal interaction using chimeric EST and mRNA data.

    Directory of Open Access Journals (Sweden)

    Per Unneberg

    Full Text Available Recent studies on chromosome conformation show that chromosomes colocalize in the nucleus, bringing together active genes in transcription factories. This spatial proximity of actively transcribing genes could provide a means for RNA interaction at the transcript level. We have screened public databases for chimeric EST and mRNA sequences with the intent of mapping transcription-induced interchromosomal interactions. We suggest that chimeric transcripts may be the result of close encounters of active genes, either as functional products or "noise" in the transcription process, and that they could be used as probes for chromosome interactions. We have found a total of 5,614 chimeric ESTs and 587 chimeric mRNAs that meet our selection criteria. Due to their higher quality, the mRNA findings are of particular interest and we hope that they may serve as food for thought for specialists in diverse areas of molecular biology.

  19. Relative workload determines exercise-induced increases in PGC-1alpha mRNA

    DEFF Research Database (Denmark)

    Nordsborg, Nikolai Baastrup; Lundby, Carsten; Leick, Lotte

    2010-01-01

    INTRODUCTION:: The hypothesis that brief intermittent exercise induced increases in human skeletal muscle metabolic mRNA is dependent on relative workload was investigated. METHODS:: Trained (n=10) and untrained (n=8) subjects performed exhaustive intermittent cycling exercise (4x4 min @ 85% of VO2...... peak, interspersed by 3 min). Trained subjects also performed the intermittent exercise at the same absolute workload as untrained, corresponding to 70% of VO2 peak (n=6). RESULTS:: Exercise at 85% of VO2 peak elevated (P... and untrained, respectively. PGC-1alpha mRNA expression was increased (Pelevated (3.1+/-0.7 mM) and PGC-1alpha mRNA content was less (P

  20. microRNA and mRNA profiles in ventral tegmental area relevant to stress-induced depression and resilience.

    Science.gov (United States)

    Sun, Xiaoyan; Song, Zhenhua; Si, Yawei; Wang, Jin-Hui

    2018-06-01

    Chronic stress with lack of reward presumably may impair brain reward circuit, leading to major depressive disorder (MDD). Most individuals experiencing chronic stress do not suffer from MDD, i.e., resilience, implying the presence of endogenous anti-depression in the brain. Molecular mechanisms underlying stress-induced depression versus resilience were investigated. Mice were treated by chronic unpredictable mild stress (CUMS) for four weeks. Their mood state was assessed by behavioral tasks, such as sucrose preference, Y-maze and forced swimming testes. To reveal comprehensive molecular profiles of major depression versus resilience, mRNA and microRNA profiles were analyzed by high-throughput sequencing in the ventral tegmental area (VTA) harvested from control, CUMS-susceptible and CUMS-resilience mice. In data analyses of control versus CUMS-susceptible mice as well as control versus CUMS-resilience mice, 1.5 fold ratio in reads per kilo-base per million reads was set as the threshold to judge the involvement of mRNAs and microRNAs in the CUMS, depression or resilience. The downregulation of synaptic vesicle cycle, neurotrophin, GABAergic synapse and morphine addiction as well as the upregulation of transmitter release, calcium signal and cAMP-dependent response element binding are associated to CUMS-susceptibility. The downregulation of tyrosine metabolism and protein process in endoplasmic reticulum as well as the upregulation of amino acid biosynthesis, neuroactive ligand-receptor interaction and dopaminergic synapse are associated to CUMS-resilience. Therefore, the impairment of neurons and GABA/dopaminergic synapses in the VTA is associated with major depression. The upregulation of these entities is associated with resilience. Consistent results obtained from analyzing mRNAs and microRNAs as well as using different approaches strengthen our finding and conclusion. Copyright © 2018. Published by Elsevier Inc.

  1. Robust Differentiation of mRNA-Reprogrammed Human Induced Pluripotent Stem Cells Toward a Retinal Lineage.

    Science.gov (United States)

    Sridhar, Akshayalakshmi; Ohlemacher, Sarah K; Langer, Kirstin B; Meyer, Jason S

    2016-04-01

    The derivation of human induced pluripotent stem cells (hiPSCs) from patient-specific sources has allowed for the development of novel approaches to studies of human development and disease. However, traditional methods of generating hiPSCs involve the risks of genomic integration and potential constitutive expression of pluripotency factors and often exhibit low reprogramming efficiencies. The recent description of cellular reprogramming using synthetic mRNA molecules might eliminate these shortcomings; however, the ability of mRNA-reprogrammed hiPSCs to effectively give rise to retinal cell lineages has yet to be demonstrated. Thus, efforts were undertaken to test the ability and efficiency of mRNA-reprogrammed hiPSCs to yield retinal cell types in a directed, stepwise manner. hiPSCs were generated from human fibroblasts via mRNA reprogramming, with parallel cultures of isogenic human fibroblasts reprogrammed via retroviral delivery of reprogramming factors. New lines of mRNA-reprogrammed hiPSCs were established and were subsequently differentiated into a retinal fate using established protocols in a directed, stepwise fashion. The efficiency of retinal differentiation from these lines was compared with retroviral-derived cell lines at various stages of development. On differentiation, mRNA-reprogrammed hiPSCs were capable of robust differentiation to a retinal fate, including the derivation of photoreceptors and retinal ganglion cells, at efficiencies often equal to or greater than their retroviral-derived hiPSC counterparts. Thus, given that hiPSCs derived through mRNA-based reprogramming strategies offer numerous advantages owing to the lack of genomic integration or constitutive expression of pluripotency genes, such methods likely represent a promising new approach for retinal stem cell research, in particular, those for translational applications. In the current report, the ability to derive mRNA-reprogrammed human induced pluripotent stem cells (hi

  2. Multi-bits error detection and fast recovery in RISC cores

    International Nuclear Information System (INIS)

    Wang Jing; Yang Xing; Zhang Weigong; Shen Jiao; Qiu Keni; Zhao Yuanfu

    2015-01-01

    The particles-induced soft errors are a major threat to the reliability of microprocessors. Even worse, multi-bits upsets (MBUs) are ever-increased due to the rapidly shrinking feature size of the IC on a chip. Several architecture-level mechanisms have been proposed to protect microprocessors from soft errors, such as dual and triple modular redundancies (DMR and TMR). However, most of them are inefficient to combat the growing multi-bits errors or cannot well balance the critical paths delay, area and power penalty. This paper proposes a novel architecture, self-recovery dual-pipeline (SRDP), to effectively provide soft error detection and recovery with low cost for general RISC structures. We focus on the following three aspects. First, an advanced DMR pipeline is devised to detect soft error, especially MBU. Second, SEU/MBU errors can be located by enhancing self-checking logic into pipelines stage registers. Third, a recovery scheme is proposed with a recovery cost of 1 or 5 clock cycles. Our evaluation of a prototype implementation exhibits that the SRDP can successfully detect particle-induced soft errors up to 100% and recovery is nearly 95%, the other 5% will inter a specific trap. (paper)

  3. Multi-bits error detection and fast recovery in RISC cores

    Science.gov (United States)

    Jing, Wang; Xing, Yang; Yuanfu, Zhao; Weigong, Zhang; Jiao, Shen; Keni, Qiu

    2015-11-01

    The particles-induced soft errors are a major threat to the reliability of microprocessors. Even worse, multi-bits upsets (MBUs) are ever-increased due to the rapidly shrinking feature size of the IC on a chip. Several architecture-level mechanisms have been proposed to protect microprocessors from soft errors, such as dual and triple modular redundancies (DMR and TMR). However, most of them are inefficient to combat the growing multi-bits errors or cannot well balance the critical paths delay, area and power penalty. This paper proposes a novel architecture, self-recovery dual-pipeline (SRDP), to effectively provide soft error detection and recovery with low cost for general RISC structures. We focus on the following three aspects. First, an advanced DMR pipeline is devised to detect soft error, especially MBU. Second, SEU/MBU errors can be located by enhancing self-checking logic into pipelines stage registers. Third, a recovery scheme is proposed with a recovery cost of 1 or 5 clock cycles. Our evaluation of a prototype implementation exhibits that the SRDP can successfully detect particle-induced soft errors up to 100% and recovery is nearly 95%, the other 5% will inter a specific trap.

  4. Formation of tRNA granules in the nucleus of heat-induced human cells

    Energy Technology Data Exchange (ETDEWEB)

    Miyagawa, Ryu [Radioisotope Center, The University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032 (Japan); Department of Biological Science, Graduate School of Science, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8654 (Japan); Mizuno, Rie [Radioisotope Center, The University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032 (Japan); Watanabe, Kazunori, E-mail: watanabe@ric.u-tokyo.ac.jp [Radioisotope Center, The University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032 (Japan); Ijiri, Kenichi [Radioisotope Center, The University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032 (Japan); Department of Biological Science, Graduate School of Science, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8654 (Japan)

    2012-02-03

    Highlights: Black-Right-Pointing-Pointer tRNAs are tranlocated into the nucleus in heat-induced HeLa cells. Black-Right-Pointing-Pointer tRNAs form the unique granules in the nucleus. Black-Right-Pointing-Pointer tRNA ganules overlap with nuclear stress granules. -- Abstract: The stress response, which can trigger various physiological phenomena, is important for living organisms. For instance, a number of stress-induced granules such as P-body and stress granule have been identified. These granules are formed in the cytoplasm under stress conditions and are associated with translational inhibition and mRNA decay. In the nucleus, there is a focus named nuclear stress body (nSB) that distinguishes these structures from cytoplasmic stress granules. Many splicing factors and long non-coding RNA species localize in nSBs as a result of stress. Indeed, tRNAs respond to several kinds of stress such as heat, oxidation or starvation. Although nuclear accumulation of tRNAs occurs in starved Saccharomyces cerevisiae, this phenomenon is not found in mammalian cells. We observed that initiator tRNA{sup Met} (Meti) is actively translocated into the nucleus of human cells under heat stress. During this study, we identified unique granules of Meti that overlapped with nSBs. Similarly, elongator tRNA{sup Met} was translocated into the nucleus and formed granules during heat stress. Formation of tRNA granules is closely related to the translocation ratio. Then, all tRNAs may form the specific granules.

  5. A viral microRNA down-regulates multiple cell cycle genes through mRNA 5'UTRs.

    Directory of Open Access Journals (Sweden)

    Finn Grey

    2010-06-01

    Full Text Available Global gene expression data combined with bioinformatic analysis provides strong evidence that mammalian miRNAs mediate repression of gene expression primarily through binding sites within the 3' untranslated region (UTR. Using RNA induced silencing complex immunoprecipitation (RISC-IP techniques we have identified multiple cellular targets for a human cytomegalovirus (HCMV miRNA, miR-US25-1. Strikingly, this miRNA binds target sites primarily within 5'UTRs, mediating significant reduction in gene expression. Intriguingly, many of the genes targeted by miR-US25-1 are associated with cell cycle control, including cyclin E2, BRCC3, EID1, MAPRE2, and CD147, suggesting that miR-US25-1 is targeting genes within a related pathway. Deletion of miR-US25-1 from HCMV results in over expression of cyclin E2 in the context of viral infection. Our studies demonstrate that a viral miRNA mediates translational repression of multiple cellular genes by targeting mRNA 5'UTRs.

  6. A scoring system for ascertainment of incident stroke; the Risk Index Score (RISc).

    Science.gov (United States)

    Kass-Hout, T A; Moyé, L A; Smith, M A; Morgenstern, L B

    2006-01-01

    The main objective of this study was to develop and validate a computer-based statistical algorithm that could be translated into a simple scoring system in order to ascertain incident stroke cases using hospital admission medical records data. The Risk Index Score (RISc) algorithm was developed using data collected prospectively by the Brain Attack Surveillance in Corpus Christi (BASIC) project, 2000. The validity of RISc was evaluated by estimating the concordance of scoring system stroke ascertainment to stroke ascertainment by physician and/or abstractor review of hospital admission records. RISc was developed on 1718 randomly selected patients (training set) and then statistically validated on an independent sample of 858 patients (validation set). A multivariable logistic model was used to develop RISc and subsequently evaluated by goodness-of-fit and receiver operating characteristic (ROC) analyses. The higher the value of RISc, the higher the patient's risk of potential stroke. The study showed RISc was well calibrated and discriminated those who had potential stroke from those that did not on initial screening. In this study we developed and validated a rapid, easy, efficient, and accurate method to ascertain incident stroke cases from routine hospital admission records for epidemiologic investigations. Validation of this scoring system was achieved statistically; however, clinical validation in a community hospital setting is warranted.

  7. JAK kinases are required for the bacterial RNA and poly I:C induced tyrosine phosphorylation of PKR

    OpenAIRE

    Bleiblo, Farag; Michael, Paul; Brabant, Danielle; Ramana, Chilakamarti V; Tai, TC; Saleh, Mazen; Parrillo, Joseph E; Kumar, Anand; Kumar, Aseem

    2012-01-01

    Discriminating the molecular patterns associated with RNA is central to innate immunity. The protein kinase PKR is a cytosolic sensor involved in the recognition of viral dsRNA and triggering interferon-induced signaling. Here, we identified bacterial RNA as a novel distinct pattern recognized by PKR. We show that the tyrosine phosphorylation of PKR induced by either bacterial RNA or poly I:C is impaired in mutant cells lacking TYK2, JAK1, or JAK2 kinases. PKR was found to be a direct substra...

  8. LncRNA H19 and Target Gene-mediated Cleft Palate Induced by TCDD.

    Science.gov (United States)

    Gao, Li Yun; Zhang, Feng Quan; Zhao, Wei Hui; Han, Guang Liang; Wang, Xiao; Li, Qiang; Gao, Shan Shan; Wu, Wei Dong

    2017-09-01

    This study investigated the role of long non-coding RNAs (lncRNAs) in the development of the palatal tissues. Cleft palates in mice were induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Expression levels of long non-coding RNA H19 (lncRNA H19) and insulin-like growth factor 2 (IGF2) gene were measured by quantitative real-time polymerase chain reaction (qRT-PCR). The rate of occurrence of cleft palate was found to be 100% by TCDD exposure, and TCDD could cause short upper limb, cerebral fissure, webbed neck, and short neck. The expression levels of lncRNA H19 and IGF2 gene specifically showed embryo age-related differences on E13, E14, and E15 in the palatal tissues. The expression levels of lncRNA H19 and IGF2 gene showed an inverse relationship on E13, E14, and E15. These findings demonstrated that lncRNA H19 and IGF2 can mediate the development of mouse cleft palate. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  9. Generation of human induced pluripotent stem cells using non-synthetic mRNA.

    Science.gov (United States)

    Rohani, L; Fabian, C; Holland, H; Naaldijk, Y; Dressel, R; Löffler-Wirth, H; Binder, H; Arnold, A; Stolzing, A

    2016-05-01

    Here we describe some of the crucial steps to generate induced pluripotent stem cells (iPSCs) using mRNA transfection. Our approach uses a V. virus-derived capping enzyme instead of a cap-analog, ensuring 100% proper cap orientation for in vitro transcribed mRNA. V. virus' 2'-O-Methyltransferase enzyme creates a cap1 structure found in higher eukaryotes and has higher translation efficiency compared to other methods. Use of the polymeric transfection reagent polyethylenimine proved superior to other transfection methods. The mRNA created via this method did not trigger an intracellular immune response via human IFN-gamma (hIFN-γ) or alpha (hIFN-α) release, thus circumventing the use of suppressors. Resulting mRNA and protein were expressed at high levels for over 48h, thus obviating daily transfections. Using this method, we demonstrated swift activation of pluripotency associated genes in human fibroblasts. Low oxygen conditions further facilitated colony formation. Differentiation into different germ layers was confirmed via teratoma assay. Reprogramming with non-synthetic mRNA holds great promise for safe generation of iPSCs of human origin. Using the protocols described herein we hope to make this method more accessible to other groups as a fast, inexpensive, and non-viral reprogramming approach. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  10. A systemic evaluation of cardiac differentiation from mRNA reprogrammed human induced pluripotent stem cells.

    Directory of Open Access Journals (Sweden)

    Ashish Mehta

    Full Text Available Genetically unmodified cardiomyocytes mandated for cardiac regenerative therapy is conceivable by "foot-print free" reprogramming of somatic cells to induced pluripotent stem cells (iPSC. In this study, we report generation of foot-print free hiPSC through messenger RNA (mRNA based reprograming. Subsequently, we characterize cardiomyocytes derived from these hiPSC using molecular and electrophysiological methods to characterize their applicability for regenerative medicine. Our results demonstrate that mRNA-iPSCs differentiate ontogenetically into cardiomyocytes with increased expression of early commitment markers of mesoderm, cardiac mesoderm, followed by cardiac specific transcriptional and sarcomeric structural and ion channel genes. Furthermore, these cardiomyocytes stained positively for sarcomeric and ion channel proteins. Based on multi-electrode array (MEA recordings, these mRNA-hiPSC derived cardiomyocytes responded predictably to various pharmacologically active drugs that target adrenergic, sodium, calcium and potassium channels. The cardiomyocytes responded chronotropically to isoproterenol in a dose dependent manner, inotropic activity of nifidipine decreased spontaneous contractions. Moreover, Sotalol and E-4031 prolonged QT intervals, while TTX reduced sodium influx. Our results for the first time show a systemic evaluation based on molecular, structural and functional properties of cardiomyocytes differentiated from mRNA-iPSC. These results, coupled with feasibility of generating patient-specific iPSCs hold great promise for the development of large-scale generation of clinical grade cardiomyocytes for cardiac regenerative medicine.

  11. Viral unmasking of cellular 5S rRNA pseudogene transcripts induces RIG-I-mediated immunity.

    Science.gov (United States)

    Chiang, Jessica J; Sparrer, Konstantin M J; van Gent, Michiel; Lässig, Charlotte; Huang, Teng; Osterrieder, Nikolaus; Hopfner, Karl-Peter; Gack, Michaela U

    2018-01-01

    The sensor RIG-I detects double-stranded RNA derived from RNA viruses. Although RIG-I is also known to have a role in the antiviral response to DNA viruses, physiological RNA species recognized by RIG-I during infection with a DNA virus are largely unknown. Using next-generation RNA sequencing (RNAseq), we found that host-derived RNAs, most prominently 5S ribosomal RNA pseudogene 141 (RNA5SP141), bound to RIG-I during infection with herpes simplex virus 1 (HSV-1). Infection with HSV-1 induced relocalization of RNA5SP141 from the nucleus to the cytoplasm, and virus-induced shutoff of host protein synthesis downregulated the abundance of RNA5SP141-interacting proteins, which allowed RNA5SP141 to bind RIG-I and induce the expression of type I interferons. Silencing of RNA5SP141 strongly dampened the antiviral response to HSV-1 and the related virus Epstein-Barr virus (EBV), as well as influenza A virus (IAV). Our findings reveal that antiviral immunity can be triggered by host RNAs that are unshielded following depletion of their respective binding proteins by the virus.

  12. MicroRNA-122 is involved in oxidative stress in isoniazid-induced liver injury in mice.

    Science.gov (United States)

    Song, L; Zhang, Z R; Zhang, J L; Zhu, X B; He, L; Shi, Z; Gao, L; Li, Y; Hu, B; Feng, F M

    2015-10-27

    Many studies have shown that the pathogenesis of liver injury includes oxidative stress. MicroRNA-122 may be a marker for the early diagnosis of drug-induced liver injury. However, the relationship between microRNA-122 and oxidative stress in anti-tuberculosis drug-induced liver injury remains unknown. We measured changes in tissue microRNA-122 levels and indices of oxidative stress during liver injury in mice after administration of isoniazid, a first-line anti-tuberculosis drug. We quantified microRNA-122 expression and indices of oxidative stress at 7 time points, including 1, 3, and 5 days and 1, 2, 3, and 4 weeks. The tissue microRNA-122 levels and oxidative stress significantly changed at 3 and 5 days, suggesting that isoniazid-induced liver injury reduces oxidative stress and microRNA-122 expression compared to in the control group (P microRNA-122, began to change at 5 days (P microRNA-122 profile may affect oxidative stress by regulating mitochondrial ribosome protein S11 gene during isoniazid-induced liver injury, which may contribute to the response mechanisms of microRNA-122 and oxidative stress.

  13. MicroRNA-mediated Th2 bias in methimazole-induced acute liver injury in mice

    International Nuclear Information System (INIS)

    Uematsu, Yasuaki; Akai, Sho; Tochitani, Tomoaki; Oda, Shingo; Yamada, Toru; Yokoi, Tsuyoshi

    2016-01-01

    MicroRNA (miRNA) is a class of small non-coding RNAs containing approximately 20 nucleotides that negatively regulate target gene expression. Little is known about the role of individual miRNAs and their targets in immune- and inflammation-related responses in drug-induced liver injury. In the present study, involvement of miRNAs in the T helper (Th) 2-type immune response was investigated using a methimazole (MTZ)-induced liver injury mouse model. Co-administration of L-buthionine-S,R-sulfoximine and MTZ induced acute hepatocellular necrosis and elevated plasma levels of alanine aminotransferase (ALT) from 4 h onward in female Balb/c mice. The hepatic mRNA expression of Th2 promotive factors was significantly increased concomitantly with plasma ALT levels. In contrast, the hepatic mRNA expression of Th2 suppressive factors was significantly decreased during the early phase of liver injury. Comprehensive profiling of hepatic miRNA expression was analyzed before the onset of MTZ-induced liver injury. Using in silico prediction of miRNAs that possibly regulate Th2-related genes and subsequent quantification, we identified up-regulation of expression of miR-29b-1-5p and miR-449a-5p. Among targets of these miRNAs, down-regulation of Th2 suppressive transcription factors, such as SRY-related HMG-box 4 (SOX4) and lymphoid enhancer factor-1 (LEF1), were observed from the early phase of liver injury. In conclusion, negative regulation of the expression of SOX4 by miR-29b-1-5p and that of LEF1 by miR-449a-5p is suggested to play an important role in the development of Th2 bias in MTZ-induced liver injury. - Highlights: • Methimazole induced hepatic Th2 bias in the pathogenesis of liver injury in mice. • Rapid down-regulation of SOX4 and LEF1 may initiate and/or maintain hepatic Th2 bias. • Negative regulation of SOX4 by miR-29b-1-5p and LEF1 by miR-449a-5p was suggested.

  14. MicroRNA-mediated Th2 bias in methimazole-induced acute liver injury in mice

    Energy Technology Data Exchange (ETDEWEB)

    Uematsu, Yasuaki, E-mail: yasuaki-uematsu@ds-pharma.co.jp [Department of Drug Safety Sciences, Division of Clinical Pharmacology, Nagoya University Graduate School of Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya 466-8550 (Japan); Preclinical Research Laboratories, Sumitomo Dainippon Pharma Co., Ltd., 1-98 Kasugade-naka, 3-chome, Konohana-ku, Osaka (Japan); Akai, Sho [Department of Drug Safety Sciences, Division of Clinical Pharmacology, Nagoya University Graduate School of Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya 466-8550 (Japan); Tochitani, Tomoaki [Preclinical Research Laboratories, Sumitomo Dainippon Pharma Co., Ltd., 1-98 Kasugade-naka, 3-chome, Konohana-ku, Osaka (Japan); Oda, Shingo [Department of Drug Safety Sciences, Division of Clinical Pharmacology, Nagoya University Graduate School of Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya 466-8550 (Japan); Yamada, Toru [Preclinical Research Laboratories, Sumitomo Dainippon Pharma Co., Ltd., 1-98 Kasugade-naka, 3-chome, Konohana-ku, Osaka (Japan); Yokoi, Tsuyoshi [Department of Drug Safety Sciences, Division of Clinical Pharmacology, Nagoya University Graduate School of Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya 466-8550 (Japan)

    2016-09-15

    MicroRNA (miRNA) is a class of small non-coding RNAs containing approximately 20 nucleotides that negatively regulate target gene expression. Little is known about the role of individual miRNAs and their targets in immune- and inflammation-related responses in drug-induced liver injury. In the present study, involvement of miRNAs in the T helper (Th) 2-type immune response was investigated using a methimazole (MTZ)-induced liver injury mouse model. Co-administration of L-buthionine-S,R-sulfoximine and MTZ induced acute hepatocellular necrosis and elevated plasma levels of alanine aminotransferase (ALT) from 4 h onward in female Balb/c mice. The hepatic mRNA expression of Th2 promotive factors was significantly increased concomitantly with plasma ALT levels. In contrast, the hepatic mRNA expression of Th2 suppressive factors was significantly decreased during the early phase of liver injury. Comprehensive profiling of hepatic miRNA expression was analyzed before the onset of MTZ-induced liver injury. Using in silico prediction of miRNAs that possibly regulate Th2-related genes and subsequent quantification, we identified up-regulation of expression of miR-29b-1-5p and miR-449a-5p. Among targets of these miRNAs, down-regulation of Th2 suppressive transcription factors, such as SRY-related HMG-box 4 (SOX4) and lymphoid enhancer factor-1 (LEF1), were observed from the early phase of liver injury. In conclusion, negative regulation of the expression of SOX4 by miR-29b-1-5p and that of LEF1 by miR-449a-5p is suggested to play an important role in the development of Th2 bias in MTZ-induced liver injury. - Highlights: • Methimazole induced hepatic Th2 bias in the pathogenesis of liver injury in mice. • Rapid down-regulation of SOX4 and LEF1 may initiate and/or maintain hepatic Th2 bias. • Negative regulation of SOX4 by miR-29b-1-5p and LEF1 by miR-449a-5p was suggested.

  15. MicroRNA-195 induced apoptosis in hypoxic chondrocytes by targeting hypoxia-inducible factor 1 alpha.

    Science.gov (United States)

    Bai, R; Zhao, A-Q; Zhao, Z-Q; Liu, W-L; Jian, D-M

    2015-02-01

    The chondrocytes, the resident cells of cartilage, are maintained and take effects in the whole life upon chronic hypoxic exposure, which hypoxia-inducible factor 1 alpha (HIF-1α) play pivotal roles in response to. Dysregulation of some microRNA (miRNAs) have also been identified to be involved in hypoxia-related physiologic and pathophysiologic responses in some tissues or cell lines. However, the mechanism of miRNAs reponse to hypoxia remain largely unknown in chondrocytes, including the microRNA-195 (miR-195). AIM To investigate the effects of microRNAs (miRNAs) and hypoxia-inducible factor 1 alpha (HIF-1α) on chondrocytes in physiologic environment. We compared the expression of miR-195 and HIF-1α mRNA on hypoxia with that on normoxia in ATDC 5 cells by qRT-PCR. Further experiments was performed to confirmed the relationships of miR-195 and HIF-1α by bioinformatics analysis and dual reporter gene assay. we also assessed the effect of miR-195 on apoptosis in hypoxic ATDC 5 cells by transfect with miR-195 mimics. It was found the downregulated miR-195 and upregulated HIF-1α were present in hypoxic ATDC 5 cells. miR-195 negatively regulated HIF-1α by targeting its 3'-untranslated region. Moreover, the founding indicated miR-195 greatly increased apoptosis and downregulated HIF-1α mRNA occurred simultaneously in hypoxic chondrocytes. We concluded that miR-195 induced apoptosis in hypoxic chondrocytes by directly targeting HIF-1α.

  16. RNA-Generated and Gene-Edited Induced Pluripotent Stem Cells for Disease Modeling and Therapy.

    Science.gov (United States)

    Kehler, James; Greco, Marianna; Martino, Valentina; Pachiappan, Manickam; Yokoe, Hiroko; Chen, Alice; Yang, Miranda; Auerbach, Jonathan; Jessee, Joel; Gotte, Martin; Milanesi, Luciano; Albertini, Alberto; Bellipanni, Gianfranco; Zucchi, Ileana; Reinbold, Rolland A; Giordano, Antonio

    2017-06-01

    Cellular reprogramming by epigenomic remodeling of chromatin holds great promise in the field of human regenerative medicine. As an example, human-induced Pluripotent Stem Cells (iPSCs) obtained by reprograming of patient somatic cells are sufficiently similar to embryonic stem cells (ESCs) and can generate all cell types of the human body. Clinical use of iPSCs is dependent on methods that do not utilize genome altering transgenic technologies that are potentially unsafe and ethically unacceptable. Transient delivery of exogenous RNA into cells provides a safer reprogramming system to transgenic approaches that rely on exogenous DNA or viral vectors. RNA reprogramming may prove to be more suitable for clinical applications and provide stable starting cell lines for gene-editing, isolation, and characterization of patient iPSC lines. The introduction and rapid evolution of CRISPR/Cas9 gene-editing systems has provided a readily accessible research tool to perform functional human genetic experiments. Similar to RNA reprogramming, transient delivery of mRNA encoding Cas9 in combination with guide RNA sequences to target specific points in the genome eliminates the risk of potential integration of Cas9 plasmid constructs. We present optimized RNA-based laboratory procedure for making and editing iPSCs. In the near-term these two powerful technologies are being harnessed to dissect mechanisms of human development and disease in vitro, supporting both basic, and translational research. J. Cell. Physiol. 232: 1262-1269, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  17. Strand Analysis, a free online program for the computational identification of the best RNA interference (RNAi targets based on Gibbs free energy

    Directory of Open Access Journals (Sweden)

    Tiago Campos Pereira

    2007-01-01

    Full Text Available The RNA interference (RNAi technique is a recent technology that uses double-stranded RNA molecules to promote potent and specific gene silencing. The application of this technique to molecular biology has increased considerably, from gene function identification to disease treatment. However, not all small interfering RNAs (siRNAs are equally efficient, making target selection an essential procedure. Here we present Strand Analysis (SA, a free online software tool able to identify and classify the best RNAi targets based on Gibbs free energy (deltaG. Furthermore, particular features of the software, such as the free energy landscape and deltaG gradient, may be used to shed light on RNA-induced silencing complex (RISC activity and RNAi mechanisms, which makes the SA software a distinct and innovative tool.

  18. Delineating miRNA profile induced by chewing tobacco in oral keratinocytes

    Directory of Open Access Journals (Sweden)

    Mohd Younis Bhat

    2017-10-01

    Full Text Available The major established etiologic risk factor for oral cancer is tobacco (chewed, smoked and snuffed forms. Chewing form of tobacco is predominantly used in India making it the leading cause of oral cancer. Despite being one of the leading causes of oral cancer, the molecular alterations induced by chewing tobacco remains largely unclear. Carcinogenic effect of chewing tobacco is through chronic and not acute exposure. To understand the molecular alterations induced by chewing tobacco, we developed a cell line model where non-neoplastic oral keratinocytes were chronically exposed to chewing tobacco for a period of 6 months. This resulted in increased cellular proliferation and invasive ability of normal oral keratinocytes. Using this cellular model we studied the differential expression of miRNAs associated with chewing tobacco and the altered signaling pathways through which the aberrantly expressed miRNAs affect tumorigenesis. miRNA sequencing  was carried out using Illumina HiSeq 2500 platform  which resulted in the identification of 427 annotated miRNAs of which 10 were significantly dysregulated (≥ 4 fold; p-value ≤ 0.05 in tobacco exposed cells compared to untreated parental cells. To study the altered signaling in oral keratinocytes chronically exposed to chewing tobacco, we employed quantitative proteomics to characterize the dysregulated proteins. Integration of miRNA sequencing data with proteomic data resulted in identification of 36 proven protein targets which (≥1.5 fold; p-value ≤ 0.05 showed expression correlation with the 10 significantly dysregulated miRNAs. Pathway analysis of the dysregulated targets revealed enrichment of interferon signaling and mRNA processing related pathways in the chewing tobacco exposed cells. In addition, we also identified 6 novel miRNA in oral keratinocytes chronically exposed to chewing tobacco extract. Our study provides a framework to understand the oncogenic transformation induced by

  19. RISC-KIT: Resilience-increasing Strategies for Coasts

    Directory of Open Access Journals (Sweden)

    van Dongeren Ap

    2016-01-01

    Full Text Available High-impact storm events have demonstrated the vulnerability of coastal zones in Europe and beyond. These impacts are likely to increase due to predicted climate change and ongoing coastal development. In order to reduce impacts, disaster risk reduction (DRR measures need to be taken, which prevent or mitigate the effects of storm events. To drive the DRR agenda, the UNISDR formulated the Sendai Framework for Action, and the EU has issued the Floods Directive. However, neither is specific about the methods to be used to develop actionable DRR measures in the coastal zone. Therefore, there is a need to develop methods, tools and approaches which make it possible to: identify and prioritize the coastal zones which are most at risk through a Coastal Risk Assessment Framework, and to evaluate the effectiveness of DRR options for these coastal areas, using an Early Warning/Decision Support System, which can be used both in the planning and event-phase. This paper gives an overview of the products and results obtained in the FP7-funded project RISC-KIT, which aims to develop and apply a set of tools with which highly-vulnerable coastal areas (so-called “hotspots” can be identified.

  20. Efficient Ada multitasking on a RISC register window architecture

    Science.gov (United States)

    Kearns, J. P.; Quammen, D.

    1987-01-01

    This work addresses the problem of reducing context switch overhead on a processor which supports a large register file - a register file much like that which is part of the Berkeley RISC processors and several other emerging architectures (which are not necessarily reduced instruction set machines in the purest sense). Such a reduction in overhead is particularly desirable in a real-time embedded application, in which task-to-task context switch overhead may result in failure to meet crucial deadlines. A storage management technique by which a context switch may be implemented as cheaply as a procedure call is presented. The essence of this technique is the avoidance of the save/restore of registers on the context switch. This is achieved through analysis of the static source text of an Ada tasking program. Information gained during that analysis directs the optimized storage management strategy for that program at run time. A formal verification of the technique in terms of an operational control model and an evaluation of the technique's performance via simulations driven by synthetic Ada program traces are presented.

  1. Expression profiles of mRNA and long noncoding RNA in the ovaries of letrozole-induced polycystic ovary syndrome rat model through deep sequencing.

    Science.gov (United States)

    Fu, Lu-Lu; Xu, Ying; Li, Dan-Dan; Dai, Xiao-Wei; Xu, Xin; Zhang, Jing-Shun; Ming, Hao; Zhang, Xue-Ying; Zhang, Guo-Qing; Ma, Ya-Lan; Zheng, Lian-Wen

    2018-05-30

    Polycystic ovary syndrome (PCOS) is one of the most common endocrine disorders in reproductive-aged women. However, the exact pathophysiology of PCOS remains largely unclear. We performed deep sequencing to investigate the mRNA and long noncoding RNA (lncRNA) expression profiles in the ovarian tissues of letrozole-induced PCOS rat model and control rats. A total of 2147 mRNAs and 158 lncRNAs were differentially expressed between the PCOS models and control. Gene ontology analysis indicated that differentially expressed mRNAs were associated with biological adhesion, reproduction, and metabolic process. Pathway analysis results indicated that these aberrantly expressed mRNAs were related to several specific signaling pathways, including insulin resistance, steroid hormone biosynthesis, PPAR signaling pathway, cell adhesion molecules, autoimmune thyroid disease, and AMPK signaling pathway. The relative expression levels of mRNAs and lncRNAs were validated through qRT-PCR. LncRNA-miRNA-mRNA network was constructed to explore ceRNAs involved in the PCOS model and were also verified by qRTPCR experiment. These findings may provide insight into the pathogenesis of PCOS and clues to find key diagnostic and therapeutic roles of lncRNA in PCOS. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. ESTRADIOL-INDUCED SYNTHESIS OF VITELLOGENIN .3. ISOLATION AND CHARACTERIZATION OF VITELLOGENIN MESSENGER-RNA FROM AVIAN LIVER

    NARCIS (Netherlands)

    AB, G.; Roskam, W. G.; Dijkstra, J.; Mulder, J.; Willems, M.; van der Ende, A.; Gruber, M.

    1976-01-01

    The messenger RNA of the hormone-induced protein vitellogenin was isolated from the liver of estrogen-treated roosters. Starting from total polysomal RNA, the vitellogenin messenger was purified 67-fold by oligo (dT)-cellulose chromatography and sizing on a sucrose gradient. The messenger was

  3. RNA of Enterococcus faecalis Strain EC-12 Is a Major Component Inducing Interleukin-12 Production from Human Monocytic Cells.

    Directory of Open Access Journals (Sweden)

    Ryoichiro Nishibayashi

    Full Text Available Interleukin-12 (IL-12 is an important cytokine for the immunomodulatory effects of lactic acid bacteria (LAB. Using murine immune cells, we previously reported that the RNA of Enterococcus faecalis EC-12, a LAB strain exerting probiotic-like beneficial effects, is the major IL-12-inducing immunogenic component. However, it was recently revealed that bacterial RNA can be a ligand for Toll-like receptor (TLR 13, which is only expressed in mice. Because TLR13 is not expressed in humans, the immuno-stimulatory and -modulatory effects of LAB RNA in human cells should be augmented excluding TLR13 contribution. In experiment 1 of this study, the role of LAB RNA in IL-12 induction in human immune cells was studied using three LAB strains, E.faecalis EC-12, Lactobacillus gasseri JCM5344, and Bifidobacterium breve JCM1192. RNase A treatment of heat-killed LAB significantly decreased the IL-12 production of human peripheral blood mononuclear cells on stimulation, while RNase III treatment revealed virtually no effects. Further, IL-12 production against heat-killed E. faecalis EC-12 was abolished by depleting monocytes. These results demonstrated that single stranded RNA (ssRNA of LAB is a strong inducer of IL-12 production from human monocytes. In experiment 2, major receptor for ssRNA of E. faecalis EC-12 was identified using THP-1 cells, a human monocytic cell line. The type of RNA molecules of E. faecalis EC-12 responsible for IL-12 induction was also identified. IL-12 production induced by the total RNA of E. faecalis EC-12 was significantly reduced by the treatment of siRNA for TLR8 but not for TLR7. Furthermore, both 23S and 16S rRNA, but not mRNA, of E. faecalis EC-12 markedly induced IL-12 production from THP-1 cells. These results suggested that the recognition of ssRNA of E. faecalis EC-12 was mediated by TLR8 and that rRNA was the RNA molecule that exhibited IL-12-inducing ability in human cells.

  4. Knockdown of TFIIS by RNA silencing inhibits cancer cell proliferation and induces apoptosis

    International Nuclear Information System (INIS)

    Hubbard, Kyle; Catalano, Jennifer; Puri, Raj K; Gnatt, Averell

    2008-01-01

    A common element among cancer cells is the presence of improperly controlled transcription. In these cells, the degree of specific activation of some genes is abnormal, and altering the aberrant transcription may therefore directly target cancer. TFIIS is a transcription elongation factor, which directly binds the transcription motor, RNA Polymerase II and allows it to read through various transcription arrest sites. We report on RNA interference of TFIIS, a transcription elongation factor, and its affect on proliferation of cancer cells in culture. RNA interference was performed by transfecting siRNA to specifically knock down TFIIS expression in MCF7, MCF10A, PL45 and A549 cells. Levels of TFIIS expression were determined by the Quantigene method, and relative protein levels of TFIIS, c-myc and p53 were determined by C-ELISA. Induction of apoptosis was determined by an enzymatic Caspase 3/7 assay, as well as a non-enzymatic assay detecting cytoplasmic mono- and oligonucleosomes. A gene array analysis was conducted for effects of TFIIS siRNA on MCF7 and MCF10A cell lines. Knockdown of TFIIS reduced cancer cell proliferation in breast, lung and pancreatic cancer cell lines. More specifically, TFIIS knockdown in the MCF7 breast cancer cell line induced cancer cell death and increased c-myc and p53 expression whereas TFIIS knockdown in the non-cancerous breast cell line MCF10A was less affected. Differential effects of TFIIS knockdown in MCF7 and MCF10A cells included the estrogenic, c-myc and p53 pathways, as observed by C-ELISA and gene array, and were likely involved in MCF7 cell-death. Although transcription is a fundamental process, targeting select core transcription factors may provide for a new and potent avenue for cancer therapeutics. In the present study, knockdown of TFIIS inhibited cancer cell proliferation, suggesting that TFIIS could be studied as a potential cancer target within the transcription machinery

  5. Acute exercise induces biphasic increase in respiratory mRNA in skeletal muscle

    International Nuclear Information System (INIS)

    Ikeda, Shin-ichi; Kizaki, Takako; Haga, Shukoh; Ohno, Hideki; Takemasa, Tohru

    2008-01-01

    Peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α) promotes the expression of oxidative enzymes in skeletal muscle. We hypothesized that activation of the p38 MAPK (mitogen-activated protein kinase) in response to exercise was associated with exercise-induced PGC-1α and respiratory enzymes expression and aimed to demonstrate this under the physiological level. We subjected mice to a single bout of treadmill running and found that the exercise induced a biphasic increase in the expression of respiratory enzymes mRNA. The second phase of the increase was accompanied by an increase in PGC-1α protein, but the other was not. Administration of SB203580 (SB), an inhibitor of p38 MAPK, suppressed the increase in PGC-1α expression and respiratory enzymes mRNA in both phases. These data suggest that p38 MAPK is associated with the exercise-induced expression of PGC-1α and biphasic increase in respiratory enzyme mRNAs in mouse skeletal muscle under physiological conditions

  6. Intraperitoneal administration of chitosan/DsiRNA nanoparticles targeting TNFα prevents radiation-induced fibrosis

    International Nuclear Information System (INIS)

    Nawroth, Isabel; Alsner, Jan; Behlke, Mark A.; Besenbacher, Flemming; Overgaard, Jens; Howard, Kenneth A.; Kjems, Jorgen

    2010-01-01

    Background and purpose: One of the most common and dose-limiting long-term adverse effects of radiation therapy is radiation-induced fibrosis (RIF), which is characterized by restricted tissue flexibility, reduced compliance or strictures, pain and in severe cases, ulceration and necrosis. Several strategies have been proposed to ameliorate RIF but presently no effective one is available. Recent studies have reported that tumor necrosis factor-α (TNFα) plays a role in fibrogenesis. Material and methods: Male CDF1 mice were radiated with a single dose of 45 Gy. Chitosan/DsiRNA nanoparticles targeting TNFα were intraperitoneal injected and late radiation-induced fibrosis (RIF) was assessed using a modification of the leg contracture model. Additionally, the effect of these nanoparticles on tumor growth and tumor control probability in the absence of radiation was examined in a C3H mammary carcinoma model. Results: We show in this work, that targeting TNFα in macrophages by intraperitoneal administration of chitosan/DsiRNA nanoparticles completely prevented radiation-induced fibrosis in CDF1 mice without revealing any cytotoxic side-effects after a long-term administration. Furthermore, such TNFα targeting was selective without any significant influence on tumor growth or irradiation-related tumor control probability. Conclusion: This nanoparticle-based RNAi approach represents a novel approach to prevent RIF with potential application to improve clinical radiation therapeutic strategies.

  7. Translational regulation of gene expression by an anaerobically induced small non-coding RNA in Escherichia coli

    DEFF Research Database (Denmark)

    Boysen, Anders; Møller-Jensen, Jakob; Kallipolitis, Birgitte H.

    2010-01-01

    Small non-coding RNAs (sRNA) have emerged as important elements of gene regulatory circuits. In enterobacteria such as Escherichia coli and Salmonella many of these sRNAs interact with the Hfq protein, an RNA chaperone similar to mammalian Sm-like proteins and act in the post...... that adaptation to anaerobic growth involves the action of a small regulatory RNA....... of at least one sRNA regulator. Here, we extend this view by the identification and characterization of a highly conserved, anaerobically induced small sRNA in E. coli, whose expression is strictly dependent on the anaerobic transcriptional fumarate and nitrate reductase regulator (FNR). The sRNA, named Fnr...

  8. Identifying airway sensitizers: cytokine mRNA profiles induced by various anhydrides

    International Nuclear Information System (INIS)

    Plitnick, L.M.; Loveless, S.E.; Ladics, G.S.; Holsapple, M.P.; Smialowicz, R.J.; Woolhiser, M.R.; Anderson, P.K.; Smith, C.; Selgrade, M.J.K.

    2003-01-01

    Exposure to low molecular weight (LMW) chemicals in the workplace has been linked to a variety of respiratory effects. Within the LMW chemicals, one of the major classes involved in these effects are the acid anhydrides. The immunological basis of respiratory hypersensitivity involves CD4+ cells. By virtue of their induction of cytokines typical of CD4+ T-helper type 2 (Th2) cells--interleukin (IL)-4, 10, and 13--respiratory sensitizers may be identified and differentiated from contact sensitizers which induce Th1 cytokines (IL-2 and IFN-γ). Our previous work suggested that the ribonuclease protection assay (RPA) was useful in identifying the respiratory sensitizer, trimellitic anhydride (TMA), based on quantitative differences in Th2 cytokine mRNA as compared to the contact sensitizer dinitrochlorobenzene (DNCB). Therefore, the purpose of the studies described in this report was to expand the chemicals tested in the RPA. To this end, four acid anhydrides with known respiratory sensitization potential, TMA, maleic anhydride (MA), phthalic anhydride (PA) and hexahydrophthalic anhydride (HHPA), were tested. Although previously determined to induce immunologically equivalent responses in a local lymph node assay (LLNA), the initial dose chosen (2.5%) failed to induce Th2 cytokine mRNA expression. To determine if the lack of cytokine expression was related to dose, LLNAs were conducted at higher doses for each of the anhydrides. The highest doses evaluated (four- to six-fold higher than those used in the initial RPA) gave equivalent proliferative responses for the various anhydrides and were used for subsequent RPA testing. At these higher doses, significant increases in Th2 versus Th1 cytokine mRNA were observed for all anhydrides tested. These results suggest that the RPA has the potential to serve as a screen for the detection of LMW airway sensitizing chemicals. However, the basis for selecting immunologically equivalent doses may require some modification

  9. Neuronal activity rapidly induces transcription of the CREB-regulated microRNA-132, in vivo

    DEFF Research Database (Denmark)

    Nudelman, Aaron Samuel; DiRocco, Derek P; Lambert, Talley J

    2010-01-01

    Activity-dependent changes in gene-expression are believed to underlie the molecular representation of memory. In this study, we report that in vivo activation of neurons rapidly induces the CREB-regulated microRNA miR-132. To determine if production of miR-132 is regulated by neuronal activity its......, olfactory bulb, and striatum by contextual fear conditioning, odor-exposure, and cocaine-injection, respectively, also increased pri-miR-132. Induction kinetics of pri-miR-132 were monitored and found to parallel those of immediate early genes, peaking at 45 min and returning to basal levels within 2 h...

  10. Progress in research on ionizing radiation-induced microRNA

    International Nuclear Information System (INIS)

    Hu Zheng; Tie Yi; Sun Zhixian; Zheng Xiaofei

    2011-01-01

    MicroRNAs (miRNAs) are small single-stranded noncoding RNAs consisting of 21-23 nucleotides that play important gene-regulatory roles in eukaryotes by pairing to the mRNAs of protein-coding genes to direct their posttranscriptional repression. A growing body of evidence indicates that alterations in miRNA expression may occur following exposure to several oxidative stress including ionizing radiation. So miRNAs may serve as potential new targets for co-therapies aiming to improve the effects of radiation disease therapy in cancer patients. The progress in research on ionizing radiation-induced miRNAs is reviewed in this paper. (authors)

  11. Myofibril-Inducing RNA (MIR is essential for tropomyosin expression and myofibrillogenesis in axolotl hearts

    Directory of Open Access Journals (Sweden)

    Lemanski Sharon L

    2009-09-01

    Full Text Available Abstract The Mexican axolotl, Ambystoma mexicanum, carries the naturally-occurring recessive mutant gene 'c' that results in a failure of homozygous (c/c embryos to form hearts that beat because of an absence of organized myofibrils. Our previous studies have shown that a noncoding RNA, Myofibril-Inducing RNA (MIR, is capable of promoting myofibrillogenesis and heart beating in the mutant (c/c axolotls. The present study demonstrates that the MIR gene is essential for tropomyosin (TM expression in axolotl hearts during development. Gene expression studies show that mRNA expression of various tropomyosin isoforms in untreated mutant hearts and in normal hearts knocked down with double-stranded MIR (dsMIR are similar to untreated normal. However, at the protein level, selected tropomyosin isoforms are significantly reduced in mutant and dsMIR treated normal hearts. These results suggest that MIR is involved in controlling the translation or post-translation of various TM isoforms and subsequently of regulating cardiac contractility.

  12. MicroRNA miR-125b induces senescence in human melanoma cells.

    Science.gov (United States)

    Glud, Martin; Manfé, Valentina; Biskup, Edyta; Holst, Line; Dirksen, Anne Marie Ahlburg; Hastrup, Nina; Nielsen, Finn C; Drzewiecki, Krzysztof T; Gniadecki, Robert

    2011-06-01

    MicroRNAs (miRNAs) are small noncoding RNA molecules involved in gene regulation. Aberrant expression of miRNA has been associated with the development or progression of several diseases, including cancer. In a previous study, we found that the expression of miRNA-125b (miR-125b) was two-fold lower in malignant melanoma producing lymph node micrometastases than in nonmetastasizing tumors. To get further insight into the functional role of miR-125b, we assessed whether its overexpression or silencing affects apoptosis, proliferation, or senescence in melanoma cell lines. We showed that overexpression of miR-125b induced typical senescent cell morphology, including increased cytoplasmatic/nucleus ratio and intensive cytoplasmatic β-galactosidase expression. In contrast, inhibition of miR-125b resulted in 30-35% decreased levels of spontaneous apoptosis. We propose that downregulation of miR-125b in an early cutaneous malignant melanoma can contribute to the increased metastatic capability of this tumor.

  13. MicroRNA-302 Cluster Downregulates Enterovirus 71-Induced Innate Immune Response by Targeting KPNA2.

    Science.gov (United States)

    Peng, Nanfang; Yang, Xuecheng; Zhu, Chengliang; Zhou, Li; Yu, Haisheng; Li, Mengqi; Lin, Yong; Wang, Xueyu; Li, Qian; She, Yinglong; Wang, Jun; Zhao, Qian; Lu, Mengji; Zhu, Ying; Liu, Shi

    2018-05-18

    Enterovirus 71 (EV71) induces significantly elevated levels of cytokines and chemokines, leading to local or systemic inflammation and severe complications. As shown in our previous study, microRNA (miR) 302c regulates influenza A virus-induced IFN expression by targeting NF-κB-inducing kinase. However, little is known about the role of the miR-302 cluster in EV71-mediated proinflammatory responses. In this study, we found that the miR-302 cluster controls EV71-induced cytokine expression. Further studies demonstrated that karyopherin α2 (KPNA2) is a direct target of the miR-302 cluster. Interestingly, we also found that EV71 infection upregulates KPNA2 expression by downregulating miR-302 cluster expression. Upon investigating the mechanisms behind this event, we found that KPNA2 intracellularly associates with JNK1/JNK2 and p38, leading to translocation of those transcription factors from the cytosol into the nucleus. In EV71-infected patients, miR-302 cluster expression was downregulated and KPNA2 expression was upregulated compared with controls, and their expression levels were closely correlated. Taken together, our work establishes a link between the miR-302/ KPNA2 axis and EV71-induced cytokine expression and represents a promising target for future antiviral therapy. Copyright © 2018 by The American Association of Immunologists, Inc.

  14. Rare Coumarins Induce Apoptosis, G1 Cell Block and Reduce RNA Content in HL60 Cells

    Directory of Open Access Journals (Sweden)

    Widelski Jarosław

    2017-02-01

    Full Text Available The rare coumarins stenocarpin, stenocarpin isobutyrate, oficinalin, oficinalin isobutyrate, 8-methoxypeucedanin and the known xanthotoxin, isoimperatorin, bergapten, peucedanin and 8–methoxyisoimperatorin were isolated from Peucedanum luxurians Tamamsch. (Apiaceae and identified by means of spectral data (1D and 2D NMR. Their immunomodulating activity was evaluated by flow cytometry and their influence on HL60 cells as well as on PHA-stimulated PBLs was tested. All tested coumarins induce apoptosis (maximal in the 48 h culture and decrease cell proliferation in a time- and dose-dependent manner, especially in HL60 cells. They also induce partial G1 block, but only in HL60 cells (at 100 µM concentrations. Dose-dependent reduction of RNA content was also found in G1 cells treated by the coumarins. All of the tested coumarins also possessed immunomodulatory activities. Bergapten and xanthotoxin were found to be the best candidates for further evaluation as anti-cancer drugs.

  15. A distant cis acting intronic element induces site-selective RNA editing

    DEFF Research Database (Denmark)

    Daniel, Chammiran; Venø, Morten Trillingsgaard; Ekdahl, Ylva

    2012-01-01

    Transcripts have been found to be site selectively edited from adenosine-to-inosine (A-to-I) in the mammalian brain, mostly in genes involved in neurotransmission. While A-to-I editing occurs at double-stranded structures, other structural requirements are largely unknown. We have investigated...... shown to be important for A-to-I editing. We demonstrate that the element also can induce editing in related but normally not edited RNA sequences. In human, thousands of genes are edited in duplexes formed by inverted repeats in non-coding regions. It is likely that numerous such duplexes can induce...... the requirements for editing at the I/M site in the Gabra-3 transcript of the GABA(A) receptor. We identify an evolutionarily conserved intronic duplex, 150 nt downstream of the exonic hairpin where the I/M site resides, which is required for its editing. This is the first time a distant RNA structure has been...

  16. Common changes in global gene expression induced by RNA polymerase inhibitors in Shigella flexneri.

    Directory of Open Access Journals (Sweden)

    Hua Fu

    Full Text Available Characterization of expression profile of organisms in response to antimicrobials provides important information on the potential mechanism of action of the drugs. The special expression signature can be used to predict whether other drugs act on the same target. Here, the common response of Shigella flexneri to two inhibitors of RNA polymerase was examined using gene expression profiling. Consistent with similar effects of the two drugs, the gene expression profiles indicated that responses of the bacteria to these drugs were roughly the same, with 225 genes affected commonly. Of them, 88 were induced and 137 were repressed. Real-time PCR was performed for selected genes to verify the microarray results. Analysis of the expression data revealed that more than 30% of the plasmid-encoded genes on the array were up-regulated by the antibiotics including virF regulon, other virulence-related genes, and genes responsible for plasmid replication, maintenance, and transfer. In addition, some chromosome-encoded genes involved in virulence and genes acquired from horizontal transfer were also significantly up-regulated. However, the expression of genes encoding the beta-subunit of RNA polymerase was increased moderately. The repressed genes include those that code for products associated with the ribosome, citrate cycle, glycolysis, thiamine biosynthesis, purine metabolism, fructose metabolism, mannose metabolism, and cold shock proteins. This study demonstrates that the two antibiotics induce rapid cessation of RNA synthesis resulting in inhibition of translation components. It also indicates that the production of virulence factors involved in intercellular dissemination, tissue invasion and inflammatory destruction may be enhanced through derepressing horizontal transfer genes by the drugs.

  17. lncRNA-Induced Nucleosome Repositioning Reinforces Transcriptional Repression of rRNA Genes upon Hypotonic Stress

    Directory of Open Access Journals (Sweden)

    Zhongliang Zhao

    2016-03-01

    Full Text Available The activity of rRNA genes (rDNA is regulated by pathways that target the transcription machinery or alter the epigenetic state of rDNA. Previous work has established that downregulation of rRNA synthesis in quiescent cells is accompanied by upregulation of PAPAS, a long noncoding RNA (lncRNA that recruits the histone methyltransferase Suv4-20h2 to rDNA, thus triggering trimethylation of H4K20 (H4K20me3 and chromatin compaction. Here, we show that upregulation of PAPAS in response to hypoosmotic stress does not increase H4K20me3 because of Nedd4-dependent ubiquitinylation and proteasomal degradation of Suv4-20h2. Loss of Suv4-20h2 enables PAPAS to interact with CHD4, a subunit of the chromatin remodeling complex NuRD, which shifts the promoter-bound nucleosome into the transcriptional “off” position. Thus, PAPAS exerts a “stress-tailored” dual function in rDNA silencing, facilitating either Suv4-20h2-dependent chromatin compaction or NuRD-dependent changes in nucleosome positioning.

  18. Deep sequencing uncovers commonality in small RNA profiles between transgene-induced and naturally occurring RNA silencing of chalcone synthase-A gene in petunia.

    Science.gov (United States)

    Kasai, Megumi; Matsumura, Hideo; Yoshida, Kentaro; Terauchi, Ryohei; Taneda, Akito; Kanazawa, Akira

    2013-01-30

    Introduction of a transgene that transcribes RNA homologous to an endogenous gene in the plant genome can induce silencing of both genes, a phenomenon termed cosuppression. Cosuppression was first discovered in transgenic petunia plants transformed with the CHS-A gene encoding chalcone synthase, in which nonpigmented sectors in flowers or completely white flowers are produced. Some of the flower-color patterns observed in transgenic petunias having CHS-A cosuppression resemble those in existing nontransgenic varieties. Although the mechanism by which white sectors are generated in nontransgenic petunia is known to be due to RNA silencing of the CHS-A gene as in cosuppression, whether the same trigger(s) and/or pattern of RNA degradation are involved in these phenomena has not been known. Here, we addressed this question using deep-sequencing and bioinformatic analyses of small RNAs. We analyzed short interfering RNAs (siRNAs) produced in nonpigmented sectors of petal tissues in transgenic petunia plants that have CHS-A cosuppression and a nontransgenic petunia variety Red Star, that has naturally occurring CHS-A RNA silencing. In both silencing systems, 21-nt and 22-nt siRNAs were the most and the second-most abundant size classes, respectively. CHS-A siRNA production was confined to exon 2, indicating that RNA degradation through the RNA silencing pathway occurred in this exon. Common siRNAs were detected in cosuppression and naturally occurring RNA silencing, and their ranks based on the number of siRNAs in these plants were correlated with each other. Noticeably, highly abundant siRNAs were common in these systems. Phased siRNAs were detected in multiple phases at multiple sites, and some of the ends of the regions that produced phased siRNAs were conserved. The features of siRNA production found to be common to cosuppression and naturally occurring silencing of the CHS-A gene indicate mechanistic similarities between these silencing systems especially in the

  19. A general model of concurrency and its implementation as many-core dynamic RISC processors

    NARCIS (Netherlands)

    Bernard, T.; Bousias, K.; Guang, L.; Jesshope, C.R.; Lankamp, M.; van Tol, M.W.; Zhang, L.

    2008-01-01

    This paper presents a concurrent execution model and its micro-architecture based on in-order RISC processors, which schedules instructions from large pools of contextualised threads. The model admits a strategy for programming chip multiprocessors using parallelising compilers based on existing

  20. The microelectronic and photonic test bed RISC processor and DRAM memory stack experiments

    International Nuclear Information System (INIS)

    Clark, K.A.; Meehan, T.J.

    1999-01-01

    This paper reports on the on-orbit data obtained from the MPTB RISC Processor Experiment, containing three Integrated Device Technologies R3081 processors. During operations, nine SEUs were observed in the processors, and four SEUs were observed in the memory and/or support circuitry. (authors)

  1. Competition between alliance blocks : the case of the RISC microprocessor technology

    NARCIS (Netherlands)

    Vanhaverbeke, W.P.M.; Noorderhaven, N.G.

    2001-01-01

    Competition between alliance blocks is a new form of rivalry: groups of firms link together for a common purpose by means of strategic alliances, and competition between alliance blocks is superimposed on competition between individual firms. This paper focuses on alliance blocks in the RISC

  2. Multifunctional selenium nanoparticles as carriers of HSP70 siRNA to induce apoptosis of HepG2 cells

    Directory of Open Access Journals (Sweden)

    Li Y

    2016-07-01

    Full Text Available Yinghua Li,1 Zhengfang Lin,1 Mingqi Zhao,1 Tiantian Xu,1 Changbing Wang,1 Huimin Xia,1,* Hanzhong Wang,2,* Bing Zhu1,* 1Guangzhou Women and Children’s Medical Center, Guangzhou, Guangdong, 2State Key Laboratory of Virology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, People’s Republic of China *These authors contributed equally to this work Abstract: Small interfering RNA (siRNA as a new therapeutic modality holds promise for cancer treatment, but it is unable to cross cell membrane. To overcome this limitation, nanotechnology has been proposed for mediation of siRNA transfection. Selenium (Se is a vital dietary trace element for mammalian life and plays an essential role in the growth and functioning of humans. As a novel Se species, Se nanoparticles have attracted more and more attention for their higher anticancer efficacy. In the present study, siRNAs with polyethylenimine (PEI-modified Se nanoparticles (Se@PEI@siRNA have been demonstrated to enhance the apoptosis of HepG2 cells. Heat shock protein (HSP-70 is overexpressed in many types of human cancer and plays a significant role in several biological processes including the regulation of apoptosis. The objective of this study was to silence inducible HSP70 and promote the apoptosis of Se-induced HepG2 cells. Se@PEI@siRNA were successfully prepared and characterized by various microscopic methods. Se@PEI@siRNA showed satisfactory size distribution, high stability, and selectivity between cancer and normal cells. The cytotoxicity of Se@PEI@siRNA was lower for normal cells than tumor cells, indicating that these compounds may have fewer side effects. The gene-silencing efficiency of Se@PEI@siRNA was significantly much higher than Lipofectamine 2000@siRNA and resulted in a significantly reduced HSP70 mRNA and protein expression in cancer cells. When the expression of HSP70 was diminished, the function of cell protection was also removed and cancer cells became more

  3. Clofibrate-induced increases in peroxisomal proteins: effect on synthesis, degradation, and mRNA activity

    International Nuclear Information System (INIS)

    Mortensen, R.M.

    1983-01-01

    The effect of clofibrate on the polypeptide composition of peroxisomes was determined. A simple method was developed for the isolation of peroxisomes with a purity of 90-95% using sedimentation in a metrizamide gradient. The specific activities of HD did not change with clofibrate treatment so that the increases in enzyme activities are solely due to increases in protein amounts. The hepatic concentration of HD increased 63 times. The HD synthesis rate, as measured by the incorporation of [ 3 H]leucine, increased 74 times, so that the increase in the synthesis was sufficient to account for the increase in protein. Clofibrate caused no discernible change in the degradation rate of HD labeled with [ 14 C]bicarbonate. The half-life of HD was approximately 2 days. The translatable mRBA coding for HD increased 55 times. This value is not significantly different from the increase in HD protein or in HD synthesis. This observation was also true for several other peroxisomal proteins. Therefore, clofibrate causes an increase in the mRNA activity, which increases the synthesis of HD leading to an accumulation of protein and enzyme activity. The kinetics of the clofibrate-induced changes in HD synthesis rate, protein level, and enzymatic activity was analyzed using a simple model which included the half-lives of the drug, mRNA, and protein. The best fit of the model to the data gave an mRNA half-life of 10 hours and a protein half-life of 1.8 days, with no significant change by clofibrate

  4. Introduction of in vitro transcribed ENO1 mRNA into neuroblastoma cells induces cell death

    International Nuclear Information System (INIS)

    Ejeskär, Katarina; Krona, Cecilia; Carén, Helena; Zaibak, Faten; Li, Lingli; Martinsson, Tommy; Ioannou, Panayiotis A

    2005-01-01

    Neuroblastoma is a solid tumour of childhood often with an unfavourable outcome. One common genetic feature in aggressive tumours is 1p-deletion. The α-enolase (ENO1) gene is located in chromosome region 1p36.2, within the common region of deletion in neuroblastoma. One alternative translated product of the ENO1 gene, known as MBP-1, acts as a negative regulator of the c-myc oncogene, making the ENO1 gene a candidate as a tumour suppressor gene. Methods used in this study are transfection of cDNA-vectors and in vitro transcribed mRNA, cell growth assay, TUNEL-assay, real-time RT-PCR (TaqMan) for expression studies, genomic sequencing and DHPLC for mutation detection. Here we demonstrate that transfection of ENO1 cDNA into 1p-deleted neuroblastoma cell lines causes' reduced number of viable cells over time compared to a negative control and that it induces apoptosis. Interestingly, a similar but much stronger dose-dependent reduction of cell growth was observed by transfection of in vitro transcribed ENO1 mRNA into neuroblastoma cells. These effects could also be shown in non-neuroblastoma cells (293-cells), indicating ENO1 to have general tumour suppressor activity. Expression of ENO1 is detectable in primary neuroblastomas of all different stages and no difference in the level of expression can be detected between 1p-deleted and 1p-intact tumour samples. Although small numbers (11 primary neuroblastomas), there is some evidence that Stage 4 tumours has a lower level of ENO1-mRNA than Stage 2 tumours (p = 0.01). However, mutation screening of 44 primary neuroblastomas of all different stages, failed to detect any mutations. Our studies indicate that ENO1 has tumour suppressor activity and that high level of ENO1 expression has growth inhibitory effects

  5. Localized frustration and binding-induced conformational change in recognition of 5S RNA by TFIIIA zinc finger.

    Science.gov (United States)

    Tan, Cheng; Li, Wenfei; Wang, Wei

    2013-12-19

    Protein TFIIIA is composed of nine tandemly arranged Cys2His2 zinc fingers. It can bind either to the 5S RNA gene as a transcription factor or to the 5S RNA transcript as a chaperone. Although structural and biochemical data provided valuable information on the recognition between the TFIIIIA and the 5S DNA/RNA, the involved conformational motions and energetic factors contributing to the binding affinity and specificity remain unclear. In this work, we conducted MD simulations and MM/GBSA calculations to investigate the binding-induced conformational changes in the recognition of the 5S RNA by the central three zinc fingers of TFIIIA and the energetic factors that influence the binding affinity and specificity at an atomistic level. Our results revealed drastic interdomain conformational changes between these three zinc fingers, involving the exposure/burial of several crucial DNA/RNA binding residues, which can be related to the competition between DNA and RNA for the binding of TFIIIA. We also showed that the specific recognition between finger 4/finger 6 and the 5S RNA introduces frustrations to the nonspecific interactions between finger 5 and the 5S RNA, which may be important to achieve optimal binding affinity and specificity.

  6. Nitrate-induced changes in protein synthesis and translation of RNA in maize roots

    International Nuclear Information System (INIS)

    McClure, P.R.; Omholt, T.E.; Pace, G.M.; Bouthyette, P.Y.

    1987-01-01

    Nitrate regulation of protein synthesis and RNA translation in maize (Zea mays L. var B73) roots was examined, using in vivo labeling with [ 35 S]methionine and in vitro translation. Nitrate enhanced the synthesis of a 31 kilodalton membrane polypeptide which was localized in a fraction enriched in tonoplast and/or endoplasmic reticulum membrane vesicles. The nitrate-enhanced synthesis was correlated with an acceleration of net nitrate uptake by seedlings during initial exposure to nitrate. Nitrate did not consistently enhance protein synthesis in other membrane fractions. Synthesis of up to four soluble polypeptides (21, 40, 90, and 168 kilodaltons) was also enhanced by nitrate. The most consistent enhancement was that of the 40 kilodalton polypeptide. No consistent nitrate-induced changes were noted in the organellar fraction (14,000g pellet of root homogenates). When roots were treated with nitrate, the amount of [ 35 S]methionine increased in six in vitro translation products (21, 24, 41, 56, 66, and 90 kilodaltons). Nitrate treatment did not enhance accumulation of label in translation products with a molecular weight of 31,000 (corresponding to the identified nitrate-inducible membrane polypeptide). Incubation of in vitro translation products with root membranes caused changes in the SDS-PAGE profiles in the vecinity of 31 kilodaltons. The results suggest that the nitrate-inducible, 31 kilodalton polypeptide from a fraction enriched in tonoplast and/or endoplasmic reticulum may be involved in regulating nitrate accumulation by maize roots

  7. Maternal separation induces hippocampal changes in cadherin-1 (CDH-1) mRNA and recognition memory impairment in adolescent mice.

    Science.gov (United States)

    de Azeredo, Lucas Araújo; Wearick-Silva, Luis Eduardo; Viola, Thiago Wendt; Tractenberg, Saulo Gantes; Centeno-Silva, Anderson; Orso, Rodrigo; Schröder, Nadja; Bredy, Timothy William; Grassi-Oliveira, Rodrigo

    2017-05-01

    In rodents, disruption of mother-infant attachment induced by maternal separation (MS) is associated with recognition memory impairment and long-term neurobiological consequences. Particularly stress-induced modifications have been associated to disruption of cadherin (CDH) adhesion function, which plays an important role in remodeling of neuronal connection and synaptic plasticity. This study investigated the sex-dependent effect of MS on recognition memory and mRNA levels of classical type I and type II CDH and the related β -catenin (β -Cat) in the hippocampus and prefrontal cortex of late adolescent mice. We provided evidence that the BALB/c mice exposed to MS present deficit in recognition memory, especially females. Postnatal MS induced higher hippocampal CDH-2 and CDH-8 mRNA levels, as well as an upregulation of CDH-1 in the prefrontal cortex in both males and females. MS-reared female mice presented lower CDH-1 mRNA levels in the hippocampus. In addition, hippocampal CDH-1 mRNA levels were positively correlated with recognition memory performance in females. MS-reared male mice exhibited higher β -Cat mRNA levels in the hippocampus. Considering sex-specific effects on CDH mRNA levels, it has been demonstrated mRNA changes in CDH-1, β -Cat, and CDH-6 in the hippocampus, as well as CDH-1, CDH-8 and CDH-11 in the prefrontal cortex. Overall, these findings suggest a complex interplay among MS, CDH mRNA expression, and sex differences in the PFC and hippocampus of adolescent mice. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Suberoylanilide hydroxamic acid (SAHA) inhibits EGF-induced cell transformation via reduction of cyclin D1 mRNA stability

    International Nuclear Information System (INIS)

    Zhang, Jingjie; Ouyang, Weiming; Li, Jingxia; Zhang, Dongyun; Yu, Yonghui; Wang, York; Li, Xuejun; Huang, Chuanshu

    2012-01-01

    Suberoylanilide hydroxamic acid (SAHA) inhibiting cancer cell growth has been associated with its downregulation of cyclin D1 protein expression at transcription level or translation level. Here, we have demonstrated that SAHA inhibited EGF-induced Cl41 cell transformation via the decrease of cyclin D1 mRNA stability and induction of G0/G1 growth arrest. We found that SAHA treatment resulted in the dramatic inhibition of EGF-induced cell transformation, cyclin D1 protein expression and induction of G0/G1 growth arrest. Further studies showed that SAHA downregulation of cyclin D1 was only observed with endogenous cyclin D1, but not with reconstitutionally expressed cyclin D1 in the same cells, excluding the possibility of SAHA regulating cyclin D1 at level of protein degradation. Moreover, SAHA inhibited EGF-induced cyclin d1 mRNA level, whereas it did not show any inhibitory effect on cyclin D1 promoter-driven luciferase reporter activity under the same experimental conditions, suggesting that SAHA may decrease cyclin D1 mRNA stability. This notion was supported by the results that treatment of cells with SAHA decreased the half-life of cyclin D1 mRNA from 6.95 h to 2.57 h. Consistent with downregulation of cyclin D1 mRNA stability, SAHA treatment also attenuated HuR expression, which has been well-characterized as a positive regulator of cyclin D1 mRNA stability. Thus, our study identifies a novel mechanism responsible for SAHA inhibiting cell transformation via decreasing cyclin D1 mRNA stability and induction of G0/G1 growth arrest in Cl41 cells. -- Highlights: ► SAHA inhibits cell transformation in Cl41 cells. ► SAHA suppresses Cyclin D1 protein expression. ► SAHA decreases cyclin D1 mRNA stability.

  9. H19 lncRNA mediates 17β-estradiol-induced cell proliferation in MCF-7 breast cancer cells.

    Science.gov (United States)

    Sun, Hong; Wang, Guo; Peng, Yan; Zeng, Ying; Zhu, Qiong-Ni; Li, Tai-Lin; Cai, Jia-Qin; Zhou, Hong-Hao; Zhu, Yuan-Shan

    2015-06-01

    Estrogen plays a critical role in breast cancer development and progression. However, the mechanism involved in the promotion of breast cancer development and progression by estrogen remains unclear although it has been intensively studied. In the present study, we investigated the estrogen inducibility and functional significance of H19 lncRNA in breast cancer cells and tumor tissues. The screening of 83 disease-related long non-coding RNAs (lncRNAs) revealed that H19 lncRNA was much higher in estrogen receptor (ER)-positive MCF-7 breast cancer cells than in ER-negative MDA-MB-231 cells. 17β-estradiol produced a dose- and time-dependent induction of H19 expression in MCF-7 cells, which was mediated via ERα as evident by the blockade of this 17β-estradiol effect with ICI 182780, a specific ER antagonist and knockdown of ERα using specific RNAi. Moreover, knockdown of H19 lncRNA decreased cell survival and blocked estrogen-induced cell growth while overexpression of H19 lncRNA stimulated cell proliferation. Quantitation of H19 lncRNA in human breast cancer tissues showed that the level of H19 lncRNA was >10-fold higher in ER-positive than in ER-negative tumor tissues. These results suggest that H19 is an estrogen-inducible gene and plays a key role in cell survival and in estrogen-induced cell proliferation in MCF-7 cells, indicating that H19 lncRNA may serve as a biomarker for breast cancer diagnosis and progression, and as a valuable target for breast cancer therapy.

  10. Curcumin Attenuates Lipopolysaccharide-Induced Hepatic Lipid Metabolism Disorder by Modification of m6 A RNA Methylation in Piglets.

    Science.gov (United States)

    Lu, Na; Li, Xingmei; Yu, Jiayao; Li, Yi; Wang, Chao; Zhang, Lili; Wang, Tian; Zhong, Xiang

    2018-01-01

    N 6 -methyladenosine (m 6 A) regulates gene expression and affects cellular metabolism. In this study, we checked whether the regulation of lipid metabolism by curcumin is associated with m 6 A RNA methylation. We investigated the effects of dietary curcumin supplementation on lipopolysaccharide (LPS)-induced liver injury and lipid metabolism disorder, and on m 6 A RNA methylation in weaned piglets. A total of 24 Duroc × Large White × Landrace piglets were randomly assigned to control, LPS, and CurL (LPS challenge and 200 mg/kg dietary curcumin) groups (n = 8/group). The results showed that curcumin reduced the increase in relative liver weight as well as the concentrations of aspartate aminotransferase and lactate dehydrogenase induced by LPS injection in the plasma and liver of weaning piglets (p < 0.05). The amounts of total cholesterol and triacylglycerols were decreased by curcumin compared to that by the LPS injection (p < 0.05). Additionally, curcumin reduced the expression of Bcl-2 and Bax mRNA, whereas it increased the p53 mRNA level in the liver (p < 0.05). Curcumin inhibited the enhancement of SREBP-1c and SCD-1 mRNA levels induced by LPS in the liver. Notably, dietary curcumin affected the expression of METTL3, METTL14, ALKBH5, FTO, and YTHDF2 mRNA, and increased the abundance of m 6 A in the liver of piglets. In conclusion, the protective effect of curcumin in LPS-induced liver injury and hepatic lipid metabolism disruption might be due to the increase in m 6 A RNA methylation. Our study provides mechanistic insights into the effect of curcumin in protecting against hepatic injury during inflammation and metabolic diseases. © 2018 AOCS.

  11. MicroRNA changes in rat mesentery and serum associated with drug-induced vascular injury

    International Nuclear Information System (INIS)

    Thomas, Roberta A.; Scicchitano, Marshall S.; Mirabile, Rosanna C.; Chau, Nancy T.; Frazier, Kendall S.; Thomas, Heath C.

    2012-01-01

    Regulatory miRNAs play a role in vascular biology and are involved in biochemical and molecular pathways dysregulated during vascular injury. Collection and integration of functional miRNA data into these pathways can provide insight into pathogenesis at the site of injury; the same technologies applied to biofluids may provide diagnostic or surrogate biomarkers. miRNA was analyzed from mesentery and serum from rats given vasculotoxic compounds for 4 days. Fenoldopam, dopamine and midodrine each alter hemodynamics and are associated with histologic evidence of vascular injury, while yohimbine is vasoactive but does not cause histologic evidence of vascular injury in rat. There were 38 and 35 miRNAs altered in a statistically significant manner with a fold change of 2 or greater in mesenteries of fenoldopam- and dopamine-dosed rats, respectively, with 9 of these miRNAs shared. 10 miRNAs were altered in rats given midodrine; 6 were shared with either fenoldopam or dopamine. In situ hybridization demonstrated strong expression and co-localization of miR-134 in affected but not in adjacent unaffected vessels. Mesenteric miRNA expression may provide clarity or avenues of research into mechanisms involved in vascular injury once the functional role of specific miRNAs becomes better characterized. 102 miRNAs were altered in serum from rats with drug-induced vascular injury. 10 miRNAs were commonly altered in serum from dopamine and either fenoldopam or midodrine dosed rats; 18 of these 102 were also altered in mesenteries from rats with drug-induced vascular injury, suggesting their possible utility as peripheral biomarkers. -- Highlights: ► Mesentery and serum were examined from rats given vasoactive compounds for 4 days. ► 72 miRNAs were altered in mesenteries from rats with vascular injury. ► miR-134 was localized to affected but not adjacent unaffected vessels. ► 102 miRNAs were changed in serum from rats with vascular injury. ► 18 miRNAs changed in both

  12. MicroRNA modulation induced by AICA ribonucleotide in J1 mouse ES cells.

    Directory of Open Access Journals (Sweden)

    Xiaoyan Shi

    Full Text Available ES cells can propagate indefinitely, maintain self-renewal, and differentiate into almost any cell type of the body. These properties make them valuable in the research of embryonic development, regenerative medicine, and organ transplantation. MicroRNAs (miRNAs are considered to have essential functions in the maintenance and differentiation of embryonic stem cells (ES cells. It was reported that, strong external stimuli, such as a transient low-pH and hypoxia stress, were conducive to the formation of induced pluripotent stem cells (iPS cells. AICA ribonucleotide (AICAR is an AMP-activated protein kinase activator, which can let cells in the state of energy stress. We have demonstrated that AICAR can maintain the pluripotency of J1 mouse ES cells through modulating protein expression in our previous research, but its effects on ES cell miRNA expression remain unknown. In this study, we conducted small RNA high-throughput sequencing to investigate AICAR influence on J1 mouse ES cells by comparing the miRNA expression patterns of the AICAR-treated cells and those without treatment. The result showed that AICAR can significantly modulate the expression of multiple miRNAs, including those have crucial functions in ES cell development. Some differentially expressed miRNAs were selected and confirmed by real-time PCR. For the differently expressed miRNAs identified, further study was conducted regarding the pluripotency and differentiation associated miRNAs with their targets. Moreover, miR-134 was significantly down-regulated after AICAR treatment, and this was suggested to be directly associated with the up-regulated pluripotency markers, Nanog and Sox2. Lastly, Myc was significantly down-regulated after AICAR treatment; therefore, we predicted miRNAs that may target Myc and identified that AICAR induced up-regulation of miR-34a, 34b, and 34c can repress Myc expression in J1 mouse ES cells. Taken together, our study provide a new mechanism for

  13. RNA interference and Register Machines (extended abstract

    Directory of Open Access Journals (Sweden)

    Masahiro Hamano

    2012-11-01

    Full Text Available RNA interference (RNAi is a mechanism whereby small RNAs (siRNAs directly control gene expression without assistance from proteins. This mechanism consists of interactions between RNAs and small RNAs both of which may be single or double stranded. The target of the mechanism is mRNA to be degraded or aberrated, while the initiator is double stranded RNA (dsRNA to be cleaved into siRNAs. Observing the digital nature of RNAi, we represent RNAi as a Minsky register machine such that (i The two registers hold single and double stranded RNAs respectively, and (ii Machine's instructions are interpreted by interactions of enzyme (Dicer, siRNA (with RISC com- plex and polymerization (RdRp to the appropriate registers. Interpreting RNAi as a computational structure, we can investigate the computational meaning of RNAi, especially its complexity. Initially, the machine is configured as a Chemical Ground Form (CGF, which generates incorrect jumps. To remedy this problem, the system is remodeled as recursive RNAi, in which siRNA targets not only mRNA but also the machine instructional analogues of Dicer and RISC. Finally, probabilistic termination is investigated in the recursive RNAi system.

  14. Heat shock 70 protein interaction with Turnip mosaic virus RNA-dependent RNA polymerase within virus-induced membrane vesicles

    International Nuclear Information System (INIS)

    Dufresne, Philippe J.; Thivierge, Karine; Cotton, Sophie; Beauchemin, Chantal; Ide, Christine; Ubalijoro, Eliane; Laliberte, Jean-Francois; Fortin, Marc G.

    2008-01-01

    Tandem affinity purification was used in Arabidopsis thaliana to identify cellular interactors of Turnip mosaic virus (TuMV) RNA-dependent RNA polymerase (RdRp). The heat shock cognate 70-3 (Hsc70-3) and poly(A)-binding (PABP) host proteins were recovered and shown to interact with the RdRp in vitro. As previously shown for PABP, Hsc70-3 was redistributed to nuclear and membranous fractions in infected plants and both RdRp interactors were co-immunoprecipitated from a membrane-enriched extract using RdRp-specific antibodies. Fluorescently tagged RdRp and Hsc70-3 localized to the cytoplasm and the nucleus when expressed alone or in combination in Nicotiana benthamiana. However, they were redistributed to large perinuclear ER-derived vesicles when co-expressed with the membrane binding 6K-VPg-Pro protein of TuMV. The association of Hsc70-3 with the RdRp could possibly take place in membrane-derived replication complexes. Thus, Hsc70-3 and PABP2 are potentially integral components of the replicase complex and could have important roles to play in the regulation of potyviral RdRp functions

  15. Protection against West Nile virus infection in mice after inoculation with type I interferon-inducing RNA transcripts.

    Directory of Open Access Journals (Sweden)

    Miguel Rodríguez-Pulido

    Full Text Available West Nile virus (WNV is a neurovirulent single stranded RNA mosquito-borne flavivirus, whose main natural hosts are birds, but it also infects humans and horses. Nowadays, no human vaccine is commercially available and clinical treatment is only supportive. Recently, it has been shown that RNA transcripts, mimicking structural domains in the non-coding regions (NCRs of the foot-and mouth disease virus (FMDV induce a potent IFN response and antiviral activity in transfected cultured cells, and also reduced mice susceptibility to FMDV. By using different transcripts combinations, administration schedules, and infecting routes and doses, we have demonstrated that these FMDV RNA transcripts protect suckling and adult mice against lethal challenge with WNV. The protective activity induced by the transcripts was systemic and dependent on the infection route and dose. These results confirm the antiviral potential of these synthetic RNAs for fighting viruses of different families relevant for human and animal health.

  16. Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma.

    Science.gov (United States)

    Cai, H; Liu, X; Zheng, J; Xue, Y; Ma, J; Li, Z; Xi, Z; Li, Z; Bao, M; Liu, Y

    2017-01-19

    Angiogenesis is one of the critical biological elements affecting the development and progression of cancer. Long non-coding RNAs (lncRNAs) are important regulators and aberrantly expressed in various types of human cancer. Our previous studies indicated that lncRNA taurine upregulated 1 (TUG1) implicated in the regulation of blood-tumor barrier permeability; however, its role in glioblastoma angiogenesis still unclear. Here we demonstrated that TUG1 was up-expressed in human glioblastoma tissues and glioblastoma cell lines. Knockdown of TUG1 remarkably suppressed tumor-induced endothelial cell proliferation, migration and tube formation as well as reducing spheroid-based angiogenesis ability in vitro, which are the critical steps for tumor angiogenesis. Besides, knockdown of TUG1 significantly increased the expression of mircroRNA-299 (miR-299), which was down-expressed in glioblastoma tissues and glioblastoma cell lines. Bioinformatics analysis and luciferase reporter assay revealed that TUG1 influenced tumor angiogenesis via directly binding to the miR-299 and there was a reciprocal repression between TUG1 and miR-299 in the same RNA-induced silencing complex. Moreover, knockdown of TUG1 reduced the expression of vascular endothelial growth factor A (VEGFA), which was defined as a functional downstream target of miR-299. In addition, knockdown of TUG1, shown in the in vivo studies, has effects on suppressing tumor growth, reducing tumor microvessel density and decreasing the VEGFA expression by upregulating miR-299 in xenograft glioblastoma model. Overall, the results demonstrated that TUG1 enhances tumor-induced angiogenesis and VEGF expression through inhibiting miR-299. Also, the inhibition of TUG1 could provide a novel therapeutic target for glioblastoma treatment.

  17. A conformation-induced fluorescence method for microRNA detection

    DEFF Research Database (Denmark)

    Aw, Sherry S; Tang, Melissa Xm; Teo, Yin Nah

    2016-01-01

    and quantify microRNAs may aid research into novel aspects of microRNA biology and contribute to the development of diagnostics. By introducing an additional stem loop into the fluorescent RNA Spinach and altering its 3' and 5' ends, we have generated a new RNA, Pandan, that functions as the basis for a micro......MicroRNAs play important roles in a large variety of biological systems and processes through their regulation of target mRNA expression, and show promise as clinical biomarkers. However, their small size presents challenges for tagging or direct detection. Innovation in techniques to sense......RNA sensor. Pandan contains two sequence-variable stem loops that encode complementary sequence for a target microRNA of interest. In its sensor form, it requires the binding of a target microRNA in order to reconstitute the RNA scaffold for fluorophore binding and fluorescence. Binding of the target micro...

  18. MicroRNA-132 protects hippocampal neurons against oxygen-glucose deprivation-induced apoptosis.

    Science.gov (United States)

    Sun, Zu-Zhen; Lv, Zhan-Yun; Tian, Wen-Jing; Yang, Yan

    2017-09-01

    Hypoxic-ischemic brain injury (HIBI) results in death or long-term neurologic impairment in both adults and children. In this study, we investigated the effects of microRNA-132 (miR-132) dysregulation on oxygen-glucose deprivation (OGD)-induced apoptosis in fetal rat hippocampal neurons, in order to reveal the therapeutic potential of miR-132 on HIBI. MiR-132 dysregulation was induced prior to OGD exposure by transfection of primary fetal rat hippocampal neurons with miR-132 mimic or miR-132 inhibitor. The effects of miR-132 overexpression and suppression on OGD-stimulated hippocampal neurons were evaluated by detection of cell viability, apoptotic cells rate, and the expression of apoptosis-related proteins. Besides, TargetScan database and dual luciferase activity assay were used to seek a target gene of miR-132. As a result, miR-132 was highly expressed in hippocampal neurons following 2 h of OGD exposure. MiR-132 overexpression significantly increased OGD-diminished cell viability and reduced OGD-induced apoptosis at 12, 24, and 48 h post-OGD. MiR-132 overexpression significantly down-regulated the expressions of Bax, cytochrome c, and caspase-9, but up-regulated BCl-2. Caspase-3 activity was also significantly decreased by miR-132 overexpression. Furthermore, FOXO3 was a direct target of miR-132, and it was negatively regulated by miR-132. To conclude, our results provide evidence that miR-132 protects hippocampal neurons against OGD injury by inhibiting apoptosis.

  19. MicroRNA-15b Modulates Molecular Mediators of Blood Induced Arthropathy in Hemophilia Mice

    Directory of Open Access Journals (Sweden)

    Dwaipayan Sen

    2016-04-01

    Full Text Available The development of arthropathy is a major co-morbidity in patients with hemophilia. The present study was designed to study the role of a microRNA biomarker (miR-15b in the development of joint disease. To investigate the expression profile of miR-15b during the development of arthropathy, we first isolated and studied small RNA from the acute and chronic hemarthrosis model of hemophilia A mice. We observed that miR-15b was consistently repressed (~1- to 4-fold from the onset of joint bleeding (1, 3, 7 and 24 h until six bleeding episodes (up to 90 days. To test if reconstitution of miR-15b modulates biomarkers of joint damage in a chronic hemarthrosis model, we administered an adeno-associated virus (AAV 5-miR-15b vector intra-articularly alone or in combination with systemic administration of AAV2-factor VIII. miR-15b overexpression downregulated markers of angiogenesis and hypoxia (vascular epithelial growth factor α (VEGF-α and hypoxia inducing factor 2α (HIF-2α, ~70% and ~34%, respectively in the affected joints. In addition, the co-administration of miR-15b and factor VIII vectors reduced the levels of the chondrodegenerative matrix-metalloproteinases (MMPs 1, 3, 9 and 14 (~14% to 60% in the injured joints. These data demonstrate for the first time the role of a miR-15b in the development of hemophilic arthropathy and has implications in development of miR based therapies for joint disease.

  20. The silence of MUC2 mRNA induced by promoter hypermethylation associated with HBV in Hepatocellular Carcinoma

    Directory of Open Access Journals (Sweden)

    Ling Yang

    2013-01-01

    Full Text Available Abstract Background To evaluate the promoter methylation status of MUC2 gene and mRNA expression in patients with hepatocellular carcinoma. Methods We analyzed MUC2 methylation by MSP, and MUC2 mRNA by real-time PCR in 74 HCC. Results MUC2 mRNA were lower in HCC tissues (Mean -ΔCt = −4.70 than that in Non-HCC tissues (Mean -ΔCt = −2.98. Expression of MUC2 was elevated in only 23 (31.08% of the 74 HCC patients. MUC2 promoter was hypermethylated in 62.2% (46/74 of HCCs, and in only 18.9% (14/74 of non-tumor samples. MUC2 mRNA were lower in HCC patients with hypermethylation (Mean -ΔΔCt = −2.25 than those with demethylation (Mean -ΔΔCt = −0.22, and there is a decreased tendency for MUC2 mRNA in HCC patients with promoter hypermethylation (p = 0.011. There was a significantly correlation found between MUC2 mRNA and HBV and AFP in HCC. The loss of MUC2 mRNA and hypermethylation could be poor prognostic factors. After treated by 5-Aza-CdR and TSA, we found that MUC2 mRNA induced significantly in 7721, Huh7 and HepG2 cells. Conclusion The results suggested that MUC2 mRNA silenced by promoter hypermethylation is associated with high levels HBV in HCC.

  1. Herpesvirus telomerase RNA (vTR with a mutated template sequence abrogates herpesvirus-induced lymphomagenesis.

    Directory of Open Access Journals (Sweden)

    Benedikt B Kaufer

    2011-10-01

    Full Text Available Telomerase reverse transcriptase (TERT and telomerase RNA (TR represent the enzymatically active components of telomerase. In the complex, TR provides the template for the addition of telomeric repeats to telomeres, a protective structure at the end of linear chromosomes. Human TR with a mutation in the template region has been previously shown to inhibit proliferation of cancer cells in vitro. In this report, we examined the effects of a mutation in the template of a virus encoded TR (vTR on herpesvirus-induced tumorigenesis in vivo. For this purpose, we used the oncogenic avian herpesvirus Marek's disease virus (MDV as a natural virus-host model for lymphomagenesis. We generated recombinant MDV in which the vTR template sequence was mutated from AATCCCAATC to ATATATATAT (vAU5 by two-step Red-mediated mutagenesis. Recombinant viruses harboring the template mutation replicated with kinetics comparable to parental and revertant viruses in vitro. However, mutation of the vTR template sequence completely abrogated virus-induced tumor formation in vivo, although the virus was able to undergo low-level lytic replication. To confirm that the absence of tumors was dependent on the presence of mutant vTR in the telomerase complex, a second mutation was introduced in vAU5 that targeted the P6.1 stem loop, a conserved region essential for vTR-TERT interaction. Absence of vTR-AU5 from the telomerase complex restored virus-induced lymphoma formation. To test if the attenuated vAU5 could be used as an effective vaccine against MDV, we performed vaccination-challenge studies and determined that vaccination with vAU5 completely protected chickens from lethal challenge with highly virulent MDV. Taken together, our results demonstrate 1 that mutation of the vTR template sequence can completely abrogate virus-induced tumorigenesis, likely by the inhibition of cancer cell proliferation, and 2 that this strategy could be used to generate novel vaccine candidates

  2. Inducible Major Vault Protein Plays a Pivotal Role in Double-Stranded RNA- or Virus-Induced Proinflammatory Response.

    Science.gov (United States)

    Peng, Nanfang; Liu, Shi; Xia, Zhangchuan; Ren, Sheng; Feng, Jian; Jing, Mingzhen; Gao, Xin; Wiemer, Erik A C; Zhu, Ying

    2016-03-15

    Pathogen invasion triggers robust antiviral cytokine production via different transcription factor signaling pathways. We have previously demonstrated that major vault protein (MVP) induces type I IFN production during viral infection; however, little is known about the role of MVP in proinflammatory responses. In this study, we found in vitro that expression of MVP, IL-6, and IL-8 was inducible upon dsRNA stimulation or viral infection. Moreover, MVP was essential for the induction of IL-6 and IL-8, as impaired expression of IL-6 and IL-8 in MVP-deficient human PBMCs, human lung epithelial cells (A549), and THP-1 monocytes, as well as in murine splenocytes, peritoneal macrophages, and PBMCs from MVP-knockout (MVP(-/-)) mice, was observed. Upon investigation of the underlying mechanisms, we demonstrated that MVP acted in synergy with AP-1 (c-Fos) and CCAAT/enhancer binding protein (C/EBP)β-liver-enriched transcriptional activating protein to activate the IL6 and IL8 promoters. Introduction of mutations into the AP-1 and C/EBPβ binding sites on the IL6 and IL8 promoters resulted in the loss of synergistic activation with MVP. Furthermore, we found that MVP interacted with both c-Fos and C/EBPβ. The interactions promoted nuclear translocation and recruitment of these transcription factors to IL6 and IL8 promoter regions. In the MVP(-/-) mouse model, significantly decreased expression of early antiviral cytokines resulted in higher viral titer in the lung, higher mortality, and heavier lung damage after infection with lethal influenza A virus. Taken together, our findings help to delineate a novel role of MVP in host proinflammatory response. Copyright © 2016 by The American Association of Immunologists, Inc.

  3. Suppression of the expression of hypoxia-inducible factor-1α by RNA interference alleviates hypoxia-induced pulmonary hypertension in adult rats.

    Science.gov (United States)

    Li, Ying; Shi, Bo; Huang, Liping; Wang, Xin; Yu, Xiaona; Guo, Baosheng; Ren, Weidong

    2016-12-01

    Hypoxia-inducible factor-1α (HIF-1α) has been implicated in the pathogenesis of hypoxic pulmonary hypertension (PH). However, the potential clinical value of HIF-1α as a therapeutic target in the treatment of PH has not yet been evaluated. In this study, an animal model of hypoxia-induced PH was established by exposing adult rats to 10% O2 for 3 weeks, and the effects of the lentivirus-mediated delivery of HIF-1α short hairpin RNA (shRNA) by intratracheal instillation prior to exposure to hypoxia on the manifestations of hypoxia-induced PH were assessed. The successful delivery of HIF-1α shRNA into the pulmonary arteries effectively suppressed the hypoxia-induced upregulation of HIF-1α, accompanied by the prominent attenuation the symptoms associated with hypoxia-induced PH, including the elevation of pulmonary arterial pressure, hypertrophy and hyperplasia of pulmonary artery smooth muscle cells (PASMCs), as well as the muscularization of pulmonary arterioles. In addition, the knockdown of HIF-1α in cultured rat primary PASMCs significantly inhibited the hypoxia-induced acceleration of the cell cycle and the proliferation of the PASMCs, suggesting that HIF-1α may be a direct mediator of PASMC hyperplasia in hypoxia-induced PH. In conclusion, this study demonstrates the potent suppressive effects of HIF-1α shRNA on hypoxia-induced PH and PASMC hyperplasia, providing evidence for the potential application of HIF-1α shRNA in the treatment of hypoxic PH.

  4. MOV10 RNA helicase is a potent inhibitor of retrotransposition in cells.

    Directory of Open Access Journals (Sweden)

    John L Goodier

    Full Text Available MOV10 protein, a putative RNA helicase and component of the RNA-induced silencing complex (RISC, inhibits retrovirus replication. We show that MOV10 also severely restricts human LINE1 (L1, Alu, and SVA retrotransposons. MOV10 associates with the L1 ribonucleoprotein particle, along with other RNA helicases including DDX5, DHX9, DDX17, DDX21, and DDX39A. However, unlike MOV10, these other helicases do not strongly inhibit retrotransposition, an activity dependent upon intact helicase domains. MOV10 association with retrotransposons is further supported by its colocalization with L1 ORF1 protein in stress granules, by cytoplasmic structures associated with RNA silencing, and by the ability of MOV10 to reduce endogenous and ectopic L1 expression. The majority of the human genome is repetitive DNA, most of which is the detritus of millions of years of accumulated retrotransposition. Retrotransposons remain active mutagens, and their insertion can disrupt gene function. Therefore, the host has evolved defense mechanisms to protect against retrotransposition, an arsenal we are only beginning to understand. With homologs in other vertebrates, insects, and plants, MOV10 may represent an ancient and innate form of immunity against both infective viruses and endogenous retroelements.

  5. MicroRNA-124 inhibits the progression of adjuvant-induced arthritis in rats.

    Science.gov (United States)

    Nakamachi, Yuji; Ohnuma, Kenichiro; Uto, Kenichi; Noguchi, Yoriko; Saegusa, Jun; Kawano, Seiji

    2016-03-01

    MicroRNAs (miRNAs) are small endogenous, non-coding RNAs that act as post-transcriptional regulators. We analysed the in vivo effect of miRNA-124 (miR-124, the rat analogue of human miR-124a) on adjuvant-induced arthritis (AIA) in rats. AIA was induced in Lewis rats by injecting incomplete Freund's adjuvant with heat-killed Mycobacterium tuberculosis. Precursor (pre)-miR-124 was injected into the right hind ankle on day 9. Morphological changes in the ankle joint were assessed by micro-CT and histopathology. Cytokine expression was examined by western blotting and real-time RT-PCR. The effect of miR-124 on predicted target messenger RNAs (mRNAs) was examined by luciferase reporter assays. The effect of pre-miR-124 or pre-miR-124a on the differentiation of human osteoclasts was examined by tartrate-resistant acid phosphatase staining. We found that miR-124 suppressed AIA in rats, as demonstrated by decreased synoviocyte proliferation, leucocyte infiltration and cartilage or bone destruction. Osteoclast counts and expression level of receptor activator of the nuclear factor κB ligand (RANKL), integrin β1 (ITGB1) and nuclear factor of activated T cells cytoplasmic 1 (NFATc1) were reduced in AIA rats treated with pre-miR-124. Luciferase analysis showed that miR-124 directly targeted the 3'UTR of the rat NFATc1, ITGB1, specificity protein 1 and CCAAT/enhancer-binding protein α mRNAs. Pre-miR-124 also suppressed NFATc1 expression in RAW264.7 cells. Both miR-124 and miR-124a directly targeted the 3'-UTR of human NFATc1 mRNA, and both pre-miR-124 and pre-miR-124a suppressed the differentiation of human osteoclasts. We found that miR-124 ameliorated AIA by suppressing critical prerequisites for arthritis development, such as RANKL and NFATc1. Thus, miR-124a is a candidate for therapeutic use for human rheumatoid arthritis. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  6. Antiresistin RNA Oligonucleotide Ameliorates Diet-Induced Nonalcoholic Fatty Liver Disease in Mice through Attenuating Proinflammatory Cytokines

    Directory of Open Access Journals (Sweden)

    Yi Tan

    2015-01-01

    Full Text Available The aim of this study was to determine whether inhibition of resistin by a synthetic antiresistin RNA (oligonucleotide oligo ameliorates metabolic and histological abnormalities in nonalcoholic fatty liver disease (NAFLD induced by high-fat diet (HFD in mice. The antiresistin RNA oligo and a scrambled control oligo (25 mg/kg of body weight were i.p. injected to HFD mice. Serum metabolic parameters and hepatic enzymes were measured after 4-week treatment. The treatment significantly reduced epididymal fat and attenuated the elevated serum resistin, cholesterol, triglycerides, glucose, and insulin with an improved glucose tolerance test. Antiresistin RNA oligo also normalized serum AST and ALT levels with improved pathohistology of NAFLD. Immunoblotting and qRT-PCR revealed that decreased protein and mRNA expression of resistin in fat and liver tissues of the treated mice were associated with reduction of adipose TNF-α and IL-6 expression and secretion into circulation. mRNA and protein expression of hepatic phosphoenolpyruvate carboxykinase (PEPCK and sterol regulatory element-binding protein-1c (SREBP-1c were also significantly decreased in the treated mice. Our results suggest that resistin may exacerbate NAFLD in metabolic syndrome through upregulating inflammatory cytokines and hepatic PEPCK and SREBP-1c. Antiresistin RNA oligo ameliorated metabolic abnormalities and histopathology of NAFLD through attenuating proinflammatory cytokines.

  7. Nucleolar TRF2 attenuated nucleolus stress-induced HCC cell-cycle arrest by altering rRNA synthesis.

    Science.gov (United States)

    Yuan, Fuwen; Xu, Chenzhong; Li, Guodong; Tong, Tanjun

    2018-05-03

    The nucleolus is an important organelle that is responsible for the biogenesis of ribosome RNA (rRNA) and ribosomal subunits assembly. It is also deemed to be the center of metabolic control, considering the critical role of ribosomes in protein translation. Perturbations of rRNA synthesis are closely related to cell proliferation and tumor progression. Telomeric repeat-binding factor 2 (TRF2) is a member of shelterin complex that is responsible for telomere DNA protection. Interestingly, it was recently reported to localize in the nucleolus of human cells in a cell-cycle-dependent manner, while the underlying mechanism and its role on the nucleolus remained unclear. In this study, we found that nucleolar and coiled-body phosphoprotein 1 (NOLC1), a nucleolar protein that is responsible for the nucleolus construction and rRNA synthesis, interacted with TRF2 and mediated the shuttle of TRF2 between the nucleolus and nucleus. Abating the expression of NOLC1 decreased the nucleolar-resident TRF2. Besides, the nucleolar TRF2 could bind rDNA and promoted rRNA transcription. Furthermore, in hepatocellular carcinoma (HCC) cell lines HepG2 and SMMC7721, TRF2 overexpression participated in the nucleolus stress-induced rRNA inhibition and cell-cycle arrest.

  8. RISC mezzanines for controlling data acquisition in the NA48 experiment at CERN

    CERN Document Server

    Guzik, Z; Bal, F; Formenti, F; Lacourt, A

    2000-01-01

    A part of the LKr calorimeter data acquisition system of the NA48 experiment (a precision measurements of epsilon / epsilon ' in CP- violating K/sup 0/ to 2 pi decays) is described. The experiment runs on the SPS north area in CERN. This paper presents some aspects of controlling the NA48 readout process based on commercial RIO 8260 RISC processors, which were used as a core for maintaining control algorithms. Several RISC processors were equipped with custom-made VME mezzanine boards providing interfacing, pre-processing and data formatting. These mezzanines are the subjects of this paper. They are: RIO-TIC/DAT (a time-stamp distributor and buffered DT-bus interface), FOL-RIO (an optical data formatter and event merger) and "TAXI receiver" (for handling trigger data of the NA48 Level-2 trigger supervisor). Also, the interface between the DT-bus and S- link/PCI is described. (8 refs).

  9. RISC mezzanines for controlling data acquisition in the NA48 experiment at CERN

    International Nuclear Information System (INIS)

    Guzik, Z.; Chlopik, A.; Bal, Fr.; Formenti, F.; Lacourt, A.

    2000-01-01

    A part of the LKr calorimeter data acquisition system of the NA48 experiment (a precision measurements of ε/ε' in CP violating; K 0 →2π decays) is described. The experiment runs on the SPS north area in CERN. This paper presents some aspects of controlling the NA48 readout process based on commercial RIO 8260 RISC processors, which were used as a core for maintaining control algorithms. Several RISC processors were equipped with custom-made VME mezzanine boards providing interfacing, pre-processing and data formatting. These mezzanines are subjects of this paper. They are: RIO-TIC/DAT - time stamp distributor and buffered DT-bus interface, FOL-RIO - optical data formatter and event merger and 'TAXI receiver' - handling trigger data of the NA48 Level 2 trigger supervisor. Also the interface between DT-bus and S-link/PCI is described

  10. Development of a data acquisition system using a RISC/UNIXTM workstation

    International Nuclear Information System (INIS)

    Takeuchi, Y.; Tanimori, T.; Yasu, Y.

    1993-01-01

    We have developed a compact data acquisition system on RISC/UNIX workstations. A SUN TM SPARCstation TM IPC was used, in which an extension bus 'SBus TM ' was linked to a VMEbus. The transfer rate achieved was better than 7 Mbyte/s between the VMEbus and the SUN. A device driver for CAMAC was developed in order to realize an interruptive feature in UNIX. In addition, list processing has been incorporated in order to keep the high priority of the data handling process in UNIX. The successful developments of both device driver and list processing have made it possible to realize the good real-time feature on the RISC/UNIX system. Based on this architecture, a portable and versatile data taking system has been developed, which consists of a graphical user interface, I/O handler, user analysis process, process manager and a CAMAC device driver. (orig.)

  11. Listeria monocytogenes Induces a Virulence-Dependent microRNA Signature That Regulates the Immune Response in Galleria mellonella

    Directory of Open Access Journals (Sweden)

    Gopala K. Mannala

    2017-12-01

    Full Text Available microRNAs (miRNAs coordinate several physiological and pathological processes by regulating the fate of mRNAs. Studies conducted in vitro indicate a role of microRNAs in the control of host-microbe interactions. However, there is limited understanding of miRNA functions in in vivo models of bacterial infections. In this study, we systematically explored changes in miRNA expression levels of Galleria mellonella larvae (greater-wax moth, a model system that recapitulates the vertebrate innate immunity, following infection with L. monocytogenes. Using an insect-specific miRNA microarray with more than 2000 probes, we found differential expression of 90 miRNAs (39 upregulated and 51 downregulated in response to infection with L. monocytogenes. We validated the expression of a subset of miRNAs which have mammalian homologs of known or predicted function. In contrast, non-pathogenic L. innocua failed to induce these miRNAs, indicating a virulence-dependent miRNA deregulation. To predict miRNA targets using established algorithms, we generated a publically available G. mellonella transcriptome database. We identified miRNA targets involved in innate immunity, signal transduction and autophagy, including spätzle, MAP kinase, and optineurin, respectively, which exhibited a virulence-specific differential expression. Finally, in silico estimation of minimum free energy of miRNA-mRNA duplexes of validated microRNAs and target transcripts revealed a regulatory network of the host immune response to L. monocytogenes. In conclusion, this study provides evidence for a role of miRNAs in the regulation of the innate immune response following bacterial infection in a simple, rapid and scalable in vivo model that may predict host-microbe interactions in higher vertebrates.

  12. Phorbol esters induce interleukin 2 mRNA in sensitive but not in resistant EL4 cells

    International Nuclear Information System (INIS)

    Harrison, J.R.; Lynch, K.R.; Sando, J.J.

    1986-01-01

    Phorbol ester (PE) sensitive EL4 cells are growth-inhibited and produce interleukin 2 (IL2) when treated with PE. Resistant EL4 cells lack both responses. To determine whether the defect in resistant cells occurs pre or post-transcriptionally, an assay for IL2 mRNA was developed using a synthetic oligonucleotide to mouse IL2 as a probe. Total RNA (15 μg) from cells +/- PE was electrophoresed, blotted onto a cationic nylon membrane, and probed with radiolabeled oligomer. This probe hybridized to a 1.1 kb band in RNA from PE-treated sensitive cells. This RNA was detectable within 3h of PE administration, was clearly visible by 6h, and peaked by 9 to 12h. No bands hybridizing with the IL2 probe were detected in RNA isolated from unstimulated cells or from resistant EL4 cells at any time following PE stimulation. Since levels of the protooncogene c-myc have been shown to decrease in a number of cell lines during differentiation and growth inhibition, total RNA from EL4 cells was probed with a nick-translated plasmid containing the protein coding region of the c-myc gene. In PE sensitive cells, levels of c-myc RNA are markedly reduced by 3h. In a pilot experiment with resistant cells, c-myc levels appeared to remain constant. These results demonstrate that PE induced IL2 mRNA in PE sensitive but not resistant EL4 cells. Sensitive and resistant EL4 cell lines provide a useful model for the investigation of the regulation of gene expression by PE

  13. The double-stranded RNA-activated protein kinase mediates viral-induced encephalitis

    International Nuclear Information System (INIS)

    Scheuner, Donalyn; Gromeier, Matthias; Davies, Monique V.; Dorner, Andrew J.; Song Benbo; Patel, Rupali V.; Wimmer, Eckard J.; McLendon, Roger E.; Kaufman, Randal J.

    2003-01-01

    The double-stranded (ds) RNA-activated protein kinase (PKR) plays an important role in control of viral infections and cell growth. We have studied the role of PKR in viral infection in mice that are defective in the PKR signaling pathway. Transgenic mice were derived that constitutively express a trans-dominant-negative kinase-defective mutant PKR under control of the β-actin promoter. The trans-dominant-negative PKR mutant expressing transgenic mice do not have a detectable phenotype, similar to observations with PKR knock-out mice. The requirement for PKR in viral pathogenesis was studied by intracerebral infection of mice with a mouse-adapted poliovirus. Histopathological analysis revealed diffuse encephalomyelitis with severe inflammatory lesions throughout the central nervous system (CNS) in infected wild-type mice. In contrast, histopathological evaluation of virus-injected trans-dominant-negative PKR transgenic mice as well as PKR knock-out mice yielded no signs of tissue damage associated with inflammatory host responses. However, the virus did replicate in both models of PKR-deficient mice at a level equal to that observed in wild-type infected mice. Although the results indicate a clear difference in susceptibility to poliovirus-induced encephalitis, this difference manifests clinically as a slight delay in fatal neuropathy in trans-dominant-negative PKR transgenic and PKR knock-out animals. Our observations support the finding that viral-induced PKR activation may play a significant role in pathogenesis by mediating the host response to viral CNS infection. They support PKR to be an effective target to control tissue damage due to deleterious host responses to viral infection

  14. An Efficient Power Estimation Methodology for Complex RISC Processor-based Platforms

    OpenAIRE

    Rethinagiri , Santhosh Kumar; Ben Atitallah , Rabie; Dekeyser , Jean-Luc; Niar , Smail; Senn , Eric

    2012-01-01

    International audience; In this contribution, we propose an efficient power estima- tion methodology for complex RISC processor-based plat- forms. In this methodology, the Functional Level Power Analysis (FLPA) is used to set up generic power models for the different parts of the system. Then, a simulation framework based on virtual platform is developed to evalu- ate accurately the activities used in the related power mod- els. The combination of the two parts above leads to a het- erogeneou...

  15. Long Non-Coding RNA MEG3 Inhibits Cell Proliferation and Induces Apoptosis in Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Gang Luo

    2015-11-01

    Full Text Available Background/Aims: Long non-coding RNAs (lncRNAs play important roles in diverse biological processes, such as cell growth, apoptosis and migration. Although downregulation of lncRNA maternally expressed gene 3 (MEG3 has been identified in several cancers, little is known about its role in prostate cancer progression. The aim of this study was to detect MEG3 expression in clinical prostate cancer tissues, investigate its biological functions in the development of prostate cancer and the underlying mechanism. Methods: MEG3 expression levels were detected by qRT-PCR in both tumor tissues and adjacent non-tumor tissues from 21 prostate cancer patients. The effects of MEG3 on PC3 and DU145 cells were assessed by MTT assay, colony formation assay, western blot and flow cytometry. Transfected PC3 cells were transplanted into nude mice, and the tumor growth curves were determined. Results: MEG3 decreased significantly in prostate cancer tissues relative to adjacent normal tissues. MEG3 inhibited intrinsic cell survival pathway in vitro and in vivo by reducing the protein expression of Bcl-2, enhancing Bax and activating caspase 3. We further demonstrated that MEG3 inhibited the expression of cell cycle regulatory protein Cyclin D1 and induced cell cycle arrest in G0/G1 phase. Conclusions: Our study presents an important role of MEG3 in the molecular etiology of prostate cancer and implicates the potential application of MEG3 in prostate cancer therapy.

  16. Role of Myofibril-Inducing RNA in cardiac TnT expression in developing Mexican axolotl

    Science.gov (United States)

    Sferrazza, Gian-Franco; Zhang, Chi; Jia, Pingping; Lemanski, Sharon L.; Athauda, Gagani; Stassi, Alyssa; Halager, Kristine; Maier, Jennifer A.; Rueda-de-Leon, Elena; Gupta, Amit; Dube, Syamalima; Huang, Xupei; Prentice, Howard M.; Dube, Dipak K.; Lemanski, Larry F.

    2007-01-01

    The Mexican axolotl, Ambystoma mexicanum, has been a useful animal model to study heart development and cardiac myofibrillogenesis. A naturally-occurring recessive mutant, gene “c”, for cardiac non-function in the Mexican axolotl causes a failure of myofibrillogenesis due to a lack of tropomyosin expression in homozygous mutant (c/c) embryonic hearts.. Myofibril-Inducing RNA (MIR) rescues mutant hearts in vitro by promoting tropomyosin expression and myofibril formation thereafter. We have studied the effect of MIR on the expression of various isoforms of cardiac Troponin-T (cTnT), a component of the thin filament that binds with tropomyosin. Four alternatively spliced cTnT isoforms have been characterized from developing axolotl heart. The expression of various cTnT isoforms in normal, mutant, and mutant hearts corrected with MIR, is evaluated by real-time RT-PCR using isoform specific primer pairs; MIR affects the total transcription as well as the splicing of the cTnT in axolotl heart PMID:17408593

  17. MicroRNA-1185 Induces Endothelial Cell Apoptosis by Targeting UVRAG and KRIT1

    Directory of Open Access Journals (Sweden)

    Haoyuan Deng

    2017-04-01

    Full Text Available Background/Aims: Atherosclerosis is a multifactorial chronic disease and is the main cause of death and impairment in the world. Endothelial injury and apoptosis play a crucial role in the onset and development of atherosclerosis. MicroRNAs (miRNAs have been proven to be involved in the pathogenesis of atherosclerosis. However, studies of the functional role of apoptosis-related miRNAs in the endothelium during atherogenesis are limited. Methods: Cell injury and apoptosis were measured in five types of cells transfected with miR-1185 or co-transfected with miR-1185 and its inhibitor. Bioinformatics analysis and a luciferase reporter assay were used to confirm the targets of miR-1185. The effects of the targets of miR-1185 on endothelial apoptosis were determined using small-interfering RNA. Results: In this study, we first report that miR-1185 significantly promoted apoptosis in endothelial cells but not in vascular smooth muscle cells and macrophages. A mechanistic analysis showed that ultraviolet irradiation resistance-associated gene (UVRAG and krev1 interaction trapped gene 1 (KRIT1, targets of miR-1185, mediated miR-1185-induced endothelial cell apoptosis. Conclusion: The results revealed the impact of miR-1185 on endothelial apoptosis, suggesting that miR-1185 may be a potential target for the prevention and treatment of atherosclerosis.

  18. Performance awareness execution performance of HEP codes on RISC platforms,issues and solutions

    CERN Document Server

    Yaari, R; Yaari, Refael; Jarp, Sverre

    1995-01-01

    The work described in this paper was started during the migration of Aleph's production jobs from the IBM mainframe/CRAY supercomputer to several RISC/Unix workstation platforms. The aim was to understand why Aleph did not obtain the performance on the RISC platforms that was "promised" after a CERN Unit comparison between these RISC platforms and the IBM mainframe. Remedies were also sought. Since the work with the Aleph jobs in turn led to the related task of understanding compilers and their options, the conditions under which the CERN benchmarks (and other benchmarks) were run, kernel routines and frequently used CERNLIB routines, the whole undertaking expanded to try to look at all the factors that influence the performance of High Energy Physics (HEP) jobs in general. Finally, key performance issues were reviewed against the programs of one of the LHC collaborations (Atlas) with the hope that the conclusions would be of long- term interest during the establishment of their simulation, reconstruction and...

  19. Accurate RNA consensus sequencing for high-fidelity detection of transcriptional mutagenesis-induced epimutations.

    Science.gov (United States)

    Reid-Bayliss, Kate S; Loeb, Lawrence A

    2017-08-29

    Transcriptional mutagenesis (TM) due to misincorporation during RNA transcription can result in mutant RNAs, or epimutations, that generate proteins with altered properties. TM has long been hypothesized to play a role in aging, cancer, and viral and bacterial evolution. However, inadequate methodologies have limited progress in elucidating a causal association. We present a high-throughput, highly accurate RNA sequencing method to measure epimutations with single-molecule sensitivity. Accurate RNA consensus sequencing (ARC-seq) uniquely combines RNA barcoding and generation of multiple cDNA copies per RNA molecule to eliminate errors introduced during cDNA synthesis, PCR, and sequencing. The stringency of ARC-seq can be scaled to accommodate the quality of input RNAs. We apply ARC-seq to directly assess transcriptome-wide epimutations resulting from RNA polymerase mutants and oxidative stress.

  20. Bacterial RNA induces myocyte cellular dysfunction through the activation of PKR

    OpenAIRE

    Bleiblo, Farag; Michael, Paul; Brabant, Danielle; Ramana, Chilakamarti V.; Tai, TC; Saleh, Mazen; Parrillo, Joseph E.; Kumar, Anand; Kumar, Aseem

    2012-01-01

    Severe sepsis and the ensuing septic shock are serious life threatening conditions. These diseases are triggered by the host's over exuberant systemic response to the infecting pathogen. Several surveillance mechanisms have evolved to discriminate self from foreign RNA and accordingly trigger effective cellular responses to target the pathogenic threats. The RNA-dependent protein kinase (PKR) is a key component of the cytoplasmic RNA sensors involved in the recognition of viral double-strande...

  1. Technical advances in trigger-induced RNA interference gene silencing in the parasite Entamoeba histolytica.

    Science.gov (United States)

    Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder

    2016-03-01

    Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016

  2. Characterization of the Zika virus induced small RNA response in Aedes aegypti cells.

    Directory of Open Access Journals (Sweden)

    Margus Varjak

    2017-10-01

    Full Text Available RNA interference (RNAi controls arbovirus infections in mosquitoes. Two different RNAi pathways are involved in antiviral responses: the PIWI-interacting RNA (piRNA and exogenous short interfering RNA (exo-siRNA pathways, which are characterized by the production of virus-derived small RNAs of 25-29 and 21 nucleotides, respectively. The exo-siRNA pathway is considered to be the key mosquito antiviral response mechanism. In Aedes aegypti-derived cells, Zika virus (ZIKV-specific siRNAs were produced and loaded into the exo-siRNA pathway effector protein Argonaute 2 (Ago2; although the knockdown of Ago2 did not enhance virus replication. Enhanced ZIKV replication was observed in a Dcr2-knockout cell line suggesting that the exo-siRNA pathway is implicated in the antiviral response. Although ZIKV-specific piRNA-sized small RNAs were detected, these lacked the characteristic piRNA ping-pong signature motif and were bound to Ago3 but not Piwi5 or Piwi6. Silencing of PIWI proteins indicated that the knockdown of Ago3, Piwi5 or Piwi6 did not enhance ZIKV replication and only Piwi4 displayed antiviral activity. We also report that the expression of ZIKV capsid (C protein amplified the replication of a reporter alphavirus; although, unlike yellow fever virus C protein, it does not inhibit the exo-siRNA pathway. Our findings elucidate ZIKV-mosquito RNAi interactions that are important for understanding its spread.

  3. Spliced leader RNA silencing (SLS - a programmed cell death pathway in Trypanosoma brucei that is induced upon ER stress

    Directory of Open Access Journals (Sweden)

    Michaeli Shulamit

    2012-05-01

    Full Text Available Abstract Trypanosoma brucei is the causative agent of African sleeping sickness. The parasite cycles between its insect (procyclic form and mammalian hosts (bloodstream form. Trypanosomes lack conventional transcription regulation, and their genes are transcribed in polycistronic units that are processed by trans-splicing and polyadenylation. In trans-splicing, which is essential for processing of each mRNA, an exon, the spliced leader (SL is added to all mRNAs from a small RNA, the SL RNA. Trypanosomes lack the machinery for the unfolded protein response (UPR, which in other eukaryotes is induced under endoplasmic reticulum (ER stress. Trypanosomes respond to such stress by changing the stability of mRNAs, which are essential for coping with the stress. However, under severe ER stress that is induced by blocking translocation of proteins to the ER, treatment of cells with chemicals that induce misfolding in the ER, or extreme pH, trypanosomes elicit the spliced leader silencing (SLS pathway. In SLS, the transcription of the SL RNA gene is extinguished, and tSNAP42, a specific SL RNA transcription factor, fails to bind to its cognate promoter. SLS leads to complete shut-off of trans-splicing. In this review, I discuss the UPR in mammals and compare it to the ER stress response in T. brucei leading to SLS. I summarize the evidence supporting the notion that SLS is a programmed cell death (PCD pathway that is utilized by the parasites to substitute for the apoptosis observed in higher eukaryotes under prolonged ER stress. I present the hypothesis that SLS evolved to expedite the death process, and rapidly remove from the population unfit parasites that, by elimination via SLS, cause minimal damage to the parasite population.

  4. Gene silencing of HPV16 E6/E7 induced by promoter-targeting siRNA in SiHa cells

    OpenAIRE

    Hong, D; Lu, W; Ye, F; Hu, Y; Xie, X

    2009-01-01

    Background: Recently, transcriptional gene silencing induced by small interfering RNA (siRNA) was found in mammalian and human cells. However, previous studies focused on endogenous genes. Methods: In this study, we designed siRNA targeting the promoter of human papillomavirus 16 E6/E7 and transfected it into the cervical cancer cell line, SiHa. E6 and E7 mRNA and protein expression were detected in cells treated by promoter-targeting siRNA. Futhermore, cellular growth, proliferation, apoptos...

  5. Mycobacterium tuberculosis Transfer RNA Induces IL-12p70 via Synergistic Activation of Pattern Recognition Receptors within a Cell Network.

    Science.gov (United States)

    Keegan, Caroline; Krutzik, Stephan; Schenk, Mirjam; Scumpia, Philip O; Lu, Jing; Pang, Yan Ling Joy; Russell, Brandon S; Lim, Kok Seong; Shell, Scarlet; Prestwich, Erin; Su, Dan; Elashoff, David; Hershberg, Robert M; Bloom, Barry R; Belisle, John T; Fortune, Sarah; Dedon, Peter C; Pellegrini, Matteo; Modlin, Robert L

    2018-05-01

    Upon recognition of a microbial pathogen, the innate and adaptive immune systems are linked to generate a cell-mediated immune response against the foreign invader. The culture filtrate of Mycobacterium tuberculosis contains ligands, such as M. tuberculosis tRNA, that activate the innate immune response and secreted Ags recognized by T cells to drive adaptive immune responses. In this study, bioinformatics analysis of gene-expression profiles derived from human PBMCs treated with distinct microbial ligands identified a mycobacterial tRNA-induced innate immune network resulting in the robust production of IL-12p70, a cytokine required to instruct an adaptive Th1 response for host defense against intracellular bacteria. As validated by functional studies, this pathway contained a feed-forward loop, whereby the early production of IL-18, type I IFNs, and IL-12p70 primed NK cells to respond to IL-18 and produce IFN-γ, enhancing further production of IL-12p70. Mechanistically, tRNA activates TLR3 and TLR8, and this synergistic induction of IL-12p70 was recapitulated by the addition of a specific TLR8 agonist with a TLR3 ligand to PBMCs. These data indicate that M. tuberculosis tRNA activates a gene network involving the integration of multiple innate signals, including types I and II IFNs, as well as distinct cell types to induce IL-12p70. Copyright © 2018 by The American Association of Immunologists, Inc.

  6. MicroRNA-146a modulates human bronchial epithelial cell survival in response to the cytokine-induced apoptosis

    International Nuclear Information System (INIS)

    Liu Xiangde; Nelson, Amy; Wang Xingqi; Kanaji, Nobuhiro; Kim, Miok; Sato, Tadashi; Nakanishi, Masanori; Li Yingji; Sun Jianhong; Michalski, Joel; Patil, Amol; Basma, Hesham; Rennard, Stephen I.

    2009-01-01

    MicroRNA plays an important role in cell differentiation, proliferation and cell death. The current study found that miRNA-146a was up-regulated in human bronchial epithelial cells (HBECs) in response to stimulation by TGF-ss1 plus cytomix (a mixture of IL-1ss, IFN-γ and TNF-α). TGF-ss1 plus cytomix (TCM) induced apoptosis in HBECs (3.4 ± 0.6% of control vs 83.1 ± 4.0% of TCM treated cells, p < 0.01), and this was significantly blocked by the miRNA-146a mimic (8.8 ± 1.5%, p < 0.01). In contrast, a miRNA-146a inhibitor had only a modest effect on cell survival but appeared to augment the induction of epithelial-mesenchymal transition (EMT) in response to the cytokines. The MicroRNA-146a mimic appears to modulate HBEC survival through a mechanism of up-regulating Bcl-XL and STAT3 phosphorylation, and by this mechanism it could contribute to tissue repair and remodeling.

  7. Differences in correlation of mRNA gene expression in mice sensitive and resistant to radiation-induced pulmonary fibrosis

    International Nuclear Information System (INIS)

    Johnston, C.J.; Piedboeuf, B.; Finkelstein, J.N.; Baggs, R.; Rubin, P.

    1995-01-01

    Fibrosis, characterized by the accumulation of collagen, is a late result of thoracic irradiation. The purpose of this study was to determine if extracellular matrix protein and transforming growth factor β mRNA expression are altered late in the course of pulmonary fibrosis after irradiation, and then to determine if these changes differ between two strains of mice which vary in their sensitivity to radiation. Radiation-sensitive (C57BL/6) and radiation-resistant (C3H/HeJ) mice were irradiated with a single dose of 5 or 12.5 Gy to the thorax. Total lung RNA was prepared and immobilized by Northern and slot blotting and hybridized with radiolabeled cDNA probes for collagens I, III and IV, fibronectin, and transforming growth factor β 1 and β 3 . Autoradiographic data were quantified by video densitometry and results normalized to a control probe encoding for glyceralde-hyde-3-phosphate dehydrogenase. Alterations in mRNA abundance were observed in the sensitive mice at all times, while levels in the resistant mice were unaffected until 26 weeks after irradiation. The relationship between extracellular matrix protein per se and increased mRNA abundance suggests that late matrix protein accumulation may be a function of gene expression. Differences in levels of transforming growth factor βmRNA may lead to strain-dependent variation in fibrotic response and may also contribute to the radiation-induced component of pulmonary fibrosis. 32 refs., 5 figs

  8. Nonparametric testing for DNA copy number induced differential mRNA gene expression

    NARCIS (Netherlands)

    van Wieringen, W.N.; van de Wiel, M.A.

    2009-01-01

    The central dogma of molecular biology relates DNA with mRNA. Array CGH measures DNA copy number and gene expression microarrays measure the amount of mRNA. Methods that integrate data from these two platforms may uncover meaningful biological relationships that further our understanding of cancer.

  9. The Caenorhabditis elegans RDE-10/RDE-11 complex regulates RNAi by promoting secondary siRNA amplification.

    Science.gov (United States)

    Zhang, Chi; Montgomery, Taiowa A; Fischer, Sylvia E J; Garcia, Susana M D A; Riedel, Christian G; Fahlgren, Noah; Sullivan, Christopher M; Carrington, James C; Ruvkun, Gary

    2012-05-22

    In nematodes, plants, and fungi, RNAi is remarkably potent and persistent due to the amplification of initial silencing signals by RNA-dependent RNA polymerases (RdRPs). In Caenorhabditis elegans (C. elegans), the interaction between the RNA-induced silencing complex (RISC) loaded with primary small interfering RNAs (siRNAs) and the target messenger RNA (mRNA) leads to the recruitment of RdRPs and synthesis of secondary siRNAs using the target mRNA as the template. The mechanism and genetic requirements for secondary siRNA accumulation are not well understood. From a forward genetic screen for C. elegans genes required for RNAi, we identified rde-10, and through proteomic analysis of RDE-10-interacting proteins, we identified a protein complex containing the new RNAi factor RDE-11, the known RNAi factors RSD-2 and ERGO-1, and other candidate RNAi factors. The RNAi defective genes rde-10 and rde-11 encode a novel protein and a RING-type zinc finger domain protein, respectively. Mutations in rde-10 and rde-11 genes cause dosage-sensitive RNAi deficiencies: these mutants are resistant to low dosage but sensitive to high dosage of double-stranded RNAs. We assessed the roles of rde-10, rde-11, and other dosage-sensitive RNAi-defective genes rsd-2, rsd-6, and haf-6 in both exogenous and endogenous small RNA pathways using high-throughput sequencing and qRT-PCR. These genes are required for the accumulation of secondary siRNAs in both exogenous and endogenous RNAi pathways. The RDE-10/RDE-11 complex is essential for the amplification of RNAi in C. elegans by promoting secondary siRNA accumulation. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Persistent ER stress induces the spliced leader RNA silencing pathway (SLS, leading to programmed cell death in Trypanosoma brucei.

    Directory of Open Access Journals (Sweden)

    Hanoch Goldshmidt

    2010-01-01

    Full Text Available Trypanosomes are parasites that cycle between the insect host (procyclic form and mammalian host (bloodstream form. These parasites lack conventional transcription regulation, including factors that induce the unfolded protein response (UPR. However, they possess a stress response mechanism, the spliced leader RNA silencing (SLS pathway. SLS elicits shut-off of spliced leader RNA (SL RNA transcription by perturbing the binding of the transcription factor tSNAP42 to its cognate promoter, thus eliminating trans-splicing of all mRNAs. Induction of endoplasmic reticulum (ER stress in procyclic trypanosomes elicits changes in the transcriptome similar to those induced by conventional UPR found in other eukaryotes. The mechanism of up-regulation under ER stress is dependent on differential stabilization of mRNAs. The transcriptome changes are accompanied by ER dilation and elevation in the ER chaperone, BiP. Prolonged ER stress induces SLS pathway. RNAi silencing of SEC63, a factor that participates in protein translocation across the ER membrane, or SEC61, the translocation channel, also induces SLS. Silencing of these genes or prolonged ER stress led to programmed cell death (PCD, evident by exposure of phosphatidyl serine, DNA laddering, increase in reactive oxygen species (ROS production, increase in cytoplasmic Ca(2+, and decrease in mitochondrial membrane potential, as well as typical morphological changes observed by transmission electron microscopy (TEM. ER stress response is also induced in the bloodstream form and if the stress persists it leads to SLS. We propose that prolonged ER stress induces SLS, which serves as a unique death pathway, replacing the conventional caspase-mediated PCD observed in higher eukaryotes.

  11. RNA-Mediated cis Regulation in Acinetobacter baumannii Modulates Stress-Induced Phenotypic Variation.

    Science.gov (United States)

    Ching, Carly; Gozzi, Kevin; Heinemann, Björn; Chai, Yunrong; Godoy, Veronica G

    2017-06-01

    In the nosocomial opportunistic pathogen Acinetobacter baumannii , RecA-dependent mutagenesis, which causes antibiotic resistance acquisition, is linked to the DNA damage response (DDR). Notably, unlike the Escherichia coli paradigm, recA and DDR gene expression in A. baumannii is bimodal. Namely, there is phenotypic variation upon DNA damage, which may provide a bet-hedging strategy for survival. Thus, understanding recA gene regulation is key to elucidate the yet unknown DDR regulation in A. baumannii Here, we identify a structured 5' untranslated region (UTR) in the recA transcript which serves as a cis -regulatory element. We show that a predicted stem-loop structure in this 5' UTR affects mRNA half-life and underlies bimodal gene expression and thus phenotypic variation in response to ciprofloxacin treatment. We furthermore show that the stem-loop structure of the recA 5' UTR influences intracellular RecA protein levels and, in vivo , impairing the formation of the stem-loop structure of the recA 5' UTR lowers cell survival of UV treatment and decreases rifampin resistance acquisition from DNA damage-induced mutagenesis. We hypothesize that the 5' UTR allows for stable recA transcripts during stress, including antibiotic treatment, enabling cells to maintain suitable RecA levels for survival. This innovative strategy to regulate the DDR in A. baumannii may contribute to its success as a pathogen. IMPORTANCE Acinetobacter baumannii is an opportunistic pathogen quickly gaining antibiotic resistances. Mutagenesis and antibiotic resistance acquisition are linked to the DNA damage response (DDR). However, how the DDR is regulated in A. baumannii remains unknown, since unlike most bacteria, A. baumannii does not follow the regulation of the Escherichia coli paradigm. In this study, we have started to uncover the mechanisms regulating the novel A. baumannii DDR. We have found that a cis -acting 5' UTR regulates recA transcript stability, RecA protein levels, and DNA

  12. Lectin-induced agglutination method of urinary exosomes isolation followed by mi-RNA analysis: Application for prostate cancer diagnostic.

    Science.gov (United States)

    Samsonov, Roman; Shtam, Tatiana; Burdakov, Vladimir; Glotov, Andrey; Tsyrlina, Evgenia; Berstein, Lev; Nosov, Alexander; Evtushenko, Vladimir; Filatov, Michael; Malek, Anastasia

    2016-01-01

    Prostate cancer is the most common cancer in men. Prostate-specific antigen has, however, insufficient diagnostic specificity. Novel complementary diagnostic approaches are greatly needed. MiRNAs are small regulatory RNAs which play an important role in tumorogenesis and are being investigated as a cancer biomarker. In addition to their intracellular regulatory functions, miRNAs are secreted into the extracellular space and can be found in various body fluids, including urine. The stability of extracellular miRNAs is defined by association with proteins, lipoprotein particles, and membrane vesicles. Among the known forms of miRNA packaging, tumour-derived exosome-enclosed miRNAs is thought to reflect the vital activity of cancer cells. The assessment of the exosomal fraction of urinary miRNA may present a new and highly specific method for prostate cancer diagnostics; however, this is challenged by the absence of reliable and inexpensive methods for isolation of exosomes. Prostate cancer (PC) cell lines and urine samples collected from 35 PC patients and 35 healthy donors were used in the study. Lectins, phytohemagglutinin, and concanavalin A were used to induce agglutination of exosomes. The efficiency of isolation process was evaluated by AFM and DLS assays. The protein content of isolated exosomes was analysed by western blotting. Exosomal RNA was assayed by automated electrophoresis and expression level of selected miRNAs was evaluated by RT-qPCR. The diagnostic potency of the urinary exosomal miRNA assessment was estimated by the ROC method. The formation of multi-vesicular agglutinates in urine can be induced by incubation with lectin at a final concentration of 2 mg/ml. These agglutinates contain urinary exosomes and may be pelleted by centrifugation with a relatively low G-force. The analysis of PC-related miRNA in urinary exosomes revealed significant up-regulation of miR-574-3p, miR-141-5p, and miR-21-5p associated with PC. Lectin-induced aggregation is a

  13. Spanish validation of the 10-item Connor-Davidson Resilience Scale (CD-RISC 10) with non-professional caregivers.

    Science.gov (United States)

    Blanco, Vanessa; Guisande, María Adelina; Sánchez, María Teresa; Otero, Patricia; Vázquez, Fernando L

    2017-11-08

    Despite the importance of resilience in populations under stress, and the fact that the 10-item version Connor-Davidson Resilience Scale (CD-RISC 10) is the shortest instrument for reliable and valid evaluation of resilience, there are no data on their psychometric properties in non-professional caregivers. The aim of this study was to analyze the psychometric properties and factorial structure of the spanish version of the CD-RISC 10 in non-professional caregivers. Independently trained assessors evaluated resilience, self-esteem, social support, emotional distress and depression in a sample of 294 caregivers (89.8% women, mean age 55.3 years). The internal consistency of CD-RISC 10 was α = .86. A single factor was found that accounted for 44.7% of the total variance. Confirmatory factor analysis corroborated this unifactorial model. The CD-RISC 10 was significantly correlated with the self-esteem (r = .416, p caregivers with depression (sensitivity = 70.0%, specificity = 68.2%). The CD-RISC 10 is a reliable and valid instrument to evaluate resilience in the caregiver population.

  14. Cold-inducible RNA-binding protein mediates cold air inducible airway mucin production through TLR4/NF-κB signaling pathway.

    Science.gov (United States)

    Chen, Lingxiu; Ran, Danhua; Xie, Wenyue; Xu, Qing; Zhou, Xiangdong

    2016-10-01

    Mucus overproduction is an important feature in patients with chronic inflammatory airway diseases and cold air stimulation has been shown to be associated with the severity of these diseases. However, the regulatory mechanisms that mediate excessive mucin production under cold stress remain elusive. Recently, the cold-inducible RNA-binding protein (CIRP) has been shown to be markedly induced after exposure to cold air. In this study, we sought to explore the expression of CIRP within bronchial biopsy specimens, the effect on mucin5AC (MUC5AC) production in chronic inflammatory airway diseases and the potential signaling pathways involved in cold air stimulation process. We found that CIRP protein expression was significantly increased in patients with COPD and in mice treated with cold air. Moreover, cold air stimulation induced MUC5AC expression in wild-type mice but not in CIRP(-/-) mice. In vitro, cold air stress significantly elevated the transcriptional and protein expression levels of MUC5AC in human bronchial epithelial cells. CIRP, toll-like receptor 4 (TLR4) and phosphorylated NF-κB p65 (p-p65) increased significantly in response to cold stress and CIRP siRNA, TLR4 - neutralizing Ab and a specific inhibitor of NF-κB could attenuated cold stress inducible MUC5AC expression. In addition, CIRP siRNA could hindered the expression levels of TLR4 and p-p65 both induced by cold stress. Taken together, these results suggest that airway epithelial cells constitutively express CIRP in vitro and in vivo. CIRP is responsible for cold-inducible MUC5AC expression by activating TLR4/NF-κB signaling pathway. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Dynamic Blue Light-Inducible T7 RNA Polymerases (Opto-T7RNAPs) for Precise Spatiotemporal Gene Expression Control.

    Science.gov (United States)

    Baumschlager, Armin; Aoki, Stephanie K; Khammash, Mustafa

    2017-11-17

    Light has emerged as a control input for biological systems due to its precise spatiotemporal resolution. The limited toolset for light control in bacteria motivated us to develop a light-inducible transcription system that is independent from cellular regulation through the use of an orthogonal RNA polymerase. Here, we present our engineered blue light-responsive T7 RNA polymerases (Opto-T7RNAPs) that show properties such as low leakiness of gene expression in the dark state, high expression strength when induced with blue light, and an inducible range of more than 300-fold. Following optimization of the system to reduce expression variability, we created a variant that returns to the inactive dark state within minutes once the blue light is turned off. This allows for precise dynamic control of gene expression, which is a key aspect for most applications using optogenetic regulation. The regulators, which only require blue light from ordinary light-emitting diodes for induction, were developed and tested in the bacterium Escherichia coli, which is a crucial cell factory for biotechnology due to its fast and inexpensive cultivation and well understood physiology and genetics. Opto-T7RNAP, with minor alterations, should be extendable to other bacterial species as well as eukaryotes such as mammalian cells and yeast in which the T7 RNA polymerase and the light-inducible Vivid regulator have been shown to be functional. We anticipate that our approach will expand the applicability of using light as an inducer for gene expression independent from cellular regulation and allow for a more reliable dynamic control of synthetic and natural gene networks.

  16. Novel targets for sensitizing breast cancer cells to TRAIL-induced apoptosis with siRNA delivery.

    Science.gov (United States)

    Thapa, Bindu; Bahadur Kc, Remant; Uludağ, Hasan

    2018-02-01

    Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) induces apoptosis in variety of cancer cells without affecting most normal cells, which makes it a promising agent for cancer therapy. However, TRAIL therapy is clinically not effective due to resistance induction. To identify novel regulators of TRAIL that can aid in therapy, protein targets whose silencing sensitized breast cancer cells against TRAIL were screened with an siRNA library against 446 human apoptosis-related proteins in MDA-231 cells. Using a cationic lipopolymer (PEI-αLA) for delivery of library members, 16 siRNAs were identified that sensitized the TRAIL-induced death in MDA-231 cells. The siRNAs targeting BCL2L12 and SOD1 were further evaluated based on the novelty and their ability to sensitize TRAIL induced cell death. Silencing both targets sensitized TRAIL-mediated cell death in MDA-231 cells as well as TRAIL resistant breast cancer cells, MCF-7. Combination of TRAIL and siRNA silencing BCL2L12 had no effect in normal human umbilical vein cells and human bone marrow stromal cell. The silencing of BCL2L12 and SOD1 enhanced TRAIL-mediated apoptosis in MDA-231 cells via synergistically activating capsase-3 activity. Hence, here we report siRNAs targeting BCL2L12 and SOD1 as a novel regulator of TRAIL-induced cell death in breast cancer cells, providing a new approach for enhancing TRAIL therapy for breast cancer. The combination of siRNA targeting BCL2L12 and TRAIL can be a highly effective synergistic pair in breast cancer cells with minimal effect on the non-transformed cells. © 2017 UICC.

  17. MicroRNA regulatory networks reflective of polyhexamethylene guanidine phosphate-induced fibrosis in A549 human alveolar adenocarcinoma cells.

    Science.gov (United States)

    Shin, Da Young; Jeong, Mi Ho; Bang, In Jae; Kim, Ha Ryong; Chung, Kyu Hyuck

    2018-05-01

    Polyhexamethylene guanidine phosphate (PHMG-phosphate), an active component of humidifier disinfectant, is suspected to be a major cause of pulmonary fibrosis. Fibrosis, induced by recurrent epithelial damage, is significantly affected by epigenetic regulation, including microRNAs (miRNAs). The aim of this study was to investigate the fibrogenic mechanisms of PHMG-phosphate through the profiling of miRNAs and their target genes. A549 cells were treated with 0.75 μg/mL PHMG-phosphate for 24 and 48 h and miRNA microarray expression analysis was conducted. The putative mRNA targets of the miRNAs were identified and subjected to Gene Ontology analysis. After exposure to PHMG-phosphate for 24 and 48 h, 46 and 33 miRNAs, respectively, showed a significant change in expression over 1.5-fold compared with the control. The integrated analysis of miRNA and mRNA microarray results revealed the putative targets that were prominently enriched were associated with the epithelial-mesenchymal transition (EMT), cell cycle changes, and apoptosis. The dose-dependent induction of EMT by PHMG-phosphate exposure was confirmed by western blot. We identified 13 putative EMT-related targets that may play a role in PHMG-phosphate-induced fibrosis according to the Comparative Toxicogenomic Database. Our findings contribute to the comprehension of the fibrogenic mechanism of PHMG-phosphate and will aid further study on PHMG-phosphate-induced toxicity. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Alteration of BRCA1 expression affects alcohol-induced transcription of RNA Pol III-dependent genes.

    Science.gov (United States)

    Zhong, Qian; Shi, Ganggang; Zhang, Yanmei; Lu, Lei; Levy, Daniel; Zhong, Shuping

    2015-02-01

    Emerging evidence has indicated that alcohol consumption is an established risk factor for breast cancer. Deregulation of RNA polymerase III (Pol III) transcription enhances cellular Pol III gene production, leading to an increase in translational capacity to promote cell transformation and tumor formation. We have reported that alcohol intake increases Pol III gene transcription to promote cell transformation and tumor formation in vitro and in vivo. Studies revealed that tumor suppressors, pRb, p53, PTEN and Maf1 repress the transcription of Pol III genes. BRCA1 is a tumor suppressor and its mutation is tightly related to breast cancer development. However, it is not clear whether BRCA1 expression affects alcohol-induced transcription of Pol III genes. At the present studies, we report that restoring BRCA1 in HCC 1937 cells, which is a BRCA1 deficient cell line, represses Pol III gene transcription. Expressing mutant or truncated BRCA1 in these cells does not affect the ability of repression on Pol III genes. Our analysis has demonstrated that alcohol induces Pol III gene transcription. More importantly, overexpression of BRCA1 in estrogen receptor positive (ER+) breast cancer cells (MCF-7) decreases the induction of tRNA(Leu) and 5S rRNA genes by alcohol, whereas reduction of BRCA1 by its siRNA slightly increases the transcription of the class of genes. This suggests that BRCA1 is associated with alcohol-induced deregulation of Pol III genes. These studies for the first time demonstrate the role of BRCA1 in induction of Pol III genes by alcohol and uncover a novel mechanism of alcohol-associated breast cancer. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome

    Science.gov (United States)

    Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.

    2015-06-01

    The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.

  20. Endurance exercise induces mRNA expression of oxidative enzymes in human skeletal muscle late in recovery

    DEFF Research Database (Denmark)

    Leick, Lotte; Plomgaard, Peter S.; Grønløkke, L.

    2010-01-01

    exercise. To test the hypothesis that mRNA expression of many oxidative enzymes is up-regulated late in recovery (10-24 h) after exercise, male subjects (n=8) performed a 90-min cycling exercise (70% VO(2-max)), with muscle biopsies obtained before exercise (pre), and after 10, 18 and 24 h of recovery....... The mRNA expression of carnitine-palmitoyltransferase (CPT)I, CD36, 3-hydroxyacyl-CoA-dehydrogenase (HAD), cytochrome (Cyt)c, aminolevulinate-delta-synthase (ALAS)1 and GLUT4 was 100-200% higher at 10-24 h of recovery from exercise than in a control trial. Exercise induced a 100-300% increase...... in peroxisome proliferator-activated receptor gamma co-activator (PGC)-1alpha, citrate synthase (CS), CPTI, CD36, HAD and ALAS1 mRNA contents at 10-24 h of recovery relative to before exercise. No protein changes were detected in Cytc, ALAS1 or GLUT4. This shows that mRNA expression of several training...

  1. Nephron segment specific microRNA biomarkers of pre-clinical drug-induced renal toxicity: Opportunities and challenges

    Energy Technology Data Exchange (ETDEWEB)

    Nassirpour, Rounak, E-mail: Rounak.nassirpour@pfizer.com [Drug Safety, Pfizer Worldwide Research and Development, 1 Burtt Rd, Andover, MA 01810 (United States); Ramaiah, Shashi K. [Drug Safety, Pfizer Worldwide Research and Development, 610 Main Street, Cambridge, MA 02139 (United States); Whiteley, Laurence O. [Drug Safety, Pfizer Worldwide Research and Development, 1 Burtt Rd, Andover, MA 01810 (United States)

    2016-12-01

    Drug-induced nephrotoxicity is a common drug development complication for pharmaceutical companies. Sensitive, specific, translatable and non-invasive biomarkers of renal toxicity are urgently needed to diagnose nephron segment specific injury. The currently available gold standard biomarkers for nephrotoxicity are not kidney-specific, lack sensitivity for early detection, and are not suitable for renal damage localization (glomerular vs tubulointerstitial injury). MicroRNAs (miRNAs) are increasingly gaining momentum as promising biomarkers of various organ toxicities, including drug induced renal injury. This is mostly due to their stability in easily accessible biofluids, ease of developing nucleic acids detection compared to protein detection assays, as well as their interspecies translatability. Increasing concordance of miRNA findings by standardizing methodology most suitable for their detection and quantitation, as well as characterization of their expression pattern in a cell type specific manner, will accelerate progress toward validation of these miRNAs as biomarkers in pre-clinical, and clinical settings. This review aims to highlight the current pre-clinical findings surrounding miRNAs as biomarkers in two important segments of the nephron, the glomerulus and tubules. - Highlights: • miRNAs are promising biomarkers of drug-induced kidney injury. • Summarized pre-clinical miRNA biomarkers of drug-induced nephrotoxicity. • Described the strengths and challenges associated with miRNAs as biomarkers.

  2. Circular RNA alterations are involved in resistance to avian leukosis virus subgroup-J-induced tumor formation in chickens.

    Science.gov (United States)

    Zhang, Xinheng; Yan, Yiming; Lei, Xiaoya; Li, Aijun; Zhang, Huanmin; Dai, Zhenkai; Li, Xinjian; Chen, Weiguo; Lin, Wencheng; Chen, Feng; Ma, Jingyun; Xie, Qingmei

    2017-05-23

    Avian leukosis virus subgroup (ALV-J) is an oncogenic neoplasm-inducing retrovirus that causes significant economic losses in the poultry industry. Recent studies have demonstrated circular RNAs (circRNAs) are implicated in pathogenic processes; however, no research has indicated circRNAs are involved in resistance to disease. In this study, over 1800 circRNAs were detected by circRNA sequencing of liver tissues from ALV-J-resistant (n = 3) and ALV-J-susceptible chickens (n = 3). 32 differentially expressed circRNAs were selected for analyzing including 12 upregulated in ALV-J-resistant chickens and 20 upregulated in ALV-J-susceptible chickens, besides, the top five microRNAs (miRNAs) for 12 upregulated circRNAs in ALV-J-resistant chickens were analyzed. Gene ontology and KEGG pathway analyses were performed for miRNA target genes, the predicted genes were mainly involved in immune pathways. This study provides the first evidence that circRNA alterations are involved in resistance to ALV-J-induced tumor formation. We propose circRNAs may help to mediate tumor induction and development in chickens.

  3. A double base change in alternate base pairs induced by ultraviolet irradiation in a glycine transfer RNA gene

    International Nuclear Information System (INIS)

    Coleman, R.D.; Dunst, R.W.; Hill, C.W.; Pennsylvania State Univ., Hershey

    1980-01-01

    The glyUsusub(AGA) mutation affects Escherichia coli tRNAsup(Gly)sub(GGG), changing it to an AGA missense suppressor tRNA. Sequence studies have shown that the mutation involves a double base substitution at the first and third positions of the tRNA anticodon, the result being a change in the anticodon from CCC to UCU. A system has been developed to facilitate the detection of this novel mutation, and we have shown that ultraviolet irradiation and N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) are effective in causing the double base change. A single observation of the mutation occuring spontaneously has been made also. The frequency of MNNG-induced glyUsusub(AGA) mutations is compatible with their being caused by two separate mutagenic events. The frequency of UV-induced glyUsusub(AGA) mutations, however, strongly suggests that the occurence of one base substitution strongly enhances the chance of finding the second substitution at the alternate position. In addition to the double change in the anticodon, the glyUsusub(AGA) tRNA differs from tRNAsup(gly)sub(GGG) in that it bears a modification of the A adjacent to the 3' position of the anticodon. Most likely, this modified base is N-[9-(β-D-ribofuranosyl)-purin-6-ylcarbamoyl] threonine. (orig.) 891 AJ/orig. 892 BRE [de

  4. Development and Transition of the Radiation, Interplanetary Shocks, and Coronal Sources (RISCS) Toolset

    Science.gov (United States)

    Spann, James F.; Zank, G.

    2014-01-01

    We outline a plan to develop and transition a physics based predictive toolset called The Radiation, Interplanetary Shocks, and Coronal Sources (RISCS) to describe the interplanetary energetic particle and radiation environment throughout the inner heliosphere, including at the Earth. To forecast and "nowcast" the radiation environment requires the fusing of three components: 1) the ability to provide probabilities for incipient solar activity; 2) the use of these probabilities and daily coronal and solar wind observations to model the 3D spatial and temporal heliosphere, including magnetic field structure and transients, within 10 Astronomical Units; and 3) the ability to model the acceleration and transport of energetic particles based on current and anticipated coronal and heliospheric conditions. We describe how to address 1) - 3) based on our existing, well developed, and validated codes and models. The goal of RISCS toolset is to provide an operational forecast and "nowcast" capability that will a) predict solar energetic particle (SEP) intensities; b) spectra for protons and heavy ions; c) predict maximum energies and their duration; d) SEP composition; e) cosmic ray intensities, and f) plasma parameters, including shock arrival times, strength and obliquity at any given heliospheric location and time. The toolset would have a 72 hour predicative capability, with associated probabilistic bounds, that would be updated hourly thereafter to improve the predicted event(s) and reduce the associated probability bounds. The RISCS toolset would be highly adaptable and portable, capable of running on a variety of platforms to accommodate various operational needs and requirements. The described transition plan is based on a well established approach developed in the Earth Science discipline that ensures that the customer has a tool that meets their needs

  5. Benchmark Tests on the New IBM RISC System/6000 590 Workstation

    Directory of Open Access Journals (Sweden)

    Harvey J. Wasserman

    1995-01-01

    Full Text Available The results of benchmark tests on the superscalar IBM RISC System/6000 Model 590 are presented. A set of well-characterized Fortran benchmarks spanning a range of computational characteristics was used for the study. The data from the 590 system are compared with those from a single-processor CRAY C90 system as well as with other microprocessor-based systems, such as the Digital Equipment Corporation AXP 3000/500X and the Hewlett-Packard HP/735.

  6. 3' RNA ligase mediated rapid amplification of cDNA ends for validating viroid induced cleavage at the 3' extremity of the host mRNA.

    Science.gov (United States)

    Adkar-Purushothama, Charith Raj; Bru, Pierrick; Perreault, Jean-Pierre

    2017-12-01

    5' RNA ligase-mediated rapid amplification of cDNA ends (5' RLM-RACE) is a widely-accepted method for the validation of direct cleavage of a target gene by a microRNA (miRNA) and viroid-derived small RNA (vd-sRNA). However, this method cannot be used if cleavage takes place in the 3' extremity of the target RNA, as this gives insufficient sequence length to design nested PCR primers for 5' RLM RACE. To overcome this hurdle, we have developed 3' RNA ligase-mediated rapid amplification of cDNA ends (3' RLM RACE). In this method, an oligonucleotide adapter having 5' adenylated and 3' blocked is ligated to the 3' end of the cleaved RNA followed by PCR amplification using gene specific primers. In other words, in 3' RLM RACE, 3' end is mapped using 5' fragment instead of small 3' fragment. The method developed here was verified by examining the bioinformatics predicted and parallel analysis of RNA ends (PARE) proved cleavage sites of chloride channel protein CLC-b-like mRNA in Potato spindle tuber viroid infected tomato plants. The 3' RLM RACE developed in this study has the potential to validate the miRNA and vd-sRNA mediated cleavage of mRNAs at its 3' untranslated region (3' UTR). Copyright © 2017 Elsevier B.V. All rights reserved.

  7. HuD Regulates Coding and Noncoding RNA to Induce APP→Aβ Processing

    Directory of Open Access Journals (Sweden)

    Min-Ju Kang

    2014-06-01

    Full Text Available The primarily neuronal RNA-binding protein HuD is implicated in learning and memory. Here, we report the identification of several HuD target transcripts linked to Alzheimer’s disease (AD pathogenesis. HuD interacted with the 3′ UTRs of APP mRNA (encoding amyloid precursor protein and BACE1 mRNA (encoding β-site APP-cleaving enzyme 1 and increased the half-lives of these mRNAs. HuD also associated with and stabilized the long noncoding (lncRNA BACE1AS, which partly complements BACE1 mRNA and enhances BACE1 expression. Consistent with HuD promoting production of APP and APP-cleaving enzyme, the levels of APP, BACE1, BACE1AS, and Aβ were higher in the brain of HuD-overexpressing mice. Importantly, cortex (superior temporal gyrus from patients with AD displayed significantly higher levels of HuD and, accordingly, elevated APP, BACE1, BACE1AS, and Aβ than did cortical tissue from healthy age-matched individuals. We propose that HuD jointly promotes the production of APP and the cleavage of its amyloidogenic fragment, Aβ.

  8. Estradiol-Induced Transcriptional Regulation of Long Non-Coding RNA, HOTAIR.

    Science.gov (United States)

    Bhan, Arunoday; Mandal, Subhrangsu S

    2016-01-01

    HOTAIR (HOX antisense intergenic RNA) is a 2.2 kb long non-coding RNA (lncRNA), transcribed from the antisense strand of homeobox C (HOXC) gene locus in chromosome 12. HOTAIR acts as a scaffolding lncRNA. It interacts and guides various chromatin-modifying complexes such as PRC2 (polycomb-repressive complex 2) and LSD1 (lysine-specific demethylase 1) to the target gene promoters leading to their gene silencing. Various studies have demonstrated that HOTAIR overexpression is associated with breast cancer. Recent studies from our laboratory demonstrate that HOTAIR is required for viability of breast cancer cells and is transcriptionally regulated by estradiol (E2) in vitro and in vivo. This chapter describes protocols for analysis of the HOTAIR promoter, cloning, transfection and dual luciferase assays, knockdown of protein synthesis by antisense oligonucleotides, and chromatin immunoprecipitation (ChIP) assay. These protocols are useful for studying the estrogen-mediated transcriptional regulation of lncRNA HOTAIR, as well as other protein coding genes and non-coding RNAs.

  9. Bed rest reduces metabolic protein content and abolishes exercise-induced mRNA responses in human skeletal muscle

    DEFF Research Database (Denmark)

    Jørgensen, Stine Ringholm; Biensø, Rasmus S; Kiilerich, Kristian

    2011-01-01

    Background: The aim was to test the hypothesis that one week of bed rest will reduce mitochondrial number and expression and activity of oxidative proteins in human skeletal muscle, but that exercise-induced intracellular signaling as well as mRNA and microRNA (miR) responses are maintained after......-legged knee extensor exercise performed before and after bed rest. Results: Maximal oxygen uptake decreased 5% and exercise endurance decreased non-significantly 25% by bed rest. Bed rest reduced skeletal muscle mitochondrial DNA/nuclear DNA content 15%, hexokinase II and sirtuin 1 protein content ~45%, 3...... bed rest. Research Design and Methods: Twelve young, healthy, male subjects completed 7 days of bed rest with vastus lateralis muscle biopsies taken before and after bed rest. In addition, muscle biopsies were obtained from 6 of the subjects prior to, immediately after and 3h after 45 min one...

  10. LncRNA NEAT1 promotes autophagy in MPTP-induced Parkinson's disease through stabilizing PINK1 protein.

    Science.gov (United States)

    Yan, Wang; Chen, Zhao-Ying; Chen, Jia-Qi; Chen, Hui-Min

    2018-02-19

    Long non-coding RNA nuclear paraspeckle assembly transcript 1 (lncRNA NEAT1) was found to be closely related to the pathological changes in brain and nervous system. However, the role of NEAT1 and its potential mechanism in Parkinson's disease (PD) largely remain uncharacterized. In this study, PD mouse model was established by intraperitoneal injection of MPTP. The numbers of TH + neurons, NEAT1 expression and the level of PINK1, LC3-II, LC3-I protein were assessed in PD mice. SH-SY5Y cells were treated with MPP + as PD cell model. RNA pull-down assay was used to identify the interaction between NEAT1 and PINK1 in vitro. The endogenous expression of NEAT1 was modified by lentiviral vector carrying interference sequence for NEAT1 in vivo. The numbers of TH + neurons significantly decreased in PD mice compared with the control. The expressions of NEAT1, PINK1 protein and LC3-II/LC3-I level were increased by MPTP in vitro and in vivo. Moreover, NEAT1 positively regulated the protein level of PINK1 through inhibition of PINK1 protein degradation. And NEAT1 mediated the effects of MPP + on SH-SY5Y cells through stabilization of PINK1 protein. The results of in vivo experiments revealed that NEAT1 knockdown could effectively suppress MPTP-induced autophagy in vivo that alleviated dopaminergic neuronal injury. LncRNA NEAT1 promoted the MPTP-induced autophagy in PD through stabilization of PINK1 protein. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Hepatitis C virus (HCV) induces formation of stress granules whose proteins regulate HCV RNA replication and virus assembly and egress.

    Science.gov (United States)

    Garaigorta, Urtzi; Heim, Markus H; Boyd, Bryan; Wieland, Stefan; Chisari, Francis V

    2012-10-01

    Stress granules (SGs) are cytoplasmic structures that are induced in response to environmental stress, including viral infections. Here we report that hepatitis C virus (HCV) triggers the appearance of SGs in a PKR- and interferon (IFN)-dependent manner. Moreover, we show an inverse correlation between the presence of stress granules and the induction of IFN-stimulated proteins, i.e., MxA and USP18, in HCV-infected cells despite high-level expression of the corresponding MxA and USP18 mRNAs, suggesting that interferon-stimulated gene translation is inhibited in stress granule-containing HCV-infected cells. Finally, in short hairpin RNA (shRNA) knockdown experiments, we found that the stress granule proteins T-cell-restricted intracellular antigen 1 (TIA-1), TIA1-related protein (TIAR), and RasGAP-SH3 domain binding protein 1 (G3BP1) are required for efficient HCV RNA and protein accumulation at early time points in the infection and that G3BP1 and TIA-1 are required for intracellular and extracellular infectious virus production late in the infection, suggesting that they are required for virus assembly. In contrast, TIAR downregulation decreases extracellular infectious virus titers with little effect on intracellular RNA content or infectivity late in the infection, suggesting that it is required for infectious particle release. Collectively, these results illustrate that HCV exploits the stress granule machinery at least two ways: by inducing the formation of SGs by triggering PKR phosphorylation, thereby downregulating the translation of antiviral interferon-stimulated genes, and by co-opting SG proteins for its replication, assembly, and egress.

  12. Overexpression of Nitrate Reductase in Tobacco Delays Drought-Induced Decreases in Nitrate Reductase Activity and mRNA1

    Science.gov (United States)

    Ferrario-Méry, Sylvie; Valadier, Marie-Hélène; Foyer, Christine H.

    1998-01-01

    Transformed (cauliflower mosaic virus 35S promoter [35S]) tobacco (Nicotiana plumbaginifolia L.) plants constitutively expressing nitrate reductase (NR) and untransformed controls were subjected to drought for 5 d. Drought-induced changes in biomass accumulation and photosynthesis were comparable in both lines of plants. After 4 d of water deprivation, a large increase in the ratio of shoot dry weight to fresh weight was observed, together with a decrease in the rate of photosynthetic CO2 assimilation. Foliar sucrose increased in both lines during water stress, but hexoses increased only in leaves from untransformed controls. Foliar NO3− decreased rapidly in both lines and was halved within 2 d of the onset of water deprivation. Total foliar amino acids decreased in leaves of both lines following water deprivation. After 4 d of water deprivation no NR activity could be detected in leaves of untransformed plants, whereas about 50% of the original activity remained in the leaves of the 35S-NR transformants. NR mRNA was much more stable than NR activity. NR mRNA abundance increased in the leaves of the 35S-NR plants and remained constant in controls for the first 3 d of drought. On the 4th d, however, NR mRNA suddenly decreased in both lines. Rehydration at d 3 caused rapid recovery (within 24 h) of 35S-NR transcripts, but no recovery was observed in the controls. The phosphorylation state of the protein was unchanged by long-term drought. There was a strong correlation between maximal extractable NR activity and ambient photosynthesis in both lines. We conclude that drought first causes increased NR protein turnover and then accelerates NR mRNA turnover. Constitutive NR expression temporarily delayed drought-induced losses in NR activity. 35S-NR expression may therefore allow more rapid recovery of N assimilation following short-term water deficit. PMID:9576799

  13. RNA Interference towards the Potato Psyllid, Bactericera cockerelli, Is Induced in Plants Infected with Recombinant Tobacco mosaic virus (TMV)

    Science.gov (United States)

    Wuriyanghan, Hada; Falk, Bryce W.

    2013-01-01

    The potato/tomato psyllid, Bactericera cockerelli (B. cockerelli), is an important plant pest and the vector of the phloem-limited bacterium Candidatus Liberibacter psyllaurous (solanacearum), which is associated with the zebra chip disease of potatoes. Previously, we reported induction of RNA interference effects in B. cockerelli via in vitro-prepared dsRNA/siRNAs after intrathoracic injection, and after feeding of artificial diets containing these effector RNAs. In order to deliver RNAi effectors via plant hosts and to rapidly identify effective target sequences in plant-feeding B. cockerelli, here we developed a plant virus vector-based in planta system for evaluating candidate sequences. We show that recombinant Tobacco mosaic virus (TMV) containing B. cockerelli sequences can efficiently infect and generate small interfering RNAs in tomato (Solanum lycopersicum), tomatillo (Physalis philadelphica) and tobacco (Nicotiana tabacum) plants, and more importantly delivery of interfering sequences via TMV induces RNAi effects, as measured by actin and V-ATPase mRNA reductions, in B. cockerelli feeding on these plants. RNAi effects were primarily detected in the B. cockerelli guts. In contrast to our results with TMV, recombinant Potato virus X (PVX) and Tobacco rattle virus (TRV) did not give robust infections in all plants and did not induce detectable RNAi effects in B. cockerelli. The greatest RNA interference effects were observed when B. cockerelli nymphs were allowed to feed on leaf discs collected from inoculated or lower expanded leaves from corresponding TMV-infected plants. Tomatillo plants infected with recombinant TMV containing B. cockerelli actin or V-ATPase sequences also showed phenotypic effects resulting in decreased B. cockerelli progeny production as compared to plants infected by recombinant TMV containing GFP. These results showed that RNAi effects can be achieved in plants against the phloem feeder, B. cockerelli, and the TMV-plant system will

  14. Long Non-Coding RNA Malat-1 Is Dispensable during Pressure Overload-Induced Cardiac Remodeling and Failure in Mice.

    Directory of Open Access Journals (Sweden)

    Tim Peters

    Full Text Available Long non-coding RNAs (lncRNAs are a class of RNA molecules with diverse regulatory functions during embryonic development, normal life, and disease in higher organisms. However, research on the role of lncRNAs in cardiovascular diseases and in particular heart failure is still in its infancy. The exceptionally well conserved nuclear lncRNA Metastasis associated in lung adenocarcinoma transcript 1 (Malat-1 is a regulator of mRNA splicing and highly expressed in the heart. Malat-1 modulates hypoxia-induced vessel growth, activates ERK/MAPK signaling, and scavenges the anti-hypertrophic microRNA-133. We therefore hypothesized that Malat-1 may act as regulator of cardiac hypertrophy and failure during cardiac pressure overload induced by thoracic aortic constriction (TAC in mice.Absence of Malat-1 did not affect cardiac hypertrophy upon pressure overload: Heart weight to tibia length ratio significantly increased in WT mice (sham: 5.78±0.55, TAC 9.79±1.82 g/mm; p<0.001 but to a similar extend also in Malat-1 knockout (KO mice (sham: 6.21±1.12, TAC 8.91±1.74 g/mm; p<0.01 with no significant difference between genotypes. As expected, TAC significantly reduced left ventricular fractional shortening in WT (sham: 38.81±6.53%, TAC: 23.14±11.99%; p<0.01 but to a comparable degree also in KO mice (sham: 37.01±4.19%, TAC: 25.98±9.75%; p<0.05. Histological hallmarks of myocardial remodeling, such as cardiomyocyte hypertrophy, increased interstitial fibrosis, reduced capillary density, and immune cell infiltration, did not differ significantly between WT and KO mice after TAC. In line, the absence of Malat-1 did not significantly affect angiotensin II-induced cardiac hypertrophy, dysfunction, and overall remodeling. Above that, pressure overload by TAC significantly induced mRNA levels of the hypertrophy marker genes Nppa, Nppb and Acta1, to a similar extend in both genotypes. Alternative splicing of Ndrg2 after TAC was apparent in WT (isoform ratio

  15. Occupational Toluene Exposure Induces Cytochrome P450 2E1 mRNA Expression in Peripheral Lymphocytes

    Science.gov (United States)

    Mendoza-Cantú, Ania; Castorena-Torres, Fabiola; de León, Mario Bermúdez; Cisneros, Bulmaro; López-Carrillo, Lizbeth; Rojas-García, Aurora E.; Aguilar-Salinas, Alberto; Manno, Maurizio; Albores, Arnulfo

    2006-01-01

    Print workers are exposed to organic solvents, of which the systemic toxicant toluene is a main component. Toluene induces expression of cytochrome P450 2E1 (CYP2E1), an enzyme involved in its own metabolism and that of other protoxicants, including some procarcinogens. Therefore, we investigated the association between toluene exposure and the CYP2E1 response, as assessed by mRNA content in peripheral lymphocytes or the 6-hydroxychlorzoxazone (6OH-CHZ)/chlorzoxazone (CHZ) quotient (known as CHZ metabolic ratio) in plasma, and the role of genotype (5′-flanking region RsaI/PstI polymorphic sites) in 97 male print workers. The geometric mean (GM) of toluene concentration in the air was 52.80 ppm (10–760 ppm); 54% of the study participants were exposed to toluene concentrations that exceeded the maximum permissible exposure level (MPEL). The GM of urinary hippuric acid at the end of a work shift (0.041 g/g creatinine) was elevated relative to that before the shift (0.027 g/g creatinine; p < 0.05). The GM of the CHZ metabolic ratio was 0.33 (0–9.3), with 40% of the subjects having ratios below the GM. However, the average CYP2E1 mRNA level in peripheral lymphocytes was 1.07 (0.30–3.08), and CYP2E1 mRNA levels within subjects correlated with the toluene exposure ratio (environmental toluene concentration:urinary hippuric acid concentration) (p = 0.014). Genotype did not alter the association between the toluene exposure ratio and mRNA content. In summary, with further validation, CYP2E1 mRNA content in peripheral lymphocytes could be a sensitive and noninvasive biomarker for the continuous monitoring of toluene effects in exposed persons. PMID:16581535

  16. Analysis of serum microRNA expression in male workers with occupational noise-induced hearing loss

    Directory of Open Access Journals (Sweden)

    Y.H. Li

    2018-01-01

    Full Text Available Occupational noise-induced hearing loss (ONIHL is a prevalent occupational disorder that impairs auditory function in workers exposed to prolonged noise. However, serum microRNA expression in ONIHL subjects has not yet been studied. We aimed to compare the serum microRNA expression profiles in male workers of ONIHL subjects and controls. MicroRNA microarray analysis revealed that four serum microRNAs were differentially expressed between controls (n=3 and ONIHL subjects (n=3. Among these microRNAs, three were upregulated (hsa-miR-3162-5p, hsa-miR-4484, hsa-miR-1229-5p and one was downregulated (hsa-miR-4652-3p in the ONIHL group (fold change >1.5 and Pbon value <0.05. Real time quantitative PCR was conducted for validation of the microRNA expression. Significantly increased serum levels of miR-1229-5p were found in ONIHL subjects compared to controls (n=10 for each group; P<0.05. A total of 659 (27.0% genes were predicted as the target genes of miR-1229-5p. These genes were involved in various pathways, such as mitogen-activated protein kinase (MAPK signaling pathway. Overexpression of miR-1229-5p dramatically inhibited the luciferase activity of 3′ UTR segment of MAPK1 (P<0.01. Compared to the negative control, HEK293T cells expressing miR-1229-5p mimics showed a significant decline in mRNA levels of MAPK1 (P<0.05. This preliminary study indicated that serum miR-1229-5p was significantly elevated in ONIHL subjects. Increased miR-1229-5p may participate in the pathogenesis of ONIHL through repressing MAPK1 signaling.

  17. Analysis of serum microRNA expression in male workers with occupational noise-induced hearing loss.

    Science.gov (United States)

    Li, Y H; Yang, Y; Yan, Y T; Xu, L W; Ma, H Y; Shao, Y X; Cao, C J; Wu, X; Qi, M J; Wu, Y Y; Chen, R; Hong, Y; Tan, X H; Yang, L

    2018-01-11

    Occupational noise-induced hearing loss (ONIHL) is a prevalent occupational disorder that impairs auditory function in workers exposed to prolonged noise. However, serum microRNA expression in ONIHL subjects has not yet been studied. We aimed to compare the serum microRNA expression profiles in male workers of ONIHL subjects and controls. MicroRNA microarray analysis revealed that four serum microRNAs were differentially expressed between controls (n=3) and ONIHL subjects (n=3). Among these microRNAs, three were upregulated (hsa-miR-3162-5p, hsa-miR-4484, hsa-miR-1229-5p) and one was downregulated (hsa-miR-4652-3p) in the ONIHL group (fold change >1.5 and Pbon value <0.05). Real time quantitative PCR was conducted for validation of the microRNA expression. Significantly increased serum levels of miR-1229-5p were found in ONIHL subjects compared to controls (n=10 for each group; P<0.05). A total of 659 (27.0%) genes were predicted as the target genes of miR-1229-5p. These genes were involved in various pathways, such as mitogen-activated protein kinase (MAPK) signaling pathway. Overexpression of miR-1229-5p dramatically inhibited the luciferase activity of 3' UTR segment of MAPK1 (P<0.01). Compared to the negative control, HEK293T cells expressing miR-1229-5p mimics showed a significant decline in mRNA levels of MAPK1 (P<0.05). This preliminary study indicated that serum miR-1229-5p was significantly elevated in ONIHL subjects. Increased miR-1229-5p may participate in the pathogenesis of ONIHL through repressing MAPK1 signaling.

  18. Small activating RNA induces myogenic differentiation of rat adipose-derived stem cells by upregulating MyoD

    Directory of Open Access Journals (Sweden)

    Chenghe Wang

    2015-08-01

    Full Text Available ABSTRACTPurpose:RNA activation (RNAa is a mechanism of gene activation triggered by promoter-targeted small double stranded RNAs (dsRNAs, also known as small activating RNAs (saRNAs. Myogenic regulatory factor MyoD is regarded as the master activator of myogenic differentiation cascade by binding to enhancer of muscle specific genes. Stress urinary incontinence (SUI is a condition primarily resulted from urethral sphincter deficiency. It is thus expected that by promoting differentiation of adipose-derived stem cells (ADSCs into myoblasts by activating MyoD gene through RNAa may offer benefits to SUI.Materials and Methods:Rats ADSCs were isolated, proliferated in vitro, and identified by flow cytometry. Purified ADSCs were then transfected with a MyoD saRNA or control transfected. Real-time polymerase chain reaction (RT-PCR and western blotting were used to detect MyoD mRNA and protein expression, respectively. Immunocytochemical staining was applied to determine the expression of desmin protein in transfected cells. Cell viability was measured by using CellTiter 96® AQueous One Solution Cell Proliferation Assay kit.Results:Transfection of a MyoD saRNA (dsMyoD into ADSCs significantly induced the expression of MyoD at both the mRNA and protein levels, and inhibited cell proliferation. Desmin protein expression was detected in dsMyoD treated ADSCs 2 weeks later.Conclusion:Our findings show that RNAa mediated overexpression of MyoD can promote transdifferentiation of ADSCs into myoblasts and may help treat stress urinary incontinence (SUI–a condition primarily resulted from urethral sphincter deficiency.

  19. MicroRNA-145 protects cardiomyocytes against hydrogen peroxide (H₂O₂-induced apoptosis through targeting the mitochondria apoptotic pathway.

    Directory of Open Access Journals (Sweden)

    Ruotian Li

    Full Text Available MicroRNAs, a class of small and non-encoding RNAs that transcriptionally or post-transcriptionally modulate the expression of their target genes, has been implicated as critical regulatory molecules in many cardiovascular diseases, including ischemia/reperfusion induced cardiac injury. Here, we report microRNA-145, a tumor suppressor miRNA, can protect cardiomyocytes from hydrogen peroxide H₂O₂-induced apoptosis through targeting the mitochondrial pathway. Quantitative real-time PCR (qPCR demonstrated that the expression of miR-145 in either ischemia/reperfused mice myocardial tissues or H₂O₂-treated neonatal rat ventricle myocytes (NRVMs was markedly down-regulated. Over-expression of miR-145 significantly inhibited the H₂O₂-induced cellular apoptosis, ROS production, mitochondrial structure disruption as well as the activation of key signaling proteins in mitochondrial apoptotic pathway. These protective effects of miR-145 were abrogated by over-expression of Bnip3, an initiation factor of the mitochondrial apoptotic pathway in cardiomyocytes. Finally, we utilized both luciferase reporter assay and western blot analysis to identify Bnip3 as a direct target of miR-145. Our results suggest miR-145 plays an important role in regulating mitochondrial apoptotic pathway in heart challenged with oxidative stress. MiR-145 may represent a potential therapeutic target for treatment of oxidative stress-associated cardiovascular diseases, such as myocardial ischemia/reperfusion injury.

  20. Targeting CCl4 -induced liver fibrosis by RNA interference-mediated inhibition of cyclin E1 in mice.

    Science.gov (United States)

    Bangen, Jörg-Martin; Hammerich, Linda; Sonntag, Roland; Baues, Maike; Haas, Ute; Lambertz, Daniela; Longerich, Thomas; Lammers, Twan; Tacke, Frank; Trautwein, Christian; Liedtke, Christian

    2017-10-01

    Initiation and progression of liver fibrosis requires proliferation and activation of resting hepatic stellate cells (HSCs). Cyclin E1 (CcnE1) is the regulatory subunit of the cyclin-dependent kinase 2 (Cdk2) and controls cell cycle re-entry. We have recently shown that genetic inactivation of CcnE1 prevents activation, proliferation, and survival of HSCs and protects from liver fibrogenesis. The aim of the present study was to translate these findings into preclinical applications using an RNA interference (RNAi)-based approach. CcnE1-siRNA (small interfering RNA) efficiently inhibited CcnE1 gene expression in murine and human HSC cell lines and in primary HSCs, resulting in diminished proliferation and increased cell death. In C57BL/6 wild-type (WT) mice, delivery of stabilized siRNA using a liposome-based carrier targeted approximately 95% of HSCs, 70% of hepatocytes, and 40% of CD45 + cells after single injection. Acute CCl 4 -mediated liver injury in WT mice induced endogenous CcnE1 expression and proliferation of surviving hepatocytes and nonparenchymal cells, including CD45 + leukocytes. Pretreatment with CcnE1-siRNA reverted CcnE1 induction to baseline levels of healthy mice, which was associated with reduced liver injury, diminished proliferation of hepatocytes and leukocytes, and attenuated overall inflammatory response. For induction of liver fibrosis, WT mice were challenged with CCl 4 for 4-6 weeks. Co-treatment with CcnE1-siRNA once a week was sufficient to continuously block CcnE1 expression and cell-cycle activity of hepatocytes and nonparenchymal cells, resulting in significantly ameliorated liver fibrosis and inflammation. Importantly, CcnE1-siRNA also prevented progression of liver fibrosis if applied after onset of chronic liver injury. Therapeutic targeting of CcnE1 in vivo using RNAi is feasible and has high antifibrotic activity. (Hepatology 2017;66:1242-1257). © 2017 by the American Association for the Study of Liver Diseases.

  1. MicroRNA-145 suppresses ROS-induced Ca2+ overload of cardiomyocytes by targeting CaMKIIδ

    International Nuclear Information System (INIS)

    Cha, Min-Ji; Jang, Jin-Kyung; Ham, Onju; Song, Byeong-Wook; Lee, Se-Yeon; Lee, Chang Yeon; Park, Jun-Hee; Lee, Jiyun; Seo, Hyang-Hee; Choi, Eunhyun; Jeon, Woo-min; Hwang, Hye Jin; Shin, Hyun-Taek

    2013-01-01

    Highlights: •CaMKIIδ mediates H 2 O 2 -induced Ca 2+ overload in cardiomyocytes. •miR-145 can inhibit Ca 2+ overload. •A luciferase assay confirms that miR-145 functions as a CaMKIIδ-targeting miRNA. •Overexpression of miR-145 regulates CaMKIIδ-related genes and ameliorates apoptosis. -- Abstract: A change in intracellular free calcium (Ca 2+ ) is a common signaling mechanism of reperfusion-induced cardiomyocyte death. Calcium/calmodulin dependent protein kinase II (CaMKII) is a critical regulator of Ca 2+ signaling and mediates signaling pathways responsible for functions in the heart including hypertrophy, apoptosis, arrhythmia, and heart disease. MicroRNAs (miRNA) are involved in the regulation of cell response, including survival, proliferation, apoptosis, and development. However, the roles of miRNAs in Ca 2+ -mediated apoptosis of cardiomyocytes are uncertain. Here, we determined the potential role of miRNA in the regulation of CaMKII dependent apoptosis and explored its underlying mechanism. To determine the potential roles of miRNAs in H 2 O 2 -mediated Ca 2+ overload, we selected and tested 6 putative miRNAs that targeted CaMKIIδ, and showed that miR-145 represses CaMKIIδ protein expression and Ca 2+ overload. We confirmed CaMKIIδ as a direct downstream target of miR-145. Furthermore, miR-145 regulates Ca 2+ -related signals and ameliorates apoptosis. This study demonstrates that miR-145 regulates reactive oxygen species (ROS)-induced Ca 2+ overload in cardiomyocytes. Thus, miR-145 affects ROS-mediated gene regulation and cellular injury responses

  2. MicroRNA-145 suppresses ROS-induced Ca{sup 2+} overload of cardiomyocytes by targeting CaMKIIδ

    Energy Technology Data Exchange (ETDEWEB)

    Cha, Min-Ji [Cardiovascular Research Institute, Yonsei University College of Medicine, 250 Seongsanno, Seodamun-gu, Seoul 120-752 (Korea, Republic of); Brain Korea 21 Project for Medical Science, Yonsei University College of Medicine, 250 Seongsanno, Seodamun-gu, Seoul 120-752 (Korea, Republic of); Jang, Jin-Kyung [College of Pharmacy, Sookmyung Women’s University, 52 HyoChangWon-Gil, Yongsan-ku, Seoul 140-742 (Korea, Republic of); Ham, Onju; Song, Byeong-Wook; Lee, Se-Yeon [Cardiovascular Research Institute, Yonsei University College of Medicine, 250 Seongsanno, Seodamun-gu, Seoul 120-752 (Korea, Republic of); Brain Korea 21 Project for Medical Science, Yonsei University College of Medicine, 250 Seongsanno, Seodamun-gu, Seoul 120-752 (Korea, Republic of); Lee, Chang Yeon; Park, Jun-Hee [Department of Integrated Omics for Biomedical Sciences, Graduate School, Yonsei University, 50 Yonsei-ro, Seodamun-gu, Seoul 120-759 (Korea, Republic of); Lee, Jiyun; Seo, Hyang-Hee [Cardiovascular Research Institute, Yonsei University College of Medicine, 250 Seongsanno, Seodamun-gu, Seoul 120-752 (Korea, Republic of); Brain Korea 21 Project for Medical Science, Yonsei University College of Medicine, 250 Seongsanno, Seodamun-gu, Seoul 120-752 (Korea, Republic of); Choi, Eunhyun [Severance Integrative Research Institute for Cerebral and Cardiovascular Disease, Yonsei University Health System, 250 Seongsanno, Seodamun-gu, Seoul 120-752 (Korea, Republic of); Jeon, Woo-min [Department of Animal Resource, Sahmyook University, Seoul 139-742 (Korea, Republic of); Hwang, Hye Jin [Cardiovascular Research Institute, Yonsei University College of Medicine, 250 Seongsanno, Seodamun-gu, Seoul 120-752 (Korea, Republic of); Shin, Hyun-Taek [College of Pharmacy, Sookmyung Women’s University, 52 HyoChangWon-Gil, Yongsan-ku, Seoul 140-742 (Korea, Republic of); and others

    2013-06-14

    Highlights: •CaMKIIδ mediates H{sub 2}O{sub 2}-induced Ca{sup 2+} overload in cardiomyocytes. •miR-145 can inhibit Ca{sup 2+} overload. •A luciferase assay confirms that miR-145 functions as a CaMKIIδ-targeting miRNA. •Overexpression of miR-145 regulates CaMKIIδ-related genes and ameliorates apoptosis. -- Abstract: A change in intracellular free calcium (Ca{sup 2+}) is a common signaling mechanism of reperfusion-induced cardiomyocyte death. Calcium/calmodulin dependent protein kinase II (CaMKII) is a critical regulator of Ca{sup 2+} signaling and mediates signaling pathways responsible for functions in the heart including hypertrophy, apoptosis, arrhythmia, and heart disease. MicroRNAs (miRNA) are involved in the regulation of cell response, including survival, proliferation, apoptosis, and development. However, the roles of miRNAs in Ca{sup 2+}-mediated apoptosis of cardiomyocytes are uncertain. Here, we determined the potential role of miRNA in the regulation of CaMKII dependent apoptosis and explored its underlying mechanism. To determine the potential roles of miRNAs in H{sub 2}O{sub 2}-mediated Ca{sup 2+} overload, we selected and tested 6 putative miRNAs that targeted CaMKIIδ, and showed that miR-145 represses CaMKIIδ protein expression and Ca{sup 2+} overload. We confirmed CaMKIIδ as a direct downstream target of miR-145. Furthermore, miR-145 regulates Ca{sup 2+}-related signals and ameliorates apoptosis. This study demonstrates that miR-145 regulates reactive oxygen species (ROS)-induced Ca{sup 2+} overload in cardiomyocytes. Thus, miR-145 affects ROS-mediated gene regulation and cellular injury responses.

  3. Urothelial carcinoma associated 1 is a hypoxia-inducible factor-1α-targeted long noncoding RNA that enhances hypoxic bladder cancer cell proliferation, migration, and invasion.

    Science.gov (United States)

    Xue, Mei; Li, Xu; Li, Zhengkun; Chen, Wei

    2014-07-01

    Urothelial carcinoma associated 1 (UCA1) has been identified as an oncogenic long noncoding RNA (lncRNA) that is involved in bladder cancer progression and acts as a diagnostic biomarker for bladder carcinoma. Here, we studied the expression and function of lncRNA-UCA1 in the hypoxic microenvironment of bladder cancer. The expression and transcriptional activity of lncRNA-UCA1 were measured by quantitative real-time polymerase chain reaction and luciferase assays. Cell proliferation and apoptosis were evaluated by MTT assays and flow cytometry. Cell migration and invasion were detected by wound healing, migration, and invasion assays. The binding of hypoxia-inducible factor-1α (HIF-1α) to hypoxia response elements (HREs) in the lncRNA-UCA1 promoter was confirmed by electrophoretic mobility shift assay and chromatin immunoprecipitation. HRE mutations were generated by using a site-directed mutagenesis kit, and HIF-1α knockdown was mediated by small interfering RNA. The effect of HIF-1α inhibition by YC-1 on lncRNA-UCA1 expression was also examined. LncRNA-UCA1 was upregulated by hypoxia in bladder cancer cells. Under hypoxic conditions, lncRNA-UCA1 upregulation increased cell proliferation, migration, and invasion and inhibited apoptosis. The underlying mechanism of hypoxia-upregulated lncRNA-UCA1 expression was that HIF-1α specifically bound to HREs in the lncRNA-UCA1 promoter. Furthermore, HIF-1α knockdown or inhibition could prevent lncRNA-UCA1 upregulation under hypoxia. These findings revealed the mechanism of lncRNA-UCA1 upregulation in hypoxic bladder cancer cells and suggested that effective blocking of lncRNA-UCA1 expression in the hypoxic microenvironment of bladder cancer could be a novel therapeutic strategy.

  4. Tumor-specific RNA interference targeting Pokemon suppresses tumor growth and induces apoptosis in prostate cancer.

    Science.gov (United States)

    Li, Yining; Xu, Shuxiong; Wang, Xiangwei; Shi, Hua; Sun, Zhaolin; Yang, Zhao

    2013-02-01

    To explore the exact mechanism of Pokemon in prostate cancer. Pokemon is a member of the POK family of transcriptional repressors. Its main function is suppression of the p14ARF (alternate reading frame) tumor suppressor gene. Although Pokemon expression has been found to be increased in various types of lymphoma, the exact mechanism of the gene in prostate cancer is not clear. In the present study, prostate cancer cells were transfected with the specific short hairpin ribonucleic acid (RNA) expression vector targeting Pokemon. The expression of Pokemon messenger RNA and its protein was detected by semiquantitative reverse transcriptase-polymerase chain reaction and Western blotting, respectively. The cell growth and cell apoptosis were also examined using the methyl thiazolyl tetrazolium assay and flow cytometry. The results demonstrated that specific RNA interference (RNAi) could decrease the expression levels of Pokemon gene messenger RNA and protein in prostate cancer cells. In addition, that specific RNAi significantly inhibited the cell proliferation and increased the apoptotic rate. In vivo experiments showed that specific RNAi inhibited the tumorigenicity of prostate cancer cells and significantly suppressed tumor growth. Therefore, an RNAi-targeted Pokemon gene strategy could be a potential approach to prostate cancer therapy. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. A survey of small RNA population during FR-induced apical hook opening

    Directory of Open Access Journals (Sweden)

    Ying eLi

    2014-04-01

    Full Text Available Photomorphogenesis is a mechanism employed by plants to regulate their architecture and developmental program in response to light conditions. As they emerge into light for the first time, dark-grown seedlings employ a rapid and finely-controlled photomorphogenic signaling network. Small RNAs have increasingly been revealed to play an important role in regulating multiple aspects of plant development, by modulating the stability of mRNAs. The rapid alteration of the mRNA transcriptome is a known hallmark of the de-etiolation response, thus we investigated the small RNA transcriptome during this process in specific seedling tissues. Here we describe a survey of the small RNA expression profile in four tissues of etiolated soybean seedlings, the cotyledons, hypocotyl and the convex and concave sides of the apical hook. We also investigate how this profile responds to a one-hour far-red light treatment. Our data suggests that miRNAs show a different global profile between these tissues and treatments, suggesting a possible role for tissue- and treatment-specific expression in the differential morphology of the seedling on de-etiolation. Further evidence for the role of miRNA in light-regulated development is given by the de-etiolation responses of a hypomorphic ago1 mutant, which displays reduced and delayed photomorphogenic responses in apical hook and cotyledon angle to far-red light.

  6. Generation of human induced pluripotent stem cells using non-synthetic mRNA

    Directory of Open Access Journals (Sweden)

    L. Rohani

    2016-05-01

    Reprogramming with non-synthetic mRNA holds great promise for safe generation of iPSCs of human origin. Using the protocols described herein we hope to make this method more accessible to other groups as a fast, inexpensive, and non-viral reprogramming approach.

  7. Iron induced RNA-oxidation in the general population and in mouse tissue

    DEFF Research Database (Denmark)

    Cejvanovic, Vanja; Kjær, Laura Kofoed; Bergholdt, Helle Kirstine Mørup

    2018-01-01

    Iron promotes formation of hydroxyl radicals by the Fenton reaction, subsequently leading to potential oxidatively generated damage of nucleic acids. Oxidatively generated damage to RNA, measured as 8-oxo-7,8-dihydroguanosine (8-oxoGuo) in urine, is increased in patients with genetic iron overloa...

  8. Polo-like kinase 1 siRNA-607 induces mitotic arrest and apoptosis in ...

    African Journals Online (AJOL)

    Polo-like kinase (Plk) 1 is overexpressed in many human malignancies including nasopharyngeal carcinoma, indicating its potential as a therapeutic target. Recently, using a simple cellular morphologybased strategy, we have identified several novel effective siRNAs against Plk1 including Plk1 siRNA- 607. In this study, we ...

  9. Environmental cues induce a long noncoding RNA-dependent remodeling of the nucleolus.

    Science.gov (United States)

    Jacob, Mathieu D; Audas, Timothy E; Uniacke, James; Trinkle-Mulcahy, Laura; Lee, Stephen

    2013-09-01

    The nucleolus is a plurifunctional organelle in which structure and function are intimately linked. Its structural plasticity has long been appreciated, particularly in response to transcriptional inhibition and other cellular stresses, although the mechanism and physiological relevance of these phenomena are unclear. Using MCF-7 and other mammalian cell lines, we describe a structural and functional adaptation of the nucleolus, triggered by heat shock or physiological acidosis, that depends on the expression of ribosomal intergenic spacer long noncoding RNA (IGS lncRNA). At the heart of this process is the de novo formation of a large subnucleolar structure, termed the detention center (DC). The DC is a spatially and dynamically distinct region, characterized by an 8-anilino-1-naphthalenesulfonate-positive hydrophobic signature. Its formation is accompanied by redistribution of nucleolar factors and arrest in ribosomal biogenesis. Silencing of regulatory IGS lncRNA prevents the creation of this structure and allows the nucleolus to retain its tripartite organization and transcriptional activity. Signal termination causes a decrease in IGS transcript levels and a return to the active nucleolar conformation. We propose that the induction of IGS lncRNA by environmental signals operates as a molecular switch that regulates the structure and function of the nucleolus.

  10. MicroRNA-661 Enhances TRAIL or STS Induced Osteosarcoma Cell Apoptosis by Modulating the Expression of Cytochrome c1

    Directory of Open Access Journals (Sweden)

    Lin Fan

    2017-04-01

    Full Text Available Aim: Osteosarcoma (OS is an aggressive bone malignancy that affects rapidly growing bones and is associated with a poor prognosis. Our previous study showed that cytochrome c1 (CYC1, a subunit of the cytochrome bc1 complex (complex III of the mitochondrial electron chain, is overexpressed in human OS tissues and cell lines and its silencing induces apoptosis in vitro and inhibits tumor growth in vivo. Here, we investigated the mechanism underlying the modulation of CYC1 expression in OS and its role in the resistance of OS to apoptosis. Methods: qRT-PCR, luciferase reporter assay, western blotting, fow cytometry, and animal experiments were performed in this study. Results: MicroRNA (miR-661 was identified as a downregulated miRNA in OS tissues and cells and shown to directly target CYC1. Ectopically expressed miR-661 inhibited OS cell growth, promoted apoptosis, and reduced the activity of mitochondrial complex III. miR-661 overexpression enhanced TRAIL or STS induced apoptosis and promoted the release of cytochrome c into the cytosol, which induced caspase-9 activation, and these effects were abolished by a caspase-3 inhibitor. Overexpression of CYC1 rescued the effects of miR-661 on sensitizing OS cells to TRAIL or STS induced apoptosis, indicating that the antitumor effect of miR-661 is mediated by the downregulation of CYC1. In vivo, miR-661 overexpression sensitized tumors to TRAIL or STS induced apoptosis in a xenograft mouse model, and these effects were attenuated by co-expression of CYC1. Conclusion: Taken together, our results indicate that miR-661 plays a tumor suppressor role in OS mediated by the downregulation of CYC1, suggesting a potential mechanism underlying cell death resistance in OS.

  11. A Real-Time Image Acquisition And Processing System For A RISC-Based Microcomputer

    Science.gov (United States)

    Luckman, Adrian J.; Allinson, Nigel M.

    1989-03-01

    A low cost image acquisition and processing system has been developed for the Acorn Archimedes microcomputer. Using a Reduced Instruction Set Computer (RISC) architecture, the ARM (Acorn Risc Machine) processor provides instruction speeds suitable for image processing applications. The associated improvement in data transfer rate has allowed real-time video image acquisition without the need for frame-store memory external to the microcomputer. The system is comprised of real-time video digitising hardware which interfaces directly to the Archimedes memory, and software to provide an integrated image acquisition and processing environment. The hardware can digitise a video signal at up to 640 samples per video line with programmable parameters such as sampling rate and gain. Software support includes a work environment for image capture and processing with pixel, neighbourhood and global operators. A friendly user interface is provided with the help of the Archimedes Operating System WIMP (Windows, Icons, Mouse and Pointer) Manager. Windows provide a convenient way of handling images on the screen and program control is directed mostly by pop-up menus.

  12. Silencing of the HER2/neu Gene by siRNA Inhibits Proliferation and Induces Apoptosis in HER2/neu-Overexpressing Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Timo Faltus

    2004-11-01

    Full Text Available In eukaryotes, double-stranded (ds RNA induces sequence-specific inhibition of gene expression referred to as RNA interference (RNAi. We exploited RNAi to define the role of HER2/neu in the neoplastic proliferation of human breast cancer cells. We transfected SK-BR-3, BT-474, MCF-7, and MDA-MB-468 breast cancer cells with short interfering RNA (siRNA targeted against human HER2/neu and analyzed the specific inhibition of HER2/neu expression by Northern and Western blots. Transfection with HER2/neu-specific siRNA resulted in a sequence-specific decrease in HER2/neu mRNA and protein levels. Moreover, transfection with HER2/neu siRNA caused cell cycle arrest at G0/G1 in the breast cancer cell lines SKBR-3 and BT-474, consistent with a powerful RNA silencing effect. siRNA treatment resulted in an antiproliferative and apoptotic response in cells overexpressing HER2/neu, but had no influence in cells with almost no expression of HER2/neu proteins like MDA-MB-468 cells. These data indicate that HER2/neu function is essential for the proliferation of HER2/neuoverexpressing breast cancer cells. Our observations suggest that siRNA targeted against human HER2/neu may be valuable tools as anti proliferative agents that display activity against neoplastic cells at very low doses.

  13. MicroRNA-16 Modulates HuR Regulation of Cyclin E1 in Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Xun Guo

    2015-03-01

    Full Text Available RNA binding protein (RBPs and microRNAs (miRNAs or miRs are post-transcriptional regulators of gene expression that are implicated in development of cancers. Although their individual roles have been studied, the crosstalk between RBPs and miRNAs is under intense investigation. Here, we show that in breast cancer cells, cyclin E1 upregulation by the RBP HuR is through specific binding to regions in the cyclin E1 mRNA 3' untranslated region (3'UTR containing U-rich elements. Similarly, miR-16 represses cyclin E1, dependent on its cognate binding sites in the cyclin E1 3'UTR. Evidence in the literature indicates that HuR can regulate miRNA expression and recruit or dissociate RNA-induced silencing complexes (RISC. Despite this, miR-16 and HuR do not affect the other’s expression level or binding to the cyclin E1 3'UTR. While HuR overexpression partially blocks miR-16 repression of a reporter mRNA containing the cyclin E1 3'UTR, it does not block miR-16 repression of endogenous cyclin E1 mRNA. In contrast, miR-16 blocks HuR-mediated upregulation of cyclin E1. Overall our results suggest that miR-16 can override HuR upregulation of cyclin E1 without affecting HuR expression or association with the cyclin E1 mRNA.

  14. MicroRNA-365 in macrophages regulates Mycobacterium tuberculosis-induced active pulmonary tuberculosis via interleukin-6.

    Science.gov (United States)

    Song, Qingzhang; Li, Hui; Shao, Hua; Li, Chunling; Lu, Xiao

    2015-01-01

    The present study is to investigate the relationship between microRNA (miR)-365 expression and the levels of interleukin (IL)-6 mRNA and protein in patients with active tuberculosis. From June 2011 to June 2014, 48 patients with active pulmonary tuberculosis induced by Mycobacterium tuberculosis were included in the study. In addition, 23 healthy subjects were enrolled as control. Macrophages were collected by pulmonary alveolus lavage. In addition, serum and mononuclear cells were isolated from peripheral blood. The levels of miR-365 and IL-6 in macrophages, mononuclear cells and serum were determined using quantitative real-time polymerase chain reaction. The protein expression of IL-6 in macrophages and mononuclear cells was measured using Western blotting, while that in serum was detected by enzyme-linked immunoabsorbent assay. Expression of IL-6 mRNA and protein was significantly enhanced in patients with active pulmonary tuberculosis. Increase of IL-6 protein concentration in serum was probably due to the release of IL-6 protein from mononuclear cells in the blood. In addition, miR-365 levels were significantly lowered in patients with active pulmonary tuberculosis. Up-regulated IL-6 expression in macrophages, mononuclear cells and serum in patients with active pulmonary tuberculosis is related to the down-regulation of miR-365, suggesting that miR-365 may regulate the occurrence and immune responses of active pulmonary tuberculosis via IL-6.

  15. Small RNA sequence analysis of adenovirus VA RNA-derived miRNAs reveals an unexpected serotype-specific difference in structure and abundance.

    Directory of Open Access Journals (Sweden)

    Wael Kamel

    Full Text Available Human adenoviruses (HAds encode for one or two highly abundant virus-associated RNAs, designated VA RNAI and VA RNAII, which fold into stable hairpin structures resembling miRNA precursors. Here we show that the terminal stem of the VA RNAs originating from Ad4, Ad5, Ad11 and Ad37, all undergo Dicer dependent processing into virus-specific miRNAs (so-called mivaRNAs. We further show that the mivaRNA duplex is subjected to a highly asymmetric RISC loading with the 3'-strand from all VA RNAs being the favored strand, except for the Ad37 VA RNAII, where the 5'-mivaRNAII strand was preferentially assembled into RISC. Although the mivaRNA seed sequences are not fully conserved between the HAds a bioinformatics prediction approach suggests that a large fraction of the VA RNAII-, but not the VA RNAI-derived mivaRNAs still are able to target the same cellular genes. Using small RNA deep sequencing we demonstrate that the Dicer processing event in the terminal stem of the VA RNAs is not unique and generates 3'-mivaRNAs with a slight variation of the position of the 5' terminal nucleotide in the RISC loaded guide strand. Also, we show that all analyzed VA RNAs, except Ad37 VA RNAI and Ad5 VA RNAII, utilize an alternative upstream A start site in addition to the classical +1 G start site. Further, the 5'-mivaRNAs with an A start appears to be preferentially incorporated into RISC. Although the majority of mivaRNA research has been done using Ad5 as the model system our analysis demonstrates that the mivaRNAs expressed in Ad11- and Ad37-infected cells are the most abundant mivaRNAs associated with Ago2-containing RISC. Collectively, our results show an unexpected variability in Dicer processing of the VA RNAs and a serotype-specific loading of mivaRNAs into Ago2-based RISC.

  16. [miRNA profile of the human dental pulp cells during odontoblast differentiation induced by BMP-2].

    Science.gov (United States)

    Bao, Li-Rong; Zhao, Wen-Qing; Lin, Tian; Lu, Yan-Ling; Wu, Yu

    2017-10-01

    To screen and verify the differentially expressed microRNAs (miRNAs) during the differentiation of human dental pulp cells (hDPCs) to odontoblasts induced by BMP-2. The isolated hDPCs were cultured in vitro and induced by BMP-2. The levels of ALP, DMP-1 and DSPP were quantified by quantitative real-time polymerase chain reaction (qRT-PCR). The potential characteristics of hDPCs were investigated by miRNA microarray and highly expressed miRNAs were selected with bio-information software for predicting target genes and their biological functions. Then the results were validated using qRT-PCR analysis for the selected miRNAs. Statistical analysis was performed using SPSS 18.0 software package. The expression of ALP, DSPP, and DMP-1 showed significantly higher levels in BMP-2 induced groups compared to the control group(Pfunction(33%), while the function of other 0.2% genes remained unknown. This study identified differential expression of miRNAs in BMP-2-induced odontoblastic differentiation of hDPCs, thus contributing to further investigations of regulatory mechanisms and biological effect of target genes in BMP-2-induced odontoblastic differentiation of hDPCs.

  17. Candidate gene identification of ovulation-inducing genes by RNA sequencing with an in vivo assay in zebrafish.

    Directory of Open Access Journals (Sweden)

    Wanlada Klangnurak

    Full Text Available We previously reported the microarray-based selection of three ovulation-related genes in zebrafish. We used a different selection method in this study, RNA sequencing analysis. An additional eight up-regulated candidates were found as specifically up-regulated genes in ovulation-induced samples. Changes in gene expression were confirmed by qPCR analysis. Furthermore, up-regulation prior to ovulation during natural spawning was verified in samples from natural pairing. Gene knock-out zebrafish strains of one of the candidates, the starmaker gene (stm, were established by CRISPR genome editing techniques. Unexpectedly, homozygous mutants were fertile and could spawn eggs. However, a high percentage of unfertilized eggs and abnormal embryos were produced from these homozygous females. The results suggest that the stm gene is necessary for fertilization. In this study, we selected additional ovulation-inducing candidate genes, and a novel function of the stm gene was investigated.

  18. siRNA targeting PLK-1 induces apoptosis of synoviocytes in rheumatoid arthritis

    International Nuclear Information System (INIS)

    Wada, Makoto; Kawahito, Yutaka; Kimura, Shinya; Kohno, Masataka; Ishino, Hidetaka; Kimura, Mizuho; Omoto, Atsushi; Yamamoto, Aihiro; Hamaguchi, Masahide; Tsubouchi, Yasunori; Tokunaga, Daisaku; Hojo, Tatsuya; Ashihara, Eishi; Maekawa, Taira; Yoshikawa, Toshikazu

    2007-01-01

    Polo-like kinase-1 (PLK-1) is a member of the PLK family and participates in the control of cell mitosis. Here, we show that immunoreactive PLK-1 is strongly expressed in synoviocytes and some infiltrative mononuclear cells in synovial tissues from patients with rheumatoid arthritis (RA), while patients with osteoarthritis and injury show little or no expression of PLK-1 in synovial tissues. Western blot analysis shows that PLK is expressed and its expression is enhanced by IL-1β in RA synoviocytes. IL-1β also enhanced the cell growth of RA synoviocytes. Moreover, siRNA targeted against PLK-1 significantly decreases the expression of PLK-1 of RA synoviocytes stimulated by IL-1β and suppresses the proliferation of these synoviocytes through apoptosis. These findings suggest that PLK-1 plays a critical role in the proliferation of RA synoviocytes leading to bone destruction, and siRNA against PLK-1 is potentially useful for the treatment of RA

  19. Long Non-Coding RNA MALAT1 Mediates Transforming Growth Factor Beta1-Induced Epithelial-Mesenchymal Transition of Retinal Pigment Epithelial Cells.

    Directory of Open Access Journals (Sweden)

    Shuai Yang

    Full Text Available To study the role of long non-coding RNA (lncRNA MALAT1 in transforming growth factor beta 1 (TGF-β1-induced epithelial-mesenchymal transition (EMT of retinal pigment epithelial (RPE cells.ARPE-19 cells were cultured and exposed to TGF-β1. The EMT of APRE-19 cells is confirmed by morphological change, as well as the increased expression of alpha-smooth muscle actin (αSMA and fibronectin, and the down-regulation of E-cadherin and Zona occludin-1(ZO-1 at both mRNA and protein levels. The expression of lncRNA MALAT1 in RPE cells were detected by quantitative real-time PCR. Knockdown of MALAT1 was achieved by transfecting a small interfering RNA (SiRNA. The effect of inhibition of MALAT1 on EMT, migration, proliferation, and TGFβ signalings were observed. MALAT1 expression was also detected in primary RPE cells incubated with proliferative vitreoretinopathy (PVR vitreous samples.The expression of MALAT1 is significantly increased in RPE cells incubated with TGFβ1. MALAT1 silencing attenuates TGFβ1-induced EMT, migration, and proliferation of RPE cells, at least partially through activating Smad2/3 signaling. MALAT1 is also significantly increased in primary RPE cells incubated with PVR vitreous samples.LncRNA MALAT1 is involved in TGFβ1-induced EMT of human RPE cells and provides new understandings for the pathogenesis of PVR.

  20. Transitive RNA silencing signals induce cytosine methylation of a transgenic but not an endogenous target

    Czech Academy of Sciences Publication Activity Database

    Vermeersch, L.; De Winne, N.; Nolf, J.; Bleys, A.; Kovařík, Aleš; Depicker, A.

    2013-01-01

    Roč. 74, č. 5 (2013), s. 867-879 ISSN 0960-7412 R&D Projects: GA ČR GBP501/12/G090 Institutional research plan: CEZ:AV0Z50040702 Institutional support: RVO:68081707 Keywords : DIRECTED DNA METHYLATION * POTATO-VIRUS-X * DOUBLE-STRANDED-RNA Subject RIV: BO - Biophysics Impact factor: 6.815, year: 2013

  1. The hormone response element mimic sequence of GAS5 lncRNA is sufficient to induce apoptosis in breast cancer cells

    Science.gov (United States)

    Pickard, Mark R.; Williams, Gwyn T.

    2016-01-01

    Growth arrest-specific 5 (GAS5) lncRNA promotes apoptosis, and its expression is down-regulated in breast cancer. GAS5 lncRNA is a decoy of glucocorticoid/related receptors; a stem-loop sequence constitutes the GAS5 hormone response element mimic (HREM), which is essential for the regulation of breast cancer cell apoptosis. This preclinical study aimed to determine if the GAS5 HREM sequence alone promotes the apoptosis of breast cancer cells. Nucleofection of hormone-sensitive and –insensitive breast cancer cell lines with a GAS5 HREM DNA oligonucleotide increased both basal and ultraviolet-C-induced apoptosis, and decreased culture viability and clonogenic growth, similar to GAS5 lncRNA. The HREM oligonucleotide demonstrated similar sequence specificity to the native HREM for its functional activity and had no effect on endogenous GAS5 lncRNA levels. Certain chemically modified HREM oligonucleotides, notably DNA and RNA phosphorothioates, retained pro-apoptotic. activity. Crucially the HREM oligonucleotide could overcome apoptosis resistance secondary to deficient endogenous GAS5 lncRNA levels. Thus, the GAS5 lncRNA HREM sequence alone is sufficient to induce apoptosis in breast cancer cells, including triple-negative breast cancer cells. These findings further suggest that emerging knowledge of structure/function relationships in the field of lncRNA biology can be exploited for the development of entirely novel, oligonucleotide mimic-based, cancer therapies. PMID:26862727

  2. Constitutive expression of interferon-induced human MxA protein in transgenic tobacco plants does not confer resistance to a variety of RNA viruses

    NARCIS (Netherlands)

    Frese, M.; Prins, M.; Ponten, A.; Goldbach, R.W.; Haller, O.; Zeltz, P.

    2000-01-01

    MxA is a key component in the interferon-induced antiviral defense in humans. After viral infections, MxA is rapidly induced and accumulates in the cytoplasm. The multiplication of many RNA viruses,including all bunyaviruses tested so far, is inhibited by MxA. These findings prompted us to express

  3. PPARalpha siRNA-treated expression profiles uncover the causal sufficiency network for compound-induced liver hypertrophy.

    Directory of Open Access Journals (Sweden)

    Xudong Dai

    2007-03-01

    Full Text Available Uncovering pathways underlying drug-induced toxicity is a fundamental objective in the field of toxicogenomics. Developing mechanism-based toxicity biomarkers requires the identification of such novel pathways and the order of their sufficiency in causing a phenotypic response. Genome-wide RNA interference (RNAi phenotypic screening has emerged as an effective tool in unveiling the genes essential for specific cellular functions and biological activities. However, eliciting the relative contribution of and sufficiency relationships among the genes identified remains challenging. In the rodent, the most widely used animal model in preclinical studies, it is unrealistic to exhaustively examine all potential interactions by RNAi screening. Application of existing computational approaches to infer regulatory networks with biological outcomes in the rodent is limited by the requirements for a large number of targeted permutations. Therefore, we developed a two-step relay method that requires only one targeted perturbation for genome-wide de novo pathway discovery. Using expression profiles in response to small interfering RNAs (siRNAs against the gene for peroxisome proliferator-activated receptor alpha (Ppara, our method unveiled the potential causal sufficiency order network for liver hypertrophy in the rodent. The validity of the inferred 16 causal transcripts or 15 known genes for PPARalpha-induced liver hypertrophy is supported by their ability to predict non-PPARalpha-induced liver hypertrophy with 84% sensitivity and 76% specificity. Simulation shows that the probability of achieving such predictive accuracy without the inferred causal relationship is exceedingly small (p < 0.005. Five of the most sufficient causal genes have been previously disrupted in mouse models; the resulting phenotypic changes in the liver support the inferred causal roles in liver hypertrophy. Our results demonstrate the feasibility of defining pathways mediating drug-induced

  4. Analysis of microRNA Expression Profiles Induced by Yiqifumai Injection in Rats with Chronic Heart Failure

    Directory of Open Access Journals (Sweden)

    Yu Zhao

    2018-02-01

    Full Text Available Background: Yiqifumai Injection (YQFM is clinically used to treat various cardiovascular diseases including chronic heart failure (CHF. The efficacy of YQFM for treating heart failure has been suggested, but the mechanism of action for pharmacological effects of YQFM is unclear.Methods: Echocardiography detection, left ventricular intubation evaluation, histopathology and immunohistochemical examination were performed in CHF rats to evaluate the cardioprotective effect of YQFM. Rat miRNA microarray and bioinformatics analysis were employed to investigate the differentially expressed microRNAs. In vitro models of AngII-induced hypertrophy and t-BHP induced oxidative stress in H9c2 myocardial cells were used to validate the anti-hypertrophy and anti-apoptosis effects of YQFM. Measurement of cell surface area, ATP content and cell viability, Real-time PCR and Western blot were performed.Results: YQFM significantly improved the cardiac function of CHF rats by increasing left ventricular ejection fraction and fractional shortening, decreasing left ventricular internal diameter and enhancing cardiac output. Seven microRNAs which have a reversible regulation by YQFM treatment were found. Among them, miR-21-3p and miR-542-3p are related to myocardial hypertrophy and cell proliferation, respectively and were further verified by RT-PCR. Target gene network was established and potential related signaling pathways were predicted. YQFM could significantly alleviate AngII induced hypertrophy in cellular model. It also significantly increased cell viabilities and ATP content in t-BHP induced apoptotic cell model. Western blot analysis showed that YQFM could increase the phosphorylation of Akt.Conclusion: Our findings provided scientific evidence to uncover the mechanism of action of YQFM on miRNAs regulation against CHF by miRNA expression profile technology. The results indicated that YQFM has a potential effect on alleviate cardiac hypertrophy and apoptosis

  5. Data on cell growth inhibition induced by anti-VEGF siRNA delivered by Stealth liposomes incorporating G2 PAMAM-cholesterol versus Metafectene® as a function of exposure time and siRNA concentration

    Directory of Open Access Journals (Sweden)

    Nasim Golkar

    2016-09-01

    Full Text Available In this data article, carboxyfluorescein-loaded liposomes were prepared and purified from free carboxyfluorescein using gel filtration chromatography in the first part. In the next part, following preparation of anti-VEGF siRNA loaded liposomes incorporating hydrophobically modified G2 PAMAM dendrimer (G2-Chol40% (Golkar et al., 2016 [1], the cell growth inhibition induced by the formulations (siRNA/Metafectene complexes and siRNA loaded liposomes incorporating hydrophobic G2 was evaluated at two exposure times through MTT assay in a breast cancer cell (SKBR-3 and compared by two-way ANOVA. Keywords: Anti-VEGF siRNA, Cell growth inhibition, Polyamidoaminedendrimer, Liposome

  6. Burden to importance ratio as a quantitative measure to validate the RISC-3 SSC in OPTION-2

    International Nuclear Information System (INIS)

    Ha, J. S.; Sung, P. H.

    2004-01-01

    A Risk-Informed Safety Significance Categorization (RISSC) is to categorize structures, systems, or components (SSCs) of a Nuclear Power Plant (NPP) into two or more groups, according to their safety significance using both probabilistic and deterministic insights. Recently, OPTION-2 (which is an emerging risk-informed paradigm) recommends that SSCs should be categorized into four groups according to whether they are safety-related or not as well as their safety significance. With the change of 10 CFR 50, safety-related components which categorized into low safety significant SSC (RISC-3 SSC) can be exempted from the existing conservative requirements. Consequently, as OPTION-2 paradigm is applied, a validation process focused on the RISC-3 SSC is needed to assure the categorization results, because most of existing RISSC methods focused on the categorization of the whole SSCs of NPPs based on importance measures obtained from probabilistic and deterministic insights. In this work, Burden to Importance Ratio (BIR) is utilized as a measure for the validation of RISC-3 SSC in OPTION-2. To demonstrate the usefulness of the proposed approach, the approach is applied to 22 components selected from 512 In-Service Test (IST) components of Ulchin unit 3. The results of the application show that the proposed approach is useful for the validation of RISC-3 SSC in OPTION-2

  7. Changes in microRNA expression during differentiation of embryonic and induced pluripotent stem cells to definitive endoderm.

    Science.gov (United States)

    Francis, Natalie; Moore, Melanie; Asan, Simona G; Rutter, Guy A; Burns, Chris

    2015-01-01

    Pluripotent stem cells, including embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs), have the potential to treat type 1 diabetes through cell replacement therapy. However, the protocols used to generate insulin-expressing cells in vitro frequently result in cells which have an immature phenotype and are functionally restricted. MicroRNAs (miRNAs) are now known to be important in cell fate specification, and a unique miRNA signature characterises pancreatic development at the definitive endoderm stage. Several studies have described differences in miRNA expression between ESCs and iPSCs. Here we have used microarray analysis both to identify miRNAs up- or down-regulated upon endoderm formation, and also miRNAs differentially expressed between ESCs and iPSCs. Several miRNAs fulfilling both these criteria were identified, suggesting that differences in the expression of these miRNAs may affect the ability of pluripotent stem cells to differentiate into definitive endoderm. The expression of these miRNAs was validated by qRT-PCR, and the relationship between one of these miRNAs, miR-151a-5p, and its predicted target gene, SOX17, was investigated by luciferase assay, and suggested an interaction between miR-151a-5p and this key transcription factor. In conclusion, these findings demonstrate a unique miRNA expression pattern for definitive endoderm derived from both embryonic and induced pluripotent stem cells. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. RNA-Seq-based analysis of the physiologic cold shock-induced changes in Moraxella catarrhalis gene expression.

    Directory of Open Access Journals (Sweden)

    Violeta Spaniol

    Full Text Available BACKGROUND: Moraxella catarrhalis, a major nasopharyngeal pathogen of the human respiratory tract, is exposed to rapid downshifts of environmental temperature when humans breathe cold air. The prevalence of pharyngeal colonization and respiratory tract infections caused by M. catarrhalis is greatest in winter. We investigated how M. catarrhalis uses the physiologic exposure to cold air to regulate pivotal survival systems that may contribute to M. catarrhalis virulence. RESULTS: In this study we used the RNA-seq techniques to quantitatively catalogue the transcriptome of M. catarrhalis exposed to a 26 °C cold shock or to continuous growth at 37 °C. Validation of RNA-seq data using quantitative RT-PCR analysis demonstrated the RNA-seq results to be highly reliable. We observed that a 26 °C cold shock induces the expression of genes that in other bacteria have been related to virulence a strong induction was observed for genes involved in high affinity phosphate transport and iron acquisition, indicating that M. catarrhalis makes a better use of both phosphate and iron resources after exposure to cold shock. We detected the induction of genes involved in nitrogen metabolism, as well as several outer membrane proteins, including ompA, m35-like porin and multidrug efflux pump (acrAB indicating that M. catarrhalis remodels its membrane components in response to downshift of temperature. Furthermore, we demonstrate that a 26 °C cold shock enhances the induction of genes encoding the type IV pili that are essential for natural transformation, and increases the genetic competence of M. catarrhalis, which may facilitate the rapid spread and acquisition of novel virulence-associated genes. CONCLUSION: Cold shock at a physiologically relevant temperature of 26 °C induces in M. catarrhalis a complex of adaptive mechanisms that could convey novel pathogenic functions and may contribute to enhanced colonization and virulence.

  9. Insights into the therapeutic potential of hypoxia-inducible factor-1α small interfering RNA in malignant melanoma delivered via folate-decorated cationic liposomes

    Directory of Open Access Journals (Sweden)

    Chen Z

    2016-03-01

    Full Text Available Zhongjian Chen,1,* Tianpeng Zhang,2,* Baojian Wu,2 Xingwang Zhang2 1Department of Pharmaceutics, Shanghai Dermatology Hospital, 2Division of Pharmaceutics, College of Pharmacy, Jinan University, Gangzhou, People’s Republic of China *These authors contributed equally to this work Abstract: Malignant melanoma (MM represents the most dangerous form of skin cancer, and its incidence is expected to rise in the coming time. However, therapy for MM is limited by low topical drug concentration and multidrug resistance. This article aimed to develop folate-decorated cationic liposomes (fc-LPs for hypoxia-inducible factor-1α (HIF-1α small interfering (siRNA delivery, and to evaluate the potential of such siRNA/liposome complexes in MM therapy. HIF-1α siRNA-loaded fc-LPs (siRNA-fc-LPs were prepared by a film hydration method followed by siRNA incubation. Folate decoration of liposomes was achieved by incorporation of folate/oleic acid-diacylated oligochitosans. The resulting siRNA-fc-LPs were 95.3 nm in size with a ζ potential of 2.41 mV. The liposomal vectors exhibited excellent loading capacity and protective effect toward siRNA. The in vitro cell transfection efficiency was almost parallel to the commercially available Lipofectamine™ 2000. Moreover, the anti-melanoma activity of HIF-1α siRNA was significantly enhanced through fc-LPs. Western blot analysis and apoptosis test demonstrated that siRNA-fc-LPs substantially reduced the production of HIF-1α-associated protein and induced the apoptosis of hypoxia-tolerant melanoma cells. Our designed liposomal vectors might be applicable as siRNA delivery vehicle to systemically or topically treat MM. Keywords: malignant melanoma, HIF-1α siRNA, chitosan, cationic liposomes, gene therapy

  10. Hepatitis B virus induces cell proliferation via HBx-induced microRNA-21 in hepatocellular carcinoma by targeting programmed cell death protein4 (PDCD4 and phosphatase and tensin homologue (PTEN.

    Directory of Open Access Journals (Sweden)

    Preeti Damania

    Full Text Available Hepatitis B viral infection-induced hepatocellular carcinoma is one of the major problems in the developing countries. One of the HBV proteins, HBx, modulates the host cell machinery via several mechanisms. In this study we hypothesized that HBV enhances cell proliferation via HBx-induced microRNA-21 in hepatocellular carcinoma. HBx gene was over-expressed, and miRNA-21 expression and cell proliferation were measured in Huh 7 and Hep G2 cells. miRNA-21 was over-expressed in these cells, cell proliferation and the target proteins were analyzed. To confirm the role of miRNA-21 in HBx-induced proliferation, Hep G 2.2.1.5 cells (a cell line that expresses HBV stably were used for miRNA-21 inhibition studies. HBx over-expression enhanced proliferation (3.7- and 4.5-fold increase; n = 3; p<0.01 and miRNA-21 expression (24- and 36-fold increase, normalized with 5S rRNA; p<0.001 in Huh 7 and Hep G2 cells respectively. HBx also resulted in the inhibition of miRNA-21 target proteins, PDCD4 and PTEN. miRNA-21 resulted in a significant increase in proliferation (2- and 2.3-fold increase over control cells; p<0.05 in Huh 7 and Hep G2 cells respectively and decreased target proteins, PDCD4 and PTEN expression. Anti-miR-21 resulted in a significant decrease in proliferation (p<0.05 and increased miRNA-21 target protein expression. We conclude that HBV infection enhances cell proliferation, at least in part, via HBx-induced miRNA-21 expression during hepatocellular carcinoma progression.

  11. MicroRNA-99 family targets AKT/mTOR signaling pathway in dermal wound healing.

    Science.gov (United States)

    Jin, Yi; Tymen, Stéphanie D; Chen, Dan; Fang, Zong Juan; Zhao, Yan; Dragas, Dragan; Dai, Yang; Marucha, Phillip T; Zhou, Xiaofeng

    2013-01-01

    Recent studies suggest that microRNAs play important roles in dermal wound healing and microRNA deregulation has been linked with impaired wound repair. Here, using a mouse experimental wound healing model, we identified a panel of 63 differentially expressed microRNAs during dermal wound healing, including members of miR-99 family (miR-99a, miR-99b, miR-100). We further demonstrated that miR-99 family members regulate cell proliferation, cell migration, and AKT/mTOR signaling. Combined experimental and bioinformatics analyses revealed that miR-99 family members regulate AKT/mTOR signaling by targeting multiple genes, including known target genes (e.g., IGF1R, mTOR) and a new target (AKT1). The effects of miR-99 family members on the expression of IGF1R, mTOR and AKT1 were validated at both the mRNA and protein levels. Two adjacent miR-99 family targeting sites were identified in the 3'-UTR of the AKT1 mRNA. The direct interaction of miR-100 with these targeting sites was confirmed using luciferase reporter assays. The microRNA-100-directed recruitment of AKT1 mRNA to the RNAi-induced silencing complex (RISC) was confirmed by a ribonucleoprotein-IP assay. In summary, we identified a panel of differentially expressed microRNAs which may play important roles in wound healing. We provide evidence that miR-99 family members contribute to wound healing by regulating the AKT/mTOR signaling.

  12. The RDE-10/RDE-11 complex triggers RNAi-induced mRNA degradation by association with target mRNA in C. elegans.

    Science.gov (United States)

    Yang, Huan; Zhang, Ying; Vallandingham, Jim; Li, Hua; Li, Hau; Florens, Laurence; Mak, Ho Yi

    2012-04-15

    The molecular mechanisms for target mRNA degradation in Caenorhabditis elegans undergoing RNAi are not fully understood. Using a combination of genetic, proteomic, and biochemical approaches, we report a divergent RDE-10/RDE-11 complex that is required for RNAi in C. elegans. Genetic analysis indicates that the RDE-10/RDE-11 complex acts in parallel to nuclear RNAi. Association of the complex with target mRNA is dependent on RDE-1 but not RRF-1, suggesting that target mRNA recognition depends on primary but not secondary siRNA. Furthermore, RDE-11 is required for mRNA degradation subsequent to target engagement. Deep sequencing reveals a fivefold decrease in secondary siRNA abundance in rde-10 and rde-11 mutant animals, while primary siRNA and microRNA biogenesis is normal. Therefore, the RDE-10/RDE-11 complex is critical for amplifying the exogenous RNAi response. Our work uncovers an essential output of the RNAi pathway in C. elegans.

  13. Epithelial-mesenchymal transition and cancer stem cells, mediated by a long non-coding RNA, HOTAIR, are involved in cell malignant transformation induced by cigarette smoke extract

    International Nuclear Information System (INIS)

    Liu, Yi; Luo, Fei; Xu, Yuan; Wang, Bairu; Zhao, Yue; Xu, Wenchao; Shi, Le; Lu, Xiaolin; Liu, Qizhan

    2015-01-01

    The incidence of lung diseases, including cancer, caused by cigarette smoke is increasing, but the molecular mechanisms of gene regulation induced by cigarette smoke remain unclear. This report describes a long noncoding RNA (lncRNA) that is induced by cigarette smoke extract (CSE) and experiments utilizing lncRNAs to integrate inflammation with the epithelial-mesenchymal transition (EMT) in human bronchial epithelial (HBE) cells. The present study shows that, induced by CSE, IL-6, a pro-inflammatory cytokine, leads to activation of STAT3, a transcription activator. A ChIP assay determined that the interaction of STAT3 with the promoter regions of HOX transcript antisense RNA (HOTAIR) increased levels of HOTAIR. Blocking of IL-6 with anti-IL-6 antibody, decreasing STAT3, and inhibiting STAT3 activation reduced HOTAIR expression. Moreover, for HBE cells cultured in the presence of HOTAIR siRNA for 24 h, the CSE-induced EMT, formation of cancer stem cells (CSCs), and malignant transformation were reversed. Thus, IL-6, acting on STAT3 signaling, which up-regulates HOTAIR in an autocrine manner, contributes to the EMT and to CSCs induced by CSE. These data define a link between inflammation and EMT, processes involved in the malignant transformation of cells caused by CSE. This link, mediated through lncRNAs, establishes a mechanism for CSE-induced lung carcinogenesis. - Highlights: • STAT3 directly regulates the levels of LncRNA HOTAIR. • LncRNA HOTAIR mediates the link between inflammation and EMT. • LncRNA HOTAIR is involved in the malignant transformation of cells caused by CSE

  14. Overexpression of the long noncoding RNA TUG1 protects against cold-induced injury of mouse livers by inhibiting apoptosis and inflammation.

    Science.gov (United States)

    Su, Song; Liu, Jiang; He, Kai; Zhang, Mengyu; Feng, Chunhong; Peng, Fangyi; Li, Bo; Xia, Xianming

    2016-04-01

    Hepatic injury provoked by cold storage is a major problem affecting liver transplantation, as exposure to cold induces apoptosis in hepatic tissues. Long noncoding RNAs (lncRNAs) are increasingly understood to regulate apoptosis, but the contribution of lncRNAs to cold-induced liver injury remains unknown. Using RNA-seq, we determined the differential lncRNA expression profile in mouse livers after cold storage and found that expression of the lncRNA TUG1 was significantly down-regulated. Overexpression of TUG1 attenuated cold-induced apoptosis in mouse hepatocytes and liver sinusoidal endothelial cells LSECs, in part by blocking mitochondrial apoptosis and endoplasmic reticulum (ER) stress pathways. Moreover, TUG1 attenuated apoptosis, inflammation, and oxidative stress in vivo in livers subjected to cold storage. Overexpression of TUG1 also improved hepatocyte function and prolonged hepatic graft survival rates in mice. These results suggest that the lncRNA TUG1 exerts a protective effect against cold-induced liver damage by inhibiting apoptosis in mice, and suggests a potential role for TUG1 as a target for the prevention of cold-induced liver damage in liver transplantation. RNA-seq data are available from GEO using accession number GSE76609. © 2016 Federation of European Biochemical Societies.

  15. Microglial-derived miRNA let-7 and HMGB1 contribute to ethanol-induced neurotoxicity via TLR7.

    Science.gov (United States)

    Coleman, Leon G; Zou, Jian; Crews, Fulton T

    2017-01-25

    Toll-like receptor (TLR) signaling is emerging as an important component of neurodegeneration. TLR7 senses viral RNA and certain endogenous miRNAs to initiate innate immune responses leading to neurodegeneration. Alcoholism is associated with hippocampal degeneration, with preclinical studies linking ethanol-induced neurodegeneration with central innate immune induction and TLR activation. The endogenous miRNA let-7b binds TLR7 to cause neurodegeneration. TLR7 and other immune markers were assessed in postmortem human hippocampal tissue that was obtained from the New South Wales Tissue Bank. Rat hippocampal-entorhinal cortex (HEC) slice culture was used to assess specific effects of ethanol on TLR7, let-7b, and microvesicles. We report here that hippocampal tissue from postmortem human alcoholic brains shows increased expression of TLR7 and increased microglial activation. Using HEC slice culture, we found that ethanol induces TLR7 and let-7b expression. Ethanol caused TLR7-associated neuroimmune gene induction and initiated the release let-7b in microvesicles (MVs), enhancing TLR7-mediated neurotoxicity. Further, ethanol increased let-7b binding to the danger signaling molecule high mobility group box-1 (HMGB1) in MVs, while reducing let-7 binding to classical chaperone protein argonaute (Ago2). Flow cytometric analysis of MVs from HEC media and analysis of MVs from brain cell culture lines found that microglia were the primary source of let-7b and HMGB1-containing MVs. Our results identify that ethanol induces neuroimmune pathology involving the release of let-7b/HMGB1 complexes in microglia-derived microvesicles. This contributes to hippocampal neurodegeneration and may play a role in the pathology of alcoholism.

  16. MicroRNA-98 rescues proliferation and alleviates ox-LDL-induced apoptosis in HUVECs by targeting LOX-1

    Science.gov (United States)

    Chen, Zhibo; Wang, Mian; He, Qiong; Li, Zilun; Zhao, Yang; Wang, Wenjian; Ma, Jieyi; Li, Yongxin; Chang, Guangqi

    2017-01-01

    Oxidized low-density lipoprotein (ox-LDL) is a major and critical mediator of atherosclerosis, and the underlying mechanism is thought to involve the ox-LDL-induced dysfunction of endothelial cells (ECs). MicroRNAs (miRNAs), which are a group of small non-coding RNA molecules that post-transcriptionally regulate the expression of target genes, have been associated with diverse cellular functions and the pathogenesis of various diseases, including atherosclerosis. miRNA-98 (miR-98) has been demonstrated to be involved in the regulation of cellular apoptosis; however, the role of miR-98 in ox-LDL-induced dysfunction of ECs and atherosclerosis has yet to be elucidated. Therefore, the present study aimed to investigate the role of miR-98 in ox-LDL-induced dysfunction of ECs and the underlying mechanism. It was demonstrated that miR-98 expression was markedly downregulated in ox-LDL-treated human umbilical vein ECs (HUVECs) and that miR-98 promoted the proliferation and alleviated apoptosis of HUVECs exposed to ox-LDL. In addition, the results demonstrated that lectin-like oxidized low-density lipoprotein receptor 1 (LOX-1) was a direct target of miR-98 in HUVECs, as indicated by a luciferase assay. The results of the present study suggested that miR-98 may inhibit the uptake of toxic ox-LDL, maintain HUVEC proliferation and protect HUVECs against apoptosis via the suppression of LOX-1. PMID:28565756

  17. A neuron-specific deletion of the microRNA-processing enzyme DICER induces severe but transient obesity in mice.

    Directory of Open Access Journals (Sweden)

    Géraldine M Mang

    Full Text Available MicroRNAs (miRNAs are small, non-coding RNA molecules that regulate gene expression post-transcriptionally. MiRNAs are implicated in various biological processes associated with obesity, including adipocyte differentiation and lipid metabolism. We used a neuronal-specific inhibition of miRNA maturation in adult mice to study the consequences of miRNA loss on obesity development. Camk2a-CreERT2 (Cre+ and floxed Dicer (Dicerlox/lox mice were crossed to generate tamoxifen-inducible conditional Dicer knockouts (cKO. Vehicle- and/or tamoxifen-injected Cre+;Dicerlox/lox and Cre+;Dicer+/+ served as controls. Four cohorts were used to a measure body composition, b follow food intake and body weight dynamics, c evaluate basal metabolism and effects of food deprivation, and d assess the brain transcriptome consequences of miRNA loss. cKO mice developed severe obesity and gained 18 g extra weight over the 5 weeks following tamoxifen injection, mainly due to increased fat mass. This phenotype was highly reproducible and observed in all 38 cKO mice recorded and in none of the controls, excluding possible effects of tamoxifen or the non-induced transgene. Development of obesity was concomitant with hyperphagia, increased food efficiency, and decreased activity. Surprisingly, after reaching maximum body weight, obese cKO mice spontaneously started losing weight as rapidly as it was gained. Weight loss was accompanied by lowered O2-consumption and respiratory-exchange ratio. Brain transcriptome analyses in obese mice identified several obesity-related pathways (e.g. leptin, somatostatin, and nemo-like kinase signaling, as well as genes involved in feeding and appetite (e.g. Pmch, Neurotensin and in metabolism (e.g. Bmp4, Bmp7, Ptger1, Cox7a1. A gene cluster with anti-correlated expression in the cerebral cortex of post-obese compared to obese mice was enriched for synaptic plasticity pathways. While other studies have identified a role for miRNAs in obesity, we

  18. MicroRNA-target gene responses to lead-induced stress in cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    He, Qiuling; Zhu, Shuijin; Zhang, Baohong

    2014-09-01

    MicroRNAs (miRNAs) play key roles in plant responses to various metal stresses. To investigate the miRNA-mediated plant response to heavy metals, cotton (Gossypium hirsutum L.), the most important fiber crop in the world, was exposed to different concentrations (0, 25, 50, 100, and 200 µM) of lead (Pb) and then the toxicological effects were investigated. The expression patterns of 16 stress-responsive miRNAs and 10 target genes were monitored in cotton leaves and roots by quantitative real-time PCR (qRT-PCR); of these selected genes, several miRNAs and their target genes are involved in root development. The results show a reciprocal regulation of cotton response to lead stress by miRNAs. The characterization of the miRNAs and the associated target genes in response to lead exposure would help in defining the potential roles of miRNAs in plant adaptation to heavy metal stress and further understanding miRNA regulation in response to abiotic stress.

  19. Low cost RISC implementation of intelligent ultra fast charger for Ni-Cd battery

    International Nuclear Information System (INIS)

    Petchjatuporn, Panom; Sirisuk, Phaophak; Khaehintung, Noppadol; Sunat, Khamron; Wicheanchote, Phinyo; Kiranon, Wiwat

    2008-01-01

    This paper presents a low cost reduced instruction set computer (RISC) implementation of an intelligent ultra fast charger for a nickel-cadmium (Ni-Cd) battery. The charger employs a genetic algorithm (GA) trained generalized regression neural network (GRNN) as a key to ultra fast charging while avoiding battery damage. The tradeoff between mean square error (MSE) and the computational burden of the GRNN is addressed. Besides, an efficient technique is proposed for estimation of a radial basis function (RBF) in the GRNN. Hardware realization based upon the techniques is discussed. Experimental results with commercial Ni-Cd batteries reveal that while the proposed charger significantly reduces the charging time, it scarcely deteriorates the battery energy storage capability when compared with the conventional charger

  20. Depressive symptoms, insulin sensitivity and insulin secretion in the RISC cohort study

    DEFF Research Database (Denmark)

    Bot, M; Pouwer, F; De Jonge, P

    2013-01-01

    Sensitivity and Cardiovascular Disease Risk (RISC) study. Presence of significant depressive symptoms was defined as a Center for Epidemiologic Studies Depression Scale (CES-D) score ≥ 16. Standard oral glucose tolerance tests were performed. Insulin sensitivity was assessed with the oral glucose insulin......AIM: This study explored the association of depressive symptoms with indices of insulin sensitivity and insulin secretion in a cohort of non-diabetic men and women aged 30 to 64 years. METHODS: The study population was derived from the 3-year follow-up of the Relationship between Insulin...... sensitivity (OGIS) index. Insulin secretion was estimated using three model-based parameters of insulin secretion (beta-cell glucose sensitivity, the potentiation factor ratio, and beta-cell rate sensitivity). RESULTS: A total of 162 out of 1027 participants (16%) had significant depressive symptoms. Having...

  1. Using a Cray Y-MP as an array processor for a RISC Workstation

    Science.gov (United States)

    Lamaster, Hugh; Rogallo, Sarah J.

    1992-01-01

    As microprocessors increase in power, the economics of centralized computing has changed dramatically. At the beginning of the 1980's, mainframes and super computers were often considered to be cost-effective machines for scalar computing. Today, microprocessor-based RISC (reduced-instruction-set computer) systems have displaced many uses of mainframes and supercomputers. Supercomputers are still cost competitive when processing jobs that require both large memory size and high memory bandwidth. One such application is array processing. Certain numerical operations are appropriate to use in a Remote Procedure Call (RPC)-based environment. Matrix multiplication is an example of an operation that can have a sufficient number of arithmetic operations to amortize the cost of an RPC call. An experiment which demonstrates that matrix multiplication can be executed remotely on a large system to speed the execution over that experienced on a workstation is described.

  2. Low cost RISC implementation of intelligent ultra fast charger for Ni-Cd battery

    Energy Technology Data Exchange (ETDEWEB)

    Petchjatuporn, Panom; Khaehintung, Noppadol [Department of Control and Instrumentation Engineering, Faculty of Engineering, Mahanakorn University of Technology, Bangkok 10530 (Thailand); Sirisuk, Phaophak; Sunat, Khamron [Department of Computer Engineering, Faculty of Engineering, Mahanakorn University of Technology, Bangkok 10530 (Thailand); Wicheanchote, Phinyo [Test Engineering Department, Sanmina-SCI Systems Co. Ltd. (Thailand); Kiranon, Wiwat [Department of Telecommunication Engineering, Faculty of Engineering, King Mongkut' s Institue of Technology, Ladkrabang, Bangkok 10520 (Thailand)

    2008-02-15

    This paper presents a low cost reduced instruction set computer (RISC) implementation of an intelligent ultra fast charger for a nickel-cadmium (Ni-Cd) battery. The charger employs a genetic algorithm (GA) trained generalized regression neural network (GRNN) as a key to ultra fast charging while avoiding battery damage. The tradeoff between mean square error (MSE) and the computational burden of the GRNN is addressed. Besides, an efficient technique is proposed for estimation of a radial basis function (RBF) in the GRNN. Hardware realization based upon the techniques is discussed. Experimental results with commercial Ni-Cd batteries reveal that while the proposed charger significantly reduces the charging time, it scarcely deteriorates the battery energy storage capability when compared with the conventional charger. (author)

  3. Cold-inducible RNA-binding protein through TLR4 signaling induces mitochondrial DNA fragmentation and regulates macrophage cell death after trauma.

    Science.gov (United States)

    Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie

    2017-05-11

    Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mφ) direct trauma-induced inflammation, and Mφ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mφ and the subsequent regulation of Mφ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)-TLR4-MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mφ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mφ. However, autophagy activation also suppressed Mφ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mφ homeostasis in response to trauma.

  4. A complex small RNA repertoire is generated by a plant/fungal-like machinery and effected by a metazoan-like Argonaute in the single-cell human parasite Toxoplasma gondii.

    Directory of Open Access Journals (Sweden)

    Laurence Braun

    2010-05-01

    Full Text Available In RNA silencing, small RNAs produced by the RNase-III Dicer guide Argonaute-like proteins as part of RNA-induced silencing complexes (RISC to regulate gene expression transcriptionally or post-transcriptionally. Here, we have characterized the RNA silencing machinery and exhaustive small RNAome of Toxoplasma gondii, member of the Apicomplexa, a phylum of animal- and human-infecting parasites that cause extensive health and economic damages to human populations worldwide. Remarkably, the small RNA-generating machinery of Toxoplasma is phylogenetically and functionally related to that of plants and fungi, and accounts for an exceptionally diverse array of small RNAs. This array includes conspicuous populations of repeat-associated small interfering RNA (siRNA, which, as in plants, likely generate and maintain heterochromatin at DNA repeats and satellites. Toxoplasma small RNAs also include many microRNAs with clear metazoan-like features whose accumulation is sometimes extremely high and dynamic, an unexpected finding given that Toxoplasma is a unicellular protist. Both plant-like heterochromatic small RNAs and metazoan-like microRNAs bind to a single Argonaute protein, Tg-AGO. Toxoplasma miRNAs co-sediment with polyribosomes, and thus, are likely to act as translational regulators, consistent with the lack of catalytic residues in Tg-AGO. Mass spectrometric analyses of the Tg-AGO protein complex revealed a common set of virtually all known RISC components so far characterized in human and Drosophila, as well as novel proteins involved in RNA metabolism. In agreement with its loading with heterochromatic small RNAs, Tg-AGO also associates substoichiometrically with components of known chromatin-repressing complexes. Thus, a puzzling patchwork of silencing processor and effector proteins from plant, fungal and metazoan origin accounts for the production and action of an unsuspected variety of small RNAs in the single-cell parasite Toxoplasma and

  5. MicroRNA-26a modulates transforming growth factor beta-1-induced proliferation in human fetal lung fibroblasts

    International Nuclear Information System (INIS)

    Li, Xiaoou; Liu, Lian; Shen, Yongchun; Wang, Tao; Chen, Lei; Xu, Dan; Wen, Fuqiang

    2014-01-01

    Highlights: • Endogenous miR-26a inhibits TGF-beta 1 induced proliferation of lung fibroblasts. • miR-26a induces G1 arrest through directly targeting 3′-UTR of CCND2. • TGF indispensable receptor, TGF-beta R I, is regulated by miR-26a. • miR-26a acts through inhibiting TGF-beta 2 feedback loop to reduce TGF-beta 1. • Collagen type I and connective tissue growth factor are suppressed by miR-26a. - Abstract: MicroRNA-26a is a newly discovered microRNA that has a strong anti-tumorigenic capacity and is capable of suppressing cell proliferation and activating tumor-specific apoptosis. However, whether miR-26a can inhibit the over-growth of lung fibroblasts remains unclear. The relationship between miR-26a and lung fibrosis was explored in the current study. We first investigated the effect of miR-26a on the proliferative activity of human lung fibroblasts with or without TGF-beta1 treatment. We found that the inhibition of endogenous miR-26a promoted proliferation and restoration of mature miR-26a inhibited the proliferation of human lung fibroblasts. We also examined that miR-26a can block the G1/S phase transition via directly targeting 3′-UTR of CCND2, degrading mRNA and decreasing protein expression of Cyclin D2. Furthermore, we showed that miR-26a mediated a TGF-beta 2-TGF-beta 1 feedback loop and inhibited TGF-beta R I activation. In addition, the overexpression of miR-26a also significantly suppressed the TGF-beta 1-interacting-CTGF–collagen fibrotic pathway. In summary, our studies indicated an essential role of miR-26a in the anti-fibrotic mechanism in TGF-beta1-induced proliferation in human lung fibroblasts, by directly targeting Cyclin D2, regulating TGF-beta R I as well as TGF-beta 2, and suggested the therapeutic potential of miR-26a in ameliorating lung fibrosis

  6. MicroRNA-26a modulates transforming growth factor beta-1-induced proliferation in human fetal lung fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiaoou [Division of Pulmonary Diseases, State Key Laboratory of Biotherapy of China, West China Hospital, West China School of Medicine, Sichuan University, Chengdu, Sichuan (China); Department of Respiratory Medicine, West China Hospital, West China School of Medicine, Sichuan University, Chengdu, Sichuan (China); Liu, Lian [Division of Pulmonary Diseases, State Key Laboratory of Biotherapy of China, West China Hospital, West China School of Medicine, Sichuan University, Chengdu, Sichuan (China); Shen, Yongchun; Wang, Tao; Chen, Lei; Xu, Dan [Division of Pulmonary Diseases, State Key Laboratory of Biotherapy of China, West China Hospital, West China School of Medicine, Sichuan University, Chengdu, Sichuan (China); Department of Respiratory Medicine, West China Hospital, West China School of Medicine, Sichuan University, Chengdu, Sichuan (China); Wen, Fuqiang, E-mail: wenfuqiang.scu@gmail.com [Division of Pulmonary Diseases, State Key Laboratory of Biotherapy of China, West China Hospital, West China School of Medicine, Sichuan University, Chengdu, Sichuan (China); Department of Respiratory Medicine, West China Hospital, West China School of Medicine, Sichuan University, Chengdu, Sichuan (China)

    2014-11-28

    Highlights: • Endogenous miR-26a inhibits TGF-beta 1 induced proliferation of lung fibroblasts. • miR-26a induces G1 arrest through directly targeting 3′-UTR of CCND2. • TGF indispensable receptor, TGF-beta R I, is regulated by miR-26a. • miR-26a acts through inhibiting TGF-beta 2 feedback loop to reduce TGF-beta 1. • Collagen type I and connective tissue growth factor are suppressed by miR-26a. - Abstract: MicroRNA-26a is a newly discovered microRNA that has a strong anti-tumorigenic capacity and is capable of suppressing cell proliferation and activating tumor-specific apoptosis. However, whether miR-26a can inhibit the over-growth of lung fibroblasts remains unclear. The relationship between miR-26a and lung fibrosis was explored in the current study. We first investigated the effect of miR-26a on the proliferative activity of human lung fibroblasts with or without TGF-beta1 treatment. We found that the inhibition of endogenous miR-26a promoted proliferation and restoration of mature miR-26a inhibited the proliferation of human lung fibroblasts. We also examined that miR-26a can block the G1/S phase transition via directly targeting 3′-UTR of CCND2, degrading mRNA and decreasing protein expression of Cyclin D2. Furthermore, we showed that miR-26a mediated a TGF-beta 2-TGF-beta 1 feedback loop and inhibited TGF-beta R I activation. In addition, the overexpression of miR-26a also significantly suppressed the TGF-beta 1-interacting-CTGF–collagen fibrotic pathway. In summary, our studies indicated an essential role of miR-26a in the anti-fibrotic mechanism in TGF-beta1-induced proliferation in human lung fibroblasts, by directly targeting Cyclin D2, regulating TGF-beta R I as well as TGF-beta 2, and suggested the therapeutic potential of miR-26a in ameliorating lung fibrosis.

  7. Persistence of smoking-induced dysregulation of miRNA expression in the small airway epithelium despite smoking cessation.

    Directory of Open Access Journals (Sweden)

    Guoqing Wang

    Full Text Available Even after quitting smoking, the risk of the development of chronic obstructive pulmonary disease (COPD and lung cancer remains significantly higher compared to healthy nonsmokers. Based on the knowledge that COPD and most lung cancers start in the small airway epithelium (SAE, we hypothesized that smoking modulates miRNA expression in the SAE linked to the pathogenesis of smoking-induced airway disease, and that some of these changes persist after smoking cessation. SAE was collected from 10th to 12th order bronchi using fiberoptic bronchoscopy. Affymetrix miRNA 2.0 arrays were used to assess miRNA expression in the SAE from 9 healthy nonsmokers and 10 healthy smokers, before and after they quit smoking for 3 months. Smoking status was determined by urine nicotine and cotinine measurement. There were significant differences in the expression of 34 miRNAs between healthy smokers and healthy nonsmokers (p1.5, with functions associated with lung development, airway epithelium differentiation, inflammation and cancer. After quitting smoking for 3 months, 12 out of the 34 miRNAs did not return to normal levels, with Wnt/β-catenin signaling pathway being the top identified enriched pathway of the target genes of the persistent dysregulated miRNAs. In the context that many of these persistent smoking-dependent miRNAs are associated with differentiation, inflammatory diseases or lung cancer, it is likely that persistent smoking-related changes in SAE miRNAs play a role in the subsequent development of these disorders.

  8. Efficient mRNA delivery with graphene oxide-polyethylenimine for generation of footprint-free human induced pluripotent stem cells.

    Science.gov (United States)

    Choi, Hye Yeon; Lee, Tae-Jin; Yang, Gwang-Mo; Oh, Jaesur; Won, Jihye; Han, Jihae; Jeong, Gun-Jae; Kim, Jongpil; Kim, Jin-Hoi; Kim, Byung-Soo; Cho, Ssang-Goo

    2016-08-10

    Clinical applications of induced pluripotent stem cells (iPSCs) require development of technologies for the production of "footprint-free" (gene integration-free) iPSCs, which avoid the potential risk of insertional mutagenesis in humans. Previously, several studies have shown that mRNA transfer can generate "footprint-free" iPSCs, but these studies did not use a delivery vehicle and thus repetitive daily transfection was required because of mRNA degradation. Here, we report an mRNA delivery system employing graphene oxide (GO)-polyethylenimine (PEI) complexes for the efficient generation of "footprint-free" iPSCs. GO-PEI complexes were found to be very effective for loading mRNA of reprogramming transcription factors and protection from mRNA degradation by RNase. Dynamic suspension cultures of GO-PEI/RNA complexes-treated cells dramatically increased the reprogramming efficiency and successfully generated rat and human iPSCs from adult adipose tissue-derived fibroblasts without repetitive daily transfection. The iPSCs showed all the hallmarks of pluripotent stem cells including expression of pluripotency genes, epigenetic reprogramming, and differentiation into the three germ layers. These results demonstrate that mRNA delivery using GO-PEI-RNA complexes can efficiently generate "footprint-free" iPSCs, which may advance the translation of iPSC technology into the clinical settings. Copyright © 2016. Published by Elsevier B.V.

  9. MicroRNA-424 suppresses estradiol-induced cell proliferation via targeting GPER in endometrial cancer cells.

    Science.gov (United States)

    Zhang, H; Wang, X; Chen, Z; Wang, W

    2015-11-30

    Endometrial carcinoma (EC) is the most common gynecologic malignancy with increasing morbidity in recent years. MicroRNAs (miRNAs), a type of non-coding RNA, have been proven to be critical in the process of tumorigenesis. miR-424 has been reported to play a protective role in various type of cancer including endometrial carcinoma. It has been reported that high levels of estrogen increase morbidity of EC by promoting cell growth ability. The current research was designed to delineate the mechanism of miR-424 in regulating E2 (17β-estradiol)-induced cell proliferation in endometrial cancer. In this study, we confirmed that cell proliferation is increased significantly in E2-treated endometrial cancer cell lines. Moreover, miR-424 overexpression dramatically decreased E2-induced cell proliferation, indicating a pivotal role in endometrial cancer cell growth. In addition, the results suggest that miR-424 up-regulation inactivated the PI3K/AKT signaling, which was mediated by G-protein-coupled estrogen receptor-1 (GPER) in endometrial cancer. Furthermore, the luciferase report confirmed the targeting reaction between miR-424 and GPER. After transfection with the GPER overexpression vector into E2-induced endometrial cancer cells, we found that GPER significantly attenuated the inhibition effect of miR-424 in E2-induced cell growth in EC. Taken together, our study suggests that increased miR-424 suppresses E2-induced cell growth, and providing a potential therapeutic target for estrogen-associated endometrial carcinoma.

  10. Angiotensin II induces calcium/calcineurin signaling and podocyte injury by downregulating microRNA-30 family members.

    Science.gov (United States)

    Zhao, Yue; Wu, Junnan; Zhang, Mingchao; Zhou, Minlin; Xu, Feng; Zhu, Xiaodong; Zhou, Xianguang; Lang, Yue; Yang, Fan; Yun, Shifeng; Shi, Shaolin; Liu, Zhihong

    2017-08-01

    Angiotensin II (AngII) is capable of inducing calcium/calcineurin signaling and podocyte injury; however, the precise underlying mechanism is not well understood. Because we have previously demonstrated that microRNA-30s (miR-30s) inhibit calcium/calcineurin signaling in podocytes, we hypothesize that AngII may induce podocyte injury by downregulating miR-30s and thereby activating calcium/calcineurin signaling. To test this hypothesis, we used an AngII-induced podocyte injury mouse model. The mice were treated with AngII via infusion for 28 days, which resulted in hypertension, albuminuria, and glomerular damage. AngII treatment also resulted in a significant reduction of miR-30s and upregulation of calcium/calcineurin signaling components, including TRPC6, PPP3CA, PPP3CB, PPP3R1, and NFATC3, which are the known targets of miR-30s in podocytes. The delivery of miR-30a-expressing lentivirus to the podocytes on day 14 of the infusion ameliorated the AngII-induced podocyte and glomerular injury and attenuated the upregulation of the calcium/calcineurin signaling components. Similarly, treatment with losartan, which is an AngII receptor blocker, also prevented AngII-induced podocyte injury and calcium/calcineurin signaling activation. Notably, losartan was found to sustain miR-30 levels during AngII treatment both in vivo and in vitro. In conclusion, the effect of AngII on podocytes is in part mediated by miR-30s through calcium/calcineurin signaling, a novel mechanism underlying AngII-induced podocyte injury. • AngII infusion resulted in downregulation of miR-30s in podocytes. • Exogenous miR-30a delivery mitigated the glomerular and podocyte injuries induced by AngII. • Both miR-30a and losartan prevented AngII-induced activation of calcium-calcineurin signaling.

  11. Generation of human induced pluripotent stem cell lines from human dermal fibroblasts using a modified RNA system

    Directory of Open Access Journals (Sweden)

    Kyung-Ok Uhm

    2017-10-01

    Full Text Available We generated human induced pluripotent stem cells (KSCBi002-B and KSCBi002-B-1 from the dermal fibroblasts of a donor using a modified RNA-based gene delivery method. According to GTG-banding analysis, the generated KSCBi002-B line has a cytogenetic abnormality (46,XY, t(1;4(q21;q25 that is distinct from that of the donor, whereas KSCBi002-B-1 has a normal karyotype (46,XY. These cell lines can be useful as a model for characterizing the hiPSCs generated by a non-viral and non-integrative system, or as a chromosomal balanced translocation model. These two cell lines are registered and available from the National Stem Cell Bank, Korea National Institute of Health.

  12. Changes in growth, rRNA content, and cell morphology of Listeria monocytogenes induced by CO2 up- and downshift

    DEFF Research Database (Denmark)

    Jydegaard-Axelsen, A.M.; Aaes-Jorgensen, A.; Koch, A.G.

    2005-01-01

    Cell morphology, rRNA content, and growth were examined for Listeria monocytogenes LO28 and EGD, respectively, grown in brain-heart infusion (BHI) and on slices of sausage at 10degreesC in 100% CO2, 100% N-2, and air. In CO2, filamentous cells were formed by both strains on sausage slices and by L...... units under circumstances where filamentation may occur. Furthermore, the study illustrates the lack of residual inhibitory effect of CO2 in this type of products after opening....... in air and CO2.. Septation and cell division were induced in the filaments after a CO2 downshift (i.e., exposure to air). In BHI, the number of colony forming units increased rapidly when L. monocytogenes EGD grown in CO2 was exposed to air whereas the number of L. monocytogenes LO28 remained almost...

  13. MicroRNA-486-5p suppresses TGF-ß2-induced proliferation ...

    Indian Academy of Sciences (India)

    Bei Liu

    2017-09-27

    486-5p) on TGF-b2-induced proliferation, invasion ... The human lens epithelial cell line was purchased from ... MiR-486-5p mimics and negative control mimics were ... specific binding was blocked using 5% non-fat milk for 1.

  14. A RNA antagonist of hypoxia-inducible factor-1alpha, EZN-2968, inhibits tumor cell growth

    DEFF Research Database (Denmark)

    Greenberger, Lee M; Horak, Ivan D; Filpula, David

    2008-01-01

    Hypoxia-inducible factor-1 (HIF-1) is a transcription factor that plays a critical role in angiogenesis, survival, metastasis, drug resistance, and glucose metabolism. Elevated expression of the alpha-subunit of HIF-1 (HIF-1alpha), which occurs in response to hypoxia or activation of growth facto...

  15. Impact of adrenaline and metabolic stress on exercise-induced intracellular signaling and PGC-1α mRNA response in human skeletal muscle

    DEFF Research Database (Denmark)

    Brandt, Nina; Gunnarsson, Thomas Gunnar Petursson; Hostrup, Morten

    2016-01-01

    This study tested the hypothesis that elevated plasma adrenaline or metabolic stress enhances exercise-induced PGC-1α mRNA and intracellular signaling in human muscle. Trained (VO2-max: 53.8 ± 1.8 mL min(-1) kg(-1)) male subjects completed four different exercise protocols (work load of the legs...... exercise than at rest in all protocols, and higher (P adrenaline nor muscle metabolic stress determines the magnitude of PGC-1α mRNA response in human muscle. Furthermore, higher exercise-induced changes in AMPK, p38, and CREB...

  16. Time-Course Transcriptome Analysis Reveals Resistance Genes of Panax ginseng Induced by Cylindrocarpon destructans Infection Using RNA-Seq.

    Directory of Open Access Journals (Sweden)

    Yuan Gao

    Full Text Available Panax ginseng C. A. Meyer is a highly valued medicinal plant. Cylindrocarpon destructans is a destructive pathogen that causes root rot and significantly reduces the quality and yield of P. ginseng. However, an efficient method to control root rot remains unavailable because of insufficient understanding of the molecular mechanism underlying C. destructans-P. ginseng interaction. In this study, C. destructans-induced transcriptomes at different time points were investigated using RNA sequencing (RNA-Seq. De novo assembly produced 73,335 unigenes for the P. ginseng transcriptome after C. destructans infection, in which 3,839 unigenes were up-regulated. Notably, the abundance of the up-regulated unigenes sharply increased at 0.5 d postinoculation to provide effector-triggered immunity. In total, 24 of 26 randomly selected unigenes can be validated using quantitative reverse transcription (qRT-PCR. Gene ontology enrichment analysis of these unigenes showed that "defense response to fungus", "defense response" and "response to stress" were enriched. In addition, differentially expressed transcription factors involved in the hormone signaling pathways after C. destructans infection were identified. Finally, differentially expressed unigenes involved in reactive oxygen species and ginsenoside biosynthetic pathway during C. destructans infection were indentified. To our knowledge, this study is the first to report on the dynamic transcriptome triggered by C. destructans. These results improve our understanding of disease resistance in P. ginseng and provide a useful resource for quick detection of induced markers in P. ginseng before the comprehensive outbreak of this disease caused by C. destructans.

  17. Recovery of Nicotiana benthamiana plants from a necrotic response induced by a nepovirus is associated with RNA silencing but not with reduced virus titer.

    Science.gov (United States)

    Jovel, Juan; Walker, Melanie; Sanfaçon, Hélène

    2007-11-01

    Recovery of plants from virus-induced symptoms is often described as a consequence of RNA silencing, an antiviral defense mechanism. For example, recovery of Nicotiana clevelandii from a nepovirus (tomato black ring virus) is associated with a decreased viral RNA concentration and sequence-specific resistance to further virus infection. In this study, we have characterized the interaction of another nepovirus, tomato ringspot virus (ToRSV), with host defense responses during symptom induction and subsequent recovery. Early in infection, ToRSV induced a necrotic phenotype in Nicotiana benthamiana that showed characteristics typical of a hypersensitive response. RNA silencing was also activated during ToRSV infection, as evidenced by the presence of ToRSV-derived small interfering RNAs (siRNAs) that could direct degradation of ToRSV sequences introduced into sensor constructs. Surprisingly, disappearance of symptoms was not accompanied by a commensurate reduction in viral RNA levels. The stability of ToRSV RNA after recovery was also observed in N. clevelandii and Cucumis sativus and in N. benthamiana plants carrying a functional RNA-dependent RNA polymerase 1 ortholog from Medicago truncatula. In experiments with a reporter transgene (green fluorescent protein), ToRSV did not suppress the initiation or maintenance of transgene silencing, although the movement of the silencing signal was partially hindered. Our results demonstrate that although RNA silencing is active during recovery, reduction of virus titer is not required for the initiation of this phenotype. This scenario adds an unforeseen layer of complexity to the interaction of nepoviruses with the host RNA silencing machinery. The possibility that viral proteins, viral RNAs, and/or virus-derived siRNAs inactivate host defense responses is discussed.

  18. Multi-task learning for cross-platform siRNA efficacy prediction: an in-silico study.

    Science.gov (United States)

    Liu, Qi; Xu, Qian; Zheng, Vincent W; Xue, Hong; Cao, Zhiwei; Yang, Qiang

    2010-04-10

    Gene silencing using exogenous small interfering RNAs (siRNAs) is now a widespread molecular tool for gene functional study and new-drug target identification. The key mechanism in this technique is to design efficient siRNAs that incorporated into the RNA-induced silencing complexes (RISC) to bind and interact with the mRNA targets to repress their translations to proteins. Although considerable progress has been made in the computational analysis of siRNA binding efficacy, few joint analysis of different RNAi experiments conducted under different experimental scenarios has been done in research so far, while the joint analysis is an important issue in cross-platform siRNA efficacy prediction. A collective analysis of RNAi mechanisms for different datasets and experimental conditions can often provide new clues on the design of potent siRNAs. An elegant multi-task learning paradigm for cross-platform siRNA efficacy prediction is proposed. Experimental studies were performed on a large dataset of siRNA sequences which encompass several RNAi experiments recently conducted by different research groups. By using our multi-task learning method, the synergy among different experiments is exploited and an efficient multi-task predictor for siRNA efficacy prediction is obtained. The 19 most popular biological features for siRNA according to their jointly importance in multi-task learning were ranked. Furthermore, the hypothesis is validated out that the siRNA binding efficacy on different messenger RNAs(mRNAs) have different conditional distribution, thus the multi-task learning can be conducted by viewing tasks at an "mRNA"-level rather than at the "experiment"-level. Such distribution diversity derived from siRNAs bound to different mRNAs help indicate that the properties of target mRNA have important implications on the siRNA binding efficacy. The knowledge gained from our study provides useful insights on how to analyze various cross-platform RNAi data for uncovering

  19. Multi-task learning for cross-platform siRNA efficacy prediction: an in-silico study

    Directory of Open Access Journals (Sweden)

    Xue Hong

    2010-04-01

    Full Text Available Abstract Background Gene silencing using exogenous small interfering RNAs (siRNAs is now a widespread molecular tool for gene functional study and new-drug target identification. The key mechanism in this technique is to design efficient siRNAs that incorporated into the RNA-induced silencing complexes (RISC to bind and interact with the mRNA targets to repress their translations to proteins. Although considerable progress has been made in the computational analysis of siRNA binding efficacy, few joint analysis of different RNAi experiments conducted under different experimental scenarios has been done in research so far, while the joint analysis is an important issue in cross-platform siRNA efficacy prediction. A collective analysis of RNAi mechanisms for different datasets and experimental conditions can often provide new clues on the design of potent siRNAs. Results An elegant multi-task learning paradigm for cross-platform siRNA efficacy prediction is proposed. Experimental studies were performed on a large dataset of siRNA sequences which encompass several RNAi experiments recently conducted by different research groups. By using our multi-task learning method, the synergy among different experiments is exploited and an efficient multi-task predictor for siRNA efficacy prediction is obtained. The 19 most popular biological features for siRNA according to their jointly importance in multi-task learning were ranked. Furthermore, the hypothesis is validated out that the siRNA binding efficacy on different messenger RNAs(mRNAs have different conditional distribution, thus the multi-task learning can be conducted by viewing tasks at an "mRNA"-level rather than at the "experiment"-level. Such distribution diversity derived from siRNAs bound to different mRNAs help indicate that the properties of target mRNA have important implications on the siRNA binding efficacy. Conclusions The knowledge gained from our study provides useful insights on how to

  20. Computational analysis of siRNA recognition by the Ago2 PAZ domain and identification of the determinants of RNA-induced gene silencing.

    Directory of Open Access Journals (Sweden)

    Mahmoud Kandeel

    Full Text Available RNA interference (RNAi is a highly specialized process of protein-siRNA interaction that results in the regulation of gene expression and cleavage of target mRNA. The PAZ domain of the Argonaute proteins binds to the 3' end of siRNA, and during RNAi the attaching end of the siRNA switches between binding and release from its binding pocket. This biphasic interaction of the 3' end of siRNA with the PAZ domain is essential for RNAi activity; however, it remains unclear whether stronger or weaker binding with PAZ domain will facilitate or hinder the overall RNAi process. Here we report the correlation between the binding of modified siRNA 3' overhang analogues and their in vivo RNAi efficacy. We found that higher RNAi efficacy was associated with the parameters of lower Ki value, lower total intermolecular energy, lower free energy, higher hydrogen bonding, smaller total surface of interaction and fewer van der Waals interactions. Electrostatic interaction was a minor contributor to compounds recognition, underscoring the presence of phosphate groups in the modified analogues. Thus, compounds with lower binding affinity are associated with better gene silencing. Lower binding strength along with the smaller interaction surface, higher hydrogen bonding and fewer van der Waals interactions were among the markers for favorable RNAi activity. Within the measured parameters, the interaction surface, van der Waals interactions and inhibition constant showed a statistically significant correlation with measured RNAi efficacy. The considerations provided in this report will be helpful in the design of new compounds with better gene silencing ability.

  1. Exercise-induced circulating microRNA changes in athletes in various training scenarios.

    Directory of Open Access Journals (Sweden)

    Martin Horak

    Full Text Available The aim of the study was to compare selected extracellular miRNA levels (miR-16, miR-21, miR-93 and miR-222 with the response to 8-week-long explosive strength training (EXPL, hypertrophic strength training (HYP and high-intensity interval training (HIIT.30 young male athletes of white European origin (mean age: 22.5 ± 4.06 years recruited at the Faculty of Sports Studies of Masaryk University were enrolled in this study. The study participants were randomly assigned to three possible training scenarios: EXPL, HYP or HITT and participated in 8-week-long program in given arm. Blood plasma samples were collected at the baseline and at week 5 and 8 and anthropometric and physical activity parameters were measured. Pre- and post-intervention characteristics were compared and participants were further evaluated as responders (RES or non-responders (NRES. RES/NRES status was established for the following characteristics: 300°/s right leg extension (t300, 60°/s right leg extension (t60, isometric extension (IE, vertical jump, isometric extension of the right leg and body fat percentage (BFP.No differences in miRNA levels were apparent between the intervention groups at baseline. No statistically significant prediction role was observed using crude univariate stepwise regression model analysis where RES/NRES status for t300, t60, IE, vertical jump and pFM was used as a dependent variable and miR-21, miR-222, miR-16 and miR-93 levels at baseline were used as independent variables. The baseline levels of miR-93 expressed an independent prediction role for responder status based on isometric extension of the right leg (beta estimate 0.76, 95% CI: -0.01; 1.53, p = 0.052.The results of the study indicate that 8-week-long explosive strength training, hypertrophic strength training and high-intensity interval training regimens are associated with significant changes in miR-16, mir-21, miR-222 and miR-93 levels compared to a baseline in athletic young men.

  2. Spot 42 Small RNA Regulates Arabinose-Inducible araBAD Promoter Activity by Repressing Synthesis of the High-Affinity Low-Capacity Arabinose Transporter

    Science.gov (United States)

    Chen, Jiandong

    2016-01-01

    ABSTRACT The l-arabinose-inducible araBAD promoter (PBAD) enables tightly controlled and tunable expression of genes of interest in a broad range of bacterial species. It has been used successfully to study bacterial sRNA regulation, where PBAD drives expression of target mRNA translational fusions. Here we report that in Escherichia coli, Spot 42 sRNA regulates PBAD promoter activity by affecting arabinose uptake. We demonstrate that Spot 42 sRNA represses araF, a gene encoding the AraF subunit of the high-affinity low-capacity arabinose transporter AraFGH, through direct base-pairing interactions. We further show that endogenous Spot 42 sRNA is sufficient to repress araF expression under various growth conditions. Finally, we demonstrate this posttranscriptional repression has a biological consequence, decreasing the induction of PBAD at low levels of arabinose. This problem can be circumvented using strategies reported previously for avoiding all-or-none induction behavior, such as through constitutive expression of the low-affinity high-capacity arabinose transporter AraE or induction with a higher concentration of inducers. This work adds araF to the set of Spot 42-regulated genes, in agreement with previous studies suggesting that Spot 42, itself negatively regulated by the cyclic AMP (cAMP) receptor protein-cAMP complex, reinforces the catabolite repression network. IMPORTANCE The bacterial arabinose-inducible system is widely used for titratable control of gene expression. We demonstrate here that a posttranscriptional mechanism mediated by Spot 42 sRNA contributes to the functionality of the PBAD system at subsaturating inducer concentrations by affecting inducer uptake. Our finding extends the inputs into the known transcriptional control for the PBAD system and has implications for improving its usage for tunable gene expression. PMID:27849174

  3. 15-lipoxygenase metabolites play an important role in the development of a T-helper type 1 allergic inflammation induced by double-stranded RNA.

    Science.gov (United States)

    Jeon, S G; Moon, H-G; Kim, Y-S; Choi, J-P; Shin, T-S; Hong, S-W; Tae, Y-M; Kim, S-H; Zhu, Z; Gho, Y S; Kim, Y-K

    2009-06-01

    We recently demonstrated that the T-helper type 1 (Th1) immune response plays an important role in the development of non-eosinophilic inflammation induced by airway exposure of an allergen plus double-stranded RNA (dsRNA). However, the role of lipoxygenase (LO) metabolites in the development of Th1 inflammation is poorly understood. To evaluate the role of LO metabolites in the development of Th1 inflammation induced by sensitization with an allergen plus dsRNA. A Th2-allergic inflammation mouse model was created by an intraperitoneal injection of lipopolysaccharide-depleted ovalbumin (OVA, 75 microg) and alum (2 mg) twice, and the Th1 model was created by intranasal application of OVA (75 microg) and synthetic dsRNA [10 microg of poly(I : C)] four times, followed by an intranasal challenge with 50 microg of OVA four times. The role of LO metabolites was evaluated using two approaches: a transgenic approach using 5-LO(-/-) and 15-LO(-/-) mice, and a pharmacological approach using inhibitors of cysteinyl leucotriene receptor-1 (cysLTR1), LTB4 receptor (BLT1), and 15-LO. We found that the Th1-allergic inflammation induced by OVA+dsRNA sensitization was similar between 5-LO(-/-) and wild-type (WT) control mice, although Th2 inflammation induced by sensitization with OVA+alum was reduced in the former group. In addition, dsRNA-induced Th1 allergic inflammation, which is associated with down-regulation of 15-hydroxyeicosateraenoic acids production, was not affected by treatment with cysLTR1 or BLT1 inhibitors, whereas it was significantly lower in 12/15-LO(-/-) mice compared with WT control mice. Moreover, dsRNA-induced allergic inflammation and the recruitment of T cells following an allergen challenge were significantly inhibited by treatment with a specific 15-LO inhibitor (PD146176). 15-LO metabolites appear to be important mediators in the development of Th1-allergic inflammation induced by sensitization with an allergen plus dsRNA. Our findings suggest that the

  4. Replicative age induces mitotic recombination in the ribosomal RNA gene cluster of Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Derek L Lindstrom

    2011-03-01

    Full Text Available Somatic mutations contribute to the development of age-associated disease. In earlier work, we found that, at high frequency, aging Saccharomyces cerevisiae diploid cells produce daughters without mitochondrial DNA, leading to loss of respiration competence and increased loss of heterozygosity (LOH in the nuclear genome. Here we used the recently developed Mother Enrichment Program to ask whether aging cells that maintain the ability to produce respiration-competent daughters also experience increased genomic instability. We discovered that this population exhibits a distinct genomic instability phenotype that primarily affects the repeated ribosomal RNA gene array (rDNA array. As diploid cells passed their median replicative life span, recombination rates between rDNA arrays on homologous chromosomes progressively increased, resulting in mutational events that generated LOH at >300 contiguous open reading frames on the right arm of chromosome XII. We show that, while these recombination events were dependent on the replication fork block protein Fob1, the aging process that underlies this phenotype is Fob1-independent. Furthermore, we provide evidence that this aging process is not driven by mechanisms that modulate rDNA recombination in young cells, including loss of cohesion within the rDNA array or loss of Sir2 function. Instead, we suggest that the age-associated increase in rDNA recombination is a response to increasing DNA replication stress generated in aging cells.

  5. Effects of exogenous ATM gene on mRNA expression of human telomerase reverse transcriptase in AT cells induced by irradiation

    International Nuclear Information System (INIS)

    Sheng Fangjun; Cao Jianping; Luo Jialin; Zhu Wei; Liu Fenju; Feng Shuang; Song Jianyuan; Li Chong

    2005-01-01

    The study is to observe effects of exogenous ATM gene on mRNA expression of hTERT (human telomerase reverse transcriptase) in fibroblast cells (AT5BIVA cells) from skin of Ataxia-telangiectasia (AT) patients and to study the regulation of ATM to hTERT. Using reverse transcription polymerase chain reaction (RT-PCR), mRNA expression of hTERT in AT, PEBS7-AT, ATM + -AT and GM cells irradiated with 0 and 3 Gy of 60 Co γ-rays were examined respectively. The difference of the mRNA expression of hTERT among AT, PEBS7-AT, ATM + -AT and GM cells were analyzed. Difference of the mRNA expression of hTERT between 0 Gy and 3 Gy groups was analyzed, too. The results showed that the mRNA expression of hTERT in GM cells was negative, but positive mRNA expression of hTERT in AT cells. The mRNA expression of hTERT in ATM + -AT cells decreased significantly (p 60 Co γ-rays, the mRNA expression of hTERT in GM cells was positive, and that in AT, PEBS7-AT, ATM + -AT cells was increased (p + -AT cells was lower than that in AT and PEBS7-AT cells respectively (p<0.05). It is postulated that exogenous ATM is able to downregulate the mRNA expression of hTERT in AT cells, ionizing radiation can induce the mRNA expression of hTERT in cells and telomerase anticipates the repair of damaged DNA. (authors)

  6. Combination of siRNA-directed Kras oncogene silencing and arsenic-induced apoptosis using a nanomedicine strategy for the effective treatment of pancreatic cancer.

    Science.gov (United States)

    Zeng, Linjuan; Li, Jingguo; Wang, Yong; Qian, Chenchen; Chen, Yinting; Zhang, Qiubo; Wu, Wei; Lin, Zhong; Liang, Jianzhong; Shuai, Xintao; Huang, Kaihong

    2014-02-01

    The synergetic inhibitory effects on human pancreatic cancer by nanoparticle-mediated siRNA and arsenic therapy were investigated both in vitro and in vivo. Poly(ethylene glycol)-block-poly(L-lysine) were prepared to form siRNA-complexed polyplex and poly(ethylene glycol)-block-poly(DL-lactide) were prepared to form arsenic-encapsulated vesicle, respectively. Down-regulation of the mutant Kras gene by siRNA caused defective abilities of proliferation, clonal formation, migration, and invasion of pancreatic cancer cells, as well as cell cycle arrest at the G0/G1 phase, which substantially enhanced the apoptosis-inducing effect of arsenic administration. Consequently, co-administration of the two nanomedicines encapsulating siRNA or arsenic showed ideal tumor growth inhibition both in vitro and in vivo as a result of synergistic effect of the siRNA-directed Kras oncogene silencing and arsenic-induced cell apoptosis. These results suggest that the combination of mutant Kras gene silencing and arsenic therapy using nanoparticle-mediated delivery strategy is promising for pancreatic cancer treatment. Treatment of pancreatic cancer remains a major challenge. These authors demonstrate a method that combines a siRNA-based Kras silencing with arsenic delivery to pancreatic cancer cells using nanoparticles, resulting in enhanced apoptosis induction in the treated cells. © 2013.

  7. Simultaneous separation of five major ribonucleic acids by capillary electrophoresis with laser-induced fluorescence in the presence of electroosmotic flow: application to the rapid screening of 5S rRNA from ovarian cancer cells.

    Science.gov (United States)

    Shih, Ya-Chu; Liao, Ching-Ru; Chung, I-Che; Chang, Yu-Sun; Chang, Po-Ling

    2014-10-17

    RNA integrity is important in RNA studies because poor RNA quality may impact downstream methodologies. This study proposes a rapid and cost-effective method for the determination of RNA integrity based on CE-LIF in the presence of electroosmotic flow. The proposed method uses poly(ethylene) oxide (Mavg=4,000,000 Da) as a sieving matrix for total RNA separation. Ethidium bromide (μg mL(-1)) was dissolved in a polymer solution as an interchelating dye for on-column fluorescent labeling. The 28S rRNA, 18S rRNA, 5.8S rRNA, 5S rRNA and tRNA from the total human RNA extracted from the cells were fully separated using the proposed method. The lowest detectable concentration of total RNA achieved was 100 pg μL(-1) with a 6 min sample injection followed by on-column concentration. In addition, the temperature-induced degradation of total RNA was observed by CE-LIF. The electropherograms revealed more fragmentation of 28S and 18S rRNAs by temperature-induced hydrolysis compared with the 5.8S rRNA, 5S rRNA and tRNA. Therefore, the results indicated that RNA degradation should be considered for long-term, high-temperature incubations in RNA-related experiments involving RNA hybridization. The proposed method is furthermore, applied to the determination of 5S rRNA overexpressed in ovarian cancer cells as compared to the cervical cancer cells. Overall, CE-LIF is highly promising for rapid screening of ovarian cancers without tedious pre-amplification steps. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Amitriptyline induces brain-derived neurotrophic factor (BDNF) mRNA expression through ERK-dependent modulation of multiple BDNF mRNA variants in primary cultured rat cortical astrocytes and microglia.

    Science.gov (United States)

    Hisaoka-Nakashima, Kazue; Kajitani, Naoto; Kaneko, Masahiro; Shigetou, Takahiro; Kasai, Miho; Matsumoto, Chie; Yokoe, Toshiki; Azuma, Honami; Takebayashi, Minoru; Morioka, Norimitsu; Nakata, Yoshihiro

    2016-03-01

    A significant role of brain-derived neurotrophic factor (BDNF) has been previously implicated in the therapeutic effect of antidepressants. To ascertain the contribution of specific cell types in the brain that produce BDNF following antidepressant treatment, the effects of the tricyclic antidepressant amitriptyline on rat primary neuronal, astrocytic and microglial cortical cultures were examined. Amitriptyline increased the expression of BDNF mRNA in astrocytic and microglial cultures but not neuronal cultures. Antidepressants with distinct mechanisms of action, such as clomipramine, duloxetine and fluvoxamine, also increased BDNF mRNA expression in astrocytic and microglial cultures. There are multiple BDNF mRNA variants (exon I, IIA, IV and VI) expressed in astrocytes and microglia and the variant induced by antidepressants has yet to be elaborated. Treatment with antidepressants increased the expression of exon I, IV and VI in astrocyte and microglia. Clomipramine alone significantly upregulated expression of exon IIA. The amitriptyline-induced expression of both total and individual BDNF mRNA variants (exon I, IV and VI) were blocked by MEK inhibitor U0126, indicating MEK/ERK signaling is required in the expression of BDNF. These findings indicate that non-neural cells are a significant target of antidepressants and further support the contention that glial production of BDNF is crucial role in the therapeutic effect of antidepressants. The current data suggest that targeting of glial function could lead to the development of antidepressants with a truly novel mechanism of action. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. The Crystal Structure of the Drosophila Germline Inducer Oskar Identifies Two Domains with Distinct Vasa Helicase- and RNA-Binding Activities

    Directory of Open Access Journals (Sweden)

    Mandy Jeske

    2015-07-01

    Full Text Available In many animals, the germ plasm segregates germline from soma during early development. Oskar protein is known for its ability to induce germ plasm formation and germ cells in Drosophila. However, the molecular basis of germ plasm formation remains unclear. Here, we show that Oskar is an RNA-binding protein in vivo, crosslinking to nanos, polar granule component, and germ cell-less mRNAs, each of which has a role in germline formation. Furthermore, we present high-resolution crystal structures of the two Oskar domains. RNA-binding maps in vitro to the C-terminal domain, which shows structural similarity to SGNH hydrolases. The highly conserved N-terminal LOTUS domain forms dimers and mediates Oskar interaction with the germline-specific RNA helicase Vasa in vitro. Our findings suggest a dual function of Oskar in RNA and Vasa binding, providing molecular clues to its germ plasm function.

  10. Exosomes derived from hypoxic epithelial ovarian cancer deliver microRNA-940 to induce macrophage M2 polarization.

    Science.gov (United States)

    Chen, Xin; Ying, Xiang; Wang, Xinjing; Wu, Xiaoli; Zhu, Qinyi; Wang, Xipeng

    2017-07-01

    Hypoxia is a common feature of solid tumors. It is closely related to tumor progression. Exosomal microRNAs derived from cancers are considered to be mediators between cancer cells and the tumor microenvironment. In addition, the number of tumor-associated macrophages (TAMs) in the tumor microenvironment has also been demonstrated to correlate with tumor development. However, the relationship between tumor-secreted exosomes and TAM polarization under hypoxic conditions during tumor progression is not clear. Herein, we demonstrated that hypoxia induces the high expression of microRNA-940 (miR‑940) in exosomes derived from epithelial ovarian cancer (EOC). We also found that miR‑940 is highly expressed in exosomes isolated from ascites of EOC patients. Moreover, the overexpression of miR‑940 in macrophages delivered by exosomes stimulated M2 phenotype polarization, while the M2 subtype macrophages promoted EOC proliferation and migration. These results highlight the function of hypoxia in enhancing the high level of expression of miR‑940 in tumor exosomes taken up by macrophages. We also showed that the tumor-promoting function of miR‑940 is mediated by TAM polarization in EOC. These findings show that tumor-derived exosomal miR‑940 induced by hypoxia plays an important role in stimulating TAM polarization in the progression of EOC.

  11. Intracellular delivery of poly(I:C) induces apoptosis of fibroblast-like synoviocytes via an unknown dsRNA sensor

    Energy Technology Data Exchange (ETDEWEB)

    Karpus, Olga N.; Hsiao, Cheng-Chih; Kort, Hanneke de; Tak, Paul P.; Hamann, Jörg, E-mail: j.hamann@amc.uva.nl

    2016-08-26

    Fibroblast-like synoviocytes (FLS) express functional membranous and cytoplasmic sensors for double-stranded (ds)RNA. Notably, FLS undergo apoptosis upon transfection with the synthetic dsRNA analog poly(I:C). We here studied the mechanism of intracellular poly(I:C) recognition and subsequent cell death in FLS. FLS responded similarly to poly(I:C) or 3pRNA transfection; however, only intracellular delivery of poly(I:C) induced significant cell death, accompanied by upregulation of pro-apoptotic proteins Puma and Noxa, caspase 3 cleavage, and nuclear segregation. Knockdown of the DExD/H-box helicase MDA5 did not affect the response to intracellular poly(I:C); in contrast, knockdown of RIG-I abrogated the response to 3pRNA. Knockdown of the downstream adaptor proteins IPS, STING, and TRIF or inhibition of TBK1 did not affect the response to intracellular poly(I:C), while knockdown of IFNAR blocked intracellular poly(I:C)-mediated signaling and cell death. We conclude that a so far unknown intracellular sensor recognizes linear dsRNA and induces apoptosis in FLS. - Highlights: • Intracellular poly(I:C) and 3pRNA evoke immune responses in FLS. • Only intracellular delivery of poly(I:C) induces FLS apoptosis. • FLS do not require MDA5 for their response to intracellular poly(I:C). • FLS respond to intracellular poly(I:C) independent of IPS and STING. • An unknown intracellular sensor recognizes linear dsRNA in FLS.

  12. The Effects of Exercise on Expression of CYP19 and StAR mRNA in Steroid-Induced Polycystic Ovaries of Female Rats.

    Science.gov (United States)

    Aghaie, Fatemeh; Khazali, Homayoun; Hedayati, Mehdi; Akbarnejad, Ali

    2018-01-01

    Polycystic ovarian syndrome (PCOS) is the most frequent female endocrine disorder that affects 5-10% of women. PCOS is characterized by hyperandrogenism, oligo-/anovulation, and polycystic ovaries. The aim of the present research is to evaluate the expression of steroidogenic acute regulatory protein (StAR) and aromatase (CYP19) mRNA in the ovaries of an estradiol valerate (EV)-induced PCOS rat model, and the effect of treadmill and running wheel (voluntary) exercise on these parameters. In this experimental study, we divided adult female Wistar rats that weighed approximately 220 ± 20 g initially into control (n=10) and PCOS (n=30). Subsequently, PCOS group were divided to PCOS, PCOS with treadmill exercise (P-ExT), and PCOS with running wheel exercise (P-ExR) groups (n=10 per group). The expressions of StAR and CYP19 mRNA in the ovaries were determined by quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR). Data were analyzed by one-way ANOVA using SPSS software, version 16. The data were assessed at α=0.05. There was significantly lower mRNA expression of CYP19 in the EV-induced PCOS, running wheel and treadmill exercise rats compared to the control group (PStAR in the ovaries of the PCOS group indicated an increasing trend compared to the control group, however this was not statistically significant (P=0.810). We observed that 8 weeks of running wheel and treadmill exercises could not statistically decrease StAR mRNA expression compared to the PCOS group (P=0.632). EV-induced PCOS in rats decreased CYP19 mRNA expression, but had no effect on StAR mRNA expression. We demonstrated that running wheel and moderate treadmill exercise could not modify CYP19 and StAR mRNA expressions. Copyright© by Royan Institute. All rights reserved.

  13. A RISC multiprocessor event trigger for the data acquisition system of the H1 experiment at HERA

    International Nuclear Information System (INIS)

    Campbell, A.J.

    1991-09-01

    In late 1991 HERA will for the first time collide stored beams of electrons and protons. This paper describes the multiple (RISC) modern reduced instruction set processor system for online event filtering and reconstruction installed within the data acquisition system of the H1 experiment. Data is processed at a continuous average rate of ∼ 6 Mbytes/s in parallel by ∼ 20 R3000 VMEbus based monoboard computers providing some 400 mips computing power. (author)

  14. Development of the Respiratory Index of Severity in Children (RISC score among young children with respiratory infections in South Africa.

    Directory of Open Access Journals (Sweden)

    Carrie Reed

    Full Text Available OBJECTIVE: Pneumonia is a leading cause of death in children worldwide. A simple clinical score predicting the probability of death in a young child with lower respiratory tract infection (LRTI could aid clinicians in case management and provide a standardized severity measure during epidemiologic studies. METHODS: We analyzed 4,148 LRTI hospitalizations in children <24 months enrolled in a pneumococcal conjugate vaccine trial in South Africa from 1998-2001, to develop the Respiratory Index of Severity in Children (RISC. Using clinical data at admission, a multivariable logistic regression model for mortality was developed and statistically evaluated using bootstrap resampling techniques. Points were assigned to risk factors based on their coefficients in the multivariable model. A child's RISC score is the sum of points for each risk factor present. Separate models were developed for HIV-infected and non-infected children. RESULTS: Significant risk factors for HIV-infected and non-infected children included low oxygen saturation, chest indrawing, wheezing, and refusal to feed. The models also included age and HIV clinical classification (for HIV-infected children or weight-for-age (for non-infected children. RISC scores ranged up to 7 points for HIV-infected or 6 points for non-infected children and correlated with probability of death (0-47%, HIV-infected; 0-14%, non-infected. Final models showed good discrimination (area under the ROC curve and calibration (goodness-of-fit. CONCLUSION: The RISC score incorporates a simple set of risk factors that accurately discriminate between young children based on their risk of death from LRTI, and may provide an objective means to quantify severity based on the risk of mortality.

  15. A RISC multiprocessor event trigger for the data acquisition system of the H1 experiment at HERA

    International Nuclear Information System (INIS)

    Campbell, A.J.

    1992-01-01

    In late 1991 HERA will collide for the first time stored beams of electrons and protons. This paper describes the multiple RISC processor system for online event filtering and reconstruction installed within the data acquisition system of the H1 experiment. Data is processed at a continuous average rate of ∼6 Mbytes/s in parallel by ∼20 R3000 VMEbus based monoboard computers providing some 400 MIPS computing power

  16. Application of specialized RISC processor for realization of algorithms for track signal filtration on data read from CCD

    International Nuclear Information System (INIS)

    Ban, Ya.; Kotov, V.M.; Kharcharufkova, K.

    1987-01-01

    Algorithms for track signal filtration from bubble and streamer spark chambers read by CCD matrix with elements of 256x288 dimensions are described. The microprogrammed RISC processor is used for preliminary processing and filtration of data obtained. It makes possible to recognize and filter track elements in the zone of 0.25 mm 2 square during 0.17-0.20 s, that maintains it in real time operation

  17. Exercise induced regulation of muscular Na+,K+ pump, FXYD1, and NHE1 mRNA and protein expression: importance of training status, intensity, and muscle type

    DEFF Research Database (Denmark)

    Rasmussen, Martin Krøyer; Juel, Carsten; Nordsborg, Nikolai Baastrup

    2011-01-01

    It is investigated if exercise induced mRNA changes cause similar protein expression changes of Na(+), K(+) pump isoforms (a1, a2, ß1, ß2), FXYD1 and NHE1 in rat skeletal muscle. Expression was evaluated (n=8 per group) in Soleus and EDL after 1 day, 3 days and 3 weeks (5 sessions per week...

  18. Silica-induced initiation of circular ZC3H4 RNA/ZC3H4 pathway promotes the pulmonary macrophage activation.

    Science.gov (United States)

    Yang, Xiyue; Wang, Jing; Zhou, Zewei; Jiang, Rong; Huang, Jie; Chen, Lulu; Cao, Zhouli; Chu, Han; Han, Bing; Cheng, Yusi; Chao, Jie

    2018-01-22

    Phagocytosis of silicon dioxide (SiO 2 ) into lung cells causes an inflammatory cascade that results in fibroblast proliferation and migration, followed by fibrosis. Circular RNAs (circRNAs) are a subclass of noncoding RNAs that are present within mammalian cells; however, researchers have not determined whether circRNAs are involved in the pathophysiologic process of silicosis. To elucidate the role of these RNAs in SiO 2 -induced inflammation in pulmonary macrophages, we investigated the upstream molecular mechanisms and functional effects of circRNAs on cell apoptosis, proliferation, and migration. Primary cultures of alveolar macrophages from healthy donors and from patients and the RAW264.7 macrophage cell line were used to explore the functions of circZC3H4 RNA in macrophage activation. The experimental results indicated the following: 1) SiO 2 concomitantly increased circZC3H4 RNA expression and increased ZC3H4 protein levels; 2) circular ZC3H4 (circZC3H4) RNA and ZC3H4 protein participated in SiO 2 -induced macrophage activation; and 3) SiO 2 -activated macrophages promoted fibroblast proliferation and migration via the circZC3H4 RNA/ZC3H4 pathway. The up-regulation of the ZC3H4 protein was confirmed in tissue samples from patients with silicosis. Our study elucidates a link between SiO 2 -induced macrophage activation and the circZC3H4 RNA/ZC3H4 pathway, thereby providing novel insight into the potential use of ZC3H4 to develop novel therapeutic strategies for silicosis.-Yang, X., Wang, J., Zhou, Z., Jiang, R., Huang, J., Chen, L., Cao, Z., Chu, H., Han, B., Cheng, Y., Chao, J. Silica-induced initiation of circular ZC3H4 RNA/ZC3H4 pathway promotes the pulmonary macrophage activation.

  19. Structure of the gene encoding VGF, a nervous system-specific mRNA that is rapidly and selectively induced by nerve growth factor in PC12 cells.

    Science.gov (United States)

    Salton, S R; Fischberg, D J; Dong, K W

    1991-05-01

    Nerve growth factor (NGF) plays a critical role in the development and survival of neurons in the peripheral nervous system. Following treatment with NGF but not epidermal growth factor, rat pheochromocytoma (PC12) cells undergo neural differentiation. We have cloned a nervous system-specific mRNA, NGF33.1, that is rapidly and relatively selectively induced by treatment of PC12 cells with NGF and basic fibroblast growth factor in comparison with epidermal growth factor. Analysis of the nucleic acid and predicted amino acid sequences of the NGF33.1 cDNA clone suggested that this clone corresponded to the NGF-inducible mRNA called VGF (A. Levi, J. D. Eldridge, and B. M. Paterson, Science 229:393-395, 1985; R. Possenti, J. D. Eldridge, B. M. Paterson, A. Grasso, and A. Levi, EMBO J. 8:2217-2223, 1989). We have used the NGF33.1 cDNA clone to isolate and characterize the VGF gene, and in this paper we report the complete sequence of the VGF gene, including 853 bases of 5' flank revealed TATAA and CCAAT elements, several GC boxes, and a consensus cyclic AMP response element-binding protein binding site. The VGF promoter contains sequences homologous to other NGF-inducible, neuronal promoters. We further show that VGF mRNA is induced in PC12 cells to a greater extent by depolarization and by phorbol-12-myristate-13-acetate treatment than by 8-bromo-cyclic AMP treatment. By Northern (RNA) and RNase protection analysis, VGF mRNA is detectable in embryonic and postnatal central and peripheral nervous tissues but not in a number of nonneural tissues. In the cascade of events which ultimately leads to the neural differentiation of NGF-treated PC12 cells, the VGF gene encodes the most rapidly and selectively regulated, nervous-system specific mRNA yet identified.

  20. ARC2D - EFFICIENT SOLUTION METHODS FOR THE NAVIER-STOKES EQUATIONS (DEC RISC ULTRIX VERSION)

    Science.gov (United States)

    Biyabani, S. R.

    1994-01-01

    computers to emulate Cray system time calls, which should be easy to modify for other machines as well. The standard distribution media for this version is a 9-track 1600 BPI ASCII Card Image format magnetic tape. The Cray version was developed in 1987. The IBM ES/3090 version is an IBM port of the Cray version. It is written in IBM VS FORTRAN and has the capability of executing in both vector and parallel modes on the MVS/XA operating system and in vector mode on the VM/XA operating system. Various options of the IBM VS FORTRAN compiler provide new features for the ES/3090 version, including 64-bit arithmetic and up to 2 GB of virtual addressability. The IBM ES/3090 version is available only as a 9-track, 1600 BPI IBM IEBCOPY format magnetic tape. The IBM ES/3090 version was developed in 1989. The DEC RISC ULTRIX version is a DEC port of the Cray version. It is written in FORTRAN 77 for RISC-based Digital Equipment platforms. The memory requirement is approximately 7Mb of main memory. It is available in UNIX tar format on TK50 tape cartridge. The port to DEC RISC ULTRIX was done in 1990. COS and UNICOS are trademarks and Cray is a registered trademark of Cray Research, Inc. IBM, ES/3090, VS FORTRAN, MVS/XA, and VM/XA are registered trademarks of International Business Machines. DEC and ULTRIX are registered trademarks of Digital Equipment Corporation.

  1. Identification of Toyocamycin, an agent cytotoxic for multiple myeloma cells, as a potent inhibitor of ER stress-induced XBP1 mRNA splicing

    International Nuclear Information System (INIS)

    Ri, M; Tashiro, E; Oikawa, D; Shinjo, S; Tokuda, M; Yokouchi, Y; Narita, T; Masaki, A; Ito, A; Ding, J; Kusumoto, S; Ishida, T; Komatsu, H; Shiotsu, Y; Ueda, R; Iwawaki, T; Imoto, M; Iida, S

    2012-01-01

    The IRE1α-XBP1 pathway, a key component of the endoplasmic reticulum (ER) stress response, is considered to be a critical regulator for survival of multiple myeloma (MM) cells. Therefore, the availability of small-molecule inhibitors targeting this pathway would offer a new chemotherapeutic strategy for MM. Here, we screened small-molecule inhibitors of ER stress-induced XBP1 activation, and identified toyocamycin from a culture broth of an Actinomycete strain. Toyocamycin was shown to suppress thapsigargin-, tunicamycin- and 2-deoxyglucose-induced XBP1 mRNA splicing in HeLa cells without affecting activating transcription factor 6 (ATF6) and PKR-like ER kinase (PERK) activation. Furthermore, although toyocamycin was unable to inhibit IRE1α phosphorylation, it prevented IRE1α-induced XBP1 mRNA cleavage in vitro. Thus, toyocamycin is an inhibitor of IRE1α-induced XBP1 mRNA cleavage. Toyocamycin inhibited not only ER stress-induced but also constitutive activation of XBP1 expression in MM lines as well as primary samples from patients. It showed synergistic effects with bortezomib, and induced apoptosis of MM cells including bortezomib-resistant cells at nanomolar levels in a dose-dependent manner. It also inhibited growth of xenografts in an in vivo model of human MM. Taken together, our results suggest toyocamycin as a lead compound for developing anti-MM therapy and XBP1 as an appropriate molecular target for anti-MM therapy

  2. Differential microRNA expression in the prefrontal cortex of mouse offspring induced by glyphosate exposure during pregnancy and lactation.

    Science.gov (United States)

    Ji, Hua; Xu, Linhao; Wang, Zheng; Fan, Xinli; Wu, Lihui

    2018-03-01

    Glyphosate is the active ingredient in numerous herbicide formulations. The role of glyphosate in neurotoxicity has been reported in human and animal models. However, the detailed mechanism of the role of glyphosate in neuronal development remains unknown. Recently, several studies have reported evidence linking neurodevelopmental disorders (NDDs) with gestational glyphosate exposure. The current group previously identified microRNAs (miRNAs) that are associated with the etiology of NDDs, but their expression levels in the developing brain following glyphosate exposure have not been characterized. In the present study, miRNA expression patterns were evaluated in the prefrontal cortex (PFC) of 28 postnatal day mouse offspring following glyphosate exposure during pregnancy and lactation. An miRNA microarray detected 55 upregulated and 19 downregulated miRNAs in the PFC of mouse offspring, and 20 selected deregulated miRNAs were further evaluated by quantitative polymerase chain reaction (PCR). A total of 11 targets of these selected deregulated miRNAs were analyzed using bioinformatics. Gene Ontology (GO) terms associated with the relevant miRNAs included neurogenesis (GO:0050769), neuron differentiation (GO:0030182) and brain development (GO:0007420). The genes Cdkn1a, Numbl, Notch1, Fosl1 and Lef1 are involved in the Wnt and Notch signaling pathways, which are closely associated with neural development. PCR arrays for the mouse Wnt and Notch signaling pathways were used to validate the effects of glyphosate on the expression pattern of genes involved in the Wnt and Notch pathways. Nr4a2 and Wnt7b were downregulated, while Dkk1, Dixdc1, Runx1, Shh, Lef-1 and Axin2 were upregulated in the PFC of mice offspring following glyphosate exposure during pregnancy and lactation. These results indicated abnormalities of the Wnt/β-catenin and Notch pathways. These findings may be of particular interest for understanding the mechanism of glyphosate-induced neurotoxicity, as

  3. Pro-apoptotic signaling induced by Retinoic acid and dsRNA is under the control of Interferon Regulatory Factor-3 in breast cancer cells.

    Science.gov (United States)

    Bernardo, Ana R; Cosgaya, José M; Aranda, Ana; Jiménez-Lara, Ana M

    2017-07-01

    Breast cancer is one of the most lethal malignancies for women. Retinoic acid (RA) and double-stranded RNA (dsRNA) are considered signaling molecules with potential anticancer activity. RA, co-administered with the dsRNA mimic polyinosinic-polycytidylic acid (poly(I:C)), synergizes to induce a TRAIL (Tumor-Necrosis-Factor Related Apoptosis-Inducing Ligand)- dependent apoptotic program in breast cancer cells. Here, we report that RA/poly(I:C) co-treatment, synergically, induce the activation of Interferon Regulatory Factor-3 (IRF3) in breast cancer cells. IRF3 activation is mediated by a member of the pathogen recognition receptors, Toll-like receptor-3 (TLR3), since its depletion abrogates IRF3 activation by RA/poly(I:C) co-treatment. Besides induction of TRAIL, apoptosis induced by RA/poly(I:C) correlates with the increased expression of pro-apoptotic TRAIL receptors, TRAIL-R1/2, and the inhibition of the antagonistic receptors TRAIL-R3/4. IRF3 plays an important role in RA/poly(I:C)-induced apoptosis since IRF3 depletion suppresses caspase-8 and caspase-3 activation, TRAIL expression upregulation and apoptosis. Interestingly, RA/poly(I:C) combination synergizes to induce a bioactive autocrine/paracrine loop of type-I Interferons (IFNs) which is ultimately responsible for TRAIL and TRAIL-R1/2 expression upregulation, while inhibition of TRAIL-R3/4 expression is type-I IFN-independent. Our results highlight the importance of IRF3 and type-I IFNs signaling for the pro-apoptotic effects induced by RA and synthetic dsRNA in breast cancer cells.

  4. Effect of Chinese Herbs Bu-shen on PRLR, PR, ER mRNA of Decidue in Bromocriptine-induced Hypoprolactin Rat Abortion Model

    Institute of Scientific and Technical Information of China (English)

    Kun-ming LI; Sui-qi GUI; Li-hui JIANG; Li-min LU

    2003-01-01

    Objective To explore the effect of Chinese herbs on PRLR, PR, ER mRNA of decidue in Bromocriptine-induced hypoprolactin abortion rat model from gene transcription level, and observe the changes of blood PRL, P, E2.Methods RT-PCR method was taken to analyses the differences of PRLR, PR, ER mRNA in decidue between model group (A group) and model + herbs group (A + H group); RIA was taken to measure the serum levels of PRL, P, E2.Results PRLR, PR mRNA expression in decidue of Group A was significantly lower than the A+H group (P0.05); the abortion rate of Group A was 67%, Group A+H was 17%, the difference was significant; as for the PRL and P level of day 7~10, the A group was significantly lower than the A+H group (P<0.05).Conclusion Bromocriptine could induce abortion by declining the blood PRL, P level and downregulating PRLR, PR mRNA expression in decidue. Chinese herbs might maintain pregnancy by promoting PRL, P secretion and upregulating PRLR, PR mRNA expression in decidue.

  5. Growth differentiation factor 3 is induced by bone morphogenetic protein 6 (BMP-6) and BMP-7 and increases luteinizing hormone receptor messenger RNA expression in human granulosa cells.

    Science.gov (United States)

    Shi, Jia; Yoshino, Osamu; Osuga, Yutaka; Akiyama, Ikumi; Harada, Miyuki; Koga, Kaori; Fujimoto, Akihisa; Yano, Tetsu; Taketani, Yuji

    2012-04-01

    To examine the relevance of growth differentiation factor 3 (GDF-3) and bone morphogenetic protein (BMP) cytokines in human ovary. Molecular studies. Research laboratory. Eight women undergoing salpingo-oophorectomy and 30 women undergoing ovarian stimulation for in vitro fertilization. Localizing GDF-3 protein in human ovaries; granulosa cells (GC) cultured with GDF-3, BMP-6, or BMP-7 followed by RNA extraction. The localization of GDF-3 protein in normal human ovaries via immunohistochemical analysis, GDF-3 messenger RNA (mRNA) expression evaluation via quantitative real-time reverse transcription and polymerase chain reaction (RT-PCR), and evaluation of the effect of GDF-3 on leuteinizing hormone (LH) receptor mRNA expression via quantitative real-time RT-PCR. In the ovary, BMP cytokines, of the transforming growth factor beta (TGF-β) superfamily, are known as a luteinization inhibitor by suppressing LH receptor expression in GC. Growth differentiation factor 3, a TGF-β superfamily cytokine, is recognized as an inhibitor of BMP cytokines in other cells. Immunohistochemical analysis showed that GDF-3 was strongly detected in the GC of antral follicles. An in vitro assay revealed that BMP-6 or BMP-7 induced GDF-3 mRNA in GC. Also, GDF-3 increased LH receptor mRNA expression and inhibited the effect of BMP-7, which suppressed the LH receptor mRNA expression in GC. GDF-3, induced with BMP-6 and BMP-7, might play a role in folliculogenesis by inhibiting the effect of BMP cytokines. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  6. Adrenal-dependent and -independent stress-induced Per1 mRNA in hypothalamic paraventricular nucleus and prefrontal cortex of male and female rats.

    Science.gov (United States)

    Chun, Lauren E; Christensen, Jenny; Woodruff, Elizabeth R; Morton, Sarah J; Hinds, Laura R; Spencer, Robert L

    2018-01-01

    Oscillating clock gene expression gives rise to a molecular clock that is present not only in the body's master circadian pacemaker, the hypothalamic suprachiasmatic nucleus (SCN), but also in extra-SCN brain regions. These extra-SCN molecular clocks depend on the SCN for entrainment to a light:dark cycle. The SCN has limited neural efferents, so it may entrain extra-SCN molecular clocks through its well-established circadian control of glucocorticoid hormone secretion. Glucocorticoids can regulate the normal rhythmic expression of clock genes in some extra-SCN tissues. Untimely stress-induced glucocorticoid secretion may compromise extra-SCN molecular clock function. We examined whether acute restraint stress during the rat's inactive phase can rapidly (within 30 min) alter clock gene (Per1, Per2, Bmal1) and cFos mRNA (in situ hybridization) in the SCN, hypothalamic paraventricular nucleus (PVN), and prefrontal cortex (PFC) of male and female rats (6 rats per treatment group). Restraint stress increased Per1 and cFos mRNA in the PVN and PFC of both sexes. Stress also increased cFos mRNA in the SCN of male rats, but not when subsequently tested during their active phase. We also examined in male rats whether endogenous glucocorticoids are necessary for stress-induced Per1 mRNA (6-7 rats per treatment group). Adrenalectomy attenuated stress-induced Per1 mRNA in the PVN and ventral orbital cortex, but not in the medial PFC. These data indicate that increased Per1 mRNA may be a means by which extra-SCN molecular clocks adapt to environmental stimuli (e.g. stress), and in the PFC this effect is largely independent of glucocorticoids.

  7. Inhibition of Poliovirus-Induced Cleavage of Cellular Protein PCBP2 Reduces the Levels of Viral RNA Replication

    Science.gov (United States)

    Chase, Amanda J.; Daijogo, Sarah

    2014-01-01

    ABSTRACT Due to their small genome size, picornaviruses must utilize host proteins to mediate cap-independent translation and viral RNA replication. The host RNA-binding protein poly(rC) binding protein 2 (PCBP2) is involved in both processes in poliovirus infected cells. It has been shown that the viral proteinase 3CD cleaves PCBP2 and contributes to viral translation inhibition. However, cleaved PCBP2 remains active in viral RNA replication. This would suggest that both cleaved and intact forms of PCBP2 have a role in the viral RNA replication cycle. The picornavirus genome must act as a template for both translation and RNA replication. However, a template that is actively being translated cannot function as a template for RNA replication, suggesting that there is a switch in template usage from translation to RNA replication. We demonstrate that the cleavage of PCBP2 by the poliovirus 3CD proteinase is a necessary step for efficient viral RNA replication and, as such, may be important for mediating a switch in template usage from translation to RNA replication. IMPORTANCE Poliovirus, like all positive-strand RNA viruses that replicate in the cytoplasm of eukaryotic cells, uses its genomic RNA as a template for both viral protein synthesis and RNA replication. Given that these processes cannot occur simultaneously on the same template, poliovirus has evolved a mechanism(s) to facilitate the switch from using templates for translation to using them for RNA synthesis. This study explores one possible scenario for how the virus alters the functions of a host cell RNA binding protein to mediate, in part, this important transition. PMID:24371074

  8. MICROPROCESADOR DIDÁCTICO DE ARQUITECTURA RISC IMPLEMENTADO EN UN FPGA

    Directory of Open Access Journals (Sweden)

    Víctor H. García Ortega

    2009-01-01

    Full Text Available En este trabajo se presenta el diseño e implementación de un microprocesador de 16 bits de arquitectura RISC tipo MIPS. Las características principales que presenta el microprocesador son: una arquitectura Harvard con una memoria de programa de 64K x 25 bits y una memoria de datos de 64k x 16 bits, una pila de ocho niveles implementada en hardware y la Unidad Lógica-Aritmética (ALU con esquema de acarreo anticipado por propagación y generación para el aumento de velocidad en la ejecución de las operaciones aritméticas. La unidad de control decodifica y maneja las señales de control del microprocesador para ejecutar las instrucciones en un solo ciclo de reloj. La implementación se realizó en un dispositivo lógico programable del tipo FPGA (Field Programmable Gate Array de la familia Spartan-3A de Xilinx. El diseño de cada elemento del microprocesador se desarrolló con el lenguaje de descripción de hardware VHDL.

  9. The Long Non-Coding RNA XIST Controls Non-Small Cell Lung Cancer Proliferation and Invasion by Modulating miR-186-5p

    Directory of Open Access Journals (Sweden)

    Haoyou Wang

    2017-04-01

    Full Text Available Background/Aims: Long non-coding RNAs (lncRNAs are key players in the development and progression of human cancers. The lncRNA XIST (X-inactive specific transcript has been shown to be upregulated in human non-small cell lung cancer (NSCLC; however, its role and molecular mechanisms in NSCLC cell progression remain unclear. Methods: qRT-PCR was conducted to assess the expression of XIST and miR-186. Cell proliferation was detected using MTT assay. Cell invasion and migration were evaluated using transwell assay. Cell cycle distribution and apoptosis rates were analyzed by flow cytometry. Luciferase reporter assay was used to identify the direct regulation of XIST and miR-186. A RNA immunoprecipitation was used to analyze whether XIST was associated with the RNA-induced silencing complex (RISC. Results: We confirmed that XIST was upregulated in NSCLC cell lines and tissues. Functionally, XIST knockdown inhibited cancer cell proliferation and invasion, and induced apoptosis in vitro, and suppressed subcutaneous tumor growth in vivo. Mechanistic investigations revealed a reciprocal repressive interaction between XIST and miR-186-5p. Furthermore, we showed that miR-186-5p has a binding site for XIST. Our data also indicated that XIST and miR-186-5p are likely in the same RNA induced silencing complex. Conclusion: Together, our data revealed that XIST knockdown confers suppressive function in NSCLC and XIST may be a novel therapeutic marker in this disease.

  10. Expressions of interferon-inducible genes IFIT1 and IFIT4 mRNA in PBMCs of patients with systemic lupus erythematosus

    International Nuclear Information System (INIS)

    Liu Chunyan; Chen Xingguo; Wang Zizheng

    2009-01-01

    To investigate the expression levels of interferon-inducible genes (IFIT1, IFIT4) in the peripheral blood mononuclear cells (PBMCs) of patients with systemic lupus erythematosus (SLE), and the relations between these genes expression levels and disease activity, the expression levels of IFIT1 and IFIT4 mRNA in the 95 patients with SLE and 48 normal controls were detected by Sybr green dye based real-time quantitative PCR method, and these genes expression levels were compared with anti-double strand DNA antibody. The associations between the expression levels of IFIT1, IFIT4 mRNA, anti-double strand DNA antibody and SLEDAI scores in patients with SLE were analyzed. The results showed that the expression levels of IFIT1, IFIT4 mRNA in the SLE patients were significantly higher than those of the normal controls (P<0.01). The expression levels of IFIT1, IFIT4 mRNA in the active SLE patients were higher than those of the inactive SLE patients (P<0.05). The real time expression levels of IFIT1 and IFIT4 mRNA showed positive correlations with each other (P<0.05) in patients with SLE. There was positively correlation between the expression levels of IFIT1, IFIT4 mRNA and the anti-double strand DNA antibody (P<0.05). The expression levels of IFIT1, IFIT4 mRNA in patients with SLE were significantly higher than those of the normal controls, and positively associated with SLEDAI scores, so they were helpful in evaluating SLE disease activity and severity. To inhibit the expressions of IFIT1, IFIT4 mRNA may provide a novel target for SLE treatment. (authors)

  11. microRNA-340 induces apoptosis by downregulation of BAG3 in ovarian cancer SKOV3 cells.

    Science.gov (United States)

    Qu, Fei; Wang, Xiufen

    2017-08-01

    Aberrant expression of miR-340 has been found in several kinds of cancers including ovarian cancer. Pro-apoptotic and anti-metastasis roles of miR-340 in ovarian cancer have also been reported; however, the underling molecular mechanisms by which miR-340 suppresses ovarian cancer are still unclear. This study focused on the role and molecular mechanism of miR-340 in ovarian cancer. Human ovarian carcinoma SKOV3 cells were used and transfected with miR-340 mimic, miR-340 inhibitor and their correspondingly negative controls (mimic control and inhibitor control). Thereafter, cell viability, apoptosis, and the expressions of apoptosis-associated factors and BAG3 were respectively assessed by MTT assay, flow cytometry, qRT-PCR and Western blotting. SKOV3 cells were then co-transfected with miR-340 inhibitor and BAG3 targeted siRNA, then cell viability, apoptosis and the expression of apoptosis-associated factors were retested. Besides, the expressions of main factors in PI3K/AKT pathway were detected. Overexpression of miR-340 suppressed BAG3 cells viability (P BAG3 was negatively regulated by miR-340 (P BAG3 silence significantly induced cell apoptosis (P BAG3 silence abolished miR-340 suppression-induced activation of PI3K and AKT. This study revealed the tumor suppressive role of miR-340 in SKOV3 cells by negative regulation of BAG3. PI3K/AKT pathway might be involved in the regulation of miR-340 and BAG3.

  12. Foot-and-mouth disease virus leader proteinase inhibits dsRNA-induced type I interferon transcription by decreasing interferon regulatory factor 3/7 in protein levels

    International Nuclear Information System (INIS)

    Wang, Dang; Fang, Liurong; Luo, Rui; Ye, Rui; Fang, Ying; Xie, Lilan; Chen, Huanchun; Xiao, Shaobo

    2010-01-01

    Research highlights: → FMDV L pro inhibits poly(I:C)-induced IFN-α1/β mRNA expression. → L pro inhibits MDA5-mediated activation of the IFN-α1/β promoter. → L pro significantly reduced the transcription of multiple IRF-responsive genes. → L pro inhibits IFN-α1/β promoter activation by decreasing IRF-3/7 in protein levels. → The ability to process eIF-4G of L pro is not necessary to inhibit IFN-α1/β activation. -- Abstract: The leader proteinase (L pro ) of foot-and-mouth disease virus (FMDV) has been identified as an interferon-β (IFN-β) antagonist that disrupts the integrity of transcription factor nuclear factor κB (NF-κB). In this study, we showed that the reduction of double stranded RNA (dsRNA)-induced IFN-α1/β expression caused by L pro was also associated with a decrease of interferon regulatory factor 3/7 (IRF-3/7) in protein levels, two critical transcription factors for activation of IFN-α/β. Furthermore, overexpression of L pro significantly reduced the transcription of multiple IRF-responsive genes including 2',5'-OAS, ISG54, IP-10, and RANTES. Screening L pro mutants indicated that the ability to process eIF-4G of L pro is not required for suppressing dsRNA-induced activation of the IFN-α1/β promoter and decreasing IRF-3/7 expression. Taken together, our results demonstrate that, in addition to disrupting NF-κB, L pro also decreases IRF-3/7 expression to suppress dsRNA-induced type I IFN production, suggesting multiple strategies used by FMDV to counteract the immune response to viral infection.

  13. Foot-and-mouth disease virus leader proteinase inhibits dsRNA-induced type I interferon transcription by decreasing interferon regulatory factor 3/7 in protein levels

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Dang; Fang, Liurong; Luo, Rui; Ye, Rui; Fang, Ying; Xie, Lilan; Chen, Huanchun [Division of Animal Infectious Diseases, State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070 (China); Xiao, Shaobo, E-mail: shaoboxiao@yahoo.com [Division of Animal Infectious Diseases, State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070 (China)

    2010-08-13

    Research highlights: {yields} FMDV L{sup pro} inhibits poly(I:C)-induced IFN-{alpha}1/{beta} mRNA expression. {yields} L{sup pro} inhibits MDA5-mediated activation of the IFN-{alpha}1/{beta} promoter. {yields} L{sup pro} significantly reduced the transcription of multiple IRF-responsive genes. {yields} L{sup pro} inhibits IFN-{alpha}1/{beta} promoter activation by decreasing IRF-3/7 in protein levels. {yields} The ability to process eIF-4G of L{sup pro} is not necessary to inhibit IFN-{alpha}1/{beta} activation. -- Abstract: The leader proteinase (L{sup pro}) of foot-and-mouth disease virus (FMDV) has been identified as an interferon-{beta} (IFN-{beta}) antagonist that disrupts the integrity of transcription factor nuclear factor {kappa}B (NF-{kappa}B). In this study, we showed that the reduction of double stranded RNA (dsRNA)-induced IFN-{alpha}1/{beta} expression caused by L{sup pro} was also associated with a decrease of interferon regulatory factor 3/7 (IRF-3/7) in protein levels, two critical transcription factors for activation of IFN-{alpha}/{beta}. Furthermore, overexpression of L{sup pro} significantly reduced the transcription of multiple IRF-responsive genes including 2',5'-OAS, ISG54, IP-10, and RANTES. Screening L{sup pro} mutants indicated that the ability to process eIF-4G of L{sup pro} is not required for suppressing dsRNA-induced activation of the IFN-{alpha}1/{beta} promoter and decreasing IRF-3/7 expression. Taken together, our results demonstrate that, in addition to disrupting NF-{kappa}B, L{sup pro} also decreases IRF-3/7 expression to suppress dsRNA-induced type I IFN production, suggesting multiple strategies used by FMDV to counteract the immune response to viral infection.

  14. Targeting chitinase gene of Helicoverpa armigera by host-induced RNA interference confers insect resistance in tobacco and tomato.

    Science.gov (United States)

    Mamta; Reddy, K R K; Rajam, M V

    2016-02-01

    Helicoverpa armigera Hübner (Lepidoptera: Noctuidae) is a devastating agricultural insect pest with broad spectrum of host range, causing million dollars crop loss annually. Limitations in the present conventional and transgenic approaches have made it crucial to develop sustainable and environmental friendly methods for crop improvement. In the present study, host-induced RNA interference (HI-RNAi) approach was used to develop H. armigera resistant tobacco and tomato plants. Chitinase (HaCHI) gene, critically required for insect molting and metamorphosis was selected as a potential target. Hair-pin RNAi construct was prepared from the conserved off-target free partial HaCHI gene sequence and was used to generate several HaCHI-RNAi tobacco and tomato plants. Northern hybridization confirmed the production of HaCHI gene-specific siRNAs in HaCHI-RNAi tobacco and tomato lines. Continuous feeding on leaves of RNAi lines drastically reduced the target gene transcripts and consequently, affected the overall growth and survival of H. armigera. Various developmental deformities were also manifested in H. armigera larvae after feeding on the leaves of RNAi lines. These results demonstrated the role of chitinase in insect development and potential of HI-RNAi for effective management of H. armigera.

  15. Inhalable delivery of AAV-based MRP4/ABCC4 silencing RNA prevents monocrotaline-induced pulmonary hypertension

    Directory of Open Access Journals (Sweden)

    Caroline Claude

    Full Text Available The ATP-binding cassette transporter MRP4 (encoded by ABCC4 regulates membrane cyclic nucleotides concentrations in arterial cells including smooth muscle cells. MRP4/ABCC4 deficient mice display a reduction in smooth muscle cells proliferation and a prevention of pulmonary hypertension in response to hypoxia. We aimed to study gene transfer of a MRP4/ABCC4 silencing RNA via intratracheal delivery of aerosolized adeno-associated virus 1 (AAV1.shMRP4 or AAV1.control in a monocrotaline-induced model of pulmonary hypertension in rats. Gene transfer was performed at the time of monocrotaline administration and the effect on the development of pulmonary vascular remodeling was assessed 35 days later. AAV1.shMRP4 dose-dependently reduced right ventricular systolic pressure and hypertrophy with a significant reduction with the higher doses (i.e., >1011 DRP/animal as compared to AAV1.control. The higher dose of AAV1.shMRP4 was also associated with a significant reduction in distal pulmonary arteries remodeling. AAV1.shMRP4 was finally associated with a reduction in the expression of ANF, a marker of cardiac hypertrophy. Collectively, these results support a therapeutic potential for downregulation of MRP4 for the treatment of pulmonary artery hypertension.

  16. Genome-wide mapping of infection-induced SINE RNAs reveals a role in selective mRNA export.

    Science.gov (United States)

    Karijolich, John; Zhao, Yang; Alla, Ravi; Glaunsinger, Britt

    2017-06-02

    Short interspersed nuclear elements (SINEs) are retrotransposons evolutionarily derived from endogenous RNA Polymerase III RNAs. Though SINE elements have undergone exaptation into gene regulatory elements, how transcribed SINE RNA impacts transcriptional and post-transcriptional regulation is largely unknown. This is partly due to a lack of information regarding which of the loci have transcriptional potential. Here, we present an approach (short interspersed nuclear element sequencing, SINE-seq), which selectively profiles RNA Polymerase III-derived SINE RNA, thereby identifying transcriptionally active SINE loci. Applying SINE-seq to monitor murine B2 SINE expression during a gammaherpesvirus infection revealed transcription from 28 270 SINE loci, with ∼50% of active SINE elements residing within annotated RNA Polymerase II loci. Furthermore, B2 RNA can form intermolecular RNA-RNA interactions with complementary mRNAs, leading to nuclear retention of the targeted mRNA via a mechanism involving p54nrb. These findings illuminate a pathway for the selective regulation of mRNA export during stress via retrotransposon activation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. PI3K-delta mediates double-stranded RNA-induced upregulation of B7-H1 in BEAS-2B airway epithelial cells

    International Nuclear Information System (INIS)

    Kan-o, Keiko; Matsumoto, Koichiro; Asai-Tajiri, Yukari; Fukuyama, Satoru; Hamano, Saaka; Seki, Nanae; Nakanishi, Yoichi; Inoue, Hiromasa

    2013-01-01

    Highlights: •Double-stranded RNA upregulates B7-H1 on BEAS-2B airway epithelial cells. •The upregulation of B7-H1 is attenuated by inhibition of PI3Kδ isoform. •PI3Kδ-mediated upregulation of B7-H1 is independent of NF-κB activation. •Inhibition of PI3Kδ may prevent persistent viral infection induced by B7-H1. -- Abstract: Airway viral infection disturbs the health-related quality of life. B7-H1 (also known as PD-L1) is a coinhibitory molecule associated with the escape of viruses from the mucosal immunity, leading to persistent infection. Most respiratory viruses generate double-stranded (ds) RNA during replication. The stimulation of cultured airway epithelial cells with an analog of viral dsRNA, polyinosinic-polycytidylic acid (poly IC) upregulates the expression of B7-H1 via activation of the nuclear factor κB(NF-κB). The mechanism of upregulation was investigated in association with phosphatidylinositol 3-kinases (PI3Ks). Poly IC-induced upregulation of B7-H1 was profoundly suppressed by a pan-PI3K inhibitor and partially by an inhibitor or a small interfering (si)RNA for PI3Kδ in BEAS-2B cells. Similar results were observed in the respiratory syncytial virus-infected cells. The expression of p110δ was detected by Western blot and suppressed by pretreatment with PI3Kδ siRNA. The activation of PI3Kδ is typically induced by oxidative stress. The generation of reactive oxygen species was increased by poly IC. Poly IC-induced upregulation of B7-H1 was attenuated by N-acetyl-L-cysteine, an antioxidant, or by oxypurinol, an inhibitor of xanthine oxidase. Poly IC-induced activation of NF-κB was suppressed by a pan-PI3K inhibitor but not by a PI3Kδ inhibitor. These results suggest that PI3Kδ mediates dsRNA-induced upregulation of B7-H1 without affecting the activation of NF-κB

  18. UV-induced modifications in the peptidyl transferase loop of 23S rRNA dependent on binding of the streptogramin B antibiotic, pristinamycin IA

    DEFF Research Database (Denmark)

    Porse, B T; Kirillov, S V; Awayez, M J

    1999-01-01

    The naturally occurring streptogramin B antibiotic, pristinamycin IA, which inhibits peptide elongation, can produce two modifications in 23S rRNA when bound to the Escherichia coli 70S ribosome and irradiated at 365 nm. Both drug-induced effects map to highly conserved nucleotides within...... in the latter modification to A2062/C2063. Pristinamycin IA can also produce a modification on binding to deproteinized, mature 23S rRNA, at position U2500/C2501. The same modification occurs on an approximately 37-nt fragment, encompassing positions approximately 2496-2532 of the peptidyl transferase loop...... the sequence Cm-C-U-C-G-m2A-psi-G2505 are important for pristinamycin IA binding and/or the antibiotic-dependent modification of 23S rRNA....

  19. Analysis of plasma microRNA expression profiles in male textile workers with noise-induced hearing loss.

    Science.gov (United States)

    Ding, Lu; Liu, Jing; Shen, Huan-Xi; Pan, Li-Ping; Liu, Qing-Dong; Zhang, Heng-Dong; Han, Lei; Shuai, Li-Guo; Ding, En-Min; Zhao, Qiu-Ni; Wang, Bo-Shen; Zhu, Bao-Li

    2016-03-01

    Circulating microRNAs (miRNAs) have attracted interests as non-invasive biomarkers of physiological and pathological conditions, which may be applied in noise-induced hearing loss (NIHL). However, no epidemiology studies have yet examined the potential effects of NIHL or noise exposure on miRNA expression profiles. We sought to identify permanent NIHL-related miRNAs and to predict the biological functions of the putative genes encoding the indicated miRNAs. In the discovery stage, we used a microarray assay to detect the miRNA expression profiles between pooled plasma samples from 10 noise-exposed individuals with normal hearing and 10 NIHL patients. In addition, we conducted a preliminary validation of six candidate miRNAs in the same 20 workers. Subsequently, three miRNAs were selected for expanded validation in 23 non-exposed individuals with normal hearing and 46 noise-exposed textile workers which including 23 noise-exposed workers with normal hearing and 23 NIHL patients. Moreover, we predicted the biological functions of the putative target genes using a Gene Ontology (GO) function enrichment analysis. In the discovery stage, compared with the noise exposures with normal hearing, 73 miRNAs demonstrated at least a 1.5-fold differential expression in the NIHL patients. In the preliminary validation, compared with the noise exposures, the plasma levels of miR-16-5p, miR-24-3p, miR-185-5p and miR-451a were all upregulated (P < 0.001) in the NIHL patients. In the expanded validation stage, compared with the non-exposures, the plasma levels of miR-24, miR-185-5p and miR-451a were all significantly downregulated (P < 0.001) in the exposures. And compared with the noise exposures, the plasma levels of miR-185-5p and miR-451a were slightly elevated (P < 0.001) in the NIHL patients, which were consistent with the results of preliminary validation and microarray analysis. The two indicated plasma miRNAs may be biomarkers of indicating responses to noise exposure

  20. High Intensity High Volume Interval Training Improves Endurance Performance and Induces a Nearly Complete Slow-to-Fast Fiber Transformation on the mRNA Level

    Directory of Open Access Journals (Sweden)

    Julian Eigendorf

    2018-05-01

    Full Text Available We present here a longitudinal study determining the effects of two 3 week-periods of high intensity high volume interval training (HIHVT (90 intervals of 6 s cycling at 250% maximum power, Pmax/24 s on a cycle ergometer. HIHVT was evaluated by comparing performance tests before and after the entire training (baseline, BSL, and endpoint, END and between the two training sets (intermediate, INT. The mRNA expression levels of myosin heavy chain (MHC isoforms and markers of energy metabolism were analyzed in M. vastus lateralis biopsies by quantitative real-time PCR. In incremental tests peak power (Ppeak was increased, whereas V˙O2peak was unaltered. Prolonged time-to-exhaustion was found in endurance tests with 65 and 80% Pmax at INT and END. No changes in blood levels of lipid metabolites were detected. Training-induced decreases of hematocrit indicate hypervolemia. A shift from slow MHCI/β to fast MHCIIa mRNA expression occurred after the first and second training set. The mRNA expression of peroxisome proliferator-activated receptor gamma coactivator 1α (PGC-1α, a master regulator of oxidative energy metabolism, decreased after the second training set. In agreement, a significant decrease was also found for citrate synthase mRNA after the second training set, indicating reduced oxidative capacity. However, mRNA expression levels of glycolytic marker enzyme glyceraldehyde-3-phosphate dehydrogenase did not change after the first and second training set. HIHVT induced a nearly complete slow-to-fast fiber type transformation on the mRNA level, which, however, cannot account for the improvements of performance parameters. The latter might be explained by the well-known effects of hypervolemia on exercise performance.

  1. Uncoupling of the hnRNP Npl3p from mRNAs during the stress-induced block in mRNA export.

    Science.gov (United States)

    Krebber, H; Taura, T; Lee, M S; Silver, P A

    1999-08-01

    Npl3p, the major mRNA-binding protein of the yeast Saccharomyces cerevisiae shuttles between the nucleus and the cytoplasm. A single amino acid change in the carboxyl terminus of Npl3p (E409 --> K) renders the mutant protein largely cytoplasmic because of a delay in its import into the nucleus. This import defect can be reversed by increasing the intracellular concentration of Mtr10p, the nuclear import receptor for Npl3p. Conversely, using this mutant, we show that Npl3p and mRNA export out of the nucleus is significantly slowed in cells bearing mutations in XPO1/CRM1, which encodes the export receptor for NES-containing proteins and in RAT7, which encodes an essential nucleoporin. Interestingly, following induction of stress by heat shock, high salt, or ethanol, conditions under which most mRNA export is blocked, Npl3p is still exported from the nucleus. The stress-induced export of Npl3p is independent of both the activity of Xpo1p and the continued selective export of heat-shock mRNAs that occurs following stress. UV-cross-linking experiments show that Npl3p is bound to mRNA under normal conditions, but is no longer RNA associated in stressed cells. Taken together, we suggest that the uncoupling of Npl3p and possibly other mRNA-binding proteins from mRNAs in the nucleus provides a general switch that regulates mRNA export. By this model, under normal conditions Npl3p is a major component of an export-competent RNP complex. However, under conditions of stress, Npl3p no longer associates with the export complex, rendering it export incompetent and thus nuclear.

  2. Sodium arsenite-induced inhibition of cell proliferation is related to inhibition of IL-2 mRNA expression in mouse activated T cells

    Energy Technology Data Exchange (ETDEWEB)

    Conde, Patricia; Acosta-Saavedra, Leonor C.; Calderon-Aranda, Emma S. [Centro de Investigacion y de Estudios Avanzados, CINVESTAV, Seccion Toxicologia, P.O. Box 14-740, Mexico, D.F. (Mexico); Goytia-Acevedo, Raquel C. [Universidad Juarez del Estado de Durango, Facultad de Medicina, Gomez Palacio, Durango (Mexico)

    2007-04-15

    A proposed mechanism for the As-induced inhibition of cell proliferation is the inhibition of IL-2 secretion. However, the effects of arsenite on IL-2 mRNA expression or on the ERK pathway in activated-T cells have not yet been described. We examined the effect of arsenite on IL-2 mRNA expression, cell activation and proliferation in PHA-stimulated murine lymphocytes. Arsenite (1 and 10 {mu}M) decreased IL-2 mRNA expression, IL-2 secretion and cell proliferation. Arsenite (10 {mu}M) strongly inhibited ERK-phosphorylation. However, the partial inhibition (50%) of IL-2 mRNA produced by 1 {mu}M, consistent with the effects on IL-2 secretion and cell proliferation, could not be explained by the inhibition of ERK-phosphorylation, which was not affected at this concentration. The inhibition of IL-2 mRNA expression caused by 1 {mu}M could be associated to effects on pathways located downstream or parallel to ERK. Arsenite also decreased early activation (surface CD69{sup +} expression) in both CD4{sup +} and CD8{sup +}, and decreased total CD8{sup +} count without significantly affecting CD4{sup +}, supporting that the cellular immune response mediated by cytotoxic T cells is an arsenic target. Thus, our results suggest that arsenite decreases IL-2 mRNA levels and T-cell activation and proliferation. However, further studies on the effects of arsenite on IL-2 gene transcription and IL-2 mRNA stability are needed. (orig.)

  3. Keratin-18 and microRNA-122 complement alanine aminotransferase as novel safety biomarkers for drug-induced liver injury in two human cohorts.

    Science.gov (United States)

    Thulin, Petra; Nordahl, Gunnar; Gry, Marcus; Yimer, Getnet; Aklillu, Eleni; Makonnen, Eyasu; Aderaye, Getachew; Lindquist, Lars; Mattsson, C Mikael; Ekblom, Björn; Antoine, Daniel J; Park, B Kevin; Linder, Stig; Harrill, Alison H; Watkins, Paul B; Glinghammar, Björn; Schuppe-Koistinen, Ina

    2014-03-01

    There is a demand for more sensitive, specific and predictive biomarkers for drug-induced liver injury (DILI) than the gold standard used today, alanine aminotransferase (ALT). The aim of this study was to qualify novel DILI biomarkers (keratin-18 markers M65/M30, microRNA-122, glutamate dehydrogenase and alpha-foetoprotein) in human DILI. Levels of the novel biomarkers were measured by enzyme-linked immunosorbent assay or real-time quantitative reverse-transcription PCR (qRT-PCR) in two human DILI cohorts: a human volunteer study with acetaminophen and a human immunodeficiency virus (HIV)/tuberculosis (TB) study. In the acetaminophen study, serum M65 and microRNA-122 levels were significantly increased at an earlier time point than ALT. Furthermore, the maximal elevation of M65 and microRNA-122 exceeded the increase in ALT. In the HIV/TB study, all the analysed novel biomarkers increased after 1 week of treatment. In contrast to ALT, the novel biomarkers remained stable in a human cohort with exercise-induced muscular injury. M65 and microRNA-122 are potential biomarkers of DILI superior to ALT with respect to sensitivity and specificity. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. Expression of Flk-1 and Cyclin D2 mRNA in the Myocardium of Rats with Doxorubicin-Induced Cardiomyopathy and after Treatment with Betulonic Acid Amide.

    Science.gov (United States)

    Mzhelskaya, M M; Klinnikova, M G; Koldysheva, E V; Lushnikova, E L

    2017-10-01

    The expression of VEGFR2 (Flk-1, according to immunohistochemistry) and of cyclin D2 mRNA (according to real-time PCR) in the myocardium of rats is studied in doxorubicin-induced cardiomyopathy and in response to betulonic acid amide. Doxorubicin alone and in combination with betulonic acid amide causes after 3 days a manifest reduction of cyclin D2 mRNA expression (by 38 and 63%, respectively), while injection of betulonic acid amide alone causes a 23-fold increase of cyclin D2 mRNA expression. An increase of cyclin D2 mRNA expression has been detected in all experimental groups after 14 days of experiment, the most pronounced in response to betulonic acid amide (63 times). The expression of Flk-1 in cardiomyocytes increases significantly in response to both chemical agents starting from day 3 of experiment. These results indicate that doxorubicin and betulonic acid amide induce cytoprotective reactions in the myocardium, first at the intracellular, then at the cellular levels.

  5. Inducible and reversible suppression of Npm1 gene expression using stably integrated small interfering RNA vector in mouse embryonic stem cells

    International Nuclear Information System (INIS)

    Wang Beibei; Lu Rui; Wang Weicheng; Jin Ying

    2006-01-01

    The tetracycline (Tc)-inducible small interference RNA (siRNA) is a powerful tool for studying gene function in mammalian cells. However, the system is infrequently utilized in embryonic stem (ES) cells. Here, we present First application of the Tc-inducible, stably integrated plasmid-based siRNA system in mouse ES cells to down-regulate expression of Npm1, an essential gene for embryonic development. The physiological role of Npm1 in ES cells has not been defined. Our data show that the knock-down of Npm1 expression by this siRNA system was not only highly efficient, but also Tc- dose- and induction time-dependent. Particularly, the down-regulation of Npm1 expression was reversible. Importantly, suppression of Npm1 expression in ES cells resulted in reduced cell proliferation. Taken together, this system allows for studying gene function in a highly controlled manner, otherwise difficult to achieve in ES cells. Moreover, our results demonstrate that Npm1 is essential for ES cell proliferation

  6. Ultraviolet light-induced crosslinking reveals a unique region of local tertiary structure in potato spindle tuber viroid and HeLa 5S RNA

    International Nuclear Information System (INIS)

    Branch, A.D.; Benenfeld, B.J.; Robertson, H.D.

    1985-01-01

    The positions of intramolecular crosslinks induced by irradiation with ultraviolet light were mapped into potato spindle tuber viroid RNA and HeLa 5S rRNA. Crosslinking in each of these molecules occurred at a single major site, which was located by RNA fingerprinting and secondary analysis. Various lines of evidence suggest that these crosslinks identify a previously undescribed element of local tertiary structure common to these two widely divergent RNA molecules: (i) both crosslinks occur in an identical eight-base context, with the sequence 5 GGGAA 3 on one side and the sequence 5 UAC 3 on the other; (ii) both crosslinks connect bases that are not thought to be involved in conventional hydrogen bonding, within regions usually depicted as single-stranded loops flanked by short helical segments; and (iii) both crosslinks connect a purine and a pyrimidine residue, and both may generate the same G-U dimer. Furthermore, it is likely that the crosslinking site is of functional significance because it is located within the most highly conserved region of the viroid sequence and involves bases that are essentially invariant among eukaryotic 5S rRNA molecules

  7. Transgenic Expression of the piRNA-Resistant Masculinizer Gene Induces Female-Specific Lethality and Partial Female-to-Male Sex Reversal in the Silkworm, Bombyx mori.

    Science.gov (United States)

    Sakai, Hiroki; Sumitani, Megumi; Chikami, Yasuhiko; Yahata, Kensuke; Uchino, Keiro; Kiuchi, Takashi; Katsuma, Susumu; Aoki, Fugaku; Sezutsu, Hideki; Suzuki, Masataka G

    2016-08-01

    In Bombyx mori (B. mori), Fem piRNA originates from the W chromosome and is responsible for femaleness. The Fem piRNA-PIWI complex targets and cleaves mRNAs transcribed from the Masc gene. Masc encodes a novel CCCH type zinc-finger protein and is required for male-specific splicing of B. mori doublesex (Bmdsx) transcripts. In the present study, several silkworm strains carrying a transgene, which encodes a Fem piRNA-resistant Masc mRNA (Masc-R), were generated. Forced expression of the Masc-R transgene caused female-specific lethality during the larval stages. One of the Masc-R strains weakly expressed Masc-R in various tissues. Females heterozygous for the transgene expressed male-specific isoform of the Bombyx homolog of insulin-like growth factor II mRNA-binding protein (ImpM) and Bmdsx. All examined females showed a lower inducibility of vitellogenin synthesis and exhibited abnormalities in the ovaries. Testis-like tissues were observed in abnormal ovaries and, notably, the tissues contained considerable numbers of sperm bundles. Homozygous expression of the transgene resulted in formation of the male-specific abdominal segment in adult females and caused partial male differentiation in female genitalia. These results strongly suggest that Masc is an important regulatory gene of maleness in B. mori.

  8. Genetic Tools for Self-Organizing Culture of Mouse Embryonic Stem Cells via Small Regulatory RNA-Mediated Technologies, CRISPR/Cas9, and Inducible RNAi.

    Science.gov (United States)

    Takata, Nozomu; Sakakura, Eriko; Sakuma, Tetsushi; Yamamoto, Takashi

    2017-01-01

    Approaches to investigate gene functions in experimental biology are becoming more diverse and reliable. Furthermore, several kinds of tissues and organs that possess their original identities can be generated in petri dishes from stem cells including embryonic, adult and induced pluripotent stem cells. Researchers now have several choices of experimental methods and their combinations to analyze gene functions in various biological systems. Here, as an example we describe one of the better protocols, which combines three-dimensional embryonic stem cell culture with small regulatory RNA-mediated technologies, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9), and inducible RNA interference (RNAi). This protocol allows investigation of genes of interest to better understand gene functions in target tissues (or organs) during in vitro development.

  9. Non-targeted effects of ionising radiation. Proceedings of the RISC-RAD specialised training course

    International Nuclear Information System (INIS)

    Belyakov, O.V.

    2008-12-01

    The training course 'Non-targeted effects of ionising radiation' took place at the STUK, Radiation and Nuclear Safety Authority, Helsinki, Finland 14-16 February 2005. Proceeding of this course is collected in this volume. The idea of the course was to convene a number of scientists leading in the area of non-targeted effects of ionising radiation with the aim to outline their visions for the role of these effects and outline the future directions of radiation research on the basis of their expertise. The course was supported by the RISC-RAD IP FI6R-CT-2003-508842, Euratom specific programme for research and training on nuclear energy, 6th FP of the EC. The main objectives of the training course were: (1) to clarify the mechanisms of non-targeted effects, in particular, bystander effects, genomic instability and adaptive response; (2) to look if and how non-targeted effects modulate the cancer risk in the low dose region, and whether they relate to protective or harmful functions; (3) to clarify if ionising radiation can cause non-cancer diseases or beneficial effects at low and intermediate doses; (4) address the issue of individual susceptibility and other factors modifying non-targeted responses; (5) attempt to assess the relevance of non-targeted effects for radiation protection and to set the scientific basis for a modern, more realistic, radiation safety system; (6) and finally to contribute to the conceptualisation of a new paradigm in radiation biology that would cover both the classical direct (DNA-targeted) and non-targeted (indirect) effects

  10. MicroRNA-155 attenuates late sepsis-induced cardiac dysfunction through JNK and β-arrestin 2.

    Science.gov (United States)

    Zhou, Yu; Song, Yan; Shaikh, Zahir; Li, Hui; Zhang, Haiju; Caudle, Yi; Zheng, Shouhua; Yan, Hui; Hu, Dan; Stuart, Charles; Yin, Deling

    2017-07-18

    Cardiac dysfunction is correlated with detrimental prognosis of sepsis and contributes to a high risk of mortality. After an initial hyperinflammatory reaction, most patients enter a protracted state of immunosuppression (late sepsis) that alters both innate and adaptive immunity. The changes of cardiac function in late sepsis are not yet known. MicroRNA-155 (miR-155) is previously found to play important roles in both regulations of immune activation and cardiac function. In this study, C57BL/6 mice were operated to develop into early and late sepsis phases, and miR-155 mimic was injected through the tail vein 48 h after cecal ligation and puncture (CLP). The effect of miR-155 on CLP-induced cardiac dysfunction was explored in late sepsis. We found that increased expression of miR-155 in the myocardium protected against cardiac dysfunction in late sepsis evidenced by attenuating sepsis-reduced cardiac output and enhancing left ventricular systolic function. We also observed that miR-155 markedly reduced the infiltration of macrophages and neutrophils into the myocardium and attenuated the inflammatory response via suppression of JNK signaling pathway. Moreover, overexpression of β-arrestin 2 (Arrb2) exacerbated the mice mortality and immunosuppression in late sepsis. Furthermore, transfection of miR-155 mimic reduced Arrb2 expression, and then restored immunocompetence and improved survival in late septic mice. We conclude that increased miR-155 expression through systemic administration of miR-155 mimic attenuates cardiac dysfunction and improves late sepsis survival by targeting JNK associated inflammatory signaling and Arrb2 mediated immunosuppression.

  11. Enhanced expressions of mRNA for neuropeptide Y and interleukin 1 beta in hypothalamic arcuate nuclei during adjuvant arthritis-induced anorexia in Lewis rats.

    Science.gov (United States)

    Stofkova, Andrea; Haluzik, Martin; Zelezna, Blanka; Kiss, Alexander; Skurlova, Martina; Lacinova, Zdenka; Jurcovicova, Jana

    2009-01-01

    Food intake is activated by hypothalamic orexigenic neuropeptide Y (NPY), which is mainly under the dual control of leptin and ghrelin. Rat adjuvant arthritis (AA), similarly as human rheumatoid arthritis, is associated with cachexia caused by yet unknown mechanisms. The aim of our study was to evaluate NPY expression in hypothalamic arcuate nuclei (nARC) under the conditions of AA-induced changes in leptin, ghrelin and adiponectin. Since IL-1beta is involved in the central induction of anorexia, we studied its expression in the nARC as well. AA was induced to Lewis rats using complete Freund's adjuvant. On days 12, 15 and 18 after complete Freund's adjuvant injection, the levels of leptin, adiponectin, ghrelin and IL-1beta were determined by RIA or ELISA. The mRNA expressions for NPY, leptin receptor (OB-R), ghrelin receptor (Ghsr) and IL-1beta were determined by TaqMan RT-PCR from isolated nARC. In AA rats, decreased appetite, body mass and epididymal fat stores positively correlated with reduced circulating and epididymal fat leptin and adiponectin. Ghrelin plasma levels were increased. In nARC, mRNA for OB-R, Ghsr and NPY were overexpressed in AA rats. AA rats showed overexpression of mRNA for IL-1beta in nARC while circulating, and spleen IL-1beta was unaltered. During AA, overexpression of orexigenic NPY mRNA in nARC along with enhanced plasma ghrelin and lowered leptin levels occur. Decreased food intake indicates a predominant effect of the anorexigenic pathway. Activated expression of IL-1beta in nARC suggests its role in keeping AA-induced anorexia in progress. The reduction in adiponectin may also contribute to AA-induced anorexia. Copyright 2009 S. Karger AG, Basel.

  12. Effects of sinomenine on the expression of microRNA-155 in 2,4,6-trinitrobenzenesulfonic acid-induced colitis in mice.

    Directory of Open Access Journals (Sweden)

    Qiao Yu

    Full Text Available Sinomenine, a pure alkaloid isolated in Chinese medicine from the root of Sinomenium acutum, has been demonstrated to have anti-inflammatory and immunosuppressive effects. MicroRNAs (miRNAs are gradually being recognized as critical mediators of disease pathogenesis via coordinated regulation of molecular effector pathways.After colitis was induced in mice by instillation of 5% (w/v 2,4,6-trinitrobenzenesulfonic acid (TNBS, sinomenine at a dose of 100 or 200 mg/kg was orally administered once daily for 7 days. We evaluated body weight, survival rate, diarrhea score, histological score and myeloperoxidase (MPO activity. The mRNA and protein expression levels of miR-155, c-Maf, TNF-α and IFN-γ were determined by quantitative RT-PCR and immunohistochemistry, respectively. Sinomenine (100 or 200 mg/kg-treated mice with TNBS-induced colitis were significantly improved in terms of body weight, survival rate, diarrhea score, histological score and MPO activity compared with untreated mice. Both dosages of sinomenine significantly decreased the mRNA and protein expression levels of c-Maf, TNF-α and IFN-γ, which elevated in TNBS-induced colitis. Furthermore, sinomenine at a dose of 200 mg/kg significantly decreased the level of miR-155 expression by 71% (p = 0.025 compared with untreated TNBS-induced colitis in mice.Our study evaluated the effects and potential mechanisms of sinomenine in the anti-inflammatory response via miRNA-155 in mice with TNBS-induced colitis. Our findings suggest that sinomenine has anti-inflammatory effects on TNBS-induced colitis by down-regulating the levels of miR-155 and several related inflammatory cytokines.

  13. Expression profiling and cross-species RNA interference (RNAi of desiccation-induced transcripts in the anhydrobiotic nematode Aphelenchus avenae

    Directory of Open Access Journals (Sweden)

    Culleton Bridget A

    2010-01-01

    Full Text Available Abstract Background Some organisms can survive extreme desiccation by entering a state of suspended animation known as anhydrobiosis. The free-living mycophagous nematode Aphelenchus avenae can be induced to enter anhydrobiosis by pre-exposure to moderate reductions in relative humidity (RH prior to extreme desiccation. This preconditioning phase is thought to allow modification of the transcriptome by activation of genes required for desiccation tolerance. Results To identify such genes, a panel of expressed sequence tags (ESTs enriched for sequences upregulated in A. avenae during preconditioning was created. A subset of 30 genes with significant matches in databases, together with a number of apparently novel sequences, were chosen for further study. Several of the recognisable genes are associated with water stress, encoding, for example, two new hydrophilic proteins related to the late embryogenesis abundant (LEA protein family. Expression studies confirmed EST panel members to be upregulated by evaporative water loss, and the majority of genes was also induced by osmotic stress and cold, but rather fewer by heat. We attempted to use RNA interference (RNAi to demonstrate the importance of this gene set for anhydrobiosis, but found A. avenae to be recalcitrant with the techniques used. Instead, therefore, we developed a cross-species RNAi procedure using A. avenae sequences in another anhydrobiotic nematode, Panagrolaimus superbus, which is amenable to gene silencing. Of 20 A. avenae ESTs screened, a significant reduction in survival of desiccation in treated P. superbus populations was observed with two sequences, one of which was novel, while the other encoded a glutathione peroxidase. To confirm a role for glutathione peroxidases in anhydrobiosis, RNAi with cognate sequences from P. superbus was performed and was also shown to reduce desiccation tolerance in this species. Conclusions This study has identified and characterised the

  14. Permissive effect of dexamethasone on the increase of proenkephalin mRNA induced by depolarization of chromaffin cells

    International Nuclear Information System (INIS)

    Naranjo, J.R.; Mocchetti, I.; Schwartz, J.P.; Costa, E.

    1986-01-01

    In cultured bovine chromaffin cells, changes in the dynamic state of enkephalin stores elicited experimentally were studied by measuring cellular proenkephalin mRNA, as well as enkephalin precursors and authentic enkephalin content of cells and culture media. In parallel, tyrosine hydroxylase mRNA and catecholamine cell content were also determined. Low concentrations (0.5-100 pM) of dexamethasone increased the cell contents of proenkephalin mRNA and enkephalin-containing peptides. High concentrations of the hormone(1 μM) were required to increase the cell contents of tyrosine hydroxylase mRNA and catecholamines. Depolarization of the cells with 10 μM veratridine resulted in a depletion of enkephalin and catecholamine stores after 24 hr. The enkephalin, but not the catecholamine, content was restored by 48 hr. An increase in proenkephalin mRNA content might account for the recovery; this increase was curtailed by tetrodotoxin and enhanced by 10 pM dexamethasone. Tyrosine hydroxylase mRNA content was not significantly modified by depolarization, even in the presence of 1 μM dexamethasone. Aldosterone, progesterone, testosterone, or estradiol (1 μM) failed to change proenkephalin mRNA. Hence, dexamethasone appears to exert a specific permissive action on the stimulation of the proenkephalin gene elicited by depolarization. Though the catecholamines and enkephalins are localized in the same chromaffin granules and are coreleased by depolarization, the genes coding for the processes that are rate limiting in the production of these neuromodulators can be differentially regulated

  15. Haloperidol induces pharmacoepigenetic response by modulating miRNA expression, global DNA methylation and expression profiles of methylation maintenance genes and genes involved in neurotransmission in neuronal cells.

    Directory of Open Access Journals (Sweden)

    Babu Swathy

    Full Text Available Haloperidol has been extensively used in various psychiatric conditions. It has also been reported to induce severe side effects. We aimed to evaluate whether haloperidol can influence host methylome, and if so what are the possible mechanisms for it in neuronal cells. Impact on host methylome and miRNAs can have wide spread alterations in gene expression, which might possibly help in understanding how haloperidol may impact treatment response or induce side effects.SK-N-SH, a neuroblasoma cell line was treated with haloperidol at 10μm concentration for 24 hours and global DNA methylation was evaluated. Methylation at global level is maintained by methylation maintenance machinery and certain miRNAs. Therefore, the expression of methylation maintenance genes and their putative miRNA expression profiles were assessed. These global methylation alterations could result in gene expression changes. Therefore genes expressions for neurotransmitter receptors, regulators, ion channels and transporters were determined. Subsequently, we were also keen to identify a strong candidate miRNA based on biological and in-silico approach which can reflect on the pharmacoepigenetic trait of haloperidol and can also target the altered neuroscience panel of genes used in the study.Haloperidol induced increase in global DNA methylation which was found to be associated with corresponding increase in expression of various epigenetic modifiers that include DNMT1, DNMT3A, DNMT3B and MBD2. The expression of miR-29b that is known to putatively regulate the global methylation by modulating the expression of epigenetic modifiers was observed to be down regulated by haloperidol. In addition to miR-29b, miR-22 was also found to be downregulated by haloperidol treatment. Both these miRNA are known to putatively target several genes associated with various epigenetic modifiers, pharmacogenes and neurotransmission. Interestingly some of these putative target genes involved in

  16. Haloperidol induces pharmacoepigenetic response by modulating miRNA expression, global DNA methylation and expression profiles of methylation maintenance genes and genes involved in neurotransmission in neuronal cells.

    Science.gov (United States)

    Swathy, Babu; Banerjee, Moinak

    2017-01-01

    Haloperidol has been extensively used in various psychiatric conditions. It has also been reported to induce severe side effects. We aimed to evaluate whether haloperidol can influence host methylome, and if so what are the possible mechanisms for it in neuronal cells. Impact on host methylome and miRNAs can have wide spread alterations in gene expression, which might possibly help in understanding how haloperidol may impact treatment response or induce side effects. SK-N-SH, a neuroblasoma cell line was treated with haloperidol at 10μm concentration for 24 hours and global DNA methylation was evaluated. Methylation at global level is maintained by methylation maintenance machinery and certain miRNAs. Therefore, the expression of methylation maintenance genes and their putative miRNA expression profiles were assessed. These global methylation alterations could result in gene expression changes. Therefore genes expressions for neurotransmitter receptors, regulators, ion channels and transporters were determined. Subsequently, we were also keen to identify a strong candidate miRNA based on biological and in-silico approach which can reflect on the pharmacoepigenetic trait of haloperidol and can also target the altered neuroscience panel of genes used in the study. Haloperidol induced increase in global DNA methylation which was found to be associated with corresponding increase in expression of various epigenetic modifiers that include DNMT1, DNMT3A, DNMT3B and MBD2. The expression of miR-29b that is known to putatively regulate the global methylation by modulating the expression of epigenetic modifiers was observed to be down regulated by haloperidol. In addition to miR-29b, miR-22 was also found to be downregulated by haloperidol treatment. Both these miRNA are known to putatively target several genes associated with various epigenetic modifiers, pharmacogenes and neurotransmission. Interestingly some of these putative target genes involved in neurotransmission

  17. Regular endurance training reduces the exercise induced HIF-1alpha and HIF-2alpha mRNA expression in human skeletal muscle in normoxic conditions

    DEFF Research Database (Denmark)

    Lundby, Carsten; Gassmann, Max; Pilegaard, Henriette

    2005-01-01

    and 2 (HIFs) are clearly related heterodimeric transcription factors that consist of an oxygen-depended alpha-subunit and a constitutive beta-subunit. With hypoxic exposure, HIF-1alpha and HIF-2alpha protein are stabilized. Upon heterodimerization, HIFs induce the transcription of a variety of genes......Regular exercise induces a variety of adaptive responses that enhance the oxidative and metabolic capacity of human skeletal muscle. Although the physiological adjustments of regular exercise have been known for decades, the underlying mechanisms are still unclear. The hypoxia inducible factors 1...... including erythropoietin (EPO), transferrin and its receptor, as well as vascular endothelial growth factor (VEGF) and its receptor. Considering that several of these genes are also induced with exercise, we tested the hypothesis that the mRNA level of HIF-1alpha and HIF-2alpha subunits increases...

  18. DNA methylation regulates gabrb2 mRNA expression: developmental variations and disruptions in l-methionine-induced zebrafish with schizophrenia-like symptoms.

    Science.gov (United States)

    Wang, L; Jiang, W; Lin, Q; Zhang, Y; Zhao, C

    2016-11-01

    Single nucleotide polymorphisms (SNPs) in the human type A gamma-aminobutyric acid (GABA) receptor β 2 subunit gene (GABRB2) have been associated with schizophrenia and quantitatively correlated with mRNA expression in the postmortem brain tissue of patients with schizophrenia. l-Methionine (MET) administration has been reported to cause a recrudescence of psychotic symptoms in patients with schizophrenia, and similar symptoms have been generated in MET-induced mice. In this study, a zebrafish animal model was used to evaluate the relationship between the gabrb2 mRNA expression and its promoter DNA methylation in developmental and MET-induced schizophrenia-like zebrafish. The results indicated developmental increases in global DNA methylation and decreases in gabrb2 promoter methylation in zebrafish. A significant increase in gabrb2 mRNA levels was observed after GABA was synthesized. Additionally, the MET-triggered schizophrenia-like symptoms in adult zebrafish, involving social withdrawal and cognitive dysfunction analyzed with social interaction and T-maze behavioral tests, were accompanied by significantly increased DNA methylation levels in the global genome and the gabrb2 promoter. Furthermore, the significant correlation between gabrb2 mRNA expression and gabrb2 promoter methylation observed in the developmental stages became non-significant in MET-triggered adult zebrafish. These findings demonstrate that gabrb2 mRNA expression is associated with DNA methylation varies by developmental stage and show that these epigenetic association mechanisms are disrupted in MET-triggered adult zebrafish with schizophrenia-like symptoms. In conclusion, these results provide plausible epigenetic evidence of the GABA A receptor β 2 subunit involvement in the schizophrenia-like behaviors and demonstrate the potential use of zebrafish models in neuropsychiatric research. © 2016 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

  19. In Vivo Short-Term Topical Application of BAY 11-7082 Prevents the Acidic Bile–Induced mRNA and miRNA Oncogenic Phenotypes in Exposed Murine Hypopharyngeal Mucosa

    Directory of Open Access Journals (Sweden)

    Clarence T. Sasaki

    2018-04-01

    Full Text Available PURPOSE: Bile-containing gastroesophageal reflux may promote cancer at extraesophageal sites. Acidic bile can accelerate NF-κB activation and molecular events, linked to premalignant changes in murine hypopharyngeal mucosa (HM. We hypothesize that short-term in vivo topical application of NF-κB inhibitor BAY 11-7082 can prevent acidic bile–induced early preneoplastic molecular events, suggesting its potential role in disease prevention. EXPERIMENTAL DESIGN: We topically exposed HM (C57Bl/6j wild-type to a mixture of bile acids at pH 3.0 with and without BAY 11-7082 3 times/day for 7 days. We used immunofluorescence, Western blotting, immunohistochemistry, quantitative polymerase chain reaction, and polymerase chain reaction microarrays to identify NF-κB activation and its associated oncogenic mRNA and miRNA phenotypes, in murine hypopharyngeal cells in vitro and in murine HM in vivo. RESULTS: Short-term exposure of HM to acidic bile is a potent stimulus accelerating the expression of NF-κB signaling (70 out of 84 genes and oncogenic molecules. Topical application of BAY 11-7082 sufficiently blocks the effect of acidic bile. BAY 11-7082 eliminates NF-κB activation in regenerating basal cells of acidic bile–treated HM and prevents overexpression of molecules central to head and neck cancer, including bcl-2, STAT3, EGFR, TNF-α, and WNT5A. NF-κB inhibitor reverses the upregulated “oncomirs” miR-155 and miR-192 and the downregulated “tumor suppressors” miR-451a and miR-375 phenotypes in HM affected by acidic bile. CONCLUSION: There is novel evidence that acidic bile–induced NF-κB–related oncogenic mRNA and miRNA phenotypes are generated after short-term 7-day mucosal exposure and that topical mucosal application of BAY 11-7082 can prevent the acidic bile–induced molecular alterations associated with unregulated cell growth and proliferation of hypopharyngeal cells.

  20. Study of risc factors affecting the number of mental disorders and nervous system diseases for people who participated in liquidation of consequences of ChNPP accident

    International Nuclear Information System (INIS)

    Ivanov, V.K.; Chekin, S.Yu.; Mikhal'skij, A.I.; Petrovskij, A.M.

    1992-01-01

    Interrelation of disease incidence for liquidators and factors affecting it has been studied. The diseases (mental disorders and nervous system diseases) have been taken into account provided more than 10% of people have suffered of the above diseases. Date of getting into the accident zone; duration of work within the zone; the radiation dose accumulated were considered to be risc factors. Getting into the accident zone and duration of work within the zone of accident have been though to be the main risc factors. 3 figs.; 2 tabs

  1. Early-life stress induces persistent alterationsin 5-HT1Areceptor and serotonin transporter mRNA expression in the adultrat brain.

    Directory of Open Access Journals (Sweden)

    Javier A. Bravo

    2014-04-01

    Full Text Available Early-life experience plays a major role in the stress response throughout life. Neonatal maternal separation (MS is an animal model of depression with an altered serotonergic response. We hypothesize that this alteration may be caused by differences in 5-HT1A receptor and serotonin transporter (SERT mRNA expression in brain areas involved in the control of emotions, memory and fear as well as in regions controlling the central serotonergic tone.To test this, Sprague-Dawley rats were subjected to MS for 3h daily during post-natal days 2-12. As control, age matched rats were not separated (NS from their dams. When animals reached adulthood (11-13 weeks brain was extracted and mRNA expression of 5-HT1A receptor in amygdala, hippocampus and dorsal raphé nucleus (DRN and SERT in the DRN was analyzed through in-situ hybridisation.Densitometric analysis revealed that MS increased 5-HT1A receptor mRNA expression in the amygdala, and reduced its expression in the DRN, but no changes were observed in the hippocampus in comparison to NS controls. Also, MS reduced SERT mRNA expression in the DRN when compared to NS rats.These results suggest that early-life stress induces persistent changes in 5-HT1A receptor and SERT mRNA expression in key brain regions involved in the development of stress-related psychiatric disorders. The reduction in SERT mRNA indicates an alteration that is in line with clinical findings such as polymorphic variants in individuals with higher risk of depression. These data may help to understand how early-life stress contributes to the development of mood disorders in adulthood.

  2. The acquired radioresistance in HeLa cells under conditions mimicking hypoxia was attenuated by a decreased expression of HIF subunit genes induced by RNA interference

    International Nuclear Information System (INIS)

    Doi, Nobutaka; Ogawa, Ryohei; Cui, Zheng-Guo; Morii, Akihiro; Watanabe, Akihiko; Kanayama, Shinji; Yoneda, Yuko; Kondo, Takashi

    2015-01-01

    The cancer cells residing in the hypoxic layer are resistant to radiation and these are ones responsible for cancer recurrence after radiation therapy. One of the reasons why hypoxic cancer cells acquire radioresistance may be attributable to changes in the gene expression profile by the activation of hypoxia inducible factors (HIFs). However, the details underlying this process remain unknown. In this study, we investigated the effects of knockdown of HIF subunit genes to elucidate how HIF subunit genes may be involved in the radioresistance acquired by HeLa cells following exposure to a hypoxia mimic. Interestingly, HIF-1α and HIF-2α seemed mutually complementary for each other when either of them was suppressed. We thus suppressed the expression of both genes simultaneously. To do this, we developed a short hairpin RNA (shRNA) targeting a high homology region between HIF-1α and HIF-2α. It was shown that the expression of the shRNA effectively suppressed the acquisition of radioresistance following the hypoxia mimic. Moreover, it was confirmed that suppression of both subunits resulted in the downregulation of stem cell markers and the suppression of spheroid formation during the hypoxia mimicking-conditions. This shRNA-mediated knockdown method targeting a common region shared by a family of genes may offer a new candidate cancer treatment. - Highlights: • Incubation with CoCl 2 confers radioresistance to HeLa cells. • Both HIF-1α and HIF-2α are involved in the acquisition of radioresistance. • An shRNA to a homology region of HIF-1α and HIF-2α suppressed the radioresistance. • The shRNA decreased cells with stem cell markers and a stem cell phenotype

  3. The acquired radioresistance in HeLa cells under conditions mimicking hypoxia was attenuated by a decreased expression of HIF subunit genes induced by RNA interference

    Energy Technology Data Exchange (ETDEWEB)

    Doi, Nobutaka [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan); New Products Research & Development, Gene Engineering Division, NIPPON GENE Co., Ltd. (Japan); Ogawa, Ryohei, E-mail: ogawa@med.u-toyama.ac.jp [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan); Cui, Zheng-Guo [Department of Public Health, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama (Japan); Morii, Akihiro; Watanabe, Akihiko [Department of Urology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama (Japan); Kanayama, Shinji; Yoneda, Yuko [New Products Research & Development, Gene Engineering Division, NIPPON GENE Co., Ltd. (Japan); Kondo, Takashi [Department of Radiological Sciences, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama 930-0194 (Japan)

    2015-05-01

    The cancer cells residing in the hypoxic layer are resistant to radiation and these are ones responsible for cancer recurrence after radiation therapy. One of the reasons why hypoxic cancer cells acquire radioresistance may be attributable to changes in the gene expression profile by the activation of hypoxia inducible factors (HIFs). However, the details underlying this process remain unknown. In this study, we investigated the effects of knockdown of HIF subunit genes to elucidate how HIF subunit genes may be involved in the radioresistance acquired by HeLa cells following exposure to a hypoxia mimic. Interestingly, HIF-1α and HIF-2α seemed mutually complementary for each other when either of them was suppressed. We thus suppressed the expression of both genes simultaneously. To do this, we developed a short hairpin RNA (shRNA) targeting a high homology region between HIF-1α and HIF-2α. It was shown that the expression of the shRNA effectively suppressed the acquisition of radioresistance following the hypoxia mimic. Moreover, it was confirmed that suppression of both subunits resulted in the downregulation of stem cell markers and the suppression of spheroid formation during the hypoxia mimicking-conditions. This shRNA-mediated knockdown method targeting a common region shared by a family of genes may offer a new candidate cancer treatment. - Highlights: • Incubation with CoCl{sub 2} confers radioresistance to HeLa cells. • Both HIF-1α and HIF-2α are involved in the acquisition of radioresistance. • An shRNA to a homology region of HIF-1α and HIF-2α suppressed the radioresistance. • The shRNA decreased cells with stem cell markers and a stem cell phenotype.

  4. Triggering of the dsRNA sensors TLR3, MDA5, and RIG-I induces CD55 expression in synovial fibroblasts.

    Directory of Open Access Journals (Sweden)

    Olga N Karpus

    Full Text Available CD55 (decay-accelerating factor is a complement-regulatory protein highly expressed on fibroblast-like synoviocytes (FLS. CD55 is also a ligand for CD97, an adhesion-type G protein-coupled receptor abundantly present on leukocytes. Little is known regarding the regulation of CD55 expression in FLS.FLS isolated from arthritis patients were stimulated with pro-inflammatory cytokines and Toll-like receptor (TLR ligands. Transfection with polyinosinic-polycytidylic acid (poly(I:C and 5'-triphosphate RNA were used to activate the cytoplasmic double-stranded (dsRNA sensors melanoma differentiation-associated gene 5 (MDA5 and retinoic acid-inducible gene-I (RIG-I. CD55 expression, cell viability, and binding of CD97-loaded beads were quantified by flow cytometry.CD55 was expressed at equal levels on FLS isolated from patients with rheumatoid arthritis (RA, osteoarthritis, psoriatic arthritis and spondyloarthritis. CD55 expression in RA FLS was significantly induced by IL-1β and especially by the TLR3 ligand poly(I:C. Activation of MDA5 and RIG-I also enhanced CD55 expression. Notably, activation of MDA5 dose-dependently induced cell death, while triggering of TLR3 or RIG-I had a minor effect on viability. Upregulation of CD55 enhanced the binding capacity of FLS to CD97-loaded beads, which could be blocked by antibodies against CD55.Activation of dsRNA sensors enhances the expression of CD55 in cultured FLS, which increases the binding to CD97. Our findings suggest that dsRNA promotes the interaction between FLS and CD97-expressing leukocytes.

  5. Dysregulated microRNA clusters in response to retinoic acid and CYP26B1 inhibitor induced testicular function in dogs.

    Directory of Open Access Journals (Sweden)

    Vanmathy R Kasimanickam

    Full Text Available Spermatogenesis is a multistep synchronized process. Diploid spermatogonia differentiate into haploid spermatozoa following mitosis, meiosis and spermiogenesis. Division and differentiation of male germ cells is achieved through the sequential expression of several genes. Numerous mRNAs in the differentiating germ cells undergo post-transcriptional and translational regulation. MiRNAs are powerful negative regulators of mRNA transcription, stability, and translation and recognize their mRNA targets through base-pairing. Retinoic acid (RA signaling is essential for spermatogenesis and testicular function. Testicular RA level is critical for RA signal transduction. This study investigated the miRNAs modulation in an RA- induced testicular environment following the administration of all-trans RA (2 µM and CYP26B1- inhibitor (1 µM compared to control. Eighty four canine mature miRNAs were analyzed and their expression signatures were distinguished using real-time PCR based array technology. Of the miRNAs analyzed, miRNA families such as miR-200 (cfa-miR-200a, cfa-miR-200b and cfa-miR-200c, Mirlet-7 (cfa-let-7a, cfa-let-7b, cfa-let-7c, cfa-let-7g and cfa-let-7f, miR-125 (cfa-miR-125a and cfa-miR-125b, miR-146 (cfa-miR-146a and cfa-miR-146b, miR-34 (cfa-miR-34a, cfa-miR-34b and cfa-miR-34c, miR-23 (cfa-miR-23a and cfa-miR-23b, cfa-miR-184, cfa-miR-214 and cfa-miR-141 were significantly up-regulated with testicular RA intervention via administration of CYP26B1 inhibitor and all-trans-RA and species of miRNA such as cfa-miR-19a, cfa-miR-29b, cfa-miR-29c, cfa-miR-101 and cfa-miR-137 were significantly down-regulated. This study explored information regarding chromosome distribution, human orthologous sequences and the interaction of target genes of miRNA families significantly distinguished in this study using prediction algorithms. This study importantly identified dysregulated miRNA species resulting from RA-induced spermatogenesis. The present

  6. Maintenance of Self-Renewal and Pluripotency in J1 Mouse Embryonic Stem Cells through Regulating Transcription Factor and MicroRNA Expression Induced by PD0325901

    Directory of Open Access Journals (Sweden)

    Zhiying Ai

    2016-01-01

    Full Text Available Embryonic stem cells (ESCs have the ability to grow indefinitely and retain their pluripotency in culture, and this self-renewal capacity is governed by several crucial molecular pathways controlled by specific regulatory genes and epigenetic modifications. It is reported that multiple epigenetic regulators, such as miRNA and pluripotency factors, can be tightly integrated into molecular pathways and cooperate to maintain self-renewal of ESCs. However, mouse ESCs in serum-containing medium seem to be heterogeneous due to the self-activating differentiation signal of MEK/ERK. Thus, to seek for the crucial miRNA and key regulatory genes that establish ESC properties in MEK/ERK pathway, we performed microarray analysis and small RNA deep-sequencing of J1 mESCs treated with or without PD0325901 (PD, a well-known inhibitor of MEK/ERK signal pathway, followed by verification of western blot analysis and quantitative real-time PCR verification; we found that PD regulated the transcript expressions related to self-renewal and differentiation and antagonized the action of retinoic acid- (RA- induced differentiation. Moreover, PD can significantly modulate the expressions of multiple miRNAs that have crucial functions in ESC development. Overall, our results demonstrate that PD could enhance ESC self-renewal capacity both by key regulatory genes and ES cell-specific miRNA, which in turn influences ESC self-renewal and cellular differentiation.

  7. Methylmethane-sulphonate and X-ray-induced mutations in the Chinese hamster hprt gene: mRNA phenotyping using polymerase chain reactions

    International Nuclear Information System (INIS)

    Chaudhry, M.A.; Fox, Margaret

    1990-01-01

    Alterations in the hprt gene of Chinese hamster cells were determined in 71 spontaneous, methylmethane sulphonate (MMS)-and X-ray induced mutants, using the Southern blot hybridization technique. To investigate the possibility of small deletions, MMS-induced mutants were studied with proves derived from exons 3 and 9 but no evidence of specific deletion of these two exons was found. The polymerase chain reaction (PCR) was used to phenotype hprt transcripts in 48 MMS, X-ray and spontaneous Chinese hamster mutants by amplifying the coding region of their cDNA. Among 22 MMS-induced mutants the message was present in 16 instances. An analysis of 20 X-ray-induced mutants showed the presence of hprt mRNA in 11 of them with five having low levels of transcription. Among six spontaneous mutants, four were negative for mRNA on standard Northern blots and in one the message was only detected after PCR amplification. Direct DNA sequencing of 10 mutants revealed the presence of base substitutions in five of them while a 7 bp deletion was found in another. No mutations were found in another four mutants, suggesting the presence of mutation outside the coding region. (author)

  8. Hypoxia-inducible factors regulate pluripotency factor expression by ZNF217- and ALKBH5-mediated modulation of RNA methylation in breast cancer cells.

    Science.gov (United States)

    Zhang, Chuanzhao; Zhi, Wanqing Iris; Lu, Haiquan; Samanta, Debangshu; Chen, Ivan; Gabrielson, Edward; Semenza, Gregg L

    2016-10-04

    Exposure of breast cancer cells to hypoxia increases the percentage of breast cancer stem cells (BCSCs), which are required for tumor initiation and metastasis, and this response is dependent on the activity of hypoxia-inducible factors (HIFs). We previously reported that exposure of breast cancer cells to hypoxia induces the ALKBH5-mediated demethylation of N6-methyladenosine (m6A) in NANOG mRNA leading to increased expression of NANOG, which is a pluripotency factor that promotes BCSC specification. Here we report that exposure of breast cancer cells to hypoxia also induces ZNF217-dependent inhibition of m6A methylation of mRNAs encoding NANOG and KLF4, which is another pluripotency factor that mediates BCSC specification. Although hypoxia induced the BCSC phenotype in all breast-cancer cell lines analyzed, it did so through variable induction of pluripotency factors and ALKBH5 or ZNF217. However, in every breast cancer line, the hypoxic induction of pluripotency factor and ALKBH5 or ZNF217 expression was HIF-dependent. Immunohistochemistry revealed that expression of HIF-1α and ALKBH5 was concordant in all human breast cancer biopsies analyzed. ALKBH5 knockdown in MDA-MB-231 breast cancer cells significantly decreased metastasis from breast to lungs in immunodeficient mice. Thus, HIFs stimulate pluripotency factor expression and BCSC specification by negative regulation of RNA methylation.

  9. Enhancement of allele discrimination by introduction of nucleotide mismatches into siRNA in allele-specific gene silencing by RNAi.

    Directory of Open Access Journals (Sweden)

    Yusuke Ohnishi

    -strand siRNA elements, which possibly increase the assembly of antisense-strand (guide siRNAs into RNA-induced silencing complexes (RISCs, may enhance ASP-RNAi in the case of inert siRNA duplexes. Therefore, the data presented here suggest that structural modification of functional portions of an siRNA duplex by base substitution could greatly influence allele discrimination and gene silencing, thereby contributing to enhancement of ASP-RNAi.

  10. Validity and reliability of the Spanish version of the 10-item CD-RISC in patients with fibromyalgia

    Science.gov (United States)

    2014-01-01

    Background No resilience scale has been validated in Spanish patients with fibromyalgia. The aim of this study was to evaluate the validity and reliability of the 10-item CD-RISC in a sample of Spanish patients with fibromyalgia. Methods Design: Observational prospective multicenter study. Sample: Patients with diagnoses of fibromyalgia recruited from primary care settings (N = 208). Instruments: In addition to sociodemographic data, the following questionnaires were administered: Pain Visual Analogue Scale (PVAS), the 10-item Connor-Davidson Resilience scale (10-item CD-RISC), the Fibromyalgia Impact Questionnaire (FIQ), the Hospital Anxiety and Depression Scale (HADS), the Pain Catastrophizing Scale (PCS), the Chronic Pain Acceptance Questionnaire (CPAQ), and the Mindful Attention Awareness Scale (MAAS). Results Regarding construct validity, the factor solution in the Principal Component Analysis (PCA) was considered adequate, so the KMO test had a value of 0.91, and the Barlett’s test of sphericity was significant (χ2 = 852.8; gl = 45; p fibromyalgia, acceptable psychometric properties, with a high level of reliability and validity. PMID:24484847

  11. Identifying hotspots of coastal risk and evaluating DRR measures: results from the RISC-KIT project.

    Science.gov (United States)

    Van Dongeren, A.; Ciavola, P.; Viavattene, C.; Dekleermaeker, S.; Martinez, G.; Ferreira, O.; Costa, C.

    2016-02-01

    High-impact storm events have demonstrated the vulnerability of coastal zones in Europe and beyond. These impacts are likely to increase due to predicted climate change and ongoing coastal development. In order to reduce impacts, disaster risk reduction (DRR) measures need to be taken, which prevent or mitigate the effects of storm events. To drive the DRR agenda, the UNISDR formulated the Sendai Framework for Action, and the EU has issued the Floods Directive. However, neither is specific about the methods to be used to develop actionable DRR measures in the coastal zone. Therefore, there is a need to develop methods, tools and approaches which make it possible to: identify and prioritize the coastal zones which are most at risk through a Coastal Risk Assessment Framework, evaluate the effectiveness of DRR options for these coastal areas, using an Early Warning/Decision Support System, which can be used both in the planning and event-phase. This paper gives an overview of the products and results obtained in the FP7-funded project RISC-KIT, which aims to develop and apply a set of tools with which highly-vulnerable coastal areas (so-called "hotspots") can be identified. The identification is done using the Coastal Risk Assessment Framework, or CRAF, which computes the intensity from multi-hazards, the exposure and the vulnerability, all components of risk, including network and cascading effects. Based on this analysis hot spots of risk which warrant coastal protection investments are selected. For these hotspot areas, high-resolution Early Warning and Decision Support Tools are developed with which it is possible to compute in detail the effectiveness of Disaster Risk Reduction measures in storm event scenarios, which helps decide which measures to implement in the planning phase. The same systems, but now driven with real time data, can also be used for early warning systems. All tools are tested on eleven case study areas, at least one on each EU Regional Sea

  12. Estrogens and growth factors induce the mRNA of the 52K-pro-cathepsin-D secreted by breast cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Cavailles, V; Augereau, P; Garcia, M; Rochefort, H

    1988-03-25

    The estrogen-induced 52K protein secreted by human breast cancer cells is a lysosomal protease recently identified as a pro-cathepsin D by sequencing several cDNA clones isolated from MCF/sub 7/ cells. Using one of these clones, the authors detected, in MCF/sub 7/ cells a 2.2 kb mRNA whose level was rapidly increased 4- to 10-fold by estradiol, but not by other classes of steroids. Other mitogens, such as epidermal growth factor and insulin, also induced the 2.2 kb mRNA in a dose-dependent manner. Induction with epidermal growth factor was as rapid but was 2- to 3-fold lower than with estradiol. Antiestrogens had no effect on the 52K-cathepsin-D mRNA in MCF/sub 7/ cells, but became estrogen agonists in two antiestrogen-resistant sublines R/sub 27/ and LY2. The use of transcription and translation inhibitors and nuclear run-on experiments indicate that estradiol enhances transcription of the 52K-cathepsin-D gene in MCF/sub 7/ cells.

  13. Contraction-induced increases in Na+-K+-ATPase mRNA levels in human skeletal muscle are not amplified by activation of additional muscle mass

    DEFF Research Database (Denmark)

    Nordsborg, Nikolai; Thomassen, Martin; Lundby, Carsten

    2005-01-01

    The present study tested the hypothesis that exercise with a large compared with a small active muscle mass results in a higher contraction-induced increase in Na+-K+-ATPase mRNA expression due to greater hormonal responses. Furthermore, the relative abundance of Na+-K+-ATPase subunit a1, a2, a3, a......% of the a2 expression, and no reliable detection of a3 and a4 was possible. In conclusion, activation of additional muscle mass does not result in a higher exercise-induced increase in Na+-K+-ATPase subunit-specific mRNA.......4, ß1, ß2, and ß3 mRNA in human skeletal muscle was investigated. On two occasions, eight subjects performed one-legged knee extension exercise (L) or combined one-legged knee extension and bilateral arm cranking (AL) for 5.00, 4.25, 3.50, 2.75, and 2.00 min separated by 3 min of rest. Leg exercise...

  14. Aging-induced dysregulation of dicer1-dependent microRNA expression impairs angiogenic capacity of rat cerebromicrovascular endothelial cells.

    Science.gov (United States)

    Ungvari, Zoltan; Tucsek, Zsuzsanna; Sosnowska, Danuta; Toth, Peter; Gautam, Tripti; Podlutsky, Andrej; Csiszar, Agnes; Losonczy, Gyorgy; Valcarcel-Ares, M Noa; Sonntag, William E; Csiszar, Anna

    2013-08-01

    Age-related impairment of angiogenesis is likely to play a central role in cerebromicrovascular rarefaction and development of vascular cognitive impairment, but the underlying mechanisms remain elusive. To test the hypothesis that dysregulation of Dicer1 (ribonuclease III, a key enzyme of the microRNA [miRNA] machinery) impairs endothelial angiogenic capacity in aging, primary cerebromicrovascular endothelial cells (CMVECs) were isolated from young (3 months old) and aged (24 months old) Fischer 344 × Brown Norway rats. We found an age-related downregulation of Dicer1 expression both in CMVECs and in small cerebral vessels isolated from aged rats. In aged CMVECs, Dicer1 expression was increased by treatment with polyethylene glycol-catalase. Compared with young cells, aged CMVECs exhibited altered miRNA expression profile, which was associated with impaired proliferation, adhesion to vitronectin, collagen and fibronectin, cellular migration (measured by a wound-healing assay using electric cell-substrate impedance sensing technology), and impaired ability to form capillary-like structures. Overexpression of Dicer1 in aged CMVECs partially restored miRNA expression profile and significantly improved angiogenic processes. In young CMVECs, downregulation of Dicer1 (siRNA) resulted in altered miRNA expression profile associated with impaired proliferation, adhesion, migration, and tube formation, mimicking the aging phenotype. Collectively, we found that Dicer1 is essential for normal endothelial angiogenic processes, suggesting that age-related dysregulation of Dicer1-dependent miRNA expression may be a potential mechanism underlying impaired angiogenesis and cerebromicrovascular rarefaction in aging.

  15. Striatal modulation of BDNF expression using microRNA124a-expressing lentiviral vectors impairs ethanol-induced conditioned-place preference and voluntary alcohol consumption.

    Science.gov (United States)

    Bahi, Amine; Dreyer, Jean-Luc

    2013-07-01

    Alcohol abuse is a major health, economic and social concern in modern societies, but the exact molecular mechanisms underlying ethanol addiction remain elusive. Recent findings show that small non-coding microRNA (miRNA) signaling contributes to complex behavioral disorders including drug addiction. However, the role of miRNAs in ethanol-induced conditioned-place preference (CPP) and voluntary alcohol consumption has not yet been directly addressed. Here, we assessed the expression profile of miR124a in the dorsal striatum of rats upon ethanol intake. The results show that miR124a was downregulated in the dorso-lateral striatum (DLS) following alcohol drinking. Then, we identified brain-derived neurotrophic factor (BDNF) as a direct target of miR124a. In fact, BDNF mRNA was upregulated following ethanol drinking. We used lentiviral vector (LV) gene transfer technology to further address the role of miR124a and its direct target BDNF in ethanol-induced CPP and alcohol consumption. Results reveal that stereotaxic injection of LV-miR124a in the DLS enhances ethanol-induced CPP as well as voluntary alcohol consumption in a two-bottle choice drinking paradigm. Moreover, miR124a-silencer (LV-siR124a) as well as LV-BDNF infusion in the DLS attenuates ethanol-induced CPP as well as voluntary alcohol consumption. Importantly, LV-miR124a, LV-siR124a and LV-BDNF have no effect on saccharin and quinine intake. Our findings indicate that striatal miR124a and BDNF signaling have crucial roles in alcohol consumption and ethanol conditioned reward. © 2013 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  16. The dynamics and efficacy of antiviral RNA silencing: A model study

    Directory of Open Access Journals (Sweden)

    Hogeweg Paulien

    2008-03-01

    Full Text Available Abstract Background Mathematical modeling is important to provide insight in the complicated pathway of RNA silencing. RNA silencing is an RNA based mechanism that is widely used by eukaryotes to fight viruses, and to control gene expression. Results We here present the first mathematical model that combines viral growth with RNA silencing. The model involves a plus-strand RNA virus that replicates through a double-strand RNA intermediate. The model of the RNA silencing pathway consists of cleavage of viral RNA into siRNA by Dicer, target cleavage of viral RNA via the RISC complex, and a secondary response. We found that, depending on the strength of the silencing response, different viral growth patterns can occur. Silencing can decrease viral growth, cause oscillations, or clear the virus completely. Our model can explain various observed phenomena, even when they seem contradictory at first: the diverse responses to the removal of RNA dependent RNA polymerase; different viral growth curves; and the great diversity in observed siRNA ratios. Conclusion The model presented here is an important step in the understanding of the natural functioning of RNA silencing in viral infections.

  17. Behavioral alterations in autism model induced by valproic acid and translational analysis of circulating microRNA.

    Science.gov (United States)

    Hirsch, Mauro Mozael; Deckmann, Iohanna; Fontes-Dutra, Mellanie; Bauer-Negrini, Guilherme; Della-Flora Nunes, Gustavo; Nunes, Walquiria; Rabelo, Bruna; Riesgo, Rudimar; Margis, Rogerio; Bambini-Junior, Victorio; Gottfried, Carmem

    2018-05-01

    Autism spectrum disorder (ASD) is characterized by difficulties in social interaction, communication and language, and restricted repertoire of activities and interests. The etiology of ASD remains unknown and no clinical markers for diagnosis were identified. Environmental factors, including prenatal exposure to valproic acid (VPA), may contribute to increased risk of developing ASD. MicroRNA (miRNA) are small noncoding RNA that regulate gene expression and are frequently linked to biological processes affected in neurodevelopmental disorders. In this work, we analyzed the effects of resveratrol (an antioxidant and anti-inflammatory molecule) on behavioral alterations of the VPA model of autism, as well as the levels of circulating miRNA. We also evaluated the same set of miRNA in autistic patients. Rats of the VPA model of autism showed reduced total reciprocal social interaction, prevented by prenatal treatment with resveratrol (RSV). The levels of miR134-5p and miR138-5p increased in autistic patients. Interestingly, miR134-5p is also upregulated in animals of the VPA model, which is prevented by RSV. In conclusion, our findings revealed important preventive actions of RSV in the VPA model, ranging from behavior to molecular alterations. Further evaluation of preventive mechanisms of RSV can shed light in important biomarkers and etiological triggers of ASD. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. microRNA-140 Inhibits Inflammation and Stimulates Chondrogenesis in a Model of Interleukin 1β-induced Osteoarthritis

    Directory of Open Access Journals (Sweden)

    Tommy A Karlsen

    2016-01-01

    Full Text Available Osteoarthritis is a serious disease of articular cartilage. The pathogenic factors contributing to this disorder are inflammation, extracellular matrix degradation and failure to rebuild the articular cartilage. Preclinical studies suggest that microRNA-140 may play a protective role in osteoarthritis development, but little is known about the mechanism by which this occurs. Here we present the results of forced expression of microRNA-140 in an in vitro model of osteoarthritis, evaluated by global proteomics analysis. We show that inflammation was reduced through the altered levels of multiple proteins involved in the nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 pathway. microRNA-140 upregulated many of the components involved in the synthesis of hyaline extracellular matrix and reduced the levels of aggrecanases and syndecan 4, thus potentially both increasing cartilage repair and reducing cartilage breakdown. These results show how forced expression of microRNA-140 is likely to counteract all three pathogenic processes, and support the idea that intra-articular injection of microRNA-140 may benefit patients suffering from early osteoarthritis.

  19. Light and Fungal Elicitor Induce 3-Deoxy-d-arabino-Heptulosonate 7-Phosphate Synthase mRNA in Suspension Cultured Cells of Parsley (Petroselinum crispum L.) 1

    Science.gov (United States)

    Henstrand, John M.; McCue, Kent F.; Brink, Kent; Handa, Avtar K.; Herrmann, Klaus M.; Conn, Eric E.

    1992-01-01

    Light and fungal elicitor induce mRNA encoding 3-deoxy-d-arabino-heptulosonate 7-phosphate (DAHP) synthase in suspension cultured cells of parsley (Petroselinum crispum L.). The kinetics and dose response of mRNA accumulation were similar for DAHP synthase and phenylalanine ammonia-lyase (PAL). Six micrograms of elicitor from Phytophthora megasperma f. glycinia gave a detectable induction within 1 hour. Induction of DAHP synthase and PAL mRNAs by light was transient, reaching maximal levels at 4 hours and returning to pretreatment levels after 24 hours. Our data suggest that either light or fungal elicitor transcriptionally activate DAHP synthase. A coordinate regulation for key enzymes in the synthesis of primary and secondary metabolites is indicated. ImagesFigure 1 PMID:16668708

  20. RNA sequence analyses of r-Moj-DM treated cells: TXNIP is required to induce apoptosis of SK-Mel-28.

    Science.gov (United States)

    McBride, Terri D; Andrew, U; Ly, Nicko; Soto, Julio G

    2016-10-01

    RNA sequencing of untreated and r-Moj-DM treated SK-Mel-28 cells was performed after 6 h, to begin unraveling the apoptotic pathway induced by r-Moj-DM. Bioinformatic analyses of RNA sequencing data yielded 40 genes that were differentially expressed. Nine genes were upregulated and 31 were downregulated. qRT-PCR was used to validate differential expression of 13 genes with known survival or apoptotic-inducing activities. Expression of BNiP3, IGFBP3, PTPSF, Prune 2, TGF-ß, and TXNIP were compared from cells treated with r-Moj-DN (a strong apoptotic inducer) or r-Moj-DA (a non-apoptotic inducer) for 1 h, 2 h, 4 h, and 6 h after treatment. Our results demonstrate that significant differences in expression are only detected after 4 h of treatment. In addition, expression of TXNIP (an apoptotic inducer) remains elevated at 4 h and 6 h only in r-Moj-DN treated cells. Based on the consistency of elevated TXNIP expression, we further studied TXNIP as a novel target of disintegrin activation. Confocal microscopy of anti-TXNIP stained SK-Mel-28 cells suggests nuclear localization of TXNIP after r-Moj-DM treatment. A stable TXNIP knockdown SK-Mel-28 cell line was produced to test TXNIP' role in the apoptotic induction by r-Moj-DM. High cell viability (74.3% ±9.1) was obtained after r-Moj-DM treatment of TXNIP knocked down SK-Mel-28 cells, compared to 34% ±0.187 for untransduced cells. These results suggest that TXNIP is required early in the apoptotic-inducing pathway resulting from r-Moj-DM binding to the αv integrin subunit. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Directional secretory response of double stranded RNA-induced thymic stromal lymphopoetin (TSLP) and CCL11/eotaxin-1 in human asthmatic airways.

    Science.gov (United States)

    Nino, Gustavo; Huseni, Shehlanoor; Perez, Geovanny F; Pancham, Krishna; Mubeen, Humaira; Abbasi, Aleeza; Wang, Justin; Eng, Stephen; Colberg-Poley, Anamaris M; Pillai, Dinesh K; Rose, Mary C

    2014-01-01

    Thymic stromal lymphoproetin (TSLP) is a cytokine secreted by the airway epithelium in response to respiratory viruses and it is known to promote allergic Th2 responses in asthma. This study investigated whether virally-induced secretion of TSLP is directional in nature (apical vs. basolateral) and/or if there are TSLP-mediated effects occurring at both sides of the bronchial epithelial barrier in the asthmatic state. Primary human bronchial epithelial cells (HBEC) from control (n = 3) and asthmatic (n = 3) donors were differentiated into polarized respiratory tract epithelium under air-liquid interface (ALI) conditions and treated apically with dsRNA (viral surrogate) or TSLP. Sub-epithelial effects of TSLP were examined in human airway smooth muscle cells (HASMC) from normal (n = 3) and asthmatic (n = 3) donors. Clinical experiments examined nasal airway secretions obtained from asthmatic children during naturally occurring rhinovirus-induced exacerbations (n = 20) vs. non-asthmatic uninfected controls (n = 20). Protein levels of TSLP, CCL11/eotaxin-1, CCL17/TARC, CCL22/MDC, TNF-α and CXCL8 were determined with a multiplex magnetic bead assay. Our data demonstrate that: 1) Asthmatic HBEC exhibit an exaggerated apical, but not basal, secretion of TSLP after dsRNA exposure; 2) TSLP exposure induces unidirectional (apical) secretion of CCL11/eotaxin-1 in asthmatic HBEC and enhanced CCL11/eotaxin-1 secretion in asthmatic HASMC; 3) Rhinovirus-induced asthma exacerbations in children are associated with in vivo airway secretion of TSLP and CCL11/eotaxin-1. There are virally-induced TSLP-driven secretory immune responses at both sides of the bronchial epithelial barrier characterized by enhanced CCL11/eotaxin-1 secretion in asthmatic airways. These results suggest a new model of TSLP-mediated eosinophilic responses in the asthmatic airway during viral-induced exacerbations.

  2. Directional secretory response of double stranded RNA-induced thymic stromal lymphopoetin (TSLP and CCL11/eotaxin-1 in human asthmatic airways.

    Directory of Open Access Journals (Sweden)

    Gustavo Nino

    Full Text Available Thymic stromal lymphoproetin (TSLP is a cytokine secreted by the airway epithelium in response to respiratory viruses and it is known to promote allergic Th2 responses in asthma. This study investigated whether virally-induced secretion of TSLP is directional in nature (apical vs. basolateral and/or if there are TSLP-mediated effects occurring at both sides of the bronchial epithelial barrier in the asthmatic state.Primary human bronchial epithelial cells (HBEC from control (n = 3 and asthmatic (n = 3 donors were differentiated into polarized respiratory tract epithelium under air-liquid interface (ALI conditions and treated apically with dsRNA (viral surrogate or TSLP. Sub-epithelial effects of TSLP were examined in human airway smooth muscle cells (HASMC from normal (n = 3 and asthmatic (n = 3 donors. Clinical experiments examined nasal airway secretions obtained from asthmatic children during naturally occurring rhinovirus-induced exacerbations (n = 20 vs. non-asthmatic uninfected controls (n = 20. Protein levels of TSLP, CCL11/eotaxin-1, CCL17/TARC, CCL22/MDC, TNF-α and CXCL8 were determined with a multiplex magnetic bead assay.Our data demonstrate that: 1 Asthmatic HBEC exhibit an exaggerated apical, but not basal, secretion of TSLP after dsRNA exposure; 2 TSLP exposure induces unidirectional (apical secretion of CCL11/eotaxin-1 in asthmatic HBEC and enhanced CCL11/eotaxin-1 secretion in asthmatic HASMC; 3 Rhinovirus-induced asthma exacerbations in children are associated with in vivo airway secretion of TSLP and CCL11/eotaxin-1.There are virally-induced TSLP-driven secretory immune responses at both sides of the bronchial epithelial barrier characterized by enhanced CCL11/eotaxin-1 secretion in asthmatic airways. These results suggest a new model of TSLP-mediated eosinophilic responses in the asthmatic airway during viral-induced exacerbations.

  3. Downregulation of B-cell lymphoma/leukemia-2 by overexpressed microRNA 34a enhanced titanium dioxide nanoparticle-induced autophagy in BEAS-2B cells

    Science.gov (United States)

    Bai, Wenlin; Chen, Yujiao; Sun, Pengling; Gao, Ai

    2016-01-01

    Titanium dioxide (TiO2) nanoparticles (TNPs) are manufactured worldwide for a wide range of applications and the toxic effect of TNPs on biological systems is gaining attention. Autophagy is recognized as an emerging toxicity mechanism triggered by nanomaterials. MicroRNA 34a (miR34a) acts as a tumor suppressor gene by targeting many oncogenes, but how it affects autophagy induced by TNPs is not completely understood. Here, we observed the activation of TNP-induced autophagy through monodansylcadaverine staining and LC3-I/LC3-II conversion. Meanwhile, the transmission electron microscope ultrastructural analysis showed typical morphological characteristics in autophagy process. We detected the expression of miR34a and B-cell lymphoma/leukemia-2 (Bcl-2). In addition, the underlying mechanism of TNP-induced autophagy was performed using overexpression of miR34a by lentivirus vector transfection. Results showed that TNPs induced autophagy generation evidently. Typical morphological changes in the process of autophagy were observed by the transmission electron microscope ultrastructural analysis and LC3-I/LC3-II conversion increased significantly in TNP-treated cells. Meanwhile, TNPs induced the downregulation of miR34a and increased the expression of Bcl-2. Furthermore, overexpressed miR34a decreased the expression of Bcl-2 both in messenger RNA and protein level, following which the level of autophagy and cell death rate increased after the transfected cells were incubated with TNPs for 24 hours. These findings provide the first evidence that overexpressed miR34a enhanced TNP-induced autophagy and cell death through targeted downregulation of Bcl-2 in BEAS-2B cells. PMID:27226226

  4. Physiologically-induced changes in proopiomelanocortin mRNA levels in the pituitary gland of the amphibian Xenopus laevis.

    Science.gov (United States)

    Martens, G J; Weterings, K A; van Zoest, I D; Jenks, B G

    1987-03-13

    In the pars intermedia of the pituitary gland of the amphibian Xenopus laevis the level of mRNA encoding proopiomelanocortin (POMC), the precursor protein for alpha-melanophore-stimulating hormone (alpha-MSH), is shown to be dependent on physiological parameters. POMC mRNA levels in the pars intermedia of black-background-adapted Xenopus are much higher than those of white-adapted animals. These physiological changes in POMC mRNA levels are tissue-specific because they were not found in the pars distalis of the pituitary gland. Background transfer experiments revealed that modulation of POMC gene activity is much slower than changes in the secretion of alpha-MSH.

  5. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  6. Collagen V-induced nasal tolerance downregulates pulmonary collagen mRNA gene and TGF-beta expression in experimental systemic sclerosis

    Directory of Open Access Journals (Sweden)

    Parra Edwin R

    2010-01-01

    Full Text Available Abstract Background The purpose of this study was to evaluate collagen deposition, mRNA collagen synthesis and TGF-beta expression in the lung tissue in an experimental model of scleroderma after collagen V-induced nasal tolerance. Methods Female New Zealand rabbits (N = 12 were immunized with 1 mg/ml of collagen V in Freund's adjuvant (IM. After 150 days, six immunized animals were tolerated by nasal administration of collagen V (25 μg/day (IM-TOL daily for 60 days. The collagen content was determined by morphometry, and mRNA expressions of types I, III and V collagen were determined by Real-time PCR. The TGF-beta expression was evaluated by immunostaining and quantified by point counting methods. To statistic analysis ANOVA with Bonferroni test were employed for multiple comparison when appropriate and the level of significance was determined to be p Results IM-TOL, when compared to IM, showed significant reduction in total collagen content around the vessels (0.371 ± 0.118 vs. 0.874 ± 0.282, p p p = 0.026. The lung tissue of IM-TOL, when compared to IM, showed decreased immunostaining of types I, III and V collagen, reduced mRNA expression of types I (0.10 ± 0.07 vs. 1.0 ± 0.528, p = 0.002 and V (1.12 ± 0.42 vs. 4.74 ± 2.25, p = 0.009 collagen, in addition to decreased TGF-beta expression (p Conclusions Collagen V-induced nasal tolerance in the experimental model of SSc regulated the pulmonary remodeling process, inhibiting collagen deposition and collagen I and V mRNA synthesis. Additionally, it decreased TGF-beta expression, suggesting a promising therapeutic option for scleroderma treatment.

  7. Beraprost sodium, a prostacyclin analogue, reduces fructose-induced hepatocellular steatosis in mice and in vitro via the microRNA-200a and SIRT1 signaling pathway.

    Science.gov (United States)

    Zhang, Pengyuan; Xu, Lijuan; Guan, Hongyu; Liu, Liehua; Liu, Juan; Huang, Zhimin; Cao, Xiaopei; Liao, Zhihong; Xiao, Haipeng; Li, Yanbing

    2017-08-01

    To determine whether beraprost sodium, a prostacyclin analogue, could reduce hepatic lipid accumulation induced by fructose in mice and cultured human hepatocytes, and to investigate the expression of microRNAs and the sirtuin 1 (SIRT1) pathway. Male C57BL/6JNju mice were divided into three groups and fed one of the following diets: a normal diet, a high fructose diet, or a high fructose diet with beraprost sodium treatment. In addition, human-derived HepG2 cells were cultured and treated with fructose (25mmol/L) with or without beraprost sodium (10μmol/L) for 24h, and transfected with small interfering RNA (siRNA) against SIRT1, miR-200a mimic, or miR-200a inhibitor for 48h. The miRNA microarray analysis was performed on the HepG2 cells, and the expression profiles of miRNAs were analyzed using Gene Cluster 3.0 and verified using qPCR. Beraprost sodium treatment attenuated hepatic steatosis, induced the transcription of genes involved in lipid metabolism in C57BL/6 mice (Pfructose. These effects were blocked in HepG2 cells after transfection with siRNA against SIRT1. MiR-200a was highly expressed during fructose treatment and was down regulated by beraprost sodium (Pfructose and revealed the primary role of miR-200a in the regulation of hepatic SIRT1 by beraprost sodium. Our findings suggested that SIRT1 might be a therapeutic target of fructose-related metabolism disorders. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Alterations in sperm DNA methylation, non-coding RNA expression, and histone retention mediate vinclozolin-induced epigenetic transgenerational inheritance of disease.

    Science.gov (United States)

    Ben Maamar, Millissia; Sadler-Riggleman, Ingrid; Beck, Daniel; McBirney, Margaux; Nilsson, Eric; Klukovich, Rachel; Xie, Yeming; Tang, Chong; Yan, Wei; Skinner, Michael K

    2018-04-01

    Epigenetic transgenerational inheritance of disease and phenotypic variation can be induced by several toxicants, such as vinclozolin. This phenomenon can involve DNA methylation, non-coding RNA (ncRNA) and histone retention, and/or modification in the germline (e.g. sperm). These different epigenetic marks are called epimutations and can transmit in part the transgenerational phenotypes. This study was designed to investigate the vinclozolin-induced concurrent alterations of a number of different epigenetic factors, including DNA methylation, ncRNA, and histone retention in rat sperm. Gestating females (F0 generation) were exposed transiently to vinclozolin during fetal gonadal development. The directly exposed F1 generation fetus, the directly exposed germline within the fetus that will generate the F2 generation, and the transgenerational F3 generation sperm were studied. DNA methylation and ncRNA were altered in each generation rat sperm with the direct exposure F1 and F2 generations being distinct from the F3 generation epimutations. Interestingly, an increased number of differential histone retention sites were found in the F3 generation vinclozolin sperm, but not in the F1 or F2 generations. All three different epimutation types were affected in the vinclozolin lineage transgenerational sperm (F3 generation). The direct exposure generations (F1 and F2) epigenetic alterations were distinct from the transgenerational sperm epimutations. The genomic features and gene pathways associated with the epimutations were investigated to help elucidate the integration of these different epigenetic processes. Our results show that the three different types of epimutations are involved and integrated in the mediation of the epigenetic transgenerational inheritance phenomenon.

  9. Small interfering RNA targeted to IGF-IR delays tumor growth and induces proinflammatory cytokines in a mouse breast cancer model.

    Directory of Open Access Journals (Sweden)

    Tiphanie Durfort

    Full Text Available Insulin-like growth factor I (IGF-I and its type I receptor (IGF-IR play significant roles in tumorigenesis and in immune response. Here, we wanted to know whether an RNA interference approach targeted to IGF-IR could be used for specific antitumor immunostimulation in a breast cancer model. For that, we evaluated short interfering RNA (siRNAs for inhibition of in vivo tumor growth and immunological stimulation in immunocompetent mice. We designed 2'-O-methyl-modified siRNAs to inhibit expression of IGF-IR in two murine breast cancer cell lines (EMT6, C4HD. Cell transfection of IGF-IR siRNAs decreased proliferation, diminished phosphorylation of downstream signaling pathway proteins, AKT and ERK, and caused a G0/G1 cell cycle block. The IGF-IR silencing also induced secretion of two proinflammatory cytokines, TNF- α and IFN-γ. When we transfected C4HD cells with siRNAs targeting IGF-IR, mammary tumor growth was strongly delayed in syngenic mice. Histology of developing tumors in mice grafted with IGF-IR siRNA treated C4HD cells revealed a low mitotic index, and infiltration of lymphocytes and polymorphonuclear neutrophils, suggesting activation of an antitumor immune response. When we used C4HD cells treated with siRNA as an immunogen, we observed an increase in delayed-type hypersensitivity and the presence of cytotoxic splenocytes against wild-type C4HD cells, indicative of evolving immune response. Our findings show that silencing IGF-IR using synthetic siRNA bearing 2'-O-methyl nucleotides may offer a new clinical approach for treatment of mammary tumors expressing IGF-IR. Interestingly, our work also suggests that crosstalk between IGF-I axis and antitumor immune response can mobilize proinflammatory cytokines.

  10. HOXB7 mRNA is overexpressed in pancreatic ductal adenocarcinomas and its knockdown induces cell cycle arrest and apoptosis

    International Nuclear Information System (INIS)

    Chile, Thais; Bacchella, Telésforo; Giorgi, Ricardo Rodrigues; Fortes, Maria Angela Henriques Zanella; Corrêa-Giannella, Maria Lúcia Cardillo; Brentani, Helena Paula; Maria, Durvanei Augusto; Puga, Renato David; Paula, Vanessa de Jesus R de; Kubrusly, Marcia Saldanha; Novak, Estela Maria

    2013-01-01

    Human homeobox genes encode nuclear proteins that act as transcription factors involved in the control of differentiation and proliferation. Currently, the role of these genes in development and tumor progression has been extensively studied. Recently, increased expression of HOXB7 homeobox gene (HOXB7) in pancreatic ductal adenocarcinomas (PDAC) was shown to correlate with an invasive phenotype, lymph node metastasis and worse survival outcomes, but no influence on cell proliferation or viability was detected. In the present study, the effects arising from the knockdown of HOXB7 in PDAC cell lines was investigated. Real time quantitative PCR (qRT-PCR) (Taqman) was employed to assess HOXB7 mRNA expression in 29 PDAC, 6 metastatic tissues, 24 peritumoral tissues and two PDAC cell lines. siRNA was used to knockdown HOXB7 mRNA in the cell lines and its consequences on apoptosis rate and cell proliferation were measured by flow cytometry and MTT assay respectively. Overexpression of HOXB7 mRNA was observed in the tumoral tissues and in the cell lines MIA PaCa-2 and Capan-1. HOXB7 knockdown elicited (1) an increase in the expression of the pro-apoptotic proteins BAX and BAD in both cell lines; (2) a decrease in the expression of the anti-apoptotic protein BCL-2 and in cyclin D1 and an increase in the number of apoptotic cells in the MIA PaCa-2 cell line; (3) accumulation of cell in sub-G1 phase in both cell lines; (4) the modulation of several biological processes, especially in MIA PaCa-2, such as proteasomal ubiquitin-dependent catabolic process and cell cycle. The present study confirms the overexpression of HOXB7 mRNA expression in PDAC and demonstrates that decreasing its protein level by siRNA could significantly increase apoptosis and modulate several biological processes. HOXB7 might be a promising target for future therapies

  11. Screening for markers of frailty and perceived risk of adverse outcomes using the Risk Instrument for Screening in the Community (RISC).

    LENUS (Irish Health Repository)

    O Caoimh, Rónán

    2014-09-19

    Functional decline and frailty are common in community dwelling older adults, increasing the risk of adverse outcomes. Given this, we investigated the prevalence of frailty-associated risk factors and their distribution according to the severity of perceived risk in a cohort of community dwelling older adults, using the Risk Instrument for Screening in the Community (RISC).

  12. MicroRNA-15b silencing inhibits IL-1β-induced extracellular matrix degradation by targeting SMAD3 in human nucleus pulposus cells.

    Science.gov (United States)

    Kang, Liang; Yang, Cao; Yin, Huipeng; Zhao, Kangcheng; Liu, Wei; Hua, Wenbin; Wang, Kun; Song, Yu; Tu, Ji; Li, Shuai; Luo, Rongjin; Zhang, Yukun

    2017-04-01

    To determine the role of microRNA-15b (miR-15b) in interleukin-1 beta (IL-1β)-induced extracellular matrix (ECM) degradation in the nucleus pulposus (NP). MiR-15b was up-regulated in degenerative NP tissues and in IL-1β-stimulated NP cells, as compared to the levels in normal controls (normal tissue specimens from patients with idiopathic scoliosis). Bioinformatics and luciferase activity analyses showed that mothers against decapentaplegic homolog 3 (SMAD3), a key mediator of the transforming growth factor-β signaling pathway, was directly targeted by miR-15b. Functional analysis demonstrated that miR-15b overexpression aggravated IL-1β-induced ECM degradation in NP cells, while miR-15b inhibition had the opposite effects. Prevention of IL-1β-induced NP ECM degeneration by the miR-15b inhibitor was attenuated by small-interfering-RNA-mediated knockdown of SMAD3. In addition, activation of MAP kinase and nuclear factor-κB up-regulated miR-15b expression and down-regulated SMAD3 expression in IL-1β-stimulated NP cells. MiR-15b contributes to ECM degradation in intervertebral disc degeneration (IDD) via targeting of SMAD3, thus providing a novel therapeutic target for IDD treatment.

  13. The RNA gene information: retroelement-microRNA entangling as the RNA quantum code.

    Science.gov (United States)

    Fujii, Yoichi Robertus

    2013-01-01

    MicroRNA (miRNA) and retroelements may be a master of regulator in our life, which are evolutionally involved in the origin of species. To support the Darwinism from the aspect of molecular evolution process, it has tremendously been interested in the molecular information of naive RNA. The RNA wave model 2000 consists of four concepts that have altered from original idea of the miRNA genes for crosstalk among embryonic stem cells, their niche cells, and retroelements as a carrier vesicle of the RNA genes. (1) the miRNA gene as a mobile genetic element induces transcriptional and posttranscriptional silencing via networking-processes (no hierarchical architecture); (2) the RNA information supplied by the miRNA genes expands to intracellular, intercellular, intraorgan, interorgan, intraspecies, and interspecies under the cycle of life into the global environment; (3) the mobile miRNAs can self-proliferate; and (4) cells contain two types information as resident and genomic miRNAs. Based on RNA wave, we have developed an interest in investigation of the transformation from RNA information to quantum bits as physicochemical characters of RNA with the measurement of RNA electron spin. When it would have been given that the fundamental bases for the acquired characters in genetics can be controlled by RNA gene information, it may be available to apply for challenging against RNA gene diseases, such as stress-induced diseases.

  14. Downregulation of mouse CCR3 by lentiviral shRNA inhibits proliferation and induces apoptosis of mouse eosinophils.

    Science.gov (United States)

    Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui

    2017-02-01

    RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.

  15. Arctiin blocks hydrogen peroxide-induced senescence and cell death though microRNA expression changes in human dermal papilla cells

    Directory of Open Access Journals (Sweden)

    Seunghee Bae

    2014-01-01

    Full Text Available BACKGROUND: Accumulating evidence indicates that reactive oxygen species (ROS are an important etiological factor for the induction of dermal papilla cell senescence and hair loss, which is also known alopecia. Arctiin is an active lignin isolated from Arctium lappa and has anti-inflammation, anti-microbial, and anti-carcinogenic effects. In the present study, we found that arctiin exerts anti-oxidative effects on human hair dermal papilla cells (HHDPCs. RESULTS: To better understand the mechanism, we analyzed the level of hydrogen peroxide (H2O2-induced cytotoxicity, cell death, ROS production and senescence after arctiin pretreatment of HHDPCs. The results showed that arctiin pretreatment significantly inhibited the H2O2-induced reduction in cell viability. Moreover, H2O2-induced sub-G1 phase accumulation and G2 cell cycle arrest were also downregulated by arctiin pretreatment. Interestingly, the increase in intracellular ROS mediated by H2O2 was drastically decreased in HHDPCs cultured in the presence of arctiin. This effect was confirmed by senescence associated-beta galactosidase (SA-β-gal assay results; we found that arctiin pretreatment impaired H2O2-induced senescence in HHDPCs. Using microRNA (miRNA microarray and bioinformatic analysis, we showed that this anti-oxidative effect of arctiin in HHDPCs was related with mitogen-activated protein kinase (MAPK and Wnt signaling pathways. CONCLUSIONS: Taken together, our data suggest that arctiin has a protective effect on ROS-induced cell dysfunction in HHDPCs and may therefore be useful for alopecia prevention and treatment strategies.

  16. Radiation-induced phosphorylation of P53 protects radioresistant Spodoptera frugiperda 9 cells by suppressing microRNA-31-Bim-Bax mediated apoptosis

    International Nuclear Information System (INIS)

    Kumar, Ashish; Chandna, Sudhir

    2016-01-01

    In this study, we demonstrate the role of microRNA-31 (miR-31) in the regulation of radiation-induced apoptosis in model radioresistant insect cell line Sf9 (derived from the ovaries of insect Spodoptera frugiperda) which carries well-conserved apoptotic response. We also investigated the miR-31 expression regulation by p53 homologue in these cells. Our initial in silico analysis confirmed perfect conservation of mature miR-31 across various insect orders, hence we designed biotinylated probes from Bombyx mori sequence for successful detection of miR-31 in Sf9 cells

  17. The invasion of tobacco mosaic virus RNA induces endoplasmic reticulum stress-related autophagy in HeLa cells

    Science.gov (United States)

    Li, Li; Wang, Li; Xiao, Ruijing; Zhu, Guoguo; Li, Yan; Liu, Changxuan; Yang, Ru; Tang, Zhiqing; Li, Jie; Huang, Wei; Chen, Lang; Zheng, Xiaoling; He, Yuling; Tan, Jinquan

    2011-01-01

    The ability of human cells to defend against viruses originating from distant species has long been ignored. Owing to the pressure of natural evolution and human exploration, some of these viruses may be able to invade human beings. If their ‘fresh’ host had no defences, the viruses could cause a serious pandemic, as seen with HIV, SARS (severe acute respiratory syndrome) and avian influenza virus that originated from chimpanzees, the common palm civet and birds, respectively. It is unknown whether the human immune system could tolerate invasion with a plant virus. To model such an alien virus invasion, we chose TMV (tobacco mosaic virus) and used human epithelial carcinoma cells (HeLa cells) as its ‘fresh’ host. We established a reliable system for transfecting TMV-RNA into HeLa cells and found that TMV-RNA triggered autophagy in HeLa cells as shown by the appearance of autophagic vacuoles, the conversion of LC3-I (light chain protein 3-I) to LC3-II, the up-regulated expression of Beclin1 and the accumulation of TMV protein on autophagosomal membranes. We observed suspected TMV virions in HeLa cells by TEM (transmission electron microscopy). Furthermore, we found that TMV-RNA was translated into CP (coat protein) in the ER (endoplasmic reticulum) and that TMV-positive RNA translocated from the cytoplasm to the nucleolus. Finally, we detected greatly increased expression of GRP78 (78 kDa glucose-regulated protein), a typical marker of ERS (ER stress) and found that the formation of autophagosomes was closely related to the expanded ER membrane. Taken together, our data indicate that HeLa cells used ERS and ERS-related autophagy to defend against TMV-RNA. PMID:21729006